gt
stringclasses
1 value
context
stringlengths
2.49k
119k
# vim: tabstop=4 shiftwidth=4 softtabstop=4 # Copyright 2013, Big Switch Networks, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. from django.core.urlresolvers import reverse_lazy # noqa from django.utils.translation import ugettext_lazy as _ # noqa from horizon import exceptions from horizon import forms from horizon import messages from horizon import tabs from horizon import workflows import logging from openstack_dashboard import api from openstack_dashboard.dashboards.project.loadbalancers \ import forms as project_forms from openstack_dashboard.dashboards.project.loadbalancers \ import tabs as project_tabs from openstack_dashboard.dashboards.project.loadbalancers \ import workflows as project_workflows import re LOG = logging.getLogger(__name__) class IndexView(tabs.TabView): tab_group_class = (project_tabs.LoadBalancerTabs) template_name = 'project/loadbalancers/details_tabs.html' def post(self, request, *args, **kwargs): obj_ids = request.POST.getlist('object_ids') action = request.POST['action'] m = re.search('.delete([a-z]+)', action).group(1) if obj_ids == []: obj_ids.append(re.search('([0-9a-z-]+)$', action).group(1)) if m == 'monitor': for obj_id in obj_ids: try: api.lbaas.pool_health_monitor_delete(request, obj_id) messages.success(request, _('Deleted monitor %s') % obj_id) except Exception as e: exceptions.handle(request, _('Unable to delete monitor. %s') % e) if m == 'pool': for obj_id in obj_ids: try: api.lbaas.pool_delete(request, obj_id) messages.success(request, _('Deleted pool %s') % obj_id) except Exception as e: exceptions.handle(request, _('Unable to delete pool. %s') % e) if m == 'member': for obj_id in obj_ids: try: api.lbaas.member_delete(request, obj_id) messages.success(request, _('Deleted member %s') % obj_id) except Exception as e: exceptions.handle(request, _('Unable to delete member. %s') % e) if m == 'vip': for obj_id in obj_ids: try: vip_id = api.lbaas.pool_get(request, obj_id).vip_id except Exception as e: exceptions.handle(request, _('Unable to locate VIP to delete. %s') % e) if vip_id is not None: try: api.lbaas.vip_delete(request, vip_id) messages.success(request, _('Deleted VIP %s') % vip_id) except Exception as e: exceptions.handle(request, _('Unable to delete VIP. %s') % e) return self.get(request, *args, **kwargs) class AddPoolView(workflows.WorkflowView): workflow_class = project_workflows.AddPool def get_initial(self): initial = super(AddPoolView, self).get_initial() return initial class AddVipView(workflows.WorkflowView): workflow_class = project_workflows.AddVip def get_context_data(self, **kwargs): context = super(AddVipView, self).get_context_data(**kwargs) return context def get_initial(self): initial = super(AddVipView, self).get_initial() initial['pool_id'] = self.kwargs['pool_id'] try: pool = api.lbaas.pool_get(self.request, initial['pool_id']) initial['subnet'] = api.neutron.subnet_get( self.request, pool.subnet_id).cidr except Exception as e: initial['subnet'] = '' msg = _('Unable to retrieve pool subnet. %s') % e exceptions.handle(self.request, msg) return initial class AddMemberView(workflows.WorkflowView): workflow_class = project_workflows.AddMember def get_initial(self): initial = super(AddMemberView, self).get_initial() return initial class AddMonitorView(workflows.WorkflowView): workflow_class = project_workflows.AddMonitor def get_initial(self): initial = super(AddMonitorView, self).get_initial() return initial class PoolDetailsView(tabs.TabView): tab_group_class = (project_tabs.PoolDetailsTabs) template_name = 'project/loadbalancers/details_tabs.html' class VipDetailsView(tabs.TabView): tab_group_class = (project_tabs.VipDetailsTabs) template_name = 'project/loadbalancers/details_tabs.html' class MemberDetailsView(tabs.TabView): tab_group_class = (project_tabs.MemberDetailsTabs) template_name = 'project/loadbalancers/details_tabs.html' class MonitorDetailsView(tabs.TabView): tab_group_class = (project_tabs.MonitorDetailsTabs) template_name = 'project/loadbalancers/details_tabs.html' class UpdatePoolView(forms.ModalFormView): form_class = project_forms.UpdatePool template_name = "project/loadbalancers/updatepool.html" context_object_name = 'pool' success_url = reverse_lazy("horizon:project:loadbalancers:index") def get_context_data(self, **kwargs): context = super(UpdatePoolView, self).get_context_data(**kwargs) context["pool_id"] = self.kwargs['pool_id'] return context def _get_object(self, *args, **kwargs): if not hasattr(self, "_object"): pool_id = self.kwargs['pool_id'] try: self._object = api.lbaas.pool_get(self.request, pool_id) except Exception as e: redirect = self.success_url msg = _('Unable to retrieve pool details. %s') % e exceptions.handle(self.request, msg, redirect=redirect) return self._object def get_initial(self): pool = self._get_object() return {'name': pool['name'], 'pool_id': pool['id'], 'description': pool['description'], 'lb_method': pool['lb_method'], 'admin_state_up': pool['admin_state_up']} class UpdateVipView(forms.ModalFormView): form_class = project_forms.UpdateVip template_name = "project/loadbalancers/updatevip.html" context_object_name = 'vip' success_url = reverse_lazy("horizon:project:loadbalancers:index") def get_context_data(self, **kwargs): context = super(UpdateVipView, self).get_context_data(**kwargs) context["vip_id"] = self.kwargs['vip_id'] return context def _get_object(self, *args, **kwargs): if not hasattr(self, "_object"): vip_id = self.kwargs['vip_id'] try: self._object = api.lbaas.vip_get(self.request, vip_id) except Exception as e: redirect = self.success_url msg = _('Unable to retrieve VIP details. %s') % e exceptions.handle(self.request, msg, redirect=redirect) return self._object def get_initial(self): vip = self._get_object() stype = vip['session_persistence'] if stype['type'] == 'APP_COOKIE': cookie = stype['cookie_name'] else: cookie = '' return {'name': vip['name'], 'vip_id': vip['id'], 'description': vip['description'], 'pool_id': vip['pool_id'], 'session_persistence': vip['session_persistence']['type'], 'cookie_name': cookie, 'connection_limit': vip['connection_limit'], 'admin_state_up': vip['admin_state_up']} class UpdateMemberView(forms.ModalFormView): form_class = project_forms.UpdateMember template_name = "project/loadbalancers/updatemember.html" context_object_name = 'member' success_url = reverse_lazy("horizon:project:loadbalancers:index") def get_context_data(self, **kwargs): context = super(UpdateMemberView, self).get_context_data(**kwargs) context["member_id"] = self.kwargs['member_id'] return context def _get_object(self, *args, **kwargs): if not hasattr(self, "_object"): member_id = self.kwargs['member_id'] try: self._object = api.lbaas.member_get(self.request, member_id) except Exception as e: redirect = self.success_url msg = _('Unable to retrieve member details. %s') % e exceptions.handle(self.request, msg, redirect=redirect) return self._object def get_initial(self): member = self._get_object() return {'member_id': member['id'], 'pool_id': member['pool_id'], 'weight': member['weight'], 'admin_state_up': member['admin_state_up']} class UpdateMonitorView(forms.ModalFormView): form_class = project_forms.UpdateMonitor template_name = "project/loadbalancers/updatemonitor.html" context_object_name = 'monitor' success_url = reverse_lazy("horizon:project:loadbalancers:index") def get_context_data(self, **kwargs): context = super(UpdateMonitorView, self).get_context_data(**kwargs) context["monitor_id"] = self.kwargs['monitor_id'] return context def _get_object(self, *args, **kwargs): if not hasattr(self, "_object"): monitor_id = self.kwargs['monitor_id'] try: self._object = api.lbaas.pool_health_monitor_get( self.request, monitor_id) except Exception as e: redirect = self.success_url msg = _('Unable to retrieve health monitor details. %s') % e exceptions.handle(self.request, msg, redirect=redirect) return self._object def get_initial(self): monitor = self._get_object() return {'monitor_id': monitor['id'], 'delay': monitor['delay'], 'timeout': monitor['timeout'], 'max_retries': monitor['max_retries'], 'admin_state_up': monitor['admin_state_up']} class AddPMAssociationView(workflows.WorkflowView): workflow_class = project_workflows.AddPMAssociation def get_initial(self): initial = super(AddPMAssociationView, self).get_initial() initial['pool_id'] = self.kwargs['pool_id'] try: pool = api.lbaas.pool_get(self.request, initial['pool_id']) initial['pool_name'] = pool.name initial['pool_monitors'] = pool.health_monitors except Exception as e: msg = _('Unable to retrieve pool. %s') % e exceptions.handle(self.request, msg) return initial class DeletePMAssociationView(workflows.WorkflowView): workflow_class = project_workflows.DeletePMAssociation def get_initial(self): initial = super(DeletePMAssociationView, self).get_initial() initial['pool_id'] = self.kwargs['pool_id'] try: pool = api.lbaas.pool_get(self.request, initial['pool_id']) initial['pool_name'] = pool.name initial['pool_monitors'] = pool.health_monitors except Exception as e: msg = _('Unable to retrieve pool. %s') % e exceptions.handle(self.request, msg) return initial
from __future__ import print_function from __future__ import division from __future__ import unicode_literals from __future__ import absolute_import # Techniques to smooth jumps in location tracking. Each of these returns a # boolean mask of inliers and outliers. We assume that the incoming dataframe # has a column called "speed" that represents the speed at each point. The # speed of the first point is zero. # The result is in the inlier_mask field of the appropriate object # Standard imports from future import standard_library standard_library.install_aliases() from builtins import zip from builtins import * from past.utils import old_div from builtins import object import logging import math import pandas as pd import numpy as np import attrdict as ad from enum import Enum import emission.analysis.point_features as pf import emission.core.common as ec # logging.basicConfig(level=logging.DEBUG) class SmoothBoundary(object): def __init__(self, maxSpeed = 100): self.maxSpeed = maxSpeed def filter(self, with_speeds_df): self.inlier_mask_ = [True] * with_speeds_df.shape[0] prev_pt = None for (i, pt) in enumerate(with_speeds_df[["mLatitude", "mLongitude", "mTime", "speed"]].to_dict('records')): pt = ad.AttrDict(dict(pt)) if prev_pt is None: # Don't have enough data yet, so don't make any decisions prev_pt = pt else: currSpeed = pf.calSpeed(prev_pt, pt) logging.debug("while considering point %s(%s), prev_pt (%s) speed = %s" % (pt, i, prev_pt, currSpeed)) if currSpeed > self.maxSpeed: logging.debug("currSpeed > %s, removing index %s " % (self.maxSpeed, i)) self.inlier_mask_[i] = False else: logging.debug("currSpeed < %s, retaining index %s " % (self.maxSpeed, i)) prev_pt = pt logging.info("Filtering complete, removed indices = %s" % np.nonzero(self.inlier_mask_)) # We intentionally don't use a dataframe for the segment list, using a # segment class instead. The reasons are as follows: # 1. We don't really need any of the fancy row, column or matrix # operations. We are going to iterate over the list one step at a time. # 2. We have potentially have to resplit segments, which involves inserting # elements at arbitrary points in the list. With a dataframe, we would need # to reindex every time we did this, which we won't have to do if we use a # simple list. It should be trivial to re-implement this as a DataFrame if # we so choose. # This is only used by SmoothZigzag currently. I had originally made this an # inner class, but inner classes in python are not special so let's move it out # and make the indenting less complicated class Segment(object): State = Enum("Segment_State", "UNKNOWN BAD GOOD") CLUSTER_RADIUS = 100 def __init__(self, start, end, zigzag_algo): self.start = start self.end = end self.state = Segment.State.UNKNOWN self.point_count = end - start self.za = zigzag_algo self.segment_df = self.za.with_speeds_df[start:end] self.distance = self.za.cal_distance(self) self.is_cluster = (self.distance < Segment.CLUSTER_RADIUS) logging.debug("For cluster %s - %s, distance = %s, is_cluster = %s" % (self.start, self.end, self.distance, self.is_cluster)) def __repr__(self): return "Segment(%s, %s, %s)" % (self.start, self.end, self.distance) class SmoothZigzag(object): Direction = Enum("IterationDirection", 'RIGHT LEFT') @staticmethod def end_points_distance(segment): if segment.start == segment.end: raise RuntimeError("This is messed up segment. Investigate further") return pf.calDistance(segment.segment_df.iloc[0], segment.segment_df.iloc[-1]) @staticmethod def shortest_non_cluster_segment(segment_list): assert(len(segment_list) > 0) segment_distance_list = [[segment.distance, segment.is_cluster] for segment in segment_list] segment_distance_df = pd.DataFrame(segment_distance_list, columns = ["distance", "is_cluster"]) non_cluster_segments = segment_distance_df[segment_distance_df.is_cluster == False] logging.debug("non_cluster_segments %s" % non_cluster_segments) if len(non_cluster_segments) == 0: # If every segment is a cluster, then it is very hard to # distinguish between them for zigzags. Let us see if there is any # one point cluster - i.e. where the distance is zero. If so, that is likely # to be a bad cluster, so we return the one to the right or left of it minDistanceCluster = segment_distance_df.distance.idxmin() if minDistanceCluster == 0: goodCluster = minDistanceCluster + 1 assert(goodCluster < len(segment_list)) return goodCluster else: goodCluster = minDistanceCluster - 1 assert(goodCluster >= 0) return goodCluster retVal = non_cluster_segments.distance.idxmin() logging.debug("shortest_non_cluster_segment = %s" % retVal) return retVal def __init__(self, is_ios, same_point_distance, maxSpeed = 100): self.is_ios = is_ios self.same_point_distance = same_point_distance self.maxSpeed = maxSpeed self.cal_distance = self.end_points_distance self.find_start_segment = self.shortest_non_cluster_segment def find_segments(self): if self.is_ios: segmentation_points = self.get_segmentation_points_ios() else: segmentation_points = self.get_segmentation_points_android() segmentation_points.insert(0, 0) last_point = self.with_speeds_df.shape[0] if last_point not in segmentation_points: logging.debug("smoothing: last_point index %s not in found points %s" % (last_point, segmentation_points)) segmentation_points.insert(len(segmentation_points), last_point) logging.debug("smoothing: added new entry %s" % segmentation_points[-1]) self.segment_list = [Segment(start, end, self) for (start, end) in zip(segmentation_points, segmentation_points[1:])] logging.debug("smoothing: segment_list = %s" % self.segment_list) def get_segmentation_points_android(self): return self.with_speeds_df[self.with_speeds_df.speed > self.maxSpeed].index.tolist() def get_segmentation_points_ios(self): jump_indices = self.with_speeds_df[self.with_speeds_df.speed > self.maxSpeed].index # On iOS, as seen in ...., this is likely to be the jump back. We now need to find # the jump to jumps = self.with_speeds_df[(self.with_speeds_df.speed > self.maxSpeed) & (self.with_speeds_df.distance > 100)].index logging.debug("After first step, jumps = %s" % jumps) all_jumps = [] for jump in jumps.tolist(): jump_to = self.with_speeds_df[(self.with_speeds_df.index < jump) & ( self.with_speeds_df.distance > 100)].index[-1] logging.debug("for jump %s, jump_to = %s" % (jump, jump_to)) all_jumps.append(jump_to) all_jumps.append(jump) logging.debug("for ios, returning all_jumps = %s" % all_jumps) return all_jumps def split_segment(self, i, curr_seg, direction): import emission.analysis.intake.cleaning.location_smoothing as ls if direction == SmoothZigzag.Direction.RIGHT: recomputed_speed_df = ls.recalc_speed(curr_seg.segment_df) # Find the first point that does not belong to the cluster new_split_point = recomputed_speed_df[recomputed_speed_df.distance > Segment.CLUSTER_RADIUS].index[0] new_seg = Segment(new_split_point, curr_seg.end, self) replace_seg = Segment(curr_seg.start, new_split_point, self) self.segment_list[i] = replace_seg self.segment_list.insert(i+1, new_seg) return replace_seg if direction == SmoothZigzag.Direction.LEFT: # Need to compute speeds and distances from the left edge recomputed_speed_df = ls.recalc_speed(curr_seg.segment_df.iloc[::-1]) logging.debug("Recomputed_speed_df = %s", recomputed_speed_df.speed) # Find the first point that does not belong to the cluster new_split_point = recomputed_speed_df[recomputed_speed_df.distance > Segment.CLUSTER_RADIUS].index[0] logging.debug("new split point = %s", new_split_point) new_seg = Segment(curr_seg.start, new_split_point + 1, self) replace_seg = Segment(new_split_point + 1, curr_seg.end, self) self.segment_list[i] = replace_seg self.segment_list.insert(i, new_seg) return replace_seg @staticmethod def toggle(expected_state): assert expected_state == Segment.State.BAD or expected_state == Segment.State.GOOD, "Unable to toggle %s " % expected_state if expected_state == Segment.State.BAD: return Segment.State.GOOD if expected_state == Segment.State.GOOD: return Segment.State.BAD def mark_segment_states(self, start_segment_idx, direction): """ This is the most complicated part of the algorithm. """ if direction == SmoothZigzag.Direction.RIGHT: inc = 1 check = lambda i: i < len(self.segment_list) if direction == SmoothZigzag.Direction.LEFT: inc = -1 check = lambda i: i >= 0 i = start_segment_idx + inc expected_state = Segment.State.BAD while(check(i)): curr_seg = self.segment_list[i] logging.debug("Processing segment %d: %s, expecting state %s" % (i, curr_seg, expected_state)) assert curr_seg.state == Segment.State.UNKNOWN, "Attempting to overwite state for segment %s, curr state is %s" % (i, curr_seg.state) if expected_state == Segment.State.BAD and not curr_seg.is_cluster: # mixed cluster case curr_seg = self.split_segment(i, curr_seg, direction) # We inserted a new segment before this, so this is now moved down by one. # When we are moving right, we insert after this one, so the # current index is not affected if (direction == SmoothZigzag.Direction.LEFT): i = i + 1 logging.debug("Finishing process for %s after splitting mixed cluster"% curr_seg) assert curr_seg.is_cluster, "after splitting, the segment is not a cluster?!" # In the mixed case, we just inserted an element, so we don't # want to increment, because otherwise we will terminate too # early. Note that the end conditions are embedded in the # closure i = i + inc curr_seg.state = expected_state expected_state = SmoothZigzag.toggle(expected_state) logging.debug("At the end of the loop for direction %s, i = %s" % (direction, i)) logging.debug("Finished marking segment states for direction %s " % direction) def filter(self, with_speeds_df): self.inlier_mask_ = pd.Series([True] * with_speeds_df.shape[0]) self.with_speeds_df = with_speeds_df self.find_segments() logging.debug("After splitting, segment list is %s with size %s" % (self.segment_list, len(self.segment_list))) if len(self.segment_list) == 1: # there were no jumps, so there's nothing to do logging.info("No jumps, nothing to filter") return start_segment_idx = self.find_start_segment(self.segment_list) self.segment_list[start_segment_idx].state = Segment.State.GOOD self.mark_segment_states(start_segment_idx, SmoothZigzag.Direction.RIGHT) self.mark_segment_states(start_segment_idx, SmoothZigzag.Direction.LEFT) unknown_segments = [segment for segment in self.segment_list if segment.state == Segment.State.UNKNOWN] logging.debug("unknown_segments = %s" % unknown_segments) assert len(unknown_segments) == 0, "Found %s unknown segments - early termination of loop?" % len(unknown_segments) bad_segments = [segment for segment in self.segment_list if segment.state == Segment.State.BAD] logging.debug("bad_segments = %s" % bad_segments) for segment in bad_segments: self.inlier_mask_[segment.start:segment.end] = False logging.debug("after setting values, outlier_mask = %s" % np.nonzero((self.inlier_mask_ == False).to_numpy())) # logging.debug("point details are %s" % with_speeds_df[np.logical_not(self.inlier_mask_)]) # TODO: This is not the right place for this - adds too many dependencies # Should do this in the outer class in general so that we can do # multiple passes of any filtering algorithm import emission.analysis.intake.cleaning.cleaning_methods.speed_outlier_detection as cso import emission.analysis.intake.cleaning.location_smoothing as ls recomputed_speeds_df = ls.recalc_speed(self.with_speeds_df[self.inlier_mask_]) recomputed_threshold = cso.BoxplotOutlier(ignore_zeros = True).get_threshold(recomputed_speeds_df) # assert recomputed_speeds_df[recomputed_speeds_df.speed > recomputed_threshold].shape[0] == 0, "After first round, still have outliers %s" % recomputed_speeds_df[recomputed_speeds_df.speed > recomputed_threshold] if recomputed_speeds_df[recomputed_speeds_df.speed > recomputed_threshold].shape[0] != 0: logging.info("After first round, still have outliers %s" % recomputed_speeds_df[recomputed_speeds_df.speed > recomputed_threshold]) class SmoothPosdap(object): def __init__(self, maxSpeed = 100): self.maxSpeed = maxSpeed def filter(self, with_speeds_df): self.inlier_mask_ = [True] * with_speeds_df.shape[0] quality_segments = [] curr_segment = [] prev_pt = None for (i, pt) in enumerate(with_speeds_df.to_dict('records')): pt = ad.AttrDict(pt) if prev_pt is None: # Don't have enough data yet, so don't make any decisions prev_pt = pt else: currSpeed = pf.calSpeed(prev_pt, pt) print("while considering point %s, speed = %s" % (i, currSpeed)) # Should make this configurable if currSpeed > self.maxSpeed: print("currSpeed > %d, starting new quality segment at index %s " % (self.maxSpeed, i)) quality_segments.append(curr_segment) curr_segment = [] else: print("currSpeed < %d, retaining index %s in existing quality segment " % (self.maxSpeed, i)) prev_pt = pt curr_segment.append(i) # Append the last segment once we are at the end quality_segments.append(curr_segment) print("Number of quality segments is %d" % len(quality_segments)) last_segment = quality_segments[0] for curr_segment in quality_segments[1:]: print("Considering segments %s and %s" % (last_segment, curr_segment)) if len(last_segment) == 0: # If the last segment has no points, we can't compare last and # current, but should reset last, otherwise, we will be stuck # forever logging.info("len(last_segment) = %d, len(curr_segment) = %d, skipping" % (len(last_segment), len(curr_segment))) last_segment = curr_segment continue if len(curr_segment) == 0: # If the current segment has no points, we can't compare last and # current, but can just continue since the for loop will reset current logging.info("len(last_segment) = %d, len(curr_segment) = %d, skipping" % (len(last_segment), len(curr_segment))) continue get_coords = lambda i: [with_speeds_df.iloc[i]["mLongitude"], with_speeds_df.iloc[i]["mLatitude"]] get_ts = lambda i: with_speeds_df.iloc[i]["mTime"] # I don't know why they would use time instead of distance, but # this is what the existing POSDAP code does. print("About to compare curr_segment duration %s with last segment duration %s" % (get_ts(curr_segment[-1]) - get_ts(curr_segment[0]), get_ts(last_segment[-1]) - get_ts(last_segment[0]))) if (get_ts(curr_segment[-1]) - get_ts(curr_segment[0]) <= get_ts(last_segment[-1]) - get_ts(last_segment[0])): print("curr segment %s is shorter, cut it" % curr_segment) ref_idx = last_segment[-1] for curr_idx in curr_segment: print("Comparing distance %s with speed %s * time %s = %s" % (math.fabs(ec.calDistance(get_coords(ref_idx), get_coords(curr_idx))), old_div(self.maxSpeed, 100), abs(get_ts(ref_idx) - get_ts(curr_idx)), self.maxSpeed / 100 * abs(get_ts(ref_idx) - get_ts(curr_idx)))) if (math.fabs(ec.calDistance(get_coords(ref_idx), get_coords(curr_idx))) > (self.maxSpeed / 1000 * abs(get_ts(ref_idx) - get_ts(curr_idx)))): print("Distance is greater than max speed * time, deleting %s" % curr_idx) self.inlier_mask_[curr_idx] = False else: print("prev segment %s is shorter, cut it" % last_segment) ref_idx = curr_segment[-1] for curr_idx in reversed(last_segment): print("Comparing distance %s with speed %s * time %s = %s" % (math.fabs(ec.calDistance(get_coords(ref_idx), get_coords(curr_idx))), old_div(self.maxSpeed, 1000) , abs(get_ts(ref_idx) - get_ts(curr_idx)), self.maxSpeed / 1000 * abs(get_ts(ref_idx) - get_ts(curr_idx)))) if (abs(ec.calDistance(get_coords(ref_idx), get_coords(curr_idx))) > (self.maxSpeed / 1000 * abs(get_ts(ref_idx) - get_ts(curr_idx)))): print("Distance is greater than max speed * time, deleting %s" % curr_idx) self.inlier_mask_[curr_idx] = False last_segment = curr_segment logging.info("Filtering complete, removed indices = %s" % np.nonzero(self.inlier_mask_)) class SmoothPiecewiseRansac(object): def __init__(self, maxSpeed = 100): self.maxSpeed = maxSpeed def filter_area_using_ransac(self, area_df): from sklearn import linear_model import numpy as np latArr = [[lat] for lat in area_df.mLatitude.to_numpy()] lngArr = area_df.mLongitude.to_numpy() model_ransac = linear_model.RANSACRegressor(linear_model.LinearRegression()) model_ransac.fit(latArr, lngArr) inlier_mask = model_ransac.inlier_mask_ logging.debug("In area %s - %s, deleted %d points through ransac filtering" % (area_df.index[0], area_df.index[-1], np.count_nonzero(np.logical_not(inlier_mask)))) return inlier_mask def find_areas_of_interest(self, with_speeds_df): candidateIndices = np.nonzero(with_speeds_df.speed > self.maxSpeed)[0] logging.debug("Found %d potential outliers, list = %s" % (len(candidateIndices), candidateIndices)) if len(candidateIndices) == 0: logging.info("No potential outliers (%s), so no areas to consider", candidateIndices) return [] if len(candidateIndices) == 1: candidateClusterCenters = [candidateIndices] logging.debug("Only one candidate, cluster centers are %s" % candidateClusterCenters) else: from sklearn.cluster import AffinityPropagation af = AffinityPropagation().fit([[i] for i in candidateIndices]) candidateClusterCenters = af.cluster_centers_ logging.debug("Found %d clusters with centers %s" % (len(candidateClusterCenters), candidateClusterCenters)) dfList = [] for cc in candidateClusterCenters: logging.debug("Considering candidate cluster center %s" % cc) lowRange = max(cc[0]-5,0) highRange = min(cc[0]+5,with_speeds_df.shape[0]) logging.debug("lowRange = max(%s, %s) = %s and highRange = max(%s, %s) = %s" % (cc[0]-5,0,lowRange,cc[0]+5,with_speeds_df.shape[0],highRange)) dfList.append(with_speeds_df.loc[lowRange:highRange]) return dfList def filter(self, with_speeds_df): ransac_mask = pd.Series([True] * with_speeds_df.shape[0]) areas_of_interest = self.find_areas_of_interest(with_speeds_df) for area in areas_of_interest: logging.debug("Area size = %s, index = %s with size %s" % (area.shape[0], area.index, len(area.index))) retain_mask = self.filter_area_using_ransac(area) logging.debug("Retain mask is of size %d" % len(retain_mask)) ransac_mask[area.index] = retain_mask logging.debug("with speed df shape is %s, ransac_mask size = %s" % (with_speeds_df.shape, len(ransac_mask))) logging.debug("filtering done, ransac deleted points = %s" % np.nonzero(ransac_mask == False)) self.inlier_mask_ = ransac_mask.to_numpy().tolist()
# -*- encoding: utf-8 -*- """The home of the various metrics we gather.""" import logging import os import socket from abc import ABCMeta from abc import abstractmethod from datetime import datetime from datetime import timezone import boto3 import psutil class Metric(metaclass=ABCMeta): """ABC for metrics we track in CloudWatch. Usage:: class FooMetric(Metric): def __init__(self, **kwargs): super().__init__('Foo', **kwargs) self.unit = "foos" def _capture(self): self.value = 1 FooMetric().put() """ def __init__(self, name, cw_client=None, **kwargs): """Initialize a new ``Metric``. :param name: the name of the new ``Metric`` :type name: :class:`str` :param cw_client: the CloudWatch client to use to push this ``Metric`` up to AWS. If you do not provide one, a new one will be created. :type cw_client: :class:`~botocore.client.CloudWatch` or `None` .. note:: This *will* trigger whatever capturing logic is required to gather the relevant data. .. note:: The ``Namespace`` of the metric defaults to the hostname. """ self.cloudwatch = (cw_client or boto3.client('cloudwatch', 'us-east-1')) self.namespace = socket.gethostname() self.name = name self.value = None self.unit = None self.timestamp = datetime.now(timezone.utc) self._capture() @abstractmethod def _capture(self): """Capture the actual value to be saved.""" pass def put(self): """Push the info represented by this ``Metric`` to CloudWatch.""" try: self.cloudwatch.put_metric_data( Namespace=self.namespace, MetricData=[{ 'MetricName': self.name, 'Value': self.value, 'Timestamp': self.timestamp }] ) except Exception: logging.exception("Error pushing {0} to CloudWatch.".format(str(self))) def __str__(self): """A human-readable representation of this ``Metric``.""" return "{0} - {1}: {2} {3}".format(self.namespace, self.name, self.value, self.unit) class DiskFreeSpaceMetric(Metric): """Information about the free space on a device.""" _UNITS = ('bytes', 'KiB', 'MiB', 'GiB', 'TiB', 'PiB', 'EiB', 'ZiB', 'YiB') def __init__(self, mountpoint): """Create a new free space metric.""" self.mountpoint = mountpoint super().__init__("Disk Free Space") self.name = "{0} ({1})".format(self.name, self.mountpoint) def _capture(self): self.value = psutil.disk_usage(self.mountpoint).free unit_index = 0 while self.value >= 1024: self.value = self.value / 1024 unit_index += 1 self.unit = DiskFreeSpaceMetric._UNITS[unit_index] class DiskPercentFreeSpaceMetric(Metric): """Information about the percent of free space on a device.""" def __init__(self, mountpoint): """Create a new free space metric.""" self.mountpoint = mountpoint super().__init__("Disk Percent Free Space") self.name = "{0} ({1})".format(self.name, self.mountpoint) def _capture(self): self.value = 100 - psutil.disk_usage(self.mountpoint).percent self.unit = "%" class DiskFreeInodesMetric(Metric): """Information about the free inodes on a device.""" def __init__(self, mountpoint): """Create a new free space metric.""" self.mountpoint = mountpoint super().__init__("Disk Free Inodes") self.name = "{0} ({1})".format(self.name, self.mountpoint) def _capture(self): self.value = os.statvfs(self.mountpoint).f_ffree self.unit = "inodes" class DiskPercentFreeInodesMetric(Metric): """Information about the percent of free inodes on a device.""" def __init__(self, mountpoint): """Create a new % of inodes that are freee metric.""" self.mountpoint = mountpoint super().__init__("Disk Percent Free Inodes") self.name = "{0} ({1})".format(self.name, self.mountpoint) def _capture(self): free = os.statvfs(self.mountpoint).f_ffree total = os.statvfs(self.mountpoint).f_files self.value = round(100 * (free / total), 1) self.unit = "%" class TotalProcessesMetric(Metric): """Information about the total number of processes.""" def __init__(self): """Create a new metric for the number of total processes.""" super().__init__("Total Processes Metric") def _capture(self): self.value = len(psutil.pids()) self.unit = "processes" class ZombieProcessesMetric(Metric): """Information about the number of zombie processes.""" def __init__(self): """Create a new metric for the number of zombie processes.""" super().__init__("Zombie Processes Metric") def _capture(self): zombies = [p for p in psutil.process_iter() if p.status() == psutil.STATUS_ZOMBIE] self.value = len(zombies) self.unit = "zombie processes" class OneMinuteLoadAvgMetric(Metric): """The 1-minute load average.""" def __init__(self): """Create a new metric for the 1-minute load avg.""" super().__init__("1-Minute Load Avg") def _capture(self): self.value = os.getloadavg()[0] class FiveMinuteLoadAvgMetric(Metric): """The 5-minute load average.""" def __init__(self): """Create a new metric for the 5-minute load avg.""" super().__init__("5-Minute Load Avg") def _capture(self): self.value = os.getloadavg()[1] class FifteenMinuteLoadAvgMetric(Metric): """The 15-minute load average.""" def __init__(self): """Create a new metric for the 15-minute load avg.""" super().__init__("15-Minute Load Avg") def _capture(self): self.value = os.getloadavg()[2] class CpuPercentageMetric(Metric): """The percent of the CPU currently being used.""" def __init__(self): """Create a new metric for the percent of the CPU being used.""" super().__init__("CPU Percentage") def _capture(self): self.value = psutil.cpu_percent(interval=.1) class CpuContextSwitchesMetric(Metric): """The number of CPU context switches since boot.""" def __init__(self): """Create a new metric for the number of CPU context switches since boot.""" super().__init__("CPU Context Switches") def _capture(self): self.value = psutil.cpu_stats().ctx_switches class MemoryAvailableMetric(Metric): """The amount of memory 'available'. This number is calculated different ways depending on platform, and is likely not the same as physically unallocated memory, thanks to virtual memory. """ _UNITS = ('bytes', 'KiB', 'MiB', 'GiB', 'TiB', 'PiB', 'EiB', 'ZiB', 'YiB') def __init__(self): """Create a new metric for the amount of RAM available.""" super().__init__("Available Memory") def _capture(self): self.value = psutil.virtual_memory().available unit_index = 0 while self.value >= 1024: self.value = self.value / 1024 unit_index += 1 self.unit = MemoryAvailableMetric._UNITS[unit_index] class MemoryAvailablePercentageMetric(Metric): """The amount of memory 'available' as a percentage of total memory. This number is calculated different ways depending on platform, and is likely not the same as physically unallocated memory, thanks to virtual memory. """ def __init__(self): """Create a new metric for the amount of RAM available.""" super().__init__("Available Memory Percentage") def _capture(self): self.value = round(100 - psutil.virtual_memory().percent, 1) self.unit = '%'
# Copyright (c) 2015, Frappe Technologies Pvt. Ltd. and Contributors # MIT License. See license.txt from __future__ import unicode_literals import frappe import os, json from frappe import _ from frappe.modules import scrub, get_module_path from frappe.utils import flt, cint, get_html_format, cstr from frappe.translate import send_translations import frappe.desk.reportview from frappe.permissions import get_role_permissions def get_report_doc(report_name): doc = frappe.get_doc("Report", report_name) if not doc.has_permission("read"): frappe.throw(_("You don't have access to Report: {0}").format(report_name), frappe.PermissionError) if not frappe.has_permission(doc.ref_doctype, "report"): frappe.throw(_("You don't have permission to get a report on: {0}").format(doc.ref_doctype), frappe.PermissionError) if doc.disabled: frappe.throw(_("Report {0} is disabled").format(report_name)) return doc @frappe.whitelist() def get_script(report_name): report = get_report_doc(report_name) module = report.module or frappe.db.get_value("DocType", report.ref_doctype, "module") module_path = get_module_path(module) report_folder = os.path.join(module_path, "report", scrub(report.name)) script_path = os.path.join(report_folder, scrub(report.name) + ".js") print_path = os.path.join(report_folder, scrub(report.name) + ".html") script = None if os.path.exists(script_path): with open(script_path, "r") as f: script = f.read() html_format = get_html_format(print_path) if not script and report.javascript: script = report.javascript if not script: script = "frappe.query_reports['%s']={}" % report_name # load translations if frappe.lang != "en": send_translations(frappe.get_lang_dict("report", report_name)) return { "script": script, "html_format": html_format } @frappe.whitelist() def run(report_name, filters=None, user=None): report = get_report_doc(report_name) if not user: user = frappe.session.user if not filters: filters = [] if filters and isinstance(filters, basestring): filters = json.loads(filters) if not frappe.has_permission(report.ref_doctype, "report"): frappe.msgprint(_("Must have report permission to access this report."), raise_exception=True) columns, result, message, chart = [], [], None, None if report.report_type=="Query Report": if not report.query: frappe.msgprint(_("Must specify a Query to run"), raise_exception=True) if not report.query.lower().startswith("select"): frappe.msgprint(_("Query must be a SELECT"), raise_exception=True) result = [list(t) for t in frappe.db.sql(report.query, filters)] columns = [cstr(c[0]) for c in frappe.db.get_description()] else: module = report.module or frappe.db.get_value("DocType", report.ref_doctype, "module") if report.is_standard=="Yes": method_name = get_report_module_dotted_path(module, report.name) + ".execute" res = frappe.get_attr(method_name)(frappe._dict(filters)) columns, result = res[0], res[1] if len(res) > 2: message = res[2] if len(res) > 3: chart = res[3] if report.apply_user_permissions and result: result = get_filtered_data(report.ref_doctype, columns, result, user) if cint(report.add_total_row) and result: result = add_total_row(result, columns) return { "result": result, "columns": columns, "message": message, "chart": chart } def get_report_module_dotted_path(module, report_name): return frappe.local.module_app[scrub(module)] + "." + scrub(module) \ + ".report." + scrub(report_name) + "." + scrub(report_name) def add_total_row(result, columns, meta = None): total_row = [""]*len(columns) has_percent = [] for i, col in enumerate(columns): fieldtype, options = None, None if isinstance(col, basestring): if meta: # get fieldtype from the meta field = meta.get_field(col) if field: fieldtype = meta.get_field(col).fieldtype else: col = col.split(":") if len(col) > 1: fieldtype = col[1] if "/" in fieldtype: fieldtype, options = fieldtype.split("/") else: fieldtype = col.get("fieldtype") options = col.get("options") for row in result: if fieldtype in ["Currency", "Int", "Float", "Percent"] and flt(row[i]): total_row[i] = flt(total_row[i]) + flt(row[i]) if fieldtype == "Percent" and i not in has_percent: has_percent.append(i) if fieldtype=="Link" and options == "Currency": total_row[i] = result[0][i] for i in has_percent: total_row[i] = total_row[i] / len(result) first_col_fieldtype = None if isinstance(columns[0], basestring): first_col = columns[0].split(":") if len(first_col) > 1: first_col_fieldtype = first_col[1].split("/")[0] else: first_col_fieldtype = columns[0].get("fieldtype") if first_col_fieldtype not in ["Currency", "Int", "Float", "Percent"]: if first_col_fieldtype == "Link": total_row[0] = "'" + _("Total") + "'" else: total_row[0] = _("Total") result.append(total_row) return result def get_filtered_data(ref_doctype, columns, data, user): result = [] linked_doctypes = get_linked_doctypes(columns, data) match_filters_per_doctype = get_user_match_filters(linked_doctypes, ref_doctype) shared = frappe.share.get_shared(ref_doctype, user) columns_dict = get_columns_dict(columns) role_permissions = get_role_permissions(frappe.get_meta(ref_doctype), user) if_owner = role_permissions.get("if_owner", {}).get("report") if match_filters_per_doctype: for row in data: # Why linked_doctypes.get(ref_doctype)? because if column is empty, linked_doctypes[ref_doctype] is removed if linked_doctypes.get(ref_doctype) and shared and row[linked_doctypes[ref_doctype]] in shared: result.append(row) elif has_match(row, linked_doctypes, match_filters_per_doctype, ref_doctype, if_owner, columns_dict, user): result.append(row) else: result = list(data) return result def has_match(row, linked_doctypes, doctype_match_filters, ref_doctype, if_owner, columns_dict, user): """Returns True if after evaluating permissions for each linked doctype - There is an owner match for the ref_doctype - `and` There is a user permission match for all linked doctypes Returns True if the row is empty Note: Each doctype could have multiple conflicting user permission doctypes. Hence even if one of the sets allows a match, it is true. This behavior is equivalent to the trickling of user permissions of linked doctypes to the ref doctype. """ resultant_match = True if not row: # allow empty rows :) return resultant_match for doctype, filter_list in doctype_match_filters.items(): matched_for_doctype = False if doctype==ref_doctype and if_owner: idx = linked_doctypes.get("User") if (idx is not None and row[idx]==user and columns_dict[idx]==columns_dict.get("owner")): # owner match is true matched_for_doctype = True if not matched_for_doctype: for match_filters in filter_list: match = True for dt, idx in linked_doctypes.items(): # case handled above if dt=="User" and columns_dict[idx]==columns_dict.get("owner"): continue if dt in match_filters and row[idx] not in match_filters[dt]: match = False break # each doctype could have multiple conflicting user permission doctypes, hence using OR # so that even if one of the sets allows a match, it is true matched_for_doctype = matched_for_doctype or match if matched_for_doctype: break # each doctype's user permissions should match the row! hence using AND resultant_match = resultant_match and matched_for_doctype if not resultant_match: break return resultant_match def get_linked_doctypes(columns, data): linked_doctypes = {} columns_dict = get_columns_dict(columns) for idx, col in enumerate(columns): df = columns_dict[idx] if df.get("fieldtype")=="Link": if isinstance(col, basestring): linked_doctypes[df["options"]] = idx else: # dict linked_doctypes[df["options"]] = df["fieldname"] # remove doctype if column is empty columns_with_value = [] for row in data: if row: if len(row) != len(columns_with_value): if isinstance(row, (list, tuple)): row = enumerate(row) elif isinstance(row, dict): row = row.items() for col, val in row: if val and col not in columns_with_value: columns_with_value.append(col) for doctype, key in linked_doctypes.items(): if key not in columns_with_value: del linked_doctypes[doctype] return linked_doctypes def get_columns_dict(columns): """Returns a dict with column docfield values as dict The keys for the dict are both idx and fieldname, so either index or fieldname can be used to search for a column's docfield properties """ columns_dict = {} for idx, col in enumerate(columns): col_dict = {} # string if isinstance(col, basestring): col = col.split(":") if len(col) > 1: if "/" in col[1]: col_dict["fieldtype"], col_dict["options"] = col[1].split("/") else: col_dict["fieldtype"] = col[1] col_dict["fieldname"] = frappe.scrub(col[0]) # dict else: col_dict.update(col) if "fieldname" not in col_dict: col_dict["fieldname"] = frappe.scrub(col_dict["label"]) columns_dict[idx] = col_dict columns_dict[col_dict["fieldname"]] = col_dict return columns_dict def get_user_match_filters(doctypes, ref_doctype): match_filters = {} for dt in doctypes: filter_list = frappe.desk.reportview.build_match_conditions(dt, False) if filter_list: match_filters[dt] = filter_list return match_filters
# coding=utf-8 # -------------------------------------------------------------------------- # Copyright (c) Microsoft Corporation. All rights reserved. # Licensed under the MIT License. See License.txt in the project root for license information. # Code generated by Microsoft (R) AutoRest Code Generator. # Changes may cause incorrect behavior and will be lost if the code is regenerated. # -------------------------------------------------------------------------- import functools from typing import Any, Callable, Dict, Generic, Iterable, Optional, TypeVar, Union import warnings from azure.core.exceptions import ClientAuthenticationError, HttpResponseError, ResourceExistsError, ResourceNotFoundError, map_error from azure.core.paging import ItemPaged from azure.core.pipeline import PipelineResponse from azure.core.pipeline.transport import HttpResponse from azure.core.polling import LROPoller, NoPolling, PollingMethod from azure.core.rest import HttpRequest from azure.core.tracing.decorator import distributed_trace from azure.mgmt.core.exceptions import ARMErrorFormat from azure.mgmt.core.polling.arm_polling import ARMPolling from msrest import Serializer from .. import models as _models from .._vendor import _convert_request, _format_url_section T = TypeVar('T') JSONType = Any ClsType = Optional[Callable[[PipelineResponse[HttpRequest, HttpResponse], T, Dict[str, Any]], Any]] _SERIALIZER = Serializer() _SERIALIZER.client_side_validation = False def build_create_or_update_request_initial( subscription_id: str, resource_group_name: str, disk_access_name: str, *, json: JSONType = None, content: Any = None, **kwargs: Any ) -> HttpRequest: content_type = kwargs.pop('content_type', None) # type: Optional[str] api_version = "2021-12-01" accept = "application/json" # Construct URL url = kwargs.pop("template_url", '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses/{diskAccessName}') path_format_arguments = { "subscriptionId": _SERIALIZER.url("subscription_id", subscription_id, 'str'), "resourceGroupName": _SERIALIZER.url("resource_group_name", resource_group_name, 'str'), "diskAccessName": _SERIALIZER.url("disk_access_name", disk_access_name, 'str'), } url = _format_url_section(url, **path_format_arguments) # Construct parameters query_parameters = kwargs.pop("params", {}) # type: Dict[str, Any] query_parameters['api-version'] = _SERIALIZER.query("api_version", api_version, 'str') # Construct headers header_parameters = kwargs.pop("headers", {}) # type: Dict[str, Any] if content_type is not None: header_parameters['Content-Type'] = _SERIALIZER.header("content_type", content_type, 'str') header_parameters['Accept'] = _SERIALIZER.header("accept", accept, 'str') return HttpRequest( method="PUT", url=url, params=query_parameters, headers=header_parameters, json=json, content=content, **kwargs ) def build_update_request_initial( subscription_id: str, resource_group_name: str, disk_access_name: str, *, json: JSONType = None, content: Any = None, **kwargs: Any ) -> HttpRequest: content_type = kwargs.pop('content_type', None) # type: Optional[str] api_version = "2021-12-01" accept = "application/json" # Construct URL url = kwargs.pop("template_url", '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses/{diskAccessName}') path_format_arguments = { "subscriptionId": _SERIALIZER.url("subscription_id", subscription_id, 'str'), "resourceGroupName": _SERIALIZER.url("resource_group_name", resource_group_name, 'str'), "diskAccessName": _SERIALIZER.url("disk_access_name", disk_access_name, 'str'), } url = _format_url_section(url, **path_format_arguments) # Construct parameters query_parameters = kwargs.pop("params", {}) # type: Dict[str, Any] query_parameters['api-version'] = _SERIALIZER.query("api_version", api_version, 'str') # Construct headers header_parameters = kwargs.pop("headers", {}) # type: Dict[str, Any] if content_type is not None: header_parameters['Content-Type'] = _SERIALIZER.header("content_type", content_type, 'str') header_parameters['Accept'] = _SERIALIZER.header("accept", accept, 'str') return HttpRequest( method="PATCH", url=url, params=query_parameters, headers=header_parameters, json=json, content=content, **kwargs ) def build_get_request( subscription_id: str, resource_group_name: str, disk_access_name: str, **kwargs: Any ) -> HttpRequest: api_version = "2021-12-01" accept = "application/json" # Construct URL url = kwargs.pop("template_url", '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses/{diskAccessName}') path_format_arguments = { "subscriptionId": _SERIALIZER.url("subscription_id", subscription_id, 'str'), "resourceGroupName": _SERIALIZER.url("resource_group_name", resource_group_name, 'str'), "diskAccessName": _SERIALIZER.url("disk_access_name", disk_access_name, 'str'), } url = _format_url_section(url, **path_format_arguments) # Construct parameters query_parameters = kwargs.pop("params", {}) # type: Dict[str, Any] query_parameters['api-version'] = _SERIALIZER.query("api_version", api_version, 'str') # Construct headers header_parameters = kwargs.pop("headers", {}) # type: Dict[str, Any] header_parameters['Accept'] = _SERIALIZER.header("accept", accept, 'str') return HttpRequest( method="GET", url=url, params=query_parameters, headers=header_parameters, **kwargs ) def build_delete_request_initial( subscription_id: str, resource_group_name: str, disk_access_name: str, **kwargs: Any ) -> HttpRequest: api_version = "2021-12-01" accept = "application/json" # Construct URL url = kwargs.pop("template_url", '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses/{diskAccessName}') path_format_arguments = { "subscriptionId": _SERIALIZER.url("subscription_id", subscription_id, 'str'), "resourceGroupName": _SERIALIZER.url("resource_group_name", resource_group_name, 'str'), "diskAccessName": _SERIALIZER.url("disk_access_name", disk_access_name, 'str'), } url = _format_url_section(url, **path_format_arguments) # Construct parameters query_parameters = kwargs.pop("params", {}) # type: Dict[str, Any] query_parameters['api-version'] = _SERIALIZER.query("api_version", api_version, 'str') # Construct headers header_parameters = kwargs.pop("headers", {}) # type: Dict[str, Any] header_parameters['Accept'] = _SERIALIZER.header("accept", accept, 'str') return HttpRequest( method="DELETE", url=url, params=query_parameters, headers=header_parameters, **kwargs ) def build_list_by_resource_group_request( subscription_id: str, resource_group_name: str, **kwargs: Any ) -> HttpRequest: api_version = "2021-12-01" accept = "application/json" # Construct URL url = kwargs.pop("template_url", '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses') path_format_arguments = { "subscriptionId": _SERIALIZER.url("subscription_id", subscription_id, 'str'), "resourceGroupName": _SERIALIZER.url("resource_group_name", resource_group_name, 'str'), } url = _format_url_section(url, **path_format_arguments) # Construct parameters query_parameters = kwargs.pop("params", {}) # type: Dict[str, Any] query_parameters['api-version'] = _SERIALIZER.query("api_version", api_version, 'str') # Construct headers header_parameters = kwargs.pop("headers", {}) # type: Dict[str, Any] header_parameters['Accept'] = _SERIALIZER.header("accept", accept, 'str') return HttpRequest( method="GET", url=url, params=query_parameters, headers=header_parameters, **kwargs ) def build_list_request( subscription_id: str, **kwargs: Any ) -> HttpRequest: api_version = "2021-12-01" accept = "application/json" # Construct URL url = kwargs.pop("template_url", '/subscriptions/{subscriptionId}/providers/Microsoft.Compute/diskAccesses') path_format_arguments = { "subscriptionId": _SERIALIZER.url("subscription_id", subscription_id, 'str'), } url = _format_url_section(url, **path_format_arguments) # Construct parameters query_parameters = kwargs.pop("params", {}) # type: Dict[str, Any] query_parameters['api-version'] = _SERIALIZER.query("api_version", api_version, 'str') # Construct headers header_parameters = kwargs.pop("headers", {}) # type: Dict[str, Any] header_parameters['Accept'] = _SERIALIZER.header("accept", accept, 'str') return HttpRequest( method="GET", url=url, params=query_parameters, headers=header_parameters, **kwargs ) def build_get_private_link_resources_request( subscription_id: str, resource_group_name: str, disk_access_name: str, **kwargs: Any ) -> HttpRequest: api_version = "2021-12-01" accept = "application/json" # Construct URL url = kwargs.pop("template_url", '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses/{diskAccessName}/privateLinkResources') path_format_arguments = { "subscriptionId": _SERIALIZER.url("subscription_id", subscription_id, 'str'), "resourceGroupName": _SERIALIZER.url("resource_group_name", resource_group_name, 'str'), "diskAccessName": _SERIALIZER.url("disk_access_name", disk_access_name, 'str'), } url = _format_url_section(url, **path_format_arguments) # Construct parameters query_parameters = kwargs.pop("params", {}) # type: Dict[str, Any] query_parameters['api-version'] = _SERIALIZER.query("api_version", api_version, 'str') # Construct headers header_parameters = kwargs.pop("headers", {}) # type: Dict[str, Any] header_parameters['Accept'] = _SERIALIZER.header("accept", accept, 'str') return HttpRequest( method="GET", url=url, params=query_parameters, headers=header_parameters, **kwargs ) def build_update_a_private_endpoint_connection_request_initial( subscription_id: str, resource_group_name: str, disk_access_name: str, private_endpoint_connection_name: str, *, json: JSONType = None, content: Any = None, **kwargs: Any ) -> HttpRequest: content_type = kwargs.pop('content_type', None) # type: Optional[str] api_version = "2021-12-01" accept = "application/json" # Construct URL url = kwargs.pop("template_url", '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses/{diskAccessName}/privateEndpointConnections/{privateEndpointConnectionName}') path_format_arguments = { "subscriptionId": _SERIALIZER.url("subscription_id", subscription_id, 'str'), "resourceGroupName": _SERIALIZER.url("resource_group_name", resource_group_name, 'str'), "diskAccessName": _SERIALIZER.url("disk_access_name", disk_access_name, 'str'), "privateEndpointConnectionName": _SERIALIZER.url("private_endpoint_connection_name", private_endpoint_connection_name, 'str'), } url = _format_url_section(url, **path_format_arguments) # Construct parameters query_parameters = kwargs.pop("params", {}) # type: Dict[str, Any] query_parameters['api-version'] = _SERIALIZER.query("api_version", api_version, 'str') # Construct headers header_parameters = kwargs.pop("headers", {}) # type: Dict[str, Any] if content_type is not None: header_parameters['Content-Type'] = _SERIALIZER.header("content_type", content_type, 'str') header_parameters['Accept'] = _SERIALIZER.header("accept", accept, 'str') return HttpRequest( method="PUT", url=url, params=query_parameters, headers=header_parameters, json=json, content=content, **kwargs ) def build_get_a_private_endpoint_connection_request( subscription_id: str, resource_group_name: str, disk_access_name: str, private_endpoint_connection_name: str, **kwargs: Any ) -> HttpRequest: api_version = "2021-12-01" accept = "application/json" # Construct URL url = kwargs.pop("template_url", '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses/{diskAccessName}/privateEndpointConnections/{privateEndpointConnectionName}') path_format_arguments = { "subscriptionId": _SERIALIZER.url("subscription_id", subscription_id, 'str'), "resourceGroupName": _SERIALIZER.url("resource_group_name", resource_group_name, 'str'), "diskAccessName": _SERIALIZER.url("disk_access_name", disk_access_name, 'str'), "privateEndpointConnectionName": _SERIALIZER.url("private_endpoint_connection_name", private_endpoint_connection_name, 'str'), } url = _format_url_section(url, **path_format_arguments) # Construct parameters query_parameters = kwargs.pop("params", {}) # type: Dict[str, Any] query_parameters['api-version'] = _SERIALIZER.query("api_version", api_version, 'str') # Construct headers header_parameters = kwargs.pop("headers", {}) # type: Dict[str, Any] header_parameters['Accept'] = _SERIALIZER.header("accept", accept, 'str') return HttpRequest( method="GET", url=url, params=query_parameters, headers=header_parameters, **kwargs ) def build_delete_a_private_endpoint_connection_request_initial( subscription_id: str, resource_group_name: str, disk_access_name: str, private_endpoint_connection_name: str, **kwargs: Any ) -> HttpRequest: api_version = "2021-12-01" accept = "application/json" # Construct URL url = kwargs.pop("template_url", '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses/{diskAccessName}/privateEndpointConnections/{privateEndpointConnectionName}') path_format_arguments = { "subscriptionId": _SERIALIZER.url("subscription_id", subscription_id, 'str'), "resourceGroupName": _SERIALIZER.url("resource_group_name", resource_group_name, 'str'), "diskAccessName": _SERIALIZER.url("disk_access_name", disk_access_name, 'str'), "privateEndpointConnectionName": _SERIALIZER.url("private_endpoint_connection_name", private_endpoint_connection_name, 'str'), } url = _format_url_section(url, **path_format_arguments) # Construct parameters query_parameters = kwargs.pop("params", {}) # type: Dict[str, Any] query_parameters['api-version'] = _SERIALIZER.query("api_version", api_version, 'str') # Construct headers header_parameters = kwargs.pop("headers", {}) # type: Dict[str, Any] header_parameters['Accept'] = _SERIALIZER.header("accept", accept, 'str') return HttpRequest( method="DELETE", url=url, params=query_parameters, headers=header_parameters, **kwargs ) def build_list_private_endpoint_connections_request( subscription_id: str, resource_group_name: str, disk_access_name: str, **kwargs: Any ) -> HttpRequest: api_version = "2021-12-01" accept = "application/json" # Construct URL url = kwargs.pop("template_url", '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses/{diskAccessName}/privateEndpointConnections') path_format_arguments = { "subscriptionId": _SERIALIZER.url("subscription_id", subscription_id, 'str'), "resourceGroupName": _SERIALIZER.url("resource_group_name", resource_group_name, 'str'), "diskAccessName": _SERIALIZER.url("disk_access_name", disk_access_name, 'str'), } url = _format_url_section(url, **path_format_arguments) # Construct parameters query_parameters = kwargs.pop("params", {}) # type: Dict[str, Any] query_parameters['api-version'] = _SERIALIZER.query("api_version", api_version, 'str') # Construct headers header_parameters = kwargs.pop("headers", {}) # type: Dict[str, Any] header_parameters['Accept'] = _SERIALIZER.header("accept", accept, 'str') return HttpRequest( method="GET", url=url, params=query_parameters, headers=header_parameters, **kwargs ) class DiskAccessesOperations(object): """DiskAccessesOperations operations. You should not instantiate this class directly. Instead, you should create a Client instance that instantiates it for you and attaches it as an attribute. :ivar models: Alias to model classes used in this operation group. :type models: ~azure.mgmt.compute.v2021_12_01.models :param client: Client for service requests. :param config: Configuration of service client. :param serializer: An object model serializer. :param deserializer: An object model deserializer. """ models = _models def __init__(self, client, config, serializer, deserializer): self._client = client self._serialize = serializer self._deserialize = deserializer self._config = config def _create_or_update_initial( self, resource_group_name: str, disk_access_name: str, disk_access: "_models.DiskAccess", **kwargs: Any ) -> "_models.DiskAccess": cls = kwargs.pop('cls', None) # type: ClsType["_models.DiskAccess"] error_map = { 401: ClientAuthenticationError, 404: ResourceNotFoundError, 409: ResourceExistsError } error_map.update(kwargs.pop('error_map', {})) content_type = kwargs.pop('content_type', "application/json") # type: Optional[str] _json = self._serialize.body(disk_access, 'DiskAccess') request = build_create_or_update_request_initial( subscription_id=self._config.subscription_id, resource_group_name=resource_group_name, disk_access_name=disk_access_name, content_type=content_type, json=_json, template_url=self._create_or_update_initial.metadata['url'], ) request = _convert_request(request) request.url = self._client.format_url(request.url) pipeline_response = self._client._pipeline.run(request, stream=False, **kwargs) response = pipeline_response.http_response if response.status_code not in [200, 202]: map_error(status_code=response.status_code, response=response, error_map=error_map) raise HttpResponseError(response=response, error_format=ARMErrorFormat) if response.status_code == 200: deserialized = self._deserialize('DiskAccess', pipeline_response) if response.status_code == 202: deserialized = self._deserialize('DiskAccess', pipeline_response) if cls: return cls(pipeline_response, deserialized, {}) return deserialized _create_or_update_initial.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses/{diskAccessName}'} # type: ignore @distributed_trace def begin_create_or_update( self, resource_group_name: str, disk_access_name: str, disk_access: "_models.DiskAccess", **kwargs: Any ) -> LROPoller["_models.DiskAccess"]: """Creates or updates a disk access resource. :param resource_group_name: The name of the resource group. :type resource_group_name: str :param disk_access_name: The name of the disk access resource that is being created. The name can't be changed after the disk encryption set is created. Supported characters for the name are a-z, A-Z, 0-9, _ and -. The maximum name length is 80 characters. :type disk_access_name: str :param disk_access: disk access object supplied in the body of the Put disk access operation. :type disk_access: ~azure.mgmt.compute.v2021_12_01.models.DiskAccess :keyword callable cls: A custom type or function that will be passed the direct response :keyword str continuation_token: A continuation token to restart a poller from a saved state. :keyword polling: By default, your polling method will be ARMPolling. Pass in False for this operation to not poll, or pass in your own initialized polling object for a personal polling strategy. :paramtype polling: bool or ~azure.core.polling.PollingMethod :keyword int polling_interval: Default waiting time between two polls for LRO operations if no Retry-After header is present. :return: An instance of LROPoller that returns either DiskAccess or the result of cls(response) :rtype: ~azure.core.polling.LROPoller[~azure.mgmt.compute.v2021_12_01.models.DiskAccess] :raises: ~azure.core.exceptions.HttpResponseError """ content_type = kwargs.pop('content_type', "application/json") # type: Optional[str] polling = kwargs.pop('polling', True) # type: Union[bool, azure.core.polling.PollingMethod] cls = kwargs.pop('cls', None) # type: ClsType["_models.DiskAccess"] lro_delay = kwargs.pop( 'polling_interval', self._config.polling_interval ) cont_token = kwargs.pop('continuation_token', None) # type: Optional[str] if cont_token is None: raw_result = self._create_or_update_initial( resource_group_name=resource_group_name, disk_access_name=disk_access_name, disk_access=disk_access, content_type=content_type, cls=lambda x,y,z: x, **kwargs ) kwargs.pop('error_map', None) def get_long_running_output(pipeline_response): response = pipeline_response.http_response deserialized = self._deserialize('DiskAccess', pipeline_response) if cls: return cls(pipeline_response, deserialized, {}) return deserialized if polling is True: polling_method = ARMPolling(lro_delay, **kwargs) elif polling is False: polling_method = NoPolling() else: polling_method = polling if cont_token: return LROPoller.from_continuation_token( polling_method=polling_method, continuation_token=cont_token, client=self._client, deserialization_callback=get_long_running_output ) else: return LROPoller(self._client, raw_result, get_long_running_output, polling_method) begin_create_or_update.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses/{diskAccessName}'} # type: ignore def _update_initial( self, resource_group_name: str, disk_access_name: str, disk_access: "_models.DiskAccessUpdate", **kwargs: Any ) -> "_models.DiskAccess": cls = kwargs.pop('cls', None) # type: ClsType["_models.DiskAccess"] error_map = { 401: ClientAuthenticationError, 404: ResourceNotFoundError, 409: ResourceExistsError } error_map.update(kwargs.pop('error_map', {})) content_type = kwargs.pop('content_type', "application/json") # type: Optional[str] _json = self._serialize.body(disk_access, 'DiskAccessUpdate') request = build_update_request_initial( subscription_id=self._config.subscription_id, resource_group_name=resource_group_name, disk_access_name=disk_access_name, content_type=content_type, json=_json, template_url=self._update_initial.metadata['url'], ) request = _convert_request(request) request.url = self._client.format_url(request.url) pipeline_response = self._client._pipeline.run(request, stream=False, **kwargs) response = pipeline_response.http_response if response.status_code not in [200, 202]: map_error(status_code=response.status_code, response=response, error_map=error_map) raise HttpResponseError(response=response, error_format=ARMErrorFormat) if response.status_code == 200: deserialized = self._deserialize('DiskAccess', pipeline_response) if response.status_code == 202: deserialized = self._deserialize('DiskAccess', pipeline_response) if cls: return cls(pipeline_response, deserialized, {}) return deserialized _update_initial.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses/{diskAccessName}'} # type: ignore @distributed_trace def begin_update( self, resource_group_name: str, disk_access_name: str, disk_access: "_models.DiskAccessUpdate", **kwargs: Any ) -> LROPoller["_models.DiskAccess"]: """Updates (patches) a disk access resource. :param resource_group_name: The name of the resource group. :type resource_group_name: str :param disk_access_name: The name of the disk access resource that is being created. The name can't be changed after the disk encryption set is created. Supported characters for the name are a-z, A-Z, 0-9, _ and -. The maximum name length is 80 characters. :type disk_access_name: str :param disk_access: disk access object supplied in the body of the Patch disk access operation. :type disk_access: ~azure.mgmt.compute.v2021_12_01.models.DiskAccessUpdate :keyword callable cls: A custom type or function that will be passed the direct response :keyword str continuation_token: A continuation token to restart a poller from a saved state. :keyword polling: By default, your polling method will be ARMPolling. Pass in False for this operation to not poll, or pass in your own initialized polling object for a personal polling strategy. :paramtype polling: bool or ~azure.core.polling.PollingMethod :keyword int polling_interval: Default waiting time between two polls for LRO operations if no Retry-After header is present. :return: An instance of LROPoller that returns either DiskAccess or the result of cls(response) :rtype: ~azure.core.polling.LROPoller[~azure.mgmt.compute.v2021_12_01.models.DiskAccess] :raises: ~azure.core.exceptions.HttpResponseError """ content_type = kwargs.pop('content_type', "application/json") # type: Optional[str] polling = kwargs.pop('polling', True) # type: Union[bool, azure.core.polling.PollingMethod] cls = kwargs.pop('cls', None) # type: ClsType["_models.DiskAccess"] lro_delay = kwargs.pop( 'polling_interval', self._config.polling_interval ) cont_token = kwargs.pop('continuation_token', None) # type: Optional[str] if cont_token is None: raw_result = self._update_initial( resource_group_name=resource_group_name, disk_access_name=disk_access_name, disk_access=disk_access, content_type=content_type, cls=lambda x,y,z: x, **kwargs ) kwargs.pop('error_map', None) def get_long_running_output(pipeline_response): response = pipeline_response.http_response deserialized = self._deserialize('DiskAccess', pipeline_response) if cls: return cls(pipeline_response, deserialized, {}) return deserialized if polling is True: polling_method = ARMPolling(lro_delay, **kwargs) elif polling is False: polling_method = NoPolling() else: polling_method = polling if cont_token: return LROPoller.from_continuation_token( polling_method=polling_method, continuation_token=cont_token, client=self._client, deserialization_callback=get_long_running_output ) else: return LROPoller(self._client, raw_result, get_long_running_output, polling_method) begin_update.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses/{diskAccessName}'} # type: ignore @distributed_trace def get( self, resource_group_name: str, disk_access_name: str, **kwargs: Any ) -> "_models.DiskAccess": """Gets information about a disk access resource. :param resource_group_name: The name of the resource group. :type resource_group_name: str :param disk_access_name: The name of the disk access resource that is being created. The name can't be changed after the disk encryption set is created. Supported characters for the name are a-z, A-Z, 0-9, _ and -. The maximum name length is 80 characters. :type disk_access_name: str :keyword callable cls: A custom type or function that will be passed the direct response :return: DiskAccess, or the result of cls(response) :rtype: ~azure.mgmt.compute.v2021_12_01.models.DiskAccess :raises: ~azure.core.exceptions.HttpResponseError """ cls = kwargs.pop('cls', None) # type: ClsType["_models.DiskAccess"] error_map = { 401: ClientAuthenticationError, 404: ResourceNotFoundError, 409: ResourceExistsError } error_map.update(kwargs.pop('error_map', {})) request = build_get_request( subscription_id=self._config.subscription_id, resource_group_name=resource_group_name, disk_access_name=disk_access_name, template_url=self.get.metadata['url'], ) request = _convert_request(request) request.url = self._client.format_url(request.url) pipeline_response = self._client._pipeline.run(request, stream=False, **kwargs) response = pipeline_response.http_response if response.status_code not in [200]: map_error(status_code=response.status_code, response=response, error_map=error_map) raise HttpResponseError(response=response, error_format=ARMErrorFormat) deserialized = self._deserialize('DiskAccess', pipeline_response) if cls: return cls(pipeline_response, deserialized, {}) return deserialized get.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses/{diskAccessName}'} # type: ignore def _delete_initial( self, resource_group_name: str, disk_access_name: str, **kwargs: Any ) -> None: cls = kwargs.pop('cls', None) # type: ClsType[None] error_map = { 401: ClientAuthenticationError, 404: ResourceNotFoundError, 409: ResourceExistsError } error_map.update(kwargs.pop('error_map', {})) request = build_delete_request_initial( subscription_id=self._config.subscription_id, resource_group_name=resource_group_name, disk_access_name=disk_access_name, template_url=self._delete_initial.metadata['url'], ) request = _convert_request(request) request.url = self._client.format_url(request.url) pipeline_response = self._client._pipeline.run(request, stream=False, **kwargs) response = pipeline_response.http_response if response.status_code not in [200, 202, 204]: map_error(status_code=response.status_code, response=response, error_map=error_map) raise HttpResponseError(response=response, error_format=ARMErrorFormat) if cls: return cls(pipeline_response, None, {}) _delete_initial.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses/{diskAccessName}'} # type: ignore @distributed_trace def begin_delete( self, resource_group_name: str, disk_access_name: str, **kwargs: Any ) -> LROPoller[None]: """Deletes a disk access resource. :param resource_group_name: The name of the resource group. :type resource_group_name: str :param disk_access_name: The name of the disk access resource that is being created. The name can't be changed after the disk encryption set is created. Supported characters for the name are a-z, A-Z, 0-9, _ and -. The maximum name length is 80 characters. :type disk_access_name: str :keyword callable cls: A custom type or function that will be passed the direct response :keyword str continuation_token: A continuation token to restart a poller from a saved state. :keyword polling: By default, your polling method will be ARMPolling. Pass in False for this operation to not poll, or pass in your own initialized polling object for a personal polling strategy. :paramtype polling: bool or ~azure.core.polling.PollingMethod :keyword int polling_interval: Default waiting time between two polls for LRO operations if no Retry-After header is present. :return: An instance of LROPoller that returns either None or the result of cls(response) :rtype: ~azure.core.polling.LROPoller[None] :raises: ~azure.core.exceptions.HttpResponseError """ polling = kwargs.pop('polling', True) # type: Union[bool, azure.core.polling.PollingMethod] cls = kwargs.pop('cls', None) # type: ClsType[None] lro_delay = kwargs.pop( 'polling_interval', self._config.polling_interval ) cont_token = kwargs.pop('continuation_token', None) # type: Optional[str] if cont_token is None: raw_result = self._delete_initial( resource_group_name=resource_group_name, disk_access_name=disk_access_name, cls=lambda x,y,z: x, **kwargs ) kwargs.pop('error_map', None) def get_long_running_output(pipeline_response): if cls: return cls(pipeline_response, None, {}) if polling is True: polling_method = ARMPolling(lro_delay, **kwargs) elif polling is False: polling_method = NoPolling() else: polling_method = polling if cont_token: return LROPoller.from_continuation_token( polling_method=polling_method, continuation_token=cont_token, client=self._client, deserialization_callback=get_long_running_output ) else: return LROPoller(self._client, raw_result, get_long_running_output, polling_method) begin_delete.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses/{diskAccessName}'} # type: ignore @distributed_trace def list_by_resource_group( self, resource_group_name: str, **kwargs: Any ) -> Iterable["_models.DiskAccessList"]: """Lists all the disk access resources under a resource group. :param resource_group_name: The name of the resource group. :type resource_group_name: str :keyword callable cls: A custom type or function that will be passed the direct response :return: An iterator like instance of either DiskAccessList or the result of cls(response) :rtype: ~azure.core.paging.ItemPaged[~azure.mgmt.compute.v2021_12_01.models.DiskAccessList] :raises: ~azure.core.exceptions.HttpResponseError """ cls = kwargs.pop('cls', None) # type: ClsType["_models.DiskAccessList"] error_map = { 401: ClientAuthenticationError, 404: ResourceNotFoundError, 409: ResourceExistsError } error_map.update(kwargs.pop('error_map', {})) def prepare_request(next_link=None): if not next_link: request = build_list_by_resource_group_request( subscription_id=self._config.subscription_id, resource_group_name=resource_group_name, template_url=self.list_by_resource_group.metadata['url'], ) request = _convert_request(request) request.url = self._client.format_url(request.url) else: request = build_list_by_resource_group_request( subscription_id=self._config.subscription_id, resource_group_name=resource_group_name, template_url=next_link, ) request = _convert_request(request) request.url = self._client.format_url(request.url) request.method = "GET" return request def extract_data(pipeline_response): deserialized = self._deserialize("DiskAccessList", pipeline_response) list_of_elem = deserialized.value if cls: list_of_elem = cls(list_of_elem) return deserialized.next_link or None, iter(list_of_elem) def get_next(next_link=None): request = prepare_request(next_link) pipeline_response = self._client._pipeline.run(request, stream=False, **kwargs) response = pipeline_response.http_response if response.status_code not in [200]: map_error(status_code=response.status_code, response=response, error_map=error_map) raise HttpResponseError(response=response, error_format=ARMErrorFormat) return pipeline_response return ItemPaged( get_next, extract_data ) list_by_resource_group.