gt
stringclasses
1 value
context
stringlengths
2.49k
119k
# coding=utf-8 """ Concurrency support for pyRobot. This module provides: - an implementation of :class:`SignalingThread` (threads that explicitely handle signals like cancelation) - heavily modified Python futures to support robot action management. - A future executor that simply spawn one thread per future (action) instead of a thread pool. These objects should not be directly used. Users should instead rely on the :meth:`~robots.concurrency.action.action` decorator. Helpful debugging commands:: >>> sys._current_frames() >>> inspect.getouterframes(sys._current_frames()[<id>])[0][0].f_locals """ import logging; logger = logging.getLogger("robots.actions") import sys import uuid MAX_FUTURES = 20 MAX_TIME_TO_COMPLETE = 1 # sec: time allowed to tasks to complete when cancelled. If they take more than that, force termination. ACTIVE_SLEEP_RESOLUTION = 0.1 # sec try: from concurrent.futures import Future, TimeoutError except ImportError: import sys sys.stderr.write("[error] install python-concurrent.futures\n") sys.exit(1) import os.path #for basename import weakref import threading import thread # for get_ident from collections import deque import traceback from .signals import ActionCancelled, ActionPaused class SignalingThread(threading.Thread): def __init__(self, *args, **kwargs): threading.Thread.__init__(self, *args, **kwargs) self.debugger_trace = None def cancel(self): self.__cancel = True def pause(self): self.__pause = True def _Thread__bootstrap(self): """ The name come from Python name mangling for __double_leading_underscore_names Note that in Python3, __bootstrap becomes _bootstrap, thus making it easier to override. """ if threading._trace_hook is not None: self.debugger_trace = threading._trace_hook else: self.debugger_trace = None self.__cancel = False self.__pause = False sys.settrace(self.__signal_emitter) self.name = "Ranger action thread (initialization)" super(SignalingThread, self)._Thread__bootstrap() def __signal_emitter(self, frame, event, arg): if self.__cancel: if frame.f_globals["__name__"] == "threading": # Raising exception at uncontrolled time is a dangerous sport, # especially if the thread is in the middle of locking/unlocking shared resources # like (in our case) setting result in futures and reading them. # After thinking about it for a day, I could not find any good solution except for # postponing raising the signals until out of the threading module. This is not # very nice, but seem to work out well. #logger.debug("Thread <%s> in threading module. Postponing cancelation" % self.name) pass else: self.__cancel = False desc = "Cancelling thread <%s>:\n" % self.name tb = traceback.extract_stack(frame, limit = 6) for f in tb: file, line, fn, instruction = f desc += " - in <%s> (l.%s of %s): %s\n" % (fn, line, os.path.basename(file), instruction) logger.debug(desc) raise ActionCancelled() if self.__pause: self.__pause = False logger.debug("Pausing thread <%s>" % self.name) raise ActionPaused() if self.debugger_trace: return self.debugger_trace else: return self.__signal_emitter class RobotActionThread(SignalingThread): def __init__(self, future, initialized, fn, args, kwargs): SignalingThread.__init__(self) initialized.set() self.future = future self.fn = fn self.args = args self.kwargs = kwargs def run(self): if not self.future.set_running_or_notify_cancel(): return try: result = self.fn(self.future, str(self.future),*self.args, **self.kwargs) self.future.set_result(result) logger.debug("Action <%s>: completed." % str(self.future)) except BaseException: e = sys.exc_info()[1] logger.error("Exception in action <%s>: %s"%(str(self.future), e)) #self.fn.__name__ logger.error(traceback.format_exc()) self.future.set_exception(e) class RobotAction(Future): def __init__(self, actionname): Future.__init__(self) self.actionname = actionname self.thread = None self.id = uuid.uuid4() self.subactions = [] self.parent_action = None self.has_acquired_resource = False def add_subaction(self, action): self.subactions = [a for a in self.subactions if a() is not None and a().thread() is not None] self.subactions.append(action) logger.debug("Added sub-action %s to action %s" % (str(action()), str(self)))#.actionname)) 1: action().actionname def set_parent(self, action): self.parent_action = action def childof(self, action): """ Returns true if this action is a child of the given action, ie, has been spawned from the given action or any of its descendants. """ parent = self.parent_action() # weakref! if parent is None: return False if parent is action: return True return parent.childof(action) def set_thread(self, thread): self.thread = thread def cancel(self): # we do not call the 'standard' Future.cancel method since we do not have a thread pool (ie, # the future can not be 'pending for execution'), which is the only useful usecase (well, with callback on # cancellation, I imagine... so those are not supported for now) thread = self.thread() # weakref! if thread is None: logger.debug("Action <%s>: already done" % self) return # first, cancel myself (to make sure I won't restart subactions) logger.debug("Action <%s>: signaling cancelation to action's thread" % self) thread.cancel() # then, tell all the subactions that they should stop # (can not do that in the thread's cancel (_signal_emitter), because the # thread may hold locks that are not released until the exception is raised and # the context manager are left) logger.debug("Action <%s>: %s subactions to cancel" % (self, len(self.subactions))) #self.actionname for weak_subaction in self.subactions: subaction = weak_subaction() if subaction: logger.debug("Action <%s>: Cancelling subaction %s..." % (self, subaction)) subaction.cancel() # then, make sure everybody actually terminates logger.debug("Action <%s>: now waiting for completion" % self) try: self.exception(timeout = MAX_TIME_TO_COMPLETE) # waits this amount of time for the task to effectively complete except TimeoutError: raise RuntimeError("Unable to cancel action %s (still running %s after cancellation)!" % (self, MAX_TIME_TO_COMPLETE)) logger.debug("Action <%s>: successfully cancelled" % self) #t = 0 #while t < MAX_TIME_TO_COMPLETE: # time.sleep(ACTIVE_SLEEP_RESOLUTION) # t+=ACTIVE_SLEEP_RESOLUTION # if self.thread() is None: # logger.debug("Action <%s>: successfully cancelled" % self.actionname) # return #raise RuntimeError("Unable to cancel action %s (still running %s after cancellation)!" % (self.actionname, MAX_TIME_TO_COMPLETE)) def result(self): if self.parent_action and self.parent_action(): threading.current_thread().name = "Action %s (waiting for sub-action %s)" % (self.parent_action(), self) else: threading.current_thread().name = "Main thread (waiting for sub-action %s)" % self # active wait! Instead of blocking on the condition variable in super.result() # we do an active wait to make sure we can cancel/suspend the action via our # __signal_emitter trace function while True: try: return super(RobotAction, self).result(ACTIVE_SLEEP_RESOLUTION) except TimeoutError: pass def wait(self): """ alias for result() """ return self.result() def __lt__(self, other): """ Overrides the comparision operator (used by ==, !=, <, >) to first wait for the result of the future. """ return self.result().__lt__(other) def __le__(self, other): return self.result().__le__(other) def __eq__(self, other): return self.result().__eq__(other) def __ne__(self, other): return self.result().__ne__(other) def __gt__(self, other): return self.result().__gt__(other) def __ge__(self, other): return self.result().__ge__(other) def __repr__(self): return str(self.id) def __str__(self): return self.actionname + "[" + self.__repr__() + "]" class FakeFuture: """ Used in the 'immediate' mode. """ def __init__(self, result): self._result = result def result(self): return self._result def wait(self): return self._result class RobotActionExecutor(): def __init__(self): # Attention, RobotActionExecutor must be thread-safe self.futures = [] self.futures_lock = threading.Lock() def submit(self, fn, *args, **kwargs): with self.futures_lock: self.futures = [f for f in self.futures if not f.done()] name = fn.__name__ if args and not kwargs: name += "(%s)" % ", ".join([str(a) for a in args[1:]]) # start at 1 because 0 is the robot instance elif kwargs and not args: name += "(%s)" % ", ".join(["%s=%s" % (str(k), str(v)) for k, v in kwargs.items()]) elif args and kwargs: name += "(%s, " % ", ".join([str(a) for a in args[1:]]) name += "%s)" % ", ".join(["%s=%s" % (str(k), str(v)) for k, v in kwargs.items()]) if len([f for f in self.futures if f.has_acquired_resource]) > MAX_FUTURES: raise RuntimeError("You have more than %s actions running in parallel! Likely a bug in your application logic!" % MAX_FUTURES) f = RobotAction(name) initialized = threading.Event() t = RobotActionThread(f, initialized, fn, args, kwargs) f.set_thread(weakref.ref(t)) current_action = self.get_current_action() if current_action: f.set_parent(weakref.ref(current_action)) current_action.add_subaction(weakref.ref(f)) t.start() while not initialized.is_set(): # waits for the thread to actually start pass with self.futures_lock: self.futures.append(f) return f def get_current_action(self): """Returns the RobotAction linked to the current thread. """ thread_id = threading.current_thread().ident with self.futures_lock: for f in self.futures: if not f.done(): thread = f.thread() # weak ref if thread is not None and thread.ident == thread_id: return f logger.debug("The current thread (<%s>) is not a robot action (main thread?)" % threading.current_thread().name) return None def cancel_all(self): """ Blocks until all the currently running actions are actually stopped. """ with self.futures_lock: for f in self.futures: if not f.done(): f.cancel() self.futures = [] def cancel_all_others(self): """ Blocks until all the currently running actions *except the calling one* are actually stopped. """ thread_id = threading.current_thread().ident with self.futures_lock: for f in self.futures: if not f.done(): thread = f.thread() # weak ref if thread is not None and thread.ident == thread_id: myself = f continue f.cancel() self.futures = [myself] def actioninfo(self, future_id): with self.futures_lock: future = [f for f in self.futures if id(f) == future_id] if not future: return "No task with ID %s. Maybe the task is already done?" % future_id future = future[0] desc = "Task <%s>\n" % future thread = future.thread() # weak ref if thread: frame = sys._current_frames()[thread.ident] tb = traceback.extract_stack(frame, limit = 6) for f in tb: file, line, fn, instruction = f desc += " - in <%s> (l.%s of %s): %s\n" % (fn, line, os.path.basename(file), instruction) return desc else: return "Task ID %s is already done." % future_id def __str__(self): with self.futures_lock: return "Running tasks:\n" + \ "\n".join(["Task %s (id: %s, thread: <%s>)" % (f, id(f), str(f.thread())) for f in self.futures if not f.done()])
#!/usr/bin/env python # # Copyright 2007 Google Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # """Utilities for converting between v3 and v1 datastore protocol buffers. This module is internal and should not be used by client applications. """ from google.appengine.datastore import entity_pb from google.appengine.datastore import datastore_v4_pb from google.appengine.datastore import entity_v4_pb _MIN_CLOUD_DATASTORE_VERSION = (4, 0, 0, 'b1') _CLOUD_DATASTORE_ENABLED = False try: import googledatastore if googledatastore.VERSION >= _MIN_CLOUD_DATASTORE_VERSION: _CLOUD_DATASTORE_ENABLED = True except ImportError: pass except AttributeError: pass MISSING_CLOUD_DATASTORE_MESSAGE = ( 'Could not import googledatastore. This library must be installed with ' 'version >= %s to use the Cloud Datastore API.' % '.'.join([str(v) for v in _MIN_CLOUD_DATASTORE_VERSION])) MEANING_ATOM_CATEGORY = 1 MEANING_URL = 2 MEANING_ATOM_TITLE = 3 MEANING_ATOM_CONTENT = 4 MEANING_ATOM_SUMMARY = 5 MEANING_ATOM_AUTHOR = 6 MEANING_GD_EMAIL = 8 MEANING_GEORSS_POINT = 9 MEANING_GD_IM = 10 MEANING_GD_PHONENUMBER = 11 MEANING_GD_POSTALADDRESS = 12 MEANING_PERCENT = 13 MEANING_TEXT = 15 MEANING_BYTESTRING = 16 MEANING_BLOBKEY = 17 MEANING_INDEX_ONLY = 18 MEANING_PREDEFINED_ENTITY_USER = 20 MEANING_PREDEFINED_ENTITY_POINT = 21 MEANING_ZLIB = 22 MEANING_POINT_WITHOUT_V3_MEANING = 23 MEANING_EMPTY_LIST = 24 URI_MEANING_ZLIB = 'ZLIB' MAX_URL_CHARS = 2083 MAX_INDEXED_STRING_CHARS = 500 MAX_INDEXED_BLOB_BYTES = 500 MAX_PARTITION_ID_LENGTH = 100 MAX_DATASET_ID_SECTION_LENGTH = 100 MAX_DATASET_ID_LENGTH = MAX_DATASET_ID_SECTION_LENGTH * 3 + 2 MAX_KEY_PATH_LENGTH = 100 PROPERTY_NAME_X = 'x' PROPERTY_NAME_Y = 'y' PROPERTY_NAME_EMAIL = 'email' PROPERTY_NAME_AUTH_DOMAIN = 'auth_domain' PROPERTY_NAME_USER_ID = 'user_id' PROPERTY_NAME_INTERNAL_ID = 'internal_id' PROPERTY_NAME_FEDERATED_IDENTITY = 'federated_identity' PROPERTY_NAME_FEDERATED_PROVIDER = 'federated_provider' PROPERTY_NAME_KEY = '__key__' DEFAULT_GAIA_ID = 0 def v4_key_to_string(v4_key): """Generates a string representing a key's path. The output makes no effort to qualify special characters in strings. The key need not be valid, but if any of the key path elements have both a name and an ID the name is ignored. Args: v4_key: an entity_v4_pb.Key Returns: a string representing the key's path """ path_element_strings = [] for path_element in v4_key.path_element_list(): if path_element.has_id(): id_or_name = str(path_element.id()) elif path_element.has_name(): id_or_name = path_element.name() else: id_or_name = '' path_element_strings.append('%s: %s' % (path_element.kind(), id_or_name)) return '[%s]' % ', '.join(path_element_strings) def is_complete_v4_key(v4_key): """Returns True if a key specifies an ID or name, False otherwise. Args: v4_key: an entity_v4_pb.Key Returns: True if the key specifies an ID or name, False otherwise. """ assert len(v4_key.path_element_list()) >= 1 last_element = v4_key.path_element(len(v4_key.path_element_list()) - 1) return last_element.has_id() or last_element.has_name() def v1_key_to_string(v1_key): """Generates a string representing a key's path. The output makes no effort to qualify special characters in strings. The key need not be valid, but if any of the key path elements have both a name and an ID the name is ignored. Args: v1_key: an googledatastore.Key Returns: a string representing the key's path """ path_element_strings = [] for path_element in v1_key.path: field = path_element.WhichOneof('id_type') if field == 'id': id_or_name = str(path_element.id) elif field == 'name': id_or_name = path_element.name else: id_or_name = '' path_element_strings.append('%s: %s' % (path_element.kind, id_or_name)) return '[%s]' % ', '.join(path_element_strings) def is_complete_v1_key(v1_key): """Returns True if a key specifies an ID or name, False otherwise. Args: v1_key: an googledatastore.Key Returns: True if the key specifies an ID or name, False otherwise. """ assert len(v1_key.path) >= 1 last_element = v1_key.path[len(v1_key.path) - 1] return last_element.WhichOneof('id_type') is not None def is_complete_v3_key(v3_key): """Returns True if a key specifies an ID or name, False otherwise. Args: v3_key: a datastore_pb.Reference Returns: True if the key specifies an ID or name, False otherwise. """ assert v3_key.path().element_size() >= 1 last_element = v3_key.path().element_list()[-1] return ((last_element.has_id() and last_element.id() != 0) or (last_element.has_name() and last_element.name() != '')) def get_v1_mutation_key_and_entity(v1_mutation): """Returns the v1 key and entity for a v1 mutation proto, if applicable. Args: v1_mutation: a googledatastore.Mutation Returns: a tuple (googledatastore.Key for this mutation, googledatastore.Entity or None if the mutation is a deletion) """ if v1_mutation.HasField('delete'): return v1_mutation.delete, None else: v1_entity = getattr(v1_mutation, v1_mutation.WhichOneof('operation')) return v1_entity.key, v1_entity def is_valid_utf8(s): if isinstance(s, str): return True try: s.decode('utf-8') return True except UnicodeDecodeError: return False def check_conversion(condition, message): """Asserts a conversion condition and raises an error if it's not met. Args: condition: (boolean) condition to enforce message: error message Raises: InvalidConversionError: if condition is not met """ if not condition: raise InvalidConversionError(message) class InvalidConversionError(Exception): """Raised when conversion fails.""" pass class IdResolver(object): """A class that can handle project id <--> application id transformations.""" def __init__(self, app_ids=()): """Create a new IdResolver. Args: app_ids: A list of application ids with application id shard set. i.e. s~my_app or e~my_app. """ resolver_map = {} for app_id in app_ids: resolver_map[self.resolve_project_id(app_id)] = app_id self._resolver_map = resolver_map def resolve_project_id(self, app_id): """Converts an application id to a project id. Args: app_id: The application id. Returns: The project id. """ return app_id.rsplit('~')[-1] def resolve_app_id(self, project_id): """Converts a project id to an application id. Args: project_id: The project id. Returns: The application id. Raises: InvalidConversionError: if the application is unknown for the project id. """ check_conversion(project_id in self._resolver_map, 'Cannot determine application id for provided project id: ' '"%s".' % project_id) return self._resolver_map[project_id] class _IdentityIdResolver(IdResolver): """An IdResolver that resolve app_id == project_id.""" def resolve_project_id(self, app_id): return app_id def resolve_app_id(self, project_id): return project_id class _EntityConverter(object): """Converter for entities and keys.""" def __init__(self, id_resolver): """Creates a new EntityConverter. Args: id_resolver: an IdResolver object for converting project_id <--> application_id """ self._id_resolver = id_resolver def v4_to_v3_reference(self, v4_key, v3_ref): """Converts a v4 Key to a v3 Reference. Args: v4_key: an entity_v4_pb.Key v3_ref: an entity_pb.Reference to populate """ v3_ref.Clear() if v4_key.has_partition_id(): if v4_key.partition_id().has_dataset_id(): v3_ref.set_app(v4_key.partition_id().dataset_id()) if v4_key.partition_id().has_namespace(): v3_ref.set_name_space(v4_key.partition_id().namespace()) for v4_element in v4_key.path_element_list(): v3_element = v3_ref.mutable_path().add_element() v3_element.set_type(v4_element.kind()) if v4_element.has_id(): v3_element.set_id(v4_element.id()) if v4_element.has_name(): v3_element.set_name(v4_element.name()) def v4_to_v3_references(self, v4_keys): """Converts a list of v4 Keys to a list of v3 References. Args: v4_keys: a list of entity_v4_pb.Key objects Returns: a list of entity_pb.Reference objects """ v3_refs = [] for v4_key in v4_keys: v3_ref = entity_pb.Reference() self.v4_to_v3_reference(v4_key, v3_ref) v3_refs.append(v3_ref) return v3_refs def v3_to_v4_key(self, v3_ref, v4_key): """Converts a v3 Reference to a v4 Key. Args: v3_ref: an entity_pb.Reference v4_key: an entity_v4_pb.Key to populate """ v4_key.Clear() if not v3_ref.app(): return v4_key.mutable_partition_id().set_dataset_id(v3_ref.app()) if v3_ref.name_space(): v4_key.mutable_partition_id().set_namespace(v3_ref.name_space()) for v3_element in v3_ref.path().element_list(): v4_element = v4_key.add_path_element() v4_element.set_kind(v3_element.type()) if v3_element.has_id(): v4_element.set_id(v3_element.id()) if v3_element.has_name(): v4_element.set_name(v3_element.name()) def v3_to_v4_keys(self, v3_refs): """Converts a list of v3 References to a list of v4 Keys. Args: v3_refs: a list of entity_pb.Reference objects Returns: a list of entity_v4_pb.Key objects """ v4_keys = [] for v3_ref in v3_refs: v4_key = entity_v4_pb.Key() self.v3_to_v4_key(v3_ref, v4_key) v4_keys.append(v4_key) return v4_keys def v4_to_v3_entity(self, v4_entity, v3_entity, is_projection=False): """Converts a v4 Entity to a v3 EntityProto. Args: v4_entity: an entity_v4_pb.Entity v3_entity: an entity_pb.EntityProto to populate is_projection: True if the v4_entity is from a projection query. """ v3_entity.Clear() for v4_property in v4_entity.property_list(): property_name = v4_property.name() v4_value = v4_property.value() if v4_value.list_value_list(): for v4_sub_value in v4_value.list_value_list(): self.__add_v3_property_from_v4( property_name, True, is_projection, v4_sub_value, v3_entity) else: self.__add_v3_property_from_v4( property_name, False, is_projection, v4_value, v3_entity) if v4_entity.has_key(): v4_key = v4_entity.key() self.v4_to_v3_reference(v4_key, v3_entity.mutable_key()) v3_ref = v3_entity.key() self.v3_reference_to_group(v3_ref, v3_entity.mutable_entity_group()) else: pass def v3_to_v4_entity(self, v3_entity, v4_entity): """Converts a v3 EntityProto to a v4 Entity. Args: v3_entity: an entity_pb.EntityProto v4_entity: an entity_v4_pb.Proto to populate """ v4_entity.Clear() self.v3_to_v4_key(v3_entity.key(), v4_entity.mutable_key()) if not v3_entity.key().has_app(): v4_entity.clear_key() v4_properties = {} for v3_property in v3_entity.property_list(): self.__add_v4_property_to_entity(v4_entity, v4_properties, v3_property, True) for v3_property in v3_entity.raw_property_list(): self.__add_v4_property_to_entity(v4_entity, v4_properties, v3_property, False) def v4_value_to_v3_property_value(self, v4_value, v3_value): """Converts a v4 Value to a v3 PropertyValue. Args: v4_value: an entity_v4_pb.Value v3_value: an entity_pb.PropertyValue to populate """ v3_value.Clear() if v4_value.has_boolean_value(): v3_value.set_booleanvalue(v4_value.boolean_value()) elif v4_value.has_integer_value(): v3_value.set_int64value(v4_value.integer_value()) elif v4_value.has_double_value(): v3_value.set_doublevalue(v4_value.double_value()) elif v4_value.has_timestamp_microseconds_value(): v3_value.set_int64value(v4_value.timestamp_microseconds_value()) elif v4_value.has_key_value(): v3_ref = entity_pb.Reference() self.v4_to_v3_reference(v4_value.key_value(), v3_ref) self.v3_reference_to_v3_property_value(v3_ref, v3_value) elif v4_value.has_blob_key_value(): v3_value.set_stringvalue(v4_value.blob_key_value()) elif v4_value.has_string_value(): v3_value.set_stringvalue(v4_value.string_value()) elif v4_value.has_blob_value(): v3_value.set_stringvalue(v4_value.blob_value()) elif v4_value.has_entity_value(): v4_entity_value = v4_value.entity_value() v4_meaning = v4_value.meaning() if (v4_meaning == MEANING_GEORSS_POINT or v4_meaning == MEANING_PREDEFINED_ENTITY_POINT): self.__v4_to_v3_point_value(v4_entity_value, v3_value.mutable_pointvalue()) elif v4_meaning == MEANING_PREDEFINED_ENTITY_USER: self.v4_entity_to_v3_user_value(v4_entity_value, v3_value.mutable_uservalue()) else: v3_entity_value = entity_pb.EntityProto() self.v4_to_v3_entity(v4_entity_value, v3_entity_value) v3_value.set_stringvalue(v3_entity_value.SerializePartialToString()) elif v4_value.has_geo_point_value(): point_value = v3_value.mutable_pointvalue() point_value.set_x(v4_value.geo_point_value().latitude()) point_value.set_y(v4_value.geo_point_value().longitude()) else: pass def v3_property_to_v4_value(self, v3_property, indexed, v4_value): """Converts a v3 Property to a v4 Value. Args: v3_property: an entity_pb.Property indexed: whether the v3 property is indexed v4_value: an entity_v4_pb.Value to populate """ v4_value.Clear() v3_property_value = v3_property.value() v3_meaning = v3_property.meaning() v3_uri_meaning = None if v3_property.meaning_uri(): v3_uri_meaning = v3_property.meaning_uri() if not self.__is_v3_property_value_union_valid(v3_property_value): v3_meaning = None v3_uri_meaning = None elif v3_meaning == entity_pb.Property.NO_MEANING: v3_meaning = None elif not self.__is_v3_property_value_meaning_valid(v3_property_value, v3_meaning): v3_meaning = None is_zlib_value = False if v3_uri_meaning: if v3_uri_meaning == URI_MEANING_ZLIB: if v3_property_value.has_stringvalue(): is_zlib_value = True if v3_meaning != entity_pb.Property.BLOB: v3_meaning = entity_pb.Property.BLOB else: pass else: pass if v3_property_value.has_booleanvalue(): v4_value.set_boolean_value(v3_property_value.booleanvalue()) elif v3_property_value.has_int64value(): if v3_meaning == entity_pb.Property.GD_WHEN: v4_value.set_timestamp_microseconds_value( v3_property_value.int64value()) v3_meaning = None else: v4_value.set_integer_value(v3_property_value.int64value()) elif v3_property_value.has_doublevalue(): v4_value.set_double_value(v3_property_value.doublevalue()) elif v3_property_value.has_referencevalue(): v3_ref = entity_pb.Reference() self.__v3_reference_value_to_v3_reference( v3_property_value.referencevalue(), v3_ref) self.v3_to_v4_key(v3_ref, v4_value.mutable_key_value()) elif v3_property_value.has_stringvalue(): if v3_meaning == entity_pb.Property.ENTITY_PROTO: serialized_entity_v3 = v3_property_value.stringvalue() v3_entity = entity_pb.EntityProto() v3_entity.ParsePartialFromString(serialized_entity_v3) self.v3_to_v4_entity(v3_entity, v4_value.mutable_entity_value()) v3_meaning = None elif (v3_meaning == entity_pb.Property.BLOB or v3_meaning == entity_pb.Property.BYTESTRING): v4_value.set_blob_value(v3_property_value.stringvalue()) if indexed or v3_meaning == entity_pb.Property.BLOB: v3_meaning = None else: string_value = v3_property_value.stringvalue() if is_valid_utf8(string_value): if v3_meaning == entity_pb.Property.BLOBKEY: v4_value.set_blob_key_value(string_value) v3_meaning = None else: v4_value.set_string_value(string_value) else: v4_value.set_blob_value(string_value) if v3_meaning != entity_pb.Property.INDEX_VALUE: v3_meaning = None elif v3_property_value.has_pointvalue(): if v3_meaning == MEANING_GEORSS_POINT: point_value = v3_property_value.pointvalue() v4_value.mutable_geo_point_value().set_latitude(point_value.x()) v4_value.mutable_geo_point_value().set_longitude(point_value.y()) else: self.__v3_to_v4_point_entity(v3_property_value.pointvalue(), v4_value.mutable_entity_value()) v4_value.set_meaning(MEANING_PREDEFINED_ENTITY_POINT) v3_meaning = None elif v3_property_value.has_uservalue(): self.v3_user_value_to_v4_entity(v3_property_value.uservalue(), v4_value.mutable_entity_value()) v4_value.set_meaning(MEANING_PREDEFINED_ENTITY_USER) v3_meaning = None else: pass if is_zlib_value: v4_value.set_meaning(MEANING_ZLIB) elif v3_meaning: v4_value.set_meaning(v3_meaning) if indexed != v4_value.indexed(): v4_value.set_indexed(indexed) def v4_to_v3_property(self, property_name, is_multi, is_projection, v4_value, v3_property): """Converts info from a v4 Property to a v3 Property. v4_value must not have a list_value. Args: property_name: the name of the property is_multi: whether the property contains multiple values is_projection: whether the property is projected v4_value: an entity_v4_pb.Value v3_property: an entity_pb.Property to populate """ assert not v4_value.list_value_list(), 'v4 list_value not convertable to v3' v3_property.Clear() v3_property.set_name(property_name) if v4_value.has_meaning() and v4_value.meaning() == MEANING_EMPTY_LIST: v3_property.set_meaning(MEANING_EMPTY_LIST) v3_property.set_multiple(False) v3_property.mutable_value() return v3_property.set_multiple(is_multi) self.v4_value_to_v3_property_value(v4_value, v3_property.mutable_value()) v4_meaning = None if v4_value.has_meaning(): v4_meaning = v4_value.meaning() if v4_value.has_timestamp_microseconds_value(): v3_property.set_meaning(entity_pb.Property.GD_WHEN) elif v4_value.has_blob_key_value(): v3_property.set_meaning(entity_pb.Property.BLOBKEY) elif v4_value.has_blob_value(): if v4_meaning == MEANING_ZLIB: v3_property.set_meaning_uri(URI_MEANING_ZLIB) if v4_meaning == entity_pb.Property.BYTESTRING: if v4_value.indexed(): pass else: if v4_value.indexed(): v3_property.set_meaning(entity_pb.Property.BYTESTRING) else: v3_property.set_meaning(entity_pb.Property.BLOB) v4_meaning = None elif v4_value.has_entity_value(): if v4_meaning != MEANING_GEORSS_POINT: if (v4_meaning != MEANING_PREDEFINED_ENTITY_POINT and v4_meaning != MEANING_PREDEFINED_ENTITY_USER): v3_property.set_meaning(entity_pb.Property.ENTITY_PROTO) v4_meaning = None elif v4_value.has_geo_point_value(): v3_property.set_meaning(MEANING_GEORSS_POINT) else: pass if v4_meaning is not None: v3_property.set_meaning(v4_meaning) if is_projection: v3_property.set_meaning(entity_pb.Property.INDEX_VALUE) def __add_v3_property_from_v4(self, property_name, is_multi, is_projection, v4_value, v3_entity): """Adds a v3 Property to an Entity based on information from a v4 Property. Args: property_name: the name of the property is_multi: whether the property contains multiple values is_projection: whether the property is a projection v4_value: an entity_v4_pb.Value v3_entity: an entity_pb.EntityProto """ if v4_value.indexed(): self.v4_to_v3_property(property_name, is_multi, is_projection, v4_value, v3_entity.add_property()) else: self.v4_to_v3_property(property_name, is_multi, is_projection, v4_value, v3_entity.add_raw_property()) def __build_name_to_v4_property_map(self, v4_entity): property_map = {} for prop in v4_entity.property_list(): property_map[prop.name()] = prop return property_map def __add_v4_property_to_entity(self, v4_entity, property_map, v3_property, indexed): """Adds a v4 Property to an entity or modifies an existing one. property_map is used to track of properties that have already been added. The same dict should be used for all of an entity's properties. Args: v4_entity: an entity_v4_pb.Entity property_map: a dict of name -> v4_property v3_property: an entity_pb.Property to convert to v4 and add to the dict indexed: whether the property is indexed """ property_name = v3_property.name() if property_name in property_map: v4_property = property_map[property_name] else: v4_property = v4_entity.add_property() v4_property.set_name(property_name) property_map[property_name] = v4_property if v3_property.multiple(): self.v3_property_to_v4_value(v3_property, indexed, v4_property.mutable_value().add_list_value()) else: self.v3_property_to_v4_value(v3_property, indexed, v4_property.mutable_value()) def __get_v4_integer_value(self, v4_property): """Returns an integer value from a v4 Property. Args: v4_property: an entity_v4_pb.Property Returns: an integer Raises: InvalidConversionError: if the property doesn't contain an integer value """ check_conversion(v4_property.value().has_integer_value(), 'Property does not contain an integer value.') return v4_property.value().integer_value() def __get_v4_double_value(self, v4_property): """Returns a double value from a v4 Property. Args: v4_property: an entity_v4_pb.Property Returns: a double Raises: InvalidConversionError: if the property doesn't contain a double value """ check_conversion(v4_property.value().has_double_value(), 'Property does not contain a double value.') return v4_property.value().double_value() def __get_v4_string_value(self, v4_property): """Returns an string value from a v4 Property. Args: v4_property: an entity_v4_pb.Property Returns: a string Throws: InvalidConversionError: if the property doesn't contain a string value """ check_conversion(v4_property.value().has_string_value(), 'Property does not contain a string value.') return v4_property.value().string_value() def __v4_integer_property(self, name, value, indexed): """Creates a single-integer-valued v4 Property. Args: name: the property name value: the integer value of the property indexed: whether the value should be indexed Returns: an entity_v4_pb.Property """ v4_property = entity_v4_pb.Property() v4_property.set_name(name) v4_value = v4_property.mutable_value() v4_value.set_indexed(indexed) v4_value.set_integer_value(value) return v4_property def __v4_double_property(self, name, value, indexed): """Creates a single-double-valued v4 Property. Args: name: the property name value: the double value of the property indexed: whether the value should be indexed Returns: an entity_v4_pb.Property """ v4_property = entity_v4_pb.Property() v4_property.set_name(name) v4_value = v4_property.mutable_value() v4_value.set_indexed(indexed) v4_value.set_double_value(value) return v4_property def __v4_string_property(self, name, value, indexed): """Creates a single-string-valued v4 Property. Args: name: the property name value: the string value of the property indexed: whether the value should be indexed Returns: an entity_v4_pb.Property """ v4_property = entity_v4_pb.Property() v4_property.set_name(name) v4_value = v4_property.mutable_value() v4_value.set_indexed(indexed) v4_value.set_string_value(value) return v4_property def __v4_to_v3_point_value(self, v4_point_entity, v3_point_value): """Converts a v4 point Entity to a v3 PointValue. Args: v4_point_entity: an entity_v4_pb.Entity representing a point v3_point_value: an entity_pb.Property_PointValue to populate """ v3_point_value.Clear() name_to_v4_property = self.__build_name_to_v4_property_map(v4_point_entity) v3_point_value.set_x( self.__get_v4_double_value(name_to_v4_property['x'])) v3_point_value.set_y( self.__get_v4_double_value(name_to_v4_property['y'])) def __v3_to_v4_point_entity(self, v3_point_value, v4_entity): """Converts a v3 UserValue to a v4 user Entity. Args: v3_point_value: an entity_pb.Property_PointValue v4_entity: an entity_v4_pb.Entity to populate """ v4_entity.Clear() v4_entity.property_list().append( self.__v4_double_property(PROPERTY_NAME_X, v3_point_value.x(), False)) v4_entity.property_list().append( self.__v4_double_property(PROPERTY_NAME_Y, v3_point_value.y(), False)) def v4_entity_to_v3_user_value(self, v4_user_entity, v3_user_value): """Converts a v4 user Entity to a v3 UserValue. Args: v4_user_entity: an entity_v4_pb.Entity representing a user v3_user_value: an entity_pb.Property_UserValue to populate """ v3_user_value.Clear() name_to_v4_property = self.__build_name_to_v4_property_map(v4_user_entity) v3_user_value.set_email(self.__get_v4_string_value( name_to_v4_property[PROPERTY_NAME_EMAIL])) v3_user_value.set_auth_domain(self.__get_v4_string_value( name_to_v4_property[PROPERTY_NAME_AUTH_DOMAIN])) if PROPERTY_NAME_USER_ID in name_to_v4_property: v3_user_value.set_obfuscated_gaiaid( self.__get_v4_string_value( name_to_v4_property[PROPERTY_NAME_USER_ID])) if PROPERTY_NAME_INTERNAL_ID in name_to_v4_property: v3_user_value.set_gaiaid(self.__get_v4_integer_value( name_to_v4_property[PROPERTY_NAME_INTERNAL_ID])) else: v3_user_value.set_gaiaid(0) if PROPERTY_NAME_FEDERATED_IDENTITY in name_to_v4_property: v3_user_value.set_federated_identity( self.__get_v4_string_value(name_to_v4_property[ PROPERTY_NAME_FEDERATED_IDENTITY])) if PROPERTY_NAME_FEDERATED_PROVIDER in name_to_v4_property: v3_user_value.set_federated_provider( self.__get_v4_string_value(name_to_v4_property[ PROPERTY_NAME_FEDERATED_PROVIDER])) def v3_user_value_to_v4_entity(self, v3_user_value, v4_entity): """Converts a v3 UserValue to a v4 user Entity. Args: v3_user_value: an entity_pb.Property_UserValue v4_entity: an entity_v4_pb.Entity to populate """ v4_entity.Clear() v4_entity.property_list().append( self.__v4_string_property(PROPERTY_NAME_EMAIL, v3_user_value.email(), False)) v4_entity.property_list().append(self.__v4_string_property( PROPERTY_NAME_AUTH_DOMAIN, v3_user_value.auth_domain(), False)) if v3_user_value.gaiaid() != 0: v4_entity.property_list().append(self.__v4_integer_property( PROPERTY_NAME_INTERNAL_ID, v3_user_value.gaiaid(), False)) if v3_user_value.has_obfuscated_gaiaid(): v4_entity.property_list().append(self.__v4_string_property( PROPERTY_NAME_USER_ID, v3_user_value.obfuscated_gaiaid(), False)) if v3_user_value.has_federated_identity(): v4_entity.property_list().append(self.__v4_string_property( PROPERTY_NAME_FEDERATED_IDENTITY, v3_user_value.federated_identity(), False)) if v3_user_value.has_federated_provider(): v4_entity.property_list().append(self.__v4_string_property( PROPERTY_NAME_FEDERATED_PROVIDER, v3_user_value.federated_provider(), False)) def v1_to_v3_reference(self, v1_key, v3_ref): """Converts a v1 Key to a v3 Reference. Args: v1_key: an googledatastore.Key v3_ref: an entity_pb.Reference to populate """ v3_ref.Clear() if v1_key.HasField('partition_id'): project_id = v1_key.partition_id.project_id if project_id: app_id = self._id_resolver.resolve_app_id(project_id) v3_ref.set_app(app_id) if v1_key.partition_id.namespace_id: v3_ref.set_name_space(v1_key.partition_id.namespace_id) for v1_element in v1_key.path: v3_element = v3_ref.mutable_path().add_element() v3_element.set_type(v1_element.kind.encode('utf-8')) id_type = v1_element.WhichOneof('id_type') if id_type == 'id': v3_element.set_id(v1_element.id) elif id_type == 'name': v3_element.set_name(v1_element.name.encode('utf-8')) def v1_to_v3_references(self, v1_keys): """Converts a list of v1 Keys to a list of v3 References. Args: v1_keys: a list of googledatastore.Key objects Returns: a list of entity_pb.Reference objects """ v3_refs = [] for v1_key in v1_keys: v3_ref = entity_pb.Reference() self.v1_to_v3_reference(v1_key, v3_ref) v3_refs.append(v3_ref) return v3_refs def v3_to_v1_key(self, v3_ref, v1_key): """Converts a v3 Reference to a v1 Key. Args: v3_ref: an entity_pb.Reference v1_key: an googledatastore.Key to populate """ v1_key.Clear() if not v3_ref.app(): return project_id = self._id_resolver.resolve_project_id(v3_ref.app()) v1_key.partition_id.project_id = project_id if v3_ref.name_space(): v1_key.partition_id.namespace_id = v3_ref.name_space() for v3_element in v3_ref.path().element_list(): v1_element = v1_key.path.add() v1_element.kind = v3_element.type() if v3_element.has_id(): v1_element.id = v3_element.id() if v3_element.has_name(): v1_element.name = v3_element.name() def v3_to_v1_keys(self, v3_refs): """Converts a list of v3 References to a list of v1 Keys. Args: v3_refs: a list of entity_pb.Reference objects Returns: a list of googledatastore.Key objects """ v1_keys = [] for v3_ref in v3_refs: v1_key = googledatastore.Key() self.v3_to_v1_key(v3_ref, v1_key) v1_keys.append(v1_key) return v1_keys def project_to_app_id(self, project_id): """Converts a string project id to a string app id.""" return self._id_resolver.resolve_app_id(project_id) def app_to_project_id(self, app_id): """Converts a string app id to a string project id.""" return self._id_resolver.resolve_project_id(app_id) def __new_v3_property(self, v3_entity, is_indexed): if is_indexed: return v3_entity.add_property() else: return v3_entity.add_raw_property() def v1_to_v3_entity(self, v1_entity, v3_entity, is_projection=False): """Converts a v1 Entity to a v3 EntityProto. Args: v1_entity: an googledatastore.Entity v3_entity: an entity_pb.EntityProto to populate is_projection: True if the v1_entity is from a projection query. """ v3_entity.Clear() for property_name, v1_value in v1_entity.properties.items(): if v1_value.HasField('array_value'): if len(v1_value.array_value.values) == 0: empty_list = self.__new_v3_property(v3_entity, not v1_value.exclude_from_indexes) empty_list.set_name(property_name.encode('utf-8')) empty_list.set_multiple(False) empty_list.set_meaning(MEANING_EMPTY_LIST) empty_list.mutable_value() else: for v1_sub_value in v1_value.array_value.values: list_element = self.__new_v3_property( v3_entity, not v1_sub_value.exclude_from_indexes) self.v1_to_v3_property( property_name, True, is_projection, v1_sub_value, list_element) else: value_property = self.__new_v3_property( v3_entity, not v1_value.exclude_from_indexes) self.v1_to_v3_property( property_name, False, is_projection, v1_value, value_property) if v1_entity.HasField('key'): v1_key = v1_entity.key self.v1_to_v3_reference(v1_key, v3_entity.mutable_key()) v3_ref = v3_entity.key() self.v3_reference_to_group(v3_ref, v3_entity.mutable_entity_group()) else: pass def v3_to_v1_entity(self, v3_entity, v1_entity): """Converts a v3 EntityProto to a v1 Entity. Args: v3_entity: an entity_pb.EntityProto v1_entity: an googledatastore.Proto to populate """ v1_entity.Clear() self.v3_to_v1_key(v3_entity.key(), v1_entity.key) if not v3_entity.key().has_app(): v1_entity.ClearField('key') for v3_property in v3_entity.property_list(): self.__add_v1_property_to_entity(v1_entity, v3_property, True) for v3_property in v3_entity.raw_property_list(): self.__add_v1_property_to_entity(v1_entity, v3_property, False) def v1_value_to_v3_property_value(self, v1_value, v3_value): """Converts a v1 Value to a v3 PropertyValue. Args: v1_value: an googledatastore.Value v3_value: an entity_pb.PropertyValue to populate """ v3_value.Clear() field = v1_value.WhichOneof('value_type') if field == 'boolean_value': v3_value.set_booleanvalue(v1_value.boolean_value) elif field == 'integer_value': v3_value.set_int64value(v1_value.integer_value) elif field == 'double_value': v3_value.set_doublevalue(v1_value.double_value) elif field == 'timestamp_value': v3_value.set_int64value( googledatastore.helper.micros_from_timestamp( v1_value.timestamp_value)) elif field == 'key_value': v3_ref = entity_pb.Reference() self.v1_to_v3_reference(v1_value.key_value, v3_ref) self.v3_reference_to_v3_property_value(v3_ref, v3_value) elif field == 'string_value': v3_value.set_stringvalue(v1_value.string_value.encode('utf-8')) elif field == 'blob_value': v3_value.set_stringvalue(v1_value.blob_value) elif field == 'entity_value': v1_entity_value = v1_value.entity_value v1_meaning = v1_value.meaning if v1_meaning == MEANING_PREDEFINED_ENTITY_USER: self.v1_entity_to_v3_user_value(v1_entity_value, v3_value.mutable_uservalue()) else: v3_entity_value = entity_pb.EntityProto() self.v1_to_v3_entity(v1_entity_value, v3_entity_value) v3_value.set_stringvalue(v3_entity_value.SerializePartialToString()) elif field == 'geo_point_value': point_value = v3_value.mutable_pointvalue() point_value.set_x(v1_value.geo_point_value.latitude) point_value.set_y(v1_value.geo_point_value.longitude) elif field == 'null_value': pass else: pass def v3_property_to_v1_value(self, v3_property, indexed, v1_value): """Converts a v3 Property to a v1 Value. Args: v3_property: an entity_pb.Property indexed: whether the v3 property is indexed v1_value: an googledatastore.Value to populate """ v1_value.Clear() v3_property_value = v3_property.value() v3_meaning = v3_property.meaning() v3_uri_meaning = None if v3_property.meaning_uri(): v3_uri_meaning = v3_property.meaning_uri() if not self.__is_v3_property_value_union_valid(v3_property_value): v3_meaning = None v3_uri_meaning = None elif v3_meaning == entity_pb.Property.NO_MEANING: v3_meaning = None elif not self.__is_v3_property_value_meaning_valid(v3_property_value, v3_meaning): v3_meaning = None is_zlib_value = False if v3_uri_meaning: if v3_uri_meaning == URI_MEANING_ZLIB: if v3_property_value.has_stringvalue(): is_zlib_value = True if v3_meaning != entity_pb.Property.BLOB: v3_meaning = entity_pb.Property.BLOB else: pass else: pass if v3_property.meaning() == entity_pb.Property.EMPTY_LIST: v1_value.array_value.values.extend([]) v3_meaning = None elif v3_property_value.has_booleanvalue(): v1_value.boolean_value = v3_property_value.booleanvalue() elif v3_property_value.has_int64value(): if v3_meaning == entity_pb.Property.GD_WHEN: googledatastore.helper.micros_to_timestamp( v3_property_value.int64value(), v1_value.timestamp_value) v3_meaning = None else: v1_value.integer_value = v3_property_value.int64value() elif v3_property_value.has_doublevalue(): v1_value.double_value = v3_property_value.doublevalue() elif v3_property_value.has_referencevalue(): v3_ref = entity_pb.Reference() self.__v3_reference_value_to_v3_reference( v3_property_value.referencevalue(), v3_ref) self.v3_to_v1_key(v3_ref, v1_value.key_value) elif v3_property_value.has_stringvalue(): if v3_meaning == entity_pb.Property.ENTITY_PROTO: serialized_entity_v3 = v3_property_value.stringvalue() v3_entity = entity_pb.EntityProto() v3_entity.ParsePartialFromString(serialized_entity_v3) self.v3_to_v1_entity(v3_entity, v1_value.entity_value) v3_meaning = None elif (v3_meaning == entity_pb.Property.BLOB or v3_meaning == entity_pb.Property.BYTESTRING): v1_value.blob_value = v3_property_value.stringvalue() if indexed or v3_meaning == entity_pb.Property.BLOB: v3_meaning = None else: string_value = v3_property_value.stringvalue() if is_valid_utf8(string_value): v1_value.string_value = string_value else: v1_value.blob_value = string_value if v3_meaning != entity_pb.Property.INDEX_VALUE: v3_meaning = None elif v3_property_value.has_pointvalue(): if v3_meaning != MEANING_GEORSS_POINT: v1_value.meaning = MEANING_POINT_WITHOUT_V3_MEANING point_value = v3_property_value.pointvalue() v1_value.geo_point_value.latitude = point_value.x() v1_value.geo_point_value.longitude = point_value.y() v3_meaning = None elif v3_property_value.has_uservalue(): self.v3_user_value_to_v1_entity(v3_property_value.uservalue(), v1_value.entity_value) v1_value.meaning = MEANING_PREDEFINED_ENTITY_USER v3_meaning = None else: v1_value.null_value = googledatastore.NULL_VALUE if is_zlib_value: v1_value.meaning = MEANING_ZLIB elif v3_meaning: v1_value.meaning = v3_meaning if indexed == v1_value.exclude_from_indexes: v1_value.exclude_from_indexes = not indexed def v1_to_v3_property(self, property_name, is_multi, is_projection, v1_value, v3_property): """Converts info from a v1 Property to a v3 Property. v1_value must not have an array_value. Args: property_name: the name of the property, unicode is_multi: whether the property contains multiple values is_projection: whether the property is projected v1_value: an googledatastore.Value v3_property: an entity_pb.Property to populate """ v1_value_type = v1_value.WhichOneof('value_type') if v1_value_type == 'array_value': assert False, 'v1 array_value not convertable to v3' v3_property.Clear() v3_property.set_name(property_name.encode('utf-8')) v3_property.set_multiple(is_multi) self.v1_value_to_v3_property_value(v1_value, v3_property.mutable_value()) v1_meaning = None if v1_value.meaning: v1_meaning = v1_value.meaning if v1_value_type == 'timestamp_value': v3_property.set_meaning(entity_pb.Property.GD_WHEN) elif v1_value_type == 'blob_value': if v1_meaning == MEANING_ZLIB: v3_property.set_meaning_uri(URI_MEANING_ZLIB) if v1_meaning == entity_pb.Property.BYTESTRING: if not v1_value.exclude_from_indexes: pass else: if not v1_value.exclude_from_indexes: v3_property.set_meaning(entity_pb.Property.BYTESTRING) else: v3_property.set_meaning(entity_pb.Property.BLOB) v1_meaning = None elif v1_value_type == 'entity_value': if v1_meaning != MEANING_PREDEFINED_ENTITY_USER: v3_property.set_meaning(entity_pb.Property.ENTITY_PROTO) v1_meaning = None elif v1_value_type == 'geo_point_value': if v1_meaning != MEANING_POINT_WITHOUT_V3_MEANING: v3_property.set_meaning(MEANING_GEORSS_POINT) v1_meaning = None else: pass if v1_meaning is not None: v3_property.set_meaning(v1_meaning) if is_projection: v3_property.set_meaning(entity_pb.Property.INDEX_VALUE) def __add_v1_property_to_entity(self, v1_entity, v3_property, indexed): """Adds a v1 Property to an entity or modifies an existing one. Args: v1_entity: an googledatastore.Entity v3_property: an entity_pb.Property to convert to v1 and add to the dict indexed: whether the property is indexed """ property_name = v3_property.name() v1_value = v1_entity.properties[property_name] if v3_property.multiple(): self.v3_property_to_v1_value(v3_property, indexed, v1_value.array_value.values.add()) else: self.v3_property_to_v1_value(v3_property, indexed, v1_value) def __get_v1_integer_value(self, v1_value): """Returns an integer value from a v1 Value. Args: v1_value: a googledatastore.Value Returns: an integer Raises: InvalidConversionError: if the value doesn't contain an integer value """ check_conversion(v1_value.HasField('integer_value'), 'Value does not contain an integer value.') return v1_value.integer_value def __get_v1_double_value(self, v1_value): """Returns a double value from a v1 Value. Args: v1_value: an googledatastore.Value Returns: a double Raises: InvalidConversionError: if the value doesn't contain a double value """ check_conversion(v1_value.HasField('double_value'), 'Value does not contain a double value.') return v1_value.double_value def __get_v1_string_value(self, v1_value): """Returns an string value from a v1 Value. Args: v1_value: an googledatastore.Value Returns: a string Throws: InvalidConversionError: if the value doesn't contain a string value """ check_conversion(v1_value.HasField('string_value'), 'Value does not contain a string value.') return v1_value.string_value def __v1_integer_property(self, entity, name, value, indexed): """Populates a single-integer-valued v1 Property. Args: entity: the entity to populate name: the name of the property to populate value: the integer value of the property indexed: whether the value should be indexed """ v1_value = entity.properties[name] v1_value.exclude_from_indexes = not indexed v1_value.integer_value = value def __v1_double_property(self, entity, name, value, indexed): """Populates a single-double-valued v1 Property. Args: entity: the entity to populate name: the name of the property to populate value: the double value of the property indexed: whether the value should be indexed """ v1_value = entity.properties[name] v1_value.exclude_from_indexes = not indexed v1_value.double_value = value def __v1_string_property(self, entity, name, value, indexed): """Populates a single-string-valued v1 Property. Args: entity: the entity to populate name: the name of the property to populate value: the string value of the property indexed: whether the value should be indexed """ v1_value = entity.properties[name] v1_value.exclude_from_indexes = not indexed v1_value.string_value = value def v1_entity_to_v3_user_value(self, v1_user_entity, v3_user_value): """Converts a v1 user Entity to a v3 UserValue. Args: v1_user_entity: an googledatastore.Entity representing a user v3_user_value: an entity_pb.Property_UserValue to populate """ v3_user_value.Clear() properties = v1_user_entity.properties v3_user_value.set_email(self.__get_v1_string_value( properties[PROPERTY_NAME_EMAIL])) v3_user_value.set_auth_domain(self.__get_v1_string_value( properties[PROPERTY_NAME_AUTH_DOMAIN])) if PROPERTY_NAME_USER_ID in properties: v3_user_value.set_obfuscated_gaiaid( self.__get_v1_string_value(properties[PROPERTY_NAME_USER_ID])) if PROPERTY_NAME_INTERNAL_ID in properties: v3_user_value.set_gaiaid(self.__get_v1_integer_value( properties[PROPERTY_NAME_INTERNAL_ID])) else: v3_user_value.set_gaiaid(0) if PROPERTY_NAME_FEDERATED_IDENTITY in properties: v3_user_value.set_federated_identity( self.__get_v1_string_value(properties[ PROPERTY_NAME_FEDERATED_IDENTITY])) if PROPERTY_NAME_FEDERATED_PROVIDER in properties: v3_user_value.set_federated_provider( self.__get_v1_string_value(properties[ PROPERTY_NAME_FEDERATED_PROVIDER])) def v3_user_value_to_v1_entity(self, v3_user_value, v1_entity): """Converts a v3 UserValue to a v1 user Entity. Args: v3_user_value: an entity_pb.Property_UserValue v1_entity: an googledatastore.Entity to populate """ v1_entity.Clear() self.__v1_string_property(v1_entity, PROPERTY_NAME_EMAIL, v3_user_value.email(), False) self.__v1_string_property(v1_entity, PROPERTY_NAME_AUTH_DOMAIN, v3_user_value.auth_domain(), False) if v3_user_value.gaiaid() != 0: self.__v1_integer_property( v1_entity, PROPERTY_NAME_INTERNAL_ID, v3_user_value.gaiaid(), False) if v3_user_value.has_obfuscated_gaiaid(): self.__v1_string_property( v1_entity, PROPERTY_NAME_USER_ID, v3_user_value.obfuscated_gaiaid(), False) if v3_user_value.has_federated_identity(): self.__v1_string_property( v1_entity, PROPERTY_NAME_FEDERATED_IDENTITY, v3_user_value.federated_identity(), False) if v3_user_value.has_federated_provider(): self.__v1_string_property( v1_entity, PROPERTY_NAME_FEDERATED_PROVIDER, v3_user_value.federated_provider(), False) def __is_v3_property_value_union_valid(self, v3_property_value): """Returns True if the v3 PropertyValue's union is valid.""" num_sub_values = (v3_property_value.has_booleanvalue() + v3_property_value.has_int64value() + v3_property_value.has_doublevalue() + v3_property_value.has_referencevalue() + v3_property_value.has_stringvalue() + v3_property_value.has_pointvalue() + v3_property_value.has_uservalue()) return num_sub_values <= 1 def __is_v3_property_value_meaning_valid(self, v3_property_value, v3_meaning): """Returns True if the v3 PropertyValue's type value matches its meaning.""" def ReturnTrue(): return True def HasStringValue(): return v3_property_value.has_stringvalue() def HasInt64Value(): return v3_property_value.has_int64value() def HasPointValue(): return v3_property_value.has_pointvalue() def ReturnFalse(): return False value_checkers = { entity_pb.Property.NO_MEANING: ReturnTrue, entity_pb.Property.INDEX_VALUE: ReturnTrue, entity_pb.Property.BLOB: HasStringValue, entity_pb.Property.TEXT: HasStringValue, entity_pb.Property.BYTESTRING: HasStringValue, entity_pb.Property.ATOM_CATEGORY: HasStringValue, entity_pb.Property.ATOM_LINK: HasStringValue, entity_pb.Property.ATOM_TITLE: HasStringValue, entity_pb.Property.ATOM_CONTENT: HasStringValue, entity_pb.Property.ATOM_SUMMARY: HasStringValue, entity_pb.Property.ATOM_AUTHOR: HasStringValue, entity_pb.Property.GD_EMAIL: HasStringValue, entity_pb.Property.GD_IM: HasStringValue, entity_pb.Property.GD_PHONENUMBER: HasStringValue, entity_pb.Property.GD_POSTALADDRESS: HasStringValue, entity_pb.Property.BLOBKEY: HasStringValue, entity_pb.Property.ENTITY_PROTO: HasStringValue, entity_pb.Property.GD_WHEN: HasInt64Value, entity_pb.Property.GD_RATING: HasInt64Value, entity_pb.Property.GEORSS_POINT: HasPointValue, entity_pb.Property.EMPTY_LIST: ReturnTrue, } default = ReturnFalse return value_checkers.get(v3_meaning, default)() def __v3_reference_has_id_or_name(self, v3_ref): """Determines if a v3 Reference specifies an ID or name. Args: v3_ref: an entity_pb.Reference Returns: boolean: True if the last path element specifies an ID or name. """ path = v3_ref.path() assert path.element_size() >= 1 last_element = path.element(path.element_size() - 1) return last_element.has_id() or last_element.has_name() def v3_reference_to_group(self, v3_ref, group): """Converts a v3 Reference to a v3 Path representing the entity group. The entity group is represented as an entity_pb.Path containing only the first element in the provided Reference. Args: v3_ref: an entity_pb.Reference group: an entity_pb.Path to populate """ group.Clear() path = v3_ref.path() assert path.element_size() >= 1 group.add_element().CopyFrom(path.element(0)) def v3_reference_to_v3_property_value(self, v3_ref, v3_property_value): """Converts a v3 Reference to a v3 PropertyValue. Args: v3_ref: an entity_pb.Reference v3_property_value: an entity_pb.PropertyValue to populate """ v3_property_value.Clear() reference_value = v3_property_value.mutable_referencevalue() if v3_ref.has_app(): reference_value.set_app(v3_ref.app()) if v3_ref.has_name_space(): reference_value.set_name_space(v3_ref.name_space()) for v3_path_element in v3_ref.path().element_list(): v3_ref_value_path_element = reference_value.add_pathelement() if v3_path_element.has_type(): v3_ref_value_path_element.set_type(v3_path_element.type()) if v3_path_element.has_id(): v3_ref_value_path_element.set_id(v3_path_element.id()) if v3_path_element.has_name(): v3_ref_value_path_element.set_name(v3_path_element.name()) def __v3_reference_value_to_v3_reference(self, v3_ref_value, v3_ref): """Converts a v3 ReferenceValue to a v3 Reference. Args: v3_ref_value: an entity_pb.PropertyValue_ReferenceValue v3_ref: an entity_pb.Reference to populate """ v3_ref.Clear() if v3_ref_value.has_app(): v3_ref.set_app(v3_ref_value.app()) if v3_ref_value.has_name_space(): v3_ref.set_name_space(v3_ref_value.name_space()) for v3_ref_value_path_element in v3_ref_value.pathelement_list(): v3_path_element = v3_ref.mutable_path().add_element() if v3_ref_value_path_element.has_type(): v3_path_element.set_type(v3_ref_value_path_element.type()) if v3_ref_value_path_element.has_id(): v3_path_element.set_id(v3_ref_value_path_element.id()) if v3_ref_value_path_element.has_name(): v3_path_element.set_name(v3_ref_value_path_element.name()) class _QueryConverter(object): """Base converter for v3 and v1 queries.""" def __init__(self, entity_converter): self._entity_converter = entity_converter def get_entity_converter(self): return self._entity_converter def _v3_filter_to_v1_property_filter(self, v3_filter, v1_property_filter): """Converts a v3 Filter to a v1 PropertyFilter. Args: v3_filter: a datastore_pb.Filter v1_property_filter: a googledatastore.PropertyFilter to populate Raises: InvalidConversionError if the filter cannot be converted """ check_conversion(v3_filter.property_size() == 1, 'invalid filter') check_conversion(v3_filter.op() <= 5, 'unsupported filter op: %d' % v3_filter.op()) v1_property_filter.Clear() v1_property_filter.op = v3_filter.op() v1_property_filter.property.name = v3_filter.property(0).name() self._entity_converter.v3_property_to_v1_value( v3_filter.property(0), True, v1_property_filter.value) def _v3_query_to_v1_ancestor_filter(self, v3_query, v1_property_filter): """Converts a v3 Query to a v1 ancestor PropertyFilter. Args: v3_query: a datastore_pb.Query v1_property_filter: a googledatastore.PropertyFilter to populate """ v1_property_filter.Clear() v1_property_filter.set_operator( googledatastore.PropertyFilter.HAS_ANCESTOR) prop = v1_property_filter.property prop.set_name(PROPERTY_NAME_KEY) self._entity_converter.v3_to_v1_key( v3_query.ancestor(), v1_property_filter.value.mutable_key_value) def v3_order_to_v1_order(self, v3_order, v1_order): """Converts a v3 Query order to a v1 PropertyOrder. Args: v3_order: a datastore_pb.Query.Order v1_order: a googledatastore.PropertyOrder to populate """ v1_order.property.name = v3_order.property() if v3_order.has_direction(): v1_order.direction = v3_order.direction() def _v3_filter_to_v4_property_filter(self, v3_filter, v4_property_filter): """Converts a v3 Filter to a v4 PropertyFilter. Args: v3_filter: a datastore_pb.Filter v4_property_filter: a datastore_v4_pb.PropertyFilter to populate Raises: InvalidConversionError if the filter cannot be converted """ check_conversion(v3_filter.property_size() == 1, 'invalid filter') check_conversion(v3_filter.op() <= 5, 'unsupported filter op: %d' % v3_filter.op()) v4_property_filter.Clear() v4_property_filter.set_operator(v3_filter.op()) v4_property_filter.mutable_property().set_name(v3_filter.property(0).name()) self._entity_converter.v3_property_to_v4_value( v3_filter.property(0), True, v4_property_filter.mutable_value()) def _v3_query_to_v4_ancestor_filter(self, v3_query, v4_property_filter): """Converts a v3 Query to a v4 ancestor PropertyFilter. Args: v3_query: a datastore_pb.Query v4_property_filter: a datastore_v4_pb.PropertyFilter to populate """ v4_property_filter.Clear() v4_property_filter.set_operator( datastore_v4_pb.PropertyFilter.HAS_ANCESTOR) prop = v4_property_filter.mutable_property() prop.set_name(PROPERTY_NAME_KEY) self._entity_converter.v3_to_v4_key( v3_query.ancestor(), v4_property_filter.mutable_value().mutable_key_value()) def v3_order_to_v4_order(self, v3_order, v4_order): """Converts a v3 Query order to a v4 PropertyOrder. Args: v3_order: a datastore_pb.Query.Order v4_order: a datastore_v4_pb.PropertyOrder to populate """ v4_order.mutable_property().set_name(v3_order.property()) if v3_order.has_direction(): v4_order.set_direction(v3_order.direction()) def get_entity_converter(id_resolver=None): """Returns a converter for v3 and v1 entities and keys. Args: id_resolver: An IdResolver for project id resolution. """ id_resolver = id_resolver or _IdentityIdResolver() return _EntityConverter(id_resolver)
import copy from django.utils import six class MergeDict(object): """ A simple class for creating new "virtual" dictionaries that actually look up values in more than one dictionary, passed in the constructor. If a key appears in more than one of the given dictionaries, only the first occurrence will be used. """ def __init__(self, *dicts): self.dicts = dicts def __bool__(self): return any(self.dicts) def __nonzero__(self): return type(self).__bool__(self) def __getitem__(self, key): for dict_ in self.dicts: try: return dict_[key] except KeyError: pass raise KeyError(key) def __copy__(self): return self.__class__(*self.dicts) def get(self, key, default=None): try: return self[key] except KeyError: return default # This is used by MergeDicts of MultiValueDicts. def getlist(self, key): for dict_ in self.dicts: if key in dict_: return dict_.getlist(key) return [] def _iteritems(self): seen = set() for dict_ in self.dicts: for item in six.iteritems(dict_): k = item[0] if k in seen: continue seen.add(k) yield item def _iterkeys(self): for k, v in self._iteritems(): yield k def _itervalues(self): for k, v in self._iteritems(): yield v if six.PY3: items = _iteritems keys = _iterkeys values = _itervalues else: iteritems = _iteritems iterkeys = _iterkeys itervalues = _itervalues def items(self): return list(self.iteritems()) def keys(self): return list(self.iterkeys()) def values(self): return list(self.itervalues()) def has_key(self, key): for dict_ in self.dicts: if key in dict_: return True return False __contains__ = has_key __iter__ = _iterkeys def copy(self): """Returns a copy of this object.""" return self.__copy__() def __str__(self): ''' Returns something like "{'key1': 'val1', 'key2': 'val2', 'key3': 'val3'}" instead of the generic "<object meta-data>" inherited from object. ''' return str(dict(self.items())) def __repr__(self): ''' Returns something like MergeDict({'key1': 'val1', 'key2': 'val2'}, {'key3': 'val3'}) instead of generic "<object meta-data>" inherited from object. ''' dictreprs = ', '.join(repr(d) for d in self.dicts) return '%s(%s)' % (self.__class__.__name__, dictreprs) class SortedDict(dict): """ A dictionary that keeps its keys in the order in which they're inserted. """ def __new__(cls, *args, **kwargs): instance = super(SortedDict, cls).__new__(cls, *args, **kwargs) instance.keyOrder = [] return instance def __init__(self, data=None): if data is None or isinstance(data, dict): data = data or [] super(SortedDict, self).__init__(data) self.keyOrder = list(data) if data else [] else: super(SortedDict, self).__init__() super_set = super(SortedDict, self).__setitem__ for key, value in data: # Take the ordering from first key if key not in self: self.keyOrder.append(key) # But override with last value in data (dict() does this) super_set(key, value) def __deepcopy__(self, memo): return self.__class__([(key, copy.deepcopy(value, memo)) for key, value in self.items()]) def __copy__(self): # The Python's default copy implementation will alter the state # of self. The reason for this seems complex but is likely related to # subclassing dict. return self.copy() def __setitem__(self, key, value): if key not in self: self.keyOrder.append(key) super(SortedDict, self).__setitem__(key, value) def __delitem__(self, key): super(SortedDict, self).__delitem__(key) self.keyOrder.remove(key) def __iter__(self): return iter(self.keyOrder) def __reversed__(self): return reversed(self.keyOrder) def pop(self, k, *args): result = super(SortedDict, self).pop(k, *args) try: self.keyOrder.remove(k) except ValueError: # Key wasn't in the dictionary in the first place. No problem. pass return result def popitem(self): result = super(SortedDict, self).popitem() self.keyOrder.remove(result[0]) return result def _iteritems(self): for key in self.keyOrder: yield key, self[key] def _iterkeys(self): for key in self.keyOrder: yield key def _itervalues(self): for key in self.keyOrder: yield self[key] if six.PY3: items = _iteritems keys = _iterkeys values = _itervalues else: iteritems = _iteritems iterkeys = _iterkeys itervalues = _itervalues def items(self): return [(k, self[k]) for k in self.keyOrder] def keys(self): return self.keyOrder[:] def values(self): return [self[k] for k in self.keyOrder] def update(self, dict_): for k, v in six.iteritems(dict_): self[k] = v def setdefault(self, key, default): if key not in self: self.keyOrder.append(key) return super(SortedDict, self).setdefault(key, default) def copy(self): """Returns a copy of this object.""" # This way of initializing the copy means it works for subclasses, too. return self.__class__(self) def __repr__(self): """ Replaces the normal dict.__repr__ with a version that returns the keys in their sorted order. """ return '{%s}' % ', '.join(['%r: %r' % (k, v) for k, v in six.iteritems(self)]) def clear(self): super(SortedDict, self).clear() self.keyOrder = [] class MultiValueDictKeyError(KeyError): pass class MultiValueDict(dict): """ A subclass of dictionary customized to handle multiple values for the same key. >>> d = MultiValueDict({'name': ['Adrian', 'Simon'], 'position': ['Developer']}) >>> d['name'] 'Simon' >>> d.getlist('name') ['Adrian', 'Simon'] >>> d.getlist('doesnotexist') [] >>> d.getlist('doesnotexist', ['Adrian', 'Simon']) ['Adrian', 'Simon'] >>> d.get('lastname', 'nonexistent') 'nonexistent' >>> d.setlist('lastname', ['Holovaty', 'Willison']) This class exists to solve the irritating problem raised by cgi.parse_qs, which returns a list for every key, even though most Web forms submit single name-value pairs. """ def __init__(self, key_to_list_mapping=()): super(MultiValueDict, self).__init__(key_to_list_mapping) def __repr__(self): return "<%s: %s>" % (self.__class__.__name__, super(MultiValueDict, self).__repr__()) def __getitem__(self, key): """ Returns the last data value for this key, or [] if it's an empty list; raises KeyError if not found. """ try: list_ = super(MultiValueDict, self).__getitem__(key) except KeyError: raise MultiValueDictKeyError("Key %r not found in %r" % (key, self)) try: return list_[-1] except IndexError: return [] def __setitem__(self, key, value): super(MultiValueDict, self).__setitem__(key, [value]) def __copy__(self): return self.__class__([ (k, v[:]) for k, v in self.lists() ]) def __deepcopy__(self, memo=None): if memo is None: memo = {} result = self.__class__() memo[id(self)] = result for key, value in dict.items(self): dict.__setitem__(result, copy.deepcopy(key, memo), copy.deepcopy(value, memo)) return result def __getstate__(self): obj_dict = self.__dict__.copy() obj_dict['_data'] = dict([(k, self.getlist(k)) for k in self]) return obj_dict def __setstate__(self, obj_dict): data = obj_dict.pop('_data', {}) for k, v in data.items(): self.setlist(k, v) self.__dict__.update(obj_dict) def get(self, key, default=None): """ Returns the last data value for the passed key. If key doesn't exist or value is an empty list, then default is returned. """ try: val = self[key] except KeyError: return default if val == []: return default return val def getlist(self, key, default=None): """ Returns the list of values for the passed key. If key doesn't exist, then a default value is returned. """ try: return super(MultiValueDict, self).__getitem__(key) except KeyError: if default is None: return [] return default def setlist(self, key, list_): super(MultiValueDict, self).__setitem__(key, list_) def setdefault(self, key, default=None): if key not in self: self[key] = default # Do not return default here because __setitem__() may store # another value -- QueryDict.__setitem__() does. Look it up. return self[key] def setlistdefault(self, key, default_list=None): if key not in self: if default_list is None: default_list = [] self.setlist(key, default_list) # Do not return default_list here because setlist() may store # another value -- QueryDict.setlist() does. Look it up. return self.getlist(key) def appendlist(self, key, value): """Appends an item to the internal list associated with key.""" self.setlistdefault(key).append(value) def _iteritems(self): """ Yields (key, value) pairs, where value is the last item in the list associated with the key. """ for key in self: yield key, self[key] def _iterlists(self): """Yields (key, list) pairs.""" return six.iteritems(super(MultiValueDict, self)) def _itervalues(self): """Yield the last value on every key list.""" for key in self: yield self[key] if six.PY3: items = _iteritems lists = _iterlists values = _itervalues else: iteritems = _iteritems iterlists = _iterlists itervalues = _itervalues def items(self): return list(self.iteritems()) def lists(self): return list(self.iterlists()) def values(self): return list(self.itervalues()) def copy(self): """Returns a shallow copy of this object.""" return copy.copy(self) def update(self, *args, **kwargs): """ update() extends rather than replaces existing key lists. Also accepts keyword args. """ if len(args) > 1: raise TypeError("update expected at most 1 arguments, got %d" % len(args)) if args: other_dict = args[0] if isinstance(other_dict, MultiValueDict): for key, value_list in other_dict.lists(): self.setlistdefault(key).extend(value_list) else: try: for key, value in other_dict.items(): self.setlistdefault(key).append(value) except TypeError: raise ValueError("MultiValueDict.update() takes either a MultiValueDict or dictionary") for key, value in six.iteritems(kwargs): self.setlistdefault(key).append(value) def dict(self): """ Returns current object as a dict with singular values. """ return dict((key, self[key]) for key in self) class ImmutableList(tuple): """ A tuple-like object that raises useful errors when it is asked to mutate. Example:: >>> a = ImmutableList(range(5), warning="You cannot mutate this.") >>> a[3] = '4' Traceback (most recent call last): ... AttributeError: You cannot mutate this. """ def __new__(cls, *args, **kwargs): if 'warning' in kwargs: warning = kwargs['warning'] del kwargs['warning'] else: warning = 'ImmutableList object is immutable.' self = tuple.__new__(cls, *args, **kwargs) self.warning = warning return self def complain(self, *wargs, **kwargs): if isinstance(self.warning, Exception): raise self.warning else: raise AttributeError(self.warning) # All list mutation functions complain. __delitem__ = complain __delslice__ = complain __iadd__ = complain __imul__ = complain __setitem__ = complain __setslice__ = complain append = complain extend = complain insert = complain pop = complain remove = complain sort = complain reverse = complain class DictWrapper(dict): """ Wraps accesses to a dictionary so that certain values (those starting with the specified prefix) are passed through a function before being returned. The prefix is removed before looking up the real value. Used by the SQL construction code to ensure that values are correctly quoted before being used. """ def __init__(self, data, func, prefix): super(DictWrapper, self).__init__(data) self.func = func self.prefix = prefix def __getitem__(self, key): """ Retrieves the real value after stripping the prefix string (if present). If the prefix is present, pass the value through self.func before returning, otherwise return the raw value. """ if key.startswith(self.prefix): use_func = True key = key[len(self.prefix):] else: use_func = False value = super(DictWrapper, self).__getitem__(key) if use_func: return self.func(value) return value
# -*- coding: utf-8 -*- import furl import httplib as http import urllib import markupsafe from django.utils import timezone from flask import request from modularodm import Q from modularodm.exceptions import NoResultsFound from modularodm.exceptions import ValidationError from modularodm.exceptions import ValidationValueError from framework import forms, sentry, status from framework import auth as framework_auth from framework.auth import exceptions from framework.auth import cas, campaigns from framework.auth import logout as osf_logout from framework.auth import get_user from framework.auth.exceptions import DuplicateEmailError, ExpiredTokenError, InvalidTokenError from framework.auth.core import generate_verification_key from framework.auth.decorators import block_bing_preview, collect_auth, must_be_logged_in from framework.auth.forms import ResendConfirmationForm, ForgotPasswordForm, ResetPasswordForm from framework.auth.utils import ensure_external_identity_uniqueness, validate_recaptcha from framework.exceptions import HTTPError from framework.flask import redirect # VOL-aware redirect from framework.sessions.utils import remove_sessions_for_user, remove_session from framework.sessions import get_session from website import settings, mails, language from website.models import User from website.util import web_url_for from website.util.time import throttle_period_expired from website.util.sanitize import strip_html from osf.models.preprint_provider import PreprintProvider @block_bing_preview @collect_auth def reset_password_get(auth, uid=None, token=None): """ View for user to land on the reset password page. HTTp Method: GET :param auth: the authentication state :param uid: the user id :param token: the token in verification key :return :raises: HTTPError(http.BAD_REQUEST) if verification key for the user is invalid, has expired or was used """ # if users are logged in, log them out and redirect back to this page if auth.logged_in: return auth_logout(redirect_url=request.url) # Check if request bears a valid pair of `uid` and `token` user_obj = User.load(uid) if not (user_obj and user_obj.verify_password_token(token=token)): error_data = { 'message_short': 'Invalid Request.', 'message_long': 'The requested URL is invalid, has expired, or was already used', } raise HTTPError(http.BAD_REQUEST, data=error_data) # refresh the verification key (v2) user_obj.verification_key_v2 = generate_verification_key(verification_type='password') user_obj.save() return { 'uid': user_obj._id, 'token': user_obj.verification_key_v2['token'], } def reset_password_post(uid=None, token=None): """ View for user to submit reset password form. HTTP Method: POST :param uid: the user id :param token: the token in verification key :return: :raises: HTTPError(http.BAD_REQUEST) if verification key for the user is invalid, has expired or was used """ form = ResetPasswordForm(request.form) # Check if request bears a valid pair of `uid` and `token` user_obj = User.load(uid) if not (user_obj and user_obj.verify_password_token(token=token)): error_data = { 'message_short': 'Invalid Request.', 'message_long': 'The requested URL is invalid, has expired, or was already used', } raise HTTPError(http.BAD_REQUEST, data=error_data) if not form.validate(): # Don't go anywhere forms.push_errors_to_status(form.errors) else: # clear verification key (v2) user_obj.verification_key_v2 = {} # new verification key (v1) for CAS user_obj.verification_key = generate_verification_key(verification_type=None) try: user_obj.set_password(form.password.data) user_obj.save() except exceptions.ChangePasswordError as error: for message in error.messages: status.push_status_message(message, kind='warning', trust=False) else: status.push_status_message('Password reset', kind='success', trust=False) # redirect to CAS and authenticate the user automatically with one-time verification key. return redirect(cas.get_login_url( web_url_for('user_account', _absolute=True), username=user_obj.username, verification_key=user_obj.verification_key )) return { 'uid': user_obj._id, 'token': user_obj.verification_key_v2['token'], } @collect_auth def forgot_password_get(auth): """ View for user to land on the forgot password page. HTTP Method: GET :param auth: the authentication context :return """ # if users are logged in, log them out and redirect back to this page if auth.logged_in: return auth_logout(redirect_url=request.url) return {} def forgot_password_post(): """ View for user to submit forgot password form. HTTP Method: POST :return {} """ form = ForgotPasswordForm(request.form, prefix='forgot_password') if not form.validate(): # Don't go anywhere forms.push_errors_to_status(form.errors) else: email = form.email.data status_message = ('If there is an OSF account associated with {0}, an email with instructions on how to ' 'reset the OSF password has been sent to {0}. If you do not receive an email and believe ' 'you should have, please contact OSF Support. ').format(email) kind = 'success' # check if the user exists user_obj = get_user(email=email) if user_obj: # rate limit forgot_password_post if not throttle_period_expired(user_obj.email_last_sent, settings.SEND_EMAIL_THROTTLE): status_message = 'You have recently requested to change your password. Please wait a few minutes ' \ 'before trying again.' kind = 'error' else: # TODO [OSF-6673]: Use the feature in [OSF-6998] for user to resend claim email. # if the user account is not claimed yet if (user_obj.is_invited and user_obj.unclaimed_records and not user_obj.date_last_login and not user_obj.is_claimed and not user_obj.is_registered): status_message = 'You cannot reset password on this account. Please contact OSF Support.' kind = 'error' else: # new random verification key (v2) user_obj.verification_key_v2 = generate_verification_key(verification_type='password') user_obj.email_last_sent = timezone.now() user_obj.save() reset_link = furl.urljoin( settings.DOMAIN, web_url_for( 'reset_password_get', uid=user_obj._id, token=user_obj.verification_key_v2['token'] ) ) mails.send_mail( to_addr=email, mail=mails.FORGOT_PASSWORD, reset_link=reset_link ) status.push_status_message(status_message, kind=kind, trust=False) return {} def login_and_register_handler(auth, login=True, campaign=None, next_url=None, logout=None): """ Non-view helper to handle `login` and `register` requests. :param auth: the auth context :param login: `True` if `GET /login`, `False` if `GET /register` :param campaign: a target campaign defined in `auth.campaigns` :param next_url: the service url for CAS login or redirect url for OSF :param logout: used only for `claim_user_registered` :return: data object that contains actions for `auth_register` and `auth_login` :raises: http.BAD_REQUEST """ # Only allow redirects which are relative root or full domain. Disallows external redirects. if next_url and not validate_next_url(next_url): raise HTTPError(http.BAD_REQUEST) data = { 'status_code': http.FOUND if login else http.OK, 'next_url': next_url, 'campaign': None, 'must_login_warning': False, } # login or register with campaign parameter if campaign: if validate_campaign(campaign): # GET `/register` or '/login` with `campaign=institution` # unlike other campaigns, institution login serves as an alternative for authentication if campaign == 'institution': next_url = web_url_for('dashboard', _absolute=True) data['status_code'] = http.FOUND if auth.logged_in: data['next_url'] = next_url else: data['next_url'] = cas.get_login_url(next_url, campaign='institution') # for non-institution campaigns else: destination = next_url if next_url else campaigns.campaign_url_for(campaign) if auth.logged_in: # if user is already logged in, go to the campaign landing page data['status_code'] = http.FOUND data['next_url'] = destination else: # if user is logged out, go to the osf register page with campaign context if login: # `GET /login?campaign=...` data['next_url'] = web_url_for('auth_register', campaign=campaign, next=destination) else: # `GET /register?campaign=...` data['campaign'] = campaign if campaigns.is_proxy_login(campaign): data['next_url'] = web_url_for( 'auth_login', next=destination, _absolute=True ) else: data['next_url'] = destination else: # invalid campaign, inform sentry and redirect to non-campaign sign up or sign in redirect_view = 'auth_login' if login else 'auth_register' data['status_code'] = http.FOUND data['next_url'] = web_url_for(redirect_view, campaigns=None, next=next_url) data['campaign'] = None sentry.log_message( '{} is not a valid campaign. Please add it if this is a new one'.format(campaign) ) # login or register with next parameter elif next_url: if logout: # handle `claim_user_registered` data['next_url'] = next_url if auth.logged_in: # log user out and come back data['status_code'] = 'auth_logout' else: # after logout, land on the register page with "must_login" warning data['status_code'] = http.OK data['must_login_warning'] = True elif auth.logged_in: # if user is already logged in, redirect to `next_url` data['status_code'] = http.FOUND data['next_url'] = next_url elif login: # `/login?next=next_url`: go to CAS login page with current request url as service url data['status_code'] = http.FOUND data['next_url'] = cas.get_login_url(request.url) else: # `/register?next=next_url`: land on OSF register page with request url as next url data['status_code'] = http.OK data['next_url'] = request.url else: # `/login/` or `/register/` without any parameter if auth.logged_in: data['status_code'] = http.FOUND data['next_url'] = web_url_for('dashboard', _absolute=True) return data @collect_auth def auth_login(auth): """ View (no template) for OSF Login. Redirect user based on `data` returned from `login_and_register_handler`. `/login` only takes valid campaign, valid next, or no query parameter `login_and_register_handler()` handles the following cases: if campaign and logged in, go to campaign landing page (or valid next_url if presents) if campaign and logged out, go to campaign register page (with next_url if presents) if next_url and logged in, go to next url if next_url and logged out, go to cas login page with current request url as service parameter if none, go to `/dashboard` which is decorated by `@must_be_logged_in` :param auth: the auth context :return: redirects """ campaign = request.args.get('campaign') next_url = request.args.get('next') data = login_and_register_handler(auth, login=True, campaign=campaign, next_url=next_url) if data['status_code'] == http.FOUND: return redirect(data['next_url']) @collect_auth def auth_register(auth): """ View for OSF register. Land on the register page, redirect or go to `auth_logout` depending on `data` returned by `login_and_register_handler`. `/register` only takes a valid campaign, a valid next, the logout flag or no query parameter `login_and_register_handler()` handles the following cases: if campaign and logged in, go to campaign landing page (or valid next_url if presents) if campaign and logged out, go to campaign register page (with next_url if presents) if next_url and logged in, go to next url if next_url and logged out, go to cas login page with current request url as service parameter if next_url and logout flag, log user out first and then go to the next_url if none, go to `/dashboard` which is decorated by `@must_be_logged_in` :param auth: the auth context :return: land, redirect or `auth_logout` :raise: http.BAD_REQUEST """ context = {} # a target campaign in `auth.campaigns` campaign = request.args.get('campaign') # the service url for CAS login or redirect url for OSF next_url = request.args.get('next') # used only for `claim_user_registered` logout = request.args.get('logout') # logout must have next_url if logout and not next_url: raise HTTPError(http.BAD_REQUEST) data = login_and_register_handler(auth, login=False, campaign=campaign, next_url=next_url, logout=logout) # land on register page if data['status_code'] == http.OK: if data['must_login_warning']: status.push_status_message(language.MUST_LOGIN, trust=False) destination = cas.get_login_url(data['next_url']) # "Already have and account?" link context['non_institution_login_url'] = destination # "Sign In" button in navigation bar, overwrite the default value set in routes.py context['login_url'] = destination # "Login through your institution" link context['institution_login_url'] = cas.get_login_url(data['next_url'], campaign='institution') context['preprint_campaigns'] = {k._id + '-preprints': { 'id': k._id, 'name': k.name, 'logo_path': settings.PREPRINTS_ASSETS + k._id + '/square_color_no_transparent.png' } for k in PreprintProvider.objects.all() if k._id != 'osf'} context['campaign'] = data['campaign'] return context, http.OK # redirect to url elif data['status_code'] == http.FOUND: return redirect(data['next_url']) # go to other views elif data['status_code'] == 'auth_logout': return auth_logout(redirect_url=data['next_url']) raise HTTPError(http.BAD_REQUEST) @collect_auth def auth_logout(auth, redirect_url=None, next_url=None): """ Log out, delete current session and remove OSF cookie. If next url is valid and auth is logged in, redirect to CAS logout endpoint with the current request url as service. If next url is valid and auth is logged out, redirect directly to the next url. Otherwise, redirect to CAS logout or login endpoint with redirect url as service. The CAS logout endpoint which clears sessions and cookies for CAS and Shibboleth. HTTP Method: GET Note 1: OSF tells CAS where it wants to be redirected back after successful logout. However, CAS logout flow may not respect this url if user is authenticated through remote identity provider. Note 2: The name of the query parameter is `next`, `next_url` is used to avoid python reserved word. :param auth: the authentication context :param redirect_url: url to DIRECTLY redirect after CAS logout, default is `OSF/goodbye` :param next_url: url to redirect after OSF logout, which is after CAS logout :return: the response """ # For `?next=`: # takes priority # the url must be a valid OSF next url, # the full request url is set to CAS service url, # does not support `reauth` # For `?redirect_url=`: # the url must be valid CAS service url # the redirect url is set to CAS service url. # support `reauth` # logout/?next=<an OSF verified next url> next_url = next_url or request.args.get('next', None) if next_url and validate_next_url(next_url): cas_logout_endpoint = cas.get_logout_url(request.url) if auth.logged_in: resp = redirect(cas_logout_endpoint) else: resp = redirect(next_url) # logout/ or logout/?redirect_url=<a CAS verified redirect url> else: redirect_url = redirect_url or request.args.get('redirect_url') or web_url_for('goodbye', _absolute=True) # set redirection to CAS log out (or log in if `reauth` is present) if 'reauth' in request.args: cas_endpoint = cas.get_login_url(redirect_url) else: cas_endpoint = cas.get_logout_url(redirect_url) resp = redirect(cas_endpoint) # perform OSF logout osf_logout() # set response to delete OSF cookie resp.delete_cookie(settings.COOKIE_NAME, domain=settings.OSF_COOKIE_DOMAIN) return resp def auth_email_logout(token, user): """ When a user is adding an email or merging an account, add the email to the user and log them out. """ redirect_url = cas.get_logout_url(service_url=cas.get_login_url(service_url=web_url_for('index', _absolute=True))) try: unconfirmed_email = user.get_unconfirmed_email_for_token(token) except InvalidTokenError: raise HTTPError(http.BAD_REQUEST, data={ 'message_short': 'Bad token', 'message_long': 'The provided token is invalid.' }) except ExpiredTokenError: status.push_status_message('The private link you used is expired.') raise HTTPError(http.BAD_REQUEST, data={ 'message_short': 'Expired link', 'message_long': 'The private link you used is expired.' }) try: user_merge = User.find_one(Q('emails', 'eq', unconfirmed_email)) except NoResultsFound: user_merge = False if user_merge: remove_sessions_for_user(user_merge) user.email_verifications[token]['confirmed'] = True user.save() remove_sessions_for_user(user) resp = redirect(redirect_url) resp.delete_cookie(settings.COOKIE_NAME, domain=settings.OSF_COOKIE_DOMAIN) return resp @block_bing_preview @collect_auth def external_login_confirm_email_get(auth, uid, token): """ View for email confirmation links when user first login through external identity provider. HTTP Method: GET When users click the confirm link, they are expected not to be logged in. If not, they will be logged out first and redirected back to this view. After OSF verifies the link and performs all actions, they will be automatically logged in through CAS and redirected back to this view again being authenticated. :param auth: the auth context :param uid: the user's primary key :param token: the verification token """ user = User.load(uid) if not user: raise HTTPError(http.BAD_REQUEST) destination = request.args.get('destination') if not destination: raise HTTPError(http.BAD_REQUEST) # if user is already logged in if auth and auth.user: # if it is a wrong user if auth.user._id != user._id: return auth_logout(redirect_url=request.url) # if it is the expected user new = request.args.get('new', None) if destination in campaigns.get_campaigns(): # external domain takes priority campaign_url = campaigns.external_campaign_url_for(destination) if not campaign_url: campaign_url = campaigns.campaign_url_for(destination) return redirect(campaign_url) if new: status.push_status_message(language.WELCOME_MESSAGE, kind='default', jumbotron=True, trust=True) return redirect(web_url_for('dashboard')) # token is invalid if token not in user.email_verifications: raise HTTPError(http.BAD_REQUEST) verification = user.email_verifications[token] email = verification['email'] provider = verification['external_identity'].keys()[0] provider_id = verification['external_identity'][provider].keys()[0] # wrong provider if provider not in user.external_identity: raise HTTPError(http.BAD_REQUEST) external_status = user.external_identity[provider][provider_id] try: ensure_external_identity_uniqueness(provider, provider_id, user) except ValidationError as e: raise HTTPError(http.FORBIDDEN, e.message) if not user.is_registered: user.register(email) if email.lower() not in user.emails: user.emails.append(email.lower()) user.date_last_logged_in = timezone.now() user.external_identity[provider][provider_id] = 'VERIFIED' user.social[provider.lower()] = provider_id del user.email_verifications[token] user.verification_key = generate_verification_key() user.save() service_url = request.url if external_status == 'CREATE': mails.send_mail( to_addr=user.username, mail=mails.WELCOME, mimetype='html', user=user ) service_url += '&{}'.format(urllib.urlencode({'new': 'true'})) elif external_status == 'LINK': mails.send_mail( user=user, to_addr=user.username, mail=mails.EXTERNAL_LOGIN_LINK_SUCCESS, external_id_provider=provider, ) # redirect to CAS and authenticate the user with the verification key return redirect(cas.get_login_url( service_url, username=user.username, verification_key=user.verification_key )) @block_bing_preview @collect_auth def confirm_email_get(token, auth=None, **kwargs): """ View for email confirmation links. Authenticates and redirects to user settings page if confirmation is successful, otherwise shows an "Expired Link" error. HTTP Method: GET """ user = User.load(kwargs['uid']) is_merge = 'confirm_merge' in request.args is_initial_confirmation = not user.date_confirmed log_out = request.args.get('logout', None) if user is None: raise HTTPError(http.NOT_FOUND) # if the user is merging or adding an email (they already are an osf user) if log_out: return auth_email_logout(token, user) if auth and auth.user and (auth.user._id == user._id or auth.user._id == user.merged_by._id): if not is_merge: # determine if the user registered through a campaign campaign = campaigns.campaign_for_user(user) if campaign: return redirect(campaigns.campaign_url_for(campaign)) # go to home page with push notification if len(auth.user.emails) == 1 and len(auth.user.email_verifications) == 0: status.push_status_message(language.WELCOME_MESSAGE, kind='default', jumbotron=True, trust=True) if token in auth.user.email_verifications: status.push_status_message(language.CONFIRM_ALTERNATE_EMAIL_ERROR, kind='danger', trust=True) return redirect(web_url_for('index')) status.push_status_message(language.MERGE_COMPLETE, kind='success', trust=False) return redirect(web_url_for('user_account')) try: user.confirm_email(token, merge=is_merge) except exceptions.EmailConfirmTokenError as e: raise HTTPError(http.BAD_REQUEST, data={ 'message_short': e.message_short, 'message_long': e.message_long }) if is_initial_confirmation: user.update_date_last_login() user.save() # send out our welcome message mails.send_mail( to_addr=user.username, mail=mails.WELCOME, mimetype='html', user=user ) # new random verification key, allows CAS to authenticate the user w/o password one-time only. user.verification_key = generate_verification_key() user.save() # redirect to CAS and authenticate the user with a verification key. return redirect(cas.get_login_url( request.url, username=user.username, verification_key=user.verification_key )) @must_be_logged_in def unconfirmed_email_remove(auth=None): """ Called at login if user cancels their merge or email add. HTTP Method: DELETE """ user = auth.user json_body = request.get_json() try: given_token = json_body['token'] except KeyError: raise HTTPError(http.BAD_REQUEST, data={ 'message_short': 'Missing token', 'message_long': 'Must provide a token' }) user.clean_email_verifications(given_token=given_token) user.save() return { 'status': 'success', 'removed_email': json_body['address'] }, 200 @must_be_logged_in def unconfirmed_email_add(auth=None): """ Called at login if user confirms their merge or email add. HTTP Method: PUT """ user = auth.user json_body = request.get_json() try: token = json_body['token'] except KeyError: raise HTTPError(http.BAD_REQUEST, data={ 'message_short': 'Missing token', 'message_long': 'Must provide a token' }) try: user.confirm_email(token, merge=True) except exceptions.InvalidTokenError: raise InvalidTokenError(http.BAD_REQUEST, data={ 'message_short': 'Invalid user token', 'message_long': 'The user token is invalid' }) except exceptions.EmailConfirmTokenError as e: raise HTTPError(http.BAD_REQUEST, data={ 'message_short': e.message_short, 'message_long': e.message_long }) user.save() return { 'status': 'success', 'removed_email': json_body['address'] }, 200 def send_confirm_email(user, email, renew=False, external_id_provider=None, external_id=None, destination=None): """ Sends `user` a confirmation to the given `email`. :param user: the user :param email: the email :param renew: refresh the token :param external_id_provider: user's external id provider :param external_id: user's external id :param destination: the destination page to redirect after confirmation :return: :raises: KeyError if user does not have a confirmation token for the given email. """ confirmation_url = user.get_confirmation_url( email, external=True, force=True, renew=renew, external_id_provider=external_id_provider, destination=destination ) try: merge_target = User.find_one(Q('emails', 'eq', email)) except NoResultsFound: merge_target = None campaign = campaigns.campaign_for_user(user) branded_preprints_provider = None # Choose the appropriate email template to use and add existing_user flag if a merge or adding an email. if external_id_provider and external_id: # First time login through external identity provider, link or create an OSF account confirmation if user.external_identity[external_id_provider][external_id] == 'CREATE': mail_template = mails.EXTERNAL_LOGIN_CONFIRM_EMAIL_CREATE elif user.external_identity[external_id_provider][external_id] == 'LINK': mail_template = mails.EXTERNAL_LOGIN_CONFIRM_EMAIL_LINK elif merge_target: # Merge account confirmation mail_template = mails.CONFIRM_MERGE confirmation_url = '{}?logout=1'.format(confirmation_url) elif user.is_active: # Add email confirmation mail_template = mails.CONFIRM_EMAIL confirmation_url = '{}?logout=1'.format(confirmation_url) elif campaign: # Account creation confirmation: from campaign mail_template = campaigns.email_template_for_campaign(campaign) if campaigns.is_proxy_login(campaign) and campaigns.get_service_provider(campaign) != 'OSF': branded_preprints_provider = campaigns.get_service_provider(campaign) else: # Account creation confirmation: from OSF mail_template = mails.INITIAL_CONFIRM_EMAIL mails.send_mail( email, mail_template, 'plain', user=user, confirmation_url=confirmation_url, email=email, merge_target=merge_target, external_id_provider=external_id_provider, branded_preprints_provider=branded_preprints_provider ) def register_user(**kwargs): """ Register new user account. HTTP Method: POST :param-json str email1: :param-json str email2: :param-json str password: :param-json str fullName: :param-json str campaign: :raises: HTTPError(http.BAD_REQUEST) if validation fails or user already exists """ # Verify that email address match. # Note: Both `landing.mako` and `register.mako` already have this check on the form. Users can not submit the form # if emails do not match. However, this check should not be removed given we may use the raw api call directly. json_data = request.get_json() if str(json_data['email1']).lower() != str(json_data['email2']).lower(): raise HTTPError( http.BAD_REQUEST, data=dict(message_long='Email addresses must match.') ) # Verify that captcha is valid if settings.RECAPTCHA_SITE_KEY and not validate_recaptcha(json_data.get('g-recaptcha-response'), remote_ip=request.remote_addr): raise HTTPError( http.BAD_REQUEST, data=dict(message_long='Invalid Captcha') ) try: full_name = request.json['fullName'] full_name = strip_html(full_name) campaign = json_data.get('campaign') if campaign and campaign not in campaigns.get_campaigns(): campaign = None user = framework_auth.register_unconfirmed( request.json['email1'], request.json['password'], full_name, campaign=campaign, ) framework_auth.signals.user_registered.send(user) except (ValidationValueError, DuplicateEmailError): raise HTTPError( http.BAD_REQUEST, data=dict( message_long=language.ALREADY_REGISTERED.format( email=markupsafe.escape(request.json['email1']) ) ) ) except ValidationError as e: raise HTTPError( http.BAD_REQUEST, data=dict(message_long=e.message) ) if settings.CONFIRM_REGISTRATIONS_BY_EMAIL: send_confirm_email(user, email=user.username) message = language.REGISTRATION_SUCCESS.format(email=user.username) return {'message': message} else: return {'message': 'You may now log in.'} @collect_auth def resend_confirmation_get(auth): """ View for user to land on resend confirmation page. HTTP Method: GET """ # If user is already logged in, log user out if auth.logged_in: return auth_logout(redirect_url=request.url) form = ResendConfirmationForm(request.form) return { 'form': form, } @collect_auth def resend_confirmation_post(auth): """ View for user to submit resend confirmation form. HTTP Method: POST """ # If user is already logged in, log user out if auth.logged_in: return auth_logout(redirect_url=request.url) form = ResendConfirmationForm(request.form) if form.validate(): clean_email = form.email.data user = get_user(email=clean_email) status_message = ('If there is an OSF account associated with this unconfirmed email {0}, ' 'a confirmation email has been resent to it. If you do not receive an email and believe ' 'you should have, please contact OSF Support.').format(clean_email) kind = 'success' if user: if throttle_period_expired(user.email_last_sent, settings.SEND_EMAIL_THROTTLE): try: send_confirm_email(user, clean_email, renew=True) except KeyError: # already confirmed, redirect to dashboard status_message = 'This email {0} has already been confirmed.'.format(clean_email) kind = 'warning' user.email_last_sent = timezone.now() user.save() else: status_message = ('You have recently requested to resend your confirmation email. ' 'Please wait a few minutes before trying again.') kind = 'error' status.push_status_message(status_message, kind=kind, trust=False) else: forms.push_errors_to_status(form.errors) # Don't go anywhere return {'form': form} def external_login_email_get(): """ Landing view for first-time oauth-login user to enter their email address. HTTP Method: GET """ form = ResendConfirmationForm(request.form) session = get_session() if not session.is_external_first_login: raise HTTPError(http.UNAUTHORIZED) external_id_provider = session.data['auth_user_external_id_provider'] return { 'form': form, 'external_id_provider': external_id_provider } def external_login_email_post(): """ View to handle email submission for first-time oauth-login user. HTTP Method: POST """ form = ResendConfirmationForm(request.form) session = get_session() if not session.is_external_first_login: raise HTTPError(http.UNAUTHORIZED) external_id_provider = session.data['auth_user_external_id_provider'] external_id = session.data['auth_user_external_id'] fullname = session.data['auth_user_fullname'] service_url = session.data['service_url'] # TODO: @cslzchen use user tags instead of destination destination = 'dashboard' for campaign in campaigns.get_campaigns(): if campaign != 'institution': # Handle different url encoding schemes between `furl` and `urlparse/urllib`. # OSF use `furl` to parse service url during service validation with CAS. However, `web_url_for()` uses # `urlparse/urllib` to generate service url. `furl` handles `urlparser/urllib` generated urls while ` but # not vice versa. campaign_url = furl.furl(campaigns.campaign_url_for(campaign)).url external_campaign_url = furl.furl(campaigns.external_campaign_url_for(campaign)).url if campaigns.is_proxy_login(campaign): # proxy campaigns: OSF Preprints and branded ones if check_service_url_with_proxy_campaign(str(service_url), campaign_url, external_campaign_url): destination = campaign # continue to check branded preprints even service url matches osf preprints if campaign != 'osf-preprints': break elif service_url.startswith(campaign_url): # osf campaigns: OSF Prereg and ERPC destination = campaign break if form.validate(): clean_email = form.email.data user = get_user(email=clean_email) external_identity = { external_id_provider: { external_id: None, }, } try: ensure_external_identity_uniqueness(external_id_provider, external_id, user) except ValidationError as e: raise HTTPError(http.FORBIDDEN, e.message) if user: # 1. update user oauth, with pending status external_identity[external_id_provider][external_id] = 'LINK' if external_id_provider in user.external_identity: user.external_identity[external_id_provider].update(external_identity[external_id_provider]) else: user.external_identity.update(external_identity) # 2. add unconfirmed email and send confirmation email user.add_unconfirmed_email(clean_email, external_identity=external_identity) user.save() send_confirm_email( user, clean_email, external_id_provider=external_id_provider, external_id=external_id, destination=destination ) # 3. notify user message = language.EXTERNAL_LOGIN_EMAIL_LINK_SUCCESS.format( external_id_provider=external_id_provider, email=user.username ) kind = 'success' # 4. remove session and osf cookie remove_session(session) else: # 1. create unconfirmed user with pending status external_identity[external_id_provider][external_id] = 'CREATE' user = User.create_unconfirmed( username=clean_email, password=None, fullname=fullname, external_identity=external_identity, campaign=None ) # TODO: [#OSF-6934] update social fields, verified social fields cannot be modified user.save() # 3. send confirmation email send_confirm_email( user, user.username, external_id_provider=external_id_provider, external_id=external_id, destination=destination ) # 4. notify user message = language.EXTERNAL_LOGIN_EMAIL_CREATE_SUCCESS.format( external_id_provider=external_id_provider, email=user.username ) kind = 'success' # 5. remove session remove_session(session) status.push_status_message(message, kind=kind, trust=False) else: forms.push_errors_to_status(form.errors) # Don't go anywhere return { 'form': form, 'external_id_provider': external_id_provider } def validate_campaign(campaign): """ Non-view helper function that validates `campaign`. :param campaign: the campaign to validate :return: True if valid, False otherwise """ return campaign and campaign in campaigns.get_campaigns() def validate_next_url(next_url): """ Non-view helper function that checks `next_url`. Only allow redirects which are relative root or full domain (CAS, OSF and MFR). Disallows external redirects. :param next_url: the next url to check :return: True if valid, False otherwise """ # disable external domain using `//`: the browser allows `//` as a shortcut for non-protocol specific requests # like http:// or https:// depending on the use of SSL on the page already. if next_url.startswith('//'): return False # only OSF, MFR, CAS and Branded Preprints domains are allowed if next_url[0] == '/' or next_url.startswith(settings.DOMAIN): # OSF return True if next_url.startswith(settings.CAS_SERVER_URL) or next_url.startswith(settings.MFR_SERVER_URL): # CAS or MFR return True for url in campaigns.get_external_domains(): # Branded Preprints Phase 2 if next_url.startswith(url): return True return False def check_service_url_with_proxy_campaign(service_url, campaign_url, external_campaign_url=None): """ Check if service url belongs to proxy campaigns: OSF Preprints and branded ones. Both service_url and campaign_url are parsed using `furl` encoding scheme. :param service_url: the `furl` formatted service url :param campaign_url: the `furl` formatted campaign url :param external_campaign_url: the `furl` formatted external campaign url :return: the matched object or None """ prefix_1 = settings.DOMAIN + 'login/?next=' + campaign_url prefix_2 = settings.DOMAIN + 'login?next=' + campaign_url valid = service_url.startswith(prefix_1) or service_url.startswith(prefix_2) valid_external = False if external_campaign_url: prefix_3 = settings.DOMAIN + 'login/?next=' + external_campaign_url prefix_4 = settings.DOMAIN + 'login?next=' + external_campaign_url valid_external = service_url.startswith(prefix_3) or service_url.startswith(prefix_4) return valid or valid_external
# -*- coding: utf-8 -*- """ migrate ~~~~~~~ A simple generic database migration tool :copyright: (c) 2014 Francis Asante <kofrasa@gmail.com> :license: MIT """ from __future__ import print_function import os import sys import argparse import glob import string import subprocess import tempfile from datetime import datetime __all__ = ['Migrate', 'MigrateException'] __version__ = '0.3.8' try: from ConfigParser import ConfigParser except: from configparser import ConfigParser try: import pwd def get_login_name(): return pwd.getpwuid(os.getuid())[0] except ModuleNotFoundError: def get_login_name(): return os.getlogin() COMMANDS = { 'postgres': "psql -w --host {host} --port {port} --username {user} -d {database}", 'mysql': "mysql --host {host} --port {port} --user {user} -D {database}", 'sqlite3': "sqlite3 {database}" } PORTS = dict(postgres=5432, mysql=3306) class MigrateException(Exception): pass class Migrate(object): """A simple generic database migration helper """ def __init__(self, path='./migrations', host=None, port=None, user=None, password=None, database=None, rev=None, command=None, message=None, engine=None, verbose=False, debug=False, skip_errors=False, **kwargs): # assign configuration for easy lookup self._migration_path = os.path.abspath(path) self._host = host self._port = port self._user = user self._password = password self._database = database self._rev = rev self._command = command self._message = message self._engine = engine self._verbose = int(verbose) self._debug = debug self._skip_errors = skip_errors assert os.path.exists(self._migration_path) and os.path.isdir(self._migration_path), \ "migration folder does not exist: %s" % self._migration_path current_dir = os.path.abspath(os.getcwd()) os.chdir(self._migration_path) # cache ordered list of the names of all revision folders self._revisions = list(map(str, sorted(map(int, filter(lambda x: x.isdigit(), glob.glob("*")))))) os.chdir(current_dir) def _log(self, level, msg): """Simple logging for the given verbosity level""" if self._verbose >= level: print(msg) def _cmd_create(self): """Create a migration in the current or new revision folder """ assert self._message, "need to supply a message for the \"create\" command" if not self._revisions: self._revisions.append("1") # get the migration folder rev_folder = self._revisions[-1] full_rev_path = os.path.join(self._migration_path, rev_folder) if not os.path.exists(full_rev_path): os.mkdir(full_rev_path) else: count = len(glob.glob(os.path.join(full_rev_path, "*"))) # create next revision folder if needed if count and self._rev and int(self._rev) == 0: rev_folder = str(int(rev_folder) + 1) full_rev_path = os.path.join(self._migration_path, rev_folder) os.mkdir(full_rev_path) self._revisions.append(rev_folder) # format file name filename = '_'.join([s.lower() for s in self._message.split(' ') if s.strip()]) for p in string.punctuation: if p in filename: filename = filename.replace(p, '_') filename = "%s_%s" % (datetime.utcnow().strftime("%Y%m%d%H%M%S"), filename.replace('__', '_')) # create the migration files self._log(0, "creating files: ") for s in ('up', 'down'): file_path = os.path.join(full_rev_path, "%s.%s.sql" % (filename, s)) with open(file_path, 'a+') as w: w.write('\n'.join([ '-- *** %s ***' % s.upper(), '-- file: %s' % os.path.join(rev_folder, filename), '-- comment: %s' % self._message])) self._log(0, file_path) def _cmd_up(self): """Upgrade to a revision""" revision = self._get_revision() if not self._rev: self._log(0, "upgrading current revision") else: self._log(0, "upgrading from revision %s" % revision) for rev in self._revisions[int(revision) - 1:]: sql_files = glob.glob(os.path.join(self._migration_path, rev, "*.up.sql")) sql_files.sort() self._exec(sql_files, rev) self._log(0, "done: upgraded revision to %s\n" % rev) def _cmd_down(self): """Downgrade to a revision""" revision = self._get_revision() if not self._rev: self._log(0, "downgrading current revision") else: self._log(0, "downgrading to revision %s" % revision) # execute from latest to oldest revision for rev in reversed(self._revisions[int(revision) - 1:]): sql_files = glob.glob(os.path.join(self._migration_path, rev, "*.down.sql")) sql_files.sort(reverse=True) self._exec(sql_files, rev) self._log(0, "done: downgraded revision to %s" % rev) def _cmd_reset(self): """Downgrade and re-run revisions""" self._cmd_down() self._cmd_up() def _get_revision(self): """Validate and return the revision to use for current command """ assert self._revisions, "no migration revision exist" revision = self._rev or self._revisions[-1] # revision count must be less or equal since revisions are ordered assert revision in self._revisions, "invalid revision specified" return revision def _get_command(self, **kwargs): return COMMANDS[self._engine].format( host=self._host, user=self._user, database=self._database, port=self._port or PORTS.get(self._engine, None)) def _exec(self, files, rev=0): cmd = self._get_command() func = globals()["exec_%s" % self._engine] assert callable(func), "no exec function found for " + self._engine for f in files: self._log(1, "applying: %s/%s" % (rev, os.path.basename(f))) try: func(cmd, f, self._password, self._debug) except MigrateException as e: if not self._skip_errors: raise e def run(self): # check for availability of target command line tool cmd_name = self._get_command().split()[0] cmd_path = subprocess.check_output(["which", cmd_name]).strip() assert os.path.exists(cmd_path), "no %s command found on path" % cmd_name { 'create': lambda: self._cmd_create(), 'up': lambda: self._cmd_up(), 'down': lambda: self._cmd_down(), 'reset': lambda: self._cmd_reset() }.get(self._command)() def print_debug(msg): print("[debug] %s" % msg) def exec_mysql(cmd, filename, password=None, debug=False): if password: cmd = cmd + ' -p' + password if debug: print_debug("%s < %s" % (cmd, filename)) with open(filename) as f: try: return subprocess.check_call(cmd.split(), stdin=f) except subprocess.CalledProcessError as e: raise MigrateException(str(e)) # reuse :) def exec_sqlite3(cmd, filename, password=None, debug=False): exec_mysql(cmd, filename, password, debug) def exec_postgres(cmd, filename, password=None, debug=False): if debug: if password: print_debug("PGPASSWORD=%s %s -f %s" % (password, cmd, filename)) else: print_debug("%s -f %s" % (cmd, filename)) return 0 env_password = None if password: if 'PGPASSWORD' in os.environ: env_password = os.environ['PGPASSWORD'] os.environ['PGPASSWORD'] = password # for Postgres exit status for bad file input is 0, so we use temporary file to detect errors err_filename = tempfile.mktemp() try: subprocess.check_call(cmd.split() + ['-f', filename], stdout=open(os.devnull), stderr=open(err_filename, 'w')) finally: if env_password: os.environ['PGPASSWORD'] = env_password elif password: del os.environ['PGPASSWORD'] with open(err_filename, 'r') as fd: stat = os.fstat(fd.fileno()) if stat.st_size: raise MigrateException(''.join(fd.readlines())) os.remove(err_filename) def main(*args): # allow flexibility for testing args = args or sys.argv[1:] login_name = get_login_name() migration_path = os.path.join(os.getcwd(), "migrations") program = os.path.splitext(os.path.split(__file__)[1])[0] parser = argparse.ArgumentParser( prog=program, formatter_class=argparse.RawTextHelpFormatter, usage="""\ %(prog)s [options] <command> A simple generic database migration tool using SQL scripts commands: up Upgrade from a revision to the latest down Downgrade from the latest to a lower revision reset Rollback and re-run to the current revision create Create a migration. Specify "-r 0" to add a new revision """) parser.add_argument(dest='command', choices=('create', 'up', 'down', 'reset')) parser.add_argument("-e", dest="engine", default='sqlite3', choices=('postgres', 'mysql', 'sqlite3'), help="database engine (default: \"sqlite3\")") parser.add_argument("-r", dest="rev", help="revision to use. specify \"0\" for the next revision if using the " "\"create\" command. (default: last revision)") parser.add_argument("-m", dest="message", help="message description for migrations created with the \"create\" command") parser.add_argument("-u", dest="user", default=login_name, help="database user name (default: \"%s\")" % login_name) parser.add_argument("-p", dest="password", default='', help="database password.") parser.add_argument("--host", default="localhost", help='database server host (default: "localhost")') parser.add_argument("--port", help='server port (default: postgres=5432, mysql=3306)') parser.add_argument("-d", dest="database", default=login_name, help="database name to use. specify a /path/to/file if using sqlite3. " "(default: login name)") parser.add_argument("--path", default=migration_path, help="path to the migration folder either absolute or relative to the " "current directory. (default: \"./migrations\")") parser.add_argument("-f", dest='file', metavar='CONFIG', default=".migrate", help="configuration file in \".ini\" format. " "sections represent different configuration environments.\n" "keys include: migration_path, user, password, host, port, " "database, and engine. (default: \".migrate\")") parser.add_argument("--env", default='dev', help="configuration environment. applies only to config file option " "(default: \"dev\")") parser.add_argument("--debug", action='store_true', default=False, help="print the commands but does not execute.") parser.add_argument("--skip-errors", default=False, action='store_true', help="continue migration even when some scripts in a revision fail") parser.add_argument("--verbose", dest="verbose", action='store_true', default=False, help="show verbose output.") parser.add_argument('--version', action='version', version='%(prog)s ' + __version__) config = {} args = parser.parse_args(args=args) for name in ('engine', 'command', 'rev', 'password', 'user', 'path', 'env', 'skip_errors', 'host', 'port', 'database', 'file', 'message', 'verbose', 'debug'): config[name] = getattr(args, name) try: if 'file' in config: if os.path.isfile(config['file']): cfg = ConfigParser() cfg.read(config['file']) env = config.get('env', 'dev') for name in ('engine', 'user', 'password', 'migration_path', 'host', 'port', 'database', 'verbose'): if cfg.has_option(env, name): value = cfg.get(env, name) if name == 'migration_path': config['path'] = value if value is not None: config[name] = value elif config['file'] != '.migrate': raise Exception("Couldn't find configuration file: %s" % config['file']) Migrate(**config).run() except MigrateException as e: print(str(e), file=sys.stderr) except Exception as e: print(str(e), file=sys.stderr) parser.print_usage(sys.stderr) if __name__ == '__main__': main()
from copy import copy from cStringIO import StringIO import datetime import inspect import sys import traceback from django.core.management import call_command from django.core.management.commands import loaddata from django.db import models import south.db from south import exceptions from south.db import DEFAULT_DB_ALIAS from south.models import MigrationHistory from south.signals import ran_migration class Migrator(object): def __init__(self, verbosity=0): self.verbosity = int(verbosity) @staticmethod def title(target): raise NotImplementedError() def print_title(self, target): if self.verbosity: print self.title(target) @staticmethod def status(target): raise NotImplementedError() def print_status(self, migration): status = self.status(migration) if self.verbosity and status: print status @staticmethod def orm(migration): raise NotImplementedError() def backwards(self, migration): return self._wrap_direction(migration.backwards(), migration.prev_orm()) def direction(self, migration): raise NotImplementedError() @staticmethod def _wrap_direction(direction, orm): args = inspect.getargspec(direction) if len(args[0]) == 1: # Old migration, no ORM should be passed in return direction return (lambda: direction(orm)) @staticmethod def record(migration, database): raise NotImplementedError() def run_migration_error(self, migration, extra_info=''): return (' ! Error found during real run of migration! Aborting.\n' '\n' ' ! Since you have a database that does not support running\n' ' ! schema-altering statements in transactions, we have had \n' ' ! to leave it in an interim state between migrations.\n' '%s\n' ' ! The South developers regret this has happened, and would\n' ' ! like to gently persuade you to consider a slightly\n' ' ! easier-to-deal-with DBMS.\n') % extra_info def run_migration(self, migration): migration_function = self.direction(migration) south.db.db.start_transaction() try: migration_function() south.db.db.execute_deferred_sql() except: south.db.db.rollback_transaction() if not south.db.db.has_ddl_transactions: print self.run_migration_error(migration) raise else: south.db.db.commit_transaction() def run(self, migration): # Get the correct ORM. south.db.db.current_orm = self.orm(migration) # If the database doesn't support running DDL inside a transaction # *cough*MySQL*cough* then do a dry run first. if not south.db.db.has_ddl_transactions: dry_run = DryRunMigrator(migrator=self, ignore_fail=False) dry_run.run_migration(migration) return self.run_migration(migration) def done_migrate(self, migration, database): south.db.db.start_transaction() try: # Record us as having done this self.record(migration, database) except: south.db.db.rollback_transaction() raise else: south.db.db.commit_transaction() def send_ran_migration(self, migration): ran_migration.send(None, app=migration.app_label(), migration=migration, method=self.__class__.__name__.lower()) def migrate(self, migration, database): """ Runs the specified migration forwards/backwards, in order. """ app = migration.migrations._migrations migration_name = migration.name() self.print_status(migration) result = self.run(migration) self.done_migrate(migration, database) self.send_ran_migration(migration) return result def migrate_many(self, target, migrations, database): raise NotImplementedError() class MigratorWrapper(object): def __init__(self, migrator, *args, **kwargs): self._migrator = copy(migrator) attributes = dict([(k, getattr(self, k)) for k in self.__class__.__dict__.iterkeys() if not k.startswith('__')]) self._migrator.__dict__.update(attributes) def __getattr__(self, name): return getattr(self._migrator, name) class DryRunMigrator(MigratorWrapper): def __init__(self, ignore_fail=True, *args, **kwargs): super(DryRunMigrator, self).__init__(*args, **kwargs) self._ignore_fail = ignore_fail def _run_migration(self, migration): if migration.no_dry_run() and self.verbosity: print " - Migration '%s' is marked for no-dry-run." % migration return south.db.db.dry_run = True if self._ignore_fail: south.db.db.debug, old_debug = False, south.db.db.debug pending_creates = south.db.db.get_pending_creates() south.db.db.start_transaction() migration_function = self.direction(migration) try: try: migration_function() south.db.db.execute_deferred_sql() except: raise exceptions.FailedDryRun(migration, sys.exc_info()) finally: south.db.db.rollback_transactions_dry_run() if self._ignore_fail: south.db.db.debug = old_debug south.db.db.clear_run_data(pending_creates) south.db.db.dry_run = False def run_migration(self, migration): try: self._run_migration(migration) except exceptions.FailedDryRun: if self._ignore_fail: return False raise def done_migrate(self, *args, **kwargs): pass def send_ran_migration(self, *args, **kwargs): pass class FakeMigrator(MigratorWrapper): def run(self, migration): if self.verbosity: print ' (faked)' def send_ran_migration(self, *args, **kwargs): pass class LoadInitialDataMigrator(MigratorWrapper): def load_initial_data(self, target): if target is None or target != target.migrations[-1]: return # Load initial data, if we ended up at target if self.verbosity: print " - Loading initial data for %s." % target.app_label() # Override Django's get_apps call temporarily to only load from the # current app old_get_apps = models.get_apps new_get_apps = lambda: [models.get_app(target.app_label())] models.get_apps = new_get_apps loaddata.get_apps = new_get_apps try: call_command('loaddata', 'initial_data', verbosity=self.verbosity) finally: models.get_apps = old_get_apps loaddata.get_apps = old_get_apps def migrate_many(self, target, migrations, database): migrator = self._migrator result = migrator.__class__.migrate_many(migrator, target, migrations, database) if result: self.load_initial_data(target) return True class Forwards(Migrator): """ Runs the specified migration forwards, in order. """ torun = 'forwards' @staticmethod def title(target): if target is not None: return " - Migrating forwards to %s." % target.name() else: assert False, "You cannot migrate forwards to zero." @staticmethod def status(migration): return ' > %s' % migration @staticmethod def orm(migration): return migration.orm() def forwards(self, migration): return self._wrap_direction(migration.forwards(), migration.orm()) direction = forwards @staticmethod def record(migration, database): # Record us as having done this record = MigrationHistory.for_migration(migration, database) record.applied = datetime.datetime.utcnow() if database != DEFAULT_DB_ALIAS: record.save(using=database) else: # Django 1.1 and below always go down this branch. record.save() def format_backwards(self, migration): old_debug, old_dry_run = south.db.db.debug, south.db.db.dry_run south.db.db.debug = south.db.db.dry_run = True stdout = sys.stdout sys.stdout = StringIO() try: try: self.backwards(migration)() return sys.stdout.getvalue() except: raise finally: south.db.db.debug, south.db.db.dry_run = old_debug, old_dry_run sys.stdout = stdout def run_migration_error(self, migration, extra_info=''): extra_info = ('\n' '! You *might* be able to recover with:' '%s' '%s' % (self.format_backwards(migration), extra_info)) return super(Forwards, self).run_migration_error(migration, extra_info) def migrate_many(self, target, migrations, database): try: for migration in migrations: result = self.migrate(migration, database) if result is False: # The migrations errored, but nicely. return False finally: # Call any pending post_syncdb signals south.db.db.send_pending_create_signals() return True class Backwards(Migrator): """ Runs the specified migration backwards, in order. """ torun = 'backwards' @staticmethod def title(target): if target is None: return " - Migrating backwards to zero state." else: return " - Migrating backwards to just after %s." % target.name() @staticmethod def status(migration): return ' < %s' % migration @staticmethod def orm(migration): return migration.prev_orm() direction = Migrator.backwards @staticmethod def record(migration, database): # Record us as having not done this record = MigrationHistory.for_migration(migration, database) if record.id is not None: if database != DEFAULT_DB_ALIAS: record.delete(using=database) else: # Django 1.1 always goes down here record.delete() def migrate_many(self, target, migrations, database): for migration in migrations: self.migrate(migration, database) return True
# Copyright 2014 The Chromium Authors. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. """This module implements a simple WSGI server for the memory_inspector Web UI. The WSGI server essentially handles two kinds of requests: - /ajax/foo/bar: The AJAX endpoints which exchange JSON data with the JS. Requests routing is achieved using a simple @uri decorator which simply performs regex matching on the request path. - /static/content: Anything not matching the /ajax/ prefix is treated as a static content request (for serving the index.html and JS/CSS resources). The following HTTP status code are returned by the server: - 200 - OK: The request was handled correctly. - 404 - Not found: None of the defined handlers did match the /request/path. - 410 - Gone: The path was matched but the handler returned an empty response. This typically happens when the target device is disconnected. """ import cgi import collections import datetime import glob import json import memory_inspector import mimetypes import os import posixpath import re import traceback import urlparse import uuid import wsgiref.simple_server from memory_inspector import constants from memory_inspector.core import backends from memory_inspector.core import memory_map from memory_inspector.classification import mmap_classifier from memory_inspector.classification import native_heap_classifier from memory_inspector.data import serialization from memory_inspector.data import file_storage from memory_inspector.frontends import background_tasks _HTTP_OK = '200 OK' _HTTP_GONE = '410 Gone' _HTTP_NOT_FOUND = '404 Not Found' _HTTP_INTERNAL_ERROR = '500 Internal Server Error' _PERSISTENT_STORAGE_PATH = os.path.join( os.path.expanduser('~'), '.config', 'memory_inspector') _CONTENT_DIR = os.path.abspath(os.path.join( os.path.dirname(__file__), 'www_content')) _APP_PROCESS_RE = r'^[\w.:]+$' # Regex for matching app processes. _STATS_HIST_SIZE = 120 # Keep at most 120 samples of stats per process. _CACHE_LEN = 10 # Max length of |_cached_objs|. # |_cached_objs| keeps the state of short-lived objects that the client needs to # _cached_objs subsequent AJAX calls. _cached_objs = collections.OrderedDict() _persistent_storage = file_storage.Storage(_PERSISTENT_STORAGE_PATH) _proc_stats_history = {} # /Android/device/PID -> deque([stats@T=0, stats@T=1]) class UriHandler(object): """Base decorator used to automatically route /requests/by/path. Each handler is called with the following args: args: a tuple of the matching regex groups. req_vars: a dictionary of request args (querystring for GET, body for POST). Each handler must return a tuple with the following elements: http_code: a string with the HTTP status code (e.g., '200 - OK') headers: a list of HTTP headers (e.g., [('Content-Type': 'foo/bar')]) body: the HTTP response body. """ _handlers = [] def __init__(self, path_regex, verb='GET', output_filter=None): self._path_regex = path_regex self._verb = verb default_output_filter = lambda *x: x # Just return the same args unchanged. self._output_filter = output_filter or default_output_filter def __call__(self, handler): UriHandler._handlers += [( self._verb, self._path_regex, self._output_filter, handler)] @staticmethod def Handle(method, path, req_vars): """Finds a matching handler and calls it (or returns a 404 - Not Found).""" cache_headers = [('Cache-Control', 'no-cache'), ('Expires', 'Fri, 19 Sep 1986 05:00:00 GMT')] for (match_method, path_regex, output_filter, fn) in UriHandler._handlers: if method != match_method: continue m = re.match(path_regex, path) if not m: continue try: (http_code, headers, body) = fn(m.groups(), req_vars) except Exception as e: traceback.print_exc() return _HTTP_INTERNAL_ERROR, [], str(e) return output_filter(http_code, cache_headers + headers, body) return (_HTTP_NOT_FOUND, [], 'No AJAX handlers found') class AjaxHandler(UriHandler): """Decorator for routing AJAX requests. This decorator performs JSON serialization which is shared by most of the handlers defined below. """ def __init__(self, path_regex, verb='GET'): super(AjaxHandler, self).__init__( path_regex, verb, AjaxHandler.AjaxOutputFilter) @staticmethod def AjaxOutputFilter(http_code, headers, body): serialized_content = json.dumps(body, cls=serialization.Encoder) return http_code, headers, serialized_content @AjaxHandler('/ajax/backends') def _ListBackends(args, req_vars): # pylint: disable=W0613 return _HTTP_OK, [], [backend.name for backend in backends.ListBackends()] @AjaxHandler('/ajax/devices') def _ListDevices(args, req_vars): # pylint: disable=W0613 resp = [] for device in backends.ListDevices(): # The device settings must loaded at discovery time (i.e. here), not during # startup, because it might have been plugged later. for k, v in _persistent_storage.LoadSettings(device.id).iteritems(): device.settings[k] = v resp += [{'backend': device.backend.name, 'id': device.id, 'name': device.name}] return _HTTP_OK, [], resp @AjaxHandler(r'/ajax/dump/mmap/([^/]+)/([^/]+)/(\d+)') def _DumpMmapsForProcess(args, req_vars): # pylint: disable=W0613 """Dumps memory maps for a process. The response is formatted according to the Google Charts DataTable format. """ process = _GetProcess(args) if not process: return _HTTP_GONE, [], 'Device not found or process died' mmap = process.DumpMemoryMaps() table = _ConvertMmapToGTable(mmap) # Store the dump in the cache. The client might need it later for profiling. cache_id = _CacheObject(mmap) return _HTTP_OK, [], {'table': table, 'id': cache_id} @AjaxHandler('/ajax/initialize/([^/]+)/([^/]+)$', 'POST') def _InitializeDevice(args, req_vars): # pylint: disable=W0613 device = _GetDevice(args) if not device: return _HTTP_GONE, [], 'Device not found' device.Initialize() if req_vars['enableNativeTracing']: device.EnableNativeTracing(True) return _HTTP_OK, [], { 'isNativeTracingEnabled': device.IsNativeTracingEnabled()} @AjaxHandler(r'/ajax/profile/create', 'POST') def _CreateProfile(args, req_vars): # pylint: disable=W0613 """Creates (and caches) a profile from a set of dumps. The profiling data can be retrieved afterwards using the /profile/{PROFILE_ID} endpoints (below). """ classifier = None # A classifier module (/classification/*_classifier.py). dumps = {} # dump-time -> obj. to classify (e.g., |memory_map.Map|). for arg in 'type', 'source', 'ruleset': assert(arg in req_vars), 'Expecting %s argument in POST data' % arg # Step 1: collect the memory dumps, according to what the client specified in # the 'type' and 'source' POST arguments. # Case 1a: The client requests to load data from an archive. if req_vars['source'] == 'archive': archive = _persistent_storage.OpenArchive(req_vars['archive']) if not archive: return _HTTP_GONE, [], 'Cannot open archive %s' % req_vars['archive'] first_timestamp = None for timestamp_str in req_vars['snapshots']: timestamp = file_storage.Archive.StrToTimestamp(timestamp_str) first_timestamp = first_timestamp or timestamp time_delta = int((timestamp - first_timestamp).total_seconds()) if req_vars['type'] == 'mmap': dumps[time_delta] = archive.LoadMemMaps(timestamp) elif req_vars['type'] == 'nheap': dumps[time_delta] = archive.LoadNativeHeap(timestamp) # Case 1b: Use a dump recently cached (only mmap, via _DumpMmapsForProcess). elif req_vars['source'] == 'cache': assert(req_vars['type'] == 'mmap'), 'Only cached mmap dumps are supported.' dumps[0] = _GetCacheObject(req_vars['id']) if not dumps: return _HTTP_GONE, [], 'No memory dumps could be retrieved' # Initialize the classifier (mmap or nheap) and prepare symbols for nheap. if req_vars['type'] == 'mmap': classifier = mmap_classifier elif req_vars['type'] == 'nheap': classifier = native_heap_classifier if not archive.HasSymbols(): return _HTTP_GONE, [], 'No symbols in archive %s' % req_vars['archive'] symbols = archive.LoadSymbols() for nheap in dumps.itervalues(): nheap.SymbolizeUsingSymbolDB(symbols) if not classifier: return _HTTP_GONE, [], 'Classifier %s not supported.' % req_vars['type'] # Step 2: Load the rule-set specified by the client in the 'ruleset' POST arg. if req_vars['ruleset'] == 'heuristic': assert(req_vars['type'] == 'nheap'), ( 'heuristic rules are supported only for nheap') rules = native_heap_classifier.InferHeuristicRulesFromHeap(dumps[0]) else: rules_path = os.path.join(constants.CLASSIFICATION_RULES_PATH, req_vars['ruleset']) if not os.path.isfile(rules_path): return _HTTP_GONE, [], 'Cannot find the rule-set %s' % rules_path with open(rules_path) as f: rules = classifier.LoadRules(f.read()) # Step 3: Aggregate the dump data using the classifier and generate the # profile data (which will be kept cached here in the server). # The resulting profile will consist of 1+ snapshots (depending on the number # dumps the client has requested to process) and a number of 1+ metrics # (depending on the buckets' keys returned by the classifier). # Converts the {time: dump_obj} dict into a {time: |AggregatedResult|} dict. # using the classifier. snapshots = collections.OrderedDict((time, classifier.Classify(dump, rules)) for time, dump in sorted(dumps.iteritems())) # Add the profile to the cache (and eventually discard old items). # |profile_id| is the key that the client will use in subsequent requests # (to the /ajax/profile/{ID}/ endpoints) to refer to this particular profile. profile_id = _CacheObject(snapshots) first_snapshot = next(snapshots.itervalues()) return _HTTP_OK, [], {'id': profile_id, 'times': snapshots.keys(), 'metrics': first_snapshot.keys, 'rootBucket': first_snapshot.total.name + '/'} @AjaxHandler(r'/ajax/profile/([^/]+)/tree/(\d+)/(\d+)') def _GetProfileTreeDataForSnapshot(args, req_vars): # pylint: disable=W0613 """Gets the data for the tree chart for a given time and metric. The response is formatted according to the Google Charts DataTable format. """ snapshot_id = args[0] metric_index = int(args[1]) time = int(args[2]) snapshots = _GetCacheObject(snapshot_id) if not snapshots: return _HTTP_GONE, [], 'Cannot find the selected profile.' if time not in snapshots: return _HTTP_GONE, [], 'Cannot find snapshot at T=%d.' % time snapshot = snapshots[time] if metric_index >= len(snapshot.keys): return _HTTP_GONE, [], 'Invalid metric id %d' % metric_index resp = {'cols': [{'label': 'bucket', 'type': 'string'}, {'label': 'parent', 'type': 'string'}], 'rows': []} def VisitBucketAndAddRows(bucket, parent_id=''): """Recursively creates the (node, parent) visiting |ResultTree| in DFS.""" node_id = parent_id + bucket.name + '/' node_label = '<dl><dt>%s</dt><dd>%s</dd></dl>' % ( bucket.name, _StrMem(bucket.values[metric_index])) resp['rows'] += [{'c': [ {'v': node_id, 'f': node_label}, {'v': parent_id, 'f': None}, ]}] for child in bucket.children: VisitBucketAndAddRows(child, node_id) VisitBucketAndAddRows(snapshot.total) return _HTTP_OK, [], resp @AjaxHandler(r'/ajax/profile/([^/]+)/time_serie/(\d+)/(.*)$') def _GetTimeSerieForSnapshot(args, req_vars): # pylint: disable=W0613 """Gets the data for the area chart for a given metric and bucket. The response is formatted according to the Google Charts DataTable format. """ snapshot_id = args[0] metric_index = int(args[1]) bucket_path = args[2] snapshots = _GetCacheObject(snapshot_id) if not snapshots: return _HTTP_GONE, [], 'Cannot find the selected profile.' if metric_index >= len(next(snapshots.itervalues()).keys): return _HTTP_GONE, [], 'Invalid metric id %d' % metric_index def FindBucketByPath(bucket, path, parent_path=''): # Essentially a DFS. cur_path = parent_path + bucket.name + '/' if cur_path == path: return bucket for child in bucket.children: res = FindBucketByPath(child, path, cur_path) if res: return res return None # The resulting data table will look like this (assuming len(metrics) == 2): # Time Ashmem Dalvik Other # 0 (1024,0) (4096,1024) (0,0) # 30 (512,512) (1024,1024) (0,512) # 60 (0,512) (1024,0) (512,0) resp = {'cols': [], 'rows': []} for time, aggregated_result in snapshots.iteritems(): bucket = FindBucketByPath(aggregated_result.total, bucket_path) if not bucket: return _HTTP_GONE, [], 'Bucket %s not found' % bucket_path # If the user selected a non-leaf bucket, display the breakdown of its # direct children. Otherwise just the leaf bucket. children_buckets = bucket.children if bucket.children else [bucket] # Create the columns (form the buckets) when processing the first snapshot. if not resp['cols']: resp['cols'] += [{'label': 'Time', 'type': 'string'}] for child_bucket in children_buckets: resp['cols'] += [{'label': child_bucket.name, 'type': 'number'}] row = [{'v': str(time), 'f': None}] for child_bucket in children_buckets: row += [{'v': child_bucket.values[metric_index] / 1024, 'f': None}] resp['rows'] += [{'c': row}] return _HTTP_OK, [], resp @AjaxHandler(r'/ajax/profile/rules') def _ListProfilingRules(args, req_vars): # pylint: disable=W0613 """Lists the classification rule files available for profiling.""" rules = glob.glob(constants.CLASSIFICATION_RULES_PATH + os.sep + '*' + os.sep + '*.py') rules = [x.replace(constants.CLASSIFICATION_RULES_PATH, '')[1:] # Strip /. for x in rules] resp = {'mmap': filter(lambda x: 'mmap-' in x, rules), 'nheap': filter(lambda x: 'nheap-' in x, rules)} resp['nheap'].insert(0, 'heuristic') return _HTTP_OK, [], resp @AjaxHandler(r'/ajax/ps/([^/]+)/([^/]+)$') # /ajax/ps/Android/a0b1c2[?all=1] def _ListProcesses(args, req_vars): # pylint: disable=W0613 """Lists processes and their CPU / mem stats. The response is formatted according to the Google Charts DataTable format. """ device = _GetDevice(args) if not device: return _HTTP_GONE, [], 'Device not found' resp = { 'cols': [ {'label': 'Pid', 'type':'number'}, {'label': 'Name', 'type':'string'}, {'label': 'Cpu %', 'type':'number'}, {'label': 'Mem RSS Kb', 'type':'number'}, {'label': '# Threads', 'type':'number'}, ], 'rows': []} for process in device.ListProcesses(): # Exclude system apps if the request didn't contain the ?all=1 arg. if not req_vars.get('all') and not re.match(_APP_PROCESS_RE, process.name): continue stats = process.GetStats() resp['rows'] += [{'c': [ {'v': process.pid, 'f': None}, {'v': process.name, 'f': None}, {'v': stats.cpu_usage, 'f': None}, {'v': stats.vm_rss, 'f': None}, {'v': stats.threads, 'f': None}, ]}] return _HTTP_OK, [], resp @AjaxHandler(r'/ajax/stats/([^/]+)/([^/]+)$') # /ajax/stats/Android/a0b1c2 def _GetDeviceStats(args, req_vars): # pylint: disable=W0613 """Lists device CPU / mem stats. The response is formatted according to the Google Charts DataTable format. """ device = _GetDevice(args) if not device: return _HTTP_GONE, [], 'Device not found' device_stats = device.GetStats() cpu_stats = { 'cols': [ {'label': 'CPU', 'type':'string'}, {'label': 'Usr %', 'type':'number'}, {'label': 'Sys %', 'type':'number'}, {'label': 'Idle %', 'type':'number'}, ], 'rows': []} for cpu_idx in xrange(len(device_stats.cpu_times)): cpu = device_stats.cpu_times[cpu_idx] cpu_stats['rows'] += [{'c': [ {'v': '# %d' % cpu_idx, 'f': None}, {'v': cpu['usr'], 'f': None}, {'v': cpu['sys'], 'f': None}, {'v': cpu['idle'], 'f': None}, ]}] mem_stats = { 'cols': [ {'label': 'Section', 'type':'string'}, {'label': 'MB', 'type':'number', 'pattern': ''}, ], 'rows': []} for key, value in device_stats.memory_stats.iteritems(): mem_stats['rows'] += [{'c': [ {'v': key, 'f': None}, {'v': value / 1024, 'f': None} ]}] return _HTTP_OK, [], {'cpu': cpu_stats, 'mem': mem_stats} @AjaxHandler(r'/ajax/stats/([^/]+)/([^/]+)/(\d+)$') # /ajax/stats/Android/a0/3 def _GetProcessStats(args, req_vars): # pylint: disable=W0613 """Lists CPU / mem stats for a given process (and keeps history). The response is formatted according to the Google Charts DataTable format. """ process = _GetProcess(args) if not process: return _HTTP_GONE, [], 'Device not found' proc_uri = '/'.join(args) cur_stats = process.GetStats() if proc_uri not in _proc_stats_history: _proc_stats_history[proc_uri] = collections.deque(maxlen=_STATS_HIST_SIZE) history = _proc_stats_history[proc_uri] history.append(cur_stats) cpu_stats = { 'cols': [ {'label': 'T', 'type':'string'}, {'label': 'CPU %', 'type':'number'}, {'label': '# Threads', 'type':'number'}, ], 'rows': [] } mem_stats = { 'cols': [ {'label': 'T', 'type':'string'}, {'label': 'Mem RSS Kb', 'type':'number'}, {'label': 'Page faults', 'type':'number'}, ], 'rows': [] } for stats in history: cpu_stats['rows'] += [{'c': [ {'v': str(datetime.timedelta(seconds=stats.run_time)), 'f': None}, {'v': stats.cpu_usage, 'f': None}, {'v': stats.threads, 'f': None}, ]}] mem_stats['rows'] += [{'c': [ {'v': str(datetime.timedelta(seconds=stats.run_time)), 'f': None}, {'v': stats.vm_rss, 'f': None}, {'v': stats.page_faults, 'f': None}, ]}] return _HTTP_OK, [], {'cpu': cpu_stats, 'mem': mem_stats} @AjaxHandler(r'/ajax/settings/([^/]+)/?(\w+)?$') # /ajax/settings/Android[/id] def _GetDeviceOrBackendSettings(args, req_vars): # pylint: disable=W0613 backend = backends.GetBackend(args[0]) if not backend: return _HTTP_GONE, [], 'Backend not found' if args[1]: device = _GetDevice(args) if not device: return _HTTP_GONE, [], 'Device not found' settings = device.settings else: settings = backend.settings assert(isinstance(settings, backends.Settings)) resp = {} for key in settings.expected_keys: resp[key] = {'description': settings.expected_keys[key], 'value': settings.values[key]} return _HTTP_OK, [], resp @AjaxHandler(r'/ajax/settings/([^/]+)/?(\w+)?$', 'POST') def _SetDeviceOrBackendSettings(args, req_vars): # pylint: disable=W0613 backend = backends.GetBackend(args[0]) if not backend: return _HTTP_GONE, [], 'Backend not found' if args[1]: device = _GetDevice(args) if not device: return _HTTP_GONE, [], 'Device not found' settings = device.settings storage_name = device.id else: settings = backend.settings storage_name = backend.name for key in req_vars.iterkeys(): settings[key] = req_vars[key] _persistent_storage.StoreSettings(storage_name, settings.values) return _HTTP_OK, [], '' @AjaxHandler(r'/ajax/storage/list') def _ListStorage(args, req_vars): # pylint: disable=W0613 resp = { 'cols': [ {'label': 'Archive', 'type':'string'}, {'label': 'Snapshot', 'type':'string'}, {'label': 'Mem maps', 'type':'boolean'}, {'label': 'N. Heap', 'type':'boolean'}, ], 'rows': []} for archive_name in _persistent_storage.ListArchives(): archive = _persistent_storage.OpenArchive(archive_name) first_timestamp = None for timestamp in archive.ListSnapshots(): first_timestamp = timestamp if not first_timestamp else first_timestamp time_delta = '%d s.' % (timestamp - first_timestamp).total_seconds() resp['rows'] += [{'c': [ {'v': archive_name, 'f': None}, {'v': file_storage.Archive.TimestampToStr(timestamp), 'f': time_delta}, {'v': archive.HasMemMaps(timestamp), 'f': None}, {'v': archive.HasNativeHeap(timestamp), 'f': None}, ]}] return _HTTP_OK, [], resp @AjaxHandler(r'/ajax/storage/(.+)/(.+)/mmaps') def _LoadMmapsFromStorage(args, req_vars): # pylint: disable=W0613 archive = _persistent_storage.OpenArchive(args[0]) if not archive: return _HTTP_GONE, [], 'Cannot open archive %s' % req_vars['archive'] timestamp = file_storage.Archive.StrToTimestamp(args[1]) if not archive.HasMemMaps(timestamp): return _HTTP_GONE, [], 'No mmaps for snapshot %s' % timestamp mmap = archive.LoadMemMaps(timestamp) return _HTTP_OK, [], {'table': _ConvertMmapToGTable(mmap)} @AjaxHandler(r'/ajax/storage/(.+)/(.+)/nheap') def _LoadNheapFromStorage(args, req_vars): """Returns a Google Charts DataTable dictionary for the nheap.""" archive = _persistent_storage.OpenArchive(args[0]) if not archive: return _HTTP_GONE, [], 'Cannot open archive %s' % req_vars['archive'] timestamp = file_storage.Archive.StrToTimestamp(args[1]) if not archive.HasNativeHeap(timestamp): return _HTTP_GONE, [], 'No native heap dump for snapshot %s' % timestamp nheap = archive.LoadNativeHeap(timestamp) symbols = archive.LoadSymbols() nheap.SymbolizeUsingSymbolDB(symbols) resp = { 'cols': [ {'label': 'Allocated', 'type':'number'}, {'label': 'Resident', 'type':'number'}, {'label': 'Flags', 'type':'number'}, {'label': 'Stack Trace', 'type':'string'}, ], 'rows': []} for alloc in nheap.allocations: strace = '<dl>' for frame in alloc.stack_trace.frames: # Use the fallback libname.so+0xaddr if symbol info is not available. symbol_name = frame.symbol.name if frame.symbol else '??' source_info = (str(frame.symbol.source_info[0]) if frame.symbol and frame.symbol.source_info else frame.raw_address) strace += '<dd title="%s">%s</dd><dt>%s</dt>' % ( cgi.escape(source_info), cgi.escape(posixpath.basename(source_info)), cgi.escape(symbol_name)) strace += '</dl>' resp['rows'] += [{'c': [ {'v': alloc.size, 'f': _StrMem(alloc.size)}, {'v': alloc.resident_size, 'f': _StrMem(alloc.resident_size)}, {'v': alloc.flags, 'f': None}, {'v': strace, 'f': None}, ]}] return _HTTP_OK, [], resp # /ajax/tracer/start/Android/device-id/pid @AjaxHandler(r'/ajax/tracer/start/([^/]+)/([^/]+)/(\d+)', 'POST') def _StartTracer(args, req_vars): for arg in 'interval', 'count', 'traceNativeHeap': assert(arg in req_vars), 'Expecting %s argument in POST data' % arg process = _GetProcess(args) if not process: return _HTTP_GONE, [], 'Device not found or process died' task_id = background_tasks.StartTracer( storage_path=_PERSISTENT_STORAGE_PATH, process=process, interval=int(req_vars['interval']), count=int(req_vars['count']), trace_native_heap=req_vars['traceNativeHeap']) return _HTTP_OK, [], task_id @AjaxHandler(r'/ajax/tracer/status/(\d+)') # /ajax/tracer/status/{task_id} def _GetTracerStatus(args, req_vars): # pylint: disable=W0613 task = background_tasks.Get(int(args[0])) if not task: return _HTTP_GONE, [], 'Task not found' return _HTTP_OK, [], task.GetProgress() @UriHandler(r'^(?!/ajax)/(.*)$') def _StaticContent(args, req_vars): # pylint: disable=W0613 req_path = args[0] if args[0] else 'index.html' file_path = os.path.abspath(os.path.join(_CONTENT_DIR, req_path)) if (os.path.isfile(file_path) and os.path.commonprefix([file_path, _CONTENT_DIR]) == _CONTENT_DIR): mtype = 'text/plain' guessed_mime = mimetypes.guess_type(file_path) if guessed_mime and guessed_mime[0]: mtype = guessed_mime[0] with open(file_path, 'rb') as f: body = f.read() return _HTTP_OK, [('Content-Type', mtype)], body return _HTTP_NOT_FOUND, [], file_path + ' not found' def _GetDevice(args): """Returns a |backends.Device| instance from a /backend/device URI.""" assert(len(args) >= 2), 'Malformed request. Expecting /backend/device' return backends.GetDevice(backend_name=args[0], device_id=args[1]) def _GetProcess(args): """Returns a |backends.Process| instance from a /backend/device/pid URI.""" assert(len(args) >= 3 and args[2].isdigit()), ( 'Malformed request. Expecting /backend/device/pid') device = _GetDevice(args) if not device: return None return device.GetProcess(int(args[2])) def _ConvertMmapToGTable(mmap): """Returns a Google Charts DataTable dictionary for the given mmap.""" assert(isinstance(mmap, memory_map.Map)) table = { 'cols': [ {'label': 'Start', 'type':'string'}, {'label': 'End', 'type':'string'}, {'label': 'Length Kb', 'type':'number'}, {'label': 'Prot', 'type':'string'}, {'label': 'RSS Kb', 'type':'number'}, {'label': 'Priv. Dirty Kb', 'type':'number'}, {'label': 'Priv. Clean Kb', 'type':'number'}, {'label': 'Shared Dirty Kb', 'type':'number'}, {'label': 'Shared Clean Kb', 'type':'number'}, {'label': 'File', 'type':'string'}, {'label': 'Offset', 'type':'number'}, {'label': 'Resident Pages', 'type':'string'}, ], 'rows': []} for entry in mmap.entries: table['rows'] += [{'c': [ {'v': '%08x' % entry.start, 'f': None}, {'v': '%08x' % entry.end, 'f': None}, {'v': entry.len / 1024, 'f': None}, {'v': entry.prot_flags, 'f': None}, {'v': entry.rss_bytes / 1024, 'f': None}, {'v': entry.priv_dirty_bytes / 1024, 'f': None}, {'v': entry.priv_clean_bytes / 1024, 'f': None}, {'v': entry.shared_dirty_bytes / 1024, 'f': None}, {'v': entry.shared_clean_bytes / 1024, 'f': None}, {'v': entry.mapped_file, 'f': None}, {'v': entry.mapped_offset, 'f': None}, {'v': '[%s]' % (','.join(map(str, entry.resident_pages))), 'f': None}, ]}] return table def _CacheObject(obj_to_store): """Stores an object in the server-side cache and returns its unique id.""" if len(_cached_objs) >= _CACHE_LEN: _cached_objs.popitem(last=False) obj_id = uuid.uuid4().hex _cached_objs[obj_id] = obj_to_store return str(obj_id) def _GetCacheObject(obj_id): """Retrieves an object in the server-side cache by its id.""" return _cached_objs.get(obj_id) def _StrMem(nbytes): """Converts a number (of bytes) into a human readable string (kb, mb).""" UNITS = ['B', 'K', 'M', 'G'] for unit in UNITS: if abs(nbytes) < 1024.0 or unit == UNITS[-1]: return ('%3.1f' % nbytes).replace('.0','') + ' ' + unit nbytes /= 1024.0 def _HttpRequestHandler(environ, start_response): """Parses a single HTTP request and delegates the handling through UriHandler. This essentially wires up wsgiref.simple_server with our @UriHandler(s). """ path = environ['PATH_INFO'] method = environ['REQUEST_METHOD'] if method == 'POST': req_body_size = int(environ.get('CONTENT_LENGTH', 0)) req_body = environ['wsgi.input'].read(req_body_size) req_vars = json.loads(req_body) else: req_vars = urlparse.parse_qs(environ['QUERY_STRING']) (http_code, headers, body) = UriHandler.Handle(method, path, req_vars) start_response(http_code, headers) return [body] def Start(http_port): # Load the saved backends' settings (some of them might be needed to bootstrap # as, for instance, the adb path for the Android backend). memory_inspector.RegisterAllBackends() for backend in backends.ListBackends(): for k, v in _persistent_storage.LoadSettings(backend.name).iteritems(): backend.settings[k] = v httpd = wsgiref.simple_server.make_server( '127.0.0.1', http_port, _HttpRequestHandler) try: httpd.serve_forever() except KeyboardInterrupt: pass # Don't print useless stack traces when the user hits CTRL-C.
# Copyright 2012-2013 OpenStack Foundation # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. # """Identity v2.0 User action implementations""" import six from keystoneauth1 import exceptions as ks_exc from openstackclient.common import command from openstackclient.common import utils from openstackclient.i18n import _ class CreateUser(command.ShowOne): """Create new user""" def get_parser(self, prog_name): parser = super(CreateUser, self).get_parser(prog_name) parser.add_argument( 'name', metavar='<name>', help=_('New user name'), ) parser.add_argument( '--project', metavar='<project>', help=_('Default project (name or ID)'), ) parser.add_argument( '--password', metavar='<password>', help=_('Set user password'), ) parser.add_argument( '--password-prompt', dest="password_prompt", action="store_true", help=_('Prompt interactively for password'), ) parser.add_argument( '--email', metavar='<email-address>', help=_('Set user email address'), ) enable_group = parser.add_mutually_exclusive_group() enable_group.add_argument( '--enable', action='store_true', help=_('Enable user (default)'), ) enable_group.add_argument( '--disable', action='store_true', help=_('Disable user'), ) parser.add_argument( '--or-show', action='store_true', help=_('Return existing user'), ) return parser def take_action(self, parsed_args): identity_client = self.app.client_manager.identity if parsed_args.project: project_id = utils.find_resource( identity_client.tenants, parsed_args.project, ).id else: project_id = None enabled = True if parsed_args.disable: enabled = False if parsed_args.password_prompt: parsed_args.password = utils.get_password(self.app.stdin) try: user = identity_client.users.create( parsed_args.name, parsed_args.password, parsed_args.email, tenant_id=project_id, enabled=enabled, ) except ks_exc.Conflict as e: if parsed_args.or_show: user = utils.find_resource( identity_client.users, parsed_args.name, ) self.log.info(_('Returning existing user %s'), user.name) else: raise e # NOTE(dtroyer): The users.create() method wants 'tenant_id' but # the returned resource has 'tenantId'. Sigh. # We're using project_id now inside OSC so there. if 'tenantId' in user._info: user._info.update( {'project_id': user._info.pop('tenantId')} ) info = {} info.update(user._info) return zip(*sorted(six.iteritems(info))) class DeleteUser(command.Command): """Delete user(s)""" def get_parser(self, prog_name): parser = super(DeleteUser, self).get_parser(prog_name) parser.add_argument( 'users', metavar='<user>', nargs="+", help=_('User(s) to delete (name or ID)'), ) return parser def take_action(self, parsed_args): identity_client = self.app.client_manager.identity for user in parsed_args.users: user_obj = utils.find_resource( identity_client.users, user, ) identity_client.users.delete(user_obj.id) class ListUser(command.Lister): """List users""" def get_parser(self, prog_name): parser = super(ListUser, self).get_parser(prog_name) parser.add_argument( '--project', metavar='<project>', help=_('Filter users by project (name or ID)'), ) parser.add_argument( '--long', action='store_true', default=False, help=_('List additional fields in output'), ) return parser def take_action(self, parsed_args): identity_client = self.app.client_manager.identity def _format_project(project): if not project: return "" if project in project_cache.keys(): return project_cache[project].name else: return project project = None if parsed_args.project: project = utils.find_resource( identity_client.tenants, parsed_args.project, ) project = project.id if parsed_args.long: columns = ( 'ID', 'Name', 'tenantId', 'Email', 'Enabled', ) column_headers = ( 'ID', 'Name', 'Project', 'Email', 'Enabled', ) # Cache the project list project_cache = {} try: for p in identity_client.tenants.list(): project_cache[p.id] = p except Exception: # Just forget it if there's any trouble pass else: columns = column_headers = ('ID', 'Name') data = identity_client.users.list(tenant_id=project) if parsed_args.project: d = {} for s in data: d[s.id] = s data = d.values() if parsed_args.long: # FIXME(dtroyer): Sometimes user objects have 'tenant_id' instead # of 'tenantId'. Why? Dunno yet, but until that # is fixed we need to handle it; auth_token.py # only looks for 'tenantId'. for d in data: if 'tenant_id' in d._info: d._info['tenantId'] = d._info.pop('tenant_id') d._add_details(d._info) return (column_headers, (utils.get_item_properties( s, columns, mixed_case_fields=('tenantId',), formatters={'tenantId': _format_project}, ) for s in data)) class SetUser(command.Command): """Set user properties""" def get_parser(self, prog_name): parser = super(SetUser, self).get_parser(prog_name) parser.add_argument( 'user', metavar='<user>', help=_('User to change (name or ID)'), ) parser.add_argument( '--name', metavar='<name>', help=_('Set user name'), ) parser.add_argument( '--project', metavar='<project>', help=_('Set default project (name or ID)'), ) parser.add_argument( '--password', metavar='<user-password>', help=_('Set user password'), ) parser.add_argument( '--password-prompt', dest="password_prompt", action="store_true", help=_('Prompt interactively for password'), ) parser.add_argument( '--email', metavar='<email-address>', help=_('Set user email address'), ) enable_group = parser.add_mutually_exclusive_group() enable_group.add_argument( '--enable', action='store_true', help=_('Enable user (default)'), ) enable_group.add_argument( '--disable', action='store_true', help=_('Disable user'), ) return parser def take_action(self, parsed_args): identity_client = self.app.client_manager.identity if parsed_args.password_prompt: parsed_args.password = utils.get_password(self.app.stdin) if (not parsed_args.name and not parsed_args.name and not parsed_args.password and not parsed_args.email and not parsed_args.project and not parsed_args.enable and not parsed_args.disable): return user = utils.find_resource( identity_client.users, parsed_args.user, ) if parsed_args.password: identity_client.users.update_password( user.id, parsed_args.password, ) if parsed_args.project: project = utils.find_resource( identity_client.tenants, parsed_args.project, ) identity_client.users.update_tenant( user.id, project.id, ) kwargs = {} if parsed_args.name: kwargs['name'] = parsed_args.name if parsed_args.email: kwargs['email'] = parsed_args.email kwargs['enabled'] = user.enabled if parsed_args.enable: kwargs['enabled'] = True if parsed_args.disable: kwargs['enabled'] = False identity_client.users.update(user.id, **kwargs) class ShowUser(command.ShowOne): """Display user details""" def get_parser(self, prog_name): parser = super(ShowUser, self).get_parser(prog_name) parser.add_argument( 'user', metavar='<user>', help=_('User to display (name or ID)'), ) return parser def take_action(self, parsed_args): identity_client = self.app.client_manager.identity info = {} try: user = utils.find_resource( identity_client.users, parsed_args.user, ) info.update(user._info) except ks_exc.Forbidden as e: auth_ref = self.app.client_manager.auth_ref if ( parsed_args.user == auth_ref.user_id or parsed_args.user == auth_ref.username ): # Ask for currently auth'ed project so return it info = { 'id': auth_ref.user_id, 'name': auth_ref.username, 'project_id': auth_ref.project_id, # True because we don't get this far if it is disabled 'enabled': True, } else: raise e if 'tenantId' in info: info.update( {'project_id': info.pop('tenantId')} ) if 'tenant_id' in info: info.update( {'project_id': info.pop('tenant_id')} ) return zip(*sorted(six.iteritems(info)))
# import the modules import numpy as np import os import sys import tarfile from scipy import ndimage from sklearn.linear_model import LogisticRegression from six.moves.urllib.request import urlretrieve from six.moves import cPickle as pickle url = "http://commondatastorage.googleapis.com/books1000/" last_percent_reported = None def download_progress_hook(count,blockSize,totalSize): global last_percent_reported percent = int(count*blockSize*100/totalSize) if last_percent_reported != percent: if percent % 5 == 0: sys.stdout.write("%s%%" % percent) sys.stdout.flush() else: sys.stdout.write(".") sys.stdout.flush() last_percent_reported = percent def maybe_download(filename,expected_bytes, force = False): if force or not os.path.exists(filename): print("attempting to download: ", filename) filename, _ = urlretrieve(url + filename,filename, reporthook = download_progress_hook) print("\n Download complete!") statinfo = os.stat(filename) if statinfo.st_size == expected_bytes: print("founded and verified ", filename) else: raise Exception(\ "failed to verify "+ filename + ". Can you get to it with a browser?") return filename train_filename = maybe_download("notMNIST_large.tar.gz", 247336696) test_filename = maybe_download("notMNIST_small.tar.gz",8458043) num_classes = 10 np.random.seed(133) def maybe_extract(filename, force = False): root = os.path.splitext(os.path.splitext(filename)[0])[0] if os.path.isdir(root) and not force: print("%s alread present - Skipping extraction of %s." %(root,filename)) else: print("extracting data for %s. This may take a while. Please wait." % root) tar = tarfile.open(filename) sys.stdout.flush() tar.extractall() tar.close() data_folders = [\ os.path.join(root,d) for d in sorted(os.listdir(root))\ if os.path.isdir(os.path.join(root,d))] if len(data_folders) != num_classes: raise Exception("expected %d folders, one per class. Found %d instead." %(num_classes, len(data_folders))) return data_folders train_folders = maybe_extract(train_filename) test_folders = maybe_extract(test_filename) print train_folders ###### # Problem One ###### image_size = 28 pixel_depth = 255.0 def load_letter(folder,min_num_images): image_files = os.listdir(folder) dataset = np.ndarray(shape = (len(image_files),image_size,image_size),dtype=np.float32) print(folder) num_images = 0 for image in image_files: image_file = os.path.join(folder,image) try: image_data = (ndimage.imread(image_file).astype(float)-pixel_depth/2)/pixel_depth if image_data.shape != (image_size,image_size): raise Exception("unexpected image shape : %s" % str(image_data.shape)) dataset[num_images,:,:] = image_data num_images += 1 except IOError as e: print("count not read ", image_file,': ', e, "we will skip it ") dataset = dataset[0:num_images,:,:] if num_images < min_num_images: raise Exception("Many fewer images than expected: %d < %d" % (num_images, min_num_images)) print("full datasettensor: ", dataset.shape) print("Mean: ", np.mean(dataset)) print("Standard deviation: ", np.std(dataset)) return dataset def maybe_pickle(data_folders, min_num_images_per_class,force = False): dataset_names = [] for folder in data_folders: set_filename = folder + '.pickle' dataset_names.append(set_filename) if os.path.exists(set_filename) and not force: print("%s already present -skipping pickling." % set_filename) else: print("pickling %s." % set_filename) dataset = load_letter(folder, min_num_images_per_class) try: with open(set_filename, 'wb') as f: pickle.dump(dataset,f,pickle.HIGHEST_PROTOCOL) except Exception as e: print("Unable to save data to ", set_filename, " :",e ) return dataset_names train_datasets = maybe_pickle(train_folders, 45000) test_datasets = maybe_pickle(test_folders,1800) # randomly select an image to display # skipped def make_arrays(nb_rows,img_size): if nb_rows: dataset = np.ndarray((nb_rows,image_size,image_size), dtype=np.float32) labels = np.ndarray(nb_rows,dtype=np.int32) else: dataset,labels = None,None return dataset,labels def merge_datasets(pickle_files,train_size,valid_size = 0): num_classes = len(pickle_files) valid_dataset,valid_labels = make_arrays(valid_size,image_size) train_dataset,train_labels = make_arrays(train_size,image_size) vsize_per_class = valid_size // num_classes tsize_per_class = train_size // num_classes start_v, start_t = 0,0 end_v,end_t = vsize_per_class, tsize_per_class end_l = vsize_per_class + tsize_per_class for label, pickle_file in enumerate(pickle_files): try: with open(pickle_file,'rb') as f: letter_set = pickle.load(f) np.random.shuffle(letter_set) if valid_dataset is not None: valid_letter = letter_set[:vsize_per_class,:,:] valid_dataset[start_v:end_v,:,:] = valid_letter valid_labels[start_v:end_v] = label start_v += vsize_per_class end_v += vsize_per_class train_letter = letter_set[vsize_per_class:end_l,:,:] train_dataset[start_t:end_t,:,:] = train_letter train_labels[start_t:end_t] = label start_t += tsize_per_class end_t += tsize_per_class except Exception as e: print("Unable to process data from ", pickle_file, ": ",e) raise return valid_dataset,valid_labels, train_dataset,train_labels train_size = 200000 valid_size = 10000 test_size = 10000 valid_dataset,valid_labels, train_dataset,train_labels = merge_datasets(\ train_datasets,train_size,valid_size) _,_, test_dataset,test_labels = merge_datasets(test_datasets,test_size) print("Training: ", train_dataset.shape,train_labels.shape) print("Validation: ", valid_dataset.shape,valid_labels.shape) print("Testing: ", test_dataset.shape,test_labels.shape) # Originally the dataset is organized letter by letter, now let us randomly shuffle it def randomize(dataset,labels): permutation = np.random.permutation(labels.shape[0]) shuffled_dataset = dataset[permutation,:,:] shuffled_labels = labels[permutation] return shuffled_dataset, shuffled_labels train_dataset,train_labels = randomize(train_dataset,train_labels) test_dataset,test_labels = randomize(test_dataset,test_labels) valid_dataset,valid_labels = randomize(valid_dataset,valid_labels) # next we will save the datase for later use pickle_file = "notMNIST.pickle" try: f = open(pickle_file,'wb') save = {'train_dataset': train_dataset,\ 'train_labels': train_labels,\ 'valid_dataset': valid_dataset,\ 'valid_labels': valid_labels,\ 'test_dataset': test_dataset,\ 'test_labels': test_labels,} pickle.dump(save,f,pickle.HIGHEST_PROTOCOL) f.close() except Exception as e: print('Unable to save data to', pickle_file, ':', e) raise statinfo = os.stat(pickle_file) print("compressed pickle size", statinfo.st_size) del train_dataset, train_labels,valid_dataset,valid_labels,test_dataset,test_labels try: f = open(pickle_file,'rb') data = pickle.load(f) f.close() except Exception as e: print('Unable to save data to', pickle_file, ':', e) raise print("Training: ", data['train_dataset'].shape,data['train_labels'].shape) print("Validation: ", data['valid_dataset'].shape,data['valid_labels'].shape) print("Testing: ", data['test_dataset'].shape,data['test_labels'].shape)
# coding=utf-8 r""" This code was generated by \ / _ _ _| _ _ | (_)\/(_)(_|\/| |(/_ v1.0.0 / / """ from tests import IntegrationTestCase from tests.holodeck import Request from twilio.base.exceptions import TwilioException from twilio.http.response import Response class TaskTestCase(IntegrationTestCase): def test_fetch_request(self): self.holodeck.mock(Response(500, '')) with self.assertRaises(TwilioException): self.client.taskrouter.v1.workspaces(sid="WSXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX") \ .tasks(sid="WTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX").fetch() self.holodeck.assert_has_request(Request( 'get', 'https://taskrouter.twilio.com/v1/Workspaces/WSXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX/Tasks/WTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX', )) def test_fetch_response(self): self.holodeck.mock(Response( 200, ''' { "account_sid": "ACaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "age": 25200, "assignment_status": "pending", "attributes": "{\\"body\\": \\"hello\\"}", "date_created": "2014-05-14T18:50:02Z", "date_updated": "2014-05-15T07:26:06Z", "priority": 0, "reason": "Test Reason", "sid": "WTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "task_queue_sid": "WQaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "task_channel_sid": "TCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "task_channel_unique_name": "task-channel", "timeout": 60, "url": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/Tasks/WTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "workflow_sid": "WFaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "workspace_sid": "WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "workflow_friendly_name": "Test Workflow", "task_queue_friendly_name": "Test Queue", "addons": "{}", "links": { "task_queue": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/TaskQueues/WQaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "workflow": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/Workflows/WFaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "workspace": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "reservations": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/Tasks/WTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/Reservations" } } ''' )) actual = self.client.taskrouter.v1.workspaces(sid="WSXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX") \ .tasks(sid="WTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX").fetch() self.assertIsNotNone(actual) def test_update_request(self): self.holodeck.mock(Response(500, '')) with self.assertRaises(TwilioException): self.client.taskrouter.v1.workspaces(sid="WSXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX") \ .tasks(sid="WTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX").update() self.holodeck.assert_has_request(Request( 'post', 'https://taskrouter.twilio.com/v1/Workspaces/WSXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX/Tasks/WTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX', )) def test_update_response(self): self.holodeck.mock(Response( 200, ''' { "account_sid": "ACaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "age": 25200, "assignment_status": "pending", "attributes": "{\\"body\\": \\"hello\\"}", "date_created": "2014-05-14T18:50:02Z", "date_updated": "2014-05-15T07:26:06Z", "priority": 0, "reason": "Test Reason", "sid": "WTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "task_queue_sid": "WQaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "task_channel_sid": "TCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "task_channel_unique_name": "task-channel", "timeout": 60, "url": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/Tasks/WTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "workflow_sid": "WFaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "workspace_sid": "WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "workflow_friendly_name": "Test Workflow", "task_queue_friendly_name": "Test Queue", "addons": "{}", "links": { "task_queue": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/TaskQueues/WQaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "workflow": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/Workflows/WFaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "workspace": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "reservations": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/Tasks/WTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/Reservations" } } ''' )) actual = self.client.taskrouter.v1.workspaces(sid="WSXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX") \ .tasks(sid="WTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX").update() self.assertIsNotNone(actual) def test_delete_request(self): self.holodeck.mock(Response(500, '')) with self.assertRaises(TwilioException): self.client.taskrouter.v1.workspaces(sid="WSXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX") \ .tasks(sid="WTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX").delete() self.holodeck.assert_has_request(Request( 'delete', 'https://taskrouter.twilio.com/v1/Workspaces/WSXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX/Tasks/WTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX', )) def test_delete_response(self): self.holodeck.mock(Response( 204, None, )) actual = self.client.taskrouter.v1.workspaces(sid="WSXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX") \ .tasks(sid="WTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX").delete() self.assertTrue(actual) def test_list_request(self): self.holodeck.mock(Response(500, '')) with self.assertRaises(TwilioException): self.client.taskrouter.v1.workspaces(sid="WSXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX") \ .tasks.list() self.holodeck.assert_has_request(Request( 'get', 'https://taskrouter.twilio.com/v1/Workspaces/WSXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX/Tasks', )) def test_read_full_response(self): self.holodeck.mock(Response( 200, ''' { "meta": { "first_page_url": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/Tasks?TaskQueueSid=WQaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa&Priority=1&TaskQueueName=task_queue_name&WorkflowName=workflow_name&WorkflowSid=WFaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa&AssignmentStatus=pending%2Creserved&PageSize=50&Page=0", "key": "tasks", "next_page_url": null, "page": 0, "page_size": 50, "previous_page_url": null, "url": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/Tasks?TaskQueueSid=WQaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa&Priority=1&TaskQueueName=task_queue_name&WorkflowName=workflow_name&WorkflowSid=WFaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa&AssignmentStatus=pending%2Creserved&PageSize=50&Page=0" }, "tasks": [ { "account_sid": "ACaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "age": 25200, "assignment_status": "pending", "attributes": "{\\"body\\": \\"hello\\"}", "date_created": "2014-05-14T14:26:54Z", "date_updated": "2014-05-15T16:03:42Z", "priority": 0, "reason": "Test Reason", "sid": "WTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "task_queue_sid": "WQaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "task_channel_sid": "TCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "task_channel_unique_name": "task-channel", "timeout": 60, "url": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/Tasks/WTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "workflow_sid": "WFaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "workspace_sid": "WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "workflow_friendly_name": "Test Workflow", "task_queue_friendly_name": "Test Queue", "addons": "{}", "links": { "task_queue": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/TaskQueues/WQaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "workflow": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/Workflows/WFaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "workspace": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "reservations": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/Tasks/WTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/Reservations" } } ] } ''' )) actual = self.client.taskrouter.v1.workspaces(sid="WSXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX") \ .tasks.list() self.assertIsNotNone(actual) def test_read_empty_response(self): self.holodeck.mock(Response( 200, ''' { "meta": { "first_page_url": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/Tasks?TaskQueueSid=WQaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa&Priority=1&TaskQueueName=task_queue_name&WorkflowName=workflow_name&WorkflowSid=WFaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa&AssignmentStatus=pending&PageSize=50&Page=0", "key": "tasks", "next_page_url": null, "page": 0, "page_size": 50, "previous_page_url": null, "url": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/Tasks?TaskQueueSid=WQaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa&Priority=1&TaskQueueName=task_queue_name&WorkflowName=workflow_name&WorkflowSid=WFaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa&AssignmentStatus=pending&PageSize=50&Page=0" }, "tasks": [] } ''' )) actual = self.client.taskrouter.v1.workspaces(sid="WSXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX") \ .tasks.list() self.assertIsNotNone(actual) def test_read_assignment_status_multiple_response(self): self.holodeck.mock(Response( 200, ''' { "meta": { "first_page_url": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/Tasks?TaskQueueSid=WQaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa&Priority=1&TaskQueueName=task_queue_name&WorkflowName=workflow_name&WorkflowSid=WFaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa&AssignmentStatus=pending&PageSize=50&Page=0", "key": "tasks", "next_page_url": null, "page": 0, "page_size": 50, "previous_page_url": null, "url": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/Tasks?TaskQueueSid=WQaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa&Priority=1&TaskQueueName=task_queue_name&WorkflowName=workflow_name&WorkflowSid=WFaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa&AssignmentStatus=pending&PageSize=50&Page=0" }, "tasks": [] } ''' )) actual = self.client.taskrouter.v1.workspaces(sid="WSXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX") \ .tasks.list() self.assertIsNotNone(actual) def test_create_request(self): self.holodeck.mock(Response(500, '')) with self.assertRaises(TwilioException): self.client.taskrouter.v1.workspaces(sid="WSXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX") \ .tasks.create() self.holodeck.assert_has_request(Request( 'post', 'https://taskrouter.twilio.com/v1/Workspaces/WSXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX/Tasks', )) def test_create_response(self): self.holodeck.mock(Response( 201, ''' { "account_sid": "ACaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "age": 25200, "assignment_status": "pending", "attributes": "{\\"body\\": \\"attributes\\"}", "date_created": "2014-05-14T18:50:02Z", "date_updated": "2014-05-15T07:26:06Z", "priority": 1, "reason": "Test Reason", "sid": "WTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "task_queue_sid": "WQaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "task_channel_sid": "TCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "task_channel_unique_name": "unique", "timeout": 60, "url": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/Tasks/WTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "workspace_sid": "WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "workflow_sid": "WFaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "workflow_friendly_name": "Example Workflow", "task_queue_friendly_name": "Example Task Queue", "addons": "{}", "links": { "task_queue": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/TaskQueues/WQaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "workflow": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/Workflows/WFaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "workspace": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "reservations": "https://taskrouter.twilio.com/v1/Workspaces/WSaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/Tasks/WTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa/Reservations" } } ''' )) actual = self.client.taskrouter.v1.workspaces(sid="WSXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX") \ .tasks.create() self.assertIsNotNone(actual)
# Copyright (C) 2003 Python Software Foundation import unittest import shutil import tempfile import sys import stat import os import os.path from test import support from test.support import TESTFN from os.path import splitdrive from distutils.spawn import find_executable, spawn from shutil import (_make_tarball, _make_zipfile, make_archive, register_archive_format, unregister_archive_format, get_archive_formats, Error, unpack_archive, register_unpack_format, RegistryError, unregister_unpack_format, get_unpack_formats) import tarfile import warnings from test import support from test.support import TESTFN, check_warnings, captured_stdout try: import bz2 BZ2_SUPPORTED = True except ImportError: BZ2_SUPPORTED = False TESTFN2 = TESTFN + "2" try: import grp import pwd UID_GID_SUPPORT = True except ImportError: UID_GID_SUPPORT = False try: import zlib except ImportError: zlib = None try: import zipfile ZIP_SUPPORT = True except ImportError: ZIP_SUPPORT = find_executable('zip') class TestShutil(unittest.TestCase): def setUp(self): super(TestShutil, self).setUp() self.tempdirs = [] def tearDown(self): super(TestShutil, self).tearDown() while self.tempdirs: d = self.tempdirs.pop() shutil.rmtree(d, os.name in ('nt', 'cygwin')) def write_file(self, path, content='xxx'): """Writes a file in the given path. path can be a string or a sequence. """ if isinstance(path, (list, tuple)): path = os.path.join(*path) f = open(path, 'w') try: f.write(content) finally: f.close() def mkdtemp(self): """Create a temporary directory that will be cleaned up. Returns the path of the directory. """ d = tempfile.mkdtemp() self.tempdirs.append(d) return d def test_rmtree_errors(self): # filename is guaranteed not to exist filename = tempfile.mktemp() self.assertRaises(OSError, shutil.rmtree, filename) # See bug #1071513 for why we don't run this on cygwin # and bug #1076467 for why we don't run this as root. if (hasattr(os, 'chmod') and sys.platform[:6] != 'cygwin' and not (hasattr(os, 'geteuid') and os.geteuid() == 0)): def test_on_error(self): self.errorState = 0 os.mkdir(TESTFN) self.childpath = os.path.join(TESTFN, 'a') f = open(self.childpath, 'w') f.close() old_dir_mode = os.stat(TESTFN).st_mode old_child_mode = os.stat(self.childpath).st_mode # Make unwritable. os.chmod(self.childpath, stat.S_IREAD) os.chmod(TESTFN, stat.S_IREAD) shutil.rmtree(TESTFN, onerror=self.check_args_to_onerror) # Test whether onerror has actually been called. self.assertEqual(self.errorState, 2, "Expected call to onerror function did not happen.") # Make writable again. os.chmod(TESTFN, old_dir_mode) os.chmod(self.childpath, old_child_mode) # Clean up. shutil.rmtree(TESTFN) def check_args_to_onerror(self, func, arg, exc): # test_rmtree_errors deliberately runs rmtree # on a directory that is chmod 400, which will fail. # This function is run when shutil.rmtree fails. # 99.9% of the time it initially fails to remove # a file in the directory, so the first time through # func is os.remove. # However, some Linux machines running ZFS on # FUSE experienced a failure earlier in the process # at os.listdir. The first failure may legally # be either. if self.errorState == 0: if func is os.remove: self.assertEqual(arg, self.childpath) else: self.assertIs(func, os.listdir, "func must be either os.remove or os.listdir") self.assertEqual(arg, TESTFN) self.assertTrue(issubclass(exc[0], OSError)) self.errorState = 1 else: self.assertEqual(func, os.rmdir) self.assertEqual(arg, TESTFN) self.assertTrue(issubclass(exc[0], OSError)) self.errorState = 2 def test_rmtree_dont_delete_file(self): # When called on a file instead of a directory, don't delete it. handle, path = tempfile.mkstemp() os.fdopen(handle).close() self.assertRaises(OSError, shutil.rmtree, path) os.remove(path) def _write_data(self, path, data): f = open(path, "w") f.write(data) f.close() def test_copytree_simple(self): def read_data(path): f = open(path) data = f.read() f.close() return data src_dir = tempfile.mkdtemp() dst_dir = os.path.join(tempfile.mkdtemp(), 'destination') self._write_data(os.path.join(src_dir, 'test.txt'), '123') os.mkdir(os.path.join(src_dir, 'test_dir')) self._write_data(os.path.join(src_dir, 'test_dir', 'test.txt'), '456') try: shutil.copytree(src_dir, dst_dir) self.assertTrue(os.path.isfile(os.path.join(dst_dir, 'test.txt'))) self.assertTrue(os.path.isdir(os.path.join(dst_dir, 'test_dir'))) self.assertTrue(os.path.isfile(os.path.join(dst_dir, 'test_dir', 'test.txt'))) actual = read_data(os.path.join(dst_dir, 'test.txt')) self.assertEqual(actual, '123') actual = read_data(os.path.join(dst_dir, 'test_dir', 'test.txt')) self.assertEqual(actual, '456') finally: for path in ( os.path.join(src_dir, 'test.txt'), os.path.join(dst_dir, 'test.txt'), os.path.join(src_dir, 'test_dir', 'test.txt'), os.path.join(dst_dir, 'test_dir', 'test.txt'), ): if os.path.exists(path): os.remove(path) for path in (src_dir, os.path.dirname(dst_dir) ): if os.path.exists(path): shutil.rmtree(path) def test_copytree_with_exclude(self): def read_data(path): f = open(path) data = f.read() f.close() return data # creating data join = os.path.join exists = os.path.exists src_dir = tempfile.mkdtemp() try: dst_dir = join(tempfile.mkdtemp(), 'destination') self._write_data(join(src_dir, 'test.txt'), '123') self._write_data(join(src_dir, 'test.tmp'), '123') os.mkdir(join(src_dir, 'test_dir')) self._write_data(join(src_dir, 'test_dir', 'test.txt'), '456') os.mkdir(join(src_dir, 'test_dir2')) self._write_data(join(src_dir, 'test_dir2', 'test.txt'), '456') os.mkdir(join(src_dir, 'test_dir2', 'subdir')) os.mkdir(join(src_dir, 'test_dir2', 'subdir2')) self._write_data(join(src_dir, 'test_dir2', 'subdir', 'test.txt'), '456') self._write_data(join(src_dir, 'test_dir2', 'subdir2', 'test.py'), '456') # testing glob-like patterns try: patterns = shutil.ignore_patterns('*.tmp', 'test_dir2') shutil.copytree(src_dir, dst_dir, ignore=patterns) # checking the result: some elements should not be copied self.assertTrue(exists(join(dst_dir, 'test.txt'))) self.assertTrue(not exists(join(dst_dir, 'test.tmp'))) self.assertTrue(not exists(join(dst_dir, 'test_dir2'))) finally: if os.path.exists(dst_dir): shutil.rmtree(dst_dir) try: patterns = shutil.ignore_patterns('*.tmp', 'subdir*') shutil.copytree(src_dir, dst_dir, ignore=patterns) # checking the result: some elements should not be copied self.assertTrue(not exists(join(dst_dir, 'test.tmp'))) self.assertTrue(not exists(join(dst_dir, 'test_dir2', 'subdir2'))) self.assertTrue(not exists(join(dst_dir, 'test_dir2', 'subdir'))) finally: if os.path.exists(dst_dir): shutil.rmtree(dst_dir) # testing callable-style try: def _filter(src, names): res = [] for name in names: path = os.path.join(src, name) if (os.path.isdir(path) and path.split()[-1] == 'subdir'): res.append(name) elif os.path.splitext(path)[-1] in ('.py'): res.append(name) return res shutil.copytree(src_dir, dst_dir, ignore=_filter) # checking the result: some elements should not be copied self.assertTrue(not exists(join(dst_dir, 'test_dir2', 'subdir2', 'test.py'))) self.assertTrue(not exists(join(dst_dir, 'test_dir2', 'subdir'))) finally: if os.path.exists(dst_dir): shutil.rmtree(dst_dir) finally: shutil.rmtree(src_dir) shutil.rmtree(os.path.dirname(dst_dir)) @unittest.skipUnless(hasattr(os, 'link'), 'requires os.link') def test_dont_copy_file_onto_link_to_itself(self): # Temporarily disable test on Windows. if os.name == 'nt': return # bug 851123. os.mkdir(TESTFN) src = os.path.join(TESTFN, 'cheese') dst = os.path.join(TESTFN, 'shop') try: with open(src, 'w') as f: f.write('cheddar') os.link(src, dst) self.assertRaises(shutil.Error, shutil.copyfile, src, dst) with open(src, 'r') as f: self.assertEqual(f.read(), 'cheddar') os.remove(dst) finally: shutil.rmtree(TESTFN, ignore_errors=True) @support.skip_unless_symlink def test_dont_copy_file_onto_symlink_to_itself(self): # bug 851123. os.mkdir(TESTFN) src = os.path.join(TESTFN, 'cheese') dst = os.path.join(TESTFN, 'shop') try: with open(src, 'w') as f: f.write('cheddar') # Using `src` here would mean we end up with a symlink pointing # to TESTFN/TESTFN/cheese, while it should point at # TESTFN/cheese. os.symlink('cheese', dst) self.assertRaises(shutil.Error, shutil.copyfile, src, dst) with open(src, 'r') as f: self.assertEqual(f.read(), 'cheddar') os.remove(dst) finally: shutil.rmtree(TESTFN, ignore_errors=True) @support.skip_unless_symlink def test_rmtree_on_symlink(self): # bug 1669. os.mkdir(TESTFN) try: src = os.path.join(TESTFN, 'cheese') dst = os.path.join(TESTFN, 'shop') os.mkdir(src) os.symlink(src, dst) self.assertRaises(OSError, shutil.rmtree, dst) finally: shutil.rmtree(TESTFN, ignore_errors=True) if hasattr(os, "mkfifo"): # Issue #3002: copyfile and copytree block indefinitely on named pipes def test_copyfile_named_pipe(self): os.mkfifo(TESTFN) try: self.assertRaises(shutil.SpecialFileError, shutil.copyfile, TESTFN, TESTFN2) self.assertRaises(shutil.SpecialFileError, shutil.copyfile, __file__, TESTFN) finally: os.remove(TESTFN) @support.skip_unless_symlink def test_copytree_named_pipe(self): os.mkdir(TESTFN) try: subdir = os.path.join(TESTFN, "subdir") os.mkdir(subdir) pipe = os.path.join(subdir, "mypipe") os.mkfifo(pipe) try: shutil.copytree(TESTFN, TESTFN2) except shutil.Error as e: errors = e.args[0] self.assertEqual(len(errors), 1) src, dst, error_msg = errors[0] self.assertEqual("`%s` is a named pipe" % pipe, error_msg) else: self.fail("shutil.Error should have been raised") finally: shutil.rmtree(TESTFN, ignore_errors=True) shutil.rmtree(TESTFN2, ignore_errors=True) def test_copytree_special_func(self): src_dir = self.mkdtemp() dst_dir = os.path.join(self.mkdtemp(), 'destination') self._write_data(os.path.join(src_dir, 'test.txt'), '123') os.mkdir(os.path.join(src_dir, 'test_dir')) self._write_data(os.path.join(src_dir, 'test_dir', 'test.txt'), '456') copied = [] def _copy(src, dst): copied.append((src, dst)) shutil.copytree(src_dir, dst_dir, copy_function=_copy) self.assertEqual(len(copied), 2) @support.skip_unless_symlink def test_copytree_dangling_symlinks(self): # a dangling symlink raises an error at the end src_dir = self.mkdtemp() dst_dir = os.path.join(self.mkdtemp(), 'destination') os.symlink('IDONTEXIST', os.path.join(src_dir, 'test.txt')) os.mkdir(os.path.join(src_dir, 'test_dir')) self._write_data(os.path.join(src_dir, 'test_dir', 'test.txt'), '456') self.assertRaises(Error, shutil.copytree, src_dir, dst_dir) # a dangling symlink is ignored with the proper flag dst_dir = os.path.join(self.mkdtemp(), 'destination2') shutil.copytree(src_dir, dst_dir, ignore_dangling_symlinks=True) self.assertNotIn('test.txt', os.listdir(dst_dir)) # a dangling symlink is copied if symlinks=True dst_dir = os.path.join(self.mkdtemp(), 'destination3') shutil.copytree(src_dir, dst_dir, symlinks=True) self.assertIn('test.txt', os.listdir(dst_dir)) @unittest.skipUnless(zlib, "requires zlib") def test_make_tarball(self): # creating something to tar tmpdir = self.mkdtemp() self.write_file([tmpdir, 'file1'], 'xxx') self.write_file([tmpdir, 'file2'], 'xxx') os.mkdir(os.path.join(tmpdir, 'sub')) self.write_file([tmpdir, 'sub', 'file3'], 'xxx') tmpdir2 = self.mkdtemp() unittest.skipUnless(splitdrive(tmpdir)[0] == splitdrive(tmpdir2)[0], "source and target should be on same drive") base_name = os.path.join(tmpdir2, 'archive') # working with relative paths to avoid tar warnings old_dir = os.getcwd() os.chdir(tmpdir) try: _make_tarball(splitdrive(base_name)[1], '.') finally: os.chdir(old_dir) # check if the compressed tarball was created tarball = base_name + '.tar.gz' self.assertTrue(os.path.exists(tarball)) # trying an uncompressed one base_name = os.path.join(tmpdir2, 'archive') old_dir = os.getcwd() os.chdir(tmpdir) try: _make_tarball(splitdrive(base_name)[1], '.', compress=None) finally: os.chdir(old_dir) tarball = base_name + '.tar' self.assertTrue(os.path.exists(tarball)) def _tarinfo(self, path): tar = tarfile.open(path) try: names = tar.getnames() names.sort() return tuple(names) finally: tar.close() def _create_files(self): # creating something to tar tmpdir = self.mkdtemp() dist = os.path.join(tmpdir, 'dist') os.mkdir(dist) self.write_file([dist, 'file1'], 'xxx') self.write_file([dist, 'file2'], 'xxx') os.mkdir(os.path.join(dist, 'sub')) self.write_file([dist, 'sub', 'file3'], 'xxx') os.mkdir(os.path.join(dist, 'sub2')) tmpdir2 = self.mkdtemp() base_name = os.path.join(tmpdir2, 'archive') return tmpdir, tmpdir2, base_name @unittest.skipUnless(zlib, "Requires zlib") @unittest.skipUnless(find_executable('tar') and find_executable('gzip'), 'Need the tar command to run') def test_tarfile_vs_tar(self): tmpdir, tmpdir2, base_name = self._create_files() old_dir = os.getcwd() os.chdir(tmpdir) try: _make_tarball(base_name, 'dist') finally: os.chdir(old_dir) # check if the compressed tarball was created tarball = base_name + '.tar.gz' self.assertTrue(os.path.exists(tarball)) # now create another tarball using `tar` tarball2 = os.path.join(tmpdir, 'archive2.tar.gz') tar_cmd = ['tar', '-cf', 'archive2.tar', 'dist'] gzip_cmd = ['gzip', '-f9', 'archive2.tar'] old_dir = os.getcwd() os.chdir(tmpdir) try: with captured_stdout() as s: spawn(tar_cmd) spawn(gzip_cmd) finally: os.chdir(old_dir) self.assertTrue(os.path.exists(tarball2)) # let's compare both tarballs self.assertEqual(self._tarinfo(tarball), self._tarinfo(tarball2)) # trying an uncompressed one base_name = os.path.join(tmpdir2, 'archive') old_dir = os.getcwd() os.chdir(tmpdir) try: _make_tarball(base_name, 'dist', compress=None) finally: os.chdir(old_dir) tarball = base_name + '.tar' self.assertTrue(os.path.exists(tarball)) # now for a dry_run base_name = os.path.join(tmpdir2, 'archive') old_dir = os.getcwd() os.chdir(tmpdir) try: _make_tarball(base_name, 'dist', compress=None, dry_run=True) finally: os.chdir(old_dir) tarball = base_name + '.tar' self.assertTrue(os.path.exists(tarball)) @unittest.skipUnless(zlib, "Requires zlib") @unittest.skipUnless(ZIP_SUPPORT, 'Need zip support to run') def test_make_zipfile(self): # creating something to tar tmpdir = self.mkdtemp() self.write_file([tmpdir, 'file1'], 'xxx') self.write_file([tmpdir, 'file2'], 'xxx') tmpdir2 = self.mkdtemp() base_name = os.path.join(tmpdir2, 'archive') _make_zipfile(base_name, tmpdir) # check if the compressed tarball was created tarball = base_name + '.zip' self.assertTrue(os.path.exists(tarball)) def test_make_archive(self): tmpdir = self.mkdtemp() base_name = os.path.join(tmpdir, 'archive') self.assertRaises(ValueError, make_archive, base_name, 'xxx') @unittest.skipUnless(zlib, "Requires zlib") def test_make_archive_owner_group(self): # testing make_archive with owner and group, with various combinations # this works even if there's not gid/uid support if UID_GID_SUPPORT: group = grp.getgrgid(0)[0] owner = pwd.getpwuid(0)[0] else: group = owner = 'root' base_dir, root_dir, base_name = self._create_files() base_name = os.path.join(self.mkdtemp() , 'archive') res = make_archive(base_name, 'zip', root_dir, base_dir, owner=owner, group=group) self.assertTrue(os.path.exists(res)) res = make_archive(base_name, 'zip', root_dir, base_dir) self.assertTrue(os.path.exists(res)) res = make_archive(base_name, 'tar', root_dir, base_dir, owner=owner, group=group) self.assertTrue(os.path.exists(res)) res = make_archive(base_name, 'tar', root_dir, base_dir, owner='kjhkjhkjg', group='oihohoh') self.assertTrue(os.path.exists(res)) @unittest.skipUnless(zlib, "Requires zlib") @unittest.skipUnless(UID_GID_SUPPORT, "Requires grp and pwd support") def test_tarfile_root_owner(self): tmpdir, tmpdir2, base_name = self._create_files() old_dir = os.getcwd() os.chdir(tmpdir) group = grp.getgrgid(0)[0] owner = pwd.getpwuid(0)[0] try: archive_name = _make_tarball(base_name, 'dist', compress=None, owner=owner, group=group) finally: os.chdir(old_dir) # check if the compressed tarball was created self.assertTrue(os.path.exists(archive_name)) # now checks the rights archive = tarfile.open(archive_name) try: for member in archive.getmembers(): self.assertEqual(member.uid, 0) self.assertEqual(member.gid, 0) finally: archive.close() def test_make_archive_cwd(self): current_dir = os.getcwd() def _breaks(*args, **kw): raise RuntimeError() register_archive_format('xxx', _breaks, [], 'xxx file') try: try: make_archive('xxx', 'xxx', root_dir=self.mkdtemp()) except Exception: pass self.assertEqual(os.getcwd(), current_dir) finally: unregister_archive_format('xxx') def test_register_archive_format(self): self.assertRaises(TypeError, register_archive_format, 'xxx', 1) self.assertRaises(TypeError, register_archive_format, 'xxx', lambda: x, 1) self.assertRaises(TypeError, register_archive_format, 'xxx', lambda: x, [(1, 2), (1, 2, 3)]) register_archive_format('xxx', lambda: x, [(1, 2)], 'xxx file') formats = [name for name, params in get_archive_formats()] self.assertIn('xxx', formats) unregister_archive_format('xxx') formats = [name for name, params in get_archive_formats()] self.assertNotIn('xxx', formats) def _compare_dirs(self, dir1, dir2): # check that dir1 and dir2 are equivalent, # return the diff diff = [] for root, dirs, files in os.walk(dir1): for file_ in files: path = os.path.join(root, file_) target_path = os.path.join(dir2, os.path.split(path)[-1]) if not os.path.exists(target_path): diff.append(file_) return diff @unittest.skipUnless(zlib, "Requires zlib") def test_unpack_archive(self): formats = ['tar', 'gztar', 'zip'] if BZ2_SUPPORTED: formats.append('bztar') for format in formats: tmpdir = self.mkdtemp() base_dir, root_dir, base_name = self._create_files() tmpdir2 = self.mkdtemp() filename = make_archive(base_name, format, root_dir, base_dir) # let's try to unpack it now unpack_archive(filename, tmpdir2) diff = self._compare_dirs(tmpdir, tmpdir2) self.assertEqual(diff, []) def test_unpack_registery(self): formats = get_unpack_formats() def _boo(filename, extract_dir, extra): self.assertEqual(extra, 1) self.assertEqual(filename, 'stuff.boo') self.assertEqual(extract_dir, 'xx') register_unpack_format('Boo', ['.boo', '.b2'], _boo, [('extra', 1)]) unpack_archive('stuff.boo', 'xx') # trying to register a .boo unpacker again self.assertRaises(RegistryError, register_unpack_format, 'Boo2', ['.boo'], _boo) # should work now unregister_unpack_format('Boo') register_unpack_format('Boo2', ['.boo'], _boo) self.assertIn(('Boo2', ['.boo'], ''), get_unpack_formats()) self.assertNotIn(('Boo', ['.boo'], ''), get_unpack_formats()) # let's leave a clean state unregister_unpack_format('Boo2') self.assertEqual(get_unpack_formats(), formats) class TestMove(unittest.TestCase): def setUp(self): filename = "foo" self.src_dir = tempfile.mkdtemp() self.dst_dir = tempfile.mkdtemp() self.src_file = os.path.join(self.src_dir, filename) self.dst_file = os.path.join(self.dst_dir, filename) # Try to create a dir in the current directory, hoping that it is # not located on the same filesystem as the system tmp dir. try: self.dir_other_fs = tempfile.mkdtemp( dir=os.path.dirname(__file__)) self.file_other_fs = os.path.join(self.dir_other_fs, filename) except OSError: self.dir_other_fs = None with open(self.src_file, "wb") as f: f.write(b"spam") def tearDown(self): for d in (self.src_dir, self.dst_dir, self.dir_other_fs): try: if d: shutil.rmtree(d) except: pass def _check_move_file(self, src, dst, real_dst): with open(src, "rb") as f: contents = f.read() shutil.move(src, dst) with open(real_dst, "rb") as f: self.assertEqual(contents, f.read()) self.assertFalse(os.path.exists(src)) def _check_move_dir(self, src, dst, real_dst): contents = sorted(os.listdir(src)) shutil.move(src, dst) self.assertEqual(contents, sorted(os.listdir(real_dst))) self.assertFalse(os.path.exists(src)) def test_move_file(self): # Move a file to another location on the same filesystem. self._check_move_file(self.src_file, self.dst_file, self.dst_file) def test_move_file_to_dir(self): # Move a file inside an existing dir on the same filesystem. self._check_move_file(self.src_file, self.dst_dir, self.dst_file) def test_move_file_other_fs(self): # Move a file to an existing dir on another filesystem. if not self.dir_other_fs: # skip return self._check_move_file(self.src_file, self.file_other_fs, self.file_other_fs) def test_move_file_to_dir_other_fs(self): # Move a file to another location on another filesystem. if not self.dir_other_fs: # skip return self._check_move_file(self.src_file, self.dir_other_fs, self.file_other_fs) def test_move_dir(self): # Move a dir to another location on the same filesystem. dst_dir = tempfile.mktemp() try: self._check_move_dir(self.src_dir, dst_dir, dst_dir) finally: try: shutil.rmtree(dst_dir) except: pass def test_move_dir_other_fs(self): # Move a dir to another location on another filesystem. if not self.dir_other_fs: # skip return dst_dir = tempfile.mktemp(dir=self.dir_other_fs) try: self._check_move_dir(self.src_dir, dst_dir, dst_dir) finally: try: shutil.rmtree(dst_dir) except: pass def test_move_dir_to_dir(self): # Move a dir inside an existing dir on the same filesystem. self._check_move_dir(self.src_dir, self.dst_dir, os.path.join(self.dst_dir, os.path.basename(self.src_dir))) def test_move_dir_to_dir_other_fs(self): # Move a dir inside an existing dir on another filesystem. if not self.dir_other_fs: # skip return self._check_move_dir(self.src_dir, self.dir_other_fs, os.path.join(self.dir_other_fs, os.path.basename(self.src_dir))) def test_existing_file_inside_dest_dir(self): # A file with the same name inside the destination dir already exists. with open(self.dst_file, "wb"): pass self.assertRaises(shutil.Error, shutil.move, self.src_file, self.dst_dir) def test_dont_move_dir_in_itself(self): # Moving a dir inside itself raises an Error. dst = os.path.join(self.src_dir, "bar") self.assertRaises(shutil.Error, shutil.move, self.src_dir, dst) def test_destinsrc_false_negative(self): os.mkdir(TESTFN) try: for src, dst in [('srcdir', 'srcdir/dest')]: src = os.path.join(TESTFN, src) dst = os.path.join(TESTFN, dst) self.assertTrue(shutil._destinsrc(src, dst), msg='_destinsrc() wrongly concluded that ' 'dst (%s) is not in src (%s)' % (dst, src)) finally: shutil.rmtree(TESTFN, ignore_errors=True) def test_destinsrc_false_positive(self): os.mkdir(TESTFN) try: for src, dst in [('srcdir', 'src/dest'), ('srcdir', 'srcdir.new')]: src = os.path.join(TESTFN, src) dst = os.path.join(TESTFN, dst) self.assertFalse(shutil._destinsrc(src, dst), msg='_destinsrc() wrongly concluded that ' 'dst (%s) is in src (%s)' % (dst, src)) finally: shutil.rmtree(TESTFN, ignore_errors=True) class TestCopyFile(unittest.TestCase): _delete = False class Faux(object): _entered = False _exited_with = None _raised = False def __init__(self, raise_in_exit=False, suppress_at_exit=True): self._raise_in_exit = raise_in_exit self._suppress_at_exit = suppress_at_exit def read(self, *args): return '' def __enter__(self): self._entered = True def __exit__(self, exc_type, exc_val, exc_tb): self._exited_with = exc_type, exc_val, exc_tb if self._raise_in_exit: self._raised = True raise IOError("Cannot close") return self._suppress_at_exit def tearDown(self): if self._delete: del shutil.open def _set_shutil_open(self, func): shutil.open = func self._delete = True def test_w_source_open_fails(self): def _open(filename, mode='r'): if filename == 'srcfile': raise IOError('Cannot open "srcfile"') assert 0 # shouldn't reach here. self._set_shutil_open(_open) self.assertRaises(IOError, shutil.copyfile, 'srcfile', 'destfile') def test_w_dest_open_fails(self): srcfile = self.Faux() def _open(filename, mode='r'): if filename == 'srcfile': return srcfile if filename == 'destfile': raise IOError('Cannot open "destfile"') assert 0 # shouldn't reach here. self._set_shutil_open(_open) shutil.copyfile('srcfile', 'destfile') self.assertTrue(srcfile._entered) self.assertTrue(srcfile._exited_with[0] is IOError) self.assertEqual(srcfile._exited_with[1].args, ('Cannot open "destfile"',)) def test_w_dest_close_fails(self): srcfile = self.Faux() destfile = self.Faux(True) def _open(filename, mode='r'): if filename == 'srcfile': return srcfile if filename == 'destfile': return destfile assert 0 # shouldn't reach here. self._set_shutil_open(_open) shutil.copyfile('srcfile', 'destfile') self.assertTrue(srcfile._entered) self.assertTrue(destfile._entered) self.assertTrue(destfile._raised) self.assertTrue(srcfile._exited_with[0] is IOError) self.assertEqual(srcfile._exited_with[1].args, ('Cannot close',)) def test_w_source_close_fails(self): srcfile = self.Faux(True) destfile = self.Faux() def _open(filename, mode='r'): if filename == 'srcfile': return srcfile if filename == 'destfile': return destfile assert 0 # shouldn't reach here. self._set_shutil_open(_open) self.assertRaises(IOError, shutil.copyfile, 'srcfile', 'destfile') self.assertTrue(srcfile._entered) self.assertTrue(destfile._entered) self.assertFalse(destfile._raised) self.assertTrue(srcfile._exited_with[0] is None) self.assertTrue(srcfile._raised) def test_main(): support.run_unittest(TestShutil, TestMove, TestCopyFile) if __name__ == '__main__': test_main()
# Copyright (c) 2010-2012 OpenStack Foundation # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or # implied. # See the License for the specific language governing permissions and # limitations under the License. import json import unittest import time from mock import Mock from swift.proxy.controllers import InfoController from swift.proxy.server import Application as ProxyApp from swift.common import utils from swift.common.swob import Request, HTTPException class TestInfoController(unittest.TestCase): def setUp(self): utils._swift_info = {} utils._swift_admin_info = {} def get_controller(self, expose_info=None, disallowed_sections=None, admin_key=None): disallowed_sections = disallowed_sections or [] app = Mock(spec=ProxyApp) return InfoController(app, None, expose_info, disallowed_sections, admin_key) def start_response(self, status, headers): self.got_statuses.append(status) for h in headers: self.got_headers.append({h[0]: h[1]}) def test_disabled_info(self): controller = self.get_controller(expose_info=False) req = Request.blank( '/info', environ={'REQUEST_METHOD': 'GET'}) resp = controller.GET(req) self.assertIsInstance(resp, HTTPException) self.assertEqual('403 Forbidden', str(resp)) def test_get_info(self): controller = self.get_controller(expose_info=True) utils._swift_info = {'foo': {'bar': 'baz'}} utils._swift_admin_info = {'qux': {'quux': 'corge'}} req = Request.blank( '/info', environ={'REQUEST_METHOD': 'GET'}) resp = controller.GET(req) self.assertIsInstance(resp, HTTPException) self.assertEqual('200 OK', str(resp)) info = json.loads(resp.body) self.assertNotIn('admin', info) self.assertIn('foo', info) self.assertIn('bar', info['foo']) self.assertEqual(info['foo']['bar'], 'baz') def test_options_info(self): controller = self.get_controller(expose_info=True) req = Request.blank( '/info', environ={'REQUEST_METHOD': 'GET'}) resp = controller.OPTIONS(req) self.assertIsInstance(resp, HTTPException) self.assertEqual('200 OK', str(resp)) self.assertIn('Allow', resp.headers) def test_get_info_cors(self): controller = self.get_controller(expose_info=True) utils._swift_info = {'foo': {'bar': 'baz'}} utils._swift_admin_info = {'qux': {'quux': 'corge'}} req = Request.blank( '/info', environ={'REQUEST_METHOD': 'GET'}, headers={'Origin': 'http://example.com'}) resp = controller.GET(req) self.assertIsInstance(resp, HTTPException) self.assertEqual('200 OK', str(resp)) info = json.loads(resp.body) self.assertNotIn('admin', info) self.assertIn('foo', info) self.assertIn('bar', info['foo']) self.assertEqual(info['foo']['bar'], 'baz') self.assertIn('Access-Control-Allow-Origin', resp.headers) self.assertIn('Access-Control-Expose-Headers', resp.headers) def test_head_info(self): controller = self.get_controller(expose_info=True) utils._swift_info = {'foo': {'bar': 'baz'}} utils._swift_admin_info = {'qux': {'quux': 'corge'}} req = Request.blank( '/info', environ={'REQUEST_METHOD': 'HEAD'}) resp = controller.HEAD(req) self.assertIsInstance(resp, HTTPException) self.assertEqual('200 OK', str(resp)) def test_disallow_info(self): controller = self.get_controller(expose_info=True, disallowed_sections=['foo2']) utils._swift_info = {'foo': {'bar': 'baz'}, 'foo2': {'bar2': 'baz2'}} utils._swift_admin_info = {'qux': {'quux': 'corge'}} req = Request.blank( '/info', environ={'REQUEST_METHOD': 'GET'}) resp = controller.GET(req) self.assertIsInstance(resp, HTTPException) self.assertEqual('200 OK', str(resp)) info = json.loads(resp.body) self.assertIn('foo', info) self.assertIn('bar', info['foo']) self.assertEqual(info['foo']['bar'], 'baz') self.assertNotIn('foo2', info) def test_disabled_admin_info(self): controller = self.get_controller(expose_info=True, admin_key='') utils._swift_info = {'foo': {'bar': 'baz'}} utils._swift_admin_info = {'qux': {'quux': 'corge'}} expires = int(time.time() + 86400) sig = utils.get_hmac('GET', '/info', expires, '') path = '/info?swiftinfo_sig={sig}&swiftinfo_expires={expires}'.format( sig=sig, expires=expires) req = Request.blank( path, environ={'REQUEST_METHOD': 'GET'}) resp = controller.GET(req) self.assertIsInstance(resp, HTTPException) self.assertEqual('403 Forbidden', str(resp)) def test_get_admin_info(self): controller = self.get_controller(expose_info=True, admin_key='secret-admin-key') utils._swift_info = {'foo': {'bar': 'baz'}} utils._swift_admin_info = {'qux': {'quux': 'corge'}} expires = int(time.time() + 86400) sig = utils.get_hmac('GET', '/info', expires, 'secret-admin-key') path = '/info?swiftinfo_sig={sig}&swiftinfo_expires={expires}'.format( sig=sig, expires=expires) req = Request.blank( path, environ={'REQUEST_METHOD': 'GET'}) resp = controller.GET(req) self.assertIsInstance(resp, HTTPException) self.assertEqual('200 OK', str(resp)) info = json.loads(resp.body) self.assertIn('admin', info) self.assertIn('qux', info['admin']) self.assertIn('quux', info['admin']['qux']) self.assertEqual(info['admin']['qux']['quux'], 'corge') def test_head_admin_info(self): controller = self.get_controller(expose_info=True, admin_key='secret-admin-key') utils._swift_info = {'foo': {'bar': 'baz'}} utils._swift_admin_info = {'qux': {'quux': 'corge'}} expires = int(time.time() + 86400) sig = utils.get_hmac('GET', '/info', expires, 'secret-admin-key') path = '/info?swiftinfo_sig={sig}&swiftinfo_expires={expires}'.format( sig=sig, expires=expires) req = Request.blank( path, environ={'REQUEST_METHOD': 'HEAD'}) resp = controller.GET(req) self.assertIsInstance(resp, HTTPException) self.assertEqual('200 OK', str(resp)) expires = int(time.time() + 86400) sig = utils.get_hmac('HEAD', '/info', expires, 'secret-admin-key') path = '/info?swiftinfo_sig={sig}&swiftinfo_expires={expires}'.format( sig=sig, expires=expires) req = Request.blank( path, environ={'REQUEST_METHOD': 'HEAD'}) resp = controller.GET(req) self.assertIsInstance(resp, HTTPException) self.assertEqual('200 OK', str(resp)) def test_get_admin_info_invalid_method(self): controller = self.get_controller(expose_info=True, admin_key='secret-admin-key') utils._swift_info = {'foo': {'bar': 'baz'}} utils._swift_admin_info = {'qux': {'quux': 'corge'}} expires = int(time.time() + 86400) sig = utils.get_hmac('HEAD', '/info', expires, 'secret-admin-key') path = '/info?swiftinfo_sig={sig}&swiftinfo_expires={expires}'.format( sig=sig, expires=expires) req = Request.blank( path, environ={'REQUEST_METHOD': 'GET'}) resp = controller.GET(req) self.assertIsInstance(resp, HTTPException) self.assertEqual('401 Unauthorized', str(resp)) def test_get_admin_info_invalid_expires(self): controller = self.get_controller(expose_info=True, admin_key='secret-admin-key') utils._swift_info = {'foo': {'bar': 'baz'}} utils._swift_admin_info = {'qux': {'quux': 'corge'}} expires = 1 sig = utils.get_hmac('GET', '/info', expires, 'secret-admin-key') path = '/info?swiftinfo_sig={sig}&swiftinfo_expires={expires}'.format( sig=sig, expires=expires) req = Request.blank( path, environ={'REQUEST_METHOD': 'GET'}) resp = controller.GET(req) self.assertIsInstance(resp, HTTPException) self.assertEqual('401 Unauthorized', str(resp)) expires = 'abc' sig = utils.get_hmac('GET', '/info', expires, 'secret-admin-key') path = '/info?swiftinfo_sig={sig}&swiftinfo_expires={expires}'.format( sig=sig, expires=expires) req = Request.blank( path, environ={'REQUEST_METHOD': 'GET'}) resp = controller.GET(req) self.assertIsInstance(resp, HTTPException) self.assertEqual('401 Unauthorized', str(resp)) def test_get_admin_info_invalid_path(self): controller = self.get_controller(expose_info=True, admin_key='secret-admin-key') utils._swift_info = {'foo': {'bar': 'baz'}} utils._swift_admin_info = {'qux': {'quux': 'corge'}} expires = int(time.time() + 86400) sig = utils.get_hmac('GET', '/foo', expires, 'secret-admin-key') path = '/info?swiftinfo_sig={sig}&swiftinfo_expires={expires}'.format( sig=sig, expires=expires) req = Request.blank( path, environ={'REQUEST_METHOD': 'GET'}) resp = controller.GET(req) self.assertIsInstance(resp, HTTPException) self.assertEqual('401 Unauthorized', str(resp)) def test_get_admin_info_invalid_key(self): controller = self.get_controller(expose_info=True, admin_key='secret-admin-key') utils._swift_info = {'foo': {'bar': 'baz'}} utils._swift_admin_info = {'qux': {'quux': 'corge'}} expires = int(time.time() + 86400) sig = utils.get_hmac('GET', '/foo', expires, 'invalid-admin-key') path = '/info?swiftinfo_sig={sig}&swiftinfo_expires={expires}'.format( sig=sig, expires=expires) req = Request.blank( path, environ={'REQUEST_METHOD': 'GET'}) resp = controller.GET(req) self.assertIsInstance(resp, HTTPException) self.assertEqual('401 Unauthorized', str(resp)) def test_admin_disallow_info(self): controller = self.get_controller(expose_info=True, disallowed_sections=['foo2'], admin_key='secret-admin-key') utils._swift_info = {'foo': {'bar': 'baz'}, 'foo2': {'bar2': 'baz2'}} utils._swift_admin_info = {'qux': {'quux': 'corge'}} expires = int(time.time() + 86400) sig = utils.get_hmac('GET', '/info', expires, 'secret-admin-key') path = '/info?swiftinfo_sig={sig}&swiftinfo_expires={expires}'.format( sig=sig, expires=expires) req = Request.blank( path, environ={'REQUEST_METHOD': 'GET'}) resp = controller.GET(req) self.assertIsInstance(resp, HTTPException) self.assertEqual('200 OK', str(resp)) info = json.loads(resp.body) self.assertNotIn('foo2', info) self.assertIn('admin', info) self.assertIn('disallowed_sections', info['admin']) self.assertIn('foo2', info['admin']['disallowed_sections']) self.assertIn('qux', info['admin']) self.assertIn('quux', info['admin']['qux']) self.assertEqual(info['admin']['qux']['quux'], 'corge') if __name__ == '__main__': unittest.main()
# vim: tabstop=4 shiftwidth=4 softtabstop=4 # Copyright 2010 United States Government as represented by the # Administrator of the National Aeronautics and Space Administration. # All Rights Reserved. # Copyright 2011 - 2012, Red Hat, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. """ Shared code between AMQP based openstack.common.rpc implementations. The code in this module is shared between the rpc implemenations based on AMQP. Specifically, this includes impl_kombu and impl_qpid. impl_carrot also uses AMQP, but is deprecated and predates this code. """ import collections import inspect import sys import uuid from eventlet import greenpool from eventlet import pools from eventlet import queue from eventlet import semaphore # TODO(pekowsk): Remove import cfg and below comment in Havana. # This import should no longer be needed when the amqp_rpc_single_reply_queue # option is removed. from oslo.config import cfg from nova.openstack.common import excutils from nova.openstack.common.gettextutils import _ from nova.openstack.common import local from nova.openstack.common import log as logging from nova.openstack.common.rpc import common as rpc_common # TODO(pekowski): Remove this option in Havana. amqp_opts = [ cfg.BoolOpt('amqp_rpc_single_reply_queue', default=False, help='Enable a fast single reply queue if using AMQP based ' 'RPC like RabbitMQ or Qpid.'), ] cfg.CONF.register_opts(amqp_opts) UNIQUE_ID = '_unique_id' LOG = logging.getLogger(__name__) class Pool(pools.Pool): """Class that implements a Pool of Connections.""" def __init__(self, conf, connection_cls, *args, **kwargs): self.connection_cls = connection_cls self.conf = conf kwargs.setdefault("max_size", self.conf.rpc_conn_pool_size) kwargs.setdefault("order_as_stack", True) super(Pool, self).__init__(*args, **kwargs) self.reply_proxy = None # TODO(comstud): Timeout connections not used in a while def create(self): LOG.debug(_('Pool creating new connection')) return self.connection_cls(self.conf) def empty(self): while self.free_items: self.get().close() # Force a new connection pool to be created. # Note that this was added due to failing unit test cases. The issue # is the above "while loop" gets all the cached connections from the # pool and closes them, but never returns them to the pool, a pool # leak. The unit tests hang waiting for an item to be returned to the # pool. The unit tests get here via the teatDown() method. In the run # time code, it gets here via cleanup() and only appears in service.py # just before doing a sys.exit(), so cleanup() only happens once and # the leakage is not a problem. self.connection_cls.pool = None _pool_create_sem = semaphore.Semaphore() def get_connection_pool(conf, connection_cls): with _pool_create_sem: # Make sure only one thread tries to create the connection pool. if not connection_cls.pool: connection_cls.pool = Pool(conf, connection_cls) return connection_cls.pool class ConnectionContext(rpc_common.Connection): """The class that is actually returned to the caller of create_connection(). This is essentially a wrapper around Connection that supports 'with'. It can also return a new Connection, or one from a pool. The function will also catch when an instance of this class is to be deleted. With that we can return Connections to the pool on exceptions and so forth without making the caller be responsible for catching them. If possible the function makes sure to return a connection to the pool. """ def __init__(self, conf, connection_pool, pooled=True, server_params=None): """Create a new connection, or get one from the pool""" self.connection = None self.conf = conf self.connection_pool = connection_pool if pooled: self.connection = connection_pool.get() else: self.connection = connection_pool.connection_cls( conf, server_params=server_params) self.pooled = pooled def __enter__(self): """When with ConnectionContext() is used, return self""" return self def _done(self): """If the connection came from a pool, clean it up and put it back. If it did not come from a pool, close it. """ if self.connection: if self.pooled: # Reset the connection so it's ready for the next caller # to grab from the pool self.connection.reset() self.connection_pool.put(self.connection) else: try: self.connection.close() except Exception: pass self.connection = None def __exit__(self, exc_type, exc_value, tb): """End of 'with' statement. We're done here.""" self._done() def __del__(self): """Caller is done with this connection. Make sure we cleaned up.""" self._done() def close(self): """Caller is done with this connection.""" self._done() def create_consumer(self, topic, proxy, fanout=False): self.connection.create_consumer(topic, proxy, fanout) def create_worker(self, topic, proxy, pool_name): self.connection.create_worker(topic, proxy, pool_name) def join_consumer_pool(self, callback, pool_name, topic, exchange_name): self.connection.join_consumer_pool(callback, pool_name, topic, exchange_name) def consume_in_thread(self): self.connection.consume_in_thread() def __getattr__(self, key): """Proxy all other calls to the Connection instance""" if self.connection: return getattr(self.connection, key) else: raise rpc_common.InvalidRPCConnectionReuse() class ReplyProxy(ConnectionContext): """ Connection class for RPC replies / callbacks """ def __init__(self, conf, connection_pool): self._call_waiters = {} self._num_call_waiters = 0 self._num_call_waiters_wrn_threshhold = 10 self._reply_q = 'reply_' + uuid.uuid4().hex super(ReplyProxy, self).__init__(conf, connection_pool, pooled=False) self.declare_direct_consumer(self._reply_q, self._process_data) self.consume_in_thread() def _process_data(self, message_data): msg_id = message_data.pop('_msg_id', None) waiter = self._call_waiters.get(msg_id) if not waiter: LOG.warn(_('no calling threads waiting for msg_id : %s' ', message : %s') % (msg_id, message_data)) else: waiter.put(message_data) def add_call_waiter(self, waiter, msg_id): self._num_call_waiters += 1 if self._num_call_waiters > self._num_call_waiters_wrn_threshhold: LOG.warn(_('Number of call waiters is greater than warning ' 'threshhold: %d. There could be a MulticallProxyWaiter ' 'leak.') % self._num_call_waiters_wrn_threshhold) self._num_call_waiters_wrn_threshhold *= 2 self._call_waiters[msg_id] = waiter def del_call_waiter(self, msg_id): self._num_call_waiters -= 1 del self._call_waiters[msg_id] def get_reply_q(self): return self._reply_q def msg_reply(conf, msg_id, reply_q, connection_pool, reply=None, failure=None, ending=False, log_failure=True): """Sends a reply or an error on the channel signified by msg_id. Failure should be a sys.exc_info() tuple. """ with ConnectionContext(conf, connection_pool) as conn: if failure: failure = rpc_common.serialize_remote_exception(failure, log_failure) try: msg = {'result': reply, 'failure': failure} except TypeError: msg = {'result': dict((k, repr(v)) for k, v in reply.__dict__.iteritems()), 'failure': failure} if ending: msg['ending'] = True _add_unique_id(msg) # If a reply_q exists, add the msg_id to the reply and pass the # reply_q to direct_send() to use it as the response queue. # Otherwise use the msg_id for backward compatibilty. if reply_q: msg['_msg_id'] = msg_id conn.direct_send(reply_q, rpc_common.serialize_msg(msg)) else: conn.direct_send(msg_id, rpc_common.serialize_msg(msg)) class RpcContext(rpc_common.CommonRpcContext): """Context that supports replying to a rpc.call""" def __init__(self, **kwargs): self.msg_id = kwargs.pop('msg_id', None) self.reply_q = kwargs.pop('reply_q', None) self.conf = kwargs.pop('conf') super(RpcContext, self).__init__(**kwargs) def deepcopy(self): values = self.to_dict() values['conf'] = self.conf values['msg_id'] = self.msg_id values['reply_q'] = self.reply_q return self.__class__(**values) def reply(self, reply=None, failure=None, ending=False, connection_pool=None, log_failure=True): if self.msg_id: msg_reply(self.conf, self.msg_id, self.reply_q, connection_pool, reply, failure, ending, log_failure) if ending: self.msg_id = None def unpack_context(conf, msg): """Unpack context from msg.""" context_dict = {} for key in list(msg.keys()): # NOTE(vish): Some versions of python don't like unicode keys # in kwargs. key = str(key) if key.startswith('_context_'): value = msg.pop(key) context_dict[key[9:]] = value context_dict['msg_id'] = msg.pop('_msg_id', None) context_dict['reply_q'] = msg.pop('_reply_q', None) context_dict['conf'] = conf ctx = RpcContext.from_dict(context_dict) rpc_common._safe_log(LOG.debug, _('unpacked context: %s'), ctx.to_dict()) return ctx def pack_context(msg, context): """Pack context into msg. Values for message keys need to be less than 255 chars, so we pull context out into a bunch of separate keys. If we want to support more arguments in rabbit messages, we may want to do the same for args at some point. """ context_d = dict([('_context_%s' % key, value) for (key, value) in context.to_dict().iteritems()]) msg.update(context_d) class _MsgIdCache(object): """This class checks any duplicate messages.""" # NOTE: This value is considered can be a configuration item, but # it is not necessary to change its value in most cases, # so let this value as static for now. DUP_MSG_CHECK_SIZE = 16 def __init__(self, **kwargs): self.prev_msgids = collections.deque([], maxlen=self.DUP_MSG_CHECK_SIZE) def check_duplicate_message(self, message_data): """AMQP consumers may read same message twice when exceptions occur before ack is returned. This method prevents doing it. """ if UNIQUE_ID in message_data: msg_id = message_data[UNIQUE_ID] if msg_id not in self.prev_msgids: self.prev_msgids.append(msg_id) else: raise rpc_common.DuplicateMessageError(msg_id=msg_id) def _add_unique_id(msg): """Add unique_id for checking duplicate messages.""" unique_id = uuid.uuid4().hex msg.update({UNIQUE_ID: unique_id}) LOG.debug(_('UNIQUE_ID is %s.') % (unique_id)) class _ThreadPoolWithWait(object): """Base class for a delayed invocation manager used by the Connection class to start up green threads to handle incoming messages. """ def __init__(self, conf, connection_pool): self.pool = greenpool.GreenPool(conf.rpc_thread_pool_size) self.connection_pool = connection_pool self.conf = conf def wait(self): """Wait for all callback threads to exit.""" self.pool.waitall() class CallbackWrapper(_ThreadPoolWithWait): """Wraps a straight callback to allow it to be invoked in a green thread. """ def __init__(self, conf, callback, connection_pool): """ :param conf: cfg.CONF instance :param callback: a callable (probably a function) :param connection_pool: connection pool as returned by get_connection_pool() """ super(CallbackWrapper, self).__init__( conf=conf, connection_pool=connection_pool, ) self.callback = callback def __call__(self, message_data): self.pool.spawn_n(self.callback, message_data) class ProxyCallback(_ThreadPoolWithWait): """Calls methods on a proxy object based on method and args.""" def __init__(self, conf, proxy, connection_pool): super(ProxyCallback, self).__init__( conf=conf, connection_pool=connection_pool, ) self.proxy = proxy self.msg_id_cache = _MsgIdCache() def __call__(self, message_data): """Consumer callback to call a method on a proxy object. Parses the message for validity and fires off a thread to call the proxy object method. Message data should be a dictionary with two keys: method: string representing the method to call args: dictionary of arg: value Example: {'method': 'echo', 'args': {'value': 42}} """ # It is important to clear the context here, because at this point # the previous context is stored in local.store.context if hasattr(local.store, 'context'): del local.store.context rpc_common._safe_log(LOG.debug, _('received %s'), message_data) self.msg_id_cache.check_duplicate_message(message_data) ctxt = unpack_context(self.conf, message_data) method = message_data.get('method') args = message_data.get('args', {}) version = message_data.get('version', None) if not method: LOG.warn(_('no method for message: %s') % message_data) ctxt.reply(_('No method for message: %s') % message_data, connection_pool=self.connection_pool) return self.pool.spawn_n(self._process_data, ctxt, version, method, args) def _process_data(self, ctxt, version, method, args): """Process a message in a new thread. If the proxy object we have has a dispatch method (see rpc.dispatcher.RpcDispatcher), pass it the version, method, and args and let it dispatch as appropriate. If not, use the old behavior of magically calling the specified method on the proxy we have here. """ ctxt.update_store() try: rval = self.proxy.dispatch(ctxt, version, method, **args) # Check if the result was a generator if inspect.isgenerator(rval): for x in rval: ctxt.reply(x, None, connection_pool=self.connection_pool) else: ctxt.reply(rval, None, connection_pool=self.connection_pool) # This final None tells multicall that it is done. ctxt.reply(ending=True, connection_pool=self.connection_pool) except rpc_common.ClientException as e: LOG.debug(_('Expected exception during message handling (%s)') % e._exc_info[1]) ctxt.reply(None, e._exc_info, connection_pool=self.connection_pool, log_failure=False) except Exception: # sys.exc_info() is deleted by LOG.exception(). exc_info = sys.exc_info() LOG.error(_('Exception during message handling'), exc_info=exc_info) ctxt.reply(None, exc_info, connection_pool=self.connection_pool) class MulticallProxyWaiter(object): def __init__(self, conf, msg_id, timeout, connection_pool): self._msg_id = msg_id self._timeout = timeout or conf.rpc_response_timeout self._reply_proxy = connection_pool.reply_proxy self._done = False self._got_ending = False self._conf = conf self._dataqueue = queue.LightQueue() # Add this caller to the reply proxy's call_waiters self._reply_proxy.add_call_waiter(self, self._msg_id) self.msg_id_cache = _MsgIdCache() def put(self, data): self._dataqueue.put(data) def done(self): if self._done: return self._done = True # Remove this caller from reply proxy's call_waiters self._reply_proxy.del_call_waiter(self._msg_id) def _process_data(self, data): result = None self.msg_id_cache.check_duplicate_message(data) if data['failure']: failure = data['failure'] result = rpc_common.deserialize_remote_exception(self._conf, failure) elif data.get('ending', False): self._got_ending = True else: result = data['result'] return result def __iter__(self): """Return a result until we get a reply with an 'ending" flag""" if self._done: raise StopIteration while True: try: data = self._dataqueue.get(timeout=self._timeout) result = self._process_data(data) except queue.Empty: LOG.exception(_('Timed out waiting for RPC response.')) self.done() raise rpc_common.Timeout() except Exception: with excutils.save_and_reraise_exception(): self.done() if self._got_ending: self.done() raise StopIteration if isinstance(result, Exception): self.done() raise result yield result #TODO(pekowski): Remove MulticallWaiter() in Havana. class MulticallWaiter(object): def __init__(self, conf, connection, timeout): self._connection = connection self._iterator = connection.iterconsume(timeout=timeout or conf.rpc_response_timeout) self._result = None self._done = False self._got_ending = False self._conf = conf self.msg_id_cache = _MsgIdCache() def done(self): if self._done: return self._done = True self._iterator.close() self._iterator = None self._connection.close() def __call__(self, data): """The consume() callback will call this. Store the result.""" self.msg_id_cache.check_duplicate_message(data) if data['failure']: failure = data['failure'] self._result = rpc_common.deserialize_remote_exception(self._conf, failure) elif data.get('ending', False): self._got_ending = True else: self._result = data['result'] def __iter__(self): """Return a result until we get a 'None' response from consumer""" if self._done: raise StopIteration while True: try: self._iterator.next() except Exception: with excutils.save_and_reraise_exception(): self.done() if self._got_ending: self.done() raise StopIteration result = self._result if isinstance(result, Exception): self.done() raise result yield result def create_connection(conf, new, connection_pool): """Create a connection""" return ConnectionContext(conf, connection_pool, pooled=not new) _reply_proxy_create_sem = semaphore.Semaphore() def multicall(conf, context, topic, msg, timeout, connection_pool): """Make a call that returns multiple times.""" # TODO(pekowski): Remove all these comments in Havana. # For amqp_rpc_single_reply_queue = False, # Can't use 'with' for multicall, as it returns an iterator # that will continue to use the connection. When it's done, # connection.close() will get called which will put it back into # the pool # For amqp_rpc_single_reply_queue = True, # The 'with' statement is mandatory for closing the connection LOG.debug(_('Making synchronous call on %s ...'), topic) msg_id = uuid.uuid4().hex msg.update({'_msg_id': msg_id}) LOG.debug(_('MSG_ID is %s') % (msg_id)) _add_unique_id(msg) pack_context(msg, context) # TODO(pekowski): Remove this flag and the code under the if clause # in Havana. if not conf.amqp_rpc_single_reply_queue: conn = ConnectionContext(conf, connection_pool) wait_msg = MulticallWaiter(conf, conn, timeout) conn.declare_direct_consumer(msg_id, wait_msg) conn.topic_send(topic, rpc_common.serialize_msg(msg), timeout) else: with _reply_proxy_create_sem: if not connection_pool.reply_proxy: connection_pool.reply_proxy = ReplyProxy(conf, connection_pool) msg.update({'_reply_q': connection_pool.reply_proxy.get_reply_q()}) wait_msg = MulticallProxyWaiter(conf, msg_id, timeout, connection_pool) with ConnectionContext(conf, connection_pool) as conn: conn.topic_send(topic, rpc_common.serialize_msg(msg), timeout) return wait_msg def call(conf, context, topic, msg, timeout, connection_pool): """Sends a message on a topic and wait for a response.""" rv = multicall(conf, context, topic, msg, timeout, connection_pool) # NOTE(vish): return the last result from the multicall rv = list(rv) if not rv: return return rv[-1] def cast(conf, context, topic, msg, connection_pool): """Sends a message on a topic without waiting for a response.""" LOG.debug(_('Making asynchronous cast on %s...'), topic) _add_unique_id(msg) pack_context(msg, context) with ConnectionContext(conf, connection_pool) as conn: conn.topic_send(topic, rpc_common.serialize_msg(msg)) def fanout_cast(conf, context, topic, msg, connection_pool): """Sends a message on a fanout exchange without waiting for a response.""" LOG.debug(_('Making asynchronous fanout cast...')) _add_unique_id(msg) pack_context(msg, context) with ConnectionContext(conf, connection_pool) as conn: conn.fanout_send(topic, rpc_common.serialize_msg(msg)) def cast_to_server(conf, context, server_params, topic, msg, connection_pool): """Sends a message on a topic to a specific server.""" _add_unique_id(msg) pack_context(msg, context) with ConnectionContext(conf, connection_pool, pooled=False, server_params=server_params) as conn: conn.topic_send(topic, rpc_common.serialize_msg(msg)) def fanout_cast_to_server(conf, context, server_params, topic, msg, connection_pool): """Sends a message on a fanout exchange to a specific server.""" _add_unique_id(msg) pack_context(msg, context) with ConnectionContext(conf, connection_pool, pooled=False, server_params=server_params) as conn: conn.fanout_send(topic, rpc_common.serialize_msg(msg)) def notify(conf, context, topic, msg, connection_pool, envelope): """Sends a notification event on a topic.""" LOG.debug(_('Sending %(event_type)s on %(topic)s'), dict(event_type=msg.get('event_type'), topic=topic)) _add_unique_id(msg) pack_context(msg, context) with ConnectionContext(conf, connection_pool) as conn: if envelope: msg = rpc_common.serialize_msg(msg, force_envelope=True) conn.notify_send(topic, msg) def cleanup(connection_pool): if connection_pool: connection_pool.empty() def get_control_exchange(conf): return conf.control_exchange
import datetime as dt import logging import queue from abc import ABCMeta, abstractmethod from typing import Dict, Iterable, Union import numpy as np import pandas as pd import pytech.utils as utils from pytech.decorators.decorators import memoize, lazy_property from pytech.backtest.event import MarketEvent from pytech.data.reader import BarReader class DataHandler(metaclass=ABCMeta): CHUNK_SIZE = 'D' def __init__(self, events: queue.Queue, tickers: Iterable[str], start_date: dt.datetime, end_date: dt.datetime, asset_lib_name: str = 'pytech.bars', market_lib_name: str = 'pytech.market'): """ All child classes MUST call this constructor. :param events: The universal queue. :param tickers: An iterable of tickers. This will create the asset universe or all the assets that will available to be traded. :param start_date: The start of the sim. :param end_date: The end of the sim. :param asset_lib_name: The name of the mongo library where asset bars are stored. Defaults to *pytech.bars* :param market_lib_name: The name of the mongo library where market bars are stored. Defaults to *pytech.market* """ self.logger = logging.getLogger(__name__) self.events = events self.tickers = [] self.tickers.extend(tickers) # self._ticker_data = {} self.latest_ticker_data = {} self.continue_backtest = True self.start_date = utils.parse_date(start_date) self.end_date = utils.parse_date(end_date) self.asset_lib_name = asset_lib_name self.market_lib_name = market_lib_name self.asset_reader = BarReader(asset_lib_name) self.market_reader = BarReader(market_lib_name) # self._populate_ticker_data() @lazy_property def ticker_data(self): return self._populate_ticker_data() @abstractmethod def get_latest_bar(self, ticker: str): """ Return the latest bar updated. :param str ticker: The ticker to retrieve the bar for. :return: The latest update bar for the given ticker. """ raise NotImplementedError('Must implement get_latest_bar()') @abstractmethod def get_latest_bars(self, ticker: str, n: int = 1): """ Returns the last **n** bars from the latest_symbol list, or fewer if less bars available. :param ticker: :param int n: The number of bars. :return: """ raise NotImplementedError('Must implement get_latest_bars()') @abstractmethod def get_latest_bar_dt(self, ticker: str): """ Return the datetime for the last bar for the given ticker. :param str ticker: The ticker of the asset. :return: The datetime of the last bar for the given asset :rtype: dt.datetime """ raise NotImplementedError('Must implement get_latest_bar_dt()') @abstractmethod def get_latest_bar_value(self, ticker: str, val_type, n=1): """ Return the last **n** bars from the latest_symbol list. :param ticker: :param val_type: :param n: :return: """ raise NotImplementedError('Must implement get_latest_bar_value()') @abstractmethod def update_bars(self): """ Pushes the latest bar to the latest symbol structure for all symbols in the symbol list. """ raise NotImplementedError('Must implement update_bars()') @abstractmethod def _populate_ticker_data(self): """ Populate the ticker_data dict with a pandas OHLCV df as the value and the ticker as the key. This will get called on ``__init__`` and is **NOT** intended to ever be called directly by child classes. """ raise NotImplementedError('Must implement _populate_ticker_data()') class Bars(DataHandler): def __init__(self, events: queue.Queue, tickers: Iterable, start_date: dt.datetime, end_date: dt.datetime, source: str = 'google', asset_lib_name: str = 'pytech.bars', market_lib_name: str = 'pytech.market'): self.source = source super().__init__(events, tickers, start_date, end_date, asset_lib_name, market_lib_name) def _populate_ticker_data(self) -> Dict[str, Iterable[pd.Series]]: """ Populate the ticker_data dict with a pandas OHLCV df as the value and the ticker as the key. """ comb_index = None df_dict = self._get_data() out = {} for t in self.tickers: out[t] = df_dict[t] # TODO needed? if comb_index is None: comb_index = out[t].index else: comb_index.union(out[t].index) self.latest_ticker_data[t] = [] for t in self.tickers: out[t] = out[t].iterrows() # self.ticker_data[t] = (self.ticker_data[t].iterrows()) return out @memoize def make_agg_df(self, col: str = utils.CLOSE_COL, market_ticker: Union[str, None] = 'SPY') -> pd.DataFrame: """ Make a df that contains all of the ticker data and write it the db. This is used to do analysis like correlation, so a market ticker should be added. :param col: The column to use to create the aggregate DF. :param market_ticker: The ticker that will be used to represent the market. If None is passed then no market_ticker will be used. :return: The aggregate data frame. """ agg_df = pd.DataFrame() df_dict = self._get_data() if market_ticker is not None and market_ticker not in self.tickers: # get the market data if it has not already been fetched market_df = self.market_reader.get_data(market_ticker, columns=col) agg_df[market_ticker] = market_df[col] for t in self.tickers: temp_df = df_dict[t] agg_df[t] = temp_df[col] return agg_df @memoize def _get_data(self, tickers: Iterable[str] = None, **kwargs) -> Dict[str, pd.DataFrame]: """ Get the data. :param tickers: any extra tickers to get data for. :return: """ if tickers is not None: tickers = self.tickers tickers.extend(tickers) else: tickers = self.tickers return self.asset_reader.get_data(tickers, source=self.source, start=self.start_date, end=self.end_date, **kwargs) def _get_new_bar(self, ticker: str): """ Get the latest bar from the data feed and return it as a tuple. :return: bar """ # yield from self.ticker_data for bar in self.ticker_data[ticker]: yield bar def get_latest_bar(self, ticker: str): try: bars_list = self.latest_ticker_data[ticker] except KeyError: self.logger.exception( f'{ticker} is not available in the given data set.') raise else: return bars_list[-1] def get_latest_bars(self, ticker: str, n: int = 1): """ Returns the last ``n`` bars from the latest_ticker_data. If there is less than ``n`` bars available then n-k is returned. :param str ticker: The ticker of the asset for which the bars are needed. :param int n: The number of bars to return. (default: 1) :return: A list of bars. """ try: bars_list = self.latest_ticker_data[ticker] except KeyError: self.logger.exception( f'Could not find {ticker} in latest_ticker_data') raise else: return bars_list[-n:] def get_latest_bar_dt(self, ticker) -> dt.datetime: try: bars_list = self.latest_ticker_data[ticker] except KeyError: self.logger.exception( f'Could not find {ticker} in latest_ticker_data') raise else: return utils.dt_utils.parse_date(bars_list[-1].name) def get_latest_bar_value(self, ticker, val_type, n=1): """ Get the last ``n`` bars but return a series containing only the ``val_type`` requested. :param str ticker: The ticker of the asset for which the bars are needed. :param val_type: :param n: :return: """ try: bars_list = self.get_latest_bars(ticker, n) except KeyError: self.logger.exception( f'Could not find {ticker} in latest_ticker_data') raise else: return np.array([getattr(bar, val_type) for bar in bars_list]) def update_bars(self): for ticker in self.tickers: try: bar = next(self._get_new_bar(ticker)) # bar is a tuple and we only care about the 2nd value in it. bar = bar[1] except StopIteration: self.continue_backtest = False else: if bar is not None: self.latest_ticker_data[ticker].append(bar) self.events.put(MarketEvent())
#!/usr/bin/env python3 # Copyright (c) 2017-2019 The Bitcoin Core developers # Distributed under the MIT software license, see the accompanying # file COPYING or http://www.opensource.org/licenses/mit-license.php. """Test multiwallet. Verify that a bitcoind node can load multiple wallet files """ import os import shutil import time from decimal import Decimal from threading import Thread from test_framework.authproxy import JSONRPCException from test_framework.test_framework import BitcoinTestFramework from test_framework.test_node import ErrorMatch from test_framework.util import ( assert_equal, assert_raises_rpc_error, get_rpc_proxy, ) got_loading_error = False def test_load_unload(node, name, timeout=60.): global got_loading_error t0 = time.time() while time.time() - t0 < timeout and not got_loading_error: try: node.loadwallet(name) node.unloadwallet(name) except JSONRPCException as e: if e.error['code'] == - \ 4 and 'Wallet already being loading' in e.error['message']: got_loading_error = True return # Add a small sleep to avoid CPU exhaustion in the unlikely case # the race never happens. time.sleep(0.001) class MultiWalletTest(BitcoinTestFramework): def set_test_params(self): self.setup_clean_chain = True self.num_nodes = 2 def skip_test_if_missing_module(self): self.skip_if_no_wallet() def add_options(self, parser): parser.add_argument( '--data_wallets_dir', default=os.path.join( os.path.dirname( os.path.realpath(__file__)), 'data/wallets/'), help='Test data with wallet directories (default: %(default)s)', ) def run_test(self): node = self.nodes[0] def data_dir(*p): return os.path.join(node.datadir, self.chain, *p) def wallet_dir(*p): return data_dir('wallets', *p) def wallet(name): return node.get_wallet_rpc(name) def wallet_file(name): if os.path.isdir(wallet_dir(name)): return wallet_dir(name, self.wallet_data_filename) return wallet_dir(name) assert_equal(self.nodes[0].listwalletdir(), {'wallets': [{'name': self.default_wallet_name}]}) # check wallet.dat is created self.stop_nodes() assert_equal(os.path.isfile(wallet_dir(self.default_wallet_name, self.wallet_data_filename)), True) # create symlink to verify wallet directory path can be referenced # through symlink if os.name != 'nt': os.mkdir(wallet_dir('w7')) os.symlink('w7', wallet_dir('w7_symlink')) # rename wallet.dat to make sure plain wallet file paths (as opposed to # directory paths) can be loaded os.rename(wallet_dir(self.default_wallet_name, self.wallet_data_filename), wallet_dir("w8")) # create another dummy wallet for use in testing backups later self.start_node( 0, ["-nowallet", "-wallet=" + self.default_wallet_name]) self.stop_nodes() empty_wallet = os.path.join(self.options.tmpdir, 'empty.dat') os.rename(wallet_dir(self.default_wallet_name, self.wallet_data_filename), empty_wallet) # restart node with a mix of wallet names: # w1, w2, w3 - to verify new wallets created when non-existing paths specified # w - to verify wallet name matching works when one wallet path is prefix of another # sub/w5 - to verify relative wallet path is created correctly # extern/w6 - to verify absolute wallet path is created correctly # w7_symlink - to verify symlinked wallet path is initialized correctly # w8 - to verify existing wallet file is loaded correctly # '' - to verify default wallet file is created correctly wallet_names = ['w1', 'w2', 'w3', 'w', 'sub/w5', os.path.join(self.options.tmpdir, 'extern/w6'), 'w7_symlink', 'w8', self.default_wallet_name] if os.name == 'nt': wallet_names.remove('w7_symlink') extra_args = ['-nowallet'] + \ ['-wallet={}'.format(n) for n in wallet_names] self.start_node(0, extra_args) assert_equal( sorted(map(lambda w: w['name'], self.nodes[0].listwalletdir()['wallets'])), [self.default_wallet_name, os.path.join('sub', 'w5'), 'w', 'w1', 'w2', 'w3', 'w7', 'w7_symlink', 'w8']) assert_equal(set(node.listwallets()), set(wallet_names)) # check that all requested wallets were created self.stop_node(0) for wallet_name in wallet_names: assert_equal(os.path.isfile(wallet_file(wallet_name)), True) # should not initialize if wallet path can't be created exp_stderr = "boost::filesystem::create_director" self.nodes[0].assert_start_raises_init_error( ['-wallet=w8/bad'], exp_stderr, match=ErrorMatch.PARTIAL_REGEX) self.nodes[0].assert_start_raises_init_error( ['-walletdir=wallets'], 'Error: Specified -walletdir "wallets" does not exist') self.nodes[0].assert_start_raises_init_error( ['-walletdir=wallets'], 'Error: Specified -walletdir "wallets" is a relative path', cwd=data_dir()) self.nodes[0].assert_start_raises_init_error( ['-walletdir=debug.log'], 'Error: Specified -walletdir "debug.log" is not a directory', cwd=data_dir()) self.start_node(0, ['-wallet=w1', '-wallet=w1']) self.stop_node(0, 'Warning: Ignoring duplicate -wallet w1.') # should not initialize if one wallet is a copy of another shutil.copyfile(wallet_dir('w8'), wallet_dir('w8_copy')) exp_stderr = r"BerkeleyDatabase: Can't open database w8_copy \(duplicates fileid \w+ from w8\)" self.nodes[0].assert_start_raises_init_error( ['-wallet=w8', '-wallet=w8_copy'], exp_stderr, match=ErrorMatch.PARTIAL_REGEX) # should not initialize if wallet file is a symlink if os.name != 'nt': os.symlink('w8', wallet_dir('w8_symlink')) self.nodes[0].assert_start_raises_init_error( ['-wallet=w8_symlink'], r'Error: Invalid -wallet path \'w8_symlink\'\. .*', match=ErrorMatch.FULL_REGEX) # should not initialize if the specified walletdir does not exist self.nodes[0].assert_start_raises_init_error( ['-walletdir=bad'], 'Error: Specified -walletdir "bad" does not exist') # should not initialize if the specified walletdir is not a directory not_a_dir = wallet_dir('notadir') open(not_a_dir, 'a', encoding="utf8").close() self.nodes[0].assert_start_raises_init_error( ['-walletdir=' + not_a_dir], 'Error: Specified -walletdir "' + not_a_dir + '" is not a directory') # if wallets/ doesn't exist, datadir should be the default wallet dir wallet_dir2 = data_dir('walletdir') os.rename(wallet_dir(), wallet_dir2) self.start_node(0, ['-nowallet', '-wallet=w4', '-wallet=w5']) assert_equal(set(node.listwallets()), {"w4", "w5"}) w5 = wallet("w5") node.generatetoaddress(nblocks=1, address=w5.getnewaddress()) # now if wallets/ exists again, but the rootdir is specified as the # walletdir, w4 and w5 should still be loaded os.rename(wallet_dir2, wallet_dir()) self.restart_node(0, ['-nowallet', '-wallet=w4', '-wallet=w5', '-walletdir=' + data_dir()]) assert_equal(set(node.listwallets()), {"w4", "w5"}) w5 = wallet("w5") w5_info = w5.getwalletinfo() assert_equal(w5_info['immature_balance'], 50000000) competing_wallet_dir = os.path.join( self.options.tmpdir, 'competing_walletdir') os.mkdir(competing_wallet_dir) self.restart_node(0, ['-walletdir=' + competing_wallet_dir]) exp_stderr = r"Error: Error initializing wallet database environment \"\S+competing_walletdir\"!" self.nodes[1].assert_start_raises_init_error( ['-walletdir=' + competing_wallet_dir], exp_stderr, match=ErrorMatch.PARTIAL_REGEX) self.restart_node(0, extra_args) assert_equal(sorted(map(lambda w: w['name'], self.nodes[0].listwalletdir()['wallets'])), [self.default_wallet_name, os.path.join('sub', 'w5'), 'w', 'w1', 'w2', 'w3', 'w7', 'w7_symlink', 'w8', 'w8_copy']) wallets = [wallet(w) for w in wallet_names] wallet_bad = wallet("bad") # check wallet names and balances node.generatetoaddress(nblocks=1, address=wallets[0].getnewaddress()) for wallet_name, wallet in zip(wallet_names, wallets): info = wallet.getwalletinfo() assert_equal(info['immature_balance'], 50000000 if wallet is wallets[0] else 0) assert_equal(info['walletname'], wallet_name) # accessing invalid wallet fails assert_raises_rpc_error(-18, "Requested wallet does not exist or is not loaded", wallet_bad.getwalletinfo) # accessing wallet RPC without using wallet endpoint fails assert_raises_rpc_error(-19, "Wallet file not specified (must request wallet RPC through /wallet/<filename> uri-path).", node.getwalletinfo) w1, w2, w3, w4, *_ = wallets node.generatetoaddress(nblocks=101, address=w1.getnewaddress()) assert_equal(w1.getbalance(), 100000000) assert_equal(w2.getbalance(), 0) assert_equal(w3.getbalance(), 0) assert_equal(w4.getbalance(), 0) w1.sendtoaddress(w2.getnewaddress(), 1000000) w1.sendtoaddress(w3.getnewaddress(), 2000000) w1.sendtoaddress(w4.getnewaddress(), 3000000) node.generatetoaddress(nblocks=1, address=w1.getnewaddress()) assert_equal(w2.getbalance(), 1000000) assert_equal(w3.getbalance(), 2000000) assert_equal(w4.getbalance(), 3000000) batch = w1.batch([w1.getblockchaininfo.get_request(), w1.getwalletinfo.get_request()]) assert_equal(batch[0]["result"]["chain"], self.chain) assert_equal(batch[1]["result"]["walletname"], "w1") self.log.info('Check for per-wallet settxfee call') assert_equal(w1.getwalletinfo()['paytxfee'], 0) assert_equal(w2.getwalletinfo()['paytxfee'], 0) w2.settxfee(1000) assert_equal(w1.getwalletinfo()['paytxfee'], 0) assert_equal(w2.getwalletinfo()['paytxfee'], Decimal('1000.00')) self.log.info("Test dynamic wallet loading") self.restart_node(0, ['-nowallet']) assert_equal(node.listwallets(), []) assert_raises_rpc_error( -18, "No wallet is loaded. Load a wallet using loadwallet or create a new" " one with createwallet. (Note: A default wallet is no longer " "automatically created)", node.getwalletinfo ) self.log.info("Load first wallet") loadwallet_name = node.loadwallet(wallet_names[0]) assert_equal(loadwallet_name['name'], wallet_names[0]) assert_equal(node.listwallets(), wallet_names[0:1]) node.getwalletinfo() w1 = node.get_wallet_rpc(wallet_names[0]) w1.getwalletinfo() self.log.info("Load second wallet") loadwallet_name = node.loadwallet(wallet_names[1]) assert_equal(loadwallet_name['name'], wallet_names[1]) assert_equal(node.listwallets(), wallet_names[0:2]) assert_raises_rpc_error(-19, "Wallet file not specified", node.getwalletinfo) w2 = node.get_wallet_rpc(wallet_names[1]) w2.getwalletinfo() self.log.info("Concurrent wallet loading") threads = [] for _ in range(3): n = node.cli if self.options.usecli else get_rpc_proxy( node.url, 1, timeout=600, coveragedir=node.coverage_dir) t = Thread(target=test_load_unload, args=(n, wallet_names[2], )) t.start() threads.append(t) for t in threads: t.join() global got_loading_error assert_equal(got_loading_error, True) self.log.info("Load remaining wallets") for wallet_name in wallet_names[2:]: loadwallet_name = self.nodes[0].loadwallet(wallet_name) assert_equal(loadwallet_name['name'], wallet_name) assert_equal(set(self.nodes[0].listwallets()), set(wallet_names)) # Fail to load if wallet doesn't exist path = os.path.join(self.options.tmpdir, "node0", "regtest", "wallets", "wallets") assert_raises_rpc_error( -18, "Wallet file verification failed. Failed to load database path " "'{}'. Path does not exist.".format(path), self.nodes[0].loadwallet, 'wallets') # Fail to load duplicate wallets path = os.path.join( self.options.tmpdir, "node0", "regtest", "wallets", "w1", self.wallet_data_filename) assert_raises_rpc_error( -4, "Wallet file verification failed. Refusing to load database. Data file '{}' is already loaded.".format( path), self.nodes[0].loadwallet, wallet_names[0]) # Fail to load duplicate wallets by different ways (directory and # filepath) path = os.path.join( self.options.tmpdir, "node0", "regtest", "wallets", self.wallet_data_filename) assert_raises_rpc_error( -4, "Wallet file verification failed. Refusing to load database. Data file '{}' is already loaded.".format( path), self.nodes[0].loadwallet, self.wallet_data_filename) # Fail to load if one wallet is a copy of another assert_raises_rpc_error(-4, "BerkeleyDatabase: Can't open database w8_copy (duplicates fileid", self.nodes[0].loadwallet, 'w8_copy') # Fail to load if one wallet is a copy of another. # Test this twice to make sure that we don't re-introduce # https://github.com/bitcoin/bitcoin/issues/14304 assert_raises_rpc_error(-4, "BerkeleyDatabase: Can't open database w8_copy (duplicates fileid", self.nodes[0].loadwallet, 'w8_copy') # Fail to load if wallet file is a symlink if os.name != 'nt': assert_raises_rpc_error( -4, "Wallet file verification failed. Invalid -wallet path 'w8_symlink'", self.nodes[0].loadwallet, 'w8_symlink') # Fail to load if a directory is specified that doesn't contain a # wallet os.mkdir(wallet_dir('empty_wallet_dir')) path = os.path.join(self.options.tmpdir, "node0", "regtest", "wallets", "empty_wallet_dir") assert_raises_rpc_error( -18, "Wallet file verification failed. Failed to load database " "path '{}'. Data is not in recognized format.".format(path), self.nodes[0].loadwallet, 'empty_wallet_dir') self.log.info("Test dynamic wallet creation.") # Fail to create a wallet if it already exists. path = os.path.join(self.options.tmpdir, "node0", "regtest", "wallets", "w2") assert_raises_rpc_error( -4, f"Failed to create database path '{path}'. Database already exists.", self.nodes[0].createwallet, 'w2') # Successfully create a wallet with a new name loadwallet_name = self.nodes[0].createwallet('w9') assert_equal(loadwallet_name['name'], 'w9') w9 = node.get_wallet_rpc('w9') assert_equal(w9.getwalletinfo()['walletname'], 'w9') assert 'w9' in self.nodes[0].listwallets() # Successfully create a wallet using a full path new_wallet_dir = os.path.join(self.options.tmpdir, 'new_walletdir') new_wallet_name = os.path.join(new_wallet_dir, 'w10') loadwallet_name = self.nodes[0].createwallet(new_wallet_name) assert_equal(loadwallet_name['name'], new_wallet_name) w10 = node.get_wallet_rpc(new_wallet_name) assert_equal(w10.getwalletinfo()['walletname'], new_wallet_name) assert new_wallet_name in self.nodes[0].listwallets() self.log.info("Test dynamic wallet unloading") # Test `unloadwallet` errors assert_raises_rpc_error(-1, "JSON value is not a string as expected", self.nodes[0].unloadwallet) assert_raises_rpc_error(-18, "Requested wallet does not exist or is not loaded", self.nodes[0].unloadwallet, "dummy") assert_raises_rpc_error(-18, "Requested wallet does not exist or is not loaded", node.get_wallet_rpc("dummy").unloadwallet) assert_raises_rpc_error(-8, "Cannot unload the requested wallet", w1.unloadwallet, "w2"), # Successfully unload the specified wallet name self.nodes[0].unloadwallet("w1") assert 'w1' not in self.nodes[0].listwallets() # Successfully unload the wallet referenced by the request endpoint # Also ensure unload works during walletpassphrase timeout w2.encryptwallet('test') w2.walletpassphrase('test', 1) w2.unloadwallet() time.sleep(1.1) assert 'w2' not in self.nodes[0].listwallets() # Successfully unload all wallets for wallet_name in self.nodes[0].listwallets(): self.nodes[0].unloadwallet(wallet_name) assert_equal(self.nodes[0].listwallets(), []) assert_raises_rpc_error( -18, "No wallet is loaded. Load a wallet using loadwallet or create a new" " one with createwallet. (Note: A default wallet is no longer " "automatically created)", self.nodes[0].getwalletinfo ) # Successfully load a previously unloaded wallet self.nodes[0].loadwallet('w1') assert_equal(self.nodes[0].listwallets(), ['w1']) assert_equal(w1.getwalletinfo()['walletname'], 'w1') assert_equal(sorted(map(lambda w: w['name'], self.nodes[0].listwalletdir()['wallets'])), [self.default_wallet_name, os.path.join('sub', 'w5'), 'w', 'w1', 'w2', 'w3', 'w7', 'w7_symlink', 'w8', 'w8_copy', 'w9']) # Test backing up and restoring wallets self.log.info("Test wallet backup") self.restart_node(0, ['-nowallet']) for wallet_name in wallet_names: self.nodes[0].loadwallet(wallet_name) for wallet_name in wallet_names: rpc = self.nodes[0].get_wallet_rpc(wallet_name) addr = rpc.getnewaddress() backup = os.path.join(self.options.tmpdir, 'backup.dat') rpc.backupwallet(backup) self.nodes[0].unloadwallet(wallet_name) shutil.copyfile(empty_wallet, wallet_file(wallet_name)) self.nodes[0].loadwallet(wallet_name) assert_equal(rpc.getaddressinfo(addr)['ismine'], False) self.nodes[0].unloadwallet(wallet_name) shutil.copyfile(backup, wallet_file(wallet_name)) self.nodes[0].loadwallet(wallet_name) assert_equal(rpc.getaddressinfo(addr)['ismine'], True) # Test .walletlock file is closed self.start_node(1) wallet = os.path.join(self.options.tmpdir, 'my_wallet') self.nodes[0].createwallet(wallet) assert_raises_rpc_error(-4, "Error initializing wallet database environment", self.nodes[1].loadwallet, wallet) self.nodes[0].unloadwallet(wallet) self.nodes[1].loadwallet(wallet) if __name__ == '__main__': MultiWalletTest().main()
from __future__ import unicode_literals from django.template import Template from django.template.loader import render_to_string from django.utils.html import conditional_escape from crispy_forms.compatibility import text_type from crispy_forms.utils import flatatt from crispy_forms.helper import FormHelper from crispy_forms.layout import LayoutObject, Layout, Field, Button from crispy_forms.bootstrap import ContainerHolder, Container TEMPLATE_PACK = 'vds/forms' class TabHolder(ContainerHolder): """ TabHolder object. It wraps Tab objects in a container. Requires bootstrap-tab.js:: TabHolder( Tab('form_field_1', 'form_field_2'), Tab('form_field_3') ) """ template = '%s/layout/tab.html' def render(self, form, form_style, context, template_pack=None, **kwargs): for tab in self.fields: tab.active = False # Open the group that should be open. self.open_target_group_for_form(form) content = self.get_rendered_fields(form, form_style, context, template_pack) links = ''.join(tab.render_link(form, template_pack) for tab in self.fields) context.update({ 'tabs': self, 'links': links, 'content': content }) template = self.get_template_name(template_pack) return render_to_string(template, context.flatten()) class Tab(Container): """ Tab object. It wraps fields in a div whose default class is "tab-pane" and takes a name as first argument. Example:: Tab('tab_name', 'form_field_1', 'form_field_2', 'form_field_3') """ css_class = 'vds-tabs--default__content' link_template = '%s/layout/tab-link.html' errors = True def _has_errors(self, form): for field in self.fields: if field.errors: return True else: return False def render_link(self, form, template_pack=TEMPLATE_PACK, **kwargs): """ Render the link for the tab-pane. It must be called after render so css_class is updated with active if needed. """ self.errors = self._has_errors(form=form) link_template = self.link_template % template_pack return render_to_string(link_template, {'link': self}) def render(self, form, form_style, context, template_pack=TEMPLATE_PACK, **kwargs): if self.active: self.css_class = 'vds-tabs--default__content vds-show' else: self.css_class = 'vds-tabs--default__content vds-hide' return super(Container, self).render(form, form_style, context, template_pack) class Fieldset(LayoutObject): """ Layout object. It wraps fields in a <fieldset> Example:: Fieldset("Text for the legend", 'form_field_1', 'form_field_2' ) The first parameter is the text for the fieldset legend. This text is context aware, so you can do things like:: Fieldset("Data for {{ user.username }}", 'form_field_1', 'form_field_2' ) """ template = "%s/layout/fieldset.html" def _has_errors(self, form): for field in self.fields: if field.errors: return True else: return False def __init__(self, legend, *fields, **kwargs): self.fields = list(fields) self.legend = legend self.css_class = kwargs.pop('css_class', '') self.css_id = kwargs.pop('css_id', None) self.template = kwargs.pop('template', self.template) self.flat_attrs = flatatt(kwargs) self.errors = False def render(self, form, form_style, context, template_pack=TEMPLATE_PACK, **kwargs): fields = self.get_rendered_fields(form, form_style, context, template_pack, **kwargs) self.errors = self._has_errors(form=form) legend = '' if self.legend: legend = '%s' % Template(text_type(self.legend)).render(context) template = self.get_template_name(template_pack) return render_to_string( template, {'fieldset': self, 'legend': legend, 'fields': fields, 'form_style': form_style} ) class Field(LayoutObject): """ Layout object, It contains one field name, and you can add attributes to it easily. For setting class attributes, you need to use `css_class`, as `class` is a Python keyword. Example:: Field('field_name', style="color: #333;", css_class="whatever", id="field_name") """ template = "%s/layout/field.html" def __init__(self, *args, **kwargs): self.fields = list(args) self.attrs = {} if not hasattr(self, 'attrs'): self.attrs = {} if 'css_class' in kwargs: if 'class' in self.attrs: self.attrs['class'] += " %s" % kwargs.pop('css_class') else: self.attrs['class'] = kwargs.pop('css_class') self.wrapper_class = kwargs.pop('wrapper_class', None) self.template = kwargs.pop('template', self.template) # We use kwargs as HTML attributes, turning data_id='test' into data-id='test' self.attrs.update(dict([(k.replace('_', '-'), conditional_escape(v)) for k, v in kwargs.items()])) self.errors = False def _has_errors(self, form): if self.fields[0] in form.errors.keys(): return True else: return False def render(self, form, form_style, context, template_pack=TEMPLATE_PACK, extra_context=None, **kwargs): if extra_context is None: extra_context = {} if hasattr(self, 'wrapper_class'): extra_context['wrapper_class'] = self.wrapper_class template = self.get_template_name(template_pack) self.errors = self._has_errors(form=form) field_class = form.fields.get(self.fields[0]) if 'choices' in field_class.widget.__dict__: self.attrs['class'] = 'vds-select' else: self.attrs['class'] = 'vds-input' return self.get_rendered_fields( form, form_style, context, template_pack, template=template, attrs=self.attrs, extra_context=extra_context, **kwargs ) class Inline(LayoutObject): """ """ def __init__(self, name, **kwargs): self.fields = list() self.name = name self.errors = False super(LayoutObject, self).__init__(**kwargs) def render(self, form, form_style, context, template_pack=None, **kwargs): try: for inline_admin_formset in context['inline_admin_formsets']: if self.name == inline_admin_formset.opts.__class__.__name__: context['inline_admin_formset'] = inline_admin_formset self.template = inline_admin_formset.opts.template return render_to_string(self.template, context) except: for inline_formset in context['inline_formsets']: if self.name == inline_formset.name: formset = inline_formset.get_formset() context['inline_formset'] = formset self.template = 'vds/forms/inlines/base.html' return render_to_string(self.template, context) # class Button(Button): # """ # Button("id", "name", "type") # Button("id-cnl", "Cancel", "/sss/") # # Button('id-save', _("Save"), "submit", "primary") # Button('id-cancel', _("Cancel"), "/action/delete", style="primary") # # Button('id-cancel', _("Cancel"), "/action/delete", style="danger", icon="danger") # """ # template = '%s/layout/button.html' # input_type = 'button' # # def __init__(self, name, value, link, style='secondary', *args, **kwargs): # # super(Button, self).__init__(name=name, value=value, *args, **kwargs) # # # Link # if link == 'submit': # self.input_type = 'submit' # else: # self.input_type = 'a' # self.attrs = { # 'href': link # } # # # Style # self.field_classes = 'vds-button' # if style == 'secondary': # self.field_classes += ' vds-button--neutral' # # if style == 'primary': # self.field_classes += ' vds-button--brand' # # if style == 'danger': # self.field_classes += ' vds-button--destructive' # # # Icon # try: # self.icon = kwargs['icon'] # except: # self.icon = False # # def render(self, form, form_style, context, template_pack=TEMPLATE_PACK, **kwargs): # """ # Renders an `<button />` if container is used as a Layout object. # Input button value can be a variable in context. # """ # self.value = Template(text_type(self.value)).render(context) # template = self.get_template_name(template_pack) # # self.attrs.update({ # 'class': self.field_classes, # 'value': self.value, # 'name': self.name, # }) # # self.flat_attrs = flatatt(self.attrs) # # return render_to_string(template, {'button': self}, context) class Button(object): """ """ def __init__(self, name, value, link='/', style='secondary', *args, **kwargs): self.name = name self.value = value self.link = link if style == 'secondary': self.style = 'neutral' if style == 'primary': self.style = 'brand' if style == 'danger': self.style = 'destructive' def render(self): """ """ context = { "value": self.value, "link": self.link, "name": self.name, "style": self.style, } if self.link == 'submit': html = '<button class="vds-button vds-button--{style} type="submit" name="{name}">{value}</button>'.format(**context) else: html = '<a class="vds-button vds-button--{style}" href="{link}">{value}</a>'.format(**context) return html class Breadcrumb(object): """ """ def __init__(self, title, href): self.title = title self.href= href class Header(object): """ """ def __init__(self): self.title = None self.icon = None self.actions = [] self.navigation = []
from flask import render_template, flash, redirect, session, url_for, request, g from flask import jsonify from flask.ext.login import login_user, logout_user, current_user, login_required from flask.ext.babel import lazy_gettext from flask.ext.sqlalchemy import get_debug_queries from app import app, db, lm, babel from .forms import LoginForm, EditForm, PostForm from .models import User, Post from oauth import OAuthSignIn from datetime import datetime from config import POSTS_PER_PAGE, LANGUAGES, DATABASE_QUERY_TIMEOUT from .emails import follower_notification from guess_language import guessLanguage from .translate import microsoft_translate @app.route('/', methods=['GET', 'POST']) @app.route('/index', methods=['GET', 'POST']) @app.route('/index/<int:page>', methods=['GET', 'POST']) @login_required # add login_required def index(page=1): # add page argument form = PostForm() if form.validate_on_submit(): language = guessLanguage(form.post.data) if language == 'UNKNOWN' or len(language) > 5: language = '' post = Post(body=form.post.data, timestamp=datetime.utcnow(), author=g.user, language=language) db.session.add(post) db.session.commit() flash(lazy_gettext('Your post is now live!')) return redirect(url_for('index')) # avoid re-submiting posts = g.user.followed_posts().paginate(page, POSTS_PER_PAGE, False) return render_template('index.html', title='Home', posts=posts, form=form) # @app.route('/login', methods=['GET', 'POST']) # @oid.loginhandler # tells Flask-OpenID this is our login view function # def login(): # if g.user is not None and g.user.is_authenticated: # return redirect(url_for('index')) # clean than redirect('/index') # form = LoginForm() # # handle submitted form data # # validate_on_submit() will run all the validators and return boolean # if form.validate_on_submit(): # session['remember_me'] = form.remember_me.data # return oid.try_login(form.openid.data, ask_for=['nickname', 'email']) # return render_template('login.html', # title='Sign In', # form=form, # providers=app.config['OPENID_PROVIDERS']) # loads a user from database, used by Flask-Login # user ids in Flask-Login are always unicode strings, so convert to int is necessary @lm.user_loader def load_user(id): return User.query.get(int(id)) # @oid.after_login # def after_login(resp): # # validation # if resp.email is None or resp.email == "": # flash('Invalid login. Please try again.') # return redirect(url_for('login')) # # search our database for the user # user = User.query.filter_by(email=resp.email).first() # # if not found, this is a new user, add into databse # if user is None: # nickname = resp.nickname # if nickname is None or nickname == "": # nickname = resp.email.split('@')[0] # user = User(nickname=nickname, email=resp.email) # db.session.add(user) # db.session.commit() # remember_me = False # if 'remember_me' in session: # remember_me = session['remember_me'] # session.pop('remember_me', None) # login_user(user, remember=remember_me) # return redirect(request.args.get('next') or url_for('index')) # Any function decorated with before_request will run before # the view function # `current_user` is set by Flask-Login, so store it in g.user @app.before_request def before_request(): g.user = current_user if g.user.is_authenticated: g.user.last_seen = datetime.utcnow() db.session.add(g.user) db.session.commit() g.locale = get_locale() @app.after_request def after_request(response): for query in get_debug_queries(): if query.duration >= DATABASE_QUERY_TIMEOUT: app.logger.Warning("SLOW QUERY: %s\nParameters: %s\nDuration: %fs\nContext: %s\n" % (query.statement, query.parameters, query.duration, query.context)) return response @app.route('/logout') def logout(): logout_user() return redirect(url_for('index')) ################################# # OAuth views ################################# @app.route('/oauth') def oauth(): if g.user is not None and g.user.is_authenticated: return redirect(url_for('index')) # clean than redirect('/index') return render_template('oauth.html') @app.route('/authorize/<provider>') def oauth_authorize(provider): if not g.user.is_anonymous: return redirect(url_for('index')) oauth = OAuthSignIn.get_provider(provider) return oauth.authorize() @app.route('/callback/<provider>') def oauth_callback(provider): if not g.user.is_anonymous: return redirect(url_for('index')) oauth = OAuthSignIn.get_provider(provider) social_id, username, email, avatarLarge, avatarSmall = oauth.callback() if social_id is None: flash('Authentication failed.') return redirect(url_for('index')) user = User.query.filter_by(social_id=social_id).first() if not user: nickname = User.make_unique_nickname(username) user = User(social_id=social_id, nickname=nickname, email=email, avatarLarge=avatarLarge, avatarSmall=avatarSmall) db.session.add(user) db.session.commit() # follow him/herself db.session.add(user.follow(user)) db.session.commit() else: u = user.follow(user) if u: db.session.add(u) db.session.commit() remember_me = False if 'remember_me' in session: remember_me = session['remember_me'] session.pop('remember_me', None) login_user(user, remember=remember_me) return redirect(url_for('index')) # User profile view @app.route('/user/<nickname>') @app.route('/user/<nickname>/<int:page>') @login_required def user(nickname, page=1): user = User.query.filter_by(nickname=nickname).first() if user == None: flash('User %s not found.' % nickname) return redirect(url_for('index')) posts = user.sorted_posts().paginate(page, POSTS_PER_PAGE, False) return render_template('user.html', user=user, posts=posts) # User about_me edit view @app.route('/edit', methods=['GET', 'POST']) @login_required def edit(): form = EditForm(g.user.nickname) if form.validate_on_submit(): g.user.nickname = form.nickname.data g.user.about_me = form.about_me.data db.session.add(g.user) db.session.commit() flash(lazy_gettext('Your changes have been saved.')) return redirect(url_for('edit')) else: form.nickname.data = g.user.nickname form.about_me.data = g.user.about_me return render_template('edit.html', form=form) @app.route('/user_list') @login_required def user_list(): users = User.query.all() if users == None: flash('No user are found!') return redirect(url_for('index')) return render_template('user_list.html', users=users) @app.errorhandler(404) def not_found_error(error): return render_template('404.html'), 404 @app.errorhandler(500) def internal_error(error): #roll database back to a working session db.session.rollback() return render_template('500.html'), 500 @app.route('/follow/<nickname>') @login_required def follow(nickname): user = User.query.filter_by(nickname=nickname).first() if user is None: flash('User %s not found.' % nickname) return redirect(url_for('index')) if user == g.user: flash('You can\'t follow yourself!') return redirect(url_for('user', nickname=nickname)) u = g.user.follow(user) if u is None: flash('Cannot follow ' + nickname + '.') return redirect(url_for('user', nickname=nickname)) db.session.add(u) db.session.commit() flash('You are now following ' + nickname + '!') return redirect(url_for('user', nickname=nickname)) @app.route('/unfollow/<nickname>') @login_required def unfollow(nickname): user = User.query.filter_by(nickname=nickname).first() if user is None: flash('User %s not found.' % nickname) return redirect(url_for('index')) if user == g.user: flash('You can\'t unfollow yourself!') return redirect(url_for('user', nickname=nickname)) u = g.user.unfollow(user) if u is None: flash('Cannot unfollow ' + nickname + '.') return redirect(url_for('user', nickname=nickname)) db.session.add(u) db.session.commit() flash('You have stopped following ' + nickname + '.') follower_notification(user, g.user) return redirect(url_for('user', nickname=nickname)) @babel.localeselector def get_locale(): return request.accept_languages.best_match(LANGUAGES.keys()) @app.route('/translate', methods=['POST']) @login_required def translate(): return jsonify({ 'text': microsoft_translate( request.form['text'], request.form['sourceLang'], request.form['destLang'] ) }) @app.route('/delete/<int:id>') @login_required def delete(id): post = Post.query.get(id) if post is None: flash(lazy_gettext('Post not found.')) return redirect(url_for('index')) if post.author.id != g.user.id: flash(lazy_gettext('You cannot delete this post!')) return redirect(url_for('index')) db.session.delete(post) db.session.commit() flash(lazy_gettext('Your post has been deleted.')) return redirect(url_for('index'))
## ## MCMC sampler for Mixture-of-Isoforms (MISO) model ## ## Yarden Katz <yarden@mit.edu> ## ## The sampler uses a Metropolis-Hastings sampling scheme, combined with ## a Gibbs sampling step. ## import scipy import misopy from misopy.reads_utils import count_aligned_reads, \ count_isoform_assignments from misopy.read_simulator import simulate_reads, print_reads_summary, \ read_counts_to_read_list, \ get_reads_summary import misopy.hypothesis_test as ht from misopy.Gene import Gene, Exon from misopy.py2c_gene import * # C MISO interface import pysplicing from scipy import * from numpy import * import cPickle as pickle from scipy.stats import mode import math import time from numpy import numarray import os import sys from collections import defaultdict import glob import logging import logging.handlers loggers = {} def get_logger(logger_name, log_outdir, level=logging.WARNING, include_stdout=True): """ Return a logging object. """ global loggers # Avoid race-conditions try: os.makedirs(log_outdir) except OSError: pass if loggers.get(logger_name): return loggers.get(logger_name) logger = logging.getLogger(logger_name) formatter = \ logging.Formatter('%(asctime)s - %(name)s - %(levelname)s - %(message)s', datefmt='%m/%d/%Y %I:%M:%S %p') # Do not log to file #if log_outdir is not None: # log_filename = os.path.join(log_outdir, "%s.log" %(logger_name)) # fh = logging.FileHandler(log_filename) # fh.setLevel(level) # fh.setFormatter(formatter) # logger.addHandler(fh) logging.root.setLevel(level) # Optionally add handler that streams all logs # to stdout if include_stdout: ch = logging.StreamHandler(sys.stdout) ch.setLevel(level) ch.setFormatter(formatter) logger.addHandler(ch) logger.info("Created logger %s" %(logger_name)) loggers.update({logger_name: logger}) return logger ## ## Helper statistics/linear algebra functions ## def set_diag(a, v): for i, elt in enumerate(a): a[i, i] = v return a def maxi(l): m = max(l) for i, v in enumerate(l): if m == v: return i def mini(l): m = min(l) for i, v in enumerate(l): if m == v: return i def exp_logsumexp(a): return exp(a - logsumexp(a)) def vect_logsumexp(a, axis=None): if axis is None: # Use the scipy.maxentropy version. return logsumexp(a) a = asarray(a) shp = list(a.shape) shp[axis] = 1 a_max = a.max(axis=axis) s = log(exp(a - a_max.reshape(shp)).sum(axis=axis)) lse = a_max + s return lse def print_assignment_summary(assignments): counts = defaultdict(int) for a in assignments: counts[a] += 1 for k, v in counts.iteritems(): print "Total of %d in isoform %d" %(v, k) def float_array_to_str(array_of_floats): """ Convert a float numpy array to a string for printing purposes. """ str_float_array = '[' + ' '.join(['%.3f' %(val) for val in array_of_floats]) + ']' return str_float_array def get_paired_end_sampler_params(num_isoforms, mean_frag_len, frag_variance, read_len, overhang_len=1): """ Return parameters for MISO sampler, in paired-end mode. """ hyperparameters = ones(num_isoforms) proposal_diag = 0.05 sigma = set_diag(zeros([num_isoforms-1, num_isoforms-1]), proposal_diag) sampler_params = {'read_len': read_len, 'overhang_len': overhang_len, 'uniform_proposal': False, 'sigma_proposal': sigma, 'mean_frag_len': mean_frag_len, 'frag_variance': frag_variance} return sampler_params def get_single_end_sampler_params(num_isoforms, read_len, overhang_len=1): """ Return parameters for MISO sampler, in single-end mode. """ hyperparameters = ones(num_isoforms) proposal_diag = 0.05 sigma = set_diag(zeros([num_isoforms-1, num_isoforms-1]), proposal_diag) sampler_params = {'read_len': read_len, 'overhang_len': overhang_len, 'uniform_proposal': False, 'sigma_proposal': sigma} return sampler_params class MISOSampler: def __init__(self, params, paired_end=False, log_dir=None): """ Make a sampler with the given parameters. """ self.params = params self.paired_end = paired_end # set default fragment length distribution parameters if self.paired_end: if ((not 'mean_frag_len' in self.params) or \ (not 'frag_variance' in self.params)): raise Exception, "Must set mean_frag_len and frag_variance when " \ "running in sampler on paired-end data." self.mean_frag_len = self.params['mean_frag_len'] self.frag_variance = self.params['frag_variance'] if log_dir != None: self.log_dir = os.path.abspath(os.path.expanduser(log_dir)) self.log_dir = os.path.join(log_dir, 'logs') # Avoid race-conditions try: os.makedirs(self.log_dir) except OSError: pass self.miso_logger = get_logger('miso_logger', self.log_dir) self.miso_logger.info("Instantiated sampler.") def run_sampler(self, num_iters, reads, gene, hyperparameters, params, output_file, num_chains=6, burn_in=1000, lag=2, prior_params=None, # By default, use sampler with read classes (collapsed) # to get speed boost for single-end reads # (To revert to old reassigning sampler, use # pysplicing.MISO_ALGO_REASSIGN) algorithm=pysplicing.MISO_ALGO_CLASSES, start_cond=pysplicing.MISO_START_AUTO, stop_cond=pysplicing.MISO_STOP_FIXEDNO, verbose=True): """ Fast version of MISO MCMC sampler. Calls C version and returns results. """ num_isoforms = len(gene.isoforms) self.num_isoforms = num_isoforms if prior_params == None: prior_params = (1.0,) * num_isoforms read_positions = reads[0] read_cigars = reads[1] self.num_reads = len(read_positions) if self.num_reads == 0: print "No reads for gene: %s" %(gene.label) return output_file = output_file + ".miso" # If output filename exists, don't run sampler if os.path.isfile(os.path.normpath(output_file)): print "Output filename %s exists, not running MISO." \ %(output_file) return None self.params['iters'] = num_iters self.params['burn_in'] = burn_in self.params['lag'] = lag # Define local variables related to reads and overhang self.overhang_len = self.params['overhang_len'] self.read_len = self.params['read_len'] t1 = 0 t2 = 0 if verbose: t1 = time.time() #self.miso_logger.info("Running sampler...") #self.miso_logger.info(" - num_iters: " + str(num_iters)) #self.miso_logger.info(" - burn-in: " + str(burn_in)) #self.miso_logger.info(" - lag: " + str(lag)) #self.miso_logger.info(" - paired-end? " + str(self.paired_end)) #self.miso_logger.info(" - gene: " + str(gene)) rejected_proposals = 0 accepted_proposals = 0 psi_vectors = [] all_psi_proposals = [] if params['uniform_proposal']: self.miso_logger.debug("UNIFORM independent proposal being used.") proposal_type = "unif" else: self.miso_logger.debug("Non-uniform proposal being used.") self.miso_logger.debug(" - sigma_proposal: " + str(params['sigma_proposal'])) proposal_type = "drift" init_psi = ones(num_isoforms)/float(num_isoforms) # Do not process genes with one isoform if num_isoforms == 1: one_iso_msg = "Gene %s has only one isoform; skipping..." \ %(gene.label) self.miso_logger.warning(one_iso_msg) return # Convert Python Gene object to C c_gene = py2c_gene(gene) ## ## Run C MISO ## read_positions = tuple([r+1 for r in read_positions]) if self.paired_end: # Number of standard deviations in insert length # distribution to consider when assigning reads # to isoforms num_sds = 4L # Run paired-end miso_results = pysplicing.MISOPaired(c_gene, 0L, read_positions, read_cigars, long(self.read_len), float(self.mean_frag_len), float(self.frag_variance), float(num_sds), long(num_iters), long(burn_in), long(lag), prior_params, long(self.overhang_len), long(num_chains), start_cond, stop_cond) else: # Run single-end miso_results = pysplicing.MISO(c_gene, 0L, read_positions, read_cigars, long(self.read_len), long(num_iters), long(burn_in), long(lag), prior_params, long(self.overhang_len), long(num_chains), start_cond, stop_cond, algorithm) # Psi samples psi_vectors = transpose(array(miso_results[0])) # Log scores of accepted samples kept_log_scores = transpose(array(miso_results[1])) # Read classes read_classes = miso_results[2] # Read class statistics read_class_data = miso_results[3] # Assignments of reads to isoforms assignments = miso_results[4] # Statistics and parameters about sampler run run_stats = miso_results[5] # Assignments of reads to classes. # read_classes[n] represents the read class that has # read_assignments[n]-many reads. reads_data = (read_classes, read_class_data) assignments = array(assignments) # Skip events where all reads are incompatible with the annotation; # do not output a file for those. if all(assignments == -1): print "All reads incompatible with annotation, skipping..." return accepted_proposals = run_stats[4] rejected_proposals = run_stats[5] percent_acceptance = (float(accepted_proposals)/(accepted_proposals + \ rejected_proposals)) * 100 #self.miso_logger.info("Percent acceptance (including burn-in): %.4f" %(percent_acceptance)) #self.miso_logger.info("Number of iterations recorded: %d" %(len(psi_vectors))) # Write MISO output to file print "Outputting samples to: %s..." %(output_file) self.miso_logger.info("Outputting samples to: %s" %(output_file)) self.output_miso_results(output_file, gene, reads_data, assignments, psi_vectors, kept_log_scores, num_iters, burn_in, lag, percent_acceptance, proposal_type) if verbose: t2 = time.time() print "Event took %.2f seconds" %(t2 - t1) def output_miso_results(self, output_file, gene, reads_data, assignments, psi_vectors, kept_log_scores, num_iters, burn_in, lag, percent_acceptance, proposal_type): """ Output results of MISO to a file. """ output = open(output_file, 'w') # Get a string representation of the isoforms - use '_' # in the delimiter regardless iso_delim = '_' if type(gene.isoforms[0].desc) == list: str_isoforms = '[' + ",".join(["\'" + iso_delim.join(iso.desc) + "\'" \ for iso in gene.isoforms]) + ']' else: str_isoforms = '[' + ",".join(["\'" + iso.desc + "\'" \ for iso in gene.isoforms]) + ']' num_isoforms = len(gene.isoforms) # And of the exon lengths exon_lens = ",".join(["(\'%s\',%d)" %(p.label, p.len) \ for p in gene.parts]) ## Compile header with information about isoforms and internal parameters used ## by the sampler, and also information about read counts and number of ## reads assigned to each isoform. read_classes, read_class_counts = reads_data read_counts_list = [] for class_num, class_type in enumerate(read_classes): class_counts = read_class_counts[class_num] # Get the read class type in string format class_str = str(tuple([int(c) for c in class_type])).replace(" ", "") # Get the read class counts in string format class_counts_str = "%s" %(int(read_class_counts[class_num])) # Put class and counts together curr_str = "%s:%s" %(class_str, class_counts_str) read_counts_list.append(curr_str) # Get a summary of the raw read counts supporting each isoform read_counts_str = ",".join(read_counts_list) assigned_counts = count_isoform_assignments(assignments) # Get number of reads assigned to each isoform assigned_counts_str = ",".join(["%d:%d" %(c[0], c[1]) \ for c in assigned_counts]) # coordinates where mRNAs start mRNA_starts = [] mRNA_ends = [] for iso in gene.isoforms: mRNA_starts.append(iso.genomic_start) mRNA_ends.append(iso.genomic_end) mRNA_start_coords = ",".join([str(start) for start in mRNA_starts]) mRNA_end_coords = ",".join([str(end) for end in mRNA_ends]) chrom = gene.chrom if chrom == None: chrom = "NA" strand = gene.strand if strand == None: strand = "NA" header = "#isoforms=%s\texon_lens=%s\titers=%d\tburn_in=%d\tlag=%d\t" \ "percent_accept=%.2f\tproposal_type=%s\t" \ "counts=%s\tassigned_counts=%s\tchrom=%s\tstrand=%s\tmRNA_starts=%s\tmRNA_ends=%s\n" \ %(str_isoforms, exon_lens, num_iters, burn_in, lag, percent_acceptance, proposal_type, read_counts_str, assigned_counts_str, # Fields related to gene/event chrom, strand, mRNA_start_coords, mRNA_end_coords) output.write(header) # Output samples and their associated log scores, as well as read counts results_fields = ["sampled_psi", "log_score"] results_header = "%s\n" %("\t".join(results_fields)) output.write(results_header) for psi_sample, curr_log_score in zip(psi_vectors, kept_log_scores): psi_sample_str = ",".join(["%.4f" %(psi) for psi in psi_sample]) output_line = "%s\t%.2f\n" %(psi_sample_str, curr_log_score) output.write(output_line) output.close() print "Completed outputting." # return [percent_acceptance, array(psi_vectors), array(kept_log_scores)] def run_sampler_on_event(gene, ni, ne, nb, read_len, overhang_len, num_iters, output_dir, confidence_level=.95): """ Run sampler on a two-isoform gene event. """ print "Running sampler on a two-isoform event..." print " - Gene label: ", gene.label, gene print " - NI, NE, NB: %d, %d, %d" %(ni, ne, nb) print "Using default sampler parameters." if gene.chrom != None: # Index output by chromosome print "Indexing by chromosome..." output_dir = os.path.join(output_dir, gene.chrom) if not os.path.exists(output_dir): os.makedirs(output_dir) output_filename = os.path.join(output_dir, gene.label) samples = [] cred_interval = [] num_isoforms = len(gene.isoforms) burn_in = 500 lag = 10 hyperparameters = ones(num_isoforms) proposal_diag = 0.05 sigma = set_diag(zeros([num_isoforms-1, num_isoforms-1]), proposal_diag) sampler_params = {'read_len': read_len, 'overhang_len': overhang_len, 'uniform_proposal': False, 'sigma_proposal': sigma} sampler = MISOSampler(sampler_params, log_dir=output_dir) reads = read_counts_to_read_list(ni, ne, nb) t1 = time.time() sampler_results = sampler.run_sampler(num_iters, reads, gene, hyperparameters, sampler_params, output_filename, burn_in=burn_in, lag=lag) if not sampler_results: return (samples, cred_interval) samples = sampler_results[1] # Compute credible intervals cred_interval = ht.compute_credible_intervals(samples, confidence_level=confidence_level) t2 = time.time() print " - Sampler run took %s seconds." %(str(t2-t1)) # return samples and credible intervals return (samples, cred_interval) def profile_miso(): from Gene import make_gene gene = make_gene([150, 100, 150], [[1, 2, 3], [1, 3]]) read_len = 36 overhang_len = 4 output_dir = "profiler-test" for x in range(10): print "x = %d" %(x) a, b = run_sampler_on_event(gene, 500, 50, 40, read_len, overhang_len, 10000, output_dir) def main(): return # import cProfile as profile # import pstats # output_file = "profile" # profile.run('profile_miso()', output_file) # p = pstats.Stats(output_file) # print "name: " # print p.sort_stats('name') # print "all stats: " # p.print_stats() # print "cumulative (top 10): " # p.sort_stats('cumulative').print_stats(20) if __name__ == '__main__': main()
from inspect import getmembers, isroutine, stack from re import search, sub import six from selenium.common.exceptions import ElementNotInteractableException, \ NoSuchWindowException, StaleElementReferenceException from selenium.webdriver.common.action_chains import ActionChains import nerodia from nerodia.adjacent import Adjacent from nerodia.browser import Browser from nerodia.container import Container from nerodia.elements.scroll import Scrolling from nerodia.exception import Error, NoMatchingWindowFoundException, ObjectDisabledException, \ ObjectReadOnlyException, UnknownFrameException, UnknownObjectException from nerodia.js_execution import JSExecution from nerodia.js_snippet import JSSnippet from nerodia.locators.class_helpers import ClassHelpers from nerodia.locators.element.selector_builder import SelectorBuilder from nerodia.user_editable import UserEditable from nerodia.wait.wait import TimeoutError, Waitable from nerodia.window import Dimension, Point class Element(ClassHelpers, JSExecution, Container, JSSnippet, Waitable, Adjacent, Scrolling): ATTRIBUTES = [] CASE_INSENSITIVE_ATTRIBUTES = ['accept', 'accept_charset', 'align', 'alink', 'axis', 'bgcolor', 'charset', 'checked', 'clear', 'codetype', 'color', 'compact', 'declare', 'defer', 'dir', 'direction', 'disabled', 'enctype', 'face', 'frame', 'hreflang', 'http_equiv', 'lang', 'language', 'link', 'media', 'method', 'multiple', 'nohref', 'noresize', 'noshade', 'nowrap', 'readonly', 'rel', 'rev', 'rules', 'scope', 'scrolling', 'selected', 'shape', 'target', 'text', 'type', 'valign', 'valuetype', 'vlink'] keyword = None _content_editable = None _selector_builder = None _element_matcher = None _locator = None def __init__(self, query_scope, selector): self.query_scope = query_scope if not isinstance(selector, dict): raise TypeError('invalid argument: {!r}'.format(selector)) self.el = selector.pop('element', None) if self.el and len(set(selector) - {'tag_name'}) > 0: nerodia.logger.deprecate("'element' locator to initialize a relocatable Element", '#cache=', ids=['element_cache']) self.selector = selector if self.el is None: self.build() @property def exists(self): """ Returns True if element exists, False otherwise Checking for staleness is deprecated :rtype: bool """ try: if self._located and self.stale: self.reset() elif self._located: return True self.assert_exists() return True except (UnknownObjectException, UnknownFrameException): return False exist = exists def __repr__(self): string = '#<{}: '.format(self.__class__.__name__) if self.keyword: string += 'keyword: {} '.format(self.keyword) string += 'located: {}; '.format(self._located) if not self.selector: string += '{element: (selenium element)}' else: string += self.selector_string string += '>' return string def __eq__(self, other): """ Returns True if two elements are equal :param other: other element to compare :rtype: bool """ return isinstance(other, self.__class__) and self.wd == other.wd eql = __eq__ def __hash__(self): return self.el.__hash__() if self._located else super(Element, self).__hash__() @property def text(self): """ Returns the text of the element :rtype: str """ return self._element_call(lambda: self.el.text) @property def tag_name(self): """ Returns the tag name of the element :rtype: str """ return self._element_call(lambda: self.el.tag_name).lower() def click(self, *modifiers): """ Clicks the element, optionally while pressing the given modifier keys. Note that support for holding a modifier key is currently experimental, and may not work at all. :param modifiers: modifier keys to press while clicking :Example: Click an element browser.element(name='new_user_button').click() :Example: Click an element with shift key pressed from selenium.webdriver.common.keys import Keys browser.element(name='new_user_button').click(Keys.SHIFT) :Example: Click an element with several modifier keys pressed from selenium.webdriver.common.keys import Keys browser.element(name='new_user_button').click(Keys.SHIFT, Keys.CONTROL) """ def method(): if modifiers: action = ActionChains(self.driver) for mod in modifiers: action.key_down(mod) action.click(self.el) for mod in modifiers: action.key_up(mod) action.perform() else: self.el.click() self._element_call(method, self.wait_for_enabled) self.browser.after_hooks.run() def js_click(self): """ Simulates JavaScript click event on element. :Example: Click an element browser.element(name='new_user_button').js_click() """ self.fire_event('click') self.browser.after_hooks.run() def double_click(self): """ Double clicks the element. Note that browser support may vary. :Example: Double-click an element browser.element(name='new_user_button').double_click() """ self._element_call(lambda: ActionChains(self.driver).double_click(self.el) .perform(), self.wait_for_present) self.browser.after_hooks.run() def js_double_click(self): """ Simulates JavaScript double click event on element. :Example: Click an element browser.element(name='new_user_button').js_double_click() """ self.fire_event('dblclick') self.browser.after_hooks.run() def right_click(self, *modifiers): """ Right clicks the element, optionally while pressing the given modifier keys. Note that support for holding a modifier key is currently experimental, and may not work at all. Also, the browser support may vary. :Example: Right click an element browser.element(name='new_user_button').right_click() :Example: Right click an element with shift key pressed browser.element(name='new_user_button').right_click(nerodia.Keys.SHIFT) :Example: Click an element with several modifier keys pressed browser.element(name='new_user_button').right_click(nerodia.Keys.SHIFT, nerodia.Keys.ALT) """ def _right_click(): action = ActionChains(self.driver) if len(modifiers) > 0: for mod in modifiers: action.key_down(mod) action.context_click(self.el) for mod in modifiers: action.key_up(mod) action.perform() else: action.context_click(self.el).perform() self._element_call(_right_click, self.wait_for_present) self.browser.after_hooks.run() def hover(self): """ Moves the mouse to the middle of this element Note that browser support may vary :Example: Hover over an element browser.element(name='new_user_button').hover() """ self._element_call(lambda: ActionChains(self.driver).move_to_element(self.el) .perform(), self.wait_for_present) self.browser.after_hooks.run() def drag_and_drop_on(self, other): """ Drag and drop this element on to another element instance Note that browser support may vary :param other: element to drop on :Example: Drag an element onto another a = browser.div(id='draggable') b = browser.div(id='droppable') a.drag_and_drop_on(b) """ self._assert_is_element(other) value = self._element_call(lambda: ActionChains(self.driver) .drag_and_drop(self.el, other.wd).perform(), self.wait_for_present) self.browser.after_hooks.run() return value def drag_and_drop_by(self, xoffset, yoffset): """ Drag and drop this element by the given offsets. Note that browser support may vary. :param xoffset: amount to move horizontally :param yoffset: amount to move vertically :Example: Drag an element onto another browser.div(id='draggable').drag_and_drop_by(100, -200) """ self._element_call(lambda: ActionChains(self.driver). drag_and_drop_by_offset(self.el, xoffset, yoffset).perform(), self.wait_for_present) def select_text(self, string): """ Selects text on page (as if dragging clicked mouse across provided text) :param string: string to select :Example: browser.legend().select_text('information') """ self._element_call(lambda: self._execute_js('selectText', self.el, string)) @property def classes(self): return self.class_name.split() def attribute_value(self, attribute_name): """ Returns given attribute value of the element :param attribute_name: attribute to retrieve :type attribute_name: str :rtype: str :Example: browser.a(id='link_2').attribute_value('title') #=> 'link_title_2' """ return self._element_call(lambda: self.el.get_attribute(attribute_name)) get_attribute = attribute_value attribute = attribute_value @property def attribute_values(self): """ Returns all attribute values. Attributes with special characters are returned as String, rest are returned as a Symbol. :rtype: dict :Example: browser.pre(id='rspec').attribute_values #=> {'class': 'ruby', 'id': 'rspec' } """ result = self._element_call(lambda: self._execute_js('attributeValues', self.el)) regex = r'[a-zA-Z\-]*' for key in result: match = search(regex, key) if match and match.group(0) == key: result[key.replace('-', '_')] = result.pop(key) return result get_attributes = attribute_values attributes = attribute_values @property def attribute_list(self): """ Returns list of all attributes. :rtype: list :Example: browser.pre(id='rspec').attribute_list #=> ['class', 'id'] """ return list(self.attribute_values) def send_keys(self, *args): """ Sends sequence of keystrokes to the element :param args: keystrokes to send :Example: browser.text_field(name='new_user_first_name').send_keys('nerodia') """ return self._element_call(lambda: self.el.send_keys(*args), self.wait_for_writable) @property def focused(self): """ Returns True if the element is focused :rtype: bool """ return self._element_call(lambda: self.el == self.driver.switch_to.active_element) def fire_event(self, event_name): """ Simulates JavaScript events on element Note that you may omit 'on' from event name :param event_name: event to fire :Example: browser.button(name='new_user_button').fire_event('click') browser.button(name='new_user_button').fire_event('mousemove') browser.button(name='new_user_button').fire_event('onmouseover') """ event_name = sub(r'^on', '', str(event_name)).lower() self._element_call(lambda: self._execute_js('fireEvent', self.el, event_name)) def scroll_into_view(self): """ Scroll until the element is in the view screen :rtype: Point :Example: browser.button(name='new_user_button').scroll_into_view() """ nerodia.logger.deprecate('Element#scroll_into_view', 'Element#scroll methods', ids=['scroll_into_view']) return Point(**self._element_call(lambda: self.el.location_once_scrolled_into_view)) @property def location(self): """ Get the location of the element (x, y) :rtype: Point :Example: browser.button(name='new_user_button').location """ return Point(**self._element_call(lambda: self.el.location)) @property def size(self): """ Get the size of the element (width, height) :rtype: Dimension :Example: browser.button(name='new_user_button').size """ return Dimension(**self._element_call(lambda: self.el.size)) @property def height(self): """ Get the height of the element :rtype: int :Example: browser.button(name='new_user_button').height """ return self.size.height @property def width(self): """ Get the width of the element :rtype: int :Example: browser.button(name='new_user_button').width """ return self.size.width @property def center(self): """ Get the center coordinates of the element :rtype: Point :Example: browser.button(name='new_user_button').center """ location = self.location size = self.size return Point(round(location.x + size.width / 2), round(location.y + size.height / 2)) centre = center @property def driver(self): return self.query_scope.driver @property def wd(self): """ Returns underlying Selenium object of the Nerodia Element :rtype: selenium.webdriver.remote.webelement.WebElement """ self.assert_exists() return self.el @property def visible(self): """ Returns true if this element is visible on the page Raises exception if element does not exist :rtype: bool """ nerodia.logger.warning('#visible behavior will be changing slightly, consider ' 'switching to #present (more details: ' 'http://watir.com/element-existentialism/', ids=['visible_element']) displayed = self._display_check() if displayed is None and self._display_check(): nerodia.logger.deprecate('Checking `#visible is False` to determine a stale ' 'element', '`#stale is True`', ids=['stale_visible']) if displayed is None: raise self._unknown_exception return displayed @property def enabled(self): """ Returns True if the element is present and enabled on the page :rtype: bool """ return self._element_call(lambda: self.el.is_enabled(), self.assert_exists) @property def present(self): """ Returns True if the element exists and is visible on the page Returns False if the element does not exist or exists but is not visible :rtype: bool """ try: return self._display_check() except (UnknownObjectException, UnknownFrameException): return False @property def obscured(self): """ Returns if the element's center point is covered by a non-descendant element. :rtype: bool :Example: browser.button(value='Delete').obscured #=> False """ def func(): if not self.present: return True self.scroll.to() return self._execute_js('elementObscured', self) return self._element_call(func) def style(self, prop=None): """ Returns given style property of this element :param prop: property to get :type prop: str :rtype: str :Example: browser.button(value='Delete').style #=> "border: 4px solid red;" browser.button(value='Delete').style('border') #=> "4px solid rgb(255, 0, 0)" """ if prop: return self._element_call(lambda: self.el.value_of_css_property(prop)) else: return str(self.attribute_value('style')).strip() def to_subtype(self): """ Cast this Element instance to a more specific subtype :Example: browser.element(xpath="//input[@type='submit']").to_subtype() #=> #<Button> """ tag = self.tag_name from .button import Button from .check_box import CheckBox from .file_field import FileField from .html_elements import HTMLElement from .radio import Radio from .text_field import TextField if tag == 'input': elem_type = self.attribute_value('type') if elem_type in Button.VALID_TYPES: klass = Button elif elem_type == 'checkbox': klass = CheckBox elif elem_type == 'radio': klass = Radio elif elem_type == 'file': klass = FileField else: klass = TextField else: klass = nerodia.element_class_for(tag) or HTMLElement el = klass(self.query_scope, selector=self.selector) el.cache = self.wd return el @property def browser(self): """ Returns browser :rtype: nerodia.browser.Browser """ return self.query_scope.browser @property def stale(self): """ Returns True if a previously located element is no longer attached to the DOM :rtype: bool """ if self.el is None: raise Error('Can not check staleness of unused element') self._ensure_context() return self.stale_in_context @property def stale_in_context(self): try: self.el.value_of_css_property('staleness_check') # any wire call checks for staleness return False except StaleElementReferenceException: return True def reset(self): self.el = None def locate(self): self._ensure_context() self.locate_in_context() return self def build(self): self.selector_builder.build(self.selector.copy()) @property def cache(self): return self.el @cache.setter def cache(self, element): """ Set the cached element. For use when element can be relocated with the provided selector. """ self.el = element @property def selector_string(self): from ..browser import Browser if isinstance(self.query_scope, Browser): return repr(self.selector) else: return '{} --> {}'.format(self.query_scope.selector_string, self.selector) def wait_for_exists(self): if not nerodia.relaxed_locate: return self.assert_exists() if self._located: # Performance shortcut return None try: if not isinstance(self.query_scope, Browser): self.query_scope.wait_for_exists() self.wait_until(lambda e: e.exists, element_reset=True) except TimeoutError: raise self._unknown_exception('timed out after {} seconds, waiting for {} to be ' 'located'.format(nerodia.default_timeout, self)) def wait_for_present(self): pres = self.present if not nerodia.relaxed_locate or pres: return pres try: if not isinstance(self.query_scope, Browser): self.query_scope.wait_for_present() self.wait_until(lambda e: e.present) except TimeoutError as e: raise self._unknown_exception('element located, but {}'.format(e)) def wait_for_enabled(self): from .button import Button from .input import Input from .option import Option from .select import Select if not nerodia.relaxed_locate: return self._assert_enabled() self.wait_for_exists() if not any(isinstance(self, klass) for klass in [Input, Button, Select, Option]) \ and not self._content_editable: return if self.enabled: return try: self.wait_until(lambda e: e.enabled) except TimeoutError: self._raise_disabled() def wait_for_writable(self): self.wait_for_enabled() if not nerodia.relaxed_locate: if hasattr(self, 'readonly') and self.readonly: self._raise_writable() if not hasattr(self, 'readonly') or not self.readonly: return try: self.wait_until(lambda e: not getattr(e, 'readonly', None) or not e.readonly) except TimeoutError: self._raise_writable() def assert_exists(self): """ Locates if not previously found; does not check for staleness for performance reasons """ if not self._located: self.locate() if not self._located: raise self._unknown_exception('unable to locate element: {}'.format(self)) def locate_in_context(self): self.el = self.locator.locate(self.selector_builder.built) return self.el # private @property def _located(self): """ Returns if the element has previously been located :rtype: bool """ return self.el is not None @property def _raise_writable(self): raise ObjectReadOnlyException('element present and enabled, but timed out after {} ' 'seconds, waiting for {} to not be ' 'readonly'.format(nerodia.default_timeout, self)) def _raise_disabled(self): raise ObjectDisabledException('element present, but timed out after {} ' 'seconds, waiting for {} to be ' 'enabled'.format(nerodia.default_timeout, self)) def _raise_present(self): raise UnknownObjectException('element located, but timed out after {} seconds, waiting ' 'for {} to be present'.format(nerodia.default_timeout, self)) @property def _unknown_exception(self): return UnknownObjectException @property def _element_class(self): return self.__class__ def _ensure_context(self): from nerodia.elements.i_frame import IFrame if isinstance(self.query_scope, Browser) or self.query_scope._located is False or \ (self.query_scope._located is False and self.query_scope.stale): self.query_scope.locate() if isinstance(self.query_scope, IFrame): self.query_scope.switch_to() def _assert_enabled(self): if not self._element_call(lambda: self.el.is_enabled()): raise ObjectDisabledException('object is disabled {}'.format(self)) @classmethod def _assert_is_element(cls, obj): if not isinstance(obj, Element): raise TypeError('expected nerodia.Element, ' 'got {}:{}'.format(obj, obj.__class__.__name__)) def _display_check(self): """ Removes duplication in #present? & #visible? and makes setting deprecation notice easier """ check = self._display_check_retry() if check is None: return self._display_check_retry() return check def _display_check_retry(self): try: self.assert_exists() return self.el.is_displayed() except StaleElementReferenceException: self.reset() def _element_call(self, method, precondition=None): caller = stack()[1][3] already_locked = self.browser.timer.locked if not already_locked: from ..wait.timer import Timer self.browser.timer = Timer(timeout=nerodia.default_timeout) try: return self._element_call_check(precondition, method, caller) finally: nerodia.logger.debug('<- `Completed {}#{}`'.format(self, caller)) if not already_locked: self.browser.timer.reset() def _check_condition(self, condition, caller): nerodia.logger.debug('<- `Verifying precondition {}#{} for ' '{}`'.format(self, condition, caller)) try: if not condition: self.assert_exists() else: condition() nerodia.logger.debug('<- `Verified precondition ' '{}#{!r}`'.format(self, condition or 'assert_exists')) except self._unknown_exception: if condition is None: nerodia.logger.debug('<- `Unable to satisfy precondition ' '{}#{}`'.format(self, condition)) self._check_condition(self.wait_for_exists, caller) else: raise def _element_call_check(self, precondition, method, caller): nerodia.logger.debug('-> `Executing {}#{}`'.format(self, caller)) while True: try: self._check_condition(precondition, caller) return method() except self._unknown_exception as e: if precondition is None: self._element_call(method, self.wait_for_exists) msg = str(e) if self.query_scope.iframe().exists: msg += '; Maybe look in an iframe?' custom_attributes = [] if self.locator: custom_attributes = self.selector_builder.custom_attributes if custom_attributes: msg += '; Nerodia treated {!r} as a non-HTML compliant attribute, ' \ 'ensure that was intended'.format(custom_attributes) raise self._unknown_exception(msg) except StaleElementReferenceException: self.reset() self._check_condition(precondition, caller) return method() except ElementNotInteractableException: if (self.browser.timer.remaining_time <= 0) or \ (precondition not in [self.wait_for_present, self.wait_for_enabled, self.wait_for_writable]): self._raise_present() continue except NoSuchWindowException: raise NoMatchingWindowFoundException('browser window was closed') def __getattribute__(self, name): if search(SelectorBuilder.WILDCARD_ATTRIBUTE, name): return self.attribute_value(name.replace('_', '-')) else: return object.__getattribute__(self, name) def __getattr__(self, name): if name in (_[0] for _ in getmembers(UserEditable, predicate=isroutine)) and \ self.is_content_editable: self._content_editable = True setattr(self, name, six.create_bound_method( six.get_unbound_function(getattr(UserEditable, name)), self)) return getattr(self, name) else: raise AttributeError("Element '{}' has no attribute " "'{}'".format(self.__class__.__name__.capitalize(), name))
# Copyright 2008-2015 Nokia Solutions and Networks # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import os from robot.errors import (DataError, ExecutionFailed, ExecutionPassed, PassExecution, ReturnFromKeyword, UserKeywordExecutionFailed) from robot.variables import is_list_var from robot.output import LOGGER from robot import utils from .arguments import (ArgumentMapper, ArgumentResolver, EmbeddedArguments, UserKeywordArgumentParser) from .handlerstore import HandlerStore from .keywordrunner import KeywordRunner from .timeouts import KeywordTimeout from .usererrorhandler import UserErrorHandler class UserLibrary(object): def __init__(self, user_keywords, path=None): basename = os.path.basename(path) if path else None self.name = os.path.splitext(basename)[0] if path else None self.handlers = HandlerStore(basename) for kw in user_keywords: try: handler, embedded = self._create_handler(kw) self._validate_not_duplicate(handler) except DataError as err: LOGGER.error("Creating user keyword '%s' failed: %s" % (kw.name, unicode(err))) handler = UserErrorHandler(kw.name, unicode(err)) embedded = False self.handlers.add(handler, embedded) def _create_handler(self, kw): embedded = EmbeddedArguments(kw.name) if embedded: if kw.args: raise DataError('Keyword cannot have both normal and embedded ' 'arguments.') return EmbeddedArgsTemplate(kw, self.name, embedded), True return UserKeywordHandler(kw, self.name), False def _validate_not_duplicate(self, handler): if handler.name in self.handlers: self.handlers.remove(handler.name) raise DataError('Keyword with same name defined multiple times.') class UserKeywordHandler(object): type = 'user' def __init__(self, keyword, libname): self.name = keyword.name self.keywords = keyword.keywords.normal self.return_value = tuple(keyword.return_) self.teardown = keyword.keywords.teardown self.libname = libname self.doc = self._doc = unicode(keyword.doc) self.arguments = UserKeywordArgumentParser().parse(tuple(keyword.args), self.longname) self._timeout = keyword.timeout @property def longname(self): return '%s.%s' % (self.libname, self.name) if self.libname else self.name @property def shortdoc(self): return self.doc.splitlines()[0] if self.doc else '' def init_keyword(self, variables): # TODO: Should use runner and not change internal state like this. # Timeouts should also be cleaned up in general. self.doc = variables.replace_string(self._doc, ignore_errors=True) if self._timeout: self.timeout = KeywordTimeout(self._timeout.value, self._timeout.message, variables) else: self.timeout = KeywordTimeout() def run(self, context, arguments): context.start_user_keyword(self) try: return self._run(context, arguments) finally: context.end_user_keyword() def _run(self, context, arguments): if context.dry_run: return self._dry_run(context, arguments) return self._normal_run(context, arguments) def _dry_run(self, context, arguments): positional, kwargs = self._resolve_arguments(arguments) error, return_ = self._execute(context, positional, kwargs) if error: raise error return None def _normal_run(self, context, arguments): positional, kwargs = self._resolve_arguments(arguments, context.variables) error, return_ = self._execute(context, positional, kwargs) if error and not error.can_continue(context.in_teardown): raise error return_value = self._get_return_value(context.variables, return_) if error: error.return_value = return_value raise error return return_value def _resolve_arguments(self, arguments, variables=None): resolver = ArgumentResolver(self.arguments) mapper = ArgumentMapper(self.arguments) positional, named = resolver.resolve(arguments, variables) positional, kwargs = mapper.map(positional, named, variables) return positional, kwargs def _execute(self, context, positional, kwargs): self._set_variables(positional, kwargs, context.variables) context.output.trace(lambda: self._log_args(context.variables)) self._verify_keyword_is_valid() self.timeout.start() error = return_ = pass_ = None runner = KeywordRunner(context) try: runner.run_keywords(self.keywords) except ReturnFromKeyword as exception: return_ = exception error = exception.earlier_failures except ExecutionPassed as exception: pass_ = exception error = exception.earlier_failures except ExecutionFailed as exception: error = exception with context.keyword_teardown(error): td_error = self._run_teardown(context) if error or td_error: error = UserKeywordExecutionFailed(error, td_error) return error or pass_, return_ def _set_variables(self, positional, kwargs, variables): before_varargs, varargs = self._split_args_and_varargs(positional) for name, value in zip(self.arguments.positional, before_varargs): variables['${%s}' % name] = value if self.arguments.varargs: variables['@{%s}' % self.arguments.varargs] = varargs if self.arguments.kwargs: variables['&{%s}' % self.arguments.kwargs] = kwargs def _split_args_and_varargs(self, args): if not self.arguments.varargs: return args, [] positional = len(self.arguments.positional) return args[:positional], args[positional:] def _log_args(self, variables): args = ['${%s}' % arg for arg in self.arguments.positional] if self.arguments.varargs: args.append('@{%s}' % self.arguments.varargs) if self.arguments.kwargs: args.append('&{%s}' % self.arguments.kwargs) args = ['%s=%s' % (name, utils.prepr(variables[name])) for name in args] return 'Arguments: [ %s ]' % ' | '.join(args) def _run_teardown(self, context): if not self.teardown: return None try: name = context.variables.replace_string(self.teardown.name) except DataError as err: return ExecutionFailed(unicode(err), syntax=True) if name.upper() in ('', 'NONE'): return None runner = KeywordRunner(context) try: runner.run_keyword(self.teardown, name) except PassExecution: return None except ExecutionFailed as err: return err return None def _verify_keyword_is_valid(self): if not (self.keywords or self.return_value): raise DataError("User keyword '%s' contains no keywords." % self.name) def _get_return_value(self, variables, return_): ret = self.return_value if not return_ else return_.return_value if not ret: return None contains_list_var = any(is_list_var(item) for item in ret) try: ret = variables.replace_list(ret) except DataError as err: raise DataError('Replacing variables from keyword return value ' 'failed: %s' % unicode(err)) if len(ret) != 1 or contains_list_var: return ret return ret[0] class EmbeddedArgsTemplate(UserKeywordHandler): def __init__(self, keyword, libname, embedded): UserKeywordHandler.__init__(self, keyword, libname) self.keyword = keyword self.embedded_name = embedded.name self.embedded_args = embedded.args def matches(self, name): return self.embedded_name.match(name) is not None def create(self, name): return EmbeddedArgs(name, self) class EmbeddedArgs(UserKeywordHandler): def __init__(self, name, template): match = template.embedded_name.match(name) if not match: raise ValueError('Does not match given name') UserKeywordHandler.__init__(self, template.keyword, template.libname) self.embedded_args = zip(template.embedded_args, match.groups()) self.name = name self.orig_name = template.name def _run(self, context, args): if not context.dry_run: variables = context.variables self._resolve_arguments(args, variables) # validates no args given for name, value in self.embedded_args: variables['${%s}' % name] = variables.replace_scalar(value) return UserKeywordHandler._run(self, context, args)
""" Python Interchangeable Virtual Instrument Library Copyright (c) 2012-2017 Alex Forencich Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. """ import math from .. import ivi from .. import dmm from . import common MeasurementFunctionMapping = { 'dc_volts': 'volt', 'ac_volts': 'volt:ac', 'dc_current': 'curr', 'ac_current': 'curr:ac', 'two_wire_resistance': 'res', 'four_wire_resistance': 'fres', 'frequency': 'freq', 'period': 'per', 'temperature': 'temp', 'capacitance': 'cap', 'continuity': 'cont', 'diode': 'diod'} MeasurementRangeMapping = { 'dc_volts': 'volt:dc:range', 'ac_volts': 'volt:ac:range', 'dc_current': 'curr:dc:range', 'ac_current': 'curr:ac:range', 'two_wire_resistance': 'res:range', 'four_wire_resistance': 'fres:range', 'frequency': 'freq:range:lower', 'period': 'per:range:lower', 'capacitance': 'cap:range'} MeasurementAutoRangeMapping = { 'dc_volts': 'volt:dc:range:auto', 'ac_volts': 'volt:ac:range:auto', 'dc_current': 'curr:dc:range:auto', 'ac_current': 'curr:ac:range:auto', 'two_wire_resistance': 'res:range:auto', 'four_wire_resistance': 'fres:range:auto', 'capacitance': 'cap:range:auto'} MeasurementResolutionMapping = { 'dc_volts': 'volt:dc:resolution', 'ac_volts': 'volt:ac:resolution', 'dc_current': 'curr:dc:resolution', 'ac_current': 'curr:ac:resolution', 'two_wire_resistance': 'res:resolution', 'four_wire_resistance': 'fres:resolution'} TriggerSourceMapping = { 'bus': 'bus', 'external': 'ext', 'immediate': 'imm'} class Base(common.IdnCommand, common.ErrorQuery, common.Reset, common.SelfTest, ivi.Driver, dmm.Base): "Generic SCPI IVI DMM driver" def __init__(self, *args, **kwargs): self.__dict__.setdefault('_instrument_id', '') # early define of _do_scpi_init self.__dict__.setdefault('_do_scpi_init', True) super(Base, self).__init__(*args, **kwargs) self._self_test_delay = 40 self._identity_description = "Generic SCPI IVI DMM driver" self._identity_identifier = "" self._identity_revision = "" self._identity_vendor = "" self._identity_instrument_manufacturer = "" self._identity_instrument_model = "" self._identity_instrument_firmware_revision = "" self._identity_specification_major_version = 4 self._identity_specification_minor_version = 1 self._identity_supported_instrument_models = ['DMM'] def _initialize(self, resource = None, id_query = False, reset = False, **keywargs): "Opens an I/O session to the instrument." super(Base, self)._initialize(resource, id_query, reset, **keywargs) # interface clear if not self._driver_operation_simulate: self._clear() # check ID if id_query and not self._driver_operation_simulate: id = self.identity.instrument_model id_check = self._instrument_id id_short = id[:len(id_check)] if id_short != id_check: raise Exception("Instrument ID mismatch, expecting %s, got %s", id_check, id_short) # reset if reset: self.utility.reset() def _utility_disable(self): pass def _utility_lock_object(self): pass def _utility_unlock_object(self): pass def _get_measurement_function(self): if not self._driver_operation_simulate and not self._get_cache_valid(): value = self._ask(":sense:function?").lower().strip('"') value = [k for k,v in MeasurementFunctionMapping.items() if v==value][0] self._measurement_function = value self._set_cache_valid() return self._measurement_function def _set_measurement_function(self, value): if value not in MeasurementFunctionMapping: raise ivi.ValueNotSupportedException() if not self._driver_operation_simulate: self._write(":sense:function '%s'" % MeasurementFunctionMapping[value]) self._measurement_function = value self._set_cache_valid() self._set_cache_valid(False, 'range') self._set_cache_valid(False, 'auto_range') self._set_cache_valid(False, 'resolution') def _get_range(self): if not self._driver_operation_simulate and not self._get_cache_valid(): func = self._get_measurement_function() if func in MeasurementRangeMapping: cmd = MeasurementRangeMapping[func] value = float(self._ask("%s?" % (cmd))) self._range = value self._set_cache_valid() return self._range def _set_range(self, value): value = float(value) # round up to even power of 10 value = math.pow(10, math.ceil(math.log10(value))) if not self._driver_operation_simulate: func = self._get_measurement_function() if func in MeasurementRangeMapping: cmd = MeasurementRangeMapping[func] self._write("%s %g" % (cmd, value)) self._range = value self._set_cache_valid() def _get_auto_range(self): if not self._driver_operation_simulate and not self._get_cache_valid(): func = self._get_measurement_function() if func in MeasurementAutoRangeMapping: cmd = MeasurementAutoRangeMapping[func] value = int(self._ask("%s?" % (cmd))) if value == 0: value = 'off' elif value == 1: value = 'on' self._auto_range = value self._set_cache_valid() return self._auto_range def _set_auto_range(self, value): if value not in dmm.Auto2: raise ivi.ValueNotSupportedException() if not self._driver_operation_simulate: func = self._get_measurement_function() if func in MeasurementAutoRangeMapping: cmd = MeasurementAutoRangeMapping[func] self._write("%s %d" % (cmd, int(value == 'on'))) self._auto_range = value self._set_cache_valid() def _get_resolution(self): if not self._driver_operation_simulate and not self._get_cache_valid(): func = self._get_measurement_function() if func in MeasurementResolutionMapping: cmd = MeasurementResolutionMapping[func] value = float(self._ask("%s?" % (cmd))) self._resolution = value self._set_cache_valid() return self._resolution def _set_resolution(self, value): value = float(value) # round up to even power of 10 value = math.pow(10, math.ceil(math.log10(value))) if not self._driver_operation_simulate: func = self._get_measurement_function() if func in MeasurementResolutionMapping: cmd = MeasurementResolutionMapping[func] self._write("%s %g" % (cmd, value)) self._resolution = value self._set_cache_valid() def _get_trigger_delay(self): if not self._driver_operation_simulate and not self._get_cache_valid(): value = float(self._ask("trigger:delay?")) self._trigger_delay = value self._set_cache_valid() return self._trigger_delay def _set_trigger_delay(self, value): value = float(value) if not self._driver_operation_simulate: self._write('trigger:delay %g' % value) self._trigger_delay = value self._set_cache_valid() def _get_trigger_delay_auto(self): if not self._driver_operation_simulate and not self._get_cache_valid(): value = bool(int(self._ask("trigger:delay:auto?"))) self._trigger_delay_auto = value self._set_cache_valid() return self._trigger_delay_auto def _set_trigger_delay_auto(self, value): value = bool(value) if not self._driver_operation_simulate: self._write('trigger:delay:auto %d' % int(value)) self._trigger_delay_auto = value self._set_cache_valid() def _get_trigger_source(self): if not self._driver_operation_simulate and not self._get_cache_valid(): value = self._ask("trigger:source?").lower() value = [k for k,v in TriggerSourceMapping.items() if v==value][0] self._trigger_source = value self._set_cache_valid() return self._trigger_source def _set_trigger_source(self, value): if value not in TriggerSourceMapping: raise ivi.ValueNotSupportedException() if not self._driver_operation_simulate: self._write(":trigger:source %s" % TriggerSourceMapping[value]) self._trigger_source = value def _measurement_abort(self): if not self._driver_operation_simulate: self._write(":abort") def _measurement_fetch(self, max_time): if not self._driver_operation_simulate: return float(self._ask(":fetch?")) return 0.0 def _measurement_initiate(self): if not self._driver_operation_simulate: self._write(":initiate") def _measurement_is_out_of_range(self, value): return self._measurement_is_over_range(value) or self._measurement_is_under_range(value) def _measurement_is_over_range(self, value): return value == 9.9e+37 def _measurement_is_under_range(self, value): return value == -9.9e+37 def _measurement_read(self, max_time): if not self._driver_operation_simulate: return float(self._ask(":read?")) return 0.0 class MultiPoint(dmm.MultiPoint): "Extension IVI methods for DMMs capable of acquiring measurements based on multiple triggers" def _get_trigger_measurement_complete_destination(self): return self._trigger_measurement_complete_destination def _set_trigger_measurement_complete_destination(self, value): value = str(value) self._trigger_measurement_complete_destination = value def _get_trigger_multi_point_sample_count(self): if not self._driver_operation_simulate and not self._get_cache_valid(): value = int(self._ask("sample:count?")) self._trigger_multi_point_sample_count = value self._set_cache_valid() return self._trigger_multi_point_sample_count def _set_trigger_multi_point_sample_count(self, value): value = int(value) if not self._driver_operation_simulate: self._write("sample:count %d" % value) self._trigger_multi_point_sample_count = value self._set_cache_valid() def _get_trigger_multi_point_sample_interval(self): return self._trigger_multi_point_sample_interval def _set_trigger_multi_point_sample_interval(self, value): value = int(value) self._trigger_multi_point_sample_interval = value def _get_trigger_multi_point_sample_trigger(self): return self._trigger_multi_point_sample_trigger def _set_trigger_multi_point_sample_trigger(self, value): value = str(value) self._trigger_multi_point_sample_trigger = value def _get_trigger_multi_point_count(self): if not self._driver_operation_simulate and not self._get_cache_valid(): value = self._ask("trigger:count?") if float(value) >= 9.9e37: value = float('inf') else: value = int(float(value)) self._trigger_multi_point_count = value self._set_cache_valid() return self._trigger_multi_point_count def _set_trigger_multi_point_count(self, value): if float(value) >= 9.9e37 or float(value) == float('inf'): value = float('inf') else: value = int(value) if not self._driver_operation_simulate: if value == float('inf'): self._write("trigger:count inf") else: self._write("trigger:count %d" % value) self._trigger_multi_point_count = value self._set_cache_valid() def _measurement_fetch_multi_point(self, max_time, num_of_measurements = 0): if not self._driver_operation_simulate: return self._ask_for_values(":fetch?", array=False) return [0.0 for i in range(self._trigger_multi_point_count*self._trigger_multi_point_sample_count)] def _measurement_read_multi_point(self, max_time, num_of_measurements = 0): if not self._driver_operation_simulate: return self._ask_for_values(":read?", array=False) return [0.0 for i in range(self._trigger_multi_point_count*self._trigger_multi_point_sample_count)] class SoftwareTrigger(dmm.SoftwareTrigger): "Extension IVI methods for DMMs that can initiate a measurement based on a software trigger signal" def _send_software_trigger(self): if not self._driver_operation_simulate: self._write("*trg")
#!/usr/bin/env python # # Copyright (c) 2016-2020 Intel Corporation # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from __future__ import print_function import multiprocessing.pool import ctypes import atexit import sys import os from .api import * from .api import __all__ as api__all from .pool import * from .pool import __all__ as pool__all __all__ = ["Monkey", "is_active"] + api__all + pool__all __doc__ = """ Python API for Intel(R) Threading Building Blocks (Intel(R) TBB) extended with standard Python's pools implementation and monkey-patching. Command-line interface example: $ python -m tbb $your_script.py Runs your_script.py in context of tbb.Monkey """ is_active = False """ Indicates whether TBB context is activated """ ipc_enabled = False """ Indicates whether IPC mode is enabled """ libirml = "libirml.so.1" def _test(arg=None): """Some tests""" import platform if platform.system() == "Linux": ctypes.CDLL(libirml) assert 256 == os.system("ldd "+_api.__file__+"| grep -E 'libimf|libsvml|libintlc'") from .test import test test(arg) print("done") def tbb_process_pool_worker27(inqueue, outqueue, initializer=None, initargs=(), maxtasks=None): from multiprocessing.pool import worker worker(inqueue, outqueue, initializer, initargs, maxtasks) if ipc_enabled: try: librml = ctypes.CDLL(libirml) librml.release_resources() except: print("Warning: Can not load ", libirml, file=sys.stderr) class TBBProcessPool27(multiprocessing.pool.Pool): def _repopulate_pool(self): """Bring the number of pool processes up to the specified number, for use after reaping workers which have exited. """ from multiprocessing.util import debug for i in range(self._processes - len(self._pool)): w = self.Process(target=tbb_process_pool_worker27, args=(self._inqueue, self._outqueue, self._initializer, self._initargs, self._maxtasksperchild) ) self._pool.append(w) w.name = w.name.replace('Process', 'PoolWorker') w.daemon = True w.start() debug('added worker') def __del__(self): self.close() for p in self._pool: p.join() def __exit__(self, *args): self.close() for p in self._pool: p.join() def tbb_process_pool_worker3(inqueue, outqueue, initializer=None, initargs=(), maxtasks=None, wrap_exception=False): from multiprocessing.pool import worker worker(inqueue, outqueue, initializer, initargs, maxtasks, wrap_exception) if ipc_enabled: try: librml = ctypes.CDLL(libirml) librml.release_resources() except: print("Warning: Can not load ", libirml, file=sys.stderr) class TBBProcessPool3(multiprocessing.pool.Pool): def _repopulate_pool(self): """Bring the number of pool processes up to the specified number, for use after reaping workers which have exited. """ from multiprocessing.util import debug for i in range(self._processes - len(self._pool)): w = self.Process(target=tbb_process_pool_worker3, args=(self._inqueue, self._outqueue, self._initializer, self._initargs, self._maxtasksperchild, self._wrap_exception) ) self._pool.append(w) w.name = w.name.replace('Process', 'PoolWorker') w.daemon = True w.start() debug('added worker') def __del__(self): self.close() for p in self._pool: p.join() def __exit__(self, *args): self.close() for p in self._pool: p.join() class Monkey: """ Context manager which replaces standard multiprocessing.pool implementations with tbb.pool using monkey-patching. It also enables TBB threading for Intel(R) Math Kernel Library (Intel(R) MKL). For example: with tbb.Monkey(): run_my_numpy_code() It allows multiple parallel tasks to be executed on the same thread pool and coordinate number of threads across multiple processes thus avoiding overheads from oversubscription. """ _items = {} _modules = {} def __init__(self, max_num_threads=None, benchmark=False): """ Create context manager for running under TBB scheduler. :param max_num_threads: if specified, limits maximal number of threads :param benchmark: if specified, blocks in initialization until requested number of threads are ready """ if max_num_threads: self.ctl = global_control(global_control.max_allowed_parallelism, int(max_num_threads)) if benchmark: if not max_num_threads: max_num_threads = default_num_threads() from .api import _concurrency_barrier _concurrency_barrier(int(max_num_threads)) def _patch(self, class_name, module_name, obj): m = self._modules[class_name] = __import__(module_name, globals(), locals(), [class_name]) if m == None: return oldattr = getattr(m, class_name, None) if oldattr == None: self._modules[class_name] = None return self._items[class_name] = oldattr setattr(m, class_name, obj) def __enter__(self): global is_active assert is_active == False, "tbb.Monkey does not support nesting yet" is_active = True self.env_mkl = os.getenv('MKL_THREADING_LAYER') os.environ['MKL_THREADING_LAYER'] = 'TBB' self.env_numba = os.getenv('NUMBA_THREADING_LAYER') os.environ['NUMBA_THREADING_LAYER'] = 'TBB' if ipc_enabled: if sys.version_info.major == 2 and sys.version_info.minor >= 7: self._patch("Pool", "multiprocessing.pool", TBBProcessPool27) elif sys.version_info.major == 3 and sys.version_info.minor >= 5: self._patch("Pool", "multiprocessing.pool", TBBProcessPool3) self._patch("ThreadPool", "multiprocessing.pool", Pool) return self def __exit__(self, exc_type, exc_value, traceback): global is_active assert is_active == True, "modified?" is_active = False if self.env_mkl is None: del os.environ['MKL_THREADING_LAYER'] else: os.environ['MKL_THREADING_LAYER'] = self.env_mkl if self.env_numba is None: del os.environ['NUMBA_THREADING_LAYER'] else: os.environ['NUMBA_THREADING_LAYER'] = self.env_numba for name in self._items.keys(): setattr(self._modules[name], name, self._items[name]) def init_sem_name(): try: librml = ctypes.CDLL(libirml) librml.set_active_sem_name() librml.set_stop_sem_name() except Exception as e: print("Warning: Can not initialize name of shared semaphores:", e, file=sys.stderr) def tbb_atexit(): if ipc_enabled: try: librml = ctypes.CDLL(libirml) librml.release_semaphores() except: print("Warning: Can not release shared semaphores", file=sys.stderr) def _main(): # Run the module specified as the next command line argument # python -m TBB user_app.py global ipc_enabled import platform import argparse parser = argparse.ArgumentParser(prog="python -m tbb", description=""" Run your Python script in context of tbb.Monkey, which replaces standard Python pools and threading layer of Intel(R) Math Kernel Library by implementation based on Intel(R) Threading Building Blocks. It enables multiple parallel tasks to be executed on the same thread pool and coordinate number of threads across multiple processes thus avoiding overheads from oversubscription. """, formatter_class=argparse.ArgumentDefaultsHelpFormatter) if platform.system() == "Linux": parser.add_argument('--ipc', action='store_true', help="Enable inter-process (IPC) coordination between Intel TBB schedulers") parser.add_argument('-a', '--allocator', action='store_true', help="Enable Intel TBB scalable allocator as a replacement for standard memory allocator") parser.add_argument('--allocator-huge-pages', action='store_true', help="Enable huge pages for Intel TBB allocator (implies: -a)") parser.add_argument('-p', '--max-num-threads', default=default_num_threads(), type=int, help="Initialize Intel TBB with P max number of threads per process", metavar='P') parser.add_argument('-b', '--benchmark', action='store_true', help="Block Intel TBB initialization until all the threads are created before continue the script. " "This is necessary for performance benchmarks that want to exclude lazy scheduler initialization effects from the measurements") parser.add_argument('-v', '--verbose', action='store_true', help="Request verbose and version information") parser.add_argument('-m', action='store_true', dest='module', help="Executes following as a module") parser.add_argument('name', help="Script or module name") parser.add_argument('args', nargs=argparse.REMAINDER, help="Command line arguments") args = parser.parse_args() if args.verbose: os.environ["TBB_VERSION"] = "1" if platform.system() == "Linux": if args.allocator_huge_pages: args.allocator = True if args.allocator and not os.environ.get("_TBB_MALLOC_PRELOAD"): libtbbmalloc_lib = 'libtbbmalloc_proxy.so.2' ld_preload = 'LD_PRELOAD' os.environ["_TBB_MALLOC_PRELOAD"] = "1" preload_list = filter(None, os.environ.get(ld_preload, "").split(':')) if libtbbmalloc_lib in preload_list: print('Info:', ld_preload, "contains", libtbbmalloc_lib, "already\n") else: os.environ[ld_preload] = ':'.join([libtbbmalloc_lib] + list(preload_list)) if args.allocator_huge_pages: assert platform.system() == "Linux" try: with open('/proc/sys/vm/nr_hugepages', 'r') as f: pages = int(f.read()) if pages == 0: print("TBB: Pre-allocated huge pages are not currently reserved in the system. To reserve, run e.g.:\n" "\tsudo sh -c 'echo 2000 > /proc/sys/vm/nr_hugepages'") os.environ["TBB_MALLOC_USE_HUGE_PAGES"] = "1" except: print("TBB: Failed to read number of pages from /proc/sys/vm/nr_hugepages\n" "\tIs the Linux kernel configured with the huge pages feature?") sys.exit(1) os.execl(sys.executable, sys.executable, '-m', 'tbb', *sys.argv[1:]) assert False, "Re-execution failed" sys.argv = [args.name] + args.args ipc_enabled = platform.system() == "Linux" and args.ipc os.environ["IPC_ENABLE"] = "1" if ipc_enabled else "0" if ipc_enabled: atexit.register(tbb_atexit) init_sem_name() if not os.environ.get("KMP_BLOCKTIME"): # TODO move os.environ["KMP_BLOCKTIME"] = "0" if '_' + args.name in globals(): return globals()['_' + args.name](*args.args) else: import runpy runf = runpy.run_module if args.module else runpy.run_path with Monkey(max_num_threads=args.max_num_threads, benchmark=args.benchmark): runf(args.name, run_name='__main__')