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses'} # type: ignore @distributed_trace def list( self, **kwargs: Any ) -> Iterable["_models.DiskAccessList"]: """Lists all the disk access resources under a subscription. :keyword callable cls: A custom type or function that will be passed the direct response :return: An iterator like instance of either DiskAccessList or the result of cls(response) :rtype: ~azure.core.paging.ItemPaged[~azure.mgmt.compute.v2021_12_01.models.DiskAccessList] :raises: ~azure.core.exceptions.HttpResponseError """ cls = kwargs.pop('cls', None) # type: ClsType["_models.DiskAccessList"] error_map = { 401: ClientAuthenticationError, 404: ResourceNotFoundError, 409: ResourceExistsError } error_map.update(kwargs.pop('error_map', {})) def prepare_request(next_link=None): if not next_link: request = build_list_request( subscription_id=self._config.subscription_id, template_url=self.list.metadata['url'], ) request = _convert_request(request) request.url = self._client.format_url(request.url) else: request = build_list_request( subscription_id=self._config.subscription_id, template_url=next_link, ) request = _convert_request(request) request.url = self._client.format_url(request.url) request.method = "GET" return request def extract_data(pipeline_response): deserialized = self._deserialize("DiskAccessList", pipeline_response) list_of_elem = deserialized.value if cls: list_of_elem = cls(list_of_elem) return deserialized.next_link or None, iter(list_of_elem) def get_next(next_link=None): request = prepare_request(next_link) pipeline_response = self._client._pipeline.run(request, stream=False, **kwargs) response = pipeline_response.http_response if response.status_code not in [200]: map_error(status_code=response.status_code, response=response, error_map=error_map) raise HttpResponseError(response=response, error_format=ARMErrorFormat) return pipeline_response return ItemPaged( get_next, extract_data ) list.metadata = {'url': '/subscriptions/{subscriptionId}/providers/Microsoft.Compute/diskAccesses'} # type: ignore @distributed_trace def get_private_link_resources( self, resource_group_name: str, disk_access_name: str, **kwargs: Any ) -> "_models.PrivateLinkResourceListResult": """Gets the private link resources possible under disk access resource. :param resource_group_name: The name of the resource group. :type resource_group_name: str :param disk_access_name: The name of the disk access resource that is being created. The name can't be changed after the disk encryption set is created. Supported characters for the name are a-z, A-Z, 0-9, _ and -. The maximum name length is 80 characters. :type disk_access_name: str :keyword callable cls: A custom type or function that will be passed the direct response :return: PrivateLinkResourceListResult, or the result of cls(response) :rtype: ~azure.mgmt.compute.v2021_12_01.models.PrivateLinkResourceListResult :raises: ~azure.core.exceptions.HttpResponseError """ cls = kwargs.pop('cls', None) # type: ClsType["_models.PrivateLinkResourceListResult"] error_map = { 401: ClientAuthenticationError, 404: ResourceNotFoundError, 409: ResourceExistsError } error_map.update(kwargs.pop('error_map', {})) request = build_get_private_link_resources_request( subscription_id=self._config.subscription_id, resource_group_name=resource_group_name, disk_access_name=disk_access_name, template_url=self.get_private_link_resources.metadata['url'], ) request = _convert_request(request) request.url = self._client.format_url(request.url) pipeline_response = self._client._pipeline.run(request, stream=False, **kwargs) response = pipeline_response.http_response if response.status_code not in [200]: map_error(status_code=response.status_code, response=response, error_map=error_map) raise HttpResponseError(response=response, error_format=ARMErrorFormat) deserialized = self._deserialize('PrivateLinkResourceListResult', pipeline_response) if cls: return cls(pipeline_response, deserialized, {}) return deserialized get_private_link_resources.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses/{diskAccessName}/privateLinkResources'} # type: ignore def _update_a_private_endpoint_connection_initial( self, resource_group_name: str, disk_access_name: str, private_endpoint_connection_name: str, private_endpoint_connection: "_models.PrivateEndpointConnection", **kwargs: Any ) -> "_models.PrivateEndpointConnection": cls = kwargs.pop('cls', None) # type: ClsType["_models.PrivateEndpointConnection"] error_map = { 401: ClientAuthenticationError, 404: ResourceNotFoundError, 409: ResourceExistsError } error_map.update(kwargs.pop('error_map', {})) content_type = kwargs.pop('content_type', "application/json") # type: Optional[str] _json = self._serialize.body(private_endpoint_connection, 'PrivateEndpointConnection') request = build_update_a_private_endpoint_connection_request_initial( subscription_id=self._config.subscription_id, resource_group_name=resource_group_name, disk_access_name=disk_access_name, private_endpoint_connection_name=private_endpoint_connection_name, content_type=content_type, json=_json, template_url=self._update_a_private_endpoint_connection_initial.metadata['url'], ) request = _convert_request(request) request.url = self._client.format_url(request.url) pipeline_response = self._client._pipeline.run(request, stream=False, **kwargs) response = pipeline_response.http_response if response.status_code not in [200, 202]: map_error(status_code=response.status_code, response=response, error_map=error_map) raise HttpResponseError(response=response, error_format=ARMErrorFormat) if response.status_code == 200: deserialized = self._deserialize('PrivateEndpointConnection', pipeline_response) if response.status_code == 202: deserialized = self._deserialize('PrivateEndpointConnection', pipeline_response) if cls: return cls(pipeline_response, deserialized, {}) return deserialized _update_a_private_endpoint_connection_initial.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses/{diskAccessName}/privateEndpointConnections/{privateEndpointConnectionName}'} # type: ignore @distributed_trace def begin_update_a_private_endpoint_connection( self, resource_group_name: str, disk_access_name: str, private_endpoint_connection_name: str, private_endpoint_connection: "_models.PrivateEndpointConnection", **kwargs: Any ) -> LROPoller["_models.PrivateEndpointConnection"]: """Approve or reject a private endpoint connection under disk access resource, this can't be used to create a new private endpoint connection. :param resource_group_name: The name of the resource group. :type resource_group_name: str :param disk_access_name: The name of the disk access resource that is being created. The name can't be changed after the disk encryption set is created. Supported characters for the name are a-z, A-Z, 0-9, _ and -. The maximum name length is 80 characters. :type disk_access_name: str :param private_endpoint_connection_name: The name of the private endpoint connection. :type private_endpoint_connection_name: str :param private_endpoint_connection: private endpoint connection object supplied in the body of the Put private endpoint connection operation. :type private_endpoint_connection: ~azure.mgmt.compute.v2021_12_01.models.PrivateEndpointConnection :keyword callable cls: A custom type or function that will be passed the direct response :keyword str continuation_token: A continuation token to restart a poller from a saved state. :keyword polling: By default, your polling method will be ARMPolling. Pass in False for this operation to not poll, or pass in your own initialized polling object for a personal polling strategy. :paramtype polling: bool or ~azure.core.polling.PollingMethod :keyword int polling_interval: Default waiting time between two polls for LRO operations if no Retry-After header is present. :return: An instance of LROPoller that returns either PrivateEndpointConnection or the result of cls(response) :rtype: ~azure.core.polling.LROPoller[~azure.mgmt.compute.v2021_12_01.models.PrivateEndpointConnection] :raises: ~azure.core.exceptions.HttpResponseError """ content_type = kwargs.pop('content_type', "application/json") # type: Optional[str] polling = kwargs.pop('polling', True) # type: Union[bool, azure.core.polling.PollingMethod] cls = kwargs.pop('cls', None) # type: ClsType["_models.PrivateEndpointConnection"] lro_delay = kwargs.pop( 'polling_interval', self._config.polling_interval ) cont_token = kwargs.pop('continuation_token', None) # type: Optional[str] if cont_token is None: raw_result = self._update_a_private_endpoint_connection_initial( resource_group_name=resource_group_name, disk_access_name=disk_access_name, private_endpoint_connection_name=private_endpoint_connection_name, private_endpoint_connection=private_endpoint_connection, content_type=content_type, cls=lambda x,y,z: x, **kwargs ) kwargs.pop('error_map', None) def get_long_running_output(pipeline_response): response = pipeline_response.http_response deserialized = self._deserialize('PrivateEndpointConnection', pipeline_response) if cls: return cls(pipeline_response, deserialized, {}) return deserialized if polling is True: polling_method = ARMPolling(lro_delay, **kwargs) elif polling is False: polling_method = NoPolling() else: polling_method = polling if cont_token: return LROPoller.from_continuation_token( polling_method=polling_method, continuation_token=cont_token, client=self._client, deserialization_callback=get_long_running_output ) else: return LROPoller(self._client, raw_result, get_long_running_output, polling_method) begin_update_a_private_endpoint_connection.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses/{diskAccessName}/privateEndpointConnections/{privateEndpointConnectionName}'} # type: ignore @distributed_trace def get_a_private_endpoint_connection( self, resource_group_name: str, disk_access_name: str, private_endpoint_connection_name: str, **kwargs: Any ) -> "_models.PrivateEndpointConnection": """Gets information about a private endpoint connection under a disk access resource. :param resource_group_name: The name of the resource group. :type resource_group_name: str :param disk_access_name: The name of the disk access resource that is being created. The name can't be changed after the disk encryption set is created. Supported characters for the name are a-z, A-Z, 0-9, _ and -. The maximum name length is 80 characters. :type disk_access_name: str :param private_endpoint_connection_name: The name of the private endpoint connection. :type private_endpoint_connection_name: str :keyword callable cls: A custom type or function that will be passed the direct response :return: PrivateEndpointConnection, or the result of cls(response) :rtype: ~azure.mgmt.compute.v2021_12_01.models.PrivateEndpointConnection :raises: ~azure.core.exceptions.HttpResponseError """ cls = kwargs.pop('cls', None) # type: ClsType["_models.PrivateEndpointConnection"] error_map = { 401: ClientAuthenticationError, 404: ResourceNotFoundError, 409: ResourceExistsError } error_map.update(kwargs.pop('error_map', {})) request = build_get_a_private_endpoint_connection_request( subscription_id=self._config.subscription_id, resource_group_name=resource_group_name, disk_access_name=disk_access_name, private_endpoint_connection_name=private_endpoint_connection_name, template_url=self.get_a_private_endpoint_connection.metadata['url'], ) request = _convert_request(request) request.url = self._client.format_url(request.url) pipeline_response = self._client._pipeline.run(request, stream=False, **kwargs) response = pipeline_response.http_response if response.status_code not in [200]: map_error(status_code=response.status_code, response=response, error_map=error_map) raise HttpResponseError(response=response, error_format=ARMErrorFormat) deserialized = self._deserialize('PrivateEndpointConnection', pipeline_response) if cls: return cls(pipeline_response, deserialized, {}) return deserialized get_a_private_endpoint_connection.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses/{diskAccessName}/privateEndpointConnections/{privateEndpointConnectionName}'} # type: ignore def _delete_a_private_endpoint_connection_initial( self, resource_group_name: str, disk_access_name: str, private_endpoint_connection_name: str, **kwargs: Any ) -> None: cls = kwargs.pop('cls', None) # type: ClsType[None] error_map = { 401: ClientAuthenticationError, 404: ResourceNotFoundError, 409: ResourceExistsError } error_map.update(kwargs.pop('error_map', {})) request = build_delete_a_private_endpoint_connection_request_initial( subscription_id=self._config.subscription_id, resource_group_name=resource_group_name, disk_access_name=disk_access_name, private_endpoint_connection_name=private_endpoint_connection_name, template_url=self._delete_a_private_endpoint_connection_initial.metadata['url'], ) request = _convert_request(request) request.url = self._client.format_url(request.url) pipeline_response = self._client._pipeline.run(request, stream=False, **kwargs) response = pipeline_response.http_response if response.status_code not in [200, 202, 204]: map_error(status_code=response.status_code, response=response, error_map=error_map) raise HttpResponseError(response=response, error_format=ARMErrorFormat) if cls: return cls(pipeline_response, None, {}) _delete_a_private_endpoint_connection_initial.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses/{diskAccessName}/privateEndpointConnections/{privateEndpointConnectionName}'} # type: ignore @distributed_trace def begin_delete_a_private_endpoint_connection( self, resource_group_name: str, disk_access_name: str, private_endpoint_connection_name: str, **kwargs: Any ) -> LROPoller[None]: """Deletes a private endpoint connection under a disk access resource. :param resource_group_name: The name of the resource group. :type resource_group_name: str :param disk_access_name: The name of the disk access resource that is being created. The name can't be changed after the disk encryption set is created. Supported characters for the name are a-z, A-Z, 0-9, _ and -. The maximum name length is 80 characters. :type disk_access_name: str :param private_endpoint_connection_name: The name of the private endpoint connection. :type private_endpoint_connection_name: str :keyword callable cls: A custom type or function that will be passed the direct response :keyword str continuation_token: A continuation token to restart a poller from a saved state. :keyword polling: By default, your polling method will be ARMPolling. Pass in False for this operation to not poll, or pass in your own initialized polling object for a personal polling strategy. :paramtype polling: bool or ~azure.core.polling.PollingMethod :keyword int polling_interval: Default waiting time between two polls for LRO operations if no Retry-After header is present. :return: An instance of LROPoller that returns either None or the result of cls(response) :rtype: ~azure.core.polling.LROPoller[None] :raises: ~azure.core.exceptions.HttpResponseError """ polling = kwargs.pop('polling', True) # type: Union[bool, azure.core.polling.PollingMethod] cls = kwargs.pop('cls', None) # type: ClsType[None] lro_delay = kwargs.pop( 'polling_interval', self._config.polling_interval ) cont_token = kwargs.pop('continuation_token', None) # type: Optional[str] if cont_token is None: raw_result = self._delete_a_private_endpoint_connection_initial( resource_group_name=resource_group_name, disk_access_name=disk_access_name, private_endpoint_connection_name=private_endpoint_connection_name, cls=lambda x,y,z: x, **kwargs ) kwargs.pop('error_map', None) def get_long_running_output(pipeline_response): if cls: return cls(pipeline_response, None, {}) if polling is True: polling_method = ARMPolling(lro_delay, **kwargs) elif polling is False: polling_method = NoPolling() else: polling_method = polling if cont_token: return LROPoller.from_continuation_token( polling_method=polling_method, continuation_token=cont_token, client=self._client, deserialization_callback=get_long_running_output ) else: return LROPoller(self._client, raw_result, get_long_running_output, polling_method) begin_delete_a_private_endpoint_connection.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses/{diskAccessName}/privateEndpointConnections/{privateEndpointConnectionName}'} # type: ignore @distributed_trace def list_private_endpoint_connections( self, resource_group_name: str, disk_access_name: str, **kwargs: Any ) -> Iterable["_models.PrivateEndpointConnectionListResult"]: """List information about private endpoint connections under a disk access resource. :param resource_group_name: The name of the resource group. :type resource_group_name: str :param disk_access_name: The name of the disk access resource that is being created. The name can't be changed after the disk encryption set is created. Supported characters for the name are a-z, A-Z, 0-9, _ and -. The maximum name length is 80 characters. :type disk_access_name: str :keyword callable cls: A custom type or function that will be passed the direct response :return: An iterator like instance of either PrivateEndpointConnectionListResult or the result of cls(response) :rtype: ~azure.core.paging.ItemPaged[~azure.mgmt.compute.v2021_12_01.models.PrivateEndpointConnectionListResult] :raises: ~azure.core.exceptions.HttpResponseError """ cls = kwargs.pop('cls', None) # type: ClsType["_models.PrivateEndpointConnectionListResult"] error_map = { 401: ClientAuthenticationError, 404: ResourceNotFoundError, 409: ResourceExistsError } error_map.update(kwargs.pop('error_map', {})) def prepare_request(next_link=None): if not next_link: request = build_list_private_endpoint_connections_request( subscription_id=self._config.subscription_id, resource_group_name=resource_group_name, disk_access_name=disk_access_name, template_url=self.list_private_endpoint_connections.metadata['url'], ) request = _convert_request(request) request.url = self._client.format_url(request.url) else: request = build_list_private_endpoint_connections_request( subscription_id=self._config.subscription_id, resource_group_name=resource_group_name, disk_access_name=disk_access_name, template_url=next_link, ) request = _convert_request(request) request.url = self._client.format_url(request.url) request.method = "GET" return request def extract_data(pipeline_response): deserialized = self._deserialize("PrivateEndpointConnectionListResult", pipeline_response) list_of_elem = deserialized.value if cls: list_of_elem = cls(list_of_elem) return deserialized.next_link or None, iter(list_of_elem) def get_next(next_link=None): request = prepare_request(next_link) pipeline_response = self._client._pipeline.run(request, stream=False, **kwargs) response = pipeline_response.http_response if response.status_code not in [200]: map_error(status_code=response.status_code, response=response, error_map=error_map) raise HttpResponseError(response=response, error_format=ARMErrorFormat) return pipeline_response return ItemPaged( get_next, extract_data ) list_private_endpoint_connections.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Compute/diskAccesses/{diskAccessName}/privateEndpointConnections'} # type: ignore
""" Testing for the gradient boosting module (sklearn.ensemble.gradient_boosting). """ import warnings import numpy as np from itertools import product from scipy.sparse import csr_matrix from scipy.sparse import csc_matrix from scipy.sparse import coo_matrix from sklearn import datasets from sklearn.base import clone from sklearn.datasets import make_classification from sklearn.ensemble import GradientBoostingClassifier from sklearn.ensemble import GradientBoostingRegressor from sklearn.ensemble.gradient_boosting import ZeroEstimator from sklearn.metrics import mean_squared_error from sklearn.model_selection import train_test_split from sklearn.utils import check_random_state, tosequence from sklearn.utils.testing import assert_almost_equal from sklearn.utils.testing import assert_array_almost_equal from sklearn.utils.testing import assert_array_equal from sklearn.utils.testing import assert_equal from sklearn.utils.testing import assert_greater from sklearn.utils.testing import assert_less from sklearn.utils.testing import assert_raises from sklearn.utils.testing import assert_true from sklearn.utils.testing import assert_warns from sklearn.utils.testing import assert_warns_message from sklearn.utils.testing import skip_if_32bit from sklearn.exceptions import DataConversionWarning from sklearn.exceptions import NotFittedError # toy sample X = [[-2, -1], [-1, -1], [-1, -2], [1, 1], [1, 2], [2, 1]] y = [-1, -1, -1, 1, 1, 1] T = [[-1, -1], [2, 2], [3, 2]] true_result = [-1, 1, 1] rng = np.random.RandomState(0) # also load the boston dataset # and randomly permute it boston = datasets.load_boston() perm = rng.permutation(boston.target.size) boston.data = boston.data[perm] boston.target = boston.target[perm] # also load the iris dataset # and randomly permute it iris = datasets.load_iris() perm = rng.permutation(iris.target.size) iris.data = iris.data[perm] iris.target = iris.target[perm] def check_classification_toy(presort, loss): # Check classification on a toy dataset. clf = GradientBoostingClassifier(loss=loss, n_estimators=10, random_state=1, presort=presort) assert_raises(ValueError, clf.predict, T) clf.fit(X, y) assert_array_equal(clf.predict(T), true_result) assert_equal(10, len(clf.estimators_)) deviance_decrease = (clf.train_score_[:-1] - clf.train_score_[1:]) assert_true(np.any(deviance_decrease >= 0.0)) leaves = clf.apply(X) assert_equal(leaves.shape, (6, 10, 1)) def test_classification_toy(): for presort, loss in product(('auto', True, False), ('deviance', 'exponential')): yield check_classification_toy, presort, loss def test_parameter_checks(): # Check input parameter validation. assert_raises(ValueError, GradientBoostingClassifier(n_estimators=0).fit, X, y) assert_raises(ValueError, GradientBoostingClassifier(n_estimators=-1).fit, X, y) assert_raises(ValueError, GradientBoostingClassifier(learning_rate=0.0).fit, X, y) assert_raises(ValueError, GradientBoostingClassifier(learning_rate=-1.0).fit, X, y) assert_raises(ValueError, GradientBoostingClassifier(loss='foobar').fit, X, y) assert_raises(ValueError, GradientBoostingClassifier(min_samples_split=0.0).fit, X, y) assert_raises(ValueError, GradientBoostingClassifier(min_samples_split=-1.0).fit, X, y) assert_raises(ValueError, GradientBoostingClassifier(min_samples_split=1.1).fit, X, y) assert_raises(ValueError, GradientBoostingClassifier(min_samples_leaf=0).fit, X, y) assert_raises(ValueError, GradientBoostingClassifier(min_samples_leaf=-1.0).fit, X, y) assert_raises(ValueError, GradientBoostingClassifier(min_weight_fraction_leaf=-1.).fit, X, y) assert_raises(ValueError, GradientBoostingClassifier(min_weight_fraction_leaf=0.6).fit, X, y) assert_raises(ValueError, GradientBoostingClassifier(subsample=0.0).fit, X, y) assert_raises(ValueError, GradientBoostingClassifier(subsample=1.1).fit, X, y) assert_raises(ValueError, GradientBoostingClassifier(subsample=-0.1).fit, X, y) assert_raises(ValueError, GradientBoostingClassifier(max_depth=-0.1).fit, X, y) assert_raises(ValueError, GradientBoostingClassifier(max_depth=0).fit, X, y) assert_raises(ValueError, GradientBoostingClassifier(init={}).fit, X, y) # test fit before feature importance assert_raises(ValueError, lambda: GradientBoostingClassifier().feature_importances_) # deviance requires ``n_classes >= 2``. assert_raises(ValueError, lambda X, y: GradientBoostingClassifier( loss='deviance').fit(X, y), X, [0, 0, 0, 0]) def test_loss_function(): assert_raises(ValueError, GradientBoostingClassifier(loss='ls').fit, X, y) assert_raises(ValueError, GradientBoostingClassifier(loss='lad').fit, X, y) assert_raises(ValueError, GradientBoostingClassifier(loss='quantile').fit, X, y) assert_raises(ValueError, GradientBoostingClassifier(loss='huber').fit, X, y) assert_raises(ValueError, GradientBoostingRegressor(loss='deviance').fit, X, y) assert_raises(ValueError, GradientBoostingRegressor(loss='exponential').fit, X, y) def check_classification_synthetic(presort, loss): # Test GradientBoostingClassifier on synthetic dataset used by # Hastie et al. in ESLII Example 12.7. X, y = datasets.make_hastie_10_2(n_samples=12000, random_state=1) X_train, X_test = X[:2000], X[2000:] y_train, y_test = y[:2000], y[2000:] gbrt = GradientBoostingClassifier(n_estimators=100, min_samples_split=2, max_depth=1, loss=loss, learning_rate=1.0, random_state=0) gbrt.fit(X_train, y_train) error_rate = (1.0 - gbrt.score(X_test, y_test)) assert_less(error_rate, 0.09) gbrt = GradientBoostingClassifier(n_estimators=200, min_samples_split=2, max_depth=1, loss=loss, learning_rate=1.0, subsample=0.5, random_state=0, presort=presort) gbrt.fit(X_train, y_train) error_rate = (1.0 - gbrt.score(X_test, y_test)) assert_less(error_rate, 0.08) def test_classification_synthetic(): for presort, loss in product(('auto', True, False), ('deviance', 'exponential')): yield check_classification_synthetic, presort, loss def check_boston(presort, loss, subsample): # Check consistency on dataset boston house prices with least squares # and least absolute deviation. ones = np.ones(len(boston.target)) last_y_pred = None for sample_weight in None, ones, 2 * ones: clf = GradientBoostingRegressor(n_estimators=100, loss=loss, max_depth=4, subsample=subsample, min_samples_split=2, random_state=1, presort=presort) assert_raises(ValueError, clf.predict, boston.data) clf.fit(boston.data, boston.target, sample_weight=sample_weight) leaves = clf.apply(boston.data) assert_equal(leaves.shape, (506, 100)) y_pred = clf.predict(boston.data) mse = mean_squared_error(boston.target, y_pred) assert_less(mse, 6.0) if last_y_pred is not None: assert_array_almost_equal(last_y_pred, y_pred) last_y_pred = y_pred def test_boston(): for presort, loss, subsample in product(('auto', True, False), ('ls', 'lad', 'huber'), (1.0, 0.5)): yield check_boston, presort, loss, subsample def check_iris(presort, subsample, sample_weight): # Check consistency on dataset iris. clf = GradientBoostingClassifier(n_estimators=100, loss='deviance', random_state=1, subsample=subsample, presort=presort) clf.fit(iris.data, iris.target, sample_weight=sample_weight) score = clf.score(iris.data, iris.target) assert_greater(score, 0.9) leaves = clf.apply(iris.data) assert_equal(leaves.shape, (150, 100, 3)) def test_iris(): ones = np.ones(len(iris.target)) for presort, subsample, sample_weight in product(('auto', True, False), (1.0, 0.5), (None, ones)): yield check_iris, presort, subsample, sample_weight def test_regression_synthetic(): # Test on synthetic regression datasets used in Leo Breiman, # `Bagging Predictors?. Machine Learning 24(2): 123-140 (1996). random_state = check_random_state(1) regression_params = {'n_estimators': 100, 'max_depth': 4, 'min_samples_split': 2, 'learning_rate': 0.1, 'loss': 'ls'} # Friedman1 X, y = datasets.make_friedman1(n_samples=1200, random_state=random_state, noise=1.0) X_train, y_train = X[:200], y[:200] X_test, y_test = X[200:], y[200:] for presort in True, False: clf = GradientBoostingRegressor(presort=presort) clf.fit(X_train, y_train) mse = mean_squared_error(y_test, clf.predict(X_test)) assert_less(mse, 5.0) # Friedman2 X, y = datasets.make_friedman2(n_samples=1200, random_state=random_state) X_train, y_train = X[:200], y[:200] X_test, y_test = X[200:], y[200:] for presort in True, False: regression_params['presort'] = presort clf = GradientBoostingRegressor(**regression_params) clf.fit(X_train, y_train) mse = mean_squared_error(y_test, clf.predict(X_test)) assert_less(mse, 1700.0) # Friedman3 X, y = datasets.make_friedman3(n_samples=1200, random_state=random_state) X_train, y_train = X[:200], y[:200] X_test, y_test = X[200:], y[200:] for presort in True, False: regression_params['presort'] = presort clf = GradientBoostingRegressor(**regression_params) clf.fit(X_train, y_train) mse = mean_squared_error(y_test, clf.predict(X_test)) assert_less(mse, 0.015) def test_feature_importances(): X = np.array(boston.data, dtype=np.float32) y = np.array(boston.target, dtype=np.float32) for presort in True, False: clf = GradientBoostingRegressor(n_estimators=100, max_depth=5, min_samples_split=2, random_state=1, presort=presort) clf.fit(X, y) assert_true(hasattr(clf, 'feature_importances_')) def test_probability_log(): # Predict probabilities. clf = GradientBoostingClassifier(n_estimators=100, random_state=1) assert_raises(ValueError, clf.predict_proba, T) clf.fit(X, y) assert_array_equal(clf.predict(T), true_result) # check if probabilities are in [0, 1]. y_proba = clf.predict_proba(T) assert_true(np.all(y_proba >= 0.0)) assert_true(np.all(y_proba <= 1.0)) # derive predictions from probabilities y_pred = clf.classes_.take(y_proba.argmax(axis=1), axis=0) assert_array_equal(y_pred, true_result) def test_check_inputs(): # Test input checks (shape and type of X and y). clf = GradientBoostingClassifier(n_estimators=100, random_state=1) assert_raises(ValueError, clf.fit, X, y + [0, 1]) clf = GradientBoostingClassifier(n_estimators=100, random_state=1) assert_raises(ValueError, clf.fit, X, y, sample_weight=([1] * len(y)) + [0, 1]) def test_check_inputs_predict(): # X has wrong shape clf = GradientBoostingClassifier(n_estimators=100, random_state=1) clf.fit(X, y) x = np.array([1.0, 2.0])[:, np.newaxis] assert_raises(ValueError, clf.predict, x) x = np.array([[]]) assert_raises(ValueError, clf.predict, x) x = np.array([1.0, 2.0, 3.0])[:, np.newaxis] assert_raises(ValueError, clf.predict, x) clf = GradientBoostingRegressor(n_estimators=100, random_state=1) clf.fit(X, rng.rand(len(X))) x = np.array([1.0, 2.0])[:, np.newaxis] assert_raises(ValueError, clf.predict, x) x = np.array([[]]) assert_raises(ValueError, clf.predict, x) x = np.array([1.0, 2.0, 3.0])[:, np.newaxis] assert_raises(ValueError, clf.predict, x) def test_check_max_features(): # test if max_features is valid. clf = GradientBoostingRegressor(n_estimators=100, random_state=1, max_features=0) assert_raises(ValueError, clf.fit, X, y) clf = GradientBoostingRegressor(n_estimators=100, random_state=1, max_features=(len(X[0]) + 1)) assert_raises(ValueError, clf.fit, X, y) clf = GradientBoostingRegressor(n_estimators=100, random_state=1, max_features=-0.1) assert_raises(ValueError, clf.fit, X, y) def test_max_feature_regression(): # Test to make sure random state is set properly. X, y = datasets.make_hastie_10_2(n_samples=12000, random_state=1) X_train, X_test = X[:2000], X[2000:] y_train, y_test = y[:2000], y[2000:] gbrt = GradientBoostingClassifier(n_estimators=100, min_samples_split=5, max_depth=2, learning_rate=.1, max_features=2, random_state=1) gbrt.fit(X_train, y_train) deviance = gbrt.loss_(y_test, gbrt.decision_function(X_test)) assert_true(deviance < 0.5, "GB failed with deviance %.4f" % deviance) def test_max_feature_auto(): # Test if max features is set properly for floats and str. X, y = datasets.make_hastie_10_2(n_samples=12000, random_state=1) _, n_features = X.shape X_train = X[:2000] y_train = y[:2000] gbrt = GradientBoostingClassifier(n_estimators=1, max_features='auto') gbrt.fit(X_train, y_train) assert_equal(gbrt.max_features_, int(np.sqrt(n_features))) gbrt = GradientBoostingRegressor(n_estimators=1, max_features='auto') gbrt.fit(X_train, y_train) assert_equal(gbrt.max_features_, n_features) gbrt = GradientBoostingRegressor(n_estimators=1, max_features=0.3) gbrt.fit(X_train, y_train) assert_equal(gbrt.max_features_, int(n_features * 0.3)) gbrt = GradientBoostingRegressor(n_estimators=1, max_features='sqrt') gbrt.fit(X_train, y_train) assert_equal(gbrt.max_features_, int(np.sqrt(n_features))) gbrt = GradientBoostingRegressor(n_estimators=1, max_features='log2') gbrt.fit(X_train, y_train) assert_equal(gbrt.max_features_, int(np.log2(n_features))) gbrt = GradientBoostingRegressor(n_estimators=1, max_features=0.01 / X.shape[1]) gbrt.fit(X_train, y_train) assert_equal(gbrt.max_features_, 1) def test_staged_predict(): # Test whether staged decision function eventually gives # the same prediction. X, y = datasets.make_friedman1(n_samples=1200, random_state=1, noise=1.0) X_train, y_train = X[:200], y[:200] X_test = X[200:] clf = GradientBoostingRegressor() # test raise ValueError if not fitted assert_raises(ValueError, lambda X: np.fromiter( clf.staged_predict(X), dtype=np.float64), X_test) clf.fit(X_train, y_train) y_pred = clf.predict(X_test) # test if prediction for last stage equals ``predict`` for y in clf.staged_predict(X_test): assert_equal(y.shape, y_pred.shape) assert_array_almost_equal(y_pred, y) def test_staged_predict_proba(): # Test whether staged predict proba eventually gives # the same prediction. X, y = datasets.make_hastie_10_2(n_samples=1200, random_state=1) X_train, y_train = X[:200], y[:200] X_test, y_test = X[200:], y[200:] clf = GradientBoostingClassifier(n_estimators=20) # test raise NotFittedError if not fitted assert_raises(NotFittedError, lambda X: np.fromiter( clf.staged_predict_proba(X), dtype=np.float64), X_test) clf.fit(X_train, y_train) # test if prediction for last stage equals ``predict`` for y_pred in clf.staged_predict(X_test): assert_equal(y_test.shape, y_pred.shape) assert_array_equal(clf.predict(X_test), y_pred) # test if prediction for last stage equals ``predict_proba`` for staged_proba in clf.staged_predict_proba(X_test): assert_equal(y_test.shape[0], staged_proba.shape[0]) assert_equal(2, staged_proba.shape[1]) assert_array_almost_equal(clf.predict_proba(X_test), staged_proba) def test_staged_functions_defensive(): # test that staged_functions make defensive copies rng = np.random.RandomState(0) X = rng.uniform(size=(10, 3)) y = (4 * X[:, 0]).astype(np.int) + 1 # don't predict zeros for estimator in [GradientBoostingRegressor(), GradientBoostingClassifier()]: estimator.fit(X, y) for func in ['predict', 'decision_function', 'predict_proba']: staged_func = getattr(estimator, "staged_" + func, None) if staged_func is None: # regressor has no staged_predict_proba continue with warnings.catch_warnings(record=True): staged_result = list(staged_func(X)) staged_result[1][:] = 0 assert_true(np.all(staged_result[0] != 0)) def test_serialization(): # Check model serialization. clf = GradientBoostingClassifier(n_estimators=100, random_state=1) clf.fit(X, y) assert_array_equal(clf.predict(T), true_result) assert_equal(100, len(clf.estimators_)) try: import cPickle as pickle except ImportError: import pickle serialized_clf = pickle.dumps(clf, protocol=pickle.HIGHEST_PROTOCOL) clf = None clf = pickle.loads(serialized_clf) assert_array_equal(clf.predict(T), true_result) assert_equal(100, len(clf.estimators_)) def test_degenerate_targets(): # Check if we can fit even though all targets are equal. clf = GradientBoostingClassifier(n_estimators=100, random_state=1) # classifier should raise exception assert_raises(ValueError, clf.fit, X, np.ones(len(X))) clf = GradientBoostingRegressor(n_estimators=100, random_state=1) clf.fit(X, np.ones(len(X))) clf.predict([rng.rand(2)]) assert_array_equal(np.ones((1,), dtype=np.float64), clf.predict([rng.rand(2)])) def test_quantile_loss(): # Check if quantile loss with alpha=0.5 equals lad. clf_quantile = GradientBoostingRegressor(n_estimators=100, loss='quantile', max_depth=4, alpha=0.5, random_state=7) clf_quantile.fit(boston.data, boston.target) y_quantile = clf_quantile.predict(boston.data) clf_lad = GradientBoostingRegressor(n_estimators=100, loss='lad', max_depth=4, random_state=7) clf_lad.fit(boston.data, boston.target) y_lad = clf_lad.predict(boston.data) assert_array_almost_equal(y_quantile, y_lad, decimal=4) def test_symbol_labels(): # Test with non-integer class labels. clf = GradientBoostingClassifier(n_estimators=100, random_state=1) symbol_y = tosequence(map(str, y)) clf.fit(X, symbol_y) assert_array_equal(clf.predict(T), tosequence(map(str, true_result))) assert_equal(100, len(clf.estimators_)) def test_float_class_labels(): # Test with float class labels. clf = GradientBoostingClassifier(n_estimators=100, random_state=1) float_y = np.asarray(y, dtype=np.float32) clf.fit(X, float_y) assert_array_equal(clf.predict(T), np.asarray(true_result, dtype=np.float32)) assert_equal(100, len(clf.estimators_)) def test_shape_y(): # Test with float class labels. clf = GradientBoostingClassifier(n_estimators=100, random_state=1) y_ = np.asarray(y, dtype=np.int32) y_ = y_[:, np.newaxis] # This will raise a DataConversionWarning that we want to # "always" raise, elsewhere the warnings gets ignored in the # later tests, and the tests that check for this warning fail assert_warns(DataConversionWarning, clf.fit, X, y_) assert_array_equal(clf.predict(T), true_result) assert_equal(100, len(clf.estimators_)) def test_mem_layout(): # Test with different memory layouts of X and y X_ = np.asfortranarray(X) clf = GradientBoostingClassifier(n_estimators=100, random_state=1) clf.fit(X_, y) assert_array_equal(clf.predict(T), true_result) assert_equal(100, len(clf.estimators_)) X_ = np.ascontiguousarray(X) clf = GradientBoostingClassifier(n_estimators=100, random_state=1) clf.fit(X_, y) assert_array_equal(clf.predict(T), true_result) assert_equal(100, len(clf.estimators_)) y_ = np.asarray(y, dtype=np.int32) y_ = np.ascontiguousarray(y_) clf = GradientBoostingClassifier(n_estimators=100, random_state=1) clf.fit(X, y_) assert_array_equal(clf.predict(T), true_result) assert_equal(100, len(clf.estimators_)) y_ = np.asarray(y, dtype=np.int32) y_ = np.asfortranarray(y_) clf = GradientBoostingClassifier(n_estimators=100, random_state=1) clf.fit(X, y_) assert_array_equal(clf.predict(T), true_result) assert_equal(100, len(clf.estimators_)) def test_oob_improvement(): # Test if oob improvement has correct shape and regression test. clf = GradientBoostingClassifier(n_estimators=100, random_state=1, subsample=0.5) clf.fit(X, y) assert_equal(clf.oob_improvement_.shape[0], 100) # hard-coded regression test - change if modification in OOB computation assert_array_almost_equal(clf.oob_improvement_[:5], np.array([0.19, 0.15, 0.12, -0.12, -0.11]), decimal=2) def test_oob_improvement_raise(): # Test if oob improvement has correct shape. clf = GradientBoostingClassifier(n_estimators=100, random_state=1, subsample=1.0) clf.fit(X, y) assert_raises(AttributeError, lambda: clf.oob_improvement_) def test_oob_multilcass_iris(): # Check OOB improvement on multi-class dataset. clf = GradientBoostingClassifier(n_estimators=100, loss='deviance', random_state=1, subsample=0.5) clf.fit(iris.data, iris.target) score = clf.score(iris.data, iris.target) assert_greater(score, 0.9) assert_equal(clf.oob_improvement_.shape[0], clf.n_estimators) # hard-coded regression test - change if modification in OOB computation # FIXME: the following snippet does not yield the same results on 32 bits # assert_array_almost_equal(clf.oob_improvement_[:5], # np.array([12.68, 10.45, 8.18, 6.43, 5.13]), # decimal=2) def test_verbose_output(): # Check verbose=1 does not cause error. from sklearn.externals.six.moves import cStringIO as StringIO import sys old_stdout = sys.stdout sys.stdout = StringIO() clf = GradientBoostingClassifier(n_estimators=100, random_state=1, verbose=1, subsample=0.8) clf.fit(X, y) verbose_output = sys.stdout sys.stdout = old_stdout # check output verbose_output.seek(0) header = verbose_output.readline().rstrip() # with OOB true_header = ' '.join(['%10s'] + ['%16s'] * 3) % ( 'Iter', 'Train Loss', 'OOB Improve', 'Remaining Time') assert_equal(true_header, header) n_lines = sum(1 for l in verbose_output.readlines()) # one for 1-10 and then 9 for 20-100 assert_equal(10 + 9, n_lines) def test_more_verbose_output(): # Check verbose=2 does not cause error. from sklearn.externals.six.moves import cStringIO as StringIO import sys old_stdout = sys.stdout sys.stdout = StringIO() clf = GradientBoostingClassifier(n_estimators=100, random_state=1, verbose=2) clf.fit(X, y) verbose_output = sys.stdout sys.stdout = old_stdout # check output verbose_output.seek(0) header = verbose_output.readline().rstrip() # no OOB true_header = ' '.join(['%10s'] + ['%16s'] * 2) % ( 'Iter', 'Train Loss', 'Remaining Time') assert_equal(true_header, header) n_lines = sum(1 for l in verbose_output.readlines()) # 100 lines for n_estimators==100 assert_equal(100, n_lines) def test_warm_start(): # Test if warm start equals fit. X, y = datasets.make_hastie_10_2(n_samples=100, random_state=1) for Cls in [GradientBoostingRegressor, GradientBoostingClassifier]: est = Cls(n_estimators=200, max_depth=1) est.fit(X, y) est_ws = Cls(n_estimators=100, max_depth=1, warm_start=True) est_ws.fit(X, y) est_ws.set_params(n_estimators=200) est_ws.fit(X, y) if Cls is GradientBoostingRegressor: assert_array_almost_equal(est_ws.predict(X), est.predict(X)) else: # Random state is preserved and hence predict_proba must also be # same assert_array_equal(est_ws.predict(X), est.predict(X)) assert_array_almost_equal(est_ws.predict_proba(X), est.predict_proba(X)) def test_warm_start_n_estimators(): # Test if warm start equals fit - set n_estimators. X, y = datasets.make_hastie_10_2(n_samples=100, random_state=1) for Cls in [GradientBoostingRegressor, GradientBoostingClassifier]: est = Cls(n_estimators=300, max_depth=1) est.fit(X, y) est_ws = Cls(n_estimators=100, max_depth=1, warm_start=True) est_ws.fit(X, y) est_ws.set_params(n_estimators=300) est_ws.fit(X, y) assert_array_almost_equal(est_ws.predict(X), est.predict(X)) def test_warm_start_max_depth(): # Test if possible to fit trees of different depth in ensemble. X, y = datasets.make_hastie_10_2(n_samples=100, random_state=1) for Cls in [GradientBoostingRegressor, GradientBoostingClassifier]: est = Cls(n_estimators=100, max_depth=1, warm_start=True) est.fit(X, y) est.set_params(n_estimators=110, max_depth=2) est.fit(X, y) # last 10 trees have different depth assert_equal(est.estimators_[0, 0].max_depth, 1) for i in range(1, 11): assert_equal(est.estimators_[-i, 0].max_depth, 2) def test_warm_start_clear(): # Test if fit clears state. X, y = datasets.make_hastie_10_2(n_samples=100, random_state=1) for Cls in [GradientBoostingRegressor, GradientBoostingClassifier]: est = Cls(n_estimators=100, max_depth=1) est.fit(X, y) est_2 = Cls(n_estimators=100, max_depth=1, warm_start=True) est_2.fit(X, y) # inits state est_2.set_params(warm_start=False) est_2.fit(X, y) # clears old state and equals est assert_array_almost_equal(est_2.predict(X), est.predict(X)) def test_warm_start_zero_n_estimators(): # Test if warm start with zero n_estimators raises error X, y = datasets.make_hastie_10_2(n_samples=100, random_state=1) for Cls in [GradientBoostingRegressor, GradientBoostingClassifier]: est = Cls(n_estimators=100, max_depth=1, warm_start=True) est.fit(X, y) est.set_params(n_estimators=0) assert_raises(ValueError, est.fit, X, y) def test_warm_start_smaller_n_estimators(): # Test if warm start with smaller n_estimators raises error X, y = datasets.make_hastie_10_2(n_samples=100, random_state=1) for Cls in [GradientBoostingRegressor, GradientBoostingClassifier]: est = Cls(n_estimators=100, max_depth=1, warm_start=True) est.fit(X, y) est.set_params(n_estimators=99) assert_raises(ValueError, est.fit, X, y) def test_warm_start_equal_n_estimators(): # Test if warm start with equal n_estimators does nothing X, y = datasets.make_hastie_10_2(n_samples=100, random_state=1) for Cls in [GradientBoostingRegressor, GradientBoostingClassifier]: est = Cls(n_estimators=100, max_depth=1) est.fit(X, y) est2 = clone(est) est2.set_params(n_estimators=est.n_estimators, warm_start=True) est2.fit(X, y) assert_array_almost_equal(est2.predict(X), est.predict(X)) def test_warm_start_oob_switch(): # Test if oob can be turned on during warm start. X, y = datasets.make_hastie_10_2(n_samples=100, random_state=1) for Cls in [GradientBoostingRegressor, GradientBoostingClassifier]: est = Cls(n_estimators=100, max_depth=1, warm_start=True) est.fit(X, y) est.set_params(n_estimators=110, subsample=0.5) est.fit(X, y) assert_array_equal(est.oob_improvement_[:100], np.zeros(100)) # the last 10 are not zeros assert_array_equal(est.oob_improvement_[-10:] == 0.0, np.zeros(10, dtype=np.bool)) def test_warm_start_oob(): # Test if warm start OOB equals fit. X, y = datasets.make_hastie_10_2(n_samples=100, random_state=1) for Cls in [GradientBoostingRegressor, GradientBoostingClassifier]: est = Cls(n_estimators=200, max_depth=1, subsample=0.5, random_state=1) est.fit(X, y) est_ws = Cls(n_estimators=100, max_depth=1, subsample=0.5, random_state=1, warm_start=True) est_ws.fit(X, y) est_ws.set_params(n_estimators=200) est_ws.fit(X, y) assert_array_almost_equal(est_ws.oob_improvement_[:100], est.oob_improvement_[:100]) def early_stopping_monitor(i, est, locals): """Returns True on the 10th iteration. """ if i == 9: return True else: return False def test_monitor_early_stopping(): # Test if monitor return value works. X, y = datasets.make_hastie_10_2(n_samples=100, random_state=1) for Cls in [GradientBoostingRegressor, GradientBoostingClassifier]: est = Cls(n_estimators=20, max_depth=1, random_state=1, subsample=0.5) est.fit(X, y, monitor=early_stopping_monitor) assert_equal(est.n_estimators, 20) # this is not altered assert_equal(est.estimators_.shape[0], 10) assert_equal(est.train_score_.shape[0], 10) assert_equal(est.oob_improvement_.shape[0], 10) # try refit est.set_params(n_estimators=30) est.fit(X, y) assert_equal(est.n_estimators, 30) assert_equal(est.estimators_.shape[0], 30) assert_equal(est.train_score_.shape[0], 30) est = Cls(n_estimators=20, max_depth=1, random_state=1, subsample=0.5, warm_start=True) est.fit(X, y, monitor=early_stopping_monitor) assert_equal(est.n_estimators, 20) assert_equal(est.estimators_.shape[0], 10) assert_equal(est.train_score_.shape[0], 10) assert_equal(est.oob_improvement_.shape[0], 10) # try refit est.set_params(n_estimators=30, warm_start=False) est.fit(X, y) assert_equal(est.n_estimators, 30) assert_equal(est.train_score_.shape[0], 30) assert_equal(est.estimators_.shape[0], 30) assert_equal(est.oob_improvement_.shape[0], 30) def test_complete_classification(): # Test greedy trees with max_depth + 1 leafs. from sklearn.tree._tree import TREE_LEAF X, y = datasets.make_hastie_10_2(n_samples=100, random_state=1) k = 4 est = GradientBoostingClassifier(n_estimators=20, max_depth=None, random_state=1, max_leaf_nodes=k + 1) est.fit(X, y) tree = est.estimators_[0, 0].tree_ assert_equal(tree.max_depth, k) assert_equal(tree.children_left[tree.children_left == TREE_LEAF].shape[0], k + 1) def test_complete_regression(): # Test greedy trees with max_depth + 1 leafs. from sklearn.tree._tree import TREE_LEAF k = 4 est = GradientBoostingRegressor(n_estimators=20, max_depth=None, random_state=1, max_leaf_nodes=k + 1) est.fit(boston.data, boston.target) tree = est.estimators_[-1, 0].tree_ assert_equal(tree.children_left[tree.children_left == TREE_LEAF].shape[0], k + 1) def test_zero_estimator_reg(): # Test if ZeroEstimator works for regression. est = GradientBoostingRegressor(n_estimators=20, max_depth=1, random_state=1, init=ZeroEstimator()) est.fit(boston.data, boston.target) y_pred = est.predict(boston.data) mse = mean_squared_error(boston.target, y_pred) assert_almost_equal(mse, 33.0, decimal=0) est = GradientBoostingRegressor(n_estimators=20, max_depth=1, random_state=1, init='zero') est.fit(boston.data, boston.target) y_pred = est.predict(boston.data) mse = mean_squared_error(boston.target, y_pred) assert_almost_equal(mse, 33.0, decimal=0) est = GradientBoostingRegressor(n_estimators=20, max_depth=1, random_state=1, init='foobar') assert_raises(ValueError, est.fit, boston.data, boston.target) def test_zero_estimator_clf(): # Test if ZeroEstimator works for classification. X = iris.data y = np.array(iris.target) est = GradientBoostingClassifier(n_estimators=20, max_depth=1, random_state=1, init=ZeroEstimator()) est.fit(X, y) assert_greater(est.score(X, y), 0.96) est = GradientBoostingClassifier(n_estimators=20, max_depth=1, random_state=1, init='zero') est.fit(X, y) assert_greater(est.score(X, y), 0.96) # binary clf mask = y != 0 y[mask] = 1 y[~mask] = 0 est = GradientBoostingClassifier(n_estimators=20, max_depth=1, random_state=1, init='zero') est.fit(X, y) assert_greater(est.score(X, y), 0.96) est = GradientBoostingClassifier(n_estimators=20, max_depth=1, random_state=1, init='foobar') assert_raises(ValueError, est.fit, X, y) def test_max_leaf_nodes_max_depth(): # Test precedence of max_leaf_nodes over max_depth. X, y = datasets.make_hastie_10_2(n_samples=100, random_state=1) all_estimators = [GradientBoostingRegressor, GradientBoostingClassifier] k = 4 for GBEstimator in all_estimators: est = GBEstimator(max_depth=1, max_leaf_nodes=k).fit(X, y) tree = est.estimators_[0, 0].tree_ assert_greater(tree.max_depth, 1) est = GBEstimator(max_depth=1).fit(X, y) tree = est.estimators_[0, 0].tree_ assert_equal(tree.max_depth, 1) def test_min_impurity_split(): # Test if min_impurity_split of base estimators is set # Regression test for #8006 X, y = datasets.make_hastie_10_2(n_samples=100, random_state=1) all_estimators = [GradientBoostingRegressor, GradientBoostingClassifier] for GBEstimator in all_estimators: est = GBEstimator(min_impurity_split=0.1) est = assert_warns_message(DeprecationWarning, "min_impurity_decrease", est.fit, X, y) for tree in est.estimators_.flat: assert_equal(tree.min_impurity_split, 0.1) def test_min_impurity_decrease(): X, y = datasets.make_hastie_10_2(n_samples=100, random_state=1) all_estimators = [GradientBoostingRegressor, GradientBoostingClassifier] for GBEstimator in all_estimators: est = GBEstimator(min_impurity_decrease=0.1) est.fit(X, y) for tree in est.estimators_.flat: # Simply check if the parameter is passed on correctly. Tree tests # will suffice for the actual working of this param assert_equal(tree.min_impurity_decrease, 0.1) def test_warm_start_wo_nestimators_change(): # Test if warm_start does nothing if n_estimators is not changed. # Regression test for #3513. clf = GradientBoostingClassifier(n_estimators=10, warm_start=True) clf.fit([[0, 1], [2, 3]], [0, 1]) assert_equal(clf.estimators_.shape[0], 10) clf.fit([[0, 1], [2, 3]], [0, 1]) assert_equal(clf.estimators_.shape[0], 10) def test_probability_exponential(): # Predict probabilities. clf = GradientBoostingClassifier(loss='exponential', n_estimators=100, random_state=1) assert_raises(ValueError, clf.predict_proba, T) clf.fit(X, y) assert_array_equal(clf.predict(T), true_result) # check if probabilities are in [0, 1]. y_proba = clf.predict_proba(T) assert_true(np.all(y_proba >= 0.0)) assert_true(np.all(y_proba <= 1.0)) score = clf.decision_function(T).ravel() assert_array_almost_equal(y_proba[:, 1], 1.0 / (1.0 + np.exp(-2 * score))) # derive predictions from probabilities y_pred = clf.classes_.take(y_proba.argmax(axis=1), axis=0) assert_array_equal(y_pred, true_result) def test_non_uniform_weights_toy_edge_case_reg(): X = [[1, 0], [1, 0], [1, 0], [0, 1]] y = [0, 0, 1, 0] # ignore the first 2 training samples by setting their weight to 0 sample_weight = [0, 0, 1, 1] for loss in ('huber', 'ls', 'lad', 'quantile'): gb = GradientBoostingRegressor(learning_rate=1.0, n_estimators=2, loss=loss) gb.fit(X, y, sample_weight=sample_weight) assert_greater(gb.predict([[1, 0]])[0], 0.5) def test_non_uniform_weights_toy_edge_case_clf(): X = [[1, 0], [1, 0], [1, 0], [0, 1]] y = [0, 0, 1, 0] # ignore the first 2 training samples by setting their weight to 0 sample_weight = [0, 0, 1, 1] for loss in ('deviance', 'exponential'): gb = GradientBoostingClassifier(n_estimators=5, loss=loss) gb.fit(X, y, sample_weight=sample_weight) assert_array_equal(gb.predict([[1, 0]]), [1]) def check_sparse_input(EstimatorClass, X, X_sparse, y): dense = EstimatorClass(n_estimators=10, random_state=0, max_depth=2).fit(X, y) sparse = EstimatorClass(n_estimators=10, random_state=0, max_depth=2, presort=False).fit(X_sparse, y) auto = EstimatorClass(n_estimators=10, random_state=0, max_depth=2, presort='auto').fit(X_sparse, y) assert_array_almost_equal(sparse.apply(X), dense.apply(X)) assert_array_almost_equal(sparse.predict(X), dense.predict(X)) assert_array_almost_equal(sparse.feature_importances_, dense.feature_importances_) assert_array_almost_equal(sparse.apply(X), auto.apply(X)) assert_array_almost_equal(sparse.predict(X), auto.predict(X)) assert_array_almost_equal(sparse.feature_importances_, auto.feature_importances_) assert_array_almost_equal(sparse.predict(X_sparse), dense.predict(X)) assert_array_almost_equal(dense.predict(X_sparse), sparse.predict(X)) if isinstance(EstimatorClass, GradientBoostingClassifier): assert_array_almost_equal(sparse.predict_proba(X), dense.predict_proba(X)) assert_array_almost_equal(sparse.predict_log_proba(X), dense.predict_log_proba(X)) assert_array_almost_equal(sparse.predict_proba(X), auto.predict_proba(X)) assert_array_almost_equal(sparse.predict_log_proba(X), auto.predict_log_proba(X)) assert_array_almost_equal(sparse.decision_function(X_sparse), sparse.decision_function(X)) assert_array_almost_equal(dense.decision_function(X_sparse), sparse.decision_function(X)) assert_array_almost_equal( np.array(sparse.staged_decision_function(X_sparse)), np.array(sparse.staged_decision_function(X))) @skip_if_32bit def test_sparse_input(): ests = (GradientBoostingClassifier, GradientBoostingRegressor) sparse_matrices = (csr_matrix, csc_matrix, coo_matrix) y, X = datasets.make_multilabel_classification(random_state=0, n_samples=50, n_features=1, n_classes=20) y = y[:, 0] for EstimatorClass, sparse_matrix in product(ests, sparse_matrices): yield check_sparse_input, EstimatorClass, X, sparse_matrix(X), y def test_gradient_boosting_early_stopping(): X, y = make_classification(n_samples=1000, random_state=0) gbc = GradientBoostingClassifier(n_estimators=1000, n_iter_no_change=10, learning_rate=0.1, max_depth=3, random_state=42) gbr = GradientBoostingRegressor(n_estimators=1000, n_iter_no_change=10, learning_rate=0.1, max_depth=3, random_state=42) X_train, X_test, y_train, y_test = train_test_split(X, y, random_state=42) # Check if early_stopping works as expected for est, tol, early_stop_n_estimators in ((gbc, 1e-1, 24), (gbr, 1e-1, 13), (gbc, 1e-3, 36), (gbr, 1e-3, 28)): est.set_params(tol=tol) est.fit(X_train, y_train) assert_equal(est.n_estimators_, early_stop_n_estimators) assert est.score(X_test, y_test) > 0.7 # Without early stopping gbc = GradientBoostingClassifier(n_estimators=100, learning_rate=0.1, max_depth=3, random_state=42) gbc.fit(X, y) gbr = GradientBoostingRegressor(n_estimators=200, learning_rate=0.1, max_depth=3, random_state=42) gbr.fit(X, y) assert gbc.n_estimators_ == 100 assert gbr.n_estimators_ == 200 def test_gradient_boosting_validation_fraction(): X, y = make_classification(n_samples=1000, random_state=0) gbc = GradientBoostingClassifier(n_estimators=100, n_iter_no_change=10, validation_fraction=0.1, learning_rate=0.1, max_depth=3, random_state=42) gbc2 = clone(gbc).set_params(validation_fraction=0.3) gbc3 = clone(gbc).set_params(n_iter_no_change=20) gbr = GradientBoostingRegressor(n_estimators=100, n_iter_no_change=10, learning_rate=0.1, max_depth=3, validation_fraction=0.1, random_state=42) gbr2 = clone(gbr).set_params(validation_fraction=0.3) gbr3 = clone(gbr).set_params(n_iter_no_change=20) X_train, X_test, y_train, y_test = train_test_split(X, y, random_state=42) # Check if validation_fraction has an effect gbc.fit(X_train, y_train) gbc2.fit(X_train, y_train) assert gbc.n_estimators_ != gbc2.n_estimators_ gbr.fit(X_train, y_train) gbr2.fit(X_train, y_train) assert gbr.n_estimators_ != gbr2.n_estimators_ # Check if n_estimators_ increase monotonically with n_iter_no_change # Set validation gbc3.fit(X_train, y_train) gbr3.fit(X_train, y_train) assert gbr.n_estimators_ < gbr3.n_estimators_ assert gbc.n_estimators_ < gbc3.n_estimators_
# Copyright 2014 Cloudbase Solutions Srl # # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. import mock from os_brick.initiator import connector from oslo_config import cfg from oslo_utils import units from nova import exception from nova import test from nova.tests.unit import fake_block_device from nova.tests.unit.virt.hyperv import test_base from nova.virt.hyperv import constants from nova.virt.hyperv import volumeops CONF = cfg.CONF connection_data = {'volume_id': 'fake_vol_id', 'target_lun': mock.sentinel.fake_lun, 'target_iqn': mock.sentinel.fake_iqn, 'target_portal': mock.sentinel.fake_portal, 'auth_method': 'chap', 'auth_username': mock.sentinel.fake_user, 'auth_password': mock.sentinel.fake_pass} def get_fake_block_dev_info(): return {'block_device_mapping': [ fake_block_device.AnonFakeDbBlockDeviceDict({'source_type': 'volume'})] } def get_fake_connection_info(**kwargs): return {'data': dict(connection_data, **kwargs), 'serial': mock.sentinel.serial} class VolumeOpsTestCase(test_base.HyperVBaseTestCase): """Unit tests for VolumeOps class.""" def setUp(self): super(VolumeOpsTestCase, self).setUp() self._volumeops = volumeops.VolumeOps() self._volumeops._volutils = mock.MagicMock() self._volumeops._vmutils = mock.Mock() def test_get_volume_driver(self): fake_conn_info = {'driver_volume_type': mock.sentinel.fake_driver_type} self._volumeops.volume_drivers[mock.sentinel.fake_driver_type] = ( mock.sentinel.fake_driver) result = self._volumeops._get_volume_driver( connection_info=fake_conn_info) self.assertEqual(mock.sentinel.fake_driver, result) def test_get_volume_driver_exception(self): fake_conn_info = {'driver_volume_type': 'fake_driver'} self.assertRaises(exception.VolumeDriverNotFound, self._volumeops._get_volume_driver, connection_info=fake_conn_info) @mock.patch.object(volumeops.VolumeOps, 'attach_volume') def test_attach_volumes(self, mock_attach_volume): block_device_info = get_fake_block_dev_info() self._volumeops.attach_volumes( block_device_info['block_device_mapping'], mock.sentinel.instance_name) mock_attach_volume.assert_called_once_with( block_device_info['block_device_mapping'][0]['connection_info'], mock.sentinel.instance_name) def test_fix_instance_volume_disk_paths_empty_bdm(self): self._volumeops.fix_instance_volume_disk_paths( mock.sentinel.instance_name, block_device_info={}) self.assertFalse( self._volumeops._vmutils.get_vm_physical_disk_mapping.called) @mock.patch.object(volumeops.VolumeOps, 'get_disk_path_mapping') def test_fix_instance_volume_disk_paths(self, mock_get_disk_path_mapping): block_device_info = get_fake_block_dev_info() mock_disk1 = { 'mounted_disk_path': mock.sentinel.mounted_disk1_path, 'resource_path': mock.sentinel.resource1_path } mock_disk2 = { 'mounted_disk_path': mock.sentinel.mounted_disk2_path, 'resource_path': mock.sentinel.resource2_path } mock_vm_disk_mapping = { mock.sentinel.disk1_serial: mock_disk1, mock.sentinel.disk2_serial: mock_disk2 } # In this case, only the first disk needs to be updated. mock_phys_disk_path_mapping = { mock.sentinel.disk1_serial: mock.sentinel.actual_disk1_path, mock.sentinel.disk2_serial: mock.sentinel.mounted_disk2_path } vmutils = self._volumeops._vmutils vmutils.get_vm_physical_disk_mapping.return_value = ( mock_vm_disk_mapping) mock_get_disk_path_mapping.return_value = mock_phys_disk_path_mapping self._volumeops.fix_instance_volume_disk_paths( mock.sentinel.instance_name, block_device_info) vmutils.get_vm_physical_disk_mapping.assert_called_once_with( mock.sentinel.instance_name) mock_get_disk_path_mapping.assert_called_once_with( block_device_info) vmutils.set_disk_host_res.assert_called_once_with( mock.sentinel.resource1_path, mock.sentinel.actual_disk1_path) @mock.patch.object(volumeops.VolumeOps, '_get_volume_driver') def test_disconnect_volumes(self, mock_get_volume_driver): block_device_info = get_fake_block_dev_info() block_device_mapping = block_device_info['block_device_mapping'] fake_volume_driver = mock_get_volume_driver.return_value self._volumeops.disconnect_volumes(block_device_info) fake_volume_driver.disconnect_volume.assert_called_once_with( block_device_mapping[0]['connection_info']) @mock.patch('time.sleep') @mock.patch.object(volumeops.VolumeOps, '_get_volume_driver') def _test_attach_volume(self, mock_get_volume_driver, mock_sleep, attach_failed): fake_conn_info = get_fake_connection_info( qos_specs=mock.sentinel.qos_specs) fake_volume_driver = mock_get_volume_driver.return_value expected_try_count = 1 if attach_failed: expected_try_count += CONF.hyperv.volume_attach_retry_count fake_volume_driver.set_disk_qos_specs.side_effect = ( test.TestingException) self.assertRaises(exception.VolumeAttachFailed, self._volumeops.attach_volume, fake_conn_info, mock.sentinel.inst_name, mock.sentinel.disk_bus) else: self._volumeops.attach_volume( fake_conn_info, mock.sentinel.inst_name, mock.sentinel.disk_bus) mock_get_volume_driver.assert_any_call( fake_conn_info) fake_volume_driver.attach_volume.assert_has_calls( [mock.call(fake_conn_info, mock.sentinel.inst_name, mock.sentinel.disk_bus)] * expected_try_count) fake_volume_driver.set_disk_qos_specs.assert_has_calls( [mock.call(fake_conn_info, mock.sentinel.qos_specs)] * expected_try_count) if attach_failed: fake_volume_driver.disconnect_volume.assert_called_once_with( fake_conn_info) mock_sleep.assert_has_calls( [mock.call(CONF.hyperv.volume_attach_retry_interval)] * CONF.hyperv.volume_attach_retry_count) else: mock_sleep.assert_not_called() def test_attach_volume(self): self._test_attach_volume(attach_failed=False) def test_attach_volume_exc(self): self._test_attach_volume(attach_failed=True) @mock.patch.object(volumeops.VolumeOps, '_get_volume_driver') def test_disconnect_volume(self, mock_get_volume_driver): fake_volume_driver = mock_get_volume_driver.return_value self._volumeops.disconnect_volume(mock.sentinel.conn_info) mock_get_volume_driver.assert_called_once_with( mock.sentinel.conn_info) fake_volume_driver.disconnect_volume.assert_called_once_with( mock.sentinel.conn_info) @mock.patch.object(volumeops.VolumeOps, '_get_volume_driver') def test_detach_volume(self, mock_get_volume_driver): fake_volume_driver = mock_get_volume_driver.return_value fake_conn_info = {'data': 'fake_conn_info_data'} self._volumeops.detach_volume(fake_conn_info, mock.sentinel.inst_name) mock_get_volume_driver.assert_called_once_with( fake_conn_info) fake_volume_driver.detach_volume.assert_called_once_with( fake_conn_info, mock.sentinel.inst_name) fake_volume_driver.disconnect_volume.assert_called_once_with( fake_conn_info) @mock.patch.object(connector, 'get_connector_properties') def test_get_volume_connector(self, mock_get_connector): conn = self._volumeops.get_volume_connector() mock_get_connector.assert_called_once_with( root_helper=None, my_ip=CONF.my_block_storage_ip, multipath=CONF.hyperv.use_multipath_io, enforce_multipath=True, host=CONF.host) self.assertEqual(mock_get_connector.return_value, conn) @mock.patch.object(volumeops.VolumeOps, '_get_volume_driver') def test_connect_volumes(self, mock_get_volume_driver): block_device_info = get_fake_block_dev_info() self._volumeops.connect_volumes(block_device_info) init_vol_conn = ( mock_get_volume_driver.return_value.connect_volume) init_vol_conn.assert_called_once_with( block_device_info['block_device_mapping'][0]['connection_info']) @mock.patch.object(volumeops.VolumeOps, 'get_disk_resource_path') def test_get_disk_path_mapping(self, mock_get_disk_path): block_device_info = get_fake_block_dev_info() block_device_mapping = block_device_info['block_device_mapping'] fake_conn_info = get_fake_connection_info() block_device_mapping[0]['connection_info'] = fake_conn_info mock_get_disk_path.return_value = mock.sentinel.disk_path resulted_disk_path_mapping = self._volumeops.get_disk_path_mapping( block_device_info) mock_get_disk_path.assert_called_once_with(fake_conn_info) expected_disk_path_mapping = { mock.sentinel.serial: mock.sentinel.disk_path } self.assertEqual(expected_disk_path_mapping, resulted_disk_path_mapping) @mock.patch.object(volumeops.VolumeOps, '_get_volume_driver') def test_get_disk_resource_path(self, mock_get_volume_driver): fake_conn_info = get_fake_connection_info() fake_volume_driver = mock_get_volume_driver.return_value resulted_disk_path = self._volumeops.get_disk_resource_path( fake_conn_info) mock_get_volume_driver.assert_called_once_with(fake_conn_info) get_mounted_disk = fake_volume_driver.get_disk_resource_path get_mounted_disk.assert_called_once_with(fake_conn_info) self.assertEqual(get_mounted_disk.return_value, resulted_disk_path) def test_bytes_per_sec_to_iops(self): no_bytes = 15 * units.Ki expected_iops = 2 resulted_iops = self._volumeops.bytes_per_sec_to_iops(no_bytes) self.assertEqual(expected_iops, resulted_iops) @mock.patch.object(volumeops.LOG, 'warning') def test_validate_qos_specs(self, mock_warning): supported_qos_specs = [mock.sentinel.spec1, mock.sentinel.spec2] requested_qos_specs = {mock.sentinel.spec1: mock.sentinel.val, mock.sentinel.spec3: mock.sentinel.val2} self._volumeops.validate_qos_specs(requested_qos_specs, supported_qos_specs) self.assertTrue(mock_warning.called) class BaseVolumeDriverTestCase(test_base.HyperVBaseTestCase): """Unit tests for Hyper-V BaseVolumeDriver class.""" def setUp(self): super(BaseVolumeDriverTestCase, self).setUp() self._base_vol_driver = volumeops.BaseVolumeDriver() self._base_vol_driver._diskutils = mock.Mock() self._base_vol_driver._vmutils = mock.Mock() self._base_vol_driver._migrutils = mock.Mock() self._base_vol_driver._conn = mock.Mock() self._vmutils = self._base_vol_driver._vmutils self._migrutils = self._base_vol_driver._migrutils self._diskutils = self._base_vol_driver._diskutils self._conn = self._base_vol_driver._conn @mock.patch.object(connector.InitiatorConnector, 'factory') def test_connector(self, mock_conn_factory): self._base_vol_driver._conn = None self._base_vol_driver._protocol = mock.sentinel.protocol self._base_vol_driver._extra_connector_args = dict( fake_conn_arg=mock.sentinel.conn_val) conn = self._base_vol_driver._connector self.assertEqual(mock_conn_factory.return_value, conn) mock_conn_factory.assert_called_once_with( protocol=mock.sentinel.protocol, root_helper=None, use_multipath=CONF.hyperv.use_multipath_io, device_scan_attempts=CONF.hyperv.mounted_disk_query_retry_count, device_scan_interval=( CONF.hyperv.mounted_disk_query_retry_interval), **self._base_vol_driver._extra_connector_args) def test_connect_volume(self): conn_info = get_fake_connection_info() dev_info = self._base_vol_driver.connect_volume(conn_info) expected_dev_info = self._conn.connect_volume.return_value self.assertEqual(expected_dev_info, dev_info) self._conn.connect_volume.assert_called_once_with( conn_info['data']) def test_disconnect_volume(self): conn_info = get_fake_connection_info() self._base_vol_driver.disconnect_volume(conn_info) self._conn.disconnect_volume.assert_called_once_with( conn_info['data']) @mock.patch.object(volumeops.BaseVolumeDriver, '_get_disk_res_path') def _test_get_disk_resource_path_by_conn_info(self, mock_get_disk_res_path, disk_found=True): conn_info = get_fake_connection_info() mock_vol_paths = [mock.sentinel.disk_path] if disk_found else [] self._conn.get_volume_paths.return_value = mock_vol_paths if disk_found: disk_res_path = self._base_vol_driver.get_disk_resource_path( conn_info) self._conn.get_volume_paths.assert_called_once_with( conn_info['data']) self.assertEqual(mock_get_disk_res_path.return_value, disk_res_path) mock_get_disk_res_path.assert_called_once_with( mock.sentinel.disk_path) else: self.assertRaises(exception.DiskNotFound, self._base_vol_driver.get_disk_resource_path, conn_info) def test_get_existing_disk_res_path(self): self._test_get_disk_resource_path_by_conn_info() def test_get_unfound_disk_res_path(self): self._test_get_disk_resource_path_by_conn_info(disk_found=False) def test_get_block_dev_res_path(self): self._base_vol_driver._is_block_dev = True mock_get_dev_number = ( self._diskutils.get_device_number_from_device_name) mock_get_dev_number.return_value = mock.sentinel.dev_number self._vmutils.get_mounted_disk_by_drive_number.return_value = ( mock.sentinel.disk_path) disk_path = self._base_vol_driver._get_disk_res_path( mock.sentinel.dev_name) mock_get_dev_number.assert_called_once_with(mock.sentinel.dev_name) self._vmutils.get_mounted_disk_by_drive_number.assert_called_once_with( mock.sentinel.dev_number) self.assertEqual(mock.sentinel.disk_path, disk_path) def test_get_virt_disk_res_path(self): # For virtual disk images, we expect the resource path to be the # actual image path, as opposed to passthrough disks, in which case we # need the Msvm_DiskDrive resource path when attaching it to a VM. self._base_vol_driver._is_block_dev = False path = self._base_vol_driver._get_disk_res_path( mock.sentinel.disk_path) self.assertEqual(mock.sentinel.disk_path, path) @mock.patch.object(volumeops.BaseVolumeDriver, '_get_disk_res_path') @mock.patch.object(volumeops.BaseVolumeDriver, '_get_disk_ctrl_and_slot') @mock.patch.object(volumeops.BaseVolumeDriver, 'connect_volume') def _test_attach_volume(self, mock_connect_volume, mock_get_disk_ctrl_and_slot, mock_get_disk_res_path, is_block_dev=True): connection_info = get_fake_connection_info() self._base_vol_driver._is_block_dev = is_block_dev mock_connect_volume.return_value = dict(path=mock.sentinel.raw_path) mock_get_disk_res_path.return_value = ( mock.sentinel.disk_path) mock_get_disk_ctrl_and_slot.return_value = ( mock.sentinel.ctrller_path, mock.sentinel.slot) self._base_vol_driver.attach_volume( connection_info=connection_info, instance_name=mock.sentinel.instance_name, disk_bus=mock.sentinel.disk_bus) if is_block_dev: self._vmutils.attach_volume_to_controller.assert_called_once_with( mock.sentinel.instance_name, mock.sentinel.ctrller_path, mock.sentinel.slot, mock.sentinel.disk_path, serial=connection_info['serial']) else: self._vmutils.attach_drive.assert_called_once_with( mock.sentinel.instance_name, mock.sentinel.disk_path, mock.sentinel.ctrller_path, mock.sentinel.slot) mock_get_disk_res_path.assert_called_once_with( mock.sentinel.raw_path) mock_get_disk_ctrl_and_slot.assert_called_once_with( mock.sentinel.instance_name, mock.sentinel.disk_bus) def test_attach_volume_image_file(self): self._test_attach_volume(is_block_dev=False) def test_attach_volume_block_dev(self): self._test_attach_volume(is_block_dev=True) def test_detach_volume_planned_vm(self): self._base_vol_driver.detach_volume(mock.sentinel.connection_info, mock.sentinel.inst_name) self._vmutils.detach_vm_disk.assert_not_called() @mock.patch.object(volumeops.BaseVolumeDriver, 'get_disk_resource_path') def test_detach_volume(self, mock_get_disk_resource_path): self._migrutils.planned_vm_exists.return_value = False connection_info = get_fake_connection_info() self._base_vol_driver.detach_volume(connection_info, mock.sentinel.instance_name) mock_get_disk_resource_path.assert_called_once_with( connection_info) self._vmutils.detach_vm_disk.assert_called_once_with( mock.sentinel.instance_name, mock_get_disk_resource_path.return_value, is_physical=self._base_vol_driver._is_block_dev) def test_get_disk_ctrl_and_slot_ide(self): ctrl, slot = self._base_vol_driver._get_disk_ctrl_and_slot( mock.sentinel.instance_name, disk_bus=constants.CTRL_TYPE_IDE) expected_ctrl = self._vmutils.get_vm_ide_controller.return_value expected_slot = 0 self._vmutils.get_vm_ide_controller.assert_called_once_with( mock.sentinel.instance_name, 0) self.assertEqual(expected_ctrl, ctrl) self.assertEqual(expected_slot, slot) def test_get_disk_ctrl_and_slot_scsi(self): ctrl, slot = self._base_vol_driver._get_disk_ctrl_and_slot( mock.sentinel.instance_name, disk_bus=constants.CTRL_TYPE_SCSI) expected_ctrl = self._vmutils.get_vm_scsi_controller.return_value expected_slot = ( self._vmutils.get_free_controller_slot.return_value) self._vmutils.get_vm_scsi_controller.assert_called_once_with( mock.sentinel.instance_name) self._vmutils.get_free_controller_slot( self._vmutils.get_vm_scsi_controller.return_value) self.assertEqual(expected_ctrl, ctrl) self.assertEqual(expected_slot, slot) def test_set_disk_qos_specs(self): # This base method is a noop, we'll just make sure # it doesn't error out. self._base_vol_driver.set_disk_qos_specs( mock.sentinel.conn_info, mock.sentinel.disk_qos_spes) class ISCSIVolumeDriverTestCase(test_base.HyperVBaseTestCase): """Unit tests for Hyper-V BaseVolumeDriver class.""" def test_extra_conn_args(self): fake_iscsi_initiator = ( 'PCI\\VEN_1077&DEV_2031&SUBSYS_17E8103C&REV_02\\' '4&257301f0&0&0010_0') self.flags(iscsi_initiator_list=[fake_iscsi_initiator], group='hyperv') expected_extra_conn_args = dict( initiator_list=[fake_iscsi_initiator]) vol_driver = volumeops.ISCSIVolumeDriver() self.assertEqual(expected_extra_conn_args, vol_driver._extra_connector_args) class SMBFSVolumeDriverTestCase(test_base.HyperVBaseTestCase): """Unit tests for the Hyper-V SMBFSVolumeDriver class.""" _FAKE_EXPORT_PATH = '//ip/share/' _FAKE_CONN_INFO = get_fake_connection_info(export=_FAKE_EXPORT_PATH) def setUp(self): super(SMBFSVolumeDriverTestCase, self).setUp() self._volume_driver = volumeops.SMBFSVolumeDriver() self._volume_driver._conn = mock.Mock() self._conn = self._volume_driver._conn def test_get_export_path(self): export_path = self._volume_driver._get_export_path( self._FAKE_CONN_INFO) expected_path = self._FAKE_EXPORT_PATH.replace('/', '\\') self.assertEqual(expected_path, export_path) @mock.patch.object(volumeops.BaseVolumeDriver, 'attach_volume') def test_attach_volume(self, mock_attach): # The tested method will just apply a lock before calling # the superclass method. self._volume_driver.attach_volume( self._FAKE_CONN_INFO, mock.sentinel.instance_name, disk_bus=mock.sentinel.disk_bus) mock_attach.assert_called_once_with( self._FAKE_CONN_INFO, mock.sentinel.instance_name, disk_bus=mock.sentinel.disk_bus) @mock.patch.object(volumeops.BaseVolumeDriver, 'detach_volume') def test_detach_volume(self, mock_detach): self._volume_driver.detach_volume( self._FAKE_CONN_INFO, instance_name=mock.sentinel.instance_name) mock_detach.assert_called_once_with( self._FAKE_CONN_INFO, instance_name=mock.sentinel.instance_name) @mock.patch.object(volumeops.VolumeOps, 'bytes_per_sec_to_iops') @mock.patch.object(volumeops.VolumeOps, 'validate_qos_specs') @mock.patch.object(volumeops.BaseVolumeDriver, 'get_disk_resource_path') def test_set_disk_qos_specs(self, mock_get_disk_path, mock_validate_qos_specs, mock_bytes_per_sec_to_iops): fake_total_bytes_sec = 8 fake_total_iops_sec = 1 storage_qos_specs = {'total_bytes_sec': fake_total_bytes_sec} expected_supported_specs = ['total_iops_sec', 'total_bytes_sec'] mock_set_qos_specs = self._volume_driver._vmutils.set_disk_qos_specs mock_bytes_per_sec_to_iops.return_value = fake_total_iops_sec mock_get_disk_path.return_value = mock.sentinel.disk_path self._volume_driver.set_disk_qos_specs(self._FAKE_CONN_INFO, storage_qos_specs) mock_validate_qos_specs.assert_called_once_with( storage_qos_specs, expected_supported_specs) mock_bytes_per_sec_to_iops.assert_called_once_with( fake_total_bytes_sec) mock_get_disk_path.assert_called_once_with(self._FAKE_CONN_INFO) mock_set_qos_specs.assert_called_once_with( mock.sentinel.disk_path, fake_total_iops_sec) class RBDVolumeDriver(test_base.HyperVBaseTestCase): def test_get_vol_driver(self): self._volumeops = volumeops.VolumeOps() self._volumeops._volutils = mock.MagicMock() self._volumeops._vmutils = mock.Mock() connection_info = get_fake_connection_info() connection_info['driver_volume_type'] = 'rbd' drv = self._volumeops._get_volume_driver(connection_info) # Not much to test here. The Hyper-V driver volume attach code # is mostly generic and all the RBD related plumbing is handled # by os-brick. # # We'll just ensure that the RBD driver can be retrieved and that it # has the right fields. self.assertTrue(drv._is_block_dev) self.assertEqual('rbd', drv._protocol) # Hyper-V requires a virtual SCSI disk so we'll ask for a # local attach. self.assertEqual(dict(do_local_attach=True), drv._extra_connector_args)
from urllib.request import urlretrieve from os.path import isfile, isdir from tqdm import tqdm import problem_unittests as tests import tarfile cifar10_dataset_folder_path = 'cifar-10-batches-py' class DLProgress(tqdm): last_block = 0 def hook(self, block_num=1, block_size=1, total_size=None): self.total = total_size self.update((block_num - self.last_block) * block_size) self.last_block = block_num if not isfile('cifar-10-python.tar.gz'): with DLProgress(unit='B', unit_scale=True, miniters=1, desc='CIFAR-10 Dataset') as pbar: urlretrieve( 'https://www.cs.toronto.edu/~kriz/cifar-10-python.tar.gz', 'cifar-10-python.tar.gz', pbar.hook) if not isdir(cifar10_dataset_folder_path): with tarfile.open('cifar-10-python.tar.gz') as tar: tar.extractall() tar.close() tests.test_folder_path(cifar10_dataset_folder_path) # ## Explore the Data # The dataset is broken into batches to prevent your machine from running out of memory. The CIFAR-10 dataset consists of 5 batches, named `data_batch_1`, `data_batch_2`, etc.. Each batch contains the labels and images that are one of the following: # * airplane # * automobile # * bird # * cat # * deer # * dog # * frog # * horse # * ship # * truck # # Understanding a dataset is part of making predictions on the data. Play around with the code cell below by changing the `batch_id` and `sample_id`. The `batch_id` is the id for a batch (1-5). The `sample_id` is the id for a image and label pair in the batch. # # Ask yourself "What are all possible labels?", "What is the range of values for the image data?", "Are the labels in order or random?". Answers to questions like these will help you preprocess the data and end up with better predictions. # In[2]: #get_ipython().magic('matplotlib inline') #get_ipython().magic("config InlineBackend.figure_format = 'retina'") import helper import numpy as np # Explore the dataset batch_id = 4 sample_id = 222 #helper.display_stats(cifar10_dataset_folder_path, batch_id, sample_id) # In[3]: import pickle def load_cfar10_batch(cifar10_dataset_folder_path, batch_id): """ Load a batch of the dataset """ with open(cifar10_dataset_folder_path + '/data_batch_' + str(batch_id), mode='rb') as file: batch = pickle.load(file, encoding='latin1') features = batch['data'].reshape((len(batch['data']), 3, 32, 32)).transpose(0, 2, 3, 1) labels = batch['labels'] return features, labels # In[4]: # check value range of data features, labels = load_cfar10_batch(cifar10_dataset_folder_path, batch_id) print("min value: {:d} max value: {:d}".format(features.min(), features.max())) # ## Implement Preprocess Functions # ### Normalize # In the cell below, implement the `normalize` function to take in image data, `x`, and return it as a normalized Numpy array. The values should be in the range of 0 to 1, inclusive. The return object should be the same shape as `x`. # In[5]: #def normalize(x): # """ # Normalize a list of sample image data in the range of 0 to 1 # : x: List of image data. The image shape is (32, 32, 3) # : return: Numpy array of normalize data # """ # # TODO: Implement Function # normalizer = lambda n: n/255 # return np.vectorize normalizer # do this in one line instead with a lambda and numpy's great vectorize function :) normalize = np.vectorize(lambda i: i/255) # ### One-hot encode # Just like the previous code cell, you'll be implementing a function for preprocessing. This time, you'll implement the `one_hot_encode` function. The input, `x`, are a list of labels. Implement the function to return the list of labels as One-Hot encoded Numpy array. The possible values for labels are 0 to 9. The one-hot encoding function should return the same encoding for each value between each call to `one_hot_encode`. Make sure to save the map of encodings outside the function. # # Hint: Don't reinvent the wheel. # In[6]: def one_hot_encode(x): """ One hot encode a list of sample labels. Return a one-hot encoded vector for each label. : x: List of sample Labels : return: Numpy array of one-hot encoded labels """ # the return matrix (shape: [num samples x 10 categories]) ret = np.zeros([len(x), 10], dtype=np.float32) for i, label in enumerate(x): ret[i][label] = 1 # only set the label/category-slot to 1, leave all others at 0 return ret import pickle import helper # Load the Preprocessed Validation data valid_features, valid_labels = pickle.load(open('preprocess_validation.p', mode='rb')) import importlib import aiopening as ai import tensorflow as tf n_classes = 10 class MyNet(ai.Model): def __init__(self, name, num_colors=3, **kwargs): super().