# coding=utf-8 # -------------------------------------------------------------------------- # Copyright (c) Microsoft Corporation. All rights reserved. # Licensed under the MIT License. See License.txt in the project root for # license information. # # Code generated by Microsoft (R) AutoRest Code Generator. # Changes may cause incorrect behavior and will be lost if the code is # regenerated. # -------------------------------------------------------------------------- from msrest.pipeline import ClientRawResponse from .. import models class HttpClientFailure(object): """HttpClientFailure operations. :param client: Client for service requests. :param config: Configuration of service client. :param serializer: An object model serializer. :param deserializer: An objec model deserializer. """ def __init__(self, client, config, serializer, deserializer): self._client = client self._serialize = serializer self._deserialize = deserializer self.config = config def head400( self, custom_headers=None, raw=False, **operation_config): """ Return 400 status code - should be represented in the client as an error :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`Error <fixtures.acceptancetestshttp.models.Error>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true """ # Construct URL url = '/http/failure/client/400' # Construct parameters query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if custom_headers: header_parameters.update(custom_headers) # Construct and send request request = self._client.head(url, query_parameters) response = self._client.send(request, header_parameters, **operation_config) if response.status_code < 200 or response.status_code >= 300: raise models.ErrorException(self._deserialize, response) if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response def get400( self, custom_headers=None, raw=False, **operation_config): """ Return 400 status code - should be represented in the client as an error :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`Error <fixtures.acceptancetestshttp.models.Error>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true """ # Construct URL url = '/http/failure/client/400' # Construct parameters query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if custom_headers: header_parameters.update(custom_headers) # Construct and send request request = self._client.get(url, query_parameters) response = self._client.send(request, header_parameters, **operation_config) if response.status_code < 200 or response.status_code >= 300: raise models.ErrorException(self._deserialize, response) if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response def put400( self, boolean_value=None, custom_headers=None, raw=False, **operation_config): """ Return 400 status code - should be represented in the client as an error :param boolean_value: Simple boolean value true :type boolean_value: bool :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`Error <fixtures.acceptancetestshttp.models.Error>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true """ # Construct URL url = '/http/failure/client/400' # Construct parameters query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if custom_headers: header_parameters.update(custom_headers) # Construct body if boolean_value is not None: body_content = self._serialize.body(boolean_value, 'bool') else: body_content = None # Construct and send request request = self._client.put(url, query_parameters) response = self._client.send( request, header_parameters, body_content, **operation_config) if response.status_code < 200 or response.status_code >= 300: raise models.ErrorException(self._deserialize, response) if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response def patch400( self, boolean_value=None, custom_headers=None, raw=False, **operation_config): """ Return 400 status code - should be represented in the client as an error :param boolean_value: Simple boolean value true :type boolean_value: bool :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`Error <fixtures.acceptancetestshttp.models.Error>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true """ # Construct URL url = '/http/failure/client/400' # Construct parameters query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if custom_headers: header_parameters.update(custom_headers) # Construct body if boolean_value is not None: body_content = self._serialize.body(boolean_value, 'bool') else: body_content = None # Construct and send request request = self._client.patch(url, query_parameters) response = self._client.send( request, header_parameters, body_content, **operation_config) if response.status_code < 200 or response.status_code >= 300: raise models.ErrorException(self._deserialize, response) if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response def post400( self, boolean_value=None, custom_headers=None, raw=False, **operation_config): """ Return 400 status code - should be represented in the client as an error :param boolean_value: Simple boolean value true :type boolean_value: bool :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`Error <fixtures.acceptancetestshttp.models.Error>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true """ # Construct URL url = '/http/failure/client/400' # Construct parameters query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if custom_headers: header_parameters.update(custom_headers) # Construct body if boolean_value is not None: body_content = self._serialize.body(boolean_value, 'bool') else: body_content = None # Construct and send request request = self._client.post(url, query_parameters) response = self._client.send( request, header_parameters, body_content, **operation_config) if response.status_code < 200 or response.status_code >= 300: raise models.ErrorException(self._deserialize, response) if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response def delete400( self, boolean_value=None, custom_headers=None, raw=False, **operation_config): """ Return 400 status code - should be represented in the client as an error :param boolean_value: Simple boolean value true :type boolean_value: bool :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`Error <fixtures.acceptancetestshttp.models.Error>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true """ # Construct URL url = '/http/failure/client/400' # Construct parameters query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if custom_headers: header_parameters.update(custom_headers) # Construct body if boolean_value is not None: body_content = self._serialize.body(boolean_value, 'bool') else: body_content = None # Construct and send request request = self._client.delete(url, query_parameters) response = self._client.send( request, header_parameters, body_content, **operation_config) if response.status_code < 200 or response.status_code >= 300: raise models.ErrorException(self._deserialize, response) if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response def head401( self, custom_headers=None, raw=False, **operation_config): """ Return 401 status code - should be represented in the client as an error :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`Error <fixtures.acceptancetestshttp.models.Error>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true """ # Construct URL url = '/http/failure/client/401' # Construct parameters query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if custom_headers: header_parameters.update(custom_headers) # Construct and send request request = self._client.head(url, query_parameters) response = self._client.send(request, header_parameters, **operation_config) if response.status_code < 200 or response.status_code >= 300: raise models.ErrorException(self._deserialize, response) if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response def get402( self, custom_headers=None, raw=False, **operation_config): """ Return 402 status code - should be represented in the client as an error :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`Error <fixtures.acceptancetestshttp.models.Error>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true """ # Construct URL url = '/http/failure/client/402' # Construct parameters query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if custom_headers: header_parameters.update(custom_headers) # Construct and send request request = self._client.get(url, query_parameters) response = self._client.send(request, header_parameters, **operation_config) if response.status_code < 200 or response.status_code >= 300: raise models.ErrorException(self._deserialize, response) if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response def get403( self, custom_headers=None, raw=False, **operation_config): """ Return 403 status code - should be represented in the client as an error :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`Error <fixtures.acceptancetestshttp.models.Error>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true """ # Construct URL url = '/http/failure/client/403' # Construct parameters query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if custom_headers: header_parameters.update(custom_headers) # Construct and send request request = self._client.get(url, query_parameters) response = self._client.send(request, header_parameters, **operation_config) if response.status_code < 200 or response.status_code >= 300: raise models.ErrorException(self._deserialize, response) if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response def put404( self, boolean_value=None, custom_headers=None, raw=False, **operation_config): """ Return 404 status code - should be represented in the client as an error :param boolean_value: Simple boolean value true :type boolean_value: bool :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`Error <fixtures.acceptancetestshttp.models.Error>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true """ # Construct URL url = '/http/failure/client/404' # Construct parameters query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if custom_headers: header_parameters.update(custom_headers) # Construct body if boolean_value is not None: body_content = self._serialize.body(boolean_value, 'bool') else: body_content = None # Construct and send request request = self._client.put(url, query_parameters) response = self._client.send( request, header_parameters, body_content, **operation_config) if response.status_code < 200 or response.status_code >= 300: raise models.ErrorException(self._deserialize, response) if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response def patch405( self, boolean_value=None, custom_headers=None, raw=False, **operation_config): """ Return 405 status code - should be represented in the client as an error :param boolean_value: Simple boolean value true :type boolean_value: bool :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`Error <fixtures.acceptancetestshttp.models.Error>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true """ # Construct URL url = '/http/failure/client/405' # Construct parameters query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if custom_headers: header_parameters.update(custom_headers) # Construct body if boolean_value is not None: body_content = self._serialize.body(boolean_value, 'bool') else: body_content = None # Construct and send request request = self._client.patch(url, query_parameters) response = self._client.send( request, header_parameters, body_content, **operation_config) if response.status_code < 200 or response.status_code >= 300: raise models.ErrorException(self._deserialize, response) if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response def post406( self, boolean_value=None, custom_headers=None, raw=False, **operation_config): """ Return 406 status code - should be represented in the client as an error :param boolean_value: Simple boolean value true :type boolean_value: bool :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`Error <fixtures.acceptancetestshttp.models.Error>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true """ # Construct URL url = '/http/failure/client/406' # Construct parameters query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if custom_headers: header_parameters.update(custom_headers) # Construct body if boolean_value is not None: body_content = self._serialize.body(boolean_value, 'bool') else: body_content = None # Construct and send request request = self._client.post(url, query_parameters) response = self._client.send( request, header_parameters, body_content, **operation_config) if response.status_code < 200 or response.status_code >= 300: raise models.ErrorException(self._deserialize, response) if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response def delete407( self, boolean_value=None, custom_headers=None, raw=False, **operation_config): """ Return 407 status code - should be represented in the client as an error :param boolean_value: Simple boolean value true :type boolean_value: bool :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`Error <fixtures.acceptancetestshttp.models.Error>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true """ # Construct URL url = '/http/failure/client/407' # Construct parameters query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if custom_headers: header_parameters.update(custom_headers) # Construct body if boolean_value is not None: body_content = self._serialize.body(boolean_value, 'bool') else: body_content = None # Construct and send request request = self._client.delete(url, query_parameters) response = self._client.send( request, header_parameters, body_content, **operation_config) if response.status_code < 200 or response.status_code >= 300: raise models.ErrorException(self._deserialize, response) if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response def put409( self, boolean_value=None, custom_headers=None, raw=False, **operation_config): """ Return 409 status code - should be represented in the client as an error :param boolean_value: Simple boolean value true :type boolean_value: bool :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`Error <fixtures.acceptancetestshttp.models.Error>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true """ # Construct URL url = '/http/failure/client/409' # Construct parameters query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if custom_headers: header_parameters.update(custom_headers) # Construct body if boolean_value is not None: body_content = self._serialize.body(boolean_value, 'bool') else: body_content = None # Construct and send request request = self._client.put(url, query_parameters) response = self._client.send( request, header_parameters, body_content, **operation_config) if response.status_code < 200 or response.status_code >= 300: raise models.ErrorException(self._deserialize, response) if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response def head410( self, custom_headers=None, raw=False, **operation_config): """ Return 410 status code - should be represented in the client as an error :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`Error <fixtures.acceptancetestshttp.models.Error>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true """ # Construct URL url = '/http/failure/client/410' # Construct parameters query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if custom_headers: header_parameters.update(custom_headers) # Construct and send request request = self._client.head(url, query_parameters) response = self._client.send(request, header_parameters, **operation_config) if response.status_code < 200 or response.status_code >= 300: raise models.ErrorException(self._deserialize, response) if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response def get411( self, custom_headers=None, raw=False, **operation_config): """ Return 411 status code - should be represented in the client as an error :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`Error <fixtures.acceptancetestshttp.models.Error>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true """ # Construct URL url = '/http/failure/client/411' # Construct parameters query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if custom_headers: header_parameters.update(custom_headers) # Construct and send request request = self._client.get(url, query_parameters) response = self._client.send(request, header_parameters, **operation_config) if response.status_code < 200 or response.status_code >= 300: raise models.ErrorException(self._deserialize, response) if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response def get412( self, custom_headers=None, raw=False, **operation_config): """ Return 412 status code - should be represented in the client as an error :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`Error <fixtures.acceptancetestshttp.models.Error>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true """ # Construct URL url = '/http/failure/client/412' # Construct parameters query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if custom_headers: header_parameters.update(custom_headers) # Construct and send request request = self._client.get(url, query_parameters) response = self._client.send(request, header_parameters, **operation_config) if response.status_code < 200 or response.status_code >= 300: raise models.ErrorException(self._deserialize, response) if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response def put413( self, boolean_value=None, custom_headers=None, raw=False, **operation_config): """ Return 413 status code - should be represented in the client as an error :param boolean_value: Simple boolean value true :type boolean_value: bool :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`Error <fixtures.acceptancetestshttp.models.Error>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true """ # Construct URL url = '/http/failure/client/413' # Construct parameters query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if custom_headers: header_parameters.update(custom_headers) # Construct body if boolean_value is not None: body_content = self._serialize.body(boolean_value, 'bool') else: body_content = None # Construct and send request request = self._client.put(url, query_parameters) response = self._client.send( request, header_parameters, body_content, **operation_config) if response.status_code < 200 or response.status_code >= 300: raise models.ErrorException(self._deserialize, response) if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response def patch414( self, boolean_value=None, custom_headers=None, raw=False, **operation_config): """ Return 414 status code - should be represented in the client as an error :param boolean_value: Simple boolean value true :type boolean_value: bool :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`Error <fixtures.acceptancetestshttp.models.Error>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true """ # Construct URL url = '/http/failure/client/414' # Construct parameters query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if custom_headers: header_parameters.update(custom_headers) # Construct body if boolean_value is not None: body_content = self._serialize.body(boolean_value, 'bool') else: body_content = None # Construct and send request request = self._client.patch(url, query_parameters) response = self._client.send( request, header_parameters, body_content, **operation_config) if response.status_code < 200 or response.status_code >= 300: raise models.ErrorException(self._deserialize, response) if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response def post415( self, boolean_value=None, custom_headers=None, raw=False, **operation_config): """ Return 415 status code - should be represented in the client as an error :param boolean_value: Simple boolean value true :type boolean_value: bool :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`Error <fixtures.acceptancetestshttp.models.Error>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true """ # Construct URL url = '/http/failure/client/415' # Construct parameters query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if custom_headers: header_parameters.update(custom_headers) # Construct body if boolean_value is not None: body_content = self._serialize.body(boolean_value, 'bool') else: body_content = None # Construct and send request request = self._client.post(url, query_parameters) response = self._client.send( request, header_parameters, body_content, **operation_config) if response.status_code < 200 or response.status_code >= 300: raise models.ErrorException(self._deserialize, response) if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response def get416( self, custom_headers=None, raw=False, **operation_config): """ Return 416 status code - should be represented in the client as an error :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`Error <fixtures.acceptancetestshttp.models.Error>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true """ # Construct URL url = '/http/failure/client/416' # Construct parameters query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if custom_headers: header_parameters.update(custom_headers) # Construct and send request request = self._client.get(url, query_parameters) response = self._client.send(request, header_parameters, **operation_config) if response.status_code < 200 or response.status_code >= 300: raise models.ErrorException(self._deserialize, response) if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response def delete417( self, boolean_value=None, custom_headers=None, raw=False, **operation_config): """ Return 417 status code - should be represented in the client as an error :param boolean_value: Simple boolean value true :type boolean_value: bool :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`Error <fixtures.acceptancetestshttp.models.Error>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true """ # Construct URL url = '/http/failure/client/417' # Construct parameters query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if custom_headers: header_parameters.update(custom_headers) # Construct body if boolean_value is not None: body_content = self._serialize.body(boolean_value, 'bool') else: body_content = None # Construct and send request request = self._client.delete(url, query_parameters) response = self._client.send( request, header_parameters, body_content, **operation_config) if response.status_code < 200 or response.status_code >= 300: raise models.ErrorException(self._deserialize, response) if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response def head429( self, custom_headers=None, raw=False, **operation_config): """ Return 429 status code - should be represented in the client as an error :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`Error <fixtures.acceptancetestshttp.models.Error>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true """ # Construct URL url = '/http/failure/client/429' # Construct parameters query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if custom_headers: header_parameters.update(custom_headers) # Construct and send request request = self._client.head(url, query_parameters) response = self._client.send(request, header_parameters, **operation_config) if response.status_code < 200 or response.status_code >= 300: raise models.ErrorException(self._deserialize, response) if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response
import sys from ..format import Layout from .core import HTMLRuleBuilder, HTMLNode, make_joiner from ..rulesets import basic html_boxy = Layout() html_boxy.layout = dict( # Note: the classes "scalar", "sequence" and "empty" are added by # rules in descr.ruleset.basic, so make sure to include that # ruleset if you want to make your own layout with rules based on # these classes. # When the layout is applied, we add the rulesets open + close, so # that rules can be added to open without overriding those in # close. For instance classes meant for highlighting will be in # close so that they get priority over all the others. open = basic + HTMLRuleBuilder( # Note: a class declaration like ".toplevel" will be # inserted before every selector below, so that the rules' # effect cannot "leak" outside of what we are displaying. So # in effect, "" -> ".toplevel", ".{@str} > span" -> # ".toplevel .{@str} > span", and so on. # The following will therefore match the top level span: ("", {"display": "block"}), # And this will match all spans inside that: ("span", {"display": "inline-block", "vertical-align": "middle", "font-family": "monospace"}), # For text. (".{text} *", {"display": "inline"}), (".{pre} *", {"display": "inline", "white-space": "pre" }), # scalar = @str, @int, @True, @False, ... (".{scalar}", {"white-space": "pre", "padding": "3px", "margin": "3px", "max-height": "300px", "overflow": "auto" }), # we add a double quote "" before an empty string (".{empty}.{@str}::before", {"content": '"\\"\\""'}), (".{sequence}", {"padding": "3px", "margin": "3px"}), # For empty strings we insert the symbol for an empty set and # we remove borders. If you wish to differentiate types of # sequences visually using borders, including empty ones, you # might need to disable the second rule, for example: # (".empty.sequence", {"!clear": True}) (".{empty}.{sequence}::before", {"content": '"\\2205"'}), # (".{empty}.{sequence}", {"border": "0px"}), (".stack", { "margin": "3px", # Whitespace before "display" is a trick to have # several entries for it in the CSS (since # whitespace is significant here but not in the # stylesheet). firefox and webkit will only see # this property when prefixed with -moz- or # -webkit- "display": "inline-box", " display": "-moz-inline-box", " display": "-webkit-inline-box", "-webkit-box-align": "middle", "-moz-box-align": "middle", "box-align": "middle", "-webkit-box-orient": "horizontal", "-moz-box-orient": "horizontal", "box-orient": "horizontal", }), (".vstack", { ":+classes": "stack", "-webkit-box-orient": "vertical", "-moz-box-orient": "vertical", "box-orient": "vertical", }), (".hstack", { ":+classes": "stack", "-webkit-box-orient": "horizontal", "-moz-box-orient": "horizontal", "box-orient": "horizontal", }), (".{stack} > span", {"display": "block", "margin": "0px", # "width": "100%" }), # Note: to display key/value pairs horizontally you can change # vstack to hstack. You might have to add a :-classes # instruction to remove vstack if you try to do it # programmatically. (".{assoc}", {":join": make_joiner(HTMLNode({"assoc_separator"}, [])), ":+classes": "vstack", }), # Rules related to printing tracebacks (".{@traceback}", {":+classes": "vstack", ":join": make_joiner(HTMLNode({"traceback_separator"}, []))}), (".{@traceback} > *", {"display": "block"}), (".source_excerpt", {":+classes": "vstack", "width": "100%" }), (".source_excerpt > *", {"display": "block"}), (".source_header", {"width": "98%"}), (".source_header > .path, .source_header > .source_loc", {"display": "block", "float": "right"}), (".path, .source_loc, .{@frame} > .{+fname}", {":+classes": "scalar"}), (".{+fname} + .path::before", {"content": '"in "'}), (".path + .source_loc::before", {"content": '"@"', "font-weight": "normal"}), (".{source_code}", {":+classes": "pre"}), (".lineno", {"padding-right": "5px", "margin-right": "10px", "display": "inline-block", "text-align": "right"}), # Quoting (".quote.class_set > *", {"margin-left": "3px", "margin-right": "3px"}), (".quote.class_set", {"padding": "3px", "margin": "3px"}), (".quote.description", {"padding": "3px", "margin": "3px"}), # Tables (".table", {"display": "table", "border-collapse": "collapse"}), (".table > *", {"display": "table-row"}), (".table > * > *", {"display": "table-cell", "padding": "0px 10px 0px 10px"}), (".table > .header", {"font-weight": "bold"}), ), close = HTMLRuleBuilder( (".{bold}", {"font-weight": "bold"}), (".{black}", {"color": "#000"}), (".{red}", {"color": "#f88"}), (".{green}", {"color": "#8f8"}), (".{yellow}", {"color": "#ff8"}), (".{blue}", {"color": "#88f"}), (".{magenta}", {"color": "#f8f"}), (".{cyan}", {"color": "#8ff"}), (".{white}", {"color": "#fff"}), (".{hl}", {"font-weight": "bold"}), (".{hl1}", {"font-weight": "bold"}), (".{hl2}", {"font-weight": "bold"}), (".{hl3}", {"font-weight": "bold"}), (".{hlE}", {"font-weight": "bold"}), (".{par}", {":wrap": lambda x: HTMLNode({}, [x], tag = p)}), (".{line}", {":after": lambda a, b: [[{"raw"}, "<br/>"]]}), (".{raw}", {":raw": True}), )) # Rules for a "dark" theme (a black, or nearly black background is assumed). html_boxy.styles["dark"] = dict( open = HTMLRuleBuilder( (".{scalar}", {"background-color": "#222"}), (".{@True}", {"color": "#5f5"}), (".{@False}", {"color": "#f55"}), (".{@None}", {"color": "#a88"}), (".{@int}", {"color": "#88f"}), (".{@float}", {"color": "#88f"}), (".{@complex}", {"color": "#88f"}), (".{@str}", {"color": "#f88"}), (".{empty}", {"color": "#888"}), (".{sequence}", {"border": "2px solid #222"}), (".{empty}.{sequence}", {"border": "2px solid #000"}), (".{@tuple}:hover", {"border": "2px solid #888"}), (".{@list}:hover", {"border": "2px solid #a44"}), (".{@dict}:hover", {"border": "2px solid #484"}), (".{@set}:hover", {"border": "2px solid #44a"}), (".{fieldlist}", {"border-bottom": "2px solid #88f"}), (".assoc:hover .assoc_separator", {"border": "2px solid #fff"}), (".{assoc_separator}", { "border": "2px solid #888"}), (".{objectlabel}", {"color": "#88f", "font-weight": "bold", ":+classes": "scalar"}), (".{objectlabel} + .{assoc_separator}", { "border": "2px solid #88f"}), (".{fieldlabel}", {"color": "#f88", ":+classes": "scalar"}), # Traceback (".{@traceback}", {"border": "1px dashed #888"}), (".traceback_separator", {"border": "2px solid #888"}), (".source_header", {"background-color": "#222"}), (".{+fname} + .path::before", {"color": "#aaa"}), (".path + .source_loc::before", {"color": "#aaa"}), (".lineno", {"border-right": "4px solid #88f"}), (".{@Exception} .{objectlabel}", {"color": "#f00", "text-align": "left"}), (".{@Exception} .{objectlabel} + .{assoc_separator}", {"border": "2px solid #f88"}), (".{@Exception} .{fieldlist}", {"border-bottom": "4px solid #f88"}), (".exception_message", {"display": "block"}), # Quoting (".quote.class_set > *", {"background-color": "#222", "color": "#88f"}), (".quote.class_set", {"border": "2px solid #88f"}), (".quote.description", {"border": "2px solid #888"}), (".quote.description:hover", {"border": "2px solid #fff"}), # Table (".table", {"border": "1px solid #fff"}), (".table > .header", {"border-bottom": "2px solid #fff"}), # HTMLNode (".{@HTMLNode} > .{+classes}", {"background-color": "#222"}), (".{@HTMLNode} > .{+classes} > *", {"color": "#88f", "padding": "3px"}), ), close = HTMLRuleBuilder( (".{hl}", {"font-weight": "bold"}), (".{hl1}", {"color": "#ff8", "background-color": "#220"}), (".{hl2}", {"color": "#8f8", "background-color": "#020"}), (".{hl3}", {"color": "#88f", "background-color": "#003"}), (".{hlE}", {"color": "#f88", "background-color": "#300"}), (".hl.empty::before, .hl1.empty::before, .hl2.empty::before, .hl3.empty::before, .hlE.empty::before", { "content": '"\\25B6"', }), )) # Rules for a "light" theme (a white, or nearly white background is assumed). html_boxy.styles["light"] = dict( open = HTMLRuleBuilder( (".{scalar}", {"background-color": "#eee"}), (".{@True}", {"color": "#080"}), (".{@False}", {"color": "#f00"}), (".{@None}", {"color": "#555"}), (".{@int}", {"color": "#00a"}), (".{@float}", {"color": "#00a"}), (".{@complex}", {"color": "#00a"}), (".{@str}", {"color": "#a00"}), (".{empty}", {"color": "#888"}), (".{sequence}", {"border": "2px solid #eee"}), (".{empty}.{sequence}", {"border": "2px solid #fff"}), (".{@tuple}:hover", {"border": "2px solid #bbb"}), (".{@list}:hover", {"border": "2px solid #f88"}), (".{@dict}:hover", {"border": "2px solid #6a6"}), (".{@set}:hover", {"border": "2px solid #88f"}), (".{fieldlist}", {"border-bottom": "2px solid #00f"}), (".assoc:hover > .assoc_separator", {"border": "2px solid #000"}), (".{assoc_separator}", {"border": "2px solid #888"}), (".{objectlabel}", {"color": "#00f", "font-weight": "bold", ":+classes": "scalar"}), (".{objectlabel} + .{assoc_separator}", { "border": "2px solid #00f"}), (".{fieldlabel}", {"color": "#a00", ":+classes": "scalar"}), # Traceback (".{@traceback}", {"border": "1px dashed #888"}), (".traceback_separator", {"border": "2px solid #888"}), (".source_header", {"background-color": "#eee"}), (".{+fname} + .path::before", {"color": "#666"}), (".path + .source_loc::before", {"color": "#666"}), (".lineno", {"border-right": "4px solid #00f"}), (".{@Exception} .{objectlabel}", {"color": "#f00", "text-align": "left"}), (".{@Exception} .{objectlabel} + .{assoc_separator}", {"border": "2px solid #800"}), (".{@Exception} .{fieldlist}", {"border-bottom": "4px solid #800"}), (".exception_message", {"display": "block"}), # Quoting (".quote.class_set > *", {"background-color": "#eee", "color": "blue"}), (".quote.class_set", {"border": "2px solid blue"}), (".quote.description", {"border": "2px solid #aaa"}), (".quote.description:hover", {"border": "2px solid #000"}), # Table (".table", {"border": "1px solid #000"}), (".table > .header", {"border-bottom": "2px solid #000"}), # HTMLNode (".{@HTMLNode} > .{+classes}", {"background-color": "#eee"}), (".{@HTMLNode} > .{+classes} > *", {"color": "#00f", "padding": "3px"}), ), close = HTMLRuleBuilder( (".{hl}", {"font-weight": "bold"}), (".{hl1}", {"color": "#00f", "background-color": "#eef"}), (".{hl2}", {"color": "#0a0", "background-color": "#efe"}), (".{hl3}", {"color": "#a60", "background-color": "#efc"}), (".{hlE}", {"color": "#f00", "background-color": "#fee"}), ) )
''' synbiochem (c) University of Manchester 2015 synbiochem is licensed under the MIT License. To view a copy of this license, visit <http://opensource.org/licenses/MIT/>. @author: neilswainston ''' # pylint: disable=no-member # pylint: disable=redundant-unittest-assert # pylint: disable=too-many-public-methods import getpass import os import unittest from synbiochem.utils import ice_utils, sbol_utils from synbiochem.utils.ice_utils import ICEClient, ICEEntry class TestICEEntry(unittest.TestCase): '''Test class for ICEEntry.''' @classmethod def setUpClass(cls): try: std_input = raw_input except NameError: std_input = input ice_url = std_input('ICE url: ') username = std_input('ICE username: ') password = getpass.getpass(prompt='ICE password: ') cls.__ice_client = ICEClient(ice_url, username, password) def test_get_ice_number(self): '''Tests get_ice_number method.''' ice_entry1 = ICEEntry(typ='PLASMID') self.__ice_client.set_ice_entry(ice_entry1) self.assertNotEqual(ice_entry1.get_ice_number(), None) ice_entry2 = ICEEntry(metadata={'type': 'PLASMID'}) self.__ice_client.set_ice_entry(ice_entry2) self.assertNotEqual(ice_entry2.get_ice_number(), None) def test_get_ice_number_none(self): '''Tests get_ice_number method.''' ice_entry1 = ICEEntry(typ='PLASMID') self.assertEqual(ice_entry1.get_ice_number(), None) ice_entry2 = ICEEntry(metadata={'type': 'PLASMID'}) self.assertEqual(ice_entry2.get_ice_number(), None) def test_get_record_id(self): '''Tests get_record_id method.''' ice_entry1 = ICEEntry(typ='PLASMID') self.__ice_client.set_ice_entry(ice_entry1) self.assertNotEqual(ice_entry1.get_record_id(), None) ice_entry2 = ICEEntry(metadata={'type': 'PLASMID'}) self.__ice_client.set_ice_entry(ice_entry2) self.assertNotEqual(ice_entry2.get_record_id(), None) def test_get_record_id_none(self): '''Tests get_record_id method.''' ice_entry1 = ICEEntry(typ='PLASMID') self.assertEqual(ice_entry1.get_record_id(), None) ice_entry2 = ICEEntry(metadata={'type': 'PLASMID'}) self.assertEqual(ice_entry2.get_record_id(), None) def test_get_type(self): '''Tests get_type method.''' ice_entry1 = ICEEntry(typ='PLASMID') self.assertEqual(ice_entry1.get_type(), 'PLASMID') ice_entry2 = ICEEntry(metadata={'type': 'PLASMID'}) self.assertEqual(ice_entry2.get_type(), 'PLASMID') def test_get_metadata(self): '''Tests get_metadata method.''' ice_entry1 = ICEEntry(typ='PLASMID') self.assertEqual(ice_entry1.get_metadata()['type'], 'PLASMID') ice_entry2 = ICEEntry(metadata={'type': 'PLASMID'}) self.assertEqual(ice_entry2.get_metadata()['type'], 'PLASMID') def test_get_sbol_doc(self): '''Tests get_sbol_doc method.''' dna = _read('sbol.xml') ice_entry = ICEEntry(typ='PLASMID', dna=dna) self.assertEqual(ice_entry.get_dna(), dna) def test_set_value(self): '''Tests set_value method.''' ice_entry1 = ICEEntry(typ='PLASMID') ice_entry1.set_value('creator', 'God') self.assertEqual(ice_entry1.get_metadata()['type'], 'PLASMID') self.assertEqual(ice_entry1.get_metadata()['creator'], 'God') self.__ice_client.set_ice_entry(ice_entry1) ice_entry2 = self.__ice_client.get_ice_entry( ice_entry1.get_ice_number()) ice_entry2.set_value('creator', 'Aitor Karanka') self.__ice_client.set_ice_entry(ice_entry2) ice_entry3 = self.__ice_client.get_ice_entry( ice_entry1.get_ice_number()) self.assertEqual(ice_entry3.get_metadata()['creator'], 'Aitor Karanka') ice_entry4 = ICEEntry(metadata={'type': 'PLASMID'}) ice_entry4.set_value('creator', 'God') self.assertEqual(ice_entry4.get_metadata()['type'], 'PLASMID') self.assertEqual(ice_entry4.get_metadata()['creator'], 'God') def test_set_values(self): '''Tests set_values method.''' ice_entry1 = ICEEntry(typ='PLASMID') ice_entry1.set_values({'creator': 'God', 'name': 'Test'}) self.assertEqual(ice_entry1.get_metadata()['type'], 'PLASMID') self.assertEqual(ice_entry1.get_metadata()['creator'], 'God') self.assertEqual(ice_entry1.get_metadata()['name'], 'Test') ice_entry2 = ICEEntry(metadata={'type': 'PLASMID'}) ice_entry2.set_values({'creator': 'God', 'name': 'Test'}) self.assertEqual(ice_entry2.get_metadata()['type'], 'PLASMID') self.assertEqual(ice_entry2.get_metadata()['creator'], 'God') self.assertEqual(ice_entry2.get_metadata()['name'], 'Test') def test_set_dna(self): '''Tests set_dna method.''' dna1 = _read('sbol.xml') dna2 = _read('sbol2.xml') ice_entry = ICEEntry(typ='PLASMID', dna=dna1) self.__ice_client.set_ice_entry(ice_entry) ice_entry.set_dna(dna2) self.__ice_client.set_ice_entry(ice_entry) self.assertEqual(ice_entry.get_seq(), dna2['seq']) def test_get_seq(self): '''Tests get_seq method.''' dna = _read('sbol.xml') ice_entry = ICEEntry(typ='PLASMID', dna=dna) self.__ice_client.set_ice_entry(ice_entry) ice_entry = self.__ice_client.get_ice_entry(ice_entry.get_ice_id()) self.assertEqual(ice_entry.get_seq(), dna['seq']) def test_set_get_parameter(self): '''Tests set/get_parameter method.''' ice_entry = ICEEntry(typ='PLASMID') ice_entry.set_parameter('Cheese', 'Brie') self.__ice_client.set_ice_entry(ice_entry) ice_entry = self.__ice_client.get_ice_entry(ice_entry.get_ice_id()) self.assertEqual(ice_entry.get_parameter('Cheese'), 'Brie') class TestICEClient(unittest.TestCase): '''Test class for ICEClient.''' @classmethod def setUpClass(cls): try: std_input = raw_input except NameError: std_input = input ice_url = std_input('ICE url: ') username = std_input('ICE username: ') password = getpass.getpass(prompt='ICE password: ') cls.__ice_client = ICEClient(ice_url, username, password) def test_get_ice_entry(self): '''Tests get_ice_entry method.''' dna = _read('sbol.xml') ice_entry_in = ICEEntry(typ='PART', dna=dna) self.__ice_client.set_ice_entry(ice_entry_in) ice_entry_out = self.__ice_client.get_ice_entry( ice_entry_in.get_ice_number()) self.assertEqual(ice_entry_out.get_seq(), dna['seq']) def test_set_ice_entry(self): '''Tests set_ice_entry method.''' dna_in = _read('sbol.xml') ice_entry_in = ICEEntry(typ='PLASMID', dna=dna_in) self.__ice_client.set_ice_entry(ice_entry_in) ice_entry_out = self.__ice_client.get_ice_entry( ice_entry_in.get_ice_number()) self.assertNotEqual(ice_entry_out, None) def test_do_blast(self): '''Tests do_blast method.''' result = self.__ice_client.do_blast('tcgagaattcaaaagatctgagataggtaga' + 'agctagacgagaaaccttcccaatcttatca' + 'ttacgaaaggacgtccctatgagcctgatta') self.assertTrue(result['resultCount'] > 0) def test_do_blast_2(self): '''Tests do_blast method.''' result = self.__ice_client.do_blast('aggcaaattcagtgaggctgacttctcatct' + 'taaatagttcccttcacgatagccgcctga') self.assertTrue(result['resultCount'] > 0) def test_get_ice_entries_by_seq(self): '''Tests get_ice_entries_by_seq method.''' dna = _read('sbol.xml') # dna.set_seq(sequence_utils.get_random_dna(4096)) ice_entry = ICEEntry(typ='PLASMID', dna=dna) self.__ice_client.set_ice_entry(ice_entry) self.__ice_client.reconnect() result = self.__ice_client.get_ice_entries_by_seq(dna['seq']) self.assertTrue(len(result) > 0) def test_get_ice_entries_by_seq_2(self): '''Tests get_ice_entries_by_seq method.''' seq = 'aggcaaattcagtgaggctgacttctcatcttaaatagttcccttcacgatagccgcctga' result = self.__ice_client.get_ice_entries_by_seq(seq) self.assertTrue(len(result) > 0) def test_add_link(self): '''Tests add_link method.''' dna1 = _read('sbol.xml') dna2 = _read('sbol2.xml') ice_entry1 = ICEEntry(typ='PLASMID', dna=dna1) self.__ice_client.set_ice_entry(ice_entry1) ice_entry2 = ICEEntry(typ='PLASMID', dna=dna2) self.__ice_client.set_ice_entry(ice_entry2) self.__ice_client.add_link( ice_entry1.get_ice_number(), ice_entry2.get_ice_number()) # "Refresh" (update metadata) ice_entry1 = self.__ice_client.get_ice_entry(ice_entry1.get_ice_id()) ice_entry2 = self.__ice_client.get_ice_entry(ice_entry2.get_ice_id()) self.assertTrue(ice_entry1.get_ice_number() in [par['id'] for par in ice_entry2.get_metadata()['parents']]) self.assertTrue(ice_entry2.get_ice_number() in [link['id'] for link in ice_entry1.get_metadata()['linkedParts']]) def test_search_groups(self): '''Tests get_group_id and search_groups method.''' groups = self.__ice_client.get_groups() for name in groups: groups = self.__ice_client.search_groups(name[:-1]) self.assertTrue(name in [grp['label'] for grp in groups]) def test_add_permission(self): '''Tests add_permission method.''' dna = _read('sbol.xml') ice_entry = ICEEntry(typ='PLASMID', dna=dna) self.__ice_client.set_ice_entry(ice_entry) groups = self.__ice_client.get_groups() for group_num in groups.values(): self.__ice_client.add_permission(ice_entry.get_ice_id(), group_num) # If test progresses to here, it has succeeded: self.assertTrue(True) def test_search(self): '''Tests search method.''' resp = self.__ice_client.search('PLASMID') # If test progresses to here, it has succeeded: self.assertTrue(resp['resultCount'] > 0) def test_search_name(self): '''Tests advanced search by name method.''' resp = self.__ice_client.search_name('SBC_DE15_PL01', 'PLASMID') # If test progresses to here, it has succeeded: self.assertTrue(resp) def test_search_design(self): '''Tests advanced search by name method.''' resp = self.__ice_client.search_design(15) # If test progresses to here, it has succeeded: self.assertTrue(len(resp) == 46) def test_advanced_search(self): '''Tests search method.''' typ = 'PLASMID' resp = self.__ice_client.advanced_search('*', typ) self.assertTrue(len(resp['results']) == 5) for result in resp['results']: self.assertTrue(result['entryInfo']['type'] == typ) def test_get_genbank(self): '''Tests get_genbank method.''' resp = self.__ice_client.get_genbank(6592) self.assertTrue(resp) class Test(unittest.TestCase): '''Test class for ice_utils.''' def test_get_ice_number(self): '''Tests get_ice_number method.''' self.assertEqual(ice_utils.get_ice_number('TEST00063', 'TEST'), '63') self.assertEqual(ice_utils.get_ice_number('TEST63', 'TEST'), '63') self.assertEqual(ice_utils.get_ice_number('63', 'TEST'), '63') self.assertEqual(ice_utils.get_ice_number(63, 'TEST'), '63') def _read(filename): '''Reads sbol file.''' directory = os.path.dirname(os.path.realpath(__file__)) return sbol_utils.read(os.path.join(directory, filename)) if __name__ == "__main__": unittest.main()
# Copyright (c) 2012, Daniel Zerbino # All rights reserved. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are # met: # # (1) Redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer. # # (2) Redistributions in binary form must reproduce the above copyright # notice, this list of conditions and the following disclaimer in # the documentation and/or other materials provided with the # distribution. # # (3)The name of the author may not be used to # endorse or promote products derived from this software without # specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE AUTHOR ``AS IS'' AND ANY EXPRESS OR # IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED # WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE # DISCLAIMED. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY DIRECT, # INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES # (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR # SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) # HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, # STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING # IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE # POSSIBILITY OF SUCH DAMAGE. #!/usr/bin/env python """Representing the molecular tree underlying the clonal tree""" import math import cnavg.history.debug from numpy import array from numpy import ones import scipy.stats.poisson as poisson PARAMETER = float(50) ################################################### ## Copy number change ################################################### def computeCopyNumberChange(event, overlaps): if event in overlaps: if event.cycle[overlaps[event][0]].value > 0: return -len(overlaps[event]) * math.ceil(abs(event.cycle[0].value)) else: return len(overlaps[event]) * math.ceil(abs(event.cycle[0].value)) else: return 0 ################################################### ## Enumerating CNV SliceTrees ################################################### class CNVSliceTree(list): def __init__(self, iter, count, event, prior=None): super(CNVSliceTree, self).__init__(iter) self.count = count self.event = event self.prior = prior # Because list not hashable def __hash__(self): return id(self) def __or__(self, other): return CNVSliceTree(super(CNVSliceTree, self).__add__(other), self.count * other.count, self.event) def nodes(self): # Careful, nodes can be carried over across slices, so set() removes doubles return set(sum(map(list, self), [])) def originators(self): return filter(lambda X: X.parent is None, self.nodes()) def organizeByEvents(eventSliceTrees, sliceTrees): if sliceTrees[0].event in eventSliceTrees: eventSliceTrees[sliceTrees[0].event].extend(sliceTrees) else: eventSliceTrees[sliceTrees[0].event] = sliceTrees return eventSliceTrees def crossProduct(list, newList): if len(list) == 0: return newList else: return [X | Y for X in list for Y in newList] class CNVSlice(set): def __init__(self, iter, parent, count, event): super(CNVSlice, self).__init__(iter) self.count = count self.weight = float(sum(X.copynumber for X in self)) if parent is not None: parent.children.append(self) self.children = [] self.event = event # Because set not hashable def __hash__(self): return id(self) def __eq__(self, other): return id(self) == id(other) def extractSliceTrees(self): if len(self.children) == 0: return [CNVSliceTree([self], self.count, self.event)] elif len(self.children) == 1: return [CNVSliceTree(list(X) + [self], X.count * self.count, self.event) for X in self.children[0].extractSliceTrees()] else: # Recursion childSliceTrees = map(lambda X: X.extractSliceTrees(), self.children) # Organize by creator event to avoid self-products childEventSliceTrees = reduce(organizeByEvents, childSliceTrees, dict()) # Cardinal product of child SliceTrees sliceTrees = reduce(crossProduct, childEventSliceTrees.values(), []) # Iterative step return [CNVSliceTree(list(X) + [self], X.count * self.count, self.event) for X in sliceTrees] def cnvNodeWeight(self, cnvNode): if self.weight == 0: return 1 else: return cnvNode.copynumber / self.weight def add(self, element): super(CNVSlice, self).add(element) self.weight += element.copynumber def remove(self, element): super(CNVSlice, self).remove(element) self.weight -= element.copynumber class CNVNode(object): def __init__(self, copynumber, creator, parent): self.copynumber = copynumber self.creator = creator self.parent = parent def shadow(self): return CNVNode(self.copynumber - 1, None, self) def __str__(self): return "\t".join(map(str, [self.copynumber, self.creator, self.parent.event])) def newHistorySlice_Node(previousSlice, event, change, cnvNode): if cnvNode.copynumber == 0: return [] else: res = CNVSlice(previousSlice, previousSlice, cnvNode.copynumber, event) res.remove(cnvNode) if cnvNode.copynumber - 1 > 0: res.add(cnvNode.shadow()) if change > 0: res.add(CNVNode(change + 1, event, cnvNode)) else: res.add(CNVNode(0, event, cnvNode)) return [res] def newHistorySlice(previousSlice, event, change): return sum((newHistorySlice_Node(previousSlice, event, change, cnvNode) for cnvNode in previousSlice), []) def virginBirth(event, change): if change < 0: return CNVNode(0, event, None) elif change > 0: return CNVNode(change + 1, event, None) else: assert False def newHistorySlices(previousSlices, event, change): if change == 0: return [CNVSlice(X, X, 1, event) for X in previousSlices] else: res = sum((newHistorySlice(slice, event, change) for slice in previousSlices), []) if len(res) > 0: return res else: # If all the nodes have copy number 0, then the result is an empty list the history is messed up but we # try to pick up the pieces as we can return [CNVSlice(list(slice) + [virginBirth(event, change)], slice, 1, event) for slice in previousSlices] def getChildren(children, node): if node.parent is not None: children[node.parent].append(node) return children def updateLikelihoods(likelihoods, sliceTree, data): if data[0] not in likelihoods: likelihoods[data[0]] = dict() if sliceTree not in likelihoods[data[0]]: likelihoods[data[0]][sliceTree] = dict() likelihoods[data[0]][sliceTree][event] = data[1] return likelihoods ################################################### ## CNVTree ################################################### class CNVTree(object): ################################################### ## Overall construction ################################################### def __init__(self, cactusHistory, overlaps, originalCopyNumber): # Recoding atomic info events = cactusHistory.parent.keys() self.cactusHistory = cactusHistory if overlaps is None: self.copyNumberChanges = None else: self.copyNumberChanges = dict((event, computeCopyNumberChange(event, overlaps)) for event in events) self.impactChanges = dict((event, event.ratio * self.copyNumberChanges[event]) for event in events) # Reconstructing possible molecular histories self.rootNode = CNVNode(originalCopyNumber, None, None) self.rootSlice = CNVSlice([self.rootNode], None, 1, None) map(lambda X: self.computeHistorySlices(X,[self.rootSlice]), cactusHistory.roots) preSliceTrees = self.rootSlice.extractSliceTrees() totalSliceTreeCount = float(sum(X.count for X in preSliceTrees)) self.sliceTrees = [CNVSliceTree(list(X), X.count, X.event, X.count/totalSliceTreeCount) for X in preSliceTrees] # Computing expected impacts self.children = dict((X, self.getSliceTreeChildren(X)) for X in self.sliceTrees) self.cumulativeImpactChanges = dict((sliceTree, self.cumulativeImpactChanges_SliceTree(sliceTree)) for sliceTree in self.sliceTrees) self.totalImpacts = dict((sliceTree, self.totalImpact(sliceTree)) for sliceTree in self.sliceTrees) ################################################### ## Building the damn thing ################################################### def computeHistorySlices(self, event, previousSlices): eventSlices = newHistorySlices(previousSlices, event, self.copyNumberChanges[event]) map(lambda X: self.computeHistorySlices(X, eventSlices), self.cactusHistory.children[event]) def getSliceTreeChildren(self, sliceTree): return reduce(getChildren, sliceTree.nodes(), dict((node, []) for node in sliceTree.nodes())) def cumulativeImpactChanges_CNVNode(self, cumulativeImpactChanges, cnvNode, sliceTree): cumulativeImpactChanges = reduce(lambda X, Y: self.cumulativeImpactChanges_CNVNode(X,Y,sliceTree), self.children[sliceTree][cnvNode], cumulativeImpactChanges) cumulativeImpactChanges[cnvNode] = sum(cumulativeImpactChanges[X] for X in self.children[sliceTree][cnvNode]) + sum(C.creator.ratio * self.copyNumberChanges[C.creator] for C in self.children[sliceTree][cnvNode] if C.creator is not None) return cumulativeImpactChanges def cumulativeImpactChanges_SliceTree(self, sliceTree): return reduce(lambda X, Y: self.cumulativeImpactChanges_CNVNode(X,Y,sliceTree), sliceTree.originators(), dict()) def totalImpact_Node(self, sliceTree, cnvNode): if cnvNode.creator is not None: return max(cnvNode.creator.ratio + self.cumulativeImpactChanges[sliceTree][cnvNode], 0) else: return max(1 + self.cumulativeImpactChanges[sliceTree][self.rootNode], 0) def totalImpact(self, sliceTree): return max(sum(self.totalImpact_Node(sliceTree, cnvNode) for cnvNode in sliceTree.originators()), 0.00001) ################################################### ## Likelihoods ################################################### def expectedImpact(self, slice, sliceTree, cnvNode): if slice.event is not None: return max(slice.event.ratio + self.cumulativeImpactChanges[sliceTree][cnvNode], 0) else: return max(1 + self.cumulativeImpactChanges[sliceTree][self.rootNode], 0) def expectedRatio(self, slice, sliceTree, cnvNode): return self.expectedImpact(slice, sliceTree, cnvNode) / float(self.totalImpacts[sliceTree]) def expectedCoverages(self, cnvNode, slice, sliceTree, totals): return FloatVector(self.expectedRatio(slice, sliceTree, cnvNode) * totals) # Poisson likelihoods (R function then numpy array) def conditionedLikelihoods(self, cnvNode, slice, sliceTree, counts, totals): return poisson.cdf(counts, self.expectedCoverages(cnvNode, slice, sliceTree, totals)) def segregatingLikelihood(self, vals): # TODO The likelihood function of a segregating SNP could be refined if vals[1] == 0: return 0 else: return PARAMETER * math.exp(-(vals[0]/float(vals[1])) * PARAMETER) def segregatingLikelihoodArray(self, counts, totals): return map(self.segregatingLikelihood, zip(counts, totals)) # Weighted sum def likelihoodArray(self, slice, sliceTree, counts, totals): if slice is self.rootSlice: return self.segregatingLikelihoodArray(counts,totals) else: return sum(slice.cnvNodeWeight(cnvNode) * self.conditionedLikelihoods(cnvNode, slice, sliceTree, counts, totals) for cnvNode in slice) # Going through events # Returns dictionary: snv -> likelihood def sliceLikelihoods(self, slice, sliceTree, snvs, counts, totals): return dict(zip(snvs, self.likelihoodArray(slice, sliceTree, counts, totals))) # Turns event -> snv -> likelihood # Into array -> likelihood def snvLikelihoods(self, snv, timings, eventLikelihoods): return array([eventLikelihoods[timing][snv] for timing in timings]) # Going through slices # Returns dictionary: snv -> array -> likelihood def sliceTreeLikelihoods(self, sliceTree, snvs, timings, counts, totals): # Computing sliceTree stats eventLikelihoods = dict((slice.event, self.sliceLikelihoods(slice, sliceTree, snvs, counts, totals)) for slice in sliceTree) return dict((snv, self.snvLikelihoods(snv, timings, eventLikelihoods)) for snv in snvs) def defaultLikelihoods_SNV(self, timing, counts, totals): if timing is None: return poisson.cdf(counts, totals) else: return array(dpois(counts, FloatVector(timing.ratio * totals))) # Returns dictionary: snv -> array -> likelihood def defaultLikelihoods_Event(self, snvs, timing, counts, totals): return dict(zip(snvs, self.defaultLikelihoods_SNV(timing, counts, totals))) # Returns dictionary: snv -> array -> likelihood def defaultLikelihoods(self, snvs, timings, counts, totals): eventLikelihoods = dict((timing, self.defaultLikelihoods_Event(snvs, timing, counts, totals)) for timing in timings) return dict((snv, self.snvLikelihoods(snv, timings, eventLikelihoods)) for snv in snvs) # Returns dictionary: sliceTree -> snv -> array -> likelihood def likelihoods(self, counts_list, totals_list, snvs, events, phasedRatio): timings = events + [None] # Creating objects to avoid multiple redundant creations counts = IntVector(counts_list) totals = array(totals_list) * phasedRatio if self.copyNumberChanges is None: return dict([(CNVSliceTree([], 1, None, 1), self.defaultLikelihoods(snvs, timings, counts, totals))]) else: return dict((sliceTree, self.sliceTreeLikelihoods(sliceTree, snvs, timings, counts, totals)) for sliceTree in self.sliceTrees) ################################################### ## Convenience ################################################### def eventString(self, event): string = '%i [label="%i,%f,%f,%f,%f"]' % (id(event), self.copyNumberChanges[event], event.ratio, self.impactChanges[event], self.cumulativeImpactChanges[event]) string += "\n" + "\n".join("%i -> %i" % (id(event), id(X)) for X in self.cactusHistory.children[event]) return string def __str__(self): string = "digraph G {\n" string += "\n".join(map(self.eventString, self.cactusHistory.parent.keys())) + "\n" string += "}\n" return string ############################################## ## Unit testing ############################################## def main(): sys.setrecursionlimit(5000) if len(sys.argv) == 1: G = avg.randomNearEulerianGraph(10) C = cactus.Cactus(G) N = normalizedCactus.NormalizedCactus(C) O = oriented.OrientedCactus(N) H = cycleCover.initialHistory(O) else: file = open(sys.argv[1]) H = None while True: try: tmp = pickle.load(file) if tmp is not None: H = tmp except: break file.close() FH = flattened.flattenGraph(H) S = FH.simplifyStubsAndTrivials() F = S.removeLowRatioEvents(debug.RATIO_CUTOFF) if len(sys.argv) == 1: print F overlapTable = dict() for e in F.parent: overlapTable = overlap.addEventToOverlapTable(overlapTable, e) counts = [] totalCounts = [] for edgeIndex in overlapTable.keys(): if edgeIndex[2] > -1: t = CNVTree(F, overlapTable[edgeIndex], 1) counts.append(len(t.sliceTrees)) totalCounts.append(sum(X.count for X in t.sliceTrees)) print [len(X.originators()) for X in t.sliceTrees] print [len(X.nodes()) for X in t.sliceTrees] print "\n".join(["\t".join(X) for X in zip(map(str, counts), map(str, totalCounts))]) if __name__ == "__main__": import sys import cPickle as pickle import cnavg.avg.graph as avg import cnavg.cactus.graph as cactus import cnavg.cactus.oriented as oriented import cnavg.cycleSampling.cycleCover as cycleCover import cnavg.cactusSampling.sampling as normalizedCactus import cnavg.history.flattened as flattened import cnavg.history.overlap as overlap main()
# Copyright 2013 Google, Inc. All Rights Reserved. # # Google Author(s): Behdad Esfahbod """GUI font inspector. """ from __future__ import print_function, division, absolute_import from fontTools.misc.py23 import * from fontTools import misc, ttLib, cffLib import pygtk pygtk.require('2.0') import gtk import sys class Row(object): def __init__(self, parent, index, key, value, font): self._parent = parent self._index = index self._key = key self._value = value self._font = font if isinstance(value, ttLib.TTFont): self._add_font(value) return if not isinstance(value, basestring): # Try sequences is_sequence = True try: len(value) iter(value) # It's hard to differentiate list-type sequences # from dict-type ones. Try fetching item 0. value[0] except (TypeError, AttributeError, KeyError, IndexError): is_sequence = False if is_sequence: self._add_list(key, value) return if hasattr(value, '__dict__'): self._add_object(key, value) return if hasattr(value, 'items'): self._add_dict(key, value) return if isinstance(value, basestring): self._value_str = '"'+value+'"' self._children = [] return # Everything else self._children = [] def _filter_items(self): items = [] for k,v in self._items: if isinstance(v, ttLib.TTFont): continue if k in ['reader', 'file', 'tableTag', 'compileStatus', 'recurse']: continue if isinstance(k, basestring) and k[0] == '_': continue items.append((k,v)) self._items = items def _add_font(self, font): self._items = [(tag,font[tag]) for tag in font.keys()] def _add_object(self, key, value): # Make sure item is decompiled try: value["asdf"] except (AttributeError, KeyError, TypeError, ttLib.TTLibError): pass if isinstance(value, ttLib.getTableModule('glyf').Glyph): # Glyph type needs explicit expanding to be useful value.expand(self._font['glyf']) if isinstance(value, misc.psCharStrings.T2CharString): try: value.decompile() except TypeError: # Subroutines can't be decompiled pass if isinstance(value, cffLib.BaseDict): for k in value.rawDict.keys(): getattr(value, k) if isinstance(value, cffLib.Index): # Load all items for i in range(len(value)): value[i] # Discard offsets as should not be needed anymore if hasattr(value, 'offsets'): del value.offsets self._value_str = value.__class__.__name__ if isinstance(value, ttLib.tables.DefaultTable.DefaultTable): self._value_str += ' (%d Bytes)' % self._font.reader.tables[key].length self._items = sorted(value.__dict__.items()) self._filter_items() def _add_dict(self, key, value): self._value_str = '%s of %d items' % (value.__class__.__name__, len(value)) self._items = sorted(value.items()) def _add_list(self, key, value): if len(value) and len(value) <= 32: self._value_str = str(value) else: self._value_str = '%s of %d items' % (value.__class__.__name__, len(value)) self._items = list(enumerate(value)) def __len__(self): if hasattr(self, '_children'): return len(self._children) if hasattr(self, '_items'): return len(self._items) assert False def _ensure_children(self): if hasattr(self, '_children'): return children = [] for i,(k,v) in enumerate(self._items): children.append(Row(self, i, k, v, self._font)) self._children = children del self._items def __getitem__(self, n): if n >= len(self): return None if not hasattr(self, '_children'): self._children = [None] * len(self) c = self._children[n] if c is None: k,v = self._items[n] c = self._children[n] = Row(self, n, k, v, self._font) self._items[n] = None return c def get_parent(self): return self._parent def get_index(self): return self._index def get_key(self): return self._key def get_value(self): return self._value def get_value_str(self): if hasattr(self,'_value_str'): return self._value_str return str(self._value) class FontTreeModel(gtk.GenericTreeModel): __gtype_name__ = 'FontTreeModel' def __init__(self, font): super(FontTreeModel, self).__init__() self._columns = (str, str) self.font = font self._root = Row(None, 0, "font", font, font) def on_get_flags(self): return 0 def on_get_n_columns(self): return len(self._columns) def on_get_column_type(self, index): return self._columns[index] def on_get_iter(self, path): rowref = self._root while path: rowref = rowref[path[0]] path = path[1:] return rowref def on_get_path(self, rowref): path = [] while rowref != self._root: path.append(rowref.get_index()) rowref = rowref.get_parent() path.reverse() return tuple(path) def on_get_value(self, rowref, column): if column == 0: return rowref.get_key() else: return rowref.get_value_str() def on_iter_next(self, rowref): return rowref.get_parent()[rowref.get_index() + 1] def on_iter_children(self, rowref): return rowref[0] def on_iter_has_child(self, rowref): return bool(len(rowref)) def on_iter_n_children(self, rowref): return len(rowref) def on_iter_nth_child(self, rowref, n): if not rowref: rowref = self._root return rowref[n] def on_iter_parent(self, rowref): return rowref.get_parent() class Inspect(object): def _delete_event(self, widget, event, data=None): gtk.main_quit() return False def __init__(self, fontfile): self.window = gtk.Window(gtk.WINDOW_TOPLEVEL) self.window.set_title("%s - pyftinspect" % fontfile) self.window.connect("delete_event", self._delete_event) self.window.set_size_request(400, 600) self.scrolled_window = gtk.ScrolledWindow() self.window.add(self.scrolled_window) self.font = ttLib.TTFont(fontfile, lazy=True) self.treemodel = FontTreeModel(self.font) self.treeview = gtk.TreeView(self.treemodel) #self.treeview.set_reorderable(True) for i in range(2): col_name = ('Key', 'Value')[i] col = gtk.TreeViewColumn(col_name) col.set_sort_column_id(-1) self.treeview.append_column(col) cell = gtk.CellRendererText() col.pack_start(cell, True) col.add_attribute(cell, 'text', i) self.treeview.set_search_column(1) self.scrolled_window.add(self.treeview) self.window.show_all() def main(args): if len(args) < 1: print("usage: pyftinspect font...", file=sys.stderr) sys.exit(1) for arg in args: Inspect(arg) gtk.main() if __name__ == "__main__": main(sys.argv[1:])
import os from arcproject.waterquality import classes from arcproject.scripts.load_data_bulk import slurp # path to location with data data = r"C:\Users\Andy\Desktop\ArcData" # or location on x drive def jan(): print("January 2014") path = os.path.join(data, "Jan_2014", "Arc_011314") s = slurp.Slurper() s.add_new_sites = True s.dst = True s.site_function_params = {"site_part": 3, "gain_part": 4} s.exclude = ['StatePlaneCAII', 'SummaryFiles'] print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) path = os.path.join(data, "Jan_2014", "Arc_011714") s = slurp.Slurper() s.add_new_sites = True s.dst = True s.site_function_params = {"site_part": 2, "gain_part": 4} s.exclude = ['StatePlaneCAII', 'SummaryFiles'] print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) def feb(): print("Feburary 2014") path = os.path.join(data, "Feb_2014") s = slurp.Slurper() s.add_new_sites = True s.dst = True s.site_function_params = {"site_part": 3, "gain_part": 4} s.exclude = ['StatePlaneCAII', 'SummaryFiles', 'Arc_022814'] print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) path = os.path.join(data, "Feb_2014", "Arc_022814") s = slurp.Slurper() s.add_new_sites = True s.dst = True s.site_function_params = {"site_part": 2} s.exclude = ['StatePlaneCAII', 'SummaryFiles', ] print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) def mar(): print("March 2014") path = os.path.join(data, "Mar_2014", "Arc_031714") s = slurp.Slurper() s.add_new_sites = True s.site_function_params = {"site_part": 2, "gain_part": 4} s.exclude = ['StatePlaneCAII', 'SummaryFiles'] print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) path = os.path.join(data, "Mar_2014") s = slurp.Slurper() s.add_new_sites = True s.transect_gps_pattern = '*PosnPnt*.shp' s.site_function_params = {"site_part": 3, "gain_part": 4} s.exclude = ['StatePlaneCAII', 'SummaryFiles', 'Arc_031714', 'Arc_032014'] print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) path = os.path.join(data, "Mar_2014", "Arc_032014") s = slurp.Slurper() s.add_new_sites = True s.transect_gps_pattern = '*PosnPnt2.shp' s.site_function_params = {"site_part": 3, "gain_part": 4} s.exclude = ['StatePlaneCAII', 'SummaryFiles', 'Arc_031714'] print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) def apr(): print("April 2014") path = os.path.join(data, "Apr_2014", "Arc_042214") s = slurp.Slurper() s.add_new_sites = True s.dst = True s.site_function_params = {"site_part": 2, "gain_part": 4} s.exclude = ['StatePlaneCAII', 'SummaryFiles', 'StatePlaneII'] print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) print("April 2014") path = os.path.join(data, "Apr_2014", "Arc_042114") s = slurp.Slurper() s.add_new_sites = True s.dst = True s.site_function_params = {"site_part": 2, "gain_part": 4} s.exclude = ['StatePlaneCAII', 'SummaryFiles', 'StatePlaneII'] print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) path = os.path.join(data, "Apr_2014") s = slurp.Slurper() s.add_new_sites = True s.dst = True s.site_function_params = {"site_part": 3, "gain_part": 4} s.exclude = ['StatePlaneCAII', 'SummaryFiles', 'StatePlaneII', 'Arc_042214', "Arc_042114"] print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) def may(): print("May 2014") path = os.path.join(data, "May_2014") s = slurp.Slurper() s.add_new_sites = True s.dst = True s.site_function_params = {"site_part": 2, "gain_part": 4} s.exclude = ['StatePlaneCAII', 'SummaryFiles', 'StatePlaneII'] s.transect_gps_pattern = "*PosnPnt.shp" # included PosnPnt2.shp results in integrity error print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) def jun(): print("June 2014") path = os.path.join(data, "Jun_2014") s = slurp.Slurper() s.add_new_sites = True s.dst = True s.site_function_params = {"site_part": 2, "gain_part": 4} s.exclude = ['StatePlaneCAII', 'SummaryFiles', 'StatePlaneII', "Arc_062314"] print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) print("June 2014") path = os.path.join(data, "Jun_2014", "Arc_062314") s = slurp.Slurper() s.add_new_sites = True s.dst = True s.site_function_params = {"site_part": 2, "gain_part": 4} s.exclude = ['StatePlaneCAII', 'SummaryFiles', 'StatePlaneII'] print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) def jul(): print("July 2014") path = os.path.join(data, "Jul_2014") s = slurp.Slurper() s.add_new_sites = True s.dst = True s.site_function_params = {"site_part": 2, "gain_part": 4} s.exclude = ['StatePlaneCAII', 'SummaryFiles', 'StatePlaneII'] print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) def aug(): print("Aug 2014") path = os.path.join(data, "Aug_2014") s = slurp.Slurper() s.add_new_sites = True s.dst = True s.site_function_params = {"site_part": 3, "gain_part": 4} s.exclude = ['StatePlaneCAII', 'SummaryFiles', 'StatePlaneII', "Arc_082614", "Arc_082814"] print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) print("Aug 2014") path = os.path.join(data, "Aug_2014", "Arc_082614") s = slurp.Slurper() s.add_new_sites = True s.dst = True s.site_function_params = {"site_part": 2, "gain_part": 4} s.exclude = ['StatePlaneCAII', 'SummaryFiles', 'StatePlaneII'] print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) print("Aug 2014") path = os.path.join(data, "Aug_2014", "Arc_082814") s = slurp.Slurper() s.add_new_sites = True s.dst = True s.site_function_params = {"site_part": 2, "gain_part": 4} s.exclude = ['StatePlaneCAII', 'SummaryFiles', 'StatePlaneII'] print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) def sep(): print("Sep 2014") path = os.path.join(data, "Sep_2014", "Arc_091514") s = slurp.Slurper() s.add_new_sites = True s.dst = True s.site_function_params = {"site_part": 3, "gain_part": 4} s.exclude = ['StatePlaneCAII', 'SummaryFiles', 'StatePlaneII'] print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) path = os.path.join(data, "Sep_2014") s = slurp.Slurper() s.add_new_sites = True s.dst = True s.site_function_params = {"site_part": 2, "gain_part": 4} s.exclude = ['StatePlaneCAII', 'SummaryFiles', 'StatePlaneII', "Arc_091514"] print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) def oct(): print("Oct 2014") path = os.path.join(data, "Oct_2014", "Arc_101314") s = slurp.Slurper() s.add_new_sites = True s.dst = True s.site_function_params = {"site_part": 2, "gain_part": 4} s.exclude = ['StatePlaneCAII', 'SummaryFiles', 'StatePlaneII'] print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) path = os.path.join(data, "Oct_2014", "Arc_101414") s = slurp.Slurper() s.add_new_sites = True s.dst = True s.site_function_params = {"site_part": 3, "gain_part": 4} s.exclude = ['StatePlaneCAII', 'SummaryFiles', 'StatePlaneII'] print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) path = os.path.join(data, "Oct_2014", "Arc_101714") s = slurp.Slurper() s.add_new_sites = True s.dst = True s.site_function_params = {"site_part": 2, "gain_part": 3} s.exclude = ['StatePlaneCAII', 'SummaryFiles', 'StatePlaneII'] print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) def nov(): print("Nov 2014") path = os.path.join(data, "Nov_2014") s = slurp.Slurper() s.add_new_sites = True s.dst = True s.site_function_params = {"site_part": 2, "gain_part": 4} s.exclude = ['StatePlaneCAII', 'SummaryFiles', 'StatePlaneII'] print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) def dec(): print("Dec 2014") path = os.path.join(data, "Dec_2014") s = slurp.Slurper() s.add_new_sites = True s.dst = True s.site_function_params = {"site_part": 2, "gain_part": 4} s.exclude = ['StatePlaneCAII', 'SummaryFiles', 'StatePlaneII', 'Arc_121614'] print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) path = os.path.join(data, "Dec_2014", "Arc_121614") s = slurp.Slurper() s.add_new_sites = True s.dst = True s.site_function_params = {"site_part": 2, "gain_part": 4} s.exclude = ['StatePlaneCAII', 'SummaryFiles', 'StatePlaneII'] print("Adding gain files to database") s.slurp_gains(path) print("Adding water quality transects to database") s.slurp_trans(path) def main(month="ALL"): if month == "ALL": jan() feb() mar() apr() may() jun() jul() aug() sep() oct() nov() dec() else: month if __name__ == '__main__': main()
# No shebang line, this module is meant to be imported # # Copyright 2013 Oliver Palmer # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """ Agent Models ============ Models and interface classes related to the agent. """ import re import uuid from datetime import datetime from sqlalchemy import or_ from sqlalchemy.schema import UniqueConstraint from sqlalchemy.orm import validates from netaddr import AddrFormatError, IPAddress from pyfarm.core.enums import ( AgentState, STRING_TYPES, UseAgentAddress, INTEGER_TYPES, WorkState) from pyfarm.master.config import config from pyfarm.master.application import db from pyfarm.models.core.functions import repr_ip from pyfarm.models.core.mixins import ( ValidatePriorityMixin, UtilityMixins, ReprMixin, ValidateWorkStateMixin) from pyfarm.models.core.types import ( id_column, IPv4Address, IDTypeAgent, IDTypeWork, UseAgentAddressEnum, OperatingSystemEnum, AgentStateEnum, MACAddress) from pyfarm.models.jobtype import JobTypeVersion from pyfarm.models.job import Job __all__ = ("Agent", ) ALLOW_AGENT_LOOPBACK = config.get("allow_agents_from_loopback") REGEX_HOSTNAME = re.compile("^(?!-)[A-Z\d-]{1,63}(?<!-)" "(\.(?!-)[A-Z\d-]{1,63}(?<!-))*\.?$", re.IGNORECASE) AgentSoftwareVersionAssociation = db.Table( config.get("table_agent_software_version_assoc"), db.metadata, db.Column( "agent_id", IDTypeAgent, db.ForeignKey("%s.id" % config.get("table_agent")), primary_key=True), db.Column( "software_version_id", db.Integer, db.ForeignKey("%s.id" % config.get("table_software_version")), primary_key=True)) AgentTagAssociation = db.Table( config.get("table_agent_tag_assoc"), db.metadata, db.Column( "agent_id", IDTypeAgent, db.ForeignKey("%s.id" % config.get("table_agent")), primary_key=True), db.Column( "tag_id", db.Integer, db.ForeignKey("%s.id" % config.get("table_tag")), primary_key=True)) FailedTaskInAgent = db.Table( config.get("table_failed_task_in_agent"), db.metadata, db.Column( "agent_id", IDTypeAgent, db.ForeignKey("%s.id" % config.get("table_agent")), primary_key=True), db.Column( "task_id", IDTypeWork, db.ForeignKey("%s.id" % config.get("table_task")), primary_key=True)) GPUInAgent = db.Table( config.get("table_gpu_in_agent"), db.metadata, db.Column( "agent_id", IDTypeAgent, db.ForeignKey("%s.id" % config.get("table_agent")), primary_key=True), db.Column( "gpu_id", db.Integer, db.ForeignKey("%s.id" % config.get("table_gpu")), primary_key=True)) class AgentTaggingMixin(object): """ Mixin used which provides some common structures to :class:`.AgentTag` and :class:`.AgentSoftware` """ @validates("tag", "software") def validate_string_column(self, key, value): """ Ensures `value` is a string or something that can be converted to a string. """ if isinstance(value, INTEGER_TYPES): value = str(value) elif not isinstance(value, STRING_TYPES): raise ValueError("expected a string for `%s`" % key) return value class AgentMacAddress(db.Model): __tablename__ = config.get("table_agent_mac_address") __table_args__ = (UniqueConstraint("agent_id", "mac_address"), ) agent_id = db.Column( IDTypeAgent, db.ForeignKey("%s.id" % config.get("table_agent")), primary_key=True, nullable=False) mac_address = db.Column( MACAddress, primary_key=True, nullable=False, autoincrement=False) class Agent(db.Model, ValidatePriorityMixin, ValidateWorkStateMixin, UtilityMixins, ReprMixin): """ Stores information about an agent include its network address, state, allocation configuration, etc. .. note:: This table enforces two forms of uniqueness. The :attr:`id` column must be unique and the combination of these columns must also be unique to limit the frequency of duplicate data: * :attr:`hostname` * :attr:`port` * :attr:`id` """ __tablename__ = config.get("table_agent") __table_args__ = (UniqueConstraint("hostname", "port", "id"), ) STATE_ENUM = AgentState STATE_DEFAULT = "online" REPR_COLUMNS = ( "id", "hostname", "port", "state", "remote_ip", "cpus", "ram", "free_ram") REPR_CONVERT_COLUMN = {"remote_ip": repr_ip} URL_TEMPLATE = config.get("agent_api_url_template") MIN_PORT = config.get("agent_min_port") MAX_PORT = config.get("agent_max_port") MIN_CPUS = config.get("agent_min_cpus") MAX_CPUS = config.get("agent_max_cpus") MIN_RAM = config.get("agent_min_ram") MAX_RAM = config.get("agent_max_ram") # quick check of the configured data assert MIN_PORT >= 1, "`agent_min_port` must be > 0" assert MAX_PORT >= 1, "`agent_max_port` must be > 0" assert MAX_PORT >= MIN_PORT, "MIN_PORT must be <= MAX_PORT" assert MIN_CPUS >= 1, "`agent_min_cpus` must be > 0" assert MAX_CPUS >= 1, "`agent_max_cpus` must be > 0" assert MAX_CPUS >= MIN_CPUS, "MIN_CPUS must be <= MAX_CPUS" assert MIN_RAM >= 1, "`agent_min_ram` must be > 0" assert MAX_RAM >= 1, "`agent_max_ram` must be > 0" assert MAX_RAM >= MIN_RAM, "`agent_min_ram` must be <= `agent_max_ram`" id = id_column(IDTypeAgent, default=uuid.uuid4, autoincrement=False) # basic host attribute information hostname = db.Column( db.String(config.get("max_hostname_length")), nullable=False, doc="The hostname we should use to talk to this host. " "Preferably this value will be the fully qualified " "name instead of the base hostname alone.") notes = db.Column( db.Text, default="", doc="Free form notes about this agent") remote_ip = db.Column( IPv4Address, nullable=True, doc="the remote address which came in with the request") use_address = db.Column( UseAgentAddressEnum, nullable=False, default=UseAgentAddress.REMOTE, doc="The address we should use when communicating with the agent") # TODO Make non-nullable later os_class = db.Column( OperatingSystemEnum, doc="The type of operating system running on the " "agent; 'linux', 'windows', or 'mac'.") os_fullname = db.Column( db.String(config.get("max_osname_length")), doc="The full human-readable name of the agent's OS, as returned " "by platform.platform()") ram = db.Column( db.Integer, nullable=False, doc="The amount of ram installed on the agent in megabytes") free_ram = db.Column( db.Integer, nullable=False, doc="The amount of ram which was last considered free") cpus = db.Column( db.Integer, nullable=False, doc="The number of logical CPU cores installed on the agent") cpu_name = db.Column( db.String(config.get("max_cpuname_length")), doc="The make and model of CPUs in this agents") port = db.Column( db.Integer, nullable=False, doc="The port the agent is currently running on") time_offset = db.Column( db.Integer, nullable=False, default=0, doc="The offset in seconds the agent is from an official time server") version = db.Column( db.String(16), nullable=True, doc="The pyfarm version number this agent is running.") upgrade_to = db.Column( db.String(16), nullable=True, doc="The version this agent should upgrade to.") restart_requested = db.Column( db.Boolean, default=False, nullable=False, doc="If True, the agent will be restarted") # host state state = db.Column( AgentStateEnum, default=AgentState.ONLINE, nullable=False, doc="Stores the current state of the host. This value can be " "changed either by a master telling the host to do " "something with a task or from the host via REST api.") last_heard_from = db.Column( db.DateTime, default=datetime.utcnow, doc="Time we last had contact with this agent") last_success_on = db.Column( db.DateTime, nullable=True, doc="The last time this agent has set a task to `done`") last_polled = db.Column( db.DateTime, doc="Time we last tried to contact the agent") # Max allocation of the two primary resources which `1.0` is 100% # allocation. For `cpu_allocation` 100% allocation typically means # one task per cpu. ram_allocation = db.Column( db.Float, default=config.get("agent_ram_allocation"), doc="The amount of ram the agent is allowed to allocate " "towards work. A value of 1.0 would mean to let the " "agent use all of the memory installed on the system " "when assigning work.") cpu_allocation = db.Column( db.Float, default=config.get("agent_cpu_allocation"), doc="The total amount of cpu space an agent is allowed to " "process work in. A value of 1.0 would mean an agent " "can handle as much work as the system could handle " "given the requirements of a task. For example if " "an agent has 8 cpus, cpu_allocation is .5, and a " "task requires 4 cpus then only that task will " "run on the system.") # # Relationships # tasks = db.relationship( "Task", backref="agent", lazy="dynamic", doc="Relationship between an :class:`Agent` and any " ":class:`pyfarm.models.Task` objects") tags = db.relationship( "Tag", secondary=AgentTagAssociation, backref=db.backref("agents", lazy="dynamic"), lazy="dynamic", doc="Tags associated with this agent") software_versions = db.relationship( "SoftwareVersion", secondary=AgentSoftwareVersionAssociation, backref=db.backref("agents", lazy="dynamic"), lazy="dynamic", doc="software this agent has installed or is configured for") mac_addresses = db.relationship( "AgentMacAddress", backref="agent", lazy="dynamic", doc="The MAC addresses this agent has", cascade="save-update, merge, delete, delete-orphan") gpus = db.relationship( "GPU", secondary=GPUInAgent, backref=db.backref("agents", lazy="dynamic"), lazy="dynamic", doc="The graphics cards that are installed in this agent") disks = db.relationship( "AgentDisk", backref=db.backref("agent"), lazy="dynamic", doc="The known disks available to this agent", cascade="save-update, merge, delete, delete-orphan") failed_tasks = db.relationship( "Task", secondary=FailedTaskInAgent, backref=db.backref("failed_in_agents", lazy="dynamic"), lazy="dynamic", doc="The tasks this agents failed to execute") def is_offline(self): return self.state == AgentState.OFFLINE def is_disabled(self): return self.state == AgentState.DISABLED def get_supported_types(self): try: return self.support_jobtype_versions except AttributeError: jobtype_versions_query = JobTypeVersion.query.filter( JobTypeVersion.jobs.any( or_(Job.state == None, Job.state == WorkState.RUNNING))) self.support_jobtype_versions = [] for jobtype_version in jobtype_versions_query: if self.satisfies_jobtype_requirements(jobtype_version): self.support_jobtype_versions.append(jobtype_version.id) return self.support_jobtype_versions def satisfies_jobtype_requirements(self, jobtype_version): requirements_to_satisfy = list(jobtype_version.software_requirements) for software_version in self.software_versions: for requirement in list(requirements_to_satisfy): if (software_version.software == requirement.software and (requirement.min_version == None or requirement.min_version.rank <= software_version.rank) and (requirement.max_version == None or requirement.max_version.rank >= software_version.rank)): requirements_to_satisfy.remove(requirement) return len(requirements_to_satisfy) == 0 def satisfies_job_requirements(self, job): if not self.satisfies_jobtype_requirements(job.jobtype_version): return False if self.cpus < job.cpus: return False if self.free_ram < job.ram: return False for tag_requirement in job.tag_requirements: if (not tag_requirement.negate and tag_requirement.tag not in self.tags): return False if (tag_requirement.negate and tag_requirement.tag in self.tags): return False return True @classmethod def validate_hostname(cls, key, value): """ Ensures that the hostname provided by `value` matches a regular expression that expresses what a valid hostname is. """ # ensure hostname does not contain characters we can't use if not REGEX_HOSTNAME.match(value): raise ValueError("%s is not valid for %s" % (value, key)) return value @classmethod def validate_resource(cls, key, value): """ Ensure the ``value`` provided for ``key`` is within an expected range. This classmethod retrieves the min and max values from the :class:`Agent` class directory using: >>> min_value = getattr(Agent, "MIN_%s" % key.upper()) >>> max_value = getattr(Agent, "MAX_%s" % key.upper()) """ min_value = getattr(cls, "MIN_%s" % key.upper()) max_value = getattr(cls, "MAX_%s" % key.upper()) # check the provided input if not min_value <= value <= max_value: msg = "value for `%s` must be between " % key msg += "%s and %s" % (min_value, max_value) raise ValueError(msg) return value @classmethod def validate_ipv4_address(cls, _, value): """ Ensures the :attr:`ip` address is valid. This checks to ensure that the value provided is: * not a hostmask * not link local (:rfc:`3927`) * not used for multicast (:rfc:`1112`) * not a netmask (:rfc:`4632`) * not reserved (:rfc:`6052`) * a private address (:rfc:`1918`) """ if value is None: return value try: address = IPAddress(value) except (AddrFormatError, ValueError) as e: raise ValueError( "%s is not a valid address format: %s" % (value, e)) if ALLOW_AGENT_LOOPBACK: loopback = lambda: False else: loopback = address.is_loopback if any([address.is_hostmask(), address.is_link_local(), loopback(), address.is_multicast(), address.is_netmask(), address.is_reserved()]): raise ValueError("%s is not a valid address type" % value) return value def api_url(self): """ Returns the base url which should be used to access the api of this specific agent. :except ValueError: Raised if this function is called while the agent's :attr:`use_address` column is set to ``PASSIVE`` """ if self.use_address == UseAgentAddress.REMOTE: return self.URL_TEMPLATE.format( host=self.remote_ip, port=self.port ) elif self.use_address == UseAgentAddress.HOSTNAME: return self.URL_TEMPLATE.format( host=self.hostname, port=self.port ) else: raise ValueError( "Cannot construct an agent API url using mode %r " "`use_address`" % self.use_address) @validates("hostname") def validate_hostname_column(self, key, value): """Validates the hostname column""" return self.validate_hostname(key, value) @validates("ram", "cpus", "port") def validate_numeric_column(self, key, value): """ Validates several numerical columns. Columns such as ram, cpus and port a are validated with this method. """ return self.validate_resource(key, value) @validates("remote_ip") def validate_remote_ip(self, key, value): """Validates the remote_ip column""" return self.validate_ipv4_address(key, value)
# Copyright 2021, Kay Hayen, mailto:kay.hayen@gmail.com # # Part of "Nuitka", an optimizing Python compiler that is compatible and # integrates with CPython, but also works on its own. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # """ Reformulation of dictionary creations. Dictionary creations might be directly translated to constants, or they might become nodes that build dictionaries. For Python3.5, unpacking can happen while creating dictionaries, these are being re-formulated to an internal function. Consult the developer manual for information. TODO: Add ability to sync source code comments with developer manual sections. """ from nuitka.nodes.AssignNodes import ( StatementAssignmentVariable, StatementReleaseVariable, ) from nuitka.nodes.AttributeNodes import ExpressionAttributeLookup from nuitka.nodes.BuiltinIteratorNodes import ExpressionBuiltinIter1 from nuitka.nodes.BuiltinNextNodes import ExpressionBuiltinNext1 from nuitka.nodes.ConstantRefNodes import makeConstantRefNode from nuitka.nodes.ContainerMakingNodes import makeExpressionMakeTuple from nuitka.nodes.DictionaryNodes import ( ExpressionKeyValuePair, StatementDictOperationUpdate, makeExpressionMakeDict, makeExpressionMakeDictOrConstant, makeExpressionPairs, ) from nuitka.nodes.ExceptionNodes import ( ExpressionBuiltinMakeException, StatementRaiseException, ) from nuitka.nodes.FunctionNodes import ( ExpressionFunctionCall, ExpressionFunctionCreation, ExpressionFunctionRef, ) from nuitka.nodes.LoopNodes import StatementLoop, StatementLoopBreak from nuitka.nodes.OperatorNodes import makeBinaryOperationNode from nuitka.nodes.ReturnNodes import StatementReturn from nuitka.nodes.TypeNodes import ExpressionBuiltinType1 from nuitka.nodes.VariableRefNodes import ( ExpressionTempVariableRef, ExpressionVariableRef, ) from nuitka.PythonVersions import python_version from nuitka.specs.ParameterSpecs import ParameterSpec from .InternalModule import ( internal_source_ref, makeInternalHelperFunctionBody, once_decorator, ) from .ReformulationTryExceptStatements import makeTryExceptSingleHandlerNode from .ReformulationTryFinallyStatements import makeTryFinallyStatement from .TreeHelpers import ( buildNode, buildNodeList, makeStatementsSequenceFromStatement, makeStatementsSequenceFromStatements, ) def buildDictionaryNode(provider, node, source_ref): if python_version >= 0x350: for key in node.keys: if key is None: return buildDictionaryUnpacking( provider=provider, node=node, source_ref=source_ref ) return makeExpressionMakeDictOrConstant( pairs=makeExpressionPairs( keys=buildNodeList(provider, node.keys, source_ref), values=buildNodeList(provider, node.values, source_ref), ), user_provided=True, source_ref=source_ref, ) @once_decorator def getDictUnpackingHelper(): helper_name = "_unpack_dict" result = makeInternalHelperFunctionBody( name=helper_name, parameters=ParameterSpec( ps_name=helper_name, ps_normal_args=(), ps_list_star_arg="args", ps_dict_star_arg=None, ps_default_count=0, ps_kw_only_args=(), ps_pos_only_args=(), ), ) temp_scope = None tmp_result_variable = result.allocateTempVariable(temp_scope, "dict") tmp_iter_variable = result.allocateTempVariable(temp_scope, "iter") tmp_item_variable = result.allocateTempVariable(temp_scope, "keys") loop_body = makeStatementsSequenceFromStatements( makeTryExceptSingleHandlerNode( tried=StatementAssignmentVariable( variable=tmp_item_variable, source=ExpressionBuiltinNext1( value=ExpressionTempVariableRef( variable=tmp_iter_variable, source_ref=internal_source_ref ), source_ref=internal_source_ref, ), source_ref=internal_source_ref, ), exception_name="StopIteration", handler_body=StatementLoopBreak(source_ref=internal_source_ref), source_ref=internal_source_ref, ), makeTryExceptSingleHandlerNode( tried=StatementDictOperationUpdate( dict_arg=ExpressionTempVariableRef( variable=tmp_result_variable, source_ref=internal_source_ref ), value=ExpressionTempVariableRef( variable=tmp_item_variable, source_ref=internal_source_ref ), source_ref=internal_source_ref, ), exception_name="AttributeError", handler_body=StatementRaiseException( exception_type=ExpressionBuiltinMakeException( exception_name="TypeError", args=( makeBinaryOperationNode( operator="Mod", left=makeConstantRefNode( constant="""\ '%s' object is not a mapping""", source_ref=internal_source_ref, user_provided=True, ), right=makeExpressionMakeTuple( elements=( ExpressionAttributeLookup( expression=ExpressionBuiltinType1( value=ExpressionTempVariableRef( variable=tmp_item_variable, source_ref=internal_source_ref, ), source_ref=internal_source_ref, ), attribute_name="__name__", source_ref=internal_source_ref, ), ), source_ref=internal_source_ref, ), source_ref=internal_source_ref, ), ), source_ref=internal_source_ref, ), exception_value=None, exception_trace=None, exception_cause=None, source_ref=internal_source_ref, ), source_ref=internal_source_ref, ), ) args_variable = result.getVariableForAssignment(variable_name="args") final = ( StatementReleaseVariable( variable=tmp_result_variable, source_ref=internal_source_ref ), StatementReleaseVariable( variable=tmp_iter_variable, source_ref=internal_source_ref ), StatementReleaseVariable( variable=tmp_item_variable, source_ref=internal_source_ref ), ) tried = makeStatementsSequenceFromStatements( StatementAssignmentVariable( variable=tmp_iter_variable, source=ExpressionBuiltinIter1( value=ExpressionVariableRef( variable=args_variable, source_ref=internal_source_ref ), source_ref=internal_source_ref, ), source_ref=internal_source_ref, ), StatementAssignmentVariable( variable=tmp_result_variable, source=makeConstantRefNode(constant={}, source_ref=internal_source_ref), source_ref=internal_source_ref, ), StatementLoop(loop_body=loop_body, source_ref=internal_source_ref), StatementReturn( expression=ExpressionTempVariableRef( variable=tmp_result_variable, source_ref=internal_source_ref ), source_ref=internal_source_ref, ), ) result.setChild( "body", makeStatementsSequenceFromStatement( makeTryFinallyStatement( provider=result, tried=tried, final=final, source_ref=internal_source_ref, ) ), ) return result def buildDictionaryUnpackingArgs(provider, keys, values, source_ref): result = [] for key, value in zip(keys, values): # TODO: We could be a lot cleverer about the dictionaries for non-starred # arguments, but lets get this to work first. if key is None: result.append(buildNode(provider, value, source_ref)) elif type(key) is str: result.append( makeExpressionMakeDict( pairs=( ExpressionKeyValuePair( key=makeConstantRefNode( constant=key, source_ref=source_ref ), value=buildNode(provider, value, source_ref), source_ref=source_ref, ), ), source_ref=source_ref, ) ) else: result.append( makeExpressionMakeDict( pairs=( ExpressionKeyValuePair( key=buildNode(provider, key, source_ref), value=buildNode(provider, value, source_ref), source_ref=source_ref, ), ), source_ref=source_ref, ) ) return result def buildDictionaryUnpacking(provider, node, source_ref): helper_args = buildDictionaryUnpackingArgs( provider, node.keys, node.values, source_ref ) result = ExpressionFunctionCall( function=ExpressionFunctionCreation( function_ref=ExpressionFunctionRef( function_body=getDictUnpackingHelper(), source_ref=source_ref ), defaults=(), kw_defaults=None, annotations=None, source_ref=source_ref, ), values=(makeExpressionMakeTuple(helper_args, source_ref),), source_ref=source_ref, ) result.setCompatibleSourceReference(helper_args[-1].getCompatibleSourceReference()) return result
#!/usr/bin/env python3 from netcdfTools import * import sys import argparse import numpy as np from utilities import filesFromList, writeLog ''' Description: Author: Mikko Auvinen mikko.auvinen@helsinki.fi University of Helsinki & Finnish Meteorological Institute ''' #==========================================================# parser = argparse.ArgumentParser(prog='extractReynoldsStressNetCdf.py') parser.add_argument("fileKey", default=None,\ help="Search string for collecting files.") parser.add_argument("-o", "--outstr",type=str, default="RS",\ help="Prefix for the output NETCDF file. Default=RS.") parser.add_argument("-vn", "--vnames",type=str, nargs=3, default=['up','vp','wp'],\ help="Names of the V or V^prime comps in (x,y,z)-order. Default = ['up','vp','wp'].") parser.add_argument("-np", "--notPrimes", action="store_true", default=False,\ help="Input data not as V^prime. They should be computed.") parser.add_argument("-sn", "--sname",type=str, default=None,\ help="Name of scalar s^prime. Default = None.") parser.add_argument("-nt", "--ntimeskip", type=int, default=0,\ help="Skip <nt> number of time steps. Default = 0.") parser.add_argument("-c", "--coarse", type=int, default=1,\ help="Coarsening level. Int > 1. Default = 1.") args = parser.parse_args() writeLog( parser, args ) #==========================================================# # Initial renaming operations and variable declarations fileKey = args.fileKey outstr = args.outstr vnames = args.vnames sname = args.sname notPrimes = args.notPrimes nt = args.ntimeskip cl = abs(int(args.coarse)) ''' Establish two boolean variables which indicate whether the created variable is an independent or dependent variable in function createNetcdfVariable(). ''' parameter = True; variable = False # Obtain a list of files to include. fileNos, fileList = filesFromList( fileKey+'*' ) for fn in fileNos: fileout = outstr+fileList[fn].split('_')[-1] # = = = = = = = = = = = = = = = = = = = = = = = = = = = = = # # Read in data. dataDict = read3dDataFromNetCDF( fileList[fn] , vnames[0], cl ) up = dataDict['v'] # Commented out temporarily by Mikko # ''' dataDict = read3dDataFromNetCDF( fileList[fn] , vnames[1], cl ) vp = dataDict['v'] ''' dataDict = read3dDataFromNetCDF( fileList[fn] , vnames[2], cl ) wp = dataDict['v'] if( notPrimes ): # Perform coord. rotation for horizontal components um = np.mean( up, axis=(0) ); vm = np.mean( vp , axis=(0) ) a = np.arctan( vm/(um+1.e-5) ) u1 = up * np.cos(a) + vp * np.sin(a) # Streamwise comp. v1 =-up * np.sin(a) + vp * np.cos(a) # Spanwise comp. up = u1; vp = v1 up -= um vp -= vm wp -= np.mean( wp, axis=(0) ) # Coords and time: x = dataDict['x']; y = dataDict['y']; z = dataDict['z'] time = dataDict['time']; time_dim = len(time) dataDict = None # = = = = = = = = = = = = = = = = = = = = = = = = = = = = = # # Create a NETCDF output dataset (dso) for writing out the data. dso = netcdfOutputDataset( fileout ) # Create the output independent variables right away and empty memory. tv = createNetcdfVariable( dso, time,'time', time_dim,'s','f4',('time',), parameter ) time = None xv = createNetcdfVariable( dso, x , 'x' , len(x) , 'm', 'f4', ('x',) , parameter ) x = None yv = createNetcdfVariable( dso, y , 'y' , len(y) , 'm', 'f4', ('y',) , parameter ) y = None zv = createNetcdfVariable( dso, z , 'z' , len(z) , 'm', 'f4', ('z',) , parameter ) z = None if( notPrimes ): # Streamwise velocity u1o = createNetcdfVariable(\ dso, up, 'u1', time_dim, 'm s^(-1)', 'f4',('time','z','y','x',) , variable ) u2o = createNetcdfVariable(\ dso, vp, 'u2', time_dim, 'm s^(-1)', 'f4',('time','z','y','x',) , variable ) u1mo = createNetcdfVariable(\ dso, um, 'um1', time_dim, 'm s^(-1)', 'f4',('z','y','x',) , variable ) u2mo = createNetcdfVariable(\ dso, vm, 'um2', time_dim, 'm s^(-1)', 'f4',('z','y','x',) , variable ) # First resolved TKE: tns = 0.5*( up**2 + wp**2 ) ## 0.5*( up**2 + vp**2 + wp**2 ) tkeo = createNetcdfVariable(\ dso, tns, 'tns', time_dim, 'm^2 s^(-2)', 'f4',('time','z','y','x',) , variable ) tns = None tke = 0.5*( np.mean(up**2, axis=0) + np.mean(wp**2, axis=0) ) #0.5*( np.mean(up**2, axis=0) + np.mean(vp**2, axis=0) + np.mean(wp**2, axis=0) ) rtke = createNetcdfVariable(\ dso, tke, 'tke', time_dim, 'm^2 s^(-2)', 'f4',('z','y','x',) , variable ) tke = None # uu uu = up * up uuo = createNetcdfVariable(\ dso, uu, 'cov_uu', time_dim, 'm^2 s^(-2)', 'f4',('time','z','y','x',) , variable ) ruu = createNetcdfVariable(\ dso, np.mean(uu, axis=0), 'r_uu', time_dim, 'm^2 s^(-2)', 'f4',('z','y','x',) , variable ) uu = None ''' # uv uv = up * vp uvo = createNetcdfVariable(\ dso, uv, 'cov_uv', time_dim, 'm^2 s^(-2)', 'f4',('time','z','y','x',) , variable ) ruv = createNetcdfVariable(\ dso, np.mean(uv, axis=0), 'r_uv', time_dim, 'm^2 s^(-2)', 'f4',('z','y','x',) , variable ) uv = None ''' # uw uw = up * wp uwo = createNetcdfVariable(\ dso, uw, 'cov_uw', time_dim, 'm^2 s^(-2)', 'f4',('time','z','y','x',) , variable ) ruw = createNetcdfVariable(\ dso, np.mean(uw, axis=0), 'r_uw', time_dim, 'm^2 s^(-2)', 'f4',('z','y','x',) , variable ) uw = None ''' # vv vv = vp * vp vvo = createNetcdfVariable(\ dso, vv, 'cov_vv', time_dim, 'm^2 s^(-2)', 'f4',('time','z','y','x',) , variable ) rvv = createNetcdfVariable(\ dso, np.mean(vv, axis=0), 'r_vv', time_dim, 'm^2 s^(-2)', 'f4',('z','y','x',) , variable ) vv = None vw = vp * wp vwo = createNetcdfVariable(\ dso, vw, 'cov_vw', time_dim, 'm^2 s^(-2)', 'f4',('time','z','y','x',) , variable ) rvw = createNetcdfVariable(\ dso, np.mean(vw, axis=0), 'r_vw', time_dim, 'm^2 s^(-2)', 'f4',('z','y','x',) , variable ) vw = None ''' # ww ww = wp * wp wwo = createNetcdfVariable(\ dso, ww, 'cov_ww', time_dim, 'm^2 s^(-2)', 'f4',('time','z','y','x',) , variable ) rww = createNetcdfVariable(\ dso, np.mean(ww, axis=0), 'r_ww', time_dim, 'm^2 s^(-2)', 'f4',('z','y','x',) , variable ) ww = None if( sname ): dataDict = read3dDataFromNetCDF( fileList[fn] , sname, cl ) sp = dataDict['v'] if( notPrimes ): sp -= np.mean( sp, axis=(0) ) dataDict = None sstr = sname[:-1] # Remove the 'p' (or similar) from the end. us = up * sp uso = createNetcdfVariable(\ dso, us, 'cov_u'+sstr, time_dim, 'm s^(-1) []', 'f4',('time','z','y','x',), variable) rus = createNetcdfVariable(\ dso, np.mean(us, axis=0), 'r_u'+sstr, time_dim, 'm s^(-1) []', 'f4',('z','y','x',), variable) us = None vs = vp * sp vso = createNetcdfVariable(\ dso, vs, 'cov_v'+sstr, time_dim, 'm s^(-1) []', 'f4',('time','z','y','x',), variable) rvs = createNetcdfVariable(\ dso, np.mean(vs, axis=0), 'r_v'+sstr, time_dim, 'm s^(-1) []', 'f4',('z','y','x',), variable) vs = None ws = wp * sp wso = createNetcdfVariable(\ dso, ws, 'cov_w'+sstr , time_dim, 'm s^(-1) []', 'f4',('time','z','y','x',), variable) rws = createNetcdfVariable(\ dso, np.mean(ws, axis=0), 'r_w'+sstr, time_dim, 'm s^(-1) []', 'f4',('z','y','x',), variable) ws = None # - - - - Done , finalize the output - - - - - - - - - - netcdfWriteAndClose( dso )
import xmlrpc.client import ssl import socket # Required for network/socket connections import os # Required for Forking/child processes import time # Required for sleep call import threading # Required for communication sub-threads import pymysql import server_monitor as myServer import certs.gencert as gencert import config import logging from logging.config import fileConfig # Load logging config fileConfig('setup/logging.conf') log = logging.getLogger(__name__) # Global Variables -- Don't change. [No need to change.] CERTFILE = "certs/domains/local.cert" # Placeholder; updated when executed KEYFILE = "certs/domains/local.key" # Default; updated when executed hostIP = "localhost" # Default; updated when executed admin_selected = False # Return ip address of local host where server is running def getMyIP(): log.info('Getting Host ip address.') s = socket.socket(socket.AF_INET, socket.SOCK_DGRAM) s.connect(("8.8.8.8", 53)) ipAdd = s.getsockname()[0] s.close() log.debug('Socket closed: ipAdd=%s' % ipAdd) return ipAdd # Return host name/fqdn of based on give ip address def findHostName(ipAddress): log.info('Finding Host Name based on ip address') try: log.debug('Trying now...') name, alias, addresslist = socket.gethostbyaddr(ipAddress) log.debug('Returning name: %s' % name) return name except socket.herror: log.exception("Hostname/FQDN not found: Hostname/FQDN Required. " "Correct by adding record in DNS server or within local" "hosts file (/etc/hosts) and then restart controller.") return "None" # Create SSL certs for current ip address if not already present def verifyCerts(): global CERTFILE global KEYFILE # Determine file path based on current ip address CERTFILE = ''.join([config.certPath, config.rootDomain, ".cert"]) KEYFILE = ''.join([config.certPath, config.rootDomain, ".key"]) log.debug("CERTFILE: %s" % (CERTFILE)) log.debug("KEYFILE: %s" % (KEYFILE)) # If cert or key file not present, create new certs if not os.path.isfile(CERTFILE) or not os.path.isfile(KEYFILE): gencert.gencert(config.rootDomain) log.info("Certfile(s) NOT present; new certs created.") print("Certfile(s) NOT present; new certs created.") else: log.info("Certfiles Verified Present") print("Certfiles Verified Present.") # Start a thread child to run server connection as a daemon def startServer(): log.info("Starting Server...") # Now, start thread log.debug("Starting new thread...") t = threading.Thread(name="Monitor_ServerDaemon", target=myServer.runServer, args=(hostIP, config.mntrServerPort, CERTFILE, KEYFILE ) ) t.daemon = True t.start() log.debug("Thread started; end of startServer fn.") # Check and Display the status of all child processes def checkStatus(): log.debug("Checking Status of Threads...") totalThreads = threading.active_count() subThreads = totalThreads - 1 print("\nSub-Thread(s): %d" % (subThreads)) main_thread = threading.currentThread() k = 1 for t in threading.enumerate(): if t is main_thread: continue print("Thread #%d:" % (k)) print("Name: %s" % (t.name)) print("Ident: %d" % (t.ident)) ans = "unknown" if t.is_alive(): ans = "YES" else: ans = "NO" print("Alive? %s\n" % (ans)) k = k+1 log.debug("End of checkStatus fn.") # Display Status of all Hosts currently connected def displayStatus(): log.debug("Displaying agents now") print("Displaying agents currently connected...") # Connect to database to query agents log.debug("Connecting to database") db = pymysql.connect(host=config.mysqlHost, port=config.mysqlPort, user=config.mntrMysqlUser, passwd=config.mntrMysqlPwd, db=config.mysqlDB) cursor = db.cursor() # Query to retrieve id/time of registration sql = "SELECT distinct agent FROM status;" agents = [] # Get agents try: # Execute the SQL command cursor.execute(sql) # Fetch all the rows in a list of lists results = cursor.fetchall() for row in results: thisAgent = row[0] agents.append(thisAgent) log.debug("Agent Received as: %s" % (thisAgent)) except: log.exception("ERROR in db query>> %s" % sql) print("FOUND %d agent(s) monitored.\n" % len(agents)) # Query to retrieve each agents's data for k in range(len(agents)): sql = "SELECT agent, status, timestamp, alias, id FROM "\ "status where agent = '%s' ORDER BY id "\ "DESC LIMIT 1" % (agents[k]) # Get host info try: # Execute the SQL command cursor.execute(sql) # Fetch all the rows in a list of lists results = cursor.fetchall() print("Agent #%d" % (k + 1)) for row in results: thisAgent = row[0] thisStatus = row[1] thisTime = row[2] thisAlias = row[3] thisID = row[4] print("Agent: %s" % thisAgent) print("Alias: %s" % thisAlias) print("Status: %s" % thisStatus) print("Time Connected: %s" % thisTime) print("ID Number: %s\n" % thisID) log.debug("Host %d Displayed" % (k + 1)) except: log.exception("ERROR in db query>> %s" % sql) # Disconnect from database db.close() # Simple test function to ensure communication is working def mathTest(): log.debug("Start of Math Test Function...") myContext = ssl.create_default_context() myContext.load_verify_locations(config.CACERTFILE) myurl = ''.join(['https://', config.agntHostName, ':', str(config.agntServerPort)]) with xmlrpc.client.ServerProxy(myurl, context=myContext) as proxy: try: print("5 + 9 is %d" % (proxy.add(5, 9))) print("21 x 3 is: %d" % (proxy.multiply(21, 3))) except ConnectionRefusedError: log.warning("Connection to Agent FAILED") print("Connection to Agent Server FAILED:\n", "Is Agent listening? Confirm connection", "settings and try again.") print("Settings used: '%s'" % myurl) except: log.warning("Connection to Agent FAILED") print("Connection Failed. Suspected incorrect URL.") print("Settings used: '%s'" % myurl) # Quit gracefully after terminting all child processes def myQuit(): log.info("Monitor Exiting. Goodbye.") print("Monitor Exiting. Goodbye.\n") raise SystemExit # Stop Controller Server def stopServer(): log.debug("Stopping Monitor Server.") # TODO Determine if it is possible to stop a daemon thread # without stopping the whole program; for now, this just # ends the entire program print("Monitor Server Stopping.") myQuit() def invalid(choice): log.debug("Invalid choice: %s" % choice) print("INVALID CHOICE!") def adminMenu(): log.debug("Displaying admin menu") print("\nAdmin Menu:") print("a) Connection Test with Agent (simple math test)") print("b) SSL Verification (verify certificates") print("c) STOP Monitor Server (program will exit)") print("d) START* Monitor Server (*only if not running already)") print("9) BACK (return to 'Menu')") return input("Make a Choice\n>>> ") def adminSelection(): global admin_selected adminChoice = adminMenu() if adminChoice == "a": mathTest() elif adminChoice == "b": verifyCerts() elif adminChoice == "c": stopServer() elif adminChoice == "d": startServer() elif adminChoice == "9": log.debug("Admin is De-selected") print("Back to Main Menu...") admin_selected = False elif adminChoice == "r": # Refresh Menu (do nothing) log.info("Refreshing Menu") elif adminChoice in ["q", ":q"]: myQuit() else: invalid(adminChoice) def menu(): log.debug("Displaying menu") print("\n\nMENU[Monitor]:") print("1) Check MONITOR server status") print("2) Display Current Status") print("9) ADMIN MENU") print("q) QUIT") return input("Make a Choice\n>>> ") def myMenu(): global admin_selected choice = 0 if admin_selected: choice = "9" else: choice = menu() if choice == "1": checkStatus() elif choice == "2": displayStatus() elif choice == "9": admin_selected = True log.debug("Admin is Selected") adminSelection() elif choice in ["q", ":q"]: myQuit() elif choice == "r": # Refresh Menu (do nothing) log.info("Refreshing Menu") else: invalid(choice) # Start of Main if __name__ == '__main__': log.info("Starting Monitor Main.") hostIP = getMyIP() verifyHostName = findHostName(hostIP) pid = os.getpid() print("Host IP: %s" % (hostIP)) print("Hostname: %s" % (verifyHostName)) log.debug("PID: %d" % (pid)) if verifyHostName == "None": log.debug("Hostname not found: Returned 'None'") elif verifyHostName in [config.ctlrHostName, config.mntrHostName]: log.debug("HostName verified.") log.debug("Verifying certificates.") # Verify certificates present prior to displaying menu verifyCerts() # Starting Server startServer() time.sleep(2) # Display Menu [repeatedly] for user while True: myMenu() time.sleep(1) else: log.error("Hostname incorrect. " "Hostname Found: %s; Hostname " "Required: %s." % (verifyHostName, config.mntrHostName))
"""Functions defined in TVM.""" # pylint: disable=invalid-name,unused-import,redefined-builtin from __future__ import absolute_import as _abs from numbers import Integral as _Integral from ._ffi.base import string_types from ._ffi.node import register_node, NodeBase from ._ffi.node import convert_to_node as _convert_to_node from ._ffi.function import Function from ._ffi.function import _init_api, register_func, get_global_func, extract_ext_funcs from ._ffi.function import convert_to_tvm_func as _convert_tvm_func from ._ffi.runtime_ctypes import TVMType from . import _api_internal from . import make as _make from . import expr as _expr from . import tensor as _tensor from . import schedule as _schedule from . import container as _container from . import tag as _tag int8 = "int8" int32 = "int32" float32 = "float32" handle = "handle" def min_value(dtype): """minimum value of dtype""" return _api_internal._min_value(dtype) def max_value(dtype): """maximum value of dtype""" return _api_internal._max_value(dtype) def const(value, dtype=None): """construct a constant""" if dtype is None: if isinstance(value, _Integral): dtype = 'int32' else: dtype = 'float32' return _api_internal._const(value, dtype) def convert(value): """Convert value to TVM node or function. Parameters ---------- value : python value Returns ------- tvm_val : Node or Function Converted value in TVM """ if isinstance(value, (Function, NodeBase)): return value if callable(value): return _convert_tvm_func(value) return _convert_to_node(value) def load_json(json_str): """Load tvm object from json_str. Parameters ---------- json_str : str The json string Returns ------- node : Node The loaded tvm node. """ return _api_internal._load_json(json_str) def save_json(node): """Load tvm object as json string. Parameters ---------- node : Node A TVM Node object to be saved. Returns ------- json_str : str Saved json string. """ return _api_internal._save_json(node) def var(name="tindex", dtype=int32): """Create a new variable with specified name and dtype Parameters ---------- name : str The name dtype : int The data type Returns ------- var : Var The result symbolic variable. """ return _api_internal._Var(name, dtype) def any(*args): """Create a new experssion of the union of all conditions in the arguments Parameters ---------- args : list List of symbolic boolean expressions Returns ------- expr: Expr Expression """ if not args: raise ValueError("Any must take at least 1 argument") if len(args) == 1: return args[0] ret = _make.Or(args[0], args[1]) for i in range(2, len(args)): ret = _make.Or(ret, args[i]) return ret def all(*args): """Create a new experssion of the intersection of all conditions in the arguments Parameters ---------- args : list List of symbolic boolean expressions Returns ------- expr: Expr Expression """ if not args: raise ValueError("Any must take at least 1 argument") if len(args) == 1: return args[0] ret = _make.And(args[0], args[1]) for i in range(2, len(args)): ret = _make.And(ret, args[i]) return ret def placeholder(shape, dtype=None, name="placeholder"): """Construct an empty tensor object. Parameters ---------- shape: Tuple of Expr The shape of the tensor dtype: str, optional The data type of the tensor name: str, optional The name hint of the tensor Returns ------- tensor: Tensor The created tensor """ shape = (shape,) if isinstance(shape, _expr.Expr) else shape dtype = float32 if dtype is None else dtype return _api_internal._Placeholder( shape, dtype, name) def compute(shape, fcompute, name="compute", tag=""): """Construct a new tensor by computing over the shape domain. The compute rule is result[axis] = fcompute(axis) Parameters ---------- shape: Tuple of Expr The shape of the tensor fcompute: lambda function of indices-> value Specifies the input source expression name: str, optional The name hint of the tensor Returns ------- tensor: Tensor The created tensor """ if _tag.TagScope.current is not None: if tag != "": raise ValueError("nested tag is not allowed for now") tag = _tag.TagScope.current.tag shape = (shape,) if isinstance(shape, _expr.Expr) else shape ndim = len(shape) code = fcompute.__code__ if fcompute.__code__.co_argcount == 0: arg_names = ["i%d" % i for i in range(ndim)] else: arg_names = code.co_varnames[:code.co_argcount] if ndim != len(arg_names): raise ValueError("fcompute do not match dimension, ndim=%d" % ndim) dim_var = [_IterVar((0, s), x, 0) for x, s in zip(arg_names, shape)] body = fcompute(*[v.var for v in dim_var]) if not isinstance(body, (list, tuple)): body = [body] body = convert(body) op_node = _api_internal._ComputeOp( name, tag, dim_var, body) num = op_node.num_outputs outputs = tuple(op_node.output(i) for i in range(num)) return outputs[0] if num == 1 else outputs def scan(init, update, state_placeholder, inputs=None, name="scan", tag=""): """Construct new tensors by scanning over axis. Parameters ---------- init: Tensor or list of Tensor The initial condition of first init.shape[0] timestamps update: Tensor or list of Tensor The update rule of the scan given by symbolic tensor. state_placeholder: Tensor or list of Tensor The placeholder variables used by update. inputs: Tensor or list of Tensor, optional The list of inputs to the scan. This is not required, but can be useful for the compiler to detect scan body faster. name: str, optional The name hint of the tensor Returns ------- tensor: Tensor or list of Tensors The created tensor or tuple of tensors it it contains multiple outputs. Example ------- .. code-block:: python # The following code is equivalent to numpy.cumsum m = tvm.var("m") n = tvm.var("n") X = tvm.placeholder((m, n), name="X") s_state = tvm.placeholder((m, n)) s_init = tvm.compute((1, n), lambda _, i: X[0, i]) s_update = tvm.compute((m, n), lambda t, i: s_state[t-1, i] + X[t, i]) res = tvm.scan(s_init, s_update, s_state, X) """ if _tag.TagScope.current is not None: if tag != "": raise ValueError("nested tag is not allowed for now") tag = _tag.TagScope.current.tag if isinstance(init, _tensor.Tensor): init = [init] if isinstance(update, _tensor.Tensor): update = [update] if isinstance(state_placeholder, _tensor.Tensor): state_placeholder = [state_placeholder] if isinstance(inputs, _tensor.Tensor): inputs = [inputs] if inputs is None: inputs = [] if len(init) != len(update) or len(init) != len(state_placeholder): raise ValueError("init, update, state_placeholder must have same length") axis = _IterVar((init[0].shape[0], update[0].shape[0]), "%s.idx" % name, 3) op = _api_internal._ScanOp(name, tag, axis, init, update, state_placeholder, inputs) res = [op.output(i) for i in range(len(update))] return res[0] if len(res) == 1 else res def extern(shape, inputs, fcompute, name="extern", dtype=None, tag=""): """Compute several tensor via extern function. Parameters ---------- shape: tuple or list of tuples. The shape of the outputs. inputs: list of Tensor The inputs fcompute: lambda function of inputs, outputs-> stmt Specifies the IR statement to do the computation. See the following note for function signature of fcompute .. note:: **Parameters** - **ins** (list of :any:`Buffer`) - Placeholder for each inputs - **outs** (list of :any:`Buffer`) - Placeholder for each outputs **Returns** - **stmt** (:any:`Stmt`) - The statement that carries out array computation. name: str, optional The name hint of the tensor dtype: str or list of str, optional The data types of outputs, by default dtype will be same as inputs. Returns ------- tensor: Tensor or list of Tensors The created tensor or tuple of tensors it it contains multiple outputs. Example ------- In the code below, C is generated by calling external PackedFunc `tvm.contrib.cblas.matmul` .. code-block:: python A = tvm.placeholder((n, l), name='A') B = tvm.placeholder((l, m), name='B') C = tvm.extern((n, m), [A, B], lambda ins, outs: tvm.call_packed( "tvm.contrib.cblas.matmul", ins[0], ins[1], outs[0], 0, 0), name="C") """ if _tag.TagScope.current is not None: if tag != "": raise ValueError("nested tag is not allowed for now") tag = _tag.TagScope.current.tag shape = (shape,) if isinstance(shape, (_expr.Expr, _Integral)) else shape shape = [shape] if isinstance(shape[0], (_expr.Expr, _Integral)) else shape input_placeholders = [] output_placeholders = [] types = set() for t in inputs: if not isinstance(t, _tensor.Tensor): raise ValueError("expect inputs to be tensor") input_placeholders.append( decl_buffer(t.shape, t.dtype, t.op.name)) types.add(t.dtype) if dtype is None: if len(types) != 1: raise ValueError("Cannot infer output type, please provide dtype argument") infered_type = types.pop() dtype = [infered_type for _ in shape] if isinstance(dtype, str): dtype = [dtype] for shp, dt in zip(shape, dtype): output_placeholders.append(decl_buffer(shp, dt, name)) body = fcompute(input_placeholders, output_placeholders) if isinstance(body, _expr.Expr): body = _make.Evaluate(body) op = _api_internal._ExternOp(name, tag, inputs, input_placeholders, output_placeholders, body) res = [op.output(i) for i in range(len(output_placeholders))] return res[0] if len(res) == 1 else res def decl_buffer(shape, dtype=None, name="buffer", data=None, strides=None, elem_offset=None, scope="", data_alignment=-1, offset_factor=0): """Decleare a new symbolic buffer. Normally buffer is created automatically during lower and build. This is only needed if user want to specify their own buffer layout. See the note below for detailed discussion on usage of buffer. Parameters ---------- shape : tuple of Expr The shape of the buffer. dtype : str, optional The data type of the buffer. name : str, optional The name of the buffer. data : Var, optional The data pointer in the buffer. strides: array of Expr The stride of the buffer. elem_offset: Expr, optional The beginning offset of the array to data. In terms of number of elements of dtype. scope: str, optional The storage scope of the buffer, if not global. If scope equals empty string, it means it is global memory. data_alignment: int, optional The alignment of data pointer in bytes. If -1 is passed, the alignment will be set to TVM's internal default. offset_factor: int, optional The factor of elem_offset field, when set, elem_offset is required to be multiple of offset_factor. If 0 is pssed, the alignment will be set to 1. if non-zero is passed, we will created a Var for elem_offset if elem_offset is not None. Returns ------- buffer : Buffer The created buffer Note ---- Buffer data structure reflects the DLTensor structure in dlpack. While DLTensor data structure is very general, it is usually helpful to create function that only handles specific case of data structure and make compiled function benefit from it. If user pass strides and elem_offset is passed as None when constructing the function, then the function will be specialized for the DLTensor that is compact and aligned. If user pass a fully generic symbolic array to the strides, then the resulting function becomes fully generic. """ shape = (shape,) if isinstance(shape, (_expr.Expr, _Integral)) else shape dtype = float32 if dtype is None else dtype strides = () if strides is None else strides if offset_factor != 0 and elem_offset is None: elem_offset = var('%s_elem_offset' % name, shape[0].dtype) if data is None: data = var(name, "handle") return _api_internal._Buffer( data, dtype, shape, strides, elem_offset, name, scope, data_alignment, offset_factor) def _IterVar(dom, name, iter_type, thread_tag=''): """Internal function to create IterVar Parameters ---------- dom : Range The domain of iteration. name : str The name of iteration variable. iter_type : int The type of iteration. thread_tag : str The thread tag of the iteration variable. Returns ------- iter_var : IterVar The result itervar """ if dom is not None: if isinstance(dom, (list, tuple)): if len(dom) != 2: raise TypeError("need to be list of ranges") dom = Range(dom[0], dom[1]) if not isinstance(dom, _container.Range): raise TypeError("dom need to be Range") name = name if name else 'iter' v = var(name) return _api_internal._IterVar(dom, v, iter_type, thread_tag) def thread_axis(dom=None, tag='', name=''): """Create a new IterVar to represent thread index. Parameters ---------- dom : Range or str The domain of iteration When str is passed, dom is set to None and str is used as tag tag : str, optional The thread tag name : str, optional The name of the var. Returns ------- axis : IterVar The thread itervar. """ if isinstance(dom, string_types): tag, dom = dom, None if not tag: raise ValueError("tag must be given as Positional or keyword argument") name = name if name else tag return _IterVar(dom, name, 1, tag) def reduce_axis(dom, name="rv"): """Create a new IterVar for reduction. Parameters ---------- dom : Range The domain of iteration. name : str The name of the variable. Returns ------- axis : IterVar An iteration variable representing the value. """ return _IterVar(dom, name, 2) def select(cond, t, f): """Construct a select branch Parameters ---------- cond : Expr The condition t : Expr The result expression if cond is true. f : Expr The result expression if cond is false. Returns ------- node : Node The tvm.expr.Select node """ return _make.Select(convert(cond), convert(t), convert(f)) def comm_reducer(fcombine, fidentity, name="reduce"): """Create a commutative reducer for reduction. Parameters ---------- fcombine : function(Expr -> Expr -> Expr) A binary function which takes two Expr as input to return a Expr. fidentity : function(str -> Expr) A function which takes a type string as input to return a const Expr. Returns ------- reducer : function A function which creates a reduce expression over axis. There are two ways to use it: 1. accept (expr, axis, where) to produce an Reduce Expr on specified axis; 2. simply use it with multiple Exprs. Example ------- .. code-block:: python n = tvm.var('n') m = tvm.var('m') mysum = tvm.comm_reducer(lambda x, y: x+y, lambda t: tvm.const(0, dtype=t), name="mysum") A = tvm.placeholder((n, m), name='A') k = tvm.reduce_axis((0, m), name='k') B = tvm.compute((n,), lambda i: mysum(A[i, k], axis=k), name='B') """ def _reduce_directly(*args): num = len(args) # process `where` is None if num == 3 and args[2] is None: num = 2 res = args[0] for i in range(num-1): res = fcombine(res, args[i+1]) return res def _make_reduce(expr, axis, where=None): code = fcombine.__code__ assert fcombine.__code__.co_argcount == 2 expr = convert(expr) if isinstance(expr, _container.Array): size = len(expr) larr = [] rarr = [] dtypes = [] for i in range(size): dtype = expr[i].dtype dtypes.append(dtype) lname = code.co_varnames[0] + '_' + str(i) larr.append(var(lname, dtype)) rname = code.co_varnames[1] + '_' + str(i) rarr.append(var(rname, dtype)) lhs = convert(larr) rhs = convert(rarr) result = fcombine(lhs, rhs) id_elem = fidentity(*dtypes) else: assert isinstance(expr, _expr.Expr) size = 1 dtype = expr.dtype lvar = var(code.co_varnames[0], dtype) rvar = var(code.co_varnames[1], dtype) result = [fcombine(lvar, rvar)] id_elem = [fidentity(dtype)] lhs = convert([lvar]) rhs = convert([rvar]) expr = convert([expr]) result = convert(result) id_elem = convert(id_elem) combiner = _make.CommReducer(lhs, rhs, result, id_elem) axis = convert(axis if isinstance(axis, (list, tuple)) else [axis]) if where is None: where = convert(True) outputs = tuple(_make.Reduce(combiner, expr, axis, where, i) for i in range(size)) return outputs[0] if size == 1 else outputs def reducer(expr, axis, where=None, *args): if isinstance(axis, (_schedule.IterVar, list, tuple)): assert not args return _make_reduce(expr, axis, where) if where is None: assert not args return _reduce_directly(expr, axis) return _reduce_directly(expr, axis, where, *args) doc_str = """Create a {0} expression over axis. Parameters ---------- expr : Expr The source expression. axis : IterVar The reduction IterVar axis where : optional, Expr Filtering predicate of the reduction. Returns ------- value : Expr The result value. Example ------- .. code-block:: python m = tvm.var("m") n = tvm.var("n") A = tvm.placeholder((m, n), name="A") k = tvm.reduce_axis((0, n), name="k") # there are two way to use this {0} reducer: # mode 1, accept (expr, axis, where) to produce an Reduce Expr B = tvm.compute((m,), lambda i: tvm.{0}(A[i, k], axis=k), name="B") # mode 2, simply use it with multiple Exprs: {0}_res = tvm.{0}(m, n) """ reducer.__doc__ = doc_str.format(name) return reducer _init_api("tvm.api") #pylint: disable=unnecessary-lambda sum = comm_reducer(lambda x, y: x+y, lambda t: const(0, dtype=t), name="sum") min = comm_reducer(lambda x, y: _make.Min(x, y), max_value, name='min') max = comm_reducer(lambda x, y: _make.Max(x, y), min_value, name='max')
"""Disassembler of Python byte code into mnemonics.""" import sys import types import collections import io from opcode import * from opcode import __all__ as _opcodes_all __all__ = ["code_info", "dis", "disassemble", "distb", "disco", "findlinestarts", "findlabels", "show_code", "get_instructions", "Instruction", "Bytecode"] + _opcodes_all del _opcodes_all _have_code = (types.MethodType, types.FunctionType, types.CodeType, classmethod, staticmethod, type) FORMAT_VALUE = opmap['FORMAT_VALUE'] def _try_compile(source, name): """Attempts to compile the given source, first as an expression and then as a statement if the first approach fails. Utility function to accept strings in functions that otherwise expect code objects """ try: c = compile(source, name, 'eval') except SyntaxError: c = compile(source, name, 'exec') return c def dis(x=None, *, file=None): """Disassemble classes, methods, functions, generators, or code. With no argument, disassemble the last traceback. """ if x is None: distb(file=file) return if hasattr(x, '__func__'): # Method x = x.__func__ if hasattr(x, '__code__'): # Function x = x.__code__ if hasattr(x, 'gi_code'): # Generator x = x.gi_code if hasattr(x, '__dict__'): # Class or module items = sorted(x.__dict__.items()) for name, x1 in items: if isinstance(x1, _have_code): print("Disassembly of %s:" % name, file=file) try: dis(x1, file=file) except TypeError as msg: print("Sorry:", msg, file=file) print(file=file) elif hasattr(x, 'co_code'): # Code object disassemble(x, file=file) elif isinstance(x, (bytes, bytearray)): # Raw bytecode _disassemble_bytes(x, file=file) elif isinstance(x, str): # Source code _disassemble_str(x, file=file) else: raise TypeError("don't know how to disassemble %s objects" % type(x).__name__) def distb(tb=None, *, file=None): """Disassemble a traceback (default: last traceback).""" if tb is None: try: tb = sys.last_traceback except AttributeError: raise RuntimeError("no last traceback to disassemble") while tb.tb_next: tb = tb.tb_next disassemble(tb.tb_frame.f_code, tb.tb_lasti, file=file) # The inspect module interrogates this dictionary to build its # list of CO_* constants. It is also used by pretty_flags to # turn the co_flags field into a human readable list. COMPILER_FLAG_NAMES = { 1: "OPTIMIZED", 2: "NEWLOCALS", 4: "VARARGS", 8: "VARKEYWORDS", 16: "NESTED", 32: "GENERATOR", 64: "NOFREE", 128: "COROUTINE", 256: "ITERABLE_COROUTINE", 512: "ASYNC_GENERATOR", } def pretty_flags(flags): """Return pretty representation of code flags.""" names = [] for i in range(32): flag = 1<<i if flags & flag: names.append(COMPILER_FLAG_NAMES.get(flag, hex(flag))) flags ^= flag if not flags: break else: names.append(hex(flags)) return ", ".join(names) def _get_code_object(x): """Helper to handle methods, functions, generators, strings and raw code objects""" if hasattr(x, '__func__'): # Method x = x.__func__ if hasattr(x, '__code__'): # Function x = x.__code__ if hasattr(x, 'gi_code'): # Generator x = x.gi_code if isinstance(x, str): # Source code x = _try_compile(x, "<disassembly>") if hasattr(x, 'co_code'): # Code object return x raise TypeError("don't know how to disassemble %s objects" % type(x).__name__) def code_info(x): """Formatted details of methods, functions, or code.""" return _format_code_info(_get_code_object(x)) def _format_code_info(co): lines = [] lines.append("Name: %s" % co.co_name) lines.append("Filename: %s" % co.co_filename) lines.append("Argument count: %s" % co.co_argcount) lines.append("Kw-only arguments: %s" % co.co_kwonlyargcount) lines.append("Number of locals: %s" % co.co_nlocals) lines.append("Stack size: %s" % co.co_stacksize) lines.append("Flags: %s" % pretty_flags(co.co_flags)) if co.co_consts: lines.append("Constants:") for i_c in enumerate(co.co_consts): lines.append("%4d: %r" % i_c) if co.co_names: lines.append("Names:") for i_n in enumerate(co.co_names): lines.append("%4d: %s" % i_n) if co.co_varnames: lines.append("Variable names:") for i_n in enumerate(co.co_varnames): lines.append("%4d: %s" % i_n) if co.co_freevars: lines.append("Free variables:") for i_n in enumerate(co.co_freevars): lines.append("%4d: %s" % i_n) if co.co_cellvars: lines.append("Cell variables:") for i_n in enumerate(co.co_cellvars): lines.append("%4d: %s" % i_n) return "\n".join(lines) def show_code(co, *, file=None): """Print details of methods, functions, or code to *file*. If *file* is not provided, the output is printed on stdout. """ print(code_info(co), file=file) _Instruction = collections.namedtuple("_Instruction", "opname opcode arg argval argrepr offset starts_line is_jump_target") _Instruction.opname.__doc__ = "Human readable name for operation" _Instruction.opcode.__doc__ = "Numeric code for operation" _Instruction.arg.__doc__ = "Numeric argument to operation (if any), otherwise None" _Instruction.argval.__doc__ = "Resolved arg value (if known), otherwise same as arg" _Instruction.argrepr.__doc__ = "Human readable description of operation argument" _Instruction.offset.__doc__ = "Start index of operation within bytecode sequence" _Instruction.starts_line.__doc__ = "Line started by this opcode (if any), otherwise None" _Instruction.is_jump_target.__doc__ = "True if other code jumps to here, otherwise False" class Instruction(_Instruction): """Details for a bytecode operation Defined fields: opname - human readable name for operation opcode - numeric code for operation arg - numeric argument to operation (if any), otherwise None argval - resolved arg value (if known), otherwise same as arg argrepr - human readable description of operation argument offset - start index of operation within bytecode sequence starts_line - line started by this opcode (if any), otherwise None is_jump_target - True if other code jumps to here, otherwise False """ def _disassemble(self, lineno_width=3, mark_as_current=False): """Format instruction details for inclusion in disassembly output *lineno_width* sets the width of the line number field (0 omits it) *mark_as_current* inserts a '-->' marker arrow as part of the line """ fields = [] # Column: Source code line number if lineno_width: if self.starts_line is not None: lineno_fmt = "%%%dd" % lineno_width fields.append(lineno_fmt % self.starts_line) else: fields.append(' ' * lineno_width) # Column: Current instruction indicator if mark_as_current: fields.append('-->') else: fields.append(' ') # Column: Jump target marker if self.is_jump_target: fields.append('>>') else: fields.append(' ') # Column: Instruction offset from start of code sequence fields.append(repr(self.offset).rjust(4)) # Column: Opcode name fields.append(self.opname.ljust(20)) # Column: Opcode argument if self.arg is not None: fields.append(repr(self.arg).rjust(5)) # Column: Opcode argument details if self.argrepr: fields.append('(' + self.argrepr + ')') return ' '.join(fields).rstrip() def get_instructions(x, *, first_line=None): """Iterator for the opcodes in methods, functions or code Generates a series of Instruction named tuples giving the details of each operations in the supplied code. If *first_line* is not None, it indicates the line number that should be reported for the first source line in the disassembled code. Otherwise, the source line information (if any) is taken directly from the disassembled code object. """ co = _get_code_object(x) cell_names = co.co_cellvars + co.co_freevars linestarts = dict(findlinestarts(co)) if first_line is not None: line_offset = first_line - co.co_firstlineno else: line_offset = 0 return _get_instructions_bytes(co.co_code, co.co_varnames, co.co_names, co.co_consts, cell_names, linestarts, line_offset) def _get_const_info(const_index, const_list): """Helper to get optional details about const references Returns the dereferenced constant and its repr if the constant list is defined. Otherwise returns the constant index and its repr(). """ argval = const_index if const_list is not None: argval = const_list[const_index] return argval, repr(argval) def _get_name_info(name_index, name_list): """Helper to get optional details about named references Returns the dereferenced name as both value and repr if the name list is defined. Otherwise returns the name index and its repr(). """ argval = name_index if name_list is not None: argval = name_list[name_index] argrepr = argval else: argrepr = repr(argval) return argval, argrepr def _get_instructions_bytes(code, varnames=None, names=None, constants=None, cells=None, linestarts=None, line_offset=0): """Iterate over the instructions in a bytecode string. Generates a sequence of Instruction namedtuples giving the details of each opcode. Additional information about the code's runtime environment (e.g. variable names, constants) can be specified using optional arguments. """ labels = findlabels(code) starts_line = None for offset, op, arg in _unpack_opargs(code): if linestarts is not None: starts_line = linestarts.get(offset, None) if starts_line is not None: starts_line += line_offset is_jump_target = offset in labels argval = None argrepr = '' if arg is not None: # Set argval to the dereferenced value of the argument when # available, and argrepr to the string representation of argval. # _disassemble_bytes needs the string repr of the # raw name index for LOAD_GLOBAL, LOAD_CONST, etc. argval = arg if op in hasconst: argval, argrepr = _get_const_info(arg, constants) elif op in hasname: argval, argrepr = _get_name_info(arg, names) elif op in hasjrel: argval = offset + 2 + arg argrepr = "to " + repr(argval) elif op in haslocal: argval, argrepr = _get_name_info(arg, varnames) elif op in hascompare: argval = cmp_op[arg] argrepr = argval elif op in hasfree: argval, argrepr = _get_name_info(arg, cells) elif op == FORMAT_VALUE: argval = ((None, str, repr, ascii)[arg & 0x3], bool(arg & 0x4)) argrepr = ('', 'str', 'repr', 'ascii')[arg & 0x3] if argval[1]: if argrepr: argrepr += ', ' argrepr += 'with format' yield Instruction(opname[op], op, arg, argval, argrepr, offset, starts_line, is_jump_target) def disassemble(co, lasti=-1, *, file=None): """Disassemble a code object.""" cell_names = co.co_cellvars + co.co_freevars linestarts = dict(findlinestarts(co)) _disassemble_bytes(co.co_code, lasti, co.co_varnames, co.co_names, co.co_consts, cell_names, linestarts, file=file) def _disassemble_bytes(code, lasti=-1, varnames=None, names=None, constants=None, cells=None, linestarts=None, *, file=None, line_offset=0): # Omit the line number column entirely if we have no line number info show_lineno = linestarts is not None # TODO?: Adjust width upwards if max(linestarts.values()) >= 1000? lineno_width = 3 if show_lineno else 0 for instr in _get_instructions_bytes(code, varnames, names, constants, cells, linestarts, line_offset=line_offset): new_source_line = (show_lineno and instr.starts_line is not None and instr.offset > 0) if new_source_line: print(file=file) is_current_instr = instr.offset == lasti print(instr._disassemble(lineno_width, is_current_instr), file=file) def _disassemble_str(source, *, file=None): """Compile the source string, then disassemble the code object.""" disassemble(_try_compile(source, '<dis>'), file=file) disco = disassemble # XXX For backwards compatibility def _unpack_opargs(code): extended_arg = 0 for i in range(0, len(code), 2): op = code[i] if op >= HAVE_ARGUMENT: arg = code[i+1] | extended_arg extended_arg = (arg << 8) if op == EXTENDED_ARG else 0 else: arg = None yield (i, op, arg) def findlabels(code): """Detect all offsets in a byte code which are jump targets. Return the list of offsets. """ labels = [] for offset, op, arg in _unpack_opargs(code): if arg is not None: if op in hasjrel: label = offset + 2 + arg elif op in hasjabs: label = arg else: continue if label not in labels: labels.append(label) return labels def findlinestarts(code): """Find the offsets in a byte code which are start of lines in the source. Generate pairs (offset, lineno) as described in Python/compile.c. """ byte_increments = code.co_lnotab[0::2] line_increments = code.co_lnotab[1::2] lastlineno = None lineno = code.co_firstlineno addr = 0 for byte_incr, line_incr in zip(byte_increments, line_increments): if byte_incr: if lineno != lastlineno: yield (addr, lineno) lastlineno = lineno addr += byte_incr if line_incr >= 0x80: # line_increments is an array of 8-bit signed integers line_incr -= 0x100 lineno += line_incr if lineno != lastlineno: yield (addr, lineno) class Bytecode: """The bytecode operations of a piece of code Instantiate this with a function, method, string of code, or a code object (as returned by compile()). Iterating over this yields the bytecode operations as Instruction instances. """ def __init__(self, x, *, first_line=None, current_offset=None): self.codeobj = co = _get_code_object(x) if first_line is None: self.first_line = co.co_firstlineno self._line_offset = 0 else: self.first_line = first_line self._line_offset = first_line - co.co_firstlineno self._cell_names = co.co_cellvars + co.co_freevars self._linestarts = dict(findlinestarts(co)) self._original_object = x self.current_offset = current_offset def __iter__(self): co = self.codeobj return _get_instructions_bytes(co.co_code, co.co_varnames, co.co_names, co.co_consts, self._cell_names, self._linestarts, line_offset=self._line_offset) def __repr__(self): return "{}({!r})".format(self.__class__.__name__, self._original_object) @classmethod def from_traceback(cls, tb): """ Construct a Bytecode from the given traceback """ while tb.tb_next: tb = tb.tb_next return cls(tb.tb_frame.f_code, current_offset=tb.tb_lasti) def info(self): """Return formatted information about the code object.""" return _format_code_info(self.codeobj) def dis(self): """Return a formatted view of the bytecode operations.""" co = self.codeobj if self.current_offset is not None: offset = self.current_offset else: offset = -1 with io.StringIO() as output: _disassemble_bytes(co.co_code, varnames=co.co_varnames, names=co.co_names, constants=co.co_consts, cells=self._cell_names, linestarts=self._linestarts, line_offset=self._line_offset, file=output, lasti=offset) return output.getvalue() def _test(): """Simple test program to disassemble a file.""" import argparse parser = argparse.ArgumentParser() parser.add_argument('infile', type=argparse.FileType(), nargs='?', default='-') args = parser.parse_args() with args.infile as infile: source = infile.read() code = compile(source, args.infile.name, "exec") dis(code) if __name__ == "__main__": _test()
# vim: tabstop=4 shiftwidth=4 softtabstop=4 # Copyright 2010 United States Government as represented by the # Administrator of the National Aeronautics and Space Administration. # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. """ Cloud Controller: Implementation of EC2 REST API calls, which are dispatched to other nodes via AMQP RPC. State is via distributed datastore. """ import base64 import time from oslo.config import cfg from nova.api.ec2 import ec2utils from nova.api.ec2 import inst_state from nova.api.metadata import password from nova.api import validator from nova import availability_zones from nova import block_device from nova.cloudpipe import pipelib from nova import compute from nova.compute import api as compute_api from nova.compute import instance_types from nova.compute import vm_states from nova import db from nova import exception from nova.image import s3 from nova import network from nova.network.security_group import quantum_driver from nova.openstack.common import log as logging from nova.openstack.common import timeutils from nova import quota from nova import servicegroup from nova import utils from nova import volume ec2_opts = [ cfg.StrOpt('ec2_host', default='$my_ip', help='the ip of the ec2 api server'), cfg.StrOpt('ec2_dmz_host', default='$my_ip', help='the internal ip of the ec2 api server'), cfg.IntOpt('ec2_port', default=8773, help='the port of the ec2 api server'), cfg.StrOpt('ec2_scheme', default='http', help='the protocol to use when connecting to the ec2 api ' 'server (http, https)'), cfg.StrOpt('ec2_path', default='/services/Cloud', help='the path prefix used to call the ec2 api server'), cfg.ListOpt('region_list', default=[], help='list of region=fqdn pairs separated by commas'), ] CONF = cfg.CONF CONF.register_opts(ec2_opts) CONF.import_opt('my_ip', 'nova.netconf') CONF.import_opt('vpn_key_suffix', 'nova.cloudpipe.pipelib') CONF.import_opt('internal_service_availability_zone', 'nova.availability_zones') LOG = logging.getLogger(__name__) QUOTAS = quota.QUOTAS def validate_ec2_id(val): if not validator.validate_str()(val): raise exception.InvalidInstanceIDMalformed(val=val) try: ec2utils.ec2_id_to_id(val) except exception.InvalidEc2Id: raise exception.InvalidInstanceIDMalformed(val=val) # EC2 API can return the following values as documented in the EC2 API # http://docs.amazonwebservices.com/AWSEC2/latest/APIReference/ # ApiReference-ItemType-InstanceStateType.html # pending 0 | running 16 | shutting-down 32 | terminated 48 | stopping 64 | # stopped 80 _STATE_DESCRIPTION_MAP = { None: inst_state.PENDING, vm_states.ACTIVE: inst_state.RUNNING, vm_states.BUILDING: inst_state.PENDING, vm_states.DELETED: inst_state.TERMINATED, vm_states.SOFT_DELETED: inst_state.TERMINATED, vm_states.STOPPED: inst_state.STOPPED, vm_states.PAUSED: inst_state.PAUSE, vm_states.SUSPENDED: inst_state.SUSPEND, vm_states.RESCUED: inst_state.RESCUE, vm_states.RESIZED: inst_state.RESIZE, } def _state_description(vm_state, _shutdown_terminate): """Map the vm state to the server status string.""" # Note(maoy): We do not provide EC2 compatibility # in shutdown_terminate flag behavior. So we ignore # it here. name = _STATE_DESCRIPTION_MAP.get(vm_state, vm_state) return {'code': inst_state.name_to_code(name), 'name': name} def _parse_block_device_mapping(bdm): """Parse BlockDeviceMappingItemType into flat hash BlockDevicedMapping.<N>.DeviceName BlockDevicedMapping.<N>.Ebs.SnapshotId BlockDevicedMapping.<N>.Ebs.VolumeSize BlockDevicedMapping.<N>.Ebs.DeleteOnTermination BlockDevicedMapping.<N>.Ebs.NoDevice BlockDevicedMapping.<N>.VirtualName => remove .Ebs and allow volume id in SnapshotId """ ebs = bdm.pop('ebs', None) if ebs: ec2_id = ebs.pop('snapshot_id', None) if ec2_id: if ec2_id.startswith('snap-'): bdm['snapshot_id'] = ec2utils.ec2_snap_id_to_uuid(ec2_id) elif ec2_id.startswith('vol-'): bdm['volume_id'] = ec2utils.ec2_vol_id_to_uuid(ec2_id) ebs.setdefault('delete_on_termination', True) bdm.update(ebs) return bdm def _properties_get_mappings(properties): return block_device.mappings_prepend_dev(properties.get('mappings', [])) def _format_block_device_mapping(bdm): """Construct BlockDeviceMappingItemType {'device_name': '...', 'snapshot_id': , ...} => BlockDeviceMappingItemType """ keys = (('deviceName', 'device_name'), ('virtualName', 'virtual_name')) item = {} for name, k in keys: if k in bdm: item[name] = bdm[k] if bdm.get('no_device'): item['noDevice'] = True if ('snapshot_id' in bdm) or ('volume_id' in bdm): ebs_keys = (('snapshotId', 'snapshot_id'), ('snapshotId', 'volume_id'), # snapshotId is abused ('volumeSize', 'volume_size'), ('deleteOnTermination', 'delete_on_termination')) ebs = {} for name, k in ebs_keys: if k in bdm: if k == 'snapshot_id': ebs[name] = ec2utils.id_to_ec2_snap_id(bdm[k]) elif k == 'volume_id': ebs[name] = ec2utils.id_to_ec2_vol_id(bdm[k]) else: ebs[name] = bdm[k] assert 'snapshotId' in ebs item['ebs'] = ebs return item def _format_mappings(properties, result): """Format multiple BlockDeviceMappingItemType.""" mappings = [{'virtualName': m['virtual'], 'deviceName': m['device']} for m in _properties_get_mappings(properties) if block_device.is_swap_or_ephemeral(m['virtual'])] block_device_mapping = [_format_block_device_mapping(bdm) for bdm in properties.get('block_device_mapping', [])] # NOTE(yamahata): overwrite mappings with block_device_mapping for bdm in block_device_mapping: for i in range(len(mappings)): if bdm['deviceName'] == mappings[i]['deviceName']: del mappings[i] break mappings.append(bdm) # NOTE(yamahata): trim ebs.no_device == true. Is this necessary? mappings = [bdm for bdm in mappings if not (bdm.get('noDevice', False))] if mappings: result['blockDeviceMapping'] = mappings class CloudController(object): """CloudController provides the critical dispatch between inbound API calls through the endpoint and messages sent to the other nodes. """ def __init__(self): self.image_service = s3.S3ImageService() self.network_api = network.API() self.volume_api = volume.API() self.security_group_api = get_cloud_security_group_api() self.compute_api = compute.API(network_api=self.network_api, volume_api=self.volume_api, security_group_api=self.security_group_api) self.keypair_api = compute_api.KeypairAPI() self.servicegroup_api = servicegroup.API() def __str__(self): return 'CloudController' def _enforce_valid_instance_ids(self, context, instance_ids): # NOTE(mikal): Amazon's implementation of the EC2 API requires that # _all_ instance ids passed in be valid. instances = {} if instance_ids: for ec2_id in instance_ids: instance_uuid = ec2utils.ec2_inst_id_to_uuid(context, ec2_id) instance = self.compute_api.get(context, instance_uuid) instances[ec2_id] = instance return instances def _get_image_state(self, image): # NOTE(vish): fallback status if image_state isn't set state = image.get('status') if state == 'active': state = 'available' return image['properties'].get('image_state', state) def describe_availability_zones(self, context, **kwargs): if ('zone_name' in kwargs and 'verbose' in kwargs['zone_name'] and context.is_admin): return self._describe_availability_zones_verbose(context, **kwargs) else: return self._describe_availability_zones(context, **kwargs) def _describe_availability_zones(self, context, **kwargs): ctxt = context.elevated() available_zones, not_available_zones = \ availability_zones.get_availability_zones(ctxt) result = [] for zone in available_zones: # Hide internal_service_availability_zone if zone == CONF.internal_service_availability_zone: continue result.append({'zoneName': zone, 'zoneState': "available"}) for zone in not_available_zones: result.append({'zoneName': zone, 'zoneState': "not available"}) return {'availabilityZoneInfo': result} def _describe_availability_zones_verbose(self, context, **kwargs): ctxt = context.elevated() available_zones, not_available_zones = \ availability_zones.get_availability_zones(ctxt) # Available services enabled_services = db.service_get_all(context, False) enabled_services = availability_zones.set_availability_zones(context, enabled_services) zone_hosts = {} host_services = {} for service in enabled_services: zone_hosts.setdefault(service['availability_zone'], []) if service['host'] not in zone_hosts[service['availability_zone']]: zone_hosts[service['availability_zone']].append( service['host']) host_services.setdefault(service['availability_zone'] + service['host'], []) host_services[service['availability_zone'] + service['host']].\ append(service) result = [] for zone in available_zones: result.append({'zoneName': zone, 'zoneState': "available"}) for host in zone_hosts[zone]: result.append({'zoneName': '|- %s' % host, 'zoneState': ''}) for service in host_services[zone + host]: alive = self.servicegroup_api.service_is_up(service) art = (alive and ":-)") or "XXX" active = 'enabled' if service['disabled']: active = 'disabled' result.append({'zoneName': '| |- %s' % service['binary'], 'zoneState': ('%s %s %s' % (active, art, service['updated_at']))}) for zone in not_available_zones: result.append({'zoneName': zone, 'zoneState': "not available"}) return {'availabilityZoneInfo': result} def describe_regions(self, context, region_name=None, **kwargs): if CONF.region_list: regions = [] for region in CONF.region_list: name, _sep, host = region.partition('=') endpoint = '%s://%s:%s%s' % (CONF.ec2_scheme, host, CONF.ec2_port, CONF.ec2_path) regions.append({'regionName': name, 'regionEndpoint': endpoint}) else: regions = [{'regionName': 'nova', 'regionEndpoint': '%s://%s:%s%s' % (CONF.ec2_scheme, CONF.ec2_host, CONF.ec2_port, CONF.ec2_path)}] return {'regionInfo': regions} def describe_snapshots(self, context, snapshot_id=None, owner=None, restorable_by=None, **kwargs): if snapshot_id: snapshots = [] for ec2_id in snapshot_id: internal_id = ec2utils.ec2_snap_id_to_uuid(ec2_id) snapshot = self.volume_api.get_snapshot( context, snapshot_id=internal_id) snapshots.append(snapshot) else: snapshots = self.volume_api.get_all_snapshots(context) formatted_snapshots = [] for s in snapshots: formatted = self._format_snapshot(context, s) if formatted: formatted_snapshots.append(formatted) return {'snapshotSet': formatted_snapshots} def _format_snapshot(self, context, snapshot): # NOTE(mikal): this is just a set of strings in cinder. If they # implement an enum, then we should move this code to use it. The # valid ec2 statuses are "pending", "completed", and "error". status_map = {'new': 'pending', 'creating': 'pending', 'available': 'completed', 'active': 'completed', 'deleting': 'pending', 'deleted': None, 'error': 'error'} mapped_status = status_map.get(snapshot['status'], snapshot['status']) if not mapped_status: return None s = {} s['snapshotId'] = ec2utils.id_to_ec2_snap_id(snapshot['id']) s['volumeId'] = ec2utils.id_to_ec2_vol_id(snapshot['volume_id']) s['status'] = mapped_status s['startTime'] = snapshot['created_at'] s['progress'] = snapshot['progress'] s['ownerId'] = snapshot['project_id'] s['volumeSize'] = snapshot['volume_size'] s['description'] = snapshot['display_description'] return s def create_snapshot(self, context, volume_id, **kwargs): validate_ec2_id(volume_id) LOG.audit(_("Create snapshot of volume %s"), volume_id, context=context) volume_id = ec2utils.ec2_vol_id_to_uuid(volume_id) volume = self.volume_api.get(context, volume_id) args = (context, volume, kwargs.get('name'), kwargs.get('description')) if kwargs.get('force', False): snapshot = self.volume_api.create_snapshot_force(*args) else: snapshot = self.volume_api.create_snapshot(*args) db.ec2_snapshot_create(context, snapshot['id']) return self._format_snapshot(context, snapshot) def delete_snapshot(self, context, snapshot_id, **kwargs): snapshot_id = ec2utils.ec2_snap_id_to_uuid(snapshot_id) snapshot = self.volume_api.get_snapshot(context, snapshot_id) self.volume_api.delete_snapshot(context, snapshot) return True def describe_key_pairs(self, context, key_name=None, **kwargs): key_pairs = self.keypair_api.get_key_pairs(context, context.user_id) if key_name is not None: key_pairs = [x for x in key_pairs if x['name'] in key_name] #If looking for non existent key pair if key_name is not None and not key_pairs: msg = _('Could not find key pair(s): %s') % ','.join(key_name) raise exception.KeypairNotFound(msg, code="InvalidKeyPair.Duplicate") result = [] for key_pair in key_pairs: # filter out the vpn keys suffix = CONF.vpn_key_suffix if context.is_admin or not key_pair['name'].endswith(suffix): result.append({ 'keyName': key_pair['name'], 'keyFingerprint': key_pair['fingerprint'], }) return {'keySet': result} def create_key_pair(self, context, key_name, **kwargs): LOG.audit(_("Create key pair %s"), key_name, context=context) try: keypair = self.keypair_api.create_key_pair(context, context.user_id, key_name) except exception.KeypairLimitExceeded: msg = _("Quota exceeded, too many key pairs.") raise exception.EC2APIError(msg, code='ResourceLimitExceeded') return {'keyName': key_name, 'keyFingerprint': keypair['fingerprint'], 'keyMaterial': keypair['private_key']} # TODO(vish): when context is no longer an object, pass it here def import_key_pair(self, context, key_name, public_key_material, **kwargs): LOG.audit(_("Import key %s"), key_name, context=context) public_key = base64.b64decode(public_key_material) try: keypair = self.keypair_api.import_key_pair(context, context.user_id, key_name, public_key) except exception.KeypairLimitExceeded: msg = _("Quota exceeded, too many key pairs.") raise exception.EC2APIError(msg) except exception.InvalidKeypair: msg = _("Keypair data is invalid") raise exception.EC2APIError(msg) return {'keyName': key_name, 'keyFingerprint': keypair['fingerprint']} def delete_key_pair(self, context, key_name, **kwargs): LOG.audit(_("Delete key pair %s"), key_name, context=context) try: self.keypair_api.delete_key_pair(context, context.user_id, key_name) except exception.NotFound: # aws returns true even if the key doesn't exist pass return True def describe_security_groups(self, context, group_name=None, group_id=None, **kwargs): search_opts = ec2utils.search_opts_from_filters(kwargs.get('filter')) raw_groups = self.security_group_api.list(context, group_name, group_id, context.project_id, search_opts=search_opts) groups = [self._format_security_group(context, g) for g in raw_groups] return {'securityGroupInfo': list(sorted(groups, key=lambda k: (k['ownerId'], k['groupName'])))} def _format_security_group(self, context, group): g = {} g['groupDescription'] = group['description'] g['groupName'] = group['name'] g['ownerId'] = group['project_id'] g['ipPermissions'] = [] for rule in group['rules']: r = {} r['groups'] = [] r['ipRanges'] = [] if rule['group_id']: if rule.get('grantee_group'): source_group = rule['grantee_group'] r['groups'] += [{'groupName': source_group['name'], 'userId': source_group['project_id']}] else: # rule is not always joined with grantee_group # for example when using quantum driver. source_group = self.security_group_api.get( context, id=rule['group_id']) r['groups'] += [{'groupName': source_group.get('name'), 'userId': source_group.get('project_id')}] if rule['protocol']: r['ipProtocol'] = rule['protocol'].lower() r['fromPort'] = rule['from_port'] r['toPort'] = rule['to_port'] g['ipPermissions'] += [dict(r)] else: for protocol, min_port, max_port in (('icmp', -1, -1), ('tcp', 1, 65535), ('udp', 1, 65535)): r['ipProtocol'] = protocol r['fromPort'] = min_port r['toPort'] = max_port g['ipPermissions'] += [dict(r)] else: r['ipProtocol'] = rule['protocol'] r['fromPort'] = rule['from_port'] r['toPort'] = rule['to_port'] r['ipRanges'] += [{'cidrIp': rule['cidr']}] g['ipPermissions'] += [r] return g def _rule_args_to_dict(self, context, kwargs): rules = [] if 'groups' not in kwargs and 'ip_ranges' not in kwargs: rule = self._rule_dict_last_step(context, **kwargs) if rule: rules.append(rule) return rules if 'ip_ranges' in kwargs: rules = self._cidr_args_split(kwargs) else: rules = [kwargs] finalset = [] for rule in rules: if 'groups' in rule: groups_values = self._groups_args_split(rule) for groups_value in groups_values: final = self._rule_dict_last_step(context, **groups_value) finalset.append(final) else: final = self._rule_dict_last_step(context, **rule) finalset.append(final) return finalset def _cidr_args_split(self, kwargs): cidr_args_split = [] cidrs = kwargs['ip_ranges'] for key, cidr in cidrs.iteritems(): mykwargs = kwargs.copy() del mykwargs['ip_ranges'] mykwargs['cidr_ip'] = cidr['cidr_ip'] cidr_args_split.append(mykwargs) return cidr_args_split def _groups_args_split(self, kwargs): groups_args_split = [] groups = kwargs['groups'] for key, group in groups.iteritems(): mykwargs = kwargs.copy() del mykwargs['groups'] if 'group_name' in group: mykwargs['source_security_group_name'] = group['group_name'] if 'user_id' in group: mykwargs['source_security_group_owner_id'] = group['user_id'] if 'group_id' in group: mykwargs['source_security_group_id'] = group['group_id'] groups_args_split.append(mykwargs) return groups_args_split def _rule_dict_last_step(self, context, to_port=None, from_port=None, ip_protocol=None, cidr_ip=None, user_id=None, source_security_group_name=None, source_security_group_owner_id=None): if source_security_group_name: source_project_id = self._get_source_project_id(context, source_security_group_owner_id) source_security_group = db.security_group_get_by_name( context.elevated(), source_project_id, source_security_group_name) notfound = exception.SecurityGroupNotFound if not source_security_group: raise notfound(security_group_id=source_security_group_name) group_id = source_security_group['id'] return self.security_group_api.new_group_ingress_rule( group_id, ip_protocol, from_port, to_port) else: cidr = self.security_group_api.parse_cidr(cidr_ip) return self.security_group_api.new_cidr_ingress_rule( cidr, ip_protocol, from_port, to_port) def _validate_group_identifier(self, group_name, group_id): if not group_name and not group_id: err = _("Not enough parameters, need group_name or group_id") raise exception.EC2APIError(err) def _validate_rulevalues(self, rulesvalues): if not rulesvalues: err = _("%s Not enough parameters to build a valid rule") raise exception.EC2APIError(err % rulesvalues) def _validate_security_group_protocol(self, values): validprotocols = ['tcp', 'udp', 'icmp', '6', '17', '1'] if 'ip_protocol' in values and \ values['ip_protocol'] not in validprotocols: protocol = values['ip_protocol'] err = _("Invalid IP protocol %(protocol)s.") % locals() raise exception.EC2APIError(message=err, code="400") def revoke_security_group_ingress(self, context, group_name=None, group_id=None, **kwargs): self._validate_group_identifier(group_name, group_id) security_group = self.security_group_api.get(context, group_name, group_id) prevalues = kwargs.get('ip_permissions', [kwargs]) rule_ids = [] for values in prevalues: rulesvalues = self._rule_args_to_dict(context, values) self._validate_rulevalues(rulesvalues) for values_for_rule in rulesvalues: values_for_rule['parent_group_id'] = security_group['id'] rule_ids.append(self.security_group_api.rule_exists( security_group, values_for_rule)) rule_ids = [id for id in rule_ids if id] if rule_ids: self.security_group_api.remove_rules(context, security_group, rule_ids) return True raise exception.EC2APIError(_("No rule for the specified parameters.")) # TODO(soren): This has only been tested with Boto as the client. # Unfortunately, it seems Boto is using an old API # for these operations, so support for newer API versions # is sketchy. def authorize_security_group_ingress(self, context, group_name=None, group_id=None, **kwargs): self._validate_group_identifier(group_name, group_id) security_group = self.security_group_api.get(context, group_name, group_id) prevalues = kwargs.get('ip_permissions', [kwargs]) postvalues = [] for values in prevalues: self._validate_security_group_protocol(values) rulesvalues = self._rule_args_to_dict(context, values) self._validate_rulevalues(rulesvalues) for values_for_rule in rulesvalues: values_for_rule['parent_group_id'] = security_group['id'] if self.security_group_api.rule_exists(security_group, values_for_rule): err = _('%s - This rule already exists in group') raise exception.EC2APIError(err % values_for_rule) postvalues.append(values_for_rule) if postvalues: self.security_group_api.add_rules(context, security_group['id'], security_group['name'], postvalues) return True raise exception.EC2APIError(_("No rule for the specified parameters.")) def _get_source_project_id(self, context, source_security_group_owner_id): if source_security_group_owner_id: # Parse user:project for source group. source_parts = source_security_group_owner_id.split(':') # If no project name specified, assume it's same as user name. # Since we're looking up by project name, the user name is not # used here. It's only read for EC2 API compatibility. if len(source_parts) == 2: source_project_id = source_parts[1] else: source_project_id = source_parts[0] else: source_project_id = context.project_id return source_project_id def create_security_group(self, context, group_name, group_description): if isinstance(group_name, unicode): group_name = group_name.encode('utf-8') if CONF.ec2_strict_validation: # EC2 specification gives constraints for name and description: # Accepts alphanumeric characters, spaces, dashes, and underscores allowed = '^[a-zA-Z0-9_\- ]+$' self.security_group_api.validate_property(group_name, 'name', allowed) self.security_group_api.validate_property(group_description, 'description', allowed) else: # Amazon accepts more symbols. # So, allow POSIX [:print:] characters. allowed = r'^[\x20-\x7E]+$' self.security_group_api.validate_property(group_name, 'name', allowed) group_ref = self.security_group_api.create_security_group( context, group_name, group_description) return {'securityGroupSet': [self._format_security_group(context, group_ref)]} def delete_security_group(self, context, group_name=None, group_id=None, **kwargs): if not group_name and not group_id: err = _("Not enough parameters, need group_name or group_id") raise exception.EC2APIError(err) security_group = self.security_group_api.get(context, group_name, group_id) self.security_group_api.destroy(context, security_group) return True def get_password_data(self, context, instance_id, **kwargs): # instance_id may be passed in as a list of instances if isinstance(instance_id, list): ec2_id = instance_id[0] else: ec2_id = instance_id validate_ec2_id(ec2_id) instance_uuid = ec2utils.ec2_inst_id_to_uuid(context, ec2_id) instance = self.compute_api.get(context, instance_uuid) output = password.extract_password(instance) # NOTE(vish): this should be timestamp from the metadata fields # but it isn't important enough to implement properly now = timeutils.utcnow() return {"InstanceId": ec2_id, "Timestamp": now, "passwordData": output} def get_console_output(self, context, instance_id, **kwargs): LOG.audit(_("Get console output for instance %s"), instance_id, context=context) # instance_id may be passed in as a list of instances if isinstance(instance_id, list): ec2_id = instance_id[0] else: ec2_id = instance_id validate_ec2_id(ec2_id) instance_uuid = ec2utils.ec2_inst_id_to_uuid(context, ec2_id) instance = self.compute_api.get(context, instance_uuid) output = self.compute_api.get_console_output(context, instance) now = timeutils.utcnow() return {"InstanceId": ec2_id, "Timestamp": now, "output": base64.b64encode(output)} def describe_volumes(self, context, volume_id=None, **kwargs): if volume_id: volumes = [] for ec2_id in volume_id: validate_ec2_id(ec2_id) internal_id = ec2utils.ec2_vol_id_to_uuid(ec2_id) volume = self.volume_api.get(context, internal_id) volumes.append(volume) else: volumes = self.volume_api.get_all(context) volumes = [self._format_volume(context, v) for v in volumes] return {'volumeSet': volumes} def _format_volume(self, context, volume): instance_ec2_id = None instance_data = None if volume.get('instance_uuid', None): instance_uuid = volume['instance_uuid'] instance = db.instance_get_by_uuid(context.elevated(), instance_uuid) instance_ec2_id = ec2utils.id_to_ec2_inst_id(instance_uuid) instance_data = '%s[%s]' % (instance_ec2_id, instance['host']) v = {} v['volumeId'] = ec2utils.id_to_ec2_vol_id(volume['id']) v['status'] = volume['status'] v['size'] = volume['size'] v['availabilityZone'] = volume['availability_zone'] v['createTime'] = volume['created_at'] if context.is_admin: # NOTE(dprince): project_id and host_id are unset w/ Cinder v['status'] = '%s (%s, %s, %s, %s)' % ( volume['status'], volume.get('project_id', ''), volume.get('host', ''), instance_data, volume['mountpoint']) if volume['attach_status'] == 'attached': v['attachmentSet'] = [{'attachTime': volume['attach_time'], 'deleteOnTermination': False, 'device': volume['mountpoint'], 'instanceId': instance_ec2_id, 'status': 'attached', 'volumeId': v['volumeId']}] else: v['attachmentSet'] = [{}] if volume.get('snapshot_id') is not None: v['snapshotId'] = ec2utils.id_to_ec2_snap_id(volume['snapshot_id']) else: v['snapshotId'] = None return v def create_volume(self, context, **kwargs): snapshot_ec2id = kwargs.get('snapshot_id', None) if snapshot_ec2id is not None: snapshot_id = ec2utils.ec2_snap_id_to_uuid(kwargs['snapshot_id']) snapshot = self.volume_api.get_snapshot(context, snapshot_id) LOG.audit(_("Create volume from snapshot %s"), snapshot_ec2id, context=context) else: snapshot = None LOG.audit(_("Create volume of %s GB"), kwargs.get('size'), context=context) create_kwargs = dict(snapshot=snapshot, volume_type=kwargs.get('volume_type'), metadata=kwargs.get('metadata'), availability_zone=kwargs.get('availability_zone')) volume = self.volume_api.create(context, kwargs.get('size'), kwargs.get('name'), kwargs.get('description'), **create_kwargs) db.ec2_volume_create(context, volume['id']) # TODO(vish): Instance should be None at db layer instead of # trying to lazy load, but for now we turn it into # a dict to avoid an error. return self._format_volume(context, dict(volume)) def delete_volume(self, context, volume_id, **kwargs): validate_ec2_id(volume_id) volume_id = ec2utils.ec2_vol_id_to_uuid(volume_id) try: volume = self.volume_api.get(context, volume_id) self.volume_api.delete(context, volume) except exception.InvalidVolume: raise exception.EC2APIError(_('Delete Failed')) return True def attach_volume(self, context, volume_id, instance_id, device, **kwargs): validate_ec2_id(instance_id) validate_ec2_id(volume_id) volume_id = ec2utils.ec2_vol_id_to_uuid(volume_id) instance_uuid = ec2utils.ec2_inst_id_to_uuid(context, instance_id) instance = self.compute_api.get(context, instance_uuid) msg = _("Attach volume %(volume_id)s to instance %(instance_id)s" " at %(device)s") % locals() LOG.audit(msg, context=context) try: self.compute_api.attach_volume(context, instance, volume_id, device) except exception.InvalidVolume: raise exception.EC2APIError(_('Attach Failed.')) volume = self.volume_api.get(context, volume_id) return {'attachTime': volume['attach_time'], 'device': volume['mountpoint'], 'instanceId': ec2utils.id_to_ec2_inst_id(instance_uuid), 'requestId': context.request_id, 'status': volume['attach_status'], 'volumeId': ec2utils.id_to_ec2_vol_id(volume_id)} def _get_instance_from_volume(self, context, volume): if volume['instance_uuid']: try: return db.instance_get_by_uuid(context, volume['instance_uuid']) except exception.InstanceNotFound: pass raise exception.VolumeUnattached(volume_id=volume['id']) def detach_volume(self, context, volume_id, **kwargs): validate_ec2_id(volume_id) volume_id = ec2utils.ec2_vol_id_to_uuid(volume_id) LOG.audit(_("Detach volume %s"), volume_id, context=context) volume = self.volume_api.get(context, volume_id) instance = self._get_instance_from_volume(context, volume) try: self.compute_api.detach_volume(context, instance, volume) except exception.InvalidVolume: raise exception.EC2APIError(_('Detach Volume Failed.')) return {'attachTime': volume['attach_time'], 'device': volume['mountpoint'], 'instanceId': ec2utils.id_to_ec2_inst_id( volume['instance_uuid']), 'requestId': context.request_id, 'status': volume['attach_status'], 'volumeId': ec2utils.id_to_ec2_vol_id(volume_id)} def _format_kernel_id(self, context, instance_ref, result, key): kernel_uuid = instance_ref['kernel_id'] if kernel_uuid is None or kernel_uuid == '': return result[key] = ec2utils.glance_id_to_ec2_id(context, kernel_uuid, 'aki') def _format_ramdisk_id(self, context, instance_ref, result, key): ramdisk_uuid = instance_ref['ramdisk_id'] if ramdisk_uuid is None or ramdisk_uuid == '': return result[key] = ec2utils.glance_id_to_ec2_id(context, ramdisk_uuid, 'ari') def describe_instance_attribute(self, context, instance_id, attribute, **kwargs): def _unsupported_attribute(instance, result): raise exception.EC2APIError(_('attribute not supported: %s') % attribute) def _format_attr_block_device_mapping(instance, result): tmp = {} self._format_instance_root_device_name(instance, tmp) self._format_instance_bdm(context, instance['uuid'], tmp['rootDeviceName'], result) def _format_attr_disable_api_termination(instance, result): result['disableApiTermination'] = instance['disable_terminate'] def _format_attr_group_set(instance, result): CloudController._format_group_set(instance, result) def _format_attr_instance_initiated_shutdown_behavior(instance, result): if instance['shutdown_terminate']: result['instanceInitiatedShutdownBehavior'] = 'terminate' else: result['instanceInitiatedShutdownBehavior'] = 'stop' def _format_attr_instance_type(instance, result): self._format_instance_type(instance, result) def _format_attr_kernel(instance, result): self._format_kernel_id(context, instance, result, 'kernel') def _format_attr_ramdisk(instance, result): self._format_ramdisk_id(context, instance, result, 'ramdisk') def _format_attr_root_device_name(instance, result): self._format_instance_root_device_name(instance, result) def _format_attr_source_dest_check(instance, result): _unsupported_attribute(instance, result) def _format_attr_user_data(instance, result): result['userData'] = base64.b64decode(instance['user_data']) attribute_formatter = { 'blockDeviceMapping': _format_attr_block_device_mapping, 'disableApiTermination': _format_attr_disable_api_termination, 'groupSet': _format_attr_group_set, 'instanceInitiatedShutdownBehavior': _format_attr_instance_initiated_shutdown_behavior, 'instanceType': _format_attr_instance_type, 'kernel': _format_attr_kernel, 'ramdisk': _format_attr_ramdisk, 'rootDeviceName': _format_attr_root_device_name, 'sourceDestCheck': _format_attr_source_dest_check, 'userData': _format_attr_user_data, } fn = attribute_formatter.get(attribute) if fn is None: raise exception.EC2APIError( _('attribute not supported: %s') % attribute) validate_ec2_id(instance_id) instance_uuid = ec2utils.ec2_inst_id_to_uuid(context, instance_id) instance = self.compute_api.get(context, instance_uuid) result = {'instance_id': instance_id} fn(instance, result) return result def describe_instances(self, context, **kwargs): # Optional DescribeInstances argument instance_id = kwargs.get('instance_id', None) filters = kwargs.get('filter', None) instances = self._enforce_valid_instance_ids(context, instance_id) return self._format_describe_instances(context, instance_id=instance_id, instance_cache=instances, filter=filters) def describe_instances_v6(self, context, **kwargs): # Optional DescribeInstancesV6 argument instance_id = kwargs.get('instance_id', None) filters = kwargs.get('filter', None) instances = self._enforce_valid_instance_ids(context, instance_id) return self._format_describe_instances(context, instance_id=instance_id, instance_cache=instances, filter=filters, use_v6=True) def _format_describe_instances(self, context, **kwargs): return {'reservationSet': self._format_instances(context, **kwargs)} def _format_run_instances(self, context, reservation_id): i = self._format_instances(context, reservation_id=reservation_id) assert len(i) == 1 return i[0] def _format_terminate_instances(self, context, instance_id, previous_states): instances_set = [] for (ec2_id, previous_state) in zip(instance_id, previous_states): i = {} i['instanceId'] = ec2_id i['previousState'] = _state_description(previous_state['vm_state'], previous_state['shutdown_terminate']) try: instance_uuid = ec2utils.ec2_inst_id_to_uuid(context, ec2_id) instance = self.compute_api.get(context, instance_uuid) i['currentState'] = _state_description(instance['vm_state'], instance['shutdown_terminate']) except exception.NotFound: i['currentState'] = _state_description(vm_states.DELETED, True) instances_set.append(i) return {'instancesSet': instances_set} def _format_instance_bdm(self, context, instance_uuid, root_device_name, result): """Format InstanceBlockDeviceMappingResponseItemType.""" root_device_type = 'instance-store' mapping = [] for bdm in db.block_device_mapping_get_all_by_instance(context, instance_uuid): volume_id = bdm['volume_id'] if (volume_id is None or bdm['no_device']): continue if (bdm['device_name'] == root_device_name and (bdm['snapshot_id'] or bdm['volume_id'])): assert not bdm['virtual_name'] root_device_type = 'ebs' vol = self.volume_api.get(context, volume_id) LOG.debug(_("vol = %s\n"), vol) # TODO(yamahata): volume attach time ebs = {'volumeId': volume_id, 'deleteOnTermination': bdm['delete_on_termination'], 'attachTime': vol['attach_time'] or '', 'status': vol['status'], } res = {'deviceName': bdm['device_name'], 'ebs': ebs, } mapping.append(res) if mapping: result['blockDeviceMapping'] = mapping result['rootDeviceType'] = root_device_type @staticmethod def _format_instance_root_device_name(instance, result): result['rootDeviceName'] = (instance.get('root_device_name') or block_device.DEFAULT_ROOT_DEV_NAME) @staticmethod def _format_instance_type(instance, result): instance_type = instance_types.extract_instance_type(instance) result['instanceType'] = instance_type['name'] @staticmethod def _format_group_set(instance, result): security_group_names = [] if instance.get('security_groups'): for security_group in instance['security_groups']: security_group_names.append(security_group['name']) result['groupSet'] = utils.convert_to_list_dict( security_group_names, 'groupId') def _format_instances(self, context, instance_id=None, use_v6=False, instances_cache=None, **search_opts): # TODO(termie): this method is poorly named as its name does not imply # that it will be making a variety of database calls # rather than simply formatting a bunch of instances that # were handed to it reservations = {} if not instances_cache: instances_cache = {} # NOTE(vish): instance_id is an optional list of ids to filter by if instance_id: instances = [] for ec2_id in instance_id: if ec2_id in instances_cache: instances.append(instances_cache[ec2_id]) else: try: instance_uuid = ec2utils.ec2_inst_id_to_uuid(context, ec2_id) instance = self.compute_api.get(context, instance_uuid) except exception.NotFound: continue instances.append(instance) else: try: # always filter out deleted instances search_opts['deleted'] = False instances = self.compute_api.get_all(context, search_opts=search_opts, sort_dir='asc') except exception.NotFound: instances = [] for instance in instances: if not context.is_admin: if pipelib.is_vpn_image(instance['image_ref']): continue i = {} instance_uuid = instance['uuid'] ec2_id = ec2utils.id_to_ec2_inst_id(instance_uuid) i['instanceId'] = ec2_id image_uuid = instance['image_ref'] i['imageId'] = ec2utils.glance_id_to_ec2_id(context, image_uuid) self._format_kernel_id(context, instance, i, 'kernelId') self._format_ramdisk_id(context, instance, i, 'ramdiskId') i['instanceState'] = _state_description( instance['vm_state'], instance['shutdown_terminate']) fixed_ip = None floating_ip = None ip_info = ec2utils.get_ip_info_for_instance(context, instance) if ip_info['fixed_ips']: fixed_ip = ip_info['fixed_ips'][0] if ip_info['floating_ips']: floating_ip = ip_info['floating_ips'][0] if ip_info['fixed_ip6s']: i['dnsNameV6'] = ip_info['fixed_ip6s'][0] if CONF.ec2_private_dns_show_ip: i['privateDnsName'] = fixed_ip else: i['privateDnsName'] = instance['hostname'] i['privateIpAddress'] = fixed_ip i['publicDnsName'] = floating_ip i['ipAddress'] = floating_ip or fixed_ip i['dnsName'] = i['publicDnsName'] or i['privateDnsName'] i['keyName'] = instance['key_name'] if context.is_admin: i['keyName'] = '%s (%s, %s)' % (i['keyName'], instance['project_id'], instance['host']) i['productCodesSet'] = utils.convert_to_list_dict([], 'product_codes') self._format_instance_type(instance, i) i['launchTime'] = instance['created_at'] i['amiLaunchIndex'] = instance['launch_index'] self._format_instance_root_device_name(instance, i) self._format_instance_bdm(context, instance['uuid'], i['rootDeviceName'], i) host = instance['host'] zone = ec2utils.get_availability_zone_by_host(host) i['placement'] = {'availabilityZone': zone} if instance['reservation_id'] not in reservations: r = {} r['reservationId'] = instance['reservation_id'] r['ownerId'] = instance['project_id'] self._format_group_set(instance, r) r['instancesSet'] = [] reservations[instance['reservation_id']] = r reservations[instance['reservation_id']]['instancesSet'].append(i) return list(reservations.values()) def describe_addresses(self, context, public_ip=None, **kwargs): if public_ip: floatings = [] for address in public_ip: floating = self.network_api.get_floating_ip_by_address(context, address) floatings.append(floating) else: floatings = self.network_api.get_floating_ips_by_project(context) addresses = [self._format_address(context, f) for f in floatings] return {'addressesSet': addresses} def _format_address(self, context, floating_ip): ec2_id = None if floating_ip['fixed_ip_id']: fixed_id = floating_ip['fixed_ip_id'] fixed = self.network_api.get_fixed_ip(context, fixed_id) if fixed['instance_uuid'] is not None: ec2_id = ec2utils.id_to_ec2_inst_id(fixed['instance_uuid']) address = {'public_ip': floating_ip['address'], 'instance_id': ec2_id} if context.is_admin: details = "%s (%s)" % (address['instance_id'], floating_ip['project_id']) address['instance_id'] = details return address def allocate_address(self, context, **kwargs): LOG.audit(_("Allocate address"), context=context) try: public_ip = self.network_api.allocate_floating_ip(context) except exception.FloatingIpLimitExceeded: raise exception.EC2APIError(_('No more floating IPs available')) return {'publicIp': public_ip} def release_address(self, context, public_ip, **kwargs): LOG.audit(_("Release address %s"), public_ip, context=context) try: self.network_api.release_floating_ip(context, address=public_ip) return {'return': "true"} except exception.FloatingIpNotFound: raise exception.EC2APIError(_('Unable to release IP Address.')) def associate_address(self, context, instance_id, public_ip, **kwargs): LOG.audit(_("Associate address %(public_ip)s to" " instance %(instance_id)s") % locals(), context=context) instance_uuid = ec2utils.ec2_inst_id_to_uuid(context, instance_id) instance = self.compute_api.get(context, instance_uuid) cached_ipinfo = ec2utils.get_ip_info_for_instance(context, instance) fixed_ips = cached_ipinfo['fixed_ips'] + cached_ipinfo['fixed_ip6s'] if not fixed_ips: msg = _('Unable to associate IP Address, no fixed_ips.') raise exception.EC2APIError(msg) # TODO(tr3buchet): this will associate the floating IP with the # first fixed_ip an instance has. This should be # changed to support specifying a particular fixed_ip if # multiple exist but this may not apply to ec2.. if len(fixed_ips) > 1: msg = _('multiple fixed_ips exist, using the first: %s') LOG.warning(msg, fixed_ips[0]) try: self.network_api.associate_floating_ip(context, instance, floating_address=public_ip, fixed_address=fixed_ips[0]) return {'return': 'true'} except exception.FloatingIpAssociated: msg = _('Floating ip is already associated.') raise exception.EC2APIError(msg) except exception.NoFloatingIpInterface: msg = _('l3driver call to add floating ip failed.') raise exception.EC2APIError(msg) except Exception: msg = _('Error, unable to associate floating ip.') LOG.exception(msg) raise exception.EC2APIError(msg) def disassociate_address(self, context, public_ip, **kwargs): instance_id = self.network_api.get_instance_id_by_floating_address( context, public_ip) instance = self.compute_api.get(context, instance_id) LOG.audit(_("Disassociate address %s"), public_ip, context=context) try: self.network_api.disassociate_floating_ip(context, instance, address=public_ip) except exception.FloatingIpNotAssociated: msg = _('Floating ip is not associated.') raise exception.EC2APIError(msg) except exception.CannotDisassociateAutoAssignedFloatingIP: msg = _('Cannot disassociate auto assigned floating ip') raise exception.EC2APIError(msg) return {'return': "true"} def run_instances(self, context, **kwargs): min_count = int(kwargs.get('min_count', 1)) if kwargs.get('kernel_id'): kernel = self._get_image(context, kwargs['kernel_id']) kwargs['kernel_id'] = ec2utils.id_to_glance_id(context, kernel['id']) if kwargs.get('ramdisk_id'): ramdisk = self._get_image(context, kwargs['ramdisk_id']) kwargs['ramdisk_id'] = ec2utils.id_to_glance_id(context, ramdisk['id']) for bdm in kwargs.get('block_device_mapping', []): _parse_block_device_mapping(bdm) image = self._get_image(context, kwargs['image_id']) image_uuid = ec2utils.id_to_glance_id(context, image['id']) if image: image_state = self._get_image_state(image) else: raise exception.ImageNotFoundEC2(image_id=kwargs['image_id']) if image_state != 'available': raise exception.EC2APIError(_('Image must be available')) (instances, resv_id) = self.compute_api.create(context, instance_type=instance_types.get_instance_type_by_name( kwargs.get('instance_type', None)), image_href=image_uuid, max_count=int(kwargs.get('max_count', min_count)), min_count=min_count, kernel_id=kwargs.get('kernel_id'), ramdisk_id=kwargs.get('ramdisk_id'), key_name=kwargs.get('key_name'), user_data=kwargs.get('user_data'), security_group=kwargs.get('security_group'), availability_zone=kwargs.get('placement', {}).get( 'availability_zone'), block_device_mapping=kwargs.get('block_device_mapping', {})) return self._format_run_instances(context, resv_id) def _ec2_ids_to_instances(self, context, instance_id): """Get all instances first, to prevent partial executions.""" instances = [] for ec2_id in instance_id: validate_ec2_id(ec2_id) instance_uuid = ec2utils.ec2_inst_id_to_uuid(context, ec2_id) instance = self.compute_api.get(context, instance_uuid) instances.append(instance) return instances def terminate_instances(self, context, instance_id, **kwargs): """Terminate each instance in instance_id, which is a list of ec2 ids. instance_id is a kwarg so its name cannot be modified.""" previous_states = self._ec2_ids_to_instances(context, instance_id) LOG.debug(_("Going to start terminating instances")) for instance in previous_states: self.compute_api.delete(context, instance) return self._format_terminate_instances(context, instance_id, previous_states) def reboot_instances(self, context, instance_id, **kwargs): """instance_id is a list of instance ids.""" instances = self._ec2_ids_to_instances(context, instance_id) LOG.audit(_("Reboot instance %r"), instance_id, context=context) for instance in instances: self.compute_api.reboot(context, instance, 'HARD') return True def stop_instances(self, context, instance_id, **kwargs): """Stop each instances in instance_id. Here instance_id is a list of instance ids""" instances = self._ec2_ids_to_instances(context, instance_id) LOG.debug(_("Going to stop instances")) for instance in instances: self.compute_api.stop(context, instance) return True def start_instances(self, context, instance_id, **kwargs): """Start each instances in instance_id. Here instance_id is a list of instance ids""" instances = self._ec2_ids_to_instances(context, instance_id) LOG.debug(_("Going to start instances")) for instance in instances: self.compute_api.start(context, instance) return True def _get_image(self, context, ec2_id): try: internal_id = ec2utils.ec2_id_to_id(ec2_id) image = self.image_service.show(context, internal_id) except (exception.InvalidEc2Id, exception.ImageNotFound): filters = {'name': ec2_id} images = self.image_service.detail(context, filters=filters) try: return images[0] except IndexError: raise exception.ImageNotFound(image_id=ec2_id) image_type = ec2_id.split('-')[0] if ec2utils.image_type(image.get('container_format')) != image_type: raise exception.ImageNotFound(image_id=ec2_id) return image def _format_image(self, image): """Convert from format defined by GlanceImageService to S3 format.""" i = {} image_type = ec2utils.image_type(image.get('container_format')) ec2_id = ec2utils.image_ec2_id(image.get('id'), image_type) name = image.get('name') i['imageId'] = ec2_id kernel_id = image['properties'].get('kernel_id') if kernel_id: i['kernelId'] = ec2utils.image_ec2_id(kernel_id, 'aki') ramdisk_id = image['properties'].get('ramdisk_id') if ramdisk_id: i['ramdiskId'] = ec2utils.image_ec2_id(ramdisk_id, 'ari') i['imageOwnerId'] = image.get('owner') img_loc = image['properties'].get('image_location') if img_loc: i['imageLocation'] = img_loc else: i['imageLocation'] = "%s (%s)" % (img_loc, name) i['name'] = name if not name and img_loc: # This should only occur for images registered with ec2 api # prior to that api populating the glance name i['name'] = img_loc i['imageState'] = self._get_image_state(image) i['description'] = image.get('description') display_mapping = {'aki': 'kernel', 'ari': 'ramdisk', 'ami': 'machine'} i['imageType'] = display_mapping.get(image_type) i['isPublic'] = not not image.get('is_public') i['architecture'] = image['properties'].get('architecture') properties = image['properties'] root_device_name = block_device.properties_root_device_name(properties) root_device_type = 'instance-store' for bdm in properties.get('block_device_mapping', []): if (block_device.strip_dev(bdm.get('device_name')) == block_device.strip_dev(root_device_name) and ('snapshot_id' in bdm or 'volume_id' in bdm) and not bdm.get('no_device')): root_device_type = 'ebs' i['rootDeviceName'] = (root_device_name or block_device.DEFAULT_ROOT_DEV_NAME) i['rootDeviceType'] = root_device_type _format_mappings(properties, i) return i def describe_images(self, context, image_id=None, **kwargs): # NOTE: image_id is a list! if image_id: images = [] for ec2_id in image_id: try: image = self._get_image(context, ec2_id) except exception.NotFound: raise exception.ImageNotFound(image_id=ec2_id) images.append(image) else: images = self.image_service.detail(context) images = [self._format_image(i) for i in images] return {'imagesSet': images} def deregister_image(self, context, image_id, **kwargs): LOG.audit(_("De-registering image %s"), image_id, context=context) image = self._get_image(context, image_id) internal_id = image['id'] self.image_service.delete(context, internal_id) return True def _register_image(self, context, metadata): image = self.image_service.create(context, metadata) image_type = ec2utils.image_type(image.get('container_format')) image_id = ec2utils.image_ec2_id(image['id'], image_type) return image_id def register_image(self, context, image_location=None, **kwargs): if image_location is None and kwargs.get('name'): image_location = kwargs['name'] if image_location is None: raise exception.EC2APIError(_('imageLocation is required')) metadata = {'properties': {'image_location': image_location}} if kwargs.get('name'): metadata['name'] = kwargs['name'] else: metadata['name'] = image_location if 'root_device_name' in kwargs: metadata['properties']['root_device_name'] = kwargs.get( 'root_device_name') mappings = [_parse_block_device_mapping(bdm) for bdm in kwargs.get('block_device_mapping', [])] if mappings: metadata['properties']['block_device_mapping'] = mappings image_id = self._register_image(context, metadata) msg = _("Registered image %(image_location)s with" " id %(image_id)s") % locals() LOG.audit(msg, context=context) return {'imageId': image_id} def describe_image_attribute(self, context, image_id, attribute, **kwargs): def _block_device_mapping_attribute(image, result): _format_mappings(image['properties'], result) def _launch_permission_attribute(image, result): result['launchPermission'] = [] if image['is_public']: result['launchPermission'].append({'group': 'all'}) def _root_device_name_attribute(image, result): _prop_root_dev_name = block_device.properties_root_device_name result['rootDeviceName'] = _prop_root_dev_name(image['properties']) if result['rootDeviceName'] is None: result['rootDeviceName'] = block_device.DEFAULT_ROOT_DEV_NAME def _kernel_attribute(image, result): kernel_id = image['properties'].get('kernel_id') if kernel_id: result['kernel'] = { 'value': ec2utils.image_ec2_id(kernel_id, 'aki') } def _ramdisk_attribute(image, result): ramdisk_id = image['properties'].get('ramdisk_id') if ramdisk_id: result['ramdisk'] = { 'value': ec2utils.image_ec2_id(ramdisk_id, 'ari') } supported_attributes = { 'blockDeviceMapping': _block_device_mapping_attribute, 'launchPermission': _launch_permission_attribute, 'rootDeviceName': _root_device_name_attribute, 'kernel': _kernel_attribute, 'ramdisk': _ramdisk_attribute, } fn = supported_attributes.get(attribute) if fn is None: raise exception.EC2APIError(_('attribute not supported: %s') % attribute) try: image = self._get_image(context, image_id) except exception.NotFound: raise exception.ImageNotFound(image_id=image_id) result = {'imageId': image_id} fn(image, result) return result def modify_image_attribute(self, context, image_id, attribute, operation_type, **kwargs): # TODO(devcamcar): Support users and groups other than 'all'. if attribute != 'launchPermission': raise exception.EC2APIError(_('attribute not supported: %s') % attribute) if 'user_group' not in kwargs: raise exception.EC2APIError(_('user or group not specified')) if len(kwargs['user_group']) != 1 and kwargs['user_group'][0] != 'all': raise exception.EC2APIError(_('only group "all" is supported')) if operation_type not in ['add', 'remove']: msg = _('operation_type must be add or remove') raise exception.EC2APIError(msg) LOG.audit(_("Updating image %s publicity"), image_id, context=context) try: image = self._get_image(context, image_id) except exception.NotFound: raise exception.ImageNotFound(image_id=image_id) internal_id = image['id'] del(image['id']) image['is_public'] = (operation_type == 'add') try: return self.image_service.update(context, internal_id, image) except exception.ImageNotAuthorized: msg = _('Not allowed to modify attributes for image %s') raise exception.EC2APIError(msg % image_id) def update_image(self, context, image_id, **kwargs): internal_id = ec2utils.ec2_id_to_id(image_id) result = self.image_service.update(context, internal_id, dict(kwargs)) return result # TODO(yamahata): race condition # At the moment there is no way to prevent others from # manipulating instances/volumes/snapshots. # As other code doesn't take it into consideration, here we don't # care of it for now. Ostrich algorithm def create_image(self, context, instance_id, **kwargs): # NOTE(yamahata): name/description are ignored by register_image(), # do so here no_reboot = kwargs.get('no_reboot', False) name = kwargs.get('name') validate_ec2_id(instance_id) ec2_instance_id = instance_id instance_uuid = ec2utils.ec2_inst_id_to_uuid(context, ec2_instance_id) instance = self.compute_api.get(context, instance_uuid) bdms = self.compute_api.get_instance_bdms(context, instance) # CreateImage only supported for the analogue of EBS-backed instances if not self.compute_api.is_volume_backed_instance(context, instance, bdms): root = instance['root_device_name'] msg = _("Invalid value '%(ec2_instance_id)s' for instanceId. " "Instance does not have a volume attached at root " "(%(root)s)") % locals() raise exception.InvalidParameterValue(err=msg) # stop the instance if necessary restart_instance = False if not no_reboot: vm_state = instance['vm_state'] # if the instance is in subtle state, refuse to proceed. if vm_state not in (vm_states.ACTIVE, vm_states.STOPPED): raise exception.InstanceNotRunning(instance_id=ec2_instance_id) if vm_state == vm_states.ACTIVE: restart_instance = True self.compute_api.stop(context, instance) # wait instance for really stopped start_time = time.time() while vm_state != vm_states.STOPPED: time.sleep(1) instance = self.compute_api.get(context, instance_uuid) vm_state = instance['vm_state'] # NOTE(yamahata): timeout and error. 1 hour for now for safety. # Is it too short/long? # Or is there any better way? timeout = 1 * 60 * 60 if time.time() > start_time + timeout: raise exception.EC2APIError( _('Couldn\'t stop instance with in %d sec') % timeout) glance_uuid = instance['image_ref'] ec2_image_id = ec2utils.glance_id_to_ec2_id(context, glance_uuid) src_image = self._get_image(context, ec2_image_id) image_meta = dict(src_image) def _unmap_id_property(properties, name): if properties[name]: properties[name] = ec2utils.id_to_glance_id(context, properties[name]) # ensure the ID properties are unmapped back to the glance UUID _unmap_id_property(image_meta['properties'], 'kernel_id') _unmap_id_property(image_meta['properties'], 'ramdisk_id') # meaningful image name name_map = dict(instance=instance['uuid'], now=timeutils.isotime()) name = name or _('image of %(instance)s at %(now)s') % name_map new_image = self.compute_api.snapshot_volume_backed(context, instance, image_meta, name) ec2_id = ec2utils.glance_id_to_ec2_id(context, new_image['id']) if restart_instance: self.compute_api.start(context, instance) return {'imageId': ec2_id} class EC2SecurityGroupExceptions(object): @staticmethod def raise_invalid_property(msg): raise exception.InvalidParameterValue(err=msg) @staticmethod def raise_group_already_exists(msg): raise exception.EC2APIError(message=msg) @staticmethod def raise_invalid_group(msg): raise exception.InvalidGroup(reason=msg) @staticmethod def raise_invalid_cidr(cidr, decoding_exception=None): if decoding_exception: raise decoding_exception else: raise exception.EC2APIError(_("Invalid CIDR")) @staticmethod def raise_over_quota(msg): raise exception.EC2APIError(message=msg) @staticmethod def raise_not_found(msg): pass class CloudSecurityGroupNovaAPI(EC2SecurityGroupExceptions, compute_api.SecurityGroupAPI): pass class CloudSecurityGroupQuantumAPI(EC2SecurityGroupExceptions, quantum_driver.SecurityGroupAPI): pass def get_cloud_security_group_api(): if cfg.CONF.security_group_api.lower() == 'nova': return CloudSecurityGroupNovaAPI() elif cfg.CONF.security_group_api.lower() == 'quantum': return CloudSecurityGroupQuantumAPI() else: raise NotImplementedError()
""" Axislines includes modified implementation of the Axes class. The biggest difference is that the artists responsible to draw axis line, ticks, ticklabel and axis labels are separated out from the mpl's Axis class, which are much more than artists in the original mpl. Originally, this change was motivated to support curvilinear grid. Here are a few reasons that I came up with new axes class. * "top" and "bottom" x-axis (or "left" and "right" y-axis) can have different ticks (tick locations and labels). This is not possible with the current mpl, although some twin axes trick can help. * Curvilinear grid. * angled ticks. In the new axes class, xaxis and yaxis is set to not visible by default, and new set of artist (AxisArtist) are defined to draw axis line, ticks, ticklabels and axis label. Axes.axis attribute serves as a dictionary of these artists, i.e., ax.axis["left"] is a AxisArtist instance responsible to draw left y-axis. The default Axes.axis contains "bottom", "left", "top" and "right". AxisArtist can be considered as a container artist and has following children artists which will draw ticks, labels, etc. * line * major_ticks, major_ticklabels * minor_ticks, minor_ticklabels * offsetText * label Note that these are separate artists from Axis class of the original mpl, thus most of tick-related command in the original mpl won't work, although some effort has made to work with. For example, color and markerwidth of the ax.axis["bottom"].major_ticks will follow those of Axes.xaxis unless explicitly specified. In addition to AxisArtist, the Axes will have *gridlines* attribute, which obviously draws grid lines. The gridlines needs to be separated from the axis as some gridlines can never pass any axis. """ from __future__ import (absolute_import, division, print_function, unicode_literals) import six import matplotlib.axes as maxes import matplotlib.artist as martist import matplotlib.text as mtext import matplotlib.font_manager as font_manager from matplotlib.path import Path from matplotlib.transforms import Affine2D, ScaledTranslation, \ IdentityTransform, TransformedPath, Bbox from matplotlib.collections import LineCollection from matplotlib import rcParams from matplotlib.artist import allow_rasterization import warnings import numpy as np import matplotlib.lines as mlines from .axisline_style import AxislineStyle from .axis_artist import AxisArtist, GridlinesCollection class AxisArtistHelper(object): """ AxisArtistHelper should define following method with given APIs. Note that the first axes argument will be axes attribute of the caller artist. # LINE (spinal line?) def get_line(self, axes): # path : Path return path def get_line_transform(self, axes): # ... # trans : transform return trans # LABEL def get_label_pos(self, axes): # x, y : position return (x, y), trans def get_label_offset_transform(self, \ axes, pad_points, fontprops, renderer, bboxes, ): # va : vertical alignment # ha : horizontal alignment # a : angle return trans, va, ha, a # TICK def get_tick_transform(self, axes): return trans def get_tick_iterators(self, axes): # iter : iterable object that yields (c, angle, l) where # c, angle, l is position, tick angle, and label return iter_major, iter_minor """ class _Base(object): """ Base class for axis helper. """ def __init__(self): """ """ self.delta1, self.delta2 = 0.00001, 0.00001 def update_lim(self, axes): pass class Fixed(_Base): """ Helper class for a fixed (in the axes coordinate) axis. """ _default_passthru_pt = dict(left=(0, 0), right=(1, 0), bottom=(0, 0), top=(0, 1)) def __init__(self, loc, nth_coord=None, ): """ nth_coord = along which coordinate value varies in 2d, nth_coord = 0 -> x axis, nth_coord = 1 -> y axis """ self._loc = loc if loc not in ["left", "right", "bottom", "top"]: raise ValueError("%s" % loc) if nth_coord is None: if loc in ["left", "right"]: nth_coord = 1 elif loc in ["bottom", "top"]: nth_coord = 0 self.nth_coord = nth_coord super(AxisArtistHelper.Fixed, self).__init__() self.passthru_pt = self._default_passthru_pt[loc] _verts = np.array([[0., 0.], [1., 1.]]) fixed_coord = 1-nth_coord _verts[:,fixed_coord] = self.passthru_pt[fixed_coord] # axis line in transAxes self._path = Path(_verts) def get_nth_coord(self): return self.nth_coord # LINE def get_line(self, axes): return self._path def get_line_transform(self, axes): return axes.transAxes # LABEL def get_axislabel_transform(self, axes): return axes.transAxes def get_axislabel_pos_angle(self, axes): """ label reference position in transAxes. get_label_transform() returns a transform of (transAxes+offset) """ loc = self._loc pos, angle_tangent = dict(left=((0., 0.5), 90), right=((1., 0.5), 90), bottom=((0.5, 0.), 0), top=((0.5, 1.), 0))[loc] return pos, angle_tangent # TICK def get_tick_transform(self, axes): trans_tick = [axes.get_xaxis_transform(), axes.get_yaxis_transform()][self.nth_coord] return trans_tick class Floating(_Base): def __init__(self, nth_coord, value): self.nth_coord = nth_coord self._value = value super(AxisArtistHelper.Floating, self).__init__() def get_nth_coord(self): return self.nth_coord def get_line(self, axes): raise RuntimeError("get_line method should be defined by the derived class") class AxisArtistHelperRectlinear(object): class Fixed(AxisArtistHelper.Fixed): def __init__(self, axes, loc, nth_coord=None, ): """ nth_coord = along which coordinate value varies in 2d, nth_coord = 0 -> x axis, nth_coord = 1 -> y axis """ super(AxisArtistHelperRectlinear.Fixed, self).__init__( \ loc, nth_coord) self.axis = [axes.xaxis, axes.yaxis][self.nth_coord] # TICK def get_tick_iterators(self, axes): """tick_loc, tick_angle, tick_label""" loc = self._loc if loc in ["bottom", "top"]: angle_normal, angle_tangent = 90, 0 else: angle_normal, angle_tangent = 0, 90 major = self.axis.major majorLocs = major.locator() major.formatter.set_locs(majorLocs) majorLabels = [major.formatter(val, i) for i, val in enumerate(majorLocs)] minor = self.axis.minor minorLocs = minor.locator() minor.formatter.set_locs(minorLocs) minorLabels = [minor.formatter(val, i) for i, val in enumerate(minorLocs)] trans_tick = self.get_tick_transform(axes) tr2ax = trans_tick + axes.transAxes.inverted() def _f(locs, labels): for x, l in zip(locs, labels): c = list(self.passthru_pt) # copy c[self.nth_coord] = x # check if the tick point is inside axes c2 = tr2ax.transform_point(c) #delta=0.00001 if 0. -self.delta1<= c2[self.nth_coord] <= 1.+self.delta2: yield c, angle_normal, angle_tangent, l return _f(majorLocs, majorLabels), _f(minorLocs, minorLabels) class Floating(AxisArtistHelper.Floating): def __init__(self, axes, nth_coord, passingthrough_point, axis_direction="bottom"): super(AxisArtistHelperRectlinear.Floating, self).__init__( \ nth_coord, passingthrough_point) self._axis_direction = axis_direction self.axis = [axes.xaxis, axes.yaxis][self.nth_coord] def get_line(self, axes): _verts = np.array([[0., 0.], [1., 1.]]) fixed_coord = 1-self.nth_coord trans_passingthrough_point = axes.transData + axes.transAxes.inverted() p = trans_passingthrough_point.transform_point([self._value, self._value]) _verts[:,fixed_coord] = p[fixed_coord] return Path(_verts) def get_line_transform(self, axes): return axes.transAxes def get_axislabel_transform(self, axes): return axes.transAxes def get_axislabel_pos_angle(self, axes): """ label reference position in transAxes. get_label_transform() returns a transform of (transAxes+offset) """ loc = self._axis_direction #angle = dict(left=0, # right=0, # bottom=.5*np.pi, # top=.5*np.pi)[loc] if self.nth_coord == 0: angle = 0 else: angle = 90 _verts = [0.5, 0.5] fixed_coord = 1-self.nth_coord trans_passingthrough_point = axes.transData + axes.transAxes.inverted() p = trans_passingthrough_point.transform_point([self._value, self._value]) _verts[fixed_coord] = p[fixed_coord] if not (0. <= _verts[fixed_coord] <= 1.): return None, None else: return _verts, angle def get_tick_transform(self, axes): return axes.transData def get_tick_iterators(self, axes): """tick_loc, tick_angle, tick_label""" loc = self._axis_direction if loc in ["bottom", "top"]: angle_normal, angle_tangent = 90, 0 else: angle_normal, angle_tangent = 0, 90 if self.nth_coord == 0: angle_normal, angle_tangent = 90, 0 else: angle_normal, angle_tangent = 0, 90 #angle = 90 - 90 * self.nth_coord major = self.axis.major majorLocs = major.locator() major.formatter.set_locs(majorLocs) majorLabels = [major.formatter(val, i) for i, val in enumerate(majorLocs)] minor = self.axis.minor minorLocs = minor.locator() minor.formatter.set_locs(minorLocs) minorLabels = [minor.formatter(val, i) for i, val in enumerate(minorLocs)] tr2ax = axes.transData + axes.transAxes.inverted() def _f(locs, labels): for x, l in zip(locs, labels): c = [self._value, self._value] c[self.nth_coord] = x c1, c2 = tr2ax.transform_point(c) if 0. <= c1 <= 1. and 0. <= c2 <= 1.: if 0. - self.delta1 <= [c1, c2][self.nth_coord] <= 1. + self.delta2: yield c, angle_normal, angle_tangent, l return _f(majorLocs, majorLabels), _f(minorLocs, minorLabels) class GridHelperBase(object): def __init__(self): self._force_update = True self._old_limits = None super(GridHelperBase, self).__init__() def update_lim(self, axes): x1, x2 = axes.get_xlim() y1, y2 = axes.get_ylim() if self._force_update or self._old_limits != (x1, x2, y1, y2): self._update(x1, x2, y1, y2) self._force_update = False self._old_limits = (x1, x2, y1, y2) def _update(self, x1, x2, y1, y2): pass def invalidate(self): self._force_update = True def valid(self): return not self._force_update def get_gridlines(self, which, axis): """ Return list of grid lines as a list of paths (list of points). *which* : "major" or "minor" *axis* : "both", "x" or "y" """ return [] def new_gridlines(self, ax): """ Create and return a new GridlineCollection instance. *which* : "major" or "minor" *axis* : "both", "x" or "y" """ gridlines = GridlinesCollection(None, transform=ax.transData, colors=rcParams['grid.color'], linestyles=rcParams['grid.linestyle'], linewidths=rcParams['grid.linewidth']) ax._set_artist_props(gridlines) gridlines.set_grid_helper(self) ax.axes._set_artist_props(gridlines) # gridlines.set_clip_path(self.axes.patch) # set_clip_path need to be deferred after Axes.cla is completed. # It is done inside the cla. return gridlines class GridHelperRectlinear(GridHelperBase): def __init__(self, axes): super(GridHelperRectlinear, self).__init__() self.axes = axes def new_fixed_axis(self, loc, nth_coord=None, axis_direction=None, offset=None, axes=None, ): if axes is None: warnings.warn("'new_fixed_axis' explicitly requires the axes keyword.") axes = self.axes _helper = AxisArtistHelperRectlinear.Fixed(axes, loc, nth_coord) if axis_direction is None: axis_direction = loc axisline = AxisArtist(axes, _helper, offset=offset, axis_direction=axis_direction, ) return axisline def new_floating_axis(self, nth_coord, value, axis_direction="bottom", axes=None, ): if axes is None: warnings.warn("'new_floating_axis' explicitly requires the axes keyword.") axes = self.axes passthrough_point = (value, value) transform = axes.transData _helper = AxisArtistHelperRectlinear.Floating( \ axes, nth_coord, value, axis_direction) axisline = AxisArtist(axes, _helper) axisline.line.set_clip_on(True) axisline.line.set_clip_box(axisline.axes.bbox) return axisline def get_gridlines(self, which="major", axis="both"): """ return list of gridline coordinates in data coordinates. *which* : "major" or "minor" *axis* : "both", "x" or "y" """ gridlines = [] if axis in ["both", "x"]: locs = [] y1, y2 = self.axes.get_ylim() #if self.axes.xaxis._gridOnMajor: if which in ["both", "major"]: locs.extend(self.axes.xaxis.major.locator()) #if self.axes.xaxis._gridOnMinor: if which in ["both", "minor"]: locs.extend(self.axes.xaxis.minor.locator()) for x in locs: gridlines.append([[x, x], [y1, y2]]) if axis in ["both", "y"]: x1, x2 = self.axes.get_xlim() locs = [] if self.axes.yaxis._gridOnMajor: #if which in ["both", "major"]: locs.extend(self.axes.yaxis.major.locator()) if self.axes.yaxis._gridOnMinor: #if which in ["both", "minor"]: locs.extend(self.axes.yaxis.minor.locator()) for y in locs: gridlines.append([[x1, x2], [y, y]]) return gridlines class SimpleChainedObjects(object): def __init__(self, objects): self._objects = objects def __getattr__(self, k): _a = SimpleChainedObjects([getattr(a, k) for a in self._objects]) return _a def __call__(self, *kl, **kwargs): for m in self._objects: m(*kl, **kwargs) class Axes(maxes.Axes): class AxisDict(dict): def __init__(self, axes): self.axes = axes super(Axes.AxisDict, self).__init__() def __getitem__(self, k): if isinstance(k, tuple): r = SimpleChainedObjects([dict.__getitem__(self, k1) for k1 in k]) return r elif isinstance(k, slice): if k.start == None and k.stop == None and k.step == None: r = SimpleChainedObjects(list(six.itervalues(self))) return r else: raise ValueError("Unsupported slice") else: return dict.__getitem__(self, k) def __call__(self, *v, **kwargs): return maxes.Axes.axis(self.axes, *v, **kwargs) def __init__(self, *kl, **kw): helper = kw.pop("grid_helper", None) self._axisline_on = True if helper: self._grid_helper = helper else: self._grid_helper = GridHelperRectlinear(self) super(Axes, self).__init__(*kl, **kw) self.toggle_axisline(True) def toggle_axisline(self, b=None): if b is None: b = not self._axisline_on if b: self._axisline_on = True for s in self.spines.values(): s.set_visible(False) self.xaxis.set_visible(False) self.yaxis.set_visible(False) else: self._axisline_on = False for s in self.spines.values(): s.set_visible(True) self.xaxis.set_visible(True) self.yaxis.set_visible(True) def _init_axis(self): super(Axes, self)._init_axis() def _init_axis_artists(self, axes=None): if axes is None: axes = self self._axislines = self.AxisDict(self) new_fixed_axis = self.get_grid_helper().new_fixed_axis for loc in ["bottom", "top", "left", "right"]: self._axislines[loc] = new_fixed_axis(loc=loc, axes=axes, axis_direction=loc) for axisline in [self._axislines["top"], self._axislines["right"]]: axisline.label.set_visible(False) axisline.major_ticklabels.set_visible(False) axisline.minor_ticklabels.set_visible(False) def _get_axislines(self): return self._axislines axis = property(_get_axislines) def new_gridlines(self, grid_helper=None): """ Create and return a new GridlineCollection instance. *which* : "major" or "minor" *axis* : "both", "x" or "y" """ if grid_helper is None: grid_helper = self.get_grid_helper() gridlines = grid_helper.new_gridlines(self) return gridlines def _init_gridlines(self, grid_helper=None): # It is done inside the cla. gridlines = self.new_gridlines(grid_helper) self.gridlines = gridlines def cla(self): # gridlines need to b created before cla() since cla calls grid() self._init_gridlines() super(Axes, self).cla() # the clip_path should be set after Axes.cla() since that's # when a patch is created. self.gridlines.set_clip_path(self.axes.patch) self._init_axis_artists() def get_grid_helper(self): return self._grid_helper def grid(self, b=None, which='major', axis="both", **kwargs): """ Toggle the gridlines, and optionally set the properties of the lines. """ # their are some discrepancy between the behavior of grid in # axes_grid and the original mpl's grid, because axes_grid # explicitly set the visibility of the gridlines. super(Axes, self).grid(b, which=which, axis=axis, **kwargs) if not self._axisline_on: return if b is None: if self.axes.xaxis._gridOnMinor or self.axes.xaxis._gridOnMajor or \ self.axes.yaxis._gridOnMinor or self.axes.yaxis._gridOnMajor: b=True else: b=False self.gridlines.set_which(which) self.gridlines.set_axis(axis) self.gridlines.set_visible(b) if len(kwargs): martist.setp(self.gridlines, **kwargs) def get_children(self): if self._axisline_on: children = list(six.itervalues(self._axislines)) + [self.gridlines] else: children = [] children.extend(super(Axes, self).get_children()) return children def invalidate_grid_helper(self): self._grid_helper.invalidate() def new_fixed_axis(self, loc, offset=None): gh = self.get_grid_helper() axis = gh.new_fixed_axis(loc, nth_coord=None, axis_direction=None, offset=offset, axes=self, ) return axis def new_floating_axis(self, nth_coord, value, axis_direction="bottom", ): gh = self.get_grid_helper() axis = gh.new_floating_axis(nth_coord, value, axis_direction=axis_direction, axes=self) return axis def draw(self, renderer, inframe=False): if not self._axisline_on: super(Axes, self).draw(renderer, inframe) return orig_artists = self.artists self.artists = self.artists + list(self._axislines.values()) + [self.gridlines] super(Axes, self).draw(renderer, inframe) self.artists = orig_artists def get_tightbbox(self, renderer, call_axes_locator=True): bb0 = super(Axes, self).get_tightbbox(renderer, call_axes_locator) if not self._axisline_on: return bb0 bb = [bb0] for axisline in list(six.itervalues(self._axislines)): if not axisline.get_visible(): continue bb.append(axisline.get_tightbbox(renderer)) # if axisline.label.get_visible(): # bb.append(axisline.label.get_window_extent(renderer)) # if axisline.major_ticklabels.get_visible(): # bb.extend(axisline.major_ticklabels.get_window_extents(renderer)) # if axisline.minor_ticklabels.get_visible(): # bb.extend(axisline.minor_ticklabels.get_window_extents(renderer)) # if axisline.major_ticklabels.get_visible() or \ # axisline.minor_ticklabels.get_visible(): # bb.append(axisline.offsetText.get_window_extent(renderer)) #bb.extend([c.get_window_extent(renderer) for c in artists \ # if c.get_visible()]) _bbox = Bbox.union([b for b in bb if b and (b.width!=0 or b.height!=0)]) return _bbox Subplot = maxes.subplot_class_factory(Axes) class AxesZero(Axes): def __init__(self, *kl, **kw): super(AxesZero, self).__init__(*kl, **kw) def _init_axis_artists(self): super(AxesZero, self)._init_axis_artists() new_floating_axis = self._grid_helper.new_floating_axis xaxis_zero = new_floating_axis(nth_coord=0, value=0., axis_direction="bottom", axes=self) xaxis_zero.line.set_clip_path(self.patch) xaxis_zero.set_visible(False) self._axislines["xzero"] = xaxis_zero yaxis_zero = new_floating_axis(nth_coord=1, value=0., axis_direction="left", axes=self) yaxis_zero.line.set_clip_path(self.patch) yaxis_zero.set_visible(False) self._axislines["yzero"] = yaxis_zero SubplotZero = maxes.subplot_class_factory(AxesZero) if 0: #if __name__ == "__main__": import matplotlib.pyplot as plt fig = plt.figure(1, (4,3)) ax = SubplotZero(fig, 1, 1, 1) fig.add_subplot(ax) ax.axis["xzero"].set_visible(True) ax.axis["xzero"].label.set_text("Axis Zero") for n in ["top", "right"]: ax.axis[n].set_visible(False) xx = np.arange(0, 2*np.pi, 0.01) ax.plot(xx, np.sin(xx)) ax.set_ylabel("Test") plt.draw() plt.show() if __name__ == "__main__": #if 1: import matplotlib.pyplot as plt fig = plt.figure(1, (4,3)) ax = Subplot(fig, 1, 1, 1) fig.add_subplot(ax) xx = np.arange(0, 2*np.pi, 0.01) ax.plot(xx, np.sin(xx)) ax.set_ylabel("Test") ax.axis["top"].major_ticks.set_tick_out(True) #set_tick_direction("out") ax.axis["bottom"].major_ticks.set_tick_out(True) #set_tick_direction("out") #ax.axis["bottom"].set_tick_direction("in") ax.axis["bottom"].set_label("Tk0") plt.draw() plt.show()