__init__(name, **kwargs) # input depth (the 4th slot of the shape of the input volume (#samples x w x h x in-depth)) self.num_colors = num_colors # have to implement the build method # build the entire graph from scratch into the default graph (the call to reset will handle this for us) def construct(self): # define our three inputs to this graph x, y, keep_prob = self.add_feeds((tf.float32, [None, 32, 32, 3], "x"), (tf.float32, [None, n_classes], "y"), (tf.float32, None, "keep_prob")) # create the convolutional part conv = ai.modules.Convolutional2DNN("convolutional_module", output_channels=16, kernel_shapes=(8, 8), strides=(1, 1), max_pooling=True, pool_k_sizes=(2, 2), pool_strides=(2, 2) ) # now conv is an snt.AbstractModule conv_out = conv(x) # add dropout to conv layer conv_out = tf.nn.dropout(conv_out, keep_prob) # conv_out is the output of the convolutional part AND input the the next module (flatten) flatten = ai.modules.FlattenLayer("flatten_module") flatten_out = flatten(conv_out) # flatten_out is the output of the flattening operation AND the input to the next module (fully connected) fc = ai.modules.FullyConnectedNN("fc_module", [160], activations=[tf.nn.relu]) fc_out = fc(flatten_out) fc_end = ai.modules.FullyConnectedNN("logits", [10], activations=None) logits = fc_end(fc_out) # out are now the logits coming from the last layer self._outputs["logits"] = logits # Loss and Optimizer cost = tf.reduce_mean(tf.nn.softmax_cross_entropy_with_logits(logits=logits, labels=y), name="cost") train_op = tf.train.AdamOptimizer().minimize(cost, name="train_op") # set this model's train operation # predictions predictions = tf.argmax(logits, 1, name="predictions") # 1=axis 1 (0 is the batch) # Accuracy correct_predictions = tf.equal(tf.argmax(logits, 1), tf.argmax(y, 1)) # this will be true or false values # casting true/false will result in 0.0/1.0, respectively # the mean of these 0.0 or 1.0 over all samples will give the accuracy over all samples accuracy = tf.reduce_mean(tf.cast(correct_predictions, tf.float32), name="accuracy") self.add_outputs(logits, cost, train_op, predictions, accuracy) # question: where is the print-out for the validation accuracy. This value is missing in the entire project. # how do we know when to stop training? # Also, this function is only called on the last piece of the batch that's being worked on (1 to 5) # so since there are 9000 training samples in a batch and my batch size if 512, this function is only run on the # last 296 samples, which doesn't really make sense. It should be run on the entire training set PLUS on # the validation set separately def print_stats(self, session, feature_batch, label_batch): """ Print information about loss and validation accuracy : session: Current TensorFlow session : feature_batch: Batch of Numpy image data : label_batch: Batch of Numpy label data : cost: TensorFlow cost function : accuracy: TensorFlow accuracy function """ cost_out, acc_out = session.run([self.get_output("cost"), self.get_output("accuracy")], feed_dict={self.get_feed("x"): feature_batch, self.get_feed("y"): label_batch, self.get_feed("keep_prob"): 1.0}) ###DEBUG: cost_out, acc_out, logits_out, labels_out = session.run([cost, accuracy, logits, y], feed_dict={x: feature_batch, y: label_batch, keep_prob: 1.0}) print("Loss: {:.2f} Accuracy: {:.2f}%".format(cost_out, acc_out*100)) #### DEBUG: (had to find out why cost would go down to ~2.3 and accuracy would stay at ~10%, it's because all 10 categories would get 0.1 in the softmax, which is useless) ## list of 10-logits (predicted) for each input sample #logits_list = tf.unpack(logits_out) ## list of 10-logits (actual label) for each input sample #labels_list = tf.unpack(labels_out) ## loop over all input samples #for i, l in enumerate(logits_list): # print("Sample: "+str(i)) # predicted_cats = tf.unpack(l) # actual_cats = tf.unpack(labels_list[i]) # print("output-predictions (softmaxed): "+str(session.run(tf.nn.softmax(predicted_cats)))) # print("output-labels: "+str(session.run(actual_cats))) epochs = 1 batch_size = 2048 keep_probability = 1.0 # making this smaller 1.0 usually gives me worse results (I'm guessing my model is too simple to be needing dropout at all) myModel = MyNet("test_conv_nn", 3) """ print('Checking the Training on a Single Batch...') with tf.Session() as sess: ## Initializing the variables #sess.run(tf.global_variables_initializer()) # Training cycle -> this will be the algorithm for epoch in range(epochs): batch_i = 1 i = 0 for batch_features, batch_labels in helper.load_preprocess_training_batch(batch_i, batch_size): #print("training mini-batch {:d} Len-features={:d} Len-labels={:d}".format(i, len(batch_features), len(batch_labels))) myModel.train(sess, {"keep_prob": keep_probability, "x": batch_features, "y": batch_labels}, init=True if epoch == 0 and i == 0 else False) i += 1 print('Epoch {:>2}/{:d}, CIFAR-10 Batch {:d}:'.format(epoch + 1, epochs, batch_i)) print('Training Set: ', end='') myModel.print_stats(sess, batch_features, batch_labels) """ # ### Fully Train the Model # Now that you got a good accuracy with a single CIFAR-10 batch, try it with all five batches. # In[ ]: print('Training...') with tf.Session() as sess: # Initializing the variables sess.run(tf.global_variables_initializer()) # Training cycle for epoch in range(epochs): # Loop over all CIFAR-10 batches n_batches = 5 for batch_i in range(1, n_batches + 1): for batch_features, batch_labels in helper.load_preprocess_training_batch(batch_i, batch_size): sess.run(myModel.get_output("train_op"), feed_dict={ myModel.get_feed("keep_prob"): keep_probability, myModel.get_feed("x"): batch_features, myModel.get_feed("y"): batch_labels}) myModel.print_stats(sess, batch_features, batch_labels) print('Epoch {:>2}, CIFAR-10 Batch {}:'.format(epoch + 1, batch_i),) print('Training Set: ', end='') # CORRECTION: print out validation loss and accuracy # also, using the print_stats function now instead of 'custom' code #print('Validation Set: ', end='') #print_stats(sess, valid_feature_batch, valid_label_batch, cost, accuracy) #print("") # Save Model's variables myModel.save_state(sess) """ import tensorflow as tf import pickle import helper import random # Set batch size if not already set try: if batch_size: pass except NameError: batch_size = 64 save_model_path = './image_classification' n_samples = 4 top_n_predictions = 3 def test_model(): #Test the saved model against the test dataset test_features, test_labels = pickle.load(open('preprocess_training.p', mode='rb')) loaded_graph = tf.Graph() with tf.Session(graph=loaded_graph) as sess: # Load model loader = tf.train.import_meta_graph(save_model_path + '.meta') loader.restore(sess, save_model_path) # Get Tensors from loaded model loaded_x = loaded_graph.get_tensor_by_name('x:0') loaded_y = loaded_graph.get_tensor_by_name('y:0') loaded_keep_prob = loaded_graph.get_tensor_by_name('keep_prob:0') loaded_logits = loaded_graph.get_tensor_by_name('logits:0') loaded_acc = loaded_graph.get_tensor_by_name('accuracy:0') # Get accuracy in batches for memory limitations test_batch_acc_total = 0 test_batch_count = 0 for train_feature_batch, train_label_batch in helper.batch_features_labels(test_features, test_labels, batch_size): test_batch_acc_total += sess.run( loaded_acc, feed_dict={loaded_x: train_feature_batch, loaded_y: train_label_batch, loaded_keep_prob: 1.0}) test_batch_count += 1 print('Testing Accuracy: {}\n'.format(test_batch_acc_total/test_batch_count)) # Print Random Samples random_test_features, random_test_labels = tuple(zip(*random.sample(list(zip(test_features, test_labels)), n_samples))) random_test_predictions = sess.run( tf.nn.top_k(tf.nn.softmax(loaded_logits), top_n_predictions), feed_dict={loaded_x: random_test_features, loaded_y: random_test_labels, loaded_keep_prob: 1.0}) helper.display_image_predictions(random_test_features, random_test_labels, random_test_predictions) test_model() """ # ## Why 50-70% Accuracy? # You might be wondering why you can't get an accuracy any higher. First things first, 50% isn't bad for a simple CNN. Pure guessing would get you 10% accuracy. However, you might notice people are getting scores [well above 70%](http://rodrigob.github.io/are_we_there_yet/build/classification_datasets_results.html#43494641522d3130). That's because we haven't taught you all there is to know about neural networks. We still need to cover a few more techniques. # ## Submitting This Project # When submitting this project, make sure to run all the cells before saving the notebook. Save the notebook file as "dlnd_image_classification.ipynb" and save it as a HTML file under "File" -> "Download as". Include the "helper.py" and "problem_unittests.py" files in your submission. # ## Trying my daughter's (7) frog painting :) # # In[ ]: """import matplotlib.pyplot as plt from matplotlib.image import imread import helper image1 = imread("/home/ubuntu/deep-learning/image-classification/katis_frog.png") image2 = imread("/home/ubuntu/deep-learning/image-classification/henrik_auto.png") image3 = imread("/home/ubuntu/deep-learning/image-classification/katis_dog.png") f, ax = plt.subplots(3, sharey=True) ax[0].set_title('picture 0') ax[0].imshow(image1) ax[1].set_title('picture 1') ax[1].imshow(image2) ax[2].set_title('picture 2') ax[2].imshow(image3) #plt.xlim(0, 32) #plt.ylim(32, 0) # slice away alpha channel def slice_alpha(image): return image[:,:,:-1] image1 = slice_alpha(image1) image2 = slice_alpha(image2) image3 = slice_alpha(image3) # fill up image array (1st dim of input tensor) images = [image1, image2, image3] loaded_graph = tf.Graph() label_names = helper._load_label_names() with tf.Session(graph=loaded_graph) as sess: # Load model loader = tf.train.import_meta_graph(save_model_path + '.meta') loader.restore(sess, save_model_path) # Get Tensors from loaded model loaded_x = loaded_graph.get_tensor_by_name('x:0') loaded_keep_prob = loaded_graph.get_tensor_by_name('keep_prob:0') loaded_logits = loaded_graph.get_tensor_by_name('logits:0') predictions = sess.run(tf.argmax(loaded_logits, 1), feed_dict={loaded_x: images, loaded_keep_prob: 1.0}) #print(predictions) for i,pred in enumerate(predictions): print("Picture {:d} is showing a {:s}".format(i,label_names[pred])) """ def predict(self, session, inputs): predictions = session.run(self._predictions, feed_dict=self.get_feed_dict())
# -*- coding: utf-8 -*- import uuid from django.conf import settings from django.conf.urls import url from django.contrib.auth import authenticate, login from django.core.mail import EmailMessage from django.http import Http404 from django.shortcuts import render, redirect from django.template import loader from django.utils.translation import ugettext as _ from organizations.backends.tokens import RegistrationTokenGenerator from organizations.backends.forms import UserRegistrationForm, OrganizationRegistrationForm from organizations.models import get_user_model from organizations.utils import create_organization from organizations.utils import model_field_attr try: from django.urls import reverse except ImportError: from django.core.urlresolvers import reverse # Backend classes should provide common interface class BaseBackend(object): """ Base backend class for registering and inviting users to an organization """ def __init__(self, *args, **kwargs): self.user_model = get_user_model() def get_urls(self): raise NotImplementedError def get_success_url(self): """Will return the class's `success_url` attribute unless overridden""" raise NotImplementedError def get_form(self, **kwargs): """Returns the form for registering or inviting a user""" if not hasattr(self, 'form_class'): raise AttributeError(_("You must define a form_class")) return self.form_class(**kwargs) def get_token(self, user, **kwargs): """Returns a unique token for the given user""" return RegistrationTokenGenerator().make_token(user) def get_username(self): """Returns a UUID based 'random' and unique username""" return str(uuid.uuid4())[:model_field_attr(self.user_model, 'username', 'max_length')] def activate_view(self, request, user_id, token): """ Activates the given User by setting `is_active` to true if the provided information is verified. """ try: user = self.user_model.objects.get(id=user_id, is_active=False) except self.user_model.DoesNotExist: raise Http404(_("Your URL may have expired.")) if not RegistrationTokenGenerator().check_token(user, token): raise Http404(_("Your URL may have expired.")) form = self.get_form(data=request.POST or None, instance=user) if form.is_valid(): form.instance.is_active = True user = form.save() user.set_password(form.cleaned_data['password']) user.save() for org in user.organization_set.filter(is_active=False): org.is_active = True org.save() user = authenticate(username=form.cleaned_data['username'], password=form.cleaned_data['password']) login(request, user) return redirect(self.get_success_url()) return render(request, 'organizations/register_form.html', {'form': form}) def send_reminder(self, user, sender=None, **kwargs): """Sends a reminder email to the specified user""" if user.is_active: return False token = RegistrationTokenGenerator().make_token(user) kwargs.update({'token': token}) self._send_email(user, self.reminder_subject, self.reminder_body, sender, **kwargs) def _send_email(self, user, subject_template, body_template, sender=None, **kwargs): """Utility method for sending emails to new users""" if sender: from_email = "%s %s <%s>" % (sender.first_name, sender.last_name, settings.DEFAULT_FROM_EMAIL) reply_to = "%s %s <%s>" % (sender.first_name, sender.last_name, sender.email) else: from_email = settings.DEFAULT_FROM_EMAIL reply_to = {} headers = {'Reply-To': reply_to} kwargs.update({'sender': sender, 'user': user}) ctx = kwargs subject_template = loader.get_template(subject_template) body_template = loader.get_template(body_template) subject = subject_template.render(ctx).strip() # Remove stray newline characters body = body_template.render(ctx) return EmailMessage(subject, body, from_email, [user.email], headers).send() class RegistrationBackend(BaseBackend): """ A backend for allowing new users to join the site by creating a new user associated with a new organization. """ # NOTE this backend stands to be simplified further, as email verification # should be beyond the purview of this app activation_subject = 'organizations/email/activation_subject.txt' activation_body = 'organizations/email/activation_body.html' reminder_subject = 'organizations/email/reminder_subject.txt' reminder_body = 'organizations/email/reminder_body.html' form_class = UserRegistrationForm def get_success_url(self): return reverse('registration_success') def get_urls(self): return [ url(r'^complete/$', self.success_view, name="registration_success"), url(r'^(?P<user_id>[\d]+)-(?P<token>[0-9A-Za-z]{1,13}-[0-9A-Za-z]{1,20})/$', self.activate_view, name="registration_register"), url(r'^$', self.create_view, name="registration_create"), ] def register_by_email(self, email, sender=None, request=None, **kwargs): """ Returns a User object filled with dummy data and not active, and sends an invitation email. """ try: user = self.user_model.objects.get(email=email) except self.user_model.DoesNotExist: user = self.user_model.objects.create(username=self.get_username(), email=email, password=self.user_model.objects.make_random_password()) user.is_active = False user.save() self.send_activation(user, sender, **kwargs) return user def send_activation(self, user, sender=None, **kwargs): """ Invites a user to join the site """ if user.is_active: return False token = self.get_token(user) kwargs.update({'token': token}) self._send_email(user, self.activation_subject, self.activation_body, sender, **kwargs) def create_view(self, request): """ Initiates the organization and user account creation process """ if callable(request.user.is_authenticated): is_authenticated = request.user.is_authenticated() else: is_authenticated = request.user.is_authenticated if is_authenticated: return redirect("organization_add") form = OrganizationRegistrationForm(request.POST or None) if form.is_valid(): try: user = self.user_model.objects.get(email=form.cleaned_data['email']) except self.user_model.DoesNotExist: user = self.user_model.objects.create(username=self.get_username(), email=form.cleaned_data['email'], password=self.user_model.objects.make_random_password()) user.is_active = False user.save() else: return redirect("organization_add") organization = create_organization(user, form.cleaned_data['name'], form.cleaned_data['slug'], is_active=False) return render(request, 'organizations/register_success.html', {'user': user, 'organization': organization}) return render(request, 'organizations/register_form.html', {'form': form}) def success_view(self, request): return render(request, 'organizations/register_success.html', {}) class InvitationBackend(BaseBackend): """ A backend for inviting new users to join the site as members of an organization. """ invitation_subject = 'organizations/email/invitation_subject.txt' invitation_body = 'organizations/email/invitation_body.html' reminder_subject = 'organizations/email/reminder_subject.txt' reminder_body = 'organizations/email/reminder_body.html' form_class = UserRegistrationForm def get_success_url(self): return reverse('organization_list') def get_urls(self): return [ url(r'^(?P<user_id>[\d]+)-(?P<token>[0-9A-Za-z]{1,13}-[0-9A-Za-z]{1,20})/$', self.activate_view, name="invitations_register"), ] def invite_by_email(self, email, sender=None, request=None, **kwargs): """Creates an inactive user with the information we know and then sends an invitation email for that user to complete registration. If your project uses email in a different way then you should make to extend this method as it only checks the `email` attribute for Users. """ try: user = self.user_model.objects.get(email=email) except self.user_model.DoesNotExist: user = self.user_model.objects.create(username=self.get_username(), email=email, password=self.user_model.objects.make_random_password()) user.is_active = False user.save() self.send_invitation(user, sender, **kwargs) return user def send_invitation(self, user, sender=None, **kwargs): """An intermediary function for sending an invitation email that selects the templates, generating the token, and ensuring that the user has not already joined the site. """ if user.is_active: return False token = self.get_token(user) kwargs.update({'token': token}) self._send_email(user, self.invitation_subject, self.invitation_body, sender, **kwargs)
#!/usr/bin/env python # -*- coding: utf-8 -*- ''' # Selenium Framework A framework built around the Selenium WebDriver to simplify the basic capabilities that are most frequently used (in my experience anyway). ''' __title__ = 'Selenium Framework' __version__ = '0.5.0' __copyright__ = '2011 - 2020' __author__ = 'John Dahl' __date__ = '2020-02-08' __license__ = '''MIT License Copyright (c) 2011-2020 John Dahl Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.''' ################################################################################ import re import time from datetime import datetime from selenium import webdriver as WD from selenium.webdriver.common.action_chains import ActionChains as AC from selenium.webdriver.common.by import By from selenium.webdriver.common.keys import Keys from selenium.webdriver.support import expected_conditions as EC from selenium.webdriver.support.ui import Select from selenium.webdriver.support.ui import WebDriverWait from selenium.webdriver.remote.webelement import WebElement from selenium.common.exceptions import NoAlertPresentException from selenium.common.exceptions import TimeoutException from selenium.common.exceptions import WebDriverException # from selenium.webdriver.remote.webdriver import WebDriver # from selenium.common import exceptions as EX # from selenium.common.exceptions import NoSuchElementException class FrameworkException(WebDriverException): '''Framework exception for deliberately thrown exceptions.''' # pass class Driver(): ''' Main framework object. Everything runs from an instance of this object. ''' def __init__(self): self.browser = None self.close = None self.web_element = WebElement self.keys = Keys ############################################################################ # Browser-dependent Methods ############################################################################ def check_alert(self, accept_alert=True): '''Given that this method is called when a browser alert is present, retrieve the message in the alert, take the action requested (accept by default), and return the message.''' try: alert = self.browser.switch_to.alert alert_text = alert.text if accept_alert: alert.accept() else: alert.dismiss() return alert_text except NoAlertPresentException: return False except WebDriverException: self.throw(f'Unable to check the alert.') def control_click(self, webelement, container=None): '''Given a web element, perform a control-click on the element and return a boolean confirmation of the success of the action.''' if container is None: container = self.browser try: AC(container)\ .context_click(webelement)\ .send_keys(Keys.ARROW_DOWN)\ .send_keys(Keys.ENTER)\ .perform() self.wait(.5) return True except WebDriverException: return False def double_click(self, webelement, container=None): '''Given a web element, perform a double-click on the element and return a boolean confirmation of the success of the action.''' if container is None: container = self.browser try: AC(container).double_click(webelement).perform() self.wait(.5) return True except WebDriverException: return False def find(self, locator_string, container=None, wait=3): '''Given a locator in the form of "type=value", an optional container within which to start a nested search, and an optional wait time, locate the elements and return a list of results. If a result is not found, a second attempt will be made after the wait time. If the search returns a single result, that result is returned from the method as a WebElement.''' if not container: container = self.browser loc_type, loc_value = self._convert_locator(locator_string) try: element_list = container.find_elements(by=loc_type, value=loc_value) if (not element_list and isinstance(wait, int) and wait > 0): WebDriverWait(self.browser, wait).until( EC.presence_of_element_located((loc_type, loc_value)) ) element_list = container.find_elements(by=loc_type, value=loc_value) if len(element_list) == 1: element_list = element_list[0] except TimeoutException: element_list = [] return element_list def goto(self, url): '''Navigate to the given url.''' self.browser.get(url) def is_element_clickable(self, webelement): '''Given a web element, determine if it is eligable to click on it.''' #if not isinstance(webelement, WebElement): # return False if (webelement.is_displayed() and webelement.is_enabled() and webelement.size['width'] > 0 and webelement.size['height'] > 0): return True else: return False def is_field_set(self, webelement): '''Given a web element representing a form field, determine if the field has a value set, and if so, return the value or None.''' try: field_tag = webelement.tag_name field_type = webelement.get_attribute('type') or None if field_tag == 'select': field_value_list = Select(webelement).all_selected_options field_value = [f.text for f in field_value_list] elif field_tag == 'input' and field_type in ['checkbox', 'radio']: field_value = webelement.is_selected() elif field_tag in ['input', 'textarea']: field_value = webelement.get_attribute('value') else: field_value = None except WebDriverException: field_value = None return field_value def is_radio_button_group_set(self, button_group): '''Given a web element representing a radio button group, determine if the field has a value set, and if so, return the value or None.''' field_value = [button.get_attribute('value') for button in button_group if button.is_selected()] return field_value def open(self, config=None): ''' Open a new instance of the selected browser and set the close method. TODO: Add custom profile support. TODO: Add remote/grid support. ''' if not config: browser = input('Which browser would you like to use: ').capitalize() headless = True else: browser = config['browser'] headless = config['headless'] if browser == 'Chrome': options = WD.chrome.options.Options() if headless: options.add_argument("--headless") options.add_argument("--window-size=1920x1080") elif browser == 'Firefox': options = WD.firefox.options.Options() options.headless = headless # Remote # if config.get('remote_hub', False): # url, port = config['remote_hub'] # if browser_name == 'Ie': # browser_name = 'INTERNETEXPLORER' # else: # browser_name = browser_name.upper() # self.browser = WD.Remote( # command_executor=f'http://{url}:{port}/wd/hub', # desired_capabilities=getattr(WD.DesiredCapabilities, browser_name), # browser_profile=browser_options['profile']) try: self.browser = getattr(WD, browser)(options=options) self.close = self.browser.close except IndexError: self.throw('Unknown browser selected.') # def open_bak(self, browser_name='gc', selenium_hub='local', selenium_port='4444'): # elif selenium_hub != 'local': # command_executor = 'http://{0}:{1}/wd/hub'.format(selenium_hub, selenium_port) # desired_capabilities = getattr(WD.DesiredCapabilities, remote_driver) # self.browser = WD.Remote( # command_executor=command_executor, # desired_capabilities=desired_capabilities, # browser_profile=None) # else: # raise 'Invalid browser selection.' # # Setup the driver close method def right_click(self, webelement, container=None): '''Given a web element, right-click on it.''' if container is None: container = self.browser try: AC(container).context_click(webelement).perform() self.wait(.5) return True except WebDriverException: return False def scroll_into_view(self, webelement): '''Given a web element on the current page, scroll the page until the element is visible.''' self.browser.execute_script("arguments[0].scrollIntoView(true);", webelement) self.wait(.5) def set_field(self, webelement, field_value, append=False): '''Given a form field, set the value of the field.''' field_tag = webelement.tag_name if field_tag == 'textarea' or \ field_tag == 'input' and \ webelement.get_attribute('type') not in ['radio', 'checkbox']: webelement.click() if not append: webelement.clear() webelement.send_keys(field_value) #self.find('tag=body').click() elif field_tag == 'input': webelement.click() elif field_tag == 'select': select_element = Select(webelement) if isinstance(field_value, str): select_element.select_by_visible_text(field_value) elif isinstance(field_value, list): if (len(field_value) > 1 and not append) or not field_value: select_element.deselect_all() for item in field_value: select_element.select_by_visible_text(str(item)) def set_window(self, window_size, window_position): '''Set the browser window size and position.''' self.browser.set_window_size(window_size[0], window_size[1]) self.browser.set_window_position(window_position[0], window_position[1]) def switch_to(self, locator_string=None, container=None): '''Change the browser context to a different window or frame.''' try: if container is None: container = self.browser if locator_string is not None: locator_type, locator_value = self._convert_locator(locator_string) else: locator_type = None if locator_type in [None, '', 'top', 'default']: self.browser.switch_to.default_content() elif locator_type == 'window': container.switch_to.window(locator_value) elif locator_type == 'frame': container.switch_to.frame(locator_value) else: self.throw(f'Invalid switch-to target: {locator_string}') except WebDriverException: self.throw(f'Unable to swtich to the target: {locator_string}') def wait_until_element_clickable(self, locator_string=None, timeout=30): '''Wait until the condition exists when the element is clickable or timeout.''' locator_object = self._convert_locator(locator_string) webelement = WebDriverWait(self.browser, timeout).until( EC.element_to_be_clickable(locator_object)) return webelement ############################################################################ # Browser-independent Utilities ############################################################################ def _convert_locator(self, locator_string): '''Given a locator string in the format type=value return a tuple in the format (valid_type, value)''' locator_map = { 'id' : By.ID, 'name' : By.NAME, 'css' : By.CSS_SELECTOR, 'class' : By.CLASS_NAME, 'link' : By.LINK_TEXT, 'plink' : By.PARTIAL_LINK_TEXT, 'tag' : By.TAG_NAME, 'xpath' : By.XPATH, 'window': 'window', 'frame' : 'frame', } locator_string_separator = locator_string.find('=') locator_type = locator_string[:locator_string_separator].strip() locator_value = locator_string[locator_string_separator + 1:].strip() return (locator_map[locator_type], locator_value) def get_date(self): '''Return the current date.''' #ut_test_001 return self.get_timestamp()[:10] def get_time(self): '''Return the current time.''' # ut_test_002 return self.get_timestamp()[-8:] def get_timestamp(self): '''Return the current datetime.''' return str(datetime.now())[:-7] def make_valid_name(self, invalid_name): '''Remove bad characters and return a valid name.''' tmp_name = invalid_name.strip() tmp_name = re.sub('[ -]', '_', tmp_name) tmp_name = re.sub('[()]', '', tmp_name) return tmp_name def pause(self, message_text=None): '''Pause the current execution until the Enter key is pressed.''' if message_text: print(message_text) input('Press the ENTER key to continue.') def wait(self, seconds=0): '''Pause the current execution for the given number of seconds.''' time.sleep(seconds) def throw(self, message): '''Raise a FrameworkException error.''' raise FrameworkException(message) if __name__ == '__main__': print('The Selenium Framework module is not intended to run \ as a script.') print('Add the following line to your scripts or type this in your \ Python session:') print('\timport selenium_framework as sf')
from collections import defaultdict from itertools import tee, chain, combinations from pgmpy.factors.discrete import DiscreteFactor from pgmpy.factors import factor_product from pgmpy.inference import Inference, BeliefPropagation class DBNInference(Inference): def __init__(self, model): """ Class for performing inference using Belief Propagation method for the input Dynamic Bayesian Network. For the exact inference implementation, the interface algorithm is used which is adapted from [1]. Parameters ---------- model: Dynamic Bayesian Network Model for which inference is to performed Examples -------- >>> from pgmpy.factors.discrete import TabularCPD >>> from pgmpy.models import DynamicBayesianNetwork as DBN >>> from pgmpy.inference import DBNInference >>> dbnet = DBN() >>> dbnet.add_edges_from([(('Z', 0), ('X', 0)), (('X', 0), ('Y', 0)), ... (('Z', 0), ('Z', 1))]) >>> z_start_cpd = TabularCPD(('Z', 0), 2, [[0.5], [0.5]]) >>> x_i_cpd = TabularCPD(('X', 0), 2, [[0.6, 0.9], ... [0.4, 0.1]], ... evidence=[('Z', 0)], ... evidence_card=[2]) >>> y_i_cpd = TabularCPD(('Y', 0), 2, [[0.2, 0.3], ... [0.8, 0.7]], ... evidence=[('X', 0)], ... evidence_card=[2]) >>> z_trans_cpd = TabularCPD(('Z', 1), 2, [[0.4, 0.7], ... [0.6, 0.3]], ... evidence=[('Z', 0)], ... evidence_card=[2]) >>> dbnet.add_cpds(z_start_cpd, z_trans_cpd, x_i_cpd, y_i_cpd) >>> dbnet.initialize_initial_state() >>> dbn_inf = DBNInference(dbnet) >>> dbn_inf.start_junction_tree.nodes() NodeView(((('X', 0), ('Y', 0)), (('X', 0), ('Z', 0)))) >>> dbn_inf.one_and_half_junction_tree.nodes() NodeView(((('Z', 1), ('Z', 0)), (('Y', 1), ('X', 1)), (('Z', 1), ('X', 1)))) References ---------- [1] Dynamic Bayesian Networks: Representation, Inference and Learning by Kevin Patrick Murphy http://www.cs.ubc.ca/~murphyk/Thesis/thesis.pdf """ super(DBNInference, self).__init__(model) self._initialize_structures() self.interface_nodes_0 = model.get_interface_nodes(time_slice=0) self.interface_nodes_1 = model.get_interface_nodes(time_slice=1) start_markov_model = self.start_bayesian_model.to_markov_model() one_and_half_markov_model = self.one_and_half_model.to_markov_model() combinations_slice_0 = tee(combinations(set(self.interface_nodes_0), 2), 2) combinations_slice_1 = combinations(set(self.interface_nodes_1), 2) start_markov_model.add_edges_from(combinations_slice_0[0]) one_and_half_markov_model.add_edges_from( chain(combinations_slice_0[1], combinations_slice_1) ) self.one_and_half_junction_tree = one_and_half_markov_model.to_junction_tree() self.start_junction_tree = start_markov_model.to_junction_tree() self.start_interface_clique = self._get_clique( self.start_junction_tree, self.interface_nodes_0 ) self.in_clique = self._get_clique( self.one_and_half_junction_tree, self.interface_nodes_0 ) self.out_clique = self._get_clique( self.one_and_half_junction_tree, self.interface_nodes_1 ) def _shift_nodes(self, nodes, time_slice): """ Shifting the nodes to a certain required timeslice. Parameters ---------- nodes: list, array-like List of node names. nodes that are to be shifted to some other time slice. time_slice: int time slice where to shift the nodes. """ return [(node[0], time_slice) for node in nodes] def _get_clique(self, junction_tree, nodes): """ Extracting the cliques from the junction tree which are a subset of the given nodes. Parameters ---------- junction_tree: Junction tree from which the nodes are to be extracted. nodes: iterable container A container of nodes (list, dict, set, etc.). """ return [ clique for clique in junction_tree.nodes() if set(nodes).issubset(clique) ][0] def _get_evidence(self, evidence_dict, time_slice, shift): """ Getting the evidence belonging to a particular timeslice. Parameters ---------- evidence: dict a dict key, value pair as {var: state_of_var_observed} None if no evidence time: int the evidence corresponding to the time slice shift: int shifting the evidence corresponding to the given time slice. """ if evidence_dict: return { (node[0], shift): evidence_dict[node] for node in evidence_dict if node[1] == time_slice } def _marginalize_factor(self, nodes, factor): """ Marginalizing the factor selectively for a set of variables. Parameters ---------- nodes: list, array-like A container of nodes (list, dict, set, etc.). factor: factor factor which is to be marginalized. """ marginalizing_nodes = list(set(factor.scope()).difference(nodes)) return factor.marginalize(marginalizing_nodes, inplace=False) def _update_belief(self, belief_prop, clique, clique_potential, message=None): """ Method for updating the belief. Parameters ---------- belief_prop: Belief Propagation Belief Propagation which needs to be updated. in_clique: clique The factor which needs to be updated corresponding to the input clique. out_clique_potential: factor Multiplying factor which will be multiplied to the factor corresponding to the clique. """ old_factor = belief_prop.junction_tree.get_factors(clique) belief_prop.junction_tree.remove_factors(old_factor) if message: if message.scope() and clique_potential.scope(): new_factor = old_factor * message new_factor = new_factor / clique_potential else: new_factor = old_factor else: new_factor = old_factor * clique_potential belief_prop.junction_tree.add_factors(new_factor) belief_prop.calibrate() def _get_factor(self, belief_prop, evidence): """ Extracts the required factor from the junction tree. Parameters ---------- belief_prop: Belief Propagation Belief Propagation which needs to be updated. evidence: dict a dict key, value pair as {var: state_of_var_observed} """ final_factor = factor_product(*belief_prop.junction_tree.get_factors()) if evidence: for var in evidence: if var in final_factor.scope(): final_factor.reduce([(var, evidence[var])]) return final_factor def _shift_factor(self, factor, shift): """ Shifting the factor to a certain required time slice. Parameters ---------- factor: DiscreteFactor The factor which needs to be shifted. shift: int The new timeslice to which the factor should belong to. """ new_scope = self._shift_nodes(factor.scope(), shift) return DiscreteFactor(new_scope, factor.cardinality, factor.values) def forward_inference(self, variables, evidence=None, args=None): """ Forward inference method using belief propagation. Parameters ---------- variables: list list of variables for which you want to compute the probability evidence: dict a dict key, value pair as {var: state_of_var_observed} None if no evidence Examples -------- >>> from pgmpy.factors.discrete import TabularCPD >>> from pgmpy.models import DynamicBayesianNetwork as DBN >>> from pgmpy.inference import DBNInference >>> dbnet = DBN() >>> dbnet.add_edges_from([(('Z', 0), ('X', 0)), (('X', 0), ('Y', 0)), ... (('Z', 0), ('Z', 1))]) >>> z_start_cpd = TabularCPD(('Z', 0), 2, [[0.5], [0.5]]) >>> x_i_cpd = TabularCPD(('X', 0), 2, [[0.6, 0.9], ... [0.4, 0.1]], ... evidence=[('Z', 0)], ... evidence_card=[2]) >>> y_i_cpd = TabularCPD(('Y', 0), 2, [[0.2, 0.3], ... [0.8, 0.7]], ... evidence=[('X', 0)], ... evidence_card=[2]) >>> z_trans_cpd = TabularCPD(('Z', 1), 2, [[0.4, 0.7], ... [0.6, 0.3]], ... evidence=[('Z', 0)], ... evidence_card=[2]) >>> dbnet.add_cpds(z_start_cpd, z_trans_cpd, x_i_cpd, y_i_cpd) >>> dbnet.initialize_initial_state() >>> dbn_inf = DBNInference(dbnet) >>> dbn_inf.forward_inference([('X', 2)], {('Y', 0):1, ('Y', 1):0, ('Y', 2):1})[('X', 2)].values array([0.76738736, 0.23261264]) """ variable_dict = defaultdict(list) for var in variables: variable_dict[var[1]].append(var) time_range = max(variable_dict) if evidence: evid_time_range = max([time_slice for var, time_slice in evidence.keys()]) time_range = max(time_range, evid_time_range) start_bp = BeliefPropagation(self.start_junction_tree) mid_bp = BeliefPropagation(self.one_and_half_junction_tree) evidence_0 = self._get_evidence(evidence, 0, 0) interface_nodes_dict = {} potential_dict = {} if evidence: interface_nodes_dict = { k: v for k, v in evidence_0.items() if k in self.interface_nodes_0 } initial_factor = self._get_factor(start_bp, evidence_0) marginalized_factor = self._marginalize_factor( self.interface_nodes_0, initial_factor ) potential_dict[0] = marginalized_factor self._update_belief(mid_bp, self.in_clique, marginalized_factor) if variable_dict[0]: factor_values = start_bp.query( variable_dict[0], evidence=evidence_0, joint=False ) else: factor_values = {} for time_slice in range(1, time_range + 1): evidence_time = self._get_evidence(evidence, time_slice, 1) if interface_nodes_dict: evidence_time.update(interface_nodes_dict) if variable_dict[time_slice]: variable_time = self._shift_nodes(variable_dict[time_slice], 1) new_values = mid_bp.query( variable_time, evidence=evidence_time, joint=False ) changed_values = {} for key in new_values.keys(): new_key = (key[0], time_slice) new_factor = DiscreteFactor( [new_key], new_values[key].cardinality, new_values[key].values ) changed_values[new_key] = new_factor factor_values.update(changed_values) clique_phi = self._get_factor(mid_bp, evidence_time) out_clique_phi = self._marginalize_factor( self.interface_nodes_1, clique_phi ) new_factor = self._shift_factor(out_clique_phi, 0) potential_dict[time_slice] = new_factor mid_bp = BeliefPropagation(self.one_and_half_junction_tree) self._update_belief(mid_bp, self.in_clique, new_factor) if evidence_time: interface_nodes_dict = { (k[0], 0): v for k, v in evidence_time.items() if k in self.interface_nodes_1 } else: interface_nodes_dict = {} if args == "potential": return potential_dict return factor_values def backward_inference(self, variables, evidence=None): """ Backward inference method using belief propagation. Parameters ---------- variables: list list of variables for which you want to compute the probability evidence: dict a dict key, value pair as {var: state_of_var_observed} None if no evidence Examples -------- >>> from pgmpy.factors.discrete import TabularCPD >>> from pgmpy.models import DynamicBayesianNetwork as DBN >>> from pgmpy.inference import DBNInference >>> dbnet = DBN() >>> dbnet.add_edges_from([(('Z', 0), ('X', 0)), (('X', 0), ('Y', 0)), ... (('Z', 0), ('Z', 1))]) >>> z_start_cpd = TabularCPD(('Z', 0), 2, [[0.5], [0.5]]) >>> x_i_cpd = TabularCPD(('X', 0), 2, [[0.6, 0.9], ... [0.4, 0.1]], ... evidence=[('Z', 0)], ... evidence_card=[2]) >>> y_i_cpd = TabularCPD(('Y', 0), 2, [[0.2, 0.3], ... [0.8, 0.7]], ... evidence=[('X', 0)], ... evidence_card=[2]) >>> z_trans_cpd = TabularCPD(('Z', 1), 2, [[0.4, 0.7], ... [0.6, 0.3]], ... evidence=[('Z', 0)], ... evidence_card=[2]) >>> dbnet.add_cpds(z_start_cpd, z_trans_cpd, x_i_cpd, y_i_cpd) >>> dbnet.initialize_initial_state() >>> dbn_inf = DBNInference(dbnet) >>> dbn_inf.backward_inference([('X', 0)], {('Y', 0):0, ('Y', 1):1, ('Y', 2):1})[('X', 0)].values array([0.66594382, 0.33405618]) """ variable_dict = defaultdict(list) for var in variables: variable_dict[var[1]].append(var) time_range = max(variable_dict) interface_nodes_dict = {} if evidence: evid_time_range = max([time_slice for var, time_slice in evidence.keys()]) time_range = max(time_range, evid_time_range) end_bp = BeliefPropagation(self.start_junction_tree) potential_dict = self.forward_inference(variables, evidence, "potential") update_factor = self._shift_factor(potential_dict[time_range], 1) factor_values = {} for time_slice in range(time_range, 0, -1): evidence_time = self._get_evidence(evidence, time_slice, 1) evidence_prev_time = self._get_evidence(evidence, time_slice - 1, 0) if evidence_prev_time: interface_nodes_dict = { k: v for k, v in evidence_prev_time.items() if k in self.interface_nodes_0 } if evidence_time: evidence_time.update(interface_nodes_dict) mid_bp = BeliefPropagation(self.one_and_half_junction_tree) self._update_belief(mid_bp, self.in_clique, potential_dict[time_slice - 1]) forward_factor = self._shift_factor(potential_dict[time_slice], 1) self._update_belief(mid_bp, self.out_clique, forward_factor, update_factor) if variable_dict[time_slice]: variable_time = self._shift_nodes(variable_dict[time_slice], 1) new_values = mid_bp.query( variable_time, evidence=evidence_time, joint=False ) changed_values = {} for key in new_values.keys(): new_key = (key[0], time_slice) new_factor = DiscreteFactor( [new_key], new_values[key].cardinality, new_values[key].values ) changed_values[new_key] = new_factor factor_values.update(changed_values) clique_phi = self._get_factor(mid_bp, evidence_time) in_clique_phi = self._marginalize_factor(self.interface_nodes_0, clique_phi) update_factor = self._shift_factor(in_clique_phi, 1) out_clique_phi = self._shift_factor(update_factor, 0) self._update_belief( end_bp, self.start_interface_clique, potential_dict[0], out_clique_phi ) evidence_0 = self._get_evidence(evidence, 0, 0) if variable_dict[0]: factor_values.update( end_bp.query(variable_dict[0], evidence_0, joint=False) ) return factor_values def query(self, variables, evidence=None, args="exact"): """ Query method for Dynamic Bayesian Network using Interface Algorithm. Parameters ---------- variables: list list of variables for which you want to compute the probability evidence: dict a dict key, value pair as {var: state_of_var_observed} None if no evidence Examples -------- >>> from pgmpy.factors.discrete import TabularCPD >>> from pgmpy.models import DynamicBayesianNetwork as DBN >>> from pgmpy.inference import DBNInference >>> dbnet = DBN() >>> dbnet.add_edges_from([(('Z', 0), ('X', 0)), (('X', 0), ('Y', 0)), ... (('Z', 0), ('Z', 1))]) >>> z_start_cpd = TabularCPD(('Z', 0), 2, [[0.5], [0.5]]) >>> x_i_cpd = TabularCPD(('X', 0), 2, [[0.6, 0.9], ... [0.4, 0.1]], ... evidence=[('Z', 0)], ... evidence_card=[2]) >>> y_i_cpd = TabularCPD(('Y', 0), 2, [[0.2, 0.3], ... [0.8, 0.7]], ... evidence=[('X', 0)], ... evidence_card=[2]) >>> z_trans_cpd = TabularCPD(('Z', 1), 2, [[0.4, 0.7], ... [0.6, 0.3]], ... evidence=[('Z', 0)], ... evidence_card=[2]) >>> dbnet.add_cpds(z_start_cpd, z_trans_cpd, x_i_cpd, y_i_cpd) >>> dbnet.initialize_initial_state() >>> dbn_inf = DBNInference(dbnet) >>> dbn_inf.query([('X', 0)], {('Y', 0):0, ('Y', 1):1, ('Y', 2):1})[('X', 0)].values array([0.66594382, 0.33405618]) """ if args == "exact": return self.backward_inference(variables, evidence)
# vim: tabstop=4 shiftwidth=4 softtabstop=4 # # Copyright 2011 Nexenta Systems, Inc. # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. """ :mod:`nexenta.volume` -- Driver to store volumes on Nexenta Appliance ===================================================================== .. automodule:: nexenta.volume .. moduleauthor:: Yuriy Taraday <yorik.sar@gmail.com> """ from cinder import exception from cinder import flags from cinder.openstack.common import cfg from cinder.openstack.common import log as logging from cinder.volume import driver from cinder.volume.drivers import nexenta from cinder.volume.drivers.nexenta import jsonrpc LOG = logging.getLogger(__name__) FLAGS = flags.FLAGS nexenta_opts = [ cfg.StrOpt('nexenta_host', default='', help='IP address of Nexenta SA'), cfg.IntOpt('nexenta_rest_port', default=2000, help='HTTP port to connect to Nexenta REST API server'), cfg.StrOpt('nexenta_rest_protocol', default='auto', help='Use http or https for REST connection (default auto)'), cfg.StrOpt('nexenta_user', default='admin', help='User name to connect to Nexenta SA'), cfg.StrOpt('nexenta_password', default='nexenta', help='Password to connect to Nexenta SA', secret=True), cfg.IntOpt('nexenta_iscsi_target_portal_port', default=3260, help='Nexenta target portal port'), cfg.StrOpt('nexenta_volume', default='cinder', help='pool on SA that will hold all volumes'), cfg.StrOpt('nexenta_target_prefix', default='iqn.1986-03.com.sun:02:cinder-', help='IQN prefix for iSCSI targets'), cfg.StrOpt('nexenta_target_group_prefix', default='cinder/', help='prefix for iSCSI target groups on SA'), cfg.StrOpt('nexenta_blocksize', default='', help='block size for volumes (blank=default,8KB)'), cfg.BoolOpt('nexenta_sparse', default=False, help='flag to create sparse volumes'), ] FLAGS.register_opts(nexenta_opts) class NexentaDriver(driver.ISCSIDriver): # pylint: disable=R0921 """Executes volume driver commands on Nexenta Appliance.""" def __init__(self): super(NexentaDriver, self).__init__() def do_setup(self, context): protocol = FLAGS.nexenta_rest_protocol auto = protocol == 'auto' if auto: protocol = 'http' self.nms = jsonrpc.NexentaJSONProxy( '%s://%s:%s/rest/nms/' % (protocol, FLAGS.nexenta_host, FLAGS.nexenta_rest_port), FLAGS.nexenta_user, FLAGS.nexenta_password, auto=auto) def check_for_setup_error(self): """Verify that the volume for our zvols exists. :raise: :py:exc:`LookupError` """ if not self.nms.volume.object_exists(FLAGS.nexenta_volume): raise LookupError(_("Volume %s does not exist in Nexenta SA"), FLAGS.nexenta_volume) @staticmethod def _get_zvol_name(volume_name): """Return zvol name that corresponds given volume name.""" return '%s/%s' % (FLAGS.nexenta_volume, volume_name) @staticmethod def _get_target_name(volume_name): """Return iSCSI target name to access volume.""" return '%s%s' % (FLAGS.nexenta_target_prefix, volume_name) @staticmethod def _get_target_group_name(volume_name): """Return Nexenta iSCSI target group name for volume.""" return '%s%s' % (FLAGS.nexenta_target_group_prefix, volume_name) def create_volume(self, volume): """Create a zvol on appliance. :param volume: volume reference """ self.nms.zvol.create( self._get_zvol_name(volume['name']), '%sG' % (volume['size'],), FLAGS.nexenta_blocksize, FLAGS.nexenta_sparse) def delete_volume(self, volume): """Destroy a zvol on appliance. :param volume: volume reference """ try: self.nms.zvol.destroy(self._get_zvol_name(volume['name']), '') except nexenta.NexentaException as exc: if "zvol has children" in exc.args[1]: raise exception.VolumeIsBusy(volume_name=volume['name']) else: raise def create_snapshot(self, snapshot): """Create snapshot of existing zvol on appliance. :param snapshot: shapshot reference """ self.nms.zvol.create_snapshot( self._get_zvol_name(snapshot['volume_name']), snapshot['name'], '') def create_volume_from_snapshot(self, volume, snapshot): """Create new volume from other's snapshot on appliance. :param volume: reference of volume to be created :param snapshot: reference of source snapshot """ self.nms.zvol.clone( '%s@%s' % (self._get_zvol_name(snapshot['volume_name']), snapshot['name']), self._get_zvol_name(volume['name'])) def delete_snapshot(self, snapshot): """Delete volume's snapshot on appliance. :param snapshot: shapshot reference """ try: self.nms.snapshot.destroy( '%s@%s' % (self._get_zvol_name(snapshot['volume_name']), snapshot['name']), '') except nexenta.NexentaException as exc: if "snapshot has dependent clones" in exc.args[1]: raise exception.SnapshotIsBusy(snapshot_name=snapshot['name']) else: raise def local_path(self, volume): """Return local path to existing local volume. We never have local volumes, so it raises NotImplementedError. :raise: :py:exc:`NotImplementedError` """ raise NotImplementedError def _do_export(self, _ctx, volume, ensure=False): """Do all steps to get zvol exported as LUN 0 at separate target. :param volume: reference of volume to be exported :param ensure: if True, ignore errors caused by already existing resources :return: iscsiadm-formatted provider location string """ zvol_name = self._get_zvol_name(volume['name']) target_name = self._get_target_name(volume['name']) target_group_name = self._get_target_group_name(volume['name']) try: self.nms.iscsitarget.create_target({'target_name': target_name}) except nexenta.NexentaException as exc: if not ensure or 'already configured' not in exc.args[1]: raise else: LOG.info(_('Ignored target creation error "%s"' ' while ensuring export'), exc) try: self.nms.stmf.create_targetgroup(target_group_name) except nexenta.NexentaException as exc: if not ensure or 'already exists' not in exc.args[1]: raise else: LOG.info(_('Ignored target group creation error "%s"' ' while ensuring export'), exc) try: self.nms.stmf.add_targetgroup_member(target_group_name, target_name) except nexenta.NexentaException as exc: if not ensure or 'already exists' not in exc.args[1]: raise else: LOG.info(_('Ignored target group member addition error "%s"' ' while ensuring export'), exc) try: self.nms.scsidisk.create_lu(zvol_name, {}) except nexenta.NexentaException as exc: if not ensure or 'in use' not in exc.args[1]: raise else: LOG.info(_('Ignored LU creation error "%s"' ' while ensuring export'), exc) try: self.nms.scsidisk.add_lun_mapping_entry(zvol_name, { 'target_group': target_group_name, 'lun': '0'}) except nexenta.NexentaException as exc: if not ensure or 'view entry exists' not in exc.args[1]: raise else: LOG.info(_('Ignored LUN mapping entry addition error "%s"' ' while ensuring export'), exc) return '%s:%s,1 %s 0' % (FLAGS.nexenta_host, FLAGS.nexenta_iscsi_target_portal_port, target_name) def create_export(self, _ctx, volume): """Create new export for zvol. :param volume: reference of volume to be exported :return: iscsiadm-formatted provider location string """ loc = self._do_export(_ctx, volume, ensure=False) return {'provider_location': loc} def ensure_export(self, _ctx, volume): """Recreate parts of export if necessary. :param volume: reference of volume to be exported """ self._do_export(_ctx, volume, ensure=True) def remove_export(self, _ctx, volume): """Destroy all resources created to export zvol. :param volume: reference of volume to be unexported """ zvol_name = self._get_zvol_name(volume['name']) target_name = self._get_target_name(volume['name']) target_group_name = self._get_target_group_name(volume['name']) self.nms.scsidisk.delete_lu(zvol_name) try: self.nms.stmf.destroy_targetgroup(target_group_name) except nexenta.NexentaException as exc: # We assume that target group is already gone LOG.warn(_('Got error trying to destroy target group' ' %(target_group)s, assuming it is ' 'already gone: %(exc)s'), {'target_group': target_group_name, 'exc': exc}) try: self.nms.iscsitarget.delete_target(target_name) except nexenta.NexentaException as exc: # We assume that target is gone as well LOG.warn(_('Got error trying to delete target %(target)s,' ' assuming it is already gone: %(exc)s'), {'target': target_name, 'exc': exc}) def copy_image_to_volume(self, context, volume, image_service, image_id): """Fetch the image from image_service and write it to the volume.""" raise NotImplementedError() def copy_volume_to_image(self, context, volume, image_service, image_meta): """Copy the volume to the specified image.""" raise NotImplementedError() def create_cloned_volume(self, volume, src_vref): """Creates a clone of the specified volume.""" raise NotImplementedError()
# -*- coding: utf-8 -*- from django.conf import settings from django.http import HttpResponse from django.test import TestCase, override_settings from django_auth_ldap.backend import _LDAPUser from django.test.client import RequestFactory from typing import Any, Callable, Dict, Optional, Text from builtins import object from oauth2client.crypt import AppIdentityError from django.core import signing from django.core.urlresolvers import reverse import jwt import mock import re from zerver.forms import HomepageForm from zerver.lib.actions import do_deactivate_realm, do_deactivate_user, \ do_reactivate_realm, do_reactivate_user from zerver.lib.initial_password import initial_password from zerver.lib.session_user import get_session_dict_user from zerver.lib.test_classes import ( ZulipTestCase, ) from zerver.models import \ get_realm, get_user_profile_by_email, email_to_username, UserProfile, \ PreregistrationUser, Realm from confirmation.models import Confirmation from zproject.backends import ZulipDummyBackend, EmailAuthBackend, \ GoogleMobileOauth2Backend, ZulipRemoteUserBackend, ZulipLDAPAuthBackend, \ ZulipLDAPUserPopulator, DevAuthBackend, GitHubAuthBackend, ZulipAuthMixin, \ dev_auth_enabled, password_auth_enabled, github_auth_enabled, \ SocialAuthMixin, AUTH_BACKEND_NAME_MAP from zerver.views.auth import maybe_send_to_registration from social_core.exceptions import AuthFailed from social_django.strategy import DjangoStrategy from social_django.storage import BaseDjangoStorage from social_core.backends.github import GithubOrganizationOAuth2, GithubTeamOAuth2, \ GithubOAuth2 from six.moves import urllib from six.moves.http_cookies import SimpleCookie import ujson from zerver.lib.test_helpers import MockLDAP class AuthBackendTest(TestCase): def verify_backend(self, backend, good_args=None, good_kwargs=None, bad_kwargs=None, email_to_username=None): # type: (Any, List[Any], Dict[str, Any], Dict[str, Any], Callable[[Text], Text]) -> None if good_args is None: good_args = [] if good_kwargs is None: good_kwargs = {} email = u"hamlet@zulip.com" user_profile = get_user_profile_by_email(email) username = email if email_to_username is not None: username = email_to_username(email) # If bad_kwargs was specified, verify auth fails in that case if bad_kwargs is not None: self.assertIsNone(backend.authenticate(username, **bad_kwargs)) # Verify auth works result = backend.authenticate(username, *good_args, **good_kwargs) self.assertEqual(user_profile, result) # Verify auth fails with a deactivated user do_deactivate_user(user_profile) self.assertIsNone(backend.authenticate(username, *good_args, **good_kwargs)) # Reactivate the user and verify auth works again do_reactivate_user(user_profile) result = backend.authenticate(username, *good_args, **good_kwargs) self.assertEqual(user_profile, result) # Verify auth fails with a deactivated realm do_deactivate_realm(user_profile.realm) self.assertIsNone(backend.authenticate(username, *good_args, **good_kwargs)) # Verify auth works again after reactivating the realm do_reactivate_realm(user_profile.realm) result = backend.authenticate(username, *good_args, **good_kwargs) self.assertEqual(user_profile, result) # ZulipDummyBackend isn't a real backend so the remainder # doesn't make sense for it if isinstance(backend, ZulipDummyBackend): return # Verify auth fails if the auth backend is disabled on server with self.settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipDummyBackend',)): self.assertIsNone(backend.authenticate(username, *good_args, **good_kwargs)) # Verify auth fails if the auth backend is disabled for the realm for backend_name in AUTH_BACKEND_NAME_MAP.keys(): if isinstance(backend, AUTH_BACKEND_NAME_MAP[backend_name]): break index = getattr(user_profile.realm.authentication_methods, backend_name).number user_profile.realm.authentication_methods.set_bit(index, False) user_profile.realm.save() self.assertIsNone(backend.authenticate(username, *good_args, **good_kwargs)) user_profile.realm.authentication_methods.set_bit(index, True) user_profile.realm.save() def test_dummy_backend(self): # type: () -> None self.verify_backend(ZulipDummyBackend(), good_kwargs=dict(use_dummy_backend=True), bad_kwargs=dict(use_dummy_backend=False)) def setup_subdomain(self, user_profile): # type: (UserProfile) -> None realm = user_profile.realm realm.string_id = 'zulip' realm.save() def test_email_auth_backend(self): # type: () -> None email = "hamlet@zulip.com" user_profile = get_user_profile_by_email(email) password = "testpassword" user_profile.set_password(password) user_profile.save() self.setup_subdomain(user_profile) self.verify_backend(EmailAuthBackend(), bad_kwargs=dict(password=''), good_kwargs=dict(password=password)) # Subdomain is ignored when feature is not enabled self.verify_backend(EmailAuthBackend(), good_kwargs=dict(password=password, realm_subdomain='acme', return_data=dict())) with self.settings(REALMS_HAVE_SUBDOMAINS=True): # With subdomains, authenticating with the right subdomain # works; using the wrong subdomain doesn't self.verify_backend(EmailAuthBackend(), good_kwargs=dict(password=password, realm_subdomain='zulip', return_data=dict()), bad_kwargs=dict(password=password, realm_subdomain='acme', return_data=dict())) # Things work normally in the event that we're using a # non-subdomain login page, even if subdomains are enabled self.verify_backend(EmailAuthBackend(), bad_kwargs=dict(password="wrong"), good_kwargs=dict(password=password)) def test_email_auth_backend_disabled_password_auth(self): # type: () -> None email = u"hamlet@zulip.com" user_profile = get_user_profile_by_email(email) password = "testpassword" user_profile.set_password(password) user_profile.save() # Verify if a realm has password auth disabled, correct password is rejected with mock.patch('zproject.backends.password_auth_enabled', return_value=False): self.assertIsNone(EmailAuthBackend().authenticate(email, password)) @override_settings(AUTHENTICATION_BACKENDS=('zproject.backends.GoogleMobileOauth2Backend',)) def test_google_backend(self): # type: () -> None email = "hamlet@zulip.com" backend = GoogleMobileOauth2Backend() payload = dict(email_verified=True, email=email) user_profile = get_user_profile_by_email(email) self.setup_subdomain(user_profile) with mock.patch('apiclient.sample_tools.client.verify_id_token', return_value=payload): self.verify_backend(backend) # With REALMS_HAVE_SUBDOMAINS off, subdomain is ignored with mock.patch('apiclient.sample_tools.client.verify_id_token', return_value=payload): self.verify_backend(backend, good_kwargs=dict(realm_subdomain='acme')) with self.settings(REALMS_HAVE_SUBDOMAINS=True): # With subdomains, authenticating with the right subdomain # works; using the wrong subdomain doesn't with mock.patch('apiclient.sample_tools.client.verify_id_token', return_value=payload): self.verify_backend(backend, good_kwargs=dict(realm_subdomain="zulip"), bad_kwargs=dict(realm_subdomain='acme')) # Verify valid_attestation parameter is set correctly unverified_payload = dict(email_verified=False) with mock.patch('apiclient.sample_tools.client.verify_id_token', return_value=unverified_payload): ret = dict() # type: Dict[str, str] result = backend.authenticate(return_data=ret) self.assertIsNone(result) self.assertFalse(ret["valid_attestation"]) nonexistent_user_payload = dict(email_verified=True, email="invalid@zulip.com") with mock.patch('apiclient.sample_tools.client.verify_id_token', return_value=nonexistent_user_payload): ret = dict() result = backend.authenticate(return_data=ret) self.assertIsNone(result) self.assertTrue(ret["valid_attestation"]) with mock.patch('apiclient.sample_tools.client.verify_id_token', side_effect=AppIdentityError): ret = dict() result = backend.authenticate(return_data=ret) self.assertIsNone(result) @override_settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipLDAPAuthBackend',)) def test_ldap_backend(self): # type: () -> None email = "hamlet@zulip.com" password = "test_password" user_profile = get_user_profile_by_email(email) self.setup_subdomain(user_profile) backend = ZulipLDAPAuthBackend() # Test LDAP auth fails when LDAP server rejects password with mock.patch('django_auth_ldap.backend._LDAPUser._authenticate_user_dn', side_effect=_LDAPUser.AuthenticationFailed("Failed")), ( mock.patch('django_auth_ldap.backend._LDAPUser._check_requirements')), ( mock.patch('django_auth_ldap.backend._LDAPUser._get_user_attrs', return_value=dict(full_name=['Hamlet']))): self.assertIsNone(backend.authenticate(email, password)) # For this backend, we mock the internals of django_auth_ldap with mock.patch('django_auth_ldap.backend._LDAPUser._authenticate_user_dn'), ( mock.patch('django_auth_ldap.backend._LDAPUser._check_requirements')), ( mock.patch('django_auth_ldap.backend._LDAPUser._get_user_attrs', return_value=dict(full_name=['Hamlet']))): self.verify_backend(backend, good_kwargs=dict(password=password)) with mock.patch('django_auth_ldap.backend._LDAPUser._authenticate_user_dn'), ( mock.patch('django_auth_ldap.backend._LDAPUser._check_requirements')), ( mock.patch('django_auth_ldap.backend._LDAPUser._get_user_attrs', return_value=dict(full_name=['Hamlet']))): self.verify_backend(backend, good_kwargs=dict(password=password, realm_subdomain='acme')) with self.settings(REALMS_HAVE_SUBDOMAINS=True): # With subdomains, authenticating with the right subdomain # works; using the wrong subdomain doesn't with mock.patch('django_auth_ldap.backend._LDAPUser._authenticate_user_dn'), ( mock.patch('django_auth_ldap.backend._LDAPUser._check_requirements')), ( mock.patch('django_auth_ldap.backend._LDAPUser._get_user_attrs', return_value=dict(full_name=['Hamlet']))): self.verify_backend(backend, bad_kwargs=dict(password=password, realm_subdomain='acme'), good_kwargs=dict(password=password, realm_subdomain='zulip')) def test_devauth_backend(self): # type: () -> None self.verify_backend(DevAuthBackend()) @override_settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipRemoteUserBackend',)) def test_remote_user_backend(self): # type: () -> None self.setup_subdomain(get_user_profile_by_email(u'hamlet@zulip.com')) self.verify_backend(ZulipRemoteUserBackend(), good_kwargs=dict(realm_subdomain='acme')) with self.settings(REALMS_HAVE_SUBDOMAINS=True): # With subdomains, authenticating with the right subdomain # works; using the wrong subdomain doesn't self.verify_backend(ZulipRemoteUserBackend(), good_kwargs=dict(realm_subdomain='zulip'), bad_kwargs=dict(realm_subdomain='acme')) @override_settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipRemoteUserBackend',)) def test_remote_user_backend_sso_append_domain(self): # type: () -> None self.setup_subdomain(get_user_profile_by_email(u'hamlet@zulip.com')) with self.settings(SSO_APPEND_DOMAIN='zulip.com'): self.verify_backend(ZulipRemoteUserBackend(), email_to_username=email_to_username, good_kwargs=dict(realm_subdomain='acme')) with self.settings(REALMS_HAVE_SUBDOMAINS=True): # With subdomains, authenticating with the right subdomain # works; using the wrong subdomain doesn't with self.settings(SSO_APPEND_DOMAIN='zulip.com'): self.verify_backend(ZulipRemoteUserBackend(), email_to_username=email_to_username, good_kwargs=dict(realm_subdomain='zulip'), bad_kwargs=dict(realm_subdomain='acme')) @override_settings(AUTHENTICATION_BACKENDS=('zproject.backends.GitHubAuthBackend',)) def test_github_backend(self): # type: () -> None email = 'hamlet@zulip.com' self.setup_subdomain(get_user_profile_by_email(email)) good_kwargs = dict(response=dict(email=email), return_data=dict(), realm_subdomain='acme') self.verify_backend(GitHubAuthBackend(), good_kwargs=good_kwargs, bad_kwargs=dict()) with self.settings(REALMS_HAVE_SUBDOMAINS=True): # With subdomains, authenticating with the right subdomain # works; using the wrong subdomain doesn't good_kwargs = dict(response=dict(email=email), return_data=dict(), realm_subdomain='zulip') bad_kwargs = dict(response=dict(email=email), return_data=dict(), realm_subdomain='acme') self.verify_backend(GitHubAuthBackend(), good_kwargs=good_kwargs, bad_kwargs=bad_kwargs) class SocialAuthMixinTest(ZulipTestCase): def test_social_auth_mixing(self): # type: () -> None mixin = SocialAuthMixin() with self.assertRaises(NotImplementedError): mixin.get_email_address() with self.assertRaises(NotImplementedError): mixin.get_full_name() class GitHubAuthBackendTest(ZulipTestCase): def setUp(self): # type: () -> None self.email = 'hamlet@zulip.com' self.name = 'Hamlet' self.backend = GitHubAuthBackend() self.backend.strategy = DjangoStrategy(storage=BaseDjangoStorage()) self.user_profile = get_user_profile_by_email(self.email) self.user_profile.backend = self.backend rf = RequestFactory() request = rf.get('/complete') request.session = {} request.get_host = lambda: 'acme.testserver' request.user = self.user_profile self.backend.strategy.request = request def do_auth(self, *args, **kwargs): # type: (*Any, **Any) -> UserProfile with self.settings(AUTHENTICATION_BACKENDS=('zproject.backends.GitHubAuthBackend',)): return self.backend.authenticate(*args, **kwargs) def test_github_auth_enabled(self): # type: () -> None with self.settings(AUTHENTICATION_BACKENDS=('zproject.backends.GitHubAuthBackend',)): self.assertTrue(github_auth_enabled()) def test_full_name_with_missing_key(self): # type: () -> None self.assertEqual(self.backend.get_full_name(), '') def test_github_backend_do_auth_without_subdomains(self): # type: () -> None with mock.patch('social_core.backends.github.GithubOAuth2.do_auth', side_effect=self.do_auth), \ mock.patch('zerver.views.auth.login'): response = dict(email=self.email, name=self.name) result = self.backend.do_auth(response=response) self.assertNotIn('subdomain=1', result.url) def test_github_backend_do_auth_with_non_existing_subdomain(self): # type: () -> None with mock.patch('social_core.backends.github.GithubOAuth2.do_auth', side_effect=self.do_auth): with self.settings(REALMS_HAVE_SUBDOMAINS=True): self.backend.strategy.session_set('subdomain', 'test') response = dict(email=self.email, name=self.name) result = self.backend.do_auth(response=response) self.assertIn('subdomain=1', result.url) def test_github_backend_do_auth_with_subdomains(self): # type: () -> None with mock.patch('social_core.backends.github.GithubOAuth2.do_auth', side_effect=self.do_auth): with self.settings(REALMS_HAVE_SUBDOMAINS=True): self.backend.strategy.session_set('subdomain', 'zulip') response = dict(email=self.email, name=self.name) result = self.backend.do_auth(response=response) self.assertEqual('http://zulip.testserver/accounts/login/subdomain/', result.url) def test_github_backend_do_auth_for_default(self): # type: () -> None with mock.patch('social_core.backends.github.GithubOAuth2.do_auth', side_effect=self.do_auth), \ mock.patch('zproject.backends.SocialAuthMixin.process_do_auth') as result: response = dict(email=self.email, name=self.name) self.backend.do_auth('fake-access-token', response=response) kwargs = {'realm_subdomain': 'acme', 'response': response, 'return_data': {}} result.assert_called_with(self.user_profile, 'fake-access-token', **kwargs) def test_github_backend_do_auth_for_team(self): # type: () -> None with mock.patch('social_core.backends.github.GithubTeamOAuth2.do_auth', side_effect=self.do_auth), \ mock.patch('zproject.backends.SocialAuthMixin.process_do_auth') as result: response = dict(email=self.email, name=self.name) with self.settings(SOCIAL_AUTH_GITHUB_TEAM_ID='zulip-webapp'): self.backend.do_auth('fake-access-token', response=response) kwargs = {'realm_subdomain': 'acme', 'response': response, 'return_data': {}} result.assert_called_with(self.user_profile, 'fake-access-token', **kwargs) def test_github_backend_do_auth_for_team_auth_failed(self): # type: () -> None with mock.patch('social_core.backends.github.GithubTeamOAuth2.do_auth', side_effect=AuthFailed('Not found')), \ mock.patch('logging.info'), \ mock.patch('zproject.backends.SocialAuthMixin.process_do_auth') as result: response = dict(email=self.email, name=self.name) with self.settings(SOCIAL_AUTH_GITHUB_TEAM_ID='zulip-webapp'): self.backend.do_auth('fake-access-token', response=response) kwargs = {'realm_subdomain': 'acme', 'response': response, 'return_data': {}} result.assert_called_with(None, 'fake-access-token', **kwargs) def test_github_backend_do_auth_for_org(self): # type: () -> None with mock.patch('social_core.backends.github.GithubOrganizationOAuth2.do_auth', side_effect=self.do_auth), \ mock.patch('zproject.backends.SocialAuthMixin.process_do_auth') as result: response = dict(email=self.email, name=self.name) with self.settings(SOCIAL_AUTH_GITHUB_ORG_NAME='Zulip'): self.backend.do_auth('fake-access-token', response=response) kwargs = {'realm_subdomain': 'acme', 'response': response, 'return_data': {}} result.assert_called_with(self.user_profile, 'fake-access-token', **kwargs) def test_github_backend_do_auth_for_org_auth_failed(self): # type: () -> None with mock.patch('social_core.backends.github.GithubOrganizationOAuth2.do_auth', side_effect=AuthFailed('Not found')), \ mock.patch('logging.info'), \ mock.patch('zproject.backends.SocialAuthMixin.process_do_auth') as result: response = dict(email=self.email, name=self.name) with self.settings(SOCIAL_AUTH_GITHUB_ORG_NAME='Zulip'): self.backend.do_auth('fake-access-token', response=response) kwargs = {'realm_subdomain': 'acme', 'response': response, 'return_data': {}} result.assert_called_with(None, 'fake-access-token', **kwargs) def test_github_backend_authenticate_nonexisting_user(self): # type: () -> None with mock.patch('zproject.backends.get_user_profile_by_email', side_effect=UserProfile.DoesNotExist("Do not exist")): response = dict(email=self.email, name=self.name) return_data = dict() # type: Dict[str, Any] user = self.backend.authenticate(return_data=return_data, response=response) self.assertIs(user, None) self.assertTrue(return_data['valid_attestation']) def test_github_backend_inactive_user(self): # type: () -> None def do_auth_inactive(*args, **kwargs): # type: (*Any, **Any) -> UserProfile return_data = kwargs['return_data'] return_data['inactive_user'] = True return self.user_profile with mock.patch('zerver.views.auth.login_or_register_remote_user') as result, \ mock.patch('social_core.backends.github.GithubOAuth2.do_auth', side_effect=do_auth_inactive): response = dict(email=self.email, name=self.name) user = self.backend.do_auth(response=response) result.assert_not_called() self.assertIs(user, None) def test_github_backend_new_user(self): # type: () -> None rf = RequestFactory() request = rf.get('/complete') request.session = {} request.user = self.user_profile self.backend.strategy.request = request def do_auth(*args, **kwargs): # type: (*Any, **Any) -> UserProfile return_data = kwargs['return_data'] return_data['valid_attestation'] = True return None with mock.patch('social_core.backends.github.GithubOAuth2.do_auth', side_effect=do_auth): response = dict(email='nonexisting@phantom.com', name='Ghost') result = self.backend.do_auth(response=response) self.assert_in_response('action="/register/"', result) self.assert_in_response('Your email address does not correspond to any ' 'existing organization.', result) def test_login_url(self): # type: () -> None result = self.client_get('/accounts/login/social/github') self.assertIn(reverse('social:begin', args=['github']), result.url) class ResponseMock(object): def __init__(self, status_code, data): # type: (int, Any) -> None self.status_code = status_code self.data = data def json(self): # type: () -> str return self.data @property def text(self): # type: () -> str return "Response text" class GoogleOAuthTest(ZulipTestCase): def google_oauth2_test(self, token_response, account_response, subdomain=None): # type: (ResponseMock, ResponseMock, Optional[str]) -> HttpResponse url = "/accounts/login/google/send/" if subdomain is not None: url += "?subdomain=" + subdomain result = self.client_get(url) self.assertEqual(result.status_code, 302) if 'google' not in result.url: return result self.client.cookies = result.cookies # Now extract the CSRF token from the redirect URL parsed_url = urllib.parse.urlparse(result.url) csrf_state = urllib.parse.parse_qs(parsed_url.query)['state'] with mock.patch("requests.post", return_value=token_response), ( mock.patch("requests.get", return_value=account_response)): result = self.client_get("/accounts/login/google/done/", dict(state=csrf_state)) return result class GoogleSubdomainLoginTest(GoogleOAuthTest): def get_signed_subdomain_cookie(self, data): # type: (Dict[str, str]) -> Dict[str, str] key = 'subdomain.signature' salt = key + 'zerver.views.auth' value = ujson.dumps(data) return {key: signing.get_cookie_signer(salt=salt).sign(value)} def unsign_subdomain_cookie(self, result): # type: (HttpResponse) -> Dict[str, Any] key = 'subdomain.signature' salt = key + 'zerver.views.auth' cookie = result.cookies.get(key) value = signing.get_cookie_signer(salt=salt).unsign(cookie.value, max_age=15) return ujson.loads(value) def test_google_oauth2_start(self): # type: () -> None with mock.patch('zerver.views.auth.get_subdomain', return_value='zulip'): result = self.client_get('/accounts/login/google/') self.assertEqual(result.status_code, 302) parsed_url = urllib.parse.urlparse(result.url) subdomain = urllib.parse.parse_qs(parsed_url.query)['subdomain'] self.assertEqual(subdomain, ['zulip']) def test_google_oauth2_success(self): # type: () -> None token_response = ResponseMock(200, {'access_token': "unique_token"}) account_data = dict(name=dict(formatted="Full Name"), emails=[dict(type="account", value="hamlet@zulip.com")]) account_response = ResponseMock(200, account_data) with self.settings(REALMS_HAVE_SUBDOMAINS=True): result = self.google_oauth2_test(token_response, account_response, 'zulip') data = self.unsign_subdomain_cookie(result) self.assertEqual(data['email'], 'hamlet@zulip.com') self.assertEqual(data['name'], 'Full Name') self.assertEqual(data['subdomain'], 'zulip') self.assertEqual(result.status_code, 302) parsed_url = urllib.parse.urlparse(result.url) uri = "{}://{}{}".format(parsed_url.scheme, parsed_url.netloc, parsed_url.path) self.assertEqual(uri, 'http://zulip.testserver/accounts/login/subdomain/') def test_log_into_subdomain(self): # type: () -> None data = {'name': 'Full Name', 'email': 'hamlet@zulip.com', 'subdomain': 'zulip'} self.client.cookies = SimpleCookie(self.get_signed_subdomain_cookie(data)) with mock.patch('zerver.views.auth.get_subdomain', return_value='zulip'): result = self.client_get('/accounts/login/subdomain/') self.assertEqual(result.status_code, 302) user_profile = get_user_profile_by_email('hamlet@zulip.com') self.assertEqual(get_session_dict_user(self.client.session), user_profile.id) def test_user_cannot_log_into_nonexisting_realm(self): # type: () -> None token_response = ResponseMock(200, {'access_token': "unique_token"}) account_data = dict(name=dict(formatted="Full Name"), emails=[dict(type="account", value="hamlet@zulip.com")]) account_response = ResponseMock(200, account_data) result = self.google_oauth2_test(token_response, account_response, 'acme') self.assertEqual(result.status_code, 302) self.assertIn('subdomain=1', result.url) def test_user_cannot_log_into_wrong_subdomain(self): # type: () -> None data = {'name': 'Full Name', 'email': 'hamlet@zulip.com', 'subdomain': 'acme'} self.client.cookies = SimpleCookie(self.get_signed_subdomain_cookie(data)) with mock.patch('zerver.views.auth.get_subdomain', return_value='zulip'): result = self.client_get('/accounts/login/subdomain/') self.assertEqual(result.status_code, 400) def test_log_into_subdomain_when_signature_is_bad(self): # type: () -> None self.client.cookies = SimpleCookie({'subdomain.signature': 'invlaid'}) with mock.patch('zerver.views.auth.get_subdomain', return_value='zulip'): result = self.client_get('/accounts/login/subdomain/') self.assertEqual(result.status_code, 400) def test_log_into_subdomain_when_state_is_not_passed(self): # type: () -> None with mock.patch('zerver.views.auth.get_subdomain', return_value='zulip'): result = self.client_get('/accounts/login/subdomain/') self.assertEqual(result.status_code, 400) def test_google_oauth2_registration(self): # type: () -> None """If the user doesn't exist yet, Google auth can be used to register an account""" with self.settings(REALMS_HAVE_SUBDOMAINS=True), ( mock.patch('zerver.views.auth.get_subdomain', return_value='zulip')), ( mock.patch('zerver.views.registration.get_subdomain', return_value='zulip')): email = "newuser@zulip.com" token_response = ResponseMock(200, {'access_token': "unique_token"}) account_data = dict(name=dict(formatted="Full Name"), emails=[dict(type="account", value=email)]) account_response = ResponseMock(200, account_data) result = self.google_oauth2_test(token_response, account_response, 'zulip') data = self.unsign_subdomain_cookie(result) self.assertEqual(data['email'], email) self.assertEqual(data['name'], 'Full Name') self.assertEqual(data['subdomain'], 'zulip') self.assertEqual(result.status_code, 302) parsed_url = urllib.parse.urlparse(result.url) uri = "{}://{}{}".format(parsed_url.scheme, parsed_url.netloc, parsed_url.path) self.assertEqual(uri, 'http://zulip.testserver/accounts/login/subdomain/') result = self.client_get(result.url) result = self.client_get(result.url) # Call the confirmation url. key_match = re.search('value="(?P<key>[0-9a-f]+)" name="key"', result.content.decode("utf-8")) name_match = re.search('value="(?P<name>[^"]+)" name="full_name"', result.content.decode("utf-8")) # This goes through a brief stop on a page that auto-submits via JS result = self.client_post('/accounts/register/', {'full_name': name_match.group("name"), 'key': key_match.group("key"), 'from_confirmation': "1"}) self.assertEqual(result.status_code, 200) result = self.client_post('/accounts/register/', {'full_name': "New User", 'password': 'test_password', 'key': key_match.group("key"), 'terms': True}) self.assertEqual(result.status_code, 302) self.assertEqual(result.url, "http://zulip.testserver/") user_profile = get_user_profile_by_email(email) self.assertEqual(get_session_dict_user(self.client.session), user_profile.id) class GoogleLoginTest(GoogleOAuthTest): def test_google_oauth2_success(self): # type: () -> None token_response = ResponseMock(200, {'access_token': "unique_token"}) account_data = dict(name=dict(formatted="Full Name"), emails=[dict(type="account", value="hamlet@zulip.com")]) account_response = ResponseMock(200, account_data) self.google_oauth2_test(token_response, account_response) user_profile = get_user_profile_by_email('hamlet@zulip.com') self.assertEqual(get_session_dict_user(self.client.session), user_profile.id) def test_google_oauth2_registration(self): # type: () -> None """If the user doesn't exist yet, Google auth can be used to register an account""" email = "newuser@zulip.com" token_response = ResponseMock(200, {'access_token': "unique_token"}) account_data = dict(name=dict(formatted="Full Name"), emails=[dict(type="account", value=email)]) account_response = ResponseMock(200, account_data) result = self.google_oauth2_test(token_response, account_response) self.assertEqual(result.status_code, 302) result = self.client_get(result.url) key_match = re.search('value="(?P<key>[0-9a-f]+)" name="key"', result.content.decode("utf-8")) name_match = re.search('value="(?P<name>[^"]+)" name="full_name"', result.content.decode("utf-8")) # This goes through a brief stop on a page that auto-submits via JS result = self.client_post('/accounts/register/', {'full_name': name_match.group("name"), 'key': key_match.group("key"), 'from_confirmation': "1"}) self.assertEqual(result.status_code, 200) result = self.client_post('/accounts/register/', {'full_name': "New User", 'password': 'test_password', 'key': key_match.group("key"), 'terms': True}) self.assertEqual(result.status_code, 302) self.assertEqual(result.url, "http://testserver/") def test_google_oauth2_wrong_subdomain(self): # type: () -> None token_response = ResponseMock(200, {'access_token': "unique_token"}) account_data = dict(name=dict(formatted="Full Name"), emails=[dict(type="account", value="hamlet@zulip.com")]) account_response = ResponseMock(200, account_data) with self.settings(REALMS_HAVE_SUBDOMAINS=True): result = self.google_oauth2_test(token_response, account_response) self.assertIn('subdomain=1', result.url) def test_google_oauth2_400_token_response(self): # type: () -> None token_response = ResponseMock(400, {}) with mock.patch("logging.warning") as m: result = self.google_oauth2_test(token_response, None) self.assertEqual(result.status_code, 400) self.assertEqual(m.call_args_list[0][0][0], "User error converting Google oauth2 login to token: Response text") def test_google_oauth2_500_token_response(self): # type: () -> None token_response = ResponseMock(500, {}) with mock.patch("logging.error") as m: result = self.google_oauth2_test(token_response, None) self.assertEqual(result.status_code, 400) self.assertEqual(m.call_args_list[0][0][0], "Could not convert google oauth2 code to access_token: Response text") def test_google_oauth2_400_account_response(self): # type: () -> None token_response = ResponseMock(200, {'access_token': "unique_token"}) account_response = ResponseMock(400, {}) with mock.patch("logging.warning") as m: result = self.google_oauth2_test(token_response, account_response) self.assertEqual(result.status_code, 400) self.assertEqual(m.call_args_list[0][0][0], "Google login failed making info API call: Response text") def test_google_oauth2_500_account_response(self): # type: () -> None token_response = ResponseMock(200, {'access_token': "unique_token"}) account_response = ResponseMock(500, {}) with mock.patch("logging.error") as m: result = self.google_oauth2_test(token_response, account_response) self.assertEqual(result.status_code, 400) self.assertEqual(m.call_args_list[0][0][0], "Google login failed making API call: Response text") def test_google_oauth2_no_fullname(self): # type: () -> None token_response = ResponseMock(200, {'access_token': "unique_token"}) account_data = dict(name=dict(givenName="Test", familyName="User"), emails=[dict(type="account", value="hamlet@zulip.com")]) account_response = ResponseMock(200, account_data) self.google_oauth2_test(token_response, account_response) user_profile = get_user_profile_by_email('hamlet@zulip.com') self.assertEqual(get_session_dict_user(self.client.session), user_profile.id) def test_google_oauth2_account_response_no_email(self): # type: () -> None token_response = ResponseMock(200, {'access_token': "unique_token"}) account_data = dict(name=dict(formatted="Full Name"), emails=[]) account_response = ResponseMock(200, account_data) with mock.patch("logging.error") as m: result = self.google_oauth2_test(token_response, account_response) self.assertEqual(result.status_code, 400) self.assertIn("Google oauth2 account email not found:", m.call_args_list[0][0][0]) def test_google_oauth2_error_access_denied(self): # type: () -> None result = self.client_get("/accounts/login/google/done/?error=access_denied") self.assertEqual(result.status_code, 302) path = urllib.parse.urlparse(result.url).path self.assertEqual(path, "/") def test_google_oauth2_error_other(self): # type: () -> None with mock.patch("logging.warning") as m: result = self.client_get("/accounts/login/google/done/?error=some_other_error") self.assertEqual(result.status_code, 400) self.assertEqual(m.call_args_list[0][0][0], "Error from google oauth2 login: some_other_error") def test_google_oauth2_missing_csrf(self): # type: () -> None with mock.patch("logging.warning") as m: result = self.client_get("/accounts/login/google/done/") self.assertEqual(result.status_code, 400) self.assertEqual(m.call_args_list[0][0][0], 'Missing Google oauth2 CSRF state') def test_google_oauth2_csrf_malformed(self): # type: () -> None with mock.patch("logging.warning") as m: result = self.client_get("/accounts/login/google/done/?state=badstate") self.assertEqual(result.status_code, 400) self.assertEqual(m.call_args_list[0][0][0], 'Missing Google oauth2 CSRF state') def test_google_oauth2_csrf_badstate(self): # type: () -> None with mock.patch("logging.warning") as m: result = self.client_get("/accounts/login/google/done/?state=badstate:otherbadstate:") self.assertEqual(result.status_code, 400) self.assertEqual(m.call_args_list[0][0][0], 'Google oauth2 CSRF error') class FetchAPIKeyTest(ZulipTestCase): def setUp(self): # type: () -> None self.email = "hamlet@zulip.com" self.user_profile = get_user_profile_by_email(self.email) def test_success(self): # type: () -> None result = self.client_post("/api/v1/fetch_api_key", dict(username=self.email, password=initial_password(self.email))) self.assert_json_success(result) def test_wrong_password(self): # type: () -> None result = self.client_post("/api/v1/fetch_api_key", dict(username=self.email, password="wrong")) self.assert_json_error(result, "Your username or password is incorrect.", 403) def test_password_auth_disabled(self): # type: () -> None with mock.patch('zproject.backends.password_auth_enabled', return_value=False): result = self.client_post("/api/v1/fetch_api_key", dict(username=self.email, password=initial_password(self.email))) self.assert_json_error_contains(result, "Password auth is disabled", 403) @override_settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipLDAPAuthBackend',)) def test_ldap_auth_email_auth_disabled_success(self): # type: () -> None ldap_patcher = mock.patch('django_auth_ldap.config.ldap.initialize') self.mock_initialize = ldap_patcher.start() self.mock_ldap = MockLDAP() self.mock_initialize.return_value = self.mock_ldap self.backend = ZulipLDAPAuthBackend() self.mock_ldap.directory = { 'uid=hamlet,ou=users,dc=zulip,dc=com': { 'userPassword': 'testing' } } with self.settings( LDAP_APPEND_DOMAIN='zulip.com', AUTH_LDAP_BIND_PASSWORD='', AUTH_LDAP_USER_DN_TEMPLATE='uid=%(user)s,ou=users,dc=zulip,dc=com'): result = self.client_post("/api/v1/fetch_api_key", dict(username=self.email, password="testing")) self.assert_json_success(result) self.mock_ldap.reset() self.mock_initialize.stop() def test_inactive_user(self): # type: () -> None do_deactivate_user(self.user_profile) result = self.client_post("/api/v1/fetch_api_key", dict(username=self.email, password=initial_password(self.email))) self.assert_json_error_contains(result, "Your account has been disabled", 403) def test_deactivated_realm(self): # type: () -> None do_deactivate_realm(self.user_profile.realm) result = self.client_post("/api/v1/fetch_api_key", dict(username=self.email, password=initial_password(self.email))) self.assert_json_error_contains(result, "Your realm has been deactivated", 403) class DevFetchAPIKeyTest(ZulipTestCase): def setUp(self): # type: () -> None self.email = "hamlet@zulip.com" self.user_profile = get_user_profile_by_email(self.email) def test_success(self): # type: () -> None result = self.client_post("/api/v1/dev_fetch_api_key", dict(username=self.email)) self.assert_json_success(result) data = ujson.loads(result.content) self.assertEqual(data["email"], self.email) self.assertEqual(data['api_key'], self.user_profile.api_key) def test_inactive_user(self): # type: () -> None do_deactivate_user(self.user_profile) result = self.client_post("/api/v1/dev_fetch_api_key", dict(username=self.email)) self.assert_json_error_contains(result, "Your account has been disabled", 403) def test_deactivated_realm(self): # type: () -> None do_deactivate_realm(self.user_profile.realm) result = self.client_post("/api/v1/dev_fetch_api_key", dict(username=self.email)) self.assert_json_error_contains(result, "Your realm has been deactivated", 403) def test_dev_auth_disabled(self): # type: () -> None with mock.patch('zerver.views.auth.dev_auth_enabled', return_value=False): result = self.client_post("/api/v1/dev_fetch_api_key", dict(username=self.email)) self.assert_json_error_contains(result, "Dev environment not enabled.", 400) class DevGetEmailsTest(ZulipTestCase): def test_success(self): # type: () -> None result = self.client_get("/api/v1/dev_get_emails") self.assert_json_success(result) self.assert_in_response("direct_admins", result) self.assert_in_response("direct_users", result) def test_dev_auth_disabled(self): # type: () -> None with mock.patch('zerver.views.auth.dev_auth_enabled', return_value=False): result = self.client_get("/api/v1/dev_get_emails") self.assert_json_error_contains(result, "Dev environment not enabled.", 400) class FetchAuthBackends(ZulipTestCase): def test_fetch_auth_backend_format(self): # type: () -> None result = self.client_get("/api/v1/get_auth_backends") self.assert_json_success(result) data = ujson.loads(result.content) self.assertEqual(set(data.keys()), {'msg', 'password', 'google', 'dev', 'result'}) for backend in set(data.keys()) - {'msg', 'result'}: self.assertTrue(isinstance(data[backend], bool)) def test_fetch_auth_backend(self): # type: () -> None backends = [GoogleMobileOauth2Backend(), DevAuthBackend()] with mock.patch('django.contrib.auth.get_backends', return_value=backends): result = self.client_get("/api/v1/get_auth_backends") self.assert_json_success(result) data = ujson.loads(result.content) self.assertEqual(data, { 'msg': '', 'password': False, 'google': True, 'dev': True, 'result': 'success', }) class TestDevAuthBackend(ZulipTestCase): def test_login_success(self): # type: () -> None email = 'hamlet@zulip.com' user_profile = get_user_profile_by_email(email) data = {'direct_email': email} result = self.client_post('/accounts/login/local/', data) self.assertEqual(result.status_code, 302) self.assertEqual(get_session_dict_user(self.client.session), user_profile.id) def test_login_failure(self): # type: () -> None email = 'hamlet@zulip.com' data = {'direct_email': email} with self.settings(AUTHENTICATION_BACKENDS=('zproject.backends.EmailAuthBackend',)): with self.assertRaisesRegex(Exception, 'Direct login not supported.'): try: with mock.patch('django.core.handlers.exception.logger'): self.client_post('/accounts/login/local/', data) except ImportError: with mock.patch('django.core.handlers.base.logger'): self.client_post('/accounts/login/local/', data) def test_login_failure_due_to_nonexistent_user(self): # type: () -> None email = 'nonexisting@zulip.com' data = {'direct_email': email} with self.assertRaisesRegex(Exception, 'User cannot login'): try: with mock.patch('django.core.handlers.exception.logger'): self.client_post('/accounts/login/local/', data) except ImportError: with mock.patch('django.core.handlers.base.logger'): self.client_post('/accounts/login/local/', data) class TestZulipRemoteUserBackend(ZulipTestCase): def test_login_success(self): # type: () -> None email = 'hamlet@zulip.com' user_profile = get_user_profile_by_email(email) with self.settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipRemoteUserBackend',)): result = self.client_post('/accounts/login/sso/', REMOTE_USER=email) self.assertEqual(result.status_code, 302) self.assertEqual(get_session_dict_user(self.client.session), user_profile.id) def test_authenticate_with_missing_user(self): # type: () -> None backend = ZulipRemoteUserBackend() self.assertIs(backend.authenticate(None), None) def test_login_success_with_sso_append_domain(self): # type: () -> None username = 'hamlet' email = 'hamlet@zulip.com' user_profile = get_user_profile_by_email(email) with self.settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipRemoteUserBackend',), SSO_APPEND_DOMAIN='zulip.com'): result = self.client_post('/accounts/login/sso/', REMOTE_USER=username) self.assertEqual(result.status_code, 302) self.assertEqual(get_session_dict_user(self.client.session), user_profile.id) def test_login_failure(self): # type: () -> None email = 'hamlet@zulip.com' result = self.client_post('/accounts/login/sso/', REMOTE_USER=email) self.assertEqual(result.status_code, 200) # This should ideally be not 200. self.assertIs(get_session_dict_user(self.client.session), None) def test_login_failure_due_to_nonexisting_user(self): # type: () -> None email = 'nonexisting@zulip.com' with self.settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipRemoteUserBackend',)): result = self.client_post('/accounts/login/sso/', REMOTE_USER=email) self.assertEqual(result.status_code, 302) self.assertIs(get_session_dict_user(self.client.session), None) def test_login_failure_due_to_missing_field(self): # type: () -> None with self.settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipRemoteUserBackend',)): result = self.client_post('/accounts/login/sso/') self.assert_json_error_contains(result, "No REMOTE_USER set.", 400) def test_login_failure_due_to_wrong_subdomain(self): # type: () -> None email = 'hamlet@zulip.com' with self.settings(REALMS_HAVE_SUBDOMAINS=True, AUTHENTICATION_BACKENDS=('zproject.backends.ZulipRemoteUserBackend',)): with mock.patch('zerver.views.auth.get_subdomain', return_value='acme'): result = self.client_post('http://testserver:9080/accounts/login/sso/', REMOTE_USER=email) self.assertEqual(result.status_code, 200) self.assertIs(get_session_dict_user(self.client.session), None) self.assertIn(b"Let's get started", result.content) def test_login_failure_due_to_empty_subdomain(self): # type: () -> None email = 'hamlet@zulip.com' with self.settings(REALMS_HAVE_SUBDOMAINS=True, AUTHENTICATION_BACKENDS=('zproject.backends.ZulipRemoteUserBackend',)): with mock.patch('zerver.views.auth.get_subdomain', return_value=''): result = self.client_post('http://testserver:9080/accounts/login/sso/', REMOTE_USER=email) self.assertEqual(result.status_code, 200) self.assertIs(get_session_dict_user(self.client.session), None) self.assertIn(b"Let's get started", result.content) def test_login_success_under_subdomains(self): # type: () -> None email = 'hamlet@zulip.com' user_profile = get_user_profile_by_email(email) with mock.patch('zerver.views.auth.get_subdomain', return_value='zulip'): with self.settings( REALMS_HAVE_SUBDOMAINS=True, AUTHENTICATION_BACKENDS=('zproject.backends.ZulipRemoteUserBackend',)): result = self.client_post('/accounts/login/sso/', REMOTE_USER=email) self.assertEqual(result.status_code, 302) self.assertIs(get_session_dict_user(self.client.session), user_profile.id) class TestJWTLogin(ZulipTestCase): """ JWT uses ZulipDummyBackend. """ def test_login_success(self): # type: () -> None payload = {'user': 'hamlet', 'realm': 'zulip.com'} with self.settings(JWT_AUTH_KEYS={'': 'key'}): email = 'hamlet@zulip.com' auth_key = settings.JWT_AUTH_KEYS[''] web_token = jwt.encode(payload, auth_key).decode('utf8') user_profile = get_user_profile_by_email(email) data = {'json_web_token': web_token} result = self.client_post('/accounts/login/jwt/', data) self.assertEqual(result.status_code, 302) self.assertEqual(get_session_dict_user(self.client.session), user_profile.id) def test_login_failure_when_user_is_missing(self): # type: () -> None payload = {'realm': 'zulip.com'} with self.settings(JWT_AUTH_KEYS={'': 'key'}): auth_key = settings.JWT_AUTH_KEYS[''] web_token = jwt.encode(payload, auth_key).decode('utf8') data = {'json_web_token': web_token} result = self.client_post('/accounts/login/jwt/', data) self.assert_json_error_contains(result, "No user specified in JSON web token claims", 400) def test_login_failure_when_realm_is_missing(self): # type: () -> None payload = {'user': 'hamlet'} with self.settings(JWT_AUTH_KEYS={'': 'key'}): auth_key = settings.JWT_AUTH_KEYS[''] web_token = jwt.encode(payload, auth_key).decode('utf8') data = {'json_web_token': web_token} result = self.client_post('/accounts/login/jwt/', data) self.assert_json_error_contains(result, "No realm specified in JSON web token claims", 400) def test_login_failure_when_key_does_not_exist(self): # type: () -> None data = {'json_web_token': 'not relevant'} result = self.client_post('/accounts/login/jwt/', data) self.assert_json_error_contains(result, "Auth key for this subdomain not found.", 400) def test_login_failure_when_key_is_missing(self): # type: () -> None with self.settings(JWT_AUTH_KEYS={'': 'key'}): result = self.client_post('/accounts/login/jwt/') self.assert_json_error_contains(result, "No JSON web token passed in request", 400) def test_login_failure_when_bad_token_is_passed(self): # type: () -> None with self.settings(JWT_AUTH_KEYS={'': 'key'}): result = self.client_post('/accounts/login/jwt/') self.assert_json_error_contains(result, "No JSON web token passed in request", 400) data = {'json_web_token': 'bad token'} result = self.client_post('/accounts/login/jwt/', data) self.assert_json_error_contains(result, "Bad JSON web token", 400) def test_login_failure_when_user_does_not_exist(self): # type: () -> None payload = {'user': 'nonexisting', 'realm': 'zulip.com'} with self.settings(JWT_AUTH_KEYS={'': 'key'}): auth_key = settings.JWT_AUTH_KEYS[''] web_token = jwt.encode(payload, auth_key).decode('utf8') data = {'json_web_token': web_token} result = self.client_post('/accounts/login/jwt/', data) self.assertEqual(result.status_code, 302) # This should ideally be not 200. self.assertIs(get_session_dict_user(self.client.session), None) def test_login_failure_due_to_wrong_subdomain(self): # type: () -> None payload = {'user': 'hamlet', 'realm': 'zulip.com'} with self.settings(REALMS_HAVE_SUBDOMAINS=True, JWT_AUTH_KEYS={'acme': 'key'}): with mock.patch('zerver.views.auth.get_subdomain', return_value='acme'): auth_key = settings.JWT_AUTH_KEYS['acme'] web_token = jwt.encode(payload, auth_key).decode('utf8') data = {'json_web_token': web_token} result = self.client_post('/accounts/login/jwt/', data) self.assert_json_error_contains(result, "Wrong subdomain", 400) self.assertEqual(get_session_dict_user(self.client.session), None) def test_login_failure_due_to_empty_subdomain(self): # type: () -> None payload = {'user': 'hamlet', 'realm': 'zulip.com'} with self.settings(REALMS_HAVE_SUBDOMAINS=True, JWT_AUTH_KEYS={'': 'key'}): with mock.patch('zerver.views.auth.get_subdomain', return_value=''): auth_key = settings.JWT_AUTH_KEYS[''] web_token = jwt.encode(payload, auth_key).decode('utf8') data = {'json_web_token': web_token} result = self.client_post('/accounts/login/jwt/', data) self.assert_json_error_contains(result, "Wrong subdomain", 400) self.assertEqual(get_session_dict_user(self.client.session), None) def test_login_success_under_subdomains(self): # type: () -> None payload = {'user': 'hamlet', 'realm': 'zulip.com'} with self.settings(REALMS_HAVE_SUBDOMAINS=True, JWT_AUTH_KEYS={'zulip': 'key'}): with mock.patch('zerver.views.auth.get_subdomain', return_value='zulip'): email = 'hamlet@zulip.com' auth_key = settings.JWT_AUTH_KEYS['zulip'] web_token = jwt.encode(payload, auth_key).decode('utf8') data = {'json_web_token': web_token} result = self.client_post('/accounts/login/jwt/', data) self.assertEqual(result.status_code, 302) user_profile = get_user_profile_by_email(email) self.assertEqual(get_session_dict_user(self.client.session), user_profile.id) class TestLDAP(ZulipTestCase): def setUp(self): # type: () -> None email = "hamlet@zulip.com" user_profile = get_user_profile_by_email(email) self.setup_subdomain(user_profile) ldap_patcher = mock.patch('django_auth_ldap.config.ldap.initialize') self.mock_initialize = ldap_patcher.start() self.mock_ldap = MockLDAP() self.mock_initialize.return_value = self.mock_ldap self.backend = ZulipLDAPAuthBackend() # Internally `_realm` attribute is automatically set by the # `authenticate()` method. But for testing the `get_or_create_user()` # method separately, we need to set it manually. self.backend._realm = get_realm('zulip') def tearDown(self): # type: () -> None self.mock_ldap.reset() self.mock_initialize.stop() def setup_subdomain(self, user_profile): # type: (UserProfile) -> None realm = user_profile.realm realm.string_id = 'zulip' realm.save() @override_settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipLDAPAuthBackend',)) def test_login_success(self): # type: () -> None self.mock_ldap.directory = { 'uid=hamlet,ou=users,dc=zulip,dc=com': { 'userPassword': 'testing' } } with self.settings( LDAP_APPEND_DOMAIN='zulip.com', AUTH_LDAP_BIND_PASSWORD='', AUTH_LDAP_USER_DN_TEMPLATE='uid=%(user)s,ou=users,dc=zulip,dc=com'): user_profile = self.backend.authenticate('hamlet@zulip.com', 'testing') self.assertEqual(user_profile.email, 'hamlet@zulip.com') @override_settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipLDAPAuthBackend',)) def test_login_failure_due_to_wrong_password(self): # type: () -> None self.mock_ldap.directory = { 'uid=hamlet,ou=users,dc=zulip,dc=com': { 'userPassword': 'testing' } } with self.settings( LDAP_APPEND_DOMAIN='zulip.com', AUTH_LDAP_BIND_PASSWORD='', AUTH_LDAP_USER_DN_TEMPLATE='uid=%(user)s,ou=users,dc=zulip,dc=com'): user = self.backend.authenticate('hamlet@zulip.com', 'wrong') self.assertIs(user, None) @override_settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipLDAPAuthBackend',)) def test_login_failure_due_to_nonexistent_user(self): # type: () -> None self.mock_ldap.directory = { 'uid=hamlet,ou=users,dc=zulip,dc=com': { 'userPassword': 'testing' } } with self.settings( LDAP_APPEND_DOMAIN='zulip.com', AUTH_LDAP_BIND_PASSWORD='', AUTH_LDAP_USER_DN_TEMPLATE='uid=%(user)s,ou=users,dc=zulip,dc=com'): user = self.backend.authenticate('nonexistent@zulip.com', 'testing') self.assertIs(user, None) @override_settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipLDAPAuthBackend',)) def test_ldap_permissions(self): # type: () -> None backend = self.backend self.assertFalse(backend.has_perm(None, None)) self.assertFalse(backend.has_module_perms(None, None)) self.assertTrue(backend.get_all_permissions(None, None) == set()) self.assertTrue(backend.get_group_permissions(None, None) == set()) @override_settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipLDAPAuthBackend',)) def test_django_to_ldap_username(self): # type: () -> None backend = self.backend with self.settings(LDAP_APPEND_DOMAIN='zulip.com'): username = backend.django_to_ldap_username('"hamlet@test"@zulip.com') self.assertEqual(username, '"hamlet@test"') @override_settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipLDAPAuthBackend',)) def test_ldap_to_django_username(self): # type: () -> None backend = self.backend with self.settings(LDAP_APPEND_DOMAIN='zulip.com'): username = backend.ldap_to_django_username('"hamlet@test"') self.assertEqual(username, '"hamlet@test"@zulip.com') @override_settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipLDAPAuthBackend',)) def test_get_or_create_user_when_user_exists(self): # type: () -> None class _LDAPUser(object): attrs = {'fn': ['Full Name'], 'sn': ['Short Name']} backend = self.backend email = 'hamlet@zulip.com' user_profile, created = backend.get_or_create_user(email, _LDAPUser()) self.assertFalse(created) self.assertEqual(user_profile.email, email) @override_settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipLDAPAuthBackend',)) def test_get_or_create_user_when_user_does_not_exist(self): # type: () -> None class _LDAPUser(object): attrs = {'fn': ['Full Name'], 'sn': ['Short Name']} ldap_user_attr_map = {'full_name': 'fn', 'short_name': 'sn'} with self.settings(AUTH_LDAP_USER_ATTR_MAP=ldap_user_attr_map): backend = self.backend email = 'nonexisting@zulip.com' user_profile, created = backend.get_or_create_user(email, _LDAPUser()) self.assertTrue(created) self.assertEqual(user_profile.email, email) self.assertEqual(user_profile.full_name, 'Full Name') @override_settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipLDAPAuthBackend',)) def test_get_or_create_user_when_user_has_invalid_name(self): # type: () -> None class _LDAPUser(object): attrs = {'fn': ['<invalid name>'], 'sn': ['Short Name']} ldap_user_attr_map = {'full_name': 'fn', 'short_name': 'sn'} with self.settings(AUTH_LDAP_USER_ATTR_MAP=ldap_user_attr_map): backend = self.backend email = 'nonexisting@zulip.com' with self.assertRaisesRegex(Exception, "Invalid characters in name!"): backend.get_or_create_user(email, _LDAPUser()) @override_settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipLDAPAuthBackend',)) def test_get_or_create_user_when_realm_is_deactivated(self): # type: () -> None class _LDAPUser(object): attrs = {'fn': ['Full Name'], 'sn': ['Short Name']} ldap_user_attr_map = {'full_name': 'fn', 'short_name': 'sn'} with self.settings(AUTH_LDAP_USER_ATTR_MAP=ldap_user_attr_map): backend = self.backend email = 'nonexisting@zulip.com' do_deactivate_realm(backend._realm) with self.assertRaisesRegex(Exception, 'Realm has been deactivated'): backend.get_or_create_user(email, _LDAPUser()) @override_settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipLDAPAuthBackend',)) def test_django_to_ldap_username_when_domain_does_not_match(self): # type: () -> None backend = self.backend email = 'hamlet@zulip.com' with self.assertRaisesRegex(Exception, 'Username does not match LDAP domain.'): with self.settings(LDAP_APPEND_DOMAIN='acme.com'): backend.django_to_ldap_username(email) @override_settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipLDAPAuthBackend',)) def test_login_failure_due_to_wrong_subdomain(self): # type: () -> None self.mock_ldap.directory = { 'uid=hamlet,ou=users,dc=zulip,dc=com': { 'userPassword': 'testing' } } with self.settings( REALMS_HAVE_SUBDOMAINS=True, LDAP_APPEND_DOMAIN='zulip.com', AUTH_LDAP_BIND_PASSWORD='', AUTH_LDAP_USER_DN_TEMPLATE='uid=%(user)s,ou=users,dc=zulip,dc=com'): user_profile = self.backend.authenticate('hamlet@zulip.com', 'testing', realm_subdomain='acme') self.assertIs(user_profile, None) @override_settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipLDAPAuthBackend',)) def test_login_failure_due_to_empty_subdomain(self): # type: () -> None self.mock_ldap.directory = { 'uid=hamlet,ou=users,dc=zulip,dc=com': { 'userPassword': 'testing' } } with self.settings( REALMS_HAVE_SUBDOMAINS=True, LDAP_APPEND_DOMAIN='zulip.com', AUTH_LDAP_BIND_PASSWORD='', AUTH_LDAP_USER_DN_TEMPLATE='uid=%(user)s,ou=users,dc=zulip,dc=com'): user_profile = self.backend.authenticate('hamlet@zulip.com', 'testing', realm_subdomain='') self.assertIs(user_profile, None) @override_settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipLDAPAuthBackend',)) def test_login_success_when_subdomain_is_none(self): # type: () -> None self.mock_ldap.directory = { 'uid=hamlet,ou=users,dc=zulip,dc=com': { 'userPassword': 'testing' } } with self.settings( REALMS_HAVE_SUBDOMAINS=True, LDAP_APPEND_DOMAIN='zulip.com', AUTH_LDAP_BIND_PASSWORD='', AUTH_LDAP_USER_DN_TEMPLATE='uid=%(user)s,ou=users,dc=zulip,dc=com'): user_profile = self.backend.authenticate('hamlet@zulip.com', 'testing', realm_subdomain=None) self.assertEqual(user_profile.email, 'hamlet@zulip.com') @override_settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipLDAPAuthBackend',)) def test_login_success_with_valid_subdomain(self): # type: () -> None self.mock_ldap.directory = { 'uid=hamlet,ou=users,dc=zulip,dc=com': { 'userPassword': 'testing' } } with self.settings( REALMS_HAVE_SUBDOMAINS=True, LDAP_APPEND_DOMAIN='zulip.com', AUTH_LDAP_BIND_PASSWORD='', AUTH_LDAP_USER_DN_TEMPLATE='uid=%(user)s,ou=users,dc=zulip,dc=com'): user_profile = self.backend.authenticate('hamlet@zulip.com', 'testing', realm_subdomain='zulip') self.assertEqual(user_profile.email, 'hamlet@zulip.com') @override_settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipLDAPAuthBackend',)) def test_login_success_when_user_does_not_exist_with_valid_subdomain(self): # type: () -> None self.mock_ldap.directory = { 'uid=nonexisting,ou=users,dc=acme,dc=com': { 'cn': ['NonExisting', ], 'userPassword': 'testing' } } with self.settings( REALMS_HAVE_SUBDOMAINS=True, LDAP_APPEND_DOMAIN='acme.com', AUTH_LDAP_BIND_PASSWORD='', AUTH_LDAP_USER_DN_TEMPLATE='uid=%(user)s,ou=users,dc=acme,dc=com'): user_profile = self.backend.authenticate('nonexisting@acme.com', 'testing', realm_subdomain='zulip') self.assertEqual(user_profile.email, 'nonexisting@acme.com') self.assertEqual(user_profile.full_name, 'NonExisting') self.assertEqual(user_profile.realm.string_id, 'zulip') class TestZulipLDAPUserPopulator(ZulipTestCase): def test_authenticate(self): # type: () -> None backend = ZulipLDAPUserPopulator() result = backend.authenticate('hamlet@zulip.com', 'testing') # type: ignore # complains that the function does not return any value! self.assertIs(result, None) class TestZulipAuthMixin(ZulipTestCase): def test_get_user(self): # type: () -> None backend = ZulipAuthMixin() result = backend.get_user(11111) self.assertIs(result, None) class TestPasswordAuthEnabled(ZulipTestCase): def test_password_auth_enabled_for_ldap(self): # type: () -> None with self.settings(AUTHENTICATION_BACKENDS=('zproject.backends.ZulipLDAPAuthBackend',)): realm = Realm.objects.get(string_id='zulip') self.assertTrue(password_auth_enabled(realm)) class TestMaybeSendToRegistration(ZulipTestCase): def test_sso_only_when_preregistration_user_does_not_exist(self): # type: () -> None rf = RequestFactory() request = rf.get('/') request.session = {} request.user = None # Creating a mock Django form in order to keep the test simple. # This form will be returned by the create_hompage_form function # and will always be valid so that the code that we want to test # actually runs. class Form(object): def is_valid(self): # type: () -> bool return True with self.settings(ONLY_SSO=True): with mock.patch('zerver.views.auth.HomepageForm', return_value=Form()): self.assertEqual(PreregistrationUser.objects.all().count(), 0) result = maybe_send_to_registration(request, 'hamlet@zulip.com') self.assertEqual(result.status_code, 302) confirmation = Confirmation.objects.all().first() confirmation_key = confirmation.confirmation_key self.assertIn('do_confirm/' + confirmation_key, result.url) self.assertEqual(PreregistrationUser.objects.all().count(), 1) result = self.client_get(result.url) self.assert_in_response('action="/accounts/register/"', result) self.assert_in_response('value="{0}" name="key"'.format(confirmation_key), result) def test_sso_only_when_preregistration_user_exists(self): # type: () -> None rf = RequestFactory() request = rf.get('/') request.session = {} request.user = None # Creating a mock Django form in order to keep the test simple. # This form will be returned by the create_hompage_form function # and will always be valid so that the code that we want to test # actually runs. class Form(object): def is_valid(self): # type: () -> bool return True email = 'hamlet@zulip.com' user = PreregistrationUser(email=email) user.save() with self.settings(ONLY_SSO=True): with mock.patch('zerver.views.auth.HomepageForm', return_value=Form()): self.assertEqual(PreregistrationUser.objects.all().count(), 1) result = maybe_send_to_registration(request, email) self.assertEqual(result.status_code, 302) confirmation = Confirmation.objects.all().first() confirmation_key = confirmation.confirmation_key self.assertIn('do_confirm/' + confirmation_key, result.url) self.assertEqual(PreregistrationUser.objects.all().count(), 1) class TestAdminSetBackends(ZulipTestCase): def test_change_enabled_backends(self): # type: () -> None # Log in as admin self.login("iago@zulip.com") result = self.client_patch("/json/realm", { 'authentication_methods': ujson.dumps({u'Email': False, u'Dev': True})}) self.assert_json_success(result) realm = get_realm('zulip') self.assertFalse(password_auth_enabled(realm)) self.assertTrue(dev_auth_enabled(realm)) def test_disable_all_backends(self): # type: () -> None # Log in as admin self.login("iago@zulip.com") result = self.client_patch("/json/realm", { 'authentication_methods': ujson.dumps({u'Email': False, u'Dev': False})}) self.assert_json_error(result, 'At least one authentication method must be enabled.', status_code=403) realm = get_realm('zulip') self.assertTrue(password_auth_enabled(realm)) self.assertTrue(dev_auth_enabled(realm)) def test_supported_backends_only_updated(self): # type: () -> None # Log in as admin self.login("iago@zulip.com") # Set some supported and unsupported backends result = self.client_patch("/json/realm", { 'authentication_methods': ujson.dumps({u'Email': False, u'Dev': True, u'GitHub': False})}) self.assert_json_success(result) realm = get_realm('zulip') # Check that unsupported backend is not enabled self.assertFalse(github_auth_enabled(realm)) self.assertTrue(dev_auth_enabled(realm)) self.assertFalse(password_auth_enabled(realm))
# Copyright (c) 2006-2012 Mitch Garnaat http://garnaat.org/ # Copyright (c) 2012 Amazon.com, Inc. or its affiliates. All Rights Reserved # # Permission is hereby granted, free of charge, to any person obtaining a # copy of this software and associated documentation files (the # "Software"), to deal in the Software without restriction, including # without limitation the rights to use, copy, modify, merge, publish, dis- # tribute, sublicense, and/or sell copies of the Software, and to permit # persons to whom the Software is furnished to do so, subject to the fol- # lowing conditions: # # The above copyright notice and this permission notice shall be included # in all copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS # OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABIL- # ITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT # SHALL THE AUTHOR BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, # WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS # IN THE SOFTWARE. from boto.ec2.elb.healthcheck import HealthCheck from boto.ec2.elb.listener import Listener from boto.ec2.elb.listelement import ListElement from boto.ec2.elb.policies import Policies, OtherPolicy from boto.ec2.elb.securitygroup import SecurityGroup from boto.ec2.instanceinfo import InstanceInfo from boto.resultset import ResultSet class Backend(object): """Backend server description""" def __init__(self, connection=None): self.connection = connection self.instance_port = None self.policies = None def __repr__(self): return 'Backend(%r:%r)' % (self.instance_port, self.policies) def startElement(self, name, attrs, connection): if name == 'PolicyNames': self.policies = ResultSet([('member', OtherPolicy)]) return self.policies def endElement(self, name, value, connection): if name == 'InstancePort': self.instance_port = int(value) return class LoadBalancerZones(object): """ Used to collect the zones for a Load Balancer when enable_zones or disable_zones are called. """ def __init__(self, connection=None): self.connection = connection self.zones = ListElement() def startElement(self, name, attrs, connection): if name == 'AvailabilityZones': return self.zones def endElement(self, name, value, connection): pass class LoadBalancer(object): """ Represents an EC2 Load Balancer. """ def __init__(self, connection=None, name=None, endpoints=None): """ :ivar boto.ec2.elb.ELBConnection connection: The connection this load balancer was instance was instantiated from. :ivar list listeners: A list of tuples in the form of ``(<Inbound port>, <Outbound port>, <Protocol>)`` :ivar boto.ec2.elb.healthcheck.HealthCheck health_check: The health check policy for this load balancer. :ivar boto.ec2.elb.policies.Policies policies: Cookie stickiness and other policies. :ivar str dns_name: The external DNS name for the balancer. :ivar str created_time: A date+time string showing when the load balancer was created. :ivar list instances: A list of :py:class:`boto.ec2.instanceinfo.InstanceInfo` instances, representing the EC2 instances this load balancer is distributing requests to. :ivar list availability_zones: The availability zones this balancer covers. :ivar str canonical_hosted_zone_name: Current CNAME for the balancer. :ivar str canonical_hosted_zone_name_id: The Route 53 hosted zone ID of this balancer. Needed when creating an Alias record in a Route 53 hosted zone. :ivar boto.ec2.elb.securitygroup.SecurityGroup source_security_group: The security group that you can use as part of your inbound rules for your load balancer back-end instances to disallow traffic from sources other than your load balancer. :ivar list subnets: A list of subnets this balancer is on. :ivar list security_groups: A list of additional security groups that have been applied. :ivar str vpc_id: The ID of the VPC that this ELB resides within. :ivar list backends: A list of :py:class:`boto.ec2.elb.loadbalancer.Backend back-end server descriptions. """ self.connection = connection self.name = name self.listeners = None self.health_check = None self.policies = None self.dns_name = None self.created_time = None self.instances = None self.availability_zones = ListElement() self.canonical_hosted_zone_name = None self.canonical_hosted_zone_name_id = None self.source_security_group = None self.subnets = ListElement() self.security_groups = ListElement() self.vpc_id = None self.scheme = None self.backends = None def __repr__(self): return 'LoadBalancer:%s' % self.name def startElement(self, name, attrs, connection): if name == 'HealthCheck': self.health_check = HealthCheck(self) return self.health_check elif name == 'ListenerDescriptions': self.listeners = ResultSet([('member', Listener)]) return self.listeners elif name == 'AvailabilityZones': return self.availability_zones elif name == 'Instances': self.instances = ResultSet([('member', InstanceInfo)]) return self.instances elif name == 'Policies': self.policies = Policies(self) return self.policies elif name == 'SourceSecurityGroup': self.source_security_group = SecurityGroup() return self.source_security_group elif name == 'Subnets': return self.subnets elif name == 'SecurityGroups': return self.security_groups elif name == 'VPCId': pass elif name == "BackendServerDescriptions": self.backends = ResultSet([('member', Backend)]) return self.backends else: return None def endElement(self, name, value, connection): if name == 'LoadBalancerName': self.name = value elif name == 'DNSName': self.dns_name = value elif name == 'CreatedTime': self.created_time = value elif name == 'InstanceId': self.instances.append(value) elif name == 'CanonicalHostedZoneName': self.canonical_hosted_zone_name = value elif name == 'CanonicalHostedZoneNameID': self.canonical_hosted_zone_name_id = value elif name == 'VPCId': self.vpc_id = value elif name == 'Scheme': self.scheme = value else: setattr(self, name, value) def enable_zones(self, zones): """ Enable availability zones to this Access Point. All zones must be in the same region as the Access Point. :type zones: string or List of strings :param zones: The name of the zone(s) to add. """ if isinstance(zones, str) or isinstance(zones, unicode): zones = [zones] new_zones = self.connection.enable_availability_zones(self.name, zones) self.availability_zones = new_zones def disable_zones(self, zones): """ Disable availability zones from this Access Point. :type zones: string or List of strings :param zones: The name of the zone(s) to add. """ if isinstance(zones, str) or isinstance(zones, unicode): zones = [zones] new_zones = self.connection.disable_availability_zones(self.name, zones) self.availability_zones = new_zones def register_instances(self, instances): """ Adds instances to this load balancer. All instances must be in the same region as the load balancer. Adding endpoints that are already registered with the load balancer has no effect. :param list instances: List of instance IDs (strings) that you'd like to add to this load balancer. """ if isinstance(instances, str) or isinstance(instances, unicode): instances = [instances] new_instances = self.connection.register_instances(self.name, instances) self.instances = new_instances def deregister_instances(self, instances): """ Remove instances from this load balancer. Removing instances that are not registered with the load balancer has no effect. :param list instances: List of instance IDs (strings) that you'd like to remove from this load balancer. """ if isinstance(instances, str) or isinstance(instances, unicode): instances = [instances] new_instances = self.connection.deregister_instances(self.name, instances) self.instances = new_instances def delete(self): """ Delete this load balancer. """ return self.connection.delete_load_balancer(self.name) def configure_health_check(self, health_check): """ Configures the health check behavior for the instances behind this load balancer. See :ref:`elb-configuring-a-health-check` for a walkthrough. :param boto.ec2.elb.healthcheck.HealthCheck health_check: A HealthCheck instance that tells the load balancer how to check its instances for health. """ return self.connection.configure_health_check(self.name, health_check) def get_instance_health(self, instances=None): """ Returns a list of :py:class:`boto.ec2.elb.instancestate.InstanceState` objects, which show the health of the instances attached to this load balancer. :rtype: list :returns: A list of :py:class:`InstanceState <boto.ec2.elb.instancestate.InstanceState>` instances, representing the instances attached to this load balancer. """ return self.connection.describe_instance_health(self.name, instances) def create_listeners(self, listeners): return self.connection.create_load_balancer_listeners(self.name, listeners) def create_listener(self, inPort, outPort=None, proto="tcp"): if outPort == None: outPort = inPort return self.create_listeners([(inPort, outPort, proto)]) def delete_listeners(self, listeners): return self.connection.delete_load_balancer_listeners(self.name, listeners) def delete_listener(self, inPort): return self.delete_listeners([inPort]) def delete_policy(self, policy_name): """ Deletes a policy from the LoadBalancer. The specified policy must not be enabled for any listeners. """ return self.connection.delete_lb_policy(self.name, policy_name) def set_policies_of_listener(self, lb_port, policies): return self.connection.set_lb_policies_of_listener(self.name, lb_port, policies) def set_policies_of_backend_server(self, instance_port, policies): return self.connection.set_lb_policies_of_backend_server(self.name, instance_port, policies) def create_cookie_stickiness_policy(self, cookie_expiration_period, policy_name): return self.connection.create_lb_cookie_stickiness_policy(cookie_expiration_period, self.name, policy_name) def create_app_cookie_stickiness_policy(self, name, policy_name): return self.connection.create_app_cookie_stickiness_policy(name, self.name, policy_name) def set_listener_SSL_certificate(self, lb_port, ssl_certificate_id): return self.connection.set_lb_listener_SSL_certificate(self.name, lb_port, ssl_certificate_id) def create_lb_policy(self, policy_name, policy_type, policy_attribute): return self.connection.create_lb_policy(self.name, policy_name, policy_type, policy_attribute) def attach_subnets(self, subnets): """ Attaches load balancer to one or more subnets. Attaching subnets that are already registered with the Load Balancer has no effect. :type subnets: string or List of strings :param subnets: The name of the subnet(s) to add. """ if isinstance(subnets, str) or isinstance(subnets, unicode): subnets = [subnets] new_subnets = self.connection.attach_lb_to_subnets(self.name, subnets) self.subnets = new_subnets def detach_subnets(self, subnets): """ Detaches load balancer from one or more subnets. :type subnets: string or List of strings :param subnets: The name of the subnet(s) to detach. """ if isinstance(subnets, str) or isinstance(subnets, unicode): subnets = [subnets] new_subnets = self.connection.detach_lb_from_subnets(self.name, subnets) self.subnets = new_subnets def apply_security_groups(self, security_groups): """ Applies security groups to the load balancer. Applying security groups that are already registered with the Load Balancer has no effect. :type security_groups: string or List of strings :param security_groups: The name of the security group(s) to add. """ if isinstance(security_groups, str) or \ isinstance(security_groups, unicode): security_groups = [security_groups] new_sgs = self.connection.apply_security_groups_to_lb( self.name, security_groups) self.security_groups = new_sgs
# coding=utf-8 # Copyright 2018 The Tensor2Tensor Authors. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """MultiModel.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function from six.moves import range # pylint: disable=redefined-builtin from tensor2tensor.layers import common_attention from tensor2tensor.layers import common_hparams from tensor2tensor.layers import common_layers from tensor2tensor.layers import modalities from tensor2tensor.models import slicenet from tensor2tensor.utils import expert_utils from tensor2tensor.utils import registry from tensor2tensor.utils import t2t_model import tensorflow as tf def conv_res_step(x, hparams, padding, mask): """One step of convolutions and mid-residual.""" k = (hparams.kernel_height, hparams.kernel_width) k2 = (hparams.large_kernel_size, 1) dilations_and_kernels1 = [((1, 1), k), ((1, 1), k)] dilations_and_kernels2 = [((1, 1), k2), ((4, 4), k2)] with tf.variable_scope("conv_res_step"): y = common_layers.subseparable_conv_block( x, hparams.filter_size, dilations_and_kernels1, padding=padding, mask=mask, separabilities=0, name="residual1") y = tf.nn.dropout(y, 1.0 - hparams.dropout) return common_layers.subseparable_conv_block( y, hparams.hidden_size, dilations_and_kernels2, padding=padding, mask=mask, separabilities=0, name="residual2") def residual_fn2(x, y, hparams): y = tf.nn.dropout(y, 1.0 - hparams.dropout) return common_layers.layer_norm(x + y) def residual_fn3(x, y, z, hparams): y = tf.nn.dropout(y, 1.0 - hparams.dropout) z = tf.nn.dropout(z, 1.0 - hparams.dropout) return common_layers.layer_norm(x + y + z) def conv_experts(xs, hparams, dp, ps, padding, mask, layer_id): """Convolutions + Mixture-of-Experts layer.""" del layer_id # Unused. train = hparams.mode == tf.estimator.ModeKeys.TRAIN, conv_out = dp(conv_res_step, xs, hparams, padding, mask) loss = 0.0 moe_hidden_sizes = [hparams.filter_size] expert_fn = expert_utils.ffn_expert_fn(hparams.hidden_size, moe_hidden_sizes, hparams.hidden_size) moe_out, loss = expert_utils.distributed_moe( dp, ps, xs, train, input_size=hparams.hidden_size, expert_fn=expert_fn, num_experts=hparams.moe_num_experts, k=hparams.moe_k, loss_coef=1.0) return dp(residual_fn3, xs, moe_out, conv_out, hparams), loss def prepare_decoder(targets, target_space_emb): """Prepare decoder.""" decoder_self_attention_bias = ( common_attention.attention_bias_lower_triangle(tf.shape(targets)[1])) target_space_emb = tf.reshape(target_space_emb, [1, 1, -1]) target_space_emb = tf.tile(target_space_emb, [tf.shape(targets)[0], 1, 1]) decoder_input = common_layers.shift_right_3d( targets, pad_value=target_space_emb) decoder_input = common_attention.add_timing_signal_1d(decoder_input) return (decoder_input, decoder_self_attention_bias) @registry.register_model class MultiModel(t2t_model.T2TModel): """Model to train on multiple tasks simultaneously.""" @property def use_body_sharded(self): return True def body_sharded(self, sharded_features): train = self._hparams.mode == tf.estimator.ModeKeys.TRAIN dp = self._data_parallelism hparams = self._hparams def project_to_hidden(inputs): return common_layers.conv_block( inputs, hparams.hidden_size, [((1, 1), (3, 3))], first_relu=False, padding="SAME", force2d=True) def flatten(inputs): return tf.expand_dims(common_layers.flatten4d3d(inputs), axis=2) # Project to hidden size if necessary if (sharded_features["inputs"][0].get_shape().as_list()[-1] != hparams.hidden_size): inputs = dp(project_to_hidden, sharded_features["inputs"]) inputs = dp(flatten, inputs) inputs_pad = dp(slicenet.embedding_to_padding, inputs) inputs_mask = dp(lambda x: 1.0 - x, inputs_pad) inputs_encoded = dp(common_layers.add_timing_signal, inputs) expert_loss = 0.0 for i in range(hparams.num_hidden_layers): with tf.variable_scope("enc_layer_%d" % i): inputs_encoded, moe_loss = conv_experts(inputs_encoded, hparams, dp, self._ps_devices, "SAME", inputs_mask, i) expert_loss += tf.reduce_mean(moe_loss) * hparams.moe_loss_coef # If we're just predicing a class, there is no use for a decoder, return. if isinstance(self._problem_hparams.target_modality, modalities.ClassLabelModality): return inputs_encoded, tf.reduce_mean(expert_loss) # Decoder. inputs3d = dp(tf.squeeze, inputs, 2) inputs_encoded3d = dp(tf.squeeze, inputs_encoded, 2) encoder_padding = dp(common_attention.embedding_to_padding, inputs3d) encoder_attention_bias = dp(common_attention.attention_bias_ignore_padding, encoder_padding) targets = dp(common_layers.flatten4d3d, sharded_features["targets"]) target_space_emb = dp(slicenet.embed_target_space, sharded_features["target_space_id"], hparams.hidden_size) (decoder_input, decoder_self_attention_bias) = dp(prepare_decoder, targets, target_space_emb) moe_hidden_sizes = [int(s) for s in hparams.moe_hidden_sizes.split(",")] expert_fn = expert_utils.ffn_expert_fn( hparams.hidden_size, moe_hidden_sizes, hparams.hidden_size) x = dp(tf.nn.dropout, decoder_input, 1.0 - hparams.dropout) for layer in range(hparams.num_hidden_layers): with tf.variable_scope("dec_layer_%d" % layer): with tf.variable_scope("attention"): y = dp( common_attention.multihead_attention, x, None, decoder_self_attention_bias, hparams.hidden_size, hparams.hidden_size, hparams.hidden_size, hparams.num_heads, hparams.attention_dropout, name="decoder_self_attention") z = dp( common_attention.multihead_attention, y, inputs_encoded3d, encoder_attention_bias, hparams.hidden_size, hparams.hidden_size, hparams.hidden_size, hparams.num_heads, hparams.attention_dropout, name="encdec_attention") x = dp(residual_fn3, x, y, z, hparams) with tf.variable_scope("ffn"): if str(layer) in hparams.moe_layers.split(","): y, moe_loss = expert_utils.distributed_moe( dp, self._ps_devices, x, train, input_size=hparams.hidden_size, expert_fn=expert_fn, num_experts=hparams.moe_num_experts, k=hparams.moe_k, loss_coef=hparams.moe_loss_coef) expert_loss += tf.reduce_mean(moe_loss) else: y = dp( common_layers.conv_hidden_relu, x, hparams.filter_size, hparams.hidden_size, dropout=hparams.dropout) x = dp(residual_fn2, x, y, hparams) x = dp(tf.expand_dims, x, 2) return x, tf.reduce_mean(expert_loss) @registry.register_hparams def multimodel_base(): """Base parameters for MultiModel.""" hparams = common_hparams.basic_params1() hparams.hidden_size = 512 hparams.batch_size = 2048 hparams.num_hidden_layers = 4 hparams.learning_rate_decay_scheme = "noam" hparams.learning_rate = 0.1 hparams.learning_rate_warmup_steps = 4000 hparams.initializer_gain = 1.0 hparams.dropout = 0.1 hparams.add_hparam("filter_size", 2048) # Add new ones like this. hparams.add_hparam("large_kernel_size", 15) hparams.add_hparam("attention_dropout", 0.1) hparams.add_hparam("num_heads", 8) hparams.add_hparam("moe_layers", "2") hparams.moe_num_experts = 30 return hparams @registry.register_hparams def multimodel_tiny(): """Tiny parameters for MultiModel.""" hparams = multimodel_base() hparams.hidden_size = 128 hparams.filter_size = 512 hparams.batch_size = 512 hparams.num_hidden_layers = 2 hparams.moe_n1 = 10 hparams.moe_layers = "0" return hparams
from collections import OrderedDict from django.conf import settings from django.contrib import messages from django.contrib.auth import update_session_auth_hash from django.contrib.auth import views as auth_views from django.db import transaction from django.forms import Media from django.http import Http404 from django.shortcuts import redirect from django.template.loader import render_to_string from django.template.response import TemplateResponse from django.urls import reverse, reverse_lazy from django.utils.translation import gettext as _ from django.utils.translation import gettext_lazy, override from django.views.decorators.debug import sensitive_post_parameters from wagtail.admin.forms.account import ( AvatarPreferencesForm, LocalePreferencesForm, NameEmailForm, NotificationPreferencesForm) from wagtail.admin.forms.auth import LoginForm, PasswordChangeForm, PasswordResetForm from wagtail.admin.localization import get_available_admin_languages, get_available_admin_time_zones from wagtail.core import hooks from wagtail.core.log_actions import log from wagtail.core.models import UserPagePermissionsProxy from wagtail.users.models import UserProfile from wagtail.utils.loading import get_custom_form def get_user_login_form(): form_setting = 'WAGTAILADMIN_USER_LOGIN_FORM' if hasattr(settings, form_setting): return get_custom_form(form_setting) else: return LoginForm # Helper functions to check password management settings to enable/disable views as appropriate. # These are functions rather than class-level constants so that they can be overridden in tests # by override_settings def password_management_enabled(): return getattr(settings, 'WAGTAIL_PASSWORD_MANAGEMENT_ENABLED', True) def email_management_enabled(): return getattr(settings, 'WAGTAIL_EMAIL_MANAGEMENT_ENABLED', True) def password_reset_enabled(): return getattr(settings, 'WAGTAIL_PASSWORD_RESET_ENABLED', password_management_enabled()) # Tabs class SettingsTab: def __init__(self, name, title, order=0): self.name = name self.title = title self.order = order profile_tab = SettingsTab('profile', gettext_lazy("Profile"), order=100) notifications_tab = SettingsTab('notifications', gettext_lazy("Notifications"), order=200) # Panels class BaseSettingsPanel: name = '' title = '' tab = profile_tab help_text = None template_name = 'wagtailadmin/account/settings_panels/base.html' form_class = None form_object = 'user' def __init__(self, request, user, profile): self.request = request self.user = user self.profile = profile def is_active(self): """ Returns True to display the panel. """ return True def get_form(self): """ Returns an initialised form. """ kwargs = { 'instance': self.profile if self.form_object == 'profile' else self.user, 'prefix': self.name } if self.request.method == 'POST': return self.form_class(self.request.POST, self.request.FILES, **kwargs) else: return self.form_class(**kwargs) def get_context_data(self): """ Returns the template context to use when rendering the template. """ return { 'form': self.get_form() } def render(self): """ Renders the panel using the template specified in .template_name and context from .get_context_data() """ return render_to_string(self.template_name, self.get_context_data(), request=self.request) class NameEmailSettingsPanel(BaseSettingsPanel): name = 'name_email' title = gettext_lazy('Name and Email') order = 100 form_class = NameEmailForm class AvatarSettingsPanel(BaseSettingsPanel): name = 'avatar' title = gettext_lazy('Profile picture') order = 300 template_name = 'wagtailadmin/account/settings_panels/avatar.html' form_class = AvatarPreferencesForm form_object = 'profile' class NotificationsSettingsPanel(BaseSettingsPanel): name = 'notifications' title = gettext_lazy('Notifications') tab = notifications_tab order = 100 form_class = NotificationPreferencesForm form_object = 'profile' def is_active(self): # Hide the panel if the user can't edit or publish pages user_perms = UserPagePermissionsProxy(self.request.user) if not user_perms.can_edit_pages() and not user_perms.can_publish_pages(): return False # Hide the panel if there are no notification preferences return self.get_form().fields class LocaleSettingsPanel(BaseSettingsPanel): name = 'locale' title = gettext_lazy('Locale') order = 400 form_class = LocalePreferencesForm form_object = 'profile' def is_active(self): return len(get_available_admin_languages()) > 1 or len(get_available_admin_time_zones()) > 1 class ChangePasswordPanel(BaseSettingsPanel): name = 'password' title = gettext_lazy('Password') order = 500 form_class = PasswordChangeForm def is_active(self): return password_management_enabled() and self.user.has_usable_password() def get_form(self): # Note: don't bind the form unless a field is specified # This prevents the validation error from displaying if the user wishes to ignore this bind_form = False if self.request.method == 'POST': bind_form = any([ self.request.POST.get(self.name + '-old_password'), self.request.POST.get(self.name + '-new_password1'), self.request.POST.get(self.name + '-new_password2'), ]) if bind_form: return self.form_class(self.user, self.request.POST, prefix=self.name) else: return self.form_class(self.user, prefix=self.name) # Views @sensitive_post_parameters() def account(request): # Fetch the user and profile objects once and pass into each panel # We need to use the same instances for all forms so they don't overwrite each other user = request.user profile = UserProfile.get_for_user(user) # Panels panels = [ NameEmailSettingsPanel(request, user, profile), AvatarSettingsPanel(request, user, profile), NotificationsSettingsPanel(request, user, profile), LocaleSettingsPanel(request, user, profile), ChangePasswordPanel(request, user, profile), ] for fn in hooks.get_hooks('register_account_settings_panel'): panel = fn(request, user, profile) if panel and panel.is_active(): panels.append(panel) panels = [panel for panel in panels if panel.is_active()] # Get tabs and order them tabs = list(set(panel.tab for panel in panels)) tabs.sort(key=lambda tab: tab.order) # Get dict of tabs to ordered panels panels_by_tab = OrderedDict([(tab, []) for tab in tabs]) for panel in panels: panels_by_tab[panel.tab].append(panel) for tab, tab_panels in panels_by_tab.items(): tab_panels.sort(key=lambda panel: panel.order) panel_forms = [panel.get_form() for panel in panels] if request.method == 'POST': if all(form.is_valid() or not form.is_bound for form in panel_forms): with transaction.atomic(): for form in panel_forms: if form.is_bound: form.save() log(user, 'wagtail.edit') # Prevent a password change from logging this user out update_session_auth_hash(request, user) # Override the language when creating the success message # If the user has changed their language in this request, the message should # be in the new language, not the existing one with override(profile.get_preferred_language()): messages.success(request, _("Your account settings have been changed successfully!")) return redirect('wagtailadmin_account') media = Media() for form in panel_forms: media += form.media # Menu items menu_items = [] for fn in hooks.get_hooks('register_account_menu_item'): item = fn(request) if item: menu_items.append(item) return TemplateResponse(request, 'wagtailadmin/account/account.html', { 'panels_by_tab': panels_by_tab, 'menu_items': menu_items, 'media': media, }) class PasswordResetEnabledViewMixin: """ Class based view mixin that disables the view if password reset is disabled by one of the following settings: - WAGTAIL_PASSWORD_RESET_ENABLED - WAGTAIL_PASSWORD_MANAGEMENT_ENABLED """ def dispatch(self, *args, **kwargs): if not password_reset_enabled(): raise Http404 return super().dispatch(*args, **kwargs) class PasswordResetView(PasswordResetEnabledViewMixin, auth_views.PasswordResetView): template_name = 'wagtailadmin/account/password_reset/form.html' email_template_name = 'wagtailadmin/account/password_reset/email.txt' subject_template_name = 'wagtailadmin/account/password_reset/email_subject.txt' form_class = PasswordResetForm success_url = reverse_lazy('wagtailadmin_password_reset_done') class PasswordResetDoneView(PasswordResetEnabledViewMixin, auth_views.PasswordResetDoneView): template_name = 'wagtailadmin/account/password_reset/done.html' class PasswordResetConfirmView(PasswordResetEnabledViewMixin, auth_views.PasswordResetConfirmView): template_name = 'wagtailadmin/account/password_reset/confirm.html' success_url = reverse_lazy('wagtailadmin_password_reset_complete') class PasswordResetCompleteView(PasswordResetEnabledViewMixin, auth_views.PasswordResetCompleteView): template_name = 'wagtailadmin/account/password_reset/complete.html' class LoginView(auth_views.LoginView): template_name = 'wagtailadmin/login.html' def get_success_url(self): return self.get_redirect_url() or reverse('wagtailadmin_home') def get(self, *args, **kwargs): # If user is already logged in, redirect them to the dashboard if self.request.user.is_authenticated and self.request.user.has_perm('wagtailadmin.access_admin'): return redirect(self.get_success_url()) return super().get(*args, **kwargs) def get_form_class(self): return get_user_login_form() def form_valid(self, form): response = super().form_valid(form) remember = form.cleaned_data.get('remember') if remember: self.request.session.set_expiry(settings.SESSION_COOKIE_AGE) else: self.request.session.set_expiry(0) return response def get_context_data(self, **kwargs): context = super().get_context_data(**kwargs) context['show_password_reset'] = password_reset_enabled() from django.contrib.auth import get_user_model User = get_user_model() context['username_field'] = User._meta.get_field(User.USERNAME_FIELD).verbose_name return context class LogoutView(auth_views.LogoutView): next_page = 'wagtailadmin_login' def dispatch(self, request, *args, **kwargs): response = super().dispatch(request, *args, **kwargs) messages.success(self.request, _('You have been successfully logged out.')) # By default, logging out will generate a fresh sessionid cookie. We want to use the # absence of sessionid as an indication that front-end pages are being viewed by a # non-logged-in user and are therefore cacheable, so we forcibly delete the cookie here. response.delete_cookie( settings.SESSION_COOKIE_NAME, domain=settings.SESSION_COOKIE_DOMAIN, path=settings.SESSION_COOKIE_PATH ) # HACK: pretend that the session hasn't been modified, so that SessionMiddleware # won't override the above and write a new cookie. self.request.session.modified = False return response