# -*- coding: utf-8 -*- # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from __future__ import print_function from future import standard_library standard_library.install_aliases() from builtins import str from past.builtins import basestring from datetime import datetime import logging from urllib.parse import urlparse from time import sleep import re import sys import airflow from airflow import hooks, settings from airflow.exceptions import AirflowException, AirflowSensorTimeout, AirflowSkipException from airflow.models import BaseOperator, TaskInstance from airflow.hooks.base_hook import BaseHook from airflow.hooks.hdfs_hook import HDFSHook from airflow.utils.state import State from airflow.utils.decorators import apply_defaults class BaseSensorOperator(BaseOperator): ''' Sensor operators are derived from this class an inherit these attributes. Sensor operators keep executing at a time interval and succeed when a criteria is met and fail if and when they time out. :param soft_fail: Set to true to mark the task as SKIPPED on failure :type soft_fail: bool :param poke_interval: Time in seconds that the job should wait in between each tries :type poke_interval: int :param timeout: Time, in seconds before the task times out and fails. :type timeout: int ''' ui_color = '#e6f1f2' @apply_defaults def __init__( self, poke_interval=60, timeout=60*60*24*7, soft_fail=False, *args, **kwargs): super(BaseSensorOperator, self).__init__(*args, **kwargs) self.poke_interval = poke_interval self.soft_fail = soft_fail self.timeout = timeout def poke(self, context): ''' Function that the sensors defined while deriving this class should override. ''' raise AirflowException('Override me.') def execute(self, context): started_at = datetime.now() while not self.poke(context): if (datetime.now() - started_at).total_seconds() > self.timeout: if self.soft_fail: raise AirflowSkipException('Snap. Time is OUT.') else: raise AirflowSensorTimeout('Snap. Time is OUT.') sleep(self.poke_interval) logging.info("Success criteria met. Exiting.") class SqlSensor(BaseSensorOperator): """ Runs a sql statement until a criteria is met. It will keep trying until sql returns no row, or if the first cell in (0, '0', ''). :param conn_id: The connection to run the sensor against :type conn_id: string :param sql: The sql to run. To pass, it needs to return at least one cell that contains a non-zero / empty string value. """ template_fields = ('sql',) template_ext = ('.hql', '.sql',) ui_color = '#7c7287' @apply_defaults def __init__(self, conn_id, sql, *args, **kwargs): self.sql = sql self.conn_id = conn_id super(SqlSensor, self).__init__(*args, **kwargs) def poke(self, context): hook = BaseHook.get_connection(self.conn_id).get_hook() logging.info('Poking: ' + self.sql) records = hook.get_records(self.sql) if not records: return False else: if str(records[0][0]) in ('0', '',): return False else: return True print(records[0][0]) class MetastorePartitionSensor(SqlSensor): """ An alternative to the HivePartitionSensor that talk directly to the MySQL db. This was created as a result of observing sub optimal queries generated by the Metastore thrift service when hitting subpartitioned tables. The Thrift service's queries were written in a way that wouldn't leverage the indexes. :param schema: the schema :type schema: str :param table: the table :type table: str :param partition_name: the partition name, as defined in the PARTITIONS table of the Metastore. Order of the fields does matter. Examples: ``ds=2016-01-01`` or ``ds=2016-01-01/sub=foo`` for a sub partitioned table :type partition_name: str :param mysql_conn_id: a reference to the MySQL conn_id for the metastore :type mysql_conn_id: str """ template_fields = ('partition_name', 'table', 'schema') ui_color = '#8da7be' @apply_defaults def __init__( self, table, partition_name, schema="default", mysql_conn_id="metastore_mysql", *args, **kwargs): self.partition_name = partition_name self.table = table self.schema = schema self.first_poke = True self.conn_id = mysql_conn_id # TODO(aoen): We shouldn't be using SqlSensor here but MetastorePartitionSensor. # The problem is the way apply_defaults works isn't compatible with inheritance. # The inheritance model needs to be reworked in order to support overriding args/ # kwargs with arguments here, then 'conn_id' and 'sql' can be passed into the # constructor below and apply_defaults will no longer throw an exception. super(SqlSensor, self).__init__(*args, **kwargs) def poke(self, context): if self.first_poke: self.first_poke = False if '.' in self.table: self.schema, self.table = self.table.split('.') self.sql = """ SELECT 'X' FROM PARTITIONS A0 LEFT OUTER JOIN TBLS B0 ON A0.TBL_ID = B0.TBL_ID LEFT OUTER JOIN DBS C0 ON B0.DB_ID = C0.DB_ID WHERE B0.TBL_NAME = '{self.table}' AND C0.NAME = '{self.schema}' AND A0.PART_NAME = '{self.partition_name}'; """.format(self=self) return super(MetastorePartitionSensor, self).poke(context) class ExternalTaskSensor(BaseSensorOperator): """ Waits for a task to complete in a different DAG :param external_dag_id: The dag_id that contains the task you want to wait for :type external_dag_id: string :param external_task_id: The task_id that contains the task you want to wait for :type external_task_id: string :param allowed_states: list of allowed states, default is ``['success']`` :type allowed_states: list :param execution_delta: time difference with the previous execution to look at, the default is the same execution_date as the current task. For yesterday, use [positive!] datetime.timedelta(days=1). Either execution_delta or execution_date_fn can be passed to ExternalTaskSensor, but not both. :type execution_delta: datetime.timedelta :param execution_date_fn: function that receives the current execution date and returns the desired execution date to query. Either execution_delta or execution_date_fn can be passed to ExternalTaskSensor, but not both. :type execution_date_fn: callable """ ui_color = '#19647e' @apply_defaults def __init__( self, external_dag_id, external_task_id, allowed_states=None, execution_delta=None, execution_date_fn=None, *args, **kwargs): super(ExternalTaskSensor, self).__init__(*args, **kwargs) self.allowed_states = allowed_states or [State.SUCCESS] if execution_delta is not None and execution_date_fn is not None: raise ValueError( 'Only one of `execution_date` or `execution_date_fn` may' 'be provided to ExternalTaskSensor; not both.') self.execution_delta = execution_delta self.execution_date_fn = execution_date_fn self.external_dag_id = external_dag_id self.external_task_id = external_task_id def poke(self, context): if self.execution_delta: dttm = context['execution_date'] - self.execution_delta elif self.execution_date_fn: dttm = self.execution_date_fn(context['execution_date']) else: dttm = context['execution_date'] logging.info( 'Poking for ' '{self.external_dag_id}.' '{self.external_task_id} on ' '{dttm} ... '.format(**locals())) TI = TaskInstance session = settings.Session() count = session.query(TI).filter( TI.dag_id == self.external_dag_id, TI.task_id == self.external_task_id, TI.state.in_(self.allowed_states), TI.execution_date == dttm, ).count() session.commit() session.close() return count class NamedHivePartitionSensor(BaseSensorOperator): """ Waits for a set of partitions to show up in Hive. :param partition_names: List of fully qualified names of the partitions to wait for. A fully qualified name is of the form ``schema.table/pk1=pv1/pk2=pv2``, for example, default.users/ds=2016-01-01. This is passed as is to the metastore Thrift client ``get_partitions_by_name`` method. Note that you cannot use logical or comparison operators as in HivePartitionSensor. :type partition_names: list of strings :param metastore_conn_id: reference to the metastore thrift service connection id :type metastore_conn_id: str """ template_fields = ('partition_names', ) ui_color = '#8d99ae' @apply_defaults def __init__( self, partition_names, metastore_conn_id='metastore_default', poke_interval=60 * 3, *args, **kwargs): super(NamedHivePartitionSensor, self).__init__( poke_interval=poke_interval, *args, **kwargs) if isinstance(partition_names, basestring): raise TypeError('partition_names must be an array of strings') self.metastore_conn_id = metastore_conn_id self.partition_names = partition_names self.next_poke_idx = 0 @classmethod def parse_partition_name(self, partition): try: schema, table_partition = partition.split('.', 1) table, partition = table_partition.split('/', 1) return schema, table, partition except ValueError as e: raise ValueError('Could not parse ' + partition) def poke(self, context): if not hasattr(self, 'hook'): self.hook = hooks.HiveMetastoreHook( metastore_conn_id=self.metastore_conn_id) def poke_partition(partition): schema, table, partition = self.parse_partition_name(partition) logging.info( 'Poking for {schema}.{table}/{partition}'.format(**locals()) ) return self.hook.check_for_named_partition( schema, table, partition) while self.next_poke_idx < len(self.partition_names): if poke_partition(self.partition_names[self.next_poke_idx]): self.next_poke_idx += 1 else: return False return True class HivePartitionSensor(BaseSensorOperator): """ Waits for a partition to show up in Hive. Note: Because ``partition`` supports general logical operators, it can be inefficient. Consider using NamedHivePartitionSensor instead if you don't need the full flexibility of HivePartitionSensor. :param table: The name of the table to wait for, supports the dot notation (my_database.my_table) :type table: string :param partition: The partition clause to wait for. This is passed as is to the metastore Thrift client ``get_partitions_by_filter`` method, and apparently supports SQL like notation as in ``ds='2015-01-01' AND type='value'`` and comparison operators as in ``"ds>=2015-01-01"`` :type partition: string :param metastore_conn_id: reference to the metastore thrift service connection id :type metastore_conn_id: str """ template_fields = ('schema', 'table', 'partition',) ui_color = '#2b2d42' @apply_defaults def __init__( self, table, partition="ds='{{ ds }}'", metastore_conn_id='metastore_default', schema='default', poke_interval=60*3, *args, **kwargs): super(HivePartitionSensor, self).__init__( poke_interval=poke_interval, *args, **kwargs) if not partition: partition = "ds='{{ ds }}'" self.metastore_conn_id = metastore_conn_id self.table = table self.partition = partition self.schema = schema def poke(self, context): if '.' in self.table: self.schema, self.table = self.table.split('.') logging.info( 'Poking for table {self.schema}.{self.table}, ' 'partition {self.partition}'.format(**locals())) if not hasattr(self, 'hook'): self.hook = hooks.HiveMetastoreHook( metastore_conn_id=self.metastore_conn_id) return self.hook.check_for_partition( self.schema, self.table, self.partition) class HdfsSensor(BaseSensorOperator): """ Waits for a file or folder to land in HDFS """ template_fields = ('filepath',) ui_color = settings.WEB_COLORS['LIGHTBLUE'] @apply_defaults def __init__( self, filepath, hdfs_conn_id='hdfs_default', ignored_ext=['_COPYING_'], ignore_copying=True, file_size=None, hook=HDFSHook, *args, **kwargs): super(HdfsSensor, self).__init__(*args, **kwargs) self.filepath = filepath self.hdfs_conn_id = hdfs_conn_id self.file_size = file_size self.ignored_ext = ignored_ext self.ignore_copying = ignore_copying self.hook = hook @staticmethod def filter_for_filesize(result, size=None): """ Will test the filepath result and test if its size is at least self.filesize :param result: a list of dicts returned by Snakebite ls :param size: the file size in MB a file should be at least to trigger True :return: (bool) depending on the matching criteria """ if size: logging.debug('Filtering for file size >= %s in files: %s', size, map(lambda x: x['path'], result)) size *= settings.MEGABYTE result = [x for x in result if x['length'] >= size] logging.debug('HdfsSensor.poke: after size filter result is %s', result) return result @staticmethod def filter_for_ignored_ext(result, ignored_ext, ignore_copying): """ Will filter if instructed to do so the result to remove matching criteria :param result: (list) of dicts returned by Snakebite ls :param ignored_ext: (list) of ignored extentions :param ignore_copying: (bool) shall we ignore ? :return: """ if ignore_copying: regex_builder = "^.*\.(%s$)$" % '$|'.join(ignored_ext) ignored_extentions_regex = re.compile(regex_builder) logging.debug('Filtering result for ignored extentions: %s in files %s', ignored_extentions_regex.pattern, map(lambda x: x['path'], result)) result = [x for x in result if not ignored_extentions_regex.match(x['path'])] logging.debug('HdfsSensor.poke: after ext filter result is %s', result) return result def poke(self, context): sb = self.hook(self.hdfs_conn_id).get_conn() logging.getLogger("snakebite").setLevel(logging.WARNING) logging.info('Poking for file {self.filepath} '.format(**locals())) try: # IMOO it's not right here, as there no raise of any kind. # if the filepath is let's say '/data/mydirectory', it's correct but if it is '/data/mydirectory/*', # it's not correct as the directory exists and sb does not raise any error # here is a quick fix result = [f for f in sb.ls([self.filepath], include_toplevel=False)] logging.debug('HdfsSensor.poke: result is %s', result) result = self.filter_for_ignored_ext(result, self.ignored_ext, self.ignore_copying) result = self.filter_for_filesize(result, self.file_size) return bool(result) except: e = sys.exc_info() logging.debug("Caught an exception !: %s", str(e)) return False class WebHdfsSensor(BaseSensorOperator): """ Waits for a file or folder to land in HDFS """ template_fields = ('filepath',) @apply_defaults def __init__( self, filepath, webhdfs_conn_id='webhdfs_default', *args, **kwargs): super(WebHdfsSensor, self).__init__(*args, **kwargs) self.filepath = filepath self.webhdfs_conn_id = webhdfs_conn_id def poke(self, context): c = airflow.hooks.webhdfs_hook.WebHDFSHook(self.webhdfs_conn_id) logging.info( 'Poking for file {self.filepath} '.format(**locals())) return c.check_for_path(hdfs_path=self.filepath) class S3KeySensor(BaseSensorOperator): """ Waits for a key (a file-like instance on S3) to be present in a S3 bucket. S3 being a key/value it does not support folders. The path is just a key a resource. :param bucket_key: The key being waited on. Supports full s3:// style url or relative path from root level. :type bucket_key: str :param bucket_name: Name of the S3 bucket :type bucket_name: str :param wildcard_match: whether the bucket_key should be interpreted as a Unix wildcard pattern :type wildcard_match: bool :param s3_conn_id: a reference to the s3 connection :type s3_conn_id: str """ template_fields = ('bucket_key', 'bucket_name') @apply_defaults def __init__( self, bucket_key, bucket_name=None, wildcard_match=False, s3_conn_id='s3_default', *args, **kwargs): super(S3KeySensor, self).__init__(*args, **kwargs) # Parse if bucket_name is None: parsed_url = urlparse(bucket_key) if parsed_url.netloc == '': raise AirflowException('Please provide a bucket_name') else: bucket_name = parsed_url.netloc if parsed_url.path[0] == '/': bucket_key = parsed_url.path[1:] else: bucket_key = parsed_url.path self.bucket_name = bucket_name self.bucket_key = bucket_key self.wildcard_match = wildcard_match self.s3_conn_id = s3_conn_id def poke(self, context): import airflow.hooks.S3_hook hook = airflow.hooks.S3_hook.S3Hook(s3_conn_id=self.s3_conn_id) full_url = "s3://" + self.bucket_name + "/" + self.bucket_key logging.info('Poking for key : {full_url}'.format(**locals())) if self.wildcard_match: return hook.check_for_wildcard_key(self.bucket_key, self.bucket_name) else: return hook.check_for_key(self.bucket_key, self.bucket_name) class S3PrefixSensor(BaseSensorOperator): """ Waits for a prefix to exist. A prefix is the first part of a key, thus enabling checking of constructs similar to glob airfl* or SQL LIKE 'airfl%'. There is the possibility to precise a delimiter to indicate the hierarchy or keys, meaning that the match will stop at that delimiter. Current code accepts sane delimiters, i.e. characters that are NOT special characters in the Python regex engine. :param bucket_name: Name of the S3 bucket :type bucket_name: str :param prefix: The prefix being waited on. Relative path from bucket root level. :type prefix: str :param delimiter: The delimiter intended to show hierarchy. Defaults to '/'. :type delimiter: str """ template_fields = ('prefix', 'bucket_name') @apply_defaults def __init__( self, bucket_name, prefix, delimiter='/', s3_conn_id='s3_default', *args, **kwargs): super(S3PrefixSensor, self).__init__(*args, **kwargs) # Parse self.bucket_name = bucket_name self.prefix = prefix self.delimiter = delimiter self.full_url = "s3://" + bucket_name + '/' + prefix self.s3_conn_id = s3_conn_id def poke(self, context): logging.info('Poking for prefix : {self.prefix}\n' 'in bucket s3://{self.bucket_name}'.format(**locals())) import airflow.hooks.S3_hook hook = airflow.hooks.S3_hook.S3Hook(s3_conn_id=self.s3_conn_id) return hook.check_for_prefix( prefix=self.prefix, delimiter=self.delimiter, bucket_name=self.bucket_name) class TimeSensor(BaseSensorOperator): """ Waits until the specified time of the day. :param target_time: time after which the job succeeds :type target_time: datetime.time """ template_fields = tuple() @apply_defaults def __init__(self, target_time, *args, **kwargs): super(TimeSensor, self).__init__(*args, **kwargs) self.target_time = target_time def poke(self, context): logging.info( 'Checking if the time ({0}) has come'.format(self.target_time)) return datetime.now().time() > self.target_time class TimeDeltaSensor(BaseSensorOperator): """ Waits for a timedelta after the task's execution_date + schedule_interval. In Airflow, the daily task stamped with ``execution_date`` 2016-01-01 can only start running on 2016-01-02. The timedelta here represents the time after the execution period has closed. :param delta: time length to wait after execution_date before succeeding :type delta: datetime.timedelta """ template_fields = tuple() @apply_defaults def __init__(self, delta, *args, **kwargs): super(TimeDeltaSensor, self).__init__(*args, **kwargs) self.delta = delta def poke(self, context): dag = context['dag'] target_dttm = dag.following_schedule(context['execution_date']) target_dttm += self.delta logging.info('Checking if the time ({0}) has come'.format(target_dttm)) return datetime.now() > target_dttm class HttpSensor(BaseSensorOperator): """ Executes a HTTP get statement and returns False on failure: 404 not found or response_check function returned False :param http_conn_id: The connection to run the sensor against :type http_conn_id: string :param endpoint: The relative part of the full url :type endpoint: string :param params: The parameters to be added to the GET url :type params: a dictionary of string key/value pairs :param headers: The HTTP headers to be added to the GET request :type headers: a dictionary of string key/value pairs :param response_check: A check against the 'requests' response object. Returns True for 'pass' and False otherwise. :type response_check: A lambda or defined function. :param extra_options: Extra options for the 'requests' library, see the 'requests' documentation (options to modify timeout, ssl, etc.) :type extra_options: A dictionary of options, where key is string and value depends on the option that's being modified. """ template_fields = ('endpoint', 'params') @apply_defaults def __init__(self, endpoint, http_conn_id='http_default', params=None, headers=None, response_check=None, extra_options=None, *args, **kwargs): super(HttpSensor, self).__init__(*args, **kwargs) self.endpoint = endpoint self.http_conn_id = http_conn_id self.params = params or {} self.headers = headers or {} self.extra_options = extra_options or {} self.response_check = response_check self.hook = hooks.http_hook.HttpHook(method='GET', http_conn_id=http_conn_id) def poke(self, context): logging.info('Poking: ' + self.endpoint) try: response = self.hook.run(self.endpoint, data=self.params, headers=self.headers, extra_options=self.extra_options) if self.response_check: # run content check on response return self.response_check(response) except AirflowException as ae: if str(ae).startswith("404"): return False raise ae return True
from __future__ import absolute_import import logging from django.contrib import messages from django.core.context_processors import csrf from django.core.urlresolvers import reverse from django.http import HttpResponseRedirect from django.utils.decorators import method_decorator from django.utils.translation import ugettext_lazy as _ from django.views.decorators.csrf import csrf_protect from django.views.generic import View from sudo.views import redirect_to_sudo from sentry.auth import access from sentry.models import ( Organization, OrganizationStatus, Project, Team ) from sentry.web.helpers import get_login_url, render_to_response ERR_MISSING_SSO_LINK = _('You need to link your account with the SSO provider to continue.') class OrganizationMixin(object): # TODO(dcramer): move the implicit organization logic into its own class # as it's only used in a single location and over complicates the rest of # the code def get_active_organization(self, request, organization_slug=None, access=None): """ Returns the currently active organization for the request or None if no organization. """ active_organization = None is_implicit = organization_slug is None if is_implicit: organization_slug = request.session.get('activeorg') if organization_slug is not None: if request.user.is_superuser: try: active_organization = Organization.objects.get_from_cache( slug=organization_slug, ) if active_organization.status != OrganizationStatus.VISIBLE: raise Organization.DoesNotExist except Organization.DoesNotExist: logging.info('Active organization [%s] not found', organization_slug) return None if active_organization is None: organizations = Organization.objects.get_for_user( user=request.user, access=access, ) if active_organization is None and organization_slug: try: active_organization = ( o for o in organizations if o.slug == organization_slug ).next() except StopIteration: logging.info('Active organization [%s] not found in scope', organization_slug) if is_implicit: del request.session['activeorg'] active_organization = None if active_organization is None: if not is_implicit: return None try: active_organization = organizations[0] except IndexError: logging.info('User is not a member of any organizations') pass if active_organization and active_organization.slug != request.session.get('activeorg'): request.session['activeorg'] = active_organization.slug return active_organization def get_active_team(self, request, organization, team_slug, access=None): """ Returns the currently selected team for the request or None if no match. """ try: team = Team.objects.get_from_cache( slug=team_slug, organization=organization, ) except Team.DoesNotExist: return None if not request.user.is_superuser and not team.has_access(request.user, access): return None return team def get_active_project(self, request, organization, project_slug, access=None): try: project = Project.objects.get_from_cache( slug=project_slug, organization=organization, ) except Project.DoesNotExist: return None if not request.user.is_superuser and not project.has_access(request.user, access): return None return project class BaseView(View, OrganizationMixin): auth_required = True # TODO(dcramer): change sudo so it can be required only on POST sudo_required = False def __init__(self, auth_required=None, sudo_required=None, *args, **kwargs): if auth_required is not None: self.auth_required = auth_required if sudo_required is not None: self.sudo_required = sudo_required super(BaseView, self).__init__(*args, **kwargs) @method_decorator(csrf_protect) def dispatch(self, request, *args, **kwargs): if self.is_auth_required(request, *args, **kwargs): return self.handle_auth_required(request, *args, **kwargs) if self.is_sudo_required(request, *args, **kwargs): return self.handle_sudo_required(request, *args, **kwargs) args, kwargs = self.convert_args(request, *args, **kwargs) request.access = self.get_access(request, *args, **kwargs) if not self.has_permission(request, *args, **kwargs): return self.handle_permission_required(request, *args, **kwargs) self.request = request self.default_context = self.get_context_data(request, *args, **kwargs) return self.handle(request, *args, **kwargs) def get_access(self, request, *args, **kwargs): return access.DEFAULT def convert_args(self, request, *args, **kwargs): return (args, kwargs) def handle(self, request, *args, **kwargs): return super(BaseView, self).dispatch(request, *args, **kwargs) def is_auth_required(self, request, *args, **kwargs): return self.auth_required and not request.user.is_authenticated() def handle_auth_required(self, request, *args, **kwargs): request.session['_next'] = request.get_full_path() if 'organization_slug' in kwargs: redirect_to = reverse('sentry-auth-organization', args=[kwargs['organization_slug']]) else: redirect_to = get_login_url() return self.redirect(redirect_to) def is_sudo_required(self, request, *args, **kwargs): return self.sudo_required and not request.is_sudo() def handle_sudo_required(self, request, *args, **kwargs): return redirect_to_sudo(request.get_full_path()) def has_permission(self, request, *args, **kwargs): return True def handle_permission_required(self, request, *args, **kwargs): redirect_uri = self.get_no_permission_url(request, *args, **kwargs) return self.redirect(redirect_uri) def get_no_permission_url(request, *args, **kwargs): return reverse('sentry') def get_context_data(self, request, **kwargs): context = csrf(request) return context def respond(self, template, context=None, status=200): default_context = self.default_context if context: default_context.update(context) return render_to_response(template, default_context, self.request, status=status) def redirect(self, url): return HttpResponseRedirect(url) def get_team_list(self, user, organization): return Team.objects.get_for_user( organization=organization, user=user, with_projects=True, ) class OrganizationView(BaseView): """ Any view acting on behalf of an organization should inherit from this base. The 'organization' keyword argument is automatically injected into the resulting dispatch. """ required_access = None valid_sso_required = True def get_access(self, request, organization, *args, **kwargs): if organization is None: return access.DEFAULT return access.from_user(request.user, organization) def get_context_data(self, request, organization, **kwargs): context = super(OrganizationView, self).get_context_data(request) context['organization'] = organization context['TEAM_LIST'] = self.get_team_list(request.user, organization) context['ACCESS'] = request.access.to_django_context() return context def has_permission(self, request, organization, *args, **kwargs): if organization is None: return False if self.valid_sso_required and not request.access.sso_is_valid: return False return True def handle_permission_required(self, request, organization, *args, **kwargs): needs_link = ( organization and request.user.is_authenticated() and self.valid_sso_required and not request.access.sso_is_valid ) request.session['_next'] = request.get_full_path() if needs_link: messages.add_message( request, messages.ERROR, ERR_MISSING_SSO_LINK, ) redirect_uri = reverse('sentry-auth-link-identity', args=[organization.slug]) else: redirect_uri = self.get_no_permission_url(request, *args, **kwargs) return self.redirect(redirect_uri) def convert_args(self, request, organization_slug=None, *args, **kwargs): active_organization = self.get_active_organization( request=request, access=self.required_access, organization_slug=organization_slug, ) kwargs['organization'] = active_organization return (args, kwargs) class TeamView(OrganizationView): """ Any view acting on behalf of a team should inherit from this base and the matching URL pattern must pass 'team_slug'. Two keyword arguments are added to the resulting dispatch: - organization - team """ def get_context_data(self, request, organization, team, **kwargs): context = super(TeamView, self).get_context_data(request, organization) context['team'] = team return context def has_permission(self, request, organization, team, *args, **kwargs): rv = super(TeamView, self).has_permission(request, organization) if not rv: return rv return team is not None def convert_args(self, request, organization_slug, team_slug, *args, **kwargs): active_organization = self.get_active_organization( request=request, organization_slug=organization_slug, ) if active_organization: active_team = self.get_active_team( request=request, team_slug=team_slug, organization=active_organization, access=self.required_access, ) else: active_team = None kwargs['organization'] = active_organization kwargs['team'] = active_team return (args, kwargs) class ProjectView(TeamView): """ Any view acting on behalf of a project should inherit from this base and the matching URL pattern must pass 'team_slug' as well as 'project_slug'. Three keyword arguments are added to the resulting dispatch: - organization - team - project """ def get_context_data(self, request, organization, team, project, **kwargs): context = super(ProjectView, self).get_context_data(request, organization, team) context['project'] = project return context def has_permission(self, request, organization, team, project, *args, **kwargs): rv = super(ProjectView, self).has_permission(request, organization, team) if not rv: return rv return project is not None def convert_args(self, request, organization_slug, project_slug, *args, **kwargs): active_organization = self.get_active_organization( request=request, organization_slug=organization_slug, ) if active_organization: active_project = self.get_active_project( request=request, organization=active_organization, project_slug=project_slug, access=self.required_access, ) else: active_project = None if active_project: active_team = active_project.team else: active_team = None kwargs['project'] = active_project kwargs['team'] = active_team kwargs['organization'] = active_organization return (args, kwargs)
#!/usr/bin/env python # -*- coding: utf-8 -*- from collections import namedtuple from os import getcwd, fdopen, fstat as stat from time import ctime, time from ..fdbus_h import * from ..exceptions.exceptions import * # a client name/id field (i.e. a process name or identifier/pid) fdobj = namedtuple('File_Descriptor', ('name', 'path', 'fd', 'mode', 'client', 'created')) class FileDescriptorPool(object): def __init__(self): self.fdobjs = {} self.client_fdobjs = defaultdict(list) def add(self, client, fdobj): self.fdobjs[fdobj.name] = [client, fdobj] self.client_fdobjs[client].append(fdobj) def remove(self, name): try: fdobj = self.fdobjs[name] self.client_fdobjs[fdobj[0]].remove(fdobj[1]) del self.fdobjs[name] except KeyError: raise UnknownDescriptorError(name) def __len__(self): return len(self.fdobjs) def retrieve(self, fdobj): pass def bypath(self): pass def byfileno(self): pass def byfname(self): pass def __iter__(self): pass class FileDescriptor(object): def __new__(self, **kwargs): path = kwargs.get('path') if path is None: raise FileDescriptorError(self) name = path.split('/')[-1] mode = kwargs.get('mode') if mode is None: raise FileDescriptorError(self) fd = kwargs.get('fd') if fd is None: fd = FileDescriptor.fopen(path, mode) client = kwargs.get('client') created = time() new_fdobj = _FileDescriptor() new_fdobj.load(name, path, fd, mode, client, created) return new_fdobj @staticmethod def fopen(path, mode): fd = libc.open(path, mode) if fd == -1: error_msg = get_error_msg() raise OpenError(error_msg) return fd class _FileDescriptor(object): def __init__(self): self.refcnt = 1 def load(self, *args): self.new_fdobj = fdobj(*args) self.name = self.new_fdobj.name self.path = self.new_fdobj.path self.fd = self.new_fdobj.fd self.mode = self.new_fdobj.path self.client = self.new_fdobj.client self.created = self.new_fdobj.created def fsize(self): try: file_size = stat(self.fd).st_size except NameError: # handle different errors # raise print("File is not open") return file_size def fpos(self): # handle errors below offset = libc.lseek(self.fd, 0, SEEK_CUR) return offset def fstart(self): # handle errors offset = libc.lseek(self.fd, 0, SEEK_SET) def fend(self): # handle errors offset = libc.lseek(self.fd, 0, SEEK_END) def fset(self, pos): # handle errors c_pos = off_t(pos) offset = libc.lseek(self.fd, c_pos, SEEK_SET) def fclose(self): ret = libc.close(self.fd) if ret == -1: error_msg = get_error_msg() raise CloseError(error_msg) def __enter__(self): # handle errors return self.fd def __exit__(self, exc_type, exc_value, traceback): # handle errors self.fclose() class FDBus(object): def __init__(self, path): super(FDBus, self).__init__() self.path = path self.fdpool = FileDescriptorPool() self.proto_funcs = {LOAD:self.ld_protomsg, PASS:self.pass_protomsg, RECV:self.recv_protomsg, CLOSE:self.cls_protomsg, REFERENCE:self.ref_protomsg} def socket(self): sock = libc.socket(AF_UNIX, SOCK_STREAM, PROTO_DEFAULT) if sock == -1: error_msg = get_error_msg() raise SocketError(error_msg) return sock def close_pool(self): fdpool = self.fdpool.fdobjs client_fdpool = self.clients.fdpool for fd in fdpool: fdpool[fd][1].fclose() for fd in client_fdpool: libc.close(fd) def get_fd(self, name): fdobj = self.fdpool.fdobjs.get(name) if fdobj is None: raise UnknownDescriptorError(name) return fdobj def send_fd(self, name, recepient=None): fdobj = self.get_fd(name)[1] cmd = fdobj.mode payload = [name, fdobj.path] + \ list(map(str, [fdobj.fd, fdobj.mode, fdobj.created])) request = self.build_msg(LOAD, cmd, *payload) recepient = recepient if recepient else self.sock ret = libc.send(recepient, cast(request, c_void_p), MSG_LEN, MSG_FLAGS) if ret == -1: error_msg = get_error_msg() raise SendError(error_msg) self.sendmsg(LOAD, cmd, fdobj.fd, recepient) def remove_fd(self, name): # XXX build protocol send, no need for sendmsg fdobj = self.get_fd(name) self.sendmsg(CLOSE, CLS_FD, fdobj[1]) def recvmsg(self, sock, cmd, payload=None): msg = pointer(msghdr(RECV, cmd, payload)) # set up a poll timout -- client disconnects -- will this call block indefin? if libc.recvmsg(sock, msg, MSG_SERV) == -1: error_msg = get_error_msg() raise RecvmsgError(error_msg) return msg def sendmsg(self, protocol, cmd, payload=None, client=None): receipent = client if client is not None else self.sock msg = pointer(msghdr(protocol, cmd, payload, client)) if libc.sendmsg(receipent, msg, MSG_SERV) == -1: error_msg = get_error_msg() raise SendmsgError(error_msg) def build_msg(self, protocol, cmd, *payload): req_buffer = REQ_BUFFER() request = (PROTOCOL_NAMES[protocol], COMMAND_NAMES[cmd]) + payload req_buffer.value = ':'.join(request) return req_buffer def createfd(self, path, mode, fd=None, client=None, created=None): client = client if client else self.sock fdobj = FileDescriptor(path=path, mode=mode, fd=fd, client=client, created=created) self.fdpool.add(client, fdobj) def extract_fd(self, msg): fd = CMSG_DATA(msg.contents.msg_control) return fd def ld_protomsg(self, sock, cmd, msg): path, created = msg[3], float(msg[6]) msg = self.recvmsg(sock, cmd) fd = self.extract_fd(msg) self.createfd(path, cmd, fd, sock, created) def recv_protomsg(self, sock, cmd, msg): if cmd == RECV_PEER: self.client_peer_req(sock) elif cmd == RECV_FD: self.send_fd(msg[2], sock) elif cmd == RECV_CMD: self.recvmsg(sock, RECV_CMD, msg) def pass_protomsg(self, sock, cmd, msg): if cmd == PASS_PEER: self.recvpeers(msg) elif cmd == PASS_FD: self.passfd(*msg[2:]) def cls_protomsg(self, sock, cmd, msg): if cmd == CLS_FD: vector = self.unpack_vector(msg) self.fdpool.remove(vector.name) elif cmd == CLS_ALL: pass else: raise InvalidCmdError(cmd) def ref_protomsg(self, sock, cmd, msg): if cmd == RET_FD: pass elif cmd == REFCNT_FD: pass else: raise InvalidCmdError(cmd)
#!/usr/bin/env python # load libraries from __future__ import print_function import argparse from openpyxl import load_workbook import coloredlogs import logging import re import couchdb import numbers import yaml # global variables WARNINGS = 0 NONNUMERIC = [] EMPTY = [] BADRIN = [] OUTCONC = [] OUTVOL = [] # Set up a logger with colored output logger = logging.getLogger(__name__) logger.propagate = False # Otherwise the messages appeared twice coloredlogs.install(level='INFO', logger=logger, fmt='%(asctime)s %(levelname)s %(message)s') class ProjectSheet: #Class Attributes SHEET_NAME = 'Sample information' FIRST_LINE = 20 # First line where user submitted data is located SAMPLE_NAME_COL = 'O' A_RATIO_COL = 'R' # A260:A280 ratio CONC_COL = 'S' VOL_COL = 'T' RIN_COL = 'V' SAMPLE_TYPE = 'O8' PLATE_ID = 'M6' PROJECT_NAME_USER_SHEET = 'M3' # Initializer / Instance attributes def __init__(self, sample_info_sheet): self.sample_info_sheet = sample_info_sheet self.work_sheet = None self.sample_rec = None # instance methods def getAccessUserSheet(self): """loads the Excel sheet""" if self.work_sheet is None: wb = load_workbook(self.sample_info_sheet, read_only=True, data_only=True) ws = wb[ProjectSheet.SHEET_NAME] self.work_sheet = ws def projectID(self): """retrieves the project and plate ID from the excel sheet and checks the correctness of the plate ID format.""" self.getAccessUserSheet() plate_id = self.work_sheet[ProjectSheet.PLATE_ID].value if(len(re.findall('P\d+P\d+', plate_id))>0): project_id_user = re.findall('P\d+', plate_id)[0] else: logger.error( 'Given plate ID ({}) in cell {} has the wrong format. It should be in the format' ' PxxxxxPx, where x are numbers. If your Plate ID is correct, contact your project coordinator.'\ .format(plate_id, ProjectSheet.PLATE_ID) ) quit() return([project_id_user, plate_id]) def getSamples(self): """ identifies the all rows containing a sample name, discards rows without entry. Rows containing whitespace only trigger a warning and are discarded for subsequent tests """ cellID_withSample = [] cellID_noSample = [] for i in range(ProjectSheet.FIRST_LINE, ProjectSheet.FIRST_LINE+96): cell_id = "{col}{row_iter}".format(col=ProjectSheet.SAMPLE_NAME_COL, row_iter=i) cell_value = str(self.work_sheet[cell_id].value) if(cell_value.isspace()): logger.warning( 'Cell {} contains empty spaces only. Remove content.'.format(cell_id) ) global WARNINGS WARNINGS += 1 elif(self.work_sheet[cell_id].value is not None): cellID_withSample.append(i) else: cellID_noSample.append(cell_id) # TODO check here that these rows do really not contain information return(cellID_withSample) def ProjectInfo(self, config): """ Retrieves the project information from couchDB, checks that the project exists in couchDB and is unique. Returns the information and the full project plateID. """ with open(config) as settings_file: server_settings = yaml.load(settings_file, Loader=yaml.FullLoader) couch = couchdb.Server(server_settings.get("couch_server", None)) db = couch["projects"] # check the existence of the project number in couchDB project_plate_ID = self.projectID() project_id_found = db.view("project/project_id", key=project_plate_ID[0]) prow = project_id_found.rows # Project not found if len(prow) == 0: logger.error( 'Project not found, please check your entry for the PlateID, it should have the format' 'PxxxxxPx, where x are numbers. If your Plate ID is correct, contact your project coordinator.' ) quit() # more than one project found elif len(prow) > 1: logger.error( 'Project ID not unique, please check your entry for the PlateID, it should have the format' 'PxxxxxPx, where x are numbers. If your Plate ID is correct, contact your project coordinator.' ) quit() else: # puts the Document of the identified project in a new variable "pdoc" pdoc = db.get(prow[0].id) return pdoc, project_plate_ID[1] def prep_standards(self, info, config): ''' gets the sample requirements from statusDB (json format) based on the given sample prep type. ''' with open(config) as settings_file: server_settings = yaml.load(settings_file, Loader=yaml.FullLoader) couch = couchdb.Server(server_settings.get("couch_server", None)) requirementsDB = couch["sample_requirements"] requirements = requirementsDB.view("valid/by_date", descending=True) recom_info = requirements.rows[0].value["requirements"] prep = info['details']['library_construction_method'] prep_recs = [None,None,None,None,None,None,None] if prep in recom_info: if recom_info[prep]['Quality requirement'] is not None: prep_recs = [\ recom_info[prep]['Concentration']['Minimum'], recom_info[prep]['Concentration']['Maximum'], recom_info[prep]['Volume']['Minimum'], recom_info[prep]['Amount']['Recommended'], recom_info[prep]['Amount']['Minimum'], recom_info[prep]['Quality requirement']['Method'], recom_info[prep]['QC recommendation']] if 'RIN' in recom_info[prep]['Quality requirement']: prep_recs.append(recom_info[prep]['Quality requirement']['RIN']) else: prep_recs.append(None) else: prep_recs = [\ recom_info[prep]['Concentration']['Minimum'], recom_info[prep]['Concentration']['Maximum'], recom_info[prep]['Volume']['Minimum'], recom_info[prep]['Amount']['Recommended'], recom_info[prep]['Amount']['Minimum'], None, recom_info[prep]['QC recommendation'], None] else: logger.error('Preparation type \"{}\" not found'.format(prep)) quit() return(prep_recs) def validate_project_Name(self, info, project_plate_ID ): """ Prints the identified project name based on the user supplied Plate/Project ID for control purposes by the project coordinator. Further checks that the plate number is not already in couchDB. """ project_name_DB = info['project_name'] samples = list(info['samples'].keys()) plate ='P{}_{}'.format(project_plate_ID.split("P")[1],project_plate_ID.split("P")[2]) found_plate = [s for s in samples if plate in s] if(len(found_plate)>0): new_plate_no = int(project_plate_ID.split("P")[2]) new_plate_no += 1 new_plate_ID = 'P{}P{}'.format(project_plate_ID.split("P")[1], new_plate_no) logger.warning( 'Plate number {} is already used. Please increase the plate number to {}.'.format(project_plate_ID, new_plate_ID)) global WARNINGS WARNINGS += 1 logger.info('identified project name: {}'.format(project_name_DB)) def validate(self, info, config_info): """Validates all rows with a sample ID Given the column letter and which rows to validate: - Initiates the given validators for cell content (numeric), concentration, volume and RIN (RNA samples only) with the optional attributes. - Loops through all the given cells and validates them individually. - prints summaries of the warnings and of the Excel file check. """ prep_recs = self.prep_standards(info, config_info) passes = 0 total = 0 recom_avail = 1 for row_nr in self.getSamples(): total += 1 cell_id_conc = "{col}{row_nr}".format(col=ProjectSheet.CONC_COL, row_nr=row_nr) cell_id_vol = "{col}{row_nr}".format(col=ProjectSheet.VOL_COL, row_nr=row_nr) cell_id_rin = "{col}{row_nr}".format(col=ProjectSheet.RIN_COL, row_nr=row_nr) validator = Validator(self.work_sheet,cell_id_conc,cell_id_vol, cell_id_rin) result_numeric = validator.validate_numeric() if any(t is not None for t in prep_recs[0:7]): result_conc = validator.validate_conc(prep_recs[0], prep_recs[1]) result_vol = validator.validate_vol(prep_recs[2]) if prep_recs[7] is not None: result_rin = validator.validate_rin(prep_recs[7]) if result_conc and result_vol and result_rin and result_numeric: # Test passed passes += 1 else: if any(t is not None for t in prep_recs): if result_conc and result_vol and result_numeric: # Test passed passes += 1 else: # this means that the prep chosen has no recommendations in the DB # i.e. ALL values for recommendations are missing recom_avail = None if result_numeric: # Test passed passes += 1 # summary of QC prerequisits and recommendations if (prep_recs[5] is not None): logger.info( 'Sample processing prerequisit: submission of {} data'.format(prep_recs[5]) ) if (prep_recs[6] is not None): logger.info( 'Sample QC recommendation: submission of {} data'.format(prep_recs[6]) ) # summary of all warnings if (len(EMPTY) > 0): logger.warning( 'Required entries in the following cells are missing: {}'\ .format(EMPTY) ) if (len(NONNUMERIC) > 0): logger.warning( 'Required entries in the following cells are non-numeric: {}'\ .format(NONNUMERIC) ) if (len(OUTCONC) > 0): logger.warning( 'Sample concentration(s) in cell(s) {} is out of specifications: {}-{}ng/ul'\ .format(OUTCONC, prep_recs[0], prep_recs[1]) ) if (len(OUTVOL) > 0): logger.warning( 'Sample volume(s) in cell(s) {} is to low: min volume = {}ul'\ .format(OUTVOL, prep_recs[2]) ) if (len(BADRIN) > 0): logger.warning( 'RIN value in cell(s) {} is below recommendation'\ .format(BADRIN) ) # summary for missing sample recommendations if (recom_avail is None): logger.info( 'Sample submission check complete. No sample recommendations available. {}/{} pass, {} warnings(s)'\ .format(passes, total, WARNINGS) ) # summary with sample recommendations else: logger.info( 'Sample submission check complete. {}/{} pass, {} warning(s).'\ .format(passes, total, WARNINGS) ) class Validator(object): # Initializer / Instance attributes def __init__(self, access_sample_info_sheet, concentrationID, volumeID, rinID): self.access_sample_info_sheet = access_sample_info_sheet self.concentrationID = concentrationID self.volumeID = volumeID self.rinID = rinID # instance methods def validate_numeric(self): global WARNINGS global EMPTY global NONNUMERIC """Checks whether value is numeric or not.""" warnings_before = WARNINGS for checkNumbers in [self.concentrationID, self.volumeID, self.rinID]: if not isinstance(self.access_sample_info_sheet[checkNumbers].value, numbers.Number): try: float(self.access_sample_info_sheet[checkNumbers].value.replace(",", ".")) WARNINGS += 1 NONNUMERIC.append(checkNumbers) except ValueError: WARNINGS += 1 NONNUMERIC.append(checkNumbers) except AttributeError: if self.access_sample_info_sheet[checkNumbers].value is None: WARNINGS += 1 EMPTY.append(checkNumbers) else: raise if (WARNINGS > warnings_before): return False else: return True def validate_conc(self, min_conc, max_conc): """checks entry for concentration""" if not(self.concentrationID in NONNUMERIC or self.concentrationID in EMPTY): global WARNINGS global OUTCONC if(self.access_sample_info_sheet[self.concentrationID].value < min_conc) \ or (self.access_sample_info_sheet[self.concentrationID].value > max_conc): WARNINGS += 1 OUTCONC.append(self.concentrationID) return False else: return True def validate_vol(self, vol): """Checks entry for volume""" if not(self.volumeID in NONNUMERIC or self.volumeID in EMPTY): global WARNINGS global OUTVOL if(self.access_sample_info_sheet[self.volumeID].value < vol): WARNINGS += 1 OUTVOL.append(self.volumeID) return False else: return True def validate_rin(self, rin): """Checks entry for RIN in RNA samples only""" if self.access_sample_info_sheet[self.rinID].value < rin: global WARNINGS global BADRIN WARNINGS += 1 BADRIN.append(self.rinID) return False else: return True def main(input_sheet, config_statusDB): # Instantiate the ProjectSheet object sheetOI = ProjectSheet(input_sheet) # get Project Information from couchDB Project_Information, project_plate_ID = sheetOI.ProjectInfo(config_statusDB) # validate the project name to ensure correct identification in couchDB sheetOI.validate_project_Name(Project_Information, project_plate_ID) # validate all entries sheetOI.validate(Project_Information, config_statusDB) if __name__ == '__main__': parser = argparse.ArgumentParser(description=__doc__) parser.add_argument('sampleInfoSheet', help="Completed sample info sent to NGI by the user.") parser.add_argument('config_statusDB', help="settings file in yaml format to access statusDB \ in the format \"couch_server: http://<username>:<password>@tools.scilifelab.se:5984\"") args = parser.parse_args() main(args.sampleInfoSheet, args.config_statusDB)
"""Tests for the Hyperion config flow.""" from __future__ import annotations import asyncio from typing import Any, Awaitable from unittest.mock import AsyncMock, Mock, patch from hyperion import const from homeassistant import data_entry_flow from homeassistant.components.hyperion.const import ( CONF_AUTH_ID, CONF_CREATE_TOKEN, CONF_EFFECT_HIDE_LIST, CONF_EFFECT_SHOW_LIST, CONF_PRIORITY, DOMAIN, ) from homeassistant.components.light import DOMAIN as LIGHT_DOMAIN from homeassistant.config_entries import SOURCE_REAUTH, SOURCE_SSDP, SOURCE_USER from homeassistant.const import ( ATTR_ENTITY_ID, CONF_HOST, CONF_PORT, CONF_TOKEN, SERVICE_TURN_ON, ) from homeassistant.core import HomeAssistant from . import ( TEST_AUTH_REQUIRED_RESP, TEST_CONFIG_ENTRY_ID, TEST_ENTITY_ID_1, TEST_HOST, TEST_INSTANCE, TEST_PORT, TEST_PORT_UI, TEST_SYSINFO_ID, TEST_TITLE, TEST_TOKEN, add_test_config_entry, create_mock_client, ) from tests.common import MockConfigEntry TEST_IP_ADDRESS = "192.168.0.1" TEST_HOST_PORT: dict[str, Any] = { CONF_HOST: TEST_HOST, CONF_PORT: TEST_PORT, } TEST_AUTH_ID = "ABCDE" TEST_REQUEST_TOKEN_SUCCESS = { "command": "authorize-requestToken", "success": True, "info": {"comment": const.DEFAULT_ORIGIN, "id": TEST_AUTH_ID, "token": TEST_TOKEN}, } TEST_REQUEST_TOKEN_FAIL = { "command": "authorize-requestToken", "success": False, "error": "Token request timeout or denied", } TEST_SSDP_SERVICE_INFO = { "ssdp_location": f"http://{TEST_HOST}:{TEST_PORT_UI}/description.xml", "ssdp_st": "upnp:rootdevice", "deviceType": "urn:schemas-upnp-org:device:Basic:1", "friendlyName": f"Hyperion ({TEST_HOST})", "manufacturer": "Hyperion Open Source Ambient Lighting", "manufacturerURL": "https://www.hyperion-project.org", "modelDescription": "Hyperion Open Source Ambient Light", "modelName": "Hyperion", "modelNumber": "2.0.0-alpha.8", "modelURL": "https://www.hyperion-project.org", "serialNumber": f"{TEST_SYSINFO_ID}", "UDN": f"uuid:{TEST_SYSINFO_ID}", "ports": { "jsonServer": f"{TEST_PORT}", "sslServer": "8092", "protoBuffer": "19445", "flatBuffer": "19400", }, "presentationURL": "index.html", "iconList": { "icon": { "mimetype": "image/png", "height": "100", "width": "100", "depth": "32", "url": "img/hyperion/ssdp_icon.png", } }, "ssdp_usn": f"uuid:{TEST_SYSINFO_ID}", "ssdp_ext": "", "ssdp_server": "Raspbian GNU/Linux 10 (buster)/10 UPnP/1.0 Hyperion/2.0.0-alpha.8", } async def _create_mock_entry(hass: HomeAssistant) -> MockConfigEntry: """Add a test Hyperion entity to hass.""" entry: MockConfigEntry = MockConfigEntry( # type: ignore[no-untyped-call] entry_id=TEST_CONFIG_ENTRY_ID, domain=DOMAIN, unique_id=TEST_SYSINFO_ID, title=TEST_TITLE, data={ "host": TEST_HOST, "port": TEST_PORT, "instance": TEST_INSTANCE, }, ) entry.add_to_hass(hass) # type: ignore[no-untyped-call] # Setup client = create_mock_client() with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): await hass.config_entries.async_setup(entry.entry_id) await hass.async_block_till_done() return entry async def _init_flow( hass: HomeAssistant, source: str = SOURCE_USER, data: dict[str, Any] | None = None, ) -> Any: """Initialize a flow.""" data = data or {} return await hass.config_entries.flow.async_init( DOMAIN, context={"source": source}, data=data ) async def _configure_flow( hass: HomeAssistant, result: dict, user_input: dict[str, Any] | None = None ) -> Any: """Provide input to a flow.""" user_input = user_input or {} with patch( "homeassistant.components.hyperion.async_setup", return_value=True ), patch( "homeassistant.components.hyperion.async_setup_entry", return_value=True, ): result = await hass.config_entries.flow.async_configure( result["flow_id"], user_input=user_input ) await hass.async_block_till_done() return result async def test_user_if_no_configuration(hass: HomeAssistant) -> None: """Check flow behavior when no configuration is present.""" result = await _init_flow(hass) assert result["type"] == data_entry_flow.RESULT_TYPE_FORM assert result["step_id"] == "user" assert result["handler"] == DOMAIN async def test_user_existing_id_abort(hass: HomeAssistant) -> None: """Verify a duplicate ID results in an abort.""" result = await _init_flow(hass) await _create_mock_entry(hass) client = create_mock_client() with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): result = await _configure_flow(hass, result, user_input=TEST_HOST_PORT) assert result["type"] == data_entry_flow.RESULT_TYPE_ABORT assert result["reason"] == "already_configured" async def test_user_client_errors(hass: HomeAssistant) -> None: """Verify correct behaviour with client errors.""" result = await _init_flow(hass) client = create_mock_client() # Fail the connection. client.async_client_connect = AsyncMock(return_value=False) with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): result = await _configure_flow(hass, result, user_input=TEST_HOST_PORT) assert result["type"] == data_entry_flow.RESULT_TYPE_FORM assert result["errors"]["base"] == "cannot_connect" # Fail the auth check call. client.async_client_connect = AsyncMock(return_value=True) client.async_is_auth_required = AsyncMock(return_value={"success": False}) with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): result = await _configure_flow(hass, result, user_input=TEST_HOST_PORT) assert result["type"] == data_entry_flow.RESULT_TYPE_ABORT assert result["reason"] == "auth_required_error" async def test_user_confirm_cannot_connect(hass: HomeAssistant) -> None: """Test a failure to connect during confirmation.""" result = await _init_flow(hass) good_client = create_mock_client() bad_client = create_mock_client() bad_client.async_client_connect = AsyncMock(return_value=False) # Confirmation sync_client_connect fails. with patch( "homeassistant.components.hyperion.client.HyperionClient", side_effect=[good_client, bad_client], ): result = await _configure_flow(hass, result, user_input=TEST_HOST_PORT) assert result["type"] == data_entry_flow.RESULT_TYPE_ABORT assert result["reason"] == "cannot_connect" async def test_user_confirm_id_error(hass: HomeAssistant) -> None: """Test a failure fetching the server id during confirmation.""" result = await _init_flow(hass) client = create_mock_client() client.async_sysinfo_id = AsyncMock(return_value=None) # Confirmation sync_client_connect fails. with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): result = await _configure_flow(hass, result, user_input=TEST_HOST_PORT) assert result["type"] == data_entry_flow.RESULT_TYPE_ABORT assert result["reason"] == "no_id" async def test_user_noauth_flow_success(hass: HomeAssistant) -> None: """Check a full flow without auth.""" result = await _init_flow(hass) client = create_mock_client() with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): result = await _configure_flow(hass, result, user_input=TEST_HOST_PORT) assert result["type"] == data_entry_flow.RESULT_TYPE_CREATE_ENTRY assert result["handler"] == DOMAIN assert result["title"] == TEST_TITLE assert result["data"] == { **TEST_HOST_PORT, } async def test_user_auth_required(hass: HomeAssistant) -> None: """Verify correct behaviour when auth is required.""" result = await _init_flow(hass) client = create_mock_client() client.async_is_auth_required = AsyncMock(return_value=TEST_AUTH_REQUIRED_RESP) with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): result = await _configure_flow(hass, result, user_input=TEST_HOST_PORT) assert result["type"] == data_entry_flow.RESULT_TYPE_FORM assert result["step_id"] == "auth" async def test_auth_static_token_auth_required_fail(hass: HomeAssistant) -> None: """Verify correct behaviour with a failed auth required call.""" result = await _init_flow(hass) client = create_mock_client() client.async_is_auth_required = AsyncMock(return_value=None) with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): result = await _configure_flow(hass, result, user_input=TEST_HOST_PORT) assert result["type"] == data_entry_flow.RESULT_TYPE_ABORT assert result["reason"] == "auth_required_error" async def test_auth_static_token_success(hass: HomeAssistant) -> None: """Test a successful flow with a static token.""" result = await _init_flow(hass) assert result["step_id"] == "user" client = create_mock_client() client.async_is_auth_required = AsyncMock(return_value=TEST_AUTH_REQUIRED_RESP) with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): result = await _configure_flow(hass, result, user_input=TEST_HOST_PORT) result = await _configure_flow( hass, result, user_input={CONF_CREATE_TOKEN: False, CONF_TOKEN: TEST_TOKEN} ) assert result["type"] == data_entry_flow.RESULT_TYPE_CREATE_ENTRY assert result["handler"] == DOMAIN assert result["title"] == TEST_TITLE assert result["data"] == { **TEST_HOST_PORT, CONF_TOKEN: TEST_TOKEN, } async def test_auth_static_token_login_connect_fail(hass: HomeAssistant) -> None: """Test correct behavior with a static token that cannot connect.""" result = await _init_flow(hass) assert result["step_id"] == "user" client = create_mock_client() client.async_is_auth_required = AsyncMock(return_value=TEST_AUTH_REQUIRED_RESP) with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): result = await _configure_flow(hass, result, user_input=TEST_HOST_PORT) client.async_client_connect = AsyncMock(return_value=False) result = await _configure_flow( hass, result, user_input={CONF_CREATE_TOKEN: False, CONF_TOKEN: TEST_TOKEN} ) assert result["type"] == data_entry_flow.RESULT_TYPE_ABORT assert result["reason"] == "cannot_connect" async def test_auth_static_token_login_fail(hass: HomeAssistant) -> None: """Test correct behavior with a static token that cannot login.""" result = await _init_flow(hass) assert result["step_id"] == "user" client = create_mock_client() client.async_is_auth_required = AsyncMock(return_value=TEST_AUTH_REQUIRED_RESP) with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): result = await _configure_flow(hass, result, user_input=TEST_HOST_PORT) client.async_login = AsyncMock( return_value={"command": "authorize-login", "success": False, "tan": 0} ) result = await _configure_flow( hass, result, user_input={CONF_CREATE_TOKEN: False, CONF_TOKEN: TEST_TOKEN} ) assert result["type"] == data_entry_flow.RESULT_TYPE_FORM assert result["errors"]["base"] == "invalid_access_token" async def test_auth_create_token_approval_declined(hass: HomeAssistant) -> None: """Verify correct behaviour when a token request is declined.""" result = await _init_flow(hass) client = create_mock_client() client.async_is_auth_required = AsyncMock(return_value=TEST_AUTH_REQUIRED_RESP) with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): result = await _configure_flow(hass, result, user_input=TEST_HOST_PORT) assert result["type"] == data_entry_flow.RESULT_TYPE_FORM assert result["step_id"] == "auth" client.async_request_token = AsyncMock(return_value=TEST_REQUEST_TOKEN_FAIL) with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ), patch( "homeassistant.components.hyperion.config_flow.client.generate_random_auth_id", return_value=TEST_AUTH_ID, ): result = await _configure_flow( hass, result, user_input={CONF_CREATE_TOKEN: True} ) assert result["type"] == data_entry_flow.RESULT_TYPE_FORM assert result["step_id"] == "create_token" assert result["description_placeholders"] == { CONF_AUTH_ID: TEST_AUTH_ID, } result = await _configure_flow(hass, result) await hass.async_block_till_done() assert result["type"] == data_entry_flow.RESULT_TYPE_EXTERNAL_STEP assert result["step_id"] == "create_token_external" # The flow will be automatically advanced by the auth token response. result = await _configure_flow(hass, result) assert result["type"] == data_entry_flow.RESULT_TYPE_ABORT assert result["reason"] == "auth_new_token_not_granted_error" async def test_auth_create_token_approval_declined_task_canceled( hass: HomeAssistant, ) -> None: """Verify correct behaviour when a token request is declined.""" result = await _init_flow(hass) client = create_mock_client() client.async_is_auth_required = AsyncMock(return_value=TEST_AUTH_REQUIRED_RESP) with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): result = await _configure_flow(hass, result, user_input=TEST_HOST_PORT) assert result["step_id"] == "auth" client.async_request_token = AsyncMock(return_value=TEST_REQUEST_TOKEN_FAIL) class CanceledAwaitableMock(AsyncMock): """A canceled awaitable mock.""" def __await__(self) -> None: raise asyncio.CancelledError mock_task = CanceledAwaitableMock() task_coro: Awaitable | None = None def create_task(arg: Any) -> CanceledAwaitableMock: nonlocal task_coro task_coro = arg return mock_task with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ), patch( "homeassistant.components.hyperion.config_flow.client.generate_random_auth_id", return_value=TEST_AUTH_ID, ), patch.object( hass, "async_create_task", side_effect=create_task ): result = await _configure_flow( hass, result, user_input={CONF_CREATE_TOKEN: True} ) assert result["step_id"] == "create_token" result = await _configure_flow(hass, result) assert result["step_id"] == "create_token_external" # Leave the task running, to ensure it is canceled. mock_task.done = Mock(return_value=False) mock_task.cancel = Mock() result = await _configure_flow(hass, result) # This await will advance to the next step. assert task_coro await task_coro # Assert that cancel is called on the task. assert mock_task.cancel.called async def test_auth_create_token_when_issued_token_fails( hass: HomeAssistant, ) -> None: """Verify correct behaviour when a token is granted by fails to authenticate.""" result = await _init_flow(hass) client = create_mock_client() client.async_is_auth_required = AsyncMock(return_value=TEST_AUTH_REQUIRED_RESP) with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): result = await _configure_flow(hass, result, user_input=TEST_HOST_PORT) assert result["type"] == data_entry_flow.RESULT_TYPE_FORM assert result["step_id"] == "auth" client.async_request_token = AsyncMock(return_value=TEST_REQUEST_TOKEN_SUCCESS) with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ), patch( "homeassistant.components.hyperion.config_flow.client.generate_random_auth_id", return_value=TEST_AUTH_ID, ): result = await _configure_flow( hass, result, user_input={CONF_CREATE_TOKEN: True} ) assert result["type"] == data_entry_flow.RESULT_TYPE_FORM assert result["step_id"] == "create_token" assert result["description_placeholders"] == { CONF_AUTH_ID: TEST_AUTH_ID, } result = await _configure_flow(hass, result) assert result["type"] == data_entry_flow.RESULT_TYPE_EXTERNAL_STEP assert result["step_id"] == "create_token_external" # The flow will be automatically advanced by the auth token response. # Make the last verification fail. client.async_client_connect = AsyncMock(return_value=False) result = await _configure_flow(hass, result) assert result["type"] == data_entry_flow.RESULT_TYPE_ABORT assert result["reason"] == "cannot_connect" async def test_auth_create_token_success(hass: HomeAssistant) -> None: """Verify correct behaviour when a token is successfully created.""" result = await _init_flow(hass) client = create_mock_client() client.async_is_auth_required = AsyncMock(return_value=TEST_AUTH_REQUIRED_RESP) with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): result = await _configure_flow(hass, result, user_input=TEST_HOST_PORT) assert result["type"] == data_entry_flow.RESULT_TYPE_FORM assert result["step_id"] == "auth" client.async_request_token = AsyncMock(return_value=TEST_REQUEST_TOKEN_SUCCESS) with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ), patch( "homeassistant.components.hyperion.config_flow.client.generate_random_auth_id", return_value=TEST_AUTH_ID, ): result = await _configure_flow( hass, result, user_input={CONF_CREATE_TOKEN: True} ) assert result["type"] == data_entry_flow.RESULT_TYPE_FORM assert result["step_id"] == "create_token" assert result["description_placeholders"] == { CONF_AUTH_ID: TEST_AUTH_ID, } result = await _configure_flow(hass, result) assert result["type"] == data_entry_flow.RESULT_TYPE_EXTERNAL_STEP assert result["step_id"] == "create_token_external" # The flow will be automatically advanced by the auth token response. result = await _configure_flow(hass, result) assert result["type"] == data_entry_flow.RESULT_TYPE_CREATE_ENTRY assert result["handler"] == DOMAIN assert result["title"] == TEST_TITLE assert result["data"] == { **TEST_HOST_PORT, CONF_TOKEN: TEST_TOKEN, } async def test_auth_create_token_success_but_login_fail( hass: HomeAssistant, ) -> None: """Verify correct behaviour when a token is successfully created but the login fails.""" result = await _init_flow(hass) client = create_mock_client() client.async_is_auth_required = AsyncMock(return_value=TEST_AUTH_REQUIRED_RESP) with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): result = await _configure_flow(hass, result, user_input=TEST_HOST_PORT) assert result["step_id"] == "auth" client.async_request_token = AsyncMock(return_value=TEST_REQUEST_TOKEN_SUCCESS) with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ), patch( "homeassistant.components.hyperion.config_flow.client.generate_random_auth_id", return_value=TEST_AUTH_ID, ): result = await _configure_flow( hass, result, user_input={CONF_CREATE_TOKEN: True} ) assert result["step_id"] == "create_token" result = await _configure_flow(hass, result) assert result["step_id"] == "create_token_external" client.async_login = AsyncMock( return_value={"command": "authorize-login", "success": False, "tan": 0} ) # The flow will be automatically advanced by the auth token response. result = await _configure_flow(hass, result) assert result["type"] == data_entry_flow.RESULT_TYPE_ABORT assert result["reason"] == "auth_new_token_not_work_error" async def test_ssdp_success(hass: HomeAssistant) -> None: """Check an SSDP flow.""" client = create_mock_client() with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): result = await _init_flow(hass, source=SOURCE_SSDP, data=TEST_SSDP_SERVICE_INFO) await hass.async_block_till_done() # Accept the confirmation. with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): result = await _configure_flow(hass, result) assert result["type"] == data_entry_flow.RESULT_TYPE_CREATE_ENTRY assert result["handler"] == DOMAIN assert result["title"] == TEST_TITLE assert result["data"] == { CONF_HOST: TEST_HOST, CONF_PORT: TEST_PORT, } async def test_ssdp_cannot_connect(hass: HomeAssistant) -> None: """Check an SSDP flow that cannot connect.""" client = create_mock_client() client.async_client_connect = AsyncMock(return_value=False) with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): result = await _init_flow(hass, source=SOURCE_SSDP, data=TEST_SSDP_SERVICE_INFO) await hass.async_block_till_done() assert result["type"] == data_entry_flow.RESULT_TYPE_ABORT assert result["reason"] == "cannot_connect" async def test_ssdp_missing_serial(hass: HomeAssistant) -> None: """Check an SSDP flow where no id is provided.""" client = create_mock_client() bad_data = {**TEST_SSDP_SERVICE_INFO} del bad_data["serialNumber"] with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): result = await _init_flow(hass, source=SOURCE_SSDP, data=bad_data) await hass.async_block_till_done() assert result["type"] == data_entry_flow.RESULT_TYPE_ABORT assert result["reason"] == "no_id" async def test_ssdp_failure_bad_port_json(hass: HomeAssistant) -> None: """Check an SSDP flow with bad json port.""" client = create_mock_client() bad_data: dict[str, Any] = {**TEST_SSDP_SERVICE_INFO} bad_data["ports"]["jsonServer"] = "not_a_port" with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): result = await _init_flow(hass, source=SOURCE_SSDP, data=bad_data) result = await _configure_flow(hass, result) await hass.async_block_till_done() assert result["type"] == data_entry_flow.RESULT_TYPE_CREATE_ENTRY assert result["data"][CONF_PORT] == const.DEFAULT_PORT_JSON async def test_ssdp_failure_bad_port_ui(hass: HomeAssistant) -> None: """Check an SSDP flow with bad ui port.""" client = create_mock_client() client.async_is_auth_required = AsyncMock(return_value=TEST_AUTH_REQUIRED_RESP) bad_data = {**TEST_SSDP_SERVICE_INFO} bad_data["ssdp_location"] = f"http://{TEST_HOST}:not_a_port/description.xml" with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ), patch( "homeassistant.components.hyperion.config_flow.client.generate_random_auth_id", return_value=TEST_AUTH_ID, ): result = await _init_flow(hass, source=SOURCE_SSDP, data=bad_data) assert result["type"] == data_entry_flow.RESULT_TYPE_FORM assert result["step_id"] == "auth" client.async_request_token = AsyncMock(return_value=TEST_REQUEST_TOKEN_FAIL) result = await _configure_flow( hass, result, user_input={CONF_CREATE_TOKEN: True} ) assert result["type"] == data_entry_flow.RESULT_TYPE_FORM assert result["step_id"] == "create_token" # Verify a working URL is used despite the bad port number assert result["description_placeholders"] == { CONF_AUTH_ID: TEST_AUTH_ID, } async def test_ssdp_abort_duplicates(hass: HomeAssistant) -> None: """Check an SSDP flow where no id is provided.""" client = create_mock_client() with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): result_1 = await _init_flow( hass, source=SOURCE_SSDP, data=TEST_SSDP_SERVICE_INFO ) result_2 = await _init_flow( hass, source=SOURCE_SSDP, data=TEST_SSDP_SERVICE_INFO ) await hass.async_block_till_done() assert result_1["type"] == data_entry_flow.RESULT_TYPE_FORM assert result_2["type"] == data_entry_flow.RESULT_TYPE_ABORT assert result_2["reason"] == "already_in_progress" async def test_options_priority(hass: HomeAssistant) -> None: """Check an options flow priority option.""" config_entry = add_test_config_entry(hass) client = create_mock_client() with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): await hass.config_entries.async_setup(config_entry.entry_id) await hass.async_block_till_done() assert hass.states.get(TEST_ENTITY_ID_1) is not None result = await hass.config_entries.options.async_init(config_entry.entry_id) assert result["type"] == data_entry_flow.RESULT_TYPE_FORM assert result["step_id"] == "init" new_priority = 1 result = await hass.config_entries.options.async_configure( result["flow_id"], user_input={CONF_PRIORITY: new_priority}, ) await hass.async_block_till_done() assert result["type"] == data_entry_flow.RESULT_TYPE_CREATE_ENTRY assert result["data"][CONF_PRIORITY] == new_priority # Turn the light on and ensure the new priority is used. client.async_send_set_color = AsyncMock(return_value=True) await hass.services.async_call( LIGHT_DOMAIN, SERVICE_TURN_ON, {ATTR_ENTITY_ID: TEST_ENTITY_ID_1}, blocking=True, ) # pylint: disable=unsubscriptable-object assert client.async_send_set_color.call_args[1][CONF_PRIORITY] == new_priority async def test_options_effect_show_list(hass: HomeAssistant) -> None: """Check an options flow effect show list.""" config_entry = add_test_config_entry(hass) client = create_mock_client() client.effects = [ {const.KEY_NAME: "effect1"}, {const.KEY_NAME: "effect2"}, {const.KEY_NAME: "effect3"}, ] with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): await hass.config_entries.async_setup(config_entry.entry_id) await hass.async_block_till_done() result = await hass.config_entries.options.async_init(config_entry.entry_id) assert result["type"] == data_entry_flow.RESULT_TYPE_FORM result = await hass.config_entries.options.async_configure( result["flow_id"], user_input={CONF_EFFECT_SHOW_LIST: ["effect1", "effect3"]}, ) await hass.async_block_till_done() assert result["type"] == data_entry_flow.RESULT_TYPE_CREATE_ENTRY # effect1 and effect3 only, so effect2 & external sources are hidden. assert result["data"][CONF_EFFECT_HIDE_LIST] == sorted( ["effect2"] + const.KEY_COMPONENTID_EXTERNAL_SOURCES ) async def test_options_effect_hide_list_cannot_connect(hass: HomeAssistant) -> None: """Check an options flow effect hide list with a failed connection.""" config_entry = add_test_config_entry(hass) client = create_mock_client() with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): await hass.config_entries.async_setup(config_entry.entry_id) await hass.async_block_till_done() client.async_client_connect = AsyncMock(return_value=False) result = await hass.config_entries.options.async_init(config_entry.entry_id) assert result["type"] == data_entry_flow.RESULT_TYPE_ABORT assert result["reason"] == "cannot_connect" async def test_reauth_success(hass: HomeAssistant) -> None: """Check a reauth flow that succeeds.""" config_data = { CONF_HOST: TEST_HOST, CONF_PORT: TEST_PORT, } config_entry = add_test_config_entry(hass, data=config_data) client = create_mock_client() client.async_is_auth_required = AsyncMock(return_value=TEST_AUTH_REQUIRED_RESP) with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ), patch("homeassistant.components.hyperion.async_setup", return_value=True), patch( "homeassistant.components.hyperion.async_setup_entry", return_value=True ): result = await _init_flow( hass, source=SOURCE_REAUTH, data=config_data, ) await hass.async_block_till_done() assert result["type"] == data_entry_flow.RESULT_TYPE_FORM result = await _configure_flow( hass, result, user_input={CONF_CREATE_TOKEN: False, CONF_TOKEN: TEST_TOKEN} ) assert result["type"] == data_entry_flow.RESULT_TYPE_ABORT assert result["reason"] == "reauth_successful" assert CONF_TOKEN in config_entry.data async def test_reauth_cannot_connect(hass: HomeAssistant) -> None: """Check a reauth flow that fails to connect.""" config_data = { CONF_HOST: TEST_HOST, CONF_PORT: TEST_PORT, } add_test_config_entry(hass, data=config_data) client = create_mock_client() client.async_client_connect = AsyncMock(return_value=False) with patch( "homeassistant.components.hyperion.client.HyperionClient", return_value=client ): result = await _init_flow( hass, source=SOURCE_REAUTH, data=config_data, ) await hass.async_block_till_done() assert result["type"] == data_entry_flow.RESULT_TYPE_ABORT assert result["reason"] == "cannot_connect"
''' YARN Cluster Metrics -------------------- yarn.metrics.appsSubmitted The number of submitted apps yarn.metrics.appsCompleted The number of completed apps yarn.metrics.appsPending The number of pending apps yarn.metrics.appsRunning The number of running apps yarn.metrics.appsFailed The number of failed apps yarn.metrics.appsKilled The number of killed apps yarn.metrics.reservedMB The size of reserved memory yarn.metrics.availableMB The amount of available memory yarn.metrics.allocatedMB The amount of allocated memory yarn.metrics.totalMB The amount of total memory yarn.metrics.reservedVirtualCores The number of reserved virtual cores yarn.metrics.availableVirtualCores The number of available virtual cores yarn.metrics.allocatedVirtualCores The number of allocated virtual cores yarn.metrics.totalVirtualCores The total number of virtual cores yarn.metrics.containersAllocated The number of containers allocated yarn.metrics.containersReserved The number of containers reserved yarn.metrics.containersPending The number of containers pending yarn.metrics.totalNodes The total number of nodes yarn.metrics.activeNodes The number of active nodes yarn.metrics.lostNodes The number of lost nodes yarn.metrics.unhealthyNodes The number of unhealthy nodes yarn.metrics.decommissionedNodes The number of decommissioned nodes yarn.metrics.rebootedNodes The number of rebooted nodes YARN App Metrics ---------------- yarn.app.progress The progress of the application as a percent yarn.app.startedTime The time in which application started (in ms since epoch) yarn.app.finishedTime The time in which the application finished (in ms since epoch) yarn.app.elapsedTime The elapsed time since the application started (in ms) yarn.app.allocatedMB The sum of memory in MB allocated to the applications running containers yarn.app.allocatedVCores The sum of virtual cores allocated to the applications running containers yarn.app.runningContainers The number of containers currently running for the application yarn.app.memorySeconds The amount of memory the application has allocated (megabyte-seconds) yarn.app.vcoreSeconds The amount of CPU resources the application has allocated (virtual core-seconds) YARN Node Metrics ----------------- yarn.node.lastHealthUpdate The last time the node reported its health (in ms since epoch) yarn.node.usedMemoryMB The total amount of memory currently used on the node (in MB) yarn.node.availMemoryMB The total amount of memory currently available on the node (in MB) yarn.node.usedVirtualCores The total number of vCores currently used on the node yarn.node.availableVirtualCores The total number of vCores available on the node yarn.node.numContainers The total number of containers currently running on the node YARN Capacity Scheduler Metrics ----------------- yarn.queue.root.maxCapacity The configured maximum queue capacity in percentage for root queue yarn.queue.root.usedCapacity The used queue capacity in percentage for root queue yarn.queue.root.capacity The configured queue capacity in percentage for root queue yarn.queue.numPendingApplications The number of pending applications in this queue yarn.queue.userAMResourceLimit.memory The maximum memory resources a user can use for Application Masters (in MB) yarn.queue.userAMResourceLimit.vCores The maximum vCpus a user can use for Application Masters yarn.queue.absoluteCapacity The absolute capacity percentage this queue can use of entire cluster yarn.queue.userLimitFactor The minimum user limit percent set in the configuration yarn.queue.userLimit The user limit factor set in the configuration yarn.queue.numApplications The number of applications currently in the queue yarn.queue.usedAMResource.memory The memory resources used for Application Masters (in MB) yarn.queue.usedAMResource.vCores The vCpus used for Application Masters yarn.queue.absoluteUsedCapacity The absolute used capacity percentage this queue is using of the entire cluster yarn.queue.resourcesUsed.memory The total memory resources this queue is using (in MB) yarn.queue.resourcesUsed.vCores The total vCpus this queue is using yarn.queue.AMResourceLimit.vCores The maximum vCpus this queue can use for Application Masters yarn.queue.AMResourceLimit.memory The maximum memory resources this queue can use for Application Masters (in MB) yarn.queue.capacity The configured queue capacity in percentage relative to its parent queue yarn.queue.numActiveApplications The number of active applications in this queue yarn.queue.absoluteMaxCapacity The absolute maximum capacity percentage this queue can use of the entire cluster yarn.queue.usedCapacity The used queue capacity in percentage yarn.queue.numContainers The number of containers being used yarn.queue.maxCapacity The configured maximum queue capacity in percentage relative to its parent queue yarn.queue.maxApplications The maximum number of applications this queue can have yarn.queue.maxApplicationsPerUser The maximum number of active applications per user this queue can have ''' # stdlib from urlparse import urljoin, urlsplit, urlunsplit # 3rd party from requests.exceptions import Timeout, HTTPError, InvalidURL, ConnectionError import requests # Project from checks import AgentCheck from config import _is_affirmative # Default settings DEFAULT_RM_URI = 'http://localhost:8088' DEFAULT_TIMEOUT = 5 DEFAULT_CUSTER_NAME = 'default_cluster' DEFAULT_COLLECT_APP_METRICS = True MAX_DETAILED_QUEUES = 100 # Path to retrieve cluster metrics YARN_CLUSTER_METRICS_PATH = '/ws/v1/cluster/metrics' # Path to retrieve YARN APPS YARN_APPS_PATH = '/ws/v1/cluster/apps' # Path to retrieve node statistics YARN_NODES_PATH = '/ws/v1/cluster/nodes' # Path to retrieve queue statistics YARN_SCHEDULER_PATH = '/ws/v1/cluster/scheduler' # Metric types GAUGE = 'gauge' INCREMENT = 'increment' # Name of the service check SERVICE_CHECK_NAME = 'yarn.can_connect' # Application states to collect YARN_APPLICATION_STATES = 'RUNNING' # Cluster metrics identifier YARN_CLUSTER_METRICS_ELEMENT = 'clusterMetrics' # Cluster metrics for YARN YARN_CLUSTER_METRICS = { 'appsSubmitted': ('yarn.metrics.apps_submitted', GAUGE), 'appsCompleted': ('yarn.metrics.apps_completed', GAUGE), 'appsPending': ('yarn.metrics.apps_pending', GAUGE), 'appsRunning': ('yarn.metrics.apps_running', GAUGE), 'appsFailed': ('yarn.metrics.apps_failed', GAUGE), 'appsKilled': ('yarn.metrics.apps_killed', GAUGE), 'reservedMB': ('yarn.metrics.reserved_mb', GAUGE), 'availableMB': ('yarn.metrics.available_mb', GAUGE), 'allocatedMB': ('yarn.metrics.allocated_mb', GAUGE), 'totalMB': ('yarn.metrics.total_mb', GAUGE), 'reservedVirtualCores': ('yarn.metrics.reserved_virtual_cores', GAUGE), 'availableVirtualCores': ('yarn.metrics.available_virtual_cores', GAUGE), 'allocatedVirtualCores': ('yarn.metrics.allocated_virtual_cores', GAUGE), 'totalVirtualCores': ('yarn.metrics.total_virtual_cores', GAUGE), 'containersAllocated': ('yarn.metrics.containers_allocated', GAUGE), 'containersReserved': ('yarn.metrics.containers_reserved', GAUGE), 'containersPending': ('yarn.metrics.containers_pending', GAUGE), 'totalNodes': ('yarn.metrics.total_nodes', GAUGE), 'activeNodes': ('yarn.metrics.active_nodes', GAUGE), 'lostNodes': ('yarn.metrics.lost_nodes', GAUGE), 'unhealthyNodes': ('yarn.metrics.unhealthy_nodes', GAUGE), 'decommissionedNodes': ('yarn.metrics.decommissioned_nodes', GAUGE), 'rebootedNodes': ('yarn.metrics.rebooted_nodes', GAUGE), } # Application metrics for YARN YARN_APP_METRICS = { 'progress': ('yarn.apps.progress', INCREMENT), 'startedTime': ('yarn.apps.started_time', INCREMENT), 'finishedTime': ('yarn.apps.finished_time', INCREMENT), 'elapsedTime': ('yarn.apps.elapsed_time', INCREMENT), 'allocatedMB': ('yarn.apps.allocated_mb', INCREMENT), 'allocatedVCores': ('yarn.apps.allocated_vcores', INCREMENT), 'runningContainers': ('yarn.apps.running_containers', INCREMENT), 'memorySeconds': ('yarn.apps.memory_seconds', INCREMENT), 'vcoreSeconds': ('yarn.apps.vcore_seconds', INCREMENT), } # Node metrics for YARN YARN_NODE_METRICS = { 'lastHealthUpdate': ('yarn.node.last_health_update', GAUGE), 'usedMemoryMB': ('yarn.node.used_memory_mb', GAUGE), 'availMemoryMB': ('yarn.node.avail_memory_mb', GAUGE), 'usedVirtualCores': ('yarn.node.used_virtual_cores', GAUGE), 'availableVirtualCores': ('yarn.node.available_virtual_cores', GAUGE), 'numContainers': ('yarn.node.num_containers', GAUGE), } # Root queue metrics for YARN YARN_ROOT_QUEUE_METRICS = { 'maxCapacity': ('yarn.queue.root.max_capacity', GAUGE), 'usedCapacity': ('yarn.queue.root.used_capacity', GAUGE), 'capacity': ('yarn.queue.root.capacity', GAUGE) } # Queue metrics for YARN YARN_QUEUE_METRICS = { 'numPendingApplications': ('yarn.queue.num_pending_applications', GAUGE), 'userAMResourceLimit.memory': ('yarn.queue.user_am_resource_limit.memory', GAUGE), 'userAMResourceLimit.vCores': ('yarn.queue.user_am_resource_limit.vcores', GAUGE), 'absoluteCapacity': ('yarn.queue.absolute_capacity', GAUGE), 'userLimitFactor': ('yarn.queue.user_limit_factor', GAUGE), 'userLimit': ('yarn.queue.user_limit', GAUGE), 'numApplications': ('yarn.queue.num_applications', GAUGE), 'usedAMResource.memory': ('yarn.queue.used_am_resource.memory', GAUGE), 'usedAMResource.vCores': ('yarn.queue.used_am_resource.vcores', GAUGE), 'absoluteUsedCapacity': ('yarn.queue.absolute_used_capacity', GAUGE), 'resourcesUsed.memory': ('yarn.queue.resources_used.memory', GAUGE), 'resourcesUsed.vCores': ('yarn.queue.resources_used.vcores', GAUGE), 'AMResourceLimit.vCores': ('yarn.queue.am_resource_limit.vcores', GAUGE), 'AMResourceLimit.memory': ('yarn.queue.am_resource_limit.memory', GAUGE), 'capacity': ('yarn.queue.capacity', GAUGE), 'numActiveApplications': ('yarn.queue.num_active_applications', GAUGE), 'absoluteMaxCapacity': ('yarn.queue.absolute_max_capacity', GAUGE), 'usedCapacity' : ('yarn.queue.used_capacity', GAUGE), 'numContainers': ('yarn.queue.num_containers', GAUGE), 'maxCapacity': ('yarn.queue.max_capacity', GAUGE), 'maxApplications': ('yarn.queue.max_applications', GAUGE), 'maxApplicationsPerUser': ('yarn.queue.max_applications_per_user', GAUGE) } class YarnCheck(AgentCheck): ''' Extract statistics from YARN's ResourceManger REST API ''' _ALLOWED_APPLICATION_TAGS = [ 'applicationTags', 'applicationType', 'name', 'queue', 'user' ] def check(self, instance): # Get properties from conf file rm_address = instance.get('resourcemanager_uri', DEFAULT_RM_URI) app_tags = instance.get('application_tags', {}) queue_blacklist = instance.get('queue_blacklist', []) if type(app_tags) is not dict: self.log.error('application_tags is incorrect: %s is not a dictionary', app_tags) app_tags = {} filtered_app_tags = {} for dd_prefix, yarn_key in app_tags.iteritems(): if yarn_key in self._ALLOWED_APPLICATION_TAGS: filtered_app_tags[dd_prefix] = yarn_key app_tags = filtered_app_tags # Collected by default app_tags['app_name'] = 'name' # Get additional tags from the conf file tags = instance.get('tags', []) if tags is None: tags = [] else: tags = list(set(tags)) # Get the cluster name from the conf file cluster_name = instance.get('cluster_name') if cluster_name is None: self.warning("The cluster_name must be specified in the instance configuration, defaulting to '%s'" % (DEFAULT_CUSTER_NAME)) cluster_name = DEFAULT_CUSTER_NAME tags.append('cluster_name:%s' % cluster_name) # Get metrics from the Resource Manager self._yarn_cluster_metrics(rm_address, tags) if _is_affirmative(instance.get('collect_app_metrics', DEFAULT_COLLECT_APP_METRICS)): self._yarn_app_metrics(rm_address, app_tags, tags) self._yarn_node_metrics(rm_address, tags) self._yarn_scheduler_metrics(rm_address, tags, queue_blacklist) def _yarn_cluster_metrics(self, rm_address, addl_tags): ''' Get metrics related to YARN cluster ''' metrics_json = self._rest_request_to_json(rm_address, YARN_CLUSTER_METRICS_PATH) if metrics_json: yarn_metrics = metrics_json[YARN_CLUSTER_METRICS_ELEMENT] if yarn_metrics is not None: self._set_yarn_metrics_from_json(addl_tags, yarn_metrics, YARN_CLUSTER_METRICS) def _yarn_app_metrics(self, rm_address, app_tags, addl_tags): ''' Get metrics for running applications ''' metrics_json = self._rest_request_to_json( rm_address, YARN_APPS_PATH, states=YARN_APPLICATION_STATES ) if (metrics_json and metrics_json['apps'] is not None and metrics_json['apps']['app'] is not None): for app_json in metrics_json['apps']['app']: tags = [] for dd_tag, yarn_key in app_tags.iteritems(): try: val = app_json[yarn_key] if val: tags.append("{tag}:{value}".format( tag=dd_tag, value=val )) except KeyError: self.log.error("Invalid value %s for application_tag", yarn_key) tags.extend(addl_tags) self._set_yarn_metrics_from_json(tags, app_json, YARN_APP_METRICS) def _yarn_node_metrics(self, rm_address, addl_tags): ''' Get metrics related to YARN nodes ''' metrics_json = self._rest_request_to_json(rm_address, YARN_NODES_PATH) if (metrics_json and metrics_json['nodes'] is not None and metrics_json['nodes']['node'] is not None): for node_json in metrics_json['nodes']['node']: node_id = node_json['id'] tags = ['node_id:%s' % str(node_id)] tags.extend(addl_tags) self._set_yarn_metrics_from_json(tags, node_json, YARN_NODE_METRICS) def _yarn_scheduler_metrics(self, rm_address, addl_tags, queue_blacklist): ''' Get metrics from YARN scheduler ''' metrics_json = self._rest_request_to_json(rm_address, YARN_SCHEDULER_PATH) try: metrics_json = metrics_json['scheduler']['schedulerInfo'] if metrics_json['type'] == 'capacityScheduler': self._yarn_capacity_scheduler_metrics(metrics_json, addl_tags, queue_blacklist) except KeyError: pass def _yarn_capacity_scheduler_metrics(self, metrics_json, addl_tags, queue_blacklist): ''' Get metrics from YARN scheduler if it's type is capacityScheduler ''' tags = ['queue_name:%s' % metrics_json['queueName']] tags.extend(addl_tags) self._set_yarn_metrics_from_json(tags, metrics_json, YARN_ROOT_QUEUE_METRICS) if metrics_json['queues'] is not None and metrics_json['queues']['queue'] is not None: queues_count = 0 for queue_json in metrics_json['queues']['queue']: queue_name = queue_json['queueName'] if queue_name in queue_blacklist: self.log.debug('Queue "%s" is blacklisted. Ignoring it' % queue_name) continue queues_count += 1 if queues_count > MAX_DETAILED_QUEUES: self.warning("Found more than 100 queues, will only send metrics on first 100 queues. " + " Please filter the queues with the check's `queue_blacklist` parameter") break tags = ['queue_name:%s' % str(queue_name)] tags.extend(addl_tags) self._set_yarn_metrics_from_json(tags, queue_json, YARN_QUEUE_METRICS) def _set_yarn_metrics_from_json(self, tags, metrics_json, yarn_metrics): ''' Parse the JSON response and set the metrics ''' for dict_path, metric in yarn_metrics.iteritems(): metric_name, metric_type = metric metric_value = self._get_value_from_json(dict_path, metrics_json) if metric_value is not None: self._set_metric(metric_name, metric_type, metric_value, tags) def _get_value_from_json(self, dict_path, metrics_json): ''' Get a value from a dictionary under N keys, represented as str("key1.key2...key{n}") ''' for key in dict_path.split('.'): if key in metrics_json: metrics_json = metrics_json.get(key) else: return None return metrics_json def _set_metric(self, metric_name, metric_type, value, tags=None, device_name=None): ''' Set a metric ''' if metric_type == GAUGE: self.gauge(metric_name, value, tags=tags, device_name=device_name) elif metric_type == INCREMENT: self.increment(metric_name, value, tags=tags, device_name=device_name) else: self.log.error('Metric type "%s" unknown', metric_type) def _rest_request_to_json(self, address, object_path, *args, **kwargs): ''' Query the given URL and return the JSON response ''' response_json = None service_check_tags = ['url:%s' % self._get_url_base(address)] url = address if object_path: url = self._join_url_dir(url, object_path) # Add args to the url if args: for directory in args: url = self._join_url_dir(url, directory) self.log.debug('Attempting to connect to "%s"' % url) # Add kwargs as arguments if kwargs: query = '&'.join(['{0}={1}'.format(key, value) for key, value in kwargs.iteritems()]) url = urljoin(url, '?' + query) try: response = requests.get(url, timeout=self.default_integration_http_timeout) response.raise_for_status() response_json = response.json() except Timeout as e: self.service_check(SERVICE_CHECK_NAME, AgentCheck.CRITICAL, tags=service_check_tags, message="Request timeout: {0}, {1}".format(url, e)) raise except (HTTPError, InvalidURL, ConnectionError) as e: self.service_check(SERVICE_CHECK_NAME, AgentCheck.CRITICAL, tags=service_check_tags, message="Request failed: {0}, {1}".format(url, e)) raise except ValueError as e: self.service_check(SERVICE_CHECK_NAME, AgentCheck.CRITICAL, tags=service_check_tags, message=str(e)) raise else: self.service_check(SERVICE_CHECK_NAME, AgentCheck.OK, tags=service_check_tags, message='Connection to %s was successful' % url) return response_json def _join_url_dir(self, url, *args): ''' Join a URL with multiple directories ''' for path in args: url = url.rstrip('/') + '/' url = urljoin(url, path.lstrip('/')) return url def _get_url_base(self, url): ''' Return the base of a URL ''' s = urlsplit(url) return urlunsplit([s.scheme, s.netloc, '', '', ''])
r"""An implementation of the Web Site Process Bus. This module is completely standalone, depending only on the stdlib. Web Site Process Bus -------------------- A Bus object is used to contain and manage site-wide behavior: daemonization, HTTP server start/stop, process reload, signal handling, drop privileges, PID file management, logging for all of these, and many more. In addition, a Bus object provides a place for each web framework to register code that runs in response to site-wide events (like process start and stop), or which controls or otherwise interacts with the site-wide components mentioned above. For example, a framework which uses file-based templates would add known template filenames to an autoreload component. Ideally, a Bus object will be flexible enough to be useful in a variety of invocation scenarios: 1. The deployer starts a site from the command line via a framework-neutral deployment script; applications from multiple frameworks are mixed in a single site. Command-line arguments and configuration files are used to define site-wide components such as the HTTP server, WSGI component graph, autoreload behavior, signal handling, etc. 2. The deployer starts a site via some other process, such as Apache; applications from multiple frameworks are mixed in a single site. Autoreload and signal handling (from Python at least) are disabled. 3. The deployer starts a site via a framework-specific mechanism; for example, when running tests, exploring tutorials, or deploying single applications from a single framework. The framework controls which site-wide components are enabled as it sees fit. The Bus object in this package uses topic-based publish-subscribe messaging to accomplish all this. A few topic channels are built in ('start', 'stop', 'exit', 'graceful', 'log', and 'main'). Frameworks and site containers are free to define their own. If a message is sent to a channel that has not been defined or has no listeners, there is no effect. In general, there should only ever be a single Bus object per process. Frameworks and site containers share a single Bus object by publishing messages and subscribing listeners. The Bus object works as a finite state machine which models the current state of the process. Bus methods move it from one state to another; those methods then publish to subscribed listeners on the channel for the new state.:: O | V STOPPING --> STOPPED --> EXITING -> X A A | | \___ | | \ | | V V STARTED <-- STARTING """ import atexit try: import ctypes except ImportError: """Google AppEngine is shipped without ctypes :seealso: http://stackoverflow.com/a/6523777/70170 """ ctypes = None import operator import os import sys import threading import time import traceback as _traceback import warnings import subprocess import functools from more_itertools import always_iterable # Here I save the value of os.getcwd(), which, if I am imported early enough, # will be the directory from which the startup script was run. This is needed # by _do_execv(), to change back to the original directory before execv()ing a # new process. This is a defense against the application having changed the # current working directory (which could make sys.executable "not found" if # sys.executable is a relative-path, and/or cause other problems). _startup_cwd = os.getcwd() class ChannelFailures(Exception): """Exception raised during errors on Bus.publish().""" delimiter = '\n' def __init__(self, *args, **kwargs): """Initialize ChannelFailures errors wrapper.""" super(ChannelFailures, self).__init__(*args, **kwargs) self._exceptions = list() def handle_exception(self): """Append the current exception to self.""" self._exceptions.append(sys.exc_info()[1]) def get_instances(self): """Return a list of seen exception instances.""" return self._exceptions[:] def __str__(self): """Render the list of errors, which happened in channel.""" exception_strings = map(repr, self.get_instances()) return self.delimiter.join(exception_strings) __repr__ = __str__ def __bool__(self): """Determine whether any error happened in channel.""" return bool(self._exceptions) __nonzero__ = __bool__ # Use a flag to indicate the state of the bus. class _StateEnum(object): class State(object): name = None def __repr__(self): return 'states.%s' % self.name def __setattr__(self, key, value): if isinstance(value, self.State): value.name = key object.__setattr__(self, key, value) states = _StateEnum() states.STOPPED = states.State() states.STARTING = states.State() states.STARTED = states.State() states.STOPPING = states.State() states.EXITING = states.State() try: import fcntl except ImportError: max_files = 0 else: try: max_files = os.sysconf('SC_OPEN_MAX') except AttributeError: max_files = 1024 class Bus(object): """Process state-machine and messenger for HTTP site deployment. All listeners for a given channel are guaranteed to be called even if others at the same channel fail. Each failure is logged, but execution proceeds on to the next listener. The only way to stop all processing from inside a listener is to raise SystemExit and stop the whole server. """ states = states state = states.STOPPED execv = False max_cloexec_files = max_files def __init__(self): """Initialize pub/sub bus.""" self.execv = False self.state = states.STOPPED channels = 'start', 'stop', 'exit', 'graceful', 'log', 'main' self.listeners = dict( (channel, set()) for channel in channels ) self._priorities = {} def subscribe(self, channel, callback=None, priority=None): """Add the given callback at the given channel (if not present). If callback is None, return a partial suitable for decorating the callback. """ if callback is None: return functools.partial( self.subscribe, channel, priority=priority, ) ch_listeners = self.listeners.setdefault(channel, set()) ch_listeners.add(callback) if priority is None: priority = getattr(callback, 'priority', 50) self._priorities[(channel, callback)] = priority def unsubscribe(self, channel, callback): """Discard the given callback (if present).""" listeners = self.listeners.get(channel) if listeners and callback in listeners: listeners.discard(callback) del self._priorities[(channel, callback)] def publish(self, channel, *args, **kwargs): """Return output of all subscribers for the given channel.""" if channel not in self.listeners: return [] exc = ChannelFailures() output = [] raw_items = ( (self._priorities[(channel, listener)], listener) for listener in self.listeners[channel] ) items = sorted(raw_items, key=operator.itemgetter(0)) for priority, listener in items: try: output.append(listener(*args, **kwargs)) except KeyboardInterrupt: raise except SystemExit: e = sys.exc_info()[1] # If we have previous errors ensure the exit code is non-zero if exc and e.code == 0: e.code = 1 raise except Exception: exc.handle_exception() if channel == 'log': # Assume any further messages to 'log' will fail. pass else: self.log('Error in %r listener %r' % (channel, listener), level=40, traceback=True) if exc: raise exc return output def _clean_exit(self): """Assert that the Bus is not running in atexit handler callback.""" if self.state != states.EXITING: warnings.warn( 'The main thread is exiting, but the Bus is in the %r state; ' 'shutting it down automatically now. You must either call ' 'bus.block() after start(), or call bus.exit() before the ' 'main thread exits.' % self.state, RuntimeWarning) self.exit() def start(self): """Start all services.""" atexit.register(self._clean_exit) self.state = states.STARTING self.log('Bus STARTING') try: self.publish('start') self.state = states.STARTED self.log('Bus STARTED') except (KeyboardInterrupt, SystemExit): raise except Exception: self.log('Shutting down due to error in start listener:', level=40, traceback=True) e_info = sys.exc_info()[1] try: self.exit() except Exception: # Any stop/exit errors will be logged inside publish(). pass # Re-raise the original error raise e_info def exit(self): """Stop all services and prepare to exit the process.""" exitstate = self.state EX_SOFTWARE = 70 try: self.stop() self.state = states.EXITING self.log('Bus EXITING') self.publish('exit') # This isn't strictly necessary, but it's better than seeing # "Waiting for child threads to terminate..." and then nothing. self.log('Bus EXITED') except Exception: # This method is often called asynchronously (whether thread, # signal handler, console handler, or atexit handler), so we # can't just let exceptions propagate out unhandled. # Assume it's been logged and just die. os._exit(EX_SOFTWARE) if exitstate == states.STARTING: # exit() was called before start() finished, possibly due to # Ctrl-C because a start listener got stuck. In this case, # we could get stuck in a loop where Ctrl-C never exits the # process, so we just call os.exit here. os._exit(EX_SOFTWARE) def restart(self): """Restart the process (may close connections). This method does not restart the process from the calling thread; instead, it stops the bus and asks the main thread to call execv. """ self.execv = True self.exit() def graceful(self): """Advise all services to reload.""" self.log('Bus graceful') self.publish('graceful') def block(self, interval=0.1): """Wait for the EXITING state, KeyboardInterrupt or SystemExit. This function is intended to be called only by the main thread. After waiting for the EXITING state, it also waits for all threads to terminate, and then calls os.execv if self.execv is True. This design allows another thread to call bus.restart, yet have the main thread perform the actual execv call (required on some platforms). """ try: self.wait(states.EXITING, interval=interval, channel='main') except (KeyboardInterrupt, IOError): # The time.sleep call might raise # "IOError: [Errno 4] Interrupted function call" on KBInt. self.log('Keyboard Interrupt: shutting down bus') self.exit() except SystemExit: self.log('SystemExit raised: shutting down bus') self.exit() raise # Waiting for ALL child threads to finish is necessary on OS X. # See https://github.com/cherrypy/cherrypy/issues/581. # It's also good to let them all shut down before allowing # the main thread to call atexit handlers. # See https://github.com/cherrypy/cherrypy/issues/751. self.log('Waiting for child threads to terminate...') for t in threading.enumerate(): # Validate the we're not trying to join the MainThread # that will cause a deadlock and the case exist when # implemented as a windows service and in any other case # that another thread executes cherrypy.engine.exit() if ( t != threading.currentThread() and not isinstance(t, threading._MainThread) and # Note that any dummy (external) threads are # always daemonic. not t.daemon ): self.log('Waiting for thread %s.' % t.getName()) t.join() if self.execv: self._do_execv() def wait(self, state, interval=0.1, channel=None): """Poll for the given state(s) at intervals; publish to channel.""" states = set(always_iterable(state)) while self.state not in states: time.sleep(interval) self.publish(channel) def _do_execv(self): """Re-execute the current process. This must be called from the main thread, because certain platforms (OS X) don't allow execv to be called in a child thread very well. """ try: args = self._get_true_argv() except NotImplementedError: """It's probably win32 or GAE""" args = [sys.executable] + self._get_interpreter_argv() + sys.argv self.log('Re-spawning %s' % ' '.join(args)) self._extend_pythonpath(os.environ) if sys.platform[:4] == 'java': from _systemrestart import SystemRestart raise SystemRestart else: if sys.platform == 'win32': args = ['"%s"' % arg for arg in args] os.chdir(_startup_cwd) if self.max_cloexec_files: self._set_cloexec() os.execv(sys.executable, args) @staticmethod def _get_interpreter_argv(): """Retrieve current Python interpreter's arguments. Returns empty tuple in case of frozen mode, uses built-in arguments reproduction function otherwise. Frozen mode is possible for the app has been packaged into a binary executable using py2exe. In this case the interpreter's arguments are already built-in into that executable. :seealso: https://github.com/cherrypy/cherrypy/issues/1526 Ref: https://pythonhosted.org/PyInstaller/runtime-information.html """ return ([] if getattr(sys, 'frozen', False) else subprocess._args_from_interpreter_flags()) @staticmethod def _get_true_argv(): """Retrieve all real arguments of the python interpreter. ...even those not listed in ``sys.argv`` :seealso: http://stackoverflow.com/a/28338254/595220 :seealso: http://stackoverflow.com/a/6683222/595220 :seealso: http://stackoverflow.com/a/28414807/595220 """ try: char_p = ctypes.c_wchar_p argv = ctypes.POINTER(char_p)() argc = ctypes.c_int() ctypes.pythonapi.Py_GetArgcArgv( ctypes.byref(argc), ctypes.byref(argv), ) _argv = argv[:argc.value] # The code below is trying to correctly handle special cases. # `-c`'s argument interpreted by Python itself becomes `-c` as # well. Same applies to `-m`. This snippet is trying to survive # at least the case with `-m` # Ref: https://github.com/cherrypy/cherrypy/issues/1545 # Ref: python/cpython@418baf9 argv_len, is_command, is_module = len(_argv), False, False try: m_ind = _argv.index('-m') if m_ind < argv_len - 1 and _argv[m_ind + 1] in ('-c', '-m'): """ In some older Python versions `-m`'s argument may be substituted with `-c`, not `-m` """ is_module = True except (IndexError, ValueError): m_ind = None try: c_ind = _argv.index('-c') if c_ind < argv_len - 1 and _argv[c_ind + 1] == '-c': is_command = True except (IndexError, ValueError): c_ind = None if is_module: """It's containing `-m -m` sequence of arguments""" if is_command and c_ind < m_ind: """There's `-c -c` before `-m`""" raise RuntimeError( "Cannot reconstruct command from '-c'. Ref: " 'https://github.com/cherrypy/cherrypy/issues/1545') # Survive module argument here original_module = sys.argv[0] if not os.access(original_module, os.R_OK): """There's no such module exist""" raise AttributeError( "{} doesn't seem to be a module " 'accessible by current user'.format(original_module)) del _argv[m_ind:m_ind + 2] # remove `-m -m` # ... and substitute it with the original module path: _argv.insert(m_ind, original_module) elif is_command: """It's containing just `-c -c` sequence of arguments""" raise RuntimeError( "Cannot reconstruct command from '-c'. " 'Ref: https://github.com/cherrypy/cherrypy/issues/1545') except AttributeError: """It looks Py_GetArgcArgv is completely absent in some environments It is known, that there's no Py_GetArgcArgv in MS Windows and ``ctypes`` module is completely absent in Google AppEngine :seealso: https://github.com/cherrypy/cherrypy/issues/1506 :seealso: https://github.com/cherrypy/cherrypy/issues/1512 :ref: http://bit.ly/2gK6bXK """ raise NotImplementedError else: return _argv @staticmethod def _extend_pythonpath(env): """Prepend current working dir to PATH environment variable if needed. If sys.path[0] is an empty string, the interpreter was likely invoked with -m and the effective path is about to change on re-exec. Add the current directory to $PYTHONPATH to ensure that the new process sees the same path. This issue cannot be addressed in the general case because Python cannot reliably reconstruct the original command line (http://bugs.python.org/issue14208). (This idea filched from tornado.autoreload) """ path_prefix = '.' + os.pathsep existing_path = env.get('PYTHONPATH', '') needs_patch = ( sys.path[0] == '' and not existing_path.startswith(path_prefix) ) if needs_patch: env['PYTHONPATH'] = path_prefix + existing_path def _set_cloexec(self): """Set the CLOEXEC flag on all open files (except stdin/out/err). If self.max_cloexec_files is an integer (the default), then on platforms which support it, it represents the max open files setting for the operating system. This function will be called just before the process is restarted via os.execv() to prevent open files from persisting into the new process. Set self.max_cloexec_files to 0 to disable this behavior. """ for fd in range(3, self.max_cloexec_files): # skip stdin/out/err try: flags = fcntl.fcntl(fd, fcntl.F_GETFD) except IOError: continue fcntl.fcntl(fd, fcntl.F_SETFD, flags | fcntl.FD_CLOEXEC) def stop(self): """Stop all services.""" self.state = states.STOPPING self.log('Bus STOPPING') self.publish('stop') self.state = states.STOPPED self.log('Bus STOPPED') def start_with_callback(self, func, args=None, kwargs=None): """Start 'func' in a new thread T, then start self (and return T).""" if args is None: args = () if kwargs is None: kwargs = {} args = (func,) + args def _callback(func, *a, **kw): self.wait(states.STARTED) func(*a, **kw) t = threading.Thread(target=_callback, args=args, kwargs=kwargs) t.setName('Bus Callback ' + t.getName()) t.start() self.start() return t def log(self, msg='', level=20, traceback=False): """Log the given message. Append the last traceback if requested.""" if traceback: msg += '\n' + ''.join(_traceback.format_exception(*sys.exc_info())) self.publish('log', msg, level) bus = Bus()
""" These MathApp-based digital logic classes are experimental. """ from abc import ABCMeta, abstractmethod from ggame.mathapp import _MathDynamic # decorator for _getvalue or any value handler that may experience recursion def _recursiontrap(handler): def trapmagic(self): """ An attempt to catch recursion (doesn't work). """ if not self.ingetvalue: self.ingetvalue = True self.lastget = handler(self) self.ingetvalue = False return self.lastget self.ingetvalue = False return self.lastget return trapmagic class _BoolDevice(_MathDynamic, metaclass=ABCMeta): """ Base class for boolean objects. :Required Arguments: :param int mininputqty: The minimum number of inputs possible. :Optional Keyword Arguments: * **namedinputs** (*list[str]*) List of input names. """ def __init__(self, mininputqty, **kwargs): self.inp = [None] * mininputqty self.enable = True namedinputs = kwargs.get("namedinputs", []) self._indict = {name: self.eval(None) for name in namedinputs} self.ingetvalue = False self.lastget = False self.resetval = False self.firsttime = True self._enable = None self._input = None super().__init__() @property def inp(self): """ Report the list of input references. """ return self._input @inp.setter def inp(self, val): try: self._input = [self.eval(v) for v in list(val)] except TypeError: self._input = [self.eval(val)] # Enable attribute controls the "tri-state" of output @property def enable(self): """ Report the enable state of the object. """ return self._enable @enable.setter def enable(self, val): self._enable = self.eval(val) @abstractmethod @_recursiontrap # MUST use with any implementation that may recurse! def _getvalue(self): return None @staticmethod def _inputState(value): """ interprets a value that could be single input or a list of inputs! """ try: inputs = [].extend(value) except TypeError: inputs = [value] scalars = [v() for v in inputs] ones = scalars.count(True) + scalars.count(1) zeros = scalars.count(False) + scalars.count(0) if ones > 0 and zeros > 0: raise ValueError("Conflicting inputs found") if ones > 0: return True if zeros > 0: return False return None def __call__(self): if self.enable: return self._getvalue() return None def getinput(self, inputname): """ Retrieve input by name. :param str inputname: Name to look up. """ return self._inputState(self._indict[inputname]) def setinput(self, inputname, reference): """ Set an input connection. :param str inputname: Name to assign. :param function reference: Callable object or function connected to input. """ self._indict[inputname] = self.eval(reference) class _BoolOneInput(_BoolDevice): """ Base class for one-input boolean objects. No required inputs. """ def __init__(self, *args, **kwargs): super().__init__(1, *args, **kwargs) @abstractmethod @_recursiontrap # MUST use with any implementation that may recurse! def _getvalue(self): return None class _BoolMultiInput(_BoolDevice): """ Base class for multiple-input boolean objects. No required inputs. """ def __init__(self, *args, **kwargs): super().__init__(2, *args, **kwargs) @abstractmethod @_recursiontrap # MUST use with any implementation that may recurse! def _getvalue(self): return None class BoolNOT(_BoolOneInput): """ Logical NOT boolean gate. """ @_recursiontrap def _getvalue(self): inval = self._inputState(self.inp[0]) if inval is None: return True # equivalent to an "open" input return not inval class BoolAND(_BoolMultiInput): """ Logical AND boolean gate. Multiple inputs. """ @_recursiontrap def _getvalue(self): for v in self._input: if not self._inputState(v): return False return True class BoolNOR(_BoolMultiInput): """ Logical NOR boolean gate. Multiple inputs. """ @_recursiontrap def _getvalue(self): for v in self._input: if self._inputState(v): return False return True class BoolNAND(_BoolMultiInput): """ Logical NAND boolean gate. Multiple inputs. """ @_recursiontrap def _getvalue(self): for v in self._input: if not self._inputState(v): return True return False class BoolSRFF(_BoolOneInput): """ Logical Set/Reset (SR) FlipFlop. :Optional Keyword Arguments: :param class gateclass: One of BoolNAND or BoolNOR (default). """ def __init__(self, *args, **kwargs): kwargs["namedinputs"] = ["R", "S"] super().__init__(*args, **kwargs) gate = kwargs.get("gateclass", BoolNOR) self.ic1 = gate() self.ic2 = gate() # we can only assign IC1 and IC2 inputs when this device's inputs are set def setinput(self, inputname, reference): super().setinput(inputname, reference) if inputname == "R": self.ic1.In = reference, self.ic2 elif inputname == "S": self.ic2.In = reference, self.ic1 def _getvalue(self): return self.ic1() # pylint: disable=invalid-name def q_(self): """ Report value of Q_ output. """ return self.ic2() # pylint: disable=invalid-name def q(self): """ Report value of Q output. """ return self._getvalue()
# -*- coding: utf-8 -*- # # This file is part of GetTor, a Tor Browser distribution system. # # :authors: Israel Leiva <ilv@riseup.net> # see also AUTHORS file # # :copyright: (c) 2008-2015, The Tor Project, Inc. # (c) 2015, Israel Leiva # # :license: This is Free Software. See LICENSE for license information. import os import re import sys import time import gettext import hashlib import logging import ConfigParser from sleekxmpp import ClientXMPP from sleekxmpp.xmlstream.stanzabase import JID from sleekxmpp.exceptions import IqError, IqTimeout import core import utils import blacklist """XMPP module for processing requests.""" OS = { 'osx': 'Mac OS X', 'linux': 'Linux', 'windows': 'Windows' } class ConfigError(Exception): pass class InternalError(Exception): pass class Bot(ClientXMPP): """XMPP bot. Handle messages and pass them to XMPP module for parsing. """ def __init__(self, jid, password, xmpp_obj): ClientXMPP.__init__(self, jid, password) self.xmpp = xmpp_obj self.add_event_handler("session_start", self.session_start) self.add_event_handler("message", self.message) def session_start(self, event): self.send_presence() self.get_roster() try: self.get_roster() except IqError as err: # error getting the roster self.xmpp.log.error(err.iq['error']['condition']) self.disconnect() except IqTimeout: # server is taking too long to respond self.xmpp.log.error("Server is taking too long to respond") self.disconnect() def message(self, msg): if msg['type'] in ('chat', 'normal'): msg_to_send = self.xmpp.parse_request(msg['from'], msg['body']) if msg_to_send: msg.reply(msg_to_send).send() class XMPP(object): """Receive and reply requests by XMPP. Public methods: parse_request(): parses a message and tries to figure out what the user is asking for. Exceptions: ConfigError: Bad configuration. InternalError: Something went wrong internally. """ def __init__(self, cfg=None): """Create new object by reading a configuration file. :param: cfg (string) the path of the configuration file. """ # define a set of default values default_cfg = 'xmpp.cfg' config = ConfigParser.ConfigParser() if cfg is None or not os.path.isfile(cfg): cfg = default_cfg try: with open(cfg) as f: config.readfp(f) except IOError: raise ConfigError("File %s not found!" % cfg) try: self.user = config.get('account', 'user') self.password = config.get('account', 'password') self.mirrors = config.get('general', 'mirrors') self.max_words = config.get('general', 'max_words') self.max_words = int(self.max_words) core_cfg = config.get('general', 'core_cfg') self.core = core.Core(core_cfg) self.i18ndir = config.get('i18n', 'dir') blacklist_cfg = config.get('blacklist', 'cfg') self.bl = blacklist.Blacklist(blacklist_cfg) self.bl_max_req = config.get('blacklist', 'max_requests') self.bl_max_req = int(self.bl_max_req) self.bl_wait_time = config.get('blacklist', 'wait_time') self.bl_wait_time = int(self.bl_wait_time) logdir = config.get('log', 'dir') logfile = os.path.join(logdir, 'xmpp.log') loglevel = config.get('log', 'level') except ConfigParser.Error as e: raise ConfigError("Configuration error: %s" % str(e)) except blacklist.ConfigError as e: raise InternalError("Blacklist error: %s" % str(e)) except core.ConfigError as e: raise InternalError("Core error: %s" % str(e)) # logging log = logging.getLogger(__name__) logging_format = utils.get_logging_format() date_format = utils.get_date_format() formatter = logging.Formatter(logging_format, date_format) log.info('Redirecting XMPP logging to %s' % logfile) logfileh = logging.FileHandler(logfile, mode='a+') logfileh.setFormatter(formatter) logfileh.setLevel(logging.getLevelName(loglevel)) log.addHandler(logfileh) # stop logging on stdout from now on log.propagate = False self.log = log def start_bot(self): """Start the bot for handling requests. Start a new sleekxmpp bot. """ self.log.info("Starting the bot with account %s" % self.user) xmpp = Bot(self.user, self.password, self) xmpp.connect() xmpp.process(block=True) def _is_blacklisted(self, account): """Check if a user is blacklisted. :param: addr (string) the hashed address of the user. :return: true is the address is blacklisted, false otherwise. """ anon_acc = utils.get_sha256(account) try: self.bl.is_blacklisted( anon_acc, 'XMPP', self.bl_max_req, self.bl_wait_time ) return False except blacklist.BlacklistError as e: return True def _get_msg(self, msgid, lc): """Get message identified by msgid in a specific locale. :param: msgid (string) the identifier of a string. :param: lc (string) the locale. :return: (string) the message from the .po file. """ # obtain the content in the proper language self.log.debug("Trying to get translated text") try: t = gettext.translation(lc, self.i18ndir, languages=[lc]) _ = t.ugettext msgstr = _(msgid) return msgstr except IOError as e: raise ConfigError("%s" % str(e)) def _parse_text(self, msg): """Parse the text part of a message. Split the message in words and look for patterns for locale, operating system and built-in pluggable transport info. :param: msg (string) the message received. :param: core_obj (object) the object of gettor core module. :return: request (list) 4-tuple with locale, os, type of request and pt info. """ # core knows what OS are supported supported_os = self.core.get_supported_os() supported_lc = self.core.get_supported_lc() self.log.debug("Parsing text") # default values req = {} req['lc'] = 'en' req['os'] = None req['type'] = 'help' found_lc = False found_os = False found_mirrors = False # analyze every word for word in msg.split(' '): # look for lc and os if not found_lc: for lc in supported_lc: if re.match(lc, word, re.IGNORECASE): found_lc = True req['lc'] = lc if not found_os: for os in supported_os: if re.match(os, word, re.IGNORECASE): found_os = True req['os'] = os req['type'] = 'links' # mirrors if not found_mirrors: if re.match("mirrors?", word, re.IGNORECASE): found_mirrors = True req['type'] = 'mirrors' if (found_lc and found_os) or (found_lc and found_mirrors): break return req def parse_request(self, account, msg): """Process the request received. Check if the user is not blacklisted and then check the body of the message to find out what is asking. :param: account (string) the account that did the request. :param: msg (string) the body of the message sent to us. :return: (string/None) the message to be sent to the user via the bot, or None if the user is blacklisted. """ bogus_request = False reply = '' status = '' req = None self.log.debug("Parsing request") try: if self._is_blacklisted(str(account)): self.log.info('blacklist; none; none') bogus_request = True # first let's find out how many words are in the message # request shouldn't be longer than 3 words, but just in case words = re.split('\s+', msg.strip()) if len(words) > self.max_words: bogus_request = True self.log.info("Message way too long") self.log.info('invalid; none; none') reply = self._get_msg('message_error', 'en') if not bogus_request: self.log.debug("Request seems legit, let's parse it") # let's try to guess what the user is asking req = self._parse_text(str(msg)) if req['type'] == 'help': self.log.info('help; none; %s' % req['lc']) reply = self._get_msg('help', 'en') elif req['type'] == 'mirrors': self.log.info('mirrors; none; %s' % req['lc']) reply = self._get_msg('mirrors', 'en') try: with open(self.mirrors, "r") as list_mirrors: mirrors = list_mirrors.read() reply = reply % mirrors except IOError as e: reply = self._get_msg('mirrors_unavailable', 'en') elif req['type'] == 'links': self.log.info('links; %s; %s' % (req['os'], req['lc'])) links = self.core.get_links( "XMPP", req['os'], req['lc'] ) reply = self._get_msg('links', 'en') reply = reply % (OS[req['os']], links) except (core.ConfigError, core.InternalError) as e: # if core failes, send the user an error message, but keep going self.log.error("Something went wrong internally: %s" % str(e)) reply = self._get_msg('internal_error', req['lc']) finally: return reply
"""Tests for the Formatters.""" import warnings from math import pi try: import numpy except: numpy = None import nose.tools as nt from IPython import get_ipython from traitlets.config import Config from IPython.core.formatters import ( PlainTextFormatter, HTMLFormatter, PDFFormatter, _mod_name_key, DisplayFormatter, JSONFormatter, ) from IPython.utils.io import capture_output class A(object): def __repr__(self): return 'A()' class B(A): def __repr__(self): return 'B()' class C: pass class BadRepr(object): def __repr__(self): raise ValueError("bad repr") class BadPretty(object): _repr_pretty_ = None class GoodPretty(object): def _repr_pretty_(self, pp, cycle): pp.text('foo') def __repr__(self): return 'GoodPretty()' def foo_printer(obj, pp, cycle): pp.text('foo') def test_pretty(): f = PlainTextFormatter() f.for_type(A, foo_printer) nt.assert_equal(f(A()), 'foo') nt.assert_equal(f(B()), 'B()') nt.assert_equal(f(GoodPretty()), 'foo') # Just don't raise an exception for the following: f(BadPretty()) f.pprint = False nt.assert_equal(f(A()), 'A()') nt.assert_equal(f(B()), 'B()') nt.assert_equal(f(GoodPretty()), 'GoodPretty()') def test_deferred(): f = PlainTextFormatter() def test_precision(): """test various values for float_precision.""" f = PlainTextFormatter() nt.assert_equal(f(pi), repr(pi)) f.float_precision = 0 if numpy: po = numpy.get_printoptions() nt.assert_equal(po['precision'], 0) nt.assert_equal(f(pi), '3') f.float_precision = 2 if numpy: po = numpy.get_printoptions() nt.assert_equal(po['precision'], 2) nt.assert_equal(f(pi), '3.14') f.float_precision = '%g' if numpy: po = numpy.get_printoptions() nt.assert_equal(po['precision'], 2) nt.assert_equal(f(pi), '3.14159') f.float_precision = '%e' nt.assert_equal(f(pi), '3.141593e+00') f.float_precision = '' if numpy: po = numpy.get_printoptions() nt.assert_equal(po['precision'], 8) nt.assert_equal(f(pi), repr(pi)) def test_bad_precision(): """test various invalid values for float_precision.""" f = PlainTextFormatter() def set_fp(p): f.float_precision=p nt.assert_raises(ValueError, set_fp, '%') nt.assert_raises(ValueError, set_fp, '%.3f%i') nt.assert_raises(ValueError, set_fp, 'foo') nt.assert_raises(ValueError, set_fp, -1) def test_for_type(): f = PlainTextFormatter() # initial return, None nt.assert_is(f.for_type(C, foo_printer), None) # no func queries nt.assert_is(f.for_type(C), foo_printer) # shouldn't change anything nt.assert_is(f.for_type(C), foo_printer) # None should do the same nt.assert_is(f.for_type(C, None), foo_printer) nt.assert_is(f.for_type(C, None), foo_printer) def test_for_type_string(): f = PlainTextFormatter() type_str = '%s.%s' % (C.__module__, 'C') # initial return, None nt.assert_is(f.for_type(type_str, foo_printer), None) # no func queries nt.assert_is(f.for_type(type_str), foo_printer) nt.assert_in(_mod_name_key(C), f.deferred_printers) nt.assert_is(f.for_type(C), foo_printer) nt.assert_not_in(_mod_name_key(C), f.deferred_printers) nt.assert_in(C, f.type_printers) def test_for_type_by_name(): f = PlainTextFormatter() mod = C.__module__ # initial return, None nt.assert_is(f.for_type_by_name(mod, 'C', foo_printer), None) # no func queries nt.assert_is(f.for_type_by_name(mod, 'C'), foo_printer) # shouldn't change anything nt.assert_is(f.for_type_by_name(mod, 'C'), foo_printer) # None should do the same nt.assert_is(f.for_type_by_name(mod, 'C', None), foo_printer) nt.assert_is(f.for_type_by_name(mod, 'C', None), foo_printer) def test_lookup(): f = PlainTextFormatter() f.for_type(C, foo_printer) nt.assert_is(f.lookup(C()), foo_printer) with nt.assert_raises(KeyError): f.lookup(A()) def test_lookup_string(): f = PlainTextFormatter() type_str = '%s.%s' % (C.__module__, 'C') f.for_type(type_str, foo_printer) nt.assert_is(f.lookup(C()), foo_printer) # should move from deferred to imported dict nt.assert_not_in(_mod_name_key(C), f.deferred_printers) nt.assert_in(C, f.type_printers) def test_lookup_by_type(): f = PlainTextFormatter() f.for_type(C, foo_printer) nt.assert_is(f.lookup_by_type(C), foo_printer) with nt.assert_raises(KeyError): f.lookup_by_type(A) def test_lookup_by_type_string(): f = PlainTextFormatter() type_str = '%s.%s' % (C.__module__, 'C') f.for_type(type_str, foo_printer) # verify insertion nt.assert_in(_mod_name_key(C), f.deferred_printers) nt.assert_not_in(C, f.type_printers) nt.assert_is(f.lookup_by_type(type_str), foo_printer) # lookup by string doesn't cause import nt.assert_in(_mod_name_key(C), f.deferred_printers) nt.assert_not_in(C, f.type_printers) nt.assert_is(f.lookup_by_type(C), foo_printer) # should move from deferred to imported dict nt.assert_not_in(_mod_name_key(C), f.deferred_printers) nt.assert_in(C, f.type_printers) def test_in_formatter(): f = PlainTextFormatter() f.for_type(C, foo_printer) type_str = '%s.%s' % (C.__module__, 'C') nt.assert_in(C, f) nt.assert_in(type_str, f) def test_string_in_formatter(): f = PlainTextFormatter() type_str = '%s.%s' % (C.__module__, 'C') f.for_type(type_str, foo_printer) nt.assert_in(type_str, f) nt.assert_in(C, f) def test_pop(): f = PlainTextFormatter() f.for_type(C, foo_printer) nt.assert_is(f.lookup_by_type(C), foo_printer) nt.assert_is(f.pop(C, None), foo_printer) f.for_type(C, foo_printer) nt.assert_is(f.pop(C), foo_printer) with nt.assert_raises(KeyError): f.lookup_by_type(C) with nt.assert_raises(KeyError): f.pop(C) with nt.assert_raises(KeyError): f.pop(A) nt.assert_is(f.pop(A, None), None) def test_pop_string(): f = PlainTextFormatter() type_str = '%s.%s' % (C.__module__, 'C') with nt.assert_raises(KeyError): f.pop(type_str) f.for_type(type_str, foo_printer) f.pop(type_str) with nt.assert_raises(KeyError): f.lookup_by_type(C) with nt.assert_raises(KeyError): f.pop(type_str) f.for_type(C, foo_printer) nt.assert_is(f.pop(type_str, None), foo_printer) with nt.assert_raises(KeyError): f.lookup_by_type(C) with nt.assert_raises(KeyError): f.pop(type_str) nt.assert_is(f.pop(type_str, None), None) def test_error_method(): f = HTMLFormatter() class BadHTML(object): def _repr_html_(self): raise ValueError("Bad HTML") bad = BadHTML() with capture_output() as captured: result = f(bad) nt.assert_is(result, None) nt.assert_in("Traceback", captured.stdout) nt.assert_in("Bad HTML", captured.stdout) nt.assert_in("_repr_html_", captured.stdout) def test_nowarn_notimplemented(): f = HTMLFormatter() class HTMLNotImplemented(object): def _repr_html_(self): raise NotImplementedError h = HTMLNotImplemented() with capture_output() as captured: result = f(h) nt.assert_is(result, None) nt.assert_equal("", captured.stderr) nt.assert_equal("", captured.stdout) def test_warn_error_for_type(): f = HTMLFormatter() f.for_type(int, lambda i: name_error) with capture_output() as captured: result = f(5) nt.assert_is(result, None) nt.assert_in("Traceback", captured.stdout) nt.assert_in("NameError", captured.stdout) nt.assert_in("name_error", captured.stdout) def test_error_pretty_method(): f = PlainTextFormatter() class BadPretty(object): def _repr_pretty_(self): return "hello" bad = BadPretty() with capture_output() as captured: result = f(bad) nt.assert_is(result, None) nt.assert_in("Traceback", captured.stdout) nt.assert_in("_repr_pretty_", captured.stdout) nt.assert_in("given", captured.stdout) nt.assert_in("argument", captured.stdout) def test_bad_repr_traceback(): f = PlainTextFormatter() bad = BadRepr() with capture_output() as captured: result = f(bad) # catches error, returns None nt.assert_is(result, None) nt.assert_in("Traceback", captured.stdout) nt.assert_in("__repr__", captured.stdout) nt.assert_in("ValueError", captured.stdout) class MakePDF(object): def _repr_pdf_(self): return 'PDF' def test_pdf_formatter(): pdf = MakePDF() f = PDFFormatter() nt.assert_equal(f(pdf), 'PDF') def test_print_method_bound(): f = HTMLFormatter() class MyHTML(object): def _repr_html_(self): return "hello" with capture_output() as captured: result = f(MyHTML) nt.assert_is(result, None) nt.assert_not_in("FormatterWarning", captured.stderr) with capture_output() as captured: result = f(MyHTML()) nt.assert_equal(result, "hello") nt.assert_equal(captured.stderr, "") def test_print_method_weird(): class TextMagicHat(object): def __getattr__(self, key): return key f = HTMLFormatter() text_hat = TextMagicHat() nt.assert_equal(text_hat._repr_html_, '_repr_html_') with capture_output() as captured: result = f(text_hat) nt.assert_is(result, None) nt.assert_not_in("FormatterWarning", captured.stderr) class CallableMagicHat(object): def __getattr__(self, key): return lambda : key call_hat = CallableMagicHat() with capture_output() as captured: result = f(call_hat) nt.assert_equal(result, None) class BadReprArgs(object): def _repr_html_(self, extra, args): return "html" bad = BadReprArgs() with capture_output() as captured: result = f(bad) nt.assert_is(result, None) nt.assert_not_in("FormatterWarning", captured.stderr) def test_format_config(): """config objects don't pretend to support fancy reprs with lazy attrs""" f = HTMLFormatter() cfg = Config() with capture_output() as captured: result = f(cfg) nt.assert_is(result, None) nt.assert_equal(captured.stderr, "") with capture_output() as captured: result = f(Config) nt.assert_is(result, None) nt.assert_equal(captured.stderr, "") def test_pretty_max_seq_length(): f = PlainTextFormatter(max_seq_length=1) lis = list(range(3)) text = f(lis) nt.assert_equal(text, '[0, ...]') f.max_seq_length = 0 text = f(lis) nt.assert_equal(text, '[0, 1, 2]') text = f(list(range(1024))) lines = text.splitlines() nt.assert_equal(len(lines), 1024) def test_ipython_display_formatter(): """Objects with _ipython_display_ defined bypass other formatters""" f = get_ipython().display_formatter catcher = [] class SelfDisplaying(object): def _ipython_display_(self): catcher.append(self) class NotSelfDisplaying(object): def __repr__(self): return "NotSelfDisplaying" def _ipython_display_(self): raise NotImplementedError save_enabled = f.ipython_display_formatter.enabled f.ipython_display_formatter.enabled = True yes = SelfDisplaying() no = NotSelfDisplaying() d, md = f.format(no) nt.assert_equal(d, {'text/plain': repr(no)}) nt.assert_equal(md, {}) nt.assert_equal(catcher, []) d, md = f.format(yes) nt.assert_equal(d, {}) nt.assert_equal(md, {}) nt.assert_equal(catcher, [yes]) f.ipython_display_formatter.enabled = save_enabled def test_json_as_string_deprecated(): class JSONString(object): def _repr_json_(self): return '{}' f = JSONFormatter() with warnings.catch_warnings(record=True) as w: d = f(JSONString()) nt.assert_equal(d, {}) nt.assert_equal(len(w), 1) def test_repr_mime(): class HasReprMime(object): def _repr_mimebundle_(self, include=None, exclude=None): return { 'application/json+test.v2': { 'x': 'y' }, 'plain/text' : '<HasReprMime>', 'image/png' : 'i-overwrite' } def _repr_png_(self): return 'should-be-overwritten' def _repr_html_(self): return '<b>hi!</b>' f = get_ipython().display_formatter html_f = f.formatters['text/html'] save_enabled = html_f.enabled html_f.enabled = True obj = HasReprMime() d, md = f.format(obj) html_f.enabled = save_enabled nt.assert_equal(sorted(d), ['application/json+test.v2', 'image/png', 'plain/text', 'text/html', 'text/plain']) nt.assert_equal(md, {}) d, md = f.format(obj, include={'image/png'}) nt.assert_equal(list(d.keys()), ['image/png'], 'Include should filter out even things from repr_mimebundle') nt.assert_equal(d['image/png'], 'i-overwrite', '_repr_mimebundle_ take precedence') def test_pass_correct_include_exclude(): class Tester(object): def __init__(self, include=None, exclude=None): self.include = include self.exclude = exclude def _repr_mimebundle_(self, include, exclude, **kwargs): if include and (include != self.include): raise ValueError('include got modified: display() may be broken.') if exclude and (exclude != self.exclude): raise ValueError('exclude got modified: display() may be broken.') return None include = {'a', 'b', 'c'} exclude = {'c', 'e' , 'f'} f = get_ipython().display_formatter f.format(Tester(include=include, exclude=exclude), include=include, exclude=exclude) f.format(Tester(exclude=exclude), exclude=exclude) f.format(Tester(include=include), include=include) def test_repr_mime_meta(): class HasReprMimeMeta(object): def _repr_mimebundle_(self, include=None, exclude=None): data = { 'image/png': 'base64-image-data', } metadata = { 'image/png': { 'width': 5, 'height': 10, } } return (data, metadata) f = get_ipython().display_formatter obj = HasReprMimeMeta() d, md = f.format(obj) nt.assert_equal(sorted(d), ['image/png', 'text/plain']) nt.assert_equal(md, { 'image/png': { 'width': 5, 'height': 10, } }) def test_repr_mime_failure(): class BadReprMime(object): def _repr_mimebundle_(self, include=None, exclude=None): raise RuntimeError f = get_ipython().display_formatter obj = BadReprMime() d, md = f.format(obj) nt.assert_in('text/plain', d)
import socket import json from django.contrib.auth.models import Group from django.core.urlresolvers import reverse from rest_framework.test import APIClient from rest_framework import status from rest_framework.test import APITestCase from hs_core.hydroshare import users from hs_core.hydroshare import resource class HSRESTTestCase(APITestCase): def setUp(self): self.hostname = socket.gethostname() self.resource_url = "http://example.com/resource/{res_id}/" self.maxDiff = None self.client = APIClient() self.group, _ = Group.objects.get_or_create(name='Resource Author') # create a user self.user = users.create_account( 'test_user@email.com', username='testuser', first_name='some_first_name', last_name='some_last_name', superuser=False) self.client.force_authenticate(user=self.user) self.resources_to_delete = [] def tearDown(self): for r in self.resources_to_delete: resource.delete_resource(r) self.user.delete() def getResourceBag(self, res_id, exhaust_stream=True): """Get resource bag from iRODS, following redirects. :param res_id: ID of resource whose bag should be fetched :param exhaust_stream: If True, the response returned will have its stream_content exhausted. This prevents an error that causes the Docker container to exit when tests are run with an external web server. :return: Django test client response object """ url = "/hydroshare/hsapi/resource/{res_id}".format(res_id=res_id) return self._get_file_irods(url, exhaust_stream) def getDownloadTaskStatus(self, task_id): """Check download celery task status. :param task_id: ID of download celery task :return: Django test client response object """ url = reverse('get_task_status', kwargs={'task_id': task_id}) return self.client.get(url, follow=True) def getResourceFile(self, res_id, file_name, exhaust_stream=True): """Get resource file from iRODS, following redirects :param res_id: ID of resource whose resource file should be fetched :param file_name: Name of the file to fetch (just the filename, not the full path) :param exhaust_stream: If True, the response returned will have its stream_content exhausted. This prevents an error that causes the Docker container to exit when tests are run with an external web server. :return: Django test client response object """ url = "/hydroshare/hsapi/resource/{res_id}/files/{file_name}".format(res_id=res_id, file_name=file_name) return self._get_file_irods(url, exhaust_stream) def _get_file_irods(self, url, exhaust_stream=True): response = self.client.get(url, follow=True) self.assertEqual(response.status_code, status.HTTP_200_OK) # Exhaust the file stream so that WSGI doesn't get upset (this causes the Docker container to exit) if exhaust_stream and hasattr(response, 'streaming_content'): for l in response.streaming_content: pass return response def getScienceMetadata(self, res_id, exhaust_stream=True): """Get sciencematadata.xml from iRODS, following redirects :param res_id: ID of resource whose science metadata should be fetched :param exhaust_stream: If True, the response returned will have its stream_content exhausted. This prevents an error that causes the Docker container to exit when tests are run with an external web server. :return: Django test client response object """ url = "/hydroshare/hsapi/scimeta/{res_id}/".format(res_id=res_id) response = self._get_file_irods(url, exhaust_stream) self.assertEqual(response['Content-Type'], 'application/xml') self.assertGreater(int(response['Content-Length']), 0) return response class SciMetaTestCase(HSRESTTestCase): NS = {'rdf': "http://www.w3.org/1999/02/22-rdf-syntax-ns#", 'rdfs1': "http://www.w3.org/2001/01/rdf-schema#", 'dc': "http://purl.org/dc/elements/1.1/", 'dcterms': "http://purl.org/dc/terms/", 'hsterms': "http://hydroshare.org/terms/"} RESOURCE_URL_TEMPLATE = "http://example.com/resource/{0}" RESOURCE_METADATA = 'resourcemetadata.xml' RESOURCE_METADATA_OLD = 'resourcemetadata_old.xml' RESOURCE_METADATA_UPDATED = 'resourcemetadata_updated.xml' def getTitle(self, scimeta, should_exist=True): """ Get title from parsed ElementTree representation of science metadata. :param scimeta: ElementTree representing science metadata :param should_exist: If True, the abstract is expected to exist in the DOM. :return: String representing title text, if should_exist == True, else None. """ title = scimeta.xpath('/rdf:RDF/rdf:Description[1]/dc:title', namespaces=self.NS) if should_exist: self.assertEqual(len(title), 1) return title[0].text else: self.assertEqual(len(title), 0) return None def getAbstract(self, scimeta, should_exist=True): """ Get abstract from parsed ElementTree representation of science metadata. :param scimeta: ElementTree representing science metadata :param should_exist: If True, the abstract is expected to exist in the DOM. :return: String representing abstract text, if should_exist == True, else None. """ abstract = scimeta.xpath('/rdf:RDF/rdf:Description[1]/dc:description/rdf:Description/dcterms:abstract', namespaces=self.NS) if should_exist: self.assertEqual(len(abstract), 1) return abstract[0].text else: self.assertEqual(len(abstract), 0) return None def getKeywords(self, scimeta): """ Get keywords from parsed ElementTree representation of science metadata. :param scimeta: ElementTree representing science metadata :return: Tuple of Strings representing keyword metadata elements """ keywords = scimeta.xpath('/rdf:RDF/rdf:Description[1]/dc:subject', namespaces=self.NS) return tuple(k.text for k in keywords) def updateScimetaResourceID(self, scimeta, new_id): """ Update resource ID of the science metadata to http://example.com/resource/$new_id :param scimeta: ElementTree representing science metadata :param new_id: String representing the new ID of the resource. :return: ElementTree representing science metadata """ desc = scimeta.xpath('/rdf:RDF/rdf:Description[1]', namespaces=self.NS)[0] desc.set('{http://www.w3.org/1999/02/22-rdf-syntax-ns#}about', self.RESOURCE_URL_TEMPLATE.format(new_id)) return scimeta def updateScimeta(self, pk, scimeta_path, should_succeed=True): """ Use the test client to perform a PUT /scimeta using scimeta_path as the resourcemetadata.xml :param pk: The ID of the resource whose :param scimeta_path: Path to a file named resourcemetadata.xml :param should_succeed: If True, will check for HTTP 202 status in the response, else will check for HTTP 400. :return: Test client HTTP response. """ params = {'file': (self.RESOURCE_METADATA, open(scimeta_path), 'application/xml')} url = "/hydroshare/hsapi/scimeta/{pid}/".format(pid=pk) response = self.client.put(url, params) if should_succeed: self.assertEqual(response.status_code, status.HTTP_202_ACCEPTED, msg=str(json.loads(response.content))) else: self.assertEqual(response.status_code, status.HTTP_400_BAD_REQUEST, msg=str(json.loads(response.content))) return response class ModelInstanceSciMetaTestCase(SciMetaTestCase): MOD_OUT_PATH = ('/rdf:RDF/rdf:Description[1]/hsterms:ModelOutput/' 'rdf:Description/hsterms:includesModelOutput') EXECUTED_BY_PATH = ('/rdf:RDF/rdf:Description[1]/hsterms:ExecutedBY/' 'rdf:Description') EXECUTED_BY_NAME_PATH = "{exec_by_path}/hsterms:modelProgramName".format(exec_by_path=EXECUTED_BY_PATH) EXECUTED_BY_ID_PATH = "{exec_by_path}/hsterms:modelProgramIdentifier".format(exec_by_path=EXECUTED_BY_PATH) def setUp(self): super(ModelInstanceSciMetaTestCase, self).setUp() self.rtype_prog = 'ModelProgramResource' self.title_prog = 'Some program' res = resource.create_resource(self.rtype_prog, self.user, self.title_prog) self.pid_prog = res.short_id self.resources_to_delete.append(self.pid_prog) def updateExecutedBy(self, scimeta, name, id): """ Update ExecutedBy :param scimeta: ElementTree representing science metadata :param name: String representing the title of the program resource. :param id: String representing the ID of the program resource. :return: ElementTree representing science metadata """ name_elem = scimeta.xpath(self.EXECUTED_BY_NAME_PATH, namespaces=self.NS)[0] name_elem.text = name id_elem = scimeta.xpath(self.EXECUTED_BY_ID_PATH, namespaces=self.NS)[0] id_elem.text = self.RESOURCE_URL_TEMPLATE.format(id) + '/' return scimeta class ResMapTestCase(HSRESTTestCase): NS = {'rdf': "http://www.w3.org/1999/02/22-rdf-syntax-ns#", 'rdfs1': "http://www.w3.org/2001/01/rdf-schema#", 'dc': "http://purl.org/dc/elements/1.1/", 'dcterms': "http://purl.org/dc/terms/", 'hsterms': "http://hydroshare.org/terms/"} RESOURCE_URL_TEMPLATE = "http://example.com/resource/{0}" RESOURCE_METADATA = 'resourcemap.xml' RESOURCE_METADATA_OLD = 'resourcemap_old.xml' RESOURCE_METADATA_UPDATED = 'resourcemap_updated.xml'
# Copyright 2012 the V8 project authors. All rights reserved. # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are # met: # # * Redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer. # * Redistributions in binary form must reproduce the above # copyright notice, this list of conditions and the following # disclaimer in the documentation and/or other materials provided # with the distribution. # * Neither the name of Google Inc. nor the names of its # contributors may be used to endorse or promote products derived # from this software without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS # "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT # LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR # A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT # OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, # SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT # LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, # DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY # THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT # (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE # OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. """Top-level presubmit script for V8. See http://dev.chromium.org/developers/how-tos/depottools/presubmit-scripts for more details about the presubmit API built into gcl. """ import sys _EXCLUDED_PATHS = ( r"^test[\\\/].*", r"^testing[\\\/].*", r"^third_party[\\\/].*", r"^tools[\\\/].*", ) # Regular expression that matches code only used for test binaries # (best effort). _TEST_CODE_EXCLUDED_PATHS = ( r'.+-unittest\.cc', # Has a method VisitForTest(). r'src[\\\/]compiler[\\\/]ast-graph-builder\.cc', # Test extension. r'src[\\\/]extensions[\\\/]gc-extension\.cc', ) _TEST_ONLY_WARNING = ( 'You might be calling functions intended only for testing from\n' 'production code. It is OK to ignore this warning if you know what\n' 'you are doing, as the heuristics used to detect the situation are\n' 'not perfect. The commit queue will not block on this warning.') def _V8PresubmitChecks(input_api, output_api): """Runs the V8 presubmit checks.""" import sys sys.path.append(input_api.os_path.join( input_api.PresubmitLocalPath(), 'tools')) from presubmit import CppLintProcessor from presubmit import SourceProcessor from presubmit import CheckRuntimeVsNativesNameClashes from presubmit import CheckExternalReferenceRegistration results = [] if not CppLintProcessor().Run(input_api.PresubmitLocalPath()): results.append(output_api.PresubmitError("C++ lint check failed")) if not SourceProcessor().Run(input_api.PresubmitLocalPath()): results.append(output_api.PresubmitError( "Copyright header, trailing whitespaces and two empty lines " \ "between declarations check failed")) if not CheckRuntimeVsNativesNameClashes(input_api.PresubmitLocalPath()): results.append(output_api.PresubmitError( "Runtime/natives name clash check failed")) if not CheckExternalReferenceRegistration(input_api.PresubmitLocalPath()): results.append(output_api.PresubmitError( "External references registration check failed")) return results def _CheckUnwantedDependencies(input_api, output_api): """Runs checkdeps on #include statements added in this change. Breaking - rules is an error, breaking ! rules is a warning. """ # We need to wait until we have an input_api object and use this # roundabout construct to import checkdeps because this file is # eval-ed and thus doesn't have __file__. original_sys_path = sys.path try: sys.path = sys.path + [input_api.os_path.join( input_api.PresubmitLocalPath(), 'buildtools', 'checkdeps')] import checkdeps from cpp_checker import CppChecker from rules import Rule finally: # Restore sys.path to what it was before. sys.path = original_sys_path added_includes = [] for f in input_api.AffectedFiles(): if not CppChecker.IsCppFile(f.LocalPath()): continue changed_lines = [line for line_num, line in f.ChangedContents()] added_includes.append([f.LocalPath(), changed_lines]) deps_checker = checkdeps.DepsChecker(input_api.PresubmitLocalPath()) error_descriptions = [] warning_descriptions = [] for path, rule_type, rule_description in deps_checker.CheckAddedCppIncludes( added_includes): description_with_path = '%s\n %s' % (path, rule_description) if rule_type == Rule.DISALLOW: error_descriptions.append(description_with_path) else: warning_descriptions.append(description_with_path) results = [] if error_descriptions: results.append(output_api.PresubmitError( 'You added one or more #includes that violate checkdeps rules.', error_descriptions)) if warning_descriptions: results.append(output_api.PresubmitPromptOrNotify( 'You added one or more #includes of files that are temporarily\n' 'allowed but being removed. Can you avoid introducing the\n' '#include? See relevant DEPS file(s) for details and contacts.', warning_descriptions)) return results def _CheckNoProductionCodeUsingTestOnlyFunctions(input_api, output_api): """Attempts to prevent use of functions intended only for testing in non-testing code. For now this is just a best-effort implementation that ignores header files and may have some false positives. A better implementation would probably need a proper C++ parser. """ # We only scan .cc files, as the declaration of for-testing functions in # header files are hard to distinguish from calls to such functions without a # proper C++ parser. file_inclusion_pattern = r'.+\.cc' base_function_pattern = r'[ :]test::[^\s]+|ForTest(ing)?|for_test(ing)?' inclusion_pattern = input_api.re.compile(r'(%s)\s*\(' % base_function_pattern) comment_pattern = input_api.re.compile(r'//.*(%s)' % base_function_pattern) exclusion_pattern = input_api.re.compile( r'::[A-Za-z0-9_]+(%s)|(%s)[^;]+\{' % ( base_function_pattern, base_function_pattern)) def FilterFile(affected_file): black_list = (_EXCLUDED_PATHS + _TEST_CODE_EXCLUDED_PATHS + input_api.DEFAULT_BLACK_LIST) return input_api.FilterSourceFile( affected_file, white_list=(file_inclusion_pattern, ), black_list=black_list) problems = [] for f in input_api.AffectedSourceFiles(FilterFile): local_path = f.LocalPath() for line_number, line in f.ChangedContents(): if (inclusion_pattern.search(line) and not comment_pattern.search(line) and not exclusion_pattern.search(line)): problems.append( '%s:%d\n %s' % (local_path, line_number, line.strip())) if problems: return [output_api.PresubmitPromptOrNotify(_TEST_ONLY_WARNING, problems)] else: return [] def _CommonChecks(input_api, output_api): """Checks common to both upload and commit.""" results = [] results.extend(input_api.canned_checks.CheckOwners( input_api, output_api, source_file_filter=None)) results.extend(input_api.canned_checks.CheckPatchFormatted( input_api, output_api)) results.extend(_V8PresubmitChecks(input_api, output_api)) results.extend(_CheckUnwantedDependencies(input_api, output_api)) results.extend( _CheckNoProductionCodeUsingTestOnlyFunctions(input_api, output_api)) return results def _SkipTreeCheck(input_api, output_api): """Check the env var whether we want to skip tree check. Only skip if include/v8-version.h has been updated.""" src_version = 'include/v8-version.h' FilterFile = lambda file: file.LocalPath() == src_version if not input_api.AffectedSourceFiles( lambda file: file.LocalPath() == src_version): return False return input_api.environ.get('PRESUBMIT_TREE_CHECK') == 'skip' def _CheckChangeLogFlag(input_api, output_api): """Checks usage of LOG= flag in the commit message.""" results = [] if input_api.change.BUG and not 'LOG' in input_api.change.tags: results.append(output_api.PresubmitError( 'An issue reference (BUG=) requires a change log flag (LOG=). ' 'Use LOG=Y for including this commit message in the change log. ' 'Use LOG=N or leave blank otherwise.')) return results def CheckChangeOnUpload(input_api, output_api): results = [] results.extend(_CommonChecks(input_api, output_api)) results.extend(_CheckChangeLogFlag(input_api, output_api)) return results def CheckChangeOnCommit(input_api, output_api): results = [] results.extend(_CommonChecks(input_api, output_api)) results.extend(_CheckChangeLogFlag(input_api, output_api)) results.extend(input_api.canned_checks.CheckChangeHasDescription( input_api, output_api)) if not _SkipTreeCheck(input_api, output_api): results.extend(input_api.canned_checks.CheckTreeIsOpen( input_api, output_api, json_url='http://v8-status.appspot.com/current?format=json')) return results def GetPreferredTryMasters(project, change): return { 'tryserver.v8': { 'v8_linux_rel': set(['defaulttests']), 'v8_linux_dbg': set(['defaulttests']), 'v8_linux_nosnap_rel': set(['defaulttests']), 'v8_linux64_rel': set(['defaulttests']), 'v8_linux_arm_dbg': set(['defaulttests']), 'v8_linux_arm64_rel': set(['defaulttests']), 'v8_linux_layout_dbg': set(['defaulttests']), 'v8_linux_chromium_gn_rel': set(['defaulttests']), 'v8_mac_rel': set(['defaulttests']), 'v8_win_rel': set(['defaulttests']), 'v8_win64_compile_rel': set(['defaulttests']), }, }
from sympy import Abs, S, Symbol, symbols, I, Rational, PurePoly, Float from sympy.matrices import \ Matrix, MutableSparseMatrix, ImmutableSparseMatrix, SparseMatrix, eye, \ ones, zeros, ShapeError from sympy.utilities.pytest import raises def test_sparse_matrix(): def sparse_eye(n): return SparseMatrix.eye(n) def sparse_zeros(n): return SparseMatrix.zeros(n) # creation args raises(TypeError, lambda: SparseMatrix(1, 2)) a = SparseMatrix(( (1, 0), (0, 1) )) assert SparseMatrix(a) == a from sympy.matrices import MutableSparseMatrix, MutableDenseMatrix a = MutableSparseMatrix([]) b = MutableDenseMatrix([1, 2]) assert a.row_join(b) == b assert a.col_join(b) == b assert type(a.row_join(b)) == type(a) assert type(a.col_join(b)) == type(a) # make sure 0 x n matrices get stacked correctly sparse_matrices = [SparseMatrix.zeros(0, n) for n in range(4)] assert SparseMatrix.hstack(*sparse_matrices) == Matrix(0, 6, []) sparse_matrices = [SparseMatrix.zeros(n, 0) for n in range(4)] assert SparseMatrix.vstack(*sparse_matrices) == Matrix(6, 0, []) # test element assignment a = SparseMatrix(( (1, 0), (0, 1) )) a[3] = 4 assert a[1, 1] == 4 a[3] = 1 a[0, 0] = 2 assert a == SparseMatrix(( (2, 0), (0, 1) )) a[1, 0] = 5 assert a == SparseMatrix(( (2, 0), (5, 1) )) a[1, 1] = 0 assert a == SparseMatrix(( (2, 0), (5, 0) )) assert a._smat == {(0, 0): 2, (1, 0): 5} # test_multiplication a = SparseMatrix(( (1, 2), (3, 1), (0, 6), )) b = SparseMatrix(( (1, 2), (3, 0), )) c = a*b assert c[0, 0] == 7 assert c[0, 1] == 2 assert c[1, 0] == 6 assert c[1, 1] == 6 assert c[2, 0] == 18 assert c[2, 1] == 0 try: eval('c = a @ b') except SyntaxError: pass else: assert c[0, 0] == 7 assert c[0, 1] == 2 assert c[1, 0] == 6 assert c[1, 1] == 6 assert c[2, 0] == 18 assert c[2, 1] == 0 x = Symbol("x") c = b * Symbol("x") assert isinstance(c, SparseMatrix) assert c[0, 0] == x assert c[0, 1] == 2*x assert c[1, 0] == 3*x assert c[1, 1] == 0 c = 5 * b assert isinstance(c, SparseMatrix) assert c[0, 0] == 5 assert c[0, 1] == 2*5 assert c[1, 0] == 3*5 assert c[1, 1] == 0 #test_power A = SparseMatrix([[2, 3], [4, 5]]) assert (A**5)[:] == [6140, 8097, 10796, 14237] A = SparseMatrix([[2, 1, 3], [4, 2, 4], [6, 12, 1]]) assert (A**3)[:] == [290, 262, 251, 448, 440, 368, 702, 954, 433] # test_creation x = Symbol("x") a = SparseMatrix([[x, 0], [0, 0]]) m = a assert m.cols == m.rows assert m.cols == 2 assert m[:] == [x, 0, 0, 0] b = SparseMatrix(2, 2, [x, 0, 0, 0]) m = b assert m.cols == m.rows assert m.cols == 2 assert m[:] == [x, 0, 0, 0] assert a == b S = sparse_eye(3) S.row_del(1) assert S == SparseMatrix([ [1, 0, 0], [0, 0, 1]]) S = sparse_eye(3) S.col_del(1) assert S == SparseMatrix([ [1, 0], [0, 0], [0, 1]]) S = SparseMatrix.eye(3) S[2, 1] = 2 S.col_swap(1, 0) assert S == SparseMatrix([ [0, 1, 0], [1, 0, 0], [2, 0, 1]]) a = SparseMatrix(1, 2, [1, 2]) b = a.copy() c = a.copy() assert a[0] == 1 a.row_del(0) assert a == SparseMatrix(0, 2, []) b.col_del(1) assert b == SparseMatrix(1, 1, [1]) assert SparseMatrix([[1, 2, 3], [1, 2], [1]]) == Matrix([ [1, 2, 3], [1, 2, 0], [1, 0, 0]]) assert SparseMatrix(4, 4, {(1, 1): sparse_eye(2)}) == Matrix([ [0, 0, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 0, 0, 0]]) raises(ValueError, lambda: SparseMatrix(1, 1, {(1, 1): 1})) assert SparseMatrix(1, 2, [1, 2]).tolist() == [[1, 2]] assert SparseMatrix(2, 2, [1, [2, 3]]).tolist() == [[1, 0], [2, 3]] raises(ValueError, lambda: SparseMatrix(2, 2, [1])) raises(ValueError, lambda: SparseMatrix(1, 1, [[1, 2]])) assert SparseMatrix([.1]).has(Float) # autosizing assert SparseMatrix(None, {(0, 1): 0}).shape == (0, 0) assert SparseMatrix(None, {(0, 1): 1}).shape == (1, 2) assert SparseMatrix(None, None, {(0, 1): 1}).shape == (1, 2) raises(ValueError, lambda: SparseMatrix(None, 1, [[1, 2]])) raises(ValueError, lambda: SparseMatrix(1, None, [[1, 2]])) raises(ValueError, lambda: SparseMatrix(3, 3, {(0, 0): ones(2), (1, 1): 2})) # test_determinant x, y = Symbol('x'), Symbol('y') assert SparseMatrix(1, 1, [0]).det() == 0 assert SparseMatrix([[1]]).det() == 1 assert SparseMatrix(((-3, 2), (8, -5))).det() == -1 assert SparseMatrix(((x, 1), (y, 2*y))).det() == 2*x*y - y assert SparseMatrix(( (1, 1, 1), (1, 2, 3), (1, 3, 6) )).det() == 1 assert SparseMatrix(( ( 3, -2, 0, 5), (-2, 1, -2, 2), ( 0, -2, 5, 0), ( 5, 0, 3, 4) )).det() == -289 assert SparseMatrix(( ( 1, 2, 3, 4), ( 5, 6, 7, 8), ( 9, 10, 11, 12), (13, 14, 15, 16) )).det() == 0 assert SparseMatrix(( (3, 2, 0, 0, 0), (0, 3, 2, 0, 0), (0, 0, 3, 2, 0), (0, 0, 0, 3, 2), (2, 0, 0, 0, 3) )).det() == 275 assert SparseMatrix(( (1, 0, 1, 2, 12), (2, 0, 1, 1, 4), (2, 1, 1, -1, 3), (3, 2, -1, 1, 8), (1, 1, 1, 0, 6) )).det() == -55 assert SparseMatrix(( (-5, 2, 3, 4, 5), ( 1, -4, 3, 4, 5), ( 1, 2, -3, 4, 5), ( 1, 2, 3, -2, 5), ( 1, 2, 3, 4, -1) )).det() == 11664 assert SparseMatrix(( ( 2, 7, -1, 3, 2), ( 0, 0, 1, 0, 1), (-2, 0, 7, 0, 2), (-3, -2, 4, 5, 3), ( 1, 0, 0, 0, 1) )).det() == 123 # test_slicing m0 = sparse_eye(4) assert m0[:3, :3] == sparse_eye(3) assert m0[2:4, 0:2] == sparse_zeros(2) m1 = SparseMatrix(3, 3, lambda i, j: i + j) assert m1[0, :] == SparseMatrix(1, 3, (0, 1, 2)) assert m1[1:3, 1] == SparseMatrix(2, 1, (2, 3)) m2 = SparseMatrix( [[0, 1, 2, 3], [4, 5, 6, 7], [8, 9, 10, 11], [12, 13, 14, 15]]) assert m2[:, -1] == SparseMatrix(4, 1, [3, 7, 11, 15]) assert m2[-2:, :] == SparseMatrix([[8, 9, 10, 11], [12, 13, 14, 15]]) assert SparseMatrix([[1, 2], [3, 4]])[[1], [1]] == Matrix([[4]]) # test_submatrix_assignment m = sparse_zeros(4) m[2:4, 2:4] = sparse_eye(2) assert m == SparseMatrix([(0, 0, 0, 0), (0, 0, 0, 0), (0, 0, 1, 0), (0, 0, 0, 1)]) assert len(m._smat) == 2 m[:2, :2] = sparse_eye(2) assert m == sparse_eye(4) m[:, 0] = SparseMatrix(4, 1, (1, 2, 3, 4)) assert m == SparseMatrix([(1, 0, 0, 0), (2, 1, 0, 0), (3, 0, 1, 0), (4, 0, 0, 1)]) m[:, :] = sparse_zeros(4) assert m == sparse_zeros(4) m[:, :] = ((1, 2, 3, 4), (5, 6, 7, 8), (9, 10, 11, 12), (13, 14, 15, 16)) assert m == SparseMatrix((( 1, 2, 3, 4), ( 5, 6, 7, 8), ( 9, 10, 11, 12), (13, 14, 15, 16))) m[:2, 0] = [0, 0] assert m == SparseMatrix((( 0, 2, 3, 4), ( 0, 6, 7, 8), ( 9, 10, 11, 12), (13, 14, 15, 16))) # test_reshape m0 = sparse_eye(3) assert m0.reshape(1, 9) == SparseMatrix(1, 9, (1, 0, 0, 0, 1, 0, 0, 0, 1)) m1 = SparseMatrix(3, 4, lambda i, j: i + j) assert m1.reshape(4, 3) == \ SparseMatrix([(0, 1, 2), (3, 1, 2), (3, 4, 2), (3, 4, 5)]) assert m1.reshape(2, 6) == \ SparseMatrix([(0, 1, 2, 3, 1, 2), (3, 4, 2, 3, 4, 5)]) # test_applyfunc m0 = sparse_eye(3) assert m0.applyfunc(lambda x: 2*x) == sparse_eye(3)*2 assert m0.applyfunc(lambda x: 0 ) == sparse_zeros(3) # test__eval_Abs assert abs(SparseMatrix(((x, 1), (y, 2*y)))) == SparseMatrix(((Abs(x), 1), (Abs(y), 2*Abs(y)))) # test_LUdecomp testmat = SparseMatrix([[ 0, 2, 5, 3], [ 3, 3, 7, 4], [ 8, 4, 0, 2], [-2, 6, 3, 4]]) L, U, p = testmat.LUdecomposition() assert L.is_lower assert U.is_upper assert (L*U).permute_rows(p, 'backward') - testmat == sparse_zeros(4) testmat = SparseMatrix([[ 6, -2, 7, 4], [ 0, 3, 6, 7], [ 1, -2, 7, 4], [-9, 2, 6, 3]]) L, U, p = testmat.LUdecomposition() assert L.is_lower assert U.is_upper assert (L*U).permute_rows(p, 'backward') - testmat == sparse_zeros(4) x, y, z = Symbol('x'), Symbol('y'), Symbol('z') M = Matrix(((1, x, 1), (2, y, 0), (y, 0, z))) L, U, p = M.LUdecomposition() assert L.is_lower assert U.is_upper assert (L*U).permute_rows(p, 'backward') - M == sparse_zeros(3) # test_LUsolve A = SparseMatrix([[2, 3, 5], [3, 6, 2], [8, 3, 6]]) x = SparseMatrix(3, 1, [3, 7, 5]) b = A*x soln = A.LUsolve(b) assert soln == x A = SparseMatrix([[0, -1, 2], [5, 10, 7], [8, 3, 4]]) x = SparseMatrix(3, 1, [-1, 2, 5]) b = A*x soln = A.LUsolve(b) assert soln == x # test_inverse A = sparse_eye(4) assert A.inv() == sparse_eye(4) assert A.inv(method="CH") == sparse_eye(4) assert A.inv(method="LDL") == sparse_eye(4) A = SparseMatrix([[2, 3, 5], [3, 6, 2], [7, 2, 6]]) Ainv = SparseMatrix(Matrix(A).inv()) assert A*Ainv == sparse_eye(3) assert A.inv(method="CH") == Ainv assert A.inv(method="LDL") == Ainv A = SparseMatrix([[2, 3, 5], [3, 6, 2], [5, 2, 6]]) Ainv = SparseMatrix(Matrix(A).inv()) assert A*Ainv == sparse_eye(3) assert A.inv(method="CH") == Ainv assert A.inv(method="LDL") == Ainv # test_cross v1 = Matrix(1, 3, [1, 2, 3]) v2 = Matrix(1, 3, [3, 4, 5]) assert v1.cross(v2) == Matrix(1, 3, [-2, 4, -2]) assert v1.norm(2)**2 == 14 # conjugate a = SparseMatrix(((1, 2 + I), (3, 4))) assert a.C == SparseMatrix([ [1, 2 - I], [3, 4] ]) # mul assert a*Matrix(2, 2, [1, 0, 0, 1]) == a assert a + Matrix(2, 2, [1, 1, 1, 1]) == SparseMatrix([ [2, 3 + I], [4, 5] ]) # col join assert a.col_join(sparse_eye(2)) == SparseMatrix([ [1, 2 + I], [3, 4], [1, 0], [0, 1] ]) # symmetric assert not a.is_symmetric(simplify=False) # test_cofactor assert sparse_eye(3) == sparse_eye(3).cofactor_matrix() test = SparseMatrix([[1, 3, 2], [2, 6, 3], [2, 3, 6]]) assert test.cofactor_matrix() == \ SparseMatrix([[27, -6, -6], [-12, 2, 3], [-3, 1, 0]]) test = SparseMatrix([[1, 2, 3], [4, 5, 6], [7, 8, 9]]) assert test.cofactor_matrix() == \ SparseMatrix([[-3, 6, -3], [6, -12, 6], [-3, 6, -3]]) # test_jacobian x = Symbol('x') y = Symbol('y') L = SparseMatrix(1, 2, [x**2*y, 2*y**2 + x*y]) syms = [x, y] assert L.jacobian(syms) == Matrix([[2*x*y, x**2], [y, 4*y + x]]) L = SparseMatrix(1, 2, [x, x**2*y**3]) assert L.jacobian(syms) == SparseMatrix([[1, 0], [2*x*y**3, x**2*3*y**2]]) # test_QR A = Matrix([[1, 2], [2, 3]]) Q, S = A.QRdecomposition() R = Rational assert Q == Matrix([ [ 5**R(-1, 2), (R(2)/5)*(R(1)/5)**R(-1, 2)], [2*5**R(-1, 2), (-R(1)/5)*(R(1)/5)**R(-1, 2)]]) assert S == Matrix([ [5**R(1, 2), 8*5**R(-1, 2)], [ 0, (R(1)/5)**R(1, 2)]]) assert Q*S == A assert Q.T * Q == sparse_eye(2) R = Rational # test nullspace # first test reduced row-ech form M = SparseMatrix([[5, 7, 2, 1], [1, 6, 2, -1]]) out, tmp = M.rref() assert out == Matrix([[1, 0, -R(2)/23, R(13)/23], [0, 1, R(8)/23, R(-6)/23]]) M = SparseMatrix([[ 1, 3, 0, 2, 6, 3, 1], [-2, -6, 0, -2, -8, 3, 1], [ 3, 9, 0, 0, 6, 6, 2], [-1, -3, 0, 1, 0, 9, 3]]) out, tmp = M.rref() assert out == Matrix([[1, 3, 0, 0, 2, 0, 0], [0, 0, 0, 1, 2, 0, 0], [0, 0, 0, 0, 0, 1, R(1)/3], [0, 0, 0, 0, 0, 0, 0]]) # now check the vectors basis = M.nullspace() assert basis[0] == Matrix([-3, 1, 0, 0, 0, 0, 0]) assert basis[1] == Matrix([0, 0, 1, 0, 0, 0, 0]) assert basis[2] == Matrix([-2, 0, 0, -2, 1, 0, 0]) assert basis[3] == Matrix([0, 0, 0, 0, 0, R(-1)/3, 1]) # test eigen x = Symbol('x') y = Symbol('y') sparse_eye3 = sparse_eye(3) assert sparse_eye3.charpoly(x) == PurePoly(((x - 1)**3)) assert sparse_eye3.charpoly(y) == PurePoly(((y - 1)**3)) # test values M = Matrix([( 0, 1, -1), ( 1, 1, 0), (-1, 0, 1)]) vals = M.eigenvals() assert sorted(vals.keys()) == [-1, 1, 2] R = Rational M = Matrix([[1, 0, 0], [0, 1, 0], [0, 0, 1]]) assert M.eigenvects() == [(1, 3, [ Matrix([1, 0, 0]), Matrix([0, 1, 0]), Matrix([0, 0, 1])])] M = Matrix([[5, 0, 2], [3, 2, 0], [0, 0, 1]]) assert M.eigenvects() == [(1, 1, [Matrix([R(-1)/2, R(3)/2, 1])]), (2, 1, [Matrix([0, 1, 0])]), (5, 1, [Matrix([1, 1, 0])])] assert M.zeros(3, 5) == SparseMatrix(3, 5, {}) A = SparseMatrix(10, 10, {(0, 0): 18, (0, 9): 12, (1, 4): 18, (2, 7): 16, (3, 9): 12, (4, 2): 19, (5, 7): 16, (6, 2): 12, (9, 7): 18}) assert A.row_list() == [(0, 0, 18), (0, 9, 12), (1, 4, 18), (2, 7, 16), (3, 9, 12), (4, 2, 19), (5, 7, 16), (6, 2, 12), (9, 7, 18)] assert A.col_list() == [(0, 0, 18), (4, 2, 19), (6, 2, 12), (1, 4, 18), (2, 7, 16), (5, 7, 16), (9, 7, 18), (0, 9, 12), (3, 9, 12)] assert SparseMatrix.eye(2).nnz() == 2 def test_transpose(): assert SparseMatrix(((1, 2), (3, 4))).transpose() == \ SparseMatrix(((1, 3), (2, 4))) def test_trace(): assert SparseMatrix(((1, 2), (3, 4))).trace() == 5 assert SparseMatrix(((0, 0), (0, 4))).trace() == 4 def test_CL_RL(): assert SparseMatrix(((1, 2), (3, 4))).row_list() == \ [(0, 0, 1), (0, 1, 2), (1, 0, 3), (1, 1, 4)] assert SparseMatrix(((1, 2), (3, 4))).col_list() == \ [(0, 0, 1), (1, 0, 3), (0, 1, 2), (1, 1, 4)] def test_add(): assert SparseMatrix(((1, 0), (0, 1))) + SparseMatrix(((0, 1), (1, 0))) == \ SparseMatrix(((1, 1), (1, 1))) a = SparseMatrix(100, 100, lambda i, j: int(j != 0 and i % j == 0)) b = SparseMatrix(100, 100, lambda i, j: int(i != 0 and j % i == 0)) assert (len(a._smat) + len(b._smat) - len((a + b)._smat) > 0) def test_errors(): raises(ValueError, lambda: SparseMatrix(1.4, 2, lambda i, j: 0)) raises(TypeError, lambda: SparseMatrix([1, 2, 3], [1, 2])) raises(ValueError, lambda: SparseMatrix([[1, 2], [3, 4]])[(1, 2, 3)]) raises(IndexError, lambda: SparseMatrix([[1, 2], [3, 4]])[5]) raises(ValueError, lambda: SparseMatrix([[1, 2], [3, 4]])[1, 2, 3]) raises(TypeError, lambda: SparseMatrix([[1, 2], [3, 4]]).copyin_list([0, 1], set([]))) raises( IndexError, lambda: SparseMatrix([[1, 2], [3, 4]])[1, 2]) raises(TypeError, lambda: SparseMatrix([1, 2, 3]).cross(1)) raises(IndexError, lambda: SparseMatrix(1, 2, [1, 2])[3]) raises(ShapeError, lambda: SparseMatrix(1, 2, [1, 2]) + SparseMatrix(2, 1, [2, 1])) def test_len(): assert not SparseMatrix() assert SparseMatrix() == SparseMatrix([]) assert SparseMatrix() == SparseMatrix([[]]) def test_sparse_zeros_sparse_eye(): assert SparseMatrix.eye(3) == eye(3, cls=SparseMatrix) assert len(SparseMatrix.eye(3)._smat) == 3 assert SparseMatrix.zeros(3) == zeros(3, cls=SparseMatrix) assert len(SparseMatrix.zeros(3)._smat) == 0 def test_copyin(): s = SparseMatrix(3, 3, {}) s[1, 0] = 1 assert s[:, 0] == SparseMatrix(Matrix([0, 1, 0])) assert s[3] == 1 assert s[3: 4] == [1] s[1, 1] = 42 assert s[1, 1] == 42 assert s[1, 1:] == SparseMatrix([[42, 0]]) s[1, 1:] = Matrix([[5, 6]]) assert s[1, :] == SparseMatrix([[1, 5, 6]]) s[1, 1:] = [[42, 43]] assert s[1, :] == SparseMatrix([[1, 42, 43]]) s[0, 0] = 17 assert s[:, :1] == SparseMatrix([17, 1, 0]) s[0, 0] = [1, 1, 1] assert s[:, 0] == SparseMatrix([1, 1, 1]) s[0, 0] = Matrix([1, 1, 1]) assert s[:, 0] == SparseMatrix([1, 1, 1]) s[0, 0] = SparseMatrix([1, 1, 1]) assert s[:, 0] == SparseMatrix([1, 1, 1]) def test_sparse_solve(): from sympy.matrices import SparseMatrix A = SparseMatrix(((25, 15, -5), (15, 18, 0), (-5, 0, 11))) assert A.cholesky() == Matrix([ [ 5, 0, 0], [ 3, 3, 0], [-1, 1, 3]]) assert A.cholesky() * A.cholesky().T == Matrix([ [25, 15, -5], [15, 18, 0], [-5, 0, 11]]) A = SparseMatrix(((25, 15, -5), (15, 18, 0), (-5, 0, 11))) L, D = A.LDLdecomposition() assert 15*L == Matrix([ [15, 0, 0], [ 9, 15, 0], [-3, 5, 15]]) assert D == Matrix([ [25, 0, 0], [ 0, 9, 0], [ 0, 0, 9]]) assert L * D * L.T == A A = SparseMatrix(((3, 0, 2), (0, 0, 1), (1, 2, 0))) assert A.inv() * A == SparseMatrix(eye(3)) A = SparseMatrix([ [ 2, -1, 0], [-1, 2, -1], [ 0, 0, 2]]) ans = SparseMatrix([ [Rational(2, 3), Rational(1, 3), Rational(1, 6)], [Rational(1, 3), Rational(2, 3), Rational(1, 3)], [ 0, 0, S.Half]]) assert A.inv(method='CH') == ans assert A.inv(method='LDL') == ans assert A * ans == SparseMatrix(eye(3)) s = A.solve(A[:, 0], 'LDL') assert A*s == A[:, 0] s = A.solve(A[:, 0], 'CH') assert A*s == A[:, 0] A = A.col_join(A) s = A.solve_least_squares(A[:, 0], 'CH') assert A*s == A[:, 0] s = A.solve_least_squares(A[:, 0], 'LDL') assert A*s == A[:, 0] def test_lower_triangular_solve(): a, b, c, d = symbols('a:d') u, v, w, x = symbols('u:x') A = SparseMatrix([[a, 0], [c, d]]) B = MutableSparseMatrix([[u, v], [w, x]]) C = ImmutableSparseMatrix([[u, v], [w, x]]) sol = Matrix([[u/a, v/a], [(w - c*u/a)/d, (x - c*v/a)/d]]) assert A.lower_triangular_solve(B) == sol assert A.lower_triangular_solve(C) == sol def test_upper_triangular_solve(): a, b, c, d = symbols('a:d') u, v, w, x = symbols('u:x') A = SparseMatrix([[a, b], [0, d]]) B = MutableSparseMatrix([[u, v], [w, x]]) C = ImmutableSparseMatrix([[u, v], [w, x]]) sol = Matrix([[(u - b*w/d)/a, (v - b*x/d)/a], [w/d, x/d]]) assert A.upper_triangular_solve(B) == sol assert A.upper_triangular_solve(C) == sol def test_diagonal_solve(): a, d = symbols('a d') u, v, w, x = symbols('u:x') A = SparseMatrix([[a, 0], [0, d]]) B = MutableSparseMatrix([[u, v], [w, x]]) C = ImmutableSparseMatrix([[u, v], [w, x]]) sol = Matrix([[u/a, v/a], [w/d, x/d]]) assert A.diagonal_solve(B) == sol assert A.diagonal_solve(C) == sol def test_hermitian(): x = Symbol('x') a = SparseMatrix([[0, I], [-I, 0]]) assert a.is_hermitian a = SparseMatrix([[1, I], [-I, 1]]) assert a.is_hermitian a[0, 0] = 2*I assert a.is_hermitian is False a[0, 0] = x assert a.is_hermitian is None a[0, 1] = a[1, 0]*I assert a.is_hermitian is False