#!/usr/bin/env python3 from auto.config import ARM, GOPTS, RV32, SBT, TOOLS, X86 from auto.utils import cat, path, unique class ArchAndMode: def __init__(self, farch, narch, mode=None): self.farch = farch self.narch = narch self.mode = mode # get arch prefix string def prefix(self): if not self.farch: return self.narch.prefix elif not self.narch: return self.farch.prefix else: return self.farch.add_prefix(self.narch.prefix) # get output file name for this ArchAndMode def bin(self, name): if not self.prefix(): raise Exception("No prefix") if not name: raise Exception("No name") return (self.prefix() + "-" + name + ("-" + self.mode if self.mode else "")); @staticmethod def sfmt(templ, prefix, mode): return templ.format(**{ "prefix": prefix, "mode": mode, }) def fmt(self, templ): prefix = self.prefix() if prefix: prefix = prefix + '-' else: prefix = '' mode = self.mode if mode: mode = '-' + mode else: mode = '' return self.sfmt(templ, prefix, mode) # arguments for a given run class Run: def __init__(self, args, id=None, rflags=None, outidx=None, stdin=None): self.args = args self.rflags_arg = rflags self.id = id self.outidx = outidx self.stdin = stdin @staticmethod def out_suffix(): return ".out" @staticmethod def build_name(am, base, id, suffix): if am: r = am.bin(base) else: r = base if id: r = r + '-' + id if suffix: r = r + suffix return r def bin(self, am, name): return am.bin(name) def out(self, am, name): if self.outidx == None: if am: return self.build_name(am, name, self.id, self.out_suffix()) else: return None return am.fmt(self.args[self.outidx]) def build(self, am): if am: return [am.fmt(arg) for arg in self.args] return [ArchAndMode.sfmt(arg, '', '') for arg in self.args] @staticmethod def _escape(args): args2 = [] for arg in args: if len(arg) > 0 and arg[0] == '-': arg = '" {}"'.format(arg) args2.append(arg) return args2 def str(self, am): args = self.build(am) if not args: return '' args2 = ["--args"] args2.extend(self._escape(args)) return " ".join(args2) def rflags(self, am, name): args_str = self.str(am) out = self.out(am, name) if not self.outidx: args_str = cat('-o', out, args_str) if self.stdin: args_str = cat(args_str, "<", self.stdin) return cat(self.rflags_arg, args_str) class Runs: def __init__(self, runs=[], name=None): self.runs = runs self.name = name def add(self, run): self.runs.append(run) def __iter__(self): return self.runs.__iter__() class GenMake: def __init__(self, narchs, xarchs, srcdir, dstdir, name, xflags, bflags, mflags, sbtflags=[], cc=None, rvcc=None, modes=None): self.narchs = narchs self.xarchs = xarchs self.srcdir = srcdir self.dstdir = dstdir self.name = name self.xflags = xflags self.bflags = bflags self.mflags = mflags self.sbtflags = sbtflags self.cc = cc self.rvcc = rvcc self.modes = modes if modes else SBT.modes # self.out_filter = None # self.txt = "### {} ###\n\n".format(name) def append(self, txt): self.txt = self.txt + txt def append_cc(self, arch, flags): s = "--cc=" if arch.is_rv32(): s = s + (self.rvcc if self.rvcc else GOPTS.rvcc) else: s = s + (self.cc if self.cc else GOPTS.cc) return cat(flags, s) def bld(self, arch, ins, out): out_is_obj = out.endswith(".o") objs = [] aobjs = [] if len(ins) == 1: if not out_is_obj: objs = [arch.out2objname(out)] aobjs = [path(self.dstdir, objs[0])] else: for src in ins: obj = arch.src2objname(src) if not out_is_obj or obj != out: objs.append(obj) aobjs = [path(self.dstdir, obj) for obj in objs] ains = [path(self.srcdir, i) for i in ins] bflags = self.append_cc(arch, self.bflags) fmtdata = { "arch": arch.name, "aobjs": " ".join(aobjs), "srcdir": self.srcdir, "dstdir": self.dstdir, "ins": " ".join(ins), "ains": " ".join(ains), "out": out, "bflags": " " + bflags if bflags else "", "build": TOOLS.build, } self.append("""\ .PHONY: {out} {out}: {dstdir}/{out} {dstdir}/{out} {aobjs}: {ains} \t{build} --arch {arch} --srcdir {srcdir} --dstdir {dstdir} {ins} -o {out}{bflags} """.format(**fmtdata)) def _ssh_copy(self, fmtdata): self.append("""\ .PHONY: {tgt} {tgt}: {out} \tscp {src} {rem}:{dst} """.format(**fmtdata)) def _adb_copy(self, fmtdata): self.append("""\ .PHONY: {tgt} {tgt}: {out} \t{rem} push {src} {dst} """.format(**fmtdata)) def copy(self, am, name): # don't copy if we're not on an x86 host OR # if 'out' is a native binary OR # if 'out' is a RISC-V binary (we can emulate it) if not X86.is_native() or am.narch.is_native() or am.narch.is_rv32(): return '' out = am.bin(name) tgt = out + self.copy_suffix() srcdir = self.dstdir src = path(srcdir, out) dstdir = am.narch.get_remote_path(srcdir) dst = path(dstdir, out) fmtdata = { "out": out, "tgt": tgt, "src": src, "rem": am.narch.rem_host, "dst": dst, } if GOPTS.ssh_copy(): self._ssh_copy(fmtdata) else: self._adb_copy(fmtdata) return tgt @staticmethod def mk_arm_dstdir_static(dstdir): return ("ssh {} mkdir -p {}" if GOPTS.ssh_copy() else "{} shell mkdir -p {}").format( ARM.rem_host, ARM.get_remote_path(dstdir)) def mk_arm_dstdir(self, name): tgt = name + "-arm-dstdir" self.append("""\ .PHONY: {0} {0}: \t{1} """.format( tgt, self.mk_arm_dstdir_static(self.dstdir))) return tgt def run(self, name, robj, am, dep_bin=True): dir = self.dstdir bin = robj.bin(am, name) suffix = "-" + robj.id if robj.id else "" rflags = robj.rflags(am, name) narch = am.narch fmtdata = { "arch": narch.name, "dir": dir, "bin": bin, "suffix": suffix, "rflags": " " + rflags if rflags else "", "run": TOOLS.run, "dep": " " + bin if dep_bin else "", } self.append("""\ .PHONY: {bin}{suffix}-run {bin}{suffix}-run:{dep} \t{run} --arch {arch} --dir {dir} {bin}{rflags} """.format(**fmtdata)) def xlate(self, am, _in, out): flags = '--sbtflags " -regs={}"'.format(am.mode) for flag in self.sbtflags: flags = flags + ' " {}"'.format(flag) xflags = self.append_cc(am.narch, self.xflags) fmtdata = { "arch": am.narch.name, "srcdir": self.srcdir, "dstdir": self.dstdir, "in": _in, "out": out, "xflags": " " + xflags if xflags else "", "flags": flags, "xlate": TOOLS.xlate, } self.append("""\ .PHONY: {out} {out}: {dstdir}/{out} {dstdir}/{out}: {dstdir}/{in} \t{xlate} --arch {arch} --srcdir {srcdir} --dstdir {dstdir} {in} -o {out}{xflags} {flags} """.format(**fmtdata)) def _diff(self, f0, f1): if self.out_filter: return ( "\tcat {0} | {2} >{0}.filt\n" + "\tcat {1} | {2} >{1}.filt\n" + "\tdiff {0}.filt {1}.filt").format( f0, f1, self.out_filter) else: return "\tdiff {0} {1}".format(f0, f1) def test1(self, run): id = run.id if run.outidx: name = lambda am: run.out(am, name=self.name) else: name = lambda am: path(self.dstdir, Run.build_name(am, self.name, id, Run.out_suffix())) # gen diffs diffs = [] def diff(f0, f1): diffs.append(self._diff(f0, f1)) xams = self._xams() for xam in xams: if not xam.narch.is_native(): continue xout = name(xam) # foreign # skip rv32 if on arm if not xam.narch.is_arm(): fam = ArchAndMode(None, xam.farch) fout = name(fam) diff(fout, xout) # native if xam.narch in self.narchs: nam = ArchAndMode(None, xam.narch) nout = name(nam) diff(nout, xout) if GOPTS.rv32 == "rv8": fam = ArchAndMode(RV32, None) nam = ArchAndMode(None, X86) fout = name(fam) nout = name(nam) diff(fout, nout) tname = Run.build_name(None, self.name, id, None) fmtdata = { "name": tname, "runs": " ".join(self.get_all_runs(Runs([run]), self.name)), "diffs": "\n".join(diffs) } self.append("""\ .PHONY: {name}-test {name}-test: {runs} {diffs} """.format(**fmtdata)) return tname + self.test_suffix() def test(self, runs): tests = [] for run in runs: tests.append(self.test1(run)) if len(tests) > 1: tsuf = self.test_suffix() self.alias(self.name + tsuf, tests) def measure(self, robj, dep_bin=True, rv32=False): args_str = robj.str(None) suffix = robj.id mflags = self.mflags if suffix: if not mflags: mflags = [] mflags.extend(["--id", self.name + '-' + suffix]) fmtdata = { "measure": TOOLS.measure, "dstdir": self.dstdir, "name": self.name, "rv32": " --rv32" if rv32 else "", "suffix": "-" + suffix if suffix else "", "args": " " + args_str if args_str else "", "stdin": " --stdin=" + robj.stdin if robj.stdin else "", "mflags": " " + " ".join(mflags) if mflags else "", "dep": " " + self.name if dep_bin else "", } self.append("""\ .PHONY: {name}{suffix}-measure {name}{suffix}-measure:{dep} \t{measure} {dstdir} {name}{rv32}{args}{stdin}{mflags} """.format(**fmtdata)) def alias(self, name, aliasees): fmtdata = { "name": name, "aliasees": " ".join(aliasees), } self.append("""\ .PHONY: {name} {name}: {aliasees} """.format(**fmtdata)) def alias_build_all(self): mod = self.name nmods = [arch.add_prefix(mod) for arch in self.narchs] xmods = [farch.add_prefix(narch.add_prefix(mod)) + "-" + mode for (farch, narch) in self.xarchs for mode in self.modes] fmtdata = { "mod": mod, "nmods": " ".join(nmods), "xmods": " ".join(xmods) } self.append("""\ .PHONY: {mod} {mod}: {nmods} {xmods} """.format(**fmtdata)) def _farchs(self): return unique([farch for (farch, narch) in self.xarchs]) def _nams(self): return [ArchAndMode(None, narch) for narch in self.narchs] def _xams(self): return [ArchAndMode(farch, narch, mode) for (farch, narch) in self.xarchs for mode in self.modes] def _ufams(self): farchs = unique([am.farch for am in self._xams() if am.farch]) return [ArchAndMode(farch, None) for farch in farchs] def _unams(self): narchs = unique([narch for narch in self.narchs]) return [ArchAndMode(None, narch) for narch in narchs] def ams(self): return self._nams() + self._xams() def _ntgts(self, name): return [am.bin(name) for am in self._nams()] def _xtgts(self, name): return [am.bin(name) for am in self._xams()] def tgts(self, name): return self._ntgts(name) + self._xtgts(name) def apply_suffixes(self, tgts, suffixes, gsuf=None): a = [] gsuf = gsuf if gsuf else '' for tgt in tgts: for suffix in suffixes: suf = "-" + suffix if suffix else "" a.append(tgt + suf + gsuf) return a @staticmethod def run_suffix(): return "-run" @staticmethod def test_suffix(): return "-test" @staticmethod def copy_suffix(): return "-copy" @staticmethod def run_suffixes(runs): return [r.id if r.id else '' for r in runs] def get_runs(self, runs, am, name): return self.apply_suffixes([am.bin(name)], self.run_suffixes(runs), self.run_suffix()) def get_all_runs(self, runs, name): return self.apply_suffixes(self.tgts(name), self.run_suffixes(runs), self.run_suffix()) def get_all_tests(self, runs, name): return self.apply_suffixes(self.tgts(name), self.run_suffixes(runs), self.test_suffix()) def alias_run_all(self, runs): fmtdata = { "name": self.name, "runs": " ".join(self.get_all_runs(runs, self.name)), } self.append("""\ .PHONY: {name}-run {name}-run: {runs} """.format(**fmtdata)) def clean(self): self.append("""\ .phony: {name}-clean {name}-clean: \trm -rf {dstdir} """.format(**{ "name": self.name, "dstdir": self.dstdir}))
# Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. import mock from oslo_serialization import jsonutils import six import testscenarios import webob from nova.api.openstack import api_version_request as api_version from nova.api.openstack import versioned_method from nova.api.openstack import wsgi from nova import exception from nova import test from nova.tests.unit.api.openstack import fakes from nova.tests.unit import matchers from nova.tests.unit import utils class MicroversionedTest(testscenarios.WithScenarios, test.NoDBTestCase): scenarios = [ ('legacy-microversion', { 'header_name': 'X-OpenStack-Nova-API-Version', }), ('modern-microversion', { 'header_name': 'OpenStack-API-Version', }) ] def _make_microversion_header(self, value): if 'nova' in self.header_name.lower(): return {self.header_name: value} else: return {self.header_name: 'compute %s' % value} class RequestTest(MicroversionedTest): def setUp(self): super(RequestTest, self).setUp() self.stub_out('nova.i18n.get_available_languages', lambda *args, **kwargs: ['en_GB', 'en_AU', 'de', 'zh_CN', 'en_US']) def test_content_type_missing(self): request = wsgi.Request.blank('/tests/123', method='POST') request.body = b"<body />" self.assertIsNone(request.get_content_type()) def test_content_type_unsupported(self): request = wsgi.Request.blank('/tests/123', method='POST') request.headers["Content-Type"] = "text/html" request.body = b"asdf<br />" self.assertRaises(exception.InvalidContentType, request.get_content_type) def test_content_type_with_charset(self): request = wsgi.Request.blank('/tests/123') request.headers["Content-Type"] = "application/json; charset=UTF-8" result = request.get_content_type() self.assertEqual(result, "application/json") def test_content_type_accept_default(self): request = wsgi.Request.blank('/tests/123.unsupported') request.headers["Accept"] = "application/unsupported1" result = request.best_match_content_type() self.assertEqual(result, "application/json") def test_from_request(self): request = wsgi.Request.blank('/') accepted = 'bogus;q=1, en-gb;q=0.7,en-us,en;q=0.5,*;q=0.7' request.headers = {'Accept-Language': accepted} self.assertEqual(request.best_match_language(), 'en_US') def test_asterisk(self): # asterisk should match first available if there # are not any other available matches request = wsgi.Request.blank('/') accepted = '*,es;q=0.5' request.headers = {'Accept-Language': accepted} self.assertEqual(request.best_match_language(), 'en_GB') def test_prefix(self): request = wsgi.Request.blank('/') accepted = 'zh' request.headers = {'Accept-Language': accepted} self.assertEqual(request.best_match_language(), 'zh_CN') def test_secondary(self): request = wsgi.Request.blank('/') accepted = 'nn,en-gb;q=0.5' request.headers = {'Accept-Language': accepted} self.assertEqual(request.best_match_language(), 'en_GB') def test_none_found(self): request = wsgi.Request.blank('/') accepted = 'nb-no' request.headers = {'Accept-Language': accepted} self.assertIsNone(request.best_match_language()) def test_no_lang_header(self): request = wsgi.Request.blank('/') accepted = '' request.headers = {'Accept-Language': accepted} self.assertIsNone(request.best_match_language()) def test_api_version_request_header_none(self): request = wsgi.Request.blank('/') request.set_api_version_request() self.assertEqual(api_version.APIVersionRequest( api_version.DEFAULT_API_VERSION), request.api_version_request) @mock.patch("nova.api.openstack.api_version_request.max_api_version") def test_api_version_request_header(self, mock_maxver): mock_maxver.return_value = api_version.APIVersionRequest("2.14") request = wsgi.Request.blank('/') request.headers = self._make_microversion_header('2.14') request.set_api_version_request() self.assertEqual(api_version.APIVersionRequest("2.14"), request.api_version_request) @mock.patch("nova.api.openstack.api_version_request.max_api_version") def test_api_version_request_header_latest(self, mock_maxver): mock_maxver.return_value = api_version.APIVersionRequest("3.5") request = wsgi.Request.blank('/') request.headers = self._make_microversion_header('latest') request.set_api_version_request() self.assertEqual(api_version.APIVersionRequest("3.5"), request.api_version_request) def test_api_version_request_header_invalid(self): request = wsgi.Request.blank('/') request.headers = self._make_microversion_header('2.1.3') self.assertRaises(exception.InvalidAPIVersionString, request.set_api_version_request) class ActionDispatcherTest(test.NoDBTestCase): def test_dispatch(self): serializer = wsgi.ActionDispatcher() serializer.create = lambda x: 'pants' self.assertEqual(serializer.dispatch({}, action='create'), 'pants') def test_dispatch_action_None(self): serializer = wsgi.ActionDispatcher() serializer.create = lambda x: 'pants' serializer.default = lambda x: 'trousers' self.assertEqual(serializer.dispatch({}, action=None), 'trousers') def test_dispatch_default(self): serializer = wsgi.ActionDispatcher() serializer.create = lambda x: 'pants' serializer.default = lambda x: 'trousers' self.assertEqual(serializer.dispatch({}, action='update'), 'trousers') class JSONDictSerializerTest(test.NoDBTestCase): def test_json(self): input_dict = dict(servers=dict(a=(2, 3))) expected_json = '{"servers":{"a":[2,3]}}' serializer = wsgi.JSONDictSerializer() result = serializer.serialize(input_dict) result = result.replace('\n', '').replace(' ', '') self.assertEqual(result, expected_json) class JSONDeserializerTest(test.NoDBTestCase): def test_json(self): data = """{"a": { "a1": "1", "a2": "2", "bs": ["1", "2", "3", {"c": {"c1": "1"}}], "d": {"e": "1"}, "f": "1"}}""" as_dict = { 'body': { 'a': { 'a1': '1', 'a2': '2', 'bs': ['1', '2', '3', {'c': {'c1': '1'}}], 'd': {'e': '1'}, 'f': '1', }, }, } deserializer = wsgi.JSONDeserializer() self.assertEqual(deserializer.deserialize(data), as_dict) def test_json_valid_utf8(self): data = b"""{"server": {"min_count": 1, "flavorRef": "1", "name": "\xe6\xa6\x82\xe5\xbf\xb5", "imageRef": "10bab10c-1304-47d", "max_count": 1}} """ as_dict = { 'body': { u'server': { u'min_count': 1, u'flavorRef': u'1', u'name': u'\u6982\u5ff5', u'imageRef': u'10bab10c-1304-47d', u'max_count': 1 } } } deserializer = wsgi.JSONDeserializer() self.assertEqual(deserializer.deserialize(data), as_dict) def test_json_invalid_utf8(self): """Send invalid utf-8 to JSONDeserializer.""" data = b"""{"server": {"min_count": 1, "flavorRef": "1", "name": "\xf0\x28\x8c\x28", "imageRef": "10bab10c-1304-47d", "max_count": 1}} """ deserializer = wsgi.JSONDeserializer() self.assertRaises(exception.MalformedRequestBody, deserializer.deserialize, data) class ResourceTest(MicroversionedTest): def get_req_id_header_name(self, request): header_name = 'x-openstack-request-id' if utils.get_api_version(request) < 3: header_name = 'x-compute-request-id' return header_name def test_resource_receives_api_version_request_default(self): class Controller(object): def index(self, req): if req.api_version_request != \ api_version.APIVersionRequest( api_version.DEFAULT_API_VERSION): raise webob.exc.HTTPInternalServerError() return 'success' app = fakes.TestRouter(Controller()) req = webob.Request.blank('/tests') response = req.get_response(app) self.assertEqual(b'success', response.body) self.assertEqual(response.status_int, 200) @mock.patch("nova.api.openstack.api_version_request.max_api_version") def test_resource_receives_api_version_request(self, mock_maxver): version = "2.5" mock_maxver.return_value = api_version.APIVersionRequest(version) class Controller(object): def index(self, req): if req.api_version_request != \ api_version.APIVersionRequest(version): raise webob.exc.HTTPInternalServerError() return 'success' app = fakes.TestRouter(Controller()) req = webob.Request.blank('/tests') req.headers = self._make_microversion_header(version) response = req.get_response(app) self.assertEqual(b'success', response.body) self.assertEqual(response.status_int, 200) def test_resource_receives_api_version_request_invalid(self): invalid_version = "2.5.3" class Controller(object): def index(self, req): return 'success' app = fakes.TestRouter(Controller()) req = webob.Request.blank('/tests') req.headers = self._make_microversion_header(invalid_version) response = req.get_response(app) self.assertEqual(400, response.status_int) def test_resource_call_with_method_get(self): class Controller(object): def index(self, req): return 'success' app = fakes.TestRouter(Controller()) # the default method is GET req = webob.Request.blank('/tests') response = req.get_response(app) self.assertEqual(b'success', response.body) self.assertEqual(response.status_int, 200) req.body = b'{"body": {"key": "value"}}' response = req.get_response(app) self.assertEqual(b'success', response.body) self.assertEqual(response.status_int, 200) req.content_type = 'application/json' response = req.get_response(app) self.assertEqual(b'success', response.body) self.assertEqual(response.status_int, 200) def test_resource_call_with_method_post(self): class Controller(object): @wsgi.expected_errors(400) def create(self, req, body): if expected_body != body: msg = "The request body invalid" raise webob.exc.HTTPBadRequest(explanation=msg) return "success" # verify the method: POST app = fakes.TestRouter(Controller()) req = webob.Request.blank('/tests', method="POST", content_type='application/json') req.body = b'{"body": {"key": "value"}}' expected_body = {'body': { "key": "value" } } response = req.get_response(app) self.assertEqual(response.status_int, 200) self.assertEqual(b'success', response.body) # verify without body expected_body = None req.body = None response = req.get_response(app) self.assertEqual(response.status_int, 200) self.assertEqual(b'success', response.body) # the body is validated in the controller expected_body = {'body': None} response = req.get_response(app) expected_unsupported_type_body = {'badRequest': {'message': 'The request body invalid', 'code': 400}} self.assertEqual(response.status_int, 400) self.assertEqual(expected_unsupported_type_body, jsonutils.loads(response.body)) def test_resource_call_with_method_put(self): class Controller(object): def update(self, req, id, body): if expected_body != body: msg = "The request body invalid" raise webob.exc.HTTPBadRequest(explanation=msg) return "success" # verify the method: PUT app = fakes.TestRouter(Controller()) req = webob.Request.blank('/tests/test_id', method="PUT", content_type='application/json') req.body = b'{"body": {"key": "value"}}' expected_body = {'body': { "key": "value" } } response = req.get_response(app) self.assertEqual(b'success', response.body) self.assertEqual(response.status_int, 200) req.body = None expected_body = None response = req.get_response(app) self.assertEqual(response.status_int, 200) # verify no content_type is contained in the request req = webob.Request.blank('/tests/test_id', method="PUT", content_type='application/xml') req.content_type = 'application/xml' req.body = b'{"body": {"key": "value"}}' response = req.get_response(app) expected_unsupported_type_body = {'badMediaType': {'message': 'Unsupported Content-Type', 'code': 415}} self.assertEqual(response.status_int, 415) self.assertEqual(expected_unsupported_type_body, jsonutils.loads(response.body)) def test_resource_call_with_method_delete(self): class Controller(object): def delete(self, req, id): return "success" # verify the method: DELETE app = fakes.TestRouter(Controller()) req = webob.Request.blank('/tests/test_id', method="DELETE") response = req.get_response(app) self.assertEqual(response.status_int, 200) self.assertEqual(b'success', response.body) # ignore the body req.body = b'{"body": {"key": "value"}}' response = req.get_response(app) self.assertEqual(response.status_int, 200) self.assertEqual(b'success', response.body) def test_resource_forbidden(self): class Controller(object): def index(self, req): raise exception.Forbidden() req = webob.Request.blank('/tests') app = fakes.TestRouter(Controller()) response = req.get_response(app) self.assertEqual(response.status_int, 403) def test_resource_not_authorized(self): class Controller(object): def index(self, req): raise exception.Unauthorized() req = webob.Request.blank('/tests') app = fakes.TestRouter(Controller()) self.assertRaises( exception.Unauthorized, req.get_response, app) def test_dispatch(self): class Controller(object): def index(self, req, pants=None): return pants controller = Controller() resource = wsgi.Resource(controller) method = resource.get_method(None, 'index', None, '') actual = resource.dispatch(method, None, {'pants': 'off'}) expected = 'off' self.assertEqual(actual, expected) def test_get_method_unknown_controller_method(self): class Controller(object): def index(self, req, pants=None): return pants controller = Controller() resource = wsgi.Resource(controller) self.assertRaises(AttributeError, resource.get_method, None, 'create', None, '') def test_get_method_action_json(self): class Controller(wsgi.Controller): @wsgi.action('fooAction') def _action_foo(self, req, id, body): return body controller = Controller() resource = wsgi.Resource(controller) method = resource.get_method(None, 'action', 'application/json', '{"fooAction": true}') self.assertEqual(controller._action_foo, method) def test_get_method_action_bad_body(self): class Controller(wsgi.Controller): @wsgi.action('fooAction') def _action_foo(self, req, id, body): return body controller = Controller() resource = wsgi.Resource(controller) self.assertRaises(exception.MalformedRequestBody, resource.get_method, None, 'action', 'application/json', '{}') def test_get_method_unknown_controller_action(self): class Controller(wsgi.Controller): @wsgi.action('fooAction') def _action_foo(self, req, id, body): return body controller = Controller() resource = wsgi.Resource(controller) self.assertRaises(KeyError, resource.get_method, None, 'action', 'application/json', '{"barAction": true}') def test_get_method_action_method(self): class Controller(object): def action(self, req, pants=None): return pants controller = Controller() resource = wsgi.Resource(controller) method = resource.get_method(None, 'action', 'application/xml', '<fooAction>true</fooAction') self.assertEqual(controller.action, method) def test_get_action_args(self): class Controller(object): def index(self, req, pants=None): return pants controller = Controller() resource = wsgi.Resource(controller) env = { 'wsgiorg.routing_args': [None, { 'controller': None, 'format': None, 'action': 'update', 'id': 12, }], } expected = {'action': 'update', 'id': 12} self.assertEqual(resource.get_action_args(env), expected) def test_get_body_bad_content(self): class Controller(object): def index(self, req, pants=None): return pants controller = Controller() resource = wsgi.Resource(controller) request = wsgi.Request.blank('/', method='POST') request.headers['Content-Type'] = 'application/none' request.body = b'foo' self.assertRaises(exception.InvalidContentType, resource.get_body, request) def test_get_body_no_content_type(self): class Controller(object): def index(self, req, pants=None): return pants controller = Controller() resource = wsgi.Resource(controller) request = wsgi.Request.blank('/', method='POST') request.body = b'foo' content_type, body = resource.get_body(request) self.assertIsNone(content_type) self.assertEqual(b'foo', body) def test_get_body_no_content_body(self): class Controller(object): def index(self, req, pants=None): return pants controller = Controller() resource = wsgi.Resource(controller) request = wsgi.Request.blank('/', method='POST') request.headers['Content-Type'] = 'application/json' request.body = b'' content_type, body = resource.get_body(request) self.assertEqual('application/json', content_type) self.assertEqual(b'', body) def test_get_body_content_body_none(self): resource = wsgi.Resource(None) request = wsgi.Request.blank('/', method='PUT') body = None contents = resource._get_request_content(body, request) self.assertIn('body', contents) self.assertIsNone(contents['body']) def test_get_body(self): class Controller(object): def index(self, req, pants=None): return pants controller = Controller() resource = wsgi.Resource(controller) request = wsgi.Request.blank('/', method='POST') request.headers['Content-Type'] = 'application/json' request.body = b'foo' content_type, body = resource.get_body(request) self.assertEqual(content_type, 'application/json') self.assertEqual(b'foo', body) def test_get_request_id_with_dict_response_body(self): class Controller(wsgi.Controller): def index(self, req): return {'foo': 'bar'} req = fakes.HTTPRequest.blank('/tests') app = fakes.TestRouter(Controller()) response = req.get_response(app) self.assertIn('nova.context', req.environ) self.assertEqual(b'{"foo": "bar"}', response.body) self.assertEqual(response.status_int, 200) def test_no_request_id_with_str_response_body(self): class Controller(wsgi.Controller): def index(self, req): return 'foo' req = fakes.HTTPRequest.blank('/tests') app = fakes.TestRouter(Controller()) response = req.get_response(app) # NOTE(alaski): This test is really to ensure that a str response # doesn't error. Not having a request_id header is a side effect of # our wsgi setup, ideally it would be there. expected_header = self.get_req_id_header_name(req) self.assertFalse(hasattr(response.headers, expected_header)) self.assertEqual(b'foo', response.body) self.assertEqual(response.status_int, 200) def test_get_request_id_no_response_body(self): class Controller(object): def index(self, req): pass req = fakes.HTTPRequest.blank('/tests') app = fakes.TestRouter(Controller()) response = req.get_response(app) self.assertIn('nova.context', req.environ) self.assertEqual(b'', response.body) self.assertEqual(response.status_int, 200) def test_deserialize_default(self): class Controller(object): def index(self, req, pants=None): return pants controller = Controller() resource = wsgi.Resource(controller) obj = resource.deserialize('["foo"]') self.assertEqual(obj, {'body': ['foo']}) def test_register_actions(self): class Controller(object): def index(self, req, pants=None): return pants class ControllerExtended(wsgi.Controller): @wsgi.action('fooAction') def _action_foo(self, req, id, body): return body @wsgi.action('barAction') def _action_bar(self, req, id, body): return body controller = Controller() resource = wsgi.Resource(controller) self.assertEqual({}, resource.wsgi_actions) extended = ControllerExtended() resource.register_actions(extended) self.assertEqual({ 'fooAction': extended._action_foo, 'barAction': extended._action_bar, }, resource.wsgi_actions) def test_get_method(self): class Controller(object): def index(self, req, pants=None): return pants controller = Controller() resource = wsgi.Resource(controller) method = resource.get_method(None, 'index', None, '') self.assertEqual(method, controller.index) def test_get_method_action(self): class Controller(wsgi.Controller): def index(self, req, pants=None): return pants @wsgi.action('fooAction') def _action_foo(self, req, id, body): return body controller = Controller() resource = wsgi.Resource(controller) method = resource.get_method(None, 'action', 'application/json', '{"fooAction": true}') self.assertEqual(method, controller._action_foo) def test_get_method_action_whitelist(self): class Controller(wsgi.Controller): def index(self, req, pants=None): return pants class ControllerExtended(wsgi.Controller): @wsgi.action('create') def _create(self, req, body): pass @wsgi.action('delete') def _delete(self, req, id): pass controller = Controller() extended = ControllerExtended() resource = wsgi.Resource(controller) resource.register_actions(extended) method = resource.get_method(None, 'create', 'application/json', '{"create": true}') self.assertEqual(method, extended._create) method = resource.get_method(None, 'delete', None, None) self.assertEqual(method, extended._delete) def test_resource_exception_handler_type_error(self): # A TypeError should be translated to a Fault/HTTP 400. def foo(a,): return a try: with wsgi.ResourceExceptionHandler(): foo() # generate a TypeError self.fail("Should have raised a Fault (HTTP 400)") except wsgi.Fault as fault: self.assertEqual(400, fault.status_int) def test_resource_headers_are_utf8(self): resp = webob.Response(status_int=202) resp.headers['x-header1'] = 1 resp.headers['x-header2'] = u'header2' resp.headers['x-header3'] = u'header3' class Controller(object): def index(self, req): return resp req = webob.Request.blank('/tests') app = fakes.TestRouter(Controller()) response = req.get_response(app) for val in six.itervalues(response.headers): # All headers must be utf8 self.assertThat(val, matchers.EncodedByUTF8()) self.assertEqual('1', response.headers['x-header1']) self.assertEqual('header2', response.headers['x-header2']) self.assertEqual('header3', response.headers['x-header3']) def test_resource_valid_utf8_body(self): class Controller(object): def update(self, req, id, body): return body req = webob.Request.blank('/tests/test_id', method="PUT") body = b""" {"name": "\xe6\xa6\x82\xe5\xbf\xb5" } """ expected_body = b'{"name": "\\u6982\\u5ff5"}' req.body = body req.headers['Content-Type'] = 'application/json' app = fakes.TestRouter(Controller()) response = req.get_response(app) self.assertEqual(response.body, expected_body) self.assertEqual(response.status_int, 200) def test_resource_invalid_utf8(self): class Controller(object): def update(self, req, id, body): return body req = webob.Request.blank('/tests/test_id', method="PUT") body = b""" {"name": "\xf0\x28\x8c\x28" } """ req.body = body req.headers['Content-Type'] = 'application/json' app = fakes.TestRouter(Controller()) self.assertRaises(UnicodeDecodeError, req.get_response, app) class ResponseObjectTest(test.NoDBTestCase): def test_default_code(self): robj = wsgi.ResponseObject({}) self.assertEqual(robj.code, 200) def test_modified_code(self): robj = wsgi.ResponseObject({}) robj._default_code = 202 self.assertEqual(robj.code, 202) def test_override_default_code(self): robj = wsgi.ResponseObject({}, code=404) self.assertEqual(robj.code, 404) def test_override_modified_code(self): robj = wsgi.ResponseObject({}, code=404) robj._default_code = 202 self.assertEqual(robj.code, 404) def test_set_header(self): robj = wsgi.ResponseObject({}) robj['Header'] = 'foo' self.assertEqual(robj.headers, {'header': 'foo'}) def test_get_header(self): robj = wsgi.ResponseObject({}) robj['Header'] = 'foo' self.assertEqual(robj['hEADER'], 'foo') def test_del_header(self): robj = wsgi.ResponseObject({}) robj['Header'] = 'foo' del robj['hEADER'] self.assertNotIn('header', robj.headers) def test_header_isolation(self): robj = wsgi.ResponseObject({}) robj['Header'] = 'foo' hdrs = robj.headers hdrs['hEADER'] = 'bar' self.assertEqual(robj['hEADER'], 'foo') class ValidBodyTest(test.NoDBTestCase): def setUp(self): super(ValidBodyTest, self).setUp() self.controller = wsgi.Controller() def test_is_valid_body(self): body = {'foo': {}} self.assertTrue(self.controller.is_valid_body(body, 'foo')) def test_is_valid_body_none(self): wsgi.Resource(controller=None) self.assertFalse(self.controller.is_valid_body(None, 'foo')) def test_is_valid_body_empty(self): wsgi.Resource(controller=None) self.assertFalse(self.controller.is_valid_body({}, 'foo')) def test_is_valid_body_no_entity(self): wsgi.Resource(controller=None) body = {'bar': {}} self.assertFalse(self.controller.is_valid_body(body, 'foo')) def test_is_valid_body_malformed_entity(self): wsgi.Resource(controller=None) body = {'foo': 'bar'} self.assertFalse(self.controller.is_valid_body(body, 'foo')) class TestController(test.NoDBTestCase): def test_check_for_versions_intersection_negative(self): func_list = \ [versioned_method.VersionedMethod('foo', api_version.APIVersionRequest( '2.1'), api_version.APIVersionRequest( '2.4'), None), versioned_method.VersionedMethod('foo', api_version.APIVersionRequest( '2.11'), api_version.APIVersionRequest( '3.1'), None), versioned_method.VersionedMethod('foo', api_version.APIVersionRequest( '2.8'), api_version.APIVersionRequest( '2.9'), None), ] result = wsgi.Controller.check_for_versions_intersection(func_list= func_list) self.assertFalse(result) func_list = \ [versioned_method.VersionedMethod('foo', api_version.APIVersionRequest( '2.12'), api_version.APIVersionRequest( '2.14'), None), versioned_method.VersionedMethod('foo', api_version.APIVersionRequest( '3.0'), api_version.APIVersionRequest( '3.4'), None) ] result = wsgi.Controller.check_for_versions_intersection(func_list= func_list) self.assertFalse(result) def test_check_for_versions_intersection_positive(self): func_list = \ [versioned_method.VersionedMethod('foo', api_version.APIVersionRequest( '2.1'), api_version.APIVersionRequest( '2.4'), None), versioned_method.VersionedMethod('foo', api_version.APIVersionRequest( '2.3'), api_version.APIVersionRequest( '3.0'), None), versioned_method.VersionedMethod('foo', api_version.APIVersionRequest( '2.8'), api_version.APIVersionRequest( '2.9'), None), ] result = wsgi.Controller.check_for_versions_intersection(func_list= func_list) self.assertTrue(result) class ExpectedErrorTestCase(test.NoDBTestCase): def test_expected_error(self): @wsgi.expected_errors(404) def fake_func(): raise webob.exc.HTTPNotFound() self.assertRaises(webob.exc.HTTPNotFound, fake_func) def test_expected_error_from_list(self): @wsgi.expected_errors((404, 403)) def fake_func(): raise webob.exc.HTTPNotFound() self.assertRaises(webob.exc.HTTPNotFound, fake_func) def test_unexpected_error(self): @wsgi.expected_errors(404) def fake_func(): raise webob.exc.HTTPConflict() self.assertRaises(webob.exc.HTTPInternalServerError, fake_func) def test_unexpected_error_from_list(self): @wsgi.expected_errors((404, 413)) def fake_func(): raise webob.exc.HTTPConflict() self.assertRaises(webob.exc.HTTPInternalServerError, fake_func) def test_unexpected_policy_not_authorized_error(self): @wsgi.expected_errors(404) def fake_func(): raise exception.PolicyNotAuthorized(action="foo") self.assertRaises(exception.PolicyNotAuthorized, fake_func)
""" The rechunk module defines: intersect_chunks: a function for converting chunks to new dimensions rechunk: a function to convert the blocks of an existing dask array to new chunks or blockshape """ from __future__ import absolute_import, division, print_function import heapq from itertools import product, chain, count from operator import getitem, add, mul, itemgetter import numpy as np import toolz from toolz import accumulate, reduce from ..base import tokenize from .core import concatenate3, Array, normalize_chunks from .wrap import empty from .. import sharedict def cumdims_label(chunks, const): """ Internal utility for cumulative sum with label. >>> cumdims_label(((5, 3, 3), (2, 2, 1)), 'n') # doctest: +NORMALIZE_WHITESPACE [(('n', 0), ('n', 5), ('n', 8), ('n', 11)), (('n', 0), ('n', 2), ('n', 4), ('n', 5))] """ return [tuple(zip((const,) * (1 + len(bds)), accumulate(add, (0,) + bds))) for bds in chunks] def _breakpoints(cumold, cumnew): """ >>> new = cumdims_label(((2, 3), (2, 2, 1)), 'n') >>> old = cumdims_label(((2, 2, 1), (5,)), 'o') >>> _breakpoints(new[0], old[0]) (('n', 0), ('o', 0), ('n', 2), ('o', 2), ('o', 4), ('n', 5), ('o', 5)) >>> _breakpoints(new[1], old[1]) (('n', 0), ('o', 0), ('n', 2), ('n', 4), ('n', 5), ('o', 5)) """ return tuple(sorted(cumold + cumnew, key=itemgetter(1))) def _intersect_1d(breaks): """ Internal utility to intersect chunks for 1d after preprocessing. >>> new = cumdims_label(((2, 3), (2, 2, 1)), 'n') >>> old = cumdims_label(((2, 2, 1), (5,)), 'o') >>> _intersect_1d(_breakpoints(old[0], new[0])) # doctest: +NORMALIZE_WHITESPACE [[(0, slice(0, 2, None))], [(1, slice(0, 2, None)), (2, slice(0, 1, None))]] >>> _intersect_1d(_breakpoints(old[1], new[1])) # doctest: +NORMALIZE_WHITESPACE [[(0, slice(0, 2, None))], [(0, slice(2, 4, None))], [(0, slice(4, 5, None))]] Parameters ---------- breaks: list of tuples Each tuple is ('o', 8) or ('n', 8) These are pairs of 'o' old or new 'n' indicator with a corresponding cumulative sum. Uses 'o' and 'n' to make new tuples of slices for the new block crosswalk to old blocks. """ start = 0 last_end = 0 old_idx = 0 ret = [] ret_next = [] for idx in range(1, len(breaks)): label, br = breaks[idx] last_label, last_br = breaks[idx - 1] if last_label == 'n': if ret_next: ret.append(ret_next) ret_next = [] if last_label == 'o': start = 0 else: start = last_end end = br - last_br + start last_end = end if br == last_br: continue ret_next.append((old_idx, slice(start, end))) if label == 'o': old_idx += 1 start = 0 if ret_next: ret.append(ret_next) return ret def intersect_chunks(old_chunks, new_chunks): """ Make dask.array slices as intersection of old and new chunks. >>> intersections = intersect_chunks(((4, 4), (2,)), ... ((8,), (1, 1))) >>> list(intersections) # doctest: +NORMALIZE_WHITESPACE [(((0, slice(0, 4, None)), (0, slice(0, 1, None))), ((1, slice(0, 4, None)), (0, slice(0, 1, None)))), (((0, slice(0, 4, None)), (0, slice(1, 2, None))), ((1, slice(0, 4, None)), (0, slice(1, 2, None))))] Parameters ---------- old_chunks : iterable of tuples block sizes along each dimension (convert from old_chunks) new_chunks: iterable of tuples block sizes along each dimension (converts to new_chunks) """ cmo = cumdims_label(old_chunks, 'o') cmn = cumdims_label(new_chunks, 'n') sums = [sum(o) for o in old_chunks] sums2 = [sum(n) for n in old_chunks] if not sums == sums2: raise ValueError('Cannot change dimensions from to %r' % sums2) old_to_new = [_intersect_1d(_breakpoints(cm[0], cm[1])) for cm in zip(cmo, cmn)] cross1 = product(*old_to_new) cross = chain(tuple(product(*cr)) for cr in cross1) return cross def blockdims_dict_to_tuple(old, new): """ >>> blockdims_dict_to_tuple((4, 5, 6), {1: 10}) (4, 10, 6) """ newlist = list(old) for k, v in new.items(): newlist[k] = v return tuple(newlist) def blockshape_dict_to_tuple(old_chunks, d): """ >>> blockshape_dict_to_tuple(((4, 4), (5, 5)), {1: 3}) ((4, 4), (3, 3, 3, 1)) """ shape = tuple(map(sum, old_chunks)) new_chunks = list(old_chunks) for k, v in d.items(): div = shape[k] // v mod = shape[k] % v new_chunks[k] = (v,) * div + ((mod,) if mod else ()) return tuple(new_chunks) DEFAULT_THRESHOLD = 4 DEFAULT_BLOCK_SIZE_LIMIT = 1e8 def rechunk(x, chunks, threshold=DEFAULT_THRESHOLD, block_size_limit=DEFAULT_BLOCK_SIZE_LIMIT): """ Convert blocks in dask array x for new chunks. >>> import dask.array as da >>> a = np.random.uniform(0, 1, 7**4).reshape((7,) * 4) >>> x = da.from_array(a, chunks=((2, 3, 2),)*4) >>> x.chunks ((2, 3, 2), (2, 3, 2), (2, 3, 2), (2, 3, 2)) >>> y = rechunk(x, chunks=((2, 4, 1), (4, 2, 1), (4, 3), (7,))) >>> y.chunks ((2, 4, 1), (4, 2, 1), (4, 3), (7,)) chunks also accept dict arguments mapping axis to blockshape >>> y = rechunk(x, chunks={1: 2}) # rechunk axis 1 with blockshape 2 Parameters ---------- x: dask array chunks: tuple The new block dimensions to create threshold: int The graph growth factor under which we don't bother introducing an intermediate step block_size_limit: int The maximum block size (in bytes) we want to produce during an intermediate step """ threshold = threshold or DEFAULT_THRESHOLD block_size_limit = block_size_limit or DEFAULT_BLOCK_SIZE_LIMIT if isinstance(chunks, dict): if not chunks or isinstance(next(iter(chunks.values())), int): chunks = blockshape_dict_to_tuple(x.chunks, chunks) else: chunks = blockdims_dict_to_tuple(x.chunks, chunks) if isinstance(chunks, (tuple, list)): chunks = tuple(lc if lc is not None else rc for lc, rc in zip(chunks, x.chunks)) chunks = normalize_chunks(chunks, x.shape) if chunks == x.chunks: return x ndim = x.ndim if not len(chunks) == ndim or tuple(map(sum, chunks)) != x.shape: raise ValueError("Provided chunks are not consistent with shape") steps = plan_rechunk(x.chunks, chunks, x.dtype.itemsize, threshold, block_size_limit) for c in steps: x = _compute_rechunk(x, c) return x def _number_of_blocks(chunks): return reduce(mul, map(len, chunks)) def _largest_block_size(chunks): return reduce(mul, map(max, chunks)) def estimate_graph_size(old_chunks, new_chunks): """ Estimate the graph size during a rechunk computation. """ # Estimate the number of intermediate blocks that will be produced # (we don't use intersect_chunks() which is much more expensive) crossed_size = reduce(mul, (len(oc) + len(nc) for oc, nc in zip(old_chunks, new_chunks))) return crossed_size def divide_to_width(desired_chunks, max_width): """ Minimally divide the given chunks so as to make the largest chunk width less or equal than *max_width*. """ chunks = [] for c in desired_chunks: nb_divides = int(np.ceil(c / max_width)) for i in range(nb_divides): n = c // (nb_divides - i) chunks.append(n) c -= n assert c == 0 return tuple(chunks) def merge_to_number(desired_chunks, max_number): """ Minimally merge the given chunks so as to drop the number of chunks below *max_number*, while minimizing the largest width. """ if len(desired_chunks) <= max_number: return desired_chunks distinct = set(desired_chunks) if len(distinct) == 1: # Fast path for homogeneous target, also ensuring a regular result w = distinct.pop() n = len(desired_chunks) total = n * w desired_width = total // max_number width = w * (desired_width // w) adjust = (total - max_number * width) // w return (width + w,) * adjust + (width,) * (max_number - adjust) desired_width = sum(desired_chunks) // max_number nmerges = len(desired_chunks) - max_number heap = [(desired_chunks[i] + desired_chunks[i + 1], i, i + 1) for i in range(len(desired_chunks) - 1)] heapq.heapify(heap) chunks = list(desired_chunks) while nmerges > 0: # Find smallest interval to merge width, i, j = heapq.heappop(heap) # If interval was made invalid by another merge, recompute # it, re-insert it and retry. if chunks[j] == 0: j += 1 while chunks[j] == 0: j += 1 heapq.heappush(heap, (chunks[i] + chunks[j], i, j)) continue elif chunks[i] + chunks[j] != width: heapq.heappush(heap, (chunks[i] + chunks[j], i, j)) continue # Merge assert chunks[i] != 0 chunks[i] = 0 # mark deleted chunks[j] = width nmerges -= 1 return tuple(filter(None, chunks)) def find_merge_rechunk(old_chunks, new_chunks, block_size_limit): """ Find an intermediate rechunk that would merge some adjacent blocks together in order to get us nearer the *new_chunks* target, without violating the *block_size_limit* (in number of elements). """ ndim = len(old_chunks) old_largest_width = [max(c) for c in old_chunks] new_largest_width = [max(c) for c in new_chunks] graph_size_effect = { dim: len(nc) / len(oc) for dim, (oc, nc) in enumerate(zip(old_chunks, new_chunks)) } block_size_effect = { dim: new_largest_width[dim] / old_largest_width[dim] for dim in range(ndim) } # Our goal is to reduce the number of nodes in the rechunk graph # by merging some adjacent chunks, so consider dimensions where we can # reduce the # of chunks merge_candidates = [dim for dim in range(ndim) if graph_size_effect[dim] <= 1.0] # Merging along each dimension reduces the graph size by a certain factor # and increases memory largest block size by a certain factor. # We want to optimize the graph size while staying below the given # block_size_limit. This is in effect a knapsack problem, except with # multiplicative values and weights. Just use a greedy algorithm # by trying dimensions in decreasing value / weight order. def key(k): gse = graph_size_effect[k] bse = block_size_effect[k] if bse == 1: bse = 1 + 1e-9 return np.log(gse) / np.log(bse) sorted_candidates = sorted(merge_candidates, key=key) largest_block_size = reduce(mul, old_largest_width) chunks = list(old_chunks) memory_limit_hit = False for dim in sorted_candidates: # Examine this dimension for possible graph reduction new_largest_block_size = ( largest_block_size * new_largest_width[dim] // old_largest_width[dim]) if new_largest_block_size <= block_size_limit: # Full replacement by new chunks is possible chunks[dim] = new_chunks[dim] largest_block_size = new_largest_block_size else: # Try a partial rechunk, dividing the new chunks into # smaller pieces largest_width = old_largest_width[dim] chunk_limit = int(block_size_limit * largest_width / largest_block_size) c = divide_to_width(new_chunks[dim], chunk_limit) if len(c) <= len(old_chunks[dim]): # We manage to reduce the number of blocks, so do it chunks[dim] = c largest_block_size = largest_block_size * max(c) // largest_width memory_limit_hit = True assert largest_block_size == _largest_block_size(chunks) assert largest_block_size <= block_size_limit return tuple(chunks), memory_limit_hit def find_split_rechunk(old_chunks, new_chunks, graph_size_limit): """ Find an intermediate rechunk that would split some chunks to get us nearer *new_chunks*, without violating the *graph_size_limit*. """ ndim = len(old_chunks) chunks = list(old_chunks) for dim in range(ndim): graph_size = estimate_graph_size(chunks, new_chunks) if graph_size > graph_size_limit: break if len(old_chunks[dim]) > len(new_chunks[dim]): # It's not interesting to split continue # Merge the new chunks so as to stay within the graph size budget max_number = int(len(old_chunks[dim]) * graph_size_limit / graph_size) c = merge_to_number(new_chunks[dim], max_number) assert len(c) <= max_number # Consider the merge successful if its result has a greater length # and smaller max width than the old chunks if len(c) >= len(old_chunks[dim]) and max(c) <= max(old_chunks[dim]): chunks[dim] = c return tuple(chunks) def plan_rechunk(old_chunks, new_chunks, itemsize, threshold=DEFAULT_THRESHOLD, block_size_limit=DEFAULT_BLOCK_SIZE_LIMIT): """ Plan an iterative rechunking from *old_chunks* to *new_chunks*. The plan aims to minimize the rechunk graph size. Parameters ---------- itemsize: int The item size of the array threshold: int The graph growth factor under which we don't bother introducing an intermediate step block_size_limit: int The maximum block size (in bytes) we want to produce during an intermediate step """ ndim = len(new_chunks) steps = [] if ndim <= 1 or not all(new_chunks): # Trivial array => no need for an intermediate return steps + [new_chunks] # Make it a number ef elements block_size_limit /= itemsize # Fix block_size_limit if too small for either old_chunks or new_chunks largest_old_block = _largest_block_size(old_chunks) largest_new_block = _largest_block_size(new_chunks) block_size_limit = max([block_size_limit, largest_old_block, largest_new_block, ]) # The graph size above which to optimize graph_size_threshold = threshold * (_number_of_blocks(old_chunks) + _number_of_blocks(new_chunks)) current_chunks = old_chunks first_pass = True while True: graph_size = estimate_graph_size(current_chunks, new_chunks) if graph_size < graph_size_threshold: break if first_pass: chunks = current_chunks else: # We hit the block_size_limit in a previous merge pass => # accept a significant increase in graph size in exchange for # 1) getting nearer the goal 2) reducing the largest block size # to make place for the following merge. # To see this pass in action, make the block_size_limit very small. chunks = find_split_rechunk(current_chunks, new_chunks, graph_size * threshold) chunks, memory_limit_hit = find_merge_rechunk(chunks, new_chunks, block_size_limit) if chunks == current_chunks or chunks == new_chunks: break steps.append(chunks) current_chunks = chunks if not memory_limit_hit: break first_pass = False return steps + [new_chunks] def _compute_rechunk(x, chunks): """ Compute the rechunk of *x* to the given *chunks*. """ if x.size == 0: # Special case for empty array, as the algorithm below does not behave correctly return empty(x.shape, chunks=chunks, dtype=x.dtype) ndim = x.ndim crossed = intersect_chunks(x.chunks, chunks) x2 = dict() intermediates = dict() token = tokenize(x, chunks) merge_temp_name = 'rechunk-merge-' + token split_temp_name = 'rechunk-split-' + token split_name_suffixes = count() # Pre-allocate old block references, to allow re-use and reduce the # graph's memory footprint a bit. old_blocks = np.empty([len(c) for c in x.chunks], dtype='O') for index in np.ndindex(old_blocks.shape): old_blocks[index] = (x.name,) + index # Iterate over all new blocks new_index = product(*(range(len(c)) for c in chunks)) for new_idx, cross1 in zip(new_index, crossed): key = (merge_temp_name,) + new_idx old_block_indices = [[cr[i][0] for cr in cross1] for i in range(ndim)] subdims1 = [len(set(old_block_indices[i])) for i in range(ndim)] rec_cat_arg = np.empty(subdims1, dtype='O') rec_cat_arg_flat = rec_cat_arg.flat # Iterate over the old blocks required to build the new block for rec_cat_index, ind_slices in enumerate(cross1): old_block_index, slices = zip(*ind_slices) name = (split_temp_name, next(split_name_suffixes)) intermediates[name] = (getitem, old_blocks[old_block_index], slices) rec_cat_arg_flat[rec_cat_index] = name assert rec_cat_index == rec_cat_arg.size - 1 # New block is formed by concatenation of sliced old blocks if all(d == 1 for d in rec_cat_arg.shape): x2[key] = rec_cat_arg.flat[0] else: x2[key] = (concatenate3, rec_cat_arg.tolist()) assert new_idx == tuple(len(c) - 1 for c in chunks) del old_blocks, new_index x2 = sharedict.merge(x.dask, (merge_temp_name, toolz.merge(x2, intermediates))) return Array(x2, merge_temp_name, chunks, dtype=x.dtype) class _PrettyBlocks(object): def __init__(self, blocks): self.blocks = blocks def __str__(self): runs = [] run = [] repeats = 0 for c in self.blocks: if run and run[-1] == c: if repeats == 0 and len(run) > 1: runs.append((None, run[:-1])) run = run[-1:] repeats += 1 else: if repeats > 0: assert len(run) == 1 runs.append((repeats + 1, run[-1])) run = [] repeats = 0 run.append(c) if run: if repeats == 0: runs.append((None, run)) else: assert len(run) == 1 runs.append((repeats + 1, run[-1])) parts = [] for repeats, run in runs: if repeats is None: parts.append(str(run)) else: parts.append("%d*[%s]" % (repeats, run)) return " | ".join(parts) __repr__ = __str__ def format_blocks(blocks): """ Pretty-format *blocks*. >>> format_blocks((10, 10, 10)) 3*[10] >>> format_blocks((2, 3, 4)) [2, 3, 4] >>> format_blocks((10, 10, 5, 6, 2, 2, 2, 7)) 2*[10] | [5, 6] | 3*[2] | [7] """ assert (isinstance(blocks, tuple) and all(isinstance(x, int) for x in blocks)) return _PrettyBlocks(blocks) def format_chunks(chunks): """ >>> format_chunks((10 * (3,), 3 * (10,))) (10*[3], 3*[10]) """ assert isinstance(chunks, tuple) return tuple(format_blocks(c) for c in chunks) def format_plan(plan): """ >>> format_plan([((10, 10, 10), (15, 15)), ((30,), (10, 10, 10))]) [(3*[10], 2*[15]), ([30], 3*[10])] """ return [format_chunks(c) for c in plan]
# coding=utf-8 # Copyright 2021 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # https://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Neural network model to predict time. ##### Features these models operate on ###### These models take featurized tasks and convert them to some hidden state. Each task is configured by some number of keys / settings. For example let's say we have a task with the following config (in pseudo code): Task.datasets.mnist.batch_size=128, Task.datasets.mnist.image_size=(14, 14), Task.activation_idx=2 These cfgs get featurized into 3 values: key_feats, float_feats, and int_feats. The float values are from values interpreted as floats, the int values are for integer / categorical features, and the key feats are a integer representation of the key string. Each of these have a leading dimension of number of configured values, N,(in this case N=3). The shapes are then: key_feats: int32[N, P] float_feats: float32[N, P1] int_feats: int32[N] For the key feats, each key represents a key in the configuration run through the hashing trick to convert to an integer then padded. See https://en.wikipedia.org/wiki/Feature_hashing for more info. So, the first key in the above example is (assuming P=8): [H("task"), H("datasets"), H("mnist"), H("batch_size"), 0, 0, 0, 0] As with the keys, the float features are also padded. In this example, both batch_size and image_size are both intpreted as float features (after logging) by a special case based on the argument name (see tasks/parametric/cfgobject.py) . So here our float features will have values: [log(128), 0, 0, 0, 0, 0, 0, 0] [log(14), log(14), 0, 0, 0, 0, 0, 0] [0, 0, 0, 0, 0, 0, 0, 0] The int features do not have to be padded as at this point are only 1D. So here the int features will be: [0, 0, 2] For a full description of the featurization see tasks/parametric/cfgobject.py. ##### Outline of the neual architecture ##### We seek to convert these features into some dense representation. The meaning of the int_feats and float_feats varies widly depending on the key. The values not only mean different things, but they can also take on vastly different scales. To account for this, we make use of a table of both running normalizers, and weights which we update depending on the keys passed in. First, we collapse the keys to have a length of 1 rather than P. This throws away information about the structure of the key and treats different sequences as different values. Next, we build these embedding tables. These tables have a length of E, where E is the number of unique hash-trick values we support. (Note there could be a collision here but I expect this to be fine.) T_norm_min: float32[E, P1] T_norm_max: float32[E, P1] float feats are normalized by: f = (float_feat - T_norm_min[key]) / (T_norm_max[key] - T_norm_min[key]) The min and max values from float_feats are used to update the T_norm_max and T_norm_min tables. Next we apply a linear layer. H is the embedding dimension and is set to say 128. T_w: float32[E, P1, H] T_b: float32[E, H] h_f = f @ T_w[E] + T_b[E] For the int features we embed them using an embedding table. E2 is the T_i: float32[E, P2, H] h_i = T_i[E, int_feats] We then add these up. h = h_i + h_f At this point h: float32[N, H]. The rest of the network consists of mixtures of linear operations mapping the H dimension, as well as reductions over the N dimension. This is inspired by ["DeepSets"](https://arxiv.org/abs/1703.06114). Finally, a reduction is done to remove the leading, variable N dimesion. This is the final featurized value and can be used to make predictions. """ import functools import os from typing import Callable, Tuple, Optional from absl import logging import haiku as hk import jax import jax.numpy as jnp from learned_optimization import checkpoints from learned_optimization.tasks.parametric import cfgobject import numpy as onp PRNGKey = jnp.ndarray def features_to_hidden(key_feats: jnp.ndarray, float_feats: jnp.ndarray, int_feats: jnp.ndarray, feat_mask: jnp.ndarray, n_embed: int = 4096, n_hidden: int = 128, n_hidden2: int = 512) -> jnp.ndarray: """Map features, to a sense hidden representation. See module level documentation for more info. For args we use the following symbols to denote shapes: BS: batch size of different featurized cfgs. N: number of tags within a given cfg. This is variable across config but padded to a fixed size. P: Padding to some fixed dim. H: Some hidden representation size Args: key_feats: float32[BS, N, P1] float_feats: float32[BS, N, P2] int_feats: int32[BS, N] feat_mask: float32[BS, N] -- a mask when there are less features than N. n_embed: Number of embedded values for both keys and ints. n_hidden: hidden size while working with the N keys. n_hidden2: hidden size after reducing across the N keys. Returns: float32[BS, H] the featurized cfgs """ # Keys right now are [bs, num_feats, 8] where 8 is each subsequent tag -- #. So the key MLP/hidden_size would have 2 values and the rest 0. # for for simplicity we will simply add each entity up and rely upon the mod # to collapse them down to one. flat_keys_feats = jnp.sum(key_feats, axis=2) flat_keys_feats = flat_keys_feats % n_embed nan = hk.initializers.Constant(jnp.nan) min_state = hk.get_state("min", shape=[n_embed, 8], init=nan) max_state = hk.get_state("max", shape=[n_embed, 8], init=nan) new_min = jnp.fmin(min_state[flat_keys_feats], jnp.min(float_feats, axis=0)) new_max = jnp.fmax(max_state[flat_keys_feats], jnp.max(float_feats, axis=0)) float_feats = (float_feats - new_min) / (1e-15 + (new_max - new_min)) float_feats = (float_feats - 0.5) * 2 new_min = min_state.at[flat_keys_feats].set(new_min) new_max = max_state.at[flat_keys_feats].set(new_max) hk.set_state("min", new_min) hk.set_state("max", new_max) id_emb = hk.get_parameter( "int_feats", shape=[n_embed, 8, n_hidden], init=hk.initializers.RandomUniform(-0.1, 0.1)) int_feat_embed = id_emb[flat_keys_feats, int_feats] float_emb = hk.get_parameter( "float_feats", shape=[n_embed, 8, n_hidden], init=hk.initializers.TruncatedNormal(1.0 / onp.sqrt(8))) float_emb_b = hk.get_parameter( "float_feats_b", shape=[n_embed, n_hidden], init=hk.initializers.Constant(0)) feat_embed = jax.nn.relu( jax.vmap(jax.vmap(lambda a, b, c: a @ b + c))( float_feats, float_emb[flat_keys_feats], float_emb_b[flat_keys_feats])) hidden = (int_feat_embed + feat_embed) assert feat_mask.shape == (hidden.shape[0], hidden.shape[1], 1) hidden = hk.Linear(n_hidden)(hidden) hidden = jax.nn.relu(hidden) hidden = hidden * feat_mask # hidden is currently [batch, number of attributes, features] hmean = jnp.sum( hidden, axis=1, keepdims=True) / jnp.sum( feat_mask, axis=1, keepdims=True) hmax = jnp.max(hidden, axis=1, keepdims=True) h0 = jax.nn.relu(hk.Linear(n_hidden)(hidden)) h1 = jax.nn.relu(hk.Linear(n_hidden)(hmean)) h2 = jax.nn.relu(hk.Linear(n_hidden)(hmax)) hidden = hk.Linear(n_hidden2)((h0 + h1 + h2) / 3.) hidden = hidden * feat_mask hidden = jnp.sum(hidden, axis=1) / jnp.sum(feat_mask, axis=1) # hidden is now [batch, features] hidden = jax.nn.relu(hk.Linear(n_hidden2)(hidden)) hidden = jax.nn.relu(hk.Linear(n_hidden2)(hidden)) return hidden def timing_model_forward(feats: Tuple[jnp.ndarray, jnp.ndarray, jnp.ndarray], mask: Optional[jnp.ndarray] = None) -> jnp.ndarray: """A haiku function which converts features to a time prediction. This must be called with hk.transform! Args: feats: [int32[B, N, P1], float32[B, N, P2], int32[B, N]] mask: float32[B, N] Returns: The predicted time model. float32[B] """ keys, floats, ints = feats if mask is None: mask = jnp.ones((keys.shape[0], floats.shape[1], 1)) outs = features_to_hidden(keys, floats, ints, mask) output = hk.Linear(1)(outs)[:, 0] # shift arbitrarily to roughly center the outputs. # TODO(lmetz) ensure this is stable across a variety of models. return jnp.exp(output - 10.) @hk.transform_with_state def loss_fn(feats: Tuple[jnp.ndarray, jnp.ndarray, jnp.ndarray], times: jnp.ndarray) -> jnp.ndarray: out = timing_model_forward(feats) assert out.shape == times.shape return jnp.mean(jnp.square(jnp.log(times) - jnp.log(out))) def get_timing_model_root_dir() -> str: root_dir = "~/lopt_model_timings" root_dir = os.environ.get("LOPT_TIMING_MODEL_DIR", root_dir) return root_dir def get_timing_model_dir(sample_fn_name: str, hardware_name: str) -> str: root_dir = get_timing_model_root_dir() path = os.path.join(root_dir, sample_fn_name, hardware_name) return os.path.expanduser(path) Feats = Tuple[jnp.ndarray, jnp.ndarray, jnp.ndarray] PredictionFN = Callable[[Feats], jnp.ndarray] @functools.lru_cache(None) def load_model(model_path_suffix: str) -> PredictionFN: """Load and construct inference function for a timing model. Args: model_path_suffix: Path to load. This suffix is appended to `get_timing_model_root_dir()` then loaded. Returns: A callable which maps from task features to predicted runtime. """ path = os.path.join(get_timing_model_root_dir(), model_path_suffix) logging.info(f"Loading timing model from {path}") # pylint: disable=logging-fstring-interpolation init, apply = hk.transform_with_state(timing_model_forward) key = jax.random.PRNGKey(0) feats = (jnp.zeros([1, 1, 8], dtype=jnp.int32), jnp.zeros([1, 1, 8], dtype=jnp.float32), jnp.zeros([1, 1], dtype=jnp.int32)) weights, state = init(key, feats) weights, state = checkpoints.load_state(path, (weights, state)) apply_jit = jax.jit(apply) def apply_model(feats): key = jax.random.PRNGKey(0) out, unused_next_state = apply_jit(weights, state, key, feats) return out return apply_model def rejection_sample(sampler: Callable[[PRNGKey], cfgobject.CFGObject], model_path_suffix: str, key: PRNGKey, max_time: float) -> cfgobject.CFGObject: """Perform rejection sampling to sample task cfgs which run in < max_time. Args: sampler: Function which returns the configurations to be sampled from. model_path_suffix: the trailing suffix to the saved model. This should be something like: "sample_image_mlp/tpu_TPUv4/20220103_133049.weights". This suffix is appended to `get_timing_model_root_dir()` then loaded. key: jax random key. max_time: Max amount of time to allow in sampled tasks. Returns: CFGObject that represents a TaskFamily which runs in less than `max_time`. """ rng = hk.PRNGSequence(key) forward_fn = load_model(model_path_suffix) # batchsize to run through the timing model. # Most of the time is spent on featurization at the moment, so this number # is low. batch_size = 1 for _ in range(512 // batch_size): keys = jax.random.split(next(rng), batch_size) cfgs = [sampler(key) for key in keys] key_feat, int_feat, float_feat, feat_mask = cfgobject.featurize_many(cfgs) # TODO(lmetz) pass through feat mask to support variable length features del feat_mask times = forward_fn((key_feat, int_feat, float_feat)) mask = times < max_time if onp.all(onp.logical_not(mask)): continue else: return cfgs[onp.argmax(mask)] raise ValueError( f"Nothing found for static: {model_path_suffix} and time {max_time}")
# # ESPrinkler2 testserver.py # # This is a smiple server so data-uncompressed can be tested # and edited using a local browser to http://localhost # Note that data-uncompressed does not save config.json nor sched.json # This server saves that data as strings # Similarly current time and zone status are simulated # import SimpleHTTPServer from urlparse import urlparse, parse_qs import SocketServer import os import time import json import cgi zones = [ 'off', 'off', 'off', 'off', 'off', 'off', 'off', 'off' ] htime = 0 ltime = time.time() offsetGMT = 0 config = None sched = None buttons = None host = 'ESPrinkler2' class ESPrinkler2RequestHandler(SimpleHTTPServer.SimpleHTTPRequestHandler): def xsend(self, content, contentType="text/html"): print "serving custom response: " + content self.send_response(200) self.send_header("Content-Type", contentType) v = len(content) self.send_header("Content-Tength", v) self.end_headers() self.wfile.write(content) def do_GET(self): global zones, htime, ltime, config, sched, host, buttons, offsetGMT print self.path query_components = parse_qs(urlparse(self.path).query) self.path = self.path.split('?', 1)[0] print self.path if self.path == '/status': htime += time.time() - ltime ltime = time.time() v = {'time': int(htime), 'host': host, 'offsetGMT': offsetGMT} for i in range(0, 8): v['zone'+str(i)] = zones[i] self.xsend(json.dumps(v), "text/json") elif self.path == '/settime': htime = 0 try: htime = int(query_components['time'][0]) except: pass ltime = time.time() try: o = int(query_components['offset'][0]) offsetGMT = o except: pass self.xsend("ok") elif self.path == '/clear': for i in range(0, 8): zones[i] = 'off' self.xsend("ok") elif self.path == '/clean': config = None sched = None buttons = None self.xsend("Persistant Storage has been cleaned.") elif self.path == '/toggle': i = 0 try: i = int(query_components['zone'][0]) except: pass print i z = zones[i] if z == 'on': z = 'off' else: z = 'on' zones[i] = z self.xsend("ok") elif self.path == '/restart': self.xsend( "Restarting... please wait a minute or two and refresh") elif self.path == '/list': v = [] for f in os.listdir('.'): v.append({'type': 'file', 'name': f}) self.xsend(json.dumps(v), "text/json") # config.json is not saved, but only temp string storage elif self.path == '/config.json': if config is None: self.send_error(404, "File not found") return None else: print('config sending\n'+config) self.xsend(config) # sched.json is not saved, but only temp string storage elif self.path == '/sched.json': if sched is None: self.send_error(404, "File not found") return None else: print('sched sending\n'+sched) self.xsend(sched) # buttons.json is not saved, but only temp string storage elif self.path == '/buttons.json': if buttons is None: self.send_error(404, "File not found") return None else: print('buttons sending\n'+buttons) self.xsend(buttons) else: return SimpleHTTPServer.SimpleHTTPRequestHandler.do_GET(self) def do_DELETE(self): self.path = self.path.split('?', 1)[0] print self.path if self.path == '/edit': form = cgi.FieldStorage( fp=self.rfile, headers=self.headers, environ={'REQUEST_METHOD': 'POST', 'CONTENT_TYPE': self.headers['Content-Type'], }) for field in form.keys(): field_item = form[field] if field == 'path': fn = field_item.value if fn.startswith('/'): fn = fn[1:] if os.path.isfile(fn): os.remove(fn) self.xsend("") return self.send_response(404) def do_PUT(self): self.path = self.path.split('?', 1)[0] print self.path if self.path == '/edit': form = cgi.FieldStorage( fp=self.rfile, headers=self.headers, environ={'REQUEST_METHOD': 'POST', 'CONTENT_TYPE': self.headers['Content-Type'], }) for field in form.keys(): field_item = form[field] if field == 'path': fn = field_item.value if fn.startswith('/'): fn = fn[1:] if not os.path.isfile(fn): f = open(fn, 'w') f.close() self.xsend("") return else: self.send_response(404) self.end_headers() return self.send_response(404) def do_POST(self): global config, sched, buttons, host, offsetGMT self.path = self.path.split('?', 1)[0] print self.path if self.path == '/edit': form = cgi.FieldStorage( fp=self.rfile, headers=self.headers, environ={'REQUEST_METHOD': 'POST', 'CONTENT_TYPE': self.headers['Content-Type'], }) for field in form.keys(): field_item = form[field] if field_item.filename: # The field contains an uploaded file file_data = field_item.file.read() file_len = len(file_data) print('Uploaded %s as "%s" (%d bytes)' % (field, field_item.filename, file_len)) if field == 'data': fn = field_item.filename if fn.startswith('/'): fn = fn[1:] f = open(fn, 'w') f.write(file_data) f.close() print 'wrote:'+fn # config and sched are never saved for testing if (fn == 'config.json' or fn == 'sched.json' or fn == 'buttons.json'): os.remove(fn) if fn == 'config.json': config = file_data try: tt = json.loads(file_data) host = tt['host'] x = int(tt['offsetGMT']) if x != -1: x = offsetGMT except: pass print('config\n'+file_data) if fn == 'sched.json': sched = file_data print('sched\n'+file_data) if fn == 'buttons.json': buttons = file_data print('buttons\n'+file_data) del file_data else: # Regular form value print('%s=%s' % (field, form[field].value)) self.xsend("<html><body>ok</body></html>") if self.path == '/update': form = cgi.FieldStorage( fp=self.rfile, headers=self.headers, environ={'REQUEST_METHOD': 'POST', 'CONTENT_TYPE': self.headers['Content-Type'], }) for field in form.keys(): fields = form[field] print(fields) for field_item in fields: if field_item.filename: # The field contains an uploaded file file_data = field_item.file.read() file_len = len(file_data) print('Uploaded update %s as "%s" (%d bytes)' % (field, field_item.filename, file_len)) # not saving this the update file else: # Regular form value print('%s=%s' % (field_item.name, field_item.value)) self.send_response(301) self.send_header('Location', '/updatesuccessful.html') self.end_headers() else: return SimpleHTTPServer.SimpleHTTPRequestHandler.do_GET(self) os.chdir("data-uncompressed") PORT = 80 Handler = ESPrinkler2RequestHandler httpd = SocketServer.TCPServer(("", PORT), Handler) print "serving at port", PORT print "serving folder", os.getcwd() httpd.serve_forever()
# -*- coding: utf-8 -*- """SQLite parser plugin for Android call history database files.""" from dfdatetime import java_time as dfdatetime_java_time from plaso.containers import events from plaso.containers import time_events from plaso.parsers import sqlite from plaso.parsers.sqlite_plugins import interface class AndroidCallEventData(events.EventData): """Android Call event data. Attributes: call_type (str): type of call, such as: Incoming, Outgoing, or Missed. duration (int): number of seconds the call lasted. name (str): name associated to the remote party. number (str): phone number associated to the remote party. offset (str): identifier of the row, from which the event data was extracted. query (str): SQL query that was used to obtain the event data. """ DATA_TYPE = 'android:event:call' def __init__(self): """Initializes event data.""" super(AndroidCallEventData, self).__init__(data_type=self.DATA_TYPE) self.call_type = None self.duration = None self.name = None self.number = None self.offset = None self.query = None class AndroidCallPlugin(interface.SQLitePlugin): """SQLite parser plugin for Android call history database files. The Android call history database file is typically stored in: contacts2.db """ NAME = 'android_calls' DATA_FORMAT = 'Android call history SQLite database (contacts2.db) file' REQUIRED_STRUCTURE = { 'calls': frozenset(['_id', 'date', 'number', 'name', 'duration', 'type'])} QUERIES = [ ('SELECT _id AS id, date, number, name, duration, type FROM calls', 'ParseCallsRow')] SCHEMAS = [{ '_sync_state': ( 'CREATE TABLE _sync_state (_id INTEGER PRIMARY KEY, account_name ' 'TEXT NOT NULL, account_type TEXT NOT NULL, data TEXT, ' 'UNIQUE(account_name, account_type))'), '_sync_state_metadata': ( 'CREATE TABLE _sync_state_metadata (version INTEGER)'), 'accounts': ( 'CREATE TABLE accounts (_id INTEGER PRIMARY KEY AUTOINCREMENT, ' 'account_name TEXT, account_type TEXT, data_set TEXT)'), 'agg_exceptions': ( 'CREATE TABLE agg_exceptions (_id INTEGER PRIMARY KEY ' 'AUTOINCREMENT, type INTEGER NOT NULL, raw_contact_id1 INTEGER ' 'REFERENCES raw_contacts(_id), raw_contact_id2 INTEGER REFERENCES ' 'raw_contacts(_id))'), 'android_metadata': ( 'CREATE TABLE android_metadata (locale TEXT)'), 'calls': ( 'CREATE TABLE calls (_id INTEGER PRIMARY KEY AUTOINCREMENT, number ' 'TEXT, date INTEGER, duration INTEGER, type INTEGER, new INTEGER, ' 'name TEXT, numbertype INTEGER, numberlabel TEXT, countryiso TEXT, ' 'voicemail_uri TEXT, is_read INTEGER, geocoded_location TEXT, ' 'lookup_uri TEXT, matched_number TEXT, normalized_number TEXT, ' 'photo_id INTEGER NOT NULL DEFAULT 0, formatted_number TEXT, _data ' 'TEXT, has_content INTEGER, mime_type TEXT, source_data TEXT, ' 'source_package TEXT, state INTEGER)'), 'contacts': ( 'CREATE TABLE contacts (_id INTEGER PRIMARY KEY AUTOINCREMENT, ' 'name_raw_contact_id INTEGER REFERENCES raw_contacts(_id), photo_id ' 'INTEGER REFERENCES data(_id), photo_file_id INTEGER REFERENCES ' 'photo_files(_id), custom_ringtone TEXT, send_to_voicemail INTEGER ' 'NOT NULL DEFAULT 0, times_contacted INTEGER NOT NULL DEFAULT 0, ' 'last_time_contacted INTEGER, starred INTEGER NOT NULL DEFAULT 0, ' 'has_phone_number INTEGER NOT NULL DEFAULT 0, lookup TEXT, ' 'status_update_id INTEGER REFERENCES data(_id), ' 'contact_last_updated_timestamp INTEGER)'), 'data': ( 'CREATE TABLE data (_id INTEGER PRIMARY KEY AUTOINCREMENT, ' 'package_id INTEGER REFERENCES package(_id), mimetype_id INTEGER ' 'REFERENCES mimetype(_id) NOT NULL, raw_contact_id INTEGER ' 'REFERENCES raw_contacts(_id) NOT NULL, is_read_only INTEGER NOT ' 'NULL DEFAULT 0, is_primary INTEGER NOT NULL DEFAULT 0, ' 'is_super_primary INTEGER NOT NULL DEFAULT 0, data_version INTEGER ' 'NOT NULL DEFAULT 0, data1 TEXT, data2 TEXT, data3 TEXT, data4 ' 'TEXT, data5 TEXT, data6 TEXT, data7 TEXT, data8 TEXT, data9 TEXT, ' 'data10 TEXT, data11 TEXT, data12 TEXT, data13 TEXT, data14 TEXT, ' 'data15 TEXT, data_sync1 TEXT, data_sync2 TEXT, data_sync3 TEXT, ' 'data_sync4 TEXT )'), 'data_usage_stat': ( 'CREATE TABLE data_usage_stat(stat_id INTEGER PRIMARY KEY ' 'AUTOINCREMENT, data_id INTEGER NOT NULL, usage_type INTEGER NOT ' 'NULL DEFAULT 0, times_used INTEGER NOT NULL DEFAULT 0, ' 'last_time_used INTEGER NOT NULL DEFAULT 0, FOREIGN KEY(data_id) ' 'REFERENCES data(_id))'), 'default_directory': ( 'CREATE TABLE default_directory (_id INTEGER PRIMARY KEY)'), 'deleted_contacts': ( 'CREATE TABLE deleted_contacts (contact_id INTEGER PRIMARY KEY, ' 'contact_deleted_timestamp INTEGER NOT NULL default 0)'), 'directories': ( 'CREATE TABLE directories(_id INTEGER PRIMARY KEY AUTOINCREMENT, ' 'packageName TEXT NOT NULL, authority TEXT NOT NULL, typeResourceId ' 'INTEGER, typeResourceName TEXT, accountType TEXT, accountName ' 'TEXT, displayName TEXT, exportSupport INTEGER NOT NULL DEFAULT 0, ' 'shortcutSupport INTEGER NOT NULL DEFAULT 0, photoSupport INTEGER ' 'NOT NULL DEFAULT 0)'), 'groups': ( 'CREATE TABLE groups (_id INTEGER PRIMARY KEY AUTOINCREMENT, ' 'package_id INTEGER REFERENCES package(_id), account_name STRING ' 'DEFAULT NULL, account_type STRING DEFAULT NULL, data_set STRING ' 'DEFAULT NULL, sourceid TEXT, version INTEGER NOT NULL DEFAULT 1, ' 'dirty INTEGER NOT NULL DEFAULT 0, title TEXT, title_res INTEGER, ' 'notes TEXT, system_id TEXT, deleted INTEGER NOT NULL DEFAULT 0, ' 'group_visible INTEGER NOT NULL DEFAULT 0, should_sync INTEGER NOT ' 'NULL DEFAULT 1, auto_add INTEGER NOT NULL DEFAULT 0, favorites ' 'INTEGER NOT NULL DEFAULT 0, group_is_read_only INTEGER NOT NULL ' 'DEFAULT 0, sync1 TEXT, sync2 TEXT, sync3 TEXT, sync4 TEXT , ' 'account_id INTEGER REFERENCES accounts(_id))'), 'mimetypes': ( 'CREATE TABLE mimetypes (_id INTEGER PRIMARY KEY AUTOINCREMENT, ' 'mimetype TEXT NOT NULL)'), 'name_lookup': ( 'CREATE TABLE name_lookup (data_id INTEGER REFERENCES data(_id) NOT ' 'NULL, raw_contact_id INTEGER REFERENCES raw_contacts(_id) NOT ' 'NULL, normalized_name TEXT NOT NULL, name_type INTEGER NOT NULL, ' 'PRIMARY KEY (data_id, normalized_name, name_type))'), 'nickname_lookup': ( 'CREATE TABLE nickname_lookup (name TEXT, cluster TEXT)'), 'packages': ( 'CREATE TABLE packages (_id INTEGER PRIMARY KEY AUTOINCREMENT, ' 'package TEXT NOT NULL)'), 'phone_lookup': ( 'CREATE TABLE phone_lookup (data_id INTEGER REFERENCES data(_id) ' 'NOT NULL, raw_contact_id INTEGER REFERENCES raw_contacts(_id) NOT ' 'NULL, normalized_number TEXT NOT NULL, min_match TEXT NOT NULL)'), 'photo_files': ( 'CREATE TABLE photo_files (_id INTEGER PRIMARY KEY AUTOINCREMENT, ' 'height INTEGER NOT NULL, width INTEGER NOT NULL, filesize INTEGER ' 'NOT NULL)'), 'properties': ( 'CREATE TABLE properties (property_key TEXT PRIMARY KEY, ' 'property_value TEXT )')}] CALL_TYPE = { 1: 'INCOMING', 2: 'OUTGOING', 3: 'MISSED'} def ParseCallsRow(self, parser_mediator, query, row, **unused_kwargs): """Parses a Call record row. Args: parser_mediator (ParserMediator): mediates interactions between parsers and other components, such as storage and dfvfs. query (str): query that created the row. row (sqlite3.Row): row. """ query_hash = hash(query) call_type = self._GetRowValue(query_hash, row, 'type') call_type = self.CALL_TYPE.get(call_type, 'UNKNOWN') duration = self._GetRowValue(query_hash, row, 'duration') timestamp = self._GetRowValue(query_hash, row, 'date') event_data = AndroidCallEventData() event_data.call_type = call_type event_data.duration = self._GetRowValue(query_hash, row, 'duration') event_data.name = self._GetRowValue(query_hash, row, 'name') event_data.number = self._GetRowValue(query_hash, row, 'number') event_data.offset = self._GetRowValue(query_hash, row, 'id') event_data.query = query date_time = dfdatetime_java_time.JavaTime(timestamp=timestamp) event = time_events.DateTimeValuesEvent(date_time, 'Call Started') parser_mediator.ProduceEventWithEventData(event, event_data) if duration: if isinstance(duration, str): try: duration = int(duration, 10) except ValueError: duration = 0 # The duration is in seconds and the date value in milliseconds. timestamp += duration * 1000 date_time = dfdatetime_java_time.JavaTime(timestamp=timestamp) event = time_events.DateTimeValuesEvent(date_time, 'Call Ended') parser_mediator.ProduceEventWithEventData(event, event_data) sqlite.SQLiteParser.RegisterPlugin(AndroidCallPlugin)
# Copyright (C) 2013 Google Inc. All rights reserved. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are # met: # # * Redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer. # * Redistributions in binary form must reproduce the above # copyright notice, this list of conditions and the following disclaimer # in the documentation and/or other materials provided with the # distribution. # * Neither the name of Google Inc. nor the names of its # contributors may be used to endorse or promote products derived from # this software without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS # "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT # LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR # A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT # OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, # SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT # LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, # DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY # THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT # (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE # OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. """Generate template values for attributes. Extends IdlType with property |constructor_type_name|. Design doc: http://www.chromium.org/developers/design-documents/idl-compiler """ import idl_types from idl_types import inherits_interface from v8_globals import includes, interfaces import v8_types import v8_utilities from v8_utilities import (cpp_name_or_partial, capitalize, cpp_name, has_extended_attribute, has_extended_attribute_value, scoped_name, strip_suffix, uncapitalize, extended_attribute_value_as_list, is_unforgeable, is_legacy_interface_type_checking) def attribute_context(interface, attribute): idl_type = attribute.idl_type base_idl_type = idl_type.base_type extended_attributes = attribute.extended_attributes idl_type.add_includes_for_type(extended_attributes) if idl_type.enum_values: includes.add('core/inspector/ConsoleMessage.h') # [CheckSecurity] is_do_not_check_security = 'DoNotCheckSecurity' in extended_attributes is_check_security_for_frame = ( has_extended_attribute_value(interface, 'CheckSecurity', 'Frame') and not is_do_not_check_security) is_check_security_for_node = ( has_extended_attribute_value(attribute, 'CheckSecurity', 'Node')) is_check_security_for_window = ( has_extended_attribute_value(interface, 'CheckSecurity', 'Window') and not is_do_not_check_security) if is_check_security_for_frame or is_check_security_for_node or is_check_security_for_window: includes.add('bindings/core/v8/BindingSecurity.h') # [CustomElementCallbacks], [Reflect] is_custom_element_callbacks = 'CustomElementCallbacks' in extended_attributes is_reflect = 'Reflect' in extended_attributes if is_custom_element_callbacks or is_reflect: includes.add('core/dom/custom/CustomElementProcessingStack.h') # [ImplementedInPrivateScript] is_implemented_in_private_script = 'ImplementedInPrivateScript' in extended_attributes if is_implemented_in_private_script: includes.add('bindings/core/v8/PrivateScriptRunner.h') includes.add('core/frame/LocalFrame.h') includes.add('platform/ScriptForbiddenScope.h') # [OnlyExposedToPrivateScript] is_only_exposed_to_private_script = 'OnlyExposedToPrivateScript' in extended_attributes # [PerWorldBindings] if 'PerWorldBindings' in extended_attributes: assert idl_type.is_wrapper_type or 'LogActivity' in extended_attributes, '[PerWorldBindings] should only be used with wrapper types: %s.%s' % (interface.name, attribute.name) if (base_idl_type == 'EventHandler' and interface.name in ['Window', 'WorkerGlobalScope'] and attribute.name == 'onerror'): includes.add('bindings/core/v8/V8ErrorHandler.h') cached_attribute_validation_method = extended_attributes.get('CachedAttribute') keep_alive_for_gc = is_keep_alive_for_gc(interface, attribute) if cached_attribute_validation_method or keep_alive_for_gc: includes.add('bindings/core/v8/V8HiddenValue.h') context = { 'access_control_list': access_control_list(interface, attribute), 'activity_logging_world_list_for_getter': v8_utilities.activity_logging_world_list(attribute, 'Getter'), # [ActivityLogging] 'activity_logging_world_list_for_setter': v8_utilities.activity_logging_world_list(attribute, 'Setter'), # [ActivityLogging] 'activity_logging_world_check': v8_utilities.activity_logging_world_check(attribute), # [ActivityLogging] 'argument_cpp_type': idl_type.cpp_type_args(used_as_rvalue_type=True), 'cached_attribute_validation_method': cached_attribute_validation_method, 'conditional_string': v8_utilities.conditional_string(attribute), 'constructor_type': idl_type.constructor_type_name if is_constructor_attribute(attribute) else None, 'cpp_name': cpp_name(attribute), 'cpp_type': idl_type.cpp_type, 'cpp_type_initializer': idl_type.cpp_type_initializer, 'deprecate_as': v8_utilities.deprecate_as(attribute), # [DeprecateAs] 'enum_type': idl_type.enum_type, 'enum_values': idl_type.enum_values, 'exposed_test': v8_utilities.exposed(attribute, interface), # [Exposed] 'has_custom_getter': has_custom_getter(attribute), 'has_custom_setter': has_custom_setter(attribute), 'has_setter': has_setter(attribute), 'idl_type': str(idl_type), # need trailing [] on array for Dictionary::ConversionContext::setConversionType 'is_call_with_execution_context': has_extended_attribute_value(attribute, 'CallWith', 'ExecutionContext'), 'is_call_with_script_state': has_extended_attribute_value(attribute, 'CallWith', 'ScriptState'), 'is_check_security_for_frame': is_check_security_for_frame, 'is_check_security_for_node': is_check_security_for_node, 'is_check_security_for_window': is_check_security_for_window, 'is_custom_element_callbacks': is_custom_element_callbacks, 'is_expose_js_accessors': is_expose_js_accessors(interface, attribute), 'is_getter_raises_exception': # [RaisesException] 'RaisesException' in extended_attributes and extended_attributes['RaisesException'] in (None, 'Getter'), 'is_implemented_in_private_script': is_implemented_in_private_script, 'is_keep_alive_for_gc': keep_alive_for_gc, 'is_lenient_this': 'LenientThis' in extended_attributes, 'is_nullable': idl_type.is_nullable, 'is_explicit_nullable': idl_type.is_explicit_nullable, 'is_partial_interface_member': 'PartialInterfaceImplementedAs' in extended_attributes, 'is_per_world_bindings': 'PerWorldBindings' in extended_attributes, 'is_put_forwards': 'PutForwards' in extended_attributes, 'is_read_only': attribute.is_read_only, 'is_reflect': is_reflect, 'is_replaceable': 'Replaceable' in attribute.extended_attributes, 'is_static': attribute.is_static, 'is_url': 'URL' in extended_attributes, 'is_unforgeable': is_unforgeable(interface, attribute), 'on_instance': v8_utilities.on_instance(interface, attribute), 'on_interface': v8_utilities.on_interface(interface, attribute), 'on_prototype': v8_utilities.on_prototype(interface, attribute), 'use_output_parameter_for_result': idl_type.use_output_parameter_for_result, 'measure_as': v8_utilities.measure_as(attribute, interface), # [MeasureAs] 'name': attribute.name, 'only_exposed_to_private_script': is_only_exposed_to_private_script, 'private_script_v8_value_to_local_cpp_value': idl_type.v8_value_to_local_cpp_value( extended_attributes, 'v8Value', 'cppValue', bailout_return_value='false', isolate='scriptState->isolate()'), 'property_attributes': property_attributes(interface, attribute), 'reflect_empty': extended_attributes.get('ReflectEmpty'), 'reflect_invalid': extended_attributes.get('ReflectInvalid', ''), 'reflect_missing': extended_attributes.get('ReflectMissing'), 'reflect_only': extended_attribute_value_as_list(attribute, 'ReflectOnly'), 'runtime_enabled_function': v8_utilities.runtime_enabled_function_name(attribute), # [RuntimeEnabled] 'should_be_exposed_to_script': not (is_implemented_in_private_script and is_only_exposed_to_private_script), 'world_suffixes': ['', 'ForMainWorld'] if 'PerWorldBindings' in extended_attributes else [''], # [PerWorldBindings] } if is_constructor_attribute(attribute): update_constructor_attribute_context(interface, attribute, context) if not has_custom_getter(attribute): getter_context(interface, attribute, context) if not has_custom_setter(attribute) and has_setter(attribute): setter_context(interface, attribute, context) return context ################################################################################ # Getter ################################################################################ def getter_context(interface, attribute, context): idl_type = attribute.idl_type base_idl_type = idl_type.base_type extended_attributes = attribute.extended_attributes cpp_value = getter_expression(interface, attribute, context) # Normally we can inline the function call into the return statement to # avoid the overhead of using a Ref<> temporary, but for some cases # (nullable types, EventHandler, [CachedAttribute], or if there are # exceptions), we need to use a local variable. # FIXME: check if compilers are smart enough to inline this, and if so, # always use a local variable (for readability and CG simplicity). release = False if 'ImplementedInPrivateScript' in extended_attributes: if (not idl_type.is_wrapper_type and not idl_type.is_basic_type and not idl_type.is_enum): raise Exception('Private scripts supports only primitive types and DOM wrappers.') context['cpp_value_original'] = cpp_value cpp_value = 'result' # EventHandler has special handling if base_idl_type != 'EventHandler': release = idl_type.release elif (idl_type.is_explicit_nullable or base_idl_type == 'EventHandler' or 'CachedAttribute' in extended_attributes or 'ReflectOnly' in extended_attributes or context['is_keep_alive_for_gc'] or context['is_getter_raises_exception']): context['cpp_value_original'] = cpp_value cpp_value = 'cppValue' # EventHandler has special handling if base_idl_type != 'EventHandler': release = idl_type.release def v8_set_return_value_statement(for_main_world=False): if context['is_keep_alive_for_gc'] or 'CachedAttribute' in extended_attributes: return 'v8SetReturnValue(info, v8Value)' return idl_type.v8_set_return_value( cpp_value, extended_attributes=extended_attributes, script_wrappable='impl', release=release, for_main_world=for_main_world, is_static=attribute.is_static) context.update({ 'cpp_value': cpp_value, 'cpp_value_to_v8_value': idl_type.cpp_value_to_v8_value( cpp_value=cpp_value, creation_context='holder', extended_attributes=extended_attributes), 'v8_set_return_value_for_main_world': v8_set_return_value_statement(for_main_world=True), 'v8_set_return_value': v8_set_return_value_statement(), }) def getter_expression(interface, attribute, context): arguments = [] this_getter_base_name = getter_base_name(interface, attribute, arguments) getter_name = scoped_name(interface, attribute, this_getter_base_name) if 'ImplementedInPrivateScript' in attribute.extended_attributes: arguments.append('toLocalFrame(toFrameIfNotDetached(info.GetIsolate()->GetCurrentContext()))') arguments.append('impl') arguments.append('&result') arguments.extend(v8_utilities.call_with_arguments( attribute.extended_attributes.get('CallWith'))) # Members of IDL partial interface definitions are implemented in C++ as # static member functions, which for instance members (non-static members) # take *impl as their first argument if ('PartialInterfaceImplementedAs' in attribute.extended_attributes and not 'ImplementedInPrivateScript' in attribute.extended_attributes and not attribute.is_static): arguments.append('*impl') if attribute.idl_type.is_explicit_nullable: arguments.append('isNull') if context['is_getter_raises_exception']: arguments.append('exceptionState') if attribute.idl_type.use_output_parameter_for_result: arguments.append('result') return '%s(%s)' % (getter_name, ', '.join(arguments)) CONTENT_ATTRIBUTE_GETTER_NAMES = { 'boolean': 'fastHasAttribute', 'long': 'getIntegralAttribute', 'unsigned long': 'getUnsignedIntegralAttribute', } def getter_base_name(interface, attribute, arguments): extended_attributes = attribute.extended_attributes if 'ImplementedInPrivateScript' in extended_attributes: return '%sAttributeGetter' % uncapitalize(cpp_name(attribute)) if 'Reflect' not in extended_attributes: return uncapitalize(cpp_name(attribute)) content_attribute_name = extended_attributes['Reflect'] or attribute.name.lower() if content_attribute_name in ['class', 'id', 'name']: # Special-case for performance optimization. return 'get%sAttribute' % content_attribute_name.capitalize() arguments.append(scoped_content_attribute_name(interface, attribute)) base_idl_type = attribute.idl_type.base_type if base_idl_type in CONTENT_ATTRIBUTE_GETTER_NAMES: return CONTENT_ATTRIBUTE_GETTER_NAMES[base_idl_type] if 'URL' in attribute.extended_attributes: return 'getURLAttribute' return 'fastGetAttribute' def is_keep_alive_for_gc(interface, attribute): idl_type = attribute.idl_type base_idl_type = idl_type.base_type extended_attributes = attribute.extended_attributes return ( # For readonly attributes, for performance reasons we keep the attribute # wrapper alive while the owner wrapper is alive, because the attribute # never changes. (attribute.is_read_only and idl_type.is_wrapper_type and # There are some exceptions, however: not( # Node lifetime is managed by object grouping. inherits_interface(interface.name, 'Node') or inherits_interface(base_idl_type, 'Node') or # A self-reference is unnecessary. attribute.name == 'self' or # FIXME: Remove these hard-coded hacks. base_idl_type in ['EventTarget', 'Window'] or base_idl_type.startswith(('HTML', 'SVG'))))) ################################################################################ # Setter ################################################################################ def setter_context(interface, attribute, context): if 'PutForwards' in attribute.extended_attributes: # Use target interface and attribute in place of original interface and # attribute from this point onwards. target_interface_name = attribute.idl_type.base_type target_attribute_name = attribute.extended_attributes['PutForwards'] interface = interfaces[target_interface_name] try: attribute = next(candidate for candidate in interface.attributes if candidate.name == target_attribute_name) except StopIteration: raise Exception('[PutForward] target not found:\n' 'Attribute "%s" is not present in interface "%s"' % (target_attribute_name, target_interface_name)) if ('Replaceable' in attribute.extended_attributes or is_constructor_attribute(attribute)): context['cpp_setter'] = '%sCreateDataProperty(propertyName, v8Value, info)' % cpp_name(interface) return extended_attributes = attribute.extended_attributes idl_type = attribute.idl_type # [RaisesException], [RaisesException=Setter] is_setter_raises_exception = ( 'RaisesException' in extended_attributes and extended_attributes['RaisesException'] in [None, 'Setter']) # [TypeChecking=Interface] / [LegacyInterfaceTypeChecking] has_type_checking_interface = ( not is_legacy_interface_type_checking(interface, attribute) and idl_type.is_wrapper_type) context.update({ 'has_setter_exception_state': is_setter_raises_exception or has_type_checking_interface or idl_type.v8_conversion_needs_exception_state, 'has_type_checking_interface': has_type_checking_interface, 'is_setter_call_with_execution_context': has_extended_attribute_value( attribute, 'SetterCallWith', 'ExecutionContext'), 'is_setter_raises_exception': is_setter_raises_exception, 'private_script_cpp_value_to_v8_value': idl_type.cpp_value_to_v8_value( 'cppValue', isolate='scriptState->isolate()', creation_context='scriptState->context()->Global()'), 'v8_value_to_local_cpp_value': idl_type.v8_value_to_local_cpp_value( extended_attributes, 'v8Value', 'cppValue'), }) # setter_expression() depends on context values we set above. context['cpp_setter'] = setter_expression(interface, attribute, context) def setter_expression(interface, attribute, context): extended_attributes = attribute.extended_attributes arguments = v8_utilities.call_with_arguments( extended_attributes.get('SetterCallWith') or extended_attributes.get('CallWith')) this_setter_base_name = setter_base_name(interface, attribute, arguments) setter_name = scoped_name(interface, attribute, this_setter_base_name) # Members of IDL partial interface definitions are implemented in C++ as # static member functions, which for instance members (non-static members) # take *impl as their first argument if ('PartialInterfaceImplementedAs' in extended_attributes and not 'ImplementedInPrivateScript' in extended_attributes and not attribute.is_static): arguments.append('*impl') idl_type = attribute.idl_type if 'ImplementedInPrivateScript' in extended_attributes: arguments.append('toLocalFrame(toFrameIfNotDetached(info.GetIsolate()->GetCurrentContext()))') arguments.append('impl') arguments.append('cppValue') elif idl_type.base_type == 'EventHandler': getter_name = scoped_name(interface, attribute, cpp_name(attribute)) context['event_handler_getter_expression'] = '%s(%s)' % ( getter_name, ', '.join(arguments)) if (interface.name in ['Window', 'WorkerGlobalScope'] and attribute.name == 'onerror'): includes.add('bindings/core/v8/V8ErrorHandler.h') arguments.append('V8EventListenerList::findOrCreateWrapper<V8ErrorHandler>(v8Value, true, ScriptState::current(info.GetIsolate()))') else: arguments.append('V8EventListenerList::getEventListener(ScriptState::current(info.GetIsolate()), v8Value, true, ListenerFindOrCreate)') elif idl_type.is_interface_type: # FIXME: should be able to eliminate WTF::getPtr in most or all cases arguments.append('WTF::getPtr(cppValue)') else: arguments.append('cppValue') if context['is_setter_raises_exception']: arguments.append('exceptionState') return '%s(%s)' % (setter_name, ', '.join(arguments)) CONTENT_ATTRIBUTE_SETTER_NAMES = { 'boolean': 'setBooleanAttribute', 'long': 'setIntegralAttribute', 'unsigned long': 'setUnsignedIntegralAttribute', } def setter_base_name(interface, attribute, arguments): if 'ImplementedInPrivateScript' in attribute.extended_attributes: return '%sAttributeSetter' % uncapitalize(cpp_name(attribute)) if 'Reflect' not in attribute.extended_attributes: return 'set%s' % capitalize(cpp_name(attribute)) arguments.append(scoped_content_attribute_name(interface, attribute)) base_idl_type = attribute.idl_type.base_type if base_idl_type in CONTENT_ATTRIBUTE_SETTER_NAMES: return CONTENT_ATTRIBUTE_SETTER_NAMES[base_idl_type] return 'setAttribute' def scoped_content_attribute_name(interface, attribute): content_attribute_name = attribute.extended_attributes['Reflect'] or attribute.name.lower() if interface.name.startswith('SVG'): namespace = 'SVGNames' else: namespace = 'HTMLNames' includes.add('core/%s.h' % namespace) return '%s::%sAttr' % (namespace, content_attribute_name) ################################################################################ # Attribute configuration ################################################################################ # [PutForwards], [Replaceable] def has_setter(attribute): return (not attribute.is_read_only or 'PutForwards' in attribute.extended_attributes or 'Replaceable' in attribute.extended_attributes) # [DoNotCheckSecurity], [Unforgeable] def access_control_list(interface, attribute): extended_attributes = attribute.extended_attributes access_control = [] if 'DoNotCheckSecurity' in extended_attributes: do_not_check_security = extended_attributes['DoNotCheckSecurity'] if do_not_check_security == 'Setter': access_control.append('v8::ALL_CAN_WRITE') else: access_control.append('v8::ALL_CAN_READ') if has_setter(attribute): access_control.append('v8::ALL_CAN_WRITE') if is_unforgeable(interface, attribute): access_control.append('v8::PROHIBITS_OVERWRITING') return access_control or ['v8::DEFAULT'] # [NotEnumerable], [Unforgeable] def property_attributes(interface, attribute): extended_attributes = attribute.extended_attributes property_attributes_list = [] if ('NotEnumerable' in extended_attributes or is_constructor_attribute(attribute)): property_attributes_list.append('v8::DontEnum') if is_unforgeable(interface, attribute): property_attributes_list.append('v8::DontDelete') return property_attributes_list or ['v8::None'] # [Custom], [Custom=Getter] def has_custom_getter(attribute): extended_attributes = attribute.extended_attributes return ('Custom' in extended_attributes and extended_attributes['Custom'] in [None, 'Getter']) # [Custom], [Custom=Setter] def has_custom_setter(attribute): extended_attributes = attribute.extended_attributes return (not attribute.is_read_only and 'Custom' in extended_attributes and extended_attributes['Custom'] in [None, 'Setter']) # [ExposeJSAccessors] def is_expose_js_accessors(interface, attribute): # Default behavior is_accessor = True if ('ExposeJSAccessors' in interface.extended_attributes and 'DoNotExposeJSAccessors' in interface.extended_attributes): raise Exception('Both of ExposeJSAccessors and DoNotExposeJSAccessors are specified at a time in an interface: ' + interface.name) if 'ExposeJSAccessors' in interface.extended_attributes: is_accessor = True if 'DoNotExposeJSAccessors' in interface.extended_attributes: is_accessor = False # Note that ExposeJSAccessors and DoNotExposeJSAccessors are more powerful # than 'static', [Unforgeable] and [OverrideBuiltins]. if ('ExposeJSAccessors' in attribute.extended_attributes and 'DoNotExposeJSAccessors' in attribute.extended_attributes): raise Exception('Both of ExposeJSAccessors and DoNotExposeJSAccessors are specified at a time on an attribute: ' + attribute.name + ' in an interface: ' + interface.name) if 'ExposeJSAccessors' in attribute.extended_attributes: return True if 'DoNotExposeJSAccessors' in attribute.extended_attributes: return False # These attributes must not be accessors on prototype chains. if (is_constructor_attribute(attribute) or attribute.is_static or is_unforgeable(interface, attribute) or 'OverrideBuiltins' in interface.extended_attributes): return False # The members of Window interface must be placed on the instance object. if interface.name == 'Window': return False return is_accessor ################################################################################ # Constructors ################################################################################ idl_types.IdlType.constructor_type_name = property( # FIXME: replace this with a [ConstructorAttribute] extended attribute lambda self: strip_suffix(self.base_type, 'Constructor')) def is_constructor_attribute(attribute): # FIXME: replace this with [ConstructorAttribute] extended attribute return attribute.idl_type.name.endswith('Constructor') def update_constructor_attribute_context(interface, attribute, context): context['needs_constructor_getter_callback'] = context['measure_as'] or context['deprecate_as'] # When the attribute name is the same as the interface name, do not generate # callback functions for each attribute and use # {{cpp_class}}ConstructorAttributeSetterCallback. Otherwise, generate # a callback function in order to hard-code the attribute name. context['needs_constructor_setter_callback'] = context['name'] != context['constructor_type']
## This file is part of Scapy ## See http://www.secdev.org/projects/scapy for more informations ## Copyright (C) Philippe Biondi <phil@secdev.org> ## This program is published under a GPLv2 license ## Copyright (C) 2005 Guillaume Valadon <guedou@hongo.wide.ad.jp> ## Arnaud Ebalard <arnaud.ebalard@eads.net> """ Routing and network interface handling for IPv6. """ ############################################################################# ############################################################################# ### Routing/Interfaces stuff ### ############################################################################# ############################################################################# import socket from config import conf from utils6 import * from arch import * class Route6: def __init__(self): self.invalidate_cache() self.resync() def invalidate_cache(self): self.cache = {} def flush(self): self.invalidate_cache() self.routes = [] def resync(self): # TODO : At the moment, resync will drop existing Teredo routes # if any. Change that ... self.invalidate_cache() self.routes = read_routes6() if self.routes == []: log_loading.info("No IPv6 support in kernel") def __repr__(self): rtlst = [('Destination', 'Next Hop', "iface", "src candidates")] for net,msk,gw,iface,cset in self.routes: rtlst.append(('%s/%i'% (net,msk), gw, iface, ", ".join(cset))) colwidth = map(lambda x: max(map(lambda y: len(y), x)), apply(zip, rtlst)) fmt = " ".join(map(lambda x: "%%-%ds"%x, colwidth)) rt = "\n".join(map(lambda x: fmt % x, rtlst)) return rt # Unlike Scapy's Route.make_route() function, we do not have 'host' and 'net' # parameters. We only have a 'dst' parameter that accepts 'prefix' and # 'prefix/prefixlen' values. # WARNING: Providing a specific device will at the moment not work correctly. def make_route(self, dst, gw=None, dev=None): """Internal function : create a route for 'dst' via 'gw'. """ prefix, plen = (dst.split("/")+["128"])[:2] plen = int(plen) if gw is None: gw = "::" if dev is None: dev, ifaddr, x = self.route(gw) else: # TODO: do better than that # replace that unique address by the list of all addresses lifaddr = in6_getifaddr() devaddrs = filter(lambda x: x[2] == dev, lifaddr) ifaddr = construct_source_candidate_set(prefix, plen, devaddrs, LOOPBACK_NAME) return (prefix, plen, gw, dev, ifaddr) def add(self, *args, **kargs): """Ex: add(dst="2001:db8:cafe:f000::/56") add(dst="2001:db8:cafe:f000::/56", gw="2001:db8:cafe::1") add(dst="2001:db8:cafe:f000::/64", gw="2001:db8:cafe::1", dev="eth0") """ self.invalidate_cache() self.routes.append(self.make_route(*args, **kargs)) def delt(self, dst, gw=None): """ Ex: delt(dst="::/0") delt(dst="2001:db8:cafe:f000::/56") delt(dst="2001:db8:cafe:f000::/56", gw="2001:db8:deca::1") """ tmp = dst+"/128" dst, plen = tmp.split('/')[:2] dst = in6_ptop(dst) plen = int(plen) l = filter(lambda x: in6_ptop(x[0]) == dst and x[1] == plen, self.routes) if gw: gw = in6_ptop(gw) l = filter(lambda x: in6_ptop(x[0]) == gw, self.routes) if len(l) == 0: warning("No matching route found") elif len(l) > 1: warning("Found more than one match. Aborting.") else: i=self.routes.index(l[0]) self.invalidate_cache() del(self.routes[i]) def ifchange(self, iff, addr): the_addr, the_plen = (addr.split("/")+["128"])[:2] the_plen = int(the_plen) naddr = inet_pton(socket.AF_INET6, the_addr) nmask = in6_cidr2mask(the_plen) the_net = inet_ntop(socket.AF_INET6, in6_and(nmask,naddr)) for i in range(len(self.routes)): net,plen,gw,iface,addr = self.routes[i] if iface != iff: continue if gw == '::': self.routes[i] = (the_net,the_plen,gw,iface,the_addr) else: self.routes[i] = (net,the_plen,gw,iface,the_addr) self.invalidate_cache() ip6_neigh_cache.flush() def ifdel(self, iff): """ removes all route entries that uses 'iff' interface. """ new_routes=[] for rt in self.routes: if rt[3] != iff: new_routes.append(rt) self.invalidate_cache() self.routes = new_routes def ifadd(self, iff, addr): """ Add an interface 'iff' with provided address into routing table. Ex: ifadd('eth0', '2001:bd8:cafe:1::1/64') will add following entry into Scapy6 internal routing table: Destination Next Hop iface Def src @ 2001:bd8:cafe:1::/64 :: eth0 2001:bd8:cafe:1::1 prefix length value can be omitted. In that case, a value of 128 will be used. """ addr, plen = (addr.split("/")+["128"])[:2] addr = in6_ptop(addr) plen = int(plen) naddr = inet_pton(socket.AF_INET6, addr) nmask = in6_cidr2mask(plen) prefix = inet_ntop(socket.AF_INET6, in6_and(nmask,naddr)) self.invalidate_cache() self.routes.append((prefix,plen,'::',iff,[addr])) def route(self, dst, dev=None): """ Provide best route to IPv6 destination address, based on Scapy6 internal routing table content. When a set of address is passed (e.g. 2001:db8:cafe:*::1-5) an address of the set is used. Be aware of that behavior when using wildcards in upper parts of addresses ! If 'dst' parameter is a FQDN, name resolution is performed and result is used. if optional 'dev' parameter is provided a specific interface, filtering is performed to limit search to route associated to that interface. """ # Transform "2001:db8:cafe:*::1-5:0/120" to one IPv6 address of the set dst = dst.split("/")[0] savedst = dst # In case following inet_pton() fails dst = dst.replace("*","0") l = dst.find("-") while l >= 0: m = (dst[l:]+":").find(":") dst = dst[:l]+dst[l+m:] l = dst.find("-") try: inet_pton(socket.AF_INET6, dst) except socket.error: dst = socket.getaddrinfo(savedst, None, socket.AF_INET6)[0][-1][0] # TODO : Check if name resolution went well # Deal with dev-specific request for cache search k = dst if dev is not None: k = dst + "%%" + dev if k in self.cache: return self.cache[k] pathes = [] # TODO : review all kinds of addresses (scope and *cast) to see # if we are able to cope with everything possible. I'm convinced # it's not the case. # -- arnaud for p, plen, gw, iface, cset in self.routes: if dev is not None and iface != dev: continue if in6_isincluded(dst, p, plen): pathes.append((plen, (iface, cset, gw))) elif (in6_ismlladdr(dst) and in6_islladdr(p) and in6_islladdr(cset[0])): pathes.append((plen, (iface, cset, gw))) if not pathes: warning("No route found for IPv6 destination %s (no default route?)" % dst) return (LOOPBACK_NAME, "::", "::") # XXX Linux specific # Sort with longest prefix first pathes.sort(reverse=True) best_plen = pathes[0][0] pathes = filter(lambda x: x[0] == best_plen, pathes) res = [] for p in pathes: # Here we select best source address for every route tmp = p[1] srcaddr = get_source_addr_from_candidate_set(dst, p[1][1]) if srcaddr is not None: res.append((p[0], (tmp[0], srcaddr, tmp[2]))) # Symptom : 2 routes with same weight (our weight is plen) # Solution : # - dst is unicast global. Check if it is 6to4 and we have a source # 6to4 address in those available # - dst is link local (unicast or multicast) and multiple output # interfaces are available. Take main one (conf.iface6) # - if none of the previous or ambiguity persists, be lazy and keep # first one # XXX TODO : in a _near_ future, include metric in the game if len(res) > 1: tmp = [] if in6_isgladdr(dst) and in6_isaddr6to4(dst): # TODO : see if taking the longest match between dst and # every source addresses would provide better results tmp = filter(lambda x: in6_isaddr6to4(x[1][1]), res) elif in6_ismaddr(dst) or in6_islladdr(dst): # TODO : I'm sure we are not covering all addresses. Check that tmp = filter(lambda x: x[1][0] == conf.iface6, res) if tmp: res = tmp # Fill the cache (including dev-specific request) k = dst if dev is not None: k = dst + "%%" + dev self.cache[k] = res[0][1] return res[0][1] conf.route6 = Route6() _res = conf.route6.route("::/0") if _res: iff, gw, addr = _res conf.iface6 = iff del(_res)
# Copyright (C) 2016, Red Hat, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. import json from oslo_log import log as logging from tempest.api.compute import base from tempest.common import utils from tempest.common.utils.linux import remote_client from tempest import config from tempest.lib.common.utils import data_utils from tempest.lib.common.utils import test_utils from tempest.lib import decorators from tempest.lib import exceptions CONF = config.CONF LOG = logging.getLogger(__name__) class DeviceTaggingTest(base.BaseV2ComputeTest): min_microversion = '2.32' # NOTE(mriedem): max_version looks odd but it's actually correct. Due to a # bug in the 2.32 microversion, tags on block devices only worked with the # 2.32 microversion specifically. And tags on networks only worked between # 2.32 and 2.36 inclusive; the 2.37 microversion broke tags for networks. max_microversion = '2.32' @classmethod def skip_checks(cls): super(DeviceTaggingTest, cls).skip_checks() if not CONF.service_available.neutron: raise cls.skipException('Neutron is required') if not CONF.validation.run_validation: raise cls.skipException('Validation must be enabled') if (not CONF.compute_feature_enabled.config_drive and not CONF.compute_feature_enabled.metadata_service): raise cls.skipException('One of metadata or config drive must be ' 'enabled') @classmethod def setup_clients(cls): super(DeviceTaggingTest, cls).setup_clients() cls.networks_client = cls.os_primary.networks_client cls.ports_client = cls.os_primary.ports_client cls.subnets_client = cls.os_primary.subnets_client cls.interfaces_client = cls.os_primary.interfaces_client @classmethod def setup_credentials(cls): cls.set_network_resources(network=True, subnet=True, router=True, dhcp=True) super(DeviceTaggingTest, cls).setup_credentials() def verify_device_metadata(self, md_json): md_dict = json.loads(md_json) for d in md_dict['devices']: if d['type'] == 'nic': if d['mac'] == self.port1['mac_address']: self.assertEqual(d['tags'], ['port-1']) if d['mac'] == self.port2['mac_address']: self.assertEqual(d['tags'], ['port-2']) if d['mac'] == self.net_2_100_mac: self.assertEqual(d['tags'], ['net-2-100']) if d['mac'] == self.net_2_200_mac: self.assertEqual(d['tags'], ['net-2-200']) # A hypervisor may present multiple paths to a tagged disk, so # there may be duplicated tags in the metadata, use set() to # remove duplicated tags. found_devices = [d['tags'][0] for d in md_dict['devices']] self.assertEqual(set(found_devices), set(['port-1', 'port-2', 'net-1', 'net-2-100', 'net-2-200', 'boot', 'other'])) @decorators.idempotent_id('a2e65a6c-66f1-4442-aaa8-498c31778d96') @utils.services('network', 'volume', 'image') def test_device_tagging(self): # Create volumes # The create_volume methods waits for the volumes to be available and # the base class will clean them up on tearDown. boot_volume = self.create_volume(CONF.compute.image_ref) other_volume = self.create_volume() untagged_volume = self.create_volume() # Create networks net1 = self.networks_client.create_network( name=data_utils.rand_name('device-tagging-net1'))['network'] self.addCleanup(self.networks_client.delete_network, net1['id']) net2 = self.networks_client.create_network( name=data_utils.rand_name('device-tagging-net2'))['network'] self.addCleanup(self.networks_client.delete_network, net2['id']) # Create subnets subnet1 = self.subnets_client.create_subnet( network_id=net1['id'], cidr='10.1.1.0/24', ip_version=4)['subnet'] self.addCleanup(self.subnets_client.delete_subnet, subnet1['id']) subnet2 = self.subnets_client.create_subnet( network_id=net2['id'], cidr='10.2.2.0/24', ip_version=4)['subnet'] self.addCleanup(self.subnets_client.delete_subnet, subnet2['id']) # Create ports self.port1 = self.ports_client.create_port( network_id=net1['id'], fixed_ips=[{'subnet_id': subnet1['id']}])['port'] self.addCleanup(self.ports_client.delete_port, self.port1['id']) self.port2 = self.ports_client.create_port( network_id=net1['id'], fixed_ips=[{'subnet_id': subnet1['id']}])['port'] self.addCleanup(self.ports_client.delete_port, self.port2['id']) # Create server admin_pass = data_utils.rand_password() config_drive_enabled = CONF.compute_feature_enabled.config_drive validation_resources = self.get_test_validation_resources( self.os_primary) server = self.create_test_server( validatable=True, validation_resources=validation_resources, config_drive=config_drive_enabled, adminPass=admin_pass, name=data_utils.rand_name('device-tagging-server'), networks=[ # Validation network for ssh { 'uuid': self.get_tenant_network()['id'] }, # Different tags for different ports { 'port': self.port1['id'], 'tag': 'port-1' }, { 'port': self.port2['id'], 'tag': 'port-2' }, # Two nics on same net, one tagged one not { 'uuid': net1['id'], 'tag': 'net-1' }, { 'uuid': net1['id'] }, # Two nics on same net, different IP { 'uuid': net2['id'], 'fixed_ip': '10.2.2.100', 'tag': 'net-2-100' }, { 'uuid': net2['id'], 'fixed_ip': '10.2.2.200', 'tag': 'net-2-200' } ], block_device_mapping_v2=[ # Boot volume { 'uuid': boot_volume['id'], 'source_type': 'volume', 'destination_type': 'volume', 'boot_index': 0, 'tag': 'boot' }, # Other volume { 'uuid': other_volume['id'], 'source_type': 'volume', 'destination_type': 'volume', 'boot_index': 1, 'tag': 'other' }, # Untagged volume { 'uuid': untagged_volume['id'], 'source_type': 'volume', 'destination_type': 'volume', 'boot_index': 2 } ]) self.addCleanup(self.delete_server, server['id']) self.ssh_client = remote_client.RemoteClient( self.get_server_ip(server, validation_resources), CONF.validation.image_ssh_user, admin_pass, validation_resources['keypair']['private_key'], server=server, servers_client=self.servers_client) # Find the MAC addresses of our fixed IPs self.net_2_100_mac = None self.net_2_200_mac = None ifaces = self.interfaces_client.list_interfaces(server['id']) for iface in ifaces['interfaceAttachments']: if 'fixed_ips' in iface: for ip in iface['fixed_ips']: if ip['ip_address'] == '10.2.2.100': self.net_2_100_mac = iface['mac_addr'] if ip['ip_address'] == '10.2.2.200': self.net_2_200_mac = iface['mac_addr'] # Make sure we have the MACs we need, there's no reason for some to be # missing self.assertTrue(self.net_2_100_mac) self.assertTrue(self.net_2_200_mac) # Verify metadata from metadata service if CONF.compute_feature_enabled.metadata_service: md_url = 'http://169.254.169.254/openstack/latest/meta_data.json' LOG.info('Attempting to verify tagged devices in server %s via ' 'the metadata service: %s', server['id'], md_url) def get_and_verify_metadata(): try: self.ssh_client.exec_command('curl -V') except exceptions.SSHExecCommandFailed: if not CONF.compute_feature_enabled.config_drive: raise self.skipException('curl not found in guest ' 'and config drive is ' 'disabled') LOG.warning('curl was not found in the guest, device ' 'tagging metadata was not checked in the ' 'metadata API') return True cmd = 'curl %s' % md_url md_json = self.ssh_client.exec_command(cmd) self.verify_device_metadata(md_json) return True if not test_utils.call_until_true(get_and_verify_metadata, CONF.compute.build_timeout, CONF.compute.build_interval): raise exceptions.TimeoutException('Timeout while verifying ' 'metadata on server.') # Verify metadata on config drive if CONF.compute_feature_enabled.config_drive: cmd_blkid = 'blkid -t LABEL=config-2 -o device' LOG.info('Attempting to verify tagged devices in server %s via ' 'the config drive.', server['id']) dev_name = self.ssh_client.exec_command(cmd_blkid) dev_name = dev_name.rstrip() try: self.ssh_client.exec_command('sudo mount %s /mnt' % dev_name) except exceptions.SSHExecCommandFailed: # So the command failed, let's try to know why and print some # useful information. lsblk = self.ssh_client.exec_command('sudo lsblk --fs --ascii') LOG.error("Mounting %s on /mnt failed. Right after the " "failure 'lsblk' in the guest reported:\n%s", dev_name, lsblk) raise cmd_md = 'sudo cat /mnt/openstack/latest/meta_data.json' md_json = self.ssh_client.exec_command(cmd_md) self.verify_device_metadata(md_json) class DeviceTaggingTestV2_42(DeviceTaggingTest): min_microversion = '2.42' max_microversion = 'latest'
# -*- coding: utf-8 -*- """This file contains a MRUList Registry plugin. Also see: https://winreg-kb.readthedocs.io/en/latest/sources/explorer-keys/Most-recently-used.html """ import abc import os from dtfabric.runtime import data_maps as dtfabric_data_maps from plaso.containers import events from plaso.containers import time_events from plaso.lib import definitions from plaso.lib import dtfabric_helper from plaso.lib import errors from plaso.parsers import logger from plaso.parsers import winreg_parser from plaso.parsers.shared import shell_items from plaso.parsers.winreg_plugins import interface class MRUListEventData(events.EventData): """MRUList event data attribute container. Attributes: entries (str): most recently used (MRU) entries. key_path (str): Windows Registry key path. """ DATA_TYPE = 'windows:registry:mrulist' def __init__(self): """Initializes event data.""" super(MRUListEventData, self).__init__(data_type=self.DATA_TYPE) self.entries = None self.key_path = None class MRUListStringRegistryKeyFilter( interface.WindowsRegistryKeyWithValuesFilter): """Windows Registry key with values filter.""" _IGNORE_KEY_PATH_SUFFIXES = frozenset([ '\\Explorer\\DesktopStreamMRU'.upper()]) _VALUE_NAMES = ('a', 'MRUList') def __init__(self): """Initializes a Windows Registry key filter object.""" super(MRUListStringRegistryKeyFilter, self).__init__(self._VALUE_NAMES) def Match(self, registry_key): """Determines if a Windows Registry key matches the filter. Args: registry_key (dfwinreg.WinRegistryKey): Windows Registry key. Returns: bool: True if the Windows Registry key matches the filter. """ key_path = registry_key.path.upper() # Prevent this filter matching non-string MRUList values. for ignore_key_path_suffix in self._IGNORE_KEY_PATH_SUFFIXES: if key_path.endswith(ignore_key_path_suffix): return False return super(MRUListStringRegistryKeyFilter, self).Match(registry_key) class BaseMRUListWindowsRegistryPlugin( interface.WindowsRegistryPlugin, dtfabric_helper.DtFabricHelper): """Class for common MRUList Windows Registry plugin functionality.""" _DEFINITION_FILE = os.path.join( os.path.dirname(__file__), 'mru.yaml') @abc.abstractmethod def _ParseMRUListEntryValue( self, parser_mediator, registry_key, entry_index, entry_letter, **kwargs): """Parses the MRUList entry value. Args: parser_mediator (ParserMediator): mediates interactions between parsers and other components, such as storage and dfvfs. registry_key (dfwinreg.WinRegistryKey): Windows Registry key that contains the MRUList value. entry_index (int): MRUList entry index. entry_letter (str): character value representing the entry. Returns: str: MRUList entry value. """ def _ParseMRUListValue(self, registry_key): """Parses the MRUList value in a given Registry key. Args: registry_key (dfwinreg.WinRegistryKey): Windows Registry key that contains the MRUList value. Returns: mrulist_entries: MRUList entries or None if not available. """ mrulist_value = registry_key.GetValueByName('MRUList') # The key exists but does not contain a value named "MRUList". if not mrulist_value: return None mrulist_entries_map = self._GetDataTypeMap('mrulist_entries') context = dtfabric_data_maps.DataTypeMapContext(values={ 'data_size': len(mrulist_value.data)}) return self._ReadStructureFromByteStream( mrulist_value.data, 0, mrulist_entries_map, context=context) def _ParseMRUListKey(self, parser_mediator, registry_key, codepage='cp1252'): """Extract event objects from a MRUList Registry key. Args: parser_mediator (ParserMediator): mediates interactions between parsers and other components, such as storage and dfvfs. registry_key (dfwinreg.WinRegistryKey): Windows Registry key. codepage (Optional[str]): extended ASCII string codepage. """ try: mrulist = self._ParseMRUListValue(registry_key) except (ValueError, errors.ParseError) as exception: parser_mediator.ProduceExtractionWarning( 'unable to parse MRUList value with error: {0!s}'.format(exception)) return if not mrulist: return entries = [] found_terminator = False for entry_index, entry_letter in enumerate(mrulist): # The MRU list is terminated with '\0' (0x0000). if entry_letter == 0: break if found_terminator: parser_mediator.ProduceExtractionWarning(( 'found additional MRUList entries after terminator in key: ' '{0:s}.').format(registry_key.path)) # Only create one parser error per terminator. found_terminator = False entry_letter = chr(entry_letter) value_string = self._ParseMRUListEntryValue( parser_mediator, registry_key, entry_index, entry_letter, codepage=codepage) value_text = 'Index: {0:d} [MRU Value {1:s}]: {2:s}'.format( entry_index + 1, entry_letter, value_string) entries.append(value_text) event_data = MRUListEventData() event_data.entries = ' '.join(entries) event_data.key_path = registry_key.path event = time_events.DateTimeValuesEvent( registry_key.last_written_time, definitions.TIME_DESCRIPTION_WRITTEN) parser_mediator.ProduceEventWithEventData(event, event_data) class MRUListStringWindowsRegistryPlugin(BaseMRUListWindowsRegistryPlugin): """Windows Registry plugin to parse a string MRUList.""" NAME = 'mrulist_string' DATA_FORMAT = 'Most Recently Used (MRU) Registry data' FILTERS = frozenset([MRUListStringRegistryKeyFilter()]) def _ParseMRUListEntryValue( self, parser_mediator, registry_key, entry_index, entry_letter, **kwargs): """Parses the MRUList entry value. Args: parser_mediator (ParserMediator): mediates interactions between parsers and other components, such as storage and dfvfs. registry_key (dfwinreg.WinRegistryKey): Windows Registry key that contains the MRUList value. entry_index (int): MRUList entry index. entry_letter (str): character value representing the entry. Returns: str: MRUList entry value. """ value_string = '' value = registry_key.GetValueByName('{0:s}'.format(entry_letter)) if value is None: parser_mediator.ProduceExtractionWarning( 'missing MRUList value: {0:s} in key: {1:s}.'.format( entry_letter, registry_key.path)) elif value.DataIsString(): value_string = value.GetDataAsObject() elif value.DataIsBinaryData(): logger.debug(( '[{0:s}] Non-string MRUList entry value: {1:s} parsed as string ' 'in key: {2:s}.').format(self.NAME, entry_letter, registry_key.path)) utf16le_string_map = self._GetDataTypeMap('utf16le_string') try: value_string = self._ReadStructureFromByteStream( value.data, 0, utf16le_string_map) except (ValueError, errors.ParseError) as exception: parser_mediator.ProduceExtractionWarning(( 'unable to parse MRUList entry value: {0:s} with error: ' '{1!s}').format(entry_letter, exception)) value_string = value_string.rstrip('\x00') return value_string # pylint: disable=arguments-differ def ExtractEvents( self, parser_mediator, registry_key, codepage='cp1252', **kwargs): """Extracts events from a Windows Registry key. Args: parser_mediator (ParserMediator): mediates interactions between parsers and other components, such as storage and dfvfs. registry_key (dfwinreg.WinRegistryKey): Windows Registry key. codepage (Optional[str]): extended ASCII string codepage. """ self._ParseMRUListKey(parser_mediator, registry_key, codepage=codepage) class MRUListShellItemListWindowsRegistryPlugin( BaseMRUListWindowsRegistryPlugin): """Windows Registry plugin to parse a shell item list MRUList.""" NAME = 'mrulist_shell_item_list' DATA_FORMAT = 'Most Recently Used (MRU) Registry data' FILTERS = frozenset([ interface.WindowsRegistryKeyPathFilter( 'HKEY_CURRENT_USER\\Software\\Microsoft\\Windows\\CurrentVersion\\' 'Explorer\\DesktopStreamMRU')]) # pylint: disable=arguments-differ def _ParseMRUListEntryValue( self, parser_mediator, registry_key, entry_index, entry_letter, codepage='cp1252', **kwargs): """Parses the MRUList entry value. Args: parser_mediator (ParserMediator): mediates interactions between parsers and other components, such as storage and dfvfs. registry_key (dfwinreg.WinRegistryKey): Windows Registry key that contains the MRUList value. entry_index (int): MRUList entry index. entry_letter (str): character value representing the entry. codepage (Optional[str]): extended ASCII string codepage. Returns: str: MRUList entry value. """ value_string = '' value = registry_key.GetValueByName('{0:s}'.format(entry_letter)) if value is None: parser_mediator.ProduceExtractionWarning( 'missing MRUList value: {0:s} in key: {1:s}.'.format( entry_letter, registry_key.path)) elif not value.DataIsBinaryData(): parser_mediator.ProduceExtractionWarning( 'Non-binary MRUList entry value: {1:s} in key: {2:s}.'.format( entry_letter, registry_key.path)) elif value.data: shell_items_parser = shell_items.ShellItemsParser(registry_key.path) shell_items_parser.ParseByteStream( parser_mediator, value.data, codepage=codepage) shell_item_path = shell_items_parser.CopyToPath() or 'N/A' value_string = 'Shell item path: {0:s}'.format(shell_item_path) return value_string # pylint: disable=arguments-differ def ExtractEvents( self, parser_mediator, registry_key, codepage='cp1252', **kwargs): """Extracts events from a Windows Registry key. Args: parser_mediator (ParserMediator): mediates interactions between parsers and other components, such as storage and dfvfs. registry_key (dfwinreg.WinRegistryKey): Windows Registry key. codepage (Optional[str]): extended ASCII string codepage. """ self._ParseMRUListKey(parser_mediator, registry_key, codepage=codepage) winreg_parser.WinRegistryParser.RegisterPlugins([ MRUListStringWindowsRegistryPlugin, MRUListShellItemListWindowsRegistryPlugin])
{% if cookiecutter.use_sentry == 'y' -%} import logging {% endif -%} from .base import * # noqa from .base import env # GENERAL # ------------------------------------------------------------------------------ # https://docs.djangoproject.com/en/dev/ref/settings/#secret-key SECRET_KEY = env('DJANGO_SECRET_KEY') # https://docs.djangoproject.com/en/dev/ref/settings/#allowed-hosts ALLOWED_HOSTS = env.list('DJANGO_ALLOWED_HOSTS', default=['{{ cookiecutter.domain_name }}']) # DATABASES # ------------------------------------------------------------------------------ DATABASES['default'] = env.db('DATABASE_URL') # noqa F405 DATABASES['default']['ATOMIC_REQUESTS'] = True # noqa F405 DATABASES['default']['CONN_MAX_AGE'] = env.int('CONN_MAX_AGE', default=60) # noqa F405 # CACHES # ------------------------------------------------------------------------------ CACHES = { 'default': { 'BACKEND': 'django_redis.cache.RedisCache', 'LOCATION': env('REDIS_URL'), 'OPTIONS': { 'CLIENT_CLASS': 'django_redis.client.DefaultClient', # Mimicing memcache behavior. # http://niwinz.github.io/django-redis/latest/#_memcached_exceptions_behavior 'IGNORE_EXCEPTIONS': True, } } } # SECURITY # ------------------------------------------------------------------------------ # https://docs.djangoproject.com/en/dev/ref/settings/#secure-proxy-ssl-header SECURE_PROXY_SSL_HEADER = ('HTTP_X_FORWARDED_PROTO', 'https') # https://docs.djangoproject.com/en/dev/ref/settings/#secure-ssl-redirect SECURE_SSL_REDIRECT = env.bool('DJANGO_SECURE_SSL_REDIRECT', default=True) # https://docs.djangoproject.com/en/dev/ref/settings/#session-cookie-secure SESSION_COOKIE_SECURE = True # https://docs.djangoproject.com/en/dev/ref/settings/#csrf-cookie-secure CSRF_COOKIE_SECURE = True # https://docs.djangoproject.com/en/dev/topics/security/#ssl-https # https://docs.djangoproject.com/en/dev/ref/settings/#secure-hsts-seconds # TODO: set this to 60 seconds first and then to 518400 once you prove the former works SECURE_HSTS_SECONDS = 60 # https://docs.djangoproject.com/en/dev/ref/settings/#secure-hsts-include-subdomains SECURE_HSTS_INCLUDE_SUBDOMAINS = env.bool('DJANGO_SECURE_HSTS_INCLUDE_SUBDOMAINS', default=True) # https://docs.djangoproject.com/en/dev/ref/settings/#secure-hsts-preload SECURE_HSTS_PRELOAD = env.bool('DJANGO_SECURE_HSTS_PRELOAD', default=True) # https://docs.djangoproject.com/en/dev/ref/middleware/#x-content-type-options-nosniff SECURE_CONTENT_TYPE_NOSNIFF = env.bool('DJANGO_SECURE_CONTENT_TYPE_NOSNIFF', default=True) # STORAGES # ------------------------------------------------------------------------------ # https://django-storages.readthedocs.io/en/latest/#installation INSTALLED_APPS += ['storages'] # noqa F405 # https://django-storages.readthedocs.io/en/latest/backends/amazon-S3.html#settings AWS_ACCESS_KEY_ID = env('DJANGO_AWS_ACCESS_KEY_ID') # https://django-storages.readthedocs.io/en/latest/backends/amazon-S3.html#settings AWS_SECRET_ACCESS_KEY = env('DJANGO_AWS_SECRET_ACCESS_KEY') # https://django-storages.readthedocs.io/en/latest/backends/amazon-S3.html#settings AWS_STORAGE_BUCKET_NAME = env('DJANGO_AWS_STORAGE_BUCKET_NAME') # https://django-storages.readthedocs.io/en/latest/backends/amazon-S3.html#settings AWS_QUERYSTRING_AUTH = False # DO NOT change these unless you know what you're doing. _AWS_EXPIRY = 60 * 60 * 24 * 7 # https://django-storages.readthedocs.io/en/latest/backends/amazon-S3.html#settings AWS_S3_OBJECT_PARAMETERS = { 'CacheControl': f'max-age={_AWS_EXPIRY}, s-maxage={_AWS_EXPIRY}, must-revalidate', } # STATIC # ------------------------ {% if cookiecutter.use_whitenoise == 'y' -%} STATICFILES_STORAGE = 'whitenoise.storage.CompressedManifestStaticFilesStorage' {%- else %} STATICFILES_STORAGE = 'config.settings.production.StaticRootS3Boto3Storage' STATIC_URL = f'https://{AWS_STORAGE_BUCKET_NAME}.s3.amazonaws.com/static/' {%- endif %} # MEDIA # ------------------------------------------------------------------------------ {% if cookiecutter.use_whitenoise == 'y' -%} DEFAULT_FILE_STORAGE = 'storages.backends.s3boto3.S3Boto3Storage' MEDIA_URL = f'https://{AWS_STORAGE_BUCKET_NAME}.s3.amazonaws.com/' {%- else %} # region http://stackoverflow.com/questions/10390244/ # Full-fledge class: https://stackoverflow.com/a/18046120/104731 from storages.backends.s3boto3 import S3Boto3Storage # noqa E402 class StaticRootS3Boto3Storage(S3Boto3Storage): location = 'static' class MediaRootS3Boto3Storage(S3Boto3Storage): location = 'media' file_overwrite = False # endregion DEFAULT_FILE_STORAGE = 'config.settings.production.MediaRootS3Boto3Storage' MEDIA_URL = f'https://{AWS_STORAGE_BUCKET_NAME}.s3.amazonaws.com/media/' {%- endif %} # TEMPLATES # ------------------------------------------------------------------------------ # https://docs.djangoproject.com/en/dev/ref/settings/#templates TEMPLATES[0]['OPTIONS']['loaders'] = [ # noqa F405 ( 'django.template.loaders.cached.Loader', [ 'django.template.loaders.filesystem.Loader', 'django.template.loaders.app_directories.Loader', ] ), ] # EMAIL # ------------------------------------------------------------------------------ # https://docs.djangoproject.com/en/dev/ref/settings/#default-from-email DEFAULT_FROM_EMAIL = env( 'DJANGO_DEFAULT_FROM_EMAIL', default='{{cookiecutter.project_name}} <noreply@{{cookiecutter.domain_name}}>' ) # https://docs.djangoproject.com/en/dev/ref/settings/#server-email SERVER_EMAIL = env('DJANGO_SERVER_EMAIL', default=DEFAULT_FROM_EMAIL) # https://docs.djangoproject.com/en/dev/ref/settings/#email-subject-prefix EMAIL_SUBJECT_PREFIX = env('DJANGO_EMAIL_SUBJECT_PREFIX', default='[{{cookiecutter.project_name}}]') # ADMIN # ------------------------------------------------------------------------------ # Django Admin URL regex. ADMIN_URL = env('DJANGO_ADMIN_URL') # Anymail (Mailgun) # ------------------------------------------------------------------------------ # https://anymail.readthedocs.io/en/stable/installation/#installing-anymail INSTALLED_APPS += ['anymail'] # noqa F405 EMAIL_BACKEND = 'anymail.backends.mailgun.EmailBackend' # https://anymail.readthedocs.io/en/stable/installation/#anymail-settings-reference ANYMAIL = { 'MAILGUN_API_KEY': env('MAILGUN_API_KEY'), 'MAILGUN_SENDER_DOMAIN': env('MAILGUN_DOMAIN') } # Gunicorn # ------------------------------------------------------------------------------ INSTALLED_APPS += ['gunicorn'] # noqa F405 {% if cookiecutter.use_whitenoise == 'y' -%} # WhiteNoise # ------------------------------------------------------------------------------ # http://whitenoise.evans.io/en/latest/django.html#enable-whitenoise MIDDLEWARE.insert(1, 'whitenoise.middleware.WhiteNoiseMiddleware') # noqa F405 {% endif %} {%- if cookiecutter.use_compressor == 'y' -%} # django-compressor # ------------------------------------------------------------------------------ # https://django-compressor.readthedocs.io/en/latest/settings/#django.conf.settings.COMPRESS_ENABLED COMPRESS_ENABLED = env.bool('COMPRESS_ENABLED', default=True) # https://django-compressor.readthedocs.io/en/latest/settings/#django.conf.settings.COMPRESS_STORAGE COMPRESS_STORAGE = 'storages.backends.s3boto3.S3Boto3Storage' # https://django-compressor.readthedocs.io/en/latest/settings/#django.conf.settings.COMPRESS_URL COMPRESS_URL = STATIC_URL {% endif %} {%- if cookiecutter.use_whitenoise == 'n' -%} # Collectfast # ------------------------------------------------------------------------------ # https://github.com/antonagestam/collectfast#installation INSTALLED_APPS = ['collectfast'] + INSTALLED_APPS # noqa F405 AWS_PRELOAD_METADATA = True {% endif %} {%- if cookiecutter.use_sentry == 'y' -%} # raven # ------------------------------------------------------------------------------ # https://docs.sentry.io/clients/python/integrations/django/ INSTALLED_APPS += ['raven.contrib.django.raven_compat'] # noqa F405 MIDDLEWARE = ['raven.contrib.django.raven_compat.middleware.SentryResponseErrorIdMiddleware'] + MIDDLEWARE # Sentry # ------------------------------------------------------------------------------ SENTRY_DSN = env('SENTRY_DSN') SENTRY_CLIENT = env('DJANGO_SENTRY_CLIENT', default='raven.contrib.django.raven_compat.DjangoClient') LOGGING = { 'version': 1, 'disable_existing_loggers': True, 'root': { 'level': 'WARNING', 'handlers': ['sentry'], }, 'formatters': { 'verbose': { 'format': '%(levelname)s %(asctime)s %(module)s ' '%(process)d %(thread)d %(message)s' }, }, 'handlers': { 'sentry': { 'level': 'ERROR', 'class': 'raven.contrib.django.raven_compat.handlers.SentryHandler', }, 'console': { 'level': 'DEBUG', 'class': 'logging.StreamHandler', 'formatter': 'verbose' } }, 'loggers': { 'django.db.backends': { 'level': 'ERROR', 'handlers': ['console'], 'propagate': False, }, 'raven': { 'level': 'DEBUG', 'handlers': ['console'], 'propagate': False, }, 'sentry.errors': { 'level': 'DEBUG', 'handlers': ['console'], 'propagate': False, }, 'django.security.DisallowedHost': { 'level': 'ERROR', 'handlers': ['console', 'sentry'], 'propagate': False, }, }, } SENTRY_CELERY_LOGLEVEL = env.int('DJANGO_SENTRY_LOG_LEVEL', logging.INFO) RAVEN_CONFIG = { 'dsn': SENTRY_DSN } {%- else %} # LOGGING # ------------------------------------------------------------------------------ # See: https://docs.djangoproject.com/en/dev/ref/settings/#logging # A sample logging configuration. The only tangible logging # performed by this configuration is to send an email to # the site admins on every HTTP 500 error when DEBUG=False. # See https://docs.djangoproject.com/en/dev/topics/logging for # more details on how to customize your logging configuration. LOGGING = { 'version': 1, 'disable_existing_loggers': False, 'filters': { 'require_debug_false': { '()': 'django.utils.log.RequireDebugFalse' } }, 'formatters': { 'verbose': { 'format': '%(levelname)s %(asctime)s %(module)s ' '%(process)d %(thread)d %(message)s' }, }, 'handlers': { 'mail_admins': { 'level': 'ERROR', 'filters': ['require_debug_false'], 'class': 'django.utils.log.AdminEmailHandler' }, 'console': { 'level': 'DEBUG', 'class': 'logging.StreamHandler', 'formatter': 'verbose', }, }, 'loggers': { 'django.request': { 'handlers': ['mail_admins'], 'level': 'ERROR', 'propagate': True }, 'django.security.DisallowedHost': { 'level': 'ERROR', 'handlers': ['console', 'mail_admins'], 'propagate': True } } } {% endif %} # Your stuff... # ------------------------------------------------------------------------------
# # Training a Network w/Tensorflow # # PART 3 - Multiple images # # refer: # 4 imgs, 128x128, 10 iter: biswal home 38.9s; cyclop (vm): 7.7s # 16 imgs, 128x128, 3 iter: biswal home 46.8s; cyclop (vm): 8.3s # 16 imgs, 128x128, 10 iter: biswal home: 151.8s; cyclop (vm): 30.2s # 16 imgs, 128x128, 1k iter: cyclop (centos vm): 3058s (~51m) # 2098s (bugfix gif too large) # import sys import os import numpy as np import matplotlib.pyplot as plt from skimage.transform import resize from skimage import data from scipy.misc import imresize import tensorflow as tf from libs import gif, utils import IPython.display as ipyd from datetime import datetime #np.set_printoptions(threshold=np.inf) # display FULL array (infinite) plt.ion() def split_image(img): # We'll first collect all the positions in the image in our list, xs xs = [] # And the corresponding colors for each of these positions ys = [] # Now loop over the image for row_i in range(img.shape[0]): for col_i in range(img.shape[1]): # And store the inputs xs.append([row_i, col_i]) # And outputs that the network needs to learn to predict ys.append(img[row_i, col_i]) # we'll convert our lists to arrays xs = np.array(xs) ys = np.array(ys) return xs, ys def build_model(xs, ys, n_neurons, n_layers, activation_fn, final_activation_fn, cost_type): xs = np.asarray(xs) ys = np.asarray(ys) if xs.ndim != 2: raise ValueError( 'xs should be a n_observates x n_features, ' + 'or a 2-dimensional array.') if ys.ndim != 2: raise ValueError( 'ys should be a n_observates x n_features, ' + 'or a 2-dimensional array.') n_xs = xs.shape[1] n_ys = ys.shape[1] X = tf.placeholder(name='X', shape=[None, n_xs], dtype=tf.float32) Y = tf.placeholder(name='Y', shape=[None, n_ys], dtype=tf.float32) current_input = X for layer_i in range(n_layers): current_input = utils.linear( current_input, n_neurons, activation=activation_fn, name='layer{}'.format(layer_i))[0] Y_pred = utils.linear( current_input, n_ys, activation=final_activation_fn, name='pred')[0] if cost_type == 'l1_norm': cost = tf.reduce_mean(tf.reduce_sum( tf.abs(Y - Y_pred), 1)) elif cost_type == 'l2_norm': cost = tf.reduce_mean(tf.reduce_sum( tf.squared_difference(Y, Y_pred), 1)) else: raise ValueError( 'Unknown cost_type: {}. '.format( cost_type) + 'Use only "l1_norm" or "l2_norm"') return {'X': X, 'Y': Y, 'Y_pred': Y_pred, 'cost': cost} def train(imgs, learning_rate=0.0001, batch_size=200, n_iterations=10, gif_step=2, n_neurons=30, n_layers=10, activation_fn=tf.nn.relu, final_activation_fn=tf.nn.tanh, cost_type='l2_norm'): N, H, W, C = imgs.shape all_xs, all_ys = [], [] for img_i, img in enumerate(imgs): xs, ys = split_image(img) all_xs.append(np.c_[xs, np.repeat(img_i, [xs.shape[0]])]) all_ys.append(ys) xs = np.array(all_xs).reshape(-1, 3) xs = (xs - np.mean(xs, 0)) / np.std(xs, 0) ys = np.array(all_ys).reshape(-1, 3) ys = ys / 127.5 - 1 g = tf.Graph() with tf.Session(graph=g) as sess: model = build_model(xs, ys, n_neurons, n_layers, activation_fn, final_activation_fn, cost_type) optimizer = tf.train.AdamOptimizer( learning_rate=learning_rate).minimize(model['cost']) sess.run(tf.initialize_all_variables()) gifs = [] costs = [] step_i = 0 for it_i in range(n_iterations): # Get a random sampling of the dataset idxs = np.random.permutation(range(len(xs))) # The number of batches we have to iterate over n_batches = len(idxs) // batch_size training_cost = 0 # Now iterate over our stochastic minibatches: for batch_i in range(n_batches): # Get just minibatch amount of data idxs_i = idxs[batch_i * batch_size: (batch_i + 1) * batch_size] # And optimize, also returning the cost so we can monitor # how our optimization is doing. cost = sess.run( [model['cost'], optimizer], feed_dict={model['X']: xs[idxs_i], model['Y']: ys[idxs_i]})[0] training_cost += cost print('iteration {}/{}: cost {}'.format( it_i + 1, n_iterations, training_cost / n_batches)) # Also, every 20 iterations, we'll draw the prediction of our # input xs, which should try to recreate our image! if (it_i + 1) % gif_step == 0: costs.append(training_cost / n_batches) ys_pred = model['Y_pred'].eval( feed_dict={model['X']: xs}, session=sess) img = ys_pred.reshape(imgs.shape) gifs.append(img) return gifs import urllib def get_celeb_files(qfil): if not os.path.exists('img_align_celeba'): os.mkdir('img_align_celeba') for img_i in range(1, qfil+1): f = '000%03d.jpg' % img_i url = 'https://s3.amazonaws.com/cadl/celeb-align/' + f print(url, end='\r') urllib.request.urlretrieve(url, os.path.join('img_align_celeba', f)) files = [os.path.join('img_align_celeba', file_i) for file_i in os.listdir('img_align_celeba') if '.jpg' in file_i] return files[0:qfil] def get_celeb_imgs(qpic): """ Returns ------- imgs : list of np.ndarray List of the first <qpic> images from the celeb dataset """ return [plt.imread(f_i) for f_i in get_celeb_files(qpic)] ############################################################# # # MAIN # print("Reading images...") QNT=16 switchcelebs=False if switchcelebs: celeb_imgs = np.array(get_celeb_imgs(QNT)) plt.figure(figsize=(6, 6)) print(celeb_imgs) print (np.array(celeb_imgs).shape) pltdataset=utils.montage(celeb_imgs, saveto="batch2_3_temp_dataset.png").astype(np.uint8) plt.imshow(pltdataset) plt.imsave(fname='batch2_3_dataset.png', arr=pltdataset) trainimgs = np.array(celeb_imgs).copy() else: dirname = "labdogs" filenames = [os.path.join(dirname, fname) for fname in os.listdir(dirname)] filenames = filenames[:QNT] assert(len(filenames) == QNT) #myimgs = [plt.imread(fname)[..., :3] for fname in filenames] myimgs=np.array([plt.imread(fname) for fname in filenames]) myimgs = [utils.imcrop_tosquare(img_i) for img_i in myimgs] myimgs = [resize(img_i, (128,128)) for img_i in myimgs] myimgs=np.clip(np.array(myimgs)*255, 0, 255).astype(np.uint8) # fix resize() conversion to 0..1 pltdataset=utils.montage(myimgs, saveto="batch2_3_temp_dataset.png").astype(np.uint8) plt.imshow(pltdataset) plt.imsave(fname='batch2_3_dataset.png', arr=pltdataset) trainimgs = np.array(myimgs).copy() plt.show() plt.pause(1) print("Training...") t1 = datetime.now() trainedgifs = train(imgs=trainimgs, n_iterations=1000, gif_step=50) t2 = datetime.now() delta = t2 - t1 print(" Total training time: ", delta.total_seconds()) plt.close() print("Saving results...") montage_gifs = [np.clip(utils.montage( (m * 127.5) + 127.5, saveto='batch2_3_montage_temp.png'), 0, 255).astype(np.uint8) for m in trainedgifs] _ = gif.build_gif(montage_gifs, saveto='batch2_3_multiple.gif') plt.show() plt.pause(5) plt.close() final = trainedgifs[-1] final_gif = [np.clip(((m * 127.5) + 127.5), 0, 255).astype(np.uint8) for m in final] gif.build_gif(final_gif, saveto='batch2_3_final.gif') #plt.imshow(_) plt.show() plt.pause(5) plt.close() # eop
#!/usr/bin/env python """ The Computer Language Benchmarks Game http://benchmarksgame.alioth.debian.org/ regex-dna Python 3 #5 program: contributed by Dominique Wahli 2to3 modified by Justin Peel fasta Python 3 #3 program: modified by Ian Osgood modified again by Heinrich Acker modified by Justin Peel Modified by Christopher Sean Forgeron """ import bisect import re import pyperf DEFAULT_INIT_LEN = 100000 DEFAULT_RNG_SEED = 42 ALU = ('GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG' 'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA' 'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT' 'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA' 'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG' 'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC' 'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA') IUB = list(zip('acgtBDHKMNRSVWY', [0.27, 0.12, 0.12, 0.27] + [0.02] * 11)) HOMOSAPIENS = [ ('a', 0.3029549426680), ('c', 0.1979883004921), ('g', 0.1975473066391), ('t', 0.3015094502008), ] def make_cumulative(table): P = [] C = [] prob = 0. for char, p in table: prob += p P += [prob] C += [ord(char)] return (P, C) def repeat_fasta(src, n, nprint): width = 60 is_trailing_line = False count_modifier = 0.0 len_of_src = len(src) ss = src + src + src[:n % len_of_src] # CSF - It's faster to work with a bytearray than a string s = bytearray(ss, encoding='utf8') if n % width: # We don't end on a 60 char wide line is_trailing_line = True count_modifier = 1.0 # CSF - Here we are stuck with using an int instead of a float for the loop, # but testing showed it still to be faster than a for loop count = 0 end = (n / float(width)) - count_modifier while count < end: i = count * 60 % len_of_src nprint(s[i:i + 60] + b'\n') count += 1 if is_trailing_line: nprint(s[-(n % width):] + b'\n') def random_fasta(table, n, seed, nprint): width = 60 r = range(width) bb = bisect.bisect # If we don't have a multiple of the width, then we will have a trailing # line, which needs a slightly different approach is_trailing_line = False count_modifier = 0.0 line = bytearray(width + 1) # Width of 60 + 1 for the \n char probs, chars = make_cumulative(table) # pRNG Vars im = 139968.0 seed = float(seed) if n % width: # We don't end on a 60 char wide line is_trailing_line = True count_modifier = 1.0 # CSF - Loops with a high iteration count run faster as a while/float loop. count = 0.0 end = (n / float(width)) - count_modifier while count < end: # CSF - Low iteration count loops may run faster as a for loop. for i in r: # CSF - Python is faster for all float math than it is for int, on my # machine at least. seed = (seed * 3877.0 + 29573.0) % 139968.0 # CSF - While real values, not variables are faster for most things, on my # machine, it's faster to have 'im' already in a var line[i] = chars[bb(probs, seed / im)] line[60] = 10 # End of Line nprint(line) count += 1.0 if is_trailing_line: for i in range(n % width): seed = (seed * 3877.0 + 29573.0) % 139968.0 line[i] = chars[bb(probs, seed / im)] nprint(line[:i + 1] + b"\n") return seed def init_benchmarks(n, rng_seed): result = bytearray() nprint = result.extend nprint(b'>ONE Homo sapiens alu\n') repeat_fasta(ALU, n * 2, nprint=nprint) # We need to keep track of the state of 'seed' so we pass it in, and return # it back so our output can pass the diff test nprint(b'>TWO IUB ambiguity codes\n') seed = random_fasta(IUB, n * 3, seed=rng_seed, nprint=nprint) nprint(b'>THREE Homo sapiens frequency\n') random_fasta(HOMOSAPIENS, n * 5, seed, nprint=nprint) return bytes(result) VARIANTS = ( b'agggtaaa|tttaccct', b'[cgt]gggtaaa|tttaccc[acg]', b'a[act]ggtaaa|tttacc[agt]t', b'ag[act]gtaaa|tttac[agt]ct', b'agg[act]taaa|ttta[agt]cct', b'aggg[acg]aaa|ttt[cgt]ccct', b'agggt[cgt]aa|tt[acg]accct', b'agggta[cgt]a|t[acg]taccct', b'agggtaa[cgt]|[acg]ttaccct', ) SUBST = ( (b'B', b'(c|g|t)'), (b'D', b'(a|g|t)'), (b'H', b'(a|c|t)'), (b'K', b'(g|t)'), (b'M', b'(a|c)'), (b'N', b'(a|c|g|t)'), (b'R', b'(a|g)'), (b'S', b'(c|g)'), (b'V', b'(a|c|g)'), (b'W', b'(a|t)'), (b'Y', b'(c|t)'), ) def run_benchmarks(seq): ilen = len(seq) seq = re.sub(b'>.*\n|\n', b'', seq) clen = len(seq) results = [] for f in VARIANTS: results.append(len(re.findall(f, seq))) for f, r in SUBST: seq = re.sub(f, r, seq) return results, ilen, clen, len(seq) def bench_regex_dna(loops, seq, expected_res): range_it = range(loops) t0 = pyperf.perf_counter() for i in range_it: res = run_benchmarks(seq) dt = pyperf.perf_counter() - t0 if (expected_res is not None) and (res != expected_res): raise Exception("run_benchmarks() error") return dt def add_cmdline_args(cmd, args): cmd.extend(("--fasta-length", str(args.fasta_length), "--rng-seed", str(args.rng_seed))) if __name__ == '__main__': runner = pyperf.Runner(add_cmdline_args=add_cmdline_args) runner.metadata['description'] = ("Test the performance of regexps " "using benchmarks from " "The Computer Language Benchmarks Game.") cmd = runner.argparser cmd.add_argument("--fasta-length", type=int, default=DEFAULT_INIT_LEN, help="Length of the fasta sequence " "(default: %s)" % DEFAULT_INIT_LEN) cmd.add_argument("--rng-seed", type=int, default=DEFAULT_RNG_SEED, help="Seed of the random number generator " "(default: %s)" % DEFAULT_RNG_SEED) args = runner.parse_args() if args.fasta_length == 100000: expected_len = 1016745 expected_res = ([6, 26, 86, 58, 113, 31, 31, 32, 43], 1016745, 1000000, 1336326) else: expected_len = None expected_res = None runner.metadata['regex_dna_fasta_len'] = args.fasta_length runner.metadata['regex_dna_rng_seed'] = args.rng_seed seq = init_benchmarks(args.fasta_length, args.rng_seed) if (expected_len is not None) and (len(seq) != expected_len): raise Exception("init_benchmarks() error") runner.bench_time_func('regex_dna', bench_regex_dna, seq, expected_res)