# emacs: -*- mode: python; py-indent-offset: 4; indent-tabs-mode: nil -*- # vi: set ft=python sts=4 ts=4 sw=4 et: ''' Miscellaneous algorithms Change directory to provide relative paths for doctests >>> import os >>> filepath = os.path.dirname(os.path.realpath(__file__)) >>> datadir = os.path.realpath(os.path.join(filepath, '../testing/data')) >>> os.chdir(datadir) ''' from __future__ import print_function from __future__ import absolute_import from __future__ import division from builtins import zip from builtins import range import os import os.path as op import nibabel as nb import numpy as np from math import floor, ceil from scipy.ndimage.morphology import grey_dilation from scipy.special import legendre import scipy.io as sio import itertools import scipy.stats as stats from nipype import logging import warnings from . import metrics as nam from ..interfaces.base import (BaseInterface, traits, TraitedSpec, File, InputMultiPath, OutputMultiPath, BaseInterfaceInputSpec, isdefined, DynamicTraitedSpec, Undefined) from nipype.utils.filemanip import fname_presuffix, split_filename iflogger = logging.getLogger('interface') class PickAtlasInputSpec(BaseInterfaceInputSpec): atlas = File(exists=True, desc="Location of the atlas that will be used.", mandatory=True) labels = traits.Either( traits.Int, traits.List(traits.Int), desc=("Labels of regions that will be included in the mask. Must be\ compatible with the atlas used."), mandatory=True ) hemi = traits.Enum( 'both', 'left', 'right', desc="Restrict the mask to only one hemisphere: left or right", usedefault=True ) dilation_size = traits.Int( usedefault=True, desc="Defines how much the mask will be dilated (expanded in 3D)." ) output_file = File(desc="Where to store the output mask.") class PickAtlasOutputSpec(TraitedSpec): mask_file = File(exists=True, desc="output mask file") class PickAtlas(BaseInterface): """Returns ROI masks given an atlas and a list of labels. Supports dilation and left right masking (assuming the atlas is properly aligned). """ input_spec = PickAtlasInputSpec output_spec = PickAtlasOutputSpec def _run_interface(self, runtime): nim = self._get_brodmann_area() nb.save(nim, self._gen_output_filename()) return runtime def _gen_output_filename(self): if not isdefined(self.inputs.output_file): output = fname_presuffix(fname=self.inputs.atlas, suffix="_mask", newpath=os.getcwd(), use_ext=True) else: output = os.path.realpath(self.inputs.output_file) return output def _get_brodmann_area(self): nii = nb.load(self.inputs.atlas) origdata = nii.get_data() newdata = np.zeros(origdata.shape) if not isinstance(self.inputs.labels, list): labels = [self.inputs.labels] else: labels = self.inputs.labels for lab in labels: newdata[origdata == lab] = 1 if self.inputs.hemi == 'right': newdata[int(floor(float(origdata.shape[0]) / 2)):, :, :] = 0 elif self.inputs.hemi == 'left': newdata[:int(ceil(float(origdata.shape[0]) / 2)), :, :] = 0 if self.inputs.dilation_size != 0: newdata = grey_dilation( newdata, (2 * self.inputs.dilation_size + 1, 2 * self.inputs.dilation_size + 1, 2 * self.inputs.dilation_size + 1)) return nb.Nifti1Image(newdata, nii.affine, nii.header) def _list_outputs(self): outputs = self._outputs().get() outputs['mask_file'] = self._gen_output_filename() return outputs class SimpleThresholdInputSpec(BaseInterfaceInputSpec): volumes = InputMultiPath( File(exists=True), desc='volumes to be thresholded', mandatory=True) threshold = traits.Float( desc='volumes to be thresholdedeverything below this value will be set\ to zero', mandatory=True ) class SimpleThresholdOutputSpec(TraitedSpec): thresholded_volumes = OutputMultiPath( File(exists=True), desc="thresholded volumes") class SimpleThreshold(BaseInterface): """Applies a threshold to input volumes """ input_spec = SimpleThresholdInputSpec output_spec = SimpleThresholdOutputSpec def _run_interface(self, runtime): for fname in self.inputs.volumes: img = nb.load(fname) data = np.array(img.get_data()) active_map = data > self.inputs.threshold thresholded_map = np.zeros(data.shape) thresholded_map[active_map] = data[active_map] new_img = nb.Nifti1Image(thresholded_map, img.affine, img.header) _, base, _ = split_filename(fname) nb.save(new_img, base + '_thresholded.nii') return runtime def _list_outputs(self): outputs = self._outputs().get() outputs["thresholded_volumes"] = [] for fname in self.inputs.volumes: _, base, _ = split_filename(fname) outputs["thresholded_volumes"].append( os.path.abspath(base + '_thresholded.nii')) return outputs class ModifyAffineInputSpec(BaseInterfaceInputSpec): volumes = InputMultiPath( File(exists=True), desc='volumes which affine matrices will be modified', mandatory=True ) transformation_matrix = traits.Array( value=np.eye(4), shape=(4, 4), desc="transformation matrix that will be left multiplied by the\ affine matrix", usedefault=True ) class ModifyAffineOutputSpec(TraitedSpec): transformed_volumes = OutputMultiPath(File(exist=True)) class ModifyAffine(BaseInterface): """Left multiplies the affine matrix with a specified values. Saves the volume as a nifti file. """ input_spec = ModifyAffineInputSpec output_spec = ModifyAffineOutputSpec def _gen_output_filename(self, name): _, base, _ = split_filename(name) return os.path.abspath(base + "_transformed.nii") def _run_interface(self, runtime): for fname in self.inputs.volumes: img = nb.load(fname) affine = img.affine affine = np.dot(self.inputs.transformation_matrix, affine) nb.save(nb.Nifti1Image(img.get_data(), affine, img.header), self._gen_output_filename(fname)) return runtime def _list_outputs(self): outputs = self._outputs().get() outputs['transformed_volumes'] = [] for fname in self.inputs.volumes: outputs['transformed_volumes'].append( self._gen_output_filename(fname)) return outputs class CreateNiftiInputSpec(BaseInterfaceInputSpec): data_file = File(exists=True, mandatory=True, desc="ANALYZE img file") header_file = File( exists=True, mandatory=True, desc="corresponding ANALYZE hdr file") affine = traits.Array(desc="affine transformation array") class CreateNiftiOutputSpec(TraitedSpec): nifti_file = File(exists=True) class CreateNifti(BaseInterface): """Creates a nifti volume """ input_spec = CreateNiftiInputSpec output_spec = CreateNiftiOutputSpec def _gen_output_file_name(self): _, base, _ = split_filename(self.inputs.data_file) return os.path.abspath(base + ".nii") def _run_interface(self, runtime): hdr = nb.AnalyzeHeader.from_fileobj( open(self.inputs.header_file, 'rb')) if isdefined(self.inputs.affine): affine = self.inputs.affine else: affine = None data = hdr.data_from_fileobj(open(self.inputs.data_file, 'rb')) img = nb.Nifti1Image(data, affine, hdr) nb.save(img, self._gen_output_file_name()) return runtime def _list_outputs(self): outputs = self._outputs().get() outputs['nifti_file'] = self._gen_output_file_name() return outputs class TSNRInputSpec(BaseInterfaceInputSpec): in_file = InputMultiPath(File(exists=True), mandatory=True, desc='realigned 4D file or a list of 3D files') regress_poly = traits.Range(low=1, desc='Remove polynomials') tsnr_file = File('tsnr.nii.gz', usedefault=True, hash_files=False, desc='output tSNR file') mean_file = File('mean.nii.gz', usedefault=True, hash_files=False, desc='output mean file') stddev_file = File('stdev.nii.gz', usedefault=True, hash_files=False, desc='output tSNR file') detrended_file = File('detrend.nii.gz', usedefault=True, hash_files=False, desc='input file after detrending') class TSNROutputSpec(TraitedSpec): tsnr_file = File(exists=True, desc='tsnr image file') mean_file = File(exists=True, desc='mean image file') stddev_file = File(exists=True, desc='std dev image file') detrended_file = File(desc='detrended input file') class TSNR(BaseInterface): """Computes the time-course SNR for a time series Typically you want to run this on a realigned time-series. Example ------- >>> tsnr = TSNR() >>> tsnr.inputs.in_file = 'functional.nii' >>> res = tsnr.run() # doctest: +SKIP """ input_spec = TSNRInputSpec output_spec = TSNROutputSpec def _run_interface(self, runtime): img = nb.load(self.inputs.in_file[0]) header = img.header.copy() vollist = [nb.load(filename) for filename in self.inputs.in_file] data = np.concatenate([vol.get_data().reshape( vol.get_shape()[:3] + (-1,)) for vol in vollist], axis=3) data = np.nan_to_num(data) if data.dtype.kind == 'i': header.set_data_dtype(np.float32) data = data.astype(np.float32) if isdefined(self.inputs.regress_poly): timepoints = img.shape[-1] X = np.ones((timepoints, 1)) for i in range(self.inputs.regress_poly): X = np.hstack((X, legendre( i + 1)(np.linspace(-1, 1, timepoints))[:, None])) betas = np.dot(np.linalg.pinv(X), np.rollaxis(data, 3, 2)) datahat = np.rollaxis(np.dot(X[:, 1:], np.rollaxis( betas[1:, :, :, :], 0, 3)), 0, 4) data = data - datahat img = nb.Nifti1Image(data, img.get_affine(), header) nb.save(img, op.abspath(self.inputs.detrended_file)) meanimg = np.mean(data, axis=3) stddevimg = np.std(data, axis=3) tsnr = np.zeros_like(meanimg) tsnr[stddevimg > 1.e-3] = meanimg[stddevimg > 1.e-3] / stddevimg[stddevimg > 1.e-3] img = nb.Nifti1Image(tsnr, img.get_affine(), header) nb.save(img, op.abspath(self.inputs.tsnr_file)) img = nb.Nifti1Image(meanimg, img.get_affine(), header) nb.save(img, op.abspath(self.inputs.mean_file)) img = nb.Nifti1Image(stddevimg, img.get_affine(), header) nb.save(img, op.abspath(self.inputs.stddev_file)) return runtime def _list_outputs(self): outputs = self._outputs().get() for k in ['tsnr_file', 'mean_file', 'stddev_file']: outputs[k] = op.abspath(getattr(self.inputs, k)) if isdefined(self.inputs.regress_poly): outputs['detrended_file'] = op.abspath(self.inputs.detrended_file) return outputs class GunzipInputSpec(BaseInterfaceInputSpec): in_file = File(exists=True, mandatory=True) class GunzipOutputSpec(TraitedSpec): out_file = File(exists=True) class Gunzip(BaseInterface): """Gunzip wrapper """ input_spec = GunzipInputSpec output_spec = GunzipOutputSpec def _gen_output_file_name(self): _, base, ext = split_filename(self.inputs.in_file) if ext[-2:].lower() == ".gz": ext = ext[:-3] return os.path.abspath(base + ext[:-3]) def _run_interface(self, runtime): import gzip in_file = gzip.open(self.inputs.in_file, 'rb') out_file = open(self._gen_output_file_name(), 'wb') out_file.write(in_file.read()) out_file.close() in_file.close() return runtime def _list_outputs(self): outputs = self._outputs().get() outputs['out_file'] = self._gen_output_file_name() return outputs def replaceext(in_list, ext): out_list = list() for filename in in_list: path, name, _ = split_filename(op.abspath(filename)) out_name = op.join(path, name) + ext out_list.append(out_name) return out_list def matlab2csv(in_array, name, reshape): output_array = np.asarray(in_array) if reshape: if len(np.shape(output_array)) > 1: output_array = np.reshape(output_array, ( np.shape(output_array)[0] * np.shape(output_array)[1], 1)) iflogger.info(np.shape(output_array)) output_name = op.abspath(name + '.csv') np.savetxt(output_name, output_array, delimiter=',') return output_name class Matlab2CSVInputSpec(TraitedSpec): in_file = File(exists=True, mandatory=True, desc='Input MATLAB .mat file') reshape_matrix = traits.Bool( True, usedefault=True, desc='The output of this interface is meant for R, so matrices will be\ reshaped to vectors by default.' ) class Matlab2CSVOutputSpec(TraitedSpec): csv_files = OutputMultiPath( File(desc='Output CSV files for each variable saved in the input .mat\ file') ) class Matlab2CSV(BaseInterface): """Simple interface to save the components of a MATLAB .mat file as a text file with comma-separated values (CSVs). CSV files are easily loaded in R, for use in statistical processing. For further information, see cran.r-project.org/doc/manuals/R-data.pdf Example ------- >>> from nipype.algorithms import misc >>> mat2csv = misc.Matlab2CSV() >>> mat2csv.inputs.in_file = 'cmatrix.mat' >>> mat2csv.run() # doctest: +SKIP """ input_spec = Matlab2CSVInputSpec output_spec = Matlab2CSVOutputSpec def _run_interface(self, runtime): in_dict = sio.loadmat(op.abspath(self.inputs.in_file)) # Check if the file has multiple variables in it. If it does, loop # through them and save them as individual CSV files. # If not, save the variable as a single CSV file using the input file # name and a .csv extension. saved_variables = list() for key in list(in_dict.keys()): if not key.startswith('__'): if isinstance(in_dict[key][0], np.ndarray): saved_variables.append(key) else: iflogger.info('One of the keys in the input file, {k}, is not a Numpy array'.format(k=key)) if len(saved_variables) > 1: iflogger.info( '{N} variables found:'.format(N=len(saved_variables))) iflogger.info(saved_variables) for variable in saved_variables: iflogger.info( '...Converting {var} - type {ty} - to\ CSV'.format(var=variable, ty=type(in_dict[variable])) ) matlab2csv( in_dict[variable], variable, self.inputs.reshape_matrix) elif len(saved_variables) == 1: _, name, _ = split_filename(self.inputs.in_file) variable = saved_variables[0] iflogger.info('Single variable found {var}, type {ty}:'.format( var=variable, ty=type(in_dict[variable]))) iflogger.info('...Converting {var} to CSV from {f}'.format( var=variable, f=self.inputs.in_file)) matlab2csv(in_dict[variable], name, self.inputs.reshape_matrix) else: iflogger.error('No values in the MATLAB file?!') return runtime def _list_outputs(self): outputs = self.output_spec().get() in_dict = sio.loadmat(op.abspath(self.inputs.in_file)) saved_variables = list() for key in list(in_dict.keys()): if not key.startswith('__'): if isinstance(in_dict[key][0], np.ndarray): saved_variables.append(key) else: iflogger.error('One of the keys in the input file, {k}, is\ not a Numpy array'.format(k=key)) if len(saved_variables) > 1: outputs['csv_files'] = replaceext(saved_variables, '.csv') elif len(saved_variables) == 1: _, name, ext = split_filename(self.inputs.in_file) outputs['csv_files'] = op.abspath(name + '.csv') else: iflogger.error('No values in the MATLAB file?!') return outputs def merge_csvs(in_list): for idx, in_file in enumerate(in_list): try: in_array = np.loadtxt(in_file, delimiter=',') except ValueError as ex: try: in_array = np.loadtxt(in_file, delimiter=',', skiprows=1) except ValueError as ex: first = open(in_file, 'r') header_line = first.readline() header_list = header_line.split(',') n_cols = len(header_list) try: in_array = np.loadtxt( in_file, delimiter=',', skiprows=1, usecols=list(range(1, n_cols)) ) except ValueError as ex: in_array = np.loadtxt( in_file, delimiter=',', skiprows=1, usecols=list(range(1, n_cols - 1))) if idx == 0: out_array = in_array else: out_array = np.dstack((out_array, in_array)) out_array = np.squeeze(out_array) iflogger.info('Final output array shape:') iflogger.info(np.shape(out_array)) return out_array def remove_identical_paths(in_files): import os.path as op from ..utils.filemanip import split_filename if len(in_files) > 1: out_names = list() commonprefix = op.commonprefix(in_files) lastslash = commonprefix.rfind('/') commonpath = commonprefix[0:(lastslash + 1)] for fileidx, in_file in enumerate(in_files): path, name, ext = split_filename(in_file) in_file = op.join(path, name) name = in_file.replace(commonpath, '') name = name.replace('_subject_id_', '') out_names.append(name) else: path, name, ext = split_filename(in_files[0]) out_names = [name] return out_names def maketypelist(rowheadings, shape, extraheadingBool, extraheading): typelist = [] if rowheadings: typelist.append(('heading', 'a40')) if len(shape) > 1: for idx in range(1, (min(shape) + 1)): typelist.append((str(idx), float)) else: for idx in range(1, (shape[0] + 1)): typelist.append((str(idx), float)) if extraheadingBool: typelist.append((extraheading, 'a40')) iflogger.info(typelist) return typelist def makefmtlist(output_array, typelist, rowheadingsBool, shape, extraheadingBool): fmtlist = [] if rowheadingsBool: fmtlist.append('%s') if len(shape) > 1: output = np.zeros(max(shape), typelist) for idx in range(1, min(shape) + 1): output[str(idx)] = output_array[:, idx - 1] fmtlist.append('%f') else: output = np.zeros(1, typelist) for idx in range(1, len(output_array) + 1): output[str(idx)] = output_array[idx - 1] fmtlist.append('%f') if extraheadingBool: fmtlist.append('%s') fmt = ','.join(fmtlist) return fmt, output class MergeCSVFilesInputSpec(TraitedSpec): in_files = InputMultiPath(File(exists=True), mandatory=True, desc='Input comma-separated value (CSV) files') out_file = File('merged.csv', usedefault=True, desc='Output filename for merged CSV file') column_headings = traits.List( traits.Str, desc='List of column headings to save in merged CSV file\ (must be equal to number of input files). If left undefined, these\ will be pulled from the input filenames.') row_headings = traits.List( traits.Str, desc='List of row headings to save in merged CSV file\ (must be equal to number of rows in the input files).') row_heading_title = traits.Str( 'label', usedefault=True, desc='Column heading for the row headings\ added') extra_column_heading = traits.Str( desc='New heading to add for the added field.') extra_field = traits.Str( desc='New field to add to each row. This is useful for saving the\ group or subject ID in the file.') class MergeCSVFilesOutputSpec(TraitedSpec): csv_file = File(desc='Output CSV file containing columns ') class MergeCSVFiles(BaseInterface): """This interface is designed to facilitate data loading in the R environment. It takes input CSV files and merges them into a single CSV file. If provided, it will also incorporate column heading names into the resulting CSV file. CSV files are easily loaded in R, for use in statistical processing. For further information, see cran.r-project.org/doc/manuals/R-data.pdf Example ------- >>> from nipype.algorithms import misc >>> mat2csv = misc.MergeCSVFiles() >>> mat2csv.inputs.in_files = ['degree.mat','clustering.mat'] >>> mat2csv.inputs.column_headings = ['degree','clustering'] >>> mat2csv.run() # doctest: +SKIP """ input_spec = MergeCSVFilesInputSpec output_spec = MergeCSVFilesOutputSpec def _run_interface(self, runtime): extraheadingBool = False extraheading = '' rowheadingsBool = False """ This block defines the column headings. """ if isdefined(self.inputs.column_headings): iflogger.info('Column headings have been provided:') headings = self.inputs.column_headings else: iflogger.info( 'Column headings not provided! Pulled from input filenames:') headings = remove_identical_paths(self.inputs.in_files) if isdefined(self.inputs.extra_field): if isdefined(self.inputs.extra_column_heading): extraheading = self.inputs.extra_column_heading iflogger.info('Extra column heading provided: {col}'.format( col=extraheading)) else: extraheading = 'type' iflogger.info( 'Extra column heading was not defined. Using "type"') headings.append(extraheading) extraheadingBool = True if len(self.inputs.in_files) == 1: iflogger.warn('Only one file input!') if isdefined(self.inputs.row_headings): iflogger.info('Row headings have been provided. Adding "labels"\ column header.') prefix = '"{p}","'.format(p=self.inputs.row_heading_title) csv_headings = prefix + '","'.join(itertools.chain( headings)) + '"\n' rowheadingsBool = True else: iflogger.info('Row headings have not been provided.') csv_headings = '"' + '","'.join(itertools.chain(headings)) + '"\n' iflogger.info('Final Headings:') iflogger.info(csv_headings) """ Next we merge the arrays and define the output text file """ output_array = merge_csvs(self.inputs.in_files) _, name, ext = split_filename(self.inputs.out_file) if not ext == '.csv': ext = '.csv' out_file = op.abspath(name + ext) file_handle = open(out_file, 'w') file_handle.write(csv_headings) shape = np.shape(output_array) typelist = maketypelist( rowheadingsBool, shape, extraheadingBool, extraheading) fmt, output = makefmtlist( output_array, typelist, rowheadingsBool, shape, extraheadingBool) if rowheadingsBool: row_heading_list = self.inputs.row_headings row_heading_list_with_quotes = [] for row_heading in row_heading_list: row_heading_with_quotes = '"' + row_heading + '"' row_heading_list_with_quotes.append(row_heading_with_quotes) row_headings = np.array(row_heading_list_with_quotes, dtype='|S40') output['heading'] = row_headings if isdefined(self.inputs.extra_field): extrafieldlist = [] if len(shape) > 1: mx = shape[0] else: mx = 1 for idx in range(0, mx): extrafieldlist.append(self.inputs.extra_field) iflogger.info(len(extrafieldlist)) output[extraheading] = extrafieldlist iflogger.info(output) iflogger.info(fmt) np.savetxt(file_handle, output, fmt, delimiter=',') file_handle.close() return runtime def _list_outputs(self): outputs = self.output_spec().get() _, name, ext = split_filename(self.inputs.out_file) if not ext == '.csv': ext = '.csv' out_file = op.abspath(name + ext) outputs['csv_file'] = out_file return outputs class AddCSVColumnInputSpec(TraitedSpec): in_file = File(exists=True, mandatory=True, desc='Input comma-separated value (CSV) files') out_file = File('extra_heading.csv', usedefault=True, desc='Output filename for merged CSV file') extra_column_heading = traits.Str( desc='New heading to add for the added field.') extra_field = traits.Str( desc='New field to add to each row. This is useful for saving the\ group or subject ID in the file.') class AddCSVColumnOutputSpec(TraitedSpec): csv_file = File(desc='Output CSV file containing columns ') class AddCSVColumn(BaseInterface): """Short interface to add an extra column and field to a text file Example ------- >>> from nipype.algorithms import misc >>> addcol = misc.AddCSVColumn() >>> addcol.inputs.in_file = 'degree.csv' >>> addcol.inputs.extra_column_heading = 'group' >>> addcol.inputs.extra_field = 'male' >>> addcol.run() # doctest: +SKIP """ input_spec = AddCSVColumnInputSpec output_spec = AddCSVColumnOutputSpec def _run_interface(self, runtime): in_file = open(self.inputs.in_file, 'r') _, name, ext = split_filename(self.inputs.out_file) if not ext == '.csv': ext = '.csv' out_file = op.abspath(name + ext) out_file = open(out_file, 'w') firstline = in_file.readline() firstline = firstline.replace('\n', '') new_firstline = firstline + ',"' + \ self.inputs.extra_column_heading + '"\n' out_file.write(new_firstline) for line in in_file: new_line = line.replace('\n', '') new_line = new_line + ',' + self.inputs.extra_field + '\n' out_file.write(new_line) return runtime def _list_outputs(self): outputs = self.output_spec().get() _, name, ext = split_filename(self.inputs.out_file) if not ext == '.csv': ext = '.csv' out_file = op.abspath(name + ext) outputs['csv_file'] = out_file return outputs class AddCSVRowInputSpec(DynamicTraitedSpec, BaseInterfaceInputSpec): in_file = traits.File(mandatory=True, desc='Input comma-separated value (CSV) files') _outputs = traits.Dict(traits.Any, value={}, usedefault=True) def __setattr__(self, key, value): if key not in self.copyable_trait_names(): if not isdefined(value): super(AddCSVRowInputSpec, self).__setattr__(key, value) self._outputs[key] = value else: if key in self._outputs: self._outputs[key] = value super(AddCSVRowInputSpec, self).__setattr__(key, value) class AddCSVRowOutputSpec(TraitedSpec): csv_file = File(desc='Output CSV file containing rows ') class AddCSVRow(BaseInterface): """Simple interface to add an extra row to a csv file .. note:: Requires `pandas <http://pandas.pydata.org/>`_ .. warning:: Multi-platform thread-safe execution is possible with `lockfile <https://pythonhosted.org/lockfile/lockfile.html>`_. Please recall that (1) this module is alpha software; and (2) it should be installed for thread-safe writing. If lockfile is not installed, then the interface is not thread-safe. Example ------- >>> from nipype.algorithms import misc >>> addrow = misc.AddCSVRow() >>> addrow.inputs.in_file = 'scores.csv' >>> addrow.inputs.si = 0.74 >>> addrow.inputs.di = 0.93 >>> addrow.inputs.subject_id = 'S400' >>> addrow.inputs.list_of_values = [ 0.4, 0.7, 0.3 ] >>> addrow.run() # doctest: +SKIP """ input_spec = AddCSVRowInputSpec output_spec = AddCSVRowOutputSpec def __init__(self, infields=None, force_run=True, **kwargs): super(AddCSVRow, self).__init__(**kwargs) undefined_traits = {} self._infields = infields self._have_lock = False self._lock = None if infields: for key in infields: self.inputs.add_trait(key, traits.Any) self.inputs._outputs[key] = Undefined undefined_traits[key] = Undefined self.inputs.trait_set(trait_change_notify=False, **undefined_traits) if force_run: self._always_run = True def _run_interface(self, runtime): try: import pandas as pd except ImportError: raise ImportError(('This interface requires pandas ' '(http://pandas.pydata.org/) to run.')) try: import lockfile as pl self._have_lock = True except ImportError: from warnings import warn warn(('Python module lockfile was not found: AddCSVRow will not be' ' thread-safe in multi-processor execution')) input_dict = {} for key, val in list(self.inputs._outputs.items()): # expand lists to several columns if key == 'trait_added' and val in self.inputs.copyable_trait_names(): continue if isinstance(val, list): for i, v in enumerate(val): input_dict['%s_%d' % (key, i)] = v else: input_dict[key] = val df = pd.DataFrame([input_dict]) if self._have_lock: self._lock = pl.FileLock(self.inputs.in_file) # Acquire lock self._lock.acquire() if op.exists(self.inputs.in_file): formerdf = pd.read_csv(self.inputs.in_file, index_col=0) df = pd.concat([formerdf, df], ignore_index=True) with open(self.inputs.in_file, 'w') as f: df.to_csv(f) if self._have_lock: self._lock.release() # Using nipype.external.portalocker this might be something like: # with pl.Lock(self.inputs.in_file, timeout=1) as fh: # if op.exists(fh): # formerdf = pd.read_csv(fh, index_col=0) # df = pd.concat([formerdf, df], ignore_index=True) # df.to_csv(fh) return runtime def _list_outputs(self): outputs = self.output_spec().get() outputs['csv_file'] = self.inputs.in_file return outputs def _outputs(self): return self._add_output_traits(super(AddCSVRow, self)._outputs()) def _add_output_traits(self, base): return base class CalculateNormalizedMomentsInputSpec(TraitedSpec): timeseries_file = File( exists=True, mandatory=True, desc='Text file with timeseries in columns and timepoints in rows,\ whitespace separated') moment = traits.Int( mandatory=True, desc="Define which moment should be calculated, 3 for skewness, 4 for\ kurtosis.") class CalculateNormalizedMomentsOutputSpec(TraitedSpec): moments = traits.List(traits.Float(), desc='Moments') class CalculateNormalizedMoments(BaseInterface): """Calculates moments of timeseries. Example ------- >>> from nipype.algorithms import misc >>> skew = misc.CalculateNormalizedMoments() >>> skew.inputs.moment = 3 >>> skew.inputs.timeseries_file = 'timeseries.txt' >>> skew.run() # doctest: +SKIP """ input_spec = CalculateNormalizedMomentsInputSpec output_spec = CalculateNormalizedMomentsOutputSpec def _run_interface(self, runtime): self._moments = calc_moments( self.inputs.timeseries_file, self.inputs.moment) return runtime def _list_outputs(self): outputs = self.output_spec().get() outputs['skewness'] = self._moments return outputs def calc_moments(timeseries_file, moment): """Returns nth moment (3 for skewness, 4 for kurtosis) of timeseries (list of values; one per timeseries). Keyword arguments: timeseries_file -- text file with white space separated timepoints in rows """ timeseries = np.genfromtxt(timeseries_file) m2 = stats.moment(timeseries, 2, axis=0) m3 = stats.moment(timeseries, moment, axis=0) zero = (m2 == 0) return np.where(zero, 0, m3 / m2 ** (moment / 2.0)) class AddNoiseInputSpec(TraitedSpec): in_file = File(exists=True, mandatory=True, desc='input image that will be corrupted with noise') in_mask = File(exists=True, desc=('input mask, voxels outside this mask ' 'will be considered background')) snr = traits.Float(10.0, desc='desired output SNR in dB', usedefault=True) dist = traits.Enum('normal', 'rician', usedefault=True, mandatory=True, desc=('desired noise distribution')) bg_dist = traits.Enum('normal', 'rayleigh', usedefault=True, mandatory=True, desc=('desired noise distribution, currently ' 'only normal is implemented')) out_file = File(desc='desired output filename') class AddNoiseOutputSpec(TraitedSpec): out_file = File(exists=True, desc='corrupted image') class AddNoise(BaseInterface): """ Corrupts with noise the input image Example ------- >>> from nipype.algorithms.misc import AddNoise >>> noise = AddNoise() >>> noise.inputs.in_file = 'T1.nii' >>> noise.inputs.in_mask = 'mask.nii' >>> noise.snr = 30.0 >>> noise.run() # doctest: +SKIP """ input_spec = AddNoiseInputSpec output_spec = AddNoiseOutputSpec def _run_interface(self, runtime): in_image = nb.load(self.inputs.in_file) in_data = in_image.get_data() snr = self.inputs.snr if isdefined(self.inputs.in_mask): in_mask = nb.load(self.inputs.in_mask).get_data() else: in_mask = np.ones_like(in_data) result = self.gen_noise(in_data, mask=in_mask, snr_db=snr, dist=self.inputs.dist, bg_dist=self.inputs.bg_dist) res_im = nb.Nifti1Image(result, in_image.affine, in_image.header) res_im.to_filename(self._gen_output_filename()) return runtime def _gen_output_filename(self): if not isdefined(self.inputs.out_file): _, base, ext = split_filename(self.inputs.in_file) out_file = os.path.abspath('%s_SNR%03.2f%s' % (base, self.inputs.snr, ext)) else: out_file = self.inputs.out_file return out_file def _list_outputs(self): outputs = self.output_spec().get() outputs['out_file'] = self._gen_output_filename() return outputs def gen_noise(self, image, mask=None, snr_db=10.0, dist='normal', bg_dist='normal'): """ Generates a copy of an image with a certain amount of added gaussian noise (rayleigh for background in mask) """ from math import sqrt snr = sqrt(np.power(10.0, snr_db / 10.0)) if mask is None: mask = np.ones_like(image) else: mask[mask > 0] = 1 mask[mask < 1] = 0 if mask.ndim < image.ndim: mask = np.rollaxis(np.array([mask] * image.shape[3]), 0, 4) signal = image[mask > 0].reshape(-1) if dist == 'normal': signal = signal - signal.mean() sigma_n = sqrt(signal.var() / snr) noise = np.random.normal(size=image.shape, scale=sigma_n) if (np.any(mask == 0)) and (bg_dist == 'rayleigh'): bg_noise = np.random.rayleigh(size=image.shape, scale=sigma_n) noise[mask == 0] = bg_noise[mask == 0] im_noise = image + noise elif dist == 'rician': sigma_n = signal.mean() / snr n_1 = np.random.normal(size=image.shape, scale=sigma_n) n_2 = np.random.normal(size=image.shape, scale=sigma_n) stde_1 = n_1 / sqrt(2.0) stde_2 = n_2 / sqrt(2.0) im_noise = np.sqrt((image + stde_1)**2 + (stde_2)**2) else: raise NotImplementedError(('Only normal and rician distributions ' 'are supported')) return im_noise class NormalizeProbabilityMapSetInputSpec(TraitedSpec): in_files = InputMultiPath(File(exists=True, mandatory=True, desc='The tpms to be normalized')) in_mask = File(exists=True, desc='Masked voxels must sum up 1.0, 0.0 otherwise.') class NormalizeProbabilityMapSetOutputSpec(TraitedSpec): out_files = OutputMultiPath(File(exists=True), desc="normalized maps") class NormalizeProbabilityMapSet(BaseInterface): """ Returns the input tissue probability maps (tpms, aka volume fractions) normalized to sum up 1.0 at each voxel within the mask. .. note:: Please recall this is not a spatial normalization algorithm Example ------- >>> from nipype.algorithms import misc >>> normalize = misc.NormalizeProbabilityMapSet() >>> normalize.inputs.in_files = [ 'tpm_00.nii.gz', 'tpm_01.nii.gz', \ 'tpm_02.nii.gz' ] >>> normalize.inputs.in_mask = 'tpms_msk.nii.gz' >>> normalize.run() # doctest: +SKIP """ input_spec = NormalizeProbabilityMapSetInputSpec output_spec = NormalizeProbabilityMapSetOutputSpec def _run_interface(self, runtime): mask = None if isdefined(self.inputs.in_mask): mask = self.inputs.in_mask self._out_filenames = normalize_tpms(self.inputs.in_files, mask) return runtime def _list_outputs(self): outputs = self.output_spec().get() outputs['out_files'] = self._out_filenames return outputs class SplitROIsInputSpec(TraitedSpec): in_file = File(exists=True, mandatory=True, desc='file to be splitted') in_mask = File(exists=True, desc='only process files inside mask') roi_size = traits.Tuple(traits.Int, traits.Int, traits.Int, desc='desired ROI size') class SplitROIsOutputSpec(TraitedSpec): out_files = OutputMultiPath(File(exists=True), desc='the resulting ROIs') out_masks = OutputMultiPath(File(exists=True), desc='a mask indicating valid values') out_index = OutputMultiPath(File(exists=True), desc='arrays keeping original locations') class SplitROIs(BaseInterface): """ Splits a 3D image in small chunks to enable parallel processing. ROIs keep time series structure in 4D images. >>> from nipype.algorithms import misc >>> rois = misc.SplitROIs() >>> rois.inputs.in_file = 'diffusion.nii' >>> rois.inputs.in_mask = 'mask.nii' >>> rois.run() # doctest: +SKIP """ input_spec = SplitROIsInputSpec output_spec = SplitROIsOutputSpec def _run_interface(self, runtime): mask = None roisize = None self._outnames = {} if isdefined(self.inputs.in_mask): mask = self.inputs.in_mask if isdefined(self.inputs.roi_size): roisize = self.inputs.roi_size res = split_rois(self.inputs.in_file, mask, roisize) self._outnames['out_files'] = res[0] self._outnames['out_masks'] = res[1] self._outnames['out_index'] = res[2] return runtime def _list_outputs(self): outputs = self.output_spec().get() for k, v in self._outnames.items(): outputs[k] = v return outputs class MergeROIsInputSpec(TraitedSpec): in_files = InputMultiPath(File(exists=True, mandatory=True, desc='files to be re-merged')) in_index = InputMultiPath(File(exists=True, mandatory=True), desc='array keeping original locations') in_reference = File(exists=True, desc='reference file') class MergeROIsOutputSpec(TraitedSpec): merged_file = File(exists=True, desc='the recomposed file') class MergeROIs(BaseInterface): """ Splits a 3D image in small chunks to enable parallel processing. ROIs keep time series structure in 4D images. Example ------- >>> from nipype.algorithms import misc >>> rois = misc.MergeROIs() >>> rois.inputs.in_files = ['roi%02d.nii' % i for i in range(1, 6)] >>> rois.inputs.in_reference = 'mask.nii' >>> rois.inputs.in_index = ['roi%02d_idx.npz' % i for i in range(1, 6)] >>> rois.run() # doctest: +SKIP """ input_spec = MergeROIsInputSpec output_spec = MergeROIsOutputSpec def _run_interface(self, runtime): res = merge_rois(self.inputs.in_files, self.inputs.in_index, self.inputs.in_reference) self._merged = res return runtime def _list_outputs(self): outputs = self.output_spec().get() outputs['merged_file'] = self._merged return outputs def normalize_tpms(in_files, in_mask=None, out_files=[]): """ Returns the input tissue probability maps (tpms, aka volume fractions) normalized to sum up 1.0 at each voxel within the mask. """ import nibabel as nib import numpy as np import os.path as op in_files = np.atleast_1d(in_files).tolist() if len(out_files) != len(in_files): for i, finname in enumerate(in_files): fname, fext = op.splitext(op.basename(finname)) if fext == '.gz': fname, fext2 = op.splitext(fname) fext = fext2 + fext out_file = op.abspath('%s_norm_%02d%s' % (fname, i, fext)) out_files += [out_file] imgs = [nib.load(fim) for fim in in_files] if len(in_files) == 1: img_data = imgs[0].get_data() img_data[img_data > 0.0] = 1.0 hdr = imgs[0].header.copy() hdr['data_type'] = 16 hdr.set_data_dtype(np.float32) nib.save(nib.Nifti1Image(img_data.astype(np.float32), imgs[0].affine, hdr), out_files[0]) return out_files[0] img_data = np.array([im.get_data() for im in imgs]).astype(np.float32) # img_data[img_data>1.0] = 1.0 img_data[img_data < 0.0] = 0.0 weights = np.sum(img_data, axis=0) msk = np.ones_like(imgs[0].get_data()) msk[weights <= 0] = 0 if in_mask is not None: msk = nib.load(in_mask).get_data() msk[msk <= 0] = 0 msk[msk > 0] = 1 msk = np.ma.masked_equal(msk, 0) for i, out_file in enumerate(out_files): data = np.ma.masked_equal(img_data[i], 0) probmap = data / weights hdr = imgs[i].header.copy() hdr['data_type'] = 16 hdr.set_data_dtype('float32') nib.save(nib.Nifti1Image(probmap.astype(np.float32), imgs[i].affine, hdr), out_file) return out_files def split_rois(in_file, mask=None, roishape=None): """ Splits an image in ROIs for parallel processing """ import nibabel as nb import numpy as np from math import sqrt, ceil import os.path as op if roishape is None: roishape = (10, 10, 1) im = nb.load(in_file) imshape = im.shape dshape = imshape[:3] nvols = imshape[-1] roisize = roishape[0] * roishape[1] * roishape[2] droishape = (roishape[0], roishape[1], roishape[2], nvols) if mask is not None: mask = nb.load(mask).get_data() mask[mask > 0] = 1 mask[mask < 1] = 0 else: mask = np.ones(dshape) mask = mask.reshape(-1).astype(np.uint8) nzels = np.nonzero(mask) els = np.sum(mask) nrois = int(ceil(els / float(roisize))) data = im.get_data().reshape((mask.size, -1)) data = np.squeeze(data.take(nzels, axis=0)) nvols = data.shape[-1] roidefname = op.abspath('onesmask.nii.gz') nb.Nifti1Image(np.ones(roishape, dtype=np.uint8), None, None).to_filename(roidefname) out_files = [] out_mask = [] out_idxs = [] for i in range(nrois): first = i * roisize last = (i + 1) * roisize fill = 0 if last > els: fill = last - els last = els droi = data[first:last, ...] iname = op.abspath('roi%010d_idx' % i) out_idxs.append(iname + '.npz') np.savez(iname, (nzels[0][first:last],)) if fill > 0: droi = np.vstack((droi, np.zeros((fill, nvols), dtype=np.float32))) partialmsk = np.ones((roisize,), dtype=np.uint8) partialmsk[-fill:] = 0 partname = op.abspath('partialmask.nii.gz') nb.Nifti1Image(partialmsk.reshape(roishape), None, None).to_filename(partname) out_mask.append(partname) else: out_mask.append(roidefname) fname = op.abspath('roi%010d.nii.gz' % i) nb.Nifti1Image(droi.reshape(droishape), None, None).to_filename(fname) out_files.append(fname) return out_files, out_mask, out_idxs def merge_rois(in_files, in_idxs, in_ref, dtype=None, out_file=None): """ Re-builds an image resulting from a parallelized processing """ import nibabel as nb import numpy as np import os.path as op import subprocess as sp if out_file is None: out_file = op.abspath('merged.nii.gz') if dtype is None: dtype = np.float32 # if file is compressed, uncompress using os # to avoid memory errors if op.splitext(in_ref)[1] == '.gz': try: iflogger.info('uncompress %i' % in_ref) sp.check_call(['gunzip', in_ref], stdout=sp.PIPE, shell=True) in_ref = op.splitext(in_ref)[0] except: pass ref = nb.load(in_ref) aff = ref.affine hdr = ref.header.copy() rsh = ref.shape del ref npix = rsh[0] * rsh[1] * rsh[2] fcdata = nb.load(in_files[0]).get_data() if fcdata.ndim == 4: ndirs = fcdata.shape[-1] else: ndirs = 1 newshape = (rsh[0], rsh[1], rsh[2], ndirs) hdr.set_data_dtype(dtype) hdr.set_xyzt_units('mm', 'sec') if ndirs < 300: data = np.zeros((npix, ndirs)) for cname, iname in zip(in_files, in_idxs): f = np.load(iname) idxs = np.squeeze(f['arr_0']) cdata = nb.load(cname).get_data().reshape(-1, ndirs) nels = len(idxs) idata = (idxs, ) try: data[idata, ...] = cdata[0:nels, ...] except: print(('Consistency between indexes and chunks was ' 'lost: data=%s, chunk=%s') % (str(data.shape), str(cdata.shape))) raise hdr.set_data_shape(newshape) nb.Nifti1Image(data.reshape(newshape).astype(dtype), aff, hdr).to_filename(out_file) else: hdr.set_data_shape(rsh[:3]) nii = [] for d in range(ndirs): fname = op.abspath('vol%06d.nii' % d) nb.Nifti1Image(np.zeros(rsh[:3]), aff, hdr).to_filename(fname) nii.append(fname) for cname, iname in zip(in_files, in_idxs): f = np.load(iname) idxs = np.squeeze(f['arr_0']) for d, fname in enumerate(nii): data = nb.load(fname).get_data().reshape(-1) cdata = nb.load(cname).get_data().reshape(-1, ndirs)[:, d] nels = len(idxs) idata = (idxs, ) data[idata] = cdata[0:nels] nb.Nifti1Image(data.reshape(rsh[:3]), aff, hdr).to_filename(fname) imgs = [nb.load(im) for im in nii] allim = nb.concat_images(imgs) allim.to_filename(out_file) return out_file # Deprecated interfaces ------------------------------------------------------ class Distance(nam.Distance): """Calculates distance between two volumes. .. deprecated:: 0.10.0 Use :py:class:`nipype.algorithms.metrics.Distance` instead. """ def __init__(self, **inputs): super(nam.Distance, self).__init__(**inputs) warnings.warn(("This interface has been deprecated since 0.10.0," " please use nipype.algorithms.metrics.Distance"), DeprecationWarning) class Overlap(nam.Overlap): """Calculates various overlap measures between two maps. .. deprecated:: 0.10.0 Use :py:class:`nipype.algorithms.metrics.Overlap` instead. """ def __init__(self, **inputs): super(nam.Overlap, self).__init__(**inputs) warnings.warn(("This interface has been deprecated since 0.10.0," " please use nipype.algorithms.metrics.Overlap"), DeprecationWarning) class FuzzyOverlap(nam.FuzzyOverlap): """Calculates various overlap measures between two maps, using a fuzzy definition. .. deprecated:: 0.10.0 Use :py:class:`nipype.algorithms.metrics.FuzzyOverlap` instead. """ def __init__(self, **inputs): super(nam.FuzzyOverlap, self).__init__(**inputs) warnings.warn(("This interface has been deprecated since 0.10.0," " please use nipype.algorithms.metrics.FuzzyOverlap"), DeprecationWarning)
# Copyright 2016 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Converter construction support. This module contains a base class for all converters, as well as supporting structures. These structures are referred to as contexts. The class hierarchy is as follows: <your converter> [extends] converter.Base [extends] transformer.Base [extends] gast.nodeTransformer [uses] transfomer.SourceInfo [uses] converter.EntityContext [uses] converter.ProgramContext [uses] transfomer.SourceInfo converter.Base is a specialization of transformer.Base for AutoGraph. It's a very lightweight subclass that adds a `ctx` attribute holding the corresponding EntityContext object (see below). Note that converters are not reusable, and `visit` will raise an error if called more than once. converter.EntityContext contains mutable state associated with an entity that the converter processes. converter.ProgramContext contains mutable state across related entities. For example, when converting several functions that call one another, the ProgramContext should be shared across these entities. Below is the overall flow at conversion: program_ctx = ProgramContext(<entities to convert>, <global settings>, ...) while <program_ctx has more entities to convert>: entity, source_info = <get next entity from program_ctx> entity_ctx = EntityContext(program_ctx, source_info) for <each ConverterClass>: converter = ConverterClass(entity_ctx) # May update entity_ctx and program_ctx entity = converter.visit(entity) <add entity's dependencies to program_ctx> Note that pyct contains a small number of transformers used for static analysis. These implement transformer.Base, rather than converter.Base, to avoid a dependency on AutoGraph. """ from __future__ import absolute_import from __future__ import division from __future__ import print_function from enum import Enum from tensorflow.python.autograph.core import config from tensorflow.python.autograph.core import naming from tensorflow.python.autograph.pyct import anno from tensorflow.python.autograph.pyct import ast_util from tensorflow.python.autograph.pyct import cfg from tensorflow.python.autograph.pyct import compiler from tensorflow.python.autograph.pyct import inspect_utils from tensorflow.python.autograph.pyct import parser from tensorflow.python.autograph.pyct import qual_names from tensorflow.python.autograph.pyct import templates from tensorflow.python.autograph.pyct import transformer from tensorflow.python.autograph.pyct.static_analysis import activity from tensorflow.python.autograph.pyct.static_analysis import live_values from tensorflow.python.autograph.pyct.static_analysis import liveness from tensorflow.python.autograph.pyct.static_analysis import reaching_definitions from tensorflow.python.autograph.pyct.static_analysis import type_info # TODO(mdan): These contexts can be refactored into first class objects. # For example, we could define Program and Entity abstractions that hold on # to the actual entity and have conversion methods. # TODO(mdan): Add a test specific to this converter. class Feature(Enum): """Constants to use when selecting AutoGraph features.""" ALL = 'Enable all features.' AUTO_CONTROL_DEPS = ( 'Insert of control dependencies in the generated code.') DECORATORS = ( 'Allow decorators in local functions. Note that special decorators, ' ' like ag.convert or tf.function are allowed regardless of this toggle.') LISTS = 'Convert list idioms, like initializers, slices, append, etc.' def __repr__(self): return self.name class ConversionOptions(object): """Immutable container for global conversion flags. Attributes: recursive: bool, whether to recursively convert any user functions or classes that the converted function may use. verbose: bool, whether to log the converted code. strip_decorators: Tuple[Callable], contains decorators that should be in excluded from the compiled output. By default, when converting a function before the decorators are applied, the compiled output will include those decorators. force_conversion: bool, whether to force convertinng the target entity. When force_conversion is turned off, the converter may decide to return the function as-is. optional_features: Union[Feature, Set[Feature]], controls the use of optional features in the conversion process. See Feature for available options. """ def __init__(self, recursive=False, verbose=False, strip_decorators=None, force_conversion=False, internal_convert_user_code=True, optional_features=Feature.ALL): self.recursive = recursive self.verbose = verbose self.strip_decorators = strip_decorators or () self.force_conversion = force_conversion # TODO(mdan): Rename to conversion_recursion_depth? self.internal_convert_user_code = internal_convert_user_code if isinstance(optional_features, Feature): optional_features = (optional_features,) optional_features = frozenset(optional_features) self.optional_features = optional_features def uses(self, feature): return (Feature.ALL in self.optional_features or feature in self.optional_features) def to_ast(self, namespace, internal_convert_user_code=None): """Returns a representation of this object as an AST node. The AST node encodes a constructor that would create an object with the same contents. Args: namespace: Dict[str, Any], the namespace to use when serializing values to names. internal_convert_user_code: Optional[bool], allows ovrriding the corresponding value. Returns: ast.Node """ template = """ constructor_name( recursive=recursive_val, verbose=verbose_val, strip_decorators=strip_decorators_val, force_conversion=force_conversion_val, optional_features=optional_features_val, internal_convert_user_code=internal_convert_user_code_val) """ def as_qualified_name(o): name = inspect_utils.getqualifiedname(namespace, o) if not name: raise ValueError('Could not locate entity {} in {}'.format( o, namespace)) return name def list_of_names(values): return parser.parse_expression('({})'.format(', '.join( tuple(as_qualified_name(v) for v in values)))) def list_of_features(values): return parser.parse_expression('({})'.format(', '.join( 'ag__.Feature.{}'.format(v) for v in Feature.__members__ if v in values))) if internal_convert_user_code is not None: internal_convert_user_code = self.internal_convert_user_code expr_ast = templates.replace( template, constructor_name=parser.parse_expression( as_qualified_name(ConversionOptions)), recursive_val=parser.parse_expression(str(self.recursive)), verbose_val=parser.parse_expression(str(self.verbose)), strip_decorators_val=list_of_names(self.strip_decorators), force_conversion_val=parser.parse_expression( str(self.force_conversion)), internal_convert_user_code_val=parser.parse_expression( str(internal_convert_user_code)), optional_features_val=list_of_features(self.optional_features)) return expr_ast[0].value class ProgramContext(object): """ProgramContext keeps track of converting function hierarchies. This object is mutable, and is updated during conversion. Not thread safe. Attributes: options: ConversionOptions dependency_cache: Dict[Any, ast.AST], the original entities mapped to their converted AST additional_imports: Set[Any], additional entities which for any reason cannot be attached after loading and need to be explicitly imported in the generated code name_map: Dict[str, str], map of original entity name to the name of their converted counterparts autograph_module: Module, a reference to the autograph module. This needs to be specified by the caller to avoid circular dependencies. uncompiled_modules: Set[Tuple[str, ...]], with each tuple representing the fully qualified name of a package containing functions that will not be compiled. required_imports: str, containing an import statement on each line. These are all the imports necessary for the compiled code to run, in addition to the closures of each entity, which are attached dynamically. """ def __init__( self, options, partial_types, autograph_module, uncompiled_modules, ): self.options = options self.partial_types = partial_types if partial_types else () self.autograph_module = autograph_module self.uncompiled_modules = uncompiled_modules self.conversion_order = [] self.dependency_cache = {} self.additional_imports = set() self.name_map = {} @property def required_imports(self): """Returns a block containing all imports required by the converted code.""" # TODO(mdan): Check that these don't clobber one another. return '\n'.join(config.COMPILED_IMPORT_STATEMENTS + tuple(self.additional_imports)) def new_namer(self, namespace): return naming.Namer(namespace, self.options.recursive, self.name_map, self.partial_types) def update_name_map(self, namer): """Updates renamed_calls based on the recent activity from the namer. Whenever we convert a new entity, any references to other entities are being renamed to match their soon-to-be-converted counterparts. The namer keeps track of these renames. When conversion is complete, we copy those renames so that when those referenced entities are being converted, their new name matches. Args: namer: naming.Namer Raises: ValueError: when an entity was renamed twice and to different names. """ # TODO(mdan): Have call_trees do this directly. # This is done so indirectly, via the namer, for historic reasons. But # now we can have the converter that does the rename record the new name # as well and skip this step altogether. for o, name in namer.renamed_calls.items(): if o in self.name_map: if self.name_map[o] != name: raise ValueError( 'Calls to %s were converted using multiple names (%s). This is ' 'possible when an entity with one of these names already ' 'existed. To fix, avoid using any of these names.' % (o, (name, self.name_map[o]))) else: self.name_map[o] = name def add_to_cache(self, original_entity, converted_ast): self.conversion_order.append(original_entity) self.dependency_cache[original_entity] = converted_ast class EntityContext(object): """Tracks the conversion of a single entity. This object is mutable, and is updated during conversion. Not thread safe. Attributes: namer: Namer info: transformer.EntityInfo program: ProgramContext """ def __init__(self, namer, entity_info, program_ctx): self.namer = namer self.info = entity_info self.program = program_ctx class Base(transformer.Base): """All converters should inherit from this class. Attributes: ctx: EntityContext """ def __init__(self, ctx): super(Base, self).__init__(ctx.info) self.ctx = ctx # Keeping this short because it's used frequently. self._used = False self._ast_depth = 0 def get_definition_directive(self, node, directive, arg, default): """Returns the unique directive argument for a symbol. See lang/directives.py for details on directives. Example: # Given a directive in the code: ag.foo_directive(bar, baz=1) # One can write for an AST node Name(id='bar'): get_definition_directive(node, ag.foo_directive, 'baz') Args: node: ast.AST, the node representing the symbol for which the directive argument is needed. directive: Callable[..., Any], the directive to search. arg: str, the directive argument to return. default: Any Raises: ValueError: if conflicting annotations have been found """ defs = anno.getanno(node, anno.Static.ORIG_DEFINITIONS, ()) if not defs: return default arg_values_found = [] for def_ in defs: if (directive in def_.directives and arg in def_.directives[directive]): arg_values_found.append(def_.directives[directive][arg]) if not arg_values_found: return default if len(arg_values_found) == 1: return arg_values_found[0] # If multiple annotations reach the symbol, they must all match. If they do, # return any of them. first_value = arg_values_found[0] for other_value in arg_values_found[1:]: if not ast_util.matches(first_value, other_value): qn = anno.getanno(node, anno.Basic.QN) raise ValueError('%s has ambiguous annotations for %s(%s): %s, %s' % (qn, directive.__name__, arg, compiler.ast_to_source(other_value).strip(), compiler.ast_to_source(first_value).strip())) return first_value def visit(self, node): if not self._ast_depth: if self._used: raise ValueError('converter objects cannot be reused') self._used = True self._ast_depth += 1 try: return super(Base, self).visit(node) finally: self._ast_depth -= 1 class AnnotatedDef(reaching_definitions.Definition): def __init__(self): super(AnnotatedDef, self).__init__() self.directives = {} class AgAnno(Enum): """Annotation labels specific to AutoGraph. See anno.py.""" DIRECTIVES = 'User directives associated with the annotated statement.' def __repr__(self): return self.name def standard_analysis(node, context, is_initial=False): """Performs a complete static analysis of the given code. Args: node: ast.AST context: converter.EntityContext is_initial: bool, whether this is the initial analysis done on the input source code Returns: ast.AST, same as node, with the static analysis annotations added """ # TODO(mdan): Clear static analysis here. # TODO(mdan): Consider not running all analyses every time. # TODO(mdan): Don't return a node because it's modified by reference. graphs = cfg.build(node) node = qual_names.resolve(node) node = activity.resolve(node, context.info, None) node = reaching_definitions.resolve(node, context.info, graphs, AnnotatedDef) node = liveness.resolve(node, context.info, graphs) node = live_values.resolve(node, context.info, config.PYTHON_LITERALS) node = type_info.resolve(node, context.info) # This second call allows resolving first-order class attributes. node = live_values.resolve(node, context.info, config.PYTHON_LITERALS) if is_initial: anno.dup( node, { anno.Static.DEFINITIONS: anno.Static.ORIG_DEFINITIONS, }, ) return node def apply_(node, context, converter_module): """Applies a converter to an AST. Args: node: ast.AST context: converter.EntityContext converter_module: converter.Base Returns: ast.AST, the result of applying converter to node """ node = standard_analysis(node, context) node = converter_module.transform(node, context) return node
# Copyright 2021 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # https://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Core functionality for tree_math.""" import functools import operator import typing from typing import Tuple from jax import tree_util import jax.numpy as jnp def _flatten_together(*args): """Flatten a collection of pytrees with matching structure/shapes together.""" all_values, all_treedefs = zip(*map(tree_util.tree_flatten, args)) all_treedefs = typing.cast(Tuple[tree_util.PyTreeDef, ...], all_treedefs) if not all(treedef == all_treedefs[0] for treedef in all_treedefs[1:]): treedefs_str = " vs ".join(map(str, all_treedefs)) raise ValueError( f"arguments have different tree structures: {treedefs_str}" ) all_shapes = [list(map(jnp.shape, values)) for values in all_values] if not all(shapes == all_shapes[0] for shapes in all_shapes[1:]): shapes_str = " vs ".join(map(str, all_shapes)) raise ValueError(f"tree leaves have different array shapes: {shapes_str}") return all_values, all_treedefs[0] def _argnums_partial(f, args, static_argnums): def g(*args3): args3 = list(args3) for i in static_argnums: args3.insert(i, args[i]) return f(*args3) args2 = tuple(x for i, x in enumerate(args) if i not in static_argnums) return g, args2 def broadcasting_map(func, *args): """Like tree_map, but scalar arguments are broadcast to all leaves.""" static_argnums = [i for i, x in enumerate(args) if not isinstance(x, VectorMixin)] func2, vector_args = _argnums_partial(func, args, static_argnums) for arg in args: if not isinstance(arg, VectorMixin): shape = jnp.shape(arg) if shape: raise TypeError( f"non-tree_math.VectorMixin argument is not a scalar: {arg!r}" ) if not vector_args: return func2() # result is a scalar _flatten_together(*[arg for arg in vector_args]) # check shapes return tree_util.tree_map(func2, *vector_args) def _binary_method(func, name): """Implement a forward binary method, e.g., __add__.""" def wrapper(self, other): return broadcasting_map(func, self, other) wrapper.__name__ = f"__{name}__" return wrapper def _reflected_binary_method(func, name): """Implement a reflected binary method, e.g., __radd__.""" def wrapper(self, other): return broadcasting_map(func, other, self) wrapper.__name__ = f"__r{name}__" return wrapper def _numeric_methods(func, name): """Implement forward and reflected methods.""" return (_binary_method(func, name), _reflected_binary_method(func, name)) def _unary_method(func, name): def wrapper(self): return tree_util.tree_map(func, self) wrapper.__name__ = f"__{name}__" return wrapper def dot(left, right, *, precision="highest"): """Dot product between tree math vectors. Note that unlike jax.numpy.dot, tree_math.dot defaults to full (highest) precision. This is more useful for numerical algorithms and will be the default for jax.numpy in the future: https://github.com/google/jax/pull/7859 Args: left: left argument. right: right argument. precision: precision. Returns: Resulting dot product (scalar). """ if not isinstance(left, VectorMixin) or not isinstance(right, VectorMixin): raise TypeError("matmul arguments must both be tree_math.VectorMixin objects") def _vector_dot(a, b): return jnp.dot(jnp.ravel(a), jnp.ravel(b), precision=precision) (left_values, right_values), _ = _flatten_together(left, right) parts = map(_vector_dot, left_values, right_values) return functools.reduce(operator.add, parts) class VectorMixin: """A mixin class that adds a 1D vector-like behaviour to any custom pytree class.""" @property def size(self): values = tree_util.tree_leaves(self) return sum(jnp.size(value) for value in values) def __len__(self): return self.size @property def shape(self): return (self.size,) @property def ndim(self): return 1 @property def dtype(self): values = tree_util.tree_leaves(self) return jnp.result_type(*values) # comparison __lt__ = _binary_method(operator.lt, "lt") __le__ = _binary_method(operator.le, "le") __eq__ = _binary_method(operator.eq, "eq") __ne__ = _binary_method(operator.ne, "ne") __ge__ = _binary_method(operator.ge, "ge") __gt__ = _binary_method(operator.gt, "gt") # arithmetic __add__, __radd__ = _numeric_methods(operator.add, "add") __sub__, __rsub__ = _numeric_methods(operator.sub, "sub") __mul__, __rmul__ = _numeric_methods(operator.mul, "mul") __truediv__, __rtruediv__ = _numeric_methods(operator.truediv, "truediv") __floordiv__, __rfloordiv__ = _numeric_methods(operator.floordiv, "floordiv") __mod__, __rmod__ = _numeric_methods(operator.mod, "mod") __pow__, __rpow__ = _numeric_methods(operator.pow, "pow") __matmul__ = __rmatmul__ = dot # TODO(shoyer): implement this via divmod() on the leaves def __divmod__(self, other): return self // other, self % other def __rdivmod__(self, other): return other // self, other % self # bitwise __lshift__, __rlshift__ = _numeric_methods(operator.lshift, "lshift") __rshift__, __rrshift__ = _numeric_methods(operator.rshift, "rshift") __and__, __rand__ = _numeric_methods(operator.and_, "and") __xor__, __rxor__ = _numeric_methods(operator.xor, "xor") __or__, __ror__ = _numeric_methods(operator.or_, "or") # unary methods __neg__ = _unary_method(operator.neg, "neg") __pos__ = _unary_method(operator.pos, "pos") __abs__ = _unary_method(abs, "abs") __invert__ = _unary_method(operator.invert, "invert") # numpy methods conj = _unary_method(jnp.conj, "conj") dot = dot real = property(_unary_method(jnp.real, "real")) imag = property(_unary_method(jnp.imag, "imag")) def sum(self): parts = map(jnp.sum, tree_util.tree_leaves(self)) return functools.reduce(operator.add, parts) def mean(self): return self.sum() / len(self) def min(self): parts = map(jnp.min, tree_util.tree_leaves(self)) return jnp.asarray(list(parts)).min() def max(self): parts = map(jnp.max, tree_util.tree_leaves(self)) return jnp.asarray(list(parts)).max() @tree_util.register_pytree_node_class class Vector(VectorMixin): """A wrapper for treating an arbitrary pytree as a 1D vector.""" def __init__(self, tree): self._tree = tree @property def tree(self): return self._tree # TODO(shoyer): consider casting to a common dtype? def __repr__(self): return f"tree_math.Vector({self._tree!r})" def tree_flatten(self): return (self._tree,), None @classmethod def tree_unflatten(cls, _, args): return cls(*args)
# -*- coding: utf-8 -*- from __future__ import unicode_literals from distutils.version import LooseVersion from functools import reduce import operator from cms import __version__ as CMS_VERSION from django.core import checks from django.db import models from django.db.models.aggregates import Sum from django.db.models.functions import Coalesce from django.utils import six from django.utils import timezone from django.utils.encoding import force_text from django.utils.six.moves.urllib.parse import urljoin from django.utils.translation import ugettext_lazy as _ from polymorphic.managers import PolymorphicManager from polymorphic.models import PolymorphicModel from shop import deferred from shop.conf import app_settings from shop.exceptions import ProductNotAvailable class Availability(object): """ Contains the currently available quantity for a given product and period. """ def __init__(self, **kwargs): """ :param earliest: Point in time from when on this product will be available. :param latest: Point in time until this product will be available. :param quantity: Number of available items. The type of this value is the same as the type of ``quantity`` in :class:`shop.models.cart.CartItemModel`. :param sell_short: If ``True``, sell the product even though it's not in stock. It then will be shipped at the point in time specified by ``earliest``. :param limited_offer: If ``True``, sell the product until the point in time specified by ``latest``. After that period, the product will not be available anymore. """ tzinfo = timezone.get_current_timezone() self.earliest = kwargs.get('earliest', timezone.datetime.min.replace(tzinfo=tzinfo)) self.latest = kwargs.get('latest', timezone.datetime.max.replace(tzinfo=tzinfo)) quantity = kwargs.get('quantity', app_settings.MAX_PURCHASE_QUANTITY) self.quantity = min(quantity, app_settings.MAX_PURCHASE_QUANTITY) self.sell_short = bool(kwargs.get('sell_short', False)) self.limited_offer = bool(kwargs.get('limited_offer', False)) self.inventory = bool(kwargs.get('inventory', None)) class AvailableProductMixin(object): """ Add this mixin class to the product models declaration, wanting to keep track on the current amount of products in stock. In comparison to :class:`shop.models.product.ReserveProductMixin`, this mixin does not reserve items in pending carts, with the risk for overselling. It thus is suited for products kept in the cart for a long period. The product class must implement a field named ``quantity`` accepting numerical values. """ def get_availability(self, request, **kwargs): """ Returns the current available quantity for this product. If other customers have pending carts containing this same product, the quantity is not not adjusted. This may result in a situation, where someone adds a product to the cart, but then is unable to purchase, because someone else bought it in the meantime. """ return Availability(quantity=self.quantity) def deduct_from_stock(self, quantity, **kwargs): if quantity > self.quantity: raise ProductNotAvailable(self) self.quantity -= quantity self.save(update_fields=['quantity']) def managed_availability(self): return True @classmethod def check(cls, **kwargs): from shop.models.cart import CartItemModel errors = super(AvailableProductMixin, cls).check(**kwargs) for cart_field in CartItemModel._meta.fields: if cart_field.attname == 'quantity': break else: msg = "Class `{}` must implement a field named `quantity`." errors.append(checks.Error(msg.format(CartItemModel.__name__))) for field in cls._meta.fields: if field.attname == 'quantity': if field.get_internal_type() != cart_field.get_internal_type(): msg = "Field `{}.quantity` must be of same type as `{}.quantity`." errors.append(checks.Error(msg.format(cls.__name__, CartItemModel.__name__))) break else: msg = "Class `{}` must implement a field named `quantity`." errors.append(checks.Error(msg.format(cls.__name__))) return errors class BaseReserveProductMixin(object): def get_availability(self, request, **kwargs): """ Returns the current available quantity for this product. If other customers have pending carts containing this same product, the quantity is adjusted accordingly. Therefore make sure to invalidate carts, which were not converted into an order after a determined period of time. Otherwise the quantity returned by this function might be considerably lower, than what it could be. """ from shop.models.cart import CartItemModel availability = super(BaseReserveProductMixin, self).get_availability(request, **kwargs) cart_items = CartItemModel.objects.filter(product=self).values('quantity') availability.quantity -= cart_items.aggregate(sum=Coalesce(Sum('quantity'), 0))['sum'] return availability class ReserveProductMixin(BaseReserveProductMixin, AvailableProductMixin): """ Add this mixin class to the product models declaration, wanting to keep track on the current amount of products in stock. In comparison to :class:`shop.models.product.AvailableProductMixin`, this mixin reserves items in pending carts, without the risk for overselling. On the other hand, the shop may run out of sellable items, if customers keep products in the cart for a long period, without proceeding to checkout. Use this mixin for products kept for a short period until checking out the cart, for instance for ticket sales. Ensure that pending carts are flushed regularly. The product class must implement a field named ``quantity`` accepting numerical values. """ class BaseProductManager(PolymorphicManager): """ A base ModelManager for all non-object manipulation needs, mostly statistics and querying. """ def select_lookup(self, search_term): """ Returning a queryset containing the products matching the declared lookup fields together with the given search term. Each product can define its own lookup fields using the member list or tuple `lookup_fields`. """ filter_by_term = (models.Q((sf, search_term)) for sf in self.model.lookup_fields) queryset = self.get_queryset().filter(reduce(operator.or_, filter_by_term)) return queryset def indexable(self): """ Return a queryset of indexable Products. """ queryset = self.get_queryset().filter(active=True) return queryset class PolymorphicProductMetaclass(deferred.PolymorphicForeignKeyBuilder): @classmethod def perform_meta_model_check(cls, Model): """ Perform some safety checks on the ProductModel being created. """ if not isinstance(Model.objects, BaseProductManager): msg = "Class `{}.objects` must provide ModelManager inheriting from BaseProductManager" raise NotImplementedError(msg.format(Model.__name__)) if not isinstance(getattr(Model, 'lookup_fields', None), (list, tuple)): msg = "Class `{}` must provide a tuple of `lookup_fields` so that we can easily lookup for Products" raise NotImplementedError(msg.format(Model.__name__)) if not callable(getattr(Model, 'get_price', None)): msg = "Class `{}` must provide a method implementing `get_price(request)`" raise NotImplementedError(msg.format(cls.__name__)) class BaseProduct(six.with_metaclass(PolymorphicProductMetaclass, PolymorphicModel)): """ An abstract basic product model for the shop. It is intended to be overridden by one or more polymorphic models, adding all the fields and relations, required to describe this type of product. Some attributes for this class are mandatory. They shall be implemented as property method. The following fields MUST be implemented by the inheriting class: ``product_name``: Return the pronounced name for this product in its localized language. Additionally the inheriting class MUST implement the following methods ``get_absolute_url()`` and ``get_price()``. See below for details. Unless each product variant offers it's own product code, it is strongly recommended to add a field ``product_code = models.CharField(_("Product code"), max_length=255, unique=True)`` to the class implementing the product. """ created_at = models.DateTimeField( _("Created at"), auto_now_add=True, ) updated_at = models.DateTimeField( _("Updated at"), auto_now=True, ) active = models.BooleanField( _("Active"), default=True, help_text=_("Is this product publicly visible."), ) class Meta: abstract = True verbose_name = _("Product") verbose_name_plural = _("Products") def product_type(self): """ Returns the polymorphic type of the product. """ return force_text(self.polymorphic_ctype) product_type.short_description = _("Product type") @property def product_model(self): """ Returns the polymorphic model name of the product's class. """ return self.polymorphic_ctype.model def get_absolute_url(self): """ Hook for returning the canonical Django URL of this product. """ msg = "Method get_absolute_url() must be implemented by subclass: `{}`" raise NotImplementedError(msg.format(self.__class__.__name__)) def get_price(self, request): """ Hook for returning the current price of this product. The price shall be of type Money. Read the appropriate section on how to create a Money type for the chosen currency. Use the `request` object to vary the price according to the logged in user, its country code or the language. """ msg = "Method get_price() must be implemented by subclass: `{}`" raise NotImplementedError(msg.format(self.__class__.__name__)) def get_product_variant(self, **kwargs): """ Hook for returning the variant of a product using parameters passed in by **kwargs. If the product has no variants, then return the product itself. :param **kwargs: A dictionary describing the product's variations. """ return self def get_availability(self, request, **kwargs): """ Hook for checking the availability of a product. :param request: Optionally used to vary the availability according to the logged in user, its country code or language. :param **kwargs: Extra arguments passed to the underlying method. Useful for products with variations. :return: An object of type :class:`shop.models.product.Availability`. """ return Availability() def managed_availability(self): """ :return True: If this product has its quantity managed by some inventory functionality. """ return False def is_in_cart(self, cart, watched=False, **kwargs): """ Checks if the current product is already in the given cart, and if so, returns the corresponding cart_item. :param watched (bool): This is used to determine if this check shall only be performed for the watch-list. :param **kwargs: Optionally one may pass arbitrary information about the product being looked up. This can be used to determine if a product with variations shall be considered equal to the same cart item, resulting in an increase of it's quantity, or if it shall be considered as a separate cart item, resulting in the creation of a new item. :returns: The cart item (of type CartItem) containing the product considered as equal to the current one, or ``None`` if no product matches in the cart. """ from shop.models.cart import CartItemModel cart_item_qs = CartItemModel.objects.filter(cart=cart, product=self) return cart_item_qs.first() def deduct_from_stock(self, quantity, **kwargs): """ Hook to deduct a number of items of the current product from the stock's inventory. :param quantity: Number of items to deduct. :param **kwargs: Extra arguments passed to the underlying method. Useful for products with variations. """ def get_weight(self): """ Optional hook to return the product's gross weight in kg. This information is required to estimate the shipping costs. The merchants product model shall override this method. """ return 0 @classmethod def check(cls, **kwargs): errors = super(BaseProduct, cls).check(**kwargs) try: cls.product_name except AttributeError: msg = "Class `{}` must provide a model field implementing `product_name`" errors.append(checks.Error(msg.format(cls.__name__))) return errors ProductModel = deferred.MaterializedModel(BaseProduct) class CMSPageReferenceMixin(object): """ Products which refer to CMS pages in order to emulate categories, normally need a method for being accessed directly through a canonical URL. Add this mixin class for adding a ``get_absolute_url()`` method to any to product model. """ category_fields = ['cms_pages'] # used by ProductIndex to fill the categories def get_absolute_url(self): """ Return the absolute URL of a product """ # sorting by highest level, so that the canonical URL # associates with the most generic category if LooseVersion(CMS_VERSION) < LooseVersion('3.5'): cms_page = self.cms_pages.order_by('depth').last() else: cms_page = self.cms_pages.order_by('node__path').last() if cms_page is None: return urljoin('/category-not-assigned/', self.slug) return urljoin(cms_page.get_absolute_url(), self.slug)
############################################################################### ## fs.py ## 9te [angband.ornl.gov] ## Wed Jan 12 10:37:50 2011 ############################################################################### ## Copyright (C) 2008 Oak Ridge National Laboratory, UT-Battelle, LLC. ##---------------------------------------------------------------------------## ## generated by /data/denovo/production/head/setup/bin/pygen built on 20110112 ############################################################################### import os, sys, math, string # pyspn equation type from spn_fv import * print_it = False ##---------------------------------------------------------------------------## ## MAIN ##---------------------------------------------------------------------------## initialize(sys.argv) if node() == 0: print "Denovo - pyspn Python Front-End" print "-------------------------------" print "Release : %16s" % (release()) print "Release Date : %16s" % (release_date()) print "Build Date : %16s" % (build_date()) print timer = Timer() timer.start() ##---------------------------------------------------------------------------## ## XS DATA ####### UO2 Fuel-Clad Macroscopic Cross Sections ########## ## Transport-corrected Total Cross Sections T_UO2 = [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] T_UO2[0] = 1.77949e-1 T_UO2[1] = 3.29805e-1 T_UO2[2] = 4.80388e-1 T_UO2[3] = 5.54367e-1 T_UO2[4] = 3.11801e-1 T_UO2[5] = 3.95168e-1 T_UO2[6] = 5.64406e-1 ## Fission Cross Section F_UO2 = [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] F_UO2[0] = 7.21206e-3 F_UO2[1] = 8.19301e-4 F_UO2[2] = 6.45320e-3 F_UO2[3] = 1.85648e-2 F_UO2[4] = 1.78084e-2 F_UO2[5] = 8.30348e-2 F_UO2[6] = 2.16004e-1 ## Nu N_UO2 = [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] N_UO2[0] = 2.78145 N_UO2[1] = 2.47443 N_UO2[2] = 2.43383 N_UO2[3] = 2.43380 N_UO2[4] = 2.43380 N_UO2[5] = 2.43380 N_UO2[6] = 2.43380 ## Chi C_UO2 = [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] C_UO2[0] = 5.87910e-1 C_UO2[1] = 4.11760e-1 C_UO2[2] = 3.39060e-4 C_UO2[3] = 1.17610e-7 C_UO2[4] = 0.00000000 C_UO2[5] = 0.00000000 C_UO2[6] = 0.00000000 ## Scattering Matrix for UO2 Fuel-Clad (Macroscopic) S_UO2 = [ [[]], [[]], [[]], [[]], [[]], [[]], [[]]] S_UO2[0] = [[1.27537e-1]] S_UO2[1] = [[4.23780e-2], [3.24456e-1]] S_UO2[2] = [[9.43740e-6], [1.63140e-3], [4.50940e-1]] S_UO2[3] = [[5.51630e-9], [3.14270e-9], [2.67920e-3], [4.52565e-1], [1.25250e-4]] S_UO2[4] = [[0.00000000], [0.00000000], [0.00000000], [5.56640e-3], [2.71401e-1], [1.29680e-3]] S_UO2[5] = [[0.00000000], [0.00000000], [0.00000000], [0.00000000], [1.02550e-2], [2.65802e-1], [8.54580e-3]] S_UO2[6] = [[0.00000000], [0.00000000], [0.00000000], [0.00000000], [1.00210e-8], [1.68090e-2], [2.73080e-1]] ## Upscattering Matrix U_UO2 = [ [], [], [], [], [], [], [] ] U_UO2[0] = [] U_UO2[1] = [] U_UO2[2] = [] U_UO2[3] = [4] U_UO2[4] = [5] U_UO2[5] = [6] U_UO2[6] = [] ######## 4.3% MOX Fuel-Clad Macroscopic Cross-Sections ############ ## Transport-corrected Total Cross Sections T_MOX43 = [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] T_MOX43[0] = 1.78731e-1 T_MOX43[1] = 3.30849e-1 T_MOX43[2] = 4.83772e-1 T_MOX43[3] = 5.66922e-1 T_MOX43[4] = 4.26227e-1 T_MOX43[5] = 6.78997e-1 T_MOX43[6] = 6.82852e-1 ## Fission Cross-Sections F_MOX43 = [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] F_MOX43[0] = 7.62704e-3 F_MOX43[1] = 8.76898e-4 F_MOX43[2] = 5.69835e-3 F_MOX43[3] = 2.28872e-2 F_MOX43[4] = 1.07635e-2 F_MOX43[5] = 2.32757e-1 F_MOX43[6] = 2.48968e-1 ## Nu Cross-Sections N_MOX43 = [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] N_MOX43[0] = 2.85209 N_MOX43[1] = 2.89099 N_MOX43[2] = 2.85486 N_MOX43[3] = 2.86073 N_MOX43[4] = 2.85447 N_MOX43[5] = 2.86415 N_MOX43[6] = 2.86780 ## Chi Cross-Sections C_MOX43 = [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] C_MOX43[0] = 5.87910e-1 C_MOX43[1] = 4.11760e-1 C_MOX43[2] = 3.39060e-4 C_MOX43[3] = 1.17610e-7 C_MOX43[4] = 0.00000000 C_MOX43[5] = 0.00000000 C_MOX43[6] = 0.00000000 ## Scattering Matrix for 4.3% MOX Fuel-Clad (Macroscopic) S_MOX43 = [ [[]], [[]], [[]], [[]], [[]], [[]], [[]] ] S_MOX43[0] = [[1.28876e-1]] S_MOX43[1] = [[4.14130e-2], [3.25452e-1]] S_MOX43[2] = [[8.22900e-6], [1.63950e-3], [4.53188e-1]] S_MOX43[3] = [[5.04050e-9], [1.59820e-9], [2.61420e-3], [4.57173e-1], [1.60460e-4]] S_MOX43[4] = [[0.00000000], [0.00000000], [0.00000000], [5.53940e-3], [2.76814e-1], [2.00510e-3]] S_MOX43[5] = [[0.00000000], [0.00000000], [0.00000000], [0.00000000], [9.31270e-3], [2.52962e-1], [8.49480e-3]] S_MOX43[6] = [[0.00000000], [0.00000000], [0.00000000], [0.00000000], [9.16560e-9], [1.48500e-2], [2.65007e-1]] ## Upscattering Matrix U_MOX43 = [ [], [], [], [], [], [], [] ] U_MOX43[0] = [] U_MOX43[1] = [] U_MOX43[2] = [] U_MOX43[3] = [4] U_MOX43[4] = [5] U_MOX43[5] = [6] U_MOX43[6] = [] ############### Moderator 1 Macroscopic Cross-Sections ################ ## Transport-corrected Total Cross Section T_MOD1 = [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] T_MOD1[0] = 1.59206e-1 T_MOD1[1] = 4.12970e-1 T_MOD1[2] = 5.90310e-1 T_MOD1[3] = 5.84350e-1 T_MOD1[4] = 7.18000e-1 T_MOD1[5] = 1.25445 T_MOD1[6] = 2.65038 ## Scattering Matrix for Moderator (Macroscopic) S_MOD1 = [ [[]], [[]], [[]], [[]], [[]], [[]], [[]] ] S_MOD1[0] = [[4.44777e-2]] S_MOD1[1] = [[1.13400e-1], [2.82334e-1]] S_MOD1[2] = [[7.23470e-4], [1.29940e-1], [3.45256e-1]] S_MOD1[3] = [[3.74990e-6], [6.23400e-4], [2.24570e-1], [9.10284e-2], [7.14370e-5]] S_MOD1[4] = [[5.31840e-8], [4.80020e-5], [1.69990e-2], [4.15510e-1], [1.39138e-1], [2.21570e-3]] S_MOD1[5] = [[0.00000000], [7.44860e-6], [2.64430e-3], [6.37320e-2], [5.11820e-1], [6.99913e-1], [1.32440e-1]] S_MOD1[6] = [[0.00000000], [1.04550e-6], [5.03440e-4], [1.21390e-2], [6.12290e-2], [5.37320e-1], [2.48070 ]] ## Upscattering Matrix U_MOD1 = [ [], [], [], [], [], [], [] ] U_MOD1[0] = [] U_MOD1[1] = [] U_MOD1[2] = [] U_MOD1[3] = [4] U_MOD1[4] = [5] U_MOD1[5] = [6] U_MOD1[6] = [] ################### Create nuf vectors NUF_UO2 = [] NUF_MOX43 = [] for i in range(0, 7): NUF_UO2.append( N_UO2[i] * F_UO2[i] ) NUF_MOX43.append( N_MOX43[i] * F_MOX43[i] ) ##---------------------------------------------------------------------------## ## BUILD MESH def build_mesh(N): # vacuum = 0 # UO2 = 1 # MOX = 2 # moderator = 3 # UO2 pins uo2_pin = Pincell() uo2_ids = [1] uo2_r = [0.4759] uo2_pin.set_shells(uo2_ids, uo2_r, 3) # MOX pins mox_pin = Pincell() mox_ids = [2] mox_r = [0.4759] mox_pin.set_shells(mox_ids, mox_r, 3) # Make a 2x2 uo2 lattice and a 2x2 mox lattice uo2_lat = Lattice(2) mox_lat = Lattice(2) # lattices are uniform layout = [0, 0, 0, 0] uo2_lat.set_pins(layout) mox_lat.set_pins(layout) # assign the pins in the lattices uo2_lat.assign_pin(uo2_pin, 0) mox_lat.assign_pin(mox_pin, 0) # build the lattice uo2_lat.build_lattice(N) mox_lat.build_lattice(N) # print out mixing tables if print_it: print "UO2 Lattice" for m in xrange(uo2_lat.num_mixtures()): vf = uo2_lat.f(m) print "%4i" % (m), for f in vf: print "%9.6f" % (f), print print "MOX Lattice" for m in xrange(mox_lat.num_mixtures()): vf = mox_lat.f(m) print "%4i" % (m), for f in vf: print "%9.6f" % (f), print # make the mixtable for the combined lattices by appending the mox table # to the UO2 table (don't include the clean mixtures at the front of the # table) num_mixtures = uo2_lat.num_mixtures() + mox_lat.num_mixtures() - 4 table = Vec_Dbl(num_mixtures * 4) ctr = 0 mox_offset = uo2_lat.num_mixtures() # add UO2 mixtures for m in xrange(uo2_lat.num_mixtures()): vf = uo2_lat.f(m) for f in vf: table[ctr] = f ctr = ctr + 1 # add MOX mixtures, skipping the clean mixes for m in xrange(4, mox_lat.num_mixtures()): vf = mox_lat.f(m) for f in vf: table[ctr] = f ctr = ctr + 1 # make the cleanids cleanids = [0, 1, 2, 3] # the total core is 3x3 assemblies (2x2 fuel surrounded by water) xylat = uo2_lat.xy_planes() Nr = len(xylat) - 1 delta = Vec_Dbl(Nr, 0.0) for i in xrange(Nr): delta[i] = xylat[i+1] - xylat[i] if Nr % 2 != 0: print "Non-even lattices cells." sys.exit(1) # build the core planes xycore = Vec_Dbl(int(2.5*Nr) + 1, 0.0) for n in xrange(2): for i in xrange(Nr): index = i + n * Nr xycore[index + 1] = xycore[index] + delta[i] for i in xrange(Nr/2): index = i + 2 * Nr xycore[index + 1] = xycore[index] + delta[i] # z-planes (14 in each assembly) height = 14.28 * 1.5 Nz = 21 z = [0.0] * (Nz + 1) dz = height / float(Nz) for k in xrange(Nz): z[k+1] = z[k] + dz # get matids for each lattice uo2ids = Vec_Int(uo2_lat.mixids()) moxids = Vec_Int(mox_lat.mixids()) # update the mox mixtures (leave clean zones alone) for m in xrange(len(moxids)): if moxids[m] > 3: moxids[m] = moxids[m] + mox_offset - 4 # assign the matids Nx = len(xycore) - 1 Ny = len(xycore) - 1 # arrangement # |-----|-----|-----| # | | | | # | mod | mod | mod | # | | | | # |-----|-----|-----| # | | | | # | mox | uo2 | mod | y # | | | | # |-----|-----|-----| # | | | | # | uo2 | mox | mod | # | | | | # |-----|-----|-----| # x mixids = Vec_Int(Nx * Ny * Nz, 3) kend = Nz / 2 # (0, 0) lattice for k in xrange(kend): for j in xrange(Nr): for i in xrange(Nr): lat_cell = i + j * Nr cell = i + j * Ny + k * Nx * Ny mixids[cell] = uo2ids[lat_cell] # (1, 0) lattice for k in xrange(kend): for j in xrange(Nr): for i in xrange(Nr): lat_cell = i + j * Nr cell = (i + Nr) + j * Ny + k * Nx * Ny mixids[cell] = moxids[lat_cell] # (0, 1) lattice for k in xrange(kend): for j in xrange(Nr): for i in xrange(Nr): lat_cell = i + j * Nr cell = i + (j + Nr) * Ny + k * Nx * Ny mixids[cell] = moxids[lat_cell] # (1, 1) lattice for k in xrange(kend): for j in xrange(Nr): for i in xrange(Nr): lat_cell = i + j * Nr cell = (i + Nr) + (j + Nr) * Ny + k * Nx * Ny mixids[cell] = uo2ids[lat_cell] return (xycore, z, mixids, cleanids, table) ##---------------------------------------------------------------------------## ## DB ##---------------------------------------------------------------------------## entries = { "problem_type" : "FIXED_SOURCE", "num_groups" : 7, "downscatter" : False, "Pn_order" : 0, "tolerance" : 1.0e-3, "max_itr" : 400, "linear_solver_xml_file" : "azilu01.xml", "boundary" : "reflect", "boundary_db" : {"reflect" : [1, 0, 1, 0, 1, 0]}, "SPN_order" : 7 } db = DB.from_dict(entries) # decomposition if nodes() == 1: db.insert("num_blocks_i", 1) db.insert("num_blocks_j", 1) elif nodes() == 2: db.insert("num_blocks_i", 2) db.insert("num_blocks_j", 1) elif nodes() == 16: db.insert("num_blocks_i", 4) db.insert("num_blocks_j", 4) # Mesh (r, z, mixids, cleanids, table) = build_mesh(10) db.insert("x_edges", r) db.insert("y_edges", r) db.insert("z_edges", z) ##---------------------------------------------------------------------------## ## MANAGER ##---------------------------------------------------------------------------## # make manager, material, and angles manager = Manager() mat = Mat() # partition the problem manager.partition(db, mat) # get mapping and mesh objects mapp = manager.get_map() indexer = manager.get_indexer() mesh = manager.get_mesh() # global and local cell numbers Gx = indexer.num_global(X) Gy = indexer.num_global(Y) Gz = mesh.num_cells_dim(Z) Nx = mesh.num_cells_dim(X) Ny = mesh.num_cells_dim(Y) Nz = mesh.num_cells_dim(Z) if node() == 0: print ">>> Partitioned global mesh with %i x %i x %i cells" \ % (Gx, Gy, Gz) ##---------------------------------------------------------------------------## ## MATERIAL SETUP ##---------------------------------------------------------------------------## # vacuum = 0 # UO2 = 1 # MOX = 2 # moderator = 3 # set database xsdb = XS_DB(db) xsdb.set_num(4) xsdb.assign_zero(0) for g in xrange(0, xsdb.num_groups()): xsdb.assign_upscatter(1, g, T_UO2[g], U_UO2[g], S_UO2[g]) xsdb.assign_upscatter(2, g, T_MOX43[g], U_MOX43[g], S_MOX43[g]) xsdb.assign_upscatter(3, g, T_MOD1[g], U_MOD1[g], S_MOD1[g]) ## Assign fission data xsdb.assign_fission(1, NUF_UO2, C_UO2) xsdb.assign_fission(2, NUF_MOX43, C_MOX43) # make macro mixer mixer = Macro_Mixer(xsdb) mixer.set(cleanids, table) # make the material database mixer.mix_with_global_ids(mixids, mat) ##---------------------------------------------------------------------------## ## ENERGY PARTITIONING ##---------------------------------------------------------------------------## manager.partition_energy(mat) ##---------------------------------------------------------------------------## ## SOURCE SETUP ##---------------------------------------------------------------------------## # allocate source and problem state source = Isotropic_Source() manager.setup(source) total = Gx * Gy * Gz Ng = mat.num_groups() srcids = Vec_Int(total, 0) srcstr = Vec_Dbl(total, 0.0) num_shapes = 2 shapes = Vec_Dbl(2 * mat.num_groups(), 0.0) chi0 = xsdb.fission_data(1, 0, CHI) chi1 = xsdb.fission_data(2, 0, CHI) # source 0 spectrum -> UO2 Chi # source 1 spectrum -> MOX Chi # make shapes ctr = 0 for g in xrange(Ng): shapes[ctr] = xsdb.fission_data(1, g, CHI) ctr += 1 for g in xrange(Ng): shapes[ctr] = xsdb.fission_data(2, g, CHI) ctr += 1 # assign ids and strengths for cell in xrange(total): matid = mixids[cell] if mat.assigned_fission(matid): for g in xrange(Ng): srcstr[cell] += mat.fission_data(matid, g, NU_SIGMA_F) if mat.fission_data(matid, 0, CHI) == chi1: srcids[cell] = 1 # set the source source.set(num_shapes, shapes, srcids, srcstr) ##---------------------------------------------------------------------------## ## SOLVE ##---------------------------------------------------------------------------## if node() == 0: print ">>> Setup complete" print ">>> Solving with %s differencing" % (manager.spatial_descriptor()) # solve the problem manager.solve(source) ##---------------------------------------------------------------------------## ## OUTPUT ##---------------------------------------------------------------------------## # make SILO output silo = SILO() silo.add_mixer(mixer) silo.open("fs") phi = Vec_Dbl(mesh.num_cells(), 0.0) for g in xrange(Ng): flux = manager.moments(g) for cell in xrange(mesh.num_cells()): phi[cell] = phi[cell] + flux.scalar_flux(cell) silo.add("phi", phi) silo.close() ##---------------------------------------------------------------------------## ## TIMING ##---------------------------------------------------------------------------## # output final database (has class-dependent defaults) db.output() timer.stop() time = timer.wall_clock() keys = timer_keys() if len(keys) > 0 and node() == 0: print "\n" print "TIMING : Problem ran in %16.6e seconds." % (time) print "------------------------------------------------------------------" for key in keys: print "%30s : %16.6e %16.6e" % (key, timer_value(key) / time, timer_value(key)) print "------------------------------------------------------------------" ##---------------------------------------------------------------------------## manager.close() finalize() ############################################################################### ## end of fs.py ###############################################################################
# -*- coding: utf-8 -*- from flask import Blueprint, jsonify, request from pns.app import app from pns.forms import CreateChannelForm from pns.models import db, Channel, User, Alert from pns.json_schemas import registration_schema channel = Blueprint('channel', __name__) @channel.route('/channels', methods=['POST']) def create_channel(): """ @api {post} /channels Create Channel @apiVersion 1.0.0 @apiName CreateChannel @apiGroup Channel @apiParam {String {..255}} name Channel name @apiParam {String} [description] Channel description @apiSuccess {Boolean} success Request status @apiSuccess {Object} message Respond payload @apiSuccess {Object} message.channel Channel object """ form = CreateChannelForm() if not form.validate_on_submit(): return jsonify(success=False, message=form.errors), 400 name = request.values.get('name') description = request.values.get('description', None) channel_obj = Channel.query.filter_by(name=name).first() if channel_obj: return jsonify(success=True, message={'channel': channel_obj.to_dict()}) channel_obj = Channel() channel_obj.name = name if description: channel_obj.description = description db.session.add(channel_obj) try: db.session.commit() return jsonify(success=True, message={'channel': channel_obj.to_dict()}) except Exception as ex: db.session.rollback() app.logger.exception(ex) return jsonify(success=False), 500 @channel.route('/channels', methods=['GET']) def list_channels(): """ @api {get} /channels List Channels @apiVersion 1.0.0 @apiName ListChannels @apiGroup Channel @apiParam {Number} offset=1 @apiParam {Number} limit=20 @apiSuccess {Boolean} success Request status @apiSuccess {Object} message Respond payload @apiSuccess {Array} message.channels Channel object array @apiSuccess {Number} message.total_pages Total number of available pages @apiSuccess {Number} message.current_page Current page number @apiSuccess {Boolean} message.has_next Next page available flag """ try: offset = int(request.values.get('offset', 1)) limit = int(request.values.get('limit', 20)) except ValueError: offset = 1 limit = 20 query = (Channel .query .order_by(Channel.created_at.desc()) .paginate(page=offset, per_page=limit, error_out=False)) channels = [channel_obj.to_dict() for channel_obj in query.items] return jsonify(success=True, message={'channels': channels, 'total_pages': query.pages, 'current_page': offset, 'has_next': query.has_next}) @channel.route('/channels/<int:channel_id>', methods=['GET']) def get_channel(channel_id): """ @api {get} /channels/:channel_id Get Unique Channel @apiVersion 1.0.0 @apiName GetChannel @apiGroup Channel @apiSuccess {Boolean} success Request status @apiSuccess {Object} message Respond payload @apiSuccess {Array} message.channel Channel object array """ channel_obj = Channel.query.get(channel_id) if not channel_obj: return jsonify(success=False, message='not found'), 404 return jsonify(success=True, message={'channel': channel_obj.to_dict()}) @channel.route('/channels/<int:channel_id>', methods=['DELETE']) def delete_channel(channel_id): """ @api {delete} /channels/:channel_id Delete Channel @apiVersion 1.0.0 @apiName DeleteChannel @apiGroup Channel @apiSuccess {Boolean} success Request status @apiSuccess {Object} message Respond payload @apiSuccess {Object} message.channel Channel object """ channel_obj = Channel.query.get(channel_id) if not channel_obj: return jsonify(success=False, message='not found'), 404 db.session.delete(channel_obj) try: db.session.commit() return jsonify(success=True, message={'channel': channel_obj.to_dict()}) except Exception as ex: db.session.rollback() app.logger.exception(ex) return jsonify(success=False), 500 @channel.route('/channels/<int:channel_id>', methods=['PUT']) def edit_channel(channel_id): """ @api {put} /channels/:channel_id Update Channel @apiVersion 1.0.0 @apiName UpdateChannel @apiGroup Channel @apiParam {String {..255}} [name] Channel name @apiParam {String} [description] Channel description @apiSuccess {Boolean} success Request status @apiSuccess {Object} message Respond payload @apiSuccess {Object} message.channel Channel object """ form = CreateChannelForm() if not form.validate_on_submit(): return jsonify(success=False, message=form.errors), 400 name = request.values.get('name') description = request.values.get('description', None) channel_obj = Channel.query.get(channel_id) if not channel_obj: return jsonify(success=False, message='not found'), 404 channel_obj.name = name if description: channel_obj.description = description db.session.add(channel_obj) try: db.session.commit() return jsonify(success=True, message={'channel': channel_obj.to_dict()}) except Exception as ex: db.session.rollback() app.logger.exception(ex) return jsonify(success=False), 500 @channel.route('/channels/<int:channel_id>/members', methods=['POST']) def register_user(channel_id): """ @api {post} /channels/:channel_id/members Subscribe to Channel @apiVersion 1.0.0 @apiName RegisterUserToChannel @apiGroup Channel @apiParam {Array} pns_id Recipients list. Array elements correspond to `pns_id` @apiParamExample {json} Request-Example: { 'pns_id': ['alex@example.com', 'neil@example.com'] } @apiSuccess {Boolean} success Request status @apiSuccess {Object} message Respond payload @apiSuccess {Object} message.channel Channel object @apiSuccess {Object} message.users Users object array """ json_req = request.get_json(force=True) try: registration_schema.validate(json_req) except Exception as ex: return jsonify(success=False, message={'error': str(ex)}), 400 pns_id_list = [pns_id.strip() for pns_id in json_req['pns_id']] channel_obj = Channel.query.get(channel_id) if not channel_obj: return jsonify(success=False, message='not found'), 404 users = User.query.filter(User.pns_id.in_(pns_id_list)).all() for user in users: channel_obj.subscribe_user(user) return jsonify(success=True, message={'channel': channel_obj.to_dict(), 'users': [user.to_dict() for user in users]}) @channel.route('/channels/<int:channel_id>/members', methods=['GET']) def list_channel_members(channel_id): """ @api {get} /channels/:channel_id/members List Channel Members @apiVersion 1.0.0 @apiName GetChannelMembers @apiGroup Channel @apiParam {Number} offset=1 @apiParam {Number} limit=20 @apiSuccess {Boolean} success Request status @apiSuccess {Object} message Respond payload @apiSuccess {Array} message.users User object array @apiSuccess {Number} message.total_pages Total number of available pages @apiSuccess {Number} message.current_page Current page number @apiSuccess {Boolean} message.has_next Next page available flag """ try: offset = int(request.values.get('offset', 1)) limit = int(request.values.get('limit', 20)) except ValueError: offset = 1 limit = 20 channel_obj = Channel.query.get(channel_id) if not channel_obj: return jsonify(success=False, message='not found'), 404 query = (channel_obj .subscribers .paginate(page=offset, per_page=limit, error_out=False)) users = [user.to_dict() for user in query.items] return jsonify(success=True, message={'users': users, 'total_pages': query.pages, 'current_page': offset, 'has_next': query.has_next}) @channel.route('/channels/<int:channel_id>/members/<pns_id>', methods=['DELETE']) def unregister_user(channel_id, pns_id): """ @api {delete} /channels/:channel_id/members/:pns_id Unsubscribe from Channel @apiVersion 1.0.0 @apiName UnregisterUser @apiGroup Channel @apiSuccess {Boolean} success Request status @apiSuccess {Object} message Respond payload @apiSuccess {Object} message.channel Channel object @apiSuccess {Object} message.user User object """ user_obj = User.query.filter_by(pns_id=pns_id).first() channel_obj = Channel.query.get(channel_id) if not user_obj or not channel_obj: return jsonify(success=False, message='not found'), 404 if channel_obj.unsubscribe_user(user_obj): return jsonify(success=True, message={'channel': channel_obj.to_dict(), 'user': user_obj.to_dict()}) else: return jsonify(success=False), 500 @channel.route('/channels/<int:channel_id>/alerts', methods=['GET']) def list_channel_alerts(channel_id): """ @api {get} /channels/:channel_id/alerts List Channel Alerts @apiVersion 1.0.0 @apiName GetChannelAlerts @apiGroup Channel @apiParam {Number} offset=1 @apiParam {Number} limit=20 @apiSuccess {Boolean} success Request status @apiSuccess {Object} message Respond payload @apiSuccess {Array} message.users User object array @apiSuccess {Number} message.total_pages Total number of available pages @apiSuccess {Number} message.current_page Current page number @apiSuccess {Boolean} message.has_next Next page available flag """ try: offset = int(request.values.get('offset', 1)) limit = int(request.values.get('limit', 20)) except ValueError: offset = 1 limit = 20 channel_obj = Channel.query.get(channel_id) if not channel_obj: return jsonify(success=False, message='not found'), 404 query = (channel_obj .alerts .order_by(Alert.created_at.desc()) .paginate(page=offset, per_page=limit, error_out=False)) alerts = [alert.to_dict() for alert in query.items] return jsonify(success=True, message={'alerts': alerts, 'total_pages': query.pages, 'current_page': offset, 'has_next': query.has_next})
import Queue import threading import time import struct import serial import colorsys import paho.mqtt.client as mqtt DEVICES = { "OVERHEAD": 0, "SLEEP": 1, "BED_LEFT": 2, "BED_CENTER": 3, "BED_RIGHT": 4 } NUM_LEDS = { "OVERHEAD": 20, "SLEEP": 144, "BED_LEFT": 18, "BED_CENTER": 14, "BED_RIGHT": 18 } ColorTemperature = { "Candle": [0xFF, 0x93, 0x29], "Tungsten40W": [0xFF, 0xC5, 0x8F], "Tungsten100W": [0xFF, 0xD6, 0xAA], "Halogen": [0xFF, 0xF1, 0xE0], "CarbonArc": [0xFF, 0xFA, 0xF4], "HighNoonSun": [0xFF, 0xFF, 0xFB], "DirectSunlight": [0xFF, 0xFF, 0xFF], "OvercastSky": [0xC9, 0xE2, 0xFF], "ClearBlueSky": [0x40, 0x9C, 0xFF], "WarmFluorescent": [0xFF, 0xF4, 0xE5], "StandardFluorescent": [0xF4, 0xFF, 0xFA], "CoolWhiteFluorescent": [0xD4, 0xEB, 0xFF], "FullSpectrumFluorescent": [0xFF, 0xF4, 0xF2], "GrowLightFluorescent": [0xFF, 0xEF, 0xF7], "BlackLightFluorescent": [0xA7, 0x00, 0xFF], "MercuryVapor": [0xD8, 0xF7, 0xFF], "SodiumVapor": [0xFF, 0xD1, 0xB2], "MetalHalide": [0xF2, 0xFC, 0xFF], "HighPressureSodium": [0xFF, 0xB7, 0x4C], "UncorrectedTemperature": [0xFF, 0xFF, 0xFF] } sendQueue = Queue.Queue() class ReceiveThread(threading.Thread): def __init__(self, ser, mqclient): threading.Thread.__init__(self) self.setDaemon(True) self._ser = ser self._mqclient = mqclient def run(self): while True: line = self._ser.readline().strip() self._mqclient.publish("ansiroom/bed/plant", line) class SendThread(threading.Thread): def __init__(self, queue, ser): threading.Thread.__init__(self) self.setDaemon(True) self._queue = queue self._ser = ser def run(self): while True: s = self._queue.get() #print ":".join("{:02x}".format(ord(c)) for c in s) for i in s: self._ser.write(i) self._ser.flush() time.sleep(0.05) self._queue.task_done() #print "DONE" time.sleep(0.5) def on_connect(client, userdata, rc): print("Connected with result code "+str(rc)) client.subscribe("ansiroom/bedlight/#") def on_message(client, userdata, msg): print "Mq Received on channel %s -> %s" % (msg.topic, msg.payload) parts = msg.topic.split("/") device = parts[2] command = parts[3] val = msg.payload print " Device: %s Command %s Value %s" % ( device, command, val ) if command == "fire": if device == "sleep": Fire(DEVICES['SLEEP'], int(val)) if device == "center": Fire(DEVICES['BED_CENTER'], int(val)) if command == "sunrise": if device == "sleep": Sunrise(DEVICES['SLEEP'], 1, int(val)) if command == "colour": values = val.split(",") c = [] for i in range(0, len(values), 3): a = [] a.append(int(values[i+0])) a.append(int(values[i+1])) a.append(int(values[i+2])) c.append(a) if device == "sleep": RGB(DEVICES['SLEEP'], c) if device == "overhead": RGB(DEVICES['OVERHEAD'], c) if device == "center": RGB(DEVICES['BED_CENTER'], c) if device == "left": RGB(DEVICES['BED_LEFT'], c) if device == "right": RGB(DEVICES['BED_RIGHT'], c) def RGB(device, values): if device > 4 or device < 0: return s = '' s += struct.pack("!BB", 0, device) for i in values: s += struct.pack('!{0}B'.format(len(i)), * i) s += ";" sendQueue.put(s) def HSV(device, values): if device > 4 or device < 0: return s = '' s += struct.pack("!BB", 1, device) for i in values: s += struct.pack('!{0}B'.format(len(i)), *i) s += ";" sendQueue.put(s) def fill(size, val): values = [] for i in range(size): values.append(val) return values def Fire(device, intensity): if intensity < 1: s = struct.pack('!BBB', 2, device, 0) s += ";" sendQueue.put(s) RGB(device, fill(20, [0, 0, 0])) else: s = struct.pack('!BBB', 2, device, intensity) s += ";" sendQueue.put(s) def Sunrise(device, num, percentage): if device > 2 or device < 0: return if percentage < 0: RGB(device, fill(num, [0, 0, 0])) return if percentage > 99: RGB(device, fill(num, [255, 255, 255])) else: h = ( (250.0 + (85.0 / 100.0) * percentage) % 256 ) s = 255.0 - ( (51.0 / 2000.0) * (percentage * percentage) ) v = ( (255.0 / 100.0) * percentage ) a, b, c = colorsys.hsv_to_rgb( (h / 255.0), (s / 255.0), (v / 255.0) ) RGB(device, fill(num, [int(a * 255),int(b * 255),int(c * 255)])) if __name__ == "__main__": ser = serial.Serial("/dev/ttyUSB0", 9600) mqclient = mqtt.Client("ansibed", clean_session=True) mqclient.on_connect = on_connect mqclient.on_message = on_message mqclient.connect("cortex", 1883, 60) receive = ReceiveThread(ser, mqclient) receive.start() send = SendThread(sendQueue, ser) send.start() Fire(DEVICES['SLEEP'], 0) Fire(DEVICES['BED_CENTER'], 0) RGB(DEVICES['OVERHEAD'], [[0,0,0]]) RGB(DEVICES['SLEEP'], [[0,0,0]]) RGB(DEVICES['BED_LEFT'], [[0,0,0]]) RGB(DEVICES['BED_CENTER'], [[0,0,0]]) RGB(DEVICES['BED_RIGHT'], [[0,0,0]]) mqclient.loop_forever()
# vim: tabstop=4 shiftwidth=4 softtabstop=4 # Copyright 2011 OpenStack Foundation. # Copyright 2012-2013 Hewlett-Packard Development Company, L.P. # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. """ Utilities with minimum-depends for use in setup.py """ import email import os import re import subprocess import sys from setuptools.command import sdist def parse_mailmap(mailmap='.mailmap'): mapping = {} if os.path.exists(mailmap): with open(mailmap, 'r') as fp: for l in fp: try: canonical_email, alias = re.match( r'[^#]*?(<.+>).*(<.+>).*', l).groups() except AttributeError: continue mapping[alias] = canonical_email return mapping def _parse_git_mailmap(git_dir, mailmap='.mailmap'): mailmap = os.path.join(os.path.dirname(git_dir), mailmap) return parse_mailmap(mailmap) def canonicalize_emails(changelog, mapping): """Takes in a string and an email alias mapping and replaces all instances of the aliases in the string with their real email. """ for alias, email_address in mapping.iteritems(): changelog = changelog.replace(alias, email_address) return changelog # Get requirements from the first file that exists def get_reqs_from_files(requirements_files): for requirements_file in requirements_files: if os.path.exists(requirements_file): with open(requirements_file, 'r') as fil: return fil.read().split('\n') return [] def parse_requirements(requirements_files=['requirements.txt', 'tools/pip-requires']): requirements = [] for line in get_reqs_from_files(requirements_files): # For the requirements list, we need to inject only the portion # after egg= so that distutils knows the package it's looking for # such as: # -e git://github.com/openstack/nova/master#egg=nova if re.match(r'\s*-e\s+', line): requirements.append(re.sub(r'\s*-e\s+.*#egg=(.*)$', r'\1', line)) # such as: # http://github.com/openstack/nova/zipball/master#egg=nova elif re.match(r'\s*https?:', line): requirements.append(re.sub(r'\s*https?:.*#egg=(.*)$', r'\1', line)) # -f lines are for index locations, and don't get used here elif re.match(r'\s*-f\s+', line): pass # argparse is part of the standard library starting with 2.7 # adding it to the requirements list screws distro installs elif line == 'argparse' and sys.version_info >= (2, 7): pass else: requirements.append(line) return requirements def parse_dependency_links(requirements_files=['requirements.txt', 'tools/pip-requires']): dependency_links = [] # dependency_links inject alternate locations to find packages listed # in requirements for line in get_reqs_from_files(requirements_files): # skip comments and blank lines if re.match(r'(\s*#)|(\s*$)', line): continue # lines with -e or -f need the whole line, minus the flag if re.match(r'\s*-[ef]\s+', line): dependency_links.append(re.sub(r'\s*-[ef]\s+', '', line)) # lines that are only urls can go in unmolested elif re.match(r'\s*https?:', line): dependency_links.append(line) return dependency_links def _run_shell_command(cmd, throw_on_error=False): if os.name == 'nt': output = subprocess.Popen(["cmd.exe", "/C", cmd], stdout=subprocess.PIPE, stderr=subprocess.PIPE) else: output = subprocess.Popen(["/bin/sh", "-c", cmd], stdout=subprocess.PIPE, stderr=subprocess.PIPE) out = output.communicate() if output.returncode and throw_on_error: raise Exception("%s returned %d" % cmd, output.returncode) if len(out) == 0: return None if len(out[0].strip()) == 0: return None return out[0].strip() def _get_git_directory(): parent_dir = os.path.dirname(__file__) while True: git_dir = os.path.join(parent_dir, '.git') if os.path.exists(git_dir): return git_dir parent_dir, child = os.path.split(parent_dir) if not child: # reached to root dir return None def write_git_changelog(): """Write a changelog based on the git changelog.""" new_changelog = 'ChangeLog' git_dir = _get_git_directory() if not os.getenv('SKIP_WRITE_GIT_CHANGELOG'): if git_dir: git_log_cmd = 'git --git-dir=%s log' % git_dir changelog = _run_shell_command(git_log_cmd) mailmap = _parse_git_mailmap(git_dir) with open(new_changelog, "w") as changelog_file: changelog_file.write(canonicalize_emails(changelog, mailmap)) else: open(new_changelog, 'w').close() def generate_authors(): """Create AUTHORS file using git commits.""" jenkins_email = 'jenkins@review.(openstack|stackforge).org' old_authors = 'AUTHORS.in' new_authors = 'AUTHORS' git_dir = _get_git_directory() if not os.getenv('SKIP_GENERATE_AUTHORS'): if git_dir: # don't include jenkins email address in AUTHORS file git_log_cmd = ("git --git-dir=" + git_dir + " log --format='%aN <%aE>' | sort -u | " "egrep -v '" + jenkins_email + "'") changelog = _run_shell_command(git_log_cmd) mailmap = _parse_git_mailmap(git_dir) with open(new_authors, 'w') as new_authors_fh: new_authors_fh.write(canonicalize_emails(changelog, mailmap)) if os.path.exists(old_authors): with open(old_authors, "r") as old_authors_fh: new_authors_fh.write('\n' + old_authors_fh.read()) else: open(new_authors, 'w').close() _rst_template = """%(heading)s %(underline)s .. automodule:: %(module)s :members: :undoc-members: :show-inheritance: """ def get_cmdclass(): """Return dict of commands to run from setup.py.""" cmdclass = dict() def _find_modules(arg, dirname, files): for filename in files: if filename.endswith('.py') and filename != '__init__.py': arg["%s.%s" % (dirname.replace('/', '.'), filename[:-3])] = True class LocalSDist(sdist.sdist): """Builds the ChangeLog and Authors files from VC first.""" def run(self): write_git_changelog() generate_authors() # sdist.sdist is an old style class, can't use super() sdist.sdist.run(self) cmdclass['sdist'] = LocalSDist # If Sphinx is installed on the box running setup.py, # enable setup.py to build the documentation, otherwise, # just ignore it try: from sphinx.setup_command import BuildDoc class LocalBuildDoc(BuildDoc): builders = ['html', 'man'] def generate_autoindex(self): print "**Autodocumenting from %s" % os.path.abspath(os.curdir) modules = {} option_dict = self.distribution.get_option_dict('build_sphinx') source_dir = os.path.join(option_dict['source_dir'][1], 'api') if not os.path.exists(source_dir): os.makedirs(source_dir) for pkg in self.distribution.packages: if '.' not in pkg: os.path.walk(pkg, _find_modules, modules) module_list = modules.keys() module_list.sort() autoindex_filename = os.path.join(source_dir, 'autoindex.rst') with open(autoindex_filename, 'w') as autoindex: autoindex.write(""".. toctree:: :maxdepth: 1 """) for module in module_list: output_filename = os.path.join(source_dir, "%s.rst" % module) heading = "The :mod:`%s` Module" % module underline = "=" * len(heading) values = dict(module=module, heading=heading, underline=underline) print "Generating %s" % output_filename with open(output_filename, 'w') as output_file: output_file.write(_rst_template % values) autoindex.write(" %s.rst\n" % module) def run(self): if not os.getenv('SPHINX_DEBUG'): self.generate_autoindex() for builder in self.builders: self.builder = builder self.finalize_options() self.project = self.distribution.get_name() self.version = self.distribution.get_version() self.release = self.distribution.get_version() BuildDoc.run(self) class LocalBuildLatex(LocalBuildDoc): builders = ['latex'] cmdclass['build_sphinx'] = LocalBuildDoc cmdclass['build_sphinx_latex'] = LocalBuildLatex except ImportError: pass return cmdclass def _get_revno(git_dir): """Return the number of commits since the most recent tag. We use git-describe to find this out, but if there are no tags then we fall back to counting commits since the beginning of time. """ describe = _run_shell_command( "git --git-dir=%s describe --always" % git_dir) if "-" in describe: return describe.rsplit("-", 2)[-2] # no tags found revlist = _run_shell_command( "git --git-dir=%s rev-list --abbrev-commit HEAD" % git_dir) return len(revlist.splitlines()) def _get_version_from_git(pre_version): """Return a version which is equal to the tag that's on the current revision if there is one, or tag plus number of additional revisions if the current revision has no tag.""" git_dir = _get_git_directory() if git_dir: if pre_version: try: return _run_shell_command( "git --git-dir=" + git_dir + " describe --exact-match", throw_on_error=True).replace('-', '.') except Exception: sha = _run_shell_command( "git --git-dir=" + git_dir + " log -n1 --pretty=format:%h") return "%s.a%s.g%s" % (pre_version, _get_revno(git_dir), sha) else: return _run_shell_command( "git --git-dir=" + git_dir + " describe --always").replace( '-', '.') return None def _get_version_from_pkg_info(package_name): """Get the version from PKG-INFO file if we can.""" try: pkg_info_file = open('PKG-INFO', 'r') except (IOError, OSError): return None try: pkg_info = email.message_from_file(pkg_info_file) except email.MessageError: return None # Check to make sure we're in our own dir if pkg_info.get('Name', None) != package_name: return None return pkg_info.get('Version', None) def get_version(package_name, pre_version=None): """Get the version of the project. First, try getting it from PKG-INFO, if it exists. If it does, that means we're in a distribution tarball or that install has happened. Otherwise, if there is no PKG-INFO file, pull the version from git. We do not support setup.py version sanity in git archive tarballs, nor do we support packagers directly sucking our git repo into theirs. We expect that a source tarball be made from our git repo - or that if someone wants to make a source tarball from a fork of our repo with additional tags in it that they understand and desire the results of doing that. """ version = os.environ.get("OSLO_PACKAGE_VERSION", None) if version: return version version = "2013.1" #_get_version_from_pkg_info(package_name) if version: return version version = _get_version_from_git(pre_version) if version: return version raise Exception("Versioning for this project requires either an sdist" " tarball, or access to an upstream git repository.")
# All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. import os import time from oslo_config import cfg from oslo_serialization import jsonutils from oslo_utils import fixture as utils_fixture from nova import test from nova.tests import fixtures as nova_fixtures from nova.tests.functional.api import client as api_client from nova.tests.functional import integrated_helpers from nova.tests.unit.api.openstack.compute import test_services from nova.tests.unit import fake_crypto from nova.tests.unit import fake_notifier import nova.tests.unit.image.fake CONF = cfg.CONF class NotificationSampleTestBase(test.TestCase, integrated_helpers.InstanceHelperMixin): """Base class for notification sample testing. To add tests for a versioned notification you have to store a sample file under doc/notification_sample directory. In the test method in the subclass trigger a change in the system that expected to generate the notification then use the _verify_notification function to assert if the stored sample matches with the generated one. If the notification has different payload content depending on the state change you triggered then the replacements parameter of the _verify_notification function can be used to override values coming from the sample file. Check nova.functional.notification_sample_tests.test_service_update as an example. """ ANY = object() REQUIRES_LOCKING = True # NOTE(gibi): Notification payloads always reflect the data needed # for every supported API microversion so we can safe to use the latest # API version in the tests. This helps the test to use the new API # features too. This can be overridden by subclasses that need to cap # at a specific microversion for older APIs. MAX_MICROVERSION = 'latest' def setUp(self): super(NotificationSampleTestBase, self).setUp() api_fixture = self.useFixture(nova_fixtures.OSAPIFixture( api_version='v2.1')) self.api = api_fixture.api self.admin_api = api_fixture.admin_api max_version = self.MAX_MICROVERSION self.api.microversion = max_version self.admin_api.microversion = max_version fake_notifier.stub_notifier(self) self.addCleanup(fake_notifier.reset) self.useFixture(utils_fixture.TimeFixture(test_services.fake_utcnow())) self.flags(driver='chance_scheduler', group='scheduler') # the image fake backend needed for image discovery nova.tests.unit.image.fake.stub_out_image_service(self) self.addCleanup(nova.tests.unit.image.fake.FakeImageService_reset) self.useFixture(nova_fixtures.PlacementFixture()) self.start_service('conductor') self.start_service('scheduler') self.start_service('network', manager=CONF.network_manager) self.compute = self.start_service('compute') def _get_notification_sample(self, sample): sample_dir = os.path.dirname(os.path.abspath(__file__)) sample_dir = os.path.normpath(os.path.join( sample_dir, "../../../../doc/notification_samples")) return sample_dir + '/' + sample + '.json' def _apply_replacements(self, replacements, sample_obj, notification): replacements = replacements or {} for key, value in replacements.items(): obj = sample_obj['payload'] n_obj = notification['payload'] for sub_key in key.split('.')[:-1]: obj = obj['nova_object.data'][sub_key] n_obj = n_obj['nova_object.data'][sub_key] if value == NotificationSampleTestBase.ANY: del obj['nova_object.data'][key.split('.')[-1]] del n_obj['nova_object.data'][key.split('.')[-1]] else: obj['nova_object.data'][key.split('.')[-1]] = value def _verify_notification(self, sample_file_name, replacements=None, actual=None): """Assert if the generated notification matches with the stored sample :param sample_file_name: The name of the sample file to match relative to doc/notification_samples :param replacements: A dict of key value pairs that is used to update the payload field of the sample data before it is matched against the generated notification. The 'x.y':'new-value' key-value pair selects the ["payload"]["nova_object.data"]["x"] ["nova_object.data"]["y"] value from the sample data and overrides it with 'new-value'. There is a special value ANY that can be used to indicate that the actual field value shall be ignored during matching. :param actual: Defines the actual notification to compare with. If None then it defaults to the first versioned notification emitted during the test. """ if not actual: self.assertEqual(1, len(fake_notifier.VERSIONED_NOTIFICATIONS)) notification = fake_notifier.VERSIONED_NOTIFICATIONS[0] else: notification = actual with open(self._get_notification_sample(sample_file_name)) as sample: sample_data = sample.read() sample_obj = jsonutils.loads(sample_data) self._apply_replacements(replacements, sample_obj, notification) self.assertJsonEqual(sample_obj, notification) def _boot_a_server(self, expected_status='ACTIVE', extra_params=None): # We have to depend on a specific image and flavor to fix the content # of the notification that will be emitted flavor_body = {'flavor': {'name': 'test_flavor', 'ram': 512, 'vcpus': 1, 'disk': 1, 'id': 'a22d5517-147c-4147-a0d1-e698df5cd4e3' }} flavor_id = self.api.post_flavor(flavor_body)['id'] extra_specs = { "extra_specs": { "hw:watchdog_action": "disabled"}} self.admin_api.post_extra_spec(flavor_id, extra_specs) # Ignore the create flavor notification fake_notifier.reset() keypair_req = { "keypair": { "name": "my-key", "public_key": fake_crypto.get_ssh_public_key() }} self.api.post_keypair(keypair_req) server = self._build_minimal_create_server_request( self.api, 'some-server', image_uuid='155d900f-4e14-4e4c-a73d-069cbf4541e6', flavor_id=flavor_id) # NOTE(gibi): from microversion 2.19 the description is not set to the # instance name automatically but can be provided at boot. server['description'] = 'some-server' if extra_params: extra_params['return_reservation_id'] = True extra_params['key_name'] = 'my-key' server.update(extra_params) post = {'server': server} created_server = self.api.post_server(post) reservation_id = created_server['reservation_id'] created_server = self.api.get_servers( detail=False, search_opts={'reservation_id': reservation_id})[0] self.assertTrue(created_server['id']) # Wait for it to finish being created found_server = self._wait_for_state_change(self.api, created_server, expected_status) found_server['reservation_id'] = reservation_id if found_server['status'] == 'ACTIVE': self.api.put_server_tags(found_server['id'], ['tag1']) return found_server def _wait_until_deleted(self, server): try: for i in range(40): server = self.api.get_server(server['id']) if server['status'] == 'ERROR': self.fail('Server went to error state instead of' 'disappearing.') time.sleep(0.5) self.fail('Server failed to delete.') except api_client.OpenStackApiNotFoundException: return def _get_notifications(self, event_type): return [notification for notification in fake_notifier.VERSIONED_NOTIFICATIONS if notification['event_type'] == event_type] def _wait_for_notification(self, event_type, timeout=1.0): received = fake_notifier.wait_for_versioned_notification( event_type, timeout) self.assertTrue( received, 'notification %s hasn\'t been received' % event_type) def _wait_for_notifications(self, event_type, expected_count, timeout=1.0): notifications = [] start_time = time.clock() while (len(notifications) < expected_count and time.clock() - start_time < timeout): fake_notifier.wait_for_versioned_notification(event_type, timeout) notifications += self._get_notifications(event_type) # NOTE(gibi): reading and then resetting the fake_notifier without # synchronization doesn't lead to race condition as the only # parallelism is due to eventlet. fake_notifier.reset() self.assertEqual(expected_count, len(notifications), 'Unexpected number of %s notifications ' 'within the given timeout. ' 'Expected %d, got %d: %s' % (event_type, expected_count, len(notifications), notifications)) return notifications def _attach_volume_to_server(self, server, volume_id): self.api.post_server_volume( server['id'], {"volumeAttachment": {"volumeId": volume_id}}) self._wait_for_notification('instance.volume_attach.end') def _wait_and_get_migrations(self, server, max_retries=20): """Simple method to wait for the migrations Here we wait for the moment where active migration is in progress so we can get them and use them in the migration-related tests. :param server: server we'd like to use :param max_retries: maximum number of retries :returns: the migrations """ retries = 0 while retries < max_retries: retries += 1 migrations = self.admin_api.get_active_migrations(server['id']) if (len(migrations) > 0 and migrations[0]['status'] != 'preparing'): return migrations if retries == max_retries: self.fail('The migration table left empty.')
from decimal import Decimal from django import forms from django.template import loader from django.template import RequestContext from django.utils.translation import ugettext_lazy as _ from l10n.utils import moneyfmt from livesettings import config_value, config_value_safe from payment import signals from payment.config import labelled_gateway_choices from payment.models import CreditCardDetail from payment.utils import get_or_create_order from product.models import Discount, TaxClass, Price from product.prices import PriceAdjustmentCalc, PriceAdjustment from product.utils import find_best_auto_discount from satchmo_store.contact.forms import ProxyContactForm, ContactInfoForm from satchmo_store.contact.models import Contact from satchmo_store.shop.models import Cart, Order from satchmo_store.shop.signals import satchmo_shipping_price_query from satchmo_utils.dynamic import lookup_template from satchmo_utils.views import CreditCard from shipping.config import shipping_methods, shipping_method_by_key from shipping.signals import shipping_choices_query from shipping.utils import update_shipping from signals_ahoy.signals import form_init, form_initialdata, form_presave, form_postsave, form_validate from tax.templatetags.satchmo_tax import _get_taxprocessor from threaded_multihost import threadlocals import calendar import datetime import logging log = logging.getLogger('payment.forms') MONTHS = [(month,'%02d'%month) for month in range(1,13)] def _get_cheapest_shipping(shipping_dict): """Use the shipping_dict as returned by _get_shipping_choices to figure the cheapest shipping option.""" least = None leastcost = None for key, value in shipping_dict.items(): current = value['cost'] if leastcost is None or current < leastcost: least = key leastcost = current return least def _get_shipping_choices(request, paymentmodule, cart, contact, default_view_tax=False, order=None): """Iterate through legal shipping modules, building the list for display to the user. Returns the shipping choices list, along with a dictionary of shipping choices, useful for building javascript that operates on shipping choices. """ shipping_options = [] shipping_dict = {} rendered = {} if not order: try: order = Order.objects.from_request(request) except Order.DoesNotExist: pass discount = None if order: try: discount = Discount.objects.by_code(order.discount_code) except Discount.DoesNotExist: pass if not cart.is_shippable: methods = [shipping_method_by_key('NoShipping'),] else: methods = shipping_methods() tax_shipping = config_value_safe('TAX','TAX_SHIPPING', False) shipping_tax = None if tax_shipping: taxer = _get_taxprocessor(request) shipping_tax = TaxClass.objects.get(title=config_value('TAX', 'TAX_CLASS')) for method in methods: method.calculate(cart, contact) if method.valid(): template = lookup_template(paymentmodule, 'shipping/options.html') t = loader.get_template(template) shipcost = finalcost = method.cost() if discount and order: order.shipping_cost = shipcost discount.calc(order) shipdiscount = discount.item_discounts.get('Shipping', 0) else: shipdiscount = 0 # set up query to determine shipping price to show shipprice = Price() shipprice.price = shipcost shipadjust = PriceAdjustmentCalc(shipprice) if shipdiscount: shipadjust += PriceAdjustment('discount', _('Discount'), shipdiscount) satchmo_shipping_price_query.send(cart, adjustment=shipadjust) shipdiscount = shipadjust.total_adjustment() if shipdiscount: finalcost -= shipdiscount shipping_dict[method.id] = {'cost' : shipcost, 'discount' : shipdiscount, 'final' : finalcost} taxed_shipping_price = None if tax_shipping: taxcost = taxer.by_price(shipping_tax, finalcost) total = finalcost + taxcost taxed_shipping_price = moneyfmt(total) shipping_dict[method.id]['taxedcost'] = total shipping_dict[method.id]['tax'] = taxcost c = RequestContext(request, { 'amount': finalcost, 'description' : method.description(), 'method' : method.method(), 'expected_delivery' : method.expectedDelivery(), 'default_view_tax' : default_view_tax, 'shipping_tax': shipping_tax, 'taxed_shipping_price': taxed_shipping_price}) rendered[method.id] = t.render(c) #now sort by price, low to high sortme = [(value['cost'], key) for key, value in shipping_dict.items()] sortme.sort() shipping_options = [(key, rendered[key]) for cost, key in sortme] shipping_choices_query.send(sender=cart, cart=cart, paymentmodule=paymentmodule, contact=contact, default_view_tax=default_view_tax, order=order, shipping_options = shipping_options, shipping_dict = shipping_dict) return shipping_options, shipping_dict def _find_sale(cart): if cart.numItems > 0: products = [item.product for item in cart.cartitem_set.all()] sale = find_best_auto_discount(products) else: sale = None return sale class CustomChargeForm(forms.Form): orderitem = forms.IntegerField(required=True, widget=forms.HiddenInput()) amount = forms.DecimalField(label=_('New price'), required=False) shipping = forms.DecimalField(label=_('Shipping adjustment'), required=False) notes = forms.CharField(_("Notes"), required=False, initial="Your custom item is ready.") def __init__(self, *args, **kwargs): initial = kwargs.get('initial', {}) form_initialdata.send('CustomChargeForm', form=self, initial=initial) kwargs['initial'] = initial super(CustomChargeForm, self).__init__(*args, **kwargs) form_init.send(CustomChargeForm, form=self) def clean(self, *args, **kwargs): super(CustomChargeForm, self).clean(*args, **kwargs) form_validate.send(CustomChargeForm, form=self) return self.cleaned_data class PaymentMethodForm(ProxyContactForm): paymentmethod = forms.ChoiceField( label=_('Payment method'), choices=labelled_gateway_choices(), widget=forms.RadioSelect, required=True ) def __init__(self, cart=None, order=None, *args, **kwargs): super(PaymentMethodForm, self).__init__(*args, **kwargs) self.cart = cart # Send a signal to perform additional filtering of available payment methods. # Receivers have cart/order passed in variables to check the contents and modify methods # list if neccessary. payment_choices = labelled_gateway_choices() signals.payment_methods_query.send( PaymentMethodForm, methods=payment_choices, cart=cart, order=order, contact=self._contact ) if self.fields['paymentmethod'].initial == None: self.fields['paymentmethod'].initial = payment_choices[0][0] if len(payment_choices) == 1: self.fields['paymentmethod'].widget = forms.HiddenInput() else: self.fields['paymentmethod'].widget = forms.RadioSelect() self.fields['paymentmethod'].choices = payment_choices def clean(self): # allow additional validation form_validate.send(PaymentMethodForm, form=self) return self.cleaned_data class PaymentContactInfoForm(PaymentMethodForm, ContactInfoForm): payment_required_fields = None def __init__(self, *args, **kwargs): super(PaymentContactInfoForm, self).__init__(*args, **kwargs) if not self.cart: request = threadlocals.get_current_request() self.cart = Cart.objects.from_request(request) self.fields['discount'] = forms.CharField(max_length=30, required=False) self.payment_required_fields = {} if config_value('PAYMENT', 'USE_DISCOUNTS'): if not self.fields['discount'].initial: sale = _find_sale(self.cart) if sale: self.fields['discount'].initial = sale.code else: self.fields['discount'].widget = forms.HiddenInput() # Listeners of the form_init signal (below) may modify the dict of # payment_required_fields. For example, if your CUSTOM_PAYMENT requires # customer's city, put the following code in the listener: # # form.payment_required_fields['CUSTOM_PAYMENT'] = ['city'] # form_init.send(PaymentContactInfoForm, form=self) def save(self, request, *args, **kwargs): form_presave.send(PaymentContactInfoForm, form=self) contactid = super(PaymentContactInfoForm, self).save(*args, **kwargs) contact = Contact.objects.get(pk=contactid) cart = kwargs.get('cart', None) if not cart: cart = Cart.objects.from_request(request) if not cart.customer: cart.customer = contact cart.save() self.order = get_or_create_order(request, cart, contact, self.cleaned_data) form_postsave.send(PaymentContactInfoForm, form=self) return contactid def clean(self): try: paymentmethod = self.cleaned_data['paymentmethod'] except KeyError: self._errors['paymentmethod'] = forms.util.ErrorList([_('This field is required')]) return self.cleaned_data required_fields = self.payment_required_fields.get(paymentmethod, []) msg = _('Selected payment method requires this field to be filled') for fld in required_fields: if not (self.cleaned_data.has_key(fld) and self.cleaned_data[fld]): self._errors[fld] = forms.util.ErrorList([msg]) elif fld == 'state': self.enforce_state = True try: self._check_state(self.cleaned_data['state'], self.cleaned_data['country']) except forms.ValidationError, e: self._errors[fld] = e.messages super(PaymentContactInfoForm, self).clean() return self.cleaned_data def clean_discount(self): """ Check if discount exists and is valid. """ if not config_value('PAYMENT', 'USE_DISCOUNTS'): return '' data = self.cleaned_data['discount'] if data: try: discount = Discount.objects.get(code=data, active=True) except Discount.DoesNotExist: raise forms.ValidationError(_('Invalid discount code.')) request = threadlocals.get_current_request() try: contact = Contact.objects.from_request(request) except Contact.DoesNotExist: contact = None valid, msg = discount.isValid(self.cart, contact=contact) if not valid: raise forms.ValidationError(msg) # TODO: validate that it can work with these products return data class SimplePayShipForm(forms.Form): shipping = forms.ChoiceField(widget=forms.RadioSelect(), required=False) def __init__(self, request, paymentmodule, *args, **kwargs): super(SimplePayShipForm, self).__init__(*args, **kwargs) try: order = Order.objects.from_request(request) except Order.DoesNotExist: order = None self.order = order self.orderpayment = None self.paymentmodule = paymentmodule try: self.tempCart = Cart.objects.from_request(request) if self.tempCart.numItems > 0: products = [item.product for item in self.tempCart.cartitem_set.all()] except Cart.DoesNotExist: self.tempCart = None try: self.tempContact = Contact.objects.from_request(request) except Contact.DoesNotExist: self.tempContact = None if kwargs.has_key('default_view_tax'): default_view_tax = kwargs['default_view_tax'] else: default_view_tax = config_value_safe('TAX', 'TAX_SHIPPING', False) shipping_choices, shipping_dict = _get_shipping_choices(request, paymentmodule, self.tempCart, self.tempContact, default_view_tax=default_view_tax) cheapshipping = _get_cheapest_shipping(shipping_dict) self.cheapshipping = cheapshipping discount = None if order and order.discount_code: try: discount = Discount.objects.by_code(order.discount_code) if discount and discount.shipping == "FREECHEAP": if cheapshipping: shipping_choices = [opt for opt in shipping_choices if opt[0] == cheapshipping] shipping_dict = {cheapshipping: shipping_dict[cheapshipping]} except Discount.DoesNotExist: pass # possibly hide the shipping based on store config shiphide = config_value('SHIPPING','HIDING') # Handle a partial payment and make sure we don't show a shipping choice after one has # already been chosen if self.order and self.order.is_partially_paid and shipping_dict.get(self.order.shipping_model, False): self.fields['shipping'] = forms.CharField(max_length=30, initial=self.order.shipping_model, widget=forms.HiddenInput(attrs={'value' : shipping_choices[0][0]})) self.shipping_hidden = True # Possibly hide if there is only 1 choise elif shiphide in ('YES', 'DESCRIPTION') and len(shipping_choices) == 1: self.fields['shipping'] = forms.CharField(max_length=30, initial=shipping_choices[0][0], widget=forms.HiddenInput(attrs={'value' : shipping_choices[0][0]})) if shiphide == 'DESCRIPTION': self.shipping_hidden = False self.shipping_description = shipping_choices[0][1] else: self.shipping_hidden = True self.shipping_description = "" elif len(shipping_choices) == 0: self.shipping_hidden = True else: self.fields['shipping'].choices = shipping_choices if config_value('SHIPPING','SELECT_CHEAPEST'): if cheapshipping is not None: self.fields['shipping'].initial = cheapshipping self.shipping_hidden = False self.shipping_dict = shipping_dict form_init.send(SimplePayShipForm, form=self) def clean_shipping(self): shipping = self.cleaned_data['shipping'] if not shipping and self.tempCart.is_shippable: raise forms.ValidationError(_('This field is required.')) return shipping def is_needed(self): """Check to see if this form is even needed it is *not* needed if: - we have an order - the order balance is zero - No shipping needs to be selected """ needed = True if self.order and self.tempContact and self.tempCart: order = self.order if order.is_shippable and len(self.shipping_dict) == 1: update_shipping(order, self.shipping_dict.keys()[0], self.tempContact, self.tempCart) order.recalculate_total(save=False) needed = not order.paid_in_full if not needed: log.debug('%s can skip the payment step - no info needed', order) return needed def save(self, request, cart, contact, payment_module, data=None): form_presave.send(SimplePayShipForm, form=self) if data is None: data = self.cleaned_data self.order = get_or_create_order(request, cart, contact, data) if payment_module: processor_module = payment_module.MODULE.load_module('processor') processor = processor_module.PaymentProcessor(payment_module) self.orderpayment = processor.create_pending_payment(order=self.order) else: self.orderpayment = None form_postsave.send(SimplePayShipForm, form=self) class CreditPayShipForm(SimplePayShipForm): credit_type = forms.ChoiceField() credit_number = forms.CharField(max_length=20, widget=forms.TextInput(attrs={'autocomplete':'off'})) month_expires = forms.ChoiceField(choices=MONTHS) year_expires = forms.ChoiceField() ccv = forms.CharField(max_length=4, label='Sec code', widget=forms.TextInput(attrs={'autocomplete':'off'})) def __init__(self, request, paymentmodule, *args, **kwargs): creditchoices = paymentmodule.CREDITCHOICES.choice_values super(CreditPayShipForm, self).__init__(request, paymentmodule, *args, **kwargs) self.cc = None self.fields['credit_type'].choices = creditchoices num_years = config_value('PAYMENT', 'CC_NUM_YEARS') year_now = datetime.date.today().year self.fields['year_expires'].choices = [(year, year) for year in range(year_now, year_now+num_years+1)] self.tempCart = Cart.objects.from_request(request) initial = kwargs.get('initial', None) if initial: if initial.get('credit_number', None): self.fields['credit_number'].widget = forms.PasswordInput() if initial.get('ccv', None): self.fields['ccv'].widget = forms.PasswordInput() try: self.tempContact = Contact.objects.from_request(request) except Contact.DoesNotExist: self.tempContact = None def clean(self): super(CreditPayShipForm, self).clean() data = self.cleaned_data if not self.is_valid(): log.debug('form not valid, no early auth') return data early = config_value('PAYMENT', 'AUTH_EARLY') if early: processor_module = self.paymentmodule.MODULE.load_module('processor') processor = processor_module.PaymentProcessor(self.paymentmodule) if processor.can_authorize(): log.debug('Processing early capture/release for: %s', self.order) processor_module = self.paymentmodule.MODULE.load_module('processor') processor = processor_module.PaymentProcessor(self.paymentmodule) if self.order: # we have to make a payment object and save the credit card data to # make an auth/release. orderpayment = processor.create_pending_payment(order=self.order, amount=Decimal('0.01')) op = orderpayment.capture cc = CreditCardDetail(orderpayment=op, expire_month=data['month_expires'], expire_year=data['year_expires'], credit_type=data['credit_type']) cc.storeCC(data['credit_number']) cc.save() # set ccv into cache cc.ccv = data['ccv'] self.cc = cc results = processor.authorize_and_release(order=self.order) if not results.success: log.debug('Payment module error: %s', results) raise forms.ValidationError(results.message) else: log.debug('Payment module capture/release success for %s', self.order) else: log.debug('Payment module %s cannot do credit authorizations, ignoring AUTH_EARLY setting.', self.paymentmodule.MODULE.value) return data def clean_credit_number(self): """ Check if credit card is valid. """ data = self.cleaned_data credit_number = data['credit_number'] card = CreditCard(credit_number, data['credit_type']) results, msg = card.verifyCardTypeandNumber() if not results: raise forms.ValidationError(msg) return credit_number def clean_month_expires(self): return int(self.cleaned_data['month_expires']) def clean_year_expires(self): """ Check if credit card has expired. """ month = self.cleaned_data['month_expires'] year = int(self.cleaned_data['year_expires']) max_day = calendar.monthrange(year, month)[1] if datetime.date.today() > datetime.date(year=year, month=month, day=max_day): raise forms.ValidationError(_('Your card has expired.')) return year def clean_ccv(self): """ Validate a proper CCV is entered. Remember it can have a leading 0 so don't convert to int and return it""" try: check = int(self.cleaned_data['ccv']) return self.cleaned_data['ccv'].strip() except ValueError: raise forms.ValidationError(_('Invalid ccv.')) def save(self, request, cart, contact, payment_module, data=None): """Save the order and the credit card information for this orderpayment""" form_presave.send(CreditPayShipForm, form=self) if data is None: data = self.cleaned_data assert(data) super(CreditPayShipForm, self).save(request, cart, contact, payment_module, data=data) if self.orderpayment: op = self.orderpayment.capture cc = CreditCardDetail(orderpayment=op, expire_month=data['month_expires'], expire_year=data['year_expires'], credit_type=data['credit_type']) cc.storeCC(data['credit_number']) cc.save() # set ccv into cache cc.ccv = data['ccv'] self.cc = cc form_postsave.send(CreditPayShipForm, form=self)
""" Algorithms for computing the skeleton of a binary image """ import numpy as np from scipy import ndimage as ndi from ._skeletonize_cy import _skeletonize_loop, _table_lookup_index # --------- Skeletonization by morphological thinning --------- def skeletonize(image): """Return the skeleton of a binary image. Thinning is used to reduce each connected component in a binary image to a single-pixel wide skeleton. Parameters ---------- image : numpy.ndarray A binary image containing the objects to be skeletonized. '1' represents foreground, and '0' represents background. It also accepts arrays of boolean values where True is foreground. Returns ------- skeleton : ndarray A matrix containing the thinned image. See also -------- medial_axis Notes ----- The algorithm [1] works by making successive passes of the image, removing pixels on object borders. This continues until no more pixels can be removed. The image is correlated with a mask that assigns each pixel a number in the range [0...255] corresponding to each possible pattern of its 8 neighbouring pixels. A look up table is then used to assign the pixels a value of 0, 1, 2 or 3, which are selectively removed during the iterations. Note that this algorithm will give different results than a medial axis transform, which is also often referred to as "skeletonization". References ---------- .. [1] A fast parallel algorithm for thinning digital patterns, T. Y. ZHANG and C. Y. SUEN, Communications of the ACM, March 1984, Volume 27, Number 3 Examples -------- >>> X, Y = np.ogrid[0:9, 0:9] >>> ellipse = (1./3 * (X - 4)**2 + (Y - 4)**2 < 3**2).astype(np.uint8) >>> ellipse array([[0, 0, 0, 1, 1, 1, 0, 0, 0], [0, 0, 1, 1, 1, 1, 1, 0, 0], [0, 0, 1, 1, 1, 1, 1, 0, 0], [0, 0, 1, 1, 1, 1, 1, 0, 0], [0, 0, 1, 1, 1, 1, 1, 0, 0], [0, 0, 1, 1, 1, 1, 1, 0, 0], [0, 0, 1, 1, 1, 1, 1, 0, 0], [0, 0, 1, 1, 1, 1, 1, 0, 0], [0, 0, 0, 1, 1, 1, 0, 0, 0]], dtype=uint8) >>> skel = skeletonize(ellipse) >>> skel.astype(np.uint8) array([[0, 0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 1, 0, 0, 0, 0], [0, 0, 0, 0, 1, 0, 0, 0, 0], [0, 0, 0, 0, 1, 0, 0, 0, 0], [0, 0, 0, 0, 1, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0, 0, 0, 0]], dtype=uint8) """ # look up table - there is one entry for each of the 2^8=256 possible # combinations of 8 binary neighbours. 1's, 2's and 3's are candidates # for removal at each iteration of the algorithm. lut = [0, 0, 0, 1, 0, 0, 1, 3, 0, 0, 3, 1, 1, 0, 1, 3, 0, 0, 0, 0, 0, 0, 0, 0, 2, 0, 2, 0, 3, 0, 3, 3, 0, 0, 0, 0, 0, 0, 0, 0, 3, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 2, 0, 0, 0, 3, 0, 2, 2, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 2, 0, 0, 0, 0, 0, 0, 0, 2, 0, 0, 0, 2, 0, 0, 0, 3, 0, 0, 0, 0, 0, 0, 0, 3, 0, 0, 0, 3, 0, 2, 0, 0, 0, 3, 1, 0, 0, 1, 3, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 3, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 2, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 2, 3, 1, 3, 0, 0, 1, 3, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 2, 3, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 3, 3, 0, 1, 0, 0, 0, 0, 2, 2, 0, 0, 2, 0, 0, 0] # convert to unsigned int (this should work for boolean values) skeleton = image.astype(np.uint8) # check some properties of the input image: # - 2D # - binary image with only 0's and 1's if skeleton.ndim != 2: raise ValueError('Skeletonize requires a 2D array') if not np.all(np.in1d(skeleton.flat, (0, 1))): raise ValueError('Image contains values other than 0 and 1') # create the mask that will assign a unique value based on the # arrangement of neighbouring pixels mask = np.array([[ 1, 2, 4], [128, 0, 8], [ 64, 32, 16]], np.uint8) pixel_removed = True while pixel_removed: pixel_removed = False # assign each pixel a unique value based on its foreground neighbours neighbours = ndi.correlate(skeleton, mask, mode='constant') # ignore background neighbours *= skeleton # use LUT to categorize each foreground pixel as a 0, 1, 2 or 3 codes = np.take(lut, neighbours) # pass 1 - remove the 1's and 3's code_mask = (codes == 1) if np.any(code_mask): pixel_removed = True skeleton[code_mask] = 0 code_mask = (codes == 3) if np.any(code_mask): pixel_removed = True skeleton[code_mask] = 0 # pass 2 - remove the 2's and 3's neighbours = ndi.correlate(skeleton, mask, mode='constant') neighbours *= skeleton codes = np.take(lut, neighbours) code_mask = (codes == 2) if np.any(code_mask): pixel_removed = True skeleton[code_mask] = 0 code_mask = (codes == 3) if np.any(code_mask): pixel_removed = True skeleton[code_mask] = 0 return skeleton.astype(bool) # --------- Skeletonization by medial axis transform -------- _eight_connect = ndi.generate_binary_structure(2, 2) def medial_axis(image, mask=None, return_distance=False): """ Compute the medial axis transform of a binary image Parameters ---------- image : binary ndarray, shape (M, N) The image of the shape to be skeletonized. mask : binary ndarray, shape (M, N), optional If a mask is given, only those elements in `image` with a true value in `mask` are used for computing the medial axis. return_distance : bool, optional If true, the distance transform is returned as well as the skeleton. Returns ------- out : ndarray of bools Medial axis transform of the image dist : ndarray of ints, optional Distance transform of the image (only returned if `return_distance` is True) See also -------- skeletonize Notes ----- This algorithm computes the medial axis transform of an image as the ridges of its distance transform. The different steps of the algorithm are as follows * A lookup table is used, that assigns 0 or 1 to each configuration of the 3x3 binary square, whether the central pixel should be removed or kept. We want a point to be removed if it has more than one neighbor and if removing it does not change the number of connected components. * The distance transform to the background is computed, as well as the cornerness of the pixel. * The foreground (value of 1) points are ordered by the distance transform, then the cornerness. * A cython function is called to reduce the image to its skeleton. It processes pixels in the order determined at the previous step, and removes or maintains a pixel according to the lookup table. Because of the ordering, it is possible to process all pixels in only one pass. Examples -------- >>> square = np.zeros((7, 7), dtype=np.uint8) >>> square[1:-1, 2:-2] = 1 >>> square array([[0, 0, 0, 0, 0, 0, 0], [0, 0, 1, 1, 1, 0, 0], [0, 0, 1, 1, 1, 0, 0], [0, 0, 1, 1, 1, 0, 0], [0, 0, 1, 1, 1, 0, 0], [0, 0, 1, 1, 1, 0, 0], [0, 0, 0, 0, 0, 0, 0]], dtype=uint8) >>> medial_axis(square).astype(np.uint8) array([[0, 0, 0, 0, 0, 0, 0], [0, 0, 1, 0, 1, 0, 0], [0, 0, 0, 1, 0, 0, 0], [0, 0, 0, 1, 0, 0, 0], [0, 0, 0, 1, 0, 0, 0], [0, 0, 1, 0, 1, 0, 0], [0, 0, 0, 0, 0, 0, 0]], dtype=uint8) """ global _eight_connect if mask is None: masked_image = image.astype(np.bool) else: masked_image = image.astype(bool).copy() masked_image[~mask] = False # # Build lookup table - three conditions # 1. Keep only positive pixels (center_is_foreground array). # AND # 2. Keep if removing the pixel results in a different connectivity # (if the number of connected components is different with and # without the central pixel) # OR # 3. Keep if # pixels in neighbourhood is 2 or less # Note that table is independent of image center_is_foreground = (np.arange(512) & 2**4).astype(bool) table = (center_is_foreground # condition 1. & (np.array([ndi.label(_pattern_of(index), _eight_connect)[1] != ndi.label(_pattern_of(index & ~ 2**4), _eight_connect)[1] for index in range(512)]) # condition 2 | np.array([np.sum(_pattern_of(index)) < 3 for index in range(512)])) # condition 3 ) # Build distance transform distance = ndi.distance_transform_edt(masked_image) if return_distance: store_distance = distance.copy() # Corners # The processing order along the edge is critical to the shape of the # resulting skeleton: if you process a corner first, that corner will # be eroded and the skeleton will miss the arm from that corner. Pixels # with fewer neighbors are more "cornery" and should be processed last. # We use a cornerness_table lookup table where the score of a # configuration is the number of background (0-value) pixels in the # 3x3 neighbourhood cornerness_table = np.array([9 - np.sum(_pattern_of(index)) for index in range(512)]) corner_score = _table_lookup(masked_image, cornerness_table) # Define arrays for inner loop i, j = np.mgrid[0:image.shape[0], 0:image.shape[1]] result = masked_image.copy() distance = distance[result] i = np.ascontiguousarray(i[result], dtype=np.intp) j = np.ascontiguousarray(j[result], dtype=np.intp) result = np.ascontiguousarray(result, np.uint8) # Determine the order in which pixels are processed. # We use a random # for tiebreaking. Assign each pixel in the image a # predictable, random # so that masking doesn't affect arbitrary choices # of skeletons # generator = np.random.RandomState(0) tiebreaker = generator.permutation(np.arange(masked_image.sum())) order = np.lexsort((tiebreaker, corner_score[masked_image], distance)) order = np.ascontiguousarray(order, dtype=np.int32) table = np.ascontiguousarray(table, dtype=np.uint8) # Remove pixels not belonging to the medial axis _skeletonize_loop(result, i, j, order, table) result = result.astype(bool) if not mask is None: result[~mask] = image[~mask] if return_distance: return result, store_distance else: return result def _pattern_of(index): """ Return the pattern represented by an index value Byte decomposition of index """ return np.array([[index & 2**0, index & 2**1, index & 2**2], [index & 2**3, index & 2**4, index & 2**5], [index & 2**6, index & 2**7, index & 2**8]], bool) def _table_lookup(image, table): """ Perform a morphological transform on an image, directed by its neighbors Parameters ---------- image : ndarray A binary image table : ndarray A 512-element table giving the transform of each pixel given the values of that pixel and its 8-connected neighbors. border_value : bool The value of pixels beyond the border of the image. Returns ------- result : ndarray of same shape as `image` Transformed image Notes ----- The pixels are numbered like this:: 0 1 2 3 4 5 6 7 8 The index at a pixel is the sum of 2**<pixel-number> for pixels that evaluate to true. """ # # We accumulate into the indexer to get the index into the table # at each point in the image # if image.shape[0] < 3 or image.shape[1] < 3: image = image.astype(bool) indexer = np.zeros(image.shape, int) indexer[1:, 1:] += image[:-1, :-1] * 2**0 indexer[1:, :] += image[:-1, :] * 2**1 indexer[1:, :-1] += image[:-1, 1:] * 2**2 indexer[:, 1:] += image[:, :-1] * 2**3 indexer[:, :] += image[:, :] * 2**4 indexer[:, :-1] += image[:, 1:] * 2**5 indexer[:-1, 1:] += image[1:, :-1] * 2**6 indexer[:-1, :] += image[1:, :] * 2**7 indexer[:-1, :-1] += image[1:, 1:] * 2**8 else: indexer = _table_lookup_index(np.ascontiguousarray(image, np.uint8)) image = table[indexer] return image
import ctypes as ct import freetype.raw as ft from ed2d import texture from ed2d import mesh from ed2d import typeutils from ed2d.opengl import gl, pgl # from ed2d import glmath as cyglmath # from ed2d.glmath import cython as cyglmath from gem import matrix, vector # Hack to verify that freetype is properly destructed after everything # this code was also commited to freetype-py class _FT_Library_Wrapper(ft.FT_Library): '''Subclass of FT_Library to help with calling FT_Done_FreeType''' # for some reason this doesn't get carried over and ctypes complains _type_ = ft.FT_Library._type_ # Store ref to FT_Done_FreeType otherwise it will be deleted before needed. _ft_done_freetype = ft.FT_Done_FreeType def __del__(self): # call FT_Done_FreeType self._ft_done_freetype(self) def init_freetype(): handle = _FT_Library_Wrapper() if ft.FT_Init_FreeType(ct.byref(handle)): raise Exception('FreeType failed to initialize.') return handle freetype = init_freetype() # These are the usable fields of FT_GlyphSlotRec # field: data type: # library FT_Library # face FT_Face # next FT_GlyphSlot # generic FT_Generic # metrics FT_Glyph_Metrics # linearHoriAdvance FT_Fixed # linearVertAdvance FT_Fixed # advance FT_Vector # format FT_Glyph_Format # bitmap FT_Bitmap # bitmap_left FT_Int # bitmap_top FT_Int # outline FT_Outline # num_subglyphs FT_UInt # subglyphs FT_SubGlyph # control_data void* # control_len long # lsb_delta FT_Pos # rsb_delta FT_Pos class Font(object): def __init__(self, size, fontPath): self.size = size self.path = fontPath self.face = ft.FT_Face() # here is the general structure of the char data dict. # # It has self.charDataCache = {} # load font face if ft.FT_New_Face(freetype, typeutils.to_c_str(fontPath), 0, ct.byref(self.face)): raise Exception('Error loading font.') # For now the device dpi will be hard coded to 72 # later on if we want to do mobile stuff, or have dpi scaling # for high-dpi monitors this will need to be changed. if ft.FT_Set_Char_Size(self.face, 0, size * 64, 72, 72): raise Exception('Error setting character size.') def load_glyph(self, char): ''' Loads glyph, and returns a dictionary containing glyph data. ''' try: return self.charDataCache[char] except KeyError: index = ft.FT_Get_Char_Index(self.face, ord(char)) if ft.FT_Load_Glyph(self.face, index, ft.FT_LOAD_RENDER): raise Exception('Error loading glyph') glyphSlot = self.face.contents.glyph charData = {} bitmapStruct = glyphSlot.contents.bitmap texWidth = bitmapStruct.width texHeight = bitmapStruct.rows pixelData = [0.0 for x in range(texWidth * texHeight)] for item in range(texWidth * texHeight): pixelData[item] = bitmapStruct.buffer[item] if not pixelData: pixelData = [0] charData['pixelData'] = pixelData charData['bitmap_x'] = glyphSlot.contents.bitmap_left charData['bitmap_y'] = glyphSlot.contents.bitmap_top charData['texWidth'] = texWidth charData['texHeight'] = texHeight charData['advance'] = glyphSlot.contents.advance.x >> 6 self.charDataCache[char] = charData return charData def delete(self): '''Delete the freetype face''' ft.FT_Done_Face(self.face) class Text(object): def __init__(self, program, font): self.program = program self.texAtlas = texture.TextureAtlas(self.program, texFormat=gl.GL_RED) self.font = font self.vertLoc = self.program.get_attribute(b'position') self.UVLoc = self.program.get_attribute(b'vertexUV') self.data = [[0.0, 1.0], [1.0, 1.0], [0.0, 0.0], [1.0, 0.0] ] self.chrMap = {} self.basePos = 0.0 self.lineSpacing = 3 for texVal in range(32, 128): char = chr(texVal) fontData = self.font.load_glyph(char) # Find the fartherst position from the baseline if fontData['bitmap_y'] > self.basePos: self.basePos = fontData['bitmap_y'] self.chrMap[char] = Glyph(self.program, self.texAtlas, fontData, char, self) print(self.basePos) self.texAtlas.gen_atlas() self.vbo = mesh.buffer_object(self.data, gl.GLfloat) for glyph in self.chrMap.values(): glyph.init_gl() def draw_text(self, text, xPos, yPos): self.program.use() self.texAtlas.bind() # When you can dynamically add textures to an Atlas # this is where the glyph objects will be created. # Instead of taking a while on init to generate all # normal characters. textLines = text.split('\n') penPosX = xPos penPosY = self.basePos + yPos for txt in textLines: for c in txt: char = self.chrMap[c] char.render(penPosX, penPosY) penPosX += char.advance penPosY += self.basePos + self.lineSpacing penPosX = xPos # gl.glDisableVertexAttribArray(self.UVLoc) # gl.glDisableVertexAttribArray(self.vertLoc) # gl.glBindBuffer(gl.GL_ARRAY_BUFFER, 0) gl.glBindVertexArray(0) class Glyph(object): def __init__(self, program, atlas, fontData, char, parent): self.atlas = atlas self.fontData = fontData self.program = program self.parent = parent self.nverts = 4 self.vertLoc = self.program.get_attribute(b'position') self.modelLoc = self.program.new_uniform(b'model') self.UVLoc = self.program.get_attribute(b'vertexUV') self.modelMatrix = matrix.Matrix(4) self.char = char self.pixelData = self.fontData['pixelData'] self.textureWidth = self.fontData['texWidth'] self.textureHeight = self.fontData['texHeight'] self.bitX = self.fontData['bitmap_x'] self.bitY = self.fontData['bitmap_y'] self.advance = self.fontData['advance'] self.uniform = self.program.get_uniform(self.modelLoc) self.textureID = self.atlas.add_texture(self.textureWidth, self.textureHeight, self.pixelData) def init_gl(self): self.vao = pgl.glGenVertexArrays(1) gl.glBindVertexArray(self.vao) self._uvCoords = self.atlas.get_uvcoords(self.textureID) self.vertexScale = self.atlas.get_vertex_scale(self.textureID) vecScale = vector.Vector( 3, data=[self.atlas.maxSubTextureHeight * self.vertexScale[0], self.atlas.maxSubTextureHeight * self.vertexScale[1], 0.0]) self.scaleMat = matrix.Matrix(4).i_scale(vecScale) self.uvbo = mesh.buffer_object(self._uvCoords, gl.GLfloat) gl.glEnableVertexAttribArray(self.vertLoc) gl.glEnableVertexAttribArray(self.UVLoc) gl.glBindBuffer(gl.GL_ARRAY_BUFFER, self.parent.vbo) pgl.glVertexAttribPointer(self.vertLoc, 2, gl.GL_FLOAT, gl.GL_FALSE, 0, None) gl.glBindBuffer(gl.GL_ARRAY_BUFFER, self.uvbo) pgl.glVertexAttribPointer(self.UVLoc, 2, gl.GL_FLOAT, gl.GL_FALSE, 0, None) gl.glBindVertexArray(0) def render(self, posX, posY): gl.glBindVertexArray(self.vao) vecScale = vector.Vector( 3, data=[posX + self.bitX, posY - self.bitY, 0.0]) self.modelMatrix = self.scaleMat.translate(vecScale) self.program.set_uniform_matrix(self.modelLoc, self.modelMatrix, uniform=self.uniform, size=4) gl.glDrawArrays(gl.GL_TRIANGLE_STRIP, 0, self.nverts)
#!/usr/local/bin/python3 # mapsParser5.py # Parsing script for multi-plate spectrophotometer in PLATE format # # Author: Daniel A Cuevas # Created on 11 Nov 2017 # Updated on 11 Nov 2017 # # ############################################################### # ASSUMPTIONS ############################################################### # = Tab delimited file # = File is for a single plate # = First two rows are machine-generated information # = Third row are column headers, a total of 13 items with overhanging tabs # === <TAB> Temperature <TAB> 1 <TAB> 2 <TAB> ... <12> <TAB> <NEWLINE> # = Remaining rows are data values for row A, then B, then C, etc. # = Time is first item in row A # = Time format: D.HH:MM:SS # === Regex for time format is (\d\.)?\d{2}:\d{2}:\d{2} # === Days and period are optional # = Plate reads are separated by a blank line # = After entirety of reads is a blank line and an "~End" indicator # = Finally, there is a text line with the date+timestamp at the end (not used) # === E.g. ...Date Last Saved: 7/8/2015 5:36:31 PM ############################################################### from __future__ import absolute_import, division, print_function import argparse import os import sys import re import datetime as dt from operator import itemgetter from itertools import product TIMESTAMP = re.compile(r"((\d)\.)?(\d{2}:\d{2}:\d{2})") ############################################################################### # Utility methods ############################################################################### def errOut(msg, parser=None): """Send a system exit exception with the given message""" if parser is not None: parser.print_help() script = os.path.basename(__file__) sys.exit("ERROR in {}\n {}".format(script, msg)) def getDataFiles(mypath): """Check directory exists and return list of non-hidden files""" # Add forward slash if directory does not have one if not mypath.endswith("/"): mypath = mypath + "/" # Check if directory exists if not os.path.isdir(mypath): errOut("Data directory not found: {}".format(mypath)) files = ["{}{}".format(mypath, f) for f in os.listdir(mypath) if os.path.isfile(os.path.join(mypath, f)) and not f.startswith(".")] return files def readPlate(mypath): """Parse plate file into dictionary""" plate = {} with open(mypath, "r") as fh: for l in fh: l = l.rstrip("\n") # Order of elements are: # 1) well # 2) mainsource # 3) compound # 4) concentration well, ms, cpd, conc = l.split("\t") well = parseWell(well) plate[well] = (ms, cpd) return plate def parseWell(well): """Convert well string to 2-tuple""" well = re.match(r"(\w)(\d+)", well).group(1, 2) well = (well[0], int(well[1])) return well def readData(data, f, t0): # Get only filename fname = os.path.basename(f) # Remove file extension fname = os.path.splitext(fname)[0] # Extract sample name and replicate from file m = re.match(r"^([A-Za-z0-9-.]+)_([A-Za-z0-9]+)", fname) if m is None: errOut("Could not extract name and replicate from filename: " "{}".format(f)) name, rep = m.group(1, 2) data_found = False # Flag when we're passed the file headers new_time = True # Flag when we're looking at a new time point od_reads = [] # Collect all of plate in a single list with open(f, "r") as fh: for ln, l in enumerate(fh, start=1): # Strip off any blank or newlines on both sides l = l.strip() # Check if we reached the end of the file if re.match(r"~End", l): break # Check if we hit the end of the header lines elif re.match(r"Temperature", l): ll = l.split("\t") # Check that there are 13 items (1 Temp, 12 columns) if len(ll) != 13: errOut("There are not 13 items in header line " + str(ln) + " for file " + f) data_found = True elif data_found and len(l) > 0: ll = l.split("\t") # Check if we're looking at the first row if new_time: # New time points have 14 items (Time, Temp, OD reads) if len(ll) != 14: errOut("There are not 14 items in data line " + str(ln) + " for file " + f) timeObj, t0 = parseTime(ll[0], t0, name, rep) od_reads.extend(ll[2:]) new_time = False else: # Data must have 12 items if len(ll) != 12: errOut("There are not 12 items in data line " + str(ln) + " for file " + f) od_reads.extend(ll) elif len(l) == 0: data = addOD(data, od_reads, timeObj, t0, name, rep) new_time = True od_reads = [] def parseTime(time_str, t0, name, rep): """Parse time from a string and return the datetime object""" m = TIMESTAMP.match(time_str) timeRaw = m.group(3) timeObj = dt.datetime.strptime(timeRaw, "%H:%M:%S") # Check if there was a day present if m.group(2): timeObj += dt.timedelta(days=int(m.group(2))) # Check if this is the first time for the sample or replicate if name not in t0: t0[name] = {rep: timeObj} elif rep not in t0[name]: t0[name][rep] = timeObj return timeObj, t0 def addOD(data, od_reads, timeObj, t0, name, rep): """Store data in Data Frame""" # Calculate time difference and convert to hours tDelta = timeObj - t0[name][rep] tDelta = tDelta.days * 24 + tDelta.seconds / 3600 if tDelta < 0: errOut("ERROR: tDelta is negative for " + name + " " + rep) wells = ["{}{}".format(*w) for w in product("ABCDEFGH", range(1, 13))] # Iterate through reads to add for idx, od_read in enumerate(od_reads): well = parseWell(wells[idx]) # Check if data keys are initialized if name not in data: data[name] = {rep: {well: {tDelta: od_read}}} elif rep not in data[name]: data[name][rep] = {well: {tDelta: od_read}} elif well not in data[name][rep]: data[name][rep][well] = {tDelta: od_read} else: data[name][rep][well][tDelta] = od_read return data def printData(data, plate=None, pn=None): """Print parsed data from dictionary. Output is tab-delimited. Columns: 1) sample 2) replicate 3) main source* 4) compound* 5) well# 6) plate name* 7) time 8) OD reading *Only printed when given a plate file """ for s in data: # s = sample name for r in data[s]: # r = replicate for w in sorted(data[s][r], key=itemgetter(0, 1)): # w = well tuple: sorted on row then column for t, od in sorted(data[s][r][w].items()): # t = time wId = "".join((w[0], str(w[1]))) if plate: ms, cpd = plate[w] print("\t".join((s, r, ms, cpd, wId, pn, "{:.1f}".format(t), str(od)))) else: print("\t".join((s, r, wId, "{:.1f}".format(t), str(od)))) ############################################################################### # Argument parsing ############################################################################### parser = argparse.ArgumentParser() parser.add_argument("indir", help="Directory containing data files") parser.add_argument("-p", "--plate", help="Plate file for wells") parser.add_argument("-v", "--verbose", action="store_true", help="Increase output for status messages") args = parser.parse_args() inDir = args.indir plateFile = args.plate verbose = args.verbose ############################################################################### # Preprocessing files ############################################################################### # Get data files filenames = getDataFiles(inDir) # Check that the plate file exists # If not, check if it exists in PMAnalyzer premade plates if plateFile and not os.path.isfile(plateFile): d = os.path.expanduser("~") + "/Projects/PMAnalyzer/plates/" plateFile = d + plateFile if not os.path.isfile(plateFile): errOut("Plate file not found: {}".format(plateFile)) if plateFile: plate = readPlate(plateFile) # Get only filename plateName = os.path.basename(plateFile) # Remove file extension plateName = os.path.splitext(plateName)[0] else: plate = None plateName = None ############################################################################### # Data extraction files ############################################################################### # All data will be contained in a dictionary # Keys will be ordered as follows: # 1) Sample name - str # 2) Replicate - str # 3) Well - 2-tuple (str, int) # 4) Time - float # 5) OD value - str data = {} t0 = {} # Dictionary containing starting time points for each replicate # Read in data for each file for f in filenames: readData(data, f, t0) # Print out header line if plateFile: print("sample\trep\tmainsource\tcompound\twell\tplate\ttime\tod") else: print("sample\trep\twell\ttime\tod") printData(data, plate, plateName)
from __future__ import unicode_literals from datetime import timedelta from .base import (OccurrenceDataTestCase, Notification, Occurrence, TimelineSubscription, now) from ..handlers.base import AppointmentHandler from ..handlers.confirm import ConfirmHandler from ..handlers.move import MoveHandler from ..handlers.new import NewHandler from ..handlers.quit import QuitHandler from ..handlers.status import StatusHandler from ..handlers.subscribe import SubscribeHandler class NewHandlerTestCase(OccurrenceDataTestCase): "Keyword handler for adding users to timelines" def setUp(self): self.timeline = self.create_timeline(name='Test', slug='foo') self.prefix = AppointmentHandler.prefix def test_help(self): "Prefix and keyword should return the help for adding subscriptions." replies = NewHandler.test('APPT NEW') self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(self.prefix + ' NEW <KEY> <NAME/ID> <DATE>' in reply) def test_match(self): "Send a successful match to create user timeline subscription." replies = NewHandler.test('APPT NEW foo bar') self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Thank you'), reply) def test_match_with_date(self): "Use start date if given." tomorrow = (now() + timedelta(days=1)).strftime('%Y-%m-%d') replies = NewHandler.test('APPT NEW foo bar %s' % tomorrow) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Thank you'), reply) def test_no_keyword_match(self): "Keyword does not match any existing timelines." self.timeline.delete() replies = NewHandler.test('APPT NEW foo bar') self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Sorry')) def test_no_name_given(self): "No name is given." replies = NewHandler.test('APPT NEW foo') self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Sorry')) def test_invalid_date_format_given(self): "Invalid date format." replies = NewHandler.test('APPT NEW foo bar baz') self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Sorry')) def test_already_joined(self): "Attempting to register and already registered connection/name pair." connection = self.create_connection() NewHandler._mock_backend = connection.backend self.create_timeline_subscription(timeline=self.timeline, connection=connection, pin='bar') replies = NewHandler.test('APPT NEW foo bar', identity=connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Sorry')) del NewHandler._mock_backend class ConfirmHandlerTestCase(OccurrenceDataTestCase): "Keyword handler for confirming occurrences." def setUp(self): self.timeline = self.create_timeline(name='Test', slug='foo') self.connection = self.create_connection() self.subscription = self.create_timeline_subscription( timeline=self.timeline, connection=self.connection, pin='bar') ConfirmHandler._mock_backend = self.connection.backend self.milestone = self.create_milestone(timeline=self.timeline) self.occurrence = self.create_occurrence(milestone=self.milestone) self.notification = self.create_notification(occurrence=self.occurrence) self.prefix = AppointmentHandler.prefix def test_help(self): "Prefix and keyword should return the help." replies = ConfirmHandler.test('APPT CONFIRM') self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(self.prefix + ' CONFIRM <KEY> <NAME/ID>' in reply) def test_occurrence_confirmed(self): "Successfully confirm an upcoming occurrence." replies = ConfirmHandler.test('APPT CONFIRM foo bar', identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Thank you')) notification = Notification.objects.get(pk=self.notification.pk) self.assertTrue(notification.completed) self.assertEqual(notification.status, Notification.STATUS_COMPLETED) occurrence = Occurrence.objects.get(pk=self.occurrence.pk) self.assertTrue(occurrence.completed) def test_no_upcoming_occurrence(self): "Matched user has no upcoming occurrence notifications." self.notification.delete() replies = ConfirmHandler.test('APPT CONFIRM foo bar', identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue('no uncompleted' in reply) def test_already_confirmed(self): "Matched user has already confirmed the upcoming occurrence." self.notification.confirm() replies = ConfirmHandler.test('APPT CONFIRM foo bar', identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue('no uncompleted' in reply) def test_no_subscription(self): "Name/ID does not match a subscription." self.subscription.delete() replies = ConfirmHandler.test('APPT CONFIRM foo bar', identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue('does not match an active subscription' in reply) def test_subscription_ended(self): "Name/ID subscription has ended." self.subscription.end = now() self.subscription.save() replies = ConfirmHandler.test('APPT CONFIRM foo bar', identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue('does not match an active subscription' in reply) class StatusHandlerTestCase(OccurrenceDataTestCase): "Keyword handler for updating the status of occurrences." def setUp(self): self.timeline = self.create_timeline(name='Test', slug='foo') self.connection = self.create_connection() self.subscription = self.create_timeline_subscription( timeline=self.timeline, connection=self.connection, pin='bar') StatusHandler._mock_backend = self.connection.backend self.milestone = self.create_milestone(timeline=self.timeline) self.occurrence = self.create_occurrence(milestone=self.milestone) self.prefix = AppointmentHandler.prefix def test_help(self): "Prefix and keyword should return the help." replies = StatusHandler.test('APPT STATUS') self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(self.prefix + ' STATUS <KEY> <NAME/ID> <SAW|MISSED>' in reply) def test_occurrence_status_updated(self): "Successfully update a recent occurrence." for status in Occurrence.STATUS_CHOICES[1:]: appt = self.create_occurrence(milestone=self.milestone) replies = StatusHandler.test('APPT STATUS foo bar %s' % status[1].upper(), identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Thank you')) self.assertTrue(appt.status, status[0]) def test_occurrence_status_invalid_update(self): "Do not update if supplied status text is not in STATUS_CHOICES." replies = StatusHandler.test('APPT STATUS foo bar FOO', identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Sorry, the status update must be in')) def test_no_recent_occurrence(self): "Matched user has no recent occurrence." self.occurrence.delete() replies = StatusHandler.test('APPT STATUS foo bar SAW', identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue('no recent occurrences' in reply) def test_no_recent_occurrence_needing_update(self): "Matched user has no recent occurrence that needs updating." self.occurrence.status = Occurrence.STATUS_MISSED self.occurrence.save() replies = StatusHandler.test('APPT STATUS foo bar MISSED', identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue('no recent occurrences' in reply) def test_future_occurrence(self): "Matched user has no recent occurrence." self.occurrence.date = self.occurrence.date + timedelta(days=1) self.occurrence.save() replies = StatusHandler.test('APPT STATUS foo bar SAW', identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue('no recent occurrences' in reply) def test_no_subscription(self): "Name/ID does not match a subscription." self.subscription.delete() replies = StatusHandler.test('APPT STATUS foo bar SAW', identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue('does not match an active subscription' in reply) def test_subscription_ended(self): "Name/ID subscription has ended." self.subscription.end = now() self.subscription.save() replies = StatusHandler.test('APPT STATUS foo bar MISSED', identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue('does not match an active subscription' in reply) class MoveHandlerTestCase(OccurrenceDataTestCase): "Keyword handler for rescheduling of occurrences." def setUp(self): self.timeline = self.create_timeline(name='Test', slug='foo') self.connection = self.create_connection() self.subscription = self.create_timeline_subscription( timeline=self.timeline, connection=self.connection, pin='bar') MoveHandler._mock_backend = self.connection.backend self.milestone = self.create_milestone(timeline=self.timeline) self.occurrence = self.create_occurrence(milestone=self.milestone, date=now() + timedelta(hours=1)) self.tomorrow = (now() + timedelta(days=1)).strftime('%Y-%m-%d') self.prefix = AppointmentHandler.prefix def test_help(self): "Prefix and keyword should return the help." replies = MoveHandler.test('APPT MOVE') self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(self.prefix + ' MOVE <KEY> <NAME/ID> <DATE>' in reply) def test_occurrence_reschedule(self): "Successfully reschedule an upcoming occurrence." self.assertEqual(1, Occurrence.objects.all().count()) replies = MoveHandler.test('APPT MOVE foo bar %s' % self.tomorrow, identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Thank you')) self.assertEqual(2, Occurrence.objects.all().count()) reschedule = Occurrence.objects.all()[0] self.assertEqual(reschedule.occurrences.all()[0], self.occurrence) def test_occurrence_reschedule_malformed_date(self): "Ensure the date is properly formatted." replies = MoveHandler.test('APPT MOVE foo bar tomorrow', identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Sorry, we cannot understand that date format')) def test_occurrence_reschedule_future_date(self): "Ensure the date must be in the future." yesterday = (now() - timedelta(days=1)).strftime('%Y-%m-%d') replies = MoveHandler.test('APPT MOVE foo bar %s' % yesterday, identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Sorry, the reschedule date')) def test_no_future_occurrence(self): "Matched user has no future occurrence." self.occurrence.delete() replies = MoveHandler.test('APPT MOVE foo bar %s' % self.tomorrow, identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue('no future occurrences' in reply) def test_no_future_occurrence_needing_update(self): "Matched user has no future occurrence that needs rescheduling." reschedule = self.create_occurrence(subscription=self.subscription, milestone=self.milestone) self.occurrence.reschedule = reschedule self.occurrence.save() replies = MoveHandler.test('APPT MOVE foo bar %s' % self.tomorrow, identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue('no future occurrences' in reply) def test_prior_occurrence(self): "Matched user has no future occurrence." self.occurrence.date = self.occurrence.date - timedelta(days=1) self.occurrence.save() replies = MoveHandler.test('APPT MOVE foo bar %s' % self.tomorrow, identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue('no future occurrences' in reply) def test_no_subscription(self): "Name/ID does not match a subscription." self.subscription.delete() replies = MoveHandler.test('APPT MOVE foo bar %s' % self.tomorrow, identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue('does not match an active subscription' in reply) def test_subscription_ended(self): "Name/ID subscription has ended." self.subscription.end = now() self.subscription.save() replies = MoveHandler.test('APPT MOVE foo bar %s' % self.tomorrow, identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue('does not match an active subscription' in reply) class QuitHandlerTestCase(OccurrenceDataTestCase): "Keyword handler for unsubscribing users to timelines" def setUp(self): self.timeline = self.create_timeline(name='Test', slug='foo') self.connection = self.create_connection() self.subscription = self.create_timeline_subscription( timeline=self.timeline, connection=self.connection, pin='bar') QuitHandler._mock_backend = self.connection.backend self.prefix = AppointmentHandler.prefix def test_help(self): "Prefix and keyword should return the help for quitting a subscription." replies = QuitHandler.test('APPT QUIT', identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(self.prefix + ' QUIT <KEY> <NAME/ID> <DATE>' in reply) def test_match(self): "Send a successful match to end a timeline subscription." replies = QuitHandler.test('APPT QUIT foo bar', identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Thank you'), reply) def test_match_with_date(self): "Use end date if given." end = (now() + timedelta(hours=1)).strftime('%Y-%m-%d') replies = QuitHandler.test('APPT QUIT foo bar %s' % end, identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Thank you'), reply) self.assertEqual(end, TimelineSubscription.objects.all()[0].end.strftime('%Y-%m-%d')) def test_no_keyword_match(self): "Keyword does not match any existing timelines." self.timeline.delete() replies = QuitHandler.test('APPT QUIT foo bar', identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Sorry')) def test_no_name_given(self): "No name is given." replies = QuitHandler.test('APPT QUIT foo', identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Sorry')) def test_invalid_date_format_given(self): "Invalid date format." replies = QuitHandler.test('APPT QUIT foo bar baz', identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Sorry')) def test_already_quit(self): "Attempting to unsubscribe and already unsubcribed connection/name pair." self.subscription.end = now() self.subscription.save() replies = QuitHandler.test('APPT QUIT foo bar', identity=self.connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Sorry')) class SubscribeHandlerTestCase(OccurrenceDataTestCase): "Keyword handler for subscribing users to timelines" def setUp(self): self.timeline = self.create_timeline(name='Test', slug='foo') def test_help(self): "Keyword should return the help for adding subscriptions." replies = SubscribeHandler.test('SUBSCRIBE') self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue('SUBSCRIBE <KEY> <NAME/ID> <DATE>' in reply) def test_match(self): "Send a successful match to create user timeline subscription." replies = SubscribeHandler.test('SUBSCRIBE foo bar') self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Thank you'), reply) def test_match_with_date(self): "Use start date if given." tomorrow = (now() + timedelta(days=1)).strftime('%Y-%m-%d') replies = SubscribeHandler.test('SUBSCRIBE foo bar %s' % tomorrow) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Thank you'), reply) def test_match_with_relative_date(self): "Use relative start date if given." two_weeks_ago = "two weeks ago" replies = SubscribeHandler.test('SUBSCRIBE foo bar %s' % two_weeks_ago) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Thank you'), reply) def test_no_keyword_match(self): "Keyword does not match any existing timelines." self.timeline.delete() replies = SubscribeHandler.test('SUBSCRIBE foo bar') self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Sorry')) def test_no_name_given(self): "No name is given." replies = SubscribeHandler.test('SUBSCRIBE foo') self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Sorry')) def test_invalid_date_format_given(self): "Invalid date format." replies = SubscribeHandler.test('SUBSCRIBE foo bar baz') self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Sorry')) def test_already_subscribed(self): "Attempting to register and already registered connection/name pair." connection = self.create_connection() SubscribeHandler._mock_backend = connection.backend self.create_timeline_subscription(timeline=self.timeline, connection=connection, pin='bar') replies = SubscribeHandler.test('SUBSCRIBE foo bar', identity=connection.identity) self.assertEqual(len(replies), 1) reply = replies[0] self.assertTrue(reply.startswith('Sorry')) del SubscribeHandler._mock_backend
# Copyright 2015 Google Inc. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Parent client for calling the Google Cloud Bigtable API. This is the base from which all interactions with the API occur. In the hierarchy of API concepts * a :class:`Client` owns an :class:`.Instance` * a :class:`.Instance` owns a :class:`Table <gcloud.bigtable.table.Table>` * a :class:`Table <gcloud.bigtable.table.Table>` owns a :class:`ColumnFamily <.column_family.ColumnFamily>` * a :class:`Table <gcloud.bigtable.table.Table>` owns a :class:`Row <.row.Row>` (and all the cells in the row) """ from pkg_resources import get_distribution from grpc.beta import implementations from gcloud.bigtable._generated_v2 import ( bigtable_instance_admin_pb2 as instance_admin_v2_pb2) # V1 table admin service from gcloud.bigtable._generated_v2 import ( bigtable_table_admin_pb2 as table_admin_v2_pb2) # V1 data service from gcloud.bigtable._generated_v2 import ( bigtable_pb2 as data_v2_pb2) from gcloud.bigtable._generated_v2 import ( operations_grpc_pb2 as operations_grpc_v2_pb2) from gcloud.bigtable.cluster import DEFAULT_SERVE_NODES from gcloud.bigtable.instance import Instance from gcloud.bigtable.instance import _EXISTING_INSTANCE_LOCATION_ID from gcloud.client import _ClientFactoryMixin from gcloud.client import _ClientProjectMixin from gcloud.credentials import get_credentials TABLE_STUB_FACTORY_V2 = ( table_admin_v2_pb2.beta_create_BigtableTableAdmin_stub) TABLE_ADMIN_HOST_V2 = 'bigtableadmin.googleapis.com' """Table Admin API request host.""" TABLE_ADMIN_PORT_V2 = 443 """Table Admin API request port.""" INSTANCE_STUB_FACTORY_V2 = ( instance_admin_v2_pb2.beta_create_BigtableInstanceAdmin_stub) INSTANCE_ADMIN_HOST_V2 = 'bigtableadmin.googleapis.com' """Cluster Admin API request host.""" INSTANCE_ADMIN_PORT_V2 = 443 """Cluster Admin API request port.""" DATA_STUB_FACTORY_V2 = data_v2_pb2.beta_create_Bigtable_stub DATA_API_HOST_V2 = 'bigtable.googleapis.com' """Data API request host.""" DATA_API_PORT_V2 = 443 """Data API request port.""" OPERATIONS_STUB_FACTORY_V2 = operations_grpc_v2_pb2.beta_create_Operations_stub OPERATIONS_API_HOST_V2 = INSTANCE_ADMIN_HOST_V2 OPERATIONS_API_PORT_V2 = INSTANCE_ADMIN_PORT_V2 ADMIN_SCOPE = 'https://www.googleapis.com/auth/bigtable.admin' """Scope for interacting with the Cluster Admin and Table Admin APIs.""" DATA_SCOPE = 'https://www.googleapis.com/auth/bigtable.data' """Scope for reading and writing table data.""" READ_ONLY_SCOPE = 'https://www.googleapis.com/auth/bigtable.data.readonly' """Scope for reading table data.""" DEFAULT_TIMEOUT_SECONDS = 10 """The default timeout to use for API requests.""" DEFAULT_USER_AGENT = 'gcloud-python/{0}'.format( get_distribution('gcloud').version) """The default user agent for API requests.""" class Client(_ClientFactoryMixin, _ClientProjectMixin): """Client for interacting with Google Cloud Bigtable API. .. note:: Since the Cloud Bigtable API requires the gRPC transport, no ``http`` argument is accepted by this class. :type project: :class:`str` or :func:`unicode <unicode>` :param project: (Optional) The ID of the project which owns the instances, tables and data. If not provided, will attempt to determine from the environment. :type credentials: :class:`OAuth2Credentials <oauth2client.client.OAuth2Credentials>` or :data:`NoneType <types.NoneType>` :param credentials: (Optional) The OAuth2 Credentials to use for this client. If not provided, defaults to the Google Application Default Credentials. :type read_only: bool :param read_only: (Optional) Boolean indicating if the data scope should be for reading only (or for writing as well). Defaults to :data:`False`. :type admin: bool :param admin: (Optional) Boolean indicating if the client will be used to interact with the Instance Admin or Table Admin APIs. This requires the :const:`ADMIN_SCOPE`. Defaults to :data:`False`. :type user_agent: str :param user_agent: (Optional) The user agent to be used with API request. Defaults to :const:`DEFAULT_USER_AGENT`. :type timeout_seconds: int :param timeout_seconds: Number of seconds for request time-out. If not passed, defaults to :const:`DEFAULT_TIMEOUT_SECONDS`. :raises: :class:`ValueError <exceptions.ValueError>` if both ``read_only`` and ``admin`` are :data:`True` """ def __init__(self, project=None, credentials=None, read_only=False, admin=False, user_agent=DEFAULT_USER_AGENT, timeout_seconds=DEFAULT_TIMEOUT_SECONDS): _ClientProjectMixin.__init__(self, project=project) if credentials is None: credentials = get_credentials() if read_only and admin: raise ValueError('A read-only client cannot also perform' 'administrative actions.') scopes = [] if read_only: scopes.append(READ_ONLY_SCOPE) else: scopes.append(DATA_SCOPE) if admin: scopes.append(ADMIN_SCOPE) self._admin = bool(admin) try: credentials = credentials.create_scoped(scopes) except AttributeError: pass self._credentials = credentials self.user_agent = user_agent self.timeout_seconds = timeout_seconds # These will be set in start(). self._data_stub_internal = None self._instance_stub_internal = None self._operations_stub_internal = None self._table_stub_internal = None def copy(self): """Make a copy of this client. Copies the local data stored as simple types but does not copy the current state of any open connections with the Cloud Bigtable API. :rtype: :class:`.Client` :returns: A copy of the current client. """ credentials = self._credentials copied_creds = credentials.create_scoped(credentials.scopes) return self.__class__( self.project, copied_creds, READ_ONLY_SCOPE in copied_creds.scopes, self._admin, self.user_agent, self.timeout_seconds, ) @property def credentials(self): """Getter for client's credentials. :rtype: :class:`OAuth2Credentials <oauth2client.client.OAuth2Credentials>` :returns: The credentials stored on the client. """ return self._credentials @property def project_name(self): """Project name to be used with Instance Admin API. .. note:: This property will not change if ``project`` does not, but the return value is not cached. The project name is of the form ``"projects/{project}"`` :rtype: str :returns: The project name to be used with the Cloud Bigtable Admin API RPC service. """ return 'projects/' + self.project @property def _data_stub(self): """Getter for the gRPC stub used for the Data API. :rtype: :class:`grpc.beta._stub._AutoIntermediary` :returns: A gRPC stub object. :raises: :class:`ValueError <exceptions.ValueError>` if the current client has not been :meth:`start`-ed. """ if self._data_stub_internal is None: raise ValueError('Client has not been started.') return self._data_stub_internal @property def _instance_stub(self): """Getter for the gRPC stub used for the Instance Admin API. :rtype: :class:`grpc.beta._stub._AutoIntermediary` :returns: A gRPC stub object. :raises: :class:`ValueError <exceptions.ValueError>` if the current client is not an admin client or if it has not been :meth:`start`-ed. """ if not self._admin: raise ValueError('Client is not an admin client.') if self._instance_stub_internal is None: raise ValueError('Client has not been started.') return self._instance_stub_internal @property def _operations_stub(self): """Getter for the gRPC stub used for the Operations API. :rtype: :class:`grpc.beta._stub._AutoIntermediary` :returns: A gRPC stub object. :raises: :class:`ValueError <exceptions.ValueError>` if the current client is not an admin client or if it has not been :meth:`start`-ed. """ if not self._admin: raise ValueError('Client is not an admin client.') if self._operations_stub_internal is None: raise ValueError('Client has not been started.') return self._operations_stub_internal @property def _table_stub(self): """Getter for the gRPC stub used for the Table Admin API. :rtype: :class:`grpc.beta._stub._AutoIntermediary` :returns: A gRPC stub object. :raises: :class:`ValueError <exceptions.ValueError>` if the current client is not an admin client or if it has not been :meth:`start`-ed. """ if not self._admin: raise ValueError('Client is not an admin client.') if self._table_stub_internal is None: raise ValueError('Client has not been started.') return self._table_stub_internal def _make_data_stub(self): """Creates gRPC stub to make requests to the Data API. :rtype: :class:`grpc.beta._stub._AutoIntermediary` :returns: A gRPC stub object. """ return _make_stub(self, DATA_STUB_FACTORY_V2, DATA_API_HOST_V2, DATA_API_PORT_V2) def _make_instance_stub(self): """Creates gRPC stub to make requests to the Instance Admin API. :rtype: :class:`grpc.beta._stub._AutoIntermediary` :returns: A gRPC stub object. """ return _make_stub(self, INSTANCE_STUB_FACTORY_V2, INSTANCE_ADMIN_HOST_V2, INSTANCE_ADMIN_PORT_V2) def _make_operations_stub(self): """Creates gRPC stub to make requests to the Operations API. These are for long-running operations of the Instance Admin API, hence the host and port matching. :rtype: :class:`grpc.beta._stub._AutoIntermediary` :returns: A gRPC stub object. """ return _make_stub(self, OPERATIONS_STUB_FACTORY_V2, OPERATIONS_API_HOST_V2, OPERATIONS_API_PORT_V2) def _make_table_stub(self): """Creates gRPC stub to make requests to the Table Admin API. :rtype: :class:`grpc.beta._stub._AutoIntermediary` :returns: A gRPC stub object. """ return _make_stub(self, TABLE_STUB_FACTORY_V2, TABLE_ADMIN_HOST_V2, TABLE_ADMIN_PORT_V2) def is_started(self): """Check if the client has been started. :rtype: bool :returns: Boolean indicating if the client has been started. """ return self._data_stub_internal is not None def start(self): """Prepare the client to make requests. Activates gRPC contexts for making requests to the Bigtable Service(s). """ if self.is_started(): return # NOTE: We __enter__ the stubs more-or-less permanently. This is # because only after entering the context managers is the # connection created. We don't want to immediately close # those connections since the client will make many # requests with it over HTTP/2. self._data_stub_internal = self._make_data_stub() self._data_stub_internal.__enter__() if self._admin: self._instance_stub_internal = self._make_instance_stub() self._operations_stub_internal = self._make_operations_stub() self._table_stub_internal = self._make_table_stub() self._instance_stub_internal.__enter__() self._operations_stub_internal.__enter__() self._table_stub_internal.__enter__() def __enter__(self): """Starts the client as a context manager.""" self.start() return self def stop(self): """Closes all the open gRPC clients.""" if not self.is_started(): return # When exit-ing, we pass None as the exception type, value and # traceback to __exit__. self._data_stub_internal.__exit__(None, None, None) if self._admin: self._instance_stub_internal.__exit__(None, None, None) self._operations_stub_internal.__exit__(None, None, None) self._table_stub_internal.__exit__(None, None, None) self._data_stub_internal = None self._instance_stub_internal = None self._operations_stub_internal = None self._table_stub_internal = None def __exit__(self, exc_type, exc_val, exc_t): """Stops the client as a context manager.""" self.stop() def instance(self, instance_id, location=_EXISTING_INSTANCE_LOCATION_ID, display_name=None, serve_nodes=DEFAULT_SERVE_NODES): """Factory to create a instance associated with this client. :type instance_id: str :param instance_id: The ID of the instance. :type location: string :param location: location name, in form ``projects/<project>/locations/<location>``; used to set up the instance's cluster. :type display_name: str :param display_name: (Optional) The display name for the instance in the Cloud Console UI. (Must be between 4 and 30 characters.) If this value is not set in the constructor, will fall back to the instance ID. :type serve_nodes: int :param serve_nodes: (Optional) The number of nodes in the instance's cluster; used to set up the instance's cluster. :rtype: :class:`.Instance` :returns: an instance owned by this client. """ return Instance(instance_id, self, location, display_name=display_name, serve_nodes=serve_nodes) def list_instances(self): """List instances owned by the project. :rtype: tuple :returns: A pair of results, the first is a list of :class:`.Instance` objects returned and the second is a list of strings (the failed locations in the request). """ request_pb = instance_admin_v2_pb2.ListInstancesRequest( parent=self.project_name) response = self._instance_stub.ListInstances( request_pb, self.timeout_seconds) instances = [Instance.from_pb(instance_pb, self) for instance_pb in response.instances] return instances, response.failed_locations class _MetadataPlugin(object): """Callable class to transform metadata for gRPC requests. :type client: :class:`.client.Client` :param client: The client that owns the instance. Provides authorization and user agent. """ def __init__(self, client): self._credentials = client.credentials self._user_agent = client.user_agent def __call__(self, unused_context, callback): """Adds authorization header to request metadata.""" access_token = self._credentials.get_access_token().access_token headers = [ ('Authorization', 'Bearer ' + access_token), ('User-agent', self._user_agent), ] callback(headers, None) def _make_stub(client, stub_factory, host, port): """Makes a stub for an RPC service. Uses / depends on the beta implementation of gRPC. :type client: :class:`.client.Client` :param client: The client that owns the instance. Provides authorization and user agent. :type stub_factory: callable :param stub_factory: A factory which will create a gRPC stub for a given service. :type host: str :param host: The host for the service. :type port: int :param port: The port for the service. :rtype: :class:`grpc.beta._stub._AutoIntermediary` :returns: The stub object used to make gRPC requests to a given API. """ # Leaving the first argument to ssl_channel_credentials() as None # loads root certificates from `grpc/_adapter/credentials/roots.pem`. transport_creds = implementations.ssl_channel_credentials(None, None, None) custom_metadata_plugin = _MetadataPlugin(client) auth_creds = implementations.metadata_call_credentials( custom_metadata_plugin, name='google_creds') channel_creds = implementations.composite_channel_credentials( transport_creds, auth_creds) channel = implementations.secure_channel(host, port, channel_creds) return stub_factory(channel)
#!/usr/bin/env python3 # -*- coding: utf-8 -*- # Author: Bertrand256 # Created on: 2017-04 import base64 import os from typing import ByteString, List, Tuple, Generator from PyQt5.QtWidgets import QMessageBox from cryptography.fernet import Fernet, InvalidToken from app_defs import get_note_url from app_utils import SHA256, write_bytes_buf, write_int_list_buf, read_bytes_from_file, read_int_list_from_file from common import CancelException from dash_utils import num_to_varint, read_varint_from_file, bip32_path_n_to_string from hw_common import HWType, HWNotConnectedException from hw_intf import hw_sign_message, get_address_and_pubkey, HwSessionInfo from wnd_utils import WndUtils DMT_ENCRYPTED_DATA_PREFIX = b'DMTEF' ENC_FILE_BLOCK_SIZE = 1000000 def prepare_hw_encryption_attrs(hw_session: HwSessionInfo, label: str) -> \ Tuple[int, int, List[int], bytes, bytes, bytes]: """ :param hw_session: :param label: :return: 0: protocol id 1: hw type id (see below) 2: bip32 path to the entryption key 3: encryption key hash 4: encryption key binary 5: pub key hash of the encryption key """ # generate a new random password which will be used to encrypt with Trezor method + Fernet protocol = 1 hw_type_bin = { HWType.trezor: 1, HWType.keepkey: 2, HWType.ledger_nano: 3 }[hw_session.hw_type] key = Fernet.generate_key() # encryption key key_bin = base64.urlsafe_b64decode(key) bip32_path_n = [10, 100, 1000] if hw_session.hw_type in (HWType.trezor, HWType.keepkey): # for trezor method, for encryption we use the raw key and the key encrypted with a device # will be part of a header encrypted_key_bin, pub_key = hw_session.hw_encrypt_value(bip32_path_n, label=label, value=key_bin) pub_key_hash = SHA256.new(pub_key).digest() return protocol, hw_type_bin, bip32_path_n, key, encrypted_key_bin, pub_key_hash elif hw_session.hw_type == HWType.ledger_nano: # Ledger Nano S does not have encryption/decryption features, so for encryption and decryption will use # a hash of a signed message, where the message the raw key itself; # The raw key will be part of the encrypted header. display_label = f'<b>Click the sign message confirmation button on the <br>hardware wallet to ' \ f'encrypt \'{label}\'.</b>' bip32_path_str = bip32_path_n_to_string(bip32_path_n) sig = hw_sign_message(hw_session, 'Dash', bip32_path_str, key_bin.hex(), display_label=display_label) adr_pk = get_address_and_pubkey(hw_session, 'Dash', bip32_path_str) pub_key_hash = SHA256.new(adr_pk.get('publicKey')).digest() enc_key_hash = SHA256.new(sig.signature).digest() enc_key_hash = base64.urlsafe_b64encode(enc_key_hash) return protocol, hw_type_bin, bip32_path_n, enc_key_hash, key_bin, pub_key_hash def write_file_encrypted(file_name: str, hw_session: HwSessionInfo, data: bytes): label = os.path.basename(file_name) if not hw_session.connect_hardware_wallet(): raise Exception('Not connected to hardware wallet.') protocol, hw_type_bin, bip32_path_n, encryption_key, encrypted_key_bin, pub_key_hash = \ prepare_hw_encryption_attrs(hw_session, label) fer = Fernet(encryption_key) with open(file_name, 'wb') as f_ptr: header = DMT_ENCRYPTED_DATA_PREFIX + \ num_to_varint(protocol) + num_to_varint(hw_type_bin) + \ write_bytes_buf(bytearray(base64.b64encode(bytearray(label, 'utf-8')))) + \ write_bytes_buf(encrypted_key_bin) + \ write_int_list_buf(bip32_path_n) + \ write_bytes_buf(pub_key_hash) f_ptr.write(header) # slice the input data into ENC_FILE_BLOCK_SIZE-byte chunks, encrypt them and # write to file; each block will be preceded with the length of the encrypted # data chunk size begin_idx = 0 while True: data_left = len(data) - begin_idx if data_left <= 0: break cur_input_chunk_size = min(ENC_FILE_BLOCK_SIZE, data_left) data_enc_base64 = fer.encrypt(data[begin_idx: begin_idx + cur_input_chunk_size]) data_enc = base64.urlsafe_b64decode(data_enc_base64) cur_chunk_size_bin = len(data_enc).to_bytes(8, byteorder='little') # write the size of the data chunk f_ptr.write(cur_chunk_size_bin) # write the data f_ptr.write(data_enc) # write the data begin_idx += cur_input_chunk_size def read_file_encrypted(file_name: str, ret_attrs: dict, hw_session: HwSessionInfo) -> Generator[bytes, None, None]: ret_attrs['encrypted'] = False try: hw_session.save_state() with open(file_name, 'rb') as f_ptr: data = f_ptr.read(len(DMT_ENCRYPTED_DATA_PREFIX)) if data == DMT_ENCRYPTED_DATA_PREFIX: ret_attrs['encrypted'] = True protocol = read_varint_from_file(f_ptr) if protocol == 1: # with Trezor method + Fernet hw_type_bin = read_varint_from_file(f_ptr) hw_type = { 1: HWType.trezor, 2: HWType.keepkey, 3: HWType.ledger_nano }.get(hw_type_bin) if hw_type: # connect hardware wallet, choosing the type compatible with the type read from # the encrypted file if hw_session.hw_client: if (hw_type in (HWType.trezor, HWType.keepkey) and hw_session.hw_type not in (HWType.trezor, HWType.keepkey)) or \ (hw_type == HWType.ledger_nano and hw_type != hw_session.hw_type): # if the currently connected hardware wallet type is not compatible with the # type from the encrypted file, disconnect it to give a user a chance to choose # the correct one in the code below hw_session.disconnect_hardware_wallet() if not hw_session.hw_client: if hw_type in (HWType.trezor, HWType.keepkey): hw_session.set_hw_types_allowed((HWType.trezor, HWType.keepkey)) else: hw_session.set_hw_types_allowed((hw_type,)) if not hw_session.connect_hardware_wallet(): raise HWNotConnectedException( f'This file was encrypted with {HWType.get_desc(hw_type)} hardware wallet, ' f'which has to be connected to the computer decrypt the file.') data_label_bin = read_bytes_from_file(f_ptr) label = base64.urlsafe_b64decode(data_label_bin).decode('utf-8') encrypted_key_bin = read_bytes_from_file(f_ptr) bip32_path_n = read_int_list_from_file(f_ptr) pub_key_hash_hdr = read_bytes_from_file(f_ptr) while True: if not hw_session.hw_client: raise HWNotConnectedException( f'This file was encrypted with {HWType.get_desc(hw_type)} hardware wallet, ' f'which has to be connected to the computer decrypt the file.') if hw_session.hw_type in (HWType.trezor, HWType.keepkey): key_bin, pub_key = hw_session.hw_decrypt_value( bip32_path_n, label=label, value=encrypted_key_bin) elif hw_session.hw_type == HWType.ledger_nano: display_label = f'<b>Click the sign message confirmation button on the <br>' \ f'hardware wallet to decrypt \'{label}\'.</b>' bip32_path_str = bip32_path_n_to_string(bip32_path_n) sig = hw_sign_message(hw_session, 'Dash', bip32_path_str, encrypted_key_bin.hex(), display_label=display_label) adr_pk = get_address_and_pubkey(hw_session, 'Dash', bip32_path_str) pub_key = adr_pk.get('publicKey') key_bin = SHA256.new(sig.signature).digest() else: raise Exception('Invalid hardware wallet type.') pub_key_hash = SHA256.new(pub_key).digest() if pub_key_hash_hdr == pub_key_hash: break url = get_note_url('DMT0003') if WndUtils.query_dlg( message='Inconsistency between encryption and decryption keys.\n\n' 'The reason may be using a different passphrase than it was used ' 'for encryption or running another application communicating with the ' 'device simultaneously, like Trezor web wallet (see <a href="{url}">' 'here</a>).\n\n' 'Do you want to try again?', buttons=QMessageBox.Yes | QMessageBox.Cancel, default_button=QMessageBox.Cancel, icon=QMessageBox.Warning) == QMessageBox.Cancel: raise CancelException('User cancelled.') hw_session.disconnect_hardware_wallet() hw_session.connect_hardware_wallet() key = base64.urlsafe_b64encode(key_bin) fer = Fernet(key) while True: # data is written in blocks; if front of each block there is a block size value data_bin = f_ptr.read(8) if len(data_bin) == 0: break # end of file elif len(data_bin) < 8: raise ValueError('File end before read completed.') data_chunk_size = int.from_bytes(data_bin, byteorder='little') if data_chunk_size < 0 or data_chunk_size > 2000000000: raise ValueError('Data corrupted: invalid data chunk size.') data_bin = f_ptr.read(data_chunk_size) if data_chunk_size != len(data_bin): raise ValueError('File end before read completed.') data_base64 = base64.urlsafe_b64encode(data_bin) try: data_decr = fer.decrypt(data_base64) except InvalidToken: raise Exception('Couldn\'t decrypt file (InvalidToken error). The file is probably ' 'corrupted or is encrypted with a different encryption method.') yield data_decr else: raise ValueError('Invalid hardware wallet type value.') else: raise ValueError('Invalid protocol value.') else: # the data inside the file isn't encrypted # read and yield raw data while True: # data is written in blocks; if front of each block there is a block size value data += f_ptr.read(ENC_FILE_BLOCK_SIZE) if not len(data): break yield data data = bytes() finally: hw_session.restore_state()
# Copyright (c) 2015, Ecole Polytechnique Federale de Lausanne, Blue Brain Project # All rights reserved. # # This file is part of NeuroM <https://github.com/BlueBrain/NeuroM> # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are met: # # 1. Redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer. # 2. Redistributions in binary form must reproduce the above copyright # notice, this list of conditions and the following disclaimer in the # documentation and/or other materials provided with the distribution. # 3. Neither the name of the copyright holder nor the names of # its contributors may be used to endorse or promote products # derived from this software without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND # ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED # WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE # DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE FOR ANY # DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES # (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; # LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND # ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT # (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS # SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. import sys from nose import tools as nt from neurom.core.tree import Tree REF_TREE = Tree() T11 = REF_TREE.add_child(Tree()) T12 = REF_TREE.add_child(Tree()) T111 = REF_TREE.children[0].add_child(Tree()) T112 = REF_TREE.children[0].add_child(Tree()) T121 = REF_TREE.children[1].add_child(Tree()) T122 = REF_TREE.children[1].add_child(Tree()) T1211 = REF_TREE.children[1].children[0].add_child(Tree()) T12111 = REF_TREE.children[1].children[0].children[0].add_child(Tree()) T12112 = REF_TREE.children[1].children[0].children[0].add_child(Tree()) REF_TREE2 = Tree() T11_ = REF_TREE2.add_child(Tree()) T12_ = REF_TREE2.add_child(Tree()) T111_ = REF_TREE2.children[0].add_child(Tree()) T112_ = REF_TREE2.children[0].add_child(Tree()) T121_ = REF_TREE2.children[1].add_child(Tree()) T122_ = REF_TREE2.children[1].add_child(Tree()) T1211_ = REF_TREE2.children[1].children[0].add_child(Tree()) T12111_ = REF_TREE2.children[1].children[0].children[0].add_child(Tree()) T12112_ = REF_TREE2.children[1].children[0].children[0].add_child(Tree()) T1111_ = REF_TREE2.children[0].children[0].add_child(Tree()) T11111_ = T1111_.add_child(Tree()) T11112_ = T1111_.add_child(Tree()) T11113_ = T1111_.add_child(Tree()) def test_instantiate_tree(): t = Tree() nt.ok_(t.parent is None) nt.ok_(len(t.children) == 0) def test_add_child(): t = Tree() ch11 = t.add_child(Tree()) ch22 = t.add_child(Tree()) nt.ok_(len(t.children) == 2) nt.ok_(t.children == [ch11, ch22]) def test_parent(): t = Tree() for i in range(10): t.add_child(Tree()) nt.ok_(len(t.children) == 10) for c in t.children: nt.ok_(c.parent is t) def test_is_root_true(): t = Tree() nt.ok_(Tree.is_root(t)) nt.ok_(t.is_root()) def test_is_root_false(): t = Tree() t.add_child(Tree()) nt.ok_(not t.children[0].is_root()) def test_is_leaf(): nt.ok_(Tree().is_leaf()) def test_is_leaf_false(): t = Tree() t.add_child(Tree()) nt.ok_(not t.is_leaf()) def test_is_forking_point(): t = Tree() t.add_child(Tree()) t.add_child(Tree()) nt.ok_(t.is_forking_point()) t.add_child(Tree()) nt.ok_(t.is_forking_point()) def test_is_forking_point_false(): t = Tree() nt.ok_(not t.is_forking_point()) t.add_child(Tree()) nt.ok_(not t.is_forking_point()) def test_is_bifurcation_point(): t = Tree() t.add_child(Tree()) t.add_child(Tree()) nt.ok_(t.is_bifurcation_point()) def test_is_bifurcation_point_false(): t = Tree() nt.ok_(not t.is_bifurcation_point()) t.add_child(Tree()) nt.ok_(not t.is_bifurcation_point()) t.add_child(Tree()) t.add_child(Tree()) nt.ok_(not t.is_bifurcation_point()) def test_deep_iteration(): root = t = Tree() for i in range(1, sys.getrecursionlimit() + 2): child = Tree() t.add_child(child) t = child list(root.ipreorder()) list(root.ipostorder()) list(t.iupstream()) def test_preorder_iteration(): nt.ok_(list(REF_TREE.ipreorder()) == [REF_TREE, T11, T111, T112, T12, T121, T1211, T12111, T12112, T122]) nt.ok_(list(REF_TREE.children[0].ipreorder()) == [T11, T111, T112]) nt.ok_(list(REF_TREE.children[1].ipreorder()) == [T12, T121, T1211, T12111, T12112, T122]) def test_postorder_iteration(): nt.ok_(list(REF_TREE.ipostorder()) == [T111, T112, T11, T12111, T12112, T1211, T121, T122, T12, REF_TREE]) nt.ok_(list(REF_TREE.children[0].ipostorder()) == [T111, T112, T11]) nt.ok_(list(REF_TREE.children[1].ipostorder()) == [T12111, T12112, T1211, T121, T122, T12]) def test_upstream_iteration(): nt.ok_(list(REF_TREE.iupstream()) == [REF_TREE]) nt.ok_(list(REF_TREE.children[0].iupstream()) == [T11, REF_TREE]) nt.ok_(list(REF_TREE.children[0].children[0].iupstream()) == [T111, T11, REF_TREE]) nt.ok_(list(REF_TREE.children[0].children[1].iupstream()) == [T112, T11, REF_TREE]) nt.ok_(list(REF_TREE.children[1].iupstream()) == [T12, REF_TREE]) nt.ok_(list(REF_TREE.children[1].children[0].iupstream()) == [T121, T12, REF_TREE]) nt.ok_(list(REF_TREE.children[1].children[1].iupstream()) == [T122, T12, REF_TREE]) def test_leaf_iteration(): ileaf = Tree.ileaf nt.ok_(list(ileaf(REF_TREE)) == [T111, T112, T12111, T12112, T122]) nt.ok_(list(ileaf(REF_TREE.children[0])) == [T111, T112]) nt.ok_(list(ileaf(REF_TREE.children[1])) == [T12111, T12112, T122]) nt.ok_(list(ileaf(REF_TREE.children[0].children[0])) == [T111]) nt.ok_(list(ileaf(REF_TREE.children[0].children[1])) == [T112]) nt.ok_(list(ileaf(REF_TREE.children[1].children[0])) == [T12111, T12112]) nt.ok_(list(ileaf(REF_TREE.children[1].children[1])) == [T122]) def test_iforking_point(): nt.assert_equal([n for n in REF_TREE2.iforking_point()], [REF_TREE2, T11_, T1111_, T12_, T1211_]) def test_iforking_point_postorder(): nt.assert_equal([n for n in REF_TREE2.iforking_point(Tree.ipostorder)], [T1111_, T11_, T1211_, T12_, REF_TREE2]) def test_iforking_point_upstream(): ileaf = Tree.ileaf leaves = [l for l in ileaf(REF_TREE2)] ref_paths = [ [T1111_, T11_, REF_TREE2], [T1111_, T11_, REF_TREE2], [T1111_, T11_, REF_TREE2], [T11_, REF_TREE2], [T1211_, T12_, REF_TREE2], [T1211_, T12_, REF_TREE2], [T12_, REF_TREE2] ] for l, ref in zip(leaves, ref_paths): nt.assert_equal([s for s in l.iforking_point(Tree.iupstream)], ref) def test_ibifurcation_point(): nt.assert_equal([n for n in REF_TREE2.ibifurcation_point()], [REF_TREE2, T11_, T12_, T1211_]) def test_ibifurcation_point_postorder(): nt.assert_equal([n for n in REF_TREE2.ibifurcation_point(Tree.ipostorder)], [T11_, T1211_, T12_, REF_TREE2]) def test_ibifurcation_point_upstream(): leaves = [l for l in REF_TREE2.ileaf()] ref_paths = [ [T11_, REF_TREE2], [T11_, REF_TREE2], [T11_, REF_TREE2], [T11_, REF_TREE2], [T1211_, T12_, REF_TREE2], [T1211_, T12_, REF_TREE2], [T12_, REF_TREE2] ] for l, ref in zip(leaves, ref_paths): nt.assert_equal([s for s in l.ibifurcation_point(Tree.iupstream)], ref) def test_valiter_bifurcation_point(): nt.ok_(list(REF_TREE2.ibifurcation_point()) == [REF_TREE2, T11_, T12_, T1211_])
# Copyright 2012 OpenStack Foundation # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. from oslo_log import log as logging from tempest_lib.common.utils import data_utils from tempest.common.utils.linux import remote_client from tempest import config from tempest import exceptions from tempest import test from tempest.thirdparty.boto import test as boto_test from tempest.thirdparty.boto.utils import s3 from tempest.thirdparty.boto.utils import wait CONF = config.CONF LOG = logging.getLogger(__name__) class InstanceRunTest(boto_test.BotoTestCase): @classmethod def setup_clients(cls): super(InstanceRunTest, cls).setup_clients() cls.s3_client = cls.os.s3_client cls.ec2_client = cls.os.ec2api_client @classmethod def resource_setup(cls): super(InstanceRunTest, cls).resource_setup() if not cls.conclusion['A_I_IMAGES_READY']: raise cls.skipException("".join(("EC2 ", cls.__name__, ": requires ami/aki/ari manifest"))) cls.zone = CONF.boto.aws_zone cls.materials_path = CONF.boto.s3_materials_path ami_manifest = CONF.boto.ami_manifest aki_manifest = CONF.boto.aki_manifest ari_manifest = CONF.boto.ari_manifest cls.instance_type = CONF.boto.instance_type cls.bucket_name = data_utils.rand_name("s3bucket") cls.keypair_name = data_utils.rand_name("keypair") cls.keypair = cls.ec2_client.create_key_pair(cls.keypair_name) cls.addResourceCleanUp(cls.ec2_client.delete_key_pair, cls.keypair_name) bucket = cls.s3_client.create_bucket(cls.bucket_name) cls.addResourceCleanUp(cls.destroy_bucket, cls.s3_client.connection_data, cls.bucket_name) s3.s3_upload_dir(bucket, cls.materials_path) cls.images = {"ami": {"name": data_utils.rand_name("ami-name"), "location": cls.bucket_name + "/" + ami_manifest}, "aki": {"name": data_utils.rand_name("aki-name"), "location": cls.bucket_name + "/" + aki_manifest}, "ari": {"name": data_utils.rand_name("ari-name"), "location": cls.bucket_name + "/" + ari_manifest}} for image in cls.images.itervalues(): image["image_id"] = cls.ec2_client.register_image( name=image["name"], image_location=image["location"]) cls.addResourceCleanUp(cls.ec2_client.deregister_image, image["image_id"]) for image in cls.images.itervalues(): def _state(): retr = cls.ec2_client.get_image(image["image_id"]) return retr.state state = wait.state_wait(_state, "available") if state != "available": for _image in cls.images.itervalues(): cls.ec2_client.deregister_image(_image["image_id"]) raise exceptions.EC2RegisterImageException( image_id=image["image_id"]) def _terminate_reservation(self, reservation, rcuk): for instance in reservation.instances: instance.terminate() for instance in reservation.instances: self.assertInstanceStateWait(instance, '_GONE') self.cancelResourceCleanUp(rcuk) @test.idempotent_id('c881fbb7-d56e-4054-9d76-1c3a60a207b0') def test_run_idempotent_instances(self): # EC2 run instances idempotently def _run_instance(client_token): reservation = self.ec2_client.run_instances( image_id=self.images["ami"]["image_id"], kernel_id=self.images["aki"]["image_id"], ramdisk_id=self.images["ari"]["image_id"], instance_type=self.instance_type, client_token=client_token) rcuk = self.addResourceCleanUp(self.destroy_reservation, reservation) return (reservation, rcuk) reservation_1, rcuk_1 = _run_instance('token_1') reservation_2, rcuk_2 = _run_instance('token_2') reservation_1a, rcuk_1a = _run_instance('token_1') self.assertIsNotNone(reservation_1) self.assertIsNotNone(reservation_2) self.assertIsNotNone(reservation_1a) # same reservation for token_1 self.assertEqual(reservation_1.id, reservation_1a.id) # Cancel cleanup -- since it's a duplicate, it's # handled by rcuk1 self.cancelResourceCleanUp(rcuk_1a) self._terminate_reservation(reservation_1, rcuk_1) self._terminate_reservation(reservation_2, rcuk_2) @test.idempotent_id('2ea26a39-f96c-48fc-8374-5c10ec184c67') def test_run_stop_terminate_instance(self): # EC2 run, stop and terminate instance image_ami = self.ec2_client.get_image(self.images["ami"] ["image_id"]) reservation = image_ami.run(kernel_id=self.images["aki"]["image_id"], ramdisk_id=self.images["ari"]["image_id"], instance_type=self.instance_type) rcuk = self.addResourceCleanUp(self.destroy_reservation, reservation) for instance in reservation.instances: LOG.info("state: %s", instance.state) if instance.state != "running": self.assertInstanceStateWait(instance, "running") for instance in reservation.instances: instance.stop() LOG.info("state: %s", instance.state) if instance.state != "stopped": self.assertInstanceStateWait(instance, "stopped") self._terminate_reservation(reservation, rcuk) @test.idempotent_id('3d77225a-5cec-4e54-a017-9ebf11a266e6') def test_run_stop_terminate_instance_with_tags(self): # EC2 run, stop and terminate instance with tags image_ami = self.ec2_client.get_image(self.images["ami"] ["image_id"]) reservation = image_ami.run(kernel_id=self.images["aki"]["image_id"], ramdisk_id=self.images["ari"]["image_id"], instance_type=self.instance_type) rcuk = self.addResourceCleanUp(self.destroy_reservation, reservation) for instance in reservation.instances: LOG.info("state: %s", instance.state) if instance.state != "running": self.assertInstanceStateWait(instance, "running") instance.add_tag('key1', value='value1') tags = self.ec2_client.get_all_tags() td = {item.name: item.value for item in tags} self.assertIn('key1', td) self.assertEqual('value1', td['key1']) tags = self.ec2_client.get_all_tags(filters={'key': 'key1'}) td = {item.name: item.value for item in tags} self.assertIn('key1', td) self.assertEqual('value1', td['key1']) tags = self.ec2_client.get_all_tags(filters={'value': 'value1'}) td = {item.name: item.value for item in tags} self.assertIn('key1', td) self.assertEqual('value1', td['key1']) tags = self.ec2_client.get_all_tags(filters={'key': 'value2'}) td = {item.name: item.value for item in tags} self.assertNotIn('key1', td) for instance in reservation.instances: instance.remove_tag('key1', value='value1') tags = self.ec2_client.get_all_tags() # NOTE: Volume-attach and detach causes metadata (tags) to be created # for the volume. So exclude them while asserting. self.assertNotIn('key1', tags) for instance in reservation.instances: instance.stop() LOG.info("state: %s", instance.state) if instance.state != "stopped": self.assertInstanceStateWait(instance, "stopped") self._terminate_reservation(reservation, rcuk) @test.idempotent_id('252945b5-3294-4fda-ae21-928a42f63f76') def test_run_terminate_instance(self): # EC2 run, terminate immediately image_ami = self.ec2_client.get_image(self.images["ami"] ["image_id"]) reservation = image_ami.run(kernel_id=self.images["aki"]["image_id"], ramdisk_id=self.images["ari"]["image_id"], instance_type=self.instance_type) for instance in reservation.instances: instance.terminate() self.assertInstanceStateWait(instance, '_GONE') @test.idempotent_id('ab836c29-737b-4101-9fb9-87045eaf89e9') def test_compute_with_volumes(self): # EC2 1. integration test (not strict) image_ami = self.ec2_client.get_image(self.images["ami"]["image_id"]) sec_group_name = data_utils.rand_name("securitygroup") group_desc = sec_group_name + " security group description " security_group = self.ec2_client.create_security_group(sec_group_name, group_desc) self.addResourceCleanUp(self.destroy_security_group_wait, security_group) self.assertTrue( self.ec2_client.authorize_security_group( sec_group_name, ip_protocol="icmp", cidr_ip="0.0.0.0/0", from_port=-1, to_port=-1)) self.assertTrue( self.ec2_client.authorize_security_group( sec_group_name, ip_protocol="tcp", cidr_ip="0.0.0.0/0", from_port=22, to_port=22)) reservation = image_ami.run(kernel_id=self.images["aki"]["image_id"], ramdisk_id=self.images["ari"]["image_id"], instance_type=self.instance_type, key_name=self.keypair_name, security_groups=(sec_group_name,)) LOG.debug("Instance booted - state: %s", reservation.instances[0].state) self.addResourceCleanUp(self.destroy_reservation, reservation) volume = self.ec2_client.create_volume(CONF.volume.volume_size, self.zone) LOG.debug("Volume created - status: %s", volume.status) self.addResourceCleanUp(self.destroy_volume_wait, volume) instance = reservation.instances[0] if instance.state != "running": self.assertInstanceStateWait(instance, "running") LOG.debug("Instance now running - state: %s", instance.state) address = self.ec2_client.allocate_address() rcuk_a = self.addResourceCleanUp(address.delete) self.assertTrue(address.associate(instance.id)) rcuk_da = self.addResourceCleanUp(address.disassociate) # TODO(afazekas): ping test. dependecy/permission ? self.assertVolumeStatusWait(volume, "available") # NOTE(afazekas): it may be reports available before it is available ssh = remote_client.RemoteClient(address.public_ip, CONF.compute.ssh_user, pkey=self.keypair.material) text = data_utils.rand_name("Pattern text for console output") resp = ssh.write_to_console(text) self.assertFalse(resp) def _output(): output = instance.get_console_output() return output.output wait.re_search_wait(_output, text) part_lines = ssh.get_partitions().split('\n') volume.attach(instance.id, "/dev/vdh") def _volume_state(): """Return volume state realizing that 'in-use' is overloaded.""" volume.update(validate=True) status = volume.status attached = volume.attach_data.status LOG.debug("Volume %s is in status: %s, attach_status: %s", volume.id, status, attached) # Nova reports 'in-use' on 'attaching' volumes because we # have a single volume status, and EC2 has 2. Ensure that # if we aren't attached yet we return something other than # 'in-use' if status == 'in-use' and attached != 'attached': return 'attaching' else: return status wait.re_search_wait(_volume_state, "in-use") # NOTE(afazekas): Different Hypervisor backends names # differently the devices, # now we just test is the partition number increased/decrised def _part_state(): current = ssh.get_partitions().split('\n') LOG.debug("Partition map for instance: %s", current) if current > part_lines: return 'INCREASE' if current < part_lines: return 'DECREASE' return 'EQUAL' wait.state_wait(_part_state, 'INCREASE') part_lines = ssh.get_partitions().split('\n') # TODO(afazekas): Resource compare to the flavor settings volume.detach() self.assertVolumeStatusWait(volume, "available") wait.state_wait(_part_state, 'DECREASE') instance.stop() address.disassociate() self.assertAddressDissasociatedWait(address) self.cancelResourceCleanUp(rcuk_da) address.release() self.assertAddressReleasedWait(address) self.cancelResourceCleanUp(rcuk_a) LOG.debug("Instance %s state: %s", instance.id, instance.state) if instance.state != "stopped": self.assertInstanceStateWait(instance, "stopped") # TODO(afazekas): move steps from teardown to the test case # TODO(afazekas): Snapshot/volume read/write test case
""" Models the HostWgsRawSeqSet object. """ import json import logging import os import string from cutlass.iHMPSession import iHMPSession from cutlass.Base import Base from cutlass.aspera import aspera from cutlass.Util import * # pylint: disable=W0703, C1801 # Create a module logger named after the module module_logger = logging.getLogger(__name__) # Add a NullHandler for the case if no logging is configured by the application module_logger.addHandler(logging.NullHandler()) class HostWgsRawSeqSet(Base): """ The class encapsulating the HostWgsRawSeqSet data for an iHMP instance. This class contains all the fields required to save a HostWgsRawSeqSet object in the OSDF instance. Attributes: namespace (str): The namespace this class will use in the OSDF instance """ namespace = "ihmp" aspera_server = "aspera2.ihmpdcc.org" def __init__(self, *args, **kwargs): """ Constructor for the HostWgsRawSeqSet class. This initializes the fields specific to the HostWgsRawSeqSet class, and inherits from the Base class. Args: None """ self.logger = logging.getLogger(self.__module__ + '.' + self.__class__.__name__) self.logger.addHandler(logging.NullHandler()) # These are common to all objects self._id = None self._version = None self._links = {} self._tags = [] # These are particular to HostWgsRawSeqSet objects self._checksums = None self._comment = None self._exp_length = None self._format = None self._format_doc = None self._local_file = None self._seq_model = None self._sequence_type = None self._size = None self._study = None self._urls = [''] # Optional properties self._private_files = None super(HostWgsRawSeqSet, self).__init__(*args, **kwargs) def validate(self): """ Validates the current object's data/JSON against the current schema in the OSDF instance for that specific object. All required fields for that specific object must be present. Args: None Returns: A list of strings, where each string is the error that the validation raised during OSDF validation """ self.logger.debug("In validate.") document = self._get_raw_doc() session = iHMPSession.get_session() self.logger.info("Got iHMP session.") (valid, error_message) = session.get_osdf().validate_node(document) problems = [] if not valid: self.logger.info("Validation did not succeed for %s.", __name__) problems.append(error_message) if self._private_files: self.logger.info("User specified the files are private.") else: self.logger.info("Data is NOT private, so check that local_file is set.") if self._local_file is None: problems.append("Local file is not yet set.") elif not os.path.isfile(self._local_file): problems.append("Local file does not point to an actual file.") if 'sequenced_from' not in self._links.keys(): problems.append("Must add a 'sequenced_from' link to a host_seq_prep.") self.logger.debug("Number of validation problems: %s.", len(problems)) return problems def is_valid(self): """ Validates the current object's data/JSON against the current schema in the OSDF instance for the specific object. However, unlike validate(), this method does not provide exact error messages, it states if the validation was successful or not. Args: None Returns: True if the data validates, False if the current state of fields in the instance do not validate with OSDF or other node requirements. """ self.logger.debug("In is_valid.") problems = self.validate() valid = True if len(problems): self.logger.error("There were %s problems.", len(problems)) valid = False self.logger.debug("Valid? %s", str(valid)) return valid @property def checksums(self): """ str: One or more checksums used to ensure file integrity. """ self.logger.debug("In 'checksums' getter.") return self._checksums @checksums.setter @enforce_dict def checksums(self, checksums): """ The setter for the checksum data. Args: checksums (dict): The checksums for the data file. Returns: None """ self.logger.debug("In 'checksums' setter.") self._checksums = checksums @property def comment(self): """ str: Free-text comment. """ self.logger.debug("In 'comment' getter.") return self._comment @comment.setter @enforce_string def comment(self, comment): """ The setter for the comment field. The comment must be a string, and less than 512 characters. Args: comment (str): The new comment to add to the string. Returns: None """ self.logger.debug("In 'comment' setter.") self._comment = comment @property def exp_length(self): """ int: The number of raw bases or color space calls expected for the read, includes both mate pairs and all technical portions. """ self.logger.debug("In 'exp_length' getter.") return self._exp_length @exp_length.setter @enforce_int def exp_length(self, exp_length): """ The setter for the HostWgsRawSeqSet exp_length. Args: exp_length (int): The new exp_length for the current instance. Returns: None """ self.logger.debug("In 'exp_length' setter.") if exp_length < 0: raise ValueError("The 'exp_length' must be non-negative.") self._exp_length = exp_length @property def format(self): """ str: The file format of the sequence file """ self.logger.debug("In 'format' getter.") return self._format @format.setter @enforce_string def format(self, format_str): """ The setter for the HostWgsRawSeqSet format. This must be either fasta or fastq. Args: format_str (str): The new format string for the current object. Returns: None """ self.logger.debug("In 'format' setter.") formats = ["fasta", "fastq"] if format_str in formats: self._format = format_str else: raise Exception("Format must be either fasta or fastq.") @property def format_doc(self): """ str: URL for documentation of file format. """ self.logger.debug("In 'format_doc' getter.") return self._format_doc @format_doc.setter @enforce_string def format_doc(self, format_doc): """ The setter for the HostWgsRawSeqSet format doc. Args: format_doc (str): The new format_doc for the current object. Returns: None """ self.logger.debug("In 'format_doc' setter.") self._format_doc = format_doc @property def local_file(self): """ str: URL to the local file to upload to the server. """ self.logger.debug("In local_file getter.") return self._local_file @local_file.setter @enforce_string def local_file(self, local_file): """ The setter for the HostWgsRawSeqSet local file. Args: local_file (str): The URL to the local file that should be uploaded to the server. Returns: None """ self.logger.debug("In 'local_file' setter.") self._local_file = local_file @property def private_files(self): """ bool: Whether this object describes private data that should not be uploaded to the DCC. Defaults to false. """ self.logger.debug("In 'private_files' getter.") return self._private_files @private_files.setter @enforce_bool def private_files(self, private_files): """ The setter for the private files flag to denote this object describes data that should not be uploaded to the DCC. Args: private_files (bool): Returns: None """ self.logger.debug("In 'private_files' setter.") self._private_files = private_files @property def seq_model(self): """ str: Sequencing instrument model. """ self.logger.debug("In 'seq_model' getter.") return self._seq_model @seq_model.setter @enforce_string def seq_model(self, seq_model): """ The setter for the HostWgsRawSeqSet seq model. Args: seq_model (str): The new seq model. Returns: None """ self.logger.debug("In 'seq_model' setter.") self._seq_model = seq_model @property def sequence_type(self): """ str: Specifies whether the file contains peptide or nucleotide data. """ self.logger.debug("In 'sequence_type' getter.") return self._sequence_type @sequence_type.setter @enforce_string def sequence_type(self, sequence_type): """ The setter for the HostWgsRawSeqSet sequence type. This must be either peptide or nucleotide. Args: sequence_type (str): The new sequence type. Returns: None """ self.logger.debug("In 'sequence_type' setter.") types = ["peptide", "nucleotide"] if sequence_type in types: self._sequence_type = sequence_type else: raise Exception("Sequence type must be peptide or nucleotide") @property def size(self): """ int: The size of the file in bytes. """ self.logger.debug("In 'size' getter.") return self._size @size.setter @enforce_int def size(self, size): """ The setter for the HostWgsRawSeqSet size. Args: size (int): The size of the seq set in bytes. Returns: None """ self.logger.debug("In 'size' setter.") if size < 0: raise ValueError("The size must be non-negative.") self._size = size @property def study(self): """ str: One of the 3 studies that are part of the iHMP. """ self.logger.debug("In 'study' getter.") return self._study @study.setter @enforce_string def study(self, study): """ The setter for the HostWgsRawSeqSet study. This is restricted to be either preg_preterm, ibd, or prediabetes. Args: study (str): The study of the seq set. Returns: None """ self.logger.debug("In 'study' setter.") studies = ["preg_preterm", "ibd", "prediabetes"] if study in studies: self._study = study else: raise Exception("Not a valid study") @property def urls(self): """ array: An array of URL from where the file can be obtained, http, ftp, fasp, etc... """ self.logger.debug("In 'urls' getter.") return self._urls @staticmethod def required_fields(): """ A static method. The required fields for the class. Args: None Returns: Tuple of strings of required properties. """ module_logger.debug("In required_fields.") return ("checksums", "comment", "exp_length", "format", "format_doc", "local_file", "seq_model", "size", "study", "tags", "urls") def _get_raw_doc(self): """ Generates the raw JSON document for the current object. All required fields are filled in, regardless of whether they are set or not. Any remaining fields are included only if they are set. Args: None Returns: A dictionary representation of the JSON document. """ self.logger.debug("In _get_raw_doc.") doc = { 'acl': { 'read': ['all'], 'write': [HostWgsRawSeqSet.namespace] }, 'linkage': self._links, 'ns': HostWgsRawSeqSet.namespace, 'node_type': 'host_wgs_raw_seq_set', 'meta': { "checksums": self._checksums, "comment": self._comment, "exp_length": self._exp_length, "format": self._format, "format_doc": self._format_doc, "seq_model": self.seq_model, "size": self._size, "study": self._study, "urls": self._urls, "subtype": "wgs", 'tags': self._tags } } if self._id is not None: self.logger.debug("%s object has the OSDF id set.", __name__) doc['id'] = self._id if self._version is not None: self.logger.debug("%s object has the OSDF version set.", __name__) doc['ver'] = self._version # Handle optional properties if self._sequence_type is not None: self.logger.debug("%s object has the sequence_type set.", __name__) doc['meta']['sequence_type'] = self._sequence_type if self._private_files is not None: self.logger.debug("%s object has the 'private_files' property set.", __name__ ) doc['meta']['private_files'] = self._private_files return doc @staticmethod def search(query="\"host_wgs_raw_seq_set\"[node_type]"): """ Searches the OSDF database through all HostWgsRawSeqSet node types. Any criteria the user wishes to add is provided by the user in the query language specifications provided in the OSDF documentation. A general format is (including the quotes and brackets): "search criteria"[field to search] If there are any results, they are returned as a HostWgsRawSeqSet instance, otherwise an empty list will be returned. Args: query (str): The query for the OSDF framework. Defaults to the HostWgsRawSeqSet node type. Returns: Returns an array of HostWgsRawSeqSet objects. It returns an empty list if there are no results. """ module_logger.debug("In search.") session = iHMPSession.get_session() module_logger.info("Got iHMP session.") if query != '"host_wgs_raw_seq_set"[node_type]': query = '({}) && "host_wgs_raw_seq_set"[node_type]'.format(query) module_logger.debug("Submitting OQL query: %s", query) seqSet_data = session.get_osdf().oql_query("ihmp", query) all_results = seqSet_data['results'] result_list = list() if len(all_results) > 0: for hit in all_results: result = HostWgsRawSeqSet.load_hostWgsRawSeqSet(hit) result_list.append(result) return result_list @staticmethod def load_hostWgsRawSeqSet(seq_set_data): """ Takes the provided JSON string and converts it to a HostWgsRawSeqSet object. Args: seq_set_data (str): The JSON string to convert Returns: Returns a HostWgsRawSeqSet instance. """ module_logger.info("Creating a template %s.", __name__) seq_set = HostWgsRawSeqSet() module_logger.debug("Filling in %s details.", __name__) # The attributes commmon to all iHMP nodes seq_set._set_id(seq_set_data['id']) seq_set.version = seq_set_data['ver'] seq_set.links = seq_set_data['linkage'] # Required fields seq_set.checksums = seq_set_data['meta']['checksums'] seq_set.comment = seq_set_data['meta']['comment'] seq_set.exp_length = seq_set_data['meta']['exp_length'] seq_set.format = seq_set_data['meta']['format'] seq_set.format_doc = seq_set_data['meta']['format_doc'] seq_set.seq_model = seq_set_data['meta']['seq_model'] seq_set.size = seq_set_data['meta']['size'] seq_set.study = seq_set_data['meta']['study'] seq_set.tags = seq_set_data['meta']['tags'] seq_set._urls = seq_set_data['meta']['urls'] # Optional fields if 'sequence_type' in seq_set_data['meta']: seq_set.sequence_type = seq_set_data['meta']['sequence_type'] if 'private_files' in seq_set_data['meta']: seq_set.private_files = seq_set_data['meta']['private_files'] module_logger.debug("Returning loaded " + __name__) return seq_set @staticmethod def load(seq_set_id): """ Loads the data for the specified input ID from the OSDF instance to this object. If the provided ID does not exist, then an error message is provided. Args: seq_set_id (str): The OSDF ID for the document to load. Returns: A HostWgsRawSeqSet object with all the available OSDF data loaded into it. """ module_logger.debug("In load. Specified ID: %s", seq_set_id) session = iHMPSession.get_session() module_logger.info("Got iHMP session.") seq_set_data = session.get_osdf().get_node(seq_set_id) seq_set = HostWgsRawSeqSet.load_hostWgsRawSeqSet(seq_set_data) module_logger.debug("Returning loaded %s.", __name__) return seq_set def _upload_data(self): self.logger.debug("In _upload_data.") session = iHMPSession.get_session() study = self._study study2dir = { "ibd": "ibd", "preg_preterm": "ptb", "prediabetes": "t2d" } if study not in study2dir: raise ValueError("Invalid study. No directory mapping for %s" % study) study_dir = study2dir[study] remote_base = os.path.basename(self._local_file) valid_chars = "-_.%s%s" % (string.ascii_letters, string.digits) remote_base = ''.join(c for c in remote_base if c in valid_chars) remote_base = remote_base.replace(' ', '_') # No spaces in filenames remote_path = "/".join(["/" + study_dir, "genome", "host", "wgs", "raw", remote_base]) self.logger.debug("Remote path for this file will be %s.", remote_path) # Upload the file to the iHMP aspera server upload_result = aspera.upload_file(HostWgsRawSeqSet.aspera_server, session.username, session.password, self._local_file, remote_path) if not upload_result: self.logger.error("Experienced an error uploading the sequence set. " "Aborting save.") raise Exception("Unable to upload host WGS raw sequence set.") else: self._urls = ["fasp://" + HostWgsRawSeqSet.aspera_server + remote_path] def save(self): """ Saves the data in OSDF. The JSON form of the current data for the instance is validated in the save function. If the data is not valid, then the data will not be saved. If the instance was saved previously, then the node ID is assigned the alpha numeric found in the OSDF instance. If not saved previously, then the node ID is 'None', and upon a successful save, will be assigned the ID found in OSDF. Also, the version is updated as the data is saved in OSDF. Args: None Returns; True if successful, False otherwise. """ self.logger.debug("In save.") # If node previously saved, use edit_node instead since ID # is given (an update in a way) # can also use get_node to check if the node already exists if not self.is_valid(): self.logger.error("Cannot save, data is invalid") return False session = iHMPSession.get_session() self.logger.info("Got iHMP session.") success = False if self._private_files: self._urls = ["<private>"] else: try: self._upload_data() except Exception as upload_exception: self.logger.exception(upload_exception) # Don't bother continuing... return False osdf = session.get_osdf() if self.id is None: # The document has not yet been saved self.logger.info("About to insert a new %s OSDF node.", __name__) # Get the JSON form of the data and load it self.logger.debug("Converting %s to parsed JSON form.", __name__) data = json.loads(self.to_json()) self.logger.info("Got the raw JSON document.") try: self.logger.info("Attempting to save a new node.") node_id = osdf.insert_node(data) self._set_id(node_id) self._version = 1 self.logger.info("Save for %s %s successful.", __name__, node_id) self.logger.info("Setting ID for %s %s.", __name__, node_id) success = True except Exception as save_exception: self.logger.exception(save_exception) self.logger.error("An error occurred while saving %s. " "Reason: %s", __name__, save_exception) else: self.logger.info("%s already has an ID, so we do an update " "(not an insert).", __name__) try: seq_set_data = self._get_raw_doc() seq_set_id = self._id self.logger.info("Attempting to update %s with ID: %s.", __name__, seq_set_id ) osdf.edit_node(seq_set_data) self.logger.info("Update for %s %s successful.", __name__, seq_set_id ) seq_set_data = osdf.get_node(seq_set_id) latest_version = seq_set_data['ver'] self.logger.debug( "The version of this %s is now: %s", __name__, str(latest_version) ) self._version = latest_version success = True except Exception as e: self.logger.error("An error occurred while updating " + __name__ + " %s. Reason: %s" % self._id, e) self.logger.debug("Returning " + str(success)) return success
# Copyright (c) Twisted Matrix Laboratories. # See LICENSE for details. """ Tests for parts of our release automation system. """ import os import sys from setuptools.dist import Distribution from twisted.trial.unittest import TestCase from twisted.python import dist from twisted.python.dist import (get_setup_args, ConditionalExtension, build_scripts_twisted, _EXTRAS_REQUIRE) from twisted.python.filepath import FilePath class SetupTests(TestCase): """ Tests for L{get_setup_args}. """ def test_conditionalExtensions(self): """ Passing C{conditionalExtensions} as a list of L{ConditionalExtension} objects to get_setup_args inserts a custom build_ext into the result which knows how to check whether they should be built. """ good_ext = ConditionalExtension("whatever", ["whatever.c"], condition=lambda b: True) bad_ext = ConditionalExtension("whatever", ["whatever.c"], condition=lambda b: False) args = get_setup_args(conditionalExtensions=[good_ext, bad_ext]) # ext_modules should be set even though it's not used. See comment # in get_setup_args self.assertEqual(args["ext_modules"], [good_ext, bad_ext]) cmdclass = args["cmdclass"] build_ext = cmdclass["build_ext"] builder = build_ext(Distribution()) builder.prepare_extensions() self.assertEqual(builder.extensions, [good_ext]) def test_win32Definition(self): """ When building on Windows NT, the WIN32 macro will be defined as 1. """ ext = ConditionalExtension("whatever", ["whatever.c"], define_macros=[("whatever", 2)]) args = get_setup_args(conditionalExtensions=[ext]) builder = args["cmdclass"]["build_ext"](Distribution()) self.patch(os, "name", "nt") builder.prepare_extensions() self.assertEqual(ext.define_macros, [("whatever", 2), ("WIN32", 1)]) class OptionalDependenciesTests(TestCase): """ Tests for L{_EXTRAS_REQUIRE} """ def test_distributeTakesExtrasRequire(self): """ Setuptools' Distribution object parses and stores its C{extras_require} argument as an attribute. """ extras = dict(im_an_extra_dependency="thing") attrs = dict(extras_require=extras) distribution = Distribution(attrs) self.assertEqual( extras, distribution.extras_require ) def test_extrasRequireDictContainsKeys(self): """ L{_EXTRAS_REQUIRE} contains options for all documented extras: C{dev}, C{tls}, C{conch}, C{soap}, C{serial}, C{all_non_platform}, C{osx_platform}, and C{windows_platform}. """ self.assertIn('dev', _EXTRAS_REQUIRE) self.assertIn('tls', _EXTRAS_REQUIRE) self.assertIn('conch', _EXTRAS_REQUIRE) self.assertIn('soap', _EXTRAS_REQUIRE) self.assertIn('serial', _EXTRAS_REQUIRE) self.assertIn('all_non_platform', _EXTRAS_REQUIRE) self.assertIn('osx_platform', _EXTRAS_REQUIRE) self.assertIn('windows_platform', _EXTRAS_REQUIRE) def test_extrasRequiresDevDeps(self): """ L{_EXTRAS_REQUIRE}'s C{dev} extra contains setuptools requirements for the tools required for Twisted development. """ deps = _EXTRAS_REQUIRE['dev'] self.assertIn('twistedchecker >= 0.2.0', deps) self.assertIn('pyflakes >= 0.8.1', deps) self.assertIn('twisted-dev-tools >= 0.0.2', deps) self.assertIn('python-subunit', deps) self.assertIn('sphinx >= 1.2.2', deps) self.assertIn('pydoctor >= 0.5', deps) def test_extrasRequiresTlsDeps(self): """ L{_EXTRAS_REQUIRE}'s C{tls} extra contains setuptools requirements for the packages required to make Twisted's transport layer security fully work for both clients and servers. """ deps = _EXTRAS_REQUIRE['tls'] self.assertIn('pyopenssl >= 0.11', deps) self.assertIn('service_identity', deps) self.assertIn('idna >= 0.6', deps) def test_extrasRequiresConchDeps(self): """ L{_EXTRAS_REQUIRE}'s C{conch} extra contains setuptools requirements for the packages required to make Twisted Conch's secure shell server work. """ deps = _EXTRAS_REQUIRE['conch'] self.assertIn('gmpy', deps) self.assertIn('pyasn1', deps) self.assertIn('pycrypto', deps) def test_extrasRequiresSoapDeps(self): """ L{_EXTRAS_REQUIRE}' C{soap} extra contains setuptools requirements for the packages required to make the C{twisted.web.soap} module function. """ self.assertIn( 'soappy', _EXTRAS_REQUIRE['soap'] ) def test_extrasRequiresSerialDeps(self): """ L{_EXTRAS_REQUIRE}'s C{serial} extra contains setuptools requirements for the packages required to make Twisted's serial support work. """ self.assertIn( 'pyserial', _EXTRAS_REQUIRE['serial'] ) def test_extrasRequiresAllNonPlatformDeps(self): """ L{_EXTRAS_REQUIRE}'s C{all_non_platform} extra contains setuptools requirements for all of Twisted's optional dependencies which work on all supported operating systems. """ deps = _EXTRAS_REQUIRE['all_non_platform'] self.assertIn('pyopenssl >= 0.11', deps) self.assertIn('service_identity', deps) self.assertIn('idna >= 0.6', deps) self.assertIn('gmpy', deps) self.assertIn('pyasn1', deps) self.assertIn('pycrypto', deps) self.assertIn('soappy', deps) self.assertIn('pyserial', deps) def test_extrasRequiresOsxPlatformDeps(self): """ L{_EXTRAS_REQUIRE}'s C{osx_platform} extra contains setuptools requirements for all of Twisted's optional dependencies usable on the Mac OS X platform. """ deps = _EXTRAS_REQUIRE['osx_platform'] self.assertIn('pyopenssl >= 0.11', deps) self.assertIn('service_identity', deps) self.assertIn('idna >= 0.6', deps) self.assertIn('gmpy', deps) self.assertIn('pyasn1', deps) self.assertIn('pycrypto', deps) self.assertIn('soappy', deps) self.assertIn('pyserial', deps) self.assertIn('pyobjc', deps) def test_extrasRequiresWindowsPlatformDeps(self): """ L{_EXTRAS_REQUIRE}'s C{windows_platform} extra contains setuptools requirements for all of Twisted's optional dependencies usable on the Microsoft Windows platform. """ deps = _EXTRAS_REQUIRE['windows_platform'] self.assertIn('pyopenssl >= 0.11', deps) self.assertIn('service_identity', deps) self.assertIn('idna >= 0.6', deps) self.assertIn('gmpy', deps) self.assertIn('pyasn1', deps) self.assertIn('pycrypto', deps) self.assertIn('soappy', deps) self.assertIn('pyserial', deps) self.assertIn('pypiwin32', deps) class GetExtensionsTests(TestCase): """ Tests for L{dist.getExtensions}. """ setupTemplate = ( "from twisted.python.dist import ConditionalExtension\n" "extensions = [\n" " ConditionalExtension(\n" " '%s', ['twisted/some/thing.c'],\n" " condition=lambda builder: True)\n" " ]\n") def setUp(self): self.basedir = FilePath(self.mktemp()).child("twisted") self.basedir.makedirs() self.addCleanup(os.chdir, os.getcwd()) os.chdir(self.basedir.parent().path) def writeSetup(self, name, *path): """ Write out a C{setup.py} file to a location determined by L{self.basedir} and L{path}. L{self.setupTemplate} is used to generate its contents. """ outdir = self.basedir.descendant(path) outdir.makedirs() setup = outdir.child("setup.py") setup.setContent(self.setupTemplate % (name,)) def writeEmptySetup(self, *path): """ Write out an empty C{setup.py} file to a location determined by L{self.basedir} and L{path}. """ outdir = self.basedir.descendant(path) outdir.makedirs() outdir.child("setup.py").setContent("") def assertExtensions(self, expected): """ Assert that the given names match the (sorted) names of discovered extensions. """ extensions = dist.getExtensions() names = [extension.name for extension in extensions] self.assertEqual(sorted(names), expected) def test_getExtensions(self): """ Files named I{setup.py} in I{twisted/topfiles} and I{twisted/*/topfiles} are executed with L{execfile} in order to discover the extensions they declare. """ self.writeSetup("twisted.transmutate", "topfiles") self.writeSetup("twisted.tele.port", "tele", "topfiles") self.assertExtensions(["twisted.tele.port", "twisted.transmutate"]) def test_getExtensionsTooDeep(self): """ Files named I{setup.py} in I{topfiles} directories are not considered if they are too deep in the directory hierarchy. """ self.writeSetup("twisted.trans.mog.rify", "trans", "mog", "topfiles") self.assertExtensions([]) def test_getExtensionsNotTopfiles(self): """ The folder in which I{setup.py} is discovered must be called I{topfiles} otherwise it is ignored. """ self.writeSetup("twisted.metamorphosis", "notfiles") self.assertExtensions([]) def test_getExtensionsNotSupportedOnJava(self): """ Extensions are not supported on Java-based platforms. """ self.addCleanup(setattr, sys, "platform", sys.platform) sys.platform = "java" self.writeSetup("twisted.sorcery", "topfiles") self.assertExtensions([]) def test_getExtensionsExtensionsLocalIsOptional(self): """ It is acceptable for extensions to not define the C{extensions} local variable. """ self.writeEmptySetup("twisted.necromancy", "topfiles") self.assertExtensions([]) class GetVersionTests(TestCase): """ Tests for L{dist.getVersion}. """ def setUp(self): self.dirname = self.mktemp() os.mkdir(self.dirname) def test_getVersionCore(self): """ Test that getting the version of core reads from the [base]/_version.py file. """ f = open(os.path.join(self.dirname, "_version.py"), "w") f.write(""" from twisted.python import versions version = versions.Version("twisted", 0, 1, 2) """) f.close() self.assertEqual(dist.getVersion("core", base=self.dirname), "0.1.2") def test_getVersionOther(self): """ Test that getting the version of a non-core project reads from the [base]/[projname]/_version.py file. """ os.mkdir(os.path.join(self.dirname, "blat")) f = open(os.path.join(self.dirname, "blat", "_version.py"), "w") f.write(""" from twisted.python import versions version = versions.Version("twisted.blat", 9, 8, 10) """) f.close() self.assertEqual(dist.getVersion("blat", base=self.dirname), "9.8.10") class GetScriptsTests(TestCase): """ Tests for L{dist.getScripts} which returns the scripts which should be included in the distribution of a project. """ def test_scriptsInSVN(self): """ getScripts should return the scripts associated with a project in the context of Twisted SVN. """ basedir = self.mktemp() os.mkdir(basedir) os.mkdir(os.path.join(basedir, 'bin')) os.mkdir(os.path.join(basedir, 'bin', 'proj')) f = open(os.path.join(basedir, 'bin', 'proj', 'exy'), 'w') f.write('yay') f.close() scripts = dist.getScripts('proj', basedir=basedir) self.assertEqual(len(scripts), 1) self.assertEqual(os.path.basename(scripts[0]), 'exy') def test_excludedPreamble(self): """ L{dist.getScripts} includes neither C{"_preamble.py"} nor C{"_preamble.pyc"}. """ basedir = FilePath(self.mktemp()) bin = basedir.child('bin') bin.makedirs() bin.child('_preamble.py').setContent('some preamble code\n') bin.child('_preamble.pyc').setContent('some preamble byte code\n') bin.child('program').setContent('good program code\n') scripts = dist.getScripts("", basedir=basedir.path) self.assertEqual(scripts, [bin.child('program').path]) def test_scriptsInRelease(self): """ getScripts should return the scripts associated with a project in the context of a released subproject tarball. """ basedir = self.mktemp() os.mkdir(basedir) os.mkdir(os.path.join(basedir, 'bin')) f = open(os.path.join(basedir, 'bin', 'exy'), 'w') f.write('yay') f.close() scripts = dist.getScripts('proj', basedir=basedir) self.assertEqual(len(scripts), 1) self.assertEqual(os.path.basename(scripts[0]), 'exy') def test_noScriptsInSVN(self): """ When calling getScripts for a project which doesn't actually have any scripts, in the context of an SVN checkout, an empty list should be returned. """ basedir = self.mktemp() os.mkdir(basedir) os.mkdir(os.path.join(basedir, 'bin')) os.mkdir(os.path.join(basedir, 'bin', 'otherproj')) scripts = dist.getScripts('noscripts', basedir=basedir) self.assertEqual(scripts, []) def test_getScriptsTopLevel(self): """ Passing the empty string to getScripts returns scripts that are (only) in the top level bin directory. """ basedir = FilePath(self.mktemp()) basedir.createDirectory() bindir = basedir.child("bin") bindir.createDirectory() included = bindir.child("included") included.setContent("yay included") subdir = bindir.child("subdir") subdir.createDirectory() subdir.child("not-included").setContent("not included") scripts = dist.getScripts("", basedir=basedir.path) self.assertEqual(scripts, [included.path]) def test_noScriptsInSubproject(self): """ When calling getScripts for a project which doesn't actually have any scripts in the context of that project's individual project structure, an empty list should be returned. """ basedir = self.mktemp() os.mkdir(basedir) scripts = dist.getScripts('noscripts', basedir=basedir) self.assertEqual(scripts, []) class DummyCommand: """ A fake Command. """ def __init__(self, **kwargs): for kw, val in kwargs.items(): setattr(self, kw, val) def ensure_finalized(self): pass class BuildScriptsTests(TestCase): """ Tests for L{dist.build_scripts_twisted}. """ def setUp(self): self.source = FilePath(self.mktemp()) self.target = FilePath(self.mktemp()) self.source.makedirs() self.addCleanup(os.chdir, os.getcwd()) os.chdir(self.source.path) def buildScripts(self): """ Write 3 types of scripts and run the L{build_scripts_twisted} command. """ self.writeScript(self.source, "script1", ("#! /usr/bin/env python2.7\n" "# bogus script w/ Python sh-bang\n" "pass\n")) self.writeScript(self.source, "script2.py", ("#!/usr/bin/python\n" "# bogus script w/ Python sh-bang\n" "pass\n")) self.writeScript(self.source, "shell.sh", ("#!/bin/sh\n" "# bogus shell script w/ sh-bang\n" "exit 0\n")) expected = ['script1', 'script2.py', 'shell.sh'] cmd = self.getBuildScriptsCmd(self.target, [self.source.child(fn).path for fn in expected]) cmd.finalize_options() cmd.run() return self.target.listdir() def getBuildScriptsCmd(self, target, scripts): """ Create a distutils L{Distribution} with a L{DummyCommand} and wrap it in L{build_scripts_twisted}. @type target: L{FilePath} """ dist = Distribution() dist.scripts = scripts dist.command_obj["build"] = DummyCommand( build_scripts = target.path, force = 1, executable = sys.executable ) return build_scripts_twisted(dist) def writeScript(self, dir, name, text): """ Write the script to disk. """ with open(dir.child(name).path, "w") as f: f.write(text) def test_notWindows(self): """ L{build_scripts_twisted} does not rename scripts on non-Windows platforms. """ self.patch(os, "name", "twisted") built = self.buildScripts() for name in ['script1', 'script2.py', 'shell.sh']: self.assertTrue(name in built) def test_windows(self): """ L{build_scripts_twisted} renames scripts so they end with '.py' on the Windows platform. """ self.patch(os, "name", "nt") built = self.buildScripts() for name in ['script1.py', 'script2.py', 'shell.sh.py']: self.assertTrue(name in built) class FakeModule(object): """ A fake module, suitable for dependency injection in testing. """ def __init__(self, attrs): """ Initializes a fake module. @param attrs: The attrs that will be accessible on the module. @type attrs: C{dict} of C{str} (Python names) to objects """ self._attrs = attrs def __getattr__(self, name): """ Gets an attribute of this fake module from its attrs. @raise AttributeError: When the requested attribute is missing. """ try: return self._attrs[name] except KeyError: raise AttributeError() fakeCPythonPlatform = FakeModule({"python_implementation": lambda: "CPython"}) fakeOtherPlatform = FakeModule({"python_implementation": lambda: "lvhpy"}) class WithPlatformTests(TestCase): """ Tests for L{_checkCPython} when used with a (fake) C{platform} module. """ def test_cpython(self): """ L{_checkCPython} returns C{True} when C{platform.python_implementation} says we're running on CPython. """ self.assertTrue(dist._checkCPython(platform=fakeCPythonPlatform)) def test_other(self): """ L{_checkCPython} returns C{False} when C{platform.python_implementation} says we're not running on CPython. """ self.assertFalse(dist._checkCPython(platform=fakeOtherPlatform))
# coding: utf-8 from sqlalchemy import and_ from sqlalchemy import bindparam from sqlalchemy import Computed from sqlalchemy import exc from sqlalchemy import except_ from sqlalchemy import ForeignKey from sqlalchemy import func from sqlalchemy import Index from sqlalchemy import Integer from sqlalchemy import literal_column from sqlalchemy import MetaData from sqlalchemy import or_ from sqlalchemy import outerjoin from sqlalchemy import schema from sqlalchemy import select from sqlalchemy import Sequence from sqlalchemy import sql from sqlalchemy import String from sqlalchemy import testing from sqlalchemy import text from sqlalchemy import type_coerce from sqlalchemy import TypeDecorator from sqlalchemy import union from sqlalchemy.dialects.oracle import base as oracle from sqlalchemy.dialects.oracle import cx_oracle from sqlalchemy.engine import default from sqlalchemy.sql import column from sqlalchemy.sql import quoted_name from sqlalchemy.sql import table from sqlalchemy.testing import assert_raises_message from sqlalchemy.testing import AssertsCompiledSQL from sqlalchemy.testing import eq_ from sqlalchemy.testing import fixtures from sqlalchemy.testing.schema import Column from sqlalchemy.testing.schema import Table class CompileTest(fixtures.TestBase, AssertsCompiledSQL): __dialect__ = "oracle" def test_true_false(self): self.assert_compile(sql.false(), "0") self.assert_compile(sql.true(), "1") def test_owner(self): meta = MetaData() parent = Table( "parent", meta, Column("id", Integer, primary_key=True), Column("name", String(50)), schema="ed", ) child = Table( "child", meta, Column("id", Integer, primary_key=True), Column("parent_id", Integer, ForeignKey("ed.parent.id")), schema="ed", ) self.assert_compile( parent.join(child), "ed.parent JOIN ed.child ON ed.parent.id = " "ed.child.parent_id", ) def test_subquery(self): t = table("sometable", column("col1"), column("col2")) s = select([t]) s = select([s.c.col1, s.c.col2]) self.assert_compile( s, "SELECT col1, col2 FROM (SELECT " "sometable.col1 AS col1, sometable.col2 " "AS col2 FROM sometable)", ) def test_bindparam_quote(self): """test that bound parameters take on quoting for reserved words, column names quote flag enabled.""" # note: this is only in cx_oracle at the moment. not sure # what other hypothetical oracle dialects might need self.assert_compile(bindparam("option"), ':"option"') self.assert_compile(bindparam("plain"), ":plain") t = Table("s", MetaData(), Column("plain", Integer, quote=True)) self.assert_compile( t.insert().values(plain=5), 'INSERT INTO s ("plain") VALUES (:"plain")', ) self.assert_compile( t.update().values(plain=5), 'UPDATE s SET "plain"=:"plain"' ) def test_bindparam_quote_raise_on_expanding(self): assert_raises_message( exc.CompileError, "Can't use expanding feature with parameter name 'uid' on " "Oracle; it requires quoting which is not supported in this " "context", bindparam("uid", expanding=True).compile, dialect=cx_oracle.dialect(), ) def test_cte(self): part = table( "part", column("part"), column("sub_part"), column("quantity") ) included_parts = ( select([part.c.sub_part, part.c.part, part.c.quantity]) .where(part.c.part == "p1") .cte(name="included_parts", recursive=True) .suffix_with( "search depth first by part set ord1", "cycle part set y_cycle to 1 default 0", dialect="oracle", ) ) incl_alias = included_parts.alias("pr1") parts_alias = part.alias("p") included_parts = included_parts.union_all( select( [ parts_alias.c.sub_part, parts_alias.c.part, parts_alias.c.quantity, ] ).where(parts_alias.c.part == incl_alias.c.sub_part) ) q = select( [ included_parts.c.sub_part, func.sum(included_parts.c.quantity).label("total_quantity"), ] ).group_by(included_parts.c.sub_part) self.assert_compile( q, "WITH included_parts(sub_part, part, quantity) AS " "(SELECT part.sub_part AS sub_part, part.part AS part, " "part.quantity AS quantity FROM part WHERE part.part = :part_1 " "UNION ALL SELECT p.sub_part AS sub_part, p.part AS part, " "p.quantity AS quantity FROM part p, included_parts pr1 " "WHERE p.part = pr1.sub_part) " "search depth first by part set ord1 cycle part set " "y_cycle to 1 default 0 " "SELECT included_parts.sub_part, sum(included_parts.quantity) " "AS total_quantity FROM included_parts " "GROUP BY included_parts.sub_part", ) def test_limit(self): t = table("sometable", column("col1"), column("col2")) s = select([t]) c = s.compile(dialect=oracle.OracleDialect()) assert t.c.col1 in set(c._create_result_map()["col1"][1]) s = select([t]).limit(10).offset(20) self.assert_compile( s, "SELECT col1, col2 FROM (SELECT col1, " "col2, ROWNUM AS ora_rn FROM (SELECT " "sometable.col1 AS col1, sometable.col2 AS " "col2 FROM sometable) WHERE ROWNUM <= " ":param_1 + :param_2) WHERE ora_rn > :param_2", checkparams={"param_1": 10, "param_2": 20}, ) c = s.compile(dialect=oracle.OracleDialect()) eq_(len(c._result_columns), 2) assert t.c.col1 in set(c._create_result_map()["col1"][1]) s2 = select([s.c.col1, s.c.col2]) self.assert_compile( s2, "SELECT col1, col2 FROM (SELECT col1, col2 " "FROM (SELECT col1, col2, ROWNUM AS ora_rn " "FROM (SELECT sometable.col1 AS col1, " "sometable.col2 AS col2 FROM sometable) " "WHERE ROWNUM <= :param_1 + :param_2) " "WHERE ora_rn > :param_2)", checkparams={"param_1": 10, "param_2": 20}, ) self.assert_compile( s2, "SELECT col1, col2 FROM (SELECT col1, col2 " "FROM (SELECT col1, col2, ROWNUM AS ora_rn " "FROM (SELECT sometable.col1 AS col1, " "sometable.col2 AS col2 FROM sometable) " "WHERE ROWNUM <= :param_1 + :param_2) " "WHERE ora_rn > :param_2)", ) c = s2.compile(dialect=oracle.OracleDialect()) eq_(len(c._result_columns), 2) assert s.c.col1 in set(c._create_result_map()["col1"][1]) s = select([t]).limit(10).offset(20).order_by(t.c.col2) self.assert_compile( s, "SELECT col1, col2 FROM (SELECT col1, " "col2, ROWNUM AS ora_rn FROM (SELECT " "sometable.col1 AS col1, sometable.col2 AS " "col2 FROM sometable ORDER BY " "sometable.col2) WHERE ROWNUM <= " ":param_1 + :param_2) WHERE ora_rn > :param_2", checkparams={"param_1": 10, "param_2": 20}, ) c = s.compile(dialect=oracle.OracleDialect()) eq_(len(c._result_columns), 2) assert t.c.col1 in set(c._create_result_map()["col1"][1]) s = select([t]).with_for_update().limit(10).order_by(t.c.col2) self.assert_compile( s, "SELECT col1, col2 FROM (SELECT " "sometable.col1 AS col1, sometable.col2 AS " "col2 FROM sometable ORDER BY " "sometable.col2) WHERE ROWNUM <= :param_1 " "FOR UPDATE", ) s = ( select([t]) .with_for_update() .limit(10) .offset(20) .order_by(t.c.col2) ) self.assert_compile( s, "SELECT col1, col2 FROM (SELECT col1, " "col2, ROWNUM AS ora_rn FROM (SELECT " "sometable.col1 AS col1, sometable.col2 AS " "col2 FROM sometable ORDER BY " "sometable.col2) WHERE ROWNUM <= " ":param_1 + :param_2) WHERE ora_rn > :param_2 FOR " "UPDATE", ) def test_limit_special_quoting(self): """Oracle-specific test for #4730. Even though this issue is generic, test the originally reported Oracle use case. """ col = literal_column("SUM(ABC)").label("SUM(ABC)") tbl = table("my_table") query = select([col]).select_from(tbl).order_by(col).limit(100) self.assert_compile( query, 'SELECT "SUM(ABC)" FROM ' '(SELECT SUM(ABC) AS "SUM(ABC)" ' "FROM my_table ORDER BY SUM(ABC)) " "WHERE ROWNUM <= :param_1", ) col = literal_column("SUM(ABC)").label(quoted_name("SUM(ABC)", True)) tbl = table("my_table") query = select([col]).select_from(tbl).order_by(col).limit(100) self.assert_compile( query, 'SELECT "SUM(ABC)" FROM ' '(SELECT SUM(ABC) AS "SUM(ABC)" ' "FROM my_table ORDER BY SUM(ABC)) " "WHERE ROWNUM <= :param_1", ) col = literal_column("SUM(ABC)").label("SUM(ABC)_") tbl = table("my_table") query = select([col]).select_from(tbl).order_by(col).limit(100) self.assert_compile( query, 'SELECT "SUM(ABC)_" FROM ' '(SELECT SUM(ABC) AS "SUM(ABC)_" ' "FROM my_table ORDER BY SUM(ABC)) " "WHERE ROWNUM <= :param_1", ) col = literal_column("SUM(ABC)").label(quoted_name("SUM(ABC)_", True)) tbl = table("my_table") query = select([col]).select_from(tbl).order_by(col).limit(100) self.assert_compile( query, 'SELECT "SUM(ABC)_" FROM ' '(SELECT SUM(ABC) AS "SUM(ABC)_" ' "FROM my_table ORDER BY SUM(ABC)) " "WHERE ROWNUM <= :param_1", ) def test_for_update(self): table1 = table( "mytable", column("myid"), column("name"), column("description") ) self.assert_compile( table1.select(table1.c.myid == 7).with_for_update(), "SELECT mytable.myid, mytable.name, mytable.description " "FROM mytable WHERE mytable.myid = :myid_1 FOR UPDATE", ) self.assert_compile( table1.select(table1.c.myid == 7).with_for_update( of=table1.c.myid ), "SELECT mytable.myid, mytable.name, mytable.description " "FROM mytable WHERE mytable.myid = :myid_1 " "FOR UPDATE OF mytable.myid", ) self.assert_compile( table1.select(table1.c.myid == 7).with_for_update(nowait=True), "SELECT mytable.myid, mytable.name, mytable.description " "FROM mytable WHERE mytable.myid = :myid_1 FOR UPDATE NOWAIT", ) self.assert_compile( table1.select(table1.c.myid == 7).with_for_update( nowait=True, of=table1.c.myid ), "SELECT mytable.myid, mytable.name, mytable.description " "FROM mytable WHERE mytable.myid = :myid_1 " "FOR UPDATE OF mytable.myid NOWAIT", ) self.assert_compile( table1.select(table1.c.myid == 7).with_for_update( nowait=True, of=[table1.c.myid, table1.c.name] ), "SELECT mytable.myid, mytable.name, mytable.description " "FROM mytable WHERE mytable.myid = :myid_1 FOR UPDATE OF " "mytable.myid, mytable.name NOWAIT", ) self.assert_compile( table1.select(table1.c.myid == 7).with_for_update( skip_locked=True, of=[table1.c.myid, table1.c.name] ), "SELECT mytable.myid, mytable.name, mytable.description " "FROM mytable WHERE mytable.myid = :myid_1 FOR UPDATE OF " "mytable.myid, mytable.name SKIP LOCKED", ) # key_share has no effect self.assert_compile( table1.select(table1.c.myid == 7).with_for_update(key_share=True), "SELECT mytable.myid, mytable.name, mytable.description " "FROM mytable WHERE mytable.myid = :myid_1 FOR UPDATE", ) # read has no effect self.assert_compile( table1.select(table1.c.myid == 7).with_for_update( read=True, key_share=True ), "SELECT mytable.myid, mytable.name, mytable.description " "FROM mytable WHERE mytable.myid = :myid_1 FOR UPDATE", ) ta = table1.alias() self.assert_compile( ta.select(ta.c.myid == 7).with_for_update( of=[ta.c.myid, ta.c.name] ), "SELECT mytable_1.myid, mytable_1.name, mytable_1.description " "FROM mytable mytable_1 " "WHERE mytable_1.myid = :myid_1 FOR UPDATE OF " "mytable_1.myid, mytable_1.name", ) def test_for_update_of_w_limit_adaption_col_present(self): table1 = table("mytable", column("myid"), column("name")) self.assert_compile( select([table1.c.myid, table1.c.name]) .where(table1.c.myid == 7) .with_for_update(nowait=True, of=table1.c.name) .limit(10), "SELECT myid, name FROM " "(SELECT mytable.myid AS myid, mytable.name AS name " "FROM mytable WHERE mytable.myid = :myid_1) " "WHERE ROWNUM <= :param_1 FOR UPDATE OF name NOWAIT", ) def test_for_update_of_w_limit_adaption_col_unpresent(self): table1 = table("mytable", column("myid"), column("name")) self.assert_compile( select([table1.c.myid]) .where(table1.c.myid == 7) .with_for_update(nowait=True, of=table1.c.name) .limit(10), "SELECT myid FROM " "(SELECT mytable.myid AS myid, mytable.name AS name " "FROM mytable WHERE mytable.myid = :myid_1) " "WHERE ROWNUM <= :param_1 FOR UPDATE OF name NOWAIT", ) def test_for_update_of_w_limit_offset_adaption_col_present(self): table1 = table("mytable", column("myid"), column("name")) self.assert_compile( select([table1.c.myid, table1.c.name]) .where(table1.c.myid == 7) .with_for_update(nowait=True, of=table1.c.name) .limit(10) .offset(50), "SELECT myid, name FROM (SELECT myid, name, ROWNUM AS ora_rn " "FROM (SELECT mytable.myid AS myid, mytable.name AS name " "FROM mytable WHERE mytable.myid = :myid_1) " "WHERE ROWNUM <= :param_1 + :param_2) WHERE ora_rn > :param_2 " "FOR UPDATE OF name NOWAIT", ) def test_for_update_of_w_limit_offset_adaption_col_unpresent(self): table1 = table("mytable", column("myid"), column("name")) self.assert_compile( select([table1.c.myid]) .where(table1.c.myid == 7) .with_for_update(nowait=True, of=table1.c.name) .limit(10) .offset(50), "SELECT myid FROM (SELECT myid, ROWNUM AS ora_rn, name " "FROM (SELECT mytable.myid AS myid, mytable.name AS name " "FROM mytable WHERE mytable.myid = :myid_1) " "WHERE ROWNUM <= :param_1 + :param_2) WHERE ora_rn > :param_2 " "FOR UPDATE OF name NOWAIT", ) def test_for_update_of_w_limit_offset_adaption_partial_col_unpresent(self): table1 = table("mytable", column("myid"), column("foo"), column("bar")) self.assert_compile( select([table1.c.myid, table1.c.bar]) .where(table1.c.myid == 7) .with_for_update(nowait=True, of=[table1.c.foo, table1.c.bar]) .limit(10) .offset(50), "SELECT myid, bar FROM (SELECT myid, bar, ROWNUM AS ora_rn, " "foo FROM (SELECT mytable.myid AS myid, mytable.bar AS bar, " "mytable.foo AS foo FROM mytable WHERE mytable.myid = :myid_1) " "WHERE ROWNUM <= :param_1 + :param_2) WHERE ora_rn > :param_2 " "FOR UPDATE OF foo, bar NOWAIT", ) def test_limit_preserves_typing_information(self): class MyType(TypeDecorator): impl = Integer stmt = select([type_coerce(column("x"), MyType).label("foo")]).limit(1) dialect = oracle.dialect() compiled = stmt.compile(dialect=dialect) assert isinstance(compiled._create_result_map()["foo"][-1], MyType) def test_use_binds_for_limits_disabled(self): t = table("sometable", column("col1"), column("col2")) dialect = oracle.OracleDialect(use_binds_for_limits=False) self.assert_compile( select([t]).limit(10), "SELECT col1, col2 FROM (SELECT sometable.col1 AS col1, " "sometable.col2 AS col2 FROM sometable) WHERE ROWNUM <= 10", dialect=dialect, ) self.assert_compile( select([t]).offset(10), "SELECT col1, col2 FROM (SELECT col1, col2, ROWNUM AS ora_rn " "FROM (SELECT sometable.col1 AS col1, sometable.col2 AS col2 " "FROM sometable)) WHERE ora_rn > 10", dialect=dialect, ) self.assert_compile( select([t]).limit(10).offset(10), "SELECT col1, col2 FROM (SELECT col1, col2, ROWNUM AS ora_rn " "FROM (SELECT sometable.col1 AS col1, sometable.col2 AS col2 " "FROM sometable) WHERE ROWNUM <= 20) WHERE ora_rn > 10", dialect=dialect, ) def test_use_binds_for_limits_enabled(self): t = table("sometable", column("col1"), column("col2")) dialect = oracle.OracleDialect(use_binds_for_limits=True) self.assert_compile( select([t]).limit(10), "SELECT col1, col2 FROM (SELECT sometable.col1 AS col1, " "sometable.col2 AS col2 FROM sometable) WHERE ROWNUM " "<= :param_1", dialect=dialect, ) self.assert_compile( select([t]).offset(10), "SELECT col1, col2 FROM (SELECT col1, col2, ROWNUM AS ora_rn " "FROM (SELECT sometable.col1 AS col1, sometable.col2 AS col2 " "FROM sometable)) WHERE ora_rn > :param_1", dialect=dialect, ) self.assert_compile( select([t]).limit(10).offset(10), "SELECT col1, col2 FROM (SELECT col1, col2, ROWNUM AS ora_rn " "FROM (SELECT sometable.col1 AS col1, sometable.col2 AS col2 " "FROM sometable) WHERE ROWNUM <= :param_1 + :param_2) " "WHERE ora_rn > :param_2", dialect=dialect, checkparams={"param_1": 10, "param_2": 10}, ) def test_long_labels(self): dialect = default.DefaultDialect() dialect.max_identifier_length = 30 ora_dialect = oracle.dialect() m = MetaData() a_table = Table( "thirty_characters_table_xxxxxx", m, Column("id", Integer, primary_key=True), ) other_table = Table( "other_thirty_characters_table_", m, Column("id", Integer, primary_key=True), Column( "thirty_characters_table_id", Integer, ForeignKey("thirty_characters_table_xxxxxx.id"), primary_key=True, ), ) anon = a_table.alias() self.assert_compile( select([other_table, anon]) .select_from(other_table.outerjoin(anon)) .apply_labels(), "SELECT other_thirty_characters_table_.id " "AS other_thirty_characters__1, " "other_thirty_characters_table_.thirty_char" "acters_table_id AS other_thirty_characters" "__2, thirty_characters_table__1.id AS " "thirty_characters_table__3 FROM " "other_thirty_characters_table_ LEFT OUTER " "JOIN thirty_characters_table_xxxxxx AS " "thirty_characters_table__1 ON " "thirty_characters_table__1.id = " "other_thirty_characters_table_.thirty_char" "acters_table_id", dialect=dialect, ) self.assert_compile( select([other_table, anon]) .select_from(other_table.outerjoin(anon)) .apply_labels(), "SELECT other_thirty_characters_table_.id " "AS other_thirty_characters__1, " "other_thirty_characters_table_.thirty_char" "acters_table_id AS other_thirty_characters" "__2, thirty_characters_table__1.id AS " "thirty_characters_table__3 FROM " "other_thirty_characters_table_ LEFT OUTER " "JOIN thirty_characters_table_xxxxxx " "thirty_characters_table__1 ON " "thirty_characters_table__1.id = " "other_thirty_characters_table_.thirty_char" "acters_table_id", dialect=ora_dialect, ) def test_outer_join(self): table1 = table( "mytable", column("myid", Integer), column("name", String), column("description", String), ) table2 = table( "myothertable", column("otherid", Integer), column("othername", String), ) table3 = table( "thirdtable", column("userid", Integer), column("otherstuff", String), ) query = select( [table1, table2], or_( table1.c.name == "fred", table1.c.myid == 10, table2.c.othername != "jack", text("EXISTS (select yay from foo where boo = lar)"), ), from_obj=[ outerjoin(table1, table2, table1.c.myid == table2.c.otherid) ], ) self.assert_compile( query, "SELECT mytable.myid, mytable.name, " "mytable.description, myothertable.otherid," " myothertable.othername FROM mytable, " "myothertable WHERE (mytable.name = " ":name_1 OR mytable.myid = :myid_1 OR " "myothertable.othername != :othername_1 OR " "EXISTS (select yay from foo where boo = " "lar)) AND mytable.myid = " "myothertable.otherid(+)", dialect=oracle.OracleDialect(use_ansi=False), ) query = table1.outerjoin( table2, table1.c.myid == table2.c.otherid ).outerjoin(table3, table3.c.userid == table2.c.otherid) self.assert_compile( query.select(), "SELECT mytable.myid, mytable.name, " "mytable.description, myothertable.otherid," " myothertable.othername, " "thirdtable.userid, thirdtable.otherstuff " "FROM mytable LEFT OUTER JOIN myothertable " "ON mytable.myid = myothertable.otherid " "LEFT OUTER JOIN thirdtable ON " "thirdtable.userid = myothertable.otherid", ) self.assert_compile( query.select(), "SELECT mytable.myid, mytable.name, " "mytable.description, myothertable.otherid," " myothertable.othername, " "thirdtable.userid, thirdtable.otherstuff " "FROM mytable, myothertable, thirdtable " "WHERE thirdtable.userid(+) = " "myothertable.otherid AND mytable.myid = " "myothertable.otherid(+)", dialect=oracle.dialect(use_ansi=False), ) query = table1.join(table2, table1.c.myid == table2.c.otherid).join( table3, table3.c.userid == table2.c.otherid ) self.assert_compile( query.select(), "SELECT mytable.myid, mytable.name, " "mytable.description, myothertable.otherid," " myothertable.othername, " "thirdtable.userid, thirdtable.otherstuff " "FROM mytable, myothertable, thirdtable " "WHERE thirdtable.userid = " "myothertable.otherid AND mytable.myid = " "myothertable.otherid", dialect=oracle.dialect(use_ansi=False), ) query = table1.join( table2, table1.c.myid == table2.c.otherid ).outerjoin(table3, table3.c.userid == table2.c.otherid) self.assert_compile( query.select().order_by(table1.c.name).limit(10).offset(5), "SELECT myid, name, description, otherid, " "othername, userid, otherstuff FROM " "(SELECT myid, name, description, otherid, " "othername, userid, otherstuff, ROWNUM AS " "ora_rn FROM (SELECT mytable.myid AS myid, " "mytable.name AS name, mytable.description " "AS description, myothertable.otherid AS " "otherid, myothertable.othername AS " "othername, thirdtable.userid AS userid, " "thirdtable.otherstuff AS otherstuff FROM " "mytable, myothertable, thirdtable WHERE " "thirdtable.userid(+) = " "myothertable.otherid AND mytable.myid = " "myothertable.otherid ORDER BY mytable.name) " "WHERE ROWNUM <= :param_1 + :param_2) " "WHERE ora_rn > :param_2", checkparams={"param_1": 10, "param_2": 5}, dialect=oracle.dialect(use_ansi=False), ) subq = ( select([table1]) .select_from( table1.outerjoin(table2, table1.c.myid == table2.c.otherid) ) .alias() ) q = select([table3]).select_from( table3.outerjoin(subq, table3.c.userid == subq.c.myid) ) self.assert_compile( q, "SELECT thirdtable.userid, " "thirdtable.otherstuff FROM thirdtable " "LEFT OUTER JOIN (SELECT mytable.myid AS " "myid, mytable.name AS name, " "mytable.description AS description FROM " "mytable LEFT OUTER JOIN myothertable ON " "mytable.myid = myothertable.otherid) " "anon_1 ON thirdtable.userid = anon_1.myid", dialect=oracle.dialect(use_ansi=True), ) self.assert_compile( q, "SELECT thirdtable.userid, " "thirdtable.otherstuff FROM thirdtable, " "(SELECT mytable.myid AS myid, " "mytable.name AS name, mytable.description " "AS description FROM mytable, myothertable " "WHERE mytable.myid = myothertable.otherid(" "+)) anon_1 WHERE thirdtable.userid = " "anon_1.myid(+)", dialect=oracle.dialect(use_ansi=False), ) q = select([table1.c.name]).where(table1.c.name == "foo") self.assert_compile( q, "SELECT mytable.name FROM mytable WHERE " "mytable.name = :name_1", dialect=oracle.dialect(use_ansi=False), ) subq = ( select([table3.c.otherstuff]) .where(table3.c.otherstuff == table1.c.name) .label("bar") ) q = select([table1.c.name, subq]) self.assert_compile( q, "SELECT mytable.name, (SELECT " "thirdtable.otherstuff FROM thirdtable " "WHERE thirdtable.otherstuff = " "mytable.name) AS bar FROM mytable", dialect=oracle.dialect(use_ansi=False), ) def test_nonansi_plusses_everthing_in_the_condition(self): table1 = table( "mytable", column("myid", Integer), column("name", String), column("description", String), ) table2 = table( "myothertable", column("otherid", Integer), column("othername", String), ) stmt = select([table1]).select_from( table1.outerjoin( table2, and_( table1.c.myid == table2.c.otherid, table2.c.othername > 5, table1.c.name == "foo", ), ) ) self.assert_compile( stmt, "SELECT mytable.myid, mytable.name, mytable.description " "FROM mytable, myothertable WHERE mytable.myid = " "myothertable.otherid(+) AND myothertable.othername(+) > " ":othername_1 AND mytable.name = :name_1", dialect=oracle.dialect(use_ansi=False), ) stmt = select([table1]).select_from( table1.outerjoin( table2, and_( table1.c.myid == table2.c.otherid, table2.c.othername == None, table1.c.name == None, ), ) ) self.assert_compile( stmt, "SELECT mytable.myid, mytable.name, mytable.description " "FROM mytable, myothertable WHERE mytable.myid = " "myothertable.otherid(+) AND myothertable.othername(+) IS NULL " "AND mytable.name IS NULL", dialect=oracle.dialect(use_ansi=False), ) def test_nonansi_nested_right_join(self): a = table("a", column("a")) b = table("b", column("b")) c = table("c", column("c")) j = a.join(b.join(c, b.c.b == c.c.c), a.c.a == b.c.b) self.assert_compile( select([j]), "SELECT a.a, b.b, c.c FROM a, b, c " "WHERE a.a = b.b AND b.b = c.c", dialect=oracle.OracleDialect(use_ansi=False), ) j = a.outerjoin(b.join(c, b.c.b == c.c.c), a.c.a == b.c.b) self.assert_compile( select([j]), "SELECT a.a, b.b, c.c FROM a, b, c " "WHERE a.a = b.b(+) AND b.b = c.c", dialect=oracle.OracleDialect(use_ansi=False), ) j = a.join(b.outerjoin(c, b.c.b == c.c.c), a.c.a == b.c.b) self.assert_compile( select([j]), "SELECT a.a, b.b, c.c FROM a, b, c " "WHERE a.a = b.b AND b.b = c.c(+)", dialect=oracle.OracleDialect(use_ansi=False), ) def test_alias_outer_join(self): address_types = table("address_types", column("id"), column("name")) addresses = table( "addresses", column("id"), column("user_id"), column("address_type_id"), column("email_address"), ) at_alias = address_types.alias() s = ( select([at_alias, addresses]) .select_from( addresses.outerjoin( at_alias, addresses.c.address_type_id == at_alias.c.id ) ) .where(addresses.c.user_id == 7) .order_by(addresses.c.id, address_types.c.id) ) self.assert_compile( s, "SELECT address_types_1.id, " "address_types_1.name, addresses.id, " "addresses.user_id, addresses.address_type_" "id, addresses.email_address FROM " "addresses LEFT OUTER JOIN address_types " "address_types_1 ON addresses.address_type_" "id = address_types_1.id WHERE " "addresses.user_id = :user_id_1 ORDER BY " "addresses.id, address_types.id", ) def test_returning_insert(self): t1 = table("t1", column("c1"), column("c2"), column("c3")) self.assert_compile( t1.insert().values(c1=1).returning(t1.c.c2, t1.c.c3), "INSERT INTO t1 (c1) VALUES (:c1) RETURNING " "t1.c2, t1.c3 INTO :ret_0, :ret_1", ) def test_returning_insert_functional(self): t1 = table( "t1", column("c1"), column("c2", String()), column("c3", String()) ) fn = func.lower(t1.c.c2, type_=String()) stmt = t1.insert().values(c1=1).returning(fn, t1.c.c3) compiled = stmt.compile(dialect=oracle.dialect()) eq_( compiled._create_result_map(), { "c3": ("c3", (t1.c.c3, "c3", "c3"), t1.c.c3.type), "lower": ("lower", (fn, "lower", None), fn.type), }, ) self.assert_compile( stmt, "INSERT INTO t1 (c1) VALUES (:c1) RETURNING " "lower(t1.c2), t1.c3 INTO :ret_0, :ret_1", ) def test_returning_insert_labeled(self): t1 = table("t1", column("c1"), column("c2"), column("c3")) self.assert_compile( t1.insert() .values(c1=1) .returning(t1.c.c2.label("c2_l"), t1.c.c3.label("c3_l")), "INSERT INTO t1 (c1) VALUES (:c1) RETURNING " "t1.c2, t1.c3 INTO :ret_0, :ret_1", ) def test_returning_insert_computed(self): m = MetaData() t1 = Table( "t1", m, Column("id", Integer, primary_key=True), Column("foo", Integer), Column("bar", Integer, Computed("foo + 42")), ) self.assert_compile( t1.insert().values(id=1, foo=5).returning(t1.c.bar), "INSERT INTO t1 (id, foo) VALUES (:id, :foo) " "RETURNING t1.bar INTO :ret_0", ) def test_returning_update_computed_warning(self): m = MetaData() t1 = Table( "t1", m, Column("id", Integer, primary_key=True), Column("foo", Integer), Column("bar", Integer, Computed("foo + 42")), ) with testing.expect_warnings( "Computed columns don't work with Oracle UPDATE" ): self.assert_compile( t1.update().values(id=1, foo=5).returning(t1.c.bar), "UPDATE t1 SET id=:id, foo=:foo RETURNING t1.bar INTO :ret_0", ) def test_compound(self): t1 = table("t1", column("c1"), column("c2"), column("c3")) t2 = table("t2", column("c1"), column("c2"), column("c3")) self.assert_compile( union(t1.select(), t2.select()), "SELECT t1.c1, t1.c2, t1.c3 FROM t1 UNION " "SELECT t2.c1, t2.c2, t2.c3 FROM t2", ) self.assert_compile( except_(t1.select(), t2.select()), "SELECT t1.c1, t1.c2, t1.c3 FROM t1 MINUS " "SELECT t2.c1, t2.c2, t2.c3 FROM t2", ) def test_no_paren_fns(self): for fn, expected in [ (func.uid(), "uid"), (func.UID(), "UID"), (func.sysdate(), "sysdate"), (func.row_number(), "row_number()"), (func.rank(), "rank()"), (func.now(), "CURRENT_TIMESTAMP"), (func.current_timestamp(), "CURRENT_TIMESTAMP"), (func.user(), "USER"), ]: self.assert_compile(fn, expected) def test_create_index_alt_schema(self): m = MetaData() t1 = Table("foo", m, Column("x", Integer), schema="alt_schema") self.assert_compile( schema.CreateIndex(Index("bar", t1.c.x)), "CREATE INDEX alt_schema.bar ON alt_schema.foo (x)", ) def test_create_index_expr(self): m = MetaData() t1 = Table("foo", m, Column("x", Integer)) self.assert_compile( schema.CreateIndex(Index("bar", t1.c.x > 5)), "CREATE INDEX bar ON foo (x > 5)", ) def test_table_options(self): m = MetaData() t = Table( "foo", m, Column("x", Integer), prefixes=["GLOBAL TEMPORARY"], oracle_on_commit="PRESERVE ROWS", ) self.assert_compile( schema.CreateTable(t), "CREATE GLOBAL TEMPORARY TABLE " "foo (x INTEGER) ON COMMIT PRESERVE ROWS", ) def test_create_table_compress(self): m = MetaData() tbl1 = Table( "testtbl1", m, Column("data", Integer), oracle_compress=True ) tbl2 = Table( "testtbl2", m, Column("data", Integer), oracle_compress="OLTP" ) self.assert_compile( schema.CreateTable(tbl1), "CREATE TABLE testtbl1 (data INTEGER) COMPRESS", ) self.assert_compile( schema.CreateTable(tbl2), "CREATE TABLE testtbl2 (data INTEGER) " "COMPRESS FOR OLTP", ) def test_create_index_bitmap_compress(self): m = MetaData() tbl = Table("testtbl", m, Column("data", Integer)) idx1 = Index("idx1", tbl.c.data, oracle_compress=True) idx2 = Index("idx2", tbl.c.data, oracle_compress=1) idx3 = Index("idx3", tbl.c.data, oracle_bitmap=True) self.assert_compile( schema.CreateIndex(idx1), "CREATE INDEX idx1 ON testtbl (data) COMPRESS", ) self.assert_compile( schema.CreateIndex(idx2), "CREATE INDEX idx2 ON testtbl (data) COMPRESS 1", ) self.assert_compile( schema.CreateIndex(idx3), "CREATE BITMAP INDEX idx3 ON testtbl (data)", ) @testing.combinations( ("no_persisted", "", "ignore"), ("persisted_none", "", None), ("persisted_false", " VIRTUAL", False), id_="iaa", ) def test_column_computed(self, text, persisted): m = MetaData() kwargs = {"persisted": persisted} if persisted != "ignore" else {} t = Table( "t", m, Column("x", Integer), Column("y", Integer, Computed("x + 2", **kwargs)), ) self.assert_compile( schema.CreateTable(t), "CREATE TABLE t (x INTEGER, y INTEGER GENERATED " "ALWAYS AS (x + 2)%s)" % text, ) def test_column_computed_persisted_true(self): m = MetaData() t = Table( "t", m, Column("x", Integer), Column("y", Integer, Computed("x + 2", persisted=True)), ) assert_raises_message( exc.CompileError, r".*Oracle computed columns do not support 'stored' ", schema.CreateTable(t).compile, dialect=oracle.dialect(), ) class SequenceTest(fixtures.TestBase, AssertsCompiledSQL): def test_basic(self): seq = Sequence("my_seq_no_schema") dialect = oracle.OracleDialect() assert ( dialect.identifier_preparer.format_sequence(seq) == "my_seq_no_schema" ) seq = Sequence("my_seq", schema="some_schema") assert ( dialect.identifier_preparer.format_sequence(seq) == "some_schema.my_seq" ) seq = Sequence("My_Seq", schema="Some_Schema") assert ( dialect.identifier_preparer.format_sequence(seq) == '"Some_Schema"."My_Seq"' )
# Copyright 2010 OpenStack Foundation # Copyright 2012 University Of Minho # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. import contextlib import os import time import fixtures import mock from oslo.config import cfg from nova import exception from nova.openstack.common import processutils from nova.storage import linuxscsi from nova import test from nova.tests.virt.libvirt import fake_libvirt_utils from nova import utils from nova.virt import fake from nova.virt.libvirt import utils as libvirt_utils from nova.virt.libvirt import volume CONF = cfg.CONF class LibvirtVolumeTestCase(test.NoDBTestCase): def setUp(self): super(LibvirtVolumeTestCase, self).setUp() self.executes = [] def fake_execute(*cmd, **kwargs): self.executes.append(cmd) return None, None self.stubs.Set(utils, 'execute', fake_execute) class FakeLibvirtDriver(object): def __init__(self, hyperv="QEMU", version=1005001): self.hyperv = hyperv self.version = version def _get_hypervisor_version(self): return self.version def _get_hypervisor_type(self): return self.hyperv def _get_all_block_devices(self): return [] self.fake_conn = FakeLibvirtDriver(fake.FakeVirtAPI()) self.connr = { 'ip': '127.0.0.1', 'initiator': 'fake_initiator', 'host': 'fake_host' } self.disk_info = { "bus": "virtio", "dev": "vde", "type": "disk", } self.name = 'volume-00000001' self.location = '10.0.2.15:3260' self.iqn = 'iqn.2010-10.org.openstack:%s' % self.name self.vol = {'id': 1, 'name': self.name} self.uuid = '875a8070-d0b9-4949-8b31-104d125c9a64' self.user = 'foo' def _assertNetworkAndProtocolEquals(self, tree): self.assertEqual(tree.get('type'), 'network') self.assertEqual(tree.find('./source').get('protocol'), 'rbd') rbd_name = '%s/%s' % ('rbd', self.name) self.assertEqual(tree.find('./source').get('name'), rbd_name) def _assertFileTypeEquals(self, tree, file_path): self.assertEqual(tree.get('type'), 'file') self.assertEqual(tree.find('./source').get('file'), file_path) def _assertDiskInfoEquals(self, tree, disk_info): self.assertEqual(tree.get('device'), disk_info['type']) self.assertEqual(tree.find('./target').get('bus'), disk_info['bus']) self.assertEqual(tree.find('./target').get('dev'), disk_info['dev']) def _test_libvirt_volume_driver_disk_info(self): libvirt_driver = volume.LibvirtVolumeDriver(self.fake_conn) connection_info = { 'driver_volume_type': 'fake', 'data': { 'device_path': '/foo', }, 'serial': 'fake_serial', } conf = libvirt_driver.connect_volume(connection_info, self.disk_info) tree = conf.format_dom() self._assertDiskInfoEquals(tree, self.disk_info) def test_libvirt_volume_disk_info_type(self): self.disk_info['type'] = 'cdrom' self._test_libvirt_volume_driver_disk_info() def test_libvirt_volume_disk_info_dev(self): self.disk_info['dev'] = 'hdc' self._test_libvirt_volume_driver_disk_info() def test_libvirt_volume_disk_info_bus(self): self.disk_info['bus'] = 'scsi' self._test_libvirt_volume_driver_disk_info() def test_libvirt_volume_driver_serial(self): libvirt_driver = volume.LibvirtVolumeDriver(self.fake_conn) connection_info = { 'driver_volume_type': 'fake', 'data': { 'device_path': '/foo', }, 'serial': 'fake_serial', } conf = libvirt_driver.connect_volume(connection_info, self.disk_info) tree = conf.format_dom() self.assertEqual('block', tree.get('type')) self.assertEqual('fake_serial', tree.find('./serial').text) self.assertIsNone(tree.find('./blockio')) def test_libvirt_volume_driver_blockio(self): libvirt_driver = volume.LibvirtVolumeDriver(self.fake_conn) connection_info = { 'driver_volume_type': 'fake', 'data': { 'device_path': '/foo', 'logical_block_size': '4096', 'physical_block_size': '4096', }, 'serial': 'fake_serial', } disk_info = { "bus": "virtio", "dev": "vde", "type": "disk", } conf = libvirt_driver.connect_volume(connection_info, disk_info) tree = conf.format_dom() blockio = tree.find('./blockio') self.assertEqual('4096', blockio.get('logical_block_size')) self.assertEqual('4096', blockio.get('physical_block_size')) def test_libvirt_volume_driver_iotune(self): libvirt_driver = volume.LibvirtVolumeDriver(self.fake_conn) connection_info = { 'driver_volume_type': 'fake', 'data': { "device_path": "/foo", 'qos_specs': 'bar', }, } disk_info = { "bus": "virtio", "dev": "vde", "type": "disk", } conf = libvirt_driver.connect_volume(connection_info, disk_info) tree = conf.format_dom() iotune = tree.find('./iotune') # ensure invalid qos_specs is ignored self.assertIsNone(iotune) specs = { 'total_bytes_sec': '102400', 'read_bytes_sec': '51200', 'write_bytes_sec': '0', 'total_iops_sec': '0', 'read_iops_sec': '200', 'write_iops_sec': '200', } del connection_info['data']['qos_specs'] connection_info['data'].update(dict(qos_specs=specs)) conf = libvirt_driver.connect_volume(connection_info, disk_info) tree = conf.format_dom() self.assertEqual('102400', tree.find('./iotune/total_bytes_sec').text) self.assertEqual('51200', tree.find('./iotune/read_bytes_sec').text) self.assertEqual('0', tree.find('./iotune/write_bytes_sec').text) self.assertEqual('0', tree.find('./iotune/total_iops_sec').text) self.assertEqual('200', tree.find('./iotune/read_iops_sec').text) self.assertEqual('200', tree.find('./iotune/write_iops_sec').text) def test_libvirt_volume_driver_readonly(self): libvirt_driver = volume.LibvirtVolumeDriver(self.fake_conn) connection_info = { 'driver_volume_type': 'fake', 'data': { "device_path": "/foo", 'access_mode': 'bar', }, } disk_info = { "bus": "virtio", "dev": "vde", "type": "disk", } self.assertRaises(exception.InvalidVolumeAccessMode, libvirt_driver.connect_volume, connection_info, self.disk_info) connection_info['data']['access_mode'] = 'rw' conf = libvirt_driver.connect_volume(connection_info, disk_info) tree = conf.format_dom() readonly = tree.find('./readonly') self.assertIsNone(readonly) connection_info['data']['access_mode'] = 'ro' conf = libvirt_driver.connect_volume(connection_info, disk_info) tree = conf.format_dom() readonly = tree.find('./readonly') self.assertIsNotNone(readonly) def iscsi_connection(self, volume, location, iqn): return { 'driver_volume_type': 'iscsi', 'data': { 'volume_id': volume['id'], 'target_portal': location, 'target_iqn': iqn, 'target_lun': 1, 'qos_specs': { 'total_bytes_sec': '102400', 'read_iops_sec': '200', } } } def test_rescan_multipath(self): libvirt_driver = volume.LibvirtISCSIVolumeDriver(self.fake_conn) libvirt_driver._rescan_multipath() expected_multipath_cmd = ('multipath', '-r') self.assertIn(expected_multipath_cmd, self.executes) def test_libvirt_iscsi_driver(self): # NOTE(vish) exists is to make driver assume connecting worked self.stubs.Set(os.path, 'exists', lambda x: True) libvirt_driver = volume.LibvirtISCSIVolumeDriver(self.fake_conn) connection_info = self.iscsi_connection(self.vol, self.location, self.iqn) conf = libvirt_driver.connect_volume(connection_info, self.disk_info) self.assertEqual('qemu', conf.driver_name) tree = conf.format_dom() dev_str = '/dev/disk/by-path/ip-%s-iscsi-%s-lun-1' % (self.location, self.iqn) self.assertEqual(tree.get('type'), 'block') self.assertEqual(tree.find('./source').get('dev'), dev_str) libvirt_driver.disconnect_volume(connection_info, "vde") expected_commands = [('iscsiadm', '-m', 'node', '-T', self.iqn, '-p', self.location), ('iscsiadm', '-m', 'session'), ('iscsiadm', '-m', 'node', '-T', self.iqn, '-p', self.location, '--login'), ('iscsiadm', '-m', 'node', '-T', self.iqn, '-p', self.location, '--op', 'update', '-n', 'node.startup', '-v', 'automatic'), ('iscsiadm', '-m', 'node', '-T', self.iqn, '-p', self.location, '--rescan'), ('iscsiadm', '-m', 'node', '-T', self.iqn, '-p', self.location, '--op', 'update', '-n', 'node.startup', '-v', 'manual'), ('iscsiadm', '-m', 'node', '-T', self.iqn, '-p', self.location, '--logout'), ('iscsiadm', '-m', 'node', '-T', self.iqn, '-p', self.location, '--op', 'delete')] self.assertEqual('102400', tree.find('./iotune/total_bytes_sec').text) self.assertEqual(self.executes, expected_commands) def test_libvirt_iscsi_driver_still_in_use(self): # NOTE(vish) exists is to make driver assume connecting worked self.stubs.Set(os.path, 'exists', lambda x: True) libvirt_driver = volume.LibvirtISCSIVolumeDriver(self.fake_conn) devs = ['/dev/disk/by-path/ip-%s-iscsi-%s-lun-2' % (self.location, self.iqn)] self.stubs.Set(self.fake_conn, '_get_all_block_devices', lambda: devs) vol = {'id': 1, 'name': self.name} connection_info = self.iscsi_connection(vol, self.location, self.iqn) conf = libvirt_driver.connect_volume(connection_info, self.disk_info) tree = conf.format_dom() dev_name = 'ip-%s-iscsi-%s-lun-1' % (self.location, self.iqn) dev_str = '/dev/disk/by-path/%s' % dev_name self.assertEqual(tree.get('type'), 'block') self.assertEqual(tree.find('./source').get('dev'), dev_str) libvirt_driver.disconnect_volume(connection_info, "vde") expected_commands = [('iscsiadm', '-m', 'node', '-T', self.iqn, '-p', self.location), ('iscsiadm', '-m', 'session'), ('iscsiadm', '-m', 'node', '-T', self.iqn, '-p', self.location, '--login'), ('iscsiadm', '-m', 'node', '-T', self.iqn, '-p', self.location, '--op', 'update', '-n', 'node.startup', '-v', 'automatic'), ('iscsiadm', '-m', 'node', '-T', self.iqn, '-p', self.location, '--rescan'), ('cp', '/dev/stdin', '/sys/block/%s/device/delete' % dev_name)] self.assertEqual(self.executes, expected_commands) def test_libvirt_iscsi_driver_disconnect_multipath_error(self): libvirt_driver = volume.LibvirtISCSIVolumeDriver(self.fake_conn) devs = ['/dev/disk/by-path/ip-%s-iscsi-%s-lun-2' % (self.location, self.iqn)] with contextlib.nested( mock.patch.object(os.path, 'exists', return_value=True), mock.patch.object(self.fake_conn, '_get_all_block_devices', return_value=devs), mock.patch.object(libvirt_driver, '_rescan_multipath'), mock.patch.object(libvirt_driver, '_run_multipath'), mock.patch.object(libvirt_driver, '_get_multipath_device_name', return_value='/dev/mapper/fake-multipath-devname'), mock.patch.object(libvirt_driver, '_get_target_portals_from_iscsiadm_output', return_value=[('fake-ip', 'fake-portal')]), mock.patch.object(libvirt_driver, '_get_multipath_iqn', return_value='fake-portal'), ) as (mock_exists, mock_devices, mock_rescan_multipath, mock_run_multipath, mock_device_name, mock_get_portals, mock_get_iqn): mock_run_multipath.side_effect = processutils.ProcessExecutionError vol = {'id': 1, 'name': self.name} connection_info = self.iscsi_connection(vol, self.location, self.iqn) conf = libvirt_driver.connect_volume(connection_info, self.disk_info) tree = conf.format_dom() dev_name = 'ip-%s-iscsi-%s-lun-1' % (self.location, self.iqn) dev_str = '/dev/disk/by-path/%s' % dev_name self.assertEqual('block', tree.get('type')) self.assertEqual(dev_str, tree.find('./source').get('dev')) libvirt_driver.use_multipath = True libvirt_driver.disconnect_volume(connection_info, "vde") mock_run_multipath.assert_called_once_with( ['-f', 'fake-multipath-devname'], check_exit_code=[0, 1]) def test_sanitize_log_run_iscsiadm(self): # Tests that the parameters to the _run_iscsiadm function are sanitized # for passwords when logged. def fake_debug(*args, **kwargs): self.assertIn('node.session.auth.password', args[0]) self.assertNotIn('scrubme', args[0]) libvirt_driver = volume.LibvirtISCSIVolumeDriver(self.fake_conn) connection_info = self.iscsi_connection(self.vol, self.location, self.iqn) iscsi_properties = connection_info['data'] with mock.patch.object(volume.LOG, 'debug', side_effect=fake_debug) as debug_mock: libvirt_driver._iscsiadm_update(iscsi_properties, 'node.session.auth.password', 'scrubme') # we don't care what the log message is, we just want to make sure # our stub method is called which asserts the password is scrubbed self.assertTrue(debug_mock.called) def iser_connection(self, volume, location, iqn): return { 'driver_volume_type': 'iser', 'data': { 'volume_id': volume['id'], 'target_portal': location, 'target_iqn': iqn, 'target_lun': 1, } } def sheepdog_connection(self, volume): return { 'driver_volume_type': 'sheepdog', 'data': { 'name': volume['name'] } } def test_libvirt_sheepdog_driver(self): libvirt_driver = volume.LibvirtNetVolumeDriver(self.fake_conn) connection_info = self.sheepdog_connection(self.vol) conf = libvirt_driver.connect_volume(connection_info, self.disk_info) tree = conf.format_dom() self.assertEqual(tree.get('type'), 'network') self.assertEqual(tree.find('./source').get('protocol'), 'sheepdog') self.assertEqual(tree.find('./source').get('name'), self.name) libvirt_driver.disconnect_volume(connection_info, "vde") def rbd_connection(self, volume): return { 'driver_volume_type': 'rbd', 'data': { 'name': '%s/%s' % ('rbd', volume['name']), 'auth_enabled': CONF.libvirt.rbd_secret_uuid is not None, 'auth_username': CONF.libvirt.rbd_user, 'secret_type': 'ceph', 'secret_uuid': CONF.libvirt.rbd_secret_uuid, 'qos_specs': { 'total_bytes_sec': '1048576', 'read_iops_sec': '500', } } } def test_libvirt_rbd_driver(self): libvirt_driver = volume.LibvirtNetVolumeDriver(self.fake_conn) connection_info = self.rbd_connection(self.vol) conf = libvirt_driver.connect_volume(connection_info, self.disk_info) tree = conf.format_dom() self._assertNetworkAndProtocolEquals(tree) self.assertIsNone(tree.find('./source/auth')) self.assertEqual('1048576', tree.find('./iotune/total_bytes_sec').text) self.assertEqual('500', tree.find('./iotune/read_iops_sec').text) libvirt_driver.disconnect_volume(connection_info, "vde") def test_libvirt_rbd_driver_hosts(self): libvirt_driver = volume.LibvirtNetVolumeDriver(self.fake_conn) connection_info = self.rbd_connection(self.vol) hosts = ['example.com', '1.2.3.4', '::1'] ports = [None, '6790', '6791'] connection_info['data']['hosts'] = hosts connection_info['data']['ports'] = ports conf = libvirt_driver.connect_volume(connection_info, self.disk_info) tree = conf.format_dom() self._assertNetworkAndProtocolEquals(tree) self.assertIsNone(tree.find('./source/auth')) found_hosts = tree.findall('./source/host') self.assertEqual([host.get('name') for host in found_hosts], hosts) self.assertEqual([host.get('port') for host in found_hosts], ports) libvirt_driver.disconnect_volume(connection_info, "vde") def test_libvirt_rbd_driver_auth_enabled(self): libvirt_driver = volume.LibvirtNetVolumeDriver(self.fake_conn) connection_info = self.rbd_connection(self.vol) secret_type = 'ceph' connection_info['data']['auth_enabled'] = True connection_info['data']['auth_username'] = self.user connection_info['data']['secret_type'] = secret_type connection_info['data']['secret_uuid'] = self.uuid conf = libvirt_driver.connect_volume(connection_info, self.disk_info) tree = conf.format_dom() self._assertNetworkAndProtocolEquals(tree) self.assertEqual(tree.find('./auth').get('username'), self.user) self.assertEqual(tree.find('./auth/secret').get('type'), secret_type) self.assertEqual(tree.find('./auth/secret').get('uuid'), self.uuid) libvirt_driver.disconnect_volume(connection_info, "vde") def test_libvirt_rbd_driver_auth_enabled_flags_override(self): libvirt_driver = volume.LibvirtNetVolumeDriver(self.fake_conn) connection_info = self.rbd_connection(self.vol) secret_type = 'ceph' connection_info['data']['auth_enabled'] = True connection_info['data']['auth_username'] = self.user connection_info['data']['secret_type'] = secret_type connection_info['data']['secret_uuid'] = self.uuid flags_uuid = '37152720-1785-11e2-a740-af0c1d8b8e4b' flags_user = 'bar' self.flags(rbd_user=flags_user, rbd_secret_uuid=flags_uuid, group='libvirt') conf = libvirt_driver.connect_volume(connection_info, self.disk_info) tree = conf.format_dom() self._assertNetworkAndProtocolEquals(tree) self.assertEqual(tree.find('./auth').get('username'), flags_user) self.assertEqual(tree.find('./auth/secret').get('type'), secret_type) self.assertEqual(tree.find('./auth/secret').get('uuid'), flags_uuid) libvirt_driver.disconnect_volume(connection_info, "vde") def test_libvirt_rbd_driver_auth_disabled(self): libvirt_driver = volume.LibvirtNetVolumeDriver(self.fake_conn) connection_info = self.rbd_connection(self.vol) secret_type = 'ceph' connection_info['data']['auth_enabled'] = False connection_info['data']['auth_username'] = self.user connection_info['data']['secret_type'] = secret_type connection_info['data']['secret_uuid'] = self.uuid conf = libvirt_driver.connect_volume(connection_info, self.disk_info) tree = conf.format_dom() self._assertNetworkAndProtocolEquals(tree) self.assertIsNone(tree.find('./auth')) libvirt_driver.disconnect_volume(connection_info, "vde") def test_libvirt_rbd_driver_auth_disabled_flags_override(self): libvirt_driver = volume.LibvirtNetVolumeDriver(self.fake_conn) connection_info = self.rbd_connection(self.vol) secret_type = 'ceph' connection_info['data']['auth_enabled'] = False connection_info['data']['auth_username'] = self.user connection_info['data']['secret_type'] = secret_type connection_info['data']['secret_uuid'] = self.uuid # NOTE: Supplying the rbd_secret_uuid will enable authentication # locally in nova-compute even if not enabled in nova-volume/cinder flags_uuid = '37152720-1785-11e2-a740-af0c1d8b8e4b' flags_user = 'bar' self.flags(rbd_user=flags_user, rbd_secret_uuid=flags_uuid, group='libvirt') conf = libvirt_driver.connect_volume(connection_info, self.disk_info) tree = conf.format_dom() self._assertNetworkAndProtocolEquals(tree) self.assertEqual(tree.find('./auth').get('username'), flags_user) self.assertEqual(tree.find('./auth/secret').get('type'), secret_type) self.assertEqual(tree.find('./auth/secret').get('uuid'), flags_uuid) libvirt_driver.disconnect_volume(connection_info, "vde") def test_libvirt_kvm_volume(self): self.stubs.Set(os.path, 'exists', lambda x: True) libvirt_driver = volume.LibvirtISCSIVolumeDriver(self.fake_conn) connection_info = self.iscsi_connection(self.vol, self.location, self.iqn) conf = libvirt_driver.connect_volume(connection_info, self.disk_info) tree = conf.format_dom() dev_str = '/dev/disk/by-path/ip-%s-iscsi-%s-lun-1' % (self.location, self.iqn) self.assertEqual(tree.get('type'), 'block') self.assertEqual(tree.find('./source').get('dev'), dev_str) libvirt_driver.disconnect_volume(connection_info, 'vde') def test_libvirt_kvm_volume_with_multipath(self): self.flags(iscsi_use_multipath=True, group='libvirt') self.stubs.Set(os.path, 'exists', lambda x: True) devs = ['/dev/mapper/sda', '/dev/mapper/sdb'] self.stubs.Set(self.fake_conn, '_get_all_block_devices', lambda: devs) libvirt_driver = volume.LibvirtISCSIVolumeDriver(self.fake_conn) connection_info = self.iscsi_connection(self.vol, self.location, self.iqn) mpdev_filepath = '/dev/mapper/foo' connection_info['data']['device_path'] = mpdev_filepath libvirt_driver._get_multipath_device_name = lambda x: mpdev_filepath self.stubs.Set(libvirt_driver, '_get_target_portals_from_iscsiadm_output', lambda x: [[self.location, self.iqn]]) conf = libvirt_driver.connect_volume(connection_info, self.disk_info) tree = conf.format_dom() self.assertEqual(tree.find('./source').get('dev'), mpdev_filepath) libvirt_driver._get_multipath_iqn = lambda x: self.iqn libvirt_driver.disconnect_volume(connection_info, 'vde') expected_multipath_cmd = ('multipath', '-f', 'foo') self.assertIn(expected_multipath_cmd, self.executes) def test_libvirt_kvm_volume_with_multipath_still_in_use(self): name = 'volume-00000001' location = '10.0.2.15:3260' iqn = 'iqn.2010-10.org.openstack:%s' % name mpdev_filepath = '/dev/mapper/foo' def _get_multipath_device_name(path): if '%s-lun-1' % iqn in path: return mpdev_filepath return '/dev/mapper/donotdisconnect' self.flags(iscsi_use_multipath=True, group='libvirt') self.stubs.Set(os.path, 'exists', lambda x: True) libvirt_driver = volume.LibvirtISCSIVolumeDriver(self.fake_conn) libvirt_driver._get_multipath_device_name =\ lambda x: _get_multipath_device_name(x) block_devs = ['/dev/disks/by-path/%s-iscsi-%s-lun-2' % (location, iqn)] self.stubs.Set(self.fake_conn, '_get_all_block_devices', lambda: block_devs) vol = {'id': 1, 'name': name} connection_info = self.iscsi_connection(vol, location, iqn) connection_info['data']['device_path'] = mpdev_filepath libvirt_driver._get_multipath_iqn = lambda x: iqn iscsi_devs = ['1.2.3.4-iscsi-%s-lun-1' % iqn, '%s-iscsi-%s-lun-1' % (location, iqn), '%s-iscsi-%s-lun-2' % (location, iqn)] libvirt_driver._get_iscsi_devices = lambda: iscsi_devs self.stubs.Set(libvirt_driver, '_get_target_portals_from_iscsiadm_output', lambda x: [[location, iqn]]) # Set up disconnect volume mock expectations self.mox.StubOutWithMock(libvirt_driver, '_delete_device') self.mox.StubOutWithMock(libvirt_driver, '_rescan_multipath') libvirt_driver._rescan_multipath() libvirt_driver._delete_device('/dev/disk/by-path/%s' % iscsi_devs[0]) libvirt_driver._delete_device('/dev/disk/by-path/%s' % iscsi_devs[1]) libvirt_driver._rescan_multipath() # Ensure that the mpath devices are deleted self.mox.ReplayAll() libvirt_driver.disconnect_volume(connection_info, 'vde') def test_libvirt_kvm_volume_with_multipath_getmpdev(self): self.flags(iscsi_use_multipath=True, group='libvirt') self.stubs.Set(os.path, 'exists', lambda x: True) libvirt_driver = volume.LibvirtISCSIVolumeDriver(self.fake_conn) name0 = 'volume-00000000' iqn0 = 'iqn.2010-10.org.openstack:%s' % name0 dev0 = '/dev/disk/by-path/ip-%s-iscsi-%s-lun-0' % (self.location, iqn0) dev = '/dev/disk/by-path/ip-%s-iscsi-%s-lun-1' % (self.location, self.iqn) devs = [dev0, dev] self.stubs.Set(self.fake_conn, '_get_all_block_devices', lambda: devs) connection_info = self.iscsi_connection(self.vol, self.location, self.iqn) mpdev_filepath = '/dev/mapper/foo' libvirt_driver._get_multipath_device_name = lambda x: mpdev_filepath self.stubs.Set(libvirt_driver, '_get_target_portals_from_iscsiadm_output', lambda x: [['fake_portal1', 'fake_iqn1']]) conf = libvirt_driver.connect_volume(connection_info, self.disk_info) tree = conf.format_dom() self.assertEqual(tree.find('./source').get('dev'), mpdev_filepath) libvirt_driver.disconnect_volume(connection_info, 'vde') def test_libvirt_kvm_iser_volume_with_multipath(self): self.flags(iser_use_multipath=True, group='libvirt') self.stubs.Set(os.path, 'exists', lambda x: True) self.stubs.Set(time, 'sleep', lambda x: None) devs = ['/dev/mapper/sda', '/dev/mapper/sdb'] self.stubs.Set(self.fake_conn, '_get_all_block_devices', lambda: devs) libvirt_driver = volume.LibvirtISERVolumeDriver(self.fake_conn) name = 'volume-00000001' location = '10.0.2.15:3260' iqn = 'iqn.2010-10.org.iser.openstack:%s' % name vol = {'id': 1, 'name': name} connection_info = self.iser_connection(vol, location, iqn) mpdev_filepath = '/dev/mapper/foo' connection_info['data']['device_path'] = mpdev_filepath disk_info = { "bus": "virtio", "dev": "vde", "type": "disk", } libvirt_driver._get_multipath_device_name = lambda x: mpdev_filepath self.stubs.Set(libvirt_driver, '_get_target_portals_from_iscsiadm_output', lambda x: [[location, iqn]]) conf = libvirt_driver.connect_volume(connection_info, disk_info) tree = conf.format_dom() self.assertEqual(tree.find('./source').get('dev'), mpdev_filepath) libvirt_driver._get_multipath_iqn = lambda x: iqn libvirt_driver.disconnect_volume(connection_info, 'vde') expected_multipath_cmd = ('multipath', '-f', 'foo') self.assertIn(expected_multipath_cmd, self.executes) def test_libvirt_kvm_iser_volume_with_multipath_getmpdev(self): self.flags(iser_use_multipath=True, group='libvirt') self.stubs.Set(os.path, 'exists', lambda x: True) self.stubs.Set(time, 'sleep', lambda x: None) libvirt_driver = volume.LibvirtISERVolumeDriver(self.fake_conn) name0 = 'volume-00000000' location0 = '10.0.2.15:3260' iqn0 = 'iqn.2010-10.org.iser.openstack:%s' % name0 dev0 = '/dev/disk/by-path/ip-%s-iscsi-%s-lun-0' % (location0, iqn0) name = 'volume-00000001' location = '10.0.2.15:3260' iqn = 'iqn.2010-10.org.iser.openstack:%s' % name vol = {'id': 1, 'name': name} dev = '/dev/disk/by-path/ip-%s-iscsi-%s-lun-1' % (location, iqn) devs = [dev0, dev] self.stubs.Set(self.fake_conn, '_get_all_block_devices', lambda: devs) self.stubs.Set(libvirt_driver, '_get_iscsi_devices', lambda: []) connection_info = self.iser_connection(vol, location, iqn) mpdev_filepath = '/dev/mapper/foo' disk_info = { "bus": "virtio", "dev": "vde", "type": "disk", } libvirt_driver._get_multipath_device_name = lambda x: mpdev_filepath self.stubs.Set(libvirt_driver, '_get_target_portals_from_iscsiadm_output', lambda x: [['fake_portal1', 'fake_iqn1']]) conf = libvirt_driver.connect_volume(connection_info, disk_info) tree = conf.format_dom() self.assertEqual(tree.find('./source').get('dev'), mpdev_filepath) libvirt_driver.disconnect_volume(connection_info, 'vde') def test_libvirt_nfs_driver(self): # NOTE(vish) exists is to make driver assume connecting worked mnt_base = '/mnt' self.flags(nfs_mount_point_base=mnt_base, group='libvirt') libvirt_driver = volume.LibvirtNFSVolumeDriver(self.fake_conn) self.stubs.Set(libvirt_utils, 'is_mounted', lambda x, d: False) export_string = '192.168.1.1:/nfs/share1' export_mnt_base = os.path.join(mnt_base, utils.get_hash_str(export_string)) file_path = os.path.join(export_mnt_base, self.name) connection_info = {'data': {'export': export_string, 'name': self.name}} conf = libvirt_driver.connect_volume(connection_info, self.disk_info) tree = conf.format_dom() self._assertFileTypeEquals(tree, file_path) libvirt_driver.disconnect_volume(connection_info, "vde") expected_commands = [ ('mkdir', '-p', export_mnt_base), ('mount', '-t', 'nfs', export_string, export_mnt_base), ('umount', export_mnt_base)] self.assertEqual(expected_commands, self.executes) def test_libvirt_nfs_driver_already_mounted(self): # NOTE(vish) exists is to make driver assume connecting worked mnt_base = '/mnt' self.flags(nfs_mount_point_base=mnt_base, group='libvirt') libvirt_driver = volume.LibvirtNFSVolumeDriver(self.fake_conn) export_string = '192.168.1.1:/nfs/share1' export_mnt_base = os.path.join(mnt_base, utils.get_hash_str(export_string)) file_path = os.path.join(export_mnt_base, self.name) connection_info = {'data': {'export': export_string, 'name': self.name}} conf = libvirt_driver.connect_volume(connection_info, self.disk_info) tree = conf.format_dom() self._assertFileTypeEquals(tree, file_path) libvirt_driver.disconnect_volume(connection_info, "vde") expected_commands = [ ('findmnt', '--target', export_mnt_base, '--source', export_string), ('umount', export_mnt_base)] self.assertEqual(self.executes, expected_commands) def test_libvirt_nfs_driver_with_opts(self): mnt_base = '/mnt' self.flags(nfs_mount_point_base=mnt_base, group='libvirt') libvirt_driver = volume.LibvirtNFSVolumeDriver(self.fake_conn) self.stubs.Set(libvirt_utils, 'is_mounted', lambda x, d: False) export_string = '192.168.1.1:/nfs/share1' options = '-o intr,nfsvers=3' export_mnt_base = os.path.join(mnt_base, utils.get_hash_str(export_string)) file_path = os.path.join(export_mnt_base, self.name) connection_info = {'data': {'export': export_string, 'name': self.name, 'options': options}} conf = libvirt_driver.connect_volume(connection_info, self.disk_info) tree = conf.format_dom() self._assertFileTypeEquals(tree, file_path) libvirt_driver.disconnect_volume(connection_info, "vde") expected_commands = [ ('mkdir', '-p', export_mnt_base), ('mount', '-t', 'nfs', '-o', 'intr,nfsvers=3', export_string, export_mnt_base), ('umount', export_mnt_base), ] self.assertEqual(expected_commands, self.executes) def aoe_connection(self, shelf, lun): return { 'driver_volume_type': 'aoe', 'data': { 'target_shelf': shelf, 'target_lun': lun, } } def test_libvirt_aoe_driver(self): # NOTE(jbr_) exists is to make driver assume connecting worked self.stubs.Set(os.path, 'exists', lambda x: True) libvirt_driver = volume.LibvirtAOEVolumeDriver(self.fake_conn) shelf = '100' lun = '1' connection_info = self.aoe_connection(shelf, lun) conf = libvirt_driver.connect_volume(connection_info, self.disk_info) tree = conf.format_dom() aoedevpath = '/dev/etherd/e%s.%s' % (shelf, lun) self.assertEqual(tree.get('type'), 'block') self.assertEqual(tree.find('./source').get('dev'), aoedevpath) libvirt_driver.disconnect_volume(connection_info, "vde") def test_libvirt_glusterfs_driver(self): mnt_base = '/mnt' self.flags(glusterfs_mount_point_base=mnt_base, group='libvirt') libvirt_driver = volume.LibvirtGlusterfsVolumeDriver(self.fake_conn) self.stubs.Set(libvirt_utils, 'is_mounted', lambda x, d: False) export_string = '192.168.1.1:/volume-00001' export_mnt_base = os.path.join(mnt_base, utils.get_hash_str(export_string)) file_path = os.path.join(export_mnt_base, self.name) connection_info = {'data': {'export': export_string, 'name': self.name}} conf = libvirt_driver.connect_volume(connection_info, self.disk_info) tree = conf.format_dom() self._assertFileTypeEquals(tree, file_path) libvirt_driver.disconnect_volume(connection_info, "vde") expected_commands = [ ('mkdir', '-p', export_mnt_base), ('mount', '-t', 'glusterfs', export_string, export_mnt_base), ('umount', export_mnt_base)] self.assertEqual(expected_commands, self.executes) def test_libvirt_glusterfs_driver_already_mounted(self): mnt_base = '/mnt' self.flags(glusterfs_mount_point_base=mnt_base, group='libvirt') libvirt_driver = volume.LibvirtGlusterfsVolumeDriver(self.fake_conn) export_string = '192.168.1.1:/volume-00001' export_mnt_base = os.path.join(mnt_base, utils.get_hash_str(export_string)) file_path = os.path.join(export_mnt_base, self.name) connection_info = {'data': {'export': export_string, 'name': self.name}} conf = libvirt_driver.connect_volume(connection_info, self.disk_info) tree = conf.format_dom() self._assertFileTypeEquals(tree, file_path) libvirt_driver.disconnect_volume(connection_info, "vde") expected_commands = [ ('findmnt', '--target', export_mnt_base, '--source', export_string), ('umount', export_mnt_base)] self.assertEqual(self.executes, expected_commands) def test_libvirt_glusterfs_driver_qcow2(self): libvirt_driver = volume.LibvirtGlusterfsVolumeDriver(self.fake_conn) self.stubs.Set(libvirt_utils, 'is_mounted', lambda x, d: False) export_string = '192.168.1.1:/volume-00001' name = 'volume-00001' format = 'qcow2' connection_info = {'data': {'export': export_string, 'name': name, 'format': format}} disk_info = { "bus": "virtio", "dev": "vde", "type": "disk", } conf = libvirt_driver.connect_volume(connection_info, disk_info) tree = conf.format_dom() self.assertEqual(tree.get('type'), 'file') self.assertEqual(tree.find('./driver').get('type'), 'qcow2') libvirt_driver.disconnect_volume(connection_info, "vde") def test_libvirt_glusterfs_driver_with_opts(self): mnt_base = '/mnt' self.flags(glusterfs_mount_point_base=mnt_base, group='libvirt') libvirt_driver = volume.LibvirtGlusterfsVolumeDriver(self.fake_conn) self.stubs.Set(libvirt_utils, 'is_mounted', lambda x, d: False) export_string = '192.168.1.1:/volume-00001' options = '-o backupvolfile-server=192.168.1.2' export_mnt_base = os.path.join(mnt_base, utils.get_hash_str(export_string)) file_path = os.path.join(export_mnt_base, self.name) connection_info = {'data': {'export': export_string, 'name': self.name, 'options': options}} conf = libvirt_driver.connect_volume(connection_info, self.disk_info) tree = conf.format_dom() self._assertFileTypeEquals(tree, file_path) libvirt_driver.disconnect_volume(connection_info, "vde") expected_commands = [ ('mkdir', '-p', export_mnt_base), ('mount', '-t', 'glusterfs', '-o', 'backupvolfile-server=192.168.1.2', export_string, export_mnt_base), ('umount', export_mnt_base), ] self.assertEqual(self.executes, expected_commands) def test_libvirt_glusterfs_libgfapi(self): self.flags(qemu_allowed_storage_drivers=['gluster'], group='libvirt') libvirt_driver = volume.LibvirtGlusterfsVolumeDriver(self.fake_conn) self.stubs.Set(libvirt_utils, 'is_mounted', lambda x, d: False) export_string = '192.168.1.1:/volume-00001' name = 'volume-00001' connection_info = {'data': {'export': export_string, 'name': name}} disk_info = { "dev": "vde", "type": "disk", "bus": "virtio", } conf = libvirt_driver.connect_volume(connection_info, disk_info) tree = conf.format_dom() self.assertEqual(tree.get('type'), 'network') self.assertEqual(tree.find('./driver').get('type'), 'raw') source = tree.find('./source') self.assertEqual(source.get('protocol'), 'gluster') self.assertEqual(source.get('name'), 'volume-00001/volume-00001') self.assertEqual(source.find('./host').get('name'), '192.168.1.1') self.assertEqual(source.find('./host').get('port'), '24007') libvirt_driver.disconnect_volume(connection_info, "vde") def fibrechan_connection(self, volume, location, wwn): return { 'driver_volume_type': 'fibrechan', 'data': { 'volume_id': volume['id'], 'target_portal': location, 'target_wwn': wwn, 'target_lun': 1, } } def test_libvirt_fibrechan_driver(self): self.stubs.Set(libvirt_utils, 'get_fc_hbas', fake_libvirt_utils.get_fc_hbas) self.stubs.Set(libvirt_utils, 'get_fc_hbas_info', fake_libvirt_utils.get_fc_hbas_info) # NOTE(vish) exists is to make driver assume connecting worked self.stubs.Set(os.path, 'exists', lambda x: True) self.stubs.Set(os.path, 'realpath', lambda x: '/dev/sdb') libvirt_driver = volume.LibvirtFibreChannelVolumeDriver(self.fake_conn) multipath_devname = '/dev/md-1' devices = {"device": multipath_devname, "id": "1234567890", "devices": [{'device': '/dev/sdb', 'address': '1:0:0:1', 'host': 1, 'channel': 0, 'id': 0, 'lun': 1}]} self.stubs.Set(linuxscsi, 'find_multipath_device', lambda x: devices) self.stubs.Set(linuxscsi, 'remove_device', lambda x: None) # Should work for string, unicode, and list wwns = ['1234567890123456', unicode('1234567890123456'), ['1234567890123456', '1234567890123457']] for wwn in wwns: connection_info = self.fibrechan_connection(self.vol, self.location, wwn) mount_device = "vde" conf = libvirt_driver.connect_volume(connection_info, self.disk_info) self.assertEqual('1234567890', connection_info['data']['multipath_id']) tree = conf.format_dom() self.assertEqual('block', tree.get('type')) self.assertEqual(multipath_devname, tree.find('./source').get('dev')) # Test the scenario where multipath_id is returned libvirt_driver.disconnect_volume(connection_info, mount_device) expected_commands = [] self.assertEqual(expected_commands, self.executes) # Test the scenario where multipath_id is not returned connection_info["data"]["devices"] = devices["devices"] del connection_info["data"]["multipath_id"] libvirt_driver.disconnect_volume(connection_info, mount_device) expected_commands = [] self.assertEqual(expected_commands, self.executes) # Should not work for anything other than string, unicode, and list connection_info = self.fibrechan_connection(self.vol, self.location, 123) self.assertRaises(exception.NovaException, libvirt_driver.connect_volume, connection_info, self.disk_info) self.stubs.Set(libvirt_utils, 'get_fc_hbas', lambda: []) self.stubs.Set(libvirt_utils, 'get_fc_hbas_info', lambda: []) self.assertRaises(exception.NovaException, libvirt_driver.connect_volume, connection_info, self.disk_info) def test_libvirt_fibrechan_getpci_num(self): libvirt_driver = volume.LibvirtFibreChannelVolumeDriver(self.fake_conn) hba = {'device_path': "/sys/devices/pci0000:00/0000:00:03.0" "/0000:05:00.3/host2/fc_host/host2"} pci_num = libvirt_driver._get_pci_num(hba) self.assertEqual("0000:05:00.3", pci_num) hba = {'device_path': "/sys/devices/pci0000:00/0000:00:03.0" "/0000:05:00.3/0000:06:00.6/host2/fc_host/host2"} pci_num = libvirt_driver._get_pci_num(hba) self.assertEqual("0000:06:00.6", pci_num) def test_libvirt_scality_driver(self): tempdir = self.useFixture(fixtures.TempDir()).path TEST_MOUNT = os.path.join(tempdir, 'fake_mount') TEST_CONFIG = os.path.join(tempdir, 'fake_config') TEST_VOLDIR = 'volumes' TEST_VOLNAME = 'volume_name' TEST_CONN_INFO = { 'data': { 'sofs_path': os.path.join(TEST_VOLDIR, TEST_VOLNAME) } } TEST_VOLPATH = os.path.join(TEST_MOUNT, TEST_VOLDIR, TEST_VOLNAME) open(TEST_CONFIG, "w+").close() os.makedirs(os.path.join(TEST_MOUNT, 'sys')) def _access_wrapper(path, flags): if path == '/sbin/mount.sofs': return True else: return os.access(path, flags) self.stubs.Set(os, 'access', _access_wrapper) self.flags(scality_sofs_config=TEST_CONFIG, scality_sofs_mount_point=TEST_MOUNT, group='libvirt') driver = volume.LibvirtScalityVolumeDriver(self.fake_conn) conf = driver.connect_volume(TEST_CONN_INFO, self.disk_info) tree = conf.format_dom() self._assertFileTypeEquals(tree, TEST_VOLPATH)
"""Builds the eye network. Summary of available functions: # Compute input images and labels for training. If you would like to run # evaluations, use inputs() instead. inputs, labels = distorted_inputs() # Compute inference on the model inputs to make a prediction. predictions = inference(inputs) # Compute the total loss of the prediction with respect to the labels. loss = loss(predictions, labels) # Create a graph to run one step of training with respect to the loss. train_op = train(loss, global_step) """ # pylint: disable=missing-docstring from __future__ import absolute_import from __future__ import division from __future__ import print_function import re import tensorflow as tf import eye_input FLAGS = tf.app.flags.FLAGS # Basic model parameters. tf.app.flags.DEFINE_integer('batch_size', 1, """Number of images to process in a batch.""") tf.app.flags.DEFINE_string('data_dir', '/home/hp/Documents/DeepLearning/MyProjects/Data/eye/new96', """Path to the eye data directory.""") tf.app.flags.DEFINE_boolean('use_fp16', False, """Train the model using fp16.""") # Global constants describing the eye data set. IMAGE_SIZE = eye_input.IMAGE_SIZE NUM_CLASSES = eye_input.NUM_CLASSES NUM_EXAMPLES_PER_EPOCH_FOR_TRAIN = eye_input.NUM_EXAMPLES_PER_EPOCH_FOR_TRAIN NUM_EXAMPLES_PER_EPOCH_FOR_EVAL = eye_input.NUM_EXAMPLES_PER_EPOCH_FOR_EVAL # Constants describing the training process. MOVING_AVERAGE_DECAY = 0.9999 # The decay to use for the moving average. NUM_EPOCHS_PER_DECAY = 2000.0 # Epochs after which learning rate decays. LEARNING_RATE_DECAY_FACTOR = 0.1 # Learning rate decay factor. INITIAL_LEARNING_RATE = 0.1 # Initial learning rate. # If a model is trained with multiple GPUs, prefix all Op names with tower_name # to differentiate the operations. Note that this prefix is removed from the # names of the summaries when visualizing a model. TOWER_NAME = 'tower' def _activation_summary(x): """Helper to create summaries for activations. Creates a summary that provides a histogram of activations. Creates a summary that measures the sparsity of activations. Args: x: Tensor Returns: nothing """ # Remove 'tower_[0-9]/' from the name in case this is a multi-GPU training # session. This helps the clarity of presentation on tensorboard. tensor_name = re.sub('%s_[0-9]*/' % TOWER_NAME, '', x.op.name) tf.histogram_summary(tensor_name + '/activations', x) tf.scalar_summary(tensor_name + '/sparsity', tf.nn.zero_fraction(x)) def _variable_on_cpu(name, shape, initializer): """Helper to create a Variable stored on CPU memory. Args: name: name of the variable shape: list of ints initializer: initializer for Variable Returns: Variable Tensor """ with tf.device('/cpu:0'): dtype = tf.float16 if FLAGS.use_fp16 else tf.float32 var = tf.get_variable(name, shape, initializer=initializer, dtype=dtype) return var def _variable_with_weight_decay(name, shape, stddev, wd): """Helper to create an initialized Variable with weight decay. Note that the Variable is initialized with a truncated normal distribution. A weight decay is added only if one is specified. Args: name: name of the variable shape: list of ints stddev: standard deviation of a truncated Gaussian wd: add L2Loss weight decay multiplied by this float. If None, weight decay is not added for this Variable. Returns: Variable Tensor """ dtype = tf.float16 if FLAGS.use_fp16 else tf.float32 var = _variable_on_cpu( name, shape, tf.truncated_normal_initializer(stddev=stddev, dtype=dtype)) if wd is not None: weight_decay = tf.mul(tf.nn.l2_loss(var), wd, name='weight_loss') tf.add_to_collection('losses', weight_decay) return var def distorted_inputs(): """Construct distorted input for eye training using the Reader ops. Returns: images: Images. 4D tensor of [batch_size, IMAGE_SIZE, IMAGE_SIZE, 3] size. labels: Labels. 1D tensor of [batch_size] size. Raises: ValueError: If no data_dir """ if not FLAGS.data_dir: raise ValueError('Please supply a data_dir') images, labels = eye_input.distorted_inputs(FLAGS.data_dir, batch_size=FLAGS.batch_size) if FLAGS.use_fp16: images = tf.cast(images, tf.float16) labels = tf.cast(labels, tf.float16) return images, labels def inputs(eval_data): """Construct input for eye evaluation using the Reader ops. Args: eval_data: bool, indicating if one should use the train or eval data set. Returns: images: Images. 4D tensor of [batch_size, IMAGE_SIZE, IMAGE_SIZE, 3] size. labels: Labels. 1D tensor of [batch_size] size. Raises: ValueError: If no data_dir """ if not FLAGS.data_dir: raise ValueError('Please supply a data_dir') images, labels = eye_input.inputs(eval_data=eval_data, data_dir=FLAGS.data_dir, batch_size=FLAGS.batch_size) if FLAGS.use_fp16: images = tf.cast(images, tf.float16) labels = tf.cast(labels, tf.float16) return images, labels def inference(images): """Build the eye model. Args: images: Images returned from distorted_inputs() or inputs(). Returns: Logits. """ # We instantiate all variables using tf.get_variable() instead of # tf.Variable() in order to share variables across multiple GPU training runs. # If we only ran this model on a single GPU, we could simplify this function # by replacing all instances of tf.get_variable() with tf.Variable(). # # conv1 with tf.variable_scope('conv1') as scope: kernel = _variable_with_weight_decay('weights', shape=[5, 5, 3, 64], stddev=5e-2, wd=0.0) conv = tf.nn.conv2d(images, kernel, [1, 1, 1, 1], padding='SAME') biases = _variable_on_cpu('biases', [64], tf.constant_initializer(0.0)) bias = tf.nn.bias_add(conv, biases) conv1 = tf.nn.relu(bias, name=scope.name) _activation_summary(conv1) # pool1 pool1 = tf.nn.max_pool(conv1, ksize=[1, 3, 3, 1], strides=[1, 2, 2, 1], padding='SAME', name='pool1') # norm1 norm1 = tf.nn.lrn(pool1, 4, bias=1.0, alpha=0.001 / 9.0, beta=0.75, name='norm1') # conv2 with tf.variable_scope('conv2') as scope: kernel = _variable_with_weight_decay('weights', shape=[5, 5, 64, 64], stddev=5e-2, wd=0.0) conv = tf.nn.conv2d(norm1, kernel, [1, 1, 1, 1], padding='SAME') biases = _variable_on_cpu('biases', [64], tf.constant_initializer(0.1)) bias = tf.nn.bias_add(conv, biases) conv2 = tf.nn.relu(bias, name=scope.name) _activation_summary(conv2) # norm2 norm2 = tf.nn.lrn(conv2, 4, bias=1.0, alpha=0.001 / 9.0, beta=0.75, name='norm2') # pool2 pool2 = tf.nn.max_pool(norm2, ksize=[1, 3, 3, 1], strides=[1, 2, 2, 1], padding='SAME', name='pool2') # More conv and pooling # conv3 with tf.variable_scope('conv3') as scope: kernel = _variable_with_weight_decay('weights', shape=[5, 5, 64, 64], stddev=5e-2, wd=0.0) conv = tf.nn.conv2d(pool2, kernel, [1, 1, 1, 1], padding='SAME') biases = _variable_on_cpu('biases', [64], tf.constant_initializer(0.0)) bias = tf.nn.bias_add(conv, biases) conv3 = tf.nn.relu(bias, name=scope.name) _activation_summary(conv3) # pool1 pool3 = tf.nn.max_pool(conv3, ksize=[1, 3, 3, 1], strides=[1, 2, 2, 1], padding='SAME', name='pool3') # norm3 norm3 = tf.nn.lrn(pool3, 4, bias=1.0, alpha=0.001 / 9.0, beta=0.75, name='norm3') # conv4 with tf.variable_scope('conv4') as scope: kernel = _variable_with_weight_decay('weights', shape=[5, 5, 64, 128], stddev=5e-2, wd=0.0) conv = tf.nn.conv2d(norm3, kernel, [1, 1, 1, 1], padding='SAME') biases = _variable_on_cpu('biases', [128], tf.constant_initializer(0.1)) bias = tf.nn.bias_add(conv, biases) conv4 = tf.nn.relu(bias, name=scope.name) _activation_summary(conv4) # norm4 norm4 = tf.nn.lrn(conv4, 4, bias=1.0, alpha=0.001 / 9.0, beta=0.75, name='norm4') # pool4 pool4 = tf.nn.max_pool(norm4, ksize=[1, 3, 3, 1], strides=[1, 2, 2, 1], padding='SAME', name='pool4') ### # local5 with tf.variable_scope('local5') as scope: # Move everything into depth so we can perform a single matrix multiply. reshape = tf.reshape(pool4, [FLAGS.batch_size, -1]) dim = reshape.get_shape()[1].value weights = _variable_with_weight_decay('weights', shape=[dim, 384], stddev=0.04, wd=0.004) biases = _variable_on_cpu('biases', [384], tf.constant_initializer(0.1)) local5 = tf.nn.relu(tf.matmul(reshape, weights) + biases, name=scope.name) _activation_summary(local5) # local6 with tf.variable_scope('local6') as scope: weights = _variable_with_weight_decay('weights', shape=[384, 192], stddev=0.04, wd=0.004) biases = _variable_on_cpu('biases', [192], tf.constant_initializer(0.1)) local6 = tf.nn.relu(tf.matmul(local5, weights) + biases, name=scope.name) _activation_summary(local6) # softmax, i.e. softmax(WX + b) with tf.variable_scope('softmax_linear') as scope: weights = _variable_with_weight_decay('weights', [192, NUM_CLASSES], stddev=1 / 192.0, wd=0.0) biases = _variable_on_cpu('biases', [NUM_CLASSES], tf.constant_initializer(0.0)) softmax_linear = tf.add(tf.matmul(local6, weights), biases, name=scope.name) _activation_summary(softmax_linear) return softmax_linear def loss(logits, labels): """Add L2Loss to all the trainable variables. Add summary for "Loss" and "Loss/avg". Args: logits: Logits from inference(). labels: Labels from distorted_inputs or inputs(). 1-D tensor of shape [batch_size] Returns: Loss tensor of type float. """ # Calculate the average cross entropy loss across the batch. labels = tf.cast(labels, tf.int64) cross_entropy = tf.nn.sparse_softmax_cross_entropy_with_logits( logits, labels, name='cross_entropy_per_example') cross_entropy_mean = tf.reduce_mean(cross_entropy, name='cross_entropy') tf.add_to_collection('losses', cross_entropy_mean) # The total loss is defined as the cross entropy loss plus all of the weight # decay terms (L2 loss). return tf.add_n(tf.get_collection('losses'), name='total_loss') def _add_loss_summaries(total_loss): """Add summaries for losses in eye model. Generates moving average for all losses and associated summaries for visualizing the performance of the network. Args: total_loss: Total loss from loss(). Returns: loss_averages_op: op for generating moving averages of losses. """ # Compute the moving average of all individual losses and the total loss. loss_averages = tf.train.ExponentialMovingAverage(0.9, name='avg') losses = tf.get_collection('losses') loss_averages_op = loss_averages.apply(losses + [total_loss]) # Attach a scalar summary to all individual losses and the total loss; do the # same for the averaged version of the losses. for l in losses + [total_loss]: # Name each loss as '(raw)' and name the moving average version of the loss # as the original loss name. tf.scalar_summary(l.op.name + ' (raw)', l) tf.scalar_summary(l.op.name, loss_averages.average(l)) return loss_averages_op def train(total_loss, global_step): """Train eye model. Create an optimizer and apply to all trainable variables. Add moving average for all trainable variables. Args: total_loss: Total loss from loss(). global_step: Integer Variable counting the number of training steps processed. Returns: train_op: op for training. """ # Variables that affect learning rate. num_batches_per_epoch = NUM_EXAMPLES_PER_EPOCH_FOR_TRAIN / FLAGS.batch_size decay_steps = int(num_batches_per_epoch * NUM_EPOCHS_PER_DECAY) # Decay the learning rate exponentially based on the number of steps. lr = tf.train.exponential_decay(INITIAL_LEARNING_RATE, global_step, decay_steps, LEARNING_RATE_DECAY_FACTOR, staircase=True) tf.scalar_summary('learning_rate', lr) # Generate moving averages of all losses and associated summaries. loss_averages_op = _add_loss_summaries(total_loss) # Compute gradients. with tf.control_dependencies([loss_averages_op]): opt = tf.train.GradientDescentOptimizer(lr) grads = opt.compute_gradients(total_loss) # Apply gradients. apply_gradient_op = opt.apply_gradients(grads, global_step=global_step) # Add histograms for trainable variables. for var in tf.trainable_variables(): tf.histogram_summary(var.op.name, var) # Add histograms for gradients. for grad, var in grads: if grad is not None: tf.histogram_summary(var.op.name + '/gradients', grad) # Track the moving averages of all trainable variables. variable_averages = tf.train.ExponentialMovingAverage( MOVING_AVERAGE_DECAY, global_step) variables_averages_op = variable_averages.apply(tf.trainable_variables()) with tf.control_dependencies([apply_gradient_op, variables_averages_op]): train_op = tf.no_op(name='train') return train_op
#---------------------------------------------------------------------- # Copyright (c) 2013-2016 Raytheon BBN Technologies # # Permission is hereby granted, free of charge, to any person obtaining # a copy of this software and/or hardware specification (the "Work") to # deal in the Work without restriction, including without limitation the # rights to use, copy, modify, merge, publish, distribute, sublicense, # and/or sell copies of the Work, and to permit persons to whom the Work # is furnished to do so, subject to the following conditions: # # The above copyright notice and this permission notice shall be # included in all copies or substantial portions of the Work. # # THE WORK IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS # OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF # MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND # NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT # HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, # WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE WORK OR THE USE OR OTHER DEALINGS # IN THE WORK. #---------------------------------------------------------------------- # Routine to check the health of a gram rack # 1. Are the essential openstack services up? [keystone, nova, quntum, glance]? # 2. Are the compute nodes up? # 3. Is gram up? # 4. Can we allocate/release a VM with gram? # Eventually this output should report to NAGIOS or some # other health-check system. For now it prints a report periodically import config import platform import subprocess import time import netaddr import logging import fileinput import sys import os import random import open_stack_interface as osi GRAM_HEALTHCHECK_INTERVAL = 600 # Every 10 minutes def get_keystone_status(): success = False try: command = "keystone tenant-list" tenants = osi._execCommand(command) success = True except: pass return success def get_nova_status(): success = False try: hosts = osi._listHosts('compute') success = True except: pass return success def get_glance_status(): success = False try: images = osi._listImages() success = True except: pass return success def get_network_status(): success = False net_node_addr = config.network_host_addr try: command = '%s net-list' % config.network_type output = osi._execCommand(command) success = True except: pass return success def compute_host_ping_status(host): ret = subprocess.call("ping -c 1 %s" % host, \ shell=True, \ stdout=open('/dev/null', 'w'), \ stderr=subprocess.STDOUT); # print "RET(%s) = %s" % (host, ret) return ret == 0 def get_host_status(): compute_hosts = osi._listHosts('compute').keys() # print "HOSTS = " + str(compute_hosts) status = {} cmd = "nova-manage service list" ret = subprocess.check_output(cmd, shell=True) lines = ret.split('\n'); for host in compute_hosts: found = 0 for line in lines: if line.find(host): if line.find(':-)'): status[host] = ':-)' found = 0 continue else: status[host] = 'xxx' if found == 0: status[host] = 'xxx' #status[host] = compute_host_ping_status(host) return status def get_compute_status(): print "Checking the status of the compute hosts: \n" cmd = "nova-manage service list" ret = subprocess.check_output(cmd, shell=True) lines = ret.split('\n'); print lines[0] for line in lines: if not line.find('nova-compute') < 0: if not line.find('xxx') < 0: print 'WARNING: compute host is down or not properly configured: \n' print line print "\n" def get_network_agent_status(): net_node_addr = config.network_host_addr cmd = '%s agent-list' % config.network_type print "Checking status of Openstack networking software modules: \n" ret = subprocess.check_output(cmd, shell=True) lines = ret.split('\n'); print lines[0] for line in lines: if not line.find('xxx') < 0: print 'WARNING: the followng agent is down or not properly configured (ignore if it is a duplicate entry): \n' print line print "\n" def compute_gram_port(): cmd = "grep port= /home/gram/.gcf/gcf_config" ret = subprocess.check_output(cmd, shell=True) # print "RET = " + str(ret) + " " + str(type(str(ret))) lines = ret.split('\n'); # print "LINES = " + str(lines) + " " + str(len(lines)) line = lines[len(lines)-2] # print "LINE = " + str(line) parts = line.split('=') gram_port = int(parts[1]) gram_port = 5001 return gram_port def compute_am_status(hostname): gram_port = compute_gram_port() # print "GP = " + str(gram_port) cmd = "/opt/gcf/src/omni.py -V3 -a https://%s:%d getversion" % (hostname, gram_port) ret = subprocess.check_output(cmd, \ shell=True, \ stderr=subprocess.STDOUT) # print "RET = " + str(ret) return ret.find('Failed') < 0 def compute_gram_status(hostname): gram_port = compute_gram_port() slice_name = "DUMMY" + str(random.randint(1,100000)) rspec_name = "/tmp/dummy.rspec" f = open(rspec_name, 'w') f.write('<rspec type="request" xmlns="http://www.geni.net/resources/rspec/3" \ xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" \ xsi:schemaLocation="http://www.geni.net/resources/rspec/3 \ http://www.geni.net/resources/rspec/3/request.xsd"><node client_id="foo"/></rspec>\n'); f.close() create_tmpl = "/opt/gcf/src/omni.py -V3 -a https://%s:%d createslice %s %s" create_cmd = create_tmpl % (hostname, gram_port, slice_name, rspec_name) #print "Creating slice: " + create_cmd ret = subprocess.check_output(create_cmd, shell=True, stderr=subprocess.STDOUT) create_tmpl = "/opt/gcf/src/omni.py -V3 -a https://%s:%d allocate %s %s" create_cmd = create_tmpl % (hostname, gram_port, slice_name, rspec_name) #print "Allocating: " + create_cmd ret = subprocess.check_output(create_cmd, shell=True, stderr=subprocess.STDOUT) # print "RET = " + ret create_success = ret.find('Allocated slivers') >= 0 if create_success: print "Allocate - success" else: print "Allocate - failure" print ret provision_tmpl = "/opt/gcf/src/omni.py -V3 -a https://%s:%d provision %s" provision_cmd = provision_tmpl % (hostname, gram_port, slice_name) #print "Provisioning slice: " + create_cmd ret = subprocess.check_output(provision_cmd, shell=True, stderr=subprocess.STDOUT) # print "RET = " + ret provision_success = ret.find('Provisioned slivers') >= 0 if provision_success: print "Provision - success" else: print "Provision - failure" print ret delete_tmpl = "/opt/gcf/src/omni.py -V3 -a https://%s:%d delete %s" delete_cmd = delete_tmpl % (hostname, gram_port, slice_name) #print "Deleting slice: " + delete_cmd ret = subprocess.check_output(delete_cmd, shell=True, stderr=subprocess.STDOUT) # print "RET = " + ret delete_success = ret.find('Result Summary: Deleted') >= 0 if delete_success: print 'Delete - success' else: print 'Delete - failure' return create_success and provision_success and delete_success def _getMgmtNamespace() : """ Looks at the namespaces on the machine and finds one that has the management network and the external network: """ mgmt_addr = (netaddr.IPNetwork(config.management_network_cidr)).broadcast public_addr = config.public_subnet_start_ip net_node_addr = config.network_host_addr ssh_prefix = 'ssh gram@' + net_node_addr + ' sudo ' # get a list of the namespaces if config.openstack_type == 'grizzly': command = 'ip netns list' else: command = ssh_prefix + 'ip netns list' print "Checking for management namespace.\n" output = osi._execCommand(command) output_lines = output.split('\n') # check for both public and mgmt address in each namespace has_mgmt = 0 has_public = 0 for line in output_lines: if not line: return None try: if config.openstack_type == 'grizzly': command = 'ip netns exec ' + line + ' ifconfig' else: command = ssh_prefix + 'ip netns exec ' + line + ' ifconfig' print "Checking through ifconfig return.\n" ifconfig = osi._execCommand(command) except subprocess.CalledProcessError as e: continue ifconfig_lines = ifconfig.split('\n') for ifconfig_line in ifconfig_lines: if str(mgmt_addr) in ifconfig_line: has_mgmt = 1 if public_addr in ifconfig_line: has_public = 1 if has_mgmt and has_public: return line else: has_mgmt = 0 has_public = 0 return None def _setField(field,value): for line in fileinput.input('/etc/gram/config.json', inplace=1): if field in line: if field == 'mgmt_ns': line = line.replace(line,' "' + field + '": "' + value + '"\n' ) else: line = line.replace(line,' "' + field + '": "' + value + '",\n' ) sys.stdout.write(line) def check_mgmt_ns(recreate=False): mgmt_ns = _getMgmtNamespace() conf_mgmt_ns = config.mgmt_ns mgmt_net_name = config.management_network_name mgmt_net_cidr = config.management_network_cidr mgmt_net_vlan = config.management_network_vlan public_subnet_start_ip = config.public_subnet_start_ip public_subnet_end_ip = config.public_subnet_end_ip public_gateway_ip = config.public_gateway_ip public_subnet_cidr = config.public_subnet_cidr net_node_addr = config.network_host_addr network_conf = "/etc/%s/l3_agent.ini" % config.network_type if not mgmt_ns or recreate: print "WARNING: Management namespace NOT found" if config.network_type == 'quantum': nscmd = 'sudo quantum-l3-agent restart' else: nscmd = 'ssh gram@' + net_node_addr + \ ' sudo service neutron-l3-agent restart' for x in range(0,10): print "Restarting L3 service to attempt to recover the namespace - attempt " + str(x) osi._execCommand(nscmd) time.sleep(20) mgmt_ns = _getMgmtNamespace() if mgmt_ns: break if not mgmt_ns: print "WARNING: Unable to recover management namespace" input_var = raw_input("Do you wish to recreate the management network? [y/N]: ") if input_var == 'y': input_var = raw_input("You must delete 'externalRouter' (router),'public' (network) and " + mgmt_net_name + " (network). Using the Horizon interface is recommended. Have you done this and are ready to proceed? [y/N] ") if input_var == 'y': cmd = ("%s net-create " + mgmt_net_name + " --provider:network_type vlan --provider:physical_network physnet2 --provider:segmentation_id " + mgmt_net_vlan + " --shared") % config.network_type osi._execCommand(cmd) cmd = ("%s subnet-create " + mgmt_net_name + " " + mgmt_net_cidr) % config.network_type output = osi._execCommand(cmd) MGMT_SUBNET_ID = osi._getValueByPropertyName(output, 'id') cmd = ("%s net-create public --router:external=True") % config.network_type output = osi._execCommand(cmd) PUBLIC_NET_ID = osi._getValueByPropertyName(output, 'id') cmd = ("%s subnet-create --allocation_pool" + \ " start=" + public_subnet_start_ip + \ ",end=" + public_subnet_end_ip + \ " --gateway=" + public_gateway_ip + \ " " + str(PUBLIC_NET_ID) + " " + public_subnet_cidr + \ " -- --enable_dhcp=False") % config.network_type output = osi._execCommand(cmd) cmd = ("%s router-create externalRouter") % config.network_type output = osi._execCommand(cmd) EXTERNAL_ROUTER_ID = osi._getValueByPropertyName(output, 'id') cmd = ("%s router-gateway-set externalRouter " + PUBLIC_NET_ID) % config.network_type output = osi._execCommand(cmd) cmd = ("%s router-interface-add externalRouter " + MGMT_SUBNET_ID) % config.network_type output = osi._execCommand(cmd) if config.openstack_type == "juno": print "Sending public net id to the network node.\n" cmd = "ssh gram@" + net_node_addr + " echo " + PUBLIC_NET_ID + " > /home/gram/neutron_public_net" output = osi._execCommand(cmd) print "Sending external router id to the network node.\n" cmd = "ssh gram@" + net_node_addr + " echo " + EXTERNAL_ROUTER_ID + " > /home/gram/neutron_ext_router" output = osi._execCommand(cmd) print "Rewriting network node neutron l3 agent config files.\n" cmd = "ssh gram@" + net_node_addr + " sudo /home/gram/gram/juno/install/network_files/synch_control_network.sh" osi._execCommand(cmd) else: osi._execCommand("service neutron-l3-agent restart") mgmt_ns = _getMgmtNamespace() if mgmt_ns: if conf_mgmt_ns and conf_mgmt_ns == mgmt_ns: print "Found management namespace and it matches config" elif conf_mgmt_ns: print "WARNING: Found management namespace but it does not match config" print "Rewriting config value" _setField('mgmt_ns',mgmt_ns) osi._execCommand("service gram-am restart") def check_openstack_services(): print 'checking OpenStack services...' if config.openstack_type == "juno": services = ['nova-api','nova-cert','nova-conductor','nova-consoleauth ','nova-novncproxy','nova-scheduler', 'neutron-server', 'glance-registry','glance-api','keystone'] remote_services = ['neutron-dhcp-agent','neutron-metadata-agent', 'neutron-l3-agent','neutron-plugin-openvswitch-agent'] else: services = ['nova-api','nova-cert','nova-conductor','nova-consoleauth ','nova-novncproxy','nova-scheduler', 'glance-registry','glance-api','keystone', 'quantum-dhcp-agent','quantum-metadata-agent','quantum-server','quantum-l3-agent','quantum-plugin-openvswitch-agent'] remote_services = [] for service in services: cmd = 'service ' + service + ' status' result = osi._execCommand(cmd) if not result.find('stop') < 0: print 'Warning: the following service is not running, will attempt to restart it - ' + service cmd = 'service ' + service + ' restart' osi._execCommand(cmd) cmd = 'service ' + service + ' status' result = osi._execCommand(cmd) if result.find('stop'): print 'Error: the following service is still not running, check logs in /var/logs' else: print service + ' - running' net_node_addr = osi._getConfigParam('/etc/gram/config.json','network_host_addr') for service in remote_services: print 'Network node status for ' + service + '\n' cmd = 'ssh gram@' + net_node_addr + ' service ' + service + ' status' result = osi._execCommand(cmd) if not result.find('stop') < 0: print 'Warning: the following service is not running, will attempt to restart it - ' + service cmd = 'ssh gram@' + net_node_addr + ' service ' + service + ' restart' cmd = 'service ' + service + ' restart' osi._execCommand(cmd) print 'Checking status\n' cmd = 'ssh gram@' + net_node_addr + ' service ' + service + ' status' result = osi._execCommand(cmd) if result.find('stop'): print 'Error: the following service is still not running, check logs in /var/logs' else: print service + ' - running' def check_gram_services(): print 'Checking GRAM services...' services = ['gram-am','gram-ctrl','gram-vmoc','gram-ch'] for service in services: cmd = 'service ' + service + ' status' result = osi._execCommand(cmd) if not result.find('stop') < 0: print 'Warning: the following service is not running, will attempt to restart it - ' + service cmd = 'service ' + service + ' restart' osi._execCommand(cmd) cmd = 'service ' + service + ' status' result = osi._execCommand(cmd) if result.find('stop'): print 'Error: the following service is still not running - ' + service + '\nCheck logs in /var/logs/upstart/' else: print service + ' - running' def perform_gram_healthcheck(): print "Starting healthcheck" check_gram_services() check_openstack_services() check_mgmt_ns() platform_info = platform.uname() hostname = platform_info[1] get_compute_status() get_network_agent_status() keystone_status = get_keystone_status() if keystone_status: print "Keystone - pass" else: print "Keystone - fail" nova_status = get_nova_status() if nova_status: print "Nova - pass" else: print "Nova - fail" glance_status = get_glance_status() if glance_status: print "Glance - pass" else: print "Glance - fail" network_status = get_network_status() if network_status: print "Network - pass" else: print "Network - fail" #host_status = {} #if nova_status: # host_status = get_host_status() # for state in host_status: # if not host_status[state]: # print "Host " + state + " is not reachable by ping" # else: # print "Host " + state + " is reachable by ping" am_status = compute_am_status(hostname) if am_status: print "AM is up : Get-Version succeeded at AM" else: print "AM is down : Get-Version failed at AM" gram_status = compute_gram_status(hostname) if gram_status: print "AM is functioning" # TTD # Create and delete a sliver # Log it to a log file # Turn this into a service that logs to a log file #template = \ #"GRAM Healthcheck %s: KEY %s NOVA %s GLN %s" + \ # " QNTM %s HOST %s AM %s GRAM %s" #print template % \ # (hostname, keystone_status, nova_status, \ # glance_status, neutron_status, str(host_status), \ # am_status, gram_status) if __name__ == "__main__": config.initialize('/etc/gram/config.json') logging.basicConfig() if len(sys.argv) > 1: if sys.argv[1] == 'recreate': check_mgmt_ns(True) perform_gram_healthcheck() #check_mgmt_ns(True) #time.sleep(GRAM_HEALTHCHECK_INTERVAL)
#! /usr/bin/env python # File Docstring """Chapter: Game This is where the actual meat of the game takes place.""" # Import Modules import __init__ import sys import random import pygame from pygame.locals import * # Import Game Data from DIR_sprite.DAT_token import SPT_token from DIR_sprite.DAT_spotselector import SPT_spotselector from DIR_audio.DAT_loadaudio import * # Chapter Class class CHP_game: """The game chapter.""" def __init__(self, param): """Initialize.""" # Token Count self.TokenPool = ['red', 'red', 'red', 'red', 'red', 'red', 'red', 'red', 'red', 'red', 'red', 'red', 'orange', 'orange', 'orange', 'orange', 'orange', 'orange', 'orange', 'orange', 'orange', 'orange', 'orange', 'yellow', 'yellow', 'yellow', 'yellow', 'yellow', 'yellow', 'yellow', 'yellow', 'yellow', 'yellow', 'green', 'green', 'green', 'green', 'green', 'green', 'green', 'green', 'green', 'blue', 'blue', 'blue', 'blue', 'blue', 'blue', 'blue', 'blue', 'purple', 'purple', 'purple', 'purple', 'purple', 'purple', 'purple'] if param[0] == 0: pass elif param[0] > 0: self.TokenPool.append('cyan') self.TokenPool.append('cyan') self.TokenPool.append('cyan') self.TokenPool.append('cyan') self.TokenPool.append('cyan') self.TokenPool.append('cyan') if param[0] > 1: self.TokenPool.append('magenta') self.TokenPool.append('magenta') self.TokenPool.append('magenta') self.TokenPool.append('magenta') self.TokenPool.append('magenta') if param[0] > 2: self.TokenPool.append('brown') self.TokenPool.append('brown') self.TokenPool.append('brown') self.TokenPool.append('brown') if param[0] > 3: self.TokenPool.append('gray') self.TokenPool.append('gray') self.TokenPool.append('gray') # Special Tokens if param[1] == 0: pass elif param[1] == 1: self.TokenPool.append('black') self.TokenPool.append('black') elif param[1] == 2: self.TokenPool.append('white') elif param[1] == 3: self.TokenPool.append('black') self.TokenPool.append('black') self.TokenPool.append('white') # Timer self.Timer = (param[2] + 3) # Random Drop Count self.RDC = param[3] + 1 # Height self.Height = param[4] * 2 # Music if param[5] == 0: self.Music = False elif param[5] == 1: self.Music = MUS_Brix = Load_Music('MUS_Brix.ogg') elif param[5] == 2: self.Music = MUS_Blox = Load_Music('MUS_Blox.ogg') else: pass def Start(self, screen, constant): """Start the chapter.""" # Prepare any data before running the loop. pygame.event.get() # Purge the Input Queue. random.seed() random.shuffle(self.TokenPool) if self.Music != False: pygame.mixer.music.play(-1) elif self.Music == False: pygame.mixer.music.stop() CLEARING = False PAUSED = False GAME_OVER = False ROUND_CLEAR = False BLACK_CLEAR = None WHITE_CLEAR = False SCORE = 0 HISCORE = constant['HighScore'] TIMER = self.Timer DELAY = 60 ROUNDS = 0 # PAUSE SCREEN PauseScreen = pygame.Surface(screen.RECT.size).convert() PauseScreen.fill((0, 0, 0)) RCT_PauseScreen = PauseScreen.get_rect() # Pause Font PauseFont = constant['BigFont'].render("P A U S E", True, (255, 255, 255)) RCT_PauseFont = PauseFont.get_rect() RCT_PauseFont.center = RCT_PauseScreen.center PauseScreen.blit(PauseFont, RCT_PauseFont.topleft) # Return to the game ReturnInfo = constant['Font'].render("Press ESC to unpause.", True, (255, 255, 255)) RCT_ReturnInfo = ReturnInfo.get_rect() RCT_ReturnInfo.midtop = RCT_PauseFont.midbottom PauseScreen.blit(ReturnInfo, RCT_ReturnInfo.topleft) # Exit the game ExitInfo = constant['Font'].render("Press SPACE or ENTER to quit this round.", True, (255, 255, 255)) RCT_ExitInfo = ExitInfo.get_rect() RCT_ExitInfo.midtop = RCT_ReturnInfo.midbottom PauseScreen.blit(ExitInfo, RCT_ExitInfo.topleft) # GAME OVER SCREEN GameOver = constant['BigFont'].render("GAME OVER", True, (255, 255, 255), (0, 0, 0)) RCT_GameOver = GameOver.get_rect() RCT_GameOver.center = screen.RECT.center # ROUND CLEAR SCREEN RoundClear = constant['BigFont'].render("ROUND CLEAR", True, (255, 255, 255), (0, 0, 0)) RCT_RoundClear = RoundClear.get_rect() RCT_RoundClear.center = screen.RECT.center # Background bg = pygame.Surface(screen.RECT.size).convert() bg.fill((random.randrange(100,201), random.randrange(100, 201), random.randrange(100, 201))) # Token Container TokenContainer = constant['Spritesheet'].Apply_Graphic((602, 1, 280, 480)) RCT_TokenContainer = TokenContainer.get_rect() RCT_TokenContainer.center = screen.RECT.center bg.blit(TokenContainer, RCT_TokenContainer.topleft) VisualGrid = pygame.Rect(0, 0, 200, 440) VisualGrid.midtop = RCT_TokenContainer.midtop # Score CPT_Score = constant['BigFont'].render("SCORE:", True, (255, 255, 255)) RCT_CPT_Score = CPT_Score.get_rect() RCT_CPT_Score.topleft = RCT_TokenContainer.topright bg.blit(CPT_Score, RCT_CPT_Score.topleft) Score = constant['BigFont'].render('%s' % SCORE, True, (0, 255, 0), (0, 0, 0)) RCT_Score = Score.get_rect() RCT_Score.topleft = RCT_CPT_Score.bottomleft # High Score CPT_HiScore = constant['BigFont'].render("HIGH SCORE:", True, (255, 255, 255)) RCT_CPT_HiScore = CPT_HiScore.get_rect() RCT_CPT_HiScore.topleft = RCT_Score.bottomleft bg.blit(CPT_HiScore, RCT_CPT_HiScore.topleft) HiScore = constant['BigFont'].render('%s' % HISCORE, True, (255, 0, 0), (0, 0, 0)) RCT_HiScore = Score.get_rect() RCT_HiScore.topleft = RCT_CPT_HiScore.bottomleft # Timer CPT_Timer = constant['BigFont'].render("TIME:", True, (255, 255, 255)) RCT_CPT_Timer = CPT_Timer.get_rect() RCT_CPT_Timer.topleft = RCT_HiScore.bottomleft bg.blit(CPT_Timer, RCT_CPT_Timer.topleft) Timer = constant['BigFont'].render('0', True, (255, 255, 0), (0, 0, 0)) RCT_Timer = Timer.get_rect() RCT_Timer.topleft = RCT_CPT_Timer.bottomleft # Next Token CPT_NextToken = constant['BigFont'].render("NEXT:", True, (255, 255, 255)) RCT_CPT_NextToken = CPT_NextToken.get_rect() RCT_CPT_NextToken.topleft = RCT_Timer.bottomleft bg.blit(CPT_NextToken, RCT_CPT_NextToken.topleft) NT_Container = pygame.Rect(0, 0, 40, 40) NT_Container.midtop = RCT_CPT_NextToken.bottomright # Current Token CPT_CurrentToken = constant['BigFont'].render("CURRENT:", True, (255, 255, 255)) RCT_CPT_CurrentToken = CPT_CurrentToken.get_rect() RCT_CPT_CurrentToken.midtop = NT_Container.midbottom RCT_CPT_CurrentToken.left = RCT_CPT_NextToken.left bg.blit(CPT_CurrentToken, RCT_CPT_CurrentToken.topleft) CT_Container = pygame.Rect(0, 0, 40, 40) CT_Container.midtop = RCT_CPT_CurrentToken.bottomright CT_Container.centerx = NT_Container.centerx # RDC CPT_RDC = constant['BigFont'].render("Random Drop:", True, (255, 255, 255)) RCT_CPT_RDC = CPT_RDC.get_rect() RCT_CPT_RDC.topright = RCT_TokenContainer.topleft bg.blit(CPT_RDC, RCT_CPT_RDC.topleft) RDC = constant['BigFont'].render('%s' % self.RDC, True, (255, 255, 255)) RCT_RDC = RDC.get_rect() RCT_RDC.midtop = RCT_CPT_RDC.midbottom bg.blit(RDC, RCT_RDC.topleft) # Rounds CPT_Rounds = constant['BigFont'].render("Rounds:", True, (255, 255, 255)) RCT_CPT_Rounds = CPT_Rounds.get_rect() RCT_CPT_Rounds.left = RCT_CPT_RDC.left RCT_CPT_Rounds.top = RCT_RDC.bottom bg.blit(CPT_Rounds, RCT_CPT_Rounds.topleft) Rounds = constant['BigFont'].render('%s' % ROUNDS, True, (255, 255, 255)) RCT_Rounds = Rounds.get_rect() RCT_Rounds.topleft = RCT_CPT_Rounds.bottomleft RCT_Rounds.centerx = RCT_RDC.centerx # Spot Selector SS = SPT_spotselector(constant['Spritesheet']) SpotChoice = [] for _ in range(0, 5): SpotChoice.append(pygame.Rect(0, 0, 40, 40)) SpotChoice[0].bottomleft = VisualGrid.bottomleft for _ in range(1,5): SpotChoice[_].bottomleft = SpotChoice[_-1].bottomright SpotSelector = pygame.sprite.RenderUpdates() SpotSelector.add(SS) Spot = 2 # Data Grid DataGrid = [[], [], [], [], []] AllTokens = pygame.sprite.RenderUpdates() # Add tokens to... for column in DataGrid: # Data Grid for heightcount in range(0, self.Height): newtoken = SPT_token(constant['Spritesheet'], random.choice(self.TokenPool)) column.append(newtoken) for _ in column: # Group AllTokens.add(_) # Apply the tokens to the Visual Grid. for colcount in range(0, 5): DataGrid[colcount][0].RECT.center = SpotChoice[colcount].center for nextcount in range(1, self.Height): DataGrid[colcount][nextcount].RECT.midbottom = \ DataGrid[colcount][nextcount-1].RECT.midtop # Prepare for action... NextToken = random.choice(self.TokenPool) CurrentToken = random.choice(self.TokenPool) Ready = constant['BigFont'].render("R E A D Y", True, (255, 255, 255), (255, 0, 0)) RCT_Ready = Ready.get_rect() RCT_Ready.center = screen.RECT.center screen.FRAME.blit(bg, (0, 0)) screen.FRAME.blit(Ready, RCT_Ready.topleft) screen.Update() pygame.time.wait(1000) SFC_NextToken = constant['Spritesheet'].\ Apply_Graphic(SPT_token.DIC_color[NextToken][1]) SFC_CurrentToken = constant['Spritesheet'].\ Apply_Graphic(SPT_token.DIC_color[CurrentToken][1]) # Sound Effects SND_GameOver = Load_Sound('SND_GameOver.ogg') ; SND_GameOver_Flag = False SND_Pause = Load_Sound('SND_Pause.ogg') SND_SpotSelect = Load_Sound('SND_SpotSelect.ogg') SND_SpotRotate = Load_Sound('SND_SpotRotate.ogg') SND_Place = Load_Sound('SND_Place.ogg') SND_NoPlace = Load_Sound('SND_NoPlace.ogg') SND_Clear = Load_Sound('SND_Clear.ogg') ; SND_Clear_Flag = False SND_RoundClear = Load_Sound('SND_RoundClear.ogg') ; SND_RoundClear_Flag = False SND_RandomDrop = Load_Sound('SND_RandomDrop.ogg') # Main Loop LS = True # Loop Switch while LS: constant['Clock'].tick(60) # Clock 60 Frames Per Second # In the event of a token-placing bug, remove any token higher than 11... for column in DataGrid: if len(column) > 11: ExtraTokens = column[11:] del column[11:] for _ in ExtraTokens: _.kill() # Check the grid for clear columns. FullGrid = [None, None, None, None, None] for colcount in range(5): if len(DataGrid[colcount]) == 11: FullGrid[colcount] = True elif len(DataGrid[colcount]) > 0 and len(DataGrid[colcount]) < 11: FullGrid[colcount] = False elif len(DataGrid[colcount]) == 0: FullGrid[colcount] = 'CLEAR' if FullGrid == [True, True, True, True, True]: # If the entire grid is full... GAME_OVER = True elif 'CLEAR' in FullGrid: # If at least one stack is cleared... ROUND_CLEAR = True # Random Drop Count if TIMER == 0 and DELAY == 60 and GAME_OVER == False: SND_RandomDrop.play() RemainingSpace = 0 # For every column in the data grid... for column in DataGrid: RemainingSpace += (11 - len(column)) TokenDrops = 0 if RemainingSpace > self.RDC: TokenDrops = self.RDC elif RemainingSpace <= self.RDC: TokenDrops = RemainingSpace for _ in range(TokenDrops): StackCheck = True while StackCheck == True: RandomSpot = random.choice(DataGrid) if len(RandomSpot) == 11: pass else: StackCheck = False RandomToken = SPT_token(constant['Spritesheet'], random.choice(self.TokenPool)) RandomSpot.append(RandomToken) AllTokens.add(RandomSpot[-1]) # Black Clear if BLACK_CLEAR: for col in DataGrid: for token in col: if token.IDEN == BLACK_CLEAR: token.CLEAR = True BLACK_CLEAR = None # White Clear if WHITE_CLEAR == True: for col in DataGrid: for token in col[2:]: token.CLEAR = True WHITE_CLEAR = False # Game Over if GAME_OVER == True and CLEARING == False: # If the game is over... if SND_GameOver_Flag == True: pass elif SND_GameOver_Flag == False: pygame.mixer.music.stop() SND_GameOver.play() SND_GameOver_Flag = True for EVT in pygame.event.get(): if EVT.type == QUIT: # Hard Exit pygame.quit() sys.exit() elif EVT.type == KEYDOWN: if EVT.key == K_ESCAPE or \ EVT.key == K_RETURN or \ EVT.key == K_SPACE: constant['HighScore'] = HISCORE LS = False else: pass screen.FRAME.blit(GameOver, RCT_GameOver.topleft) elif ROUND_CLEAR == True: # If one stack has been cleared... if SND_RoundClear_Flag == True: pass elif SND_RoundClear_Flag == False: pygame.mixer.music.stop() SND_RoundClear.play() SND_RoundClear_Flag = True for EVT in pygame.event.get(): if EVT.type == QUIT: # Hard Exit pygame.quit() sys.exit() elif EVT.type == KEYDOWN: if EVT.key == K_ESCAPE: constant['HighScore'] = HISCORE LS = False elif EVT.key == K_RETURN or \ EVT.key == K_SPACE: constant['HighScore'] = HISCORE ROUND_CLEAR = False SND_RoundClear_Flag = False if self.Music != False: pygame.mixer.music.play(-1) # Reset All ROUNDS += 1 TIMER = self.Timer DataGrid = [[], [], [], [], []] AllTokens = pygame.sprite.RenderUpdates() # Reset BG bg.fill((random.randrange(100,201), random.randrange(100, 201), random.randrange(100, 201))) bg.blit(TokenContainer, RCT_TokenContainer.topleft) bg.blit(CPT_Score, RCT_CPT_Score.topleft) bg.blit(CPT_HiScore, RCT_CPT_HiScore.topleft) bg.blit(CPT_Timer, RCT_CPT_Timer.topleft) bg.blit(CPT_NextToken, RCT_CPT_NextToken.topleft) bg.blit(CPT_CurrentToken, RCT_CPT_CurrentToken.topleft) bg.blit(CPT_RDC, RCT_CPT_RDC.topleft) bg.blit(RDC, RCT_RDC.topleft) bg.blit(CPT_Rounds, RCT_CPT_Rounds.topleft) # Add tokens to... for column in DataGrid: # Data Grid for heightcount in range(0, self.Height): newtoken = SPT_token(constant['Spritesheet'], random.choice(self.TokenPool)) column.append(newtoken) for _ in column: # Group AllTokens.add(_) # Apply the tokens to the Visual Grid. for colcount in range(0, 5): DataGrid[colcount][0].RECT.center = SpotChoice[colcount].center for nextcount in range(1, self.Height): DataGrid[colcount][nextcount].RECT.midbottom = \ DataGrid[colcount][nextcount-1].RECT.midtop else: pass screen.FRAME.blit(RoundClear, RCT_RoundClear.topleft) elif PAUSED == True: # If the game is paused... for EVT in pygame.event.get(): if EVT.type == QUIT: # Hard Exit pygame.quit() sys.exit() elif EVT.type == KEYDOWN: if EVT.key == K_ESCAPE: PAUSED = False if self.Music != False: pygame.mixer.music.unpause() elif EVT.key == K_RETURN or EVT.key == K_SPACE: constant['HighScore'] = HISCORE LS = False else: pass screen.FRAME.blit(PauseScreen, (0, 0)) elif PAUSED == False: # If the game is running... # Don't forget to pass a CLEARING flag as False. for EVT in pygame.event.get(): if EVT.type == QUIT: # Hard Exit pygame.quit() sys.exit() elif EVT.type == KEYDOWN: if EVT.key == K_ESCAPE: PAUSED = True pygame.mixer.music.pause() SND_Pause.play() elif EVT.key == K_LEFT and CLEARING == False: Spot -= 1 if Spot < 0: Spot = 0 SND_NoPlace.play() else: SND_SpotSelect.play() elif EVT.key == K_RIGHT and CLEARING == False: Spot += 1 if Spot > 4: Spot = 4 SND_NoPlace.play() else: SND_SpotSelect.play() elif EVT.key == K_UP and CLEARING == False: DataGrid[Spot].insert(0, DataGrid[Spot].pop()) SND_SpotRotate.play() elif EVT.key == K_DOWN and CLEARING == False: DataGrid[Spot].append(DataGrid[Spot].pop(0)) SND_SpotRotate.play() elif EVT.key == K_1 and CLEARING == False: Spot = 0 SND_SpotSelect.play() elif EVT.key == K_2 and CLEARING == False: Spot = 1 SND_SpotSelect.play() elif EVT.key == K_3 and CLEARING == False: Spot = 2 SND_SpotSelect.play() elif EVT.key == K_4 and CLEARING == False: Spot = 3 SND_SpotSelect.play() elif EVT.key == K_5 and CLEARING == False: Spot = 4 SND_SpotSelect.play() elif (EVT.key == K_RETURN or EVT.key == K_SPACE) \ and CLEARING == False: if FullGrid[Spot] == True: SND_NoPlace.play() elif FullGrid[Spot] == False: SND_Place.play() DataGrid[Spot].insert(0, SPT_token(constant['Spritesheet'], CurrentToken)) AllTokens.add(DataGrid[Spot][0]) CurrentToken = NextToken NextToken = random.choice(self.TokenPool) SFC_NextToken = constant['Spritesheet'].\ Apply_Graphic(SPT_token.DIC_color[NextToken][1]) SFC_CurrentToken = constant['Spritesheet'].\ Apply_Graphic(SPT_token.DIC_color[CurrentToken][1]) else: pass # Pop out any tokens that are cleared to go. for col in DataGrid: if len(col) == 0: pass elif len(col) >= 1: for token in col: if token.ALPHA <= 0: removedtoken = col.pop(col.index(token)) SCORE += removedtoken.SCORE removedtoken.kill() # Attach the token stacks on each other. for colcount in range(5): if len(DataGrid[colcount]) == 0: pass else: DataGrid[colcount][0].RECT.center = SpotChoice[colcount].center for nextcount in range(1, len(DataGrid[colcount])): DataGrid[colcount][nextcount].RECT.midbottom = \ DataGrid[colcount][nextcount-1].RECT.midtop # Mandatory Line-Clearing Check. HeightCheck = [] # A list of each column's height. for col in DataGrid: HeightCheck.append(len(col)) MinimumHeight = min(HeightCheck) ValidCount = 0 if MinimumHeight == 0: ROUND_CLEAR = True elif MinimumHeight >= 1: for rowcheck in range(MinimumHeight): ValidCheck = [] for col in DataGrid: ValidCheck.append(col[rowcheck]) ColorPool = [] for _ in ValidCheck: if _.IDEN in ColorPool: pass else: ColorPool.append(_.IDEN) ColorCount = 0 for _ in ColorPool: if _ == 'black' or _ == 'white': pass else: ColorCount += 1 if ColorCount > 1: pass elif ColorCount == 1: for token in ValidCheck: token.CLEAR = True if 'black' in ColorPool: for _ in ColorPool: if _ == 'black' or _ == 'white': pass else: BLACK_CLEAR = _ if 'white' in ColorPool: WHITE_CLEAR = True ValidCount += 1 if ValidCount >= 1: CLEARING = True if SND_Clear_Flag == True: pass else: SND_Clear.play() SND_Clear_Flag = True elif ValidCount == 0: CLEARING = False SND_Clear_Flag = False # Background Info screen.FRAME.blit(bg, (0, 0)) Score = constant['BigFont'].render('%s' % SCORE, True, (0, 255, 0), (0, 0, 0)) screen.FRAME.blit(Score, RCT_Score.topleft) if SCORE >= HISCORE: HISCORE = SCORE HiScore = constant['BigFont'].render('%s' % str(HISCORE), True, (255, 0, 0), (0, 0, 0)) screen.FRAME.blit(HiScore, RCT_HiScore.topleft) # Timer Info if CLEARING == False: DELAY -= 1 if DELAY < 0: DELAY = 60 TIMER -= 1 if TIMER < 0: TIMER = self.Timer Timer = constant['BigFont'].render('%s' % (TIMER), True, (255, 255, 0), (0, 0, 0)) screen.FRAME.blit(Timer, RCT_Timer.topleft) # Next & Current Tokens screen.FRAME.blit(SFC_NextToken, NT_Container.topleft) screen.FRAME.blit(SFC_CurrentToken, CT_Container.topleft) # Rounds Count Rounds = constant['BigFont'].render('%s' % ROUNDS, True, (255, 255, 255)) screen.FRAME.blit(Rounds, RCT_Rounds.topleft) # Tokens AllTokens.update() AllTokens.draw(screen.FRAME) # Spot Selector SS.RECT.center = SpotChoice[Spot].center SpotSelector.update() SpotSelector.draw(screen.FRAME) # Update Screen screen.Update()
# coding=utf-8 # -------------------------------------------------------------------------- # Copyright (c) Microsoft Corporation. All rights reserved. # Licensed under the MIT License. See License.txt in the project root for # license information. # # Code generated by Microsoft (R) AutoRest Code Generator. # Changes may cause incorrect behavior and will be lost if the code is # regenerated. # -------------------------------------------------------------------------- from msrest.pipeline import ClientRawResponse from msrestazure.azure_exceptions import CloudError from msrestazure.azure_operation import AzureOperationPoller import uuid from .. import models class NetworkSecurityGroupsOperations(object): """NetworkSecurityGroupsOperations operations. :param client: Client for service requests. :param config: Configuration of service client. :param serializer: An object model serializer. :param deserializer: An objec model deserializer. :ivar api_version: Client API version. Constant value: "2017-03-01". """ def __init__(self, client, config, serializer, deserializer): self._client = client self._serialize = serializer self._deserialize = deserializer self.api_version = "2017-03-01" self.config = config def delete( self, resource_group_name, network_security_group_name, custom_headers=None, raw=False, **operation_config): """Deletes the specified network security group. :param resource_group_name: The name of the resource group. :type resource_group_name: str :param network_security_group_name: The name of the network security group. :type network_security_group_name: str :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :rtype: :class:`AzureOperationPoller<msrestazure.azure_operation.AzureOperationPoller>` instance that returns None :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true :raises: :class:`CloudError<msrestazure.azure_exceptions.CloudError>` """ # Construct URL url = '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Network/networkSecurityGroups/{networkSecurityGroupName}' path_format_arguments = { 'resourceGroupName': self._serialize.url("resource_group_name", resource_group_name, 'str'), 'networkSecurityGroupName': self._serialize.url("network_security_group_name", network_security_group_name, 'str'), 'subscriptionId': self._serialize.url("self.config.subscription_id", self.config.subscription_id, 'str') } url = self._client.format_url(url, **path_format_arguments) # Construct parameters query_parameters = {} query_parameters['api-version'] = self._serialize.query("self.api_version", self.api_version, 'str') # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if self.config.generate_client_request_id: header_parameters['x-ms-client-request-id'] = str(uuid.uuid1()) if custom_headers: header_parameters.update(custom_headers) if self.config.accept_language is not None: header_parameters['accept-language'] = self._serialize.header("self.config.accept_language", self.config.accept_language, 'str') # Construct and send request def long_running_send(): request = self._client.delete(url, query_parameters) return self._client.send(request, header_parameters, **operation_config) def get_long_running_status(status_link, headers=None): request = self._client.get(status_link) if headers: request.headers.update(headers) return self._client.send( request, header_parameters, **operation_config) def get_long_running_output(response): if response.status_code not in [202, 200, 204]: exp = CloudError(response) exp.request_id = response.headers.get('x-ms-request-id') raise exp if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response if raw: response = long_running_send() return get_long_running_output(response) long_running_operation_timeout = operation_config.get( 'long_running_operation_timeout', self.config.long_running_operation_timeout) return AzureOperationPoller( long_running_send, get_long_running_output, get_long_running_status, long_running_operation_timeout) def get( self, resource_group_name, network_security_group_name, expand=None, custom_headers=None, raw=False, **operation_config): """Gets the specified network security group. :param resource_group_name: The name of the resource group. :type resource_group_name: str :param network_security_group_name: The name of the network security group. :type network_security_group_name: str :param expand: Expands referenced resources. :type expand: str :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`NetworkSecurityGroup <azure.mgmt.network.v2017_03_01.models.NetworkSecurityGroup>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true :raises: :class:`CloudError<msrestazure.azure_exceptions.CloudError>` """ # Construct URL url = '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Network/networkSecurityGroups/{networkSecurityGroupName}' path_format_arguments = { 'resourceGroupName': self._serialize.url("resource_group_name", resource_group_name, 'str'), 'networkSecurityGroupName': self._serialize.url("network_security_group_name", network_security_group_name, 'str'), 'subscriptionId': self._serialize.url("self.config.subscription_id", self.config.subscription_id, 'str') } url = self._client.format_url(url, **path_format_arguments) # Construct parameters query_parameters = {} query_parameters['api-version'] = self._serialize.query("self.api_version", self.api_version, 'str') if expand is not None: query_parameters['$expand'] = self._serialize.query("expand", expand, 'str') # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if self.config.generate_client_request_id: header_parameters['x-ms-client-request-id'] = str(uuid.uuid1()) if custom_headers: header_parameters.update(custom_headers) if self.config.accept_language is not None: header_parameters['accept-language'] = self._serialize.header("self.config.accept_language", self.config.accept_language, 'str') # Construct and send request request = self._client.get(url, query_parameters) response = self._client.send(request, header_parameters, **operation_config) if response.status_code not in [200]: exp = CloudError(response) exp.request_id = response.headers.get('x-ms-request-id') raise exp deserialized = None if response.status_code == 200: deserialized = self._deserialize('NetworkSecurityGroup', response) if raw: client_raw_response = ClientRawResponse(deserialized, response) return client_raw_response return deserialized def create_or_update( self, resource_group_name, network_security_group_name, parameters, custom_headers=None, raw=False, **operation_config): """Creates or updates a network security group in the specified resource group. :param resource_group_name: The name of the resource group. :type resource_group_name: str :param network_security_group_name: The name of the network security group. :type network_security_group_name: str :param parameters: Parameters supplied to the create or update network security group operation. :type parameters: :class:`NetworkSecurityGroup <azure.mgmt.network.v2017_03_01.models.NetworkSecurityGroup>` :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :rtype: :class:`AzureOperationPoller<msrestazure.azure_operation.AzureOperationPoller>` instance that returns :class:`NetworkSecurityGroup <azure.mgmt.network.v2017_03_01.models.NetworkSecurityGroup>` :rtype: :class:`ClientRawResponse<msrest.pipeline.ClientRawResponse>` if raw=true :raises: :class:`CloudError<msrestazure.azure_exceptions.CloudError>` """ # Construct URL url = '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Network/networkSecurityGroups/{networkSecurityGroupName}' path_format_arguments = { 'resourceGroupName': self._serialize.url("resource_group_name", resource_group_name, 'str'), 'networkSecurityGroupName': self._serialize.url("network_security_group_name", network_security_group_name, 'str'), 'subscriptionId': self._serialize.url("self.config.subscription_id", self.config.subscription_id, 'str') } url = self._client.format_url(url, **path_format_arguments) # Construct parameters query_parameters = {} query_parameters['api-version'] = self._serialize.query("self.api_version", self.api_version, 'str') # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if self.config.generate_client_request_id: header_parameters['x-ms-client-request-id'] = str(uuid.uuid1()) if custom_headers: header_parameters.update(custom_headers) if self.config.accept_language is not None: header_parameters['accept-language'] = self._serialize.header("self.config.accept_language", self.config.accept_language, 'str') # Construct body body_content = self._serialize.body(parameters, 'NetworkSecurityGroup') # Construct and send request def long_running_send(): request = self._client.put(url, query_parameters) return self._client.send( request, header_parameters, body_content, **operation_config) def get_long_running_status(status_link, headers=None): request = self._client.get(status_link) if headers: request.headers.update(headers) return self._client.send( request, header_parameters, **operation_config) def get_long_running_output(response): if response.status_code not in [201, 200]: exp = CloudError(response) exp.request_id = response.headers.get('x-ms-request-id') raise exp deserialized = None if response.status_code == 201: deserialized = self._deserialize('NetworkSecurityGroup', response) if response.status_code == 200: deserialized = self._deserialize('NetworkSecurityGroup', response) if raw: client_raw_response = ClientRawResponse(deserialized, response) return client_raw_response return deserialized if raw: response = long_running_send() return get_long_running_output(response) long_running_operation_timeout = operation_config.get( 'long_running_operation_timeout', self.config.long_running_operation_timeout) return AzureOperationPoller( long_running_send, get_long_running_output, get_long_running_status, long_running_operation_timeout) def list_all( self, custom_headers=None, raw=False, **operation_config): """Gets all network security groups in a subscription. :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`NetworkSecurityGroupPaged <azure.mgmt.network.v2017_03_01.models.NetworkSecurityGroupPaged>` :raises: :class:`CloudError<msrestazure.azure_exceptions.CloudError>` """ def internal_paging(next_link=None, raw=False): if not next_link: # Construct URL url = '/subscriptions/{subscriptionId}/providers/Microsoft.Network/networkSecurityGroups' path_format_arguments = { 'subscriptionId': self._serialize.url("self.config.subscription_id", self.config.subscription_id, 'str') } url = self._client.format_url(url, **path_format_arguments) # Construct parameters query_parameters = {} query_parameters['api-version'] = self._serialize.query("self.api_version", self.api_version, 'str') else: url = next_link query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if self.config.generate_client_request_id: header_parameters['x-ms-client-request-id'] = str(uuid.uuid1()) if custom_headers: header_parameters.update(custom_headers) if self.config.accept_language is not None: header_parameters['accept-language'] = self._serialize.header("self.config.accept_language", self.config.accept_language, 'str') # Construct and send request request = self._client.get(url, query_parameters) response = self._client.send( request, header_parameters, **operation_config) if response.status_code not in [200]: exp = CloudError(response) exp.request_id = response.headers.get('x-ms-request-id') raise exp return response # Deserialize response deserialized = models.NetworkSecurityGroupPaged(internal_paging, self._deserialize.dependencies) if raw: header_dict = {} client_raw_response = models.NetworkSecurityGroupPaged(internal_paging, self._deserialize.dependencies, header_dict) return client_raw_response return deserialized def list( self, resource_group_name, custom_headers=None, raw=False, **operation_config): """Gets all network security groups in a resource group. :param resource_group_name: The name of the resource group. :type resource_group_name: str :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :rtype: :class:`NetworkSecurityGroupPaged <azure.mgmt.network.v2017_03_01.models.NetworkSecurityGroupPaged>` :raises: :class:`CloudError<msrestazure.azure_exceptions.CloudError>` """ def internal_paging(next_link=None, raw=False): if not next_link: # Construct URL url = '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Network/networkSecurityGroups' path_format_arguments = { 'resourceGroupName': self._serialize.url("resource_group_name", resource_group_name, 'str'), 'subscriptionId': self._serialize.url("self.config.subscription_id", self.config.subscription_id, 'str') } url = self._client.format_url(url, **path_format_arguments) # Construct parameters query_parameters = {} query_parameters['api-version'] = self._serialize.query("self.api_version", self.api_version, 'str') else: url = next_link query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if self.config.generate_client_request_id: header_parameters['x-ms-client-request-id'] = str(uuid.uuid1()) if custom_headers: header_parameters.update(custom_headers) if self.config.accept_language is not None: header_parameters['accept-language'] = self._serialize.header("self.config.accept_language", self.config.accept_language, 'str') # Construct and send request request = self._client.get(url, query_parameters) response = self._client.send( request, header_parameters, **operation_config) if response.status_code not in [200]: exp = CloudError(response) exp.request_id = response.headers.get('x-ms-request-id') raise exp return response # Deserialize response deserialized = models.NetworkSecurityGroupPaged(internal_paging, self._deserialize.dependencies) if raw: header_dict = {} client_raw_response = models.NetworkSecurityGroupPaged(internal_paging, self._deserialize.dependencies, header_dict) return client_raw_response return deserialized
import logging import warnings from typing import Optional, Union from uuid import UUID from dateutil.parser import parse from great_expectations.core.data_context_key import DataContextKey from great_expectations.core.id_dict import BatchKwargs, IDDict from great_expectations.core.run_identifier import RunIdentifier, RunIdentifierSchema from great_expectations.exceptions import DataContextError, InvalidDataContextKeyError from great_expectations.marshmallow__shade import Schema, fields, post_load logger = logging.getLogger(__name__) class ExpectationSuiteIdentifier(DataContextKey): def __init__(self, expectation_suite_name: str): super().__init__() if not isinstance(expectation_suite_name, str): raise InvalidDataContextKeyError( f"expectation_suite_name must be a string, not {type(expectation_suite_name).__name__}" ) self._expectation_suite_name = expectation_suite_name @property def expectation_suite_name(self): return self._expectation_suite_name def to_tuple(self): return tuple(self.expectation_suite_name.split(".")) def to_fixed_length_tuple(self): return (self.expectation_suite_name,) @classmethod def from_tuple(cls, tuple_): return cls(".".join(tuple_)) @classmethod def from_fixed_length_tuple(cls, tuple_): return cls(expectation_suite_name=tuple_[0]) def __repr__(self): return f"{self.__class__.__name__}::{self._expectation_suite_name}" class ExpectationSuiteIdentifierSchema(Schema): expectation_suite_name = fields.Str() # noinspection PyUnusedLocal @post_load def make_expectation_suite_identifier(self, data, **kwargs): return ExpectationSuiteIdentifier(**data) class BatchIdentifier(DataContextKey): """A BatchIdentifier tracks""" def __init__( self, batch_identifier: Union[BatchKwargs, dict, str], data_asset_name: str = None, ): super().__init__() # if isinstance(batch_identifier, (BatchKwargs, dict)): # self._batch_identifier = batch_identifier.batch_fingerprint self._batch_identifier = batch_identifier self._data_asset_name = data_asset_name @property def batch_identifier(self): return self._batch_identifier @property def data_asset_name(self): return self._data_asset_name def to_tuple(self): return (self.batch_identifier,) @classmethod def from_tuple(cls, tuple_): return cls(batch_identifier=tuple_[0]) class BatchIdentifierSchema(Schema): batch_identifier = fields.Str() data_asset_name = fields.Str() # noinspection PyUnusedLocal @post_load def make_batch_identifier(self, data, **kwargs): return BatchIdentifier(**data) class ValidationResultIdentifier(DataContextKey): """A ValidationResultIdentifier identifies a validation result by the fully-qualified expectation_suite_identifier and run_id. """ def __init__(self, expectation_suite_identifier, run_id, batch_identifier): """Constructs a ValidationResultIdentifier Args: expectation_suite_identifier (ExpectationSuiteIdentifier, list, tuple, or dict): identifying information for the fully-qualified expectation suite used to validate run_id (RunIdentifier): The run_id for which validation occurred """ super().__init__() self._expectation_suite_identifier = expectation_suite_identifier if isinstance(run_id, str): warnings.warn( "String run_ids will be deprecated in the future. Please provide a run_id of type " "RunIdentifier(run_name=None, run_time=None), or a dictionary containing run_name " "and run_time (both optional).", DeprecationWarning, ) try: run_time = parse(run_id) except (ValueError, TypeError): run_time = None run_id = RunIdentifier(run_name=run_id, run_time=run_time) elif isinstance(run_id, dict): run_id = RunIdentifier(**run_id) elif run_id is None: run_id = RunIdentifier() elif not isinstance(run_id, RunIdentifier): run_id = RunIdentifier(run_name=str(run_id)) self._run_id = run_id self._batch_identifier = batch_identifier @property def expectation_suite_identifier(self) -> ExpectationSuiteIdentifier: return self._expectation_suite_identifier @property def run_id(self): return self._run_id @property def batch_identifier(self): return self._batch_identifier def to_tuple(self): return tuple( list(self.expectation_suite_identifier.to_tuple()) + list(self.run_id.to_tuple()) + [self.batch_identifier or "__none__"] ) def to_fixed_length_tuple(self): return tuple( [self.expectation_suite_identifier.expectation_suite_name] + list(self.run_id.to_tuple()) + [self.batch_identifier or "__none__"] ) @classmethod def from_tuple(cls, tuple_): return cls( ExpectationSuiteIdentifier.from_tuple(tuple_[0:-3]), RunIdentifier.from_tuple((tuple_[-3], tuple_[-2])), tuple_[-1], ) @classmethod def from_fixed_length_tuple(cls, tuple_): return cls( ExpectationSuiteIdentifier(tuple_[0]), RunIdentifier.from_tuple((tuple_[1], tuple_[2])), tuple_[3], ) @classmethod def from_object(cls, validation_result): batch_kwargs = validation_result.meta.get("batch_kwargs", {}) if isinstance(batch_kwargs, IDDict): batch_identifier = batch_kwargs.to_id() elif isinstance(batch_kwargs, dict): batch_identifier = IDDict(batch_kwargs).to_id() else: raise DataContextError( "Unable to construct ValidationResultIdentifier from provided object." ) return cls( expectation_suite_identifier=ExpectationSuiteIdentifier( validation_result.meta["expectation_suite_name"] ), run_id=validation_result.meta.get("run_id"), batch_identifier=batch_identifier, ) class GeCloudIdentifier(DataContextKey): def __init__(self, resource_type: str, ge_cloud_id: Optional[str] = None): super().__init__() self._resource_type = resource_type self._ge_cloud_id = ge_cloud_id if ge_cloud_id is not None else "" @property def resource_type(self): return self._resource_type @resource_type.setter def resource_type(self, value): self._resource_type = value @property def ge_cloud_id(self): return self._ge_cloud_id @ge_cloud_id.setter def ge_cloud_id(self, value): self._ge_cloud_id = value def to_tuple(self): return (self.resource_type, self.ge_cloud_id) def to_fixed_length_tuple(self): return self.to_tuple() @classmethod def from_tuple(cls, tuple_): return cls(resource_type=tuple_[0], ge_cloud_id=tuple_[1]) @classmethod def from_fixed_length_tuple(cls, tuple_): return cls.from_tuple(tuple_) def __repr__(self): return f"{self.__class__.__name__}::{self.resource_type}::{self.ge_cloud_id}" class ValidationResultIdentifierSchema(Schema): expectation_suite_identifier = fields.Nested( ExpectationSuiteIdentifierSchema, required=True, error_messages={ "required": "expectation_suite_identifier is required for a ValidationResultIdentifier" }, ) run_id = fields.Nested( RunIdentifierSchema, required=True, error_messages={ "required": "run_id is required for a " "ValidationResultIdentifier" }, ) batch_identifier = fields.Nested(BatchIdentifierSchema, required=True) # noinspection PyUnusedLocal @post_load def make_validation_result_identifier(self, data, **kwargs): return ValidationResultIdentifier(**data) class SiteSectionIdentifier(DataContextKey): def __init__(self, site_section_name, resource_identifier): self._site_section_name = site_section_name if site_section_name in ["validations", "profiling"]: if isinstance(resource_identifier, ValidationResultIdentifier): self._resource_identifier = resource_identifier elif isinstance(resource_identifier, (tuple, list)): self._resource_identifier = ValidationResultIdentifier( *resource_identifier ) else: self._resource_identifier = ValidationResultIdentifier( **resource_identifier ) elif site_section_name == "expectations": if isinstance(resource_identifier, ExpectationSuiteIdentifier): self._resource_identifier = resource_identifier elif isinstance(resource_identifier, (tuple, list)): self._resource_identifier = ExpectationSuiteIdentifier( *resource_identifier ) else: self._resource_identifier = ExpectationSuiteIdentifier( **resource_identifier ) else: raise InvalidDataContextKeyError( "SiteSectionIdentifier only supports 'validations' and 'expectations' as site section names" ) @property def site_section_name(self): return self._site_section_name @property def resource_identifier(self): return self._resource_identifier def to_tuple(self): site_section_identifier_tuple_list = [self.site_section_name] + list( self.resource_identifier.to_tuple() ) return tuple(site_section_identifier_tuple_list) @classmethod def from_tuple(cls, tuple_): if tuple_[0] == "validations": return cls( site_section_name=tuple_[0], resource_identifier=ValidationResultIdentifier.from_tuple(tuple_[1:]), ) elif tuple_[0] == "expectations": return cls( site_section_name=tuple_[0], resource_identifier=ExpectationSuiteIdentifier.from_tuple(tuple_[1:]), ) else: raise InvalidDataContextKeyError( "SiteSectionIdentifier only supports 'validations' and 'expectations' as site section names" ) class ConfigurationIdentifier(DataContextKey): def __init__(self, configuration_key: Union[str, UUID]): super().__init__() if isinstance(configuration_key, UUID): configuration_key = str(configuration_key) if not isinstance(configuration_key, str): raise InvalidDataContextKeyError( f"configuration_key must be a string, not {type(configuration_key).__name__}" ) self._configuration_key = configuration_key @property def configuration_key(self) -> str: return self._configuration_key def to_tuple(self): return tuple(self.configuration_key.split(".")) def to_fixed_length_tuple(self): return (self.configuration_key,) @classmethod def from_tuple(cls, tuple_): return cls(".".join(tuple_)) @classmethod def from_fixed_length_tuple(cls, tuple_): return cls(configuration_key=tuple_[0]) def __repr__(self): return f"{self.__class__.__name__}::{self._configuration_key}" class ConfigurationIdentifierSchema(Schema): configuration_key = fields.Str() # noinspection PyUnusedLocal @post_load def make_configuration_identifier(self, data, **kwargs): return ConfigurationIdentifier(**data) expectationSuiteIdentifierSchema = ExpectationSuiteIdentifierSchema() validationResultIdentifierSchema = ValidationResultIdentifierSchema() runIdentifierSchema = RunIdentifierSchema() batchIdentifierSchema = BatchIdentifierSchema() configurationIdentifierSchema = ConfigurationIdentifierSchema()