# -*- coding: utf-8 -*- """ Django settings for icecreamratings project. For more information on this file, see https://docs.djangoproject.com/en/dev/topics/settings/ For the full list of settings and their values, see https://docs.djangoproject.com/en/dev/ref/settings/ """ from __future__ import absolute_import, unicode_literals import environ ROOT_DIR = environ.Path(__file__) - 3 # (/a/b/myfile.py - 3 = /) APPS_DIR = ROOT_DIR.path('icecreamratings_project') env = environ.Env() # APP CONFIGURATION # ------------------------------------------------------------------------------ DJANGO_APPS = ( # Default Django apps: 'django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.sites', 'django.contrib.messages', 'django.contrib.staticfiles', # Useful template tags: # 'django.contrib.humanize', # Admin 'django.contrib.admin', ) THIRD_PARTY_APPS = ( 'crispy_forms', # Form layouts 'allauth', # registration 'allauth.account', # registration 'allauth.socialaccount', # registration ) # Apps specific for this project go here. LOCAL_APPS = ( 'icecreamratings_project.users', # custom users app # Your stuff: custom apps go here ) # See: https://docs.djangoproject.com/en/dev/ref/settings/#installed-apps INSTALLED_APPS = DJANGO_APPS + THIRD_PARTY_APPS + LOCAL_APPS # MIDDLEWARE CONFIGURATION # ------------------------------------------------------------------------------ MIDDLEWARE_CLASSES = ( # Make sure djangosecure.middleware.SecurityMiddleware is listed first 'django.contrib.sessions.middleware.SessionMiddleware', 'django.middleware.common.CommonMiddleware', 'django.middleware.csrf.CsrfViewMiddleware', 'django.contrib.auth.middleware.AuthenticationMiddleware', 'django.contrib.messages.middleware.MessageMiddleware', 'django.middleware.clickjacking.XFrameOptionsMiddleware', ) # MIGRATIONS CONFIGURATION # ------------------------------------------------------------------------------ MIGRATION_MODULES = { 'sites': 'icecreamratings_project.contrib.sites.migrations' } # DEBUG # ------------------------------------------------------------------------------ # See: https://docs.djangoproject.com/en/dev/ref/settings/#debug DEBUG = env.bool("DJANGO_DEBUG", False) # FIXTURE CONFIGURATION # ------------------------------------------------------------------------------ # See: https://docs.djangoproject.com/en/dev/ref/settings/#std:setting-FIXTURE_DIRS FIXTURE_DIRS = ( str(APPS_DIR.path('fixtures')), ) # EMAIL CONFIGURATION # ------------------------------------------------------------------------------ EMAIL_BACKEND = env('DJANGO_EMAIL_BACKEND', default='django.core.mail.backends.smtp.EmailBackend') # MANAGER CONFIGURATION # ------------------------------------------------------------------------------ # See: https://docs.djangoproject.com/en/dev/ref/settings/#admins ADMINS = ( ("""Pavel Karateev""", 'karateev.pavel@ya.ru'), ) # See: https://docs.djangoproject.com/en/dev/ref/settings/#managers MANAGERS = ADMINS # DATABASE CONFIGURATION # ------------------------------------------------------------------------------ # See: https://docs.djangoproject.com/en/dev/ref/settings/#databases DATABASES = { # Raises ImproperlyConfigured exception if DATABASE_URL not in os.environ 'default': env.db("DATABASE_URL", default="postgres:///icecreamratings_project"), } DATABASES['default']['ATOMIC_REQUESTS'] = True # GENERAL CONFIGURATION # ------------------------------------------------------------------------------ # Local time zone for this installation. Choices can be found here: # http://en.wikipedia.org/wiki/List_of_tz_zones_by_name # although not all choices may be available on all operating systems. # In a Windows environment this must be set to your system time zone. TIME_ZONE = 'Europe/Moscow' # See: https://docs.djangoproject.com/en/dev/ref/settings/#language-code LANGUAGE_CODE = 'en-us' # See: https://docs.djangoproject.com/en/dev/ref/settings/#site-id SITE_ID = 1 # See: https://docs.djangoproject.com/en/dev/ref/settings/#use-i18n USE_I18N = True # See: https://docs.djangoproject.com/en/dev/ref/settings/#use-l10n USE_L10N = True # See: https://docs.djangoproject.com/en/dev/ref/settings/#use-tz USE_TZ = True # TEMPLATE CONFIGURATION # ------------------------------------------------------------------------------ # See: https://docs.djangoproject.com/en/dev/ref/settings/#templates TEMPLATES = [ { # See: https://docs.djangoproject.com/en/dev/ref/settings/#std:setting-TEMPLATES-BACKEND 'BACKEND': 'django.template.backends.django.DjangoTemplates', # See: https://docs.djangoproject.com/en/dev/ref/settings/#template-dirs 'DIRS': [ str(APPS_DIR.path('templates')), ], 'OPTIONS': { # See: https://docs.djangoproject.com/en/dev/ref/settings/#template-debug 'debug': DEBUG, # See: https://docs.djangoproject.com/en/dev/ref/settings/#template-loaders # https://docs.djangoproject.com/en/dev/ref/templates/api/#loader-types 'loaders': [ 'django.template.loaders.filesystem.Loader', 'django.template.loaders.app_directories.Loader', ], # See: https://docs.djangoproject.com/en/dev/ref/settings/#template-context-processors 'context_processors': [ 'django.template.context_processors.debug', 'django.template.context_processors.request', 'django.contrib.auth.context_processors.auth', 'django.template.context_processors.i18n', 'django.template.context_processors.media', 'django.template.context_processors.static', 'django.template.context_processors.tz', 'django.contrib.messages.context_processors.messages', # Your stuff: custom template context processors go here ], }, }, ] # See: http://django-crispy-forms.readthedocs.org/en/latest/install.html#template-packs CRISPY_TEMPLATE_PACK = 'bootstrap3' # STATIC FILE CONFIGURATION # ------------------------------------------------------------------------------ # See: https://docs.djangoproject.com/en/dev/ref/settings/#static-root STATIC_ROOT = str(ROOT_DIR('staticfiles')) # See: https://docs.djangoproject.com/en/dev/ref/settings/#static-url STATIC_URL = '/static/' # See: https://docs.djangoproject.com/en/dev/ref/contrib/staticfiles/#std:setting-STATICFILES_DIRS STATICFILES_DIRS = ( str(APPS_DIR.path('static')), ) # See: https://docs.djangoproject.com/en/dev/ref/contrib/staticfiles/#staticfiles-finders STATICFILES_FINDERS = ( 'django.contrib.staticfiles.finders.FileSystemFinder', 'django.contrib.staticfiles.finders.AppDirectoriesFinder', ) # MEDIA CONFIGURATION # ------------------------------------------------------------------------------ # See: https://docs.djangoproject.com/en/dev/ref/settings/#media-root MEDIA_ROOT = str(APPS_DIR('media')) # See: https://docs.djangoproject.com/en/dev/ref/settings/#media-url MEDIA_URL = '/media/' # URL Configuration # ------------------------------------------------------------------------------ ROOT_URLCONF = 'config.urls' # See: https://docs.djangoproject.com/en/dev/ref/settings/#wsgi-application WSGI_APPLICATION = 'config.wsgi.application' # AUTHENTICATION CONFIGURATION # ------------------------------------------------------------------------------ AUTHENTICATION_BACKENDS = ( 'django.contrib.auth.backends.ModelBackend', 'allauth.account.auth_backends.AuthenticationBackend', ) # Some really nice defaults ACCOUNT_AUTHENTICATION_METHOD = 'username' ACCOUNT_EMAIL_REQUIRED = True ACCOUNT_EMAIL_VERIFICATION = 'mandatory' # Custom user app defaults # Select the correct user model AUTH_USER_MODEL = 'users.User' LOGIN_REDIRECT_URL = 'users:redirect' LOGIN_URL = 'account_login' # SLUGLIFIER AUTOSLUG_SLUGIFY_FUNCTION = 'slugify.slugify' # LOGGING CONFIGURATION # ------------------------------------------------------------------------------ # See: https://docs.djangoproject.com/en/dev/ref/settings/#logging # A sample logging configuration. The only tangible logging # performed by this configuration is to send an email to # the site admins on every HTTP 500 error when DEBUG=False. # See http://docs.djangoproject.com/en/dev/topics/logging for # more details on how to customize your logging configuration. LOGGING = { 'version': 1, 'disable_existing_loggers': False, 'filters': { 'require_debug_false': { '()': 'django.utils.log.RequireDebugFalse' } }, 'formatters': { 'verbose': { 'format': '%(levelname)s %(asctime)s %(module)s ' '%(process)d %(thread)d %(message)s' }, }, 'handlers': { 'mail_admins': { 'level': 'ERROR', 'filters': ['require_debug_false'], 'class': 'django.utils.log.AdminEmailHandler' }, 'console': { 'level': 'DEBUG', 'class': 'logging.StreamHandler', 'formatter': 'verbose', }, }, 'loggers': { 'django.request': { 'handlers': ['mail_admins'], 'level': 'ERROR', 'propagate': True }, 'django.security.DisallowedHost': { 'level': 'ERROR', 'handlers': ['console', 'mail_admins'], 'propagate': True } } } # Location of root django.contrib.admin URL, use {% url 'admin:index' %} ADMIN_URL = r'^admin/' # Your common stuff: Below this line define 3rd party library settings
# -*- coding: utf-8 -*- from __future__ import unicode_literals import itertools import httplib as http import logging import math import os import requests import urllib import waffle from django.apps import apps from django.db.models import Count from flask import request, send_from_directory, Response, stream_with_context from framework import sentry from framework.auth import Auth from framework.auth.decorators import must_be_logged_in from framework.auth.forms import SignInForm, ForgotPasswordForm from framework.exceptions import HTTPError from framework.flask import redirect # VOL-aware redirect from framework.forms import utils as form_utils from framework.routing import proxy_url from framework.auth.core import get_current_user_id, _get_current_user from website import settings from website.institutions.views import serialize_institution from osf.models import BaseFileNode, Guid, Institution, PreprintService, AbstractNode, Node from website.settings import EXTERNAL_EMBER_APPS, PROXY_EMBER_APPS, EXTERNAL_EMBER_SERVER_TIMEOUT, INSTITUTION_DISPLAY_NODE_THRESHOLD, DOMAIN from website.ember_osf_web.decorators import ember_flag_is_active, MockUser from website.ember_osf_web.views import use_ember_app from website.project.model import has_anonymous_link from osf.utils import permissions from api.providers.permissions import GroupHelper logger = logging.getLogger(__name__) preprints_dir = os.path.abspath(os.path.join(os.getcwd(), EXTERNAL_EMBER_APPS['preprints']['path'])) ember_osf_web_dir = os.path.abspath(os.path.join(os.getcwd(), EXTERNAL_EMBER_APPS['ember_osf_web']['path'])) def serialize_contributors_for_summary(node, max_count=3): # # TODO: Use .filter(visible=True) when chaining is fixed in django-include users = [contrib.user for contrib in node.contributor_set.all() if contrib.visible] contributors = [] n_contributors = len(users) others_count = '' for index, user in enumerate(users[:max_count]): if index == max_count - 1 and len(users) > max_count: separator = ' &' others_count = str(n_contributors - 3) elif index == len(users) - 1: separator = '' elif index == len(users) - 2: separator = ' &' else: separator = ',' contributor = user.get_summary(formatter='surname') contributor['user_id'] = user._primary_key contributor['separator'] = separator contributors.append(contributor) return { 'contributors': contributors, 'others_count': others_count, } def serialize_node_summary(node, auth, primary=True, show_path=False): is_registration = node.is_registration summary = { 'id': node._id, 'primary': primary, 'is_registration': node.is_registration, 'is_fork': node.is_fork, 'is_pending_registration': node.is_pending_registration if is_registration else False, 'is_retracted': node.is_retracted if is_registration else False, 'is_pending_retraction': node.is_pending_retraction if is_registration else False, 'embargo_end_date': node.embargo_end_date.strftime('%A, %b. %d, %Y') if is_registration and node.embargo_end_date else False, 'is_pending_embargo': node.is_pending_embargo if is_registration else False, 'is_embargoed': node.is_embargoed if is_registration else False, 'archiving': node.archiving if is_registration else False, } parent_node = node.parent_node user = auth.user if node.can_view(auth): # Re-query node with contributor guids included to prevent N contributor queries node = AbstractNode.objects.filter(pk=node.pk).include('contributor__user__guids').get() contributor_data = serialize_contributors_for_summary(node) summary.update({ 'can_view': True, 'can_edit': node.can_edit(auth), 'primary_id': node._id, 'url': node.url, 'primary': primary, 'api_url': node.api_url, 'title': node.title, 'category': node.category, 'isPreprint': bool(node.preprint_file_id), 'childExists': Node.objects.get_children(node, active=True).exists(), 'is_admin': node.has_permission(user, permissions.ADMIN), 'is_contributor': node.is_contributor(user), 'logged_in': auth.logged_in, 'node_type': node.project_or_component, 'is_fork': node.is_fork, 'is_registration': is_registration, 'anonymous': has_anonymous_link(node, auth), 'registered_date': node.registered_date.strftime('%Y-%m-%d %H:%M UTC') if node.is_registration else None, 'forked_date': node.forked_date.strftime('%Y-%m-%d %H:%M UTC') if node.is_fork else None, 'ua_count': None, 'ua': None, 'non_ua': None, 'is_public': node.is_public, 'parent_title': parent_node.title if parent_node else None, 'parent_is_public': parent_node.is_public if parent_node else False, 'show_path': show_path, 'contributors': contributor_data['contributors'], 'others_count': contributor_data['others_count'], 'description': node.description if len(node.description) <= 150 else node.description[0:150] + '...', }) else: summary['can_view'] = False return summary def index(): try: # Check if we're on an institution landing page #TODO : make this way more robust institution = Institution.objects.get(domains__contains=[request.host.lower()], is_deleted=False) inst_dict = serialize_institution(institution) inst_dict.update({ 'home': False, 'institution': True, 'redirect_url': '{}institutions/{}/'.format(DOMAIN, institution._id), }) return inst_dict except Institution.DoesNotExist: pass return home() @ember_flag_is_active('ember_home_page') def home(): user_id = get_current_user_id() if user_id: # Logged in: return either landing page or user home page all_institutions = ( Institution.objects.filter( is_deleted=False, nodes__is_public=True, nodes__is_deleted=False, nodes__type='osf.node' ) .annotate(Count('nodes')) .filter(nodes__count__gte=INSTITUTION_DISPLAY_NODE_THRESHOLD) .order_by('name').only('_id', 'name', 'logo_name') ) dashboard_institutions = [ {'id': inst._id, 'name': inst.name, 'logo_path': inst.logo_path_rounded_corners} for inst in all_institutions ] return { 'home': True, 'dashboard_institutions': dashboard_institutions, } else: # Logged out: return landing page return { 'home': True, } def find_bookmark_collection(user): Collection = apps.get_model('osf.Collection') return Collection.objects.get(creator=user, deleted__isnull=True, is_bookmark_collection=True) @must_be_logged_in @ember_flag_is_active('ember_dashboard_page') def dashboard(auth): return redirect('/') @ember_flag_is_active('ember_support_page') def support(): return {} @must_be_logged_in @ember_flag_is_active('ember_my_projects_page') def my_projects(auth): user = auth.user bookmark_collection = find_bookmark_collection(user) my_projects_id = bookmark_collection._id return {'addons_enabled': user.get_addon_names(), 'dashboard_id': my_projects_id, } def validate_page_num(page, pages): if page < 0 or (pages and page >= pages): raise HTTPError(http.BAD_REQUEST, data=dict( message_long='Invalid value for "page".' )) def paginate(items, total, page, size): pages = math.ceil(total / float(size)) validate_page_num(page, pages) start = page * size paginated_items = itertools.islice(items, start, start + size) return paginated_items, pages def reproducibility(): return redirect('/ezcuj/wiki') def signin_form(): return form_utils.jsonify(SignInForm()) def forgot_password_form(): return form_utils.jsonify(ForgotPasswordForm(prefix='forgot_password')) # GUID ### def _build_guid_url(base, suffix=None): url = '/'.join([ each.strip('/') for each in [base, suffix] if each ]) if not isinstance(url, unicode): url = url.decode('utf-8') return u'/{0}/'.format(url) def resolve_guid_download(guid, suffix=None, provider=None): return resolve_guid(guid, suffix='download') def resolve_guid(guid, suffix=None): """Load GUID by primary key, look up the corresponding view function in the routing table, and return the return value of the view function without changing the URL. :param str guid: GUID primary key :param str suffix: Remainder of URL after the GUID :return: Return value of proxied view function """ try: # Look up guid_object = Guid.load(guid) except KeyError as e: if e.message == 'osfstorageguidfile': # Used when an old detached OsfStorageGuidFile object is accessed raise HTTPError(http.NOT_FOUND) else: raise e if guid_object: # verify that the object implements a GuidStoredObject-like interface. If a model # was once GuidStoredObject-like but that relationship has changed, it's # possible to have referents that are instances of classes that don't # have a deep_url attribute or otherwise don't behave as # expected. if not hasattr(guid_object.referent, 'deep_url'): sentry.log_message( 'Guid resolved to an object with no deep_url', dict(guid=guid) ) raise HTTPError(http.NOT_FOUND) referent = guid_object.referent if referent is None: logger.error('Referent of GUID {0} not found'.format(guid)) raise HTTPError(http.NOT_FOUND) if not referent.deep_url: raise HTTPError(http.NOT_FOUND) # Handle file `/download` shortcut with supported types. if suffix and suffix.rstrip('/').lower() == 'download': file_referent = None if isinstance(referent, PreprintService) and referent.primary_file: if not referent.is_published: # TODO: Ideally, permissions wouldn't be checked here. # This is necessary to prevent a logical inconsistency with # the routing scheme - if a preprint is not published, only # admins and moderators should be able to know it exists. auth = Auth.from_kwargs(request.args.to_dict(), {}) group_helper = GroupHelper(referent.provider) admin_group = group_helper.get_group('admin') mod_group = group_helper.get_group('moderator') # Check if user isn't a nonetype or that the user has admin/moderator permissions if auth.user is None or not (referent.node.has_permission(auth.user, permissions.ADMIN) or (mod_group.user_set.all() | admin_group.user_set.all()).filter(id=auth.user.id).exists()): raise HTTPError(http.NOT_FOUND) file_referent = referent.primary_file elif isinstance(referent, BaseFileNode) and referent.is_file: file_referent = referent if file_referent: # Extend `request.args` adding `action=download`. request.args = request.args.copy() request.args.update({'action': 'download'}) # Do not include the `download` suffix in the url rebuild. url = _build_guid_url(urllib.unquote(file_referent.deep_url)) return proxy_url(url) # Handle Ember Applications if isinstance(referent, PreprintService): if referent.provider.domain_redirect_enabled: # This route should always be intercepted by nginx for the branded domain, # w/ the exception of `<guid>/download` handled above. return redirect(referent.absolute_url, http.MOVED_PERMANENTLY) if PROXY_EMBER_APPS: resp = requests.get(EXTERNAL_EMBER_APPS['preprints']['server'], stream=True, timeout=EXTERNAL_EMBER_SERVER_TIMEOUT) return Response(stream_with_context(resp.iter_content()), resp.status_code) return send_from_directory(preprints_dir, 'index.html') if isinstance(referent, BaseFileNode) and referent.is_file and referent.node.is_quickfiles: if referent.is_deleted: raise HTTPError(http.GONE) if PROXY_EMBER_APPS: resp = requests.get(EXTERNAL_EMBER_APPS['ember_osf_web']['server'], stream=True, timeout=EXTERNAL_EMBER_SERVER_TIMEOUT) return Response(stream_with_context(resp.iter_content()), resp.status_code) return send_from_directory(ember_osf_web_dir, 'index.html') if isinstance(referent, Node) and not referent.is_registration and suffix: page = suffix.strip('/').split('/')[0] flag_name = 'ember_project_{}_page'.format(page) request.user = _get_current_user() or MockUser() if waffle.flag_is_active(request, flag_name): use_ember_app() url = _build_guid_url(urllib.unquote(referent.deep_url), suffix) return proxy_url(url) # GUID not found; try lower-cased and redirect if exists guid_object_lower = Guid.load(guid.lower()) if guid_object_lower: return redirect( _build_guid_url(guid.lower(), suffix) ) # GUID not found raise HTTPError(http.NOT_FOUND) # Redirects # # redirect osf.io/about/ to OSF wiki page osf.io/4znzp/wiki/home/ def redirect_about(**kwargs): return redirect('https://osf.io/4znzp/wiki/home/') def redirect_help(**kwargs): return redirect('/faq/') def redirect_faq(**kwargs): return redirect('http://help.osf.io/m/faqs/') # redirect osf.io/howosfworks to osf.io/getting-started/ def redirect_howosfworks(**kwargs): return redirect('/getting-started/') # redirect osf.io/getting-started to help.osf.io/ def redirect_getting_started(**kwargs): return redirect('http://help.osf.io/') # Redirect to home page def redirect_to_home(): return redirect('/') def redirect_to_cos_news(**kwargs): # Redirect to COS News page return redirect('https://cos.io/news/') # Return error for legacy SHARE v1 search route def legacy_share_v1_search(**kwargs): return HTTPError( http.BAD_REQUEST, data=dict( message_long='Please use v2 of the SHARE search API available at {}api/v2/share/search/creativeworks/_search.'.format(settings.SHARE_URL) ) )
import sys import json from torch.utils.data import DataLoader from sentence_transformers import SentenceTransformer, LoggingHandler, util, models, evaluation, losses, InputExample import logging from datetime import datetime import gzip import os import tarfile import tqdm from torch.utils.data import Dataset import random from shutil import copyfile import pickle import argparse #### Just some code to print debug information to stdout logging.basicConfig(format='%(asctime)s - %(message)s', datefmt='%Y-%m-%d %H:%M:%S', level=logging.INFO, handlers=[LoggingHandler()]) #### /print debug information to stdout parser = argparse.ArgumentParser() parser.add_argument("--train_batch_size", default=64, type=int) parser.add_argument("--max_seq_length", default=300, type=int) parser.add_argument("--model_name", required=True) parser.add_argument("--max_passages", default=0, type=int) parser.add_argument("--epochs", default=30, type=int) parser.add_argument("--pooling", default="mean") parser.add_argument("--negs_to_use", default=None, help="From which systems should negatives be used? Multiple systems seperated by comma. None = all") parser.add_argument("--warmup_steps", default=1000, type=int) parser.add_argument("--lr", default=2e-5, type=float) parser.add_argument("--num_negs_per_system", default=5, type=int) parser.add_argument("--use_pre_trained_model", default=False, action="store_true") parser.add_argument("--use_all_queries", default=False, action="store_true") args = parser.parse_args() logging.info(str(args)) # The model we want to fine-tune train_batch_size = args.train_batch_size #Increasing the train batch size improves the model performance, but requires more GPU memory model_name = args.model_name max_passages = args.max_passages max_seq_length = args.max_seq_length #Max length for passages. Increasing it, requires more GPU memory num_negs_per_system = args.num_negs_per_system # We used different systems to mine hard negatives. Number of hard negatives to add from each system num_epochs = args.epochs # Number of epochs we want to train # Load our embedding model if args.use_pre_trained_model: logging.info("use pretrained SBERT model") model = SentenceTransformer(model_name) model.max_seq_length = max_seq_length else: logging.info("Create new SBERT model") word_embedding_model = models.Transformer(model_name, max_seq_length=max_seq_length) pooling_model = models.Pooling(word_embedding_model.get_word_embedding_dimension(), args.pooling) model = SentenceTransformer(modules=[word_embedding_model, pooling_model]) model_save_path = f'output/train_bi-encoder-margin_mse-{model_name.replace("/", "-")}-batch_size_{train_batch_size}-{datetime.now().strftime("%Y-%m-%d_%H-%M-%S")}' # Write self to path os.makedirs(model_save_path, exist_ok=True) train_script_path = os.path.join(model_save_path, 'train_script.py') copyfile(__file__, train_script_path) with open(train_script_path, 'a') as fOut: fOut.write("\n\n# Script was called via:\n#python " + " ".join(sys.argv)) ### Now we read the MS Marco dataset data_folder = 'msmarco-data' #### Read the corpus files, that contain all the passages. Store them in the corpus dict corpus = {} #dict in the format: passage_id -> passage. Stores all existent passages collection_filepath = os.path.join(data_folder, 'collection.tsv') if not os.path.exists(collection_filepath): tar_filepath = os.path.join(data_folder, 'collection.tar.gz') if not os.path.exists(tar_filepath): logging.info("Download collection.tar.gz") util.http_get('https://msmarco.blob.core.windows.net/msmarcoranking/collection.tar.gz', tar_filepath) with tarfile.open(tar_filepath, "r:gz") as tar: tar.extractall(path=data_folder) logging.info("Read corpus: collection.tsv") with open(collection_filepath, 'r', encoding='utf8') as fIn: for line in fIn: pid, passage = line.strip().split("\t") pid = int(pid) corpus[pid] = passage ### Read the train queries, store in queries dict queries = {} #dict in the format: query_id -> query. Stores all training queries queries_filepath = os.path.join(data_folder, 'queries.train.tsv') if not os.path.exists(queries_filepath): tar_filepath = os.path.join(data_folder, 'queries.tar.gz') if not os.path.exists(tar_filepath): logging.info("Download queries.tar.gz") util.http_get('https://msmarco.blob.core.windows.net/msmarcoranking/queries.tar.gz', tar_filepath) with tarfile.open(tar_filepath, "r:gz") as tar: tar.extractall(path=data_folder) with open(queries_filepath, 'r', encoding='utf8') as fIn: for line in fIn: qid, query = line.strip().split("\t") qid = int(qid) queries[qid] = query # Load a dict (qid, pid) -> ce_score that maps query-ids (qid) and paragraph-ids (pid) # to the CrossEncoder score computed by the cross-encoder/ms-marco-MiniLM-L-6-v2 model ce_scores_file = os.path.join(data_folder, 'cross-encoder-ms-marco-MiniLM-L-6-v2-scores.pkl.gz') if not os.path.exists(ce_scores_file): logging.info("Download cross-encoder scores file") util.http_get('https://huggingface.co/datasets/sentence-transformers/msmarco-hard-negatives/resolve/main/cross-encoder-ms-marco-MiniLM-L-6-v2-scores.pkl.gz', ce_scores_file) logging.info("Load CrossEncoder scores dict") with gzip.open(ce_scores_file, 'rb') as fIn: ce_scores = pickle.load(fIn) # As training data we use hard-negatives that have been mined using various systems hard_negatives_filepath = os.path.join(data_folder, 'msmarco-hard-negatives.jsonl.gz') if not os.path.exists(hard_negatives_filepath): logging.info("Download cross-encoder scores file") util.http_get('https://huggingface.co/datasets/sentence-transformers/msmarco-hard-negatives/resolve/main/msmarco-hard-negatives.jsonl.gz', hard_negatives_filepath) logging.info("Read hard negatives train file") train_queries = {} negs_to_use = None with gzip.open(hard_negatives_filepath, 'rt') as fIn: for line in tqdm.tqdm(fIn): if max_passages > 0 and len(train_queries) >= max_passages: break data = json.loads(line) #Get the positive passage ids pos_pids = data['pos'] #Get the hard negatives neg_pids = set() if negs_to_use is None: if args.negs_to_use is not None: #Use specific system for negatives negs_to_use = args.negs_to_use.split(",") else: #Use all systems negs_to_use = list(data['neg'].keys()) logging.info("Using negatives from the following systems:", negs_to_use) for system_name in negs_to_use: if system_name not in data['neg']: continue system_negs = data['neg'][system_name] negs_added = 0 for pid in system_negs: if pid not in neg_pids: neg_pids.add(pid) negs_added += 1 if negs_added >= num_negs_per_system: break if args.use_all_queries or (len(pos_pids) > 0 and len(neg_pids) > 0): train_queries[data['qid']] = {'qid': data['qid'], 'query': queries[data['qid']], 'pos': pos_pids, 'neg': neg_pids} logging.info("Train queries: {}".format(len(train_queries))) # We create a custom MSMARCO dataset that returns triplets (query, positive, negative) # on-the-fly based on the information from the mined-hard-negatives jsonl file. class MSMARCODataset(Dataset): def __init__(self, queries, corpus, ce_scores): self.queries = queries self.queries_ids = list(queries.keys()) self.corpus = corpus self.ce_scores = ce_scores for qid in self.queries: self.queries[qid]['pos'] = list(self.queries[qid]['pos']) self.queries[qid]['neg'] = list(self.queries[qid]['neg']) random.shuffle(self.queries[qid]['neg']) def __getitem__(self, item): query = self.queries[self.queries_ids[item]] query_text = query['query'] qid = query['qid'] if len(query['pos']) > 0: pos_id = query['pos'].pop(0) #Pop positive and add at end pos_text = self.corpus[pos_id] query['pos'].append(pos_id) else: #We only have negatives, use two negs pos_id = query['neg'].pop(0) #Pop negative and add at end pos_text = self.corpus[pos_id] query['neg'].append(pos_id) #Get a negative passage neg_id = query['neg'].pop(0) #Pop negative and add at end neg_text = self.corpus[neg_id] query['neg'].append(neg_id) pos_score = self.ce_scores[qid][pos_id] neg_score = self.ce_scores[qid][neg_id] return InputExample(texts=[query_text, pos_text, neg_text], label=pos_score-neg_score) def __len__(self): return len(self.queries) # For training the SentenceTransformer model, we need a dataset, a dataloader, and a loss used for training. train_dataset = MSMARCODataset(queries=train_queries, corpus=corpus, ce_scores=ce_scores) train_dataloader = DataLoader(train_dataset, shuffle=True, batch_size=train_batch_size, drop_last=True) train_loss = losses.MarginMSELoss(model=model) # Train the model model.fit(train_objectives=[(train_dataloader, train_loss)], epochs=num_epochs, warmup_steps=args.warmup_steps, use_amp=True, checkpoint_path=model_save_path, checkpoint_save_steps=10000, optimizer_params = {'lr': args.lr}, ) # Train latest model model.save(model_save_path)
# django-openid-auth - OpenID integration for django.contrib.auth # # Copyright (C) 2007 Simon Willison # Copyright (C) 2008-2010 Canonical Ltd. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions # are met: # # * Redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer. # # * Redistributions in binary form must reproduce the above copyright # notice, this list of conditions and the following disclaimer in the # documentation and/or other materials provided with the distribution. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS # "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT # LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS # FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE # COPYRIGHT OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, # INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, # BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; # LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER # CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT # LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN # ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE # POSSIBILITY OF SUCH DAMAGE. import re import urllib from urlparse import urlsplit from django.conf import settings from django.contrib.auth import ( REDIRECT_FIELD_NAME, authenticate, login as auth_login) from django.contrib.auth.models import Group from django.core.urlresolvers import reverse from django.http import HttpResponse, HttpResponseRedirect from django.shortcuts import render_to_response from django.template import RequestContext from django.template.loader import render_to_string try: from django.views.decorators.csrf import csrf_exempt except ImportError: from django.contrib.csrf.middleware import csrf_exempt from openid.consumer.consumer import ( Consumer, SUCCESS, CANCEL, FAILURE) from openid.consumer.discover import DiscoveryFailure from openid.extensions import sreg, ax, pape from django_openid_auth import teams from django_openid_auth.forms import OpenIDLoginForm from django_openid_auth.models import UserOpenID from django_openid_auth.signals import openid_login_complete from django_openid_auth.store import DjangoOpenIDStore from django_openid_auth.exceptions import ( RequiredAttributeNotReturned, DjangoOpenIDException, ) next_url_re = re.compile('^/[-\w/]+$') def is_valid_next_url(next): # When we allow this: # /openid/?next=/welcome/ # For security reasons we want to restrict the next= bit to being a local # path, not a complete URL. return bool(next_url_re.match(next)) def sanitise_redirect_url(redirect_to): """Sanitise the redirection URL.""" # Light security check -- make sure redirect_to isn't garbage. is_valid = True if not redirect_to or ' ' in redirect_to: is_valid = False elif '//' in redirect_to: # Allow the redirect URL to be external if it's a permitted domain allowed_domains = getattr(settings, "ALLOWED_EXTERNAL_OPENID_REDIRECT_DOMAINS", []) s, netloc, p, q, f = urlsplit(redirect_to) # allow it if netloc is blank or if the domain is allowed if netloc: # a domain was specified. Is it an allowed domain? if netloc.find(":") != -1: netloc, _ = netloc.split(":", 1) if netloc not in allowed_domains: is_valid = False # If the return_to URL is not valid, use the default. if not is_valid: redirect_to = settings.LOGIN_REDIRECT_URL return redirect_to def make_consumer(request): """Create an OpenID Consumer object for the given Django request.""" # Give the OpenID library its own space in the session object. session = request.session.setdefault('OPENID', {}) store = DjangoOpenIDStore() return Consumer(session, store) def render_openid_request(request, openid_request, return_to, trust_root=None): """Render an OpenID authentication request.""" if trust_root is None: trust_root = getattr(settings, 'OPENID_TRUST_ROOT', request.build_absolute_uri('/')) if openid_request.shouldSendRedirect(): redirect_url = openid_request.redirectURL( trust_root, return_to) return HttpResponseRedirect(redirect_url) else: form_html = openid_request.htmlMarkup( trust_root, return_to, form_tag_attrs={'id': 'openid_message'}) return HttpResponse(form_html, content_type='text/html;charset=UTF-8') def default_render_failure(request, message, status=403, template_name='openid/failure.html', exception=None): """Render an error page to the user.""" data = render_to_string( template_name, dict(message=message, exception=exception), context_instance=RequestContext(request)) return HttpResponse(data, status=status) def parse_openid_response(request): """Parse an OpenID response from a Django request.""" # Short cut if there is no request parameters. #if len(request.REQUEST) == 0: # return None current_url = request.build_absolute_uri() consumer = make_consumer(request) return consumer.complete(dict(request.REQUEST.items()), current_url) def login_begin(request, template_name='openid/login.html', login_complete_view='openid-complete', form_class=OpenIDLoginForm, render_failure=default_render_failure, redirect_field_name=REDIRECT_FIELD_NAME): """Begin an OpenID login request, possibly asking for an identity URL.""" redirect_to = request.REQUEST.get(redirect_field_name, '') # Get the OpenID URL to try. First see if we've been configured # to use a fixed server URL. openid_url = getattr(settings, 'OPENID_SSO_SERVER_URL', None) # We may have included a configurable GET parameter to inject into the # OPENID_SSO_SERVER_URL. Inject it if it exists. If the configuration is # there, but the actual parameter is not, proceed as if no # OPENID_SSO_SERVER_URL was specified. if (openid_url and hasattr(settings, 'OPENID_INJECT_GET_PARAM')): param_value = request.GET.get( getattr(settings, 'OPENID_INJECT_GET_PARAM')) if param_value: openid_url = openid_url % param_value else: openid_url = None if openid_url is None: if request.POST: login_form = form_class(data=request.POST) if login_form.is_valid(): openid_url = login_form.cleaned_data['openid_identifier'] else: login_form = form_class() # Invalid or no form data: if openid_url is None: return render_to_response(template_name, { 'form': login_form, redirect_field_name: redirect_to }, context_instance=RequestContext(request)) error = None consumer = make_consumer(request) try: openid_request = consumer.begin(openid_url) except DiscoveryFailure, exc: return render_failure( request, "OpenID discovery error: %s" % (str(exc),), status=500, exception=exc) # Request some user details. If the provider advertises support # for attribute exchange, use that. if openid_request.endpoint.supportsType(ax.AXMessage.ns_uri): fetch_request = ax.FetchRequest() # We mark all the attributes as required, since Google ignores # optional attributes. We request both the full name and # first/last components since some providers offer one but not # the other. for (attr, alias) in [ ('http://axschema.org/contact/email', 'email'), ('http://axschema.org/namePerson', 'fullname'), ('http://axschema.org/namePerson/first', 'firstname'), ('http://axschema.org/namePerson/last', 'lastname'), ('http://axschema.org/namePerson/friendly', 'nickname'), # The myOpenID provider advertises AX support, but uses # attribute names from an obsolete draft of the # specification. We request them for compatibility. ('http://schema.openid.net/contact/email', 'old_email'), ('http://schema.openid.net/namePerson', 'old_fullname'), ('http://schema.openid.net/namePerson/friendly', 'old_nickname')]: fetch_request.add(ax.AttrInfo(attr, alias=alias, required=True)) openid_request.addExtension(fetch_request) else: sreg_required_fields = [] sreg_required_fields.extend( getattr(settings, 'OPENID_SREG_REQUIRED_FIELDS', [])) sreg_optional_fields = ['email', 'fullname', 'nickname'] sreg_optional_fields.extend( getattr(settings, 'OPENID_SREG_EXTRA_FIELDS', [])) sreg_optional_fields = [ field for field in sreg_optional_fields if ( not field in sreg_required_fields)] openid_request.addExtension( sreg.SRegRequest(optional=sreg_optional_fields, required=sreg_required_fields)) if getattr(settings, 'OPENID_PHYSICAL_MULTIFACTOR_REQUIRED', False): preferred_auth = [ pape.AUTH_MULTI_FACTOR_PHYSICAL, ] pape_request = pape.Request(preferred_auth_policies=preferred_auth) openid_request.addExtension(pape_request) # Request team info teams_mapping_auto = getattr(settings, 'OPENID_LAUNCHPAD_TEAMS_MAPPING_AUTO', False) teams_mapping_auto_blacklist = getattr(settings, 'OPENID_LAUNCHPAD_TEAMS_MAPPING_AUTO_BLACKLIST', []) launchpad_teams = getattr(settings, 'OPENID_LAUNCHPAD_TEAMS_MAPPING', {}) if teams_mapping_auto: #ignore launchpad teams. use all django-groups launchpad_teams = dict() all_groups = Group.objects.exclude(name__in=teams_mapping_auto_blacklist) for group in all_groups: launchpad_teams[group.name] = group.name if launchpad_teams: openid_request.addExtension(teams.TeamsRequest(launchpad_teams.keys())) # Construct the request completion URL, including the page we # should redirect to. return_to = request.build_absolute_uri(reverse(login_complete_view)) if redirect_to: if '?' in return_to: return_to += '&' else: return_to += '?' return_to += urllib.urlencode({redirect_field_name: redirect_to}) return render_openid_request(request, openid_request, return_to) @csrf_exempt def login_complete(request, redirect_field_name=REDIRECT_FIELD_NAME, render_failure=None): redirect_to = request.REQUEST.get(redirect_field_name, '') render_failure = render_failure or \ getattr(settings, 'OPENID_RENDER_FAILURE', None) or \ default_render_failure openid_response = parse_openid_response(request) if not openid_response: return render_failure( request, 'This is an OpenID relying party endpoint.') if openid_response.status == SUCCESS: try: user = authenticate(openid_response=openid_response) except DjangoOpenIDException, e: return render_failure(request, e.message, exception=e) if user is not None: if user.is_active: auth_login(request, user) response = HttpResponseRedirect(sanitise_redirect_url(redirect_to)) # Notify any listeners that we successfully logged in. openid_login_complete.send(sender=UserOpenID, request=request, openid_response=openid_response) return response else: return render_failure(request, 'Disabled account') else: return render_failure(request, 'Unknown user') elif openid_response.status == FAILURE: return render_failure( request, 'OpenID authentication failed: %s' % openid_response.message) elif openid_response.status == CANCEL: return render_failure(request, 'Authentication cancelled') else: assert False, ( "Unknown OpenID response type: %r" % openid_response.status) def logo(request): return HttpResponse( OPENID_LOGO_BASE_64.decode('base64'), mimetype='image/gif' ) # Logo from http://openid.net/login-bg.gif # Embedded here for convenience; you should serve this as a static file OPENID_LOGO_BASE_64 = """ R0lGODlhEAAQAMQAAO3t7eHh4srKyvz8/P5pDP9rENLS0v/28P/17tXV1dHEvPDw8M3Nzfn5+d3d 3f5jA97Syvnv6MfLzcfHx/1mCPx4Kc/S1Pf189C+tP+xgv/k1N3OxfHy9NLV1/39/f///yH5BAAA AAAALAAAAAAQABAAAAVq4CeOZGme6KhlSDoexdO6H0IUR+otwUYRkMDCUwIYJhLFTyGZJACAwQcg EAQ4kVuEE2AIGAOPQQAQwXCfS8KQGAwMjIYIUSi03B7iJ+AcnmclHg4TAh0QDzIpCw4WGBUZeikD Fzk0lpcjIQA7 """
try: frozenset except NameError: # Import from the sets module for python 2.3 from sets import Set as set from sets import ImmutableSet as frozenset try: from collections import deque except ImportError: from utils import deque from constants import contentModelFlags, spaceCharacters from constants import entitiesWindows1252, entities from constants import asciiLowercase, asciiLetters, asciiUpper2Lower from constants import digits, hexDigits, EOF from constants import tokenTypes, tagTokenTypes from constants import replacementCharacters from inputstream import HTMLInputStream # Group entities by their first character, for faster lookups entitiesByFirstChar = {} for e in entities: entitiesByFirstChar.setdefault(e[0], []).append(e) class HTMLTokenizer: """ This class takes care of tokenizing HTML. * self.currentToken Holds the token that is currently being processed. * self.state Holds a reference to the method to be invoked... XXX * self.stream Points to HTMLInputStream object. """ # XXX need to fix documentation def __init__(self, stream, encoding=None, parseMeta=True, useChardet=True, lowercaseElementName=True, lowercaseAttrName=True): self.stream = HTMLInputStream(stream, encoding, parseMeta, useChardet) #Perform case conversions? self.lowercaseElementName = lowercaseElementName self.lowercaseAttrName = lowercaseAttrName # Setup the initial tokenizer state self.contentModelFlag = contentModelFlags["PCDATA"] self.escapeFlag = False self.lastFourChars = [] self.state = self.dataState self.escape = False # The current token being created self.currentToken = None def __iter__(self): """ This is where the magic happens. We do our usually processing through the states and when we have a token to return we yield the token which pauses processing until the next token is requested. """ self.tokenQueue = deque([]) # Start processing. When EOF is reached self.state will return False # instead of True and the loop will terminate. while self.state(): while self.stream.errors: yield {"type": tokenTypes["ParseError"], "data": self.stream.errors.pop(0)} while self.tokenQueue: yield self.tokenQueue.popleft() def consumeNumberEntity(self, isHex): """This function returns either U+FFFD or the character based on the decimal or hexadecimal representation. It also discards ";" if present. If not present self.tokenQueue.append({"type": tokenTypes["ParseError"]}) is invoked. """ allowed = digits radix = 10 if isHex: allowed = hexDigits radix = 16 charStack = [] # Consume all the characters that are in range while making sure we # don't hit an EOF. c = self.stream.char() while c in allowed and c is not EOF: charStack.append(c) c = self.stream.char() # Convert the set of characters consumed to an int. charAsInt = int("".join(charStack), radix) # Certain characters get replaced with others if charAsInt in replacementCharacters: char = replacementCharacters[charAsInt] self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "illegal-codepoint-for-numeric-entity", "datavars": {"charAsInt": charAsInt}}) elif ((0xD800 <= charAsInt <= 0xDFFF) or (charAsInt > 0x10FFFF)): char = u"\uFFFD" self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "illegal-codepoint-for-numeric-entity", "datavars": {"charAsInt": charAsInt}}) else: #Should speed up this check somehow (e.g. move the set to a constant) if ((0x0001 <= charAsInt <= 0x0008) or (0x000E <= charAsInt <= 0x001F) or (0x007F <= charAsInt <= 0x009F) or (0xFDD0 <= charAsInt <= 0xFDEF) or charAsInt in frozenset([0x000B, 0xFFFE, 0xFFFF, 0x1FFFE, 0x1FFFF, 0x2FFFE, 0x2FFFF, 0x3FFFE, 0x3FFFF, 0x4FFFE, 0x4FFFF, 0x5FFFE, 0x5FFFF, 0x6FFFE, 0x6FFFF, 0x7FFFE, 0x7FFFF, 0x8FFFE, 0x8FFFF, 0x9FFFE, 0x9FFFF, 0xAFFFE, 0xAFFFF, 0xBFFFE, 0xBFFFF, 0xCFFFE, 0xCFFFF, 0xDFFFE, 0xDFFFF, 0xEFFFE, 0xEFFFF, 0xFFFFE, 0xFFFFF, 0x10FFFE, 0x10FFFF])): self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "illegal-codepoint-for-numeric-entity", "datavars": {"charAsInt": charAsInt}}) try: # XXX We should have a separate function that does "int" to # "unicodestring" conversion since this doesn't always work # according to hsivonen. Also, unichr has a limitation of 65535 char = unichr(charAsInt) except: try: char = eval("u'\\U%08x'" % charAsInt) except: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "cant-convert-numeric-entity", "datavars": {"charAsInt": charAsInt}}) # Discard the ; if present. Otherwise, put it back on the queue and # invoke parseError on parser. if c != u";": self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "numeric-entity-without-semicolon"}) self.stream.unget(c) return char def consumeEntity(self, allowedChar=None, fromAttribute=False): # Initialise to the default output for when no entity is matched output = u"&" charStack = [self.stream.char()] if (charStack[0] in spaceCharacters or charStack[0] in (EOF, u"<", u"&") or (allowedChar is not None and allowedChar == charStack[0])): self.stream.unget(charStack[0]) elif charStack[0] == u"#": # Read the next character to see if it's hex or decimal hex = False charStack.append(self.stream.char()) if charStack[-1] in (u"x", u"X"): hex = True charStack.append(self.stream.char()) # charStack[-1] should be the first digit if (hex and charStack[-1] in hexDigits) \ or (not hex and charStack[-1] in digits): # At least one digit found, so consume the whole number self.stream.unget(charStack[-1]) output = self.consumeNumberEntity(hex) else: # No digits found self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "expected-numeric-entity"}) self.stream.unget(charStack.pop()) output = u"&" + u"".join(charStack) else: # At this point in the process might have named entity. Entities # are stored in the global variable "entities". # # Consume characters and compare to these to a substring of the # entity names in the list until the substring no longer matches. filteredEntityList = entitiesByFirstChar.get(charStack[0], []) def entitiesStartingWith(name): return [e for e in filteredEntityList if e.startswith(name)] while charStack[-1] is not EOF and\ entitiesStartingWith("".join(charStack)): charStack.append(self.stream.char()) # At this point we have a string that starts with some characters # that may match an entity entityName = None # Try to find the longest entity the string will match to take care # of &noti for instance. for entityLength in xrange(len(charStack)-1, 1, -1): possibleEntityName = "".join(charStack[:entityLength]) if possibleEntityName in entities: entityName = possibleEntityName break if entityName is not None: if entityName[-1] != ";": self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "named-entity-without-semicolon"}) if entityName[-1] != ";" and fromAttribute and \ (charStack[entityLength] in asciiLetters or charStack[entityLength] in digits): self.stream.unget(charStack.pop()) output = u"&" + u"".join(charStack) else: output = entities[entityName] self.stream.unget(charStack.pop()) output += u"".join(charStack[entityLength:]) else: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "expected-named-entity"}) self.stream.unget(charStack.pop()) output = u"&" + u"".join(charStack) if fromAttribute: self.currentToken["data"][-1][1] += output else: self.tokenQueue.append({"type": tokenTypes["Characters"], "data": output}) def processEntityInAttribute(self, allowedChar): """This method replaces the need for "entityInAttributeValueState". """ self.consumeEntity(allowedChar=allowedChar, fromAttribute=True) def emitCurrentToken(self): """This method is a generic handler for emitting the tags. It also sets the state to "data" because that's what's needed after a token has been emitted. """ token = self.currentToken # Add token to the queue to be yielded if (token["type"] in tagTokenTypes): if self.lowercaseElementName: token["name"] = token["name"].translate(asciiUpper2Lower) if token["type"] == tokenTypes["EndTag"]: if token["data"]: self.tokenQueue.append({"type":tokenTypes["ParseError"], "data":"attributes-in-end-tag"}) if token["selfClosing"]: self.tokenQueue.append({"type":tokenTypes["ParseError"], "data":"self-closing-flag-on-end-tag"}) self.tokenQueue.append(token) self.state = self.dataState # Below are the various tokenizer states worked out. def dataState(self): #XXX - consider splitting this state based on the content model flag data = self.stream.char() # Keep a charbuffer to handle the escapeFlag if (self.contentModelFlag in (contentModelFlags["CDATA"], contentModelFlags["RCDATA"])): if len(self.lastFourChars) == 4: self.lastFourChars.pop(0) self.lastFourChars.append(data) # The rest of the logic if (data == "&" and self.contentModelFlag in (contentModelFlags["PCDATA"], contentModelFlags["RCDATA"]) and not self.escapeFlag): self.state = self.entityDataState elif (data == "-" and self.contentModelFlag in (contentModelFlags["CDATA"], contentModelFlags["RCDATA"]) and not self.escapeFlag and "".join(self.lastFourChars) == "<!--"): self.escapeFlag = True self.tokenQueue.append({"type": tokenTypes["Characters"], "data":data}) elif (data == "<" and (self.contentModelFlag == contentModelFlags["PCDATA"] or (self.contentModelFlag in (contentModelFlags["CDATA"], contentModelFlags["RCDATA"]) and self.escapeFlag == False))): self.state = self.tagOpenState elif (data == ">" and self.contentModelFlag in (contentModelFlags["CDATA"], contentModelFlags["RCDATA"]) and self.escapeFlag and "".join(self.lastFourChars)[1:] == "-->"): self.escapeFlag = False self.tokenQueue.append({"type": tokenTypes["Characters"], "data":data}) elif data is EOF: # Tokenization ends. return False elif data in spaceCharacters: # Directly after emitting a token you switch back to the "data # state". At that point spaceCharacters are important so they are # emitted separately. self.tokenQueue.append({"type": tokenTypes["SpaceCharacters"], "data": data + self.stream.charsUntil(spaceCharacters, True)}) # No need to update lastFourChars here, since the first space will # have already been appended to lastFourChars and will have broken # any <!-- or --> sequences else: if (self.contentModelFlag in (contentModelFlags["CDATA"], contentModelFlags["RCDATA"])): chars = self.stream.charsUntil((u"&", u"<", u">", u"-")) self.lastFourChars += chars[-4:] self.lastFourChars = self.lastFourChars[-4:] else: chars = self.stream.charsUntil((u"&", u"<")) self.tokenQueue.append({"type": tokenTypes["Characters"], "data": data + chars}) return True def entityDataState(self): self.consumeEntity() self.state = self.dataState return True def tagOpenState(self): data = self.stream.char() if self.contentModelFlag == contentModelFlags["PCDATA"]: if data == u"!": self.state = self.markupDeclarationOpenState elif data == u"/": self.state = self.closeTagOpenState elif data in asciiLetters: self.currentToken = {"type": tokenTypes["StartTag"], "name": data, "data": [], "selfClosing": False, "selfClosingAcknowledged": False} self.state = self.tagNameState elif data == u">": # XXX In theory it could be something besides a tag name. But # do we really care? self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "expected-tag-name-but-got-right-bracket"}) self.tokenQueue.append({"type": tokenTypes["Characters"], "data": u"<>"}) self.state = self.dataState elif data == u"?": # XXX In theory it could be something besides a tag name. But # do we really care? self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "expected-tag-name-but-got-question-mark"}) self.stream.unget(data) self.state = self.bogusCommentState else: # XXX self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "expected-tag-name"}) self.tokenQueue.append({"type": tokenTypes["Characters"], "data": u"<"}) self.stream.unget(data) self.state = self.dataState else: # We know the content model flag is set to either RCDATA or CDATA # now because this state can never be entered with the PLAINTEXT # flag. if data == u"/": self.state = self.closeTagOpenState else: self.tokenQueue.append({"type": tokenTypes["Characters"], "data": u"<"}) self.stream.unget(data) self.state = self.dataState return True def closeTagOpenState(self): if (self.contentModelFlag in (contentModelFlags["RCDATA"], contentModelFlags["CDATA"])): charStack = [] if self.currentToken: # So far we know that "</" has been consumed. We now need to know # whether the next few characters match the name of last emitted # start tag which also happens to be the currentToken. matched = True for expected in self.currentToken["name"].lower(): charStack.append(self.stream.char()) if charStack[-1] not in (expected, expected.upper()): matched = False break # If the tag name prefix matched, we also need to check the # subsequent character if matched: charStack.append(self.stream.char()) if charStack[-1] in (spaceCharacters | frozenset((u">", u"/", EOF))): self.contentModelFlag = contentModelFlags["PCDATA"] # Unget the last character, so it can be re-processed # in the next state self.stream.unget(charStack.pop()) # The remaining characters in charStack are the tag name self.currentToken = {"type": tokenTypes["EndTag"], "name": u"".join(charStack), "data": [], "selfClosing":False} self.state = self.tagNameState return True # Didn't find the end tag. The last character in charStack could be # anything, so it has to be re-processed in the data state self.stream.unget(charStack.pop()) # The remaining characters are a prefix of the tag name, so they're # just letters and digits, so they can be output as character # tokens immediately self.tokenQueue.append({"type": tokenTypes["Characters"], "data": u"</" + u"".join(charStack)}) self.state = self.dataState return True data = self.stream.char() if data in asciiLetters: self.currentToken = {"type": tokenTypes["EndTag"], "name": data, "data": [], "selfClosing":False} self.state = self.tagNameState elif data == u">": self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "expected-closing-tag-but-got-right-bracket"}) self.state = self.dataState elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "expected-closing-tag-but-got-eof"}) self.tokenQueue.append({"type": tokenTypes["Characters"], "data": u"</"}) self.state = self.dataState else: # XXX data can be _'_... self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "expected-closing-tag-but-got-char", "datavars": {"data": data}}) self.stream.unget(data) self.state = self.bogusCommentState return True def tagNameState(self): data = self.stream.char() if data in spaceCharacters: self.state = self.beforeAttributeNameState elif data == u">": self.emitCurrentToken() elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "eof-in-tag-name"}) self.state = self.dataState elif data == u"/": self.state = self.selfClosingStartTagState else: self.currentToken["name"] += data # (Don't use charsUntil here, because tag names are # very short and it's faster to not do anything fancy) return True def beforeAttributeNameState(self): data = self.stream.char() if data in spaceCharacters: self.stream.charsUntil(spaceCharacters, True) elif data in asciiLetters: self.currentToken["data"].append([data, ""]) self.state = self.attributeNameState elif data == u">": self.emitCurrentToken() elif data == u"/": self.state = self.selfClosingStartTagState elif data in (u"'", u'"', u"=", u"<"): self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "invalid-character-in-attribute-name"}) self.currentToken["data"].append([data, ""]) self.state = self.attributeNameState elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "expected-attribute-name-but-got-eof"}) self.state = self.dataState else: self.currentToken["data"].append([data, ""]) self.state = self.attributeNameState return True def attributeNameState(self): data = self.stream.char() leavingThisState = True emitToken = False if data == u"=": self.state = self.beforeAttributeValueState elif data in asciiLetters: self.currentToken["data"][-1][0] += data +\ self.stream.charsUntil(asciiLetters, True) leavingThisState = False elif data == u">": # XXX If we emit here the attributes are converted to a dict # without being checked and when the code below runs we error # because data is a dict not a list emitToken = True elif data in spaceCharacters: self.state = self.afterAttributeNameState elif data == u"/": self.state = self.selfClosingStartTagState elif data in (u"'", u'"', u"<"): self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "invalid-character-in-attribute-name"}) self.currentToken["data"][-1][0] += data leavingThisState = False elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "eof-in-attribute-name"}) self.state = self.dataState emitToken = True else: self.currentToken["data"][-1][0] += data leavingThisState = False if leavingThisState: # Attributes are not dropped at this stage. That happens when the # start tag token is emitted so values can still be safely appended # to attributes, but we do want to report the parse error in time. if self.lowercaseAttrName: self.currentToken["data"][-1][0] = ( self.currentToken["data"][-1][0].translate(asciiUpper2Lower)) for name, value in self.currentToken["data"][:-1]: if self.currentToken["data"][-1][0] == name: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "duplicate-attribute"}) break # XXX Fix for above XXX if emitToken: self.emitCurrentToken() return True def afterAttributeNameState(self): data = self.stream.char() if data in spaceCharacters: self.stream.charsUntil(spaceCharacters, True) elif data == u"=": self.state = self.beforeAttributeValueState elif data == u">": self.emitCurrentToken() elif data in asciiLetters: self.currentToken["data"].append([data, ""]) self.state = self.attributeNameState elif data == u"/": self.state = self.selfClosingStartTagState elif data in (u"'", u'"', u"<"): self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "invalid-character-after-attribute-name"}) self.currentToken["data"].append([data, ""]) self.state = self.attributeNameState elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "expected-end-of-tag-but-got-eof"}) self.emitCurrentToken() else: self.currentToken["data"].append([data, ""]) self.state = self.attributeNameState return True def beforeAttributeValueState(self): data = self.stream.char() if data in spaceCharacters: self.stream.charsUntil(spaceCharacters, True) elif data == u"\"": self.state = self.attributeValueDoubleQuotedState elif data == u"&": self.state = self.attributeValueUnQuotedState self.stream.unget(data); elif data == u"'": self.state = self.attributeValueSingleQuotedState elif data == u">": self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "expected-attribute-value-but-got-right-bracket"}) self.emitCurrentToken() elif data in (u"=", u"<"): self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "equals-in-unquoted-attribute-value"}) self.currentToken["data"][-1][1] += data self.state = self.attributeValueUnQuotedState elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "expected-attribute-value-but-got-eof"}) self.emitCurrentToken() else: self.currentToken["data"][-1][1] += data self.state = self.attributeValueUnQuotedState return True def attributeValueDoubleQuotedState(self): data = self.stream.char() if data == "\"": self.state = self.afterAttributeValueState elif data == u"&": self.processEntityInAttribute(u'"') elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "eof-in-attribute-value-double-quote"}) self.emitCurrentToken() else: self.currentToken["data"][-1][1] += data +\ self.stream.charsUntil(("\"", u"&")) return True def attributeValueSingleQuotedState(self): data = self.stream.char() if data == "'": self.state = self.afterAttributeValueState elif data == u"&": self.processEntityInAttribute(u"'") elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "eof-in-attribute-value-single-quote"}) self.emitCurrentToken() else: self.currentToken["data"][-1][1] += data +\ self.stream.charsUntil(("'", u"&")) return True def attributeValueUnQuotedState(self): data = self.stream.char() if data in spaceCharacters: self.state = self.beforeAttributeNameState elif data == u"&": self.processEntityInAttribute(">") elif data == u">": self.emitCurrentToken() elif data in (u'"', u"'", u"=", u"<"): self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "unexpected-character-in-unquoted-attribute-value"}) self.currentToken["data"][-1][1] += data elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "eof-in-attribute-value-no-quotes"}) self.emitCurrentToken() else: self.currentToken["data"][-1][1] += data + self.stream.charsUntil( \ frozenset(("&", ">", "<", "=", "'", '"')) | spaceCharacters) return True def afterAttributeValueState(self): data = self.stream.char() if data in spaceCharacters: self.state = self.beforeAttributeNameState elif data == u">": self.emitCurrentToken() elif data == u"/": self.state = self.selfClosingStartTagState elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "unexpected-EOF-after-attribute-value"}) self.emitCurrentToken() self.stream.unget(data) self.state = self.dataState else: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "unexpected-character-after-attribute-value"}) self.stream.unget(data) self.state = self.beforeAttributeNameState return True def selfClosingStartTagState(self): data = self.stream.char() if data == ">": self.currentToken["selfClosing"] = True self.emitCurrentToken() elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "unexpected-EOF-after-solidus-in-tag"}) self.stream.unget(data) self.state = self.dataState else: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "unexpected-character-after-soldius-in-tag"}) self.stream.unget(data) self.state = self.beforeAttributeNameState return True def bogusCommentState(self): # Make a new comment token and give it as value all the characters # until the first > or EOF (charsUntil checks for EOF automatically) # and emit it. self.tokenQueue.append( {"type": tokenTypes["Comment"], "data": self.stream.charsUntil(u">")}) # Eat the character directly after the bogus comment which is either a # ">" or an EOF. self.stream.char() self.state = self.dataState return True def bogusCommentContinuationState(self): # Like bogusCommentState, but the caller must create the comment token # and this state just adds more characters to it self.currentToken["data"] += self.stream.charsUntil(u">") self.tokenQueue.append(self.currentToken) # Eat the character directly after the bogus comment which is either a # ">" or an EOF. self.stream.char() self.state = self.dataState return True def markupDeclarationOpenState(self): charStack = [self.stream.char()] if charStack[-1] == u"-": charStack.append(self.stream.char()) if charStack[-1] == u"-": self.currentToken = {"type": tokenTypes["Comment"], "data": u""} self.state = self.commentStartState return True elif charStack[-1] in (u'd', u'D'): matched = True for expected in ((u'o', u'O'), (u'c', u'C'), (u't', u'T'), (u'y', u'Y'), (u'p', u'P'), (u'e', u'E')): charStack.append(self.stream.char()) if charStack[-1] not in expected: matched = False break if matched: self.currentToken = {"type": tokenTypes["Doctype"], "name": u"", "publicId": None, "systemId": None, "correct": True} self.state = self.doctypeState return True self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "expected-dashes-or-doctype"}) # charStack[:-2] consists of 'safe' characters ('-', 'd', 'o', etc) # so they can be copied directly into the bogus comment data, and only # the last character might be '>' or EOF and needs to be ungetted self.stream.unget(charStack.pop()) self.currentToken = {"type": tokenTypes["Comment"], "data": u"".join(charStack)} self.state = self.bogusCommentContinuationState return True def commentStartState(self): data = self.stream.char() if data == "-": self.state = self.commentStartDashState elif data == ">": self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "incorrect-comment"}) self.tokenQueue.append(self.currentToken) self.state = self.dataState elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "eof-in-comment"}) self.tokenQueue.append(self.currentToken) self.state = self.dataState else: self.currentToken["data"] += data + self.stream.charsUntil(u"-") self.state = self.commentState return True def commentStartDashState(self): data = self.stream.char() if data == "-": self.state = self.commentEndState elif data == ">": self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "incorrect-comment"}) self.tokenQueue.append(self.currentToken) self.state = self.dataState elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "eof-in-comment"}) self.tokenQueue.append(self.currentToken) self.state = self.dataState else: self.currentToken["data"] += "-" + data + self.stream.charsUntil(u"-") self.state = self.commentState return True def commentState(self): data = self.stream.char() if data == u"-": self.state = self.commentEndDashState elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "eof-in-comment"}) self.tokenQueue.append(self.currentToken) self.state = self.dataState else: self.currentToken["data"] += data + self.stream.charsUntil(u"-") return True def commentEndDashState(self): data = self.stream.char() if data == u"-": self.state = self.commentEndState elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "eof-in-comment-end-dash"}) self.tokenQueue.append(self.currentToken) self.state = self.dataState else: self.currentToken["data"] += u"-" + data +\ self.stream.charsUntil(u"-") # Consume the next character which is either a "-" or an EOF as # well so if there's a "-" directly after the "-" we go nicely to # the "comment end state" without emitting a ParseError() there. self.stream.char() return True def commentEndState(self): data = self.stream.char() if data == u">": self.tokenQueue.append(self.currentToken) self.state = self.dataState elif data == u"-": self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "unexpected-dash-after-double-dash-in-comment"}) self.currentToken["data"] += data elif data in spaceCharacters: self.currentToken["data"] += "--" + data self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "unexpected-space-after-double-dash-in-comment"}) self.state = self.commentEndSpaceState elif data == "!": self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "unexpected-bang-after-double-dash-in-comment"}) self.state = self.commentEndBangState elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "eof-in-comment-double-dash"}) self.tokenQueue.append(self.currentToken) self.state = self.dataState else: # XXX self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "unexpected-char-in-comment"}) self.currentToken["data"] += u"--" + data self.state = self.commentState return True def commentEndBangState(self): data = self.stream.char() if data == u">": self.tokenQueue.append(self.currentToken) self.state = self.dataState elif data == u"-": self.currentToken["data"] += "--!" self.state = self.commentEndDashState elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "eof-in-comment-end-bang-state"}) self.tokenQueue.append(self.currentToken) self.state = self.dataState else: self.currentToken["data"] += u"--!" + data self.state = self.commentState return True def commentEndSpaceState(self): data = self.stream.char() if data == u">": self.tokenQueue.append(self.currentToken) self.state = self.dataState elif data == u"-": self.state = self.commentEndDashState elif data in spaceCharacters: self.currentToken["data"] += data elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "eof-in-comment-end-space-state"}) self.tokenQueue.append(self.currentToken) self.state = self.dataState else: self.currentToken["data"] += data self.state = self.commentState return True def doctypeState(self): data = self.stream.char() if data in spaceCharacters: self.state = self.beforeDoctypeNameState elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "expected-doctype-name-but-got-eof"}) self.currentToken["correct"] = False self.tokenQueue.append(self.currentToken) self.state = self.dataState else: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "need-space-after-doctype"}) self.stream.unget(data) self.state = self.beforeDoctypeNameState return True def beforeDoctypeNameState(self): data = self.stream.char() if data in spaceCharacters: pass elif data == u">": self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "expected-doctype-name-but-got-right-bracket"}) self.currentToken["correct"] = False self.tokenQueue.append(self.currentToken) self.state = self.dataState elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "expected-doctype-name-but-got-eof"}) self.currentToken["correct"] = False self.tokenQueue.append(self.currentToken) self.state = self.dataState else: self.currentToken["name"] = data self.state = self.doctypeNameState return True def doctypeNameState(self): data = self.stream.char() if data in spaceCharacters: self.currentToken["name"] = self.currentToken["name"].translate(asciiUpper2Lower) self.state = self.afterDoctypeNameState elif data == u">": self.currentToken["name"] = self.currentToken["name"].translate(asciiUpper2Lower) self.tokenQueue.append(self.currentToken) self.state = self.dataState elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "eof-in-doctype-name"}) self.currentToken["correct"] = False self.currentToken["name"] = self.currentToken["name"].translate(asciiUpper2Lower) self.tokenQueue.append(self.currentToken) self.state = self.dataState else: self.currentToken["name"] += data return True def afterDoctypeNameState(self): data = self.stream.char() if data in spaceCharacters: pass elif data == u">": self.tokenQueue.append(self.currentToken) self.state = self.dataState elif data is EOF: self.currentToken["correct"] = False self.stream.unget(data) self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "eof-in-doctype"}) self.tokenQueue.append(self.currentToken) self.state = self.dataState else: if data in (u"p", u"P"): matched = True for expected in ((u"u", u"U"), (u"b", u"B"), (u"l", u"L"), (u"i", u"I"), (u"c", u"C")): data = self.stream.char() if data not in expected: matched = False break if matched: self.state = self.beforeDoctypePublicIdentifierState return True elif data in (u"s", u"S"): matched = True for expected in ((u"y", u"Y"), (u"s", u"S"), (u"t", u"T"), (u"e", u"E"), (u"m", u"M")): data = self.stream.char() if data not in expected: matched = False break if matched: self.state = self.beforeDoctypeSystemIdentifierState return True # All the characters read before the current 'data' will be # [a-zA-Z], so they're garbage in the bogus doctype and can be # discarded; only the latest character might be '>' or EOF # and needs to be ungetted self.stream.unget(data) self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "expected-space-or-right-bracket-in-doctype", "datavars": {"data": data}}) self.currentToken["correct"] = False self.state = self.bogusDoctypeState return True def beforeDoctypePublicIdentifierState(self): data = self.stream.char() if data in spaceCharacters: pass elif data == "\"": self.currentToken["publicId"] = u"" self.state = self.doctypePublicIdentifierDoubleQuotedState elif data == "'": self.currentToken["publicId"] = u"" self.state = self.doctypePublicIdentifierSingleQuotedState elif data == ">": self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "unexpected-end-of-doctype"}) self.currentToken["correct"] = False self.tokenQueue.append(self.currentToken) self.state = self.dataState elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "eof-in-doctype"}) self.currentToken["correct"] = False self.tokenQueue.append(self.currentToken) self.state = self.dataState else: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "unexpected-char-in-doctype"}) self.currentToken["correct"] = False self.state = self.bogusDoctypeState return True def doctypePublicIdentifierDoubleQuotedState(self): data = self.stream.char() if data == "\"": self.state = self.afterDoctypePublicIdentifierState elif data == ">": self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "unexpected-end-of-doctype"}) self.currentToken["correct"] = False self.tokenQueue.append(self.currentToken) self.state = self.dataState elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "eof-in-doctype"}) self.currentToken["correct"] = False self.tokenQueue.append(self.currentToken) self.state = self.dataState else: self.currentToken["publicId"] += data return True def doctypePublicIdentifierSingleQuotedState(self): data = self.stream.char() if data == "'": self.state = self.afterDoctypePublicIdentifierState elif data == ">": self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "unexpected-end-of-doctype"}) self.currentToken["correct"] = False self.tokenQueue.append(self.currentToken) self.state = self.dataState elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "eof-in-doctype"}) self.currentToken["correct"] = False self.tokenQueue.append(self.currentToken) self.state = self.dataState else: self.currentToken["publicId"] += data return True def afterDoctypePublicIdentifierState(self): data = self.stream.char() if data in spaceCharacters: pass elif data == "\"": self.currentToken["systemId"] = u"" self.state = self.doctypeSystemIdentifierDoubleQuotedState elif data == "'": self.currentToken["systemId"] = u"" self.state = self.doctypeSystemIdentifierSingleQuotedState elif data == ">": self.tokenQueue.append(self.currentToken) self.state = self.dataState elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "eof-in-doctype"}) self.currentToken["correct"] = False self.tokenQueue.append(self.currentToken) self.state = self.dataState else: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "unexpected-char-in-doctype"}) self.currentToken["correct"] = False self.state = self.bogusDoctypeState return True def beforeDoctypeSystemIdentifierState(self): data = self.stream.char() if data in spaceCharacters: pass elif data == "\"": self.currentToken["systemId"] = u"" self.state = self.doctypeSystemIdentifierDoubleQuotedState elif data == "'": self.currentToken["systemId"] = u"" self.state = self.doctypeSystemIdentifierSingleQuotedState elif data == ">": self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "unexpected-char-in-doctype"}) self.currentToken["correct"] = False self.tokenQueue.append(self.currentToken) self.state = self.dataState elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "eof-in-doctype"}) self.currentToken["correct"] = False self.tokenQueue.append(self.currentToken) self.state = self.dataState else: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "unexpected-char-in-doctype"}) self.currentToken["correct"] = False self.state = self.bogusDoctypeState return True def doctypeSystemIdentifierDoubleQuotedState(self): data = self.stream.char() if data == "\"": self.state = self.afterDoctypeSystemIdentifierState elif data == ">": self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "unexpected-end-of-doctype"}) self.currentToken["correct"] = False self.tokenQueue.append(self.currentToken) self.state = self.dataState elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "eof-in-doctype"}) self.currentToken["correct"] = False self.tokenQueue.append(self.currentToken) self.state = self.dataState else: self.currentToken["systemId"] += data return True def doctypeSystemIdentifierSingleQuotedState(self): data = self.stream.char() if data == "'": self.state = self.afterDoctypeSystemIdentifierState elif data == ">": self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "unexpected-end-of-doctype"}) self.currentToken["correct"] = False self.tokenQueue.append(self.currentToken) self.state = self.dataState elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "eof-in-doctype"}) self.currentToken["correct"] = False self.tokenQueue.append(self.currentToken) self.state = self.dataState else: self.currentToken["systemId"] += data return True def afterDoctypeSystemIdentifierState(self): data = self.stream.char() if data in spaceCharacters: pass elif data == ">": self.tokenQueue.append(self.currentToken) self.state = self.dataState elif data is EOF: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "eof-in-doctype"}) self.currentToken["correct"] = False self.tokenQueue.append(self.currentToken) self.state = self.dataState else: self.tokenQueue.append({"type": tokenTypes["ParseError"], "data": "unexpected-char-in-doctype"}) self.state = self.bogusDoctypeState return True def bogusDoctypeState(self): data = self.stream.char() if data == u">": self.tokenQueue.append(self.currentToken) self.state = self.dataState elif data is EOF: # XXX EMIT self.stream.unget(data) self.tokenQueue.append(self.currentToken) self.state = self.dataState else: pass return True
# encoding: utf-8 import datetime from south.db import db from south.v2 import SchemaMigration from django.db import models class Migration(SchemaMigration): def forwards(self, orm): # Removing unique constraint on 'PendingProjectMember', fields ['project', 'email'] db.delete_unique('sentry_pendingprojectmember', ['project_id', 'email']) # Deleting model 'PendingProjectMember' db.delete_table('sentry_pendingprojectmember') # Adding model 'PendingTeamMember' db.create_table('sentry_pendingteammember', ( ('id', self.gf('django.db.models.fields.AutoField')(primary_key=True)), ('team', self.gf('django.db.models.fields.related.ForeignKey')(related_name='pending_member_set', to=orm['sentry.Team'])), ('email', self.gf('django.db.models.fields.EmailField')(max_length=75)), ('type', self.gf('django.db.models.fields.IntegerField')(default=0)), ('date_added', self.gf('django.db.models.fields.DateTimeField')(default=datetime.datetime.now)), )) db.send_create_signal('sentry', ['PendingTeamMember']) # Adding unique constraint on 'PendingTeamMember', fields ['team', 'email'] db.create_unique('sentry_pendingteammember', ['team_id', 'email']) def backwards(self, orm): # Removing unique constraint on 'PendingTeamMember', fields ['team', 'email'] db.delete_unique('sentry_pendingteammember', ['team_id', 'email']) # Adding model 'PendingProjectMember' db.create_table('sentry_pendingprojectmember', ( ('id', self.gf('django.db.models.fields.AutoField')(primary_key=True)), ('project', self.gf('django.db.models.fields.related.ForeignKey')(related_name='pending_member_set', to=orm['sentry.Project'])), ('date_added', self.gf('django.db.models.fields.DateTimeField')(default=datetime.datetime.now)), ('type', self.gf('django.db.models.fields.IntegerField')(default=0)), ('email', self.gf('django.db.models.fields.EmailField')(max_length=75)), )) db.send_create_signal('sentry', ['PendingProjectMember']) # Adding unique constraint on 'PendingProjectMember', fields ['project', 'email'] db.create_unique('sentry_pendingprojectmember', ['project_id', 'email']) # Deleting model 'PendingTeamMember' db.delete_table('sentry_pendingteammember') models = { 'auth.group': { 'Meta': {'object_name': 'Group'}, 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '80'}), 'permissions': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['auth.Permission']", 'symmetrical': 'False', 'blank': 'True'}) }, 'auth.permission': { 'Meta': {'ordering': "('content_type__app_label', 'content_type__model', 'codename')", 'unique_together': "(('content_type', 'codename'),)", 'object_name': 'Permission'}, 'codename': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'content_type': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['contenttypes.ContentType']"}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '50'}) }, 'sentry.user': { 'Meta': {'object_name': 'User', 'db_table': "'auth_user'"}, 'date_joined': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime(2012, 4, 5, 3, 29, 45, 137609)'}), 'email': ('django.db.models.fields.EmailField', [], {'max_length': '75', 'blank': 'True'}), 'first_name': ('django.db.models.fields.CharField', [], {'max_length': '30', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'is_active': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'is_staff': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'is_superuser': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'last_login': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime(2012, 4, 5, 3, 29, 45, 137481)'}), 'last_name': ('django.db.models.fields.CharField', [], {'max_length': '30', 'blank': 'True'}), 'password': ('django.db.models.fields.CharField', [], {'max_length': '128'}), 'username': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '30'}) }, 'contenttypes.contenttype': { 'Meta': {'ordering': "('name',)", 'unique_together': "(('app_label', 'model'),)", 'object_name': 'ContentType', 'db_table': "'django_content_type'"}, 'app_label': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'model': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '100'}) }, 'sentry.event': { 'Meta': {'unique_together': "(('project', 'event_id'),)", 'object_name': 'Event', 'db_table': "'sentry_message'"}, 'checksum': ('django.db.models.fields.CharField', [], {'max_length': '32', 'db_index': 'True'}), 'culprit': ('django.db.models.fields.CharField', [], {'max_length': '200', 'null': 'True', 'db_column': "'view'", 'blank': 'True'}), 'data': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'datetime': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'db_index': 'True'}), 'event_id': ('django.db.models.fields.CharField', [], {'max_length': '32', 'null': 'True', 'db_column': "'message_id'"}), 'group': ('django.db.models.fields.related.ForeignKey', [], {'blank': 'True', 'related_name': "'event_set'", 'null': 'True', 'to': "orm['sentry.Group']"}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'level': ('django.db.models.fields.PositiveIntegerField', [], {'default': '40', 'db_index': 'True', 'blank': 'True'}), 'logger': ('django.db.models.fields.CharField', [], {'default': "'root'", 'max_length': '64', 'db_index': 'True', 'blank': 'True'}), 'message': ('django.db.models.fields.TextField', [], {}), 'project': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['sentry.Project']", 'null': 'True'}), 'server_name': ('django.db.models.fields.CharField', [], {'max_length': '128', 'null': 'True', 'db_index': 'True'}), 'site': ('django.db.models.fields.CharField', [], {'max_length': '128', 'null': 'True', 'db_index': 'True'}), 'time_spent': ('django.db.models.fields.FloatField', [], {'null': 'True'}) }, 'sentry.filtervalue': { 'Meta': {'unique_together': "(('project', 'key', 'value'),)", 'object_name': 'FilterValue'}, 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'key': ('django.db.models.fields.CharField', [], {'max_length': '32'}), 'project': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['sentry.Project']", 'null': 'True'}), 'value': ('django.db.models.fields.CharField', [], {'max_length': '200'}) }, 'sentry.group': { 'Meta': {'unique_together': "(('project', 'logger', 'culprit', 'checksum'),)", 'object_name': 'Group', 'db_table': "'sentry_groupedmessage'"}, 'checksum': ('django.db.models.fields.CharField', [], {'max_length': '32', 'db_index': 'True'}), 'culprit': ('django.db.models.fields.CharField', [], {'max_length': '200', 'null': 'True', 'db_column': "'view'", 'blank': 'True'}), 'data': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'first_seen': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'db_index': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'last_seen': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'db_index': 'True'}), 'level': ('django.db.models.fields.PositiveIntegerField', [], {'default': '40', 'db_index': 'True', 'blank': 'True'}), 'logger': ('django.db.models.fields.CharField', [], {'default': "'root'", 'max_length': '64', 'db_index': 'True', 'blank': 'True'}), 'message': ('django.db.models.fields.TextField', [], {}), 'project': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['sentry.Project']", 'null': 'True'}), 'score': ('django.db.models.fields.IntegerField', [], {'default': '0'}), 'status': ('django.db.models.fields.PositiveIntegerField', [], {'default': '0', 'db_index': 'True'}), 'time_spent_count': ('django.db.models.fields.IntegerField', [], {'default': '0'}), 'time_spent_total': ('django.db.models.fields.FloatField', [], {'default': '0'}), 'times_seen': ('django.db.models.fields.PositiveIntegerField', [], {'default': '1', 'db_index': 'True'}), 'views': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['sentry.View']", 'symmetrical': 'False', 'blank': 'True'}) }, 'sentry.groupbookmark': { 'Meta': {'unique_together': "(('project', 'user', 'group'),)", 'object_name': 'GroupBookmark'}, 'group': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "'bookmark_set'", 'to': "orm['sentry.Group']"}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'project': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "'bookmark_set'", 'to': "orm['sentry.Project']"}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "'sentry_bookmark_set'", 'to': "orm['sentry.User']"}) }, 'sentry.groupmeta': { 'Meta': {'unique_together': "(('group', 'key'),)", 'object_name': 'GroupMeta'}, 'group': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['sentry.Group']"}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'key': ('django.db.models.fields.CharField', [], {'max_length': '64'}), 'value': ('django.db.models.fields.TextField', [], {}) }, 'sentry.messagecountbyminute': { 'Meta': {'unique_together': "(('project', 'group', 'date'),)", 'object_name': 'MessageCountByMinute'}, 'date': ('django.db.models.fields.DateTimeField', [], {}), 'group': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['sentry.Group']"}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'project': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['sentry.Project']", 'null': 'True'}), 'time_spent_count': ('django.db.models.fields.IntegerField', [], {'default': '0'}), 'time_spent_total': ('django.db.models.fields.FloatField', [], {'default': '0'}), 'times_seen': ('django.db.models.fields.PositiveIntegerField', [], {'default': '0'}) }, 'sentry.messagefiltervalue': { 'Meta': {'unique_together': "(('project', 'key', 'value', 'group'),)", 'object_name': 'MessageFilterValue'}, 'first_seen': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'null': 'True', 'db_index': 'True'}), 'group': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['sentry.Group']"}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'key': ('django.db.models.fields.CharField', [], {'max_length': '32'}), 'last_seen': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'null': 'True', 'db_index': 'True'}), 'project': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['sentry.Project']", 'null': 'True'}), 'times_seen': ('django.db.models.fields.PositiveIntegerField', [], {'default': '0'}), 'value': ('django.db.models.fields.CharField', [], {'max_length': '200'}) }, 'sentry.messageindex': { 'Meta': {'unique_together': "(('column', 'value', 'object_id'),)", 'object_name': 'MessageIndex'}, 'column': ('django.db.models.fields.CharField', [], {'max_length': '32'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'object_id': ('django.db.models.fields.PositiveIntegerField', [], {}), 'value': ('django.db.models.fields.CharField', [], {'max_length': '128'}) }, 'sentry.option': { 'Meta': {'object_name': 'Option'}, 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'key': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '64'}), 'value': ('picklefield.fields.PickledObjectField', [], {}) }, 'sentry.pendingteammember': { 'Meta': {'unique_together': "(('team', 'email'),)", 'object_name': 'PendingTeamMember'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'email': ('django.db.models.fields.EmailField', [], {'max_length': '75'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'team': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "'pending_member_set'", 'to': "orm['sentry.Team']"}), 'type': ('django.db.models.fields.IntegerField', [], {'default': '0'}) }, 'sentry.project': { 'Meta': {'object_name': 'Project'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'owner': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "'sentry_owned_project_set'", 'null': 'True', 'to': "orm['sentry.User']"}), 'public': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'slug': ('django.db.models.fields.SlugField', [], {'max_length': '50', 'unique': 'True', 'null': 'True', 'db_index': 'True'}), 'status': ('django.db.models.fields.PositiveIntegerField', [], {'default': '0', 'db_index': 'True'}), 'team': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['sentry.Team']", 'null': 'True'}) }, 'sentry.projectcountbyminute': { 'Meta': {'unique_together': "(('project', 'date'),)", 'object_name': 'ProjectCountByMinute'}, 'date': ('django.db.models.fields.DateTimeField', [], {}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'project': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['sentry.Project']", 'null': 'True'}), 'time_spent_count': ('django.db.models.fields.IntegerField', [], {'default': '0'}), 'time_spent_total': ('django.db.models.fields.FloatField', [], {'default': '0'}), 'times_seen': ('django.db.models.fields.PositiveIntegerField', [], {'default': '0'}) }, 'sentry.projectdomain': { 'Meta': {'unique_together': "(('project', 'domain'),)", 'object_name': 'ProjectDomain'}, 'domain': ('django.db.models.fields.CharField', [], {'max_length': '128'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'project': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "'domain_set'", 'to': "orm['sentry.Project']"}) }, 'sentry.projectkey': { 'Meta': {'object_name': 'ProjectKey'}, 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'project': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "'key_set'", 'to': "orm['sentry.Project']"}), 'public_key': ('django.db.models.fields.CharField', [], {'max_length': '32', 'unique': 'True', 'null': 'True'}), 'secret_key': ('django.db.models.fields.CharField', [], {'max_length': '32', 'unique': 'True', 'null': 'True'}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['sentry.User']", 'null': 'True'}) }, 'sentry.projectmember': { 'Meta': {'unique_together': "(('project', 'user'),)", 'object_name': 'ProjectMember'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'is_active': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'project': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "'member_set'", 'to': "orm['sentry.Project']"}), 'type': ('django.db.models.fields.IntegerField', [], {'default': '0'}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "'sentry_project_set'", 'to': "orm['sentry.User']"}) }, 'sentry.projectoption': { 'Meta': {'unique_together': "(('project', 'key'),)", 'object_name': 'ProjectOption', 'db_table': "'sentry_projectoptions'"}, 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'key': ('django.db.models.fields.CharField', [], {'max_length': '64'}), 'project': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['sentry.Project']"}), 'value': ('picklefield.fields.PickledObjectField', [], {}) }, 'sentry.searchdocument': { 'Meta': {'unique_together': "(('project', 'group'),)", 'object_name': 'SearchDocument'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'date_changed': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'group': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['sentry.Group']"}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'project': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['sentry.Project']"}), 'status': ('django.db.models.fields.PositiveIntegerField', [], {'default': '0'}), 'total_events': ('django.db.models.fields.PositiveIntegerField', [], {'default': '1'}) }, 'sentry.searchtoken': { 'Meta': {'unique_together': "(('document', 'field', 'token'),)", 'object_name': 'SearchToken'}, 'document': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "'token_set'", 'to': "orm['sentry.SearchDocument']"}), 'field': ('django.db.models.fields.CharField', [], {'default': "'text'", 'max_length': '64'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'times_seen': ('django.db.models.fields.PositiveIntegerField', [], {'default': '1'}), 'token': ('django.db.models.fields.CharField', [], {'max_length': '128'}) }, 'sentry.team': { 'Meta': {'object_name': 'Team'}, 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '64'}), 'owner': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['sentry.User']"}), 'slug': ('django.db.models.fields.SlugField', [], {'unique': 'True', 'max_length': '50', 'db_index': 'True'}) }, 'sentry.teammember': { 'Meta': {'unique_together': "(('team', 'user'),)", 'object_name': 'TeamMember'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'is_active': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'team': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "'member_set'", 'to': "orm['sentry.Team']"}), 'type': ('django.db.models.fields.IntegerField', [], {'default': '0'}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "'sentry_teammember_set'", 'to': "orm['sentry.User']"}) }, 'sentry.view': { 'Meta': {'object_name': 'View'}, 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'path': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '100'}), 'verbose_name': ('django.db.models.fields.CharField', [], {'max_length': '200', 'null': 'True'}), 'verbose_name_plural': ('django.db.models.fields.CharField', [], {'max_length': '200', 'null': 'True'}) } } complete_apps = ['sentry']
""" Tests for youtube api """ import random import string import pytest from googleapiclient.errors import HttpError from cloudsync.conftest import MockHttpErrorResponse from cloudsync.youtube import YouTubeApi, YouTubeUploadException, strip_bad_chars from ui.constants import VideoStatus from ui.factories import VideoFileFactory, VideoSubtitleFactory, VideoFactory pytestmark = pytest.mark.django_db # pylint: disable=redefined-outer-name,unused-argument,no-value-for-parameter,unused-variable def test_youtube_settings(mocker, settings): """ Test that Youtube object creation uses YT_* settings for credentials """ settings.YT_ACCESS_TOKEN = "yt_access_token" settings.YT_CLIENT_ID = "yt_client_id" settings.YT_CLIENT_SECRET = "yt_secret" settings.YT_REFRESH_TOKEN = "yt_refresh" mock_oauth = mocker.patch("cloudsync.youtube.oauth2client.client.GoogleCredentials") YouTubeApi() mock_oauth.assert_called_with( settings.YT_ACCESS_TOKEN, settings.YT_CLIENT_ID, settings.YT_CLIENT_SECRET, settings.YT_REFRESH_TOKEN, None, "https://accounts.google.com/o/oauth2/token", None, ) def test_upload_video(mocker): """ Test that the upload_video task calls the YouTube API execute method """ videofile = VideoFileFactory() youtube_id = "M6LymW_8qVk" video_upload_response = { "id": youtube_id, "kind": "youtube#video", "snippet": {"description": "Testing description", "title": "Testing123"}, "status": {"uploadStatus": "uploaded"}, } youtube_mocker = mocker.patch("cloudsync.youtube.build") youtube_mocker().videos.return_value.insert.return_value.next_chunk.side_effect = [ (None, None), (None, video_upload_response), ] response = YouTubeApi().upload_video(videofile.video) assert response == video_upload_response def test_upload_video_no_id(mocker): """ Test that the upload_video task fails if the response contains no id """ videofile = VideoFileFactory() youtube_mocker = mocker.patch("cloudsync.youtube.build") youtube_mocker().videos.return_value.insert.return_value.next_chunk.return_value = ( None, {}, ) with pytest.raises(YouTubeUploadException): YouTubeApi().upload_video(videofile.video) @pytest.mark.parametrize( ["error", "retryable"], [ [HttpError(MockHttpErrorResponse(500), b""), True], [HttpError(MockHttpErrorResponse(403), b""), False], [OSError, True], [IndexError, False], ], ) def test_upload_errors_retryable(mocker, error, retryable): """ Test that uploads are retried 10x for retryable exceptions """ youtube_mocker = mocker.patch("cloudsync.youtube.build") mocker.patch("cloudsync.youtube.time") videofile = VideoFileFactory() youtube_mocker().videos.return_value.insert.return_value.next_chunk.side_effect = ( error ) with pytest.raises(Exception) as exc: YouTubeApi().upload_video(videofile.video) assert str(exc.value).startswith("Retried YouTube upload 10x") == retryable def test_upload_video_long_fields(mocker): """ Test that the upload_youtube_video task truncates title and description if too long """ title = "".join(random.choice(string.ascii_lowercase) for c in range(105)) desc = "".join(random.choice(string.ascii_lowercase) for c in range(5005)) video = VideoFactory.create( title=title, description=desc, is_public=True, status=VideoStatus.COMPLETE ) VideoFileFactory(video=video) mocker.patch("cloudsync.youtube.resumable_upload") youtube_mocker = mocker.patch("cloudsync.youtube.build") mock_upload = youtube_mocker().videos.return_value.insert YouTubeApi().upload_video(video) called_args, called_kwargs = mock_upload.call_args assert called_kwargs["body"]["snippet"]["title"] == title[:100] assert called_kwargs["body"]["snippet"]["description"] == desc[:5000] def test_upload_caption_calls_insert(mocker): """ Test that the upload_caption task calls insert_caption for a YouTube video if no caption for that language exists """ subtitle = VideoSubtitleFactory() caption_id = "foo" caption_response = {"id": caption_id} mocker.patch("cloudsync.youtube.YouTubeApi.list_captions", return_value={}) youtube_mocker = mocker.patch("cloudsync.youtube.build") youtube_mocker().captions.return_value.insert.return_value.next_chunk.return_value = ( None, caption_response, ) response = YouTubeApi().upload_caption(subtitle, caption_id) assert response == caption_response def test_upload_caption_calls_update(mocker): """ Test that the upload_caption task calls update_caption for a YouTube video if a caption for that language exists """ subtitle = VideoSubtitleFactory() caption_id = "bar" caption_response = {"id": caption_id} mocker.patch( "cloudsync.youtube.YouTubeApi.list_captions", return_value={"en": caption_id} ) youtube_mocker = mocker.patch("cloudsync.youtube.build") youtube_mocker().captions.return_value.update.return_value.next_chunk.return_value = ( None, caption_response, ) response = YouTubeApi().upload_caption(subtitle, caption_id) assert response == caption_response def test_delete_video(mocker): """ Test that the 'delete_video' method executes a YouTube API deletion request and returns the status code """ youtube_mocker = mocker.patch("cloudsync.youtube.build") youtube_mocker().videos.return_value.delete.return_value.execute.return_value = 204 assert YouTubeApi().delete_video("foo") == 204 youtube_mocker().videos.return_value.delete.assert_called_with(id="foo") def test_list_captions(mocker): """ Test that the 'list_captions' method executes a YouTube API request and returns a dict with correct values """ key = "en" value = "Srnr982VEC79QzEBGcBOL_UFmu9U2e-JgOw-EWIxJXEB5Bjltl3Yvg=" youtube_mocker = mocker.patch("cloudsync.youtube.build") youtube_mocker().captions.return_value.list.return_value.execute.return_value = { "etag": "foo", "items": [ { "id": value, "kind": "youtube#caption", "snippet": { "audioTrackType": "unknown", "language": key, "lastUpdated": "2017-11-15T14:53:21.839Z", "name": "English", "videoId": "3h-0mkTVbRg", }, } ], "kind": "youtube#captionListResponse", } assert YouTubeApi().list_captions("foo") == {key: value} youtube_mocker().captions.return_value.list.assert_called_once_with( videoId="foo", part="snippet" ) def test_delete_caption(mocker): """ Test that the 'delete_caption' method executes a YouTube API deletion request and returns the status code """ youtube_mocker = mocker.patch("cloudsync.youtube.build") youtube_mocker().captions.return_value.delete.return_value.execute.return_value = ( 204 ) assert YouTubeApi().delete_caption("foo") == 204 youtube_mocker().captions.return_value.delete.assert_called_once_with(id="foo") def test_video_status(mocker): """ Test that the 'video_status' method returns the correct value from the API response """ expected_status = "processed" youtube_mocker = mocker.patch("cloudsync.youtube.build") youtube_mocker().videos.return_value.list.return_value.execute.return_value = { "etag": '"ld9biNPKjAjgjV7EZ4EKeEGrhao/Lf7oS5V-Gjw0XHBBKFJRpn60z3w"', "items": [ { "etag": '"ld9biNPKjAjgjV7EZ4EKeEGrhao/-UL82wRXbq3YJiMZuZpqCWKoq6Q"', "id": "wAjoqsZng_M", "kind": "youtube#video", "status": { "embeddable": True, "license": "youtube", "privacyStatus": "unlisted", "publicStatsViewable": True, "uploadStatus": expected_status, }, } ], "kind": "youtube#videoListResponse", "pageInfo": {"resultsPerPage": 1, "totalResults": 1}, } assert YouTubeApi().video_status("foo") == expected_status youtube_mocker().videos.return_value.list.assert_called_once_with( id="foo", part="status" ) def test_strip_bad_chars(): """ Test that `<`,`>` characters are removed from text """ assert strip_bad_chars("<OV>S>") == "OVS"
from direct.actor import Actor from direct.directnotify.DirectNotifyGlobal import * from direct.distributed import ClockDelta from direct.interval.IntervalGlobal import * from direct.showbase import PythonUtil from direct.showutil import Rope from direct.task import Task from pandac.PandaModules import * import DistributedFurnitureItem import PhoneGlobals from toontown.catalog import CatalogItem from toontown.catalog.CatalogGUI import CatalogGUI from toontown.catalog.CatalogItemListGUI import CatalogItemListGUI from toontown.catalog.CatalogItemSorter import CatalogItemSorter from toontown.quest import Quests from toontown.toonbase import TTLocalizer from toontown.toonbase import ToontownGlobals from toontown.toontowngui import TTDialog class DistributedPhone(DistributedFurnitureItem.DistributedFurnitureItem): notify = directNotify.newCategory('DistributedPhone') movieDelay = 0.5 def __init__(self, cr): DistributedFurnitureItem.DistributedFurnitureItem.__init__(self, cr) self.lastAvId = 0 self.hasLocalAvatar = 0 self.lastTime = 0 self.initialScale = None self.usedInitialScale = 0 self.toonScale = None self.phoneGui = None self.phoneDialog = None self.model = None self.cord = None self.receiverGeom = None self.receiverJoint = None self.phoneSphereEvent = 'phoneSphere' self.phoneSphereEnterEvent = 'enter' + self.phoneSphereEvent self.phoneGuiDoneEvent = 'phoneGuiDone' self.pickupMovieDoneEvent = 'phonePickupDone' self.numHouseItems = None self.interval = None self.intervalAvatar = None self.phoneInUse = 0 self.origToonHpr = None def announceGenerate(self): self.notify.debug('announceGenerate') DistributedFurnitureItem.DistributedFurnitureItem.announceGenerate(self) self.accept(self.phoneSphereEnterEvent, self.__handleEnterSphere) self.load() taskMgr.doMethodLater(6, self.ringIfHasPhoneQuest, self.uniqueName('ringDoLater')) def loadModel(self): self.model = Actor.Actor('phase_5.5/models/estate/prop_phone-mod', {'SS_phoneOut': 'phase_5.5/models/estate/prop_phone-SS_phoneOut', 'SS_takePhone': 'phase_5.5/models/estate/prop_phone-SS_takePhone', 'SS_phoneNeutral': 'phase_5.5/models/estate/prop_phone-SS_phoneNeutral', 'SS_phoneBack': 'phase_5.5/models/estate/prop_phone-SS_phoneBack', 'SM_phoneOut': 'phase_5.5/models/estate/prop_phone-SM_phoneOut', 'SM_takePhone': 'phase_5.5/models/estate/prop_phone-SM_takePhone', 'SM_phoneNeutral': 'phase_5.5/models/estate/prop_phone-SM_phoneNeutral', 'SM_phoneBack': 'phase_5.5/models/estate/prop_phone-SM_phoneBack', 'SL_phoneOut': 'phase_5.5/models/estate/prop_phone-SL_phoneOut', 'SL_takePhone': 'phase_5.5/models/estate/prop_phone-SL_takePhone', 'SL_phoneNeutral': 'phase_5.5/models/estate/prop_phone-SL_phoneNeutral', 'SL_phoneBack': 'phase_5.5/models/estate/prop_phone-SL_phoneBack', 'MS_phoneOut': 'phase_5.5/models/estate/prop_phone-MS_phoneOut', 'MS_takePhone': 'phase_5.5/models/estate/prop_phone-MS_takePhone', 'MS_phoneNeutral': 'phase_5.5/models/estate/prop_phone-MS_phoneNeutral', 'MS_phoneBack': 'phase_5.5/models/estate/prop_phone-MS_phoneBack', 'MM_phoneOut': 'phase_5.5/models/estate/prop_phone-MM_phoneOut', 'MM_takePhone': 'phase_5.5/models/estate/prop_phone-MM_takePhone', 'MM_phoneNeutral': 'phase_5.5/models/estate/prop_phone-MM_phoneNeutral', 'MM_phoneBack': 'phase_5.5/models/estate/prop_phone-MM_phoneBack', 'ML_phoneOut': 'phase_5.5/models/estate/prop_phone-ML_phoneOut', 'ML_takePhone': 'phase_5.5/models/estate/prop_phone-ML_takePhone', 'ML_phoneNeutral': 'phase_5.5/models/estate/prop_phone-ML_phoneNeutral', 'ML_phoneBack': 'phase_5.5/models/estate/prop_phone-ML_phoneBack', 'LS_phoneOut': 'phase_5.5/models/estate/prop_phone-LS_phoneOut', 'LS_takePhone': 'phase_5.5/models/estate/prop_phone-LS_takePhone', 'LS_phoneNeutral': 'phase_5.5/models/estate/prop_phone-LS_phoneNeutral', 'LS_phoneBack': 'phase_5.5/models/estate/prop_phone-LS_phoneBack', 'LM_phoneOut': 'phase_5.5/models/estate/prop_phone-LM_phoneOut', 'LM_takePhone': 'phase_5.5/models/estate/prop_phone-LM_takePhone', 'LM_phoneNeutral': 'phase_5.5/models/estate/prop_phone-LM_phoneNeutral', 'LM_phoneBack': 'phase_5.5/models/estate/prop_phone-LM_phoneBack', 'LL_phoneOut': 'phase_5.5/models/estate/prop_phone-LL_phoneOut', 'LL_takePhone': 'phase_5.5/models/estate/prop_phone-LL_takePhone', 'LL_phoneNeutral': 'phase_5.5/models/estate/prop_phone-LL_phoneNeutral', 'LL_phoneBack': 'phase_5.5/models/estate/prop_phone-LL_phoneBack'}) self.model.pose('SS_phoneOut', 0) self.receiverJoint = self.model.find('**/joint_receiver') self.receiverGeom = self.receiverJoint.getChild(0) mount = loader.loadModel('phase_5.5/models/estate/phoneMount-mod') mount.setTransparency(0, 1) self.model.reparentTo(mount) self.ringSfx = loader.loadSfx('phase_3.5/audio/sfx/telephone_ring.ogg') self.handleSfx = loader.loadSfx('phase_5.5/audio/sfx/telephone_handle2.ogg') self.hangUpSfx = loader.loadSfx('phase_5.5/audio/sfx/telephone_hang_up.ogg') self.pickUpSfx = loader.loadSfx('phase_5.5/audio/sfx/telephone_pickup1.ogg') if self.initialScale: mount.setScale(*self.initialScale) self.usedInitialScale = 1 phoneSphere = CollisionSphere(0, -0.66, 0, 0.2) phoneSphere.setTangible(0) phoneSphereNode = CollisionNode(self.phoneSphereEvent) phoneSphereNode.setIntoCollideMask(ToontownGlobals.WallBitmask) phoneSphereNode.addSolid(phoneSphere) mount.attachNewNode(phoneSphereNode) if not self.model.find('**/CurveNode7').isEmpty(): self.setupCord() return mount def setupCamera(self, mode): base.camera.wrtReparentTo(render) if mode == PhoneGlobals.PHONE_MOVIE_PICKUP: base.camera.posQuatInterval(1, (4, -4, base.localAvatar.getHeight()- 0.5), (35, -8, 0), other=base.localAvatar, blendType='easeOut').start() def setupCord(self): if self.cord: self.cord.detachNode() self.cord = None self.cord = Rope.Rope(self.uniqueName('phoneCord')) self.cord.setColor(0, 0, 0, 1) self.cord.setup(4, ((self.receiverGeom, (0, 0, 0)), (self.model.find('**/joint_curveNode1'), (0, 0, 0)), (self.model.find('**/joint_curveNode2'), (0, 0, 0)), (self.model.find('**/joint_curveNode3'), (0, 0, 0)), (self.model.find('**/joint_curveNode4'), (0, 0, 0)), (self.model.find('**/joint_curveNode5'), (0, 0, 0)), (self.model.find('**/joint_curveNode6'), (0, 0, 0)), (self.model.find('**/CurveNode7'), (0, 0, 0)))) self.cord.reparentTo(self.model) self.cord.node().setBounds(BoundingSphere(Point3(-1.0, -3.2, 2.6), 2.0)) def disable(self): self.notify.debug('disable') taskMgr.remove(self.uniqueName('ringDoLater')) self.clearInterval() if self.phoneGui: self.phoneGui.hide() self.phoneGui.unload() self.phoneGui = None if self.phoneDialog: self.phoneDialog.cleanup() self.phoneDialog = None self.__receiverToPhone() if self.hasLocalAvatar: self.freeAvatar() self.ignoreAll() DistributedFurnitureItem.DistributedFurnitureItem.disable(self) def delete(self): self.notify.debug('delete') self.model.cleanup() DistributedFurnitureItem.DistributedFurnitureItem.delete(self) def setInitialScale(self, sx, sy, sz): self.initialScale = (sx, sy, sz) if not self.usedInitialScale and self.model: self.setScale(*self.initialScale) self.usedInitialScale = 1 def __handleEnterSphere(self, collEntry): if self.smoothStarted: return if base.localAvatar.doId == self.lastAvId and globalClock.getFrameTime() <= self.lastTime + 0.5: self.notify.debug('Ignoring duplicate entry for avatar.') return if self.hasLocalAvatar: self.freeAvatar() if hasattr(base, 'wantPets') and base.wantPets: base.localAvatar.lookupPetDNA() self.notify.debug('Entering Phone Sphere....') taskMgr.remove(self.uniqueName('ringDoLater')) self.ignore(self.phoneSphereEnterEvent) self.cr.playGame.getPlace().detectedPhoneCollision() self.hasLocalAvatar = 1 self.sendUpdate('avatarEnter') def __handlePhoneDone(self): self.sendUpdate('avatarExit') self.ignore(self.phoneGuiDoneEvent) self.phoneGui = None def freeAvatar(self): if self.hasLocalAvatar: base.localAvatar.speed = 0 taskMgr.remove(self.uniqueName('lerpCamera')) base.localAvatar.posCamera(0, 0) if base.cr.playGame.place != None: base.cr.playGame.getPlace().setState('walk') self.hasLocalAvatar = 0 self.ignore(self.pickupMovieDoneEvent) self.accept(self.phoneSphereEnterEvent, self.__handleEnterSphere) self.stopSmooth() self.lastTime = globalClock.getFrameTime() def setLimits(self, numHouseItems): self.numHouseItems = numHouseItems def setMovie(self, mode, avId, timestamp): elapsed = ClockDelta.globalClockDelta.localElapsedTime(timestamp, bits=32) elapsed = max(elapsed - self.movieDelay, 0) self.ignore(self.pickupMovieDoneEvent) if avId != 0: self.lastAvId = avId self.lastTime = globalClock.getFrameTime() isLocalToon = avId == base.localAvatar.doId avatar = self.cr.doId2do.get(avId) if mode == PhoneGlobals.PHONE_MOVIE_CLEAR: if self.phoneInUse: self.clearInterval() self.numHouseItems = None self.phoneInUse = 0 elif mode == PhoneGlobals.PHONE_MOVIE_EMPTY: if isLocalToon: self.phoneDialog = TTDialog.TTDialog(dialogName='PhoneEmpty', style=TTDialog.Acknowledge, text=TTLocalizer.DistributedPhoneEmpty, text_wordwrap=15, fadeScreen=1, command=self.__clearDialog) self.numHouseItems = None self.phoneInUse = 0 elif mode == PhoneGlobals.PHONE_MOVIE_NO_HOUSE: if isLocalToon: self.phoneDialog = TTDialog.TTDialog(dialogName='PhoneNoHouse', style=TTDialog.Acknowledge, text=TTLocalizer.DistributedPhoneNoHouse, text_wordwrap=15, fadeScreen=1, command=self.__clearDialog) self.numHouseItems = None self.phoneInUse = 0 elif mode == PhoneGlobals.PHONE_MOVIE_PICKUP: if avatar: interval = self.takePhoneInterval(avatar) if isLocalToon: self.setupCamera(mode) interval.setDoneEvent(self.pickupMovieDoneEvent) self.acceptOnce(self.pickupMovieDoneEvent, self.__showPhoneGui) self.playInterval(interval, elapsed, avatar) self.phoneInUse = 1 elif mode == PhoneGlobals.PHONE_MOVIE_HANGUP: if avatar: interval = self.replacePhoneInterval(avatar) self.playInterval(interval, elapsed, avatar) self.numHouseItems = None self.phoneInUse = 0 else: self.notify.warning('unknown mode in setMovie: %s' % mode) def __showPhoneGui(self): if self.toonScale: self.sendUpdate('setNewScale', [self.toonScale[0], self.toonScale[1], self.toonScale[2]]) self.phoneGui = CatalogGUI(self, doneEvent=self.phoneGuiDoneEvent) # Hide the phone until we get our popular items set. self.phoneGui.hide() self.__generateCatalogPages() self.acceptOnce('PopularItemsSet', self.__setPopularItems) self.cr.catalogManager.fetchPopularItems() self.accept(self.phoneGuiDoneEvent, self.__handlePhoneDone) self.accept('phoneAsleep', self.__handlePhoneAsleep) def __generateCatalogPages(self): itemList = base.localAvatar.monthlyCatalog.generateList() itemList += base.localAvatar.weeklyCatalog.generateList() itemList += base.localAvatar.backCatalog.generateList() sortedItems = CatalogItemSorter(itemList).sortItems() catalogItemList = CatalogItemListGUI(self.phoneGui) for item in sortedItems['FURNITURE']: catalogItemList.addItem(item, 'Furniture') for item in sortedItems['UNSORTED']: catalogItemList.addItem(item, 'Unsorted Items') self.phoneGui.tabButtons['FURNITURE_TAB'].setCatalogItemPages(catalogItemList.generatePages()) self.phoneGui.tabButtons['FURNITURE_TAB'].tabClicked() catalogItemList = CatalogItemListGUI(self.phoneGui) for item in sortedItems['EMOTIONS']: catalogItemList.addItem(item, 'Emotions') self.phoneGui.tabButtons['EMOTE_TAB'].setCatalogItemPages(catalogItemList.generatePages()) self.phoneGui.tabButtons['EMOTE_TAB'].tabClicked() catalogItemList = CatalogItemListGUI(self.phoneGui) for item in sortedItems['SPECIAL']: catalogItemList.addItem(item, 'Special') self.phoneGui.tabButtons['SPECIAL_TAB'].setCatalogItemPages(catalogItemList.generatePages()) self.phoneGui.tabButtons['SPECIAL_TAB'].tabClicked() catalogItemList = CatalogItemListGUI(self.phoneGui) for item in sortedItems['CLOTHING']: catalogItemList.addItem(item, 'Clothing') self.phoneGui.tabButtons['CLOTHING_TAB'].setCatalogItemPages(catalogItemList.generatePages()) self.phoneGui.tabButtons['CLOTHING_TAB'].tabClicked() catalogItemList = CatalogItemListGUI(self.phoneGui) for item in sortedItems['PHRASES']: catalogItemList.addItem(item, 'Phrases') self.phoneGui.tabButtons['PHRASES_TAB'].setCatalogItemPages(catalogItemList.generatePages()) self.phoneGui.tabButtons['PHRASES_TAB'].tabClicked() catalogItemList = CatalogItemListGUI(self.phoneGui) for item in sortedItems['NAMETAG']: catalogItemList.addItem(item, 'Nametag') self.phoneGui.tabButtons['NAMETAG_TAB'].setCatalogItemPages(catalogItemList.generatePages()) self.phoneGui.tabButtons['NAMETAG_TAB'].tabClicked() def __setPopularItems(self): # Generate a list of popular items. itemList = self.cr.catalogManager.popularItems.generateList() catalogItemList = CatalogItemListGUI(self.phoneGui) for item in itemList: catalogItemList.addItem(item, 'Popular') self.phoneGui.tabButtons['POPULAR_TAB'].setCatalogItemPages(catalogItemList.generatePages()) # Now that the popular items are set we can show the CatalogGUI self.phoneGui.show() # We want our default tab to be the popular tab. We need to click it twice to prevent a glitch. self.phoneGui.tabButtons['POPULAR_TAB'].tabClicked() def __handlePhoneAsleep(self): self.ignore('phoneAsleep') if self.phoneGui: self.phoneGui.unload() self.__handlePhoneDone() def requestPurchase(self, item, callback, optional = -1): blob = item.getBlob(store=CatalogItem.Customization) context = self.getCallbackContext(callback, [item]) self.sendUpdate('requestPurchaseMessage', [context, blob, optional]) def requestGiftPurchase(self, item, targetDoID, callback, optional = -1): blob = item.getBlob(store=CatalogItem.Customization) context = self.getCallbackContext(callback, [item]) self.sendUpdate('requestGiftPurchaseMessage', [context, targetDoID, blob, optional]) def requestPurchaseResponse(self, context, retcode): self.doCallbackContext(context, [retcode]) def requestGiftPurchaseResponse(self, context, retcode): self.doCallbackContext(context, [retcode]) def __clearDialog(self, event): self.phoneDialog.cleanup() self.phoneDialog = None self.freeAvatar() def takePhoneInterval(self, toon): torso = TextEncoder.upper(toon.style.torso[0]) legs = TextEncoder.upper(toon.style.legs[0]) phoneOutAnim = '%s%s_phoneOut' % (torso, legs) takePhoneAnim = '%s%s_takePhone' % (torso, legs) phoneNeutralAnim = '%s%s_phoneNeutral' % (torso, legs) self.toonScale = toon.getGeomNode().getChild(0).getScale(self.getParent()) walkTime = 1.0 scaleTime = 1.0 origScale = self.getScale() origToonPos = toon.getPos() origToonHpr = toon.getHpr() self.origToonHpr = origToonHpr self.setScale(self.toonScale) toon.setPosHpr(self, 0, -4.5, 0, 0, 0, 0) destToonPos = toon.getPos() destToonHpr = toon.getHpr() destToonHpr = VBase3(PythonUtil.fitSrcAngle2Dest(destToonHpr[0], origToonHpr[0]), destToonHpr[1], destToonHpr[2]) self.setScale(origScale) toon.setPos(origToonPos) toon.setHpr(origToonHpr) walkToPhone = Sequence(Func(toon.stopSmooth), Func(toon.loop, 'walk'), Func(base.playSfx, base.localAvatar.soundWalk), toon.posHprInterval(walkTime, destToonPos, destToonHpr, blendType='easeInOut'), Func(toon.loop, 'neutral'), Func(toon.startSmooth)) interval = Sequence(Parallel(walkToPhone, ActorInterval(self.model, phoneOutAnim), self.scaleInterval(scaleTime, self.toonScale, blendType='easeInOut')), Parallel(ActorInterval(self.model, takePhoneAnim), ActorInterval(toon, 'takePhone'), Sequence(Wait(0.625), Func(base.playSfx, self.pickUpSfx), Func(self.__receiverToHand, toon), Wait(1), Func(base.playSfx, self.handleSfx))), Func(self.model.loop, phoneNeutralAnim), Func(toon.loop, 'phoneNeutral'), Func(base.playSfx, self.ringSfx)) return interval def replacePhoneInterval(self, toon): torso = TextEncoder.upper(toon.style.torso[0]) legs = TextEncoder.upper(toon.style.legs[0]) phoneBackAnim = '%s%s_phoneBack' % (torso, legs) scaleTime = 1.0 interval = Sequence(Parallel(ActorInterval(self.model, phoneBackAnim), ActorInterval(toon, 'phoneBack'), Sequence(Wait(1.0), Func(self.__receiverToPhone), Func(base.playSfx, self.hangUpSfx))), self.scaleInterval(scaleTime, localAvatar.getGeomNode().getScale()[2], blendType='easeInOut'), Func(toon.loop, 'neutral')) if self.origToonHpr: interval.append(Func(toon.setHpr, self.origToonHpr)) self.origToonHpr = None if toon == base.localAvatar: interval.append(Func(self.freeAvatar)) return interval def __receiverToHand(self, toon): self.receiverGeom.reparentTo(toon.leftHand) self.receiverGeom.setPosHpr(0.0906813, 0.380375, 0.1, 32.41, 70.68, 137.04) def __receiverToPhone(self): self.receiverGeom.reparentTo(self.receiverJoint) self.receiverGeom.setPosHpr(0, 0, 0, 0, 0, 0) def playInterval(self, interval, elapsed, avatar): if self.interval != None: self.interval.finish() self.interval = None self.interval = interval self.interval.start(elapsed) if self.intervalAvatar != avatar: if self.intervalAvatar: self.ignore(self.intervalAvatar.uniqueName('disable')) if avatar: self.accept(avatar.uniqueName('disable'), self.clearInterval) self.intervalAvatar = avatar def clearInterval(self): if self.interval != None: self.interval.finish() self.interval = None if self.intervalAvatar: self.ignore(self.intervalAvatar.uniqueName('disable')) self.intervalAvatar = None self.__receiverToPhone() self.model.pose('SS_phoneOut', 0) self.phoneInUse = 0 def ringIfHasPhoneQuest(self, task): if Quests.avatarHasPhoneQuest(base.localAvatar) and not Quests.avatarHasCompletedPhoneQuest(base.localAvatar): self.ring() return Task.done def ring(self): if self.phoneInUse: return 0 phone = self.find('**/prop_phone') r = 2.0 w = 0.05 shakeOnce = Sequence(Func(phone.setR, r), Wait(w), Func(phone.setR, -r), Wait(w)) shakeSeq = Sequence() for i in xrange(16): shakeSeq.append(shakeOnce) ringIval = Parallel(Func(base.playSfx, self.ringSfx), shakeSeq, Func(phone.setR, 0)) self.playInterval(ringIval, 0.0, None) def purchaseItemComplete(self): self.phoneGui.updateItems()
#!/usr/bin/python import argparse import re import os class Sample: def __init__(self,id,file): self.id = id self.file = file def process_input(): ############## # INPUT PROCESSSING ############## calling_dir = os.path.dirname(os.path.realpath(__file__)) print "########################################################" print "Take a list of samples and Illumina standard reports and convert" print "to lgen format which can then be converted to a bed file" print "########################################################" parser = argparse.ArgumentParser(description='Convert Illumina standard reports to lgen format') parser.add_argument('--out_prefix', help='the output prefix', required=True) parser.add_argument('--sample_file', help='A tab separated file. Column 1 is sample ID and column 2 is the file path', type=str, required=True) parser.add_argument('--manifest_csv', help='Illumina manifest file in column separated format', type=str, required=True) parser.add_argument('--skip_indels', help='Skip indel variants in manifest', action='store_true', required=False) parser.add_argument('--indel_regex', help='Indel regex definition', type=str, default="[DI]", required=False) parser.add_argument('--snp_col_name_manifest', help='SNP Name in manifest', type=str, default="Name", required=False) parser.add_argument('--snp_change_col_name_manifest', help='Typically formated [A/G]', type=str, default="SNP", required=False) parser.add_argument('--chrom_col_name_manifest', help='Chrom column name in manifest', type=str, default="Chr", required=False) parser.add_argument('--pos_col_name_manifest', help='Position column name in manifest', type=str, default="MapInfo", required=False) parser.add_argument('--snp_col_name_report', help='SNP Name in report', type=str, default="SNP Name", required=False) parser.add_argument('--allele_1_col_name_report', help='allele 1 column name in report', type=str, default="Allele1 - Forward", required=False) parser.add_argument('--allele_2_col_name_report', help='allele 2 column name in report', type=str, default="Allele2 - Forward", required=False) parser.add_argument('--sep_report', help='delimiter default is a tab', type=str, default="\t", required=False) args = parser.parse_args() print print "########################################################" print "OPTIONS" print "########################################################" print for attr, value in args.__dict__.iteritems(): print "{0:>25}\t\t{1!s}".format( "--{0}".format(attr), str(value)) sample_file_h = open(args.sample_file,"r") samples = [] for line in sample_file_h: cols = line.rstrip().split("\t") sample = Sample(cols[0],cols[1]) samples.append(sample) sample_file_h.close() args.samples = samples return args def main(): args = process_input() skip_indels = args.skip_indels indel_regex = args.indel_regex samples = args.samples manifest_csv = args.manifest_csv snp_col_name_manifest = args.snp_col_name_manifest snp_change_col_name_manifest = args.snp_change_col_name_manifest chrom_col_name_manifest = args.chrom_col_name_manifest pos_col_name_manifest = args.pos_col_name_manifest snp_col_name_report = args.snp_col_name_report allele_1_col_name_report = args.allele_1_col_name_report allele_2_col_name_report = args.allele_2_col_name_report out_prefix = args.out_prefix map_out = "{0}.map".format(out_prefix) sep_report = args.sep_report """ MAP COLS: chromosome (1-22, X, Y or 0 if unplaced) rs# or snp identifier Genetic distance (morgans) Base-pair position (bp units) """ lgen_out = "{0}.lgen".format(out_prefix) """ LGEN COLS: family ID individual ID snp ID allele 1 of this genotype allele 2 of this genotype """ fam_out = "{0}.fam".format(out_prefix) """ FAM COLS: first six columns of PED Family ID Individual ID Paternal ID Maternal ID Sex (1=male; 2=female; other=unknown) Phenotype """ print "Checking that all files exists" if not os.path.isfile(manifest_csv): print "Manifest {0} does not exists!".format(manifest_csv) for sample in samples: if not os.path.isfile(sample.file): print "Sample {0} file {1} does not exists!".format(sample.id,sample.file) print "All files appear to exists." print "Writing out FAM file: {0}".format(fam_out) fam_out_h = open(fam_out,"w") for sample in samples: line_out = "{0}\t{1}\t{2}\t{3}\t{4}\t{5}\n".format(sample.id,sample.id,0,0,0,0) fam_out_h.write(line_out) fam_out_h.close() print "Finished writing FAM file: {0}".format(fam_out) print print "Processing manifest file {0}...".format(manifest_csv) print manifest_h = open(manifest_csv,"r") map_out_h = open(map_out,"w") # Disover header snp_col_number_manifest = None snp_change_col_number_manifest = None chrom_col_number_manifest = None pos_col_number_manifest = None manifest_header_col_number = None ### # SNPs to keep from manifest ### snps_to_keep = dict() manifest_line_num = 0 for line in manifest_h: manifest_line_num += 1 cols = line.rstrip().split(",") if (snp_col_name_manifest in cols and snp_change_col_name_manifest in cols and chrom_col_name_manifest in cols and pos_col_name_manifest in cols): print "Header for manifest discovered..." snp_col_number_manifest = cols.index(snp_col_name_manifest) snp_change_col_number_manifest = cols.index(snp_change_col_name_manifest) chrom_col_number_manifest = cols.index(chrom_col_name_manifest) pos_col_number_manifest = cols.index(pos_col_name_manifest) manifest_header_col_number = len(cols) break if snp_col_number_manifest is None: raise ValueError("Header not discovered in manifest file please check manifest column names...") for line in manifest_h: manifest_line_num += 1 cols = line.rstrip().split(",") if len(cols) != manifest_header_col_number: print "Number of columns no longer match header at line {0:d}".format(manifest_line_num) break snp_id = cols[snp_col_number_manifest] chrom = cols[chrom_col_number_manifest] pos = cols[pos_col_number_manifest] snp_change = cols[snp_change_col_number_manifest] if manifest_line_num % 50000 == 0: print "At SNP: {0} and line: {1}".format(snp_id,manifest_line_num) match = re.search(indel_regex,snp_change) if skip_indels and match is not None: continue else: # Write to marker file map_out_line = "{chrom}\t{snp_id}\t{morgan}\t{pos}\n".format(chrom=chrom,snp_id=snp_id,morgan=0,pos=pos) map_out_h.write(map_out_line) snps_to_keep[snp_id] = None manifest_h.close() map_out_h.close() print "Finished processing manifest file" print "Finished writing: {0}".format(map_out) print "Found {0} variants in manifest".format(len(snps_to_keep)) print print "Processing {0:d} samples...".format(len(samples)) print marker_lines = [] header = None lgen_out_h = open(lgen_out,"w") sample_count = 0 snp_col_number_report = None allele_1_col_number_report = None allele_2_col_number_report = None for sample in samples: sample_count += 1 print "Processing {0}".format(sample.id) print "Processing file: {0}".format(sample.file) file_handle = open(sample.file,"r") #Get to first data line lines_skipped = 0 for line in file_handle: line = line.rstrip() lines_skipped += 1 #Match header line cols = line.split(sep_report) if (snp_col_name_report in cols and allele_1_col_name_report in cols and allele_2_col_name_report in cols): snp_col_number_report = cols.index(snp_col_name_report) allele_1_col_number_report = cols.index(allele_1_col_name_report) allele_2_col_number_report = cols.index(allele_2_col_name_report) print "Header:" print line break if snp_col_number_report is None: raise ValueError("Header not discovered in report file please check report column names...") print "Lines skipped for header: {0:d}".format(lines_skipped) # read data line_count = 0 for line in file_handle: #print line cols = line.rstrip().split(sep_report) snp_id = cols[snp_col_number_report] allele_1 = cols[allele_1_col_number_report] allele_2 = cols[allele_2_col_number_report] if line_count % 50000 == 0: print "At SNP: {0} and line: {1} for sample: {2}".format(snp_id,line_count,sample.id) #skip if snp_id not in snps_to_keep: continue if allele_1 == "-": allele_1 = "0" if allele_2 == "-": allele_2 = "0" lgen_line = "{fam_id}\t{ind_id}\t{snp_id}\t{allele_1}\t{allele_2}\n".format(fam_id=sample.id, ind_id=sample.id, snp_id=snp_id,allele_1=allele_1,allele_2=allele_2) lgen_out_h.write(lgen_line) line_count += 1 print "Lines {0} processed for sample {1}".format(line_count,sample.id) file_handle.close() lgen_out_h.close() print "Finished writing: {0}".format(lgen_out) print print "OUTPUT FILES" print "FAM: {0}".format(fam_out) print "LGEN: {0}".format(lgen_out) print "MAP: {0}".format(map_out) print "Run: plink --lfile {0} --make-bed --out {0}".format(out_prefix) if __name__ == '__main__': main()
"""kytos.utils.napps tests.""" import json import re import tempfile import unittest from pathlib import Path, PurePosixPath from unittest.mock import MagicMock, Mock, PropertyMock, call, patch from urllib.error import HTTPError from kytos.utils.exceptions import KytosException from kytos.utils.napps import NAppsManager from kytos.utils.settings import SKEL_PATH # pylint: disable=protected-access, too-many-public-methods class TestNapps(unittest.TestCase): """Test the class NAppsManager.""" def setUp(self): """Execute steps before each tests.""" self.napps_manager = NAppsManager() @staticmethod def get_napps_response_mock(napps=None): """Get mock to napps response.""" if napps is None: napps = [["kytos", "mef_eline"], ["kytos", "of_lldp"]] response = json.dumps({"napps": napps}) mock_response = MagicMock() mock_response.getcode.return_value = 200 mock_response.read.return_value = response mock_response.__enter__.return_value = mock_response return mock_response @patch('urllib.request.urlopen') def test_enabled_property(self, mock_urlopen): """Test enabled property.""" data = MagicMock() data.read.return_value = '{"napps": "ABC", "installed_napps": "DEF"}' mock_urlopen.return_value = data self.assertEqual(str(self.napps_manager._enabled), 'ABC') def test_enabled_property__error(self): """Test enabled property to error case.""" with self.assertRaises(SystemExit): # pylint: disable=pointless-statement self.napps_manager._enabled # pylint: enable=pointless-statement self.assertIsNone(self.napps_manager._NAppsManager__local_enabled) @patch('urllib.request.urlopen') def test_installed_property(self, mock_urlopen): """Test installed property.""" data = MagicMock() data.read.return_value = '{"napps": "ABC", "installed_napps": "DEF"}' mock_urlopen.return_value = data self.assertEqual(str(self.napps_manager._installed), 'DEF') def test_installed_property__error(self): """Test installed property to error case.""" with self.assertRaises(SystemExit): # pylint: disable=pointless-statement self.napps_manager._installed # pylint: enable=pointless-statement self.assertIsNone(self.napps_manager._NAppsManager__local_installed) def test_napp_id_property(self): """Test napp_id property.""" self.napps_manager.user = 'user' self.napps_manager.napp = 'napp' self.assertEqual(self.napps_manager.napp_id, 'user/napp') def test_set_napp(self): """Test set_napp method.""" self.napps_manager.set_napp('user', 'napp', 'version') self.assertEqual(self.napps_manager.user, 'user') self.assertEqual(self.napps_manager.napp, 'napp') self.assertEqual(self.napps_manager.version, 'version') def test_get_napps(self): """Test method get_napps used to find enabled and installed napps. """ mock_path = Mock() def glob_side_effect(args): """Path.glob to mock finding paths with kytos.json file.""" self.assertEqual(args, "*/*/kytos.json") mock_path1 = Mock() mock_path1.parts = ['kytos', 'of_core', 'kytos.json'] mock_path2 = Mock() mock_path2.parts = ['kytos', 'of_lldp', 'kytos.json'] return [mock_path1, mock_path2] mock_path.glob = glob_side_effect # pylint: disable=protected-access get_return = self.napps_manager._get_napps(mock_path) self.assertEqual(get_return[0][0], 'kytos') self.assertEqual(get_return[0][1], 'of_core') self.assertEqual(get_return[1][0], 'kytos') self.assertEqual(get_return[1][1], 'of_lldp') def test_get_enabled_local(self): """Test get_enabled_local used to find enabled napps in local machine""" # Mock kytos.json path mock_path = Mock() def glob_side_effect(args): """Path.glob to mock finding paths with kytos.json file.""" self.assertEqual(args, "*/*/kytos.json") mock_path1 = Mock() mock_path1.parts = ['kytos', 'of_core', 'kytos.json'] return [mock_path1] mock_path.glob = glob_side_effect mock_prop_enabled = PropertyMock() with patch.object(NAppsManager, '_enabled', mock_prop_enabled): mock_prop_enabled.return_value = mock_path get_return = self.napps_manager.get_enabled_local() self.assertEqual(get_return[0][0], 'kytos') self.assertEqual(get_return[0][1], 'of_core') self.assertEqual(mock_prop_enabled.call_count, 1) def test_get_installed_local(self): """Test get_installed_local used to find installed napps in local machine""" # Mock kytos.json path mock_path = Mock() def glob_side_effect(args): """Path.glob to mock finding paths with kytos.json file.""" self.assertEqual(args, "*/*/kytos.json") mock_path1 = Mock() mock_path1.parts = ['kytos', 'of_core', 'kytos.json'] return [mock_path1] mock_path.glob = glob_side_effect mock_prop_installed = PropertyMock() with patch.object(NAppsManager, '_installed', mock_prop_installed): mock_prop_installed.return_value = mock_path get_return = self.napps_manager.get_installed_local() self.assertEqual(get_return[0][0], 'kytos') self.assertEqual(get_return[0][1], 'of_core') self.assertEqual(mock_prop_installed.call_count, 1) @patch('urllib.request.urlopen') def test_get_installed(self, mock_urlopen): """Test method get_installed to find all installed napps.""" mock_urlopen.return_value = self.get_napps_response_mock() installed_napps = self.napps_manager.get_installed() self.assertEqual(len(installed_napps), 2) self.assertEqual(installed_napps[0], ("kytos", "mef_eline")) self.assertEqual(installed_napps[1], ("kytos", "of_lldp")) def test_get_installed__connection_error(self): """Test method get_installed to connection error case.""" with self.assertRaises(KytosException) as context: self.napps_manager.get_installed() self.assertEqual('<urlopen error [Errno 111] Connection refused>', str(context.exception)) @patch('urllib.request.urlopen') def test_get_installed__error(self, mock_urlopen): """Test method get_installed with API error.""" mock_response = MagicMock() mock_response.getcode.return_value = 500 mock_urlopen.return_value = mock_response with self.assertRaises(KytosException) as context: self.napps_manager.get_installed() self.assertEqual('Error calling Kytos to check installed NApps.', str(context.exception)) @patch('urllib.request.urlopen') def test_get_enabled(self, mock_urlopen): """Test method get_enabled to find all enabled napps.""" mock_urlopen.return_value = self.get_napps_response_mock() installed_napps = self.napps_manager.get_enabled() self.assertEqual(len(installed_napps), 2) self.assertEqual(installed_napps[0], ("kytos", "mef_eline")) self.assertEqual(installed_napps[1], ("kytos", "of_lldp")) def test_get_enabled__connection_error(self): """Test method get_enabled to connection error case.""" with self.assertRaises(KytosException) as context: self.napps_manager.get_enabled() self.assertEqual('<urlopen error [Errno 111] Connection refused>', str(context.exception)) @patch('urllib.request.urlopen') def test_get_enabled__error(self, mock_urlopen): """Test method get_enabled with API error.""" mock_response = MagicMock() mock_response.getcode.return_value = 500 mock_urlopen.return_value = mock_response with self.assertRaises(KytosException) as context: self.napps_manager.get_enabled() self.assertEqual('Error calling Kytos to check enabled NApps.', str(context.exception)) @patch('urllib.request.urlopen') def test_is_enabled(self, mock_urlopen): """Test is_enabled method.""" mock_urlopen.return_value = self.get_napps_response_mock() self.napps_manager.user = 'kytos' self.napps_manager.napp = 'mef_eline' self.assertTrue(self.napps_manager.is_enabled()) @patch('urllib.request.urlopen') def test_is_installed(self, mock_urlopen): """Test is_installed method.""" mock_urlopen.return_value = self.get_napps_response_mock() self.napps_manager.user = 'kytos' self.napps_manager.napp = 'mef_eline' self.assertTrue(self.napps_manager.is_installed()) @patch('urllib.request.urlopen') def test_get_disabled(self, mock_urlopen): """Test get_disabled method.""" enabled = [["kytos", "mef_eline"]] mock_urlopen.side_effect = [self.get_napps_response_mock(), self.get_napps_response_mock(enabled)] disabled = self.napps_manager.get_disabled() self.assertEqual(disabled, [('kytos', 'of_lldp')]) @patch('urllib.request.urlopen') def test_dependencies(self, mock_urlopen): """Test dependencies method.""" napps = {"napp_dependencies": ["kytos/mef_eline", "kytos/of_lldp"]} data = MagicMock() data.read.return_value = json.dumps(napps) mock_urlopen.return_value = data dependencies = self.napps_manager.dependencies() expected_dependencies = [('kytos', 'mef_eline'), ('kytos', 'of_lldp')] self.assertEqual(dependencies, expected_dependencies) @patch('urllib.request.urlopen') def test_get_description(self, mock_urlopen): """Test get_description method.""" data = MagicMock() data.read.return_value = '{"description": "ABC"}' mock_urlopen.return_value = data description = self.napps_manager.get_description() self.assertEqual(description, 'ABC') @patch('urllib.request.urlopen') def test_get_version(self, mock_urlopen): """Test get_version method.""" data = MagicMock() data.read.return_value = '{"version": "123"}' mock_urlopen.return_value = data version = self.napps_manager.get_version() self.assertEqual(version, '123') @patch('urllib.request.urlopen') def test_get_napp_key(self, mock_urlopen): """Test _get_napp_key method.""" data = MagicMock() data.read.return_value = '{"key": "ABC"}' mock_urlopen.return_value = data self.napps_manager.user = 'kytos' self.napps_manager.napp = 'mef_eline' meta_key = self.napps_manager._get_napp_key('key') self.assertEqual(meta_key, 'ABC') @patch('urllib.request.urlopen') def test_disable(self, mock_urlopen): """Test disable method.""" data = MagicMock() data.read.return_value = '{}' mock_urlopen.return_value = data self.napps_manager.user = 'kytos' self.napps_manager.napp = 'mef_eline' self.napps_manager.disable() uri = self.napps_manager._kytos_api + self.napps_manager._NAPP_DISABLE uri = uri.format('kytos', 'mef_eline') mock_urlopen.assert_called_with(uri) @patch('kytos.utils.napps.LOG') @patch('urllib.request.urlopen') def test_disable__error(self, *args): """Test disable method to error case.""" (mock_urlopen, mock_logger) = args http_errors = [HTTPError('url', 400, 'msg', 'hdrs', MagicMock()), HTTPError('url', 500, 'msg', 'hdrs', MagicMock())] mock_urlopen.side_effect = http_errors self.napps_manager.disable() self.napps_manager.disable() self.assertEqual(mock_logger.error.call_count, 2) @patch('urllib.request.urlopen') def test_enable(self, mock_urlopen): """Test enable method.""" data = MagicMock() data.read.return_value = '{}' mock_urlopen.return_value = data self.napps_manager.user = 'kytos' self.napps_manager.napp = 'mef_eline' self.napps_manager.enable() uri = self.napps_manager._kytos_api + self.napps_manager._NAPP_ENABLE uri = uri.format('kytos', 'mef_eline') mock_urlopen.assert_called_with(uri) @patch('kytos.utils.napps.LOG') @patch('urllib.request.urlopen') def test_enable__error(self, *args): """Test enable method to error case.""" (mock_urlopen, mock_logger) = args http_errors = [HTTPError('url', 400, 'msg', 'hdrs', MagicMock()), HTTPError('url', 500, 'msg', 'hdrs', MagicMock())] mock_urlopen.side_effect = http_errors self.napps_manager.enable() self.napps_manager.enable() self.assertEqual(mock_logger.error.call_count, 2) @patch('urllib.request.urlopen') def test_enabled_dir(self, mock_urlopen): """Test enabled_dir method.""" data = MagicMock() data.read.return_value = '{"napps": "ABC", "installed_napps": "DEF"}' mock_urlopen.return_value = data self.napps_manager.user = 'kytos' self.napps_manager.napp = 'mef_eline' enabled_dir = self.napps_manager.enabled_dir() self.assertEqual(str(enabled_dir), 'ABC/kytos/mef_eline') @patch('urllib.request.urlopen') def test_installed_dir(self, mock_urlopen): """Test installed_dir method.""" data = MagicMock() data.read.return_value = '{"napps": "ABC", "installed_napps": "DEF"}' mock_urlopen.return_value = data self.napps_manager.user = 'kytos' self.napps_manager.napp = 'mef_eline' installed_dir = self.napps_manager.installed_dir() self.assertEqual(str(installed_dir), 'DEF/kytos/mef_eline') @patch('urllib.request.urlopen') def test_remote_uninstall(self, mock_urlopen): """Test remote_uninstall method.""" data = MagicMock() data.read.return_value = '{}' mock_urlopen.return_value = data self.napps_manager.user = 'kytos' self.napps_manager.napp = 'mef_eline' self.napps_manager.remote_uninstall() uninstall_uri = self.napps_manager._NAPP_UNINSTALL uri = self.napps_manager._kytos_api + uninstall_uri uri = uri.format('kytos', 'mef_eline') mock_urlopen.assert_called_with(uri) @patch('kytos.utils.napps.LOG') @patch('urllib.request.urlopen') def test_remote_uninstall__error(self, *args): """Test remote_uninstall method to error case.""" (mock_urlopen, mock_logger) = args http_errors = [HTTPError('url', 400, 'msg', 'hdrs', MagicMock()), HTTPError('url', 500, 'msg', 'hdrs', MagicMock())] mock_urlopen.side_effect = http_errors self.napps_manager.remote_uninstall() self.napps_manager.remote_uninstall() self.assertEqual(mock_logger.error.call_count, 2) @patch('urllib.request.urlopen') def test_remote_install(self, mock_urlopen): """Test remote_install method.""" data = MagicMock() data.read.return_value = '{}' mock_urlopen.return_value = data self.napps_manager.user = 'kytos' self.napps_manager.napp = 'mef_eline' self.napps_manager.remote_install() install_uri = self.napps_manager._NAPP_INSTALL uri = self.napps_manager._kytos_api + install_uri uri = uri.format('kytos', 'mef_eline') mock_urlopen.assert_called_with(uri) def test_valid_name(self): """Test valid_name method.""" valid_name = self.napps_manager.valid_name('username') invalid_name = self.napps_manager.valid_name('_username') self.assertTrue(valid_name) self.assertFalse(invalid_name) @patch('jinja2.Environment.get_template') def test_render_template(self, mock_get_template): """Test render_template method.""" template = MagicMock() mock_get_template.return_value = template self.napps_manager.render_template('', 'filename', 'context') mock_get_template.assert_called_with('filename') template.render.assert_called_with('context') @patch('kytos.utils.napps.NAppsClient') def test_search(self, mock_napps_client): """Test search method.""" napp_1 = {'username': 'kytos', 'name': 'mef_eline', 'description': '', 'tags': ['A', 'B']} napp_2 = {'username': '0_kytos', 'name': 'any', 'description': '', 'tags': ['A', 'B']} napps_client = MagicMock() napps_client.get_napps.return_value = [napp_1, napp_2] mock_napps_client.return_value = napps_client # pattern to match strings that start with letters pattern = re.compile('^[a-z]+') napps = self.napps_manager.search(pattern) self.assertEqual(napps, [napp_1]) @patch('os.makedirs') @patch('builtins.open') @patch('builtins.input') @patch('kytos.utils.napps.NAppsManager.render_template') def test_create_napp(self, *args): """Test create_napp method.""" (mock_render_template, mock_input, _, mock_mkdirs) = args mock_input.side_effect = ['username', 'napp', None] self.napps_manager.create_napp() tmpl_path = SKEL_PATH / 'napp-structure/username/napp' description = '# TODO: <<<< Insert your NApp description here >>>>' context = {'username': 'username', 'napp': 'napp', 'description': description} calls = [] for tmp in ['__init__.py', 'main.py', '.gitignore', 'kytos.json', 'README.rst', 'settings.py']: calls.append(call(tmpl_path, '{}.template'.format(tmp), context)) calls.append(call('{}/ui'.format(tmpl_path), 'README.rst.template', context)) mock_mkdirs.assert_has_calls([call('username', exist_ok=True), call('username/napp'), call('username/napp/ui/k-info-panel'), call('username/napp/ui/k-toolbar'), call('username/napp/ui/k-action-menu')]) mock_render_template.assert_has_calls(calls, any_order=True) def test_check_module(self): """Test _check_module method.""" folder = MagicMock() folder.exists.return_value = False self.napps_manager._check_module(folder) folder.mkdir.assert_called() (folder / '__init__.py').touch.assert_called() @patch('pathspec.pathspec.PathSpec.match_tree') @patch('tarfile.TarFile.add') @patch('os.remove') @patch('os.walk') @patch('os.getcwd') @patch('builtins.open') def test_build_napp_package(self, *args): """Test build_napp_package method.""" (_, mock_getcwd, mock_walk, _, mock_add, mock_match_tree) = args with tempfile.TemporaryDirectory() as tmp_dir: mock_getcwd.return_value = tmp_dir files = ['username/napp/A', 'username/napp/B', 'username/napp/C'] mock_walk.return_value = [(tmp_dir, ['username/napp/.git'], files)] mock_match_tree.return_value = ['username/napp/C'] self.napps_manager.build_napp_package('username/napp') calls = [call(PurePosixPath('username/napp/A')), call(PurePosixPath('username/napp/B'))] mock_add.assert_has_calls(calls) @patch('ruamel.yaml.YAML.load', return_value='openapi') @patch('pathlib.Path.open') @patch('builtins.open') def test_create_metadata(self, *args): """Test create_metadata method.""" (mock_open, _, _) = args enter_file_1 = MagicMock() enter_file_1.read.return_value = '{}' enter_file_2 = MagicMock() enter_file_2.read.return_value = 'readme' mock_open.return_value.__enter__.side_effect = [enter_file_1, enter_file_2] metadata = self.napps_manager.create_metadata() self.assertEqual(metadata, {'readme': 'readme', 'OpenAPI_Spec': '"openapi"'}) @patch('kytos.utils.napps.NAppsClient') @patch('kytos.utils.napps.NAppsManager.build_napp_package') @patch('kytos.utils.napps.NAppsManager.create_metadata') @patch('kytos.utils.napps.NAppsManager.prepare') def test_upload(self, *args): """Test upload method.""" (mock_prepare, mock_create, mock_build, mock_napps_client) = args mock_create.return_value = {'name': 'ABC'} mock_build.return_value = 'package' napps_client = MagicMock() mock_napps_client.return_value = napps_client self.napps_manager.upload() mock_prepare.assert_called() mock_create.assert_called() mock_build.assert_called_with('ABC') napps_client.upload_napp.assert_called_with({'name': 'ABC'}, 'package') @patch('kytos.utils.napps.NAppsClient') def test_delete(self, mock_napps_client): """Test delete method.""" napps_client = MagicMock() mock_napps_client.return_value = napps_client self.napps_manager.user = 'kytos' self.napps_manager.napp = 'mef_eline' self.napps_manager.delete() napps_client.delete.assert_called_with('kytos', 'mef_eline') @patch('sys.exit') @patch('kytos.utils.napps.OpenAPI') @patch('kytos.utils.napps.NAppsManager._ask_openapi', return_value=True) def test_prepare(self, *args): """Test prepare method.""" (_, mock_openapi, _) = args self.napps_manager.prepare() napp_path = Path() tpl_path = SKEL_PATH / 'napp-structure/username/napp' mock_openapi.assert_called_with(napp_path, tpl_path) mock_openapi.return_value.render_template.assert_called() @patch('pathlib.Path.exists') @patch('builtins.input') def test_ask_openapi(self, *args): """Test _ask_openapi method.""" (mock_input, mock_exists) = args mock_input.side_effect = ['', '', 'yes', 'no'] mock_exists.side_effect = [True, False, False, False] for expected in [False, True, True, False]: response = self.napps_manager._ask_openapi() self.assertEqual(response, expected) @patch('kytos.utils.napps.NAppsClient') def test_reload(self, mock_napps_client): """Test reload method.""" napps_client = MagicMock() mock_napps_client.return_value = napps_client napps = [] self.napps_manager.reload(napps) napps_client.reload_napps.assert_called_with(napps)
#!/usr/bin/python # Copyright 2018 Google Inc. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS-IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Tests for lib.named_array.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function import collections import pickle from absl.testing import absltest from absl.testing import parameterized import enum import numpy as np from pysc2.lib import named_array class NamedDictTest(absltest.TestCase): def test_named_dict(self): a = named_array.NamedDict(a=2, b=(1, 2)) self.assertEqual(a["a"], a.a) self.assertEqual(a["b"], a.b) self.assertIs(a["b"], a.b) self.assertNotEqual(a["a"], a.b) a.c = 3 self.assertEqual(a["c"], 3) class TestEnum(enum.IntEnum): a = 0 b = 1 c = 2 class BadEnum(enum.IntEnum): a = 1 b = 2 c = 3 class TestNamedTuple(collections.namedtuple("TestNamedTuple", ["a", "b", "c"])): pass class BadNamedTuple(collections.namedtuple("BadNamedTuple", ["a", "b"])): pass class NamedArrayTest(parameterized.TestCase): def assertArrayEqual(self, a, b): np.testing.assert_array_equal(a, b) @parameterized.named_parameters( ("none", None), ("none2", [None]), ("short_list", ["a"]), ("long_list", ["a", "b", "c", "d"]), ("long_list2", [["a", "b", "c", "d"]]), ("ints", [[1, "b", 3]]), ("bad_enum", [BadEnum]), ("bad_namedtuple", [BadNamedTuple]), ("dict", [{"a": 0, "b": 1, "c": 2}]), ("set", [{"a", "b", "c"}]), ) def test_bad_names(self, names): with self.assertRaises(ValueError): named_array.NamedNumpyArray([1, 3, 6], names) @parameterized.named_parameters( ("list", ["a", "b", "c"]), ("tuple", ("a", "b", "c")), ("list2", [["a", "b", "c"]]), ("tuple2", (("a", "b", "c"))), ("list_tuple", [("a", "b", "c")]), ("named_tuple", TestNamedTuple), ("named_tuple2", [TestNamedTuple]), ("int_enum", TestEnum), ("int_enum2", [TestEnum]), ) def test_single_dimension(self, names): a = named_array.NamedNumpyArray([1, 3, 6], names) self.assertEqual(a[0], 1) self.assertEqual(a[1], 3) self.assertEqual(a[2], 6) self.assertEqual(a[-1], 6) self.assertEqual(a.a, 1) self.assertEqual(a.b, 3) self.assertEqual(a.c, 6) with self.assertRaises(AttributeError): a.d # pylint: disable=pointless-statement self.assertEqual(a["a"], 1) self.assertEqual(a["b"], 3) self.assertEqual(a["c"], 6) with self.assertRaises(KeyError): a["d"] # pylint: disable=pointless-statement # New axis = None self.assertArrayEqual(a, [1, 3, 6]) self.assertArrayEqual(a[np.newaxis], [[1, 3, 6]]) self.assertArrayEqual(a[None], [[1, 3, 6]]) self.assertArrayEqual(a[None, :], [[1, 3, 6]]) self.assertArrayEqual(a[:, None], [[1], [3], [6]]) self.assertArrayEqual(a[None, :, None], [[[1], [3], [6]]]) self.assertArrayEqual(a[None, a % 3 == 0, None], [[[3], [6]]]) self.assertArrayEqual(a[None][None], [[[1, 3, 6]]]) self.assertArrayEqual(a[None][0], [1, 3, 6]) self.assertEqual(a[None, 0], 1) self.assertEqual(a[None, "a"], 1) self.assertEqual(a[None][0].a, 1) self.assertEqual(a[None][0, "b"], 3) # range slicing self.assertArrayEqual(a[0:2], [1, 3]) self.assertArrayEqual(a[1:3], [3, 6]) self.assertArrayEqual(a[0:2:], [1, 3]) self.assertArrayEqual(a[0:2:1], [1, 3]) self.assertArrayEqual(a[::2], [1, 6]) self.assertArrayEqual(a[::-1], [6, 3, 1]) self.assertEqual(a[1:3][0], 3) self.assertEqual(a[1:3].b, 3) self.assertEqual(a[1:3].c, 6) # list slicing self.assertArrayEqual(a[[0, 0]], [1, 1]) self.assertArrayEqual(a[[0, 1]], [1, 3]) self.assertArrayEqual(a[[1, 0]], [3, 1]) self.assertArrayEqual(a[[1, 2]], [3, 6]) self.assertArrayEqual(a[np.array([0, 2])], [1, 6]) self.assertEqual(a[[1, 2]].b, 3) self.assertEqual(a[[2, 0]].c, 6) with self.assertRaises(TypeError): # Duplicates lead to unnamed dimensions. a[[0, 0]].a # pylint: disable=pointless-statement a[1] = 4 self.assertEqual(a[1], 4) self.assertEqual(a.b, 4) self.assertEqual(a["b"], 4) a[1:2] = 2 self.assertEqual(a[1], 2) self.assertEqual(a.b, 2) self.assertEqual(a["b"], 2) a[[1]] = 3 self.assertEqual(a[1], 3) self.assertEqual(a.b, 3) self.assertEqual(a["b"], 3) a.b = 5 self.assertEqual(a[1], 5) self.assertEqual(a.b, 5) self.assertEqual(a["b"], 5) def test_empty_array(self): named_array.NamedNumpyArray([], [None, ["a", "b"]]) with self.assertRaises(ValueError): # Must be the right length. named_array.NamedNumpyArray([], [["a", "b"]]) with self.assertRaises(ValueError): # Returning an empty slice is not supported, and it's not clear how or # even if it should be supported. named_array.NamedNumpyArray([], [["a", "b"], None]) with self.assertRaises(ValueError): # Scalar arrays are unsupported. named_array.NamedNumpyArray(1, []) def test_named_array_multi_first(self): a = named_array.NamedNumpyArray([[1, 3], [6, 8]], [["a", "b"], None]) self.assertArrayEqual(a.a, [1, 3]) self.assertArrayEqual(a[1], [6, 8]) self.assertArrayEqual(a["b"], [6, 8]) self.assertArrayEqual(a[::-1], [[6, 8], [1, 3]]) self.assertArrayEqual(a[::-1][::-1], [[1, 3], [6, 8]]) self.assertArrayEqual(a[::-1, ::-1], [[8, 6], [3, 1]]) self.assertArrayEqual(a[::-1][0], [6, 8]) self.assertArrayEqual(a[::-1, 0], [6, 1]) self.assertArrayEqual(a[::-1, 1], [8, 3]) self.assertArrayEqual(a[::-1].a, [1, 3]) self.assertArrayEqual(a[::-1].a[0], 1) self.assertArrayEqual(a[::-1].b, [6, 8]) self.assertArrayEqual(a[[0, 0]], [[1, 3], [1, 3]]) with self.assertRaises(TypeError): a[[0, 0]].a # pylint: disable=pointless-statement self.assertEqual(a[0, 1], 3) self.assertEqual(a[(0, 1)], 3) self.assertEqual(a["a", 0], 1) self.assertEqual(a["b", 0], 6) self.assertEqual(a["b", 1], 8) self.assertEqual(a.a[0], 1) self.assertArrayEqual(a[a > 2], [3, 6, 8]) self.assertArrayEqual(a[a % 3 == 0], [3, 6]) with self.assertRaises(TypeError): a[0].a # pylint: disable=pointless-statement # New axis = None self.assertArrayEqual(a, [[1, 3], [6, 8]]) self.assertArrayEqual(a[np.newaxis], [[[1, 3], [6, 8]]]) self.assertArrayEqual(a[None], [[[1, 3], [6, 8]]]) self.assertArrayEqual(a[None, :], [[[1, 3], [6