# Copyright 2014 - Mirantis, Inc. # Copyright 2015 - StackStorm, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import pkg_resources as pkg from six.moves.urllib import parse from six.moves.urllib import request from mistralclient.api import base as api_base from mistralclient.api.v2 import workbooks from mistralclient.tests.unit.v2 import base # TODO(everyone): later we need additional tests verifying all the errors etc. WB_DEF = """ --- version: 2.0 name: wb workflows: wf1: type: direct input: - param1 - param2 tasks: task1: action: std.http url="localhost:8989" on-success: - test_subsequent test_subsequent: action: std.http url="http://some_url" server_id=1 """ INVALID_WB_DEF = """ version: 2.0 name: wb workflows: wf1: type: direct tasks: task1: action: std.http url="localhost:8989" workflow: wf2 """ WORKBOOK = {'definition': WB_DEF} URL_TEMPLATE = '/workbooks' URL_TEMPLATE_NAME = '/workbooks/%s' URL_TEMPLATE_VALIDATE = '/workbooks/validate' class TestWorkbooksV2(base.BaseClientV2Test): def test_create(self): self.requests_mock.post(self.TEST_URL + URL_TEMPLATE, json=WORKBOOK, status_code=201) wb = self.workbooks.create(WB_DEF) self.assertIsNotNone(wb) self.assertEqual(WB_DEF, wb.definition) last_request = self.requests_mock.last_request self.assertEqual(WB_DEF, last_request.text) self.assertEqual('text/plain', last_request.headers['content-type']) def test_create_with_file_uri(self): self.requests_mock.post(self.TEST_URL + URL_TEMPLATE, json=WORKBOOK, status_code=201) # The contents of wb_v2.yaml must be identical to WB_DEF path = pkg.resource_filename( 'mistralclient', 'tests/unit/resources/wb_v2.yaml' ) # Convert the file path to file URI uri = parse.urljoin('file:', request.pathname2url(path)) wb = self.workbooks.create(uri) self.assertIsNotNone(wb) self.assertEqual(WB_DEF, wb.definition) last_request = self.requests_mock.last_request self.assertEqual(WB_DEF, last_request.text) self.assertEqual('text/plain', last_request.headers['content-type']) def test_update(self): self.requests_mock.put(self.TEST_URL + URL_TEMPLATE, json=WORKBOOK) wb = self.workbooks.update(WB_DEF) self.assertIsNotNone(wb) self.assertEqual(WB_DEF, wb.definition) last_request = self.requests_mock.last_request self.assertEqual(WB_DEF, last_request.text) self.assertEqual('text/plain', last_request.headers['content-type']) def test_update_with_file(self): self.requests_mock.put(self.TEST_URL + URL_TEMPLATE, json=WORKBOOK) # The contents of wb_v2.yaml must be identical to WB_DEF path = pkg.resource_filename( 'mistralclient', 'tests/unit/resources/wb_v2.yaml' ) wb = self.workbooks.update(path) self.assertIsNotNone(wb) self.assertEqual(WB_DEF, wb.definition) last_request = self.requests_mock.last_request self.assertEqual(WB_DEF, last_request.text) self.assertEqual('text/plain', last_request.headers['content-type']) def test_list(self): self.requests_mock.get(self.TEST_URL + URL_TEMPLATE, json={'workbooks': [WORKBOOK]}) workbook_list = self.workbooks.list() self.assertEqual(1, len(workbook_list)) wb = workbook_list[0] self.assertEqual( workbooks.Workbook(self.workbooks, WORKBOOK).to_dict(), wb.to_dict() ) def test_get(self): url = self.TEST_URL + URL_TEMPLATE_NAME % 'wb' self.requests_mock.get(url, json=WORKBOOK) wb = self.workbooks.get('wb') self.assertIsNotNone(wb) self.assertEqual( workbooks.Workbook(self.workbooks, WORKBOOK).to_dict(), wb.to_dict() ) def test_delete(self): url = self.TEST_URL + URL_TEMPLATE_NAME % 'wb' self.requests_mock.delete(url, status_code=204) self.workbooks.delete('wb') def test_validate(self): self.requests_mock.post(self.TEST_URL + URL_TEMPLATE_VALIDATE, json={'valid': True}) result = self.workbooks.validate(WB_DEF) self.assertIsNotNone(result) self.assertIn('valid', result) self.assertTrue(result['valid']) last_request = self.requests_mock.last_request self.assertEqual(WB_DEF, last_request.text) self.assertEqual('text/plain', last_request.headers['content-type']) def test_validate_with_file(self): self.requests_mock.post(self.TEST_URL + URL_TEMPLATE_VALIDATE, json={'valid': True}) # The contents of wb_v2.yaml must be identical to WB_DEF path = pkg.resource_filename( 'mistralclient', 'tests/unit/resources/wb_v2.yaml' ) result = self.workbooks.validate(path) self.assertIsNotNone(result) self.assertIn('valid', result) self.assertTrue(result['valid']) last_request = self.requests_mock.last_request self.assertEqual(WB_DEF, last_request.text) self.assertEqual('text/plain', last_request.headers['content-type']) def test_validate_failed(self): mock_result = { "valid": False, "error": "Task properties 'action' and 'workflow' " "can't be specified both" } self.requests_mock.post(self.TEST_URL + URL_TEMPLATE_VALIDATE, json=mock_result) result = self.workbooks.validate(INVALID_WB_DEF) self.assertIsNotNone(result) self.assertIn('valid', result) self.assertFalse(result['valid']) self.assertIn('error', result) self.assertIn( "Task properties 'action' and 'workflow' " "can't be specified both", result['error'] ) last_request = self.requests_mock.last_request self.assertEqual(INVALID_WB_DEF, last_request.text) self.assertEqual('text/plain', last_request.headers['content-type']) def test_validate_api_failed(self): self.requests_mock.post(self.TEST_URL + URL_TEMPLATE_VALIDATE, status_code=500) self.assertRaises( api_base.APIException, self.workbooks.validate, WB_DEF ) last_request = self.requests_mock.last_request self.assertEqual(WB_DEF, last_request.text) self.assertEqual('text/plain', last_request.headers['content-type'])
""" Classes and functions for templates. """ from __future__ import absolute_import, division, print_function import sys from glob import glob import os import traceback import numpy as np from astropy.io import fits from .utils import native_endian, elapsed, transmission_Lyman from .rebin import rebin_template, trapz_rebin class Template(object): """A spectral Template PCA object. The template data is read from a redrock-format template file. Alternatively, the data can be specified in the constructor. Args: filename (str): the path to the template file, either absolute or relative to the RR_TEMPLATE_DIR environment variable. """ def __init__(self, filename=None, spectype=None, redshifts=None, wave=None, flux=None, subtype=None): if filename is not None: fx = None if os.path.exists(filename): fx = fits.open(filename, memmap=False) else: xfilename = os.path.join(os.getenv('RR_TEMPLATE_DIR'), filename) if os.path.exists(xfilename): fx = fits.open(xfilename, memmap=False) else: raise IOError('unable to find '+filename) hdr = fx['BASIS_VECTORS'].header if 'VERSION' in hdr: self._version = hdr['VERSION'] else: self._version = 'unknown' self.wave = np.asarray(hdr['CRVAL1'] + \ hdr['CDELT1']*np.arange(hdr['NAXIS1']), dtype=np.float64) if 'LOGLAM' in hdr and hdr['LOGLAM'] != 0: self.wave = 10**self.wave self.flux = np.asarray(native_endian(fx['BASIS_VECTORS'].data), dtype=np.float64) self._redshifts = None ## find out if redshift info is present in the file old_style_templates = True try: self._redshifts = native_endian(fx['REDSHIFTS'].data) old_style_templates = False except KeyError: pass fx.close() self._rrtype = hdr['RRTYPE'].strip().upper() if old_style_templates: if self._rrtype == 'GALAXY': # redshifts = 10**np.arange(np.log10(1+0.005), # np.log10(1+2.0), 1.5e-4) - 1 self._redshifts = 10**np.arange(np.log10(1-0.005), np.log10(1+1.7), 3e-4) - 1 elif self._rrtype == 'STAR': self._redshifts = np.arange(-0.002, 0.00201, 4e-5) elif self._rrtype == 'QSO': self._redshifts = 10**np.arange(np.log10(1+0.05), np.log10(1+6.0), 5e-4) - 1 else: raise ValueError("Unknown redshift range to use for " "template type {}".format(self._rrtype)) zmin = self._redshifts[0] zmax = self._redshifts[-1] print("DEBUG: Using default redshift range {:.4f}-{:.4f} for " "{}".format(zmin, zmax, os.path.basename(filename))) else: zmin = self._redshifts[0] zmax = self._redshifts[-1] print("DEBUG: Using redshift range {:.4f}-{:.4f} for " "{}".format(zmin, zmax, os.path.basename(filename))) self._subtype = None if 'RRSUBTYP' in hdr: self._subtype = hdr['RRSUBTYP'].strip().upper() else: self._subtype = '' else: self._rrtype = spectype self._redshifts = redshifts self.wave = wave self.flux = flux self._subtype = subtype self._nbasis = self.flux.shape[0] self._nwave = self.flux.shape[1] @property def nbasis(self): return self._nbasis @property def nwave(self): return self._nwave @property def template_type(self): return self._rrtype @property def sub_type(self): return self._subtype @property def full_type(self): """Return formatted type:subtype string. """ if self._subtype != '': return '{}:::{}'.format(self._rrtype, self._subtype) else: return self._rrtype @property def redshifts(self): return self._redshifts def eval(self, coeff, wave, z): """Return template for given coefficients, wavelengths, and redshift Args: coeff : array of coefficients length self.nbasis wave : wavelengths at which to evaluate template flux z : redshift at which to evaluate template flux Returns: template flux array Notes: A single factor of (1+z)^-1 is applied to the resampled flux to conserve integrated flux after redshifting. """ assert len(coeff) == self.nbasis flux = self.flux.T.dot(coeff).T / (1+z) return trapz_rebin(self.wave*(1+z), flux, wave) def find_templates(template_dir=None): """Return list of redrock-\*.fits template files Search directories in this order, returning results from first one found: - template_dir - $RR_TEMPLATE_DIR - <redrock_code>/templates/ Args: template_dir (str): optional directory containing the templates. Returns: list: a list of template files. """ if template_dir is None: if 'RR_TEMPLATE_DIR' in os.environ: template_dir = os.environ['RR_TEMPLATE_DIR'] else: thisdir = os.path.dirname(__file__) tempdir = os.path.join(os.path.abspath(thisdir), 'templates') if os.path.exists(tempdir): template_dir = tempdir if template_dir is None: raise IOError("ERROR: can't find template_dir, $RR_TEMPLATE_DIR, or {rrcode}/templates/") else: print('DEBUG: Read templates from {}'.format(template_dir) ) return sorted(glob(os.path.join(template_dir, 'rrtemplate-*.fits'))) class DistTemplatePiece(object): """One piece of the distributed template data. This is a simple container for storing interpolated templates for a set of redshift values. It is used for communicating the interpolated templates between processes. In the MPI case, each process will store at most two of these simultaneously. This is the data that is computed on a single process and passed between processes. Args: index (int): the chunk index of this piece- this corresponds to the process rank that originally computed this piece. redshifts (array): the redshift range contained in this piece. data (list): a list of dictionaries, one for each redshift, and each containing the 2D interpolated template values for all "wavehash" keys. """ def __init__(self, index, redshifts, data): self.index = index self.redshifts = redshifts self.data = data def _mp_rebin_template(template, dwave, zlist, qout): """Function for multiprocessing version of rebinning. """ try: results = dict() for z in zlist: binned = rebin_template(template, z, dwave) results[z] = binned qout.put(results) except: exc_type, exc_value, exc_traceback = sys.exc_info() lines = traceback.format_exception(exc_type, exc_value, exc_traceback) lines = [ "MP rebin: {}".format(x) for x in lines ] print("".join(lines)) sys.stdout.flush() return class DistTemplate(object): """Distributed template data interpolated to all redshifts. For a given template, the redshifts are distributed among the processes in the communicator. Then each process will rebin the template to those redshifts for the wavelength grids specified by dwave. Args: template (Template): the template to distribute dwave (dict): the keys are the "wavehash" and the values are a 1D array containing the wavelength grid. mp_procs (int): if not using MPI, restrict the number of multiprocesses to this. comm (mpi4py.MPI.Comm): (optional) the MPI communicator. """ def __init__(self, template, dwave, mp_procs=1, comm=None): self._comm = comm self._template = template self._dwave = dwave self._comm_rank = 0 self._comm_size = 1 if self._comm is not None: self._comm_rank = self._comm.rank self._comm_size = self._comm.size self._distredshifts = np.array_split(self._template.redshifts, self._comm_size) myz = self._distredshifts[self._comm_rank] nz = len(myz) data = list() # In the case of not using MPI (comm == None), one process is rebinning # all the templates. In that scenario, use multiprocessing # workers to do the rebinning. if self._comm is not None: # MPI case- compute our local redshifts for z in myz: binned = rebin_template(self._template, z, self._dwave) data.append(binned) else: # We don't have MPI, so use multiprocessing import multiprocessing as mp qout = mp.Queue() work = np.array_split(myz, mp_procs) procs = list() for i in range(mp_procs): p = mp.Process(target=_mp_rebin_template, args=(self._template, self._dwave, work[i], qout)) procs.append(p) p.start() # Extract the output into a single list results = dict() for i in range(mp_procs): res = qout.get() results.update(res) for z in myz: data.append(results[z]) # Correct spectra for Lyman-series for i, z in enumerate(myz): for k in list(self._dwave.keys()): T = transmission_Lyman(z,self._dwave[k]) for vect in range(data[i][k].shape[1]): data[i][k][:,vect] *= T self._piece = DistTemplatePiece(self._comm_rank, myz, data) @property def comm(self): return self._comm @property def template(self): return self._template @property def local(self): return self._piece def cycle(self): """Pass our piece of data to the next process. If we have returned to our original data, then return True, otherwise return False. Args: Nothing Returns (bool): Whether we have finished (True) else False. """ # If we are not using MPI, this function is a no-op, so just return. if self._comm is None: return True rank = self._comm_rank nproc = self._comm_size to_proc = rank + 1 if to_proc >= nproc: to_proc = 0 from_proc = rank - 1 if from_proc < 0: from_proc = nproc - 1 # Send our data and get a request handle for later checking. req = self._comm.isend(self._piece, to_proc) # Receive our data incoming = self._comm.recv(source=from_proc) # Wait for send to finishself._comm_rank = self._comm.rank req.wait() # Now replace our local piece with the new one self._piece = incoming # Are we done? done = False if self._piece.index == rank: done = True return done def load_dist_templates(dwave, templates=None, comm=None, mp_procs=1): """Read and distribute templates from disk. This reads one or more template files from disk and distributes them among an MPI communicator. Each process will locally store interpolated data for a redshift slice of each template. For a single redshift, the template is interpolated to the wavelength grids specified by "dwave". As an example, imagine 3 templates with independent redshift ranges. Also imagine that the communicator has 2 processes. This function would return a list of 3 DistTemplate objects. Within each of those objects, the 2 processes store the interpolated data for a subset of the redshift range: DistTemplate #1: zmin1 <---- p0 ----> | <---- p1 ----> zmax1 DistTemplate #2: zmin2 <-- p0 --> | <-- p1 --> zmax2 DistTemplate #3: zmin3 <--- p0 ---> | <--- p1 ---> zmax3 Args: dwave (dict): the dictionary of wavelength grids. Keys are the "wavehash" and values are an array of wavelengths. templates (str or None): if None, find all templates from the redrock template directory. If a path to a file is specified, load that single template. If a path to a directory is given, load all templates in that directory. comm (mpi4py.MPI.Comm): (optional) the MPI communicator. mp_procs (int): if not using MPI, restrict the number of multiprocesses to this. Returns: list: a list of DistTemplate objects. """ timer = elapsed(None, "", comm=comm) template_files = None if (comm is None) or (comm.rank == 0): # Only one process needs to do this if templates is not None: if os.path.isfile(templates): # we are using just a single file template_files = [ templates ] elif os.path.isdir(templates): # this is a template dir template_files = find_templates(template_dir=templates) else: print("{} is neither a file nor a directory"\ .format(templates)) sys.stdout.flush() if comm is not None: comm.Abort() else: template_files = find_templates() if comm is not None: template_files = comm.bcast(template_files, root=0) template_data = list() if (comm is None) or (comm.rank == 0): for t in template_files: template_data.append(Template(filename=t)) if comm is not None: template_data = comm.bcast(template_data, root=0) timer = elapsed(timer, "Read and broadcast of {} templates"\ .format(len(template_files)), comm=comm) # Compute the interpolated templates in a distributed way with every # process generating a slice of the redshift range. dtemplates = list() for t in template_data: dtemplates.append(DistTemplate(t, dwave, mp_procs=mp_procs, comm=comm)) timer = elapsed(timer, "Rebinning templates", comm=comm) return dtemplates
# -*- coding: utf-8 -*- import datetime from south.db import db from south.v2 import SchemaMigration from django.db import models class Migration(SchemaMigration): def forwards(self, orm): # Adding field 'BookBorrowRequest.status' db.add_column('cabinet_bookborrowrequest', 'status', self.gf('django.db.models.fields.IntegerField')(default=0), keep_default=False) # Adding field 'EBookRequest.status' db.add_column('cabinet_ebookrequest', 'status', self.gf('django.db.models.fields.IntegerField')(default=0), keep_default=False) def backwards(self, orm): # Deleting field 'BookBorrowRequest.status' db.delete_column('cabinet_bookborrowrequest', 'status') # Deleting field 'EBookRequest.status' db.delete_column('cabinet_ebookrequest', 'status') models = { 'auth.group': { 'Meta': {'object_name': 'Group'}, 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '80'}), 'permissions': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['auth.Permission']", 'symmetrical': 'False', 'blank': 'True'}) }, 'auth.permission': { 'Meta': {'ordering': "('content_type__app_label', 'content_type__model', 'codename')", 'unique_together': "(('content_type', 'codename'),)", 'object_name': 'Permission'}, 'codename': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'content_type': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['contenttypes.ContentType']"}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '50'}) }, 'auth.user': { 'Meta': {'object_name': 'User'}, 'date_joined': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'email': ('django.db.models.fields.EmailField', [], {'max_length': '75', 'blank': 'True'}), 'first_name': ('django.db.models.fields.CharField', [], {'max_length': '30', 'blank': 'True'}), 'groups': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['auth.Group']", 'symmetrical': 'False', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'is_active': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'is_staff': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'is_superuser': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'last_login': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'last_name': ('django.db.models.fields.CharField', [], {'max_length': '30', 'blank': 'True'}), 'password': ('django.db.models.fields.CharField', [], {'max_length': '128'}), 'user_permissions': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['auth.Permission']", 'symmetrical': 'False', 'blank': 'True'}), 'username': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '30'}) }, 'cabinet.book': { 'Meta': {'object_name': 'Book'}, 'author': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'douban_id': ('django.db.models.fields.CharField', [], {'max_length': '100', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'isbn': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'title': ('django.db.models.fields.CharField', [], {'max_length': '100'}) }, 'cabinet.bookborrowrecord': { 'Meta': {'object_name': 'BookBorrowRecord'}, 'borrow_date': ('django.db.models.fields.DateTimeField', [], {}), 'borrower': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']"}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'ownership': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['cabinet.BookOwnership']"}), 'planed_return_date': ('django.db.models.fields.DateField', [], {'blank': 'True'}), 'returned_date': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}) }, 'cabinet.bookborrowrequest': { 'Meta': {'object_name': 'BookBorrowRequest'}, 'bo_ship': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['cabinet.BookOwnership']"}), 'datetime': ('django.db.models.fields.DateTimeField', [], {}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'planed_return_date': ('django.db.models.fields.DateField', [], {}), 'remark': ('django.db.models.fields.CharField', [], {'max_length': '256', 'blank': 'True'}), 'requester': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']"}), 'status': ('django.db.models.fields.IntegerField', [], {'default': '0'}) }, 'cabinet.bookcabinet': { 'Meta': {'object_name': 'BookCabinet'}, 'books': ('django.db.models.fields.related.ManyToManyField', [], {'symmetrical': 'False', 'to': "orm['cabinet.BookOwnership']", 'null': 'True', 'blank': 'True'}), 'create_datetime': ('django.db.models.fields.DateTimeField', [], {}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'owner': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']"}), 'remark': ('django.db.models.fields.CharField', [], {'max_length': '256', 'blank': 'True'}) }, 'cabinet.bookcomment': { 'Meta': {'object_name': 'BookComment'}, 'book': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['cabinet.Book']"}), 'content': ('django.db.models.fields.CharField', [], {'max_length': '2048'}), 'datetime': ('django.db.models.fields.DateTimeField', [], {}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'status': ('django.db.models.fields.IntegerField', [], {}), 'title': ('django.db.models.fields.CharField', [], {'max_length': '256'}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']"}) }, 'cabinet.bookownership': { 'Meta': {'object_name': 'BookOwnership'}, 'book': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['cabinet.Book']"}), 'has_ebook': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'owner': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']"}), 'remark': ('django.db.models.fields.CharField', [], {'max_length': '256', 'blank': 'True'}), 'status': ('django.db.models.fields.CharField', [], {'default': "'1'", 'max_length': '16'}) }, 'cabinet.bookownershiptaguse': { 'Meta': {'object_name': 'BookOwnershipTagUse'}, 'bookown': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['cabinet.BookOwnership']"}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'tag': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['cabinet.Tag']"}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']"}) }, 'cabinet.booktaguse': { 'Meta': {'unique_together': "(('tag', 'user', 'book'),)", 'object_name': 'BookTagUse'}, 'book': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['cabinet.Book']"}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'tag': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['cabinet.Tag']"}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']"}) }, 'cabinet.cabinetnews': { 'Meta': {'ordering': "['-datetime']", 'object_name': 'CabinetNews'}, 'datetime': ('django.db.models.fields.DateTimeField', [], {}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'lead': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']"}), 'news': ('django.db.models.fields.CharField', [], {'max_length': '256'}) }, 'cabinet.ebookrequest': { 'Meta': {'object_name': 'EBookRequest'}, 'bo_ship': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['cabinet.BookOwnership']"}), 'datetime': ('django.db.models.fields.DateTimeField', [], {}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'requester': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']"}), 'status': ('django.db.models.fields.IntegerField', [], {'default': '0'}) }, 'cabinet.feedback': { 'Meta': {'object_name': 'Feedback'}, 'content': ('django.db.models.fields.CharField', [], {'max_length': '1024'}), 'datetime': ('django.db.models.fields.DateTimeField', [], {}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'status': ('django.db.models.fields.IntegerField', [], {}), 'title': ('django.db.models.fields.CharField', [], {'max_length': '256'}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']"}) }, 'cabinet.follow': { 'Meta': {'unique_together': "(('following', 'user'),)", 'object_name': 'Follow'}, 'following': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "'follower_set'", 'to': "orm['auth.User']"}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'remark': ('django.db.models.fields.CharField', [], {'max_length': '32'}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']"}) }, 'cabinet.joinrepositoryrequest': { 'Meta': {'object_name': 'JoinRepositoryRequest'}, 'datetime': ('django.db.models.fields.DateTimeField', [], {}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'remark': ('django.db.models.fields.CharField', [], {'max_length': '256', 'blank': 'True'}), 'repo': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['cabinet.Repository']"}), 'requester': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']"}) }, 'cabinet.repository': { 'Meta': {'object_name': 'Repository'}, 'admin': ('django.db.models.fields.related.ManyToManyField', [], {'related_name': "'managed_repos'", 'symmetrical': 'False', 'to': "orm['auth.User']"}), 'create_time': ('django.db.models.fields.DateTimeField', [], {}), 'description': ('django.db.models.fields.CharField', [], {'max_length': '1024', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'members': ('django.db.models.fields.related.ManyToManyField', [], {'related_name': "'joined_repos'", 'symmetrical': 'False', 'to': "orm['auth.User']"}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '256'}) }, 'cabinet.sysbooktaguse': { 'Meta': {'object_name': 'SysBookTagUse'}, 'book': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['cabinet.Book']"}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'tag': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['cabinet.Tag']"}) }, 'cabinet.tag': { 'Meta': {'object_name': 'Tag'}, 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '64'}) }, 'cabinet.weibouser': { 'Meta': {'object_name': 'WeiboUser'}, 'avatar': ('django.db.models.fields.CharField', [], {'max_length': '128', 'blank': 'True'}), 'created_at': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'expires_in': ('django.db.models.fields.IntegerField', [], {}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'screen_name': ('django.db.models.fields.CharField', [], {'max_length': '32', 'blank': 'True'}), 'token': ('django.db.models.fields.CharField', [], {'max_length': '32'}), 'uid': ('django.db.models.fields.CharField', [], {'max_length': '16'}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']", 'null': 'True', 'blank': 'True'}) }, 'contenttypes.contenttype': { 'Meta': {'ordering': "('name',)", 'unique_together': "(('app_label', 'model'),)", 'object_name': 'ContentType', 'db_table': "'django_content_type'"}, 'app_label': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'model': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '100'}) } } complete_apps = ['cabinet']
#!/usr/bin/env python import json import math import re class PManager(object): def __init__(self, pm_data): if isinstance(pm_data, (str, unicode)): self.pm_data = json.loads(pm_data) else: self.pm_data = pm_data self.data = self.pm_data['ks_spaces'] self.kernel_params = self.pm_data['kernel_params'] self.factor = 1 self.unit = "MiB" self._pre = [] self._kick = [] self._post = [] self.raid_count = 0 self._pcount = {} self._pend = {} self._rcount = 0 self._pvcount = 0 def _pseparator(self, devname): pseparator = '' if devname.find('cciss') >= 0: pseparator = 'p' return pseparator def pcount(self, disk_id, increment=0): self._pcount[disk_id] = self._pcount.get(disk_id, 0) + increment return self._pcount.get(disk_id, 0) def psize(self, disk_id, increment=0): self._pend[disk_id] = self._pend.get(disk_id, 0) + increment return self._pend.get(disk_id, 0) def rcount(self, increment=0): self._rcount += increment return self._rcount def pvcount(self, increment=0): self._pvcount += increment return self._pvcount def pre(self, command=None): if command: return self._pre.append(command) return self._pre def kick(self, command=None): if command: return self._kick.append(command) return self._kick def post(self, command=None): if command: return self._post.append(command) return self._post def _disk_dev(self, disk): command = "$(readlink -f $( (" command += " || ".join(["ls /dev/{0}".format(d) for d in disk.get("extra", [])]) if disk["extra"]: command += " || " command += "ls /dev/{0}".format(disk["id"]) command += ") 2>/dev/null) )" return command def iterdisks(self): for item in self.data: if item["type"] == "disk" and item["size"] > 0: yield item def get_partition_count(self, name): count = 0 for disk in self.iterdisks(): count += len([v for v in disk["volumes"] if v.get('name') == name and v['size'] > 0]) return count def num_ceph_journals(self): return self.get_partition_count('cephjournal') def num_ceph_osds(self): return self.get_partition_count('ceph') def _gettabfstype(self, vol): if vol.get("file_system"): return vol["file_system"] elif vol["mount"] == "/": return "ext4" elif vol["mount"] == "/boot": return "ext3" elif vol["mount"] == "swap": return "swap" return "xfs" def _gettabfsoptions(self, vol): if self._gettabfstype(vol) == "xfs": return "-f -s size=512" return "" def _getfstype(self, vol): fstype = self._gettabfstype(vol) if fstype == "swap": return "" return "--fstype=%s" % fstype def _getlabel(self, label): if not label: return "" # XFS will refuse to format a partition if the # disk label is > 12 characters. return " -L {0} ".format(label[:12]) def _parttype(self, n): return "primary" def _getsize(self, vol): """Get volume size. Anaconda has hard coded limitation in 16TB for ext3/4 and xfs filesystems (the only filesystems we are supposed to use). Besides there is no stable 64-bit ext4 implementation at the moment, so the limitation in 16TB for ext4 is not only anaconda limitation. Root partition can not be located on xfs file system therefore we check if root filesystem is larger than 16TB and set it size into 16TB if it is larger. It is necessary to note that to format 16TB volume on ext4 it is needed about 1G memory. """ if vol["size"] > 16777216 and vol["mount"] == "/": return 16777216 return vol["size"] def erase_lvm_metadata(self): self.pre("for v in $(vgs | awk '{print $1}'); do " "vgreduce -f --removemissing $v; vgremove -f $v; done") self.pre("for p in $(pvs | grep '\/dev' | awk '{print $1}'); do " "pvremove -ff -y $p ; done") def erase_raid_metadata(self): for disk in self.iterdisks(): self.pre("mdadm --zero-superblock --force {0}*" "".format(self._disk_dev(disk))) def clean(self, disk): self.pre("hdparm -z {0}".format(self._disk_dev(disk))) self.pre("test -e {0} && dd if=/dev/zero " "of={0} bs=1M count=10".format( self._disk_dev(disk))) self.pre("sleep 10") self.pre("hdparm -z {0}".format(self._disk_dev(disk))) def gpt(self, disk): self.pre("parted -s {0} mklabel gpt".format(self._disk_dev(disk))) def bootable(self, disk): """Create and mark Bios Boot partition Grub will embed its code later, useable for legacy boot. May be way smaller, but be aware that the parted may shrink 1M partition to zero at some disks and versions. """ self.pre("parted -a optimal -s {0} " "unit {3} mkpart primary {1} {2}".format( self._disk_dev(disk), self.psize(disk["id"]), self.psize(disk["id"], 24 * self.factor), self.unit)) self.pre("parted -s {0} set {1} bios_grub on".format( self._disk_dev(disk), self.pcount(disk["id"], 1))) """Create partition for the EFI boot, minimum size is 100M, recommended is 200M, with fat32 and future mountpoint in the /boot/efi. There is also '/usr/sbin/parted -s /dev/sda set 2 boot on' which is strictly needed for EFI boot.""" self.pre("parted -a optimal -s {0} " "unit {3} mkpart primary fat32 {1} {2}".format( self._disk_dev(disk), self.psize(disk["id"]), self.psize(disk["id"], 200 * self.factor), self.unit)) self.pre("parted -s {0} set {1} boot on".format( self._disk_dev(disk), self.pcount(disk["id"], 1))) def boot(self): self.plains(volume_filter=lambda x: x["mount"] == "/boot") self.raids(volume_filter=lambda x: x["mount"] == "/boot") def notboot(self): self.plains(volume_filter=lambda x: x["mount"] != "/boot") self.raids(volume_filter=lambda x: x["mount"] != "/boot") def plains(self, volume_filter=None): if not volume_filter: volume_filter = default_volume_filter ceph_osds = self.num_ceph_osds() journals_left = ceph_osds ceph_journals = self.num_ceph_journals() for disk in self.iterdisks(): for part in filter(lambda p: p["type"] == "partition" and volume_filter(p), disk["volumes"]): if part["size"] <= 0: continue if part.get('name') == 'cephjournal': # We need to allocate a journal partition for each ceph OSD # Determine the number of journal partitions we need on # each device ratio = math.ceil(float(ceph_osds) / ceph_journals) # No more than 10GB will be allocated to a single # journal partition size = part["size"] / ratio if size > 10240: size = 10240 # This will attempt to evenly spread partitions across # multiple devices e.g. 5 osds with 2 journal devices will # create 3 partitions on the first device and 2 on the # second if ratio < journals_left: end = ratio else: end = journals_left for i in range(0, end): journals_left -= 1 pcount = self.pcount(disk["id"], 1) self.pre("parted -a optimal -s /dev/{0} " "unit {4} mkpart {1} {2} {3}".format( disk["id"], self._parttype(pcount), self.psize(disk["id"]), self.psize(disk["id"], size * self.factor), self.unit)) self.post("chroot /mnt/sysimage sgdisk " "--typecode={0}:{1} /dev/{2}".format( pcount, part["partition_guid"], disk["id"])) continue pcount = self.pcount(disk["id"], 1) self.pre("parted -a optimal -s {0} " "unit {4} mkpart {1} {2} {3}".format( self._disk_dev(disk), self._parttype(pcount), self.psize(disk["id"]), self.psize(disk["id"], part["size"] * self.factor), self.unit)) size = self._getsize(part) tabmount = part["mount"] if part["mount"] != "swap" else "none" tabfstype = self._gettabfstype(part) tabfsoptions = self._gettabfsoptions(part) if part.get("partition_guid"): self.post("chroot /mnt/sysimage sgdisk " "--typecode={0}:{1} {2}".format( pcount, part["partition_guid"], self._disk_dev(disk))) if size > 0 and size <= 16777216 and part["mount"] != "none" \ and tabfstype != "xfs": self.kick("partition {0} " "--onpart={2}" "{3}{4}".format(part["mount"], size, self._disk_dev(disk), self._pseparator(disk["id"]), pcount)) else: if part["mount"] != "swap" and tabfstype != "none": disk_label = self._getlabel(part.get('disk_label')) self.post("mkfs.{0} {1} {2}" "{3}{4} {5}".format( tabfstype, tabfsoptions, self._disk_dev(disk), self._pseparator(disk["id"]), pcount, disk_label)) if part["mount"] != "none": self.post("mkdir -p /mnt/sysimage{0}".format( part["mount"])) if tabfstype != "none": self.post("echo 'UUID=$(blkid -s UUID -o value " "{0}{1}{2}) " "{3} {4} defaults 0 0'" " >> /mnt/sysimage/etc/fstab".format( self._disk_dev(disk), self._pseparator(disk["id"]), pcount, tabmount, tabfstype)) def raids(self, volume_filter=None): if not volume_filter: volume_filter = default_volume_filter raids = {} raid_info = {} phys = {} for disk in self.iterdisks(): for raid in filter(lambda p: p["type"] == "raid" and volume_filter(p), disk["volumes"]): if raid["size"] <= 0: continue raid_info[raid["mount"]] = raid pcount = self.pcount(disk["id"], 1) if not phys.get(raid["mount"]): phys[raid["mount"]] = [] phys[raid["mount"]].append( "{0}{1}{2}".format( self._disk_dev(disk), self._pseparator(disk["id"]), pcount)) rname = "raid.{0:03d}".format(self.rcount(1)) begin_size = self.psize(disk["id"]) end_size = self.psize(disk["id"], raid["size"] * self.factor) self.pre("parted -a optimal -s {0} " "unit {4} mkpart {1} {2} {3}".format( self._disk_dev(disk), self._parttype(pcount), begin_size, end_size, self.unit)) self.kick("partition {0} " "--onpart={2}{3}{4}" "".format(rname, raid["size"], self._disk_dev(disk), self._pseparator(disk["id"]), pcount)) if not raids.get(raid["mount"]): raids[raid["mount"]] = [] raids[raid["mount"]].append(rname) for (num, (mount, rnames)) in enumerate(raids.iteritems()): raid = raid_info[mount] fstype = self._gettabfstype(raid) fsoptions = self._gettabfsoptions(raid) label = raid.get('disk_label') # Anaconda won't label a RAID array. It also can't create # a single-drive RAID1 array, but mdadm can. if label or len(rnames) == 1: if len(rnames) == 1: phys[mount].append('missing') self.post("mdadm --create /dev/md{0} --run --level=1 " "--raid-devices={1} {2}".format( self.raid_count, len(phys[mount]), ' '.join(phys[mount]))) self.post("mkfs.{0} {1} {2} /dev/md{3}".format( fstype, fsoptions, self._getlabel(label), self.raid_count)) self.post("mdadm --detail --scan | grep '\/dev\/md{0}'" ">> /mnt/sysimage/etc/mdadm.conf".format( self.raid_count)) self.post("mkdir -p /mnt/sysimage{0}".format(mount)) self.post("echo \\\"UUID=\$(blkid -s UUID -o value " "/dev/md{0}) " "{1} {2} defaults 0 0\\\"" " >> /mnt/sysimage/etc/fstab".format( self.raid_count, mount, fstype)) else: self.kick("raid {0} --device md{1} --fstype {3} " "--level=RAID1 {2}".format( mount, self.raid_count, " ".join(rnames), fstype)) self.raid_count += 1 def pvs(self): pvs = {} for disk in self.iterdisks(): for pv in [p for p in disk["volumes"] if p["type"] == "pv"]: if pv["size"] <= 0: continue pcount = self.pcount(disk["id"], 1) pvname = "pv.{0:03d}".format(self.pvcount(1)) begin_size = self.psize(disk["id"]) end_size = self.psize(disk["id"], pv["size"] * self.factor) self.pre("parted -a optimal -s {0} " "unit {4} mkpart {1} {2} {3}".format( self._disk_dev(disk), self._parttype(pcount), begin_size, end_size, self.unit)) self.kick("partition {0} " "--onpart={2}{3}{4}" "".format(pvname, pv["size"], self._disk_dev(disk), self._pseparator(disk["id"]), pcount)) if not pvs.get(pv["vg"]): pvs[pv["vg"]] = [] pvs[pv["vg"]].append(pvname) for vg, pvnames in pvs.iteritems(): self.kick("volgroup {0} {1}".format(vg, " ".join(pvnames))) def lvs(self): for vg in [g for g in self.data if g["type"] == "vg"]: for lv in vg["volumes"]: if lv["size"] <= 0: continue fstype = self._getfstype(lv) size = self._getsize(lv) tabmount = lv["mount"] if lv["mount"] != "swap" else "none" tabfstype = self._gettabfstype(lv) tabfsoptions = self._gettabfsoptions(lv) if size > 0 and size <= 16777216 and tabfstype != "xfs": self.kick("logvol {0} --vgname={1} --size={2} " "--name={3} {4}".format( lv["mount"], vg["id"], size, lv["name"], fstype)) else: self.post("lvcreate --size {0} --name {1} {2}".format( size, lv["name"], vg["id"])) if lv["mount"] != "swap" and tabfstype != "none": self.post("mkfs.{0} {1} /dev/mapper/{2}-{3}".format( tabfstype, tabfsoptions, vg["id"], lv["name"])) self.post("mkdir -p /mnt/sysimage{0}" "".format(lv["mount"])) if tabfstype != "none": """ The name of the device. An LVM device is expressed as the volume group name and the logical volume name separated by a hyphen. A hyphen in the original name is translated to two hyphens. """ self.post("echo '/dev/mapper/{0}-{1} {2} {3} " "defaults 0 0'" " >> /mnt/sysimage/etc/fstab".format( vg["id"].replace("-", "--"), lv["name"].replace("-", "--"), tabmount, tabfstype)) def bootloader(self): devs = [] for disk in self.iterdisks(): devs.append("$(basename {0})" "".format(self._disk_dev(disk))) if devs: self.kick("bootloader --location=mbr --driveorder={0} " "--append=' {1} '".format( ",".join(devs), self.kernel_params)) for dev in devs: self.post("echo -n > /tmp/grub.script") self.post("echo \\\"device (hd0) /dev/{0}\\\" >> " "/tmp/grub.script".format(dev)) """ This means that we set drive geometry manually into to avoid grub register overlapping. We set it so that grub thinks disk size is equal to 1G. 130 cylinders * (16065 * 512 = 8225280 bytes) = 1G """ self.post("echo \\\"geometry (hd0) 130 255 63\\\" >> " "/tmp/grub.script") self.post("echo \\\"root (hd0,2)\\\" >> /tmp/grub.script") self.post("echo \\\"install /grub/stage1 (hd0) /grub/stage2 p " "/grub/grub.conf\\\" >> /tmp/grub.script") self.post("echo quit >> /tmp/grub.script") self.post("cat /tmp/grub.script | chroot /mnt/sysimage " "/sbin/grub --no-floppy --batch") def expose(self, kickfile="/tmp/partition.ks", postfile="/tmp/post_partition.ks"): result = "" for pre in self.pre(): result += "{0}\n".format(pre) result += "echo > {0}\n".format(kickfile) for kick in self.kick(): result += "echo \"{0}\" >> {1}\n".format(kick, kickfile) result += "echo \"%post --nochroot\" > {0}\n".format(postfile) result += "echo \"set -x -v\" >> {0}\n".format(postfile) result += ("echo \"exec 1>/mnt/sysimage/root/post-partition.log " "2>&1\" >> {0}\n".format(postfile)) for post in self.post(): result += "echo \"{0}\" >> {1}\n".format(post, postfile) result += "echo \"%end\" >> {0}\n".format(postfile) return result def eval(self): for disk in self.iterdisks(): self.clean(disk) self.gpt(disk) self.bootable(disk) self.boot() self.notboot() self.pvs() self.lvs() self.bootloader() self.pre("sleep 10") for disk in self.iterdisks(): self.pre("hdparm -z {0}".format(self._disk_dev(disk))) self.erase_lvm_metadata() self.erase_raid_metadata() class PreseedPManager(object): def __init__(self, pm_data): if isinstance(pm_data, (str, unicode)): self.pm_data = json.loads(pm_data) else: self.pm_data = pm_data self.data = self.pm_data['ks_spaces'] self.kernel_params = self.pm_data['kernel_params'] # enumerating disks for num, item in enumerate( [d for d in self.data if d["type"] == "disk"]): item["enum"] = num self.validate() self.factor = 1 self.unit = "MiB" self.disks = sorted([self._disk_dev(d) for d in self.iterdisks()]) self.os_disk = self.os_disks()[0] self._pcount = {} self._pend = {} self._recipe = [] self._late = [] self._early = [] def os_disks(self): return [self._disk_dev(d) for d in self.iterdisks() if filter(lambda x: x.get("vg") == "os" and x.get("size") > 0, d["volumes"])] def validate(self): # os volume group can not be distributed over more than one disk. # it is because we use plain partition for / and swap on ubuntu. if len(self.os_disks()) > 1: raise Exception("OS volume group must be located on one disk") def _disk_by_links(self, disk): command = "$(readlink -f $( (" command += " || ".join(["ls /dev/{0}".format(d) for d in disk.get("extra", [])]) if disk["extra"]: command += " || " command += "ls /dev/{0}".format(disk["id"]) command += ") 2>/dev/null) )" return command def _disk_dev(self, disk): return "${{DISK_{0}}}".format(disk["enum"]) def disks_map(self): command = "" for disk in self.iterdisks(): command += "export DISK_{0}={1}; ".format( disk["enum"], self._disk_by_links(disk)) return command def iterdisks(self): for item in self.data: if item["type"] == "disk" and item["size"] > 0: yield item def recipe(self, command=None): if command: return self._recipe.append(command) return self._recipe def late(self, command=None, in_target=False, udev_settle=False): if command: if udev_settle: # this gonna wait until udev event queue is handled # and avoid appearing udev race condition. # for example http://permalink.gmane.org/gmane.linux.raid/34027 self._late.append(("/sbin/udevadm settle", False)) return self._late.append((command, in_target)) return self._late def early(self, command=None): if command: return self._early.append(command) return self._early def _pseparator(self, devname): pseparator = '' if devname.find('cciss') >= 0: pseparator = 'p' return pseparator def _getlabel(self, label): if not label: return "" # XFS will refuse to format a partition if the # disk label is > 12 characters. return " -L {0} ".format(label[:12]) def _parttype(self, n): return "primary" def _fsoptions(self, fstype): if fstype == "xfs": return "-f -s size=512" return "" def _umount_target(self): self.late("umount /target/dev") self.late("umount /target/sys") self.late("umount /target/proc") self.late("umount /target/boot") self.late("umount /target") self.late("umount {0}{1}3".format( self.os_disk, self._pseparator(self.os_disk))) self.late("swapoff {0}{1}4".format( self.os_disk, self._pseparator(self.os_disk))) def _mount_target(self): self.late("mount {0}{1}3 /target".format( self.os_disk, self._pseparator(self.os_disk))) self.late("mount {0}{1}2 /target/boot".format( self.os_disk, self._pseparator(self.os_disk))) self.late("mount -t proc none /target/proc") self.late("mount -o bind /dev /target/dev") self.late("mount -o bind /sys /target/sys") self.late("swapon {0}{1}4".format( self.os_disk, self._pseparator(self.os_disk))) def _long_logger(self): """Create script for logging long lines. This method puts script which splits long line and sends them to logger #!/bin/sh chunk=80 while read string; do iterations=`expr ${#string} / $chunk + 1`; i=0; while [ $i -le $(( iterations - 1)) ]; do start_sym=$(( $i * ${chunk} + 1 )) end_sym=$(( $(( $i + 1 )) * ${chunk})) echo $string | cut -c ${start_sym}-${end_sym} | logger i=$(( i + 1 )); done; done; """ return ( "echo '#!/bin/sh' > /tmp/long_logger.sh;", "echo 'chunk=80;' >> /tmp/long_logger.sh;", "echo 'while read string; do' >> /tmp/long_logger.sh;", ("echo 'iterations=`expr ${#string} / $chunk + 1`; i=0;' " ">> /tmp/long_logger.sh;"), ("echo 'while [ $i -le $(( iterations - 1)) ]; do' " ">> /tmp/long_logger.sh;"), ("echo 'start_sym=$(( $i * ${chunk} + 1 ))' " ">> /tmp/long_logger.sh;"), ("echo 'end_sym=$(( $(( $i + 1 )) * ${chunk}))' " ">> /tmp/long_logger.sh;"), ("echo 'echo $string | cut -c ${start_sym}-${end_sym} | logger' " ">> /tmp/long_logger.sh;"), "echo 'i=$(( i + 1 )); done; done;' >> /tmp/long_logger.sh;", "chmod +x /tmp/long_logger.sh;" ) def non_boot_partitions(self, volumes): for part in filter(lambda p: p["type"] == "partition" and p["mount"] != "/boot", volumes): if part["size"] > 0: yield part def pcount(self, disk_id, increment=0): self._pcount[disk_id] = self._pcount.get(disk_id, 0) + increment return self._pcount.get(disk_id, 0) def psize(self, disk_id, increment=0): self._pend[disk_id] = self._pend.get(disk_id, 0) + increment return self._pend.get(disk_id, 0) def get_partition_count(self, name): count = 0 for disk in self.iterdisks(): count += len([v for v in disk["volumes"] if v.get('name') == name and v['size'] > 0]) return count def num_ceph_journals(self): return self.get_partition_count('cephjournal') def num_ceph_osds(self): return self.get_partition_count('ceph') def erase_partition_table(self): for disk in self.iterdisks(): self.early("test -e {0} && " "dd if=/dev/zero of={0} " "bs=1M count=10".format(self._disk_dev(disk))) self.early("sleep 10") self.early("hdparm -z {0}".format(self._disk_dev(disk))) self.early("parted -s {0} print free".format(self._disk_dev(disk))) def log_lvm(self, line, early=True): func = self.early if not early: func = self.late func("echo \"=== {0} ===\"".format(line)) func("vgs -a --noheadings") func("pvs --noheadings") def erase_lvm_metadata(self, early=True): func = self.early if not early: func = self.late func("for v in $(vgs -a --noheadings 2>/dev/null | " "sed 's/^\([ ]*\)\([^ ]\+\)\(.*\)/\\2/g'); do " "vgreduce --force --removemissing $v; " "vgremove --force $v; done") func("for p in $(pvs --noheadings 2>/dev/null | " "sed 's/^\([ ]*\)\([^ ]\+\)\(.*\)/\\2/g'); do " "pvremove -ff -y $p; done") def _blacklist_udev_rules(self): self.late( "for rules in $(ls -1 /lib/udev/rules.d/*.rules); do " "test -e /etc/udev/rules.d/$(basename $rules) && " "mv /etc/udev/rules.d/$(basename $rules) " "/etc/udev/rules.d/$(basename $rules).bak; " "echo '#' > /etc/udev/rules.d/$(basename $rules); " "done") self.late("udevadm control --reload") def _unblacklist_udev_rules(self): self.late( "for rules in $(ls -1 /lib/udev/rules.d/*.rules); do " "if test -e /etc/udev/rules.d/$(basename $rules).bak; " "then mv /etc/udev/rules.d/$(basename $rules).bak " "/etc/udev/rules.d/$(basename $rules); " "else rm -f /etc/udev/rules.d/$(basename $rules); " "fi; done") self.late("udevadm control --reload") self.late("udevadm trigger") self.late("udevadm settle --quiet") def boot(self): self.recipe("24 24 24 ext3 " "$gptonly{ } " "$bios_boot{ } " "method{ biosgrub } .") self.psize(self.os_disk, 24 * self.factor) self.pcount(self.os_disk, 1) self.late("parted -s $(readlink -f {0}) set {1} bios_grub on".format( self.os_disk, self.pcount(self.os_disk) ) ) self.recipe( "200 200 200 ext3 $primary{ } " "$gptonly{ } " "$bootable{ } method{ format } format{ } use_filesystem{ } " "filesystem{ ext3 } mountpoint{ /boot } .") self.pcount(self.os_disk, 1) self.psize(self.os_disk, 200 * self.factor) def os(self): for vg in [v for v in self.data if v["type"] == "vg" and v["id"] == "os"]: for vol in vg["volumes"]: if vol["mount"] == "swap": swap_size = vol["size"] elif vol["mount"] == "/": root_size = vol["size"] self.recipe("{0} {0} {0} ext4 " "$gptonly{{ }} " "method{{ format }} format{{ }} use_filesystem{{ }} " "filesystem{{ ext4 }} mountpoint{{ / }} ." "".format(root_size)) self.pcount(self.os_disk, 1) self.psize(self.os_disk, root_size * self.factor) self.recipe("{0} {0} {0} linux-swap " "$gptonly{{ }} " "method{{ swap }} format{{ }} .".format(swap_size)) self.pcount(self.os_disk, 1) self.psize(self.os_disk, swap_size * self.factor) """ We need this line because debian-installer takes total disk space for the last partition. So to be able to allocate custom partitions during the late stage we need to create fake swap partition that we then destroy. """ self.recipe("1 1 -1 ext3 $gptonly{ } method{ keep } .") self.late("parted -s {0} print free".format(self.os_disk)) self._umount_target() self.late("parted {0} rm 5".format(self.os_disk)) self.late("sleep 10") self.late("hdparm -z {0}".format(self.os_disk)) self.late("parted -s {0} print free".format(self.os_disk)) self.late("find /dev \( -type l -o -type b \) -exec ls -l {} \;") self._mount_target() def partitions(self): ceph_osds = self.num_ceph_osds() journals_left = ceph_osds ceph_journals = self.num_ceph_journals() self._umount_target() self._blacklist_udev_rules() cephjournal_guid_commands = [] for disk in self.iterdisks(): for part in self.non_boot_partitions(disk["volumes"]): if self.pcount(self._disk_dev(disk)) == 0: self.late("parted -s {0} mklabel gpt".format( self._disk_dev(disk)), udev_settle=True) self.late("parted -a optimal -s {0} " "unit {3} mkpart primary {1} {2}".format( self._disk_dev(disk), self.psize(self._disk_dev(disk)), self.psize(self._disk_dev(disk), 24 * self.factor), self.unit), udev_settle=True) self.late("parted -s {0} set {1} " "bios_grub on".format( self._disk_dev(disk), self.pcount(self._disk_dev(disk), 1)), udev_settle=True) self.late("parted -s {0} print free".format( self._disk_dev(disk))) if part.get('name') == 'cephjournal': # We need to allocate a journal partition for each ceph OSD # Determine the number of journal partitions we need on # each device ratio = math.ceil(float(ceph_osds) / ceph_journals) # No more than 10GB will be allocated to a single # journal partition size = part["size"] / ratio if size > 10240: size = 10240 # This will attempt to evenly spread partitions across # multiple devices e.g. 5 osds with 2 journal devices will # create 3 partitions on the first device and 2 on the # second if ratio < journals_left: end = ratio else: end = journals_left for i in range(0, end): journals_left -= 1 pcount = self.pcount(self._disk_dev(disk), 1) part["pcount"] = pcount self.late( "parted -a optimal -s {0} " "unit {4} mkpart {1} {2} {3}".format( self._disk_dev(disk), self._parttype(pcount), self.psize(self._disk_dev(disk)), self.psize(self._disk_dev(disk), size * self.factor), self.unit), udev_settle=True ) # We don't want to append late command right here # because we need sgdisk to be run in-target so # the target must be mounted. Instead of additional # mounting and unmounting we just collect all those # commands and them run them all at once. cephjournal_guid_commands.append( "sgdisk --typecode={0}:{1} {2}".format( pcount, part["partition_guid"], self._disk_dev(disk) ) ) self.late("parted -s {0} print free".format( self._disk_dev(disk))) continue pcount = self.pcount(self._disk_dev(disk), 1) part["pcount"] = pcount tabmount = part["mount"] if part["mount"] != "swap" else "none" self.late("parted -a optimal -s {0} " "unit {4} mkpart {1} {2} {3}".format( self._disk_dev(disk), self._parttype(pcount), self.psize(self._disk_dev(disk)), self.psize(self._disk_dev(disk), part["size"] * self.factor), self.unit), udev_settle=True) self.late("sleep 10") self.late("hdparm -z {0}" "".format(self._disk_dev(disk))) self.late("parted -s {0} print free".format( self._disk_dev(disk))) self.late( "find /dev \( -type l -o -type b \) -exec ls -l {} \;") self.late("mount") self.late("cat /proc/swaps") self.late("cat /proc/mdstat") self.late("cat /proc/partitions") # clear any fs info that may remain on newly created partition self.late("dd if=/dev/zero of={0}{1}{2} bs=1M count=10" "".format(self._disk_dev(disk), self._pseparator(disk["id"]), pcount)) fs = part.get("file_system", "xfs") if fs not in ("swap", None, "none"): disk_label = self._getlabel(part.get("disk_label")) self.late("mkfs.{0} {1} {2}{3}{4} {5}".format( part.get("file_system", "xfs"), self._fsoptions(part.get("file_system", "xfs")), self._disk_dev(disk), self._pseparator(disk["id"]), pcount, disk_label)) self._unblacklist_udev_rules() self._mount_target() # Partition guids must be set in-target, which requires target to be # mounted. But for cephjournal we have a separate collection of # late commands. for disk in self.iterdisks(): for part in self.non_boot_partitions(disk["volumes"]): if (part.get("partition_guid") and part.get("name") != "cephjournal"): self.late("sgdisk --typecode={0}:{1} {2}" "".format(part["pcount"], part["partition_guid"], self._disk_dev(disk)), True) # This loop appends commands which set cephjournal guids. for command in cephjournal_guid_commands: self.late(command, True) for disk in self.iterdisks(): for part in filter(lambda p: p["type"] == "partition" and p["mount"] != "/boot" and p["size"] > 0 and p.get('name') != 'cephjournal', disk["volumes"]): if not part["mount"] in (None, "none", "swap"): self.late("mkdir -p /target{0}".format(part["mount"])) if not part["mount"] in (None, "none"): self.late("echo 'UUID=$(blkid -s UUID -o value " "{0}{1}{2}) " "{3} {4} {5} 0 0'" " >> /target/etc/fstab" "".format( self._disk_dev(disk), self._pseparator(disk["id"]), part["pcount"], tabmount, part.get("file_system", "xfs"), ("defaults" if part["mount"] != "swap" else "sw"))) def lv(self): self.log_lvm("before creating lvm", False) devices_dict = {} pvlist = [] self._umount_target() self._blacklist_udev_rules() for disk in self.iterdisks(): self.late("parted -s {0} print free".format(self._disk_dev(disk))) for pv in [p for p in disk["volumes"] if p["type"] == "pv" and p["vg"] != "os"]: if pv["size"] <= 0: continue if self.pcount(self._disk_dev(disk)) == 0: # this gonna wait until udev event queue is handled self.late("parted -s {0} mklabel gpt".format( self._disk_dev(disk)), udev_settle=True) self.late("parted -a optimal -s {0} " "unit {3} mkpart primary {1} {2}".format( self._disk_dev(disk), self.psize(self._disk_dev(disk)), self.psize(self._disk_dev(disk), 24 * self.factor), self.unit), udev_settle=True) self.late("parted -s {0} set {1} " "bios_grub on".format( self._disk_dev(disk), self.pcount(self._disk_dev(disk), 1)), udev_settle=True) self.late("parted -s {0} print free".format( self._disk_dev(disk))) pcount = self.pcount(self._disk_dev(disk), 1) begin_size = self.psize(self._disk_dev(disk)) end_size = self.psize(self._disk_dev(disk), pv["size"] * self.factor) self.late("parted -a optimal -s {0} " "unit {4} mkpart {1} {2} {3}".format( self._disk_dev(disk), self._parttype(pcount), begin_size, end_size, self.unit), udev_settle=True) self.late("sleep 10") self.log_lvm("after creating partition", False) self.erase_lvm_metadata(False) self.late("hdparm -z {0}" "".format(self._disk_dev(disk))) self.late("parted -s {0} print free".format( self._disk_dev(disk))) self.late( "find /dev \( -type l -o -type b \) -exec ls -l {} \;") self.late("mount") self.late("cat /proc/swaps") self.late("cat /proc/mdstat") self.late("cat /proc/partitions") pvlist.append("pvcreate -ff {0}{1}{2}" "".format(self._disk_dev(disk), self._pseparator(disk["id"]), pcount)) if not devices_dict.get(pv["vg"]): devices_dict[pv["vg"]] = [] devices_dict[pv["vg"]].append( "{0}{1}{2}" "".format(self._disk_dev(disk), self._pseparator(disk["id"]), pcount) ) self._unblacklist_udev_rules() self.log_lvm("before additional cleaning", False) self.erase_lvm_metadata(False) self.log_lvm("before pvcreate", False) for pvcommand in pvlist: self.late(pvcommand) self.log_lvm("before vgcreate", False) for vg, devs in devices_dict.iteritems(): self.late("vgremove -f {0}".format(vg), udev_settle=True) self.late("vgcreate -s 32m {0} {1}".format(vg, " ".join(devs)), udev_settle=True) self.log_lvm("after vgcreate", False) self._mount_target() for vg in [v for v in self.data if v["type"] == "vg" and v["id"] != "os"]: for lv in vg["volumes"]: if lv["size"] <= 0: continue self.late("lvcreate -L {0}m -Z n -n {1} {2}".format( lv["size"], lv["name"], vg["id"]), udev_settle=True) self.late("sleep 10") self.late("lvscan") tabmount = lv["mount"] if lv["mount"] != "swap" else "none" if ( (lv.get("file_system", "xfs") not in ("swap", None, "none")) and (lv["mount"] not in ("swap", "/")) ): self.late("mkfs.{0} {1} /dev/mapper/{2}-{3}".format( lv.get("file_system", "xfs"), self._fsoptions(lv.get("file_system", "xfs")), vg["id"].replace("-", "--"), lv["name"].replace("-", "--"))) if not lv["mount"] in (None, "none", "swap", "/"): self.late("mkdir -p /target{0}".format(lv["mount"])) if not lv["mount"] in (None, "none", "swap", "/"): self.late("echo '/dev/mapper/{0}-{1} " "{2} {3} {4} 0 0' >> /target/etc/fstab" "".format( vg["id"].replace("-", "--"), lv["name"].replace("-", "--"), tabmount, lv.get("file_system", "xfs"), ("defaults" if lv["mount"] != "swap" else "sw"))) def eval(self): self.early(self.disks_map()) self.late(self.disks_map()) self.log_lvm("before early lvm cleaning") self.erase_lvm_metadata() self.log_lvm("after early lvm cleaning") self.erase_partition_table() self.boot() self.os() self.partitions() self.erase_lvm_metadata() self.lv() self.late("apt-get install -y grub-pc", True) self.late( "sed -i " "-e '$a\ ' " "-e '$a\#Disable the waiting " "for user input if the last boot failed' " "-e '$a\GRUB_RECORDFAIL_TIMEOUT=$GRUB_TIMEOUT' /etc/default/grub", True) self.late("sed -i " "-e 's/.*GRUB_TERMINAL.*/GRUB_TERMINAL=console/g' " "-e 's/.*GRUB_GFXMODE.*/#GRUB_GFXMODE=640x480/g' " "-e 's/.*GRUB_CMDLINE_LINUX.*/" "GRUB_CMDLINE_LINUX=\" {0} \"/g' /etc/default/grub".format( self.kernel_params), True) self._umount_target() self._mount_target() self.late("grub-mkconfig", True) self.late("grub-mkdevicemap", True) for disk in self.iterdisks(): self.late("grub-install {0}" "".format(self._disk_dev(disk)), True) self.late("update-grub", True) self.late("find /dev \( -type l -o -type b \) -exec ls -l {} \;") def expose_recipe(self): return " \\\n".join(self.recipe()) def expose_late(self, gzip=False): result = "" for line, in_target in self.late(): line_to_append = "{0}{1}".format( ("in-target " if in_target else ""), line) result += ("echo '{0}' | /tmp/long_logger.sh;\\\n" "".format(re.sub("'", "'\"'\"'", line_to_append))) result += line_to_append + " 2>&1 | /tmp/long_logger.sh;\\\n" return result.rstrip() def expose_early(self): result = "" for line in self._long_logger(): result += "{0}\\\n".format(line) for line in self.early(): line_to_append = "{0}".format(line) result += ("echo '{0}' | /tmp/long_logger.sh;\\\n" "".format(re.sub("'", "'\"'\"'", line_to_append))) result += line_to_append + " 2>&1 | /tmp/long_logger.sh;\\\n" return result.rstrip() def expose_disks(self): return self.os_disk def pm(data): pmanager = PManager(data) pmanager.eval() return pmanager.expose() example = """ [ { "name": "sda", "free_space": 101772, "volumes": [ { "type": "boot", "size": 300 }, { "mount": "/boot", "type": "raid", "size": 200 }, { "type": "lvm_meta_pool", "size": 0 }, { "size": 12352, "type": "pv", "lvm_meta_size": 64, "vg": "os" }, { "size": 89548, "type": "pv", "lvm_meta_size": 64, "vg": "image" } ], "type": "disk", "id": "disk/by-path/pci-0000:00:06.0-scsi-0:0:0:0", "size": 102400 }, { "name": "sdb", "free_space": 101772, "volumes": [ { "type": "boot", "size": 300 }, { "mount": "/boot", "type": "raid", "size": 200 }, { "type": "lvm_meta_pool", "size": 64 }, { "size": 0, "type": "pv", "lvm_meta_size": 0, "vg": "os" }, { "size": 101836, "type": "pv", "lvm_meta_size": 64, "vg": "image" } ], "type": "disk", "id": "disk/by-path/pci-0000:00:06.0-scsi-0:0:1:0", "size": 102400 }, { "min_size": 12288, "type": "vg", "id": "os", "volumes": [ { "mount": "/", "type": "lv", "name": "root", "size": 10240 }, { "mount": "swap", "type": "lv", "name": "swap", "size": 2048 } ], "label": "Base System" }, { "min_size": 5120, "type": "vg", "id": "image", "volumes": [ { "mount": "/var/lib/glance", "type": "lv", "name": "glance", "size": 191256 } ], "label": "Image Storage" } ] """ # pmanager = PreseedPManager(example) # pmanager.eval() # print pmanager.expose_late() def default_volume_filter(volume): """Default volume filter. Always return True.""" return True
# Copyright 2011-2012 OpenStack Foundation # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. from oslo_config import cfg from oslo_log import log as logging from oslo_serialization import jsonutils import webob.exc from glance.api import policy from glance.common import wsgi import glance.context from glance.i18n import _, _LW context_opts = [ cfg.BoolOpt('owner_is_tenant', default=True, help=_(""" Set the image owner to tenant or the authenticated user. Assign a boolean value to determine the owner of an image. When set to True, the owner of the image is the tenant. When set to False, the owner of the image will be the authenticated user issuing the request. Setting it to False makes the image private to the associated user and sharing with other users within the same tenant (or "project") requires explicit image sharing via image membership. Possible values: * True * False Related options: * None """)), cfg.StrOpt('admin_role', default='admin', help=_(""" Role used to identify an authenticated user as administrator. Provide a string value representing a Keystone role to identify an administrative user. Users with this role will be granted administrative privileges. The default value for this option is 'admin'. Possible values: * A string value which is a valid Keystone role Related options: * None """)), cfg.BoolOpt('allow_anonymous_access', default=False, help=_(""" Allow limited access to unauthenticated users. Assign a boolean to determine API access for unathenticated users. When set to False, the API cannot be accessed by unauthenticated users. When set to True, unauthenticated users can access the API with read-only privileges. This however only applies when using ContextMiddleware. Possible values: * True * False Related options: * None """)), cfg.IntOpt('max_request_id_length', default=64, min=0, help=_(""" Limit the request ID length. Provide an integer value to limit the length of the request ID to the specified length. The default value is 64. Users can change this to any ineteger value between 0 and 16384 however keeping in mind that a larger value may flood the logs. Possible values: * Integer value between 0 and 16384 Related options: * None """)), ] CONF = cfg.CONF CONF.register_opts(context_opts) LOG = logging.getLogger(__name__) class BaseContextMiddleware(wsgi.Middleware): def process_response(self, resp): try: request_id = resp.request.context.request_id except AttributeError: LOG.warn(_LW('Unable to retrieve request id from context')) else: # For python 3 compatibility need to use bytes type prefix = b'req-' if isinstance(request_id, bytes) else 'req-' if not request_id.startswith(prefix): request_id = prefix + request_id resp.headers['x-openstack-request-id'] = request_id return resp class ContextMiddleware(BaseContextMiddleware): def __init__(self, app): self.policy_enforcer = policy.Enforcer() super(ContextMiddleware, self).__init__(app) def process_request(self, req): """Convert authentication information into a request context Generate a glance.context.RequestContext object from the available authentication headers and store on the 'context' attribute of the req object. :param req: wsgi request object that will be given the context object :raises: webob.exc.HTTPUnauthorized: when value of the X-Identity-Status header is not 'Confirmed' and anonymous access is disallowed """ if req.headers.get('X-Identity-Status') == 'Confirmed': req.context = self._get_authenticated_context(req) elif CONF.allow_anonymous_access: req.context = self._get_anonymous_context() else: raise webob.exc.HTTPUnauthorized() def _get_anonymous_context(self): kwargs = { 'user': None, 'tenant': None, 'roles': [], 'is_admin': False, 'read_only': True, 'policy_enforcer': self.policy_enforcer, } return glance.context.RequestContext(**kwargs) def _get_authenticated_context(self, req): service_catalog = None if req.headers.get('X-Service-Catalog') is not None: try: catalog_header = req.headers.get('X-Service-Catalog') service_catalog = jsonutils.loads(catalog_header) except ValueError: raise webob.exc.HTTPInternalServerError( _('Invalid service catalog json.')) request_id = req.headers.get('X-Openstack-Request-ID') if request_id and (0 < CONF.max_request_id_length < len(request_id)): msg = (_('x-openstack-request-id is too long, max size %s') % CONF.max_request_id_length) return webob.exc.HTTPRequestHeaderFieldsTooLarge(comment=msg) kwargs = { 'owner_is_tenant': CONF.owner_is_tenant, 'service_catalog': service_catalog, 'policy_enforcer': self.policy_enforcer, 'request_id': request_id, } ctxt = glance.context.RequestContext.from_environ(req.environ, **kwargs) # FIXME(jamielennox): glance has traditionally lowercased its roles. # This was related to bug #1010519 where at least the admin role was # case insensitive. This seems to no longer be the case and should be # fixed. ctxt.roles = [r.lower() for r in ctxt.roles] if CONF.admin_role.strip().lower() in ctxt.roles: ctxt.is_admin = True return ctxt class UnauthenticatedContextMiddleware(BaseContextMiddleware): def process_request(self, req): """Create a context without an authorized user.""" kwargs = { 'user': None, 'tenant': None, 'roles': [], 'is_admin': True, } req.context = glance.context.RequestContext(**kwargs)
# -*- coding: utf-8 -*- import json import yaml import pytest from unittest import TestCase from lain_sdk.yaml.parser import ( LainConf, ProcType, Proc, just_simple_scale, render_resource_instance_meta, DEFAULT_SYSTEM_VOLUMES, DOMAIN, MIN_SETUP_TIME, MAX_SETUP_TIME, MIN_KILL_TIMEOUT, MAX_KILL_TIMEOUT ) FIXTURES_EXTRA_DOMAINS = ['extra.domain1.com', 'extra.domain2.org'] class LainConfUtilsTests(TestCase): def test_just_simple_scale(self): assert just_simple_scale('cpu', Proc) assert not just_simple_scale('cmd', Proc) class LainConfTests(TestCase): def test_lain_conf_without_appname(self): meta_yaml = ''' build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test web: cmd: hello port: 80 env: - ENV_A=enva - ENV_B=envb volumes: - /data - /var/lib/mysql notify: slack: "#hello" ''' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() with pytest.raises(Exception) as e: hello_conf.load(meta_yaml, meta_version, None) assert 'invalid lain conf: no appname' in str(e.value) def test_lain_conf_smoke(self): meta_yaml = ''' appname: hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test web: cmd: hello port: 80 memory: 64m env: - ENV_A=enva - ENV_B=envb volumes: - /data - /var/lib/mysql web.bar: cmd: bar port: 8080 mountpoint: - a.com - b.cn/xyz https_only: false worker.foo: cmd: worker memory: 128m notify: slack: "#hello" ''' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() hello_conf.load(meta_yaml, meta_version, None) assert hello_conf.appname == 'hello' assert hello_conf.procs['web'].env == ['ENV_A=enva', 'ENV_B=envb'] assert hello_conf.procs['web'].memory == '64m' assert hello_conf.procs['web'].user == '' assert hello_conf.procs['web'].working_dir == '' assert hello_conf.procs['web'].dns_search == ['hello.lain'] assert hello_conf.procs['web'].volumes == ['/data', '/var/lib/mysql'] assert hello_conf.procs['web'].port[80].port == 80 assert hello_conf.procs['web'].stateful is False assert hello_conf.procs['foo'].memory == '128m' assert hello_conf.procs['foo'].cmd == ['worker'] assert hello_conf.procs['foo'].type == ProcType.worker assert hello_conf.procs['bar'].cmd == ['bar'] assert hello_conf.procs['bar'].type == ProcType.web assert hello_conf.procs['bar'].mountpoint == ['a.com', 'b.cn/xyz'] assert hello_conf.procs['bar'].https_only is False def test_lain_conf_notify_slack(self): meta_yaml = ''' appname: hello build: base: golang script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh web: cmd: hello port: 80 notify: slack: "#hello" ''' repo_name = 'lain/hello' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() hello_conf.load(meta_yaml, repo_name, meta_version) assert hello_conf.appname == 'hello' assert hello_conf.notify == {'slack': '#hello'} def test_lain_conf_notify_missing(self): meta_yaml = ''' appname: hello build: base: golang script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh web: cmd: hello port: 80 ''' repo_name = 'lain/hello' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() hello_conf.load(meta_yaml, repo_name, meta_version) assert hello_conf.appname == 'hello' assert hello_conf.notify == {} def test_lain_conf_empty_cmd(self): meta_yaml = ''' appname: hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test web: cmd: notify: slack: "#hello" ''' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() hello_conf.load(meta_yaml, meta_version, None) assert hello_conf.appname == 'hello' assert hello_conf.procs['web'].port[80].port == 80 assert hello_conf.procs['web'].cmd == [] def test_lain_conf_port_with_type(self): meta_yaml = ''' appname: hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test web: cmd: hello port: 80:tcp env: - ENV_A=enva - ENV_B=envb volumes: - /data - /var/lib/mysql notify: slack: "#hello" ''' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() hello_conf.load(meta_yaml, meta_version, None) assert hello_conf.appname == 'hello' assert hello_conf.procs['web'].env == ['ENV_A=enva', 'ENV_B=envb'] assert hello_conf.procs['web'].volumes == ['/data', '/var/lib/mysql'] assert hello_conf.procs['web'].logs == [] assert hello_conf.procs['web'].port[80].port == 80 def test_lain_conf_without_logs(self): meta_yaml = ''' appname: hello build: base: golang web: volumes: - /data - /var/lib/mysql ''' repo_name = 'lain/hello' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() hello_conf.load(meta_yaml, repo_name, meta_version) assert hello_conf.appname == 'hello' assert hello_conf.procs['web'].volumes == ['/data', '/var/lib/mysql'] assert hello_conf.procs['web'].logs == [] def test_lain_conf_logs(self): meta_yaml = ''' appname: hello build: base: golang web: volumes: - /data - /var/lib/mysql logs: - a.log - b.log - a.log ''' repo_name = 'lain/hello' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() hello_conf.load(meta_yaml, repo_name, meta_version) assert hello_conf.appname == 'hello' assert hello_conf.procs['web'].volumes == [ '/data', '/var/lib/mysql', '/lain/logs'] assert hello_conf.procs['web'].logs == ['a.log', 'b.log'] annotation = json.loads(hello_conf.procs['web'].annotation) assert annotation['logs'] == ['a.log', 'b.log'] def test_lain_conf_port_with_type_but_toomuch(self): meta_yaml = ''' appname: hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test web: cmd: hello port: 80:tcp:foo env: - ENV_A=enva - ENV_B=envb volumes: - /data - /var/lib/mysql notify: slack: "#hello" ''' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() with pytest.raises(Exception) as e: hello_conf.load(meta_yaml, meta_version, None) assert 'not supported port desc 80:tcp:foo' in str(e.value) def test_lain_conf_port_with_type_in_property_list(self): meta_yaml = ''' appname: hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test web: cmd: hello port: {80: ['type:tcp']} env: - ENV_A=enva - ENV_B=envb volumes: - /data - /var/lib/mysql notify: slack: "#hello" ''' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() hello_conf.load(meta_yaml, meta_version, None) assert hello_conf.appname == 'hello' assert hello_conf.procs['web'].env == ['ENV_A=enva', 'ENV_B=envb'] assert hello_conf.procs['web'].volumes == ['/data', '/var/lib/mysql'] assert hello_conf.procs['web'].port[80].port == 80 def test_lain_conf_port_webtype_without_port_meta(self): meta_yaml = ''' appname: hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test web: cmd: hello env: - ENV_A=enva - ENV_B=envb volumes: - /data - /var/lib/mysql notify: slack: "#hello" ''' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() hello_conf.load(meta_yaml, meta_version, None) assert hello_conf.appname == 'hello' assert hello_conf.procs['web'].env == ['ENV_A=enva', 'ENV_B=envb'] assert hello_conf.procs['web'].volumes == ['/data', '/var/lib/mysql'] assert hello_conf.procs['web'].port[80].port == 80 def test_lain_conf_proc_name(self): meta_yaml = ''' appname: hello build: base: golang script: [go build -o hello] release: dest_base: ubuntu copy: - {dest: /usr/bin/hello, src: hello} test: script: [go test] web.web1: cmd: hello port: 80 cpu: 1 mountpoint: - a.foo notify: {slack: '#hello'} ''' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() hello_conf.load(meta_yaml, meta_version, None) self.assertEquals(hello_conf.appname, 'hello') self.assertEquals(hello_conf.procs['web1'].cpu, 1) self.assertEquals(hello_conf.procs['web1'].port[80].port, 80) def test_lain_conf_dup_proc_name(self): meta_yaml = ''' appname: hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test web: cmd: hello port: 80 env: - ENV_A=enva - ENV_B=envb volumes: - /data - /var/lib/mysql proc.web: type: web cmd: hello port: 80 notify: slack: "#hello" ''' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() with pytest.raises(Exception) as e: hello_conf.load(meta_yaml, meta_version, None) assert 'duplicated proc name web' in str(e.value) def test_lain_conf_proc_type(self): meta_yaml = ''' appname: hello build: base: golang script: [go build -o hello] release: dest_base: ubuntu copy: - {dest: /usr/bin/hello, src: hello} test: script: [go test] proc.mailer: {type: worker, cmd: hello, port: 80, memory: 128m} notify: {slack: '#hello'} ''' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() hello_conf.load(meta_yaml, meta_version, None) self.assertEquals(hello_conf.appname, 'hello') self.assertEquals(hello_conf.procs['mailer'].type, ProcType.worker) self.assertEquals(hello_conf.procs['mailer'].memory, '128m') self.assertEquals(hello_conf.procs['mailer'].port[80].port, 80) def test_lain_conf_proc_env_and_volumes_null(self): meta_yaml = ''' appname: hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test web: cmd: hello port: 80 env: volumes: notify: slack: "#hello" ''' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() hello_conf.load(meta_yaml, meta_version, None) assert hello_conf.appname == 'hello' assert hello_conf.procs['web'].env == [] assert hello_conf.procs['web'].volumes == [] assert hello_conf.procs['web'].port[80].port == 80 def test_lain_conf_proc_secret_files(self): meta_yaml = ''' appname: hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test web: cmd: hello port: 80 secret_files: - "hello/hello.tex" - " /secret" - /hello notify: slack: "#hello" ''' repo_name = 'lain/hello' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() hello_conf.load(meta_yaml, repo_name, meta_version) assert hello_conf.appname == 'hello' assert hello_conf.procs['web'].env == [] assert hello_conf.procs['web'].volumes == [] assert hello_conf.procs['web'].port[80].port == 80 assert hello_conf.procs['web'].secret_files_bypass == False assert hello_conf.procs['web'].secret_files == [ '/lain/app/hello/hello.tex', '/lain/app/ /secret', '/hello'] def test_lain_conf_proc_secret_files_bypass(self): meta_yaml = ''' appname: hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test web: cmd: hello port: 80 secret_files_bypass: True secret_files: - "hello/hello.tex" - " /secret" - /hello notify: slack: "#hello" ''' repo_name = 'lain/hello' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() hello_conf.load(meta_yaml, repo_name, meta_version) assert hello_conf.appname == 'hello' assert hello_conf.procs['web'].env == [] assert hello_conf.procs['web'].volumes == [] assert hello_conf.procs['web'].port[80].port == 80 assert hello_conf.procs['web'].secret_files_bypass == True assert hello_conf.procs['web'].secret_files == [ '/lain/app/hello/hello.tex', '/lain/app/ /secret', '/hello'] def test_lain_conf_proc_env_notexists(self): meta_yaml = ''' appname: hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test web: cmd: hello port: 80 notify: slack: "#hello" ''' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() hello_conf.load(meta_yaml, meta_version, None) assert hello_conf.appname == 'hello' assert hello_conf.procs['web'].env == [] assert hello_conf.procs['web'].volumes == [] assert hello_conf.procs['web'].port[80].port == 80 def test_lain_conf_proc_patch(self): meta_yaml = ''' appname: hello build: base: golang script: [go build -o hello] release: dest_base: ubuntu copy: - {dest: /usr/bin/hello, src: hello} test: script: [go test] proc.mailer: {type: worker, cmd: hello, port: 80, memory: 128m} notify: {slack: '#hello'} ''' payload = { "cpu": 2, "memory": "64m", "num_instances": 2, "cmd": "hello world", "port": 8080 } meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() hello_conf.load(meta_yaml, meta_version, None) mailer = hello_conf.procs['mailer'] assert mailer.cpu == 0 assert mailer.memory == "128m" assert mailer.num_instances == 1 assert mailer.cmd == ["hello"] assert mailer.port[80].port == 80 mailer.patch(payload) mailer = hello_conf.procs['mailer'] assert mailer.cpu == 2 assert mailer.memory == "64m" assert mailer.num_instances == 2 assert mailer.cmd == ["hello", "world"] assert mailer.port[8080].port == 8080 def test_lain_conf_proc_patch_only_simple_scale_meta(self): meta_old = { "memory": "32m", "num_instances": 1, "cmd": "hello", "port": 80 } meta_new = { "cpu": 2, "memory": "64m", "num_instances": 2, "cmd": "hello world", "port": 8080 } proc = Proc() proc.load('web', meta_old, 'hello', '111111111-aaaaaaaaaaaaaaaaa', None) proc1 = Proc() proc1.load('web', meta_new, 'hello', '22222222-bbbbbbbbbbbbbbbbb', None) assert proc.name == 'web' assert proc.type.name == 'web' assert proc.cpu == 0 assert proc.memory == "32m" assert proc.cmd == ["hello"] assert proc.num_instances == 1 assert proc.port[80].port == 80 proc.patch_only_simple_scale_meta(proc1) assert proc.name == 'web' assert proc.type.name == 'web' assert proc.cpu == 2 assert proc.memory == "64m" assert proc.cmd == ["hello"] assert proc.num_instances == 2 assert proc.port[80].port == 80 def test_lain_conf_auto_insert_default_mountpoint_for_procname_web(self): meta_yaml = ''' appname: hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test web: cmd: hello port: 80 memory: 64m env: - ENV_A=enva - ENV_B=envb volumes: - /data - /var/lib/mysql notify: slack: "#hello" ''' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() hello_conf.load(meta_yaml, meta_version, None) assert hello_conf.appname == 'hello' assert hello_conf.procs['web'].env == ['ENV_A=enva', 'ENV_B=envb'] assert hello_conf.procs['web'].memory == '64m' assert hello_conf.procs['web'].volumes == ['/data', '/var/lib/mysql'] assert hello_conf.procs['web'].port[80].port == 80 my_mountpoint = hello_conf.procs['web'].mountpoint expect_mountpoint = [ "%s.%s" % (hello_conf.appname, DOMAIN), "%s.lain" % hello_conf.appname, ] # resource instance test resource_instance_meta_yaml = ''' appname: resource.demo-service.hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test service.echo: image: regsitry.lain.local/demo-service:release-1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc cmd: ./echo -p 1234 port: 1234 num_instances: 3 portal: allow_clients: "hello" image: regsitry.lain.local/demo-service:release-1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc cmd: ./proxy port: 4321 web: cmd: hello port: 80 memory: 64m env: - ENV_A=enva - ENV_B=envb volumes: - /data - /var/lib/mysql notify: slack: "#demo-service" ''' meta_version = '1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc' domains = [DOMAIN] + FIXTURES_EXTRA_DOMAINS r_conf = LainConf() r_conf.load(resource_instance_meta_yaml, meta_version, None, domains=domains) assert r_conf.appname == 'resource.demo-service.hello' assert r_conf.procs['web'].env == ['ENV_A=enva', 'ENV_B=envb'] assert r_conf.procs['web'].memory == '64m' assert r_conf.procs['web'].volumes == ['/data', '/var/lib/mysql'] assert r_conf.procs['web'].port[80].port == 80 app_domain = 'hello.demo-service.resource' assert r_conf.procs['web'].mountpoint == ["%s.%s" % (app_domain, DOMAIN)] + \ ["%s.%s" % (app_domain, d) for d in FIXTURES_EXTRA_DOMAINS] + \ ["%s.lain" % app_domain] def test_lain_conf_no_mountpoint_for_not_web_type_proc(self): meta_yaml = ''' appname: hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test worker: cmd: worker memory: 64m notify: slack: "#hello" ''' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() hello_conf.load(meta_yaml, meta_version, None) assert hello_conf.appname == 'hello' assert hello_conf.procs['worker'].memory == '64m' assert hello_conf.procs['worker'].mountpoint == [] # resource instance test resource_instance_meta_yaml = ''' appname: resource.demo-service.hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test service.echo: image: regsitry.lain.local/demo-service:release-1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc cmd: ./echo -p 1234 port: 1234 num_instances: 3 portal: allow_clients: "hello" image: regsitry.lain.local/demo-service:release-1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc cmd: ./proxy port: 4321 worker: cmd: worker memory: 64m notify: slack: "#demo-service" ''' repo_name = 'resource.demo-service.hello' meta_version = '1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc' r_conf = LainConf() r_conf.load(resource_instance_meta_yaml, repo_name, meta_version) assert r_conf.appname == 'resource.demo-service.hello' assert r_conf.procs['echo'].mountpoint == [] assert r_conf.procs['worker'].memory == '64m' assert r_conf.procs['worker'].mountpoint == [] def test_lain_conf_auto_prefix_default_mountpoint_for_proctype_web(self): meta_yaml = ''' appname: hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test web: cmd: hello port: 80 memory: 64m mountpoint: - /web - a.foo - c.com/y/z web.admin: cmd: admin port: 80 mountpoint: - /admin notify: slack: "#hello" ''' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() hello_conf.load(meta_yaml, meta_version, None, domains=[ DOMAIN] + FIXTURES_EXTRA_DOMAINS) assert hello_conf.appname == 'hello' my_mountpoint = hello_conf.procs['web'].mountpoint expect_mountpoint = ['a.foo', 'c.com/y/z', '%s.%s' % (hello_conf.appname, DOMAIN), '%s.lain' % hello_conf.appname, '%s.%s/web' % (hello_conf.appname, DOMAIN), '%s.lain/web' % hello_conf.appname ] for extra_domain in FIXTURES_EXTRA_DOMAINS: expect_mountpoint.append('%s.%s' % ( hello_conf.appname, extra_domain)) expect_mountpoint.append('%s.%s/web' % (hello_conf.appname, extra_domain)) my_mountpoint.sort() expect_mountpoint.sort() assert my_mountpoint == expect_mountpoint my_mountpoint1 = hello_conf.procs['admin'].mountpoint expect_mountpoint1 = [ '%s.%s/admin' % (hello_conf.appname, DOMAIN), '%s.lain/admin' % hello_conf.appname ] for extra_domain in FIXTURES_EXTRA_DOMAINS: expect_mountpoint1.append('%s.%s/admin' % (hello_conf.appname, extra_domain)) my_mountpoint1.sort() expect_mountpoint1.sort() assert my_mountpoint1 == expect_mountpoint1 # resource instance test resource_instance_meta_yaml = ''' appname: resource.demo-service.hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test service.echo: image: regsitry.lain.local/demo-service:release-1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc cmd: ./echo -p 1234 port: 1234 num_instances: 3 portal: allow_clients: "hello" image: regsitry.lain.local/demo-service:release-1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc cmd: ./proxy port: 4321 web: cmd: hello port: 80 memory: 64m mountpoint: - /web - a.foo - c.com/y/z web.admin: cmd: admin port: 80 mountpoint: - /admin notify: slack: "#demo-service" ''' repo_name = 'resource.demo-service.hello' meta_version = '1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc' r_conf = LainConf() r_conf.load(resource_instance_meta_yaml, repo_name, meta_version) assert r_conf.appname == 'resource.demo-service.hello' my_mountpoint = r_conf.procs['web'].mountpoint app_domain = 'hello.demo-service.resource' expect_mountpoint = ['a.foo', 'c.com/y/z', '%s.%s' % (app_domain, DOMAIN), '%s.lain' % app_domain, '%s.%s/web' % (app_domain, DOMAIN), '%s.lain/web' % app_domain ] my_mountpoint.sort() expect_mountpoint.sort() assert my_mountpoint == expect_mountpoint my_mountpoint1 = r_conf.procs['admin'].mountpoint expect_mountpoint1 = [ '%s.%s/admin' % (app_domain, DOMAIN), '%s.lain/admin' % app_domain ] my_mountpoint1.sort() expect_mountpoint1.sort() assert my_mountpoint1 == expect_mountpoint1 def test_lain_conf_auto_append_default_mountpoint_for_procname_web(self): meta_yaml = ''' appname: hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test web: cmd: hello port: 80 memory: 64m mountpoint: - a.foo - a.foo/search - b.foo.bar/x - c.com/y/z notify: slack: "#hello" ''' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() hello_conf.load(meta_yaml, meta_version, None, domains=[ DOMAIN] + FIXTURES_EXTRA_DOMAINS) assert hello_conf.appname == 'hello' my_mountpoint = hello_conf.procs['web'].mountpoint expect_mountpoint = ['a.foo', 'a.foo/search', 'b.foo.bar/x', 'c.com/y/z', '%s.%s' % (hello_conf.appname, DOMAIN), '%s.lain' % hello_conf.appname ] expect_mountpoint += ['%s.%s' % (hello_conf.appname, d) for d in FIXTURES_EXTRA_DOMAINS] my_mountpoint.sort() expect_mountpoint.sort() assert my_mountpoint == expect_mountpoint # resource instance test resource_instance_meta_yaml = ''' appname: resource.demo-service.hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test service.echo: image: regsitry.lain.local/demo-service:release-1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc cmd: ./echo -p 1234 port: 1234 num_instances: 3 portal: allow_clients: "hello" image: regsitry.lain.local/demo-service:release-1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc cmd: ./proxy port: 4321 web: cmd: hello port: 80 memory: 64m mountpoint: - a.foo - a.foo/search - b.foo.bar/x - c.com/y/z notify: slack: "#demo-service" ''' repo_name = 'resource.demo-service.hello' meta_version = '1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc' r_conf = LainConf() r_conf.load(resource_instance_meta_yaml, repo_name, meta_version) assert r_conf.appname == 'resource.demo-service.hello' app_domain = 'hello.demo-service.resource' my_mountpoint = r_conf.procs['web'].mountpoint expect_mountpoint = ['a.foo', 'a.foo/search', 'b.foo.bar/x', 'c.com/y/z', '%s.%s' % (app_domain, DOMAIN), '%s.lain' % app_domain ] my_mountpoint.sort() expect_mountpoint.sort() assert my_mountpoint == expect_mountpoint def test_lain_conf_no_mountpoint_for_web_type_but_name_is_not_web_proc_should_raise_exception(self): meta_yaml = ''' appname: hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test web.foo: cmd: foo memory: 64m notify: slack: "#hello" ''' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() with pytest.raises(Exception) as e: hello_conf.load(meta_yaml, meta_version, None) assert 'proc (type is web but name is not web) should have own mountpoint.' in str( e.value) # resource instance test resource_instance_meta_yaml = ''' appname: resource.demo-service.hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test service.echo: image: regsitry.lain.local/demo-service:release-1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc cmd: ./echo -p 1234 port: 1234 num_instances: 3 portal: allow_clients: "hello" image: regsitry.lain.local/demo-service:release-1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc cmd: ./proxy port: 4321 web.foo: cmd: foo memory: 64m notify: slack: "#demo-service" ''' repo_name = 'resource.demo-service.hello' meta_version = '1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc' r_conf = LainConf() with pytest.raises(Exception) as e: r_conf.load(meta_yaml, repo_name, meta_version) assert 'proc (type is web but name is not web) should have own mountpoint.' in str( e.value) def test_lain_conf_service_abbreviation(self): meta_yaml = ''' appname: hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test service.echo: cmd: ./echo -p 1234 port: 1234 num_instances: 3 portal: allow_clients: "**" cmd: ./proxy port: 4321 notify: slack: "#hello" ''' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() hello_conf.load(meta_yaml, meta_version, None) assert hello_conf.appname == 'hello' assert hello_conf.procs['echo'].port[1234].port == 1234 assert hello_conf.procs['echo'].type == ProcType.worker assert hello_conf.procs['portal-echo'].port[4321].port == 4321 assert hello_conf.procs['portal-echo'].type == ProcType.portal def test_lain_conf_service_full_definition(self): meta_yaml = ''' appname: hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test proc.echo: cmd: ./echo -p 1234 port: 1234 num_instances: 3 portal.portal-echo: service_name: echo allow_clients: "**" cmd: ./proxy port: 4321 notify: slack: "#hello" ''' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() hello_conf.load(meta_yaml, meta_version, None) assert hello_conf.appname == 'hello' assert hello_conf.procs['echo'].port[1234].port == 1234 assert hello_conf.procs['echo'].type == ProcType.worker assert hello_conf.procs['portal-echo'].port[4321].port == 4321 assert hello_conf.procs['portal-echo'].type == ProcType.portal def test_lain_conf_use_services_smoke(self): meta_yaml = ''' appname: echo-client build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test use_services: echo-server: - echo1 - echo2 bark-server: - bark1 proc.echo-client: cmd: ./ping echo1 echo2 bark1 -p 4321 ''' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' echoclient_conf = LainConf() echoclient_conf.load(meta_yaml, meta_version, None) assert echoclient_conf.appname == 'echo-client' assert echoclient_conf.use_services == { 'echo-server': ["echo1", "echo2"], 'bark-server': ["bark1"] } assert echoclient_conf.procs['echo-client'].type == ProcType.worker def test_lain_conf_resource_instance_abbreviation(self): meta_yaml = ''' appname: resource.demo-service.hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test service.echo: image: regsitry.lain.local/demo-service:release-1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc cmd: ./echo -p 1234 port: 1234 num_instances: 3 portal: allow_clients: "hello" image: regsitry.lain.local/demo-service:release-1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc cmd: ./proxy port: 4321 notify: slack: "#demo-service" ''' meta_version = '1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc' r_conf = LainConf() r_conf.load(meta_yaml, meta_version, None) assert r_conf.appname == 'resource.demo-service.hello' assert r_conf.procs['echo'].port[1234].port == 1234 assert r_conf.procs['echo'].type == ProcType.worker assert r_conf.procs[ 'echo'].image == "regsitry.lain.local/demo-service:release-1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc" assert r_conf.procs['portal-echo'].port[4321].port == 4321 assert r_conf.procs['portal-echo'].type == ProcType.portal assert r_conf.procs[ 'portal-echo'].image == "regsitry.lain.local/demo-service:release-1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc" def test_lain_conf_resource_instance_full_definition(self): meta_yaml = ''' appname: resource/demo-service/hello build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test proc.echo: image: regsitry.lain.local/demo-service:release-1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc cmd: ./echo -p 1234 port: 1234 num_instances: 3 portal.portal-echo: service_name: echo allow_clients: "hello" image: regsitry.lain.local/demo-service:release-1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc cmd: ./proxy port: 4321 notify: slack: "#demo-service" ''' repo_name = 'resource/demo-service/hello' meta_version = '1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc' r_conf = LainConf() r_conf.load(meta_yaml, meta_version, None) assert r_conf.appname == 'resource/demo-service/hello' assert r_conf.procs['echo'].port[1234].port == 1234 assert r_conf.procs['echo'].type == ProcType.worker assert r_conf.procs[ 'echo'].image == "regsitry.lain.local/demo-service:release-1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc" assert r_conf.procs['portal-echo'].port[4321].port == 4321 assert r_conf.procs['portal-echo'].type == ProcType.portal assert r_conf.procs['portal-echo'].service_name == 'echo' assert r_conf.procs['portal-echo'].allow_clients == 'hello' assert r_conf.procs[ 'portal-echo'].image == "regsitry.lain.local/demo-service:release-1428553798-7142797e64bb7b4d057455ef13de6be156ae81cc" def test_lain_conf_use_resources_smoke(self): meta_yaml = ''' appname: echo-client build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test use_resources: echo-server: memory: 128M cpu: 2 services: - echo1 - echo2 bark-server: services: - bark1 proc.echo-client: cmd: ./ping echo1 echo2 bark1 -p 4321 ''' repo_name = 'echo-client' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' echoclient_conf = LainConf() echoclient_conf.load(meta_yaml, meta_version, None) assert echoclient_conf.appname == 'echo-client' assert echoclient_conf.use_resources == { 'echo-server': { 'services': ["echo1", "echo2"], 'context': { 'cpu': 2, 'memory': '128M' } }, 'bark-server': { 'services': ["bark1"], 'context': {} } } assert echoclient_conf.procs['echo-client'].type == ProcType.worker def test_lain_conf_default_system_volumes(self): meta_yaml = ''' appname: echo-client build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test use_resources: echo-server: memory: 128M cpu: 2 services: - echo1 - echo2 bark-server: services: - bark1 proc.echo-client: cmd: ./ping echo1 echo2 bark1 -p 4321 ''' repo_name = 'echo-client' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' echoclient_conf = LainConf() echoclient_conf.load(meta_yaml, repo_name, meta_version) assert echoclient_conf.appname == 'echo-client' for proc in echoclient_conf.procs.values(): assert proc.system_volumes == DEFAULT_SYSTEM_VOLUMES def test_lain_conf_cloud_volumes_multi_type(self): meta_yaml = ''' appname: hello build: base: golang prepare: - echo prepare1 script: - echo buildscript1 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test web: cmd: hello port: 80 memory: 64m cloud_volumes: dirs: - /data - /var/lib/mysql ''' repo_name = 'hello' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' echoclient_conf = LainConf() echoclient_conf.load(meta_yaml, repo_name, meta_version) assert echoclient_conf.appname == 'hello' assert echoclient_conf.procs['web'].cloud_volumes.get( 'multi') == ['/data', '/var/lib/mysql'] print echoclient_conf.procs['web'].cloud_volumes def test_lain_conf_cloud_volumes_single_type(self): meta_yaml = ''' appname: hello build: base: golang prepare: - echo prepare1 script: - echo buildscript1 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh test: script: - go test web: cmd: hello port: 80 memory: 64m cloud_volumes: type: single dirs: - /data - /var/lib/mysql ''' repo_name = 'hello' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' echoclient_conf = LainConf() echoclient_conf.load(meta_yaml, repo_name, meta_version) assert echoclient_conf.appname == 'hello' assert echoclient_conf.procs['web'].cloud_volumes.get('multi') == None assert echoclient_conf.procs['web'].cloud_volumes.get( 'single') == ['/data', '/var/lib/mysql'] print echoclient_conf.procs['web'].cloud_volumes def test_lain_conf_volume_backup(self): meta_yaml = ''' appname: echo-client build: base: golang prepare: - echo prepare1 - echo prepare2 script: - echo buildscript1 - echo buildscript2 release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello - src: entry.sh dest: /entry.sh proc.echo-client: cmd: ./ping echo1 echo2 bark1 -p 4321 volumes: - /etc/hello: backup_full: schedule: "* 1 * * *" expire: 30d pre_run: backup.sh post_run: end.sh backup_increment: schedule: "0 1 * * *" expire: 3d pre_run: backup.sh post_run: end.sh - /data/backupfile: backup_full: schedule: "* 1 * * *" expire: 30d pre_run: backup.sh post_run: end.sh ''' repo_name = 'echo-client' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' echoclient_conf = LainConf() echoclient_conf.load(meta_yaml, repo_name, meta_version) assert len(echoclient_conf.procs['echo-client'].backup) == 3 for backup_info in echoclient_conf.procs['echo-client'].backup: assert backup_info['procname'] == 'echo-client.worker.echo-client' if backup_info['volume'] == "/data/backupfile": assert backup_info['volume'] == "/data/backupfile" assert backup_info['schedule'] == "* 1 * * *" assert backup_info['expire'] == "30d" assert backup_info['preRun'] == "backup.sh" assert backup_info['postRun'] == "end.sh" assert backup_info['mode'] == "full" elif backup_info['volume'] == "/etc/hello": assert backup_info['volume'] == "/etc/hello" assert backup_info['preRun'] == "backup.sh" assert backup_info['postRun'] == "end.sh" if backup_info['mode'] == 'increment': assert backup_info['schedule'] == "0 1 * * *" assert backup_info['expire'] == "3d" assert backup_info['mode'] == "increment" else: assert backup_info['schedule'] == "* 1 * * *" assert backup_info['expire'] == "30d" assert backup_info['mode'] == "full" def test_lain_conf_setuptime_and_killtimeout(self): meta_yaml = ''' appname: hello build: base: golang web: cmd: test ''' repo_name = 'lain/hello' meta_version = '1428553798.443334-7142797e64bb7b4d057455ef13de6be156ae81cc' hello_conf = LainConf() hello_conf.load(meta_yaml, repo_name, meta_version) assert hello_conf.procs['web'].setup_time == MIN_SETUP_TIME assert hello_conf.procs['web'].kill_timeout == MIN_KILL_TIMEOUT meta_yaml = ''' appname: hello build: base: golang web: cmd: test setup_time: 2342 kill_timeout: 1 ''' hello_conf.load(meta_yaml, repo_name, meta_version) assert hello_conf.procs['web'].setup_time == MAX_SETUP_TIME assert hello_conf.procs['web'].kill_timeout == MIN_KILL_TIMEOUT meta_yaml = ''' appname: hello build: base: golang web: cmd: test setup_time: 10 kill_timeout: 20 ''' hello_conf.load(meta_yaml, repo_name, meta_version) assert hello_conf.procs['web'].setup_time == 10 assert hello_conf.procs['web'].kill_timeout == 20 REDIS_CLIENT_META = ''' appname: hello build: base: golang script: - go build -o hello release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello use_resources: redis: memory: 128M services: - redis web: cmd: /hello env: - REDIS_ADDR: redis:3333 ''' REDIS_CLIENT_META_VERSION = '1439365341-06e92b4456116ad5e6875c8c34797d22156d44a5' REDIS_RESOURCE_META = ''' appname: redis apptype: resource build: base: golang script: - go build -o hello release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello service.redis: cmd: redis -p 3333 port: 3333 memory: "{{ memory|default('64M') }}" portal: image: myregistry.lain.org/proxy:release-1234567-abc cmd: ./proxy ''' REDIS_RESOURCE_META_VERSION = '1439365340-06e92b4456116ad5e6875c8c34797d22156d44a5' MYSQL_CLIENT_META = ''' appname: hello build: base: golang script: - go build -o hello release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello use_resources: mysql: memory: 128M num_instances: 2 services: - mysqld web: cmd: /hello env: - MYSQL_ADDR: mysqld:3309 ''' MYSQL_CLIENT_META_VERSION = '1439365342-06e92b4456116ad5e6875c8c34797d22156d44a5' MYSQL_RESOURCE_META = ''' appname: mysql apptype: resource build: base: golang script: - go build -o hello release: dest_base: ubuntu copy: - src: hello dest: /usr/bin/hello worker.mysqld: image: mysql:5.6 cmd: mysqld {{ memory|default('64M') }} port: 3306 num_instances: "{{ num_instances|default(1)|int(1) }}" memory: "{{ memory|default('64M') }}" portal.mysqlproxy: service_name: mysqld image: myregistry.lain.org/proxy:release-1234567-abc cmd: mysqlproxy port: 3309 ''' MYSQL_RESOURCE_META_VERSION = '1439365343-06e92b4456116ad5e6875c8c34797d22156d44a5' def test_resource_instance_meta_render_abbreviation(): resource_appname = 'redis' resource_meta_version = REDIS_RESOURCE_META_VERSION resource_meta_template = REDIS_RESOURCE_META client_appname = 'hello' client_meta = REDIS_CLIENT_META client_meta_version = REDIS_CLIENT_META_VERSION registry = 'registry.lain.local' domain = 'lain.local' hello_config = LainConf() hello_config.load(client_meta, client_meta_version, None, registry=registry, domain=domain) context = hello_config.use_resources[resource_appname]['context'] resource_instance_meta = render_resource_instance_meta( resource_appname, resource_meta_version, resource_meta_template, client_appname, context, registry, domain ) resource_default_image = '{}/{}:release-{}'.format( registry, resource_appname, resource_meta_version ) resource_instance_yaml = yaml.safe_load(resource_instance_meta) assert not resource_instance_yaml.has_key('apptye') resource_instance_config = LainConf() resource_instance_config.load(resource_instance_meta, resource_meta_version, resource_default_image, registry=registry, domain=domain, ) assert resource_instance_config.appname == 'resource.redis.hello' redis_proc = resource_instance_config.procs['redis'] assert redis_proc.memory == '128M' assert redis_proc.image == resource_default_image portalredis_proc = resource_instance_config.procs['portal-redis'] assert portalredis_proc.image == 'myregistry.lain.org/proxy:release-1234567-abc' def test_resource_instance_meta_render_full(): resource_appname = 'mysql' resource_meta_version = MYSQL_RESOURCE_META_VERSION resource_meta_template = MYSQL_RESOURCE_META client_appname = 'hello' client_meta = MYSQL_CLIENT_META client_meta_version = MYSQL_CLIENT_META_VERSION registry = 'registry.lain.local' domain = 'lain.local' hello_config = LainConf() hello_config.load(client_meta, client_meta_version, None, registry=registry, domain=domain) context = hello_config.use_resources[resource_appname]['context'] resource_instance_meta = render_resource_instance_meta( resource_appname, resource_meta_version, resource_meta_template, client_appname, context, registry, domain ) resource_default_image = '{}/{}:release-{}'.format( registry, resource_appname, resource_meta_version ) resource_instance_yaml = yaml.safe_load(resource_instance_meta) assert not resource_instance_yaml.has_key('apptye') resource_instance_config = LainConf() resource_instance_config.load(resource_instance_meta, resource_meta_version, None, registry=registry, domain=domain, ) assert resource_instance_config.appname == 'resource.mysql.hello' mysqld_proc = resource_instance_config.procs['mysqld'] assert mysqld_proc.memory == '128M' assert mysqld_proc.num_instances == 2 assert mysqld_proc.image == 'mysql:5.6' assert mysqld_proc.cmd == ['mysqld', '128M'] mysqlproxy_proc = resource_instance_config.procs['mysqlproxy'] assert mysqlproxy_proc.image == 'myregistry.lain.org/proxy:release-1234567-abc' def test_build_section_with_old_prepare(old_prepare_yaml): app_meta_version = '123456-abcdefg' app_conf = LainConf() app_conf.load(old_prepare_yaml, 'console', app_meta_version, domains=['registry.lain.local', 'lain.local']) assert app_conf.build.base == 'sunyi00/centos-python:1.0.0' assert app_conf.build.script == ['( pip install -r pip-req.txt )'] assert app_conf.build.build_arg == ['ARG1=arg1', 'ARG2=arg2'] assert app_conf.build.prepare.version == "0" assert app_conf.build.prepare.keep == [] assert app_conf.build.prepare.script == [ '( touch /sbin/modprobe && chmod +x /sbin/modprobe )', '( pip install -r pip-req.txt )', '( rm -rf /lain/app/* )', '( ls -1 | xargs rm -rf )' ] assert not app_conf.procs['web'].stateful def test_build_section_with_new_prepare(new_prepare_yaml): app_meta_version = '123456-abcdefg' app_conf = LainConf() app_conf.load(new_prepare_yaml, 'console', app_meta_version, domains=['registry.lain.local', 'lain.local']) assert app_conf.build.base == 'sunyi00/centos-python:1.0.0' assert app_conf.build.script == ['( pip install -r pip-req.txt )'] assert app_conf.build.build_arg == ['ARG1=arg1', 'ARG2=arg2'] assert app_conf.build.prepare.version == "0" assert app_conf.build.prepare.keep == [ 'node_modules', 'bundle' ] assert app_conf.build.prepare.script == [ '( touch /sbin/modprobe && chmod +x /sbin/modprobe )', '( pip install -r pip-req.txt )', '( rm -rf /lain/app/* )', '( ls -1 | grep -v \'\\bnode_modules\\b\' | grep -v \'\\bbundle\\b\' | xargs rm -rf )' ] assert app_conf.procs['web'].stateful def test_proc_section_with_healthcheck(healthcheck_yaml): app_meta_version = '123456-abcdefg' app_conf = LainConf() app_conf.load(healthcheck_yaml, 'console', app_meta_version, domains=['registry.lain.local', 'lain.local']) assert app_conf.build.base == 'sunyi00/centos-python:1.0.0' assert app_conf.build.script == ['( pip install -r pip-req.txt )'] assert app_conf.build.prepare.version == "0" assert app_conf.build.prepare.keep == [ 'node_modules', 'bundle' ] assert app_conf.build.prepare.script == [ '( touch /sbin/modprobe && chmod +x /sbin/modprobe )', '( pip install -r pip-req.txt )', '( rm -rf /lain/app/* )', '( ls -1 | grep -v \'\\bnode_modules\\b\' | grep -v \'\\bbundle\\b\' | xargs rm -rf )' ] annotation = json.loads(app_conf.procs['web'].annotation) assert annotation['healthcheck'] == '/kg/health/check' assert app_conf.procs['web'].healthcheck == '/kg/health/check' def test_release(release_yaml): app_meta_version = '123456-abcdefg' app_conf = LainConf() app_conf.load(release_yaml, 'release', app_meta_version, domains=['registry.lain.local', 'lain.local']) assert app_conf.release.copy == [ {'dest': '/usr/bin/hello', 'src': 'hello'}, {'dest': 'hi', 'src': 'hi'}]
from unittest import TestCase, main import datetime from random import choice, randint from string import ascii_letters from uuid import UUID from amgut.lib.data_access.ag_data_access import AGDataAccess from amgut.lib.util import rollback class TestAGDataAccess(TestCase): def setUp(self): self.ag_data = AGDataAccess() def tearDown(self): del self.ag_data def test_authenticateWebAppUser(self): # Test right pass but non-existant kit ID obs = self.ag_data.authenticateWebAppUser('randomkitID', 'test') self.assertEqual(obs, False) kit_id = 'tst_xfphP' # Test wrong password obs = self.ag_data.authenticateWebAppUser(kit_id, 'wrongPass') self.assertEqual(obs, False) # Test corect password obs = self.ag_data.authenticateWebAppUser(kit_id, 'test') self.assertTrue(isinstance(obs, dict)) self.assertEqual(obs['ag_login_id'], 'ded5101d-cafb-f6b3-e040-8a80115d6f03') def test_check_login_exists(self): email = 'Reallylongemailthatshouldntexist@someplacenotreal.com' obs = self.ag_data.check_login_exists(email) self.assertEqual(obs, None) email = 'REMOVED' obs = self.ag_data.check_login_exists(email) as_uuid = UUID(obs) self.assertTrue(as_uuid.version, 4) def test_addAGLogin(self): # test new user exists = 'EXISTS' while exists is not None: email = ''.join([choice(ascii_letters) for i in range(randint(5, 10))]) domain = ''.join([choice(ascii_letters) for i in range(randint(5, 10))]) new_email = '@'.join([email, domain]) + '.com' exists = self.ag_data.check_login_exists(new_email) # make sure the ag_login_id is a UUID4 string ag_login_id = self.ag_data.addAGLogin( new_email, 'TESTDUDE', '123 fake test street', 'testcity', 'teststate', '1L2 2G3', 'United Kingdom') as_uuid = UUID(ag_login_id) self.assertTrue(as_uuid.version, 4) # test existing user ag_login_id = self.ag_data.addAGLogin( 'TEST@EMAIL.com', 'TESTOTHER', '123 fake test street', 'testcity', 'teststate', '1L2 2G3', 'United Kingdom') obs = self.ag_data.addAGLogin( 'test@EMAIL.com', 'TESTDUDE', '123 fake test street', 'testcity', 'teststate', '1L2 2G3', 'United Kingdom') self.assertEqual(ag_login_id, obs) def test_getAGBarcodeDetails_bad_barcode(self): # test non-existant barcode with self.assertRaises(ValueError): self.ag_data.getAGBarcodeDetails('99') # test existing barcode but not in AG with self.assertRaises(ValueError): self.ag_data.getAGBarcodeDetails('000006232') def test_get_nonconsented_scanned_barcodes(self): obs = self.ag_data.get_nonconsented_scanned_barcodes('tst_KWfyv') exp = ['000027262'] self.assertEqual(obs, exp) def test_getAGBarcodeDetails(self): # test existing AG barcode obs = self.ag_data.getAGBarcodeDetails('000001047') exp = { 'barcode': '000001047', 'status': 'Received', 'ag_kit_id': 'd8592c74-7e35-2135-e040-8a80115d6401', 'name': 'REMOVED', 'participant_name': 'REMOVED-0', 'email': 'REMOVED', 'site_sampled': 'Stool', 'environment_sampled': None, 'sample_date': datetime.date(2013, 3, 28), 'sample_time': datetime.time(23, 25), 'notes': 'REMOVED', 'overloaded': None, 'withdrawn': None, 'other': None, 'moldy': None, 'refunded': None, 'ag_kit_barcode_id': 'd8592c74-7e36-2135-e040-8a80115d6401', 'date_of_last_email': None, 'other_text': 'REMOVED' } self.assertEqual(obs, exp) def test_getAGKitDetails(self): # test non-existant kit with self.assertRaises(ValueError): self.ag_data.getAGKitDetails('IDONTEXI5T') # test existing AG kit obs = self.ag_data.getAGKitDetails('tst_ODmhG') exp = {'ag_kit_id': 'd8592c74-84bb-2135-e040-8a80115d6401', 'supplied_kit_id': 'tst_ODmhG', 'swabs_per_kit': 1, 'verification_email_sent': 'n', 'kit_verification_code': 'f4UjhV4B', 'kit_password': '$2a$12$LiakUCHOpAMvEp9Wxehw5OIlD/TIIP0Bs3blw18' 'ePcmKHWWAePrQ.', 'kit_verified': 'y'} self.assertEqual(obs, exp) def test_get_all_handout_kits(self): obs = self.ag_data.get_all_handout_kits() self.assertTrue(isinstance(obs, list)) self.assertTrue(len(obs) > 0) for kit_id in obs: self.assertRegexpMatches(kit_id, 'tst_[a-zA-Z]{5}') def test_registerHandoutKit_bad_data(self): # run on bad data with self.assertRaises(ValueError): self.ag_data.registerHandoutKit('BAD', 'DATA') def test_registerHandoutKit_bad_idz(self): # run on non-existant login id ag_login_id = '877bb1b5-7352-48bf-a7b1-1248c689b819' kit = self.ag_data.get_all_handout_kits()[0] obs = self.ag_data.registerHandoutKit(ag_login_id, kit) self.assertFalse(obs) # run on non-existant kit_id ag_login_id = 'dc3172b2-792c-4087-8a20-714297821c6a' kit = 'NoTR3AL' obs = self.ag_data.registerHandoutKit(ag_login_id, kit) self.assertFalse(obs) def test_registerHandoutKit(self): # run on real data ag_login_id = 'dc3172b2-792c-4087-8a20-714297821c6a' kit = self.ag_data.get_all_handout_kits()[0] obs = self.ag_data.registerHandoutKit(ag_login_id, kit) self.assertTrue(obs) # make sure kit removed from ag_handout_kits and inserted in ag_kit kits = self.ag_data.get_all_handout_kits() self.assertNotIn(kit, kits) obs = self.ag_data.getAGKitDetails(kit) self.assertEqual(obs['supplied_kit_id'], kit) @rollback def test_deleteAGParticipantSurvey(self): self.ag_data.deleteAGParticipantSurvey( '000fc4cd-8fa4-db8b-e050-8a800c5d02b5', 'REMOVED-0') with self.assertRaises(ValueError): self.ag_data.getConsent('8b2b45bb3390b585') res = self.ag_data.get_withdrawn() today = datetime.datetime.now().date() exp = [['000fc4cd-8fa4-db8b-e050-8a800c5d02b5', 'REMOVED-0', 'REMOVED', today]] self.assertItemsEqual(res, exp) def test_getConsent(self): res = self.ag_data.getConsent("8b2b45bb3390b585") exp = {'date_signed': None, 'assent_obtainer': None, 'age_range': None, 'parent_1_name': 'REMOVED', 'participant_email': 'REMOVED', 'parent_2_name': 'REMOVED', 'ag_login_id': '000fc4cd-8fa4-db8b-e050-8a800c5d02b5', 'deceased_parent': 'false', 'participant_name': 'REMOVED-0', 'survey_id': '8b2b45bb3390b585', 'is_juvenile': False} self.assertEquals(res, exp) def test_getConsentNotPresent(self): with self.assertRaises(ValueError): self.ag_data.getConsent("42") def test_logParticipantSample_badinfo(self): # bad ag_login_id with self.assertRaises(ValueError): self.ag_data.logParticipantSample( '11111111-1111-1111-1111-714297821c6a', '000001047', 'stool', None, datetime.date(2015, 9, 27), datetime.time(15, 54), 'BADNAME', '') def test_logParticipantSample(self): # regular sample ag_login_id = '7732aafe-c4e1-4ae4-8337-6f22704c1064' barcode = '000027376' self.ag_data.logParticipantSample( ag_login_id, barcode, 'Stool', None, datetime.date(2015, 9, 27), datetime.time(15, 54), 'REMOVED-0', '') obs = self.ag_data.getAGBarcodeDetails(barcode) exp = {'status': None, 'ag_kit_id': '5bfa9526-8dbb-492f-937c-bceb6b5a56fe', 'ag_kit_barcode_id': '793dab39-d9bf-4a0f-8d67-f21796e3faae', 'barcode': '000027376', 'site_sampled': 'Stool', 'environment_sampled': None, 'name': 'REMOVED', 'sample_date': datetime.date(2015, 9, 27), 'sample_time': datetime.time(15, 54), 'notes': '', 'overloaded': None, 'withdrawn': None, 'email': 'REMOVED', 'other': None, 'moldy': None, 'participant_name': 'REMOVED-0', 'refunded': None, 'date_of_last_email': None, 'other_text': 'REMOVED' } self.ag_data.deleteSample(barcode, ag_login_id) self.assertEqual(obs, exp) # env sample self.ag_data.logParticipantSample( ag_login_id, barcode, None, 'animal_habitat', datetime.date(2015, 9, 26), datetime.time(15, 00), 'REMOVED', '') obs = self.ag_data.getAGBarcodeDetails(barcode) exp = {'status': None, 'ag_kit_id': '5bfa9526-8dbb-492f-937c-bceb6b5a56fe', 'ag_kit_barcode_id': '793dab39-d9bf-4a0f-8d67-f21796e3faae', 'barcode': '000027376', 'site_sampled': None, 'environment_sampled': 'animal_habitat', 'name': 'REMOVED', 'sample_date': datetime.date(2015, 9, 26), 'sample_time': datetime.time(15, 00), 'notes': '', 'overloaded': None, 'withdrawn': None, 'email': 'REMOVED', 'other': None, 'moldy': None, 'participant_name': None, 'refunded': None, 'date_of_last_email': None, 'other_text': 'REMOVED' } self.ag_data.deleteSample(barcode, ag_login_id) self.assertEqual(obs, exp) def test_getHumanParticipants(self): i = "d8592c74-9694-2135-e040-8a80115d6401" res = self.ag_data.getHumanParticipants(i) exp = ['REMOVED-2', 'REMOVED-0', 'REMOVED-3', 'REMOVED-1'] self.assertItemsEqual(res, exp) def test_getHumanParticipantsNotPresent(self): i = '00000000-0000-0000-0000-000000000000' res = self.ag_data.getHumanParticipants(i) self.assertEqual(res, []) def test_vioscreen_status(self): survey_id = 'eba20dea4f54b997' self.ag_data.updateVioscreenStatus(survey_id, 3) obs = self.ag_data.get_vioscreen_status(survey_id) self.assertEqual(obs, 3) self.ag_data.updateVioscreenStatus(survey_id, None) obs = self.ag_data.get_vioscreen_status(survey_id) self.assertEqual(obs, None) def test_get_vioscreen_status_unknown_survey(self): with self.assertRaises(ValueError): self.ag_data.get_vioscreen_status('SomeRandomSurveyID') def test_getAnimalParticipants(self): i = "ed5ab96f-fe3b-ead5-e040-8a80115d1c4b" res = self.ag_data.getAnimalParticipants(i) exp = ['REMOVED-0'] self.assertItemsEqual(res, exp) def test_getAnimalParticipantsNotPresent(self): i = "00711b0a-67d6-0fed-e050-8a800c5d7570" res = self.ag_data.getAnimalParticipants(i) self.assertEqual(res, []) def test_getParticipantSamples(self): i = "d6b0f287-b9d9-40d4-82fd-a8fd3db6c476" res = self.ag_data.getParticipantSamples(i, "REMOVED-0") exp = [{'status': None, 'sample_time': datetime.time(11, 55), 'notes': 'REMOVED', 'barcode': '000028432', 'sample_date': datetime.date(2015, 6, 7), 'site_sampled': 'Stool'}] self.assertEqual(res, exp) i = "d8592c74-9694-2135-e040-8a80115d6401" res = self.ag_data.getParticipantSamples(i, "REMOVED-0") exp = [{'status': 'Received', 'sample_time': datetime.time(7, 40), 'notes': 'REMOVED', 'barcode': '000016704', 'sample_date': datetime.date(2014, 6, 5), 'site_sampled': 'Stool'}, {'status': 'Received', 'sample_time': datetime.time(11, 30), 'notes': 'REMOVED', 'barcode': '000016705', 'sample_date': datetime.date(2014, 6, 1), 'site_sampled': 'Stool'}, {'status': 'Received', 'sample_time': datetime.time(9, 20), 'notes': 'REMOVED', 'barcode': '000016706', 'sample_date': datetime.date(2014, 6, 8), 'site_sampled': 'Stool'}, {'status': 'Received', 'sample_time': datetime.time(9, 20), 'notes': 'REMOVED', 'barcode': '000016707', 'sample_date': datetime.date(2014, 6, 1), 'site_sampled': 'Stool'}, {'status': 'Received', 'sample_time': datetime.time(22, 0), 'notes': 'REMOVED', 'barcode': '000016708', 'sample_date': datetime.date(2014, 5, 28), 'site_sampled': 'Stool'}, {'status': 'Received', 'sample_time': datetime.time(11, 0), 'notes': 'REMOVED', 'barcode': '000016709', 'sample_date': datetime.date(2014, 5, 29), 'site_sampled': 'Stool'}, {'status': 'Received', 'sample_time': datetime.time(22, 20), 'notes': 'REMOVED', 'barcode': '000016710', 'sample_date': datetime.date(2014, 5, 27), 'site_sampled': 'Stool'}, {'status': 'Received', 'sample_time': datetime.time(8, 0), 'notes': 'REMOVED', 'barcode': '000016711', 'sample_date': datetime.date(2014, 6, 11), 'site_sampled': 'Stool'}, {'status': 'Received', 'sample_time': datetime.time(8, 15), 'notes': 'REMOVED', 'barcode': '000016712', 'sample_date': datetime.date(2014, 6, 2), 'site_sampled': 'Stool'}, {'status': 'Received', 'sample_time': datetime.time(12, 0), 'notes': 'REMOVED', 'barcode': '000016713', 'sample_date': datetime.date(2014, 5, 30), 'site_sampled': 'Stool'}, {'status': None, 'sample_time': datetime.time(19, 30), 'notes': 'REMOVED', 'barcode': '000016496', 'sample_date': datetime.date(2014, 4, 29), 'site_sampled': 'Stool'}, {'status': None, 'sample_time': datetime.time(19, 30), 'notes': 'REMOVED', 'barcode': '000016497', 'sample_date': datetime.date(2014, 4, 29), 'site_sampled': 'Stool'}, {'status': 'Received', 'sample_time': datetime.time(10, 20), 'notes': 'REMOVED', 'barcode': '000004213', 'sample_date': datetime.date(2013, 10, 16), 'site_sampled': 'Stool'}, {'status': 'Received', 'sample_time': datetime.time(9, 50), 'notes': 'REMOVED', 'barcode': '000004214', 'sample_date': datetime.date(2013, 10, 14), 'site_sampled': 'Stool'}, {'status': 'Received', 'sample_time': datetime.time(12, 0), 'notes': 'REMOVED', 'barcode': '000004215', 'sample_date': datetime.date(2013, 10, 13), 'site_sampled': 'Stool'}, {'status': 'Received', 'sample_time': datetime.time(9, 30), 'notes': 'REMOVED', 'barcode': '000004216', 'sample_date': datetime.date(2013, 10, 15), 'site_sampled': 'Stool'}, {'status': 'Received', 'sample_time': datetime.time(14, 25), 'notes': 'REMOVED', 'barcode': '000004218', 'sample_date': datetime.date(2013, 10, 12), 'site_sampled': 'Stool'}, {'status': 'Received', 'sample_time': datetime.time(10, 15), 'notes': 'REMOVED', 'barcode': '000004219', 'sample_date': datetime.date(2013, 10, 17), 'site_sampled': 'Stool'}] self.assertItemsEqual(res, exp) def test_getParticipantSamplesNotPresent(self): i = '00000000-0000-0000-0000-000000000000' res = self.ag_data.getParticipantSamples(i, "REMOVED") self.assertEqual(res, []) def test_getEnvironmentalSamples(self): i = "d6b0f287-b9d9-40d4-82fd-a8fd3db6c476" res = self.ag_data.getEnvironmentalSamples(i) exp = [{'status': None, 'sample_time': datetime.time(21, 45), 'notes': 'REMOVED', 'barcode': '000028433', 'sample_date': datetime.date(2015, 6, 7), 'site_sampled': None}] self.assertItemsEqual(res, exp) def test_getEnvironmentalSamplesNotPresent(self): i = '00000000-0000-0000-0000-000000000000' res = self.ag_data.getEnvironmentalSamples(i) self.assertEqual(res, []) def test_getAvailableBarcodes(self): i = "d8592c74-9694-2135-e040-8a80115d6401" res = self.ag_data.getAvailableBarcodes(i) exp = ['000005628', '000005627', '000005624', '000005625', '000005626', '000004217'] self.assertItemsEqual(res, exp) i = "d6b0f287-b9d9-40d4-82fd-a8fd3db6c476" res = self.ag_data.getAvailableBarcodes(i) exp = ['000028434'] self.assertItemsEqual(res, exp) def test_getAvailableBarcodesNotPresent(self): i = '00000000-0000-0000-0000-000000000000' res = self.ag_data.getAvailableBarcodes(i) self.assertEqual(res, []) def test_verifyKit(self): # Test verifying works kit = self.ag_data._get_unverified_kits()[0] self.ag_data.verifyKit(kit) obs = self.ag_data.getAGKitDetails(kit) self.assertEqual(obs['kit_verified'], 'y') # Test verifying a non-existant kit with self.assertRaises(ValueError): self.ag_data.getAGKitDetails('NOTAREALKITID') def test__get_unverified_kits(self): obs = self.ag_data._get_unverified_kits() self.assertTrue(isinstance(obs, list)) self.assertTrue(len(obs) > 0) for kit_id in obs: self.assertRegexpMatches(kit_id, 'tst_[a-zA-Z]{5}') obs = self.ag_data.getAGKitDetails(kit_id) self.assertEqual(obs['kit_verified'], 'n') def test_handoutCheck(self): # Test proper password for handout # All tests use assertEqual to make sure bool object returned kit = self.ag_data.get_all_handout_kits()[0] obs = self.ag_data.handoutCheck(kit, 'test') self.assertEqual(obs, True) # Test wrong password obs = self.ag_data.handoutCheck(kit, 'badPass') self.assertEqual(obs, False) # Test non-handout kit obs = self.ag_data.handoutCheck('tst_ODmhG', 'test') self.assertEqual(obs, False) obs = self.ag_data.handoutCheck('randomKitID', 'test') self.assertEqual(obs, False) def test_check_access(self): # Has access obs = self.ag_data.check_access('tst_BudVu', '000001047') self.assertEqual(obs, True) # No access obs = self.ag_data.check_access('tst_BudVu', '000001111') self.assertEqual(obs, False) def test_ag_set_pass_change_code(self): # Generate new random code and assign it testcode = ''.join(choice(ascii_letters) for i in range(10)) self.ag_data.ag_set_pass_change_code('REMOVED', 'tst_ULGcr', testcode) # Actually test the code change obs = self.ag_data.ag_verify_kit_password_change_code( 'REMOVED', 'tst_ULGcr', 'SOMELONGTHINGTHATWILLFAIL') self.assertEqual(obs, False) obs = self.ag_data.ag_verify_kit_password_change_code( 'REMOVED', 'tst_ULGcr', testcode) # Using equal to make sure boolean True is returned, not something that # equates to True self.assertEqual(obs, True) # Test giving nonsense email # TODO: make this raise error and test self.ag_data.ag_set_pass_change_code('Fake@notarealemail.com', 'tst_ULGcr', testcode) # Test giving bad skid # TODO: make this raise error and test self.ag_data.ag_set_pass_change_code('REMOVED', 'NOTINTHEDB', testcode) def test_ag_update_kit_password(self): # Generate new pass and make sure is different from current pass newpass = ''.join(choice(ascii_letters) for i in range(randint(8, 15))) auth = self.ag_data.authenticateWebAppUser('tst_ULGcr', newpass) self.assertFalse( auth, msg="Randomly generated password matches existing") # Actually test password change self.ag_data.ag_update_kit_password('tst_ULGcr', newpass) auth = self.ag_data.authenticateWebAppUser('tst_ULGcr', newpass) self.assertTrue(isinstance(auth, dict)) self.assertEqual(auth['ag_login_id'], 'd8592c74-8416-2135-e040-8a80115d6401') # Test giving bad skid # TODO: make this raise error and test self.ag_data.ag_update_kit_password('NOTINTHEDB', newpass) def test_ag_verify_kit_password_change_code(self): # Test actual functionality obs = self.ag_data.ag_verify_kit_password_change_code( 'REMOVED', 'tst_omubN', 'FAIL') # Using assertEqual to make sure boolean False is returned, not # something that equates to False. Same for rest of assertEquals below self.assertEqual(obs, False) # Outside reset time, should fail obs = self.ag_data.ag_verify_kit_password_change_code( 'REMOVED', 'tst_omubN', 'Mw1eY4wWVXpE0cQlvQwS') self.assertEqual(obs, False) # Reset code and make sure it works testcode = ''.join(choice(ascii_letters) for i in range(10)) self.ag_data.ag_set_pass_change_code('REMOVED', 'tst_ULGcr', testcode) obs = self.ag_data.ag_verify_kit_password_change_code( 'REMOVED', 'tst_ULGcr', testcode) self.assertEqual(obs, True) # Test with incorrect kit id obs = self.ag_data.ag_verify_kit_password_change_code( 'REMOVED', 'NOTAREALKITID', 'FAIL') self.assertEqual(obs, False) # Test with incorrect email obs = self.ag_data.ag_verify_kit_password_change_code( 'notreal@fake.com', 'tst_ULGcr', testcode) self.assertEqual(obs, False) def test_getBarcodesByKit(self): res = self.ag_data.getBarcodesByKit('tst_qmhLX') exp = ['000001322'] self.assertItemsEqual(res, exp) def test_getBarcodesByKitNotPresent(self): res = self.ag_data.getBarcodesByKit('42') self.assertEqual(res, []) def test_checkPrintResults(self): obs = self.ag_data.checkPrintResults('tst_oasoR') self.assertFalse(obs) obs = self.ag_data.checkPrintResults('tst_TMYwD') self.assertTrue(obs) def test_checkPrintResults_invalid_ids(self): obs = self.ag_data.checkPrintResults('xxx00112333123---123222') self.assertFalse(obs) obs = self.ag_data.checkPrintResults(':Lfoo:Lbar:Lbaz:Ospam:Leggs') self.assertFalse(obs) def test_get_user_for_kit(self): obs = self.ag_data.get_user_for_kit('tst_IueFX') self.assertEqual('ded5101d-c8e3-f6b3-e040-8a80115d6f03', obs) obs = self.ag_data.get_user_for_kit('tst_esABz') self.assertEqual('d8592c74-8421-2135-e040-8a80115d6401', obs) def test_get_user_for_kit_errors(self): with self.assertRaises(ValueError): self.ag_data.get_user_for_kit('the_fooster') with self.assertRaises(ValueError): self.ag_data.get_user_for_kit('tst_esXXX') def test_get_menu_items(self): obs = self.ag_data.get_menu_items('tst_pDWcB') self.assertEqual(({}, {}, [], True), obs) obs = self.ag_data.get_menu_items('tst_VpQsT') self.assertEqual(({'REMOVED-0': []}, {}, [], True), obs) def test_get_menu_items_errors(self): with self.assertRaises(ValueError): self.ag_data.get_menu_items('tst_esXXX') def test_check_if_consent_exists(self): obs = self.ag_data.check_if_consent_exists( '00711b0a-67d6-0fed-e050-8a800c5d7570', 'REMOVED-42') self.assertTrue(obs) def test_check_if_consent_exists_non_existent_user(self): obs = self.ag_data.check_if_consent_exists( '00711b0a-67d6-0fed-e050-8a800c5d7570', 'REMOVED-111') self.assertFalse(obs) def test_get_user_info(self): obs = self.ag_data.get_user_info('tst_wAhSB') exp = {'address': 'REMOVED', 'ag_login_id': 'd8592c74-84a5-2135-e040-8a80115d6401', 'city': 'REMOVED', 'country': 'REMOVED', 'email': 'REMOVED', 'name': 'REMOVED', 'state': 'REMOVED', 'zip': 'REMOVED'} self.assertEqual(exp, obs) def test_get_user_info_non_existent(self): with self.assertRaises(ValueError): self.ag_data.get_user_info('tst_XX1123') def test_get_barcode_results(self): obs = self.ag_data.get_barcode_results('tst_yCzro') exp = [{'barcode': '000016704', 'participant_name': 'REMOVED-0'}, {'barcode': '000016705', 'participant_name': 'REMOVED-0'}, {'barcode': '000016706', 'participant_name': 'REMOVED-0'}, {'barcode': '000016707', 'participant_name': 'REMOVED-0'}, {'barcode': '000016708', 'participant_name': 'REMOVED-0'}, {'barcode': '000016709', 'participant_name': 'REMOVED-0'}, {'barcode': '000016710', 'participant_name': 'REMOVED-0'}, {'barcode': '000016711', 'participant_name': 'REMOVED-0'}, {'barcode': '000016712', 'participant_name': 'REMOVED-0'}, {'barcode': '000016713', 'participant_name': 'REMOVED-0'}, {'barcode': '000004213', 'participant_name': 'REMOVED-0'}, {'barcode': '000004214', 'participant_name': 'REMOVED-0'}, {'barcode': '000004215', 'participant_name': 'REMOVED-0'}, {'barcode': '000004216', 'participant_name': 'REMOVED-0'}, {'barcode': '000004218', 'participant_name': 'REMOVED-0'}, {'barcode': '000004219', 'participant_name': 'REMOVED-0'}] self.assertItemsEqual(obs, exp) def test_get_barcode_results_non_existant_id(self): with self.assertRaises(ValueError): self.ag_data.get_barcode_results("something that doesn't exist") def test_get_login_info(self): id_ = 'fecebeae-4244-2d78-e040-8a800c5d4f50' exp = [{'ag_login_id': id_, 'email': 'REMOVED', 'name': 'REMOVED', 'address': 'REMOVED', 'city': 'REMOVED', 'state': 'REMOVED', 'zip': 'REMOVED', 'country': 'REMOVED'}] obs = self.ag_data.get_login_info(id_) self.assertEqual(obs, exp) def test_get_login_info_non_existant_id(self): id_ = '00000000-0000-0000-0000-000000000000' with self.assertRaises(ValueError): self.ag_data.get_login_info(id_) def test_get_survey_id(self): id_ = '8ca47059-000a-469f-aa64-ff1afbd6fcb1' obs = self.ag_data.get_survey_id(id_, 'REMOVED-0') self.assertEquals(obs, 'd08758a1510256f0') def test_get_survey_id_non_existant_id(self): id_ = '00000000-0000-0000-0000-000000000000' with self.assertRaises(ValueError): self.ag_data.get_survey_id(id_, 'REMOVED') def test_get_countries(self): obs = self.ag_data.get_countries() # Make sure is a list with proper length self.assertTrue(isinstance(obs, list)) self.assertEqual(len(obs), 244) # Spot check a few countries self.assertIn('United States', obs) self.assertIn('United Kingdom', obs) def test_is_deposited_ebi(self): obs = self.ag_data.is_deposited_ebi('000027262') self.assertFalse(obs) def test_is_deposited_ebi_bad_barcode(self): with self.assertRaises(ValueError): self.ag_data.is_deposited_ebi('NOTABARCODE') if __name__ == "__main__": main()
# -*- coding: utf-8 -*- # Copyright 2014 Metaswitch Networks # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """ felix.test.test_felix ~~~~~~~~~~~ Top level tests for Felix. """ import logging import mock import socket import sys import time import unittest import uuid import calico.felix.futils as futils # Import our stub utils module which replaces time etc. import calico.felix.test.stub_utils as stub_utils # Replace zmq with our stub zmq. import calico.felix.test.stub_zmq as stub_zmq from calico.felix.test.stub_zmq import (TYPE_EP_REQ, TYPE_EP_REP, TYPE_ACL_REQ, TYPE_ACL_SUB) sys.modules['zmq'] = stub_zmq # Hide iptc, since we do not have it. sys.modules['iptc'] = __import__('calico.felix.test.stub_empty') # Replace calico.felix.fiptables with calico.felix.test.stub_fiptables import calico.felix.test.stub_fiptables sys.modules['calico.felix.fiptables'] = __import__('calico.felix.test.stub_fiptables') calico.felix.fiptables = calico.felix.test.stub_fiptables stub_fiptables = calico.felix.test.stub_fiptables #*****************************************************************************# #* Load calico.felix.devices and calico.felix.test.stub_devices, and the *# #* same for ipsets; we do not blindly override as we need to avoid getting *# #* into a state where tests of these modules cannot be made to work. *# #*****************************************************************************# import calico.felix.devices import calico.felix.test.stub_devices as stub_devices import calico.felix.ipsets import calico.felix.test.stub_ipsets as stub_ipsets # Now import felix, and away we go. import calico.felix.felix as felix import calico.felix.endpoint as endpoint import calico.felix.frules as frules import calico.common as common from calico.felix.futils import IPV4, IPV6 from calico.felix.endpoint import Endpoint # IPtables state. expected_iptables = stub_fiptables.TableState() expected_ipsets = stub_ipsets.IpsetState() # Default config path. config_path = "calico/felix/test/data/felix_debug.cfg" # Logger log = logging.getLogger(__name__) class TestBasic(unittest.TestCase): @classmethod def setUpClass(cls): # Completely replace the devices and ipsets modules. cls.real_devices = calico.felix.devices endpoint.devices = stub_devices cls.real_ipsets = calico.felix.ipsets frules.ipsets = stub_ipsets @classmethod def tearDownClass(cls): # Reinstate the modules we overwrote endpoint.devices = cls.real_devices frules.ipsets = cls.real_ipsets def create_patch(self, name): return thing def setUp(self): # Mock out time patcher = mock.patch('calico.felix.futils.time_ms') patcher.start().side_effect = stub_utils.get_time self.addCleanup(patcher.stop) stub_utils.set_time(0) stub_fiptables.reset_current_state() stub_devices.reset() stub_ipsets.reset() expected_iptables.reset() expected_ipsets.reset() def tearDown(self): pass def test_startup(self): common.default_logging() context = stub_zmq.Context() agent = felix.FelixAgent(config_path, context) set_expected_global_rules() stub_fiptables.check_state(expected_iptables) stub_ipsets.check_state(expected_ipsets) self.assertEqual(agent.hostname, "test_hostname") def test_no_work(self): """ Test starting up, and sending no work at all. """ common.default_logging() context = stub_zmq.Context() agent = felix.FelixAgent(config_path, context) context.add_poll_result(0) agent.run() set_expected_global_rules() stub_fiptables.check_state(expected_iptables) stub_ipsets.check_state(expected_ipsets) def test_main_flow(self): """ Test starting up and going through some of the basic flow. """ common.default_logging() context = stub_zmq.Context() agent = felix.FelixAgent(config_path, context) context.add_poll_result(0) agent.run() # Now we want to reply to the RESYNC request. resync_req = context.sent_data[TYPE_EP_REQ].pop() log.debug("Resync request : %s" % resync_req) self.assertFalse(context.sent_data_present()) resync_id = resync_req['resync_id'] resync_rsp = { 'type': "RESYNCSTATE", 'endpoint_count': 1, 'rc': "SUCCESS", 'message': "hello" } poll_result = context.add_poll_result(50) poll_result.add(TYPE_EP_REQ, resync_rsp) agent.run() # Felix expects one endpoint created message - give it what it wants endpoint_id = str(uuid.uuid4()) log.debug("Build first endpoint created : %s" % endpoint_id) mac = stub_utils.get_mac() suffix = endpoint_id[:11] tap = "tap" + suffix addr = '1.2.3.4' endpoint_created_req = { 'type': "ENDPOINTCREATED", 'endpoint_id': endpoint_id, 'resync_id': resync_id, 'issued': futils.time_ms(), 'mac': mac, 'state': Endpoint.STATE_ENABLED, 'addrs': [ {'gateway': "1.2.3.1", 'addr': addr} ] } poll_result = context.add_poll_result(100) poll_result.add(TYPE_EP_REP, endpoint_created_req) agent.run() log.debug("Create tap interface %s" % tap) tap_obj = stub_devices.TapInterface(tap) stub_devices.add_tap(tap_obj) poll_result = context.add_poll_result(150) agent.run() #*********************************************************************# #* As soon as that endpoint has been made to exist, we should see an *# #* ACL request coming through, and a response to the endpoint *# #* created. We send a reply to that now. *# #*********************************************************************# endpoint_created_rsp = context.sent_data[TYPE_EP_REP].pop() self.assertEqual(endpoint_created_rsp['rc'], "SUCCESS") acl_req = context.sent_data[TYPE_ACL_REQ].pop() self.assertFalse(context.sent_data_present()) self.assertEqual(acl_req['endpoint_id'], endpoint_id) acl_rsp = { 'type': "GETACLSTATE", 'rc': "SUCCESS", 'message': "" } poll_result = context.add_poll_result(200) poll_result.add(TYPE_ACL_REQ, acl_rsp) # Check the rules are what we expect. set_expected_global_rules() add_endpoint_rules(suffix, tap, addr, None, mac) stub_fiptables.check_state(expected_iptables) add_endpoint_ipsets(suffix) stub_ipsets.check_state(expected_ipsets) # OK - now try giving it some ACLs, and see if they get applied correctly. acls = get_blank_acls() acls['v4']['outbound'].append({ 'cidr': "0.0.0.0/0", 'protocol': "icmp" }) acls['v4']['outbound'].append({ 'cidr': "1.2.3.0/24", 'protocol': "tcp" }) acls['v4']['outbound'].append({ 'cidr': "0.0.0.0/0", 'protocol': "tcp", 'port': "80" }) acls['v4']['inbound'].append({ 'cidr': "1.2.2.0/24", 'protocol': "icmp" }) acls['v4']['inbound'].append({ 'cidr': "0.0.0.0/0", 'protocol': "tcp", 'port': "8080" }) acls['v4']['inbound'].append({ 'cidr': "2.4.6.8/32", 'protocol': "udp", 'port': "8080" }) acls['v4']['inbound'].append({ 'cidr': "1.2.3.3/32" }) acls['v4']['inbound'].append({ 'cidr': "3.6.9.12/32", 'protocol': "tcp", 'port': ['10', '50'] }) acls['v4']['inbound'].append({ 'cidr': "5.4.3.2/32", 'protocol': "icmp", 'icmp_type': "3", 'icmp_code': "2" }) acls['v4']['inbound'].append({ 'cidr': "5.4.3.2/32", 'protocol': "icmp", 'icmp_type': "9" }) acls['v4']['inbound'].append({ 'cidr': "5.4.3.2/32", 'protocol': "icmp", 'icmp_type': "blah" }) # We include a couple of invalid rules that Felix will just ignore (and log). acls['v4']['inbound'].append({ 'cidr': "4.3.2.1/32", 'protocol': "tcp", 'port': ['blah', 'blah'] }) acls['v4']['inbound'].append({ 'cidr': "4.3.2.1/32", 'protocol': "tcp", 'port': ['1', '2', '3'] }) acls['v4']['inbound'].append({ 'cidr': "4.3.2.1/32", 'protocol': "tcp", 'port': 'flibble' }) acls['v4']['inbound'].append({ 'protocol': "tcp" }) acls['v4']['inbound'].append({ 'cidr': "4.3.2.1/32", 'port': "123" }) acls['v4']['inbound'].append({ 'cidr': "4.3.2.1/32", 'protocol': "icmp", 'icmp_code': "blah" }) acls['v4']['inbound'].append({ 'cidr': "4.3.2.1/32", 'protocol': "icmp", 'port': "1" }) acls['v4']['inbound'].append({ 'cidr': "4.3.2.1/32", 'protocol': "rsvp", 'port': "1" }) acl_req = { 'type': "ACLUPDATE", 'acls': acls } poll_result.add(TYPE_ACL_SUB, acl_req, endpoint_id) agent.run() stub_fiptables.check_state(expected_iptables) expected_ipsets.add("felix-from-icmp-" + suffix, "0.0.0.0/1") expected_ipsets.add("felix-from-icmp-" + suffix, "128.0.0.0/1") expected_ipsets.add("felix-from-port-" + suffix, "1.2.3.0/24,tcp:0") expected_ipsets.add("felix-from-port-" + suffix, "0.0.0.0/1,tcp:80") expected_ipsets.add("felix-from-port-" + suffix, "128.0.0.0/1,tcp:80") expected_ipsets.add("felix-to-icmp-" + suffix, "1.2.2.0/24") expected_ipsets.add("felix-to-port-" + suffix, "0.0.0.0/1,tcp:8080") expected_ipsets.add("felix-to-port-" + suffix, "128.0.0.0/1,tcp:8080") expected_ipsets.add("felix-to-port-" + suffix, "2.4.6.8/32,udp:8080") expected_ipsets.add("felix-to-addr-" + suffix, "1.2.3.3/32") expected_ipsets.add("felix-to-port-" + suffix, "3.6.9.12/32,tcp:10-50") expected_ipsets.add("felix-to-port-" + suffix, "5.4.3.2/32,icmp:3/2") expected_ipsets.add("felix-to-port-" + suffix, "5.4.3.2/32,icmp:9/0") expected_ipsets.add("felix-to-port-" + suffix, "5.4.3.2/32,icmp:blah") stub_ipsets.check_state(expected_ipsets) # Add another endpoint, and check the state. endpoint_id2 = str(uuid.uuid4()) log.debug("Build second endpoint created : %s" % endpoint_id2) mac2 = stub_utils.get_mac() suffix2 = endpoint_id2[:11] tap2 = "tap" + suffix2 addr2 = '1.2.3.5' endpoint_created_req = { 'type': "ENDPOINTCREATED", 'endpoint_id': endpoint_id2, 'issued': futils.time_ms(), 'mac': mac2, 'state': Endpoint.STATE_ENABLED, 'addrs': [ {'gateway': "1.2.3.1", 'addr': addr2} ] } poll_result = context.add_poll_result(250) poll_result.add(TYPE_EP_REP, endpoint_created_req) tap_obj2 = stub_devices.TapInterface(tap2) stub_devices.add_tap(tap_obj2) agent.run() # Check that we got what we expected - i.e. a success response, a GETACLSTATE, # and the rules in the right state. endpoint_created_rsp = context.sent_data[TYPE_EP_REP].pop() self.assertEqual(endpoint_created_rsp['rc'], "SUCCESS") acl_req = context.sent_data[TYPE_ACL_REQ].pop() self.assertEqual(acl_req['endpoint_id'], endpoint_id2) self.assertFalse(context.sent_data_present()) add_endpoint_rules(suffix2, tap2, addr2, None, mac2) stub_fiptables.check_state(expected_iptables) add_endpoint_ipsets(suffix2) stub_ipsets.check_state(expected_ipsets) # OK, finally wind down with an ENDPOINTDESTROYED message for that second endpoint. endpoint_destroyed_req = { 'type': "ENDPOINTDESTROYED", 'endpoint_id': endpoint_id2, 'issued': futils.time_ms() } poll_result = context.add_poll_result(300) poll_result.add(TYPE_EP_REP, endpoint_destroyed_req) stub_devices.del_tap(tap2) agent.run() # Rebuild and recheck the state. set_expected_global_rules() add_endpoint_rules(suffix, tap, addr, None, mac) stub_fiptables.check_state(expected_iptables) def test_rule_reordering(self): # TODO: Want to check that with extra rules, the extras get tidied up. pass def test_ipv6_reordering(self): # TODO: Want to test IP v6 addresses and rules too. pass class TestTimings(unittest.TestCase): @classmethod def setUpClass(cls): # Completely replace the devices and ipsets modules. cls.real_devices = calico.felix.devices endpoint.devices = stub_devices cls.real_ipsets = calico.felix.ipsets frules.ipsets = stub_ipsets @classmethod def tearDownClass(cls): # Reinstate the modules we overwrote endpoint.devices = cls.real_devices frules.ipsets = cls.real_ipsets def setUp(self): # Mock out time patcher = mock.patch('calico.felix.futils.time_ms') patcher.start().side_effect = stub_utils.get_time self.addCleanup(patcher.stop) stub_utils.set_time(0) stub_fiptables.reset_current_state() stub_devices.reset() stub_ipsets.reset() expected_iptables.reset() expected_ipsets.reset() def tearDown(self): pass def test_resync(self): """ Test the resync flows. """ common.default_logging() context = stub_zmq.Context() agent = felix.FelixAgent(config_path, context) #*********************************************************************# #* Set the resync timeout to 5 seconds, and the KEEPALIVE timeout to *# #* much more. *# #*********************************************************************# agent.config.RESYNC_INT_SEC = 5 agent.config.CONN_TIMEOUT_MS = 50000 agent.config.CONN_KEEPALIVE_MS = 50000 # Get started. context.add_poll_result(0) agent.run() # Now we should have got a resync request. resync_req = context.sent_data[TYPE_EP_REQ].pop() log.debug("Resync request : %s" % resync_req) self.assertFalse(context.sent_data_present()) resync_id = resync_req['resync_id'] resync_rsp = { 'type': "RESYNCSTATE", 'endpoint_count': "0", 'rc': "SUCCESS", 'message': "hello" } poll_result = context.add_poll_result(1000) poll_result.add(TYPE_EP_REQ, resync_rsp) agent.run() # nothing yet self.assertFalse(context.sent_data_present()) poll_result = context.add_poll_result(5999) agent.run() # nothing yet - 4999 ms since last request self.assertFalse(context.sent_data_present()) poll_result = context.add_poll_result(6001) agent.run() # We should have got another resync request. resync_req = context.sent_data[TYPE_EP_REQ].pop() log.debug("Resync request : %s" % resync_req) self.assertFalse(context.sent_data_present()) resync_id = resync_req['resync_id'] resync_rsp = { 'type': "RESYNCSTATE", 'endpoint_count': "2", 'rc': "SUCCESS", 'message': "hello" } # No more resyncs until enough data has arrived. poll_result = context.add_poll_result(15000) poll_result.add(TYPE_EP_REQ, resync_rsp) agent.run() self.assertFalse(context.sent_data_present()) # Send an endpoint created message to Felix. endpoint_id = str(uuid.uuid4()) log.debug("Build first endpoint created : %s" % endpoint_id) mac = stub_utils.get_mac() suffix = endpoint_id[:11] tap = "tap" + suffix addr = '1.2.3.4' endpoint_created_req = { 'type': "ENDPOINTCREATED", 'endpoint_id': endpoint_id, 'resync_id': resync_id, 'issued': futils.time_ms(), 'mac': mac, 'state': Endpoint.STATE_ENABLED, 'addrs': [ {'gateway': "1.2.3.1", 'addr': addr} ] } poll_result = context.add_poll_result(15001) poll_result.add(TYPE_EP_REP, endpoint_created_req) agent.run() # We stop using sent_data_present, since there are ACL requests around. endpoint_created_rsp = context.sent_data[TYPE_EP_REP].pop() self.assertEqual(endpoint_created_rsp['rc'], "SUCCESS") self.assertFalse(context.sent_data[TYPE_EP_REQ]) # Send a second endpoint created message to Felix - triggers another resync. endpoint_id = str(uuid.uuid4()) log.debug("Build second endpoint created : %s" % endpoint_id) mac = stub_utils.get_mac() suffix = endpoint_id[:11] tap = "tap" + suffix addr = '1.2.3.5' endpoint_created_req = { 'type': "ENDPOINTCREATED", 'endpoint_id': endpoint_id, 'resync_id': resync_id, 'issued': futils.time_ms(), 'mac': mac, 'state': Endpoint.STATE_ENABLED, 'addrs': [ {'gateway': "1.2.3.1", 'addr': addr} ] } poll_result = context.add_poll_result(15002) poll_result.add(TYPE_EP_REP, endpoint_created_req) agent.run() endpoint_created_rsp = context.sent_data[TYPE_EP_REP].pop() self.assertEqual(endpoint_created_rsp['rc'], "SUCCESS") self.assertFalse(context.sent_data[TYPE_EP_REQ]) # No more resyncs until enough 5000 ms after last rsp. poll_result = context.add_poll_result(20000) poll_result.add(TYPE_EP_REQ, resync_rsp) agent.run() self.assertFalse(context.sent_data[TYPE_EP_REQ]) # We should have got another resync request. poll_result = context.add_poll_result(20003) poll_result.add(TYPE_EP_REP, endpoint_created_req) agent.run() resync_req = context.sent_data[TYPE_EP_REQ].pop() log.debug("Resync request : %s" % resync_req) self.assertFalse(context.sent_data[TYPE_EP_REQ]) def get_blank_acls(): """ Return a blank set of ACLs, with nothing permitted. """ acls = {} acls['v4'] = {} acls['v6'] = {} acls['v4']['inbound_default'] = "deny" acls['v4']['outbound_default'] = "deny" acls['v4']['inbound'] = [] acls['v4']['outbound'] = [] acls['v6']['inbound_default'] = "deny" acls['v6']['outbound_default'] = "deny" acls['v6']['inbound'] = [] acls['v6']['outbound'] = [] return acls def set_expected_global_rules(): """ Sets up the minimal global rules we expect to have. """ expected_iptables.reset() table = expected_iptables.tables_v4["filter"] stub_fiptables.get_chain(table, "felix-TO-ENDPOINT") stub_fiptables.get_chain(table, "felix-FROM-ENDPOINT") stub_fiptables.get_chain(table, "felix-FORWARD") stub_fiptables.get_chain(table, "felix-INPUT") chain = table._chains_dict["FORWARD"] chain.rules.append(stub_fiptables.Rule(IPV4, "felix-FORWARD")) chain = table._chains_dict["INPUT"] chain.rules.append(stub_fiptables.Rule(IPV4, "felix-INPUT")) chain = table._chains_dict["felix-FORWARD"] rule = stub_fiptables.Rule(type, "felix-FROM-ENDPOINT") rule.in_interface = "tap+" chain.rules.append(rule) rule = stub_fiptables.Rule(type, "felix-TO-ENDPOINT") rule.out_interface = "tap+" chain.rules.append(rule) rule = stub_fiptables.Rule(type, "ACCEPT") rule.in_interface = "tap+" chain.rules.append(rule) rule = stub_fiptables.Rule(type, "ACCEPT") rule.out_interface = "tap+" chain.rules.append(rule) chain = table._chains_dict["felix-INPUT"] rule = stub_fiptables.Rule(type, "felix-FROM-ENDPOINT") rule.in_interface = "tap+" chain.rules.append(rule) rule = stub_fiptables.Rule(type, "ACCEPT") rule.in_interface = "tap+" chain.rules.append(rule) table = expected_iptables.tables_v4["nat"] chain = table._chains_dict["PREROUTING"] chain.rules.append(stub_fiptables.Rule(IPV4, "felix-PREROUTING")) chain = stub_fiptables.get_chain(table, "felix-PREROUTING") rule = stub_fiptables.Rule(IPV4) rule.protocol = "tcp" rule.create_tcp_match("80") rule.create_target("DNAT", {'to_destination': '127.0.0.1:9697'}) chain.rules.append(rule) table = expected_iptables.tables_v6["filter"] stub_fiptables.get_chain(table, "felix-TO-ENDPOINT") stub_fiptables.get_chain(table, "felix-FROM-ENDPOINT") stub_fiptables.get_chain(table, "felix-FORWARD") stub_fiptables.get_chain(table, "felix-INPUT") chain = table._chains_dict["FORWARD"] chain.rules.append(stub_fiptables.Rule(IPV6, "felix-FORWARD")) chain = table._chains_dict["INPUT"] chain.rules.append(stub_fiptables.Rule(IPV6, "felix-INPUT")) chain = table._chains_dict["felix-FORWARD"] rule = stub_fiptables.Rule(type, "felix-FROM-ENDPOINT") rule.in_interface = "tap+" chain.rules.append(rule) rule = stub_fiptables.Rule(type, "felix-TO-ENDPOINT") rule.out_interface = "tap+" chain.rules.append(rule) rule = stub_fiptables.Rule(type, "ACCEPT") rule.in_interface = "tap+" chain.rules.append(rule) rule = stub_fiptables.Rule(type, "ACCEPT") rule.out_interface = "tap+" chain.rules.append(rule) chain = table._chains_dict["felix-INPUT"] rule = stub_fiptables.Rule(type, "felix-FROM-ENDPOINT") rule.in_interface = "tap+" chain.rules.append(rule) rule = stub_fiptables.Rule(type, "ACCEPT") rule.in_interface = "tap+" chain.rules.append(rule) def add_endpoint_rules(suffix, tap, ipv4, ipv6, mac): """ This adds the rules for an endpoint, appending to the end. This generates a clean state to allow us to test that the state is correct, even after it starts with extra rules etc. """ table = expected_iptables.tables_v4["filter"] chain = table._chains_dict["felix-FROM-ENDPOINT"] rule = stub_fiptables.Rule(IPV4, "felix-from-%s" % suffix) rule.in_interface = tap chain.rules.append(rule) chain = table._chains_dict["felix-TO-ENDPOINT"] rule = stub_fiptables.Rule(IPV4, "felix-to-%s" % suffix) rule.out_interface = tap chain.rules.append(rule) chain = stub_fiptables.get_chain(table, "felix-from-%s" % suffix) rule = stub_fiptables.Rule(IPV4, "DROP") rule.create_conntrack_match(["INVALID"]) chain.rules.append(rule) rule = stub_fiptables.Rule(IPV4, "RETURN") rule.create_conntrack_match(["RELATED,ESTABLISHED"]) chain.rules.append(rule) rule = stub_fiptables.Rule(IPV4, "RETURN") rule.protocol = "udp" rule.create_udp_match("68", "67") chain.rules.append(rule) if ipv4 is not None: rule = stub_fiptables.Rule(IPV4) rule.create_target("MARK", {"set_mark": "1"}) rule.src = ipv4 rule.create_mac_match(mac) chain.rules.append(rule) rule = stub_fiptables.Rule(IPV4, "DROP") rule.create_mark_match("!1") chain.rules.append(rule) rule = stub_fiptables.Rule(IPV4, "RETURN") rule.create_set_match(["felix-from-port-%s" % suffix, "dst,dst"]) chain.rules.append(rule) rule = stub_fiptables.Rule(IPV4, "RETURN") rule.create_set_match(["felix-from-addr-%s" % suffix, "dst"]) chain.rules.append(rule) rule = stub_fiptables.Rule(IPV4, "RETURN") rule.protocol = "icmp" rule.create_set_match(["felix-from-icmp-%s" % suffix, "dst"]) chain.rules.append(rule) rule = stub_fiptables.Rule(IPV4, "DROP") chain.rules.append(rule) chain = stub_fiptables.get_chain(table, "felix-to-%s" % suffix) rule = stub_fiptables.Rule(IPV4, "DROP") rule.create_conntrack_match(["INVALID"]) chain.rules.append(rule) rule = stub_fiptables.Rule(IPV4, "RETURN") rule.create_conntrack_match(["RELATED,ESTABLISHED"]) chain.rules.append(rule) rule = stub_fiptables.Rule(IPV4, "RETURN") rule.create_set_match(["felix-to-port-%s" % suffix, "src,dst"]) chain.rules.append(rule) rule = stub_fiptables.Rule(IPV4, "RETURN") rule.create_set_match(["felix-to-addr-%s" % suffix, "src"]) chain.rules.append(rule) rule = stub_fiptables.Rule(IPV4, "RETURN") rule.protocol = "icmp" rule.create_set_match(["felix-to-icmp-%s" % suffix, "src"]) chain.rules.append(rule) rule = stub_fiptables.Rule(IPV4, "DROP") chain.rules.append(rule) table = expected_iptables.tables_v6["filter"] chain = table._chains_dict["felix-FROM-ENDPOINT"] rule = stub_fiptables.Rule(IPV6, "felix-from-%s" % suffix) rule.in_interface = tap chain.rules.append(rule) chain = table._chains_dict["felix-TO-ENDPOINT"] rule = stub_fiptables.Rule(IPV6, "felix-to-%s" % suffix) rule.out_interface = tap chain.rules.append(rule) chain = stub_fiptables.get_chain(table, "felix-from-%s" % suffix) rule = stub_fiptables.Rule(type, "RETURN") rule.protocol = "icmpv6" chain.rules.append(rule) rule = stub_fiptables.Rule(IPV6, "DROP") rule.create_conntrack_match(["INVALID"]) chain.rules.append(rule) rule = stub_fiptables.Rule(IPV6, "RETURN") rule.create_conntrack_match(["RELATED,ESTABLISHED"]) chain.rules.append(rule) rule = stub_fiptables.Rule(IPV6, "RETURN") rule.protocol = "udp" rule.create_udp_match("546", "547") chain.rules.append(rule) if ipv6 is not None: rule = stub_fiptables.Rule(IPV6) rule.create_target("MARK", {"set_mark": "1"}) rule.src = ipv6 rule.create_mac_match(mac) chain.rules.append(rule) rule = stub_fiptables.Rule(IPV6, "DROP") rule.create_mark_match("!1") chain.rules.append(rule) rule = stub_fiptables.Rule(IPV6, "RETURN") rule.create_set_match(["felix-6-from-port-%s" % suffix, "dst,dst"]) chain.rules.append(rule) rule = stub_fiptables.Rule(IPV6, "RETURN") rule.create_set_match(["felix-6-from-addr-%s" % suffix, "dst"]) chain.rules.append(rule) rule = stub_fiptables.Rule(IPV6, "RETURN") rule.protocol = "icmpv6" rule.create_set_match(["felix-6-from-icmp-%s" % suffix, "dst"]) chain.rules.append(rule) rule = stub_fiptables.Rule(IPV6, "DROP") chain.rules.append(rule) chain = stub_fiptables.get_chain(table, "felix-to-%s" % suffix) for icmp in ["130", "131", "132", "134", "135", "136"]: rule = stub_fiptables.Rule(futils.IPV6, "RETURN") rule.protocol = "icmpv6" rule.create_icmp6_match([icmp]) chain.rules.append(rule) rule = stub_fiptables.Rule(IPV6, "DROP") rule.create_conntrack_match(["INVALID"]) chain.rules.append(rule) rule = stub_fiptables.Rule(IPV6, "RETURN") rule.create_conntrack_match(["RELATED,ESTABLISHED"]) chain.rules.append(rule) rule = stub_fiptables.Rule(IPV6, "RETURN") rule.create_set_match(["felix-6-to-port-%s" % suffix, "src,dst"]) chain.rules.append(rule) rule = stub_fiptables.Rule(IPV6, "RETURN") rule.create_set_match(["felix-6-to-addr-%s" % suffix, "src"]) chain.rules.append(rule) rule = stub_fiptables.Rule(IPV6, "RETURN") rule.protocol = "icmpv6" rule.create_set_match(["felix-6-to-icmp-%s" % suffix, "src"]) chain.rules.append(rule) rule = stub_fiptables.Rule(IPV6, "DROP") chain.rules.append(rule) def add_endpoint_ipsets(suffix): """ Sets up the ipsets for a given endpoint. Actual entries in these endpoints must then be added manually. """ # Create ipsets if they do not already exist. expected_ipsets.create("felix-to-port-" + suffix, "hash:net,port", "inet") expected_ipsets.create("felix-to-addr-" + suffix, "hash:net", "inet") expected_ipsets.create("felix-to-icmp-" + suffix, "hash:net", "inet") expected_ipsets.create("felix-from-port-" + suffix, "hash:net,port", "inet") expected_ipsets.create("felix-from-addr-" + suffix, "hash:net", "inet") expected_ipsets.create("felix-from-icmp-" + suffix, "hash:net", "inet") expected_ipsets.create("felix-6-to-port-" + suffix, "hash:net,port", "inet6") expected_ipsets.create("felix-6-to-addr-" + suffix, "hash:net", "inet6") expected_ipsets.create("felix-6-to-icmp-" + suffix, "hash:net", "inet6") expected_ipsets.create("felix-6-from-port-" + suffix, "hash:net,port", "inet6") expected_ipsets.create("felix-6-from-addr-" + suffix, "hash:net", "inet6") expected_ipsets.create("felix-6-from-icmp-" + suffix, "hash:net", "inet6")
# -*- coding: utf-8 -*- """ NEEDS CLEANUP SO IT EITHER DOES THE IMPORTS OR GENERATES THE FILE python -c "import utool" """ from __future__ import absolute_import, division, print_function, unicode_literals import sys import multiprocessing import textwrap #import types #DEBUG_IMPORTS = '--debug-imports' in sys.argv #---------- # EXECUTORS #---------- def __excecute_imports(module, modname, imports, verbose=False): """ Module Imports """ # level: -1 is a the Python2 import strategy # level: 0 is a the Python3 absolute import if verbose: print('[UTIL_IMPORT] EXECUTING %d IMPORT TUPLES' % (len(imports),)) level = 0 for name in imports: if level == -1: tmp = __import__(name, globals(), locals(), fromlist=[], level=level) elif level == 0: # FIXME: should support unicode. Maybe just a python2 thing tmp = __import__(modname, globals(), locals(), fromlist=[str(name)], level=level) def __execute_fromimport(module, modname, import_tuples, verbose=False): """ Module From Imports """ if verbose: print('[UTIL_IMPORT] EXECUTING %d FROM IMPORT TUPLES' % (len(import_tuples),)) from_imports = __get_from_imports(import_tuples) for name, fromlist in from_imports: full_modname = '.'.join((modname, name)) tmp = __import__(full_modname, globals(), locals(), fromlist=fromlist, level=0) for attrname in fromlist: setattr(module, attrname, getattr(tmp, attrname)) return from_imports def __execute_fromimport_star(module, modname, import_tuples, ignore_list=[], ignore_startswith=[], ignore_endswith=[], check_not_imported=True, verbose=False, veryverbose=False): r""" Effectively import * statements The dynamic_import must happen before any * imports otherwise it wont catch anything. Ignore: ignore_startswith = [] ignore_endswith = [] check_not_imported = False verbose = True veryverbose = True """ if verbose: print('[UTIL_IMPORT] EXECUTE %d FROMIMPORT STAR TUPLES.' % (len(import_tuples),)) from_imports = [] # Explicitly ignore these special functions (usually stdlib functions) ignoreset = set(['print', 'print_', 'printDBG', 'rrr', 'profile', 'print_function', 'absolute_import', 'division', 'zip', 'map', 'range', 'list', 'zip_longest', 'filter', 'filterfalse', 'dirname', 'realpath', 'join', 'exists', 'normpath', 'splitext', 'expanduser', 'relpath', 'isabs', 'commonprefix', 'basename', 'input', 'reduce', #'OrderedDict', #'product', ] + ignore_list) #'isdir', 'isfile', ' #def is_defined_by_module2(item, module): # belongs = False # if hasattr(item, '__module__'): # belongs = item.__module__ == module.__name__ # elif hasattr(item, 'func_globals'): # belongs = item.func_globals['__name__'] == module.__name__ # return belongs for name, fromlist in import_tuples: #absname = modname + '.' + name child_module = sys.modules[modname + '.' + name] # Check if the variable already belongs to the module varset = set(vars(module)) if check_not_imported else set() fromset = set(fromlist) if fromlist is not None else set() def valid_attrname(attrname): """ Guess if the attrname is valid based on its name """ is_forced = attrname in fromset is_private = attrname.startswith('_') is_conflit = attrname in varset is_module = attrname in sys.modules # Isn't fool proof (next step is) is_ignore1 = attrname in ignoreset is_ignore2 = any([attrname.startswith(prefix) for prefix in ignore_startswith]) is_ignore3 = any([attrname.endswith(suffix) for suffix in ignore_endswith]) is_ignore = any((is_ignore1, is_ignore2, is_ignore3)) is_valid = not any((is_ignore, is_private, is_conflit, is_module)) #is_valid = is_valid and is_defined_by_module2(getattr(child_module, attrname), child_module) return (is_forced or is_valid) allattrs = dir(child_module) fromlist_ = [attrname for attrname in allattrs if valid_attrname(attrname)] #if verbose: # print('[UTIL_IMPORT] name=%r, len(allattrs)=%d' % (name, len(allattrs))) #if verbose: # print('[UTIL_IMPORT] name=%r, len(fromlist_)=%d' % (name, len(fromlist_))) valid_fromlist_ = [] for attrname in fromlist_: attrval = getattr(child_module, attrname) try: # Disallow fromimport modules forced = attrname in fromset if not forced and getattr(attrval, '__name__') in sys.modules: if veryverbose: print('[UTIL_IMPORT] not importing: %r' % attrname) continue except AttributeError: pass if veryverbose: print('[UTIL_IMPORT] %s is importing: %r' % (modname, attrname)) valid_fromlist_.append(attrname) setattr(module, attrname, attrval) if verbose: print('[UTIL_IMPORT] name=%r, len(valid_fromlist_)=%d' % (name, len(valid_fromlist_))) from_imports.append((name, valid_fromlist_)) return from_imports #---------- # PARSERS #---------- def __get_from_imports(import_tuples): """ Returns import names and fromlist import_tuples are specified as (name, fromlist, ispackage) """ from_imports = [(tup[0], tup[1]) for tup in import_tuples if tup[1] is not None and len(tup[1]) > 0] return from_imports #---------- # STRING MAKERS #---------- def _initstr(modname, imports, from_imports, inject_execstr, withheader=True): """ Calls the other string makers """ header = _make_module_header() if withheader else '' import_str = _make_imports_str(imports, modname) fromimport_str = _make_fromimport_str(from_imports, modname) initstr = '\n'.join([str_ for str_ in [ header, import_str, fromimport_str, inject_execstr, ] if len(str_) > 0]) return initstr def _make_module_header(): return '\n'.join([ '# flake8: noqa', 'from __future__ import absolute_import, division, print_function, unicode_literals']) def _make_imports_str(imports, rootmodname='.'): imports_fmtstr = 'from {rootmodname} import %s'.format(rootmodname=rootmodname) return '\n'.join([imports_fmtstr % (name,) for name in imports]) def _make_fromimport_str(from_imports, rootmodname='.'): from utool import util_str if rootmodname == '.': # dot is already taken care of in fmtstr rootmodname = '' def _pack_fromimport(tup): name, fromlist = tup[0], tup[1] from_module_str = 'from {rootmodname}.{name} import ('.format(rootmodname=rootmodname, name=name) newline_prefix = (' ' * len(from_module_str)) if len(fromlist) > 0: rawstr = from_module_str + ', '.join(fromlist) + ',)' else: rawstr = '' # not sure why this isn't 76? >= maybe? packstr = util_str.pack_into(rawstr, textwidth=75, newline_prefix=newline_prefix, break_words=False) return packstr from_str = '\n'.join(map(_pack_fromimport, from_imports)) return from_str def _inject_execstr(modname, import_tuples): """ Injection and Reload String Defs """ if modname == 'utool': # Special case import of the util_inject module injecter = 'util_inject' injecter_import = '' else: # Normal case implicit import of util_inject injecter_import = 'import utool' injecter = 'utool' injectstr_fmt = textwrap.dedent( r''' # STARTBLOCK {injecter_import} print, rrr, profile = {injecter}.inject2(__name__, '[{modname}]') def reassign_submodule_attributes(verbose=1): """ Updates attributes in the __init__ modules with updated attributes in the submodules. """ import sys if verbose and '--quiet' not in sys.argv: print('dev reimport') # Self import import {modname} # Implicit reassignment. seen_ = set([]) for tup in IMPORT_TUPLES: if len(tup) > 2 and tup[2]: continue # dont import package names submodname, fromimports = tup[0:2] submod = getattr({modname}, submodname) for attr in dir(submod): if attr.startswith('_'): continue if attr in seen_: # This just holds off bad behavior # but it does mimic normal util_import behavior # which is good continue seen_.add(attr) setattr({modname}, attr, getattr(submod, attr)) def reload_subs(verbose=1): """ Reloads {modname} and submodules """ if verbose: print('Reloading {modname} submodules') rrr(verbose > 1) def wrap_fbrrr(mod): def fbrrr(*args, **kwargs): """ fallback reload """ if verbose > 0: print('Auto-reload (using rrr) not setup for mod=%r' % (mod,)) return fbrrr def get_rrr(mod): if hasattr(mod, 'rrr'): return mod.rrr else: return wrap_fbrrr(mod) def get_reload_subs(mod): return getattr(mod, 'reload_subs', wrap_fbrrr(mod)) {reload_body} rrr(verbose > 1) try: # hackish way of propogating up the new reloaded submodule attributes reassign_submodule_attributes(verbose=verbose) except Exception as ex: print(ex) rrrr = reload_subs # ENDBLOCK ''') injectstr_fmt = injectstr_fmt.replace('# STARTBLOCK', '') injectstr_fmt = injectstr_fmt.replace('# ENDBLOCK', '') rrrdir_fmt = ' get_reload_subs({modname})(verbose=verbose)' rrrfile_fmt = ' get_rrr({modname})(verbose > 1)' def _reload_command(tup): if len(tup) > 2 and tup[2] is True: return rrrdir_fmt.format(modname=tup[0]) else: return rrrfile_fmt.format(modname=tup[0]) reload_body = '\n'.join(map(_reload_command, import_tuples)).strip() format_dict = { 'modname': modname, 'reload_body': reload_body, 'injecter': injecter, 'injecter_import': injecter_import, } inject_execstr = injectstr_fmt.format(**format_dict).strip() return inject_execstr #---------- # PUBLIC FUNCTIONS #---------- def dynamic_import(modname, import_tuples, developing=True, ignore_froms=[], dump=False, ignore_startswith=[], ignore_endswith=[], ignore_list=[], check_not_imported=True, return_initstr=False, verbose=False): """ MAIN ENTRY POINT Dynamically import listed util libraries and their attributes. Create reload_subs function. Using __import__ like this is typically not considered good style However, it is better than import * and this will generate the good file text that can be used when the module is 'frozen" Returns: str: init_inject_str - by default all imports are executed in this function and only the remainig code needed to be executed is returned to define the reload logic. str, str: init_inject_str, init_str - if return_initstr is True then also returns init_str defining the from imports. Ignore: ignore_startswith = [] ignore_endswith = [] check_not_imported = True verbose = True """ if verbose: print('[UTIL_IMPORT] Running Dynamic Imports for modname=%r ' % modname) # Get the module that will be imported into try: module = sys.modules[modname] except: module = __import__(modname) # List of modules to be imported imports = [tup[0] for tup in import_tuples] # Import the modules __excecute_imports(module, modname, imports, verbose=verbose) # If developing do explicit import stars if developing: from_imports = __execute_fromimport_star(module, modname, import_tuples, ignore_list=ignore_list, ignore_startswith=ignore_startswith, ignore_endswith=ignore_endswith, check_not_imported=check_not_imported, verbose=verbose) else: from_imports = __execute_fromimport(module, modname, import_tuples, verbose=verbose) inject_execstr = _inject_execstr(modname, import_tuples) # If requested: print what the __init__ module should look like dump_requested = (('--dump-%s-init' % modname) in sys.argv or ('--print-%s-init' % modname) in sys.argv) or dump overwrite_requested = ('--update-%s-init' % modname) in sys.argv if verbose: print('[UTIL_IMPORT] Finished Dynamic Imports for modname=%r ' % modname) if dump_requested: is_main_proc = multiprocessing.current_process().name == 'MainProcess' if is_main_proc: from utool import util_str initstr = _initstr(modname, imports, from_imports, inject_execstr) print(util_str.indent(initstr)) # Overwrite the __init__.py file with new explicit imports if overwrite_requested: """ SeeAlso: util_inject.inject_python_code util_str.replace_between_tags """ is_main_proc = multiprocessing.current_process().name == 'MainProcess' if is_main_proc: from utool import util_str from os.path import join, exists initstr = _initstr(modname, imports, from_imports, inject_execstr, withheader=False) new_else = util_str.indent(initstr) #print(new_else) # Get path to init file so we can overwrite it init_fpath = join(module.__path__[0], '__init__.py') print('attempting to update: %r' % init_fpath) assert exists(init_fpath) new_lines = [] editing = False updated = False #start_tag = '# <AUTOGEN_INIT>' #end_tag = '# </AUTOGEN_INIT>' with open(init_fpath, 'r') as file_: #text = file_.read() lines = file_.readlines() for line in lines: if not editing: new_lines.append(line) if line.strip().startswith('# <AUTOGEN_INIT>'): new_lines.append('\n' + new_else + '\n # </AUTOGEN_INIT>\n') editing = True updated = True if line.strip().startswith('# </AUTOGEN_INIT>'): editing = False # TODO: #new_text = util_str.replace_between_tags(text, new_else, start_tag, end_tag) if updated: print('writing updated file: %r' % init_fpath) new_text = ''.join(new_lines) with open(init_fpath, 'w') as file_: file_.write(new_text) else: print('no write hook for file: %r' % init_fpath) if return_initstr: initstr = _initstr(modname, imports, from_imports, '', withheader=False) return inject_execstr, initstr else: return inject_execstr def make_initstr(modname, import_tuples, verbose=False): """ Just creates the string representation. Does no importing. """ imports = [tup[0] for tup in import_tuples] from_imports = __get_from_imports(import_tuples) inject_execstr = _inject_execstr(modname, import_tuples) return _initstr(modname, imports, from_imports, inject_execstr) def make_import_tuples(module_path, exclude_modnames=[]): """ Infer the import_tuples from a module_path """ from utool import util_path kwargs = dict(private=False, full=False) module_list = util_path.ls_modulefiles(module_path, noext=True, **kwargs) package_list = util_path.ls_moduledirs(module_path, **kwargs) exclude_set = set(exclude_modnames) module_import_tuples = [(modname, None) for modname in module_list if modname not in exclude_set] package_import_tuples = [(modname, None, True) for modname in package_list if modname not in exclude_set] import_tuples = (module_import_tuples + package_import_tuples) return import_tuples
# Copyright (c) 2013 OpenStack Foundation # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. """ Helpers for comparing version strings. """ import copy import functools import inspect import logging from oslo_config import cfg import pkg_resources import six from cinder.openstack.common._i18n import _ LOG = logging.getLogger(__name__) CONF = cfg.CONF deprecated_opts = [ cfg.BoolOpt('fatal_deprecations', default=False, help='Enables or disables fatal status of deprecations.'), ] def list_opts(): """Entry point for oslo.config-generator. """ return [(None, copy.deepcopy(deprecated_opts))] class deprecated(object): """A decorator to mark callables as deprecated. This decorator logs a deprecation message when the callable it decorates is used. The message will include the release where the callable was deprecated, the release where it may be removed and possibly an optional replacement. Examples: 1. Specifying the required deprecated release >>> @deprecated(as_of=deprecated.ICEHOUSE) ... def a(): pass 2. Specifying a replacement: >>> @deprecated(as_of=deprecated.ICEHOUSE, in_favor_of='f()') ... def b(): pass 3. Specifying the release where the functionality may be removed: >>> @deprecated(as_of=deprecated.ICEHOUSE, remove_in=+1) ... def c(): pass 4. Specifying the deprecated functionality will not be removed: >>> @deprecated(as_of=deprecated.ICEHOUSE, remove_in=0) ... def d(): pass 5. Specifying a replacement, deprecated functionality will not be removed: >>> @deprecated(as_of=deprecated.ICEHOUSE, in_favor_of='f()', remove_in=0) ... def e(): pass """ # NOTE(morganfainberg): Bexar is used for unit test purposes, it is # expected we maintain a gap between Bexar and Folsom in this list. BEXAR = 'B' FOLSOM = 'F' GRIZZLY = 'G' HAVANA = 'H' ICEHOUSE = 'I' JUNO = 'J' KILO = 'K' LIBERTY = 'L' _RELEASES = { # NOTE(morganfainberg): Bexar is used for unit test purposes, it is # expected we maintain a gap between Bexar and Folsom in this list. 'B': 'Bexar', 'F': 'Folsom', 'G': 'Grizzly', 'H': 'Havana', 'I': 'Icehouse', 'J': 'Juno', 'K': 'Kilo', 'L': 'Liberty', } _deprecated_msg_with_alternative = _( '%(what)s is deprecated as of %(as_of)s in favor of ' '%(in_favor_of)s and may be removed in %(remove_in)s.') _deprecated_msg_no_alternative = _( '%(what)s is deprecated as of %(as_of)s and may be ' 'removed in %(remove_in)s. It will not be superseded.') _deprecated_msg_with_alternative_no_removal = _( '%(what)s is deprecated as of %(as_of)s in favor of %(in_favor_of)s.') _deprecated_msg_with_no_alternative_no_removal = _( '%(what)s is deprecated as of %(as_of)s. It will not be superseded.') def __init__(self, as_of, in_favor_of=None, remove_in=2, what=None): """Initialize decorator :param as_of: the release deprecating the callable. Constants are define in this class for convenience. :param in_favor_of: the replacement for the callable (optional) :param remove_in: an integer specifying how many releases to wait before removing (default: 2) :param what: name of the thing being deprecated (default: the callable's name) """ self.as_of = as_of self.in_favor_of = in_favor_of self.remove_in = remove_in self.what = what def __call__(self, func_or_cls): if not self.what: self.what = func_or_cls.__name__ + '()' msg, details = self._build_message() if inspect.isfunction(func_or_cls): @six.wraps(func_or_cls) def wrapped(*args, **kwargs): report_deprecated_feature(LOG, msg, details) return func_or_cls(*args, **kwargs) return wrapped elif inspect.isclass(func_or_cls): orig_init = func_or_cls.__init__ # TODO(tsufiev): change `functools` module to `six` as # soon as six 1.7.4 (with fix for passing `assigned` # argument to underlying `functools.wraps`) is released # and added to the oslo-incubator requrements @functools.wraps(orig_init, assigned=('__name__', '__doc__')) def new_init(self, *args, **kwargs): report_deprecated_feature(LOG, msg, details) orig_init(self, *args, **kwargs) func_or_cls.__init__ = new_init return func_or_cls else: raise TypeError('deprecated can be used only with functions or ' 'classes') def _get_safe_to_remove_release(self, release): # TODO(dstanek): this method will have to be reimplemented once # when we get to the X release because once we get to the Y # release, what is Y+2? new_release = chr(ord(release) + self.remove_in) if new_release in self._RELEASES: return self._RELEASES[new_release] else: return new_release def _build_message(self): details = dict(what=self.what, as_of=self._RELEASES[self.as_of], remove_in=self._get_safe_to_remove_release(self.as_of)) if self.in_favor_of: details['in_favor_of'] = self.in_favor_of if self.remove_in > 0: msg = self._deprecated_msg_with_alternative else: # There are no plans to remove this function, but it is # now deprecated. msg = self._deprecated_msg_with_alternative_no_removal else: if self.remove_in > 0: msg = self._deprecated_msg_no_alternative else: # There are no plans to remove this function, but it is # now deprecated. msg = self._deprecated_msg_with_no_alternative_no_removal return msg, details def is_compatible(requested_version, current_version, same_major=True): """Determine whether `requested_version` is satisfied by `current_version`; in other words, `current_version` is >= `requested_version`. :param requested_version: version to check for compatibility :param current_version: version to check against :param same_major: if True, the major version must be identical between `requested_version` and `current_version`. This is used when a major-version difference indicates incompatibility between the two versions. Since this is the common-case in practice, the default is True. :returns: True if compatible, False if not """ requested_parts = pkg_resources.parse_version(requested_version) current_parts = pkg_resources.parse_version(current_version) if same_major and (requested_parts[0] != current_parts[0]): return False return current_parts >= requested_parts # Track the messages we have sent already. See # report_deprecated_feature(). _deprecated_messages_sent = {} def report_deprecated_feature(logger, msg, *args, **kwargs): """Call this function when a deprecated feature is used. If the system is configured for fatal deprecations then the message is logged at the 'critical' level and :class:`DeprecatedConfig` will be raised. Otherwise, the message will be logged (once) at the 'warn' level. :raises: :class:`DeprecatedConfig` if the system is configured for fatal deprecations. """ stdmsg = _("Deprecated: %s") % msg CONF.register_opts(deprecated_opts) if CONF.fatal_deprecations: logger.critical(stdmsg, *args, **kwargs) raise DeprecatedConfig(msg=stdmsg) # Using a list because a tuple with dict can't be stored in a set. sent_args = _deprecated_messages_sent.setdefault(msg, list()) if args in sent_args: # Already logged this message, so don't log it again. return sent_args.append(args) logger.warn(stdmsg, *args, **kwargs) class DeprecatedConfig(Exception): message = _("Fatal call to deprecated config: %(msg)s") def __init__(self, msg): super(Exception, self).__init__(self.message % dict(msg=msg))
from __future__ import absolute_import, division, print_function import pytest import os import numpy as np import sqlalchemy as sa from datashape import discover, dshape import datashape from into.backends.sql import (dshape_to_table, create_from_datashape, dshape_to_alchemy) from into.utils import tmpfile, raises from into import convert, append, resource, discover, into def test_resource(): sql = resource('sqlite:///:memory:::mytable', dshape='var * {x: int, y: int}') assert isinstance(sql, sa.Table) assert sql.name == 'mytable' assert isinstance(sql.bind, sa.engine.base.Engine) assert set([c.name for c in sql.c]) == set(['x', 'y']) def test_append_and_convert_round_trip(): engine = sa.create_engine('sqlite:///:memory:') metadata = sa.MetaData(engine) t = sa.Table('bank', metadata, sa.Column('name', sa.String, primary_key=True), sa.Column('balance', sa.Integer)) t.create() data = [('Alice', 1), ('Bob', 2)] append(t, data) assert convert(list, t) == data def test_plus_must_have_text(): with pytest.raises(NotImplementedError): resource('redshift+://user:pass@host:1234/db') def test_resource_on_file(): with tmpfile('.db') as fn: uri = 'sqlite:///' + fn sql = resource(uri, 'foo', dshape='var * {x: int, y: int}') assert isinstance(sql, sa.Table) with tmpfile('.db') as fn: uri = 'sqlite:///' + fn sql = resource(uri + '::' + 'foo', dshape='var * {x: int, y: int}') assert isinstance(sql, sa.Table) def test_resource_to_engine(): with tmpfile('.db') as fn: uri = 'sqlite:///' + fn r = resource(uri) assert isinstance(r, sa.engine.Engine) assert r.dialect.name == 'sqlite' def test_resource_to_engine_to_create_tables(): with tmpfile('.db') as fn: uri = 'sqlite:///' + fn ds = datashape.dshape('{mytable: var * {name: string, amt: int}}') r = resource(uri, dshape=ds) assert isinstance(r, sa.engine.Engine) assert r.dialect.name == 'sqlite' assert discover(r) == ds def test_discovery(): assert discover(sa.String()) == datashape.string metadata = sa.MetaData() s = sa.Table('accounts', metadata, sa.Column('name', sa.String), sa.Column('amount', sa.Integer), sa.Column('timestamp', sa.DateTime, primary_key=True)) assert discover(s) == \ dshape('var * {name: ?string, amount: ?int32, timestamp: datetime}') def test_discovery_numeric_column(): assert discover(sa.String()) == datashape.string metadata = sa.MetaData() s = sa.Table('name', metadata, sa.Column('name', sa.types.NUMERIC),) assert discover(s) def test_discover_null_columns(): assert dshape(discover(sa.Column('name', sa.String, nullable=True))) == \ dshape('{name: ?string}') assert dshape(discover(sa.Column('name', sa.String, nullable=False))) == \ dshape('{name: string}') def single_table_engine(): engine = sa.create_engine('sqlite:///:memory:') metadata = sa.MetaData(engine) t = sa.Table('accounts', metadata, sa.Column('name', sa.String), sa.Column('amount', sa.Integer)) t.create() return engine, t def test_select_to_iterator(): engine, t = single_table_engine() append(t, [('Alice', 100), ('Bob', 200)]) sel = sa.select([t.c.amount + 1]) assert convert(list, sel) == [(101,), (201,)] assert convert(list, sel, dshape=dshape('var * int')) == [101, 201] sel2 = sa.select([sa.sql.func.sum(t.c.amount)]) assert convert(int, sel2, dshape=dshape('int')) == 300 sel3 = sa.select([t]) result = convert(list, sel3, dshape=discover(t)) assert type(result[0]) is tuple def test_discovery_engine(): engine, t = single_table_engine() assert discover(engine, 'accounts') == discover(t) assert str(discover(engine)) == str(discover({'accounts': t})) def test_discovery_metadata(): engine, t = single_table_engine() metadata = t.metadata assert str(discover(metadata)) == str(discover({'accounts': t})) def test_discover_views(): engine, t = single_table_engine() metadata = t.metadata with engine.connect() as conn: conn.execute('''CREATE VIEW myview AS SELECT name, amount FROM accounts WHERE amount > 0''') assert str(discover(metadata)) == str(discover({'accounts': t, 'myview': t})) def test_extend_empty(): engine, t = single_table_engine() assert not convert(list, t) append(t, []) assert not convert(list, t) def test_dshape_to_alchemy(): assert dshape_to_alchemy('string') == sa.Text assert isinstance(dshape_to_alchemy('string[40]'), sa.String) assert not isinstance(dshape_to_alchemy('string["ascii"]'), sa.Unicode) assert isinstance(dshape_to_alchemy('string[40, "U8"]'), sa.Unicode) assert dshape_to_alchemy('string[40]').length == 40 assert dshape_to_alchemy('float32').precision == 24 assert dshape_to_alchemy('float64').precision == 53 def test_dshape_to_table(): t = dshape_to_table('bank', '{name: string, amount: int}') assert isinstance(t, sa.Table) assert t.name == 'bank' assert [c.name for c in t.c] == ['name', 'amount'] def test_create_from_datashape(): engine = sa.create_engine('sqlite:///:memory:') ds = dshape('''{bank: var * {name: string, amount: int}, points: var * {x: int, y: int}}''') engine = create_from_datashape(engine, ds) assert discover(engine) == ds def test_into_table_iterator(): engine = sa.create_engine('sqlite:///:memory:') metadata = sa.MetaData(engine) t = dshape_to_table('points', '{x: int, y: int}', metadata=metadata) t.create() data = [(1, 1), (2, 4), (3, 9)] append(t, data) assert convert(list, t) == data t2 = dshape_to_table('points2', '{x: int, y: int}', metadata=metadata) t2.create() data2 = [{'x': 1, 'y': 1}, {'x': 2, 'y': 4}, {'x': 3, 'y': 9}] append(t2, data2) assert convert(list, t2) == data def test_sql_field_names_disagree_on_order(): r = resource('sqlite:///:memory:::tb', dshape=dshape('{x: int, y: int}')) append(r, [(1, 2), (10, 20)], dshape=dshape('{y: int, x: int}')) assert convert(set, r) == set([(2, 1), (20, 10)]) def test_sql_field_names_disagree_on_names(): r = resource('sqlite:///:memory:::tb', dshape=dshape('{x: int, y: int}')) assert raises(Exception, lambda: append(r, [(1, 2), (10, 20)], dshape=dshape('{x: int, z: int}'))) def test_resource_on_dialects(): assert (resource.dispatch('mysql://foo') is resource.dispatch('mysql+pymysql://foo')) assert (resource.dispatch('never-before-seen-sql://foo') is resource.dispatch('mysql://foo')) @pytest.yield_fixture def sqlite_file(): try: yield 'sqlite:///db.db' finally: os.remove('db.db') def test_append_from_select(sqlite_file): # we can't test in memory here because that creates two independent # databases raw = np.array([(200.0, 'Glenn'), (314.14, 'Hope'), (235.43, 'Bob')], dtype=[('amount', 'float64'), ('name', 'S5')]) raw2 = np.array([(800.0, 'Joe'), (914.14, 'Alice'), (1235.43, 'Ratso')], dtype=[('amount', 'float64'), ('name', 'S5')]) t = into('%s::t' % sqlite_file, raw) s = into('%s::s' % sqlite_file, raw2) t = append(t, s.select()) result = into(list, t) expected = np.concatenate((raw, raw2)).tolist() assert result == expected def test_engine_metadata_caching(): with tmpfile('db') as fn: engine = resource('sqlite:///' + fn) a = resource('sqlite:///' + fn + '::a', dshape=dshape('var * {x: int}')) b = resource('sqlite:///' + fn + '::b', dshape=dshape('var * {y: int}')) assert a.metadata is b.metadata assert engine is a.bind is b.bind
# -*- coding: utf-8 -*- import datetime from south.db import db from south.v2 import SchemaMigration from django.db import models class Migration(SchemaMigration): def forwards(self, orm): # Adding model 'JobServer' db.create_table(u'porkweb_jobserver', ( (u'id', self.gf('django.db.models.fields.AutoField')(primary_key=True)), ('ipaddr', self.gf('django.db.models.fields.IPAddressField')(max_length=15)), ('port', self.gf('django.db.models.fields.IntegerField')(default=8117)), ('hostname', self.gf('django.db.models.fields.CharField')(max_length=255, blank=True)), ('os', self.gf('django.db.models.fields.CharField')(max_length=32)), ('status', self.gf('django.db.models.fields.CharField')(default='Offline', max_length=16)), ('details', self.gf('django.db.models.fields.CharField')(max_length=255, blank=True)), )) db.send_create_signal(u'porkweb', ['JobServer']) # Adding model 'AttackType' db.create_table(u'porkweb_attacktype', ( (u'id', self.gf('django.db.models.fields.AutoField')(primary_key=True)), ('name', self.gf('django.db.models.fields.CharField')(max_length=64)), ('notes', self.gf('django.db.models.fields.TextField')(blank=True)), )) db.send_create_signal(u'porkweb', ['AttackType']) # Adding model 'Param' db.create_table(u'porkweb_param', ( (u'id', self.gf('django.db.models.fields.AutoField')(primary_key=True)), ('name', self.gf('django.db.models.fields.CharField')(max_length=64)), ('value', self.gf('django.db.models.fields.CharField')(max_length=64)), )) db.send_create_signal(u'porkweb', ['Param']) # Adding model 'AttackParam' db.create_table(u'porkweb_attackparam', ( (u'param_ptr', self.gf('django.db.models.fields.related.OneToOneField')(to=orm['porkweb.Param'], unique=True, primary_key=True)), ('attack', self.gf('django.db.models.fields.related.ForeignKey')(related_name='params', to=orm['porkweb.AttackType'])), )) db.send_create_signal(u'porkweb', ['AttackParam']) # Adding model 'JobParam' db.create_table(u'porkweb_jobparam', ( (u'param_ptr', self.gf('django.db.models.fields.related.OneToOneField')(to=orm['porkweb.Param'], unique=True, primary_key=True)), ('job', self.gf('django.db.models.fields.related.ForeignKey')(related_name='params', to=orm['porkweb.Job'])), )) db.send_create_signal(u'porkweb', ['JobParam']) # Adding model 'HashType' db.create_table(u'porkweb_hashtype', ( (u'id', self.gf('django.db.models.fields.AutoField')(primary_key=True)), ('name', self.gf('django.db.models.fields.CharField')(max_length=32)), ('hashcatType', self.gf('django.db.models.fields.IntegerField')(null=True, blank=True)), ('hashcat', self.gf('django.db.models.fields.BooleanField')(default=False)), ('ocllite', self.gf('django.db.models.fields.BooleanField')(default=False)), ('oclplus', self.gf('django.db.models.fields.BooleanField')(default=False)), )) db.send_create_signal(u'porkweb', ['HashType']) # Adding model 'Cracked' db.create_table(u'porkweb_cracked', ( (u'id', self.gf('django.db.models.fields.AutoField')(primary_key=True)), ('when', self.gf('django.db.models.fields.DateTimeField')(auto_now=True, blank=True)), ('hash', self.gf('django.db.models.fields.CharField')(max_length=255)), ('value', self.gf('django.db.models.fields.CharField')(max_length=255)), ('job', self.gf('django.db.models.fields.related.ForeignKey')(to=orm['porkweb.Job'])), )) db.send_create_signal(u'porkweb', ['Cracked']) # Adding model 'Job' db.create_table(u'porkweb_job', ( (u'id', self.gf('django.db.models.fields.AutoField')(primary_key=True)), ('hashes', self.gf('django.db.models.fields.TextField')()), ('hashType', self.gf('django.db.models.fields.related.ForeignKey')(to=orm['porkweb.HashType'])), ('attackType', self.gf('django.db.models.fields.related.ForeignKey')(to=orm['porkweb.AttackType'])), ('jobServer', self.gf('django.db.models.fields.related.ForeignKey')(to=orm['porkweb.JobServer'], null=True, blank=True)), ('status', self.gf('django.db.models.fields.CharField')(default='New', max_length=16)), ('progress', self.gf('django.db.models.fields.FloatField')(default=0)), ('started', self.gf('django.db.models.fields.DateTimeField')(null=True, blank=True)), ('finished', self.gf('django.db.models.fields.DateTimeField')(null=True, blank=True)), ('eta', self.gf('django.db.models.fields.DateTimeField')(null=True, blank=True)), ('results', self.gf('django.db.models.fields.TextField')(blank=True)), ('speed', self.gf('django.db.models.fields.IntegerField')(null=True, blank=True)), )) db.send_create_signal(u'porkweb', ['Job']) # Adding model 'Log' db.create_table(u'porkweb_log', ( (u'id', self.gf('django.db.models.fields.AutoField')(primary_key=True)), ('when', self.gf('django.db.models.fields.DateTimeField')(auto_now=True, blank=True)), ('line', self.gf('django.db.models.fields.TextField')()), )) db.send_create_signal(u'porkweb', ['Log']) def backwards(self, orm): # Deleting model 'JobServer' db.delete_table(u'porkweb_jobserver') # Deleting model 'AttackType' db.delete_table(u'porkweb_attacktype') # Deleting model 'Param' db.delete_table(u'porkweb_param') # Deleting model 'AttackParam' db.delete_table(u'porkweb_attackparam') # Deleting model 'JobParam' db.delete_table(u'porkweb_jobparam') # Deleting model 'HashType' db.delete_table(u'porkweb_hashtype') # Deleting model 'Cracked' db.delete_table(u'porkweb_cracked') # Deleting model 'Job' db.delete_table(u'porkweb_job') # Deleting model 'Log' db.delete_table(u'porkweb_log') models = { u'porkweb.attackparam': { 'Meta': {'object_name': 'AttackParam', '_ormbases': [u'porkweb.Param']}, 'attack': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "'params'", 'to': u"orm['porkweb.AttackType']"}), u'param_ptr': ('django.db.models.fields.related.OneToOneField', [], {'to': u"orm['porkweb.Param']", 'unique': 'True', 'primary_key': 'True'}) }, u'porkweb.attacktype': { 'Meta': {'object_name': 'AttackType'}, u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '64'}), 'notes': ('django.db.models.fields.TextField', [], {'blank': 'True'}) }, u'porkweb.cracked': { 'Meta': {'object_name': 'Cracked'}, 'hash': ('django.db.models.fields.CharField', [], {'max_length': '255'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'job': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['porkweb.Job']"}), 'value': ('django.db.models.fields.CharField', [], {'max_length': '255'}), 'when': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}) }, u'porkweb.hashtype': { 'Meta': {'object_name': 'HashType'}, 'hashcat': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'hashcatType': ('django.db.models.fields.IntegerField', [], {'null': 'True', 'blank': 'True'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '32'}), 'ocllite': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'oclplus': ('django.db.models.fields.BooleanField', [], {'default': 'False'}) }, u'porkweb.job': { 'Meta': {'object_name': 'Job'}, 'attackType': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['porkweb.AttackType']"}), 'eta': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'finished': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'hashType': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['porkweb.HashType']"}), 'hashes': ('django.db.models.fields.TextField', [], {}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'jobServer': ('django.db.models.fields.related.ForeignKey', [], {'to': u"orm['porkweb.JobServer']", 'null': 'True', 'blank': 'True'}), 'progress': ('django.db.models.fields.FloatField', [], {'default': '0'}), 'results': ('django.db.models.fields.TextField', [], {'blank': 'True'}), 'speed': ('django.db.models.fields.IntegerField', [], {'null': 'True', 'blank': 'True'}), 'started': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'status': ('django.db.models.fields.CharField', [], {'default': "'New'", 'max_length': '16'}) }, u'porkweb.jobparam': { 'Meta': {'object_name': 'JobParam', '_ormbases': [u'porkweb.Param']}, 'job': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "'params'", 'to': u"orm['porkweb.Job']"}), u'param_ptr': ('django.db.models.fields.related.OneToOneField', [], {'to': u"orm['porkweb.Param']", 'unique': 'True', 'primary_key': 'True'}) }, u'porkweb.jobserver': { 'Meta': {'object_name': 'JobServer'}, 'details': ('django.db.models.fields.CharField', [], {'max_length': '255', 'blank': 'True'}), 'hostname': ('django.db.models.fields.CharField', [], {'max_length': '255', 'blank': 'True'}), u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'ipaddr': ('django.db.models.fields.IPAddressField', [], {'max_length': '15'}), 'os': ('django.db.models.fields.CharField', [], {'max_length': '32'}), 'port': ('django.db.models.fields.IntegerField', [], {'default': '8117'}), 'status': ('django.db.models.fields.CharField', [], {'default': "'Offline'", 'max_length': '16'}) }, u'porkweb.log': { 'Meta': {'object_name': 'Log'}, u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'line': ('django.db.models.fields.TextField', [], {}), 'when': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}) }, u'porkweb.param': { 'Meta': {'object_name': 'Param'}, u'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '64'}), 'value': ('django.db.models.fields.CharField', [], {'max_length': '64'}) } } complete_apps = ['porkweb']
#!/usr/bin/python import cgi import os import sys import json import urllib import requests import networkx as nx from networkx.readwrite import json_graph from flask import Flask, render_template, url_for, request, redirect import settings app = Flask(__name__) enable_ganglia=settings.enable_ganglia ganglia_url=settings.ganglia_url enable_prometheus=settings.enable_prometheus prometheus_url=settings.prometheus_url kibana_url=settings.kibana_url pathprefix=settings.pathprefix json_filepath=settings.json_filepath def errorhtml(txt): return ("Error: " + txt) def drawimage(filename): os.system('dot -Tsvg %s/%s.txt -o %s/%s.svg' % (pathprefix, filename, pathprefix, filename)) @app.route("/applconn", methods=["POST"]) def applconn(): # Initialize Graph G=nx.DiGraph() with open(json_filepath) as f: jsondata=json.loads(f.read()) G=json_graph.node_link_graph(jsondata) fs=request.form if (not fs.has_key('key')): errorhtml('No key defined') key=fs['key'] if (not key in G.nodes()): errorhtml('No Such key') compute_mode="dfs" # "dfs", "distance" if fs.has_key("dfsmode"): compute_mode="dfs" elif fs.has_key("distancemode"): compute_mode="distance" if (fs.has_key('distance')): distance=fs['distance'] else: distance=None # infinite large number if (fs.has_key('graphtype')): graphtype=fs['graphtype'] # 'undirectional' or 'directional' else: graphtype='directional' elif fs.has_key("shortestpathmode"): compute_mode="shortestpath" if (fs.has_key('shortest_path_target')): shortest_path_target=fs['shortest_path_target'] else: errorhtml("No shortest_path_target is given") else: errorhtml("No computation mode is specified") # if reversed is specified, create reversed graph if (fs.has_key('reversed')): reversed=True else: reversed=False if (reversed): G=G.reverse() searchtags=['All'] if (fs.has_key('SearchDev')): searchtags.append('Dev') if (fs.has_key('SearchOps')): searchtags.append('Ops') if (fs.has_key('SearchNet')): searchtags.append('Net') if (fs.has_key('SearchSdn')): searchtags.append('Sdn') for nodeid in G.nodes(): if (not 'searchtag' in G.node[nodeid] or not G.node[nodeid]['searchtag'] in searchtags): G.remove_node(nodeid) if (not key in G.nodes()): errorhtml('No Such key in given search codition') ## Compute Tree from key node if (compute_mode=="dfs"): st=nx.dfs_tree(G, key) # "st" means "spanning tree" # add other edge if other paths are there: for node1 in st.nodes(): for node2 in st.nodes(): if G.has_edge(node1, node2): st.add_edge(node1,node2) elif (compute_mode=="distance"): if (graphtype == "undirectional"): G=nx.Graph(G) st=nx.Graph() else: st=nx.DiGraph() if (distance == None): paths = nx.single_source_shortest_path(G, key) else: paths = nx.single_source_shortest_path(G, key, cutoff=distance) for target_node in paths.keys(): st.add_path(paths[target_node]) elif (compute_mode=="shortestpath"): st=nx.DiGraph() try: for path in nx.all_shortest_paths(G, key, shortest_path_target): st.add_path(path) except(nx.exception.NetworkXNoPath): errorhtml('No path found in given search codition') ### add attribute for n in st: tmp = st.node[n] tmp['name'] = n if (enable_ganglia or settings.enable_prometheus): def get_url_for_server_metric_func_ganglia(key): return ('{0}/api/metrics.php?host={1}&metric_name=load_one'.format(ganglia_url, key)) def get_url_for_haproxy_metric_func_ganglia(key): # 172.17.0.3-haproxy-main1081 tmp=key.split('-') hostname=tmp[0] applname='-'.join(tmp[1:]) return ('{0}/api/metrics.php?host={1}&metric_name={2}'.format(ganglia_url, hostname, applname)) def tmp_metric_func_ganglia(key, kind_of_node): if (kind_of_node == "server"): metric_url = get_url_for_server_metric_func_ganglia(key) elif (kind_of_node == "haproxy"): metric_url = get_url_for_haproxy_metric_func_ganglia(key) else: Exception("No Such kind_of_node: {0}", kind_of_node) f = urllib.urlopen(metric_url) js=json.loads(f.read()) # {"status":"ok","message":{"metric_value":"0.51","units":" "}} f.close() #print (js) if (js['status']=='ok'): load_one=float(js['message']['metric_value']) else: load_one=0 # hmm ... return load_one def server_metric_func_ganglia(key): return tmp_metric_func_ganglia(key, "server") def haproxy_metric_func_ganglia(key): return tmp_metric_func_ganglia(key, "haproxy") def tmp_metric_func_prometheus(key, kind_of_node): # TODO: return value is json, not float if (kind_of_node == "server"): metric_url='{0}/api/v1/query?query=node_load1{{instance="{1}:9100"}}'.format(prometheus_url, key) elif (kind_of_node == "haproxy"): tmp=key.split('-') nodename=tmp[0] applname=tmp[2] metric_url='{0}/api/v1/query?query=haproxy_frontend_current_sessions{{frontend="{1}",instance="{2}:9101"}}'.format(prometheus_url, applname, nodename) else: Exception("No Such kind_of_node: {0}", kind_of_node) returned = requests.get(metric_url) js=json.loads(returned.content) # {"status":"success","data":{"resultType":"vector","result":[{"metric":{"__name__":"node_load1","instance":"172.17.0.3:9100","job":"prometheus"},"value":[1495462713.021,"0.91"]}]}} #print (js) if (js['status']=='success'): if (len(js['data']['result']) > 0): load_one=float(js['data']['result'][0]["value"][1]) else: load_one=0 # hmmm ... else: load_one=0 # hmm ... return load_one def server_metric_func_prometheus(key): return tmp_metric_func_prometheus(key, "server") def haproxy_metric_func_prometheus(key): return tmp_metric_func_prometheus(key, "haproxy") if (settings.enable_ganglia): server_metric_func=server_metric_func_ganglia haproxy_metric_func=haproxy_metric_func_ganglia if (settings.enable_prometheus): server_metric_func=server_metric_func_prometheus haproxy_metric_func=haproxy_metric_func_prometheus node_types=[ {"type": "server", "metric_func": server_metric_func, "lower_bound": 2.0, "upper_bound": 5.0, }, {"type": "haproxy-thread", "metric_func": haproxy_metric_func, "lower_bound": 5, "upper_bound": 15, } ] try: if (n.find('haproxy-') > -1): node_type = 'haproxy-thread' else: node_type = 'server' ctx = filter (lambda x: x["type"] == node_type, node_types) [0] #print (ctx) load_one=ctx["metric_func"](n) #print (load_one) if (ctx["upper_bound"] < load_one): tmp['color'] = '#ff634f' elif (ctx["lower_bound"] < load_one < ctx["upper_bound"]): tmp['color'] = '#ffde5e' else: tmp['color'] = '#e2ecff' except (IOError): pass # ganglia is not available else: if (G.node[n].has_key('color')): tmp['color'] = G.node[n]['color'] # set other things tmp['href'] = './node-hrefs?key={0}'.format(n) if (G.node[n].has_key('searchtag')): tmp['searchtag'] = G.node[n]['searchtag'] # json output js=json_graph.node_link_data(st) with open('{0}/1.json'.format(pathprefix), 'w') as f: f.write(json.dumps(js, sort_keys=True, indent=4)) ## Graphviz A=nx.nx_agraph.to_agraph(st) A.write('%s/1.txt' % (pathprefix)) ## SVG drawimage('1') ### Write down all the data #A=nx.nx_agraph.to_agraph(G) #A.write(pathprefix+'/a.txt') #drawimage('a') ## inline svg with open(pathprefix+'/1.svg') as svgfile: svgdata=svgfile.read() ## CGI return (""" <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8"> <title></title> </head> <body> <h2>Summary</h2> <div id="d3"> <div id="chart"></div> <script type="text/javascript" src="https://cdnjs.cloudflare.com/ajax/libs/d3/3.4.11/d3.min.js"></script> <link type="text/css" rel="stylesheet" href="static/applconn.css"/> <script>var jsonpath="static/1.json";</script> <script type="text/javascript" src="static/applconn.js"></script> <a href="static/1.json">d3-graph-data</a> </div> <h2>Detail</h2> %s <div id="data"> <a href="static/1.txt">Data</a> </div> </body> </html> """ % (svgdata) ) @app.route("/node-hrefs") def node_hrefs(): # Initialize Graph G=nx.DiGraph() with open(json_filepath) as f: jsondata=json.loads(f.read()) G=json_graph.node_link_graph(jsondata) fs=request.args # when GET, use this if (not fs.has_key('key')): errorhtml('No key defined') key=fs['key'] if (not key in G.nodes()): errorhtml('No Such key') # create urls: urls = [] # default url if (G.node[key].has_key('href')): urls.append(G.node[key]['href']) # ganglia url if (settings.enable_ganglia): if (key.find('_cpu') > -1): urls.append('{0}/graph_all_periods.php?hreg%5B%5D={1}&mreg%5B%5D=cpu_&aggregate=1'.format(ganglia_url, key[:-4])) elif (key.find('-haproxy') > -1): urls.append('{0}/graph_all_periods.php?hreg%5B%5D={1}&mreg%5B%5D=haproxy&aggregate=1'.format(ganglia_url, key.split('-')[0])) else: urls.append('{0}?c=unspecified&h={1}'.format(ganglia_url, key)) if (settings.enable_prometheus): if (key.find('-haproxy') > -1): tmp=key.split('-') nodename=tmp[0] applname=tmp[2] urls.append('{0}/graph?g0.range_input=1h&g0.expr=haproxy_frontend_current_sessions{{instance%3D"{1}%3A9101",frontend%3D"{2}"}}&g0.tab=0'.format(prometheus_url, nodename, applname)) else: urls.append('{0}/graph?g0.range_input=1h&g0.expr=node_load1{{instance%3D"{1}%3A9100"}}&g0.tab=0'.format(prometheus_url, key)) # kibana url if (settings.enable_elasticsearch): urls.append('{0}{1}?id={2}'.format(kibana_url, key, G.node[key]['kibanaid'])) # if only one url is found, return that if (len(urls) == 1): return (redirect(urls[0], code=302)) # join urls urlhtml='<br/>'.join( '<a href="{0}">link</a>'.format(url) for url in urls ) ## CGI return (""" <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8"> <title></title> </head> <body> {0} </body> </html> """.format (urlhtml) ) @app.route("/") def index(): return render_template('index.html') @app.route("/prom-sd-file") def prom_sd_file(): with open(json_filepath) as f: jsondata=json.loads(f.read()) tmp=[node["name"]+":9100" for node in jsondata["nodes"] if node["searchtag"] == "All" and node["name"].find ("172.17") > -1] return json.dumps([{"targets": tmp}]) if __name__ == "__main__": app.run()
import asyncio import base64 import binascii import io import json import mimetypes import os import re import uuid import warnings import zlib from collections import Mapping, Sequence, deque from pathlib import Path from urllib.parse import parse_qsl, quote, unquote, urlencode from multidict import CIMultiDict from .hdrs import (CONTENT_DISPOSITION, CONTENT_ENCODING, CONTENT_LENGTH, CONTENT_TRANSFER_ENCODING, CONTENT_TYPE) from .helpers import parse_mimetype from .protocol import HttpParser __all__ = ('MultipartReader', 'MultipartWriter', 'BodyPartReader', 'BodyPartWriter', 'BadContentDispositionHeader', 'BadContentDispositionParam', 'parse_content_disposition', 'content_disposition_filename') CHAR = set(chr(i) for i in range(0, 128)) CTL = set(chr(i) for i in range(0, 32)) | {chr(127), } SEPARATORS = {'(', ')', '<', '>', '@', ',', ';', ':', '\\', '"', '/', '[', ']', '?', '=', '{', '}', ' ', chr(9)} TOKEN = CHAR ^ CTL ^ SEPARATORS class BadContentDispositionHeader(RuntimeWarning): pass class BadContentDispositionParam(RuntimeWarning): pass def parse_content_disposition(header): def is_token(string): return string and TOKEN >= set(string) def is_quoted(string): return string[0] == string[-1] == '"' def is_rfc5987(string): return is_token(string) and string.count("'") == 2 def is_extended_param(string): return string.endswith('*') def is_continuous_param(string): pos = string.find('*') + 1 if not pos: return False substring = string[pos:-1] if string.endswith('*') else string[pos:] return substring.isdigit() def unescape(text, *, chars=''.join(map(re.escape, CHAR))): return re.sub('\\\\([{}])'.format(chars), '\\1', text) if not header: return None, {} disptype, *parts = header.split(';') if not is_token(disptype): warnings.warn(BadContentDispositionHeader(header)) return None, {} params = {} for item in parts: if '=' not in item: warnings.warn(BadContentDispositionHeader(header)) return None, {} key, value = item.split('=', 1) key = key.lower().strip() value = value.lstrip() if key in params: warnings.warn(BadContentDispositionHeader(header)) return None, {} if not is_token(key): warnings.warn(BadContentDispositionParam(item)) continue elif is_continuous_param(key): if is_quoted(value): value = unescape(value[1:-1]) elif not is_token(value): warnings.warn(BadContentDispositionParam(item)) continue elif is_extended_param(key): if is_rfc5987(value): encoding, _, value = value.split("'", 2) encoding = encoding or 'utf-8' else: warnings.warn(BadContentDispositionParam(item)) continue try: value = unquote(value, encoding, 'strict') except UnicodeDecodeError: # pragma: nocover warnings.warn(BadContentDispositionParam(item)) continue else: if is_quoted(value): value = unescape(value[1:-1].lstrip('\\/')) elif not is_token(value): warnings.warn(BadContentDispositionHeader(header)) return None, {} params[key] = value return disptype.lower(), params def content_disposition_filename(params): if not params: return None elif 'filename*' in params: return params['filename*'] elif 'filename' in params: return params['filename'] else: parts = [] fnparams = sorted((key, value) for key, value in params.items() if key.startswith('filename*')) for num, (key, value) in enumerate(fnparams): _, tail = key.split('*', 1) if tail.endswith('*'): tail = tail[:-1] if tail == str(num): parts.append(value) else: break if not parts: return None value = ''.join(parts) if "'" in value: encoding, _, value = value.split("'", 2) encoding = encoding or 'utf-8' return unquote(value, encoding, 'strict') return value class MultipartResponseWrapper(object): """Wrapper around the :class:`MultipartBodyReader` to take care about underlying connection and close it when it needs in.""" def __init__(self, resp, stream): self.resp = resp self.stream = stream @asyncio.coroutine def __aiter__(self): return self @asyncio.coroutine def __anext__(self): part = yield from self.next() if part is None: raise StopAsyncIteration # NOQA return part def at_eof(self): """Returns ``True`` when all response data had been read. :rtype: bool """ return self.resp.content.at_eof() @asyncio.coroutine def next(self): """Emits next multipart reader object.""" item = yield from self.stream.next() if self.stream.at_eof(): yield from self.release() return item @asyncio.coroutine def release(self): """Releases the connection gracefully, reading all the content to the void.""" yield from self.resp.release() class BodyPartReader(object): """Multipart reader for single body part.""" chunk_size = 8192 def __init__(self, boundary, headers, content): self.headers = headers self._boundary = boundary self._content = content self._at_eof = False length = self.headers.get(CONTENT_LENGTH, None) self._length = int(length) if length is not None else None self._read_bytes = 0 self._unread = deque() self._prev_chunk = None self._content_eof = 0 @asyncio.coroutine def __aiter__(self): return self @asyncio.coroutine def __anext__(self): part = yield from self.next() if part is None: raise StopAsyncIteration # NOQA return part @asyncio.coroutine def next(self): item = yield from self.read() if not item: return None return item @asyncio.coroutine def read(self, *, decode=False): """Reads body part data. :param bool decode: Decodes data following by encoding method from `Content-Encoding` header. If it missed data remains untouched :rtype: bytearray """ if self._at_eof: return b'' data = bytearray() if self._length is None: while not self._at_eof: data.extend((yield from self.readline())) else: while not self._at_eof: data.extend((yield from self.read_chunk(self.chunk_size))) if decode: return self.decode(data) return data @asyncio.coroutine def read_chunk(self, size=chunk_size): """Reads body part content chunk of the specified size. :param int size: chunk size :rtype: bytearray """ if self._at_eof: return b'' if self._length: chunk = yield from self._read_chunk_from_length(size) else: chunk = yield from self._read_chunk_from_stream(size) self._read_bytes += len(chunk) if self._read_bytes == self._length: self._at_eof = True if self._at_eof: assert b'\r\n' == (yield from self._content.readline()), \ 'reader did not read all the data or it is malformed' return chunk @asyncio.coroutine def _read_chunk_from_length(self, size): """Reads body part content chunk of the specified size. The body part must has `Content-Length` header with proper value. :param int size: chunk size :rtype: bytearray """ assert self._length is not None, \ 'Content-Length required for chunked read' chunk_size = min(size, self._length - self._read_bytes) chunk = yield from self._content.read(chunk_size) return chunk @asyncio.coroutine def _read_chunk_from_stream(self, size): """Reads content chunk of body part with unknown length. The `Content-Length` header for body part is not necessary. :param int size: chunk size :rtype: bytearray """ assert size >= len(self._boundary) + 2, \ 'Chunk size must be greater or equal than boundary length + 2' first_chunk = self._prev_chunk is None if first_chunk: self._prev_chunk = yield from self._content.read(size) chunk = yield from self._content.read(size) self._content_eof += int(self._content.at_eof()) assert self._content_eof < 3, "Reading after EOF" window = self._prev_chunk + chunk sub = b'\r\n' + self._boundary if first_chunk: idx = window.find(sub) else: idx = window.find(sub, max(0, len(self._prev_chunk) - len(sub))) if idx >= 0: # pushing boundary back to content self._content.unread_data(window[idx:]) if size > idx: self._prev_chunk = self._prev_chunk[:idx] chunk = window[len(self._prev_chunk):idx] if not chunk: self._at_eof = True if 0 < len(chunk) < len(sub) and not self._content_eof: self._prev_chunk += chunk self._at_eof = False return b'' result = self._prev_chunk self._prev_chunk = chunk return result @asyncio.coroutine def readline(self): """Reads body part by line by line. :rtype: bytearray """ if self._at_eof: return b'' if self._unread: line = self._unread.popleft() else: line = yield from self._content.readline() if line.startswith(self._boundary): # the very last boundary may not come with \r\n, # so set single rules for everyone sline = line.rstrip(b'\r\n') boundary = self._boundary last_boundary = self._boundary + b'--' # ensure that we read exactly the boundary, not something alike if sline == boundary or sline == last_boundary: self._at_eof = True self._unread.append(line) return b'' else: next_line = yield from self._content.readline() if next_line.startswith(self._boundary): line = line[:-2] # strip CRLF but only once self._unread.append(next_line) return line @asyncio.coroutine def release(self): """Lke :meth:`read`, but reads all the data to the void. :rtype: None """ if self._at_eof: return if self._length is None: while not self._at_eof: yield from self.readline() else: while not self._at_eof: yield from self.read_chunk(self.chunk_size) @asyncio.coroutine def text(self, *, encoding=None): """Lke :meth:`read`, but assumes that body part contains text data. :param str encoding: Custom text encoding. Overrides specified in charset param of `Content-Type` header :rtype: str """ data = yield from self.read(decode=True) encoding = encoding or self.get_charset(default='latin1') return data.decode(encoding) @asyncio.coroutine def json(self, *, encoding=None): """Lke :meth:`read`, but assumes that body parts contains JSON data. :param str encoding: Custom JSON encoding. Overrides specified in charset param of `Content-Type` header """ data = yield from self.read(decode=True) if not data: return None encoding = encoding or self.get_charset(default='utf-8') return json.loads(data.decode(encoding)) @asyncio.coroutine def form(self, *, encoding=None): """Lke :meth:`read`, but assumes that body parts contains form urlencoded data. :param str encoding: Custom form encoding. Overrides specified in charset param of `Content-Type` header """ data = yield from self.read(decode=True) if not data: return None encoding = encoding or self.get_charset(default='utf-8') return parse_qsl(data.rstrip().decode(encoding), encoding=encoding) def at_eof(self): """Returns ``True`` if the boundary was reached or ``False`` otherwise. :rtype: bool """ return self._at_eof def decode(self, data): """Decodes data according the specified `Content-Encoding` or `Content-Transfer-Encoding` headers value. Supports ``gzip``, ``deflate`` and ``identity`` encodings for `Content-Encoding` header. Supports ``base64``, ``quoted-printable`` encodings for `Content-Transfer-Encoding` header. :param bytearray data: Data to decode. :raises: :exc:`RuntimeError` - if encoding is unknown. :rtype: bytes """ if CONTENT_TRANSFER_ENCODING in self.headers: data = self._decode_content_transfer(data) if CONTENT_ENCODING in self.headers: return self._decode_content(data) return data def _decode_content(self, data): encoding = self.headers[CONTENT_ENCODING].lower() if encoding == 'deflate': return zlib.decompress(data, -zlib.MAX_WBITS) elif encoding == 'gzip': return zlib.decompress(data, 16 + zlib.MAX_WBITS) elif encoding == 'identity': return data else: raise RuntimeError('unknown content encoding: {}'.format(encoding)) def _decode_content_transfer(self, data): encoding = self.headers[CONTENT_TRANSFER_ENCODING].lower() if encoding == 'base64': return base64.b64decode(data) elif encoding == 'quoted-printable': return binascii.a2b_qp(data) else: raise RuntimeError('unknown content transfer encoding: {}' ''.format(encoding)) def get_charset(self, default=None): """Returns charset parameter from ``Content-Type`` header or default. """ ctype = self.headers.get(CONTENT_TYPE, '') *_, params = parse_mimetype(ctype) return params.get('charset', default) @property def filename(self): """Returns filename specified in Content-Disposition header or ``None`` if missed or header is malformed.""" _, params = parse_content_disposition( self.headers.get(CONTENT_DISPOSITION)) return content_disposition_filename(params) class MultipartReader(object): """Multipart body reader.""" #: Response wrapper, used when multipart readers constructs from response. response_wrapper_cls = MultipartResponseWrapper #: Multipart reader class, used to handle multipart/* body parts. #: None points to type(self) multipart_reader_cls = None #: Body part reader class for non multipart/* content types. part_reader_cls = BodyPartReader def __init__(self, headers, content): self.headers = headers self._boundary = ('--' + self._get_boundary()).encode() self._content = content self._last_part = None self._at_eof = False self._at_bof = True self._unread = [] @asyncio.coroutine def __aiter__(self): return self @asyncio.coroutine def __anext__(self): part = yield from self.next() if part is None: raise StopAsyncIteration # NOQA return part @classmethod def from_response(cls, response): """Constructs reader instance from HTTP response. :param response: :class:`~aiohttp.client.ClientResponse` instance """ obj = cls.response_wrapper_cls(response, cls(response.headers, response.content)) return obj def at_eof(self): """Returns ``True`` if the final boundary was reached or ``False`` otherwise. :rtype: bool """ return self._at_eof @asyncio.coroutine def next(self): """Emits the next multipart body part.""" # So, if we're at BOF, we need to skip till the boundary. if self._at_eof: return yield from self._maybe_release_last_part() if self._at_bof: yield from self._read_until_first_boundary() self._at_bof = False else: yield from self._read_boundary() if self._at_eof: # we just read the last boundary, nothing to do there return self._last_part = yield from self.fetch_next_part() return self._last_part @asyncio.coroutine def release(self): """Reads all the body parts to the void till the final boundary.""" while not self._at_eof: item = yield from self.next() if item is None: break yield from item.release() @asyncio.coroutine def fetch_next_part(self): """Returns the next body part reader.""" headers = yield from self._read_headers() return self._get_part_reader(headers) def _get_part_reader(self, headers): """Dispatches the response by the `Content-Type` header, returning suitable reader instance. :param dict headers: Response headers """ ctype = headers.get(CONTENT_TYPE, '') mtype, *_ = parse_mimetype(ctype) if mtype == 'multipart': if self.multipart_reader_cls is None: return type(self)(headers, self._content) return self.multipart_reader_cls(headers, self._content) else: return self.part_reader_cls(self._boundary, headers, self._content) def _get_boundary(self): mtype, *_, params = parse_mimetype(self.headers[CONTENT_TYPE]) assert mtype == 'multipart', 'multipart/* content type expected' if 'boundary' not in params: raise ValueError('boundary missed for Content-Type: %s' % self.headers[CONTENT_TYPE]) boundary = params['boundary'] if len(boundary) > 70: raise ValueError('boundary %r is too long (70 chars max)' % boundary) return boundary @asyncio.coroutine def _readline(self): if self._unread: return self._unread.pop() return (yield from self._content.readline()) @asyncio.coroutine def _read_until_first_boundary(self): while True: chunk = yield from self._readline() if chunk == b'': raise ValueError("Could not find starting boundary %r" % (self._boundary)) chunk = chunk.rstrip() if chunk == self._boundary: return elif chunk == self._boundary + b'--': self._at_eof = True return @asyncio.coroutine def _read_boundary(self): chunk = (yield from self._readline()).rstrip() if chunk == self._boundary: pass elif chunk == self._boundary + b'--': self._at_eof = True else: raise ValueError('Invalid boundary %r, expected %r' % (chunk, self._boundary)) @asyncio.coroutine def _read_headers(self): lines = [b''] while True: chunk = yield from self._content.readline() chunk = chunk.strip() lines.append(chunk) if not chunk: break parser = HttpParser() headers, *_ = parser.parse_headers(lines) return headers @asyncio.coroutine def _maybe_release_last_part(self): """Ensures that the last read body part is read completely.""" if self._last_part is not None: if not self._last_part.at_eof(): yield from self._last_part.release() self._unread.extend(self._last_part._unread) self._last_part = None class BodyPartWriter(object): """Multipart writer for single body part.""" def __init__(self, obj, headers=None, *, chunk_size=8192): if headers is None: headers = CIMultiDict() elif not isinstance(headers, CIMultiDict): headers = CIMultiDict(headers) self.obj = obj self.headers = headers self._chunk_size = chunk_size self._fill_headers_with_defaults() self._serialize_map = { bytes: self._serialize_bytes, str: self._serialize_str, io.IOBase: self._serialize_io, MultipartWriter: self._serialize_multipart, ('application', 'json'): self._serialize_json, ('application', 'x-www-form-urlencoded'): self._serialize_form } def _fill_headers_with_defaults(self): if CONTENT_TYPE not in self.headers: content_type = self._guess_content_type(self.obj) if content_type is not None: self.headers[CONTENT_TYPE] = content_type if CONTENT_LENGTH not in self.headers: content_length = self._guess_content_length(self.obj) if content_length is not None: self.headers[CONTENT_LENGTH] = str(content_length) if CONTENT_DISPOSITION not in self.headers: filename = self._guess_filename(self.obj) if filename is not None: self.set_content_disposition('attachment', filename=filename) def _guess_content_length(self, obj): if isinstance(obj, bytes): return len(obj) elif isinstance(obj, str): *_, params = parse_mimetype(self.headers.get(CONTENT_TYPE)) charset = params.get('charset', 'us-ascii') return len(obj.encode(charset)) elif isinstance(obj, io.StringIO): *_, params = parse_mimetype(self.headers.get(CONTENT_TYPE)) charset = params.get('charset', 'us-ascii') return len(obj.getvalue().encode(charset)) - obj.tell() elif isinstance(obj, io.BytesIO): return len(obj.getvalue()) - obj.tell() elif isinstance(obj, io.IOBase): try: return os.fstat(obj.fileno()).st_size - obj.tell() except (AttributeError, OSError): return None else: return None def _guess_content_type(self, obj, default='application/octet-stream'): if hasattr(obj, 'name'): name = getattr(obj, 'name') return mimetypes.guess_type(name)[0] elif isinstance(obj, (str, io.StringIO)): return 'text/plain; charset=utf-8' else: return default def _guess_filename(self, obj): if isinstance(obj, io.IOBase): name = getattr(obj, 'name', None) if name is not None: return Path(name).name def serialize(self): """Yields byte chunks for body part.""" has_encoding = ( CONTENT_ENCODING in self.headers and self.headers[CONTENT_ENCODING] != 'identity' or CONTENT_TRANSFER_ENCODING in self.headers ) if has_encoding: # since we're following streaming approach which doesn't assumes # any intermediate buffers, we cannot calculate real content length # with the specified content encoding scheme. So, instead of lying # about content length and cause reading issues, we have to strip # this information. self.headers.pop(CONTENT_LENGTH, None) if self.headers: yield b'\r\n'.join( b': '.join(map(lambda i: i.encode('latin1'), item)) for item in self.headers.items() ) yield b'\r\n\r\n' yield from self._maybe_encode_stream(self._serialize_obj()) yield b'\r\n' def _serialize_obj(self): obj = self.obj mtype, stype, *_ = parse_mimetype(self.headers.get(CONTENT_TYPE)) serializer = self._serialize_map.get((mtype, stype)) if serializer is not None: return serializer(obj) for key in self._serialize_map: if not isinstance(key, tuple) and isinstance(obj, key): return self._serialize_map[key](obj) return self._serialize_default(obj) def _serialize_bytes(self, obj): yield obj def _serialize_str(self, obj): *_, params = parse_mimetype(self.headers.get(CONTENT_TYPE)) yield obj.encode(params.get('charset', 'us-ascii')) def _serialize_io(self, obj): while True: chunk = obj.read(self._chunk_size) if not chunk: break if isinstance(chunk, str): yield from self._serialize_str(chunk) else: yield from self._serialize_bytes(chunk) def _serialize_multipart(self, obj): yield from obj.serialize() def _serialize_json(self, obj): *_, params = parse_mimetype(self.headers.get(CONTENT_TYPE)) yield json.dumps(obj).encode(params.get('charset', 'utf-8')) def _serialize_form(self, obj): if isinstance(obj, Mapping): obj = list(obj.items()) return self._serialize_str(urlencode(obj, doseq=True)) def _serialize_default(self, obj): raise TypeError('unknown body part type %r' % type(obj)) def _maybe_encode_stream(self, stream): if CONTENT_ENCODING in self.headers: stream = self._apply_content_encoding(stream) if CONTENT_TRANSFER_ENCODING in self.headers: stream = self._apply_content_transfer_encoding(stream) yield from stream def _apply_content_encoding(self, stream): encoding = self.headers[CONTENT_ENCODING].lower() if encoding == 'identity': yield from stream elif encoding in ('deflate', 'gzip'): if encoding == 'gzip': zlib_mode = 16 + zlib.MAX_WBITS else: zlib_mode = -zlib.MAX_WBITS zcomp = zlib.compressobj(wbits=zlib_mode) for chunk in stream: yield zcomp.compress(chunk) else: yield zcomp.flush() else: raise RuntimeError('unknown content encoding: {}' ''.format(encoding)) def _apply_content_transfer_encoding(self, stream): encoding = self.headers[CONTENT_TRANSFER_ENCODING].lower() if encoding == 'base64': buffer = bytearray() while True: if buffer: div, mod = divmod(len(buffer), 3) chunk, buffer = buffer[:div * 3], buffer[div * 3:] if chunk: yield base64.b64encode(chunk) chunk = next(stream, None) if not chunk: if buffer: yield base64.b64encode(buffer[:]) return buffer.extend(chunk) elif encoding == 'quoted-printable': for chunk in stream: yield binascii.b2a_qp(chunk) else: raise RuntimeError('unknown content transfer encoding: {}' ''.format(encoding)) def set_content_disposition(self, disptype, **params): """Sets ``Content-Disposition`` header. :param str disptype: Disposition type: inline, attachment, form-data. Should be valid extension token (see RFC 2183) :param dict params: Disposition params """ if not disptype or not (TOKEN > set(disptype)): raise ValueError('bad content disposition type {!r}' ''.format(disptype)) value = disptype if params: lparams = [] for key, val in params.items(): if not key or not (TOKEN > set(key)): raise ValueError('bad content disposition parameter' ' {!r}={!r}'.format(key, val)) qval = quote(val, '') lparams.append((key, '"%s"' % qval)) if key == 'filename': lparams.append(('filename*', "utf-8''" + qval)) sparams = '; '.join('='.join(pair) for pair in lparams) value = '; '.join((value, sparams)) self.headers[CONTENT_DISPOSITION] = value @property def filename(self): """Returns filename specified in Content-Disposition header or ``None`` if missed.""" _, params = parse_content_disposition( self.headers.get(CONTENT_DISPOSITION)) return content_disposition_filename(params) class MultipartWriter(object): """Multipart body writer.""" #: Body part reader class for non multipart/* content types. part_writer_cls = BodyPartWriter def __init__(self, subtype='mixed', boundary=None): boundary = boundary if boundary is not None else uuid.uuid4().hex try: boundary.encode('us-ascii') except UnicodeEncodeError: raise ValueError('boundary should contains ASCII only chars') self.headers = CIMultiDict() self.headers[CONTENT_TYPE] = 'multipart/{}; boundary="{}"'.format( subtype, boundary ) self.parts = [] def __enter__(self): return self def __exit__(self, exc_type, exc_val, exc_tb): pass def __iter__(self): return iter(self.parts) def __len__(self): return len(self.parts) @property def boundary(self): *_, params = parse_mimetype(self.headers.get(CONTENT_TYPE)) return params['boundary'].encode('us-ascii') def append(self, obj, headers=None): """Adds a new body part to multipart writer.""" if isinstance(obj, self.part_writer_cls): if headers: obj.headers.update(headers) self.parts.append(obj) else: if not headers: headers = CIMultiDict() self.parts.append(self.part_writer_cls(obj, headers)) return self.parts[-1] def append_json(self, obj, headers=None): """Helper to append JSON part.""" if not headers: headers = CIMultiDict() headers[CONTENT_TYPE] = 'application/json' return self.append(obj, headers) def append_form(self, obj, headers=None): """Helper to append form urlencoded part.""" if not headers: headers = CIMultiDict() headers[CONTENT_TYPE] = 'application/x-www-form-urlencoded' assert isinstance(obj, (Sequence, Mapping)) return self.append(obj, headers) def serialize(self): """Yields multipart byte chunks.""" if not self.parts: yield b'' return for part in self.parts: yield b'--' + self.boundary + b'\r\n' yield from part.serialize() else: yield b'--' + self.boundary + b'--\r\n' yield b''
# Copyright 2015 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== # pylint: disable=invalid-name """VGG16 model for Keras. Reference: - [Very Deep Convolutional Networks for Large-Scale Image Recognition] (https://arxiv.org/abs/1409.1556) (ICLR 2015) """ from __future__ import absolute_import from __future__ import division from __future__ import print_function from tensorflow.python.keras import backend from tensorflow.python.keras.applications import imagenet_utils from tensorflow.python.keras.engine import training from tensorflow.python.keras.layers import VersionAwareLayers from tensorflow.python.keras.utils import data_utils from tensorflow.python.keras.utils import layer_utils from tensorflow.python.lib.io import file_io from tensorflow.python.util.tf_export import keras_export WEIGHTS_PATH = ('https://storage.googleapis.com/tensorflow/keras-applications/' 'vgg16/vgg16_weights_tf_dim_ordering_tf_kernels.h5') WEIGHTS_PATH_NO_TOP = ('https://storage.googleapis.com/tensorflow/' 'keras-applications/vgg16/' 'vgg16_weights_tf_dim_ordering_tf_kernels_notop.h5') layers = VersionAwareLayers() @keras_export('keras.applications.vgg16.VGG16', 'keras.applications.VGG16') def VGG16( include_top=True, weights='imagenet', input_tensor=None, input_shape=None, pooling=None, classes=1000, classifier_activation='softmax'): """Instantiates the VGG16 model. Reference: - [Very Deep Convolutional Networks for Large-Scale Image Recognition]( https://arxiv.org/abs/1409.1556) (ICLR 2015) For image classification use cases, see [this page for detailed examples]( https://keras.io/api/applications/#usage-examples-for-image-classification-models). For transfer learning use cases, make sure to read the [guide to transfer learning & fine-tuning]( https://keras.io/guides/transfer_learning/). The default input size for this model is 224x224. Note: each Keras Application expects a specific kind of input preprocessing. For VGG16, call `tf.keras.applications.vgg16.preprocess_input` on your inputs before passing them to the model. `vgg16.preprocess_input` will convert the input images from RGB to BGR, then will zero-center each color channel with respect to the ImageNet dataset, without scaling. Args: include_top: whether to include the 3 fully-connected layers at the top of the network. weights: one of `None` (random initialization), 'imagenet' (pre-training on ImageNet), or the path to the weights file to be loaded. input_tensor: optional Keras tensor (i.e. output of `layers.Input()`) to use as image input for the model. input_shape: optional shape tuple, only to be specified if `include_top` is False (otherwise the input shape has to be `(224, 224, 3)` (with `channels_last` data format) or `(3, 224, 224)` (with `channels_first` data format). It should have exactly 3 input channels, and width and height should be no smaller than 32. E.g. `(200, 200, 3)` would be one valid value. pooling: Optional pooling mode for feature extraction when `include_top` is `False`. - `None` means that the output of the model will be the 4D tensor output of the last convolutional block. - `avg` means that global average pooling will be applied to the output of the last convolutional block, and thus the output of the model will be a 2D tensor. - `max` means that global max pooling will be applied. classes: optional number of classes to classify images into, only to be specified if `include_top` is True, and if no `weights` argument is specified. classifier_activation: A `str` or callable. The activation function to use on the "top" layer. Ignored unless `include_top=True`. Set `classifier_activation=None` to return the logits of the "top" layer. When loading pretrained weights, `classifier_activation` can only be `None` or `"softmax"`. Returns: A `keras.Model` instance. """ if not (weights in {'imagenet', None} or file_io.file_exists_v2(weights)): raise ValueError('The `weights` argument should be either ' '`None` (random initialization), `imagenet` ' '(pre-training on ImageNet), ' 'or the path to the weights file to be loaded.') if weights == 'imagenet' and include_top and classes != 1000: raise ValueError('If using `weights` as `"imagenet"` with `include_top`' ' as true, `classes` should be 1000') # Determine proper input shape input_shape = imagenet_utils.obtain_input_shape( input_shape, default_size=224, min_size=32, data_format=backend.image_data_format(), require_flatten=include_top, weights=weights) if input_tensor is None: img_input = layers.Input(shape=input_shape) else: if not backend.is_keras_tensor(input_tensor): img_input = layers.Input(tensor=input_tensor, shape=input_shape) else: img_input = input_tensor # Block 1 x = layers.Conv2D( 64, (3, 3), activation='relu', padding='same', name='block1_conv1')( img_input) x = layers.Conv2D( 64, (3, 3), activation='relu', padding='same', name='block1_conv2')(x) x = layers.MaxPooling2D((2, 2), strides=(2, 2), name='block1_pool')(x) # Block 2 x = layers.Conv2D( 128, (3, 3), activation='relu', padding='same', name='block2_conv1')(x) x = layers.Conv2D( 128, (3, 3), activation='relu', padding='same', name='block2_conv2')(x) x = layers.MaxPooling2D((2, 2), strides=(2, 2), name='block2_pool')(x) # Block 3 x = layers.Conv2D( 256, (3, 3), activation='relu', padding='same', name='block3_conv1')(x) x = layers.Conv2D( 256, (3, 3), activation='relu', padding='same', name='block3_conv2')(x) x = layers.Conv2D( 256, (3, 3), activation='relu', padding='same', name='block3_conv3')(x) x = layers.MaxPooling2D((2, 2), strides=(2, 2), name='block3_pool')(x) # Block 4 x = layers.Conv2D( 512, (3, 3), activation='relu', padding='same', name='block4_conv1')(x) x = layers.Conv2D( 512, (3, 3), activation='relu', padding='same', name='block4_conv2')(x) x = layers.Conv2D( 512, (3, 3), activation='relu', padding='same', name='block4_conv3')(x) x = layers.MaxPooling2D((2, 2), strides=(2, 2), name='block4_pool')(x) # Block 5 x = layers.Conv2D( 512, (3, 3), activation='relu', padding='same', name='block5_conv1')(x) x = layers.Conv2D( 512, (3, 3), activation='relu', padding='same', name='block5_conv2')(x) x = layers.Conv2D( 512, (3, 3), activation='relu', padding='same', name='block5_conv3')(x) x = layers.MaxPooling2D((2, 2), strides=(2, 2), name='block5_pool')(x) if include_top: # Classification block x = layers.Flatten(name='flatten')(x) x = layers.Dense(4096, activation='relu', name='fc1')(x) x = layers.Dense(4096, activation='relu', name='fc2')(x) imagenet_utils.validate_activation(classifier_activation, weights) x = layers.Dense(classes, activation=classifier_activation, name='predictions')(x) else: if pooling == 'avg': x = layers.GlobalAveragePooling2D()(x) elif pooling == 'max': x = layers.GlobalMaxPooling2D()(x) # Ensure that the model takes into account # any potential predecessors of `input_tensor`. if input_tensor is not None: inputs = layer_utils.get_source_inputs(input_tensor) else: inputs = img_input # Create model. model = training.Model(inputs, x, name='vgg16') # Load weights. if weights == 'imagenet': if include_top: weights_path = data_utils.get_file( 'vgg16_weights_tf_dim_ordering_tf_kernels.h5', WEIGHTS_PATH, cache_subdir='models', file_hash='64373286793e3c8b2b4e3219cbf3544b') else: weights_path = data_utils.get_file( 'vgg16_weights_tf_dim_ordering_tf_kernels_notop.h5', WEIGHTS_PATH_NO_TOP, cache_subdir='models', file_hash='6d6bbae143d832006294945121d1f1fc') model.load_weights(weights_path) elif weights is not None: model.load_weights(weights) return model @keras_export('keras.applications.vgg16.preprocess_input') def preprocess_input(x, data_format=None): return imagenet_utils.preprocess_input( x, data_format=data_format, mode='caffe') @keras_export('keras.applications.vgg16.decode_predictions') def decode_predictions(preds, top=5): return imagenet_utils.decode_predictions(preds, top=top) preprocess_input.__doc__ = imagenet_utils.PREPROCESS_INPUT_DOC.format( mode='', ret=imagenet_utils.PREPROCESS_INPUT_RET_DOC_CAFFE, error=imagenet_utils.PREPROCESS_INPUT_ERROR_DOC) decode_predictions.__doc__ = imagenet_utils.decode_predictions.__doc__
#!/usr/bin/python # -*- coding: utf-8 -*- # Author: Matt Flood """ MediumBot's configuration GUI to make it easier for non-technical users to use the bot. Note: this is a starting point for the GUI and is not finished. """ from Tkinter import * from ttk import * from tempfile import mkstemp from shutil import move from os import remove, close import os import re FILE_PATH = "MediumBot.py" class MediumBotGUI(Frame): def __init__(self, parent): """ Initilaize the MediumBotGUI object. """ Frame.__init__(self, parent) self.parent = parent self.initUI() def initUI(self): """ Initialize the user interface. """ mediumBotVariables = self.parseMediumBot() self.parent.title("Medium Bot") self.pack(fill=BOTH, expand=True) self.columnconfigure(1, weight=1) self.columnconfigure(3, pad=7) self.rowconfigure(3, weight=1) self.rowconfigure(5, pad=7) self.initEmailUI(mediumBotVariables) self.initPasswordUI(mediumBotVariables) self.initLoginServiceUI(mediumBotVariables) self.initDriverUI(mediumBotVariables) self.initLikePostsUI(mediumBotVariables) self.initRandomizeLikesUI(mediumBotVariables) self.initMaxLikesUI(mediumBotVariables) self.initCommentUI(mediumBotVariables) self.initRandomizeCommentsUI(mediumBotVariables) self.initCommentsUI(mediumBotVariables) self.initArticleBlackListUI(mediumBotVariables) self.initFollowUsersUI(mediumBotVariables) self.initRandomizeFollowingUI(mediumBotVariables) self.initUnFollowUsersUI(mediumBotVariables) self.initRandomizeUnFollowingUI(mediumBotVariables) self.initUnFollowingUsersBlackListUI(mediumBotVariables) self.initUseRelatedTagsUI(mediumBotVariables) self.initArticlesPerTagUI(mediumBotVariables) self.initVerboseUI(mediumBotVariables) self.initStartButton() def initEmailUI(self, mediumBotVariables): """ Initialize the Email UI mediumBotVariables: variables pulled from the MediumBot.py file """ Label(self, text="Email: ").grid(sticky=W, pady=4, padx=5) self.emailField = Entry(self, width = 100) self.emailField.grid(row=0, column=1, columnspan = 3) self.emailField.insert(10, mediumBotVariables["EMAIL"]) def initPasswordUI(self, mediumBotVariables): """ Initialize the Password UI mediumBotVariables: variables pulled from the MediumBot.py file """ Label(self, text="Password: ").grid(sticky=W, pady=4, padx=5) self.passwordField = Entry(self, show="*", width = 100) self.passwordField.grid(row=1, column=1, columnspan = 3) self.passwordField.insert(10, mediumBotVariables["PASSWORD"]) def initLoginServiceUI(self, mediumBotVariables): """ Initialize the Login Service UI mediumBotVariables: variables pulled from the MediumBot.py file """ Label(self, text="Service: ").grid(sticky=W, pady=4, padx=5) self.serviceDropDown = Combobox(self, values=["Google", "Facebook", "Twitter"], width = 100) self.serviceDropDown.grid(row=2, column=1, columnspan = 3) if "Google, Twitter, or Facebook" not in mediumBotVariables["LOGIN_SERVICE"]: if "google" in mediumBotVariables["LOGIN_SERVICE"].lower(): self.serviceDropDown.current(0) elif "facebook" in mediumBotVariables["LOGIN_SERVICE"].lower() or "iceweasel" in mediumBotVariables["LOGIN_SERVICE"].lower(): self.serviceDropDown.current(1) elif "twitter" in mediumBotVariables["LOGIN_SERVICE"].lower(): self.serviceDropDown.current(2) def initDriverUI(self, mediumBotVariables): """ Initialize the Driver UI mediumBotVariables: variables pulled from the MediumBot.py file """ Label(self, text="Driver: ").grid(sticky=W, pady=4, padx=5) self.driverDropDown = Combobox(self, values=["Chrome", "Firefox/Iceweasel", "PhantomJS"], width = 100) self.driverDropDown.grid(row=3, column=1, columnspan = 3) self.driverDropDown.current(0) if "Google, Twitter, or Facebook" not in mediumBotVariables["LOGIN_SERVICE"].lower(): if "chrome" in mediumBotVariables["DRIVER"].lower(): self.driverDropDown.current(0) elif "firefox" in mediumBotVariables["DRIVER"].lower() or "iceweasel" in mediumBotVariables["DRIVER"].lower(): self.driverDropDown.current(1) elif "phantomjs" in mediumBotVariables["DRIVER"].lower(): self.driverDropDown.current(2) def initLikePostsUI(self, mediumBotVariables): """ Initialize the Like Posts UI mediumBotVariables: variables pulled from the MediumBot.py file """ Label(self, text="Like Posts: ").grid(sticky=W, pady=4, padx=5) self.likePosts = StringVar(value=mediumBotVariables["LIKE_POSTS"]) self.likePostsCheckBox = Checkbutton(self, text="", variable=self.likePosts, onvalue='True', offvalue='False') self.likePostsCheckBox.grid(row=4, column = 1, columnspan = 3) def initRandomizeLikesUI(self, mediumBotVariables): """ Initialize the Randomize Likes UI mediumBotVariables: variables pulled from the MediumBot.py file """ Label(self, text="Randomize Likes: ").grid(sticky=W, pady=4, padx=5) self.randomizeLikes = StringVar(value=mediumBotVariables["RANDOMIZE_LIKING_POSTS"]) self.randomizeLikesCheckBox = Checkbutton(self, text="", variable=self.randomizeLikes, onvalue='True', offvalue='False') self.randomizeLikesCheckBox.grid(row=5, column = 1, columnspan = 3) def initMaxLikesUI(self, mediumBotVariables): """ Initialize the Max Likes UI mediumBotVariables: variables pulled from the MediumBot.py file """ Label(self, text="Max Likes On Posts: ").grid(sticky=W, pady=4, padx=5) self.maxLikesField = Entry(self, width = 100) self.maxLikesField.grid(row=6, column=1, columnspan = 3) self.maxLikesField.insert(10, mediumBotVariables["MAX_LIKES_ON_POST"]) def initCommentUI(self, mediumBotVariables): """ Initialize the Comment UI mediumBotVariables: variables pulled from the MediumBot.py file """ Label(self, text="Comment On Posts: ").grid(sticky=W, pady=4, padx=5) self.commentOnPosts = StringVar(value=mediumBotVariables["COMMENT_ON_POSTS"]) self.commentPostsCheckBox = Checkbutton(self, text="", variable=self.commentOnPosts, onvalue='True', offvalue='False') self.commentPostsCheckBox.grid(row=7, column = 1, columnspan = 3) def initRandomizeCommentsUI(self, mediumBotVariables): """ Initialize the Randomize Comments UI mediumBotVariables: variables pulled from the MediumBot.py file """ Label(self, text="Randomize Comments: ").grid(sticky=W, pady=4, padx=5) self.randomizeComments = StringVar(value=mediumBotVariables["RANDOMIZE_COMMENTING_ON_POSTS"]) self.randomizeCommentsCheckBox = Checkbutton(self, text="", variable=self.randomizeComments, onvalue='True', offvalue='False') self.randomizeCommentsCheckBox.grid(row=8, column = 1, columnspan = 3) def initCommentsUI(self, mediumBotVariables): """ Initialize the Comments UI mediumBotVariables: variables pulled from the MediumBot.py file """ Label(self, text="Comments: ").grid(sticky=W, pady=4, padx=5) self.commentsField = Entry(self, width = 100) self.commentsField.grid(row=9, column=1, columnspan = 3) self.commentsField.insert(10, mediumBotVariables["COMMENTS"]) def initArticleBlackListUI(self, mediumBotVariables): """ Initialize the Article Black List UI mediumBotVariables: variables pulled from the MediumBot.py file """ Label(self, text="Article Black List: ").grid(sticky=W, pady=4, padx=5) self.articleBlackListField = Entry(self, width = 100) self.articleBlackListField.grid(row=10, column=1, columnspan = 3) self.articleBlackListField.insert(10, mediumBotVariables["ARTICLE_BLACK_LIST"]) def initFollowUsersUI(self, mediumBotVariables): """ Initialize the Follow Users UI mediumBotVariables: variables pulled from the MediumBot.py file """ Label(self, text="Follow Users: ").grid(sticky=W, pady=4, padx=5) self.followUsers = StringVar(value=mediumBotVariables["FOLLOW_USERS"]) self.followUsersCheckBox = Checkbutton(self, text="", variable=self.followUsers, onvalue='True', offvalue='False') self.followUsersCheckBox.grid(row=11, column = 1, columnspan = 3) def initRandomizeFollowingUI(self, mediumBotVariables): """ Initialize the Randomize Following UI mediumBotVariables: variables pulled from the MediumBot.py file """ Label(self, text="Randomize Following: ").grid(sticky=W, pady=4, padx=5) self.randomizeFollowingUsers = StringVar(value=mediumBotVariables["RANDOMIZE_FOLLOWING_USERS"]) self.randomizeFollowingCheckBox = Checkbutton(self, text="", variable=self.randomizeFollowingUsers, onvalue='True', offvalue='False') self.randomizeFollowingCheckBox.grid(row=12, column = 1, columnspan = 3) def initUnFollowUsersUI(self, mediumBotVariables): """ Initialize the UnFollow Users UI mediumBotVariables: variables pulled from the MediumBot.py file """ Label(self, text="Unfollow Users: ").grid(sticky=W, pady=4, padx=5) self.unfollowUsers = StringVar(value=mediumBotVariables["UNFOLLOW_USERS"]) self.unfollowUsersCheckBox = Checkbutton(self, text="", variable=self.unfollowUsers, onvalue='True', offvalue='False') self.unfollowUsersCheckBox.grid(row=13, column = 1, columnspan = 3) def initRandomizeUnFollowingUI(self, mediumBotVariables): """ Initialize the Randomize UnFollowing UI mediumBotVariables: variables pulled from the MediumBot.py file """ Label(self, text="Randomize Unfollowing: ").grid(sticky=W, pady=4, padx=5) self.randomizeUnfollowingUsers = StringVar(value=mediumBotVariables["RANDOMIZE_UNFOLLOWING_USERS"]) self.randomizeUnfollowingCheckBox = Checkbutton(self, text="", variable=self.randomizeUnfollowingUsers, onvalue='True', offvalue='False') self.randomizeUnfollowingCheckBox.grid(row=14, column = 1, columnspan = 3) def initUnFollowingUsersBlackListUI(self, mediumBotVariables): """ Initialize the UnFollowing Users Black List UI mediumBotVariables: variables pulled from the MediumBot.py file """ Label(self, text="Unfollow Black List: ").grid(sticky=W, pady=4, padx=5) self.unfollowBlackListField = Entry(self, width = 100) self.unfollowBlackListField.grid(row=15, column=1, columnspan = 3) self.unfollowBlackListField.insert(10, mediumBotVariables["UNFOLLOW_USERS_BLACK_LIST"]) def initUseRelatedTagsUI(self, mediumBotVariables): """ Initialize the Use Related Tags UI mediumBotVariables: variables pulled from the MediumBot.py file """ Label(self, text="Use Related Tags: ").grid(sticky=W, pady=4, padx=5) self.useRelatedTags = StringVar(value=mediumBotVariables["USE_RELATED_TAGS"]) self.useRelatedTagsCheckBox = Checkbutton(self, text="", variable=self.useRelatedTags, onvalue='True', offvalue='False') self.useRelatedTagsCheckBox.grid(row=16, column = 1, columnspan = 3) def initArticlesPerTagUI(self, mediumBotVariables): """ Initialize the Articles Per Tag UI mediumBotVariables: variables pulled from the MediumBot.py file """ Label(self, text="Articles Per Tag: ").grid(sticky=W, pady=4, padx=5) self.articlesPerTagField = Entry(self, width = 100) self.articlesPerTagField.grid(row=17, column=1, columnspan = 3) self.articlesPerTagField.insert(10, mediumBotVariables["ARTICLES_PER_TAG"]) def initVerboseUI(self, mediumBotVariables): """ Initialize the Verbose UI mediumBotVariables: variables pulled from the MediumBot.py file """ Label(self, text="Verbose Output: ").grid(sticky=W, pady=4, padx=5) self.verbose = StringVar(value=mediumBotVariables["VERBOSE"]) self.verboseCheckBox = Checkbutton(self, text="", variable=self.verbose, onvalue='True', offvalue='False') self.verboseCheckBox.grid(row=18, column = 1, columnspan = 3) def initStartButton(self): """ Initialize the Start Button UI """ startButton = Button(self, text="Start Bot", command=self.runMediumBot) startButton.grid(row=20, column=3) def parseMediumBot(self): """ Get the user's current set values in MediumBot.py to display in the fields. """ lines = [line.rstrip('\n') for line in open(FILE_PATH)] charsToRemove = ["'", "[", "]", '"'] mediumBotVariables = {} atStartOfVariables = False for line in lines: if not atStartOfVariables and "=" in line: atStartOfVariables = True elif atStartOfVariables and "=" not in line: break if atStartOfVariables: mediumBotVar = line.split(" = ") for charToRemove in charsToRemove: mediumBotVar[1] = mediumBotVar[1].replace(charToRemove,"") mediumBotVariables[mediumBotVar[0]] = mediumBotVar[1] return mediumBotVariables def runMediumBot(self): """ Run the MediumBot """ if self.validateFieldValues(): self.updateMediumBot() self.parent.destroy() os.system("python "+FILE_PATH) def validateFieldValues(self): """ Validate the values entered in the fields """ return True def updateMediumBot(self): """ Update the MediumBot with the values in the GUI. Called when the start buttton is clicked. """ self.updateMediumBotVariable("EMAIL = '"+self.emailField.get()+"'") self.updateMediumBotVariable("PASSWORD = '"+self.passwordField.get()+"'") self.updateMediumBotVariable("LOGIN_SERVICE = '"+self.serviceDropDown.get()+"'") self.updateMediumBotVariable("DRIVER = '"+self.driverDropDown.get()+"'") self.updateMediumBotVariable("LIKE_POSTS = "+self.likePosts.get()) self.updateMediumBotVariable("RANDOMIZE_LIKING_POSTS = "+self.randomizeLikes.get()) self.updateMediumBotVariable("MAX_LIKES_ON_POST = "+self.maxLikesField.get()) self.updateMediumBotVariable("COMMENT_ON_POSTS = "+self.commentOnPosts.get()) self.updateMediumBotVariable("RANDOMIZE_LIKING_POSTS = "+self.randomizeComments.get()) commentsConverted = self.convertStringToArrayString(self.commentsField.get()) self.updateMediumBotVariable("COMMENTS = "+commentsConverted) articlesConverted = self.convertStringToArrayString(self.articleBlackListField.get()) self.updateMediumBotVariable("ARTICLE_BLACK_LIST = "+articlesConverted) self.updateMediumBotVariable("FOLLOW_USERS = "+self.followUsers.get()) self.updateMediumBotVariable("RANDOMIZE_FOLLOWING_USERS = "+self.randomizeFollowingUsers.get()) self.updateMediumBotVariable("UNFOLLOW_USERS = "+self.unfollowUsers.get()) self.updateMediumBotVariable("RANDOMIZE_UNFOLLOWING_USERS = "+self.randomizeUnfollowingUsers.get()) unfollowConverted = self.convertStringToArrayString(self.unfollowBlackListField.get()) self.updateMediumBotVariable("UNFOLLOW_USERS_BLACK_LIST = "+unfollowConverted) self.updateMediumBotVariable("USE_RELATED_TAGS = "+self.useRelatedTags.get()) self.updateMediumBotVariable("ARTICLES_PER_TAG = "+self.articlesPerTagField.get()) self.updateMediumBotVariable("VERBOSE = "+self.verbose.get()) def validateEmail(self): """ Validate the email address passed is a valid email. return: true if the email is valid : false if the email is not valid. """ result = False email = self.emailField.get() if email: result = re.match(r"[^@]+@[^@]+\.[^@]+", email) return result def validatePassword(self): """ Validate the password passed is ot empty. return: true if the password is valid : false if the password is not valid. """ result = False if self.passwordField.get(): result = True return result def validateMaxLikesOnPost(self): """ Validate the max likes value passed is valid. return: true if the max likes value is valid : false if the max likes value is not valid. """ return self.isNumberValid(self.maxLikesField.get()) def validateComments(self): """ Validate the comments passed are valid comments. return: true if the comments are valid : false if the comments are not valid. """ return self.notContainSpecialChars(self.commentsField.get()) def validateArticleBlackList(self): """ Validate the article black list passed is valid. return: true if the article black list is valid : false if the article black list is not valid. """ return self.notContainSpecialChars(self.articleBlackListField.get()) def validateUnfollowBlackList(self): """ Validate the unfollow black list passed is valid. return: true if the unfollow blacklist is valid : false if the unfollow blacklist is not valid. """ return self.notContainSpecialChars(self.unfollowBlackListField.get()) def validateArticlesPerTag(self): """ Validate the articles per tag value passed is valid. return: true if the articles per tag value is valid : false if the articles per tag value is not valid. """ return self.isNumberValid(self.articlesPerTagField.get()) def notContainSpecialChars(self, value): """ Validate the string does not have any special characters. value: string to validate that special characters do not exist. """ return not set('[~!@#$%^&*()_+{}":;\']+$').intersection(value) def isNumberValid(self, value): """ Validate the number passed is a valid number. value: the number to validate. return: true if the number is valid : false if the number is not valid. """ result = False if value: result = isinstance(value, int) return result def updateMediumBotVariable(self, value): """ Update a variable in the MediumBot.py file. value: value to update the variable in MediumBot.py to. """ variableToUpdate = value.split()[0] fh, abs_path = mkstemp() with open(abs_path,'w') as newFile: with open(FILE_PATH) as oldFile: for line in oldFile: if (variableToUpdate+" =" in line and " = " in line and "if" not in line and "elif" not in line and ".lower()" not in line and "(" not in line and ((variableToUpdate == "FOLLOW_USERS" and "UNFOLLOW_USERS" not in line) or variableToUpdate != "FOLLOW_USERS")): newFile.write(value+"\n") else: newFile.write(line) close(fh) remove(FILE_PATH) move(abs_path, FILE_PATH) def convertStringToArrayString(self, valueToConvert): """ Convert the comma deliminated string to an array formatted string. valueToConvert: string to convert in to an array formatted string. return: the formatted string. """ array = [x.strip() for x in valueToConvert.split(',')] result = "" for val in array: if result != "": result = result+", '"+val+"'" else: result = "'"+val+"'" return "["+result+"]" def main(): """ Set the gui's window size, initialize and launch """ root = Tk() root.geometry("500x570+300+300") app = MediumBotGUI(root) root.mainloop() if __name__ == '__main__': main()
from __future__ import print_function from six import string_types as _string_types import numpy as np import tensorflow as tf import coremltools from tensorflow.python.util import compat from coremltools.models.neural_network import NeuralNetworkBuilder from coremltools.models import datatypes, utils, MLModel from warnings import warn from ._ops_to_layers import convert_ops_to_layers from . import _ops_to_layers from ._interpret_shapes import _interpret_shape as interpret_shape from ._tf_graph_transform import _topological_sort_ops, _find_unused_ops from .optimizations._optimize_nn_spec import optimize_nn_spec class SupportedVersion(): # Supported iOS Version # New OS Version must be added at the end to maintain backward version index supported_ios_version = ['11.2', '12'] @staticmethod def ios_support_check(target_ios): return target_ios in SupportedVersion.supported_ios_version @staticmethod def get_supported_ios(): return SupportedVersion.supported_ios_version # Context stores useful information about TF graph and the conversion process class Context(object): def __init__(self, consts, shape_dict, ops, blob_graph, output_features): self.builder = None self.consts = consts self.shape_dict = shape_dict #Tensor name --> shape ({str: list}) self.translated = {x: True for x in self.consts.keys()} self.out_name_to_in_name = {} #for blobs which come from a no-op self.all_ops = ops self.output_names = [] for out in output_features: self.output_names.append(out[0]) self.skip_map_names = {} # Set of all load constants added to the CoreML graph self.load_constants_mlmodel = {} # Tensor name to list of ops it feeds into self.blob_graph = blob_graph # Tensor name sto and their inferred rank 4 shape (Batch/Sequennce, C, H, W) self.shape_dict_rank_4 = {} # Tensor name to labeled shapes (one of 'S','C','H','W'). # e.g.: 'input' tensor which has shape (1,224,224,3) --> ('S','H','W','C') self.dim_labels = {} # Whether to use DFS search to infer shapes on the path to conv layers self.use_dfs_shape_infer = True #True self.session = None self.input_feed_dict = None self.unused_ops = [] # list of op names that can be skipped for conversion as they do not connect to the output self.effectively_constant_ops = [] # list of ops that are not of type "Const", but their output does not change with differently valued graph input self.skip_ops = [] self.add_custom_layers = False self.custom_conversion_functions = {} self.ops_converted_to_custom_layers = [] # list of ops that have been converted to custom coreml layers def _infer_coreml_input_shape(tf_shape): """Infer CoreML input shape from TensorFlow shape. """ if len(tf_shape) == 0: shape = [1, 1, 1] elif len(tf_shape) == 1: # TODO - remove style transfer 1D hack # Input is 1D but it goes to the width dimension: (1,1,W) shape = [1, 1, tf_shape[0]] #(C,H,W) elif len(tf_shape) == 2: # assume (Batch, Channels) - Batch dimension should be dropped shape = [tf_shape[1]] elif len(tf_shape) == 3: # assume (Batch, Sequence-Length, channels) shape = [tf_shape[2], 1, tf_shape[1]] elif len(tf_shape) == 4: #(B,H,W,C) --> (C,H,W) shape = [tf_shape[3], tf_shape[1], tf_shape[2]] #(C,H,W) else: raise ValueError('Unrecognized TensorFlow input shape' + str(tf_shape)) return shape def _infer_coreml_output_shape(tf_shape): """Infer CoreML output shape from TensorFlow shape. """ shape = [] if len(tf_shape) == 1: shape = [tf_shape[0], 1, 1] elif len(tf_shape) == 2: if tf_shape[0] == 1: # (B,C) shape = [tf_shape[1]] else: shape = None elif len(tf_shape) == 3: # since output shape is not required by CoreML and rank-3 tensor in TF is ambiguous, we do not assign a shape shape = None elif len(tf_shape) == 4: shape = [tf_shape[3], tf_shape[1], tf_shape[2]] #(C,H,W) elif len(tf_shape) == 0: # scalar shape = [1] else: raise ValueError('Unrecognized TensorFlow output shape ' + str(tf_shape)) return shape def _check_unsupported_ops(ops, output_feature_names, skip_ops): ''' Checks all the ops till the desired outputs are reached. From these ops it collects all the ops that are unsupported. Error out if there is at least one unsupported op. :param ops: ops of the TF graph :param output_feature_names: [str]: list of output names :param skip_ops: [str]: list of op names that can be skipped since they either do not depend on the actual value of the input or do not connect to the final output ''' unsupported_op_types = [] outputs_encountered = {} for op in ops: all_outputs_reached = True for out in output_feature_names: if out not in outputs_encountered: all_outputs_reached = False break if all_outputs_reached: break if op.type not in _ops_to_layers._OP_REGISTRY and \ op.type not in unsupported_op_types and \ op.name not in skip_ops: unsupported_op_types.append(op.type) for out in op.outputs: outputs_encountered[out.name] = True if len(unsupported_op_types) > 0: raise NotImplementedError("Unsupported Ops of type: %s" % ( ','.join(unsupported_op_types))) def _convert_pb_to_mlmodel(tf_model_path, mlmodel_path, output_feature_names, input_name_shape_dict={}, image_input_names=None, is_bgr=False, red_bias=0.0, green_bias=0.0, blue_bias=0.0, gray_bias=0.0, image_scale=1.0, class_labels=None, predicted_feature_name=None, predicted_probabilities_output='', add_custom_layers=False, # type: bool custom_conversion_functions={} # type: Dict[Text, Any] ): # Load the TF graph print('') print('Loading the TF graph...') with open(tf_model_path, 'rb') as f: serialized = f.read() gdef = tf.GraphDef() gdef.ParseFromString(serialized) with tf.Graph().as_default() as g: tf.import_graph_def(gdef, name='') sess = tf.Session(graph=g) OPS = g.get_operations() if 'DecodeJpeg' in [op.type for op in OPS]: raise NotImplementedError("Unsupported Op of type: DecodeJpeg. " "Kindly refer to the \"examples/inception_v3.ipynb\" notebook, " "on the tfcoreml github page, to see how to strip input " "pre-processing from the TF graph before conversion to CoreML.") print('Graph Loaded.') # Sort the ops in topological order and check whether the graph has cycles, if yes, error out OPS = _topological_sort_ops(OPS) SHAPE_DICT = {} #Tensor name --> shape ({str: list}) CONSTS = {} #Const Tensor name --> value BLOB_GRAPH = {} #Blob name to list of ops it feeds into # Make Dictionary of Input blob to the list of ops it feeds into for op in OPS: for inp in op.inputs: if inp.name in BLOB_GRAPH: BLOB_GRAPH[inp.name].append(op) for out in op.outputs: if out.name not in BLOB_GRAPH: BLOB_GRAPH[out.name] = [] # Fill in input information input_features = [] output_features = [] input_feed_dict = dict() #Input tensors' values input_feed_dict2 = dict() # used later to find skippable ops # run through all placeholders for op in OPS: output_names = set([compat.as_str_any(x.name) for x in op.outputs]) if op.type == 'Placeholder': # Handle placeholders -- all placeholders are inputs assert not any(filter(output_names.__contains__, output_feature_names)), \ ('Output feature cannot be a placeholder') input_name = compat.as_str_any(op.outputs[0].name) shape = op.outputs[0].get_shape() if input_name in input_name_shape_dict: shape = input_name_shape_dict[input_name] elif shape.is_fully_defined(): shape = shape.as_list() else: try: shape_list = shape.as_list() except: raise ValueError('Please provide the shape for the input {} through the argument \'input_name_shape_dict\''.format(input_name)) if shape_list[0] is None and None not in shape_list[1:]: shape = [1] + shape_list[1:] else: raise ValueError("%s is a placeholder with incomplete shape %s. Please provide the 'input_name_shape_dict' " "argument to the convert function, with the fully defined shape." %(input_name, str(shape))) if len(shape) == 0: # scalar - use a 1 input_feed_dict[op.outputs[0]] = 1 input_feed_dict2[op.outputs[0]] = 1 else: input_feed_dict[op.outputs[0]] = np.random.rand(*shape) input_feed_dict2[op.outputs[0]] = 255*np.random.rand(*shape) SHAPE_DICT[input_name] = list(shape) # Find "effectively_constant_ops": ops whose output(s) do not change with different valued Graph level inputs # Find "unused_ops" : ops that are not connected to the output(s) unused_ops = [] effectively_constant_ops = [] try: print("Now finding ops in the TF graph that can be dropped for inference") unused_ops, effectively_constant_ops = _find_unused_ops(OPS, sess, output_feature_names, input_feed_dict, input_feed_dict2) # return type: List[str], List[str] except: pass # Populate SHAPE_DICT: Dictionary for all tensor blobs in the graph and their shapes shapes_wanted = [] # list of output names consts_wanted = [] for op in OPS: for out in op.outputs: shape = out.get_shape() if not shape.is_fully_defined(): shapes_wanted.append((compat.as_str_any(out.name), out)) else: SHAPE_DICT[compat.as_str_any(out.name)] = shape.as_list() is_const = False if op.type == 'Const': is_const = True if op.type == 'Dequantize' and op.name in effectively_constant_ops: is_const = True if is_const: const = op.outputs[0] consts_wanted.append((compat.as_str_any(const.name), const)) print('Collecting all the \'Const\' ops from the graph, by running it....') if len(shapes_wanted) > 0 or len(consts_wanted) > 0: tensor_names, tensors = zip(*(shapes_wanted+consts_wanted)) if len(consts_wanted) > 0: const_tensor_names, _ = zip(*consts_wanted) else: const_tensor_names = [] tensors_evaluated = sess.run(tensors, feed_dict=input_feed_dict) for i in range(len(tensor_names)): if tensor_names[i] not in SHAPE_DICT: SHAPE_DICT[tensor_names[i]] = list(tensors_evaluated[i].shape) if tensor_names[i] in const_tensor_names and tensor_names[i] not in CONSTS: CONSTS[tensor_names[i]] = tensors_evaluated[i] print('Done.') # Fill in output information for op in OPS: output_names = set([compat.as_str_any(x.name) for x in op.outputs]) if any(filter(output_names.__contains__, output_feature_names)): # retrieve model outputs for output in [x for x in op.outputs if x.name in output_feature_names]: #infer shape for Core ML tf_shape = SHAPE_DICT[compat.as_str_any(output.name)] shape = _infer_coreml_output_shape(tf_shape) out_name = output.name if shape is None: output_features.append( (compat.as_str_any(out_name), None)) else: output_features.append( (compat.as_str_any(out_name), datatypes.Array(*shape))) if len(output_features) != len(output_feature_names): all_out_names_in_graph = [out_[0] for out_ in output_features] for given_out_name in output_feature_names: if given_out_name not in all_out_names_in_graph: raise ValueError("output name: {}, was provided, but the Tensorflow graph does not contain a tensor with this name.".format(given_out_name)) if not add_custom_layers: _check_unsupported_ops(OPS, output_feature_names, effectively_constant_ops + unused_ops) print('Now starting translation to CoreML graph.') # Load all the dictionaries in the object of the class "context" context = Context(CONSTS, SHAPE_DICT, OPS, BLOB_GRAPH, output_features) # Interpret Input shapes and fill in input information for Core ML # (now that SHAPE_DICT and CONSTS are complete) sequence_inputs = dict() for input_tensor in input_feed_dict: input_name = compat.as_str_any(input_tensor.name) shape = SHAPE_DICT[input_name] if context.use_dfs_shape_infer: status = interpret_shape(input_name, context) else: status = False if status: print('Automatic shape interpretation succeeded for input blob %s' \ %(input_name)) shape = context.shape_dict_rank_4[input_name] if len(shape) == 4 and shape[0] != 1: sequence_inputs[input_name] = shape[0] # if the consumer of input_tensor is an one-hot encoding op, # treat it as a sequence. consumer_op = input_tensor.consumers()[0] if consumer_op.type == 'OneHot': shape = [1,] sequence_inputs[input_name] = -1 else: shape = _infer_coreml_input_shape(shape) input_features.append( (compat.as_str_any(input_name), datatypes.Array(*shape))) # Set classifier flag is_classifier = class_labels is not None mode = 'classifier' if is_classifier else None # Convert the TF graph with builder input_features = list(input_features) output_features = list(output_features) builder = NeuralNetworkBuilder(input_features, output_features, mode=mode) context.builder = builder context.session = sess context.input_feed_dict = input_feed_dict context.unused_ops = unused_ops context.effectively_constant_ops = effectively_constant_ops context.add_custom_layers = add_custom_layers context.custom_conversion_functions = custom_conversion_functions convert_ops_to_layers(context) sess.close() #optimizations on the nn spec optimize_nn_spec(spec=builder.spec) #Add a description for inputs that are sequences for i, inputs in enumerate(builder.spec.description.input): if inputs.name in sequence_inputs: seq_length = sequence_inputs[inputs.name] proto_shape = [] if inputs.type.HasField('multiArrayType'): proto_shape = [int(s) for s in inputs.type.multiArrayType.shape] if seq_length == -1: msg = 'This input is a sequence' if len(proto_shape): msg += '. Feed it an MLMultiArray of shape {} at runtime'.format(str(['Seq_size', '1'] + proto_shape)) else: msg = 'This input is a sequence of length ' + str(seq_length) if len(proto_shape): msg += '. Feed it an MLMultiArray of shape {} at runtime'.format(str([seq_length, 1] + proto_shape)) builder.spec.description.input[i].shortDescription = msg # Add image input identifier if image_input_names is not None and isinstance( image_input_names, _string_types): image_input_names = [image_input_names] # Replace all input/output blob names with ":" to "__" for compatible # auto-generated Objective C / Swift code interface_blob_names = [] for idx, in_blob in enumerate(builder.spec.description.input): interface_blob_names.append(in_blob.name) builder.spec.description.input[idx].name = in_blob.name.replace(':', '__').replace('/', '__') for idx, out_blob in enumerate(builder.spec.description.output): interface_blob_names.append(out_blob.name) builder.spec.description.output[idx].name = out_blob.name.replace(':', '__').replace('/', '__') nn_spec = builder.nn_spec for i, spec_layer in enumerate(nn_spec.layers): for j, blob in enumerate(spec_layer.input): name = spec_layer.input[j] if name in interface_blob_names: spec_layer.input[j] = name.replace(':', '__').replace('/', '__') for j, blob in enumerate(spec_layer.output): name = spec_layer.output[j] if name in interface_blob_names: spec_layer.output[j] = name.replace(':', '__').replace('/', '__') # replace ':' and '/' in input names by '__' def rename_input_dict_or_list(array): if isinstance(array, list): for i, name in enumerate(array): array[i] = name.replace(':', '__').replace('/', '__') elif isinstance(array, dict): array = {name.replace(':','__').replace('/', '__'):value for name, value in array.items()} return array image_input_names = rename_input_dict_or_list(image_input_names) is_bgr = rename_input_dict_or_list(is_bgr) red_bias = rename_input_dict_or_list(red_bias) blue_bias = rename_input_dict_or_list(blue_bias) green_bias = rename_input_dict_or_list(green_bias) gray_bias = rename_input_dict_or_list(gray_bias) image_scale = rename_input_dict_or_list(image_scale) # Add classifier classes (if applicable) if is_classifier: classes_in = class_labels if isinstance(classes_in, _string_types): import os if not os.path.isfile(classes_in): raise ValueError("Path to class labels (%s) does not exist." % \ classes_in) with open(classes_in, 'r') as f: classes = f.read() classes = classes.splitlines() elif type(classes_in) is list: # list[int or str] classes = classes_in else: raise ValueError('Class labels must be a list of integers / strings,'\ ' or a file path') if predicted_feature_name is not None: builder.set_class_labels( classes, predicted_feature_name=predicted_feature_name, prediction_blob=predicted_probabilities_output) else: builder.set_class_labels(classes) # Set pre-processing parameters builder.set_pre_processing_parameters(image_input_names=image_input_names, is_bgr=is_bgr, red_bias=red_bias, green_bias=green_bias, blue_bias=blue_bias, gray_bias=gray_bias, image_scale=image_scale) print("Translation to CoreML spec completed. Now compiling and saving the CoreML model.") try: import coremltools if mlmodel_path is not None: coremltools.models.utils.save_spec(builder.spec, mlmodel_path) print("\n Core ML model generated. Saved at location: %s \n" % (mlmodel_path)) mlmodel = MLModel(builder.spec) except RuntimeError as e: raise ValueError('Compilation failed: {}'.format(str(e))) print('Core ML input(s): \n', builder.spec.description.input) print('Core ML output(s): \n', builder.spec.description.output) # print information about all ops for which custom layers have been added if len(context.ops_converted_to_custom_layers) > 0: print('\n') print("Custom layers have been added to the CoreML model " "corresponding to the following ops in the TF graph: ") for i, op in enumerate(context.ops_converted_to_custom_layers): input_info = [] for input_ in op.inputs: input_info.append((str(input_.name), context.shape_dict.get(input_.name, str("Shape not available")))) output_info = [] for output_ in op.outputs: output_info.append((str(output_.name), context.shape_dict.get(output_.name, str("Shape not available")))) print("{}/{}: op type: {}, op input names and shapes: {}, op output names and shapes: {}". format(i + 1, len(context.ops_converted_to_custom_layers), op.type, str(input_info), str(output_info))) # Return the protobuf model return mlmodel def convert(tf_model_path, mlmodel_path=None, output_feature_names=None, input_name_shape_dict=None, image_input_names=None, tf_image_format=None, is_bgr=False, red_bias=0.0, green_bias=0.0, blue_bias=0.0, gray_bias=0.0, image_scale=1.0, class_labels=None, predicted_feature_name=None, predicted_probabilities_output='', add_custom_layers=False, # type: bool custom_conversion_functions={}, # type: Dict[Text, Any] minimum_ios_deployment_target='12', ): """ Convert a frozen TensorFlow grpah (.pb format) to the CoreML format (.mlmodel) Parameters ---------- tf_model_path: str tf_model_path must be path to the frozen .pb model. mlmodel_path: str Path to where the generated .mlmodel will be stored output_feature_names: [str] List of strings. Names of the output tensors. input_name_shape_dict: {str: [int]} Dictionary of input tensor names and their corresponding shapes expressed as a list of ints image_input_names: [str] | str Input names (a subset of the keys of input_name_shape_dict) that can be treated as images by Core ML. All other inputs are treated as MultiArrays. tf_image_format: str Optional. Specify either 'NCHW' or 'NHWC' to set or override the image format. Without this field set, the image format may be determined from the input model. Only valid for minimum_ios_deployment_target > '12' is_bgr: bool | dict(): Applicable only if image_input_names is specified. To specify different values for each image input provide a dictionary with input names as keys. red_bias: float | dict() Bias value to be added to the red channel of the input image, after applying scale. Defaults to 0.0 Applicable only if image_input_names is specified. To specify different values for each image input provide a dictionary with input names as keys. blue_bias: float | dict() Bias value to be added to the blue channel of the input image, after applying scale. Defaults to 0.0 Applicable only if image_input_names is specified. To specify different values for each image input provide a dictionary with input names as keys. green_bias: float | dict() Bias value to be added to the green channel of the input image, after applying scale. Defaults to 0.0 Applicable only if image_input_names is specified. To specify different values for each image input provide a dictionary with input names as keys. gray_bias: float | dict() Bias value to be added to the input image (in grayscale), after applying scale. Defaults to 0.0 Applicable only if image_input_names is specified. To specify different values for each image input provide a dictionary with input names as keys. image_scale: float | dict() Value by which input images will be scaled before bias is added and Core ML model makes a prediction. Defaults to 1.0. Applicable only if image_input_names is specified. To specify different values for each image input provide a dictionary with input names as keys. class_labels: list[int or str] | str Class labels (applies to classifiers only) that map the index of the output of a neural network to labels in a classifier. If the provided class_labels is a string, it is assumed to be a filepath where classes are parsed as a list of newline separated strings. predicted_feature_name: str Name of the output feature for the class labels exposed in the Core ML model (applies to classifiers only). Defaults to 'classLabel' predicted_probabilities_output: str Name of the neural network output to be interpreted as the predicted probabilities of the resulting classes. Typically the output of a softmax function. add_custom_layers: bool Flag to turn on addition of custom CoreML layers for unsupported TF ops or attributes within a supported op. custom_conversion_functions: dict(): {Text: func(**kwargs)} Argument to provide user-defined functions for converting Tensorflow operations (op, for short). A dictionary with keys corresponding to the names or types of the TF ops and values as handle to user-defined functions. The keys can be either the type of the op or the name of the op. If former, then the function is called whenever the op of that type is encountered during conversion. By using op names, specific ops can be targeted which is useful for handling unsupported configuration in an op. The function receives multiple arguments: TF operation, the CoreML Neural network builder object, dictionary containing the op's inputs that are constants and their values (as numpy arrays). The function can add custom layers or any other combination of CoreML layers to translate the TF op. See "examples/custom_layer_examples.ipynb" jupyter-notebook for examples on using this argument. minimum_ios_deployment_target: str Minimum target deployment iOS version (default: '12'). Supported iOS version options: '11.2', '12'. Core ML model produced by the converter will be compatible with the iOS version specified in this argument and the versions after it. e.g., if minimum_ios_deployment_target='12', the converter would only utilize layers released till iOS 12 (equivalently macOS 10.14, watchOS 5 etc.), and the produced model can be deployed to iOS12+ (iOS 12, iOS 13 and later). iOS 11.2 (Core ML 0.8): https://github.com/apple/coremltools/releases/tag/v0.8 iOS 12 (Core ML 2.0): https://github.com/apple/coremltools/releases/tag/v2.0 Returns ------- model: MLModel Model in Core ML format. """ if not SupportedVersion.ios_support_check(minimum_ios_deployment_target): msg = '{} not supported. Please provide one of target iOS: {}\n'.format(minimum_ios_deployment_target, SupportedVersion.get_supported_ios()) msg += "For minimum deployment target iOS 13 and later, use Unified API 'coremltools.convert' introduced in coremltools 4.0" raise TypeError(msg) if input_name_shape_dict is None: input_name_shape_dict = {} if output_feature_names is None: raise ValueError('Output feature names must be provided.') if tf_image_format is not None: warn('tf_image_format not honored when minimum_ios_deployment_target < 13') return _convert_pb_to_mlmodel( tf_model_path, mlmodel_path, output_feature_names, input_name_shape_dict, image_input_names=image_input_names, is_bgr=is_bgr, red_bias=red_bias, green_bias=green_bias, blue_bias=blue_bias, gray_bias=gray_bias, image_scale=image_scale, class_labels=class_labels, predicted_feature_name=predicted_feature_name, predicted_probabilities_output=predicted_probabilities_output, add_custom_layers=add_custom_layers, custom_conversion_functions=custom_conversion_functions)
"""Generated message classes for testing version v1. Allows developers to run automated tests for their mobile applications on Google infrastructure. """ # NOTE: This file is autogenerated and should not be edited by hand. from apitools.base.protorpclite import messages as _messages from apitools.base.py import encoding package = 'testing' class Account(_messages.Message): """Identifies an account and how to log into it Fields: googleAuto: An automatic google login account """ googleAuto = _messages.MessageField('GoogleAuto', 1) class AndroidDevice(_messages.Message): """A single Android device. Fields: androidModelId: The id of the Android device to be used. Use the EnvironmentDiscoveryService to get supported options. Required androidVersionId: The id of the Android OS version to be used. Use the EnvironmentDiscoveryService to get supported options. Required locale: The locale the test device used for testing. Use the EnvironmentDiscoveryService to get supported options. Required orientation: How the device is oriented during the test. Use the EnvironmentDiscoveryService to get supported options. Required """ androidModelId = _messages.StringField(1) androidVersionId = _messages.StringField(2) locale = _messages.StringField(3) orientation = _messages.StringField(4) class AndroidDeviceCatalog(_messages.Message): """The currently supported Android devices. Fields: models: The set of supported Android device models. @OutputOnly runtimeConfiguration: The set of supported runtime configurations. @OutputOnly versions: The set of supported Android OS versions. @OutputOnly """ models = _messages.MessageField('AndroidModel', 1, repeated=True) runtimeConfiguration = _messages.MessageField('AndroidRuntimeConfiguration', 2) versions = _messages.MessageField('AndroidVersion', 3, repeated=True) class AndroidInstrumentationTest(_messages.Message): """A test of an Android application that can control an Android component independently of its normal lifecycle. Android instrumentation tests run an application APK and test APK inside the same process on a virtual or physical AndroidDevice. They also specify a test runner class, such as com.google.GoogleTestRunner, which can vary on the specific instrumentation framework chosen. See <http://developer.android.com/tools/testing/testing_android.html> for more information on types of Android tests. Fields: appApk: The APK for the application under test. Required appPackageId: The java package for the application under test. Optional, default is determined by examining the application's manifest. testApk: The APK containing the test code to be executed. Required testPackageId: The java package for the test to be executed. Optional, default is determined by examining the application's manifest. testRunnerClass: The InstrumentationTestRunner class. Optional, default is determined by examining the application's manifest. testTargets: Each target must be fully qualified with the package name or class name, in one of these formats: - "package package_name" - "class package_name.class_name" - "class package_name.class_name#method_name" Optional, if empty, all targets in the module will be run. """ appApk = _messages.MessageField('FileReference', 1) appPackageId = _messages.StringField(2) testApk = _messages.MessageField('FileReference', 3) testPackageId = _messages.StringField(4) testRunnerClass = _messages.StringField(5) testTargets = _messages.StringField(6, repeated=True) class AndroidMatrix(_messages.Message): """A set of Android device configuration permutations is defined by the the cross-product of the given axes. Internally, the given AndroidMatrix will be expanded into a set of AndroidDevices. Only supported permutations will be instantiated. Invalid permutations (e.g., incompatible models/versions) are ignored. Fields: androidModelIds: The ids of the set of Android device to be used. Use the EnvironmentDiscoveryService to get supported options. Required androidVersionIds: The ids of the set of Android OS version to be used. Use the EnvironmentDiscoveryService to get supported options. Required locales: The set of locales the test device will enable for testing. Use the EnvironmentDiscoveryService to get supported options. Required orientations: The set of orientations to test with. Use the EnvironmentDiscoveryService to get supported options. Required """ androidModelIds = _messages.StringField(1, repeated=True) androidVersionIds = _messages.StringField(2, repeated=True) locales = _messages.StringField(3, repeated=True) orientations = _messages.StringField(4, repeated=True) class AndroidModel(_messages.Message): """A description of an Android device tests may be run on. Enums: FormValueValuesEnum: Whether this device is virtual or physical. @OutputOnly Fields: brand: The company that this device is branded with. Example: "Google", "Samsung" @OutputOnly codename: The name of the industrial design. This corresponds to android.os.Build.DEVICE @OutputOnly form: Whether this device is virtual or physical. @OutputOnly id: The unique opaque id for this model. Use this for invoking the TestExecutionService. @OutputOnly manufacturer: The manufacturer of this device. @OutputOnly name: The human-readable marketing name for this device model. Examples: "Nexus 5", "Galaxy S5" @OutputOnly screenDensity: Screen density in DPI. This corresponds to ro.sf.lcd_density @OutputOnly screenX: Screen size in the horizontal (X) dimension measured in pixels. @OutputOnly screenY: Screen size in the vertical (Y) dimension measured in pixels. @OutputOnly supportedAbis: The list of supported ABIs for this device. This corresponds to either android.os.Build.SUPPORTED_ABIS (for API level 21 and above) or android.os.Build.CPU_ABI/CPU_ABI2. The most preferred ABI is the first element in the list. Elements are optionally prefixed by "version_id:" (where version_id is the id of an AndroidVersion), denoting an ABI that is supported only on a particular version. @OutputOnly supportedVersionIds: The set of Android versions this device supports. @OutputOnly tags: Tags for this dimension. Examples: "default", "preview", "deprecated" """ class FormValueValuesEnum(_messages.Enum): """Whether this device is virtual or physical. @OutputOnly Values: DEVICE_FORM_UNSPECIFIED: Do not use. For proto versioning only. VIRTUAL: A software stack that simulates the device PHYSICAL: Actual hardware """ DEVICE_FORM_UNSPECIFIED = 0 VIRTUAL = 1 PHYSICAL = 2 brand = _messages.StringField(1) codename = _messages.StringField(2) form = _messages.EnumField('FormValueValuesEnum', 3) id = _messages.StringField(4) manufacturer = _messages.StringField(5) name = _messages.StringField(6) screenDensity = _messages.IntegerField(7, variant=_messages.Variant.INT32) screenX = _messages.IntegerField(8, variant=_messages.Variant.INT32) screenY = _messages.IntegerField(9, variant=_messages.Variant.INT32) supportedAbis = _messages.StringField(10, repeated=True) supportedVersionIds = _messages.StringField(11, repeated=True) tags = _messages.StringField(12, repeated=True) class AndroidRoboTest(_messages.Message): """A test of an android application that explores the application on a virtual or physical Android Device, finding culprits and crashes as it goes. Fields: appApk: The APK for the application under test. Required appInitialActivity: The initial activity that should be used to start the app. Optional appPackageId: The java package for the application under test. Optional, default is determined by examining the application's manifest. maxDepth: The max depth of the traversal stack Robo can explore. Needs to be at least 2 to make Robo explore the app beyond the first activity. Default is 50. Optional maxSteps: The max number of steps Robo can execute. Default is no limit. Optional roboDirectives: A set of directives Robo should apply during the crawl. This allows users to customize the crawl. For example, the username and password for a test account can be provided. Optional """ appApk = _messages.MessageField('FileReference', 1) appInitialActivity = _messages.StringField(2) appPackageId = _messages.StringField(3) maxDepth = _messages.IntegerField(4, variant=_messages.Variant.INT32) maxSteps = _messages.IntegerField(5, variant=_messages.Variant.INT32) roboDirectives = _messages.MessageField('RoboDirective', 6, repeated=True) class AndroidRuntimeConfiguration(_messages.Message): """Configuration that can be selected at the time a test is run. Fields: locales: The set of available locales. @OutputOnly orientations: The set of available orientations. @OutputOnly """ locales = _messages.MessageField('Locale', 1, repeated=True) orientations = _messages.MessageField('Orientation', 2, repeated=True) class AndroidVersion(_messages.Message): """A version of the Android OS Fields: apiLevel: The API level for this Android version. Examples: 18, 19 @OutputOnly codeName: The code name for this Android version. Examples: "JellyBean", "KitKat" @OutputOnly distribution: Market share for this version. @OutputOnly id: An opaque id for this Android version. Use this id to invoke the TestExecutionService. @OutputOnly releaseDate: The date this Android version became available in the market. @OutputOnly tags: Tags for this dimension. Examples: "default", "preview", "deprecated" versionString: A string representing this version of the Android OS. Examples: "4.3", "4.4" @OutputOnly """ apiLevel = _messages.IntegerField(1, variant=_messages.Variant.INT32) codeName = _messages.StringField(2) distribution = _messages.MessageField('Distribution', 3) id = _messages.StringField(4) releaseDate = _messages.MessageField('Date', 5) tags = _messages.StringField(6, repeated=True) versionString = _messages.StringField(7) class CancelTestMatrixResponse(_messages.Message): """Response containing the current state of the specified test matrix. Enums: TestStateValueValuesEnum: The current rolled-up state of the test matrix. If this state is already final, then the cancelation request will have no effect. Fields: testState: The current rolled-up state of the test matrix. If this state is already final, then the cancelation request will have no effect. """ class TestStateValueValuesEnum(_messages.Enum): """The current rolled-up state of the test matrix. If this state is already final, then the cancelation request will have no effect. Values: TEST_STATE_UNSPECIFIED: Do not use. For proto versioning only. VALIDATING: The execution or matrix is being validated. PENDING: The execution or matrix is waiting for resources to become available. RUNNING: The execution is currently being processed. Can only be set on an execution. FINISHED: The execution or matrix has terminated normally. On a matrix this means that the matrix level processing completed normally, but individual executions may be in an ERROR state. ERROR: The execution or matrix has stopped because it encountered an infrastructure failure. UNSUPPORTED_ENVIRONMENT: The execution was not run because it corresponds to a unsupported environment. Can only be set on an execution. INCOMPATIBLE_ENVIRONMENT: The execution was not run because the provided inputs are incompatible with the requested environment. Example: requested AndroidVersion is lower than APK's minSdkVersion Can only be set on an execution. INCOMPATIBLE_ARCHITECTURE: The execution was not run because the provided inputs are incompatible with the requested architecture. Example: requested device does not support running the native code in the supplied APK Can only be set on an execution. CANCELLED: The user cancelled the execution. Can only be set on an execution. INVALID: The execution or matrix was not run because the provided inputs are not valid. Examples: input file is not of the expected type, is malformed/corrupt, or was flagged as malware """ TEST_STATE_UNSPECIFIED = 0 VALIDATING = 1 PENDING = 2 RUNNING = 3 FINISHED = 4 ERROR = 5 UNSUPPORTED_ENVIRONMENT = 6 INCOMPATIBLE_ENVIRONMENT = 7 INCOMPATIBLE_ARCHITECTURE = 8 CANCELLED = 9 INVALID = 10 testState = _messages.EnumField('TestStateValueValuesEnum', 1) class ClientInfo(_messages.Message): """Information about the client which invoked the test. Fields: name: Client name, such as gcloud. Required """ name = _messages.StringField(1) class Date(_messages.Message): """Represents a whole calendar date, e.g. date of birth. The time of day and time zone are either specified elsewhere or are not significant. The date is relative to the Proleptic Gregorian Calendar. The day may be 0 to represent a year and month where the day is not significant, e.g. credit card expiration date. The year may be 0 to represent a month and day independent of year, e.g. anniversary date. Related types are google.type.TimeOfDay and `google.protobuf.Timestamp`. Fields: day: Day of month. Must be from 1 to 31 and valid for the year and month, or 0 if specifying a year/month where the day is not significant. month: Month of year. Must be from 1 to 12. year: Year of date. Must be from 1 to 9999, or 0 if specifying a date without a year. """ day = _messages.IntegerField(1, variant=_messages.Variant.INT32) month = _messages.IntegerField(2, variant=_messages.Variant.INT32) year = _messages.IntegerField(3, variant=_messages.Variant.INT32) class DeviceFile(_messages.Message): """A single device file description. Fields: obbFile: A reference to an opaque binary blob file """ obbFile = _messages.MessageField('ObbFile', 1) class Distribution(_messages.Message): """Data about the relative number of devices running a given configuration of the Android platform. Fields: marketShare: The estimated fraction (0-1) of the total market with this configuration. @OutputOnly measurementTime: The time this distribution was measured. @OutputOnly """ marketShare = _messages.FloatField(1) measurementTime = _messages.StringField(2) class Empty(_messages.Message): """A generic empty message that you can re-use to avoid defining duplicated empty messages in your APIs. A typical example is to use it as the request or the response type of an API method. For instance: service Foo { rpc Bar(google.protobuf.Empty) returns (google.protobuf.Empty); } The JSON representation for `Empty` is empty JSON object `{}`. """ class Environment(_messages.Message): """The environment in which the test is run. Fields: androidDevice: An Android device which must be used with an Android test. """ androidDevice = _messages.MessageField('AndroidDevice', 1) class EnvironmentMatrix(_messages.Message): """The matrix of environments in which the test is to be executed. Fields: androidMatrix: A matrix of Android devices. """ androidMatrix = _messages.MessageField('AndroidMatrix', 1) class EnvironmentVariable(_messages.Message): """A key-value pair passed as an environment variable to the test Fields: key: Key for the environment variable value: Value for the environment variable """ key = _messages.StringField(1) value = _messages.StringField(2) class FileReference(_messages.Message): """A reference to a file, used for user inputs. Fields: gcsPath: A path to a file in Google Cloud Storage. Example: gs://build- app-1414623860166/app-debug-unaligned.apk """ gcsPath = _messages.StringField(1) class GoogleAuto(_messages.Message): """Enables automatic Google account login. If set, the service will automatically generate a Google test account and add it to the device, before executing the test. Note that test accounts might be reused. Many applications show their full set of functionalities when an account is present on the device. Logging into the device with these generated accounts allows testing more functionalities. """ class GoogleCloudStorage(_messages.Message): """A storage location within Google cloud storage (GCS). Fields: gcsPath: The path to a directory in GCS that will eventually contain the results for this test. The requesting user must have write access on the bucket in the supplied path. Required """ gcsPath = _messages.StringField(1) class ListTestMatricesResponse(_messages.Message): """Response contain a list of Test Matrices. Fields: testMatrices: The set of test matrices. """ testMatrices = _messages.MessageField('TestMatrix', 1, repeated=True) class Locale(_messages.Message): """A location/region designation for language. Fields: id: The id for this locale. Example: "en_US" @OutputOnly name: A human-friendly name for this language/locale. Example: "English" @OutputOnly region: A human-friendy string representing the region for this locale. Example: "United States" Not present for every locale. @OutputOnly tags: Tags for this dimension. Examples: "default" """ id = _messages.StringField(1) name = _messages.StringField(2) region = _messages.StringField(3) tags = _messages.StringField(4, repeated=True) class ObbFile(_messages.Message): """An opaque binary blob file to install on the device before the test starts Fields: obb: Opaque Binary Blob (OBB) file(s) to install on the device Required obbFileName: OBB file name which must conform to the format as specified by Android e.g. [main|patch].0300110.com.example.android.obb which will be installed into <shared-storage>/Android/obb/<package-name>/ on the device Required """ obb = _messages.MessageField('FileReference', 1) obbFileName = _messages.StringField(2) class Orientation(_messages.Message): """Screen orientation of the device. Fields: id: The id for this orientation. Example: "portrait" @OutputOnly name: A human-friendly name for this orientation. Example: "portrait" @OutputOnly tags: Tags for this dimension. Examples: "default" """ id = _messages.StringField(1) name = _messages.StringField(2) tags = _messages.StringField(3, repeated=True) class ResultStorage(_messages.Message): """Locations where the results of running the test are stored. Fields: googleCloudStorage: Required. toolResultsExecution: The tool results execution that results are written to. @OutputOnly toolResultsHistory: The tool results history that contains the tool results execution that results are written to. Optional, if not provided the service will choose an appropriate value. """ googleCloudStorage = _messages.MessageField('GoogleCloudStorage', 1) toolResultsExecution = _messages.MessageField('ToolResultsExecution', 2) toolResultsHistory = _messages.MessageField('ToolResultsHistory', 3) class RoboDirective(_messages.Message): """Directs Robo to interact with a specific UI element if it is encountered during the crawl. Currently, Robo can set text in text fields. Fields: inputText: The text that Robo is directed to set. Required resourceName: The android resource name of the target UI element For example, in Java: R.string.foo in xml: @string/foo Only the \u201cfoo\u201d part is needed. Reference doc: https://developer.android.com/guide/topics/resources/accessing- resources.html Required """ inputText = _messages.StringField(1) resourceName = _messages.StringField(2) class StandardQueryParameters(_messages.Message): """Query parameters accepted by all methods. Enums: FXgafvValueValuesEnum: V1 error format. AltValueValuesEnum: Data format for response. Fields: f__xgafv: V1 error format. access_token: OAuth access token. alt: Data format for response. bearer_token: OAuth bearer token. callback: JSONP fields: Selector specifying which fields to include in a partial response. key: API key. Your API key identifies your project and provides you with API access, quota, and reports. Required unless you provide an OAuth 2.0 token. oauth_token: OAuth 2.0 token for the current user. pp: Pretty-print response. prettyPrint: Returns response with indentations and line breaks. quotaUser: Available to use for quota purposes for server-side applications. Can be any arbitrary string assigned to a user, but should not exceed 40 characters. trace: A tracing token of the form "token:<tokenid>" to include in api requests. uploadType: Legacy upload protocol for media (e.g. "media", "multipart"). upload_protocol: Upload protocol for media (e.g. "raw", "multipart"). """ class AltValueValuesEnum(_messages.Enum): """Data format for response. Values: json: Responses with Content-Type of application/json media: Media download with context-dependent Content-Type proto: Responses with Content-Type of application/x-protobuf """ json = 0 media = 1 proto = 2 class FXgafvValueValuesEnum(_messages.Enum): """V1 error format. Values: _1: v1 error format _2: v2 error format """ _1 = 0 _2 = 1 f__xgafv = _messages.EnumField('FXgafvValueValuesEnum', 1) access_token = _messages.StringField(2) alt = _messages.EnumField('AltValueValuesEnum', 3, default=u'json') bearer_token = _messages.StringField(4) callback = _messages.StringField(5) fields = _messages.StringField(6) key = _messages.StringField(7) oauth_token = _messages.StringField(8) pp = _messages.BooleanField(9, default=True) prettyPrint = _messages.BooleanField(10, default=True) quotaUser = _messages.StringField(11) trace = _messages.StringField(12) uploadType = _messages.StringField(13) upload_protocol = _messages.StringField(14) class TestDetails(_messages.Message): """Additional details about the progress of the running test. Fields: errorMessage: If the TestState is ERROR, then this string will contain human-readable details about the error. @OutputOnly progressMessages: Human-readable, detailed descriptions of the test's progress. For example: "Provisioning a device", "Starting Test". During the course of execution new data may be appended to the end of progress_messages. @OutputOnly """ errorMessage = _messages.StringField(1) progressMessages = _messages.StringField(2, repeated=True) class TestEnvironmentCatalog(_messages.Message): """A description of a test environment. Fields: androidDeviceCatalog: Android devices suitable for running Android Instrumentation Tests. """ androidDeviceCatalog = _messages.MessageField('AndroidDeviceCatalog', 1) class TestExecution(_messages.Message): """Specifies a single test to be executed in a single environment. Enums: StateValueValuesEnum: Indicates the current progress of the test execution (e.g., FINISHED). @OutputOnly Fields: environment: How the host machine(s) are configured. @OutputOnly id: Unique id set by the backend. @OutputOnly matrixId: Id of the containing TestMatrix. @OutputOnly projectId: The cloud project that owns the test execution. @OutputOnly state: Indicates the current progress of the test execution (e.g., FINISHED). @OutputOnly testDetails: Additional details about the running test. @OutputOnly testSpecification: How to run the test. @OutputOnly timestamp: The time this test execution was initially created. @OutputOnly toolResultsStep: Where the results for this execution are written. @OutputOnly """ class StateValueValuesEnum(_messages.Enum): """Indicates the current progress of the test execution (e.g., FINISHED). @OutputOnly Values: TEST_STATE_UNSPECIFIED: Do not use. For proto versioning only. VALIDATING: The execution or matrix is being validated. PENDING: The execution or matrix is waiting for resources to become available. RUNNING: The execution is currently being processed. Can only be set on an execution. FINISHED: The execution or matrix has terminated normally. On a matrix this means that the matrix level processing completed normally, but individual executions may be in an ERROR state. ERROR: The execution or matrix has stopped because it encountered an infrastructure failure. UNSUPPORTED_ENVIRONMENT: The execution was not run because it corresponds to a unsupported environment. Can only be set on an execution. INCOMPATIBLE_ENVIRONMENT: The execution was not run because the provided inputs are incompatible with the requested environment. Example: requested AndroidVersion is lower than APK's minSdkVersion Can only be set on an execution. INCOMPATIBLE_ARCHITECTURE: The execution was not run because the provided inputs are incompatible with the requested architecture. Example: requested device does not support running the native code in the supplied APK Can only be set on an execution. CANCELLED: The user cancelled the execution. Can only be set on an execution. INVALID: The execution or matrix was not run because the provided inputs are not valid. Examples: input file is not of the expected type, is malformed/corrupt, or was flagged as malware """ TEST_STATE_UNSPECIFIED = 0 VALIDATING = 1 PENDING = 2 RUNNING = 3 FINISHED = 4 ERROR = 5 UNSUPPORTED_ENVIRONMENT = 6 INCOMPATIBLE_ENVIRONMENT = 7 INCOMPATIBLE_ARCHITECTURE = 8 CANCELLED = 9 INVALID = 10 environment = _messages.MessageField('Environment', 1) id = _messages.StringField(2) matrixId = _messages.StringField(3) projectId = _messages.StringField(4) state = _messages.EnumField('StateValueValuesEnum', 5) testDetails = _messages.MessageField('TestDetails', 6) testSpecification = _messages.MessageField('TestSpecification', 7) timestamp = _messages.StringField(8) toolResultsStep = _messages.MessageField('ToolResultsStep', 9) class TestMatrix(_messages.Message): """A group of one or more TestExecutions, built by taking a product of values over a pre-defined set of axes. Enums: InvalidMatrixDetailsValueValuesEnum: Describes why the matrix is considered invalid. Only useful for matrices in the INVALID state. @OutputOnly StateValueValuesEnum: Indicates the current progress of the test matrix (e.g., FINISHED) @OutputOnly Fields: clientInfo: Information about the client which invoked the test. Optional environmentMatrix: How the host machine(s) are configured. Required invalidMatrixDetails: Describes why the matrix is considered invalid. Only useful for matrices in the INVALID state. @OutputOnly projectId: The cloud project that owns the test matrix. @OutputOnly resultStorage: Where the results for the matrix are written. Required state: Indicates the current progress of the test matrix (e.g., FINISHED) @OutputOnly testExecutions: The list of test executions that the service creates for this matrix. @OutputOnly testMatrixId: Unique id set by the service. @OutputOnly testSpecification: How to run the test. Required timestamp: The time this test matrix was initially created. @OutputOnly """ class InvalidMatrixDetailsValueValuesEnum(_messages.Enum): """Describes why the matrix is considered invalid. Only useful for matrices in the INVALID state. @OutputOnly Values: INVALID_MATRIX_DETAILS_UNSPECIFIED: Do not use. For proto versioning only. DETAILS_UNAVAILABLE: The matrix is INVALID, but there are no further details available. MALFORMED_APK: The input app APK could not be parsed. MALFORMED_TEST_APK: The input test APK could not be parsed. NO_MANIFEST: The AndroidManifest.xml could not be found. NO_PACKAGE_NAME: The APK manifest does not declare a package name. TEST_SAME_AS_APP: The test package and app package are the same. NO_INSTRUMENTATION: The test apk does not declare an instrumentation. NO_LAUNCHER_ACTIVITY: A main launcher activity could not be found. FORBIDDEN_PERMISSIONS: The app declares one or more permissions that are not allowed. INVALID_ROBO_DIRECTIVES: There is a conflict in the provided robo_directives. """ INVALID_MATRIX_DETAILS_UNSPECIFIED = 0 DETAILS_UNAVAILABLE = 1 MALFORMED_APK = 2 MALFORMED_TEST_APK = 3 NO_MANIFEST = 4 NO_PACKAGE_NAME = 5 TEST_SAME_AS_APP = 6 NO_INSTRUMENTATION = 7 NO_LAUNCHER_ACTIVITY = 8 FORBIDDEN_PERMISSIONS = 9 INVALID_ROBO_DIRECTIVES = 10 class StateValueValuesEnum(_messages.Enum): """Indicates the current progress of the test matrix (e.g., FINISHED) @OutputOnly Values: TEST_STATE_UNSPECIFIED: Do not use. For proto versioning only. VALIDATING: The execution or matrix is being validated. PENDING: The execution or matrix is waiting for resources to become available. RUNNING: The execution is currently being processed. Can only be set on an execution. FINISHED: The execution or matrix has terminated normally. On a matrix this means that the matrix level processing completed normally, but individual executions may be in an ERROR state. ERROR: The execution or matrix has stopped because it encountered an infrastructure failure. UNSUPPORTED_ENVIRONMENT: The execution was not run because it corresponds to a unsupported environment. Can only be set on an execution. INCOMPATIBLE_ENVIRONMENT: The execution was not run because the provided inputs are incompatible with the requested environment. Example: requested AndroidVersion is lower than APK's minSdkVersion Can only be set on an execution. INCOMPATIBLE_ARCHITECTURE: The execution was not run because the provided inputs are incompatible with the requested architecture. Example: requested device does not support running the native code in the supplied APK Can only be set on an execution. CANCELLED: The user cancelled the execution. Can only be set on an execution. INVALID: The execution or matrix was not run because the provided inputs are not valid. Examples: input file is not of the expected type, is malformed/corrupt, or was flagged as malware """ TEST_STATE_UNSPECIFIED = 0 VALIDATING = 1 PENDING = 2 RUNNING = 3 FINISHED = 4 ERROR = 5 UNSUPPORTED_ENVIRONMENT = 6 INCOMPATIBLE_ENVIRONMENT = 7 INCOMPATIBLE_ARCHITECTURE = 8 CANCELLED = 9 INVALID = 10 clientInfo = _messages.MessageField('ClientInfo', 1) environmentMatrix = _messages.MessageField('EnvironmentMatrix', 2) invalidMatrixDetails = _messages.EnumField('InvalidMatrixDetailsValueValuesEnum', 3) projectId = _messages.StringField(4) resultStorage = _messages.MessageField('ResultStorage', 5) state = _messages.EnumField('StateValueValuesEnum', 6) testExecutions = _messages.MessageField('TestExecution', 7, repeated=True) testMatrixId = _messages.StringField(8) testSpecification = _messages.MessageField('TestSpecification', 9) timestamp = _messages.StringField(10) class TestSetup(_messages.Message): """A description of how to set up the device prior to running the test Fields: account: The device will be logged in on this account for the duration of the test. Optional directoriesToPull: The directories on the device to upload to GCS at the end of the test; they must be absolute, whitelisted paths. Refer to RegularFile for whitelisted paths. Optional environmentVariables: Environment variables to set for the test. filesToPush: Optional """ account = _messages.MessageField('Account', 1) directoriesToPull = _messages.StringField(2, repeated=True) environmentVariables = _messages.MessageField('EnvironmentVariable', 3, repeated=True) filesToPush = _messages.MessageField('DeviceFile', 4, repeated=True) class TestSpecification(_messages.Message): """A description of how to run the test. Fields: androidInstrumentationTest: An Android instrumentation test. androidRoboTest: An Android robo test. autoGoogleLogin: Enables automatic Google account login. If set, the service will automatically generate a Google test account and add it to the device, before executing the test. Note that test accounts might be reused. Many applications show their full set of functionalities when an account is present on the device. Logging into the device with these generated accounts allows testing more functionalities. Default is false. Optional testSetup: Test setup requirements e.g. files to install, bootstrap scripts Optional testTimeout: Max time a test execution is allowed to run before it is automatically cancelled. Optional, default is 5 min. """ androidInstrumentationTest = _messages.MessageField('AndroidInstrumentationTest', 1) androidRoboTest = _messages.MessageField('AndroidRoboTest', 2) autoGoogleLogin = _messages.BooleanField(3) testSetup = _messages.MessageField('TestSetup', 4) testTimeout = _messages.StringField(5) class TestingProjectsTestMatricesCancelRequest(_messages.Message): """A TestingProjectsTestMatricesCancelRequest object. Fields: projectId: Cloud project that owns the test. testMatrixId: Test matrix that will be canceled. """ projectId = _messages.StringField(1, required=True) testMatrixId = _messages.StringField(2, required=True) class TestingProjectsTestMatricesCreateRequest(_messages.Message): """A TestingProjectsTestMatricesCreateRequest object. Fields: projectId: The GCE project under which this job will run. requestId: A string id used to detect duplicated requests. Ids are automatically scoped to a project, so users should ensure the ID is unique per-project. A UUID is recommended. Optional, but strongly recommended. testMatrix: A TestMatrix resource to be passed as the request body. """ projectId = _messages.StringField(1, required=True) requestId = _messages.StringField(2) testMatrix = _messages.MessageField('TestMatrix', 3) class TestingProjectsTestMatricesDeleteRequest(_messages.Message): """A TestingProjectsTestMatricesDeleteRequest object. Fields: projectId: Cloud project that owns the test. testMatrixId: Test matrix that will be canceled. """ projectId = _messages.StringField(1, required=True) testMatrixId = _messages.StringField(2, required=True) class TestingProjectsTestMatricesGetRequest(_messages.Message): """A TestingProjectsTestMatricesGetRequest object. Fields: projectId: Cloud project that owns the test matrix. testMatrixId: Unique test matrix id which was assigned by the service. """ projectId = _messages.StringField(1, required=True) testMatrixId = _messages.StringField(2, required=True) class TestingProjectsTestMatricesListRequest(_messages.Message): """A TestingProjectsTestMatricesListRequest object. Fields: projectId: Cloud project that owns the tests. """ projectId = _messages.StringField(1, required=True) class TestingTestEnvironmentCatalogGetRequest(_messages.Message): """A TestingTestEnvironmentCatalogGetRequest object. Enums: EnvironmentTypeValueValuesEnum: The type of environment that should be listed. Fields: environmentType: The type of environment that should be listed. """ class EnvironmentTypeValueValuesEnum(_messages.Enum): """The type of environment that should be listed. Values: ENVIRONMENT_TYPE_UNSPECIFIED: <no description> ANDROID: <no description> """ ENVIRONMENT_TYPE_UNSPECIFIED = 0 ANDROID = 1 environmentType = _messages.EnumField('EnvironmentTypeValueValuesEnum', 1, required=True) class ToolResultsExecution(_messages.Message): """Represents a tool results execution resource. This has the results of a TestMatrix. Fields: executionId: A tool results execution ID. @OutputOnly historyId: A tool results history ID. @OutputOnly projectId: The cloud project that owns the tool results execution. @OutputOnly """ executionId = _messages.StringField(1) historyId = _messages.StringField(2) projectId = _messages.StringField(3) class ToolResultsHistory(_messages.Message): """Represents a tool results history resource. Fields: historyId: A tool results history ID. Required projectId: The cloud project that owns the tool results history. Required """ historyId = _messages.StringField(1) projectId = _messages.StringField(2) class ToolResultsStep(_messages.Message): """Represents a tool results step resource. This has the results of a TestExecution. Fields: executionId: A tool results execution ID. @OutputOnly historyId: A tool results history ID. @OutputOnly projectId: The cloud project that owns the tool results step. @OutputOnly stepId: A tool results step ID. @OutputOnly """ executionId = _messages.StringField(1) historyId = _messages.StringField(2) projectId = _messages.StringField(3) stepId = _messages.StringField(4) encoding.AddCustomJsonFieldMapping( StandardQueryParameters, 'f__xgafv', '$.xgafv', package=u'testing') encoding.AddCustomJsonEnumMapping( StandardQueryParameters.FXgafvValueValuesEnum, '_1', '1', package=u'testing') encoding.AddCustomJsonEnumMapping( StandardQueryParameters.FXgafvValueValuesEnum, '_2', '2', package=u'testing')
# vim: tabstop=4 shiftwidth=4 softtabstop=4 # Copyright 2014 Violin Memory, Inc. # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. """ Violin Memory tests for common driver functions by Ryan Lucio Senior Software Engineer Violin Memory Note: python documentation for unit testing can be found at http://docs.python.org/2/library/unittest.html Note: cinder documentation for development can be found at http://docs.openstack.org/developer/cinder/devref/development.environment.html """ import mox import unittest # TODO(rdl): import and use test utils (cinder.tests.utils) from cinder import context from cinder.db.sqlalchemy import models from cinder.volume import volume_types from cinder.volume.drivers.violin.vxg.core.session import XGSession from cinder.volume.drivers.violin.vxg.vshare.igroup import IGroupManager from cinder.volume.drivers.violin.vxg.vshare.iscsi import ISCSIManager from cinder.volume.drivers.violin.vxg.vshare.lun import LUNManager_3 as LUNManager from cinder.volume.drivers.violin.vxg.vshare.snapshot import SnapshotManager from cinder.volume.drivers.violin.vxg.vshare.vshare import VShare from cinder.volume import configuration as conf from cinder.volume.drivers.violin import v6000_common class testV6000Common(unittest.TestCase): """A test class for the VMEM V6000 common driver module.""" def setUp(self): self.m = mox.Mox() self.m_conn = self.m.CreateMock(VShare) self.m_conn.basic = self.m.CreateMock(XGSession) self.m_conn.lun = self.m.CreateMock(LUNManager) self.m_conn.iscsi = self.m.CreateMock(ISCSIManager) self.m_conn.igroup = self.m.CreateMock(IGroupManager) self.m_conn.snapshot = self.m.CreateMock(SnapshotManager) self.m_conn.version = '1.1.1' self.config = mox.MockObject(conf.Configuration) self.config.append_config_values(mox.IgnoreArg()) self.config.gateway_vip = '1.1.1.1' self.config.gateway_mga = '2.2.2.2' self.config.gateway_mgb = '3.3.3.3' self.config.gateway_user = 'admin' self.config.gateway_password = '' self.config.volume_backend_name = 'violin' self.config.use_igroups = False self.config.use_thin_luns = False self.config.san_is_local = False self.driver = v6000_common.V6000CommonDriver(configuration=self.config) self.driver.vmem_vip = self.m_conn self.driver.vmem_mga = self.m_conn self.driver.vmem_mgb = self.m_conn self.driver.container = 'myContainer' self.driver.device_id = 'ata-VIOLIN_MEMORY_ARRAY_23109R00000022' self.stats = {} self.driver.gateway_fc_wwns = ['wwn.21:00:00:24:ff:45:fb:22', 'wwn.21:00:00:24:ff:45:fb:23', 'wwn.21:00:00:24:ff:45:f1:be', 'wwn.21:00:00:24:ff:45:f1:bf', 'wwn.21:00:00:24:ff:45:e2:30', 'wwn.21:00:00:24:ff:45:e2:31', 'wwn.21:00:00:24:ff:45:e2:5e', 'wwn.21:00:00:24:ff:45:e2:5f'] self.volume1 = mox.MockObject(models.Volume) self.volume1.id = '3d31af29-6d7d-443f-b451-6f0040d3c9a9' self.volume1.size = 1 self.volume2 = mox.MockObject(models.Volume) self.volume2.id = '4c1af784-b328-43d2-84c8-db02158b922d' self.volume2.size = 2 self.snapshot1 = mox.MockObject(models.Snapshot) self.snapshot1.name = 'snap-01' self.snapshot1.snapshot_id = 'f8849c41-6d72-4f5a-8339-2cd6b52b5e5a' self.snapshot1.volume_id = 1 self.snapshot1.volume_name = 'vol-01' self.snapshot2 = mox.MockObject(models.Snapshot) self.snapshot2.name = 'snap-02' self.snapshot2.snapshot_id = '23e44fad-8840-46f1-99d3-5605a08fb289' self.snapshot2.volume_id = 2 self.snapshot2.volume_name = 'vol-02' def tearDown(self): self.m.UnsetStubs() def testCheckForSetupError(self): bn1 = ("/vshare/state/local/container/%s/threshold/usedspace" "/threshold_hard_val" % self.driver.container) bn2 = ("/vshare/state/local/container/%s/threshold/provision" "/threshold_hard_val" % self.driver.container) bn_thresholds = {bn1: 0, bn2: 100} self.m.StubOutWithMock(self.driver, '_is_supported_vmos_version') self.driver._is_supported_vmos_version(mox.IsA(str)).AndReturn(True) self.m_conn.basic.get_node_values([bn1, bn2]).AndReturn(bn_thresholds) self.m.ReplayAll() self.assertTrue(self.driver.check_for_setup_error() is None) self.m.VerifyAll() def testCheckForSetupError_NoContainer(self): '''Container name is empty.''' self.driver.container = "" self.assertRaises(v6000_common.InvalidBackendConfig, self.driver.check_for_setup_error) def testCheckForSetupError_InvalidUsedSpaceThreshold(self): bn1 = ("/vshare/state/local/container/%s/threshold/usedspace" "/threshold_hard_val" % self.driver.container) bn2 = ("/vshare/state/local/container/%s/threshold/provision" "/threshold_hard_val" % self.driver.container) bn_thresholds = {bn1: 99, bn2: 100} self.m.StubOutWithMock(self.driver, '_is_supported_vmos_version') self.driver._is_supported_vmos_version(mox.IsA(str)).AndReturn(True) self.m_conn.basic.get_node_values([bn1, bn2]).AndReturn(bn_thresholds) self.m.ReplayAll() self.assertRaises(v6000_common.InvalidBackendConfig, self.driver.check_for_setup_error) self.m.VerifyAll() def testCheckForSetupError_InvalidProvisionedSpaceThreshold(self): bn1 = ("/vshare/state/local/container/%s/threshold/usedspace" "/threshold_hard_val" % self.driver.container) bn2 = ("/vshare/state/local/container/%s/threshold/provision" "/threshold_hard_val" % self.driver.container) bn_thresholds = {bn1: 0, bn2: 99} self.m.StubOutWithMock(self.driver, '_is_supported_vmos_version') self.driver._is_supported_vmos_version(mox.IsA(str)).AndReturn(True) self.m_conn.basic.get_node_values([bn1, bn2]).AndReturn(bn_thresholds) self.m.ReplayAll() self.assertRaises(v6000_common.InvalidBackendConfig, self.driver.check_for_setup_error) self.m.VerifyAll() def testCreateVolume(self): volume = self.volume1 self.m.StubOutWithMock(self.driver, '_create_lun') self.driver._create_lun(volume) self.m.ReplayAll() self.assertTrue(self.driver.create_volume(volume) is None) self.m.VerifyAll() def testDeleteVolume(self): volume = self.volume1 self.m.StubOutWithMock(self.driver, '_delete_lun') self.driver._delete_lun(volume) self.m.ReplayAll() self.assertTrue(self.driver.delete_volume(volume) is None) self.m.VerifyAll() def testCreateSnapshot(self): snapshot = self.snapshot1 self.m.StubOutWithMock(self.driver, '_create_lun_snapshot') self.driver._create_lun_snapshot(snapshot) self.m.ReplayAll() self.assertTrue(self.driver.create_snapshot(snapshot) is None) self.m.VerifyAll() def testDeleteSnapshot(self): snapshot = self.snapshot1 self.m.StubOutWithMock(self.driver, '_delete_lun_snapshot') self.driver._delete_lun_snapshot(snapshot) self.m.ReplayAll() self.assertTrue(self.driver.delete_snapshot(snapshot) is None) self.m.VerifyAll() #def testCreateVolumeFromSnapshot(self): # src_snap = self.snapshot1 # dest_vol = self.volume2 # self.m.StubOutWithMock(self.driver, '_create_lun') # self.m.StubOutWithMock(self.driver, 'copy_volume_data') # self.driver._create_lun(dest_vol) # self.driver.copy_volume_data(self.driver.context, dest_vol, src_snap) # self.m.ReplayAll() # self.assertTrue(self.driver.create_volume_from_snapshot # (dest_vol, src_snap) is None) # self.m.VerifyAll() def testCreateClonedVolume(self): src_vol = self.volume1 dest_vol = self.volume2 self.m.StubOutWithMock(self.driver, '_create_lun') self.m.StubOutWithMock(self.driver, 'copy_volume_data') self.driver._create_lun(dest_vol) self.driver.copy_volume_data(self.driver.context, src_vol, dest_vol) self.m.ReplayAll() self.assertTrue(self.driver.create_cloned_volume (src_vol, dest_vol) is None) self.m.VerifyAll() def testExtendVolume(self): volume = self.volume1 new_volume_size = 10 response = {'code': 0, 'message': 'Success '} self.m.StubOutWithMock(self.driver, '_send_cmd') self.driver._send_cmd(self.m_conn.lun.resize_lun, mox.IsA(str), self.driver.container, volume['id'], new_volume_size).AndReturn(response) self.m.ReplayAll() self.assertTrue(self.driver.extend_volume(volume, new_volume_size) is None) self.m.VerifyAll() def testExtendVolume_NewSizeIsTooSmall(self): volume = self.volume1 new_volume_size = 0 response = {'code': 14036, 'message': 'Failure'} self.m.StubOutWithMock(self.driver, '_send_cmd') self.driver._send_cmd(self.m_conn.lun.resize_lun, mox.IsA(str), self.driver.container, volume['id'], new_volume_size ).AndRaise(v6000_common.ViolinBackendErr()) self.m.ReplayAll() self.assertRaises(v6000_common.ViolinBackendErr, self.driver.extend_volume, volume, new_volume_size) self.m.VerifyAll() def testCreateLun(self): volume = self.volume1 response = {'code': 0, 'message': 'LUN create: success!'} self.m.StubOutWithMock(self.driver, '_send_cmd') self.driver._send_cmd(self.m_conn.lun.create_lun, mox.IsA(str), self.driver.container, volume['id'], volume['size'], 1, "0", "0", "w", 1, 512, False, False, None).AndReturn(response) self.m.ReplayAll() self.assertTrue(self.driver._create_lun(volume) is None) self.m.VerifyAll() def testCreateLun_LunAlreadyExists(self): volume = self.volume1 response = {'code': 0, 'message': 'LUN create: success!'} self.m.StubOutWithMock(self.driver, '_send_cmd') self.driver._send_cmd(self.m_conn.lun.create_lun, mox.IsA(str), self.driver.container, volume['id'], volume['size'], 1, "0", "0", "w", 1, 512, False, False, None ).AndRaise(v6000_common.ViolinBackendErrExists()) self.m.ReplayAll() self.assertTrue(self.driver._create_lun(volume) is None) self.m.VerifyAll() def testCreateLun_CreateFailsWithException(self): volume = self.volume1 response = {'code': 0, 'message': 'LUN create: success!'} exception = v6000_common.ViolinBackendErr self.m.StubOutWithMock(self.driver, '_send_cmd') self.driver._send_cmd(self.m_conn.lun.create_lun, mox.IsA(str), self.driver.container, volume['id'], volume['size'], 1, "0", "0", "w", 1, 512, False, False, None ).AndRaise(exception('failed')) self.m.ReplayAll() self.assertRaises(exception, self.driver._create_lun, volume) self.m.VerifyAll() def testDeleteLun(self): volume = self.volume1 response = {'code': 0, 'message': 'lun deletion started'} success_msgs = ['lun deletion started', ''] self.m.StubOutWithMock(self.driver, '_send_cmd') self.m.StubOutWithMock(self.driver.lun_tracker, 'free_lun_id_for_volume') self.driver._send_cmd(self.m_conn.lun.bulk_delete_luns, success_msgs, self.driver.container, volume['id']).AndReturn(response) self.driver.lun_tracker.free_lun_id_for_volume(volume) self.m.ReplayAll() self.assertTrue(self.driver._delete_lun(volume) is None) self.m.VerifyAll() def testDeleteLun_EmptyResponseMessage(self): volume = self.volume1 response = {'code': 0, 'message': ''} success_msgs = ['lun deletion started', ''] self.m.StubOutWithMock(self.driver, '_send_cmd') self.m.StubOutWithMock(self.driver.lun_tracker, 'free_lun_id_for_volume') self.driver._send_cmd(self.m_conn.lun.bulk_delete_luns, success_msgs, self.driver.container, volume['id']).AndReturn(response) self.driver.lun_tracker.free_lun_id_for_volume(volume) self.m.ReplayAll() self.assertTrue(self.driver._delete_lun(volume) is None) self.m.VerifyAll() def testDeleteLun_LunAlreadyDeleted(self): volume = self.volume1 response = {'code': 0, 'message': 'lun deletion started'} success_msgs = ['lun deletion started', ''] self.m.StubOutWithMock(self.driver, '_send_cmd') self.m.StubOutWithMock(self.driver.lun_tracker, 'free_lun_id_for_volume') self.driver._send_cmd(self.m_conn.lun.bulk_delete_luns, success_msgs, self.driver.container, volume['id'] ).AndRaise(v6000_common.ViolinBackendErrNotFound) self.driver.lun_tracker.free_lun_id_for_volume(volume) self.m.ReplayAll() self.assertTrue(self.driver._delete_lun(volume) is None) self.m.VerifyAll() def testDeleteLun_DeleteFailsWithException(self): volume = self.volume1 response = {'code': 0, 'message': 'lun deletion started'} success_msgs = ['lun deletion started', ''] exception = v6000_common.ViolinBackendErr self.m.StubOutWithMock(self.driver, '_send_cmd') self.driver._send_cmd(self.m_conn.lun.bulk_delete_luns, success_msgs, self.driver.container, volume['id'] ).AndRaise(exception('failed!')) self.m.ReplayAll() self.assertRaises(exception, self.driver._delete_lun, volume) self.m.VerifyAll() def testCreateLunSnapshot(self): snapshot = self.snapshot1 response = {'code': 0, 'message': 'success'} self.m.StubOutWithMock(self.driver, '_send_cmd') self.driver._send_cmd(self.m_conn.snapshot.create_lun_snapshot, mox.IsA(str), self.driver.container, snapshot['volume_id'], snapshot['id']).AndReturn(response) self.m.ReplayAll() self.assertTrue(self.driver._create_lun_snapshot(snapshot) is None) self.m.VerifyAll() def testDeleteLunSnapshot(self): snapshot = self.snapshot1 response = {'code': 0, 'message': 'success'} self.m.StubOutWithMock(self.driver, '_send_cmd') self.m.StubOutWithMock(self.driver.lun_tracker, 'free_lun_id_for_snapshot') self.driver._send_cmd(self.m_conn.snapshot.delete_lun_snapshot, mox.IsA(str), self.driver.container, snapshot['volume_id'], snapshot['id']).AndReturn(response) self.driver.lun_tracker.free_lun_id_for_snapshot(snapshot) self.m.ReplayAll() self.assertTrue(self.driver._delete_lun_snapshot(snapshot) is None) self.m.VerifyAll() def testSendCmd(self): request_func = self.m.CreateMockAnything() success_msg = 'success' request_args = ['arg1', 'arg2', 'arg3'] response = {'code': 0, 'message': 'success'} request_func(request_args).AndReturn(response) self.m.ReplayAll() self.assertEqual(self.driver._send_cmd (request_func, success_msg, request_args), response) self.m.VerifyAll() def testSendCmd_RequestTimedout(self): '''The retry timeout is hit.''' request_func = self.m.CreateMockAnything() success_msg = 'success' request_args = ['arg1', 'arg2', 'arg3'] self.driver.request_timeout = 0 self.m.ReplayAll() self.assertRaises(v6000_common.RequestRetryTimeout, self.driver._send_cmd, request_func, success_msg, request_args) self.m.VerifyAll() def testSendCmd_ResponseHasNoMessage(self): '''The callback response dict has a NULL message field.''' request_func = self.m.CreateMockAnything() success_msg = 'success' request_args = ['arg1', 'arg2', 'arg3'] response1 = {'code': 0, 'message': None} response2 = {'code': 0, 'message': 'success'} request_func(request_args).AndReturn(response1) request_func(request_args).AndReturn(response2) self.m.ReplayAll() self.assertEqual(self.driver._send_cmd (request_func, success_msg, request_args), response2) self.m.VerifyAll() def testSendCmd_ResponseHasFatalError(self): '''The callback response dict contains a fatal error code.''' request_func = self.m.CreateMockAnything() success_msg = 'success' request_args = ['arg1', 'arg2', 'arg3'] response = {'code': 14000, 'message': 'try again later.'} request_func(request_args).AndReturn(response) self.m.ReplayAll() self.assertRaises(v6000_common.ViolinBackendErr, self.driver._send_cmd, request_func, success_msg, request_args) self.m.VerifyAll() def testGetIgroup(self): volume = self.volume1 connector = {'host': 'h1', 'wwpns': [u'50014380186b3f65', u'50014380186b3f67']} bn = '/vshare/config/igroup/%s' % connector['host'] resp = {bn: connector['host']} self.m_conn.basic.get_node_values(bn).AndReturn(resp) self.m.ReplayAll() self.assertEqual(self.driver._get_igroup(volume, connector), connector['host']) self.m.VerifyAll() def testGetIgroup_WithNewName(self): volume = self.volume1 connector = {'host': 'h1', 'wwpns': [u'50014380186b3f65', u'50014380186b3f67']} bn = '/vshare/config/igroup/%s' % connector['host'] resp = {} self.m_conn.basic.get_node_values(bn).AndReturn(resp) self.m_conn.igroup.create_igroup(connector['host']) self.m.ReplayAll() self.assertEqual(self.driver._get_igroup(volume, connector), connector['host']) self.m.VerifyAll() def testGetVolumeTypeExtraSpec(self): volume = {'volume_type_id': 1} volume_type = {'extra_specs': {'override:test_key': 'test_value'}} self.m.StubOutWithMock(context, 'get_admin_context') self.m.StubOutWithMock(volume_types, 'get_volume_type') context.get_admin_context().AndReturn(None) volume_types.get_volume_type(None, 1).AndReturn(volume_type) self.m.ReplayAll() result = self.driver._get_volume_type_extra_spec(volume, 'test_key') self.assertEqual(result, 'test_value') self.m.VerifyAll() def testGetVolumeTypeExtraSpec_NoVolumeType(self): volume = {'volume_type_id': None} self.m.StubOutWithMock(context, 'get_admin_context') context.get_admin_context().AndReturn(None) self.m.ReplayAll() result = self.driver._get_volume_type_extra_spec(volume, 'test_key') self.assertEqual(result, None) self.m.VerifyAll() def testGetVolumeTypeExtraSpec_NoExtraSpecs(self): volume = {'volume_type_id': 1} volume_type = {'extra_specs': {}} self.m.StubOutWithMock(context, 'get_admin_context') self.m.StubOutWithMock(volume_types, 'get_volume_type') context.get_admin_context().AndReturn(None) volume_types.get_volume_type(None, 1).AndReturn(volume_type) self.m.ReplayAll() result = self.driver._get_volume_type_extra_spec(volume, 'test_key') self.assertEqual(result, None) self.m.VerifyAll() def testGetVolumeTypeExtraSpec_NoOverridePrefixInExtraSpecKey(self): volume = {'volume_type_id': 1} volume_type = {'extra_specs': {'test_key': 'test_value'}} self.m.StubOutWithMock(context, 'get_admin_context') self.m.StubOutWithMock(volume_types, 'get_volume_type') context.get_admin_context().AndReturn(None) volume_types.get_volume_type(None, 1).AndReturn(volume_type) self.m.ReplayAll() result = self.driver._get_volume_type_extra_spec(volume, 'test_key') self.assertEqual(result, 'test_value') self.m.VerifyAll() def testWaitForExportState(self): bn = '/vshare/config/export/container/myContainer/lun/vol-01' resp = {'/vshare/config/export/container/myContainer/lun/vol-01': 'vol-01'} self.m_conn.basic.get_node_values(bn).AndReturn(resp) self.m_conn.basic.get_node_values(bn).AndReturn(resp) self.m.ReplayAll() self.assertTrue(self.driver._wait_for_exportstate('vol-01', True)) self.m.VerifyAll() def testWaitForExportState_NoState(self): self.m_conn.basic.get_node_values(mox.IsA(str)).AndReturn({}) self.m_conn.basic.get_node_values(mox.IsA(str)).AndReturn({}) self.m.ReplayAll() self.assertTrue(self.driver._wait_for_exportstate("vol-01", False)) self.m.VerifyAll() def test_is_supported_vmos_version(self): version = 'V6.3.1' self.assertTrue(self.driver._is_supported_vmos_version(version)) def testIsSupportedVMOSVersion_SupportedFutureVersion(self): version = 'V6.3.7' self.assertTrue(self.driver._is_supported_vmos_version(version)) def testIsSupportedVmosVersion_UnsupportedPastVMOSVersion(self): version = 'G5.5.2' self.assertFalse(self.driver._is_supported_vmos_version(version)) def testIsSupportedVMOSVersion_UnsupportedFutureVersion(self): version = 'V7.0.0' self.assertFalse(self.driver._is_supported_vmos_version(version)) def testFatalErrorCode(self): # NYI # pass
from typing import Any, Dict, List, Mapping, Set import orjson from zerver.lib.test_classes import ZulipTestCase from zerver.lib.user_status import get_user_info_dict, update_user_status from zerver.models import UserProfile, UserStatus, get_client def get_away_user_ids(realm_id: int) -> Set[int]: user_dict = get_user_info_dict(realm_id) return {int(user_id) for user_id in user_dict if user_dict[user_id].get("away")} def user_info(user: UserProfile) -> Dict[str, Any]: user_dict = get_user_info_dict(user.realm_id) return user_dict.get(str(user.id), {}) class UserStatusTest(ZulipTestCase): def test_basics(self) -> None: cordelia = self.example_user("cordelia") hamlet = self.example_user("hamlet") king_lear = self.lear_user("king") realm_id = hamlet.realm_id away_user_ids = get_away_user_ids(realm_id=realm_id) self.assertEqual(away_user_ids, set()) client1 = get_client("web") client2 = get_client("ZT") update_user_status( user_profile_id=hamlet.id, status=UserStatus.AWAY, status_text=None, client_id=client1.id, ) away_user_ids = get_away_user_ids(realm_id=realm_id) self.assertEqual(away_user_ids, {hamlet.id}) # Test that second client just updates # the record. We only store one record # per user. The user's status transcends # clients; we only store the client for # reference and to maybe reconcile timeout # situations. update_user_status( user_profile_id=hamlet.id, status=UserStatus.AWAY, status_text="out to lunch", client_id=client2.id, ) self.assertEqual( user_info(hamlet), dict(away=True, status_text="out to lunch"), ) away_user_ids = get_away_user_ids(realm_id=realm_id) self.assertEqual(away_user_ids, {hamlet.id}) rec_count = UserStatus.objects.filter(user_profile_id=hamlet.id).count() self.assertEqual(rec_count, 1) # Setting status_text to None causes it be ignored. update_user_status( user_profile_id=hamlet.id, status=UserStatus.NORMAL, status_text=None, client_id=client2.id, ) self.assertEqual( user_info(hamlet), dict(status_text="out to lunch"), ) # Clear the status_text now. update_user_status( user_profile_id=hamlet.id, status=None, status_text="", client_id=client2.id, ) self.assertEqual( user_info(hamlet), {}, ) away_user_ids = get_away_user_ids(realm_id=realm_id) self.assertEqual(away_user_ids, set()) # Now set away status for three different users across # two realms. update_user_status( user_profile_id=hamlet.id, status=UserStatus.AWAY, status_text=None, client_id=client1.id, ) update_user_status( user_profile_id=cordelia.id, status=UserStatus.AWAY, status_text=None, client_id=client2.id, ) update_user_status( user_profile_id=king_lear.id, status=UserStatus.AWAY, status_text=None, client_id=client2.id, ) away_user_ids = get_away_user_ids(realm_id=realm_id) self.assertEqual(away_user_ids, {cordelia.id, hamlet.id}) away_user_ids = get_away_user_ids(realm_id=king_lear.realm.id) self.assertEqual(away_user_ids, {king_lear.id}) # Set Hamlet to NORMAL but in a meeting. update_user_status( user_profile_id=hamlet.id, status=UserStatus.NORMAL, status_text="in a meeting", client_id=client2.id, ) self.assertEqual( user_info(hamlet), dict(status_text="in a meeting"), ) away_user_ids = get_away_user_ids(realm_id=realm_id) self.assertEqual(away_user_ids, {cordelia.id}) def update_status_and_assert_event( self, payload: Dict[str, Any], expected_event: Dict[str, Any] ) -> None: events: List[Mapping[str, Any]] = [] with self.tornado_redirected_to_list(events, expected_num_events=1): result = self.client_post("/json/users/me/status", payload) self.assert_json_success(result) self.assertEqual(events[0]["event"], expected_event) def test_endpoints(self) -> None: hamlet = self.example_user("hamlet") realm_id = hamlet.realm_id self.login_user(hamlet) # Try to omit parameter--this should be an error. payload: Dict[str, Any] = {} result = self.client_post("/json/users/me/status", payload) self.assert_json_error(result, "Client did not pass any new values.") # Try a long message. long_text = "x" * 61 payload = dict(status_text=long_text) result = self.client_post("/json/users/me/status", payload) self.assert_json_error(result, "status_text is too long (limit: 60 characters)") self.update_status_and_assert_event( payload=dict( away=orjson.dumps(True).decode(), status_text="on vacation", ), expected_event=dict( type="user_status", user_id=hamlet.id, away=True, status_text="on vacation" ), ) self.assertEqual( user_info(hamlet), dict(away=True, status_text="on vacation"), ) # Now revoke "away" status. self.update_status_and_assert_event( payload=dict(away=orjson.dumps(False).decode()), expected_event=dict(type="user_status", user_id=hamlet.id, away=False), ) away_user_ids = get_away_user_ids(realm_id=realm_id) self.assertEqual(away_user_ids, set()) # And now just update your info. # The server will trim the whitespace here. self.update_status_and_assert_event( payload=dict(status_text=" in office "), expected_event=dict(type="user_status", user_id=hamlet.id, status_text="in office"), ) self.assertEqual( user_info(hamlet), dict(status_text="in office"), ) # And finally clear your info. self.update_status_and_assert_event( payload=dict(status_text=""), expected_event=dict(type="user_status", user_id=hamlet.id, status_text=""), ) self.assertEqual( get_user_info_dict(realm_id=realm_id), {}, ) # Turn on "away" status again. self.update_status_and_assert_event( payload=dict(away=orjson.dumps(True).decode()), expected_event=dict(type="user_status", user_id=hamlet.id, away=True), ) away_user_ids = get_away_user_ids(realm_id=realm_id) self.assertEqual(away_user_ids, {hamlet.id}) # And set status text while away. self.update_status_and_assert_event( payload=dict(status_text=" at the beach "), expected_event=dict(type="user_status", user_id=hamlet.id, status_text="at the beach"), ) self.assertEqual( user_info(hamlet), dict(status_text="at the beach", away=True), ) away_user_ids = get_away_user_ids(realm_id=realm_id) self.assertEqual(away_user_ids, {hamlet.id})
import os import re from peewee import * from peewee import create_model_tables from peewee import drop_model_tables from peewee import mysql from peewee import print_ from playhouse.reflection import * from playhouse.tests.base import database_initializer from playhouse.tests.base import PeeweeTestCase sqlite_db = database_initializer.get_database('sqlite') DATABASES = [sqlite_db] if mysql: DATABASES.append(database_initializer.get_database('mysql')) try: import psycopg2 DATABASES.append(database_initializer.get_database('postgres')) except ImportError: pass class BaseModel(Model): class Meta: database = sqlite_db class ColTypes(BaseModel): f1 = BigIntegerField(index=True) f2 = BlobField() f3 = BooleanField() f4 = CharField(max_length=50) f5 = DateField() f6 = DateTimeField() f7 = DecimalField() f8 = DoubleField() f9 = FloatField() f10 = IntegerField(unique=True) f11 = PrimaryKeyField() f12 = TextField() f13 = TimeField() class Meta: indexes = ( (('f10', 'f11'), True), (('f11', 'f12', 'f13'), False), ) class Nullable(BaseModel): nullable_cf = CharField(null=True) nullable_if = IntegerField(null=True) class RelModel(BaseModel): col_types = ForeignKeyField(ColTypes, related_name='foo') col_types_nullable = ForeignKeyField(ColTypes, null=True) class FKPK(BaseModel): col_types = ForeignKeyField(ColTypes, primary_key=True) class Underscores(BaseModel): _id = PrimaryKeyField() _name = CharField() class Category(BaseModel): name = CharField(max_length=10) parent = ForeignKeyField('self', null=True) class Nugget(BaseModel): category_id = ForeignKeyField(Category, db_column='category_id') category = CharField() MODELS = ( ColTypes, Nullable, RelModel, FKPK, Underscores, Category, Nugget) class TestReflection(PeeweeTestCase): def setUp(self): super(TestReflection, self).setUp() if os.path.exists(sqlite_db.database): os.unlink(sqlite_db.database) sqlite_db.connect() for model in MODELS: model._meta.database = sqlite_db def tearDown(self): sqlite_db.close() def test_generate_models(self): introspector = self.get_introspector() self.assertEqual(introspector.generate_models(), {}) for model in MODELS: model.create_table() models = introspector.generate_models() self.assertEqual(sorted(models.keys()), [ 'category', 'coltypes', 'fkpk', 'nugget', 'nullable', 'relmodel', 'underscores']) def assertIsInstance(obj, klass): self.assertTrue(isinstance(obj, klass)) category = models['category'] self.assertEqual( sorted(category._meta.fields), ['id', 'name', 'parent']) assertIsInstance(category.id, PrimaryKeyField) assertIsInstance(category.name, CharField) assertIsInstance(category.parent, ForeignKeyField) self.assertEqual(category.parent.rel_model, category) fkpk = models['fkpk'] self.assertEqual(sorted(fkpk._meta.fields), ['col_types']) assertIsInstance(fkpk.col_types, ForeignKeyField) self.assertEqual(fkpk.col_types.rel_model, models['coltypes']) self.assertTrue(fkpk.col_types.primary_key) relmodel = models['relmodel'] self.assertEqual( sorted(relmodel._meta.fields), ['col_types', 'col_types_nullable', 'id']) assertIsInstance(relmodel.col_types, ForeignKeyField) assertIsInstance(relmodel.col_types_nullable, ForeignKeyField) self.assertFalse(relmodel.col_types.null) self.assertTrue(relmodel.col_types_nullable.null) self.assertEqual(relmodel.col_types.rel_model, models['coltypes']) self.assertEqual(relmodel.col_types_nullable.rel_model, models['coltypes']) def test_generate_models_indexes(self): introspector = self.get_introspector() self.assertEqual(introspector.generate_models(), {}) for model in MODELS: model.create_table() models = introspector.generate_models() self.assertEqual(models['fkpk']._meta.indexes, []) self.assertEqual(models['relmodel']._meta.indexes, []) self.assertEqual(models['category']._meta.indexes, []) col_types = models['coltypes'] indexed = set(['f1']) unique = set(['f10']) for field in col_types._meta.sorted_fields: self.assertEqual(field.index, field.name in indexed) self.assertEqual(field.unique, field.name in unique) indexes = col_types._meta.indexes self.assertEqual(sorted(indexes), [ (['f10', 'f11'], True), (['f11', 'f12', 'f13'], False), ]) def test_table_subset(self): for model in MODELS: model.create_table() introspector = self.get_introspector() models = introspector.generate_models(table_names=[ 'category', 'coltypes', 'foobarbaz']) self.assertEqual(sorted(models.keys()), ['category', 'coltypes']) def test_sqlite_fk_re(self): user_id_tests = [ 'FOREIGN KEY("user_id") REFERENCES "users"("id")', 'FOREIGN KEY(user_id) REFERENCES users(id)', 'FOREIGN KEY ([user_id]) REFERENCES [users] ([id])', '"user_id" NOT NULL REFERENCES "users" ("id")', 'user_id not null references users (id)', ] fk_pk_tests = [ ('"col_types_id" INTEGER NOT NULL PRIMARY KEY REFERENCES ' '"coltypes" ("f11")'), 'FOREIGN KEY ("col_types_id") REFERENCES "coltypes" ("f11")', ] regex = SqliteMetadata.re_foreign_key for test in user_id_tests: match = re.search(regex, test, re.I) self.assertEqual(match.groups(), ( 'user_id', 'users', 'id', )) for test in fk_pk_tests: match = re.search(regex, test, re.I) self.assertEqual(match.groups(), ( 'col_types_id', 'coltypes', 'f11', )) def get_introspector(self): return Introspector.from_database(sqlite_db) def test_make_column_name(self): introspector = self.get_introspector() tests = ( ('Column', 'column'), ('Foo_iD', 'foo'), ('foo_id', 'foo'), ('foo_id_id', 'foo_id'), ('foo', 'foo'), ('_id', '_id'), ('a123', 'a123'), ('and', 'and_'), ('Class', 'class_'), ('Class_ID', 'class_'), ) for col_name, expected in tests: self.assertEqual( introspector.make_column_name(col_name), expected) def test_make_model_name(self): introspector = self.get_introspector() tests = ( ('Table', 'Table'), ('table', 'Table'), ('table_baz', 'TableBaz'), ('foo__bar__baz2', 'FooBarBaz2'), ('foo12_3', 'Foo123'), ) for table_name, expected in tests: self.assertEqual( introspector.make_model_name(table_name), expected) def create_tables(self, db): for model in MODELS: model._meta.database = db drop_model_tables(MODELS, fail_silently=True) create_model_tables(MODELS) def generative_test(fn): def inner(self): for database in DATABASES: try: introspector = Introspector.from_database(database) self.create_tables(database) fn(self, introspector) finally: drop_model_tables(MODELS) return inner @generative_test def test_col_types(self, introspector): columns, primary_keys, foreign_keys, model_names, indexes =\ introspector.introspect() expected = ( ('coltypes', ( ('f1', BigIntegerField, False), ('f2', (BlobField, TextField), False), ('f3', (BooleanField, IntegerField), False), ('f4', CharField, False), ('f5', DateField, False), ('f6', DateTimeField, False), ('f7', DecimalField, False), ('f8', (DoubleField, FloatField), False), ('f9', FloatField, False), ('f10', IntegerField, False), ('f11', PrimaryKeyField, False), ('f12', TextField, False), ('f13', TimeField, False))), ('relmodel', ( ('col_types_id', ForeignKeyField, False), ('col_types_nullable_id', ForeignKeyField, True))), ('nugget', ( ('category_id', ForeignKeyField, False), ('category', CharField, False))), ('nullable', ( ('nullable_cf', CharField, True), ('nullable_if', IntegerField, True))), ('fkpk', ( ('col_types_id', ForeignKeyField, False),)), ('underscores', ( ('_id', PrimaryKeyField, False), ('_name', CharField, False))), ('category', ( ('name', CharField, False), ('parent_id', ForeignKeyField, True))), ) for table_name, expected_columns in expected: introspected_columns = columns[table_name] for field_name, field_class, is_null in expected_columns: if not isinstance(field_class, (list, tuple)): field_class = (field_class,) column = introspected_columns[field_name] self.assertTrue(column.field_class in field_class) self.assertEqual(column.nullable, is_null) @generative_test def test_foreign_keys(self, introspector): columns, primary_keys, foreign_keys, model_names, indexes =\ introspector.introspect() self.assertEqual(foreign_keys['coltypes'], []) rel_model = foreign_keys['relmodel'] self.assertEqual(len(rel_model), 2) fkpk = foreign_keys['fkpk'] self.assertEqual(len(fkpk), 1) fkpk_fk = fkpk[0] self.assertEqual(fkpk_fk.table, 'fkpk') self.assertEqual(fkpk_fk.column, 'col_types_id') self.assertEqual(fkpk_fk.dest_table, 'coltypes') self.assertEqual(fkpk_fk.dest_column, 'f11') category = foreign_keys['category'] self.assertEqual(len(category), 1) category_fk = category[0] self.assertEqual(category_fk.table, 'category') self.assertEqual(category_fk.column, 'parent_id') self.assertEqual(category_fk.dest_table, 'category') self.assertEqual(category_fk.dest_column, 'id') @generative_test def test_table_names(self, introspector): columns, primary_keys, foreign_keys, model_names, indexes =\ introspector.introspect() names = ( ('coltypes', 'Coltypes'), ('nullable', 'Nullable'), ('relmodel', 'Relmodel'), ('fkpk', 'Fkpk')) for k, v in names: self.assertEqual(model_names[k], v) @generative_test def test_column_meta(self, introspector): columns, primary_keys, foreign_keys, model_names, indexes =\ introspector.introspect() rel_model = columns['relmodel'] col_types_id = rel_model['col_types_id'] self.assertEqual(col_types_id.get_field_parameters(), { 'db_column': "'col_types_id'", 'rel_model': 'Coltypes', 'to_field': "'f11'", }) col_types_nullable_id = rel_model['col_types_nullable_id'] self.assertEqual(col_types_nullable_id.get_field_parameters(), { 'db_column': "'col_types_nullable_id'", 'null': True, 'related_name': "'coltypes_col_types_nullable_set'", 'rel_model': 'Coltypes', 'to_field': "'f11'", }) fkpk = columns['fkpk'] self.assertEqual(fkpk['col_types_id'].get_field_parameters(), { 'db_column': "'col_types_id'", 'rel_model': 'Coltypes', 'primary_key': True, 'to_field': "'f11'"}) category = columns['category'] parent_id = category['parent_id'] self.assertEqual(parent_id.get_field_parameters(), { 'db_column': "'parent_id'", 'null': True, 'rel_model': "'self'", 'to_field': "'id'", }) nugget = columns['nugget'] category_fk = nugget['category_id'] self.assertEqual(category_fk.name, 'category_id') self.assertEqual(category_fk.get_field_parameters(), { 'to_field': "'id'", 'rel_model': 'Category', 'db_column': "'category_id'", }) category = nugget['category'] self.assertEqual(category.name, 'category') @generative_test def test_get_field(self, introspector): columns, primary_keys, foreign_keys, model_names, indexes =\ introspector.introspect() expected = ( ('coltypes', ( ('f1', 'f1 = BigIntegerField(index=True)'), #('f2', 'f2 = BlobField()'), ('f4', 'f4 = CharField()'), ('f5', 'f5 = DateField()'), ('f6', 'f6 = DateTimeField()'), ('f7', 'f7 = DecimalField()'), ('f10', 'f10 = IntegerField(unique=True)'), ('f11', 'f11 = PrimaryKeyField()'), ('f12', 'f12 = TextField()'), ('f13', 'f13 = TimeField()'), )), ('nullable', ( ('nullable_cf', 'nullable_cf = ' 'CharField(null=True)'), ('nullable_if', 'nullable_if = IntegerField(null=True)'), )), ('fkpk', ( ('col_types_id', 'col_types = ForeignKeyField(' 'db_column=\'col_types_id\', primary_key=True, ' 'rel_model=Coltypes, to_field=\'f11\')'), )), ('nugget', ( ('category_id', 'category_id = ForeignKeyField(' 'db_column=\'category_id\', rel_model=Category, ' 'to_field=\'id\')'), ('category', 'category = CharField()'), )), ('relmodel', ( ('col_types_id', 'col_types = ForeignKeyField(' 'db_column=\'col_types_id\', rel_model=Coltypes, ' 'to_field=\'f11\')'), ('col_types_nullable_id', 'col_types_nullable = ' 'ForeignKeyField(db_column=\'col_types_nullable_id\', ' 'null=True, rel_model=Coltypes, ' 'related_name=\'coltypes_col_types_nullable_set\', ' 'to_field=\'f11\')'), )), ('underscores', ( ('_id', '_id = PrimaryKeyField()'), ('_name', '_name = CharField()'), )), ('category', ( ('name', 'name = CharField()'), ('parent_id', 'parent = ForeignKeyField(' 'db_column=\'parent_id\', null=True, rel_model=\'self\', ' 'to_field=\'id\')'), )), ) for table, field_data in expected: for field_name, field_str in field_data: self.assertEqual( columns[table][field_name].get_field(), field_str)
import logging from screen_objects import ScreenObjectsManager, ScrollBar, \ TouchAndTextItem from ..input import InputManager logger = logging.getLogger(__name__) class ListView(): def __init__(self, pos, size, base_size, font): self.size = size self.pos = pos self.base_size = base_size self.screen_objects = ScreenObjectsManager() self.max_rows = self.size[1] / font.size("TEXT SIZE")[1] self.current_item = 0 self.font = font self.list_size = 0 self.list = [] self.scrollbar = False self.selected = None self.active = [] self.set_list([]) self.update_keys = [] # Sets the list for the lisview. # It should be an iterable of strings def set_list(self, item_list): self.screen_objects.clear() self.list = item_list self.list_size = len(item_list) if self.max_rows < self.list_size: self.scrollbar = True scroll_bar = ScrollBar( (self.pos[0] + self.size[0] - self.base_size, self.pos[1]), (self.base_size, self.size[1]), self.list_size, self.max_rows) self.screen_objects.set_touch_object("scrollbar", scroll_bar) else: self.scrollbar = False if self.list_size > 0: self.selected = 0 else: self.selected = None self.load_new_item_position(0) # Will load items currently displaying in item_pos def load_new_item_position(self, item_pos): self.update_keys = [] self.current_item = item_pos if self.scrollbar: self.screen_objects.clear_touch(["scrollbar"]) else: self.screen_objects.clear_touch(None) i = self.current_item z = 0 if self.scrollbar: width = self.size[0] - self.base_size else: width = self.size[0] self.should_update_always = False current_y = self.pos[1] while i < self.list_size and current_y <= self.pos[1] + self.size[1]: item = TouchAndTextItem(self.font, self.list[i], ( self.pos[0], current_y), (width, -1)) current_y += item.size[1] if not item.fit_horizontal: self.update_keys.append(str(i)) self.screen_objects.set_touch_object(str(i), item) i += 1 z += 1 self.reload_selected() def should_update(self): if len(self.update_keys) > 0: return True else: return False def find_update_rects(self, rects): for key in self.update_keys: object = self.screen_objects.get_touch_object(key) rects.append(object.rect_in_pos) def render(self, surface, update_all, rects): if update_all: self.screen_objects.render(surface) else: for key in self.update_keys: object = self.screen_objects.get_touch_object(key) object.update() object.render(surface) def touch_event(self, touch_event): self.must_update = True if touch_event.type == InputManager.click \ or touch_event.type == InputManager.long_click: objects = self.screen_objects.get_touch_objects_in_pos( touch_event.current_pos) if objects is not None: for key in objects: if key == "scrollbar": direction = \ self.screen_objects.get_touch_object( key).touch(touch_event.current_pos) if direction != 0: self.move_to(direction) else: return int(key) elif (touch_event.type == InputManager.key and self.selected is not None): if touch_event.direction == InputManager.enter: if self.selected is not None: return self.selected elif touch_event.direction == InputManager.up: self.set_selected(self.selected-1) elif touch_event.direction == InputManager.down: self.set_selected(self.selected+1) elif touch_event.type == InputManager.swipe: if touch_event.direction == InputManager.up: self.move_to(-1) elif touch_event.direction == InputManager.down: self.move_to(1) # Scroll to direction # direction == 1 will scroll down # direction == -1 will scroll up def move_to(self, direction): if self.scrollbar: if direction == 1: self.current_item += self.max_rows if self.current_item + self.max_rows > self.list_size: self.current_item = self.list_size - self.max_rows self.load_new_item_position(self.current_item) self.screen_objects.get_touch_object( "scrollbar").set_item( self.current_item) elif direction == -1: self.current_item -= self.max_rows if self.current_item < 0: self.current_item = 0 self.load_new_item_position(self.current_item) self.screen_objects.get_touch_object( "scrollbar").set_item( self.current_item) self.set_active(self.active) # Set active items def set_active(self, active): self.must_update = True for number in self.active: try: self.screen_objects.get_touch_object( str(number)).set_active( False) except KeyError: pass for number in active: try: self.screen_objects.get_touch_object( str(number)).set_active( True) except KeyError: pass self.active = active def set_selected(self, selected): self.must_update = True if selected > -1 and selected < len(self.list): if self.selected is not None: try: self.screen_objects.get_touch_object( str(self.selected)).set_selected( False) except KeyError: pass if selected is not None: try: self.screen_objects.get_touch_object( str(selected)).set_selected( True) except KeyError: pass self.selected = selected self.set_selected_on_screen() def set_selected_on_screen(self): self.must_update = True if self.current_item + self.max_rows <= self.selected: self.move_to(1) self.set_selected_on_screen() elif self.current_item > self.selected: self.move_to(-1) self.set_selected_on_screen() def reload_selected(self): self.must_update = True if self.selected is not None: try: self.screen_objects.get_touch_object( str(self.selected)).set_selected( True) except KeyError: pass
# coding=utf-8 # -------------------------------------------------------------------------- # Copyright (c) Microsoft Corporation. All rights reserved. # Licensed under the MIT License. See License.txt in the project root for # license information. # # Code generated by Microsoft (R) AutoRest Code Generator. # Changes may cause incorrect behavior and will be lost if the code is # regenerated. # -------------------------------------------------------------------------- import uuid from msrest.pipeline import ClientRawResponse from .. import models class DatasetsOperations(object): """DatasetsOperations operations. :param client: Client for service requests. :param config: Configuration of service client. :param serializer: An object model serializer. :param deserializer: An object model deserializer. :ivar api_version: The API version. Constant value: "2017-09-01-preview". """ models = models def __init__(self, client, config, serializer, deserializer): self._client = client self._serialize = serializer self._deserialize = deserializer self.api_version = "2017-09-01-preview" self.config = config def list_by_factory( self, resource_group_name, factory_name, custom_headers=None, raw=False, **operation_config): """Lists datasets. :param resource_group_name: The resource group name. :type resource_group_name: str :param factory_name: The factory name. :type factory_name: str :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :return: An iterator like instance of DatasetResource :rtype: ~azure.mgmt.datafactory.models.DatasetResourcePaged[~azure.mgmt.datafactory.models.DatasetResource] :raises: :class:`ErrorResponseException<azure.mgmt.datafactory.models.ErrorResponseException>` """ def internal_paging(next_link=None, raw=False): if not next_link: # Construct URL url = self.list_by_factory.metadata['url'] path_format_arguments = { 'subscriptionId': self._serialize.url("self.config.subscription_id", self.config.subscription_id, 'str'), 'resourceGroupName': self._serialize.url("resource_group_name", resource_group_name, 'str', max_length=90, min_length=1, pattern=r'^[-\w\._\(\)]+$'), 'factoryName': self._serialize.url("factory_name", factory_name, 'str', max_length=63, min_length=3, pattern=r'^[A-Za-z0-9]+(?:-[A-Za-z0-9]+)*$') } url = self._client.format_url(url, **path_format_arguments) # Construct parameters query_parameters = {} query_parameters['api-version'] = self._serialize.query("self.api_version", self.api_version, 'str') else: url = next_link query_parameters = {} # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if self.config.generate_client_request_id: header_parameters['x-ms-client-request-id'] = str(uuid.uuid1()) if custom_headers: header_parameters.update(custom_headers) if self.config.accept_language is not None: header_parameters['accept-language'] = self._serialize.header("self.config.accept_language", self.config.accept_language, 'str') # Construct and send request request = self._client.get(url, query_parameters) response = self._client.send( request, header_parameters, stream=False, **operation_config) if response.status_code not in [200]: raise models.ErrorResponseException(self._deserialize, response) return response # Deserialize response deserialized = models.DatasetResourcePaged(internal_paging, self._deserialize.dependencies) if raw: header_dict = {} client_raw_response = models.DatasetResourcePaged(internal_paging, self._deserialize.dependencies, header_dict) return client_raw_response return deserialized list_by_factory.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.DataFactory/factories/{factoryName}/datasets'} def create_or_update( self, resource_group_name, factory_name, dataset_name, properties, if_match=None, custom_headers=None, raw=False, **operation_config): """Creates or updates a dataset. :param resource_group_name: The resource group name. :type resource_group_name: str :param factory_name: The factory name. :type factory_name: str :param dataset_name: The dataset name. :type dataset_name: str :param properties: Dataset properties. :type properties: ~azure.mgmt.datafactory.models.Dataset :param if_match: ETag of the dataset entity. Should only be specified for update, for which it should match existing entity or can be * for unconditional update. :type if_match: str :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :return: DatasetResource or ClientRawResponse if raw=true :rtype: ~azure.mgmt.datafactory.models.DatasetResource or ~msrest.pipeline.ClientRawResponse :raises: :class:`ErrorResponseException<azure.mgmt.datafactory.models.ErrorResponseException>` """ dataset = models.DatasetResource(properties=properties) # Construct URL url = self.create_or_update.metadata['url'] path_format_arguments = { 'subscriptionId': self._serialize.url("self.config.subscription_id", self.config.subscription_id, 'str'), 'resourceGroupName': self._serialize.url("resource_group_name", resource_group_name, 'str', max_length=90, min_length=1, pattern=r'^[-\w\._\(\)]+$'), 'factoryName': self._serialize.url("factory_name", factory_name, 'str', max_length=63, min_length=3, pattern=r'^[A-Za-z0-9]+(?:-[A-Za-z0-9]+)*$'), 'datasetName': self._serialize.url("dataset_name", dataset_name, 'str', max_length=260, min_length=1, pattern=r'^[A-Za-z0-9_][^<>*#.%&:\\+?/]*$') } url = self._client.format_url(url, **path_format_arguments) # Construct parameters query_parameters = {} query_parameters['api-version'] = self._serialize.query("self.api_version", self.api_version, 'str') # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if self.config.generate_client_request_id: header_parameters['x-ms-client-request-id'] = str(uuid.uuid1()) if custom_headers: header_parameters.update(custom_headers) if if_match is not None: header_parameters['If-Match'] = self._serialize.header("if_match", if_match, 'str') if self.config.accept_language is not None: header_parameters['accept-language'] = self._serialize.header("self.config.accept_language", self.config.accept_language, 'str') # Construct body body_content = self._serialize.body(dataset, 'DatasetResource') # Construct and send request request = self._client.put(url, query_parameters) response = self._client.send( request, header_parameters, body_content, stream=False, **operation_config) if response.status_code not in [200]: raise models.ErrorResponseException(self._deserialize, response) deserialized = None if response.status_code == 200: deserialized = self._deserialize('DatasetResource', response) if raw: client_raw_response = ClientRawResponse(deserialized, response) return client_raw_response return deserialized create_or_update.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.DataFactory/factories/{factoryName}/datasets/{datasetName}'} def get( self, resource_group_name, factory_name, dataset_name, custom_headers=None, raw=False, **operation_config): """Gets a dataset. :param resource_group_name: The resource group name. :type resource_group_name: str :param factory_name: The factory name. :type factory_name: str :param dataset_name: The dataset name. :type dataset_name: str :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :return: DatasetResource or ClientRawResponse if raw=true :rtype: ~azure.mgmt.datafactory.models.DatasetResource or ~msrest.pipeline.ClientRawResponse :raises: :class:`ErrorResponseException<azure.mgmt.datafactory.models.ErrorResponseException>` """ # Construct URL url = self.get.metadata['url'] path_format_arguments = { 'subscriptionId': self._serialize.url("self.config.subscription_id", self.config.subscription_id, 'str'), 'resourceGroupName': self._serialize.url("resource_group_name", resource_group_name, 'str', max_length=90, min_length=1, pattern=r'^[-\w\._\(\)]+$'), 'factoryName': self._serialize.url("factory_name", factory_name, 'str', max_length=63, min_length=3, pattern=r'^[A-Za-z0-9]+(?:-[A-Za-z0-9]+)*$'), 'datasetName': self._serialize.url("dataset_name", dataset_name, 'str', max_length=260, min_length=1, pattern=r'^[A-Za-z0-9_][^<>*#.%&:\\+?/]*$') } url = self._client.format_url(url, **path_format_arguments) # Construct parameters query_parameters = {} query_parameters['api-version'] = self._serialize.query("self.api_version", self.api_version, 'str') # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if self.config.generate_client_request_id: header_parameters['x-ms-client-request-id'] = str(uuid.uuid1()) if custom_headers: header_parameters.update(custom_headers) if self.config.accept_language is not None: header_parameters['accept-language'] = self._serialize.header("self.config.accept_language", self.config.accept_language, 'str') # Construct and send request request = self._client.get(url, query_parameters) response = self._client.send(request, header_parameters, stream=False, **operation_config) if response.status_code not in [200]: raise models.ErrorResponseException(self._deserialize, response) deserialized = None if response.status_code == 200: deserialized = self._deserialize('DatasetResource', response) if raw: client_raw_response = ClientRawResponse(deserialized, response) return client_raw_response return deserialized get.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.DataFactory/factories/{factoryName}/datasets/{datasetName}'} def delete( self, resource_group_name, factory_name, dataset_name, custom_headers=None, raw=False, **operation_config): """Deletes a dataset. :param resource_group_name: The resource group name. :type resource_group_name: str :param factory_name: The factory name. :type factory_name: str :param dataset_name: The dataset name. :type dataset_name: str :param dict custom_headers: headers that will be added to the request :param bool raw: returns the direct response alongside the deserialized response :param operation_config: :ref:`Operation configuration overrides<msrest:optionsforoperations>`. :return: None or ClientRawResponse if raw=true :rtype: None or ~msrest.pipeline.ClientRawResponse :raises: :class:`ErrorResponseException<azure.mgmt.datafactory.models.ErrorResponseException>` """ # Construct URL url = self.delete.metadata['url'] path_format_arguments = { 'subscriptionId': self._serialize.url("self.config.subscription_id", self.config.subscription_id, 'str'), 'resourceGroupName': self._serialize.url("resource_group_name", resource_group_name, 'str', max_length=90, min_length=1, pattern=r'^[-\w\._\(\)]+$'), 'factoryName': self._serialize.url("factory_name", factory_name, 'str', max_length=63, min_length=3, pattern=r'^[A-Za-z0-9]+(?:-[A-Za-z0-9]+)*$'), 'datasetName': self._serialize.url("dataset_name", dataset_name, 'str', max_length=260, min_length=1, pattern=r'^[A-Za-z0-9_][^<>*#.%&:\\+?/]*$') } url = self._client.format_url(url, **path_format_arguments) # Construct parameters query_parameters = {} query_parameters['api-version'] = self._serialize.query("self.api_version", self.api_version, 'str') # Construct headers header_parameters = {} header_parameters['Content-Type'] = 'application/json; charset=utf-8' if self.config.generate_client_request_id: header_parameters['x-ms-client-request-id'] = str(uuid.uuid1()) if custom_headers: header_parameters.update(custom_headers) if self.config.accept_language is not None: header_parameters['accept-language'] = self._serialize.header("self.config.accept_language", self.config.accept_language, 'str') # Construct and send request request = self._client.delete(url, query_parameters) response = self._client.send(request, header_parameters, stream=False, **operation_config) if response.status_code not in [200, 204]: raise models.ErrorResponseException(self._deserialize, response) if raw: client_raw_response = ClientRawResponse(None, response) return client_raw_response delete.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.DataFactory/factories/{factoryName}/datasets/{datasetName}'}
# Generated from Lustre.g4 by ANTLR 4.7.2 # encoding: utf-8 from __future__ import print_function from antlr4 import * from io import StringIO import sys def serializedATN(): with StringIO() as buf: buf.write(u"\3\u608b\ua72a\u8133\ub9ed\u417c\u3be7\u7786\u5964\2") buf.write(u"A\u01be\b\1\4\2\t\2\4\3\t\3\4\4\t\4\4\5\t\5\4\6\t\6\4") buf.write(u"\7\t\7\4\b\t\b\4\t\t\t\4\n\t\n\4\13\t\13\4\f\t\f\4\r") buf.write(u"\t\r\4\16\t\16\4\17\t\17\4\20\t\20\4\21\t\21\4\22\t\22") buf.write(u"\4\23\t\23\4\24\t\24\4\25\t\25\4\26\t\26\4\27\t\27\4") buf.write(u"\30\t\30\4\31\t\31\4\32\t\32\4\33\t\33\4\34\t\34\4\35") buf.write(u"\t\35\4\36\t\36\4\37\t\37\4 \t \4!\t!\4\"\t\"\4#\t#\4") buf.write(u"$\t$\4%\t%\4&\t&\4\'\t\'\4(\t(\4)\t)\4*\t*\4+\t+\4,\t") buf.write(u",\4-\t-\4.\t.\4/\t/\4\60\t\60\4\61\t\61\4\62\t\62\4\63") buf.write(u"\t\63\4\64\t\64\4\65\t\65\4\66\t\66\4\67\t\67\48\t8\4") buf.write(u"9\t9\4:\t:\4;\t;\4<\t<\4=\t=\4>\t>\4?\t?\4@\t@\3\2\3") buf.write(u"\2\3\2\3\2\3\2\3\2\3\2\3\2\3\2\3\3\3\3\3\4\3\4\3\5\3") buf.write(u"\5\3\5\3\5\3\5\3\5\3\6\3\6\3\7\3\7\3\7\3\7\3\7\3\b\3") buf.write(u"\b\3\t\3\t\3\n\3\n\3\n\3\n\3\n\3\n\3\n\3\n\3\13\3\13") buf.write(u"\3\13\3\13\3\f\3\f\3\f\3\f\3\r\3\r\3\r\3\r\3\16\3\16") buf.write(u"\3\17\3\17\3\17\3\17\3\17\3\17\3\17\3\20\3\20\3\21\3") buf.write(u"\21\3\22\3\22\3\22\3\22\3\22\3\23\3\23\3\23\3\23\3\24") buf.write(u"\3\24\3\24\3\24\3\24\3\24\3\24\3\24\3\24\3\25\3\25\3") buf.write(u"\26\3\26\3\27\3\27\3\27\3\30\3\30\3\30\3\30\3\30\3\31") buf.write(u"\3\31\3\31\3\31\3\31\3\32\3\32\3\33\3\33\3\33\3\33\3") buf.write(u"\33\3\33\3\33\3\33\3\33\3\33\3\33\3\33\3\34\3\34\3\34") buf.write(u"\3\34\3\34\3\34\3\34\3\34\3\34\3\34\3\34\3\34\3\34\3") buf.write(u"\34\3\35\3\35\3\35\3\35\3\35\3\35\3\35\3\36\3\36\3\36") buf.write(u"\3\36\3\36\3\36\3\36\3\36\3\37\3\37\3\37\3\37\3\37\3") buf.write(u"\37\3\37\3 \3 \3 \3 \3 \3 \3!\3!\3!\3!\3!\3!\3!\3!\3") buf.write(u"\"\3\"\3#\3#\3#\3$\3$\3$\3$\3%\3%\3%\3%\3&\3&\3\'\3\'") buf.write(u"\3(\3(\3(\3(\3)\3)\3)\3)\3*\3*\3+\3+\3,\3,\3,\3-\3-\3") buf.write(u".\3.\3.\3/\3/\3/\3\60\3\60\3\60\3\60\3\61\3\61\3\61\3") buf.write(u"\62\3\62\3\62\3\62\3\63\3\63\3\63\3\64\3\64\3\64\3\65") buf.write(u"\3\65\3\65\3\66\3\66\3\66\3\66\3\66\3\67\3\67\3\67\3") buf.write(u"\67\3\67\38\38\38\38\39\39\39\39\39\39\39\39\39\59\u0177") buf.write(u"\n9\3:\6:\u017a\n:\r:\16:\u017b\3;\3;\7;\u0180\n;\f;") buf.write(u"\16;\u0183\13;\3<\6<\u0186\n<\r<\16<\u0187\3<\3<\3=\3") buf.write(u"=\3=\3=\3=\7=\u0191\n=\f=\16=\u0194\13=\3=\5=\u0197\n") buf.write(u"=\3=\5=\u019a\n=\3=\5=\u019d\n=\3=\3=\3>\3>\3>\3>\7>") buf.write(u"\u01a5\n>\f>\16>\u01a8\13>\3>\3>\3>\3>\3>\3?\3?\3?\3") buf.write(u"?\7?\u01b3\n?\f?\16?\u01b6\13?\3?\3?\3?\3?\3?\3@\3@\4") buf.write(u"\u01a6\u01b4\2A\3\3\5\4\7\5\t\6\13\7\r\b\17\t\21\n\23") buf.write(u"\13\25\f\27\r\31\16\33\17\35\20\37\21!\22#\23%\24\'\25") buf.write(u")\26+\27-\30/\31\61\32\63\33\65\34\67\359\36;\37= ?!") buf.write(u"A\"C#E$G%I&K\'M(O)Q*S+U,W-Y.[/]\60_\61a\62c\63e\64g\65") buf.write(u"i\66k\67m8o9q:s;u<w=y>{?}@\177A\3\2\b\3\2\62;\6\2C\\") buf.write(u"aac|\u0080\u0080\7\2\62;C\\aac|\u0080\u0080\5\2\13\f") buf.write(u"\16\17\"\"\5\2\f\f\17\17\'\'\4\2\f\f\17\17\2\u01c7\2") buf.write(u"\3\3\2\2\2\2\5\3\2\2\2\2\7\3\2\2\2\2\t\3\2\2\2\2\13\3") buf.write(u"\2\2\2\2\r\3\2\2\2\2\17\3\2\2\2\2\21\3\2\2\2\2\23\3\2") buf.write(u"\2\2\2\25\3\2\2\2\2\27\3\2\2\2\2\31\3\2\2\2\2\33\3\2") buf.write(u"\2\2\2\35\3\2\2\2\2\37\3\2\2\2\2!\3\2\2\2\2#\3\2\2\2") buf.write(u"\2%\3\2\2\2\2\'\3\2\2\2\2)\3\2\2\2\2+\3\2\2\2\2-\3\2") buf.write(u"\2\2\2/\3\2\2\2\2\61\3\2\2\2\2\63\3\2\2\2\2\65\3\2\2") buf.write(u"\2\2\67\3\2\2\2\29\3\2\2\2\2;\3\2\2\2\2=\3\2\2\2\2?\3") buf.write(u"\2\2\2\2A\3\2\2\2\2C\3\2\2\2\2E\3\2\2\2\2G\3\2\2\2\2") buf.write(u"I\3\2\2\2\2K\3\2\2\2\2M\3\2\2\2\2O\3\2\2\2\2Q\3\2\2\2") buf.write(u"\2S\3\2\2\2\2U\3\2\2\2\2W\3\2\2\2\2Y\3\2\2\2\2[\3\2\2") buf.write(u"\2\2]\3\2\2\2\2_\3\2\2\2\2a\3\2\2\2\2c\3\2\2\2\2e\3\2") buf.write(u"\2\2\2g\3\2\2\2\2i\3\2\2\2\2k\3\2\2\2\2m\3\2\2\2\2o\3") buf.write(u"\2\2\2\2q\3\2\2\2\2s\3\2\2\2\2u\3\2\2\2\2w\3\2\2\2\2") buf.write(u"y\3\2\2\2\2{\3\2\2\2\2}\3\2\2\2\2\177\3\2\2\2\3\u0081") buf.write(u"\3\2\2\2\5\u008a\3\2\2\2\7\u008c\3\2\2\2\t\u008e\3\2") buf.write(u"\2\2\13\u0094\3\2\2\2\r\u0096\3\2\2\2\17\u009b\3\2\2") buf.write(u"\2\21\u009d\3\2\2\2\23\u009f\3\2\2\2\25\u00a7\3\2\2\2") buf.write(u"\27\u00ab\3\2\2\2\31\u00af\3\2\2\2\33\u00b3\3\2\2\2\35") buf.write(u"\u00b5\3\2\2\2\37\u00bc\3\2\2\2!\u00be\3\2\2\2#\u00c0") buf.write(u"\3\2\2\2%\u00c5\3\2\2\2\'\u00c9\3\2\2\2)\u00d2\3\2\2") buf.write(u"\2+\u00d4\3\2\2\2-\u00d6\3\2\2\2/\u00d9\3\2\2\2\61\u00de") buf.write(u"\3\2\2\2\63\u00e3\3\2\2\2\65\u00e5\3\2\2\2\67\u00f1\3") buf.write(u"\2\2\29\u00ff\3\2\2\2;\u0106\3\2\2\2=\u010e\3\2\2\2?") buf.write(u"\u0115\3\2\2\2A\u011b\3\2\2\2C\u0123\3\2\2\2E\u0125\3") buf.write(u"\2\2\2G\u0128\3\2\2\2I\u012c\3\2\2\2K\u0130\3\2\2\2M") buf.write(u"\u0132\3\2\2\2O\u0134\3\2\2\2Q\u0138\3\2\2\2S\u013c\3") buf.write(u"\2\2\2U\u013e\3\2\2\2W\u0140\3\2\2\2Y\u0143\3\2\2\2[") buf.write(u"\u0145\3\2\2\2]\u0148\3\2\2\2_\u014b\3\2\2\2a\u014f\3") buf.write(u"\2\2\2c\u0152\3\2\2\2e\u0156\3\2\2\2g\u0159\3\2\2\2i") buf.write(u"\u015c\3\2\2\2k\u015f\3\2\2\2m\u0164\3\2\2\2o\u0169\3") buf.write(u"\2\2\2q\u0176\3\2\2\2s\u0179\3\2\2\2u\u017d\3\2\2\2w") buf.write(u"\u0185\3\2\2\2y\u018b\3\2\2\2{\u01a0\3\2\2\2}\u01ae\3") buf.write(u"\2\2\2\177\u01bc\3\2\2\2\u0081\u0082\7f\2\2\u0082\u0083") buf.write(u"\7c\2\2\u0083\u0084\7v\2\2\u0084\u0085\7c\2\2\u0085\u0086") buf.write(u"\7v\2\2\u0086\u0087\7{\2\2\u0087\u0088\7r\2\2\u0088\u0089") buf.write(u"\7g\2\2\u0089\4\3\2\2\2\u008a\u008b\7?\2\2\u008b\6\3") buf.write(u"\2\2\2\u008c\u008d\7=\2\2\u008d\b\3\2\2\2\u008e\u008f") buf.write(u"\7e\2\2\u008f\u0090\7q\2\2\u0090\u0091\7p\2\2\u0091\u0092") buf.write(u"\7u\2\2\u0092\u0093\7v\2\2\u0093\n\3\2\2\2\u0094\u0095") buf.write(u"\7<\2\2\u0095\f\3\2\2\2\u0096\u0097\7p\2\2\u0097\u0098") buf.write(u"\7q\2\2\u0098\u0099\7f\2\2\u0099\u009a\7g\2\2\u009a\16") buf.write(u"\3\2\2\2\u009b\u009c\7*\2\2\u009c\20\3\2\2\2\u009d\u009e") buf.write(u"\7+\2\2\u009e\22\3\2\2\2\u009f\u00a0\7t\2\2\u00a0\u00a1") buf.write(u"\7g\2\2\u00a1\u00a2\7v\2\2\u00a2\u00a3\7w\2\2\u00a3\u00a4") buf.write(u"\7t\2\2\u00a4\u00a5\7p\2\2\u00a5\u00a6\7u\2\2\u00a6\24") buf.write(u"\3\2\2\2\u00a7\u00a8\7x\2\2\u00a8\u00a9\7c\2\2\u00a9") buf.write(u"\u00aa\7t\2\2\u00aa\26\3\2\2\2\u00ab\u00ac\7n\2\2\u00ac") buf.write(u"\u00ad\7g\2\2\u00ad\u00ae\7v\2\2\u00ae\30\3\2\2\2\u00af") buf.write(u"\u00b0\7v\2\2\u00b0\u00b1\7g\2\2\u00b1\u00b2\7n\2\2\u00b2") buf.write(u"\32\3\2\2\2\u00b3\u00b4\7.\2\2\u00b4\34\3\2\2\2\u00b5") buf.write(u"\u00b6\7u\2\2\u00b6\u00b7\7v\2\2\u00b7\u00b8\7t\2\2\u00b8") buf.write(u"\u00b9\7w\2\2\u00b9\u00ba\7e\2\2\u00ba\u00bb\7v\2\2\u00bb") buf.write(u"\36\3\2\2\2\u00bc\u00bd\7}\2\2\u00bd \3\2\2\2\u00be\u00bf") buf.write(u"\7\177\2\2\u00bf\"\3\2\2\2\u00c0\u00c1\7g\2\2\u00c1\u00c2") buf.write(u"\7p\2\2\u00c2\u00c3\7w\2\2\u00c3\u00c4\7o\2\2\u00c4$") buf.write(u"\3\2\2\2\u00c5\u00c6\7k\2\2\u00c6\u00c7\7p\2\2\u00c7") buf.write(u"\u00c8\7v\2\2\u00c8&\3\2\2\2\u00c9\u00ca\7u\2\2\u00ca") buf.write(u"\u00cb\7w\2\2\u00cb\u00cc\7d\2\2\u00cc\u00cd\7t\2\2\u00cd") buf.write(u"\u00ce\7c\2\2\u00ce\u00cf\7p\2\2\u00cf\u00d0\7i\2\2\u00d0") buf.write(u"\u00d1\7g\2\2\u00d1(\3\2\2\2\u00d2\u00d3\7]\2\2\u00d3") buf.write(u"*\3\2\2\2\u00d4\u00d5\7_\2\2\u00d5,\3\2\2\2\u00d6\u00d7") buf.write(u"\7q\2\2\u00d7\u00d8\7h\2\2\u00d8.\3\2\2\2\u00d9\u00da") buf.write(u"\7d\2\2\u00da\u00db\7q\2\2\u00db\u00dc\7q\2\2\u00dc\u00dd") buf.write(u"\7n\2\2\u00dd\60\3\2\2\2\u00de\u00df\7t\2\2\u00df\u00e0") buf.write(u"\7g\2\2\u00e0\u00e1\7c\2\2\u00e1\u00e2\7n\2\2\u00e2\62") buf.write(u"\3\2\2\2\u00e3\u00e4\7/\2\2\u00e4\64\3\2\2\2\u00e5\u00e6") buf.write(u"\7/\2\2\u00e6\u00e7\7/\2\2\u00e7\u00e8\7\'\2\2\u00e8") buf.write(u"\u00e9\7R\2\2\u00e9\u00ea\7T\2\2\u00ea\u00eb\7Q\2\2\u00eb") buf.write(u"\u00ec\7R\2\2\u00ec\u00ed\7G\2\2\u00ed\u00ee\7T\2\2\u00ee") buf.write(u"\u00ef\7V\2\2\u00ef\u00f0\7[\2\2\u00f0\66\3\2\2\2\u00f1") buf.write(u"\u00f2\7/\2\2\u00f2\u00f3\7/\2\2\u00f3\u00f4\7\'\2\2") buf.write(u"\u00f4\u00f5\7T\2\2\u00f5\u00f6\7G\2\2\u00f6\u00f7\7") buf.write(u"C\2\2\u00f7\u00f8\7N\2\2\u00f8\u00f9\7K\2\2\u00f9\u00fa") buf.write(u"\7\\\2\2\u00fa\u00fb\7C\2\2\u00fb\u00fc\7D\2\2\u00fc") buf.write(u"\u00fd\7N\2\2\u00fd\u00fe\7G\2\2\u00fe8\3\2\2\2\u00ff") buf.write(u"\u0100\7/\2\2\u0100\u0101\7/\2\2\u0101\u0102\7\'\2\2") buf.write(u"\u0102\u0103\7K\2\2\u0103\u0104\7X\2\2\u0104\u0105\7") buf.write(u"E\2\2\u0105:\3\2\2\2\u0106\u0107\7/\2\2\u0107\u0108\7") buf.write(u"/\2\2\u0108\u0109\7\'\2\2\u0109\u010a\7O\2\2\u010a\u010b") buf.write(u"\7C\2\2\u010b\u010c\7K\2\2\u010c\u010d\7P\2\2\u010d<") buf.write(u"\3\2\2\2\u010e\u010f\7c\2\2\u010f\u0110\7u\2\2\u0110") buf.write(u"\u0111\7u\2\2\u0111\u0112\7g\2\2\u0112\u0113\7t\2\2\u0113") buf.write(u"\u0114\7v\2\2\u0114>\3\2\2\2\u0115\u0116\7h\2\2\u0116") buf.write(u"\u0117\7n\2\2\u0117\u0118\7q\2\2\u0118\u0119\7q\2\2\u0119") buf.write(u"\u011a\7t\2\2\u011a@\3\2\2\2\u011b\u011c\7e\2\2\u011c") buf.write(u"\u011d\7q\2\2\u011d\u011e\7p\2\2\u011e\u011f\7f\2\2\u011f") buf.write(u"\u0120\7c\2\2\u0120\u0121\7e\2\2\u0121\u0122\7v\2\2\u0122") buf.write(u"B\3\2\2\2\u0123\u0124\7\60\2\2\u0124D\3\2\2\2\u0125\u0126") buf.write(u"\7<\2\2\u0126\u0127\7?\2\2\u0127F\3\2\2\2\u0128\u0129") buf.write(u"\7r\2\2\u0129\u012a\7t\2\2\u012a\u012b\7g\2\2\u012bH") buf.write(u"\3\2\2\2\u012c\u012d\7p\2\2\u012d\u012e\7q\2\2\u012e") buf.write(u"\u012f\7v\2\2\u012fJ\3\2\2\2\u0130\u0131\7,\2\2\u0131") buf.write(u"L\3\2\2\2\u0132\u0133\7\61\2\2\u0133N\3\2\2\2\u0134\u0135") buf.write(u"\7f\2\2\u0135\u0136\7k\2\2\u0136\u0137\7x\2\2\u0137P") buf.write(u"\3\2\2\2\u0138\u0139\7o\2\2\u0139\u013a\7q\2\2\u013a") buf.write(u"\u013b\7f\2\2\u013bR\3\2\2\2\u013c\u013d\7-\2\2\u013d") buf.write(u"T\3\2\2\2\u013e\u013f\7>\2\2\u013fV\3\2\2\2\u0140\u0141") buf.write(u"\7>\2\2\u0141\u0142\7?\2\2\u0142X\3\2\2\2\u0143\u0144") buf.write(u"\7@\2\2\u0144Z\3\2\2\2\u0145\u0146\7@\2\2\u0146\u0147") buf.write(u"\7?\2\2\u0147\\\3\2\2\2\u0148\u0149\7>\2\2\u0149\u014a") buf.write(u"\7@\2\2\u014a^\3\2\2\2\u014b\u014c\7c\2\2\u014c\u014d") buf.write(u"\7p\2\2\u014d\u014e\7f\2\2\u014e`\3\2\2\2\u014f\u0150") buf.write(u"\7q\2\2\u0150\u0151\7t\2\2\u0151b\3\2\2\2\u0152\u0153") buf.write(u"\7z\2\2\u0153\u0154\7q\2\2\u0154\u0155\7t\2\2\u0155d") buf.write(u"\3\2\2\2\u0156\u0157\7?\2\2\u0157\u0158\7@\2\2\u0158") buf.write(u"f\3\2\2\2\u0159\u015a\7/\2\2\u015a\u015b\7@\2\2\u015b") buf.write(u"h\3\2\2\2\u015c\u015d\7k\2\2\u015d\u015e\7h\2\2\u015e") buf.write(u"j\3\2\2\2\u015f\u0160\7v\2\2\u0160\u0161\7j\2\2\u0161") buf.write(u"\u0162\7g\2\2\u0162\u0163\7p\2\2\u0163l\3\2\2\2\u0164") buf.write(u"\u0165\7g\2\2\u0165\u0166\7n\2\2\u0166\u0167\7u\2\2\u0167") buf.write(u"\u0168\7g\2\2\u0168n\3\2\2\2\u0169\u016a\5s:\2\u016a") buf.write(u"\u016b\7\60\2\2\u016b\u016c\5s:\2\u016cp\3\2\2\2\u016d") buf.write(u"\u016e\7v\2\2\u016e\u016f\7t\2\2\u016f\u0170\7w\2\2\u0170") buf.write(u"\u0177\7g\2\2\u0171\u0172\7h\2\2\u0172\u0173\7c\2\2\u0173") buf.write(u"\u0174\7n\2\2\u0174\u0175\7u\2\2\u0175\u0177\7g\2\2\u0176") buf.write(u"\u016d\3\2\2\2\u0176\u0171\3\2\2\2\u0177r\3\2\2\2\u0178") buf.write(u"\u017a\t\2\2\2\u0179\u0178\3\2\2\2\u017a\u017b\3\2\2") buf.write(u"\2\u017b\u0179\3\2\2\2\u017b\u017c\3\2\2\2\u017ct\3\2") buf.write(u"\2\2\u017d\u0181\t\3\2\2\u017e\u0180\t\4\2\2\u017f\u017e") buf.write(u"\3\2\2\2\u0180\u0183\3\2\2\2\u0181\u017f\3\2\2\2\u0181") buf.write(u"\u0182\3\2\2\2\u0182v\3\2\2\2\u0183\u0181\3\2\2\2\u0184") buf.write(u"\u0186\t\5\2\2\u0185\u0184\3\2\2\2\u0186\u0187\3\2\2") buf.write(u"\2\u0187\u0185\3\2\2\2\u0187\u0188\3\2\2\2\u0188\u0189") buf.write(u"\3\2\2\2\u0189\u018a\b<\2\2\u018ax\3\2\2\2\u018b\u018c") buf.write(u"\7/\2\2\u018c\u018d\7/\2\2\u018d\u0196\3\2\2\2\u018e") buf.write(u"\u0192\n\6\2\2\u018f\u0191\n\7\2\2\u0190\u018f\3\2\2") buf.write(u"\2\u0191\u0194\3\2\2\2\u0192\u0190\3\2\2\2\u0192\u0193") buf.write(u"\3\2\2\2\u0193\u0197\3\2\2\2\u0194\u0192\3\2\2\2\u0195") buf.write(u"\u0197\3\2\2\2\u0196\u018e\3\2\2\2\u0196\u0195\3\2\2") buf.write(u"\2\u0197\u019c\3\2\2\2\u0198\u019a\7\17\2\2\u0199\u0198") buf.write(u"\3\2\2\2\u0199\u019a\3\2\2\2\u019a\u019b\3\2\2\2\u019b") buf.write(u"\u019d\7\f\2\2\u019c\u0199\3\2\2\2\u019c\u019d\3\2\2") buf.write(u"\2\u019d\u019e\3\2\2\2\u019e\u019f\b=\2\2\u019fz\3\2") buf.write(u"\2\2\u01a0\u01a1\7*\2\2\u01a1\u01a2\7,\2\2\u01a2\u01a6") buf.write(u"\3\2\2\2\u01a3\u01a5\13\2\2\2\u01a4\u01a3\3\2\2\2\u01a5") buf.write(u"\u01a8\3\2\2\2\u01a6\u01a7\3\2\2\2\u01a6\u01a4\3\2\2") buf.write(u"\2\u01a7\u01a9\3\2\2\2\u01a8\u01a6\3\2\2\2\u01a9\u01aa") buf.write(u"\7,\2\2\u01aa\u01ab\7+\2\2\u01ab\u01ac\3\2\2\2\u01ac") buf.write(u"\u01ad\b>\2\2\u01ad|\3\2\2\2\u01ae\u01af\7\61\2\2\u01af") buf.write(u"\u01b0\7,\2\2\u01b0\u01b4\3\2\2\2\u01b1\u01b3\13\2\2") buf.write(u"\2\u01b2\u01b1\3\2\2\2\u01b3\u01b6\3\2\2\2\u01b4\u01b5") buf.write(u"\3\2\2\2\u01b4\u01b2\3\2\2\2\u01b5\u01b7\3\2\2\2\u01b6") buf.write(u"\u01b4\3\2\2\2\u01b7\u01b8\7,\2\2\u01b8\u01b9\7\61\2") buf.write(u"\2\u01b9\u01ba\3\2\2\2\u01ba\u01bb\b?\2\2\u01bb~\3\2") buf.write(u"\2\2\u01bc\u01bd\13\2\2\2\u01bd\u0080\3\2\2\2\r\2\u0176") buf.write(u"\u017b\u0181\u0187\u0192\u0196\u0199\u019c\u01a6\u01b4") buf.write(u"\3\b\2\2") return buf.getvalue() class LustreLexer(Lexer): atn = ATNDeserializer().deserialize(serializedATN()) decisionsToDFA = [ DFA(ds, i) for i, ds in enumerate(atn.decisionToState) ] T__0 = 1 T__1 = 2 T__2 = 3 T__3 = 4 T__4 = 5 T__5 = 6 T__6 = 7 T__7 = 8 T__8 = 9 T__9 = 10 T__10 = 11 T__11 = 12 T__12 = 13 T__13 = 14 T__14 = 15 T__15 = 16 T__16 = 17 T__17 = 18 T__18 = 19 T__19 = 20 T__20 = 21 T__21 = 22 T__22 = 23 T__23 = 24 T__24 = 25 T__25 = 26 T__26 = 27 T__27 = 28 T__28 = 29 T__29 = 30 T__30 = 31 T__31 = 32 T__32 = 33 T__33 = 34 T__34 = 35 T__35 = 36 T__36 = 37 T__37 = 38 T__38 = 39 T__39 = 40 T__40 = 41 T__41 = 42 T__42 = 43 T__43 = 44 T__44 = 45 T__45 = 46 T__46 = 47 T__47 = 48 T__48 = 49 T__49 = 50 T__50 = 51 T__51 = 52 T__52 = 53 T__53 = 54 REAL = 55 BOOL = 56 INT = 57 ID = 58 WS = 59 SL_COMMENT = 60 ML_COMMENT = 61 C_COMMENT = 62 ERROR = 63 channelNames = [ u"DEFAULT_TOKEN_CHANNEL", u"HIDDEN" ] modeNames = [ u"DEFAULT_MODE" ] literalNames = [ u"<INVALID>", u"'datatype'", u"'='", u"';'", u"'const'", u"':'", u"'node'", u"'('", u"')'", u"'returns'", u"'var'", u"'let'", u"'tel'", u"','", u"'struct'", u"'{'", u"'}'", u"'enum'", u"'int'", u"'subrange'", u"'['", u"']'", u"'of'", u"'bool'", u"'real'", u"'-'", u"'--%PROPERTY'", u"'--%REALIZABLE'", u"'--%IVC'", u"'--%MAIN'", u"'assert'", u"'floor'", u"'condact'", u"'.'", u"':='", u"'pre'", u"'not'", u"'*'", u"'/'", u"'div'", u"'mod'", u"'+'", u"'<'", u"'<='", u"'>'", u"'>='", u"'<>'", u"'and'", u"'or'", u"'xor'", u"'=>'", u"'->'", u"'if'", u"'then'", u"'else'" ] symbolicNames = [ u"<INVALID>", u"REAL", u"BOOL", u"INT", u"ID", u"WS", u"SL_COMMENT", u"ML_COMMENT", u"C_COMMENT", u"ERROR" ] ruleNames = [ u"T__0", u"T__1", u"T__2", u"T__3", u"T__4", u"T__5", u"T__6", u"T__7", u"T__8", u"T__9", u"T__10", u"T__11", u"T__12", u"T__13", u"T__14", u"T__15", u"T__16", u"T__17", u"T__18", u"T__19", u"T__20", u"T__21", u"T__22", u"T__23", u"T__24", u"T__25", u"T__26", u"T__27", u"T__28", u"T__29", u"T__30", u"T__31", u"T__32", u"T__33", u"T__34", u"T__35", u"T__36", u"T__37", u"T__38", u"T__39", u"T__40", u"T__41", u"T__42", u"T__43", u"T__44", u"T__45", u"T__46", u"T__47", u"T__48", u"T__49", u"T__50", u"T__51", u"T__52", u"T__53", u"REAL", u"BOOL", u"INT", u"ID", u"WS", u"SL_COMMENT", u"ML_COMMENT", u"C_COMMENT", u"ERROR" ] grammarFileName = u"Lustre.g4" def __init__(self, input=None, output=sys.stdout): super(LustreLexer, self).__init__(input, output=output) self.checkVersion("4.7.2") self._interp = LexerATNSimulator(self, self.atn, self.decisionsToDFA, PredictionContextCache()) self._actions = None self._predicates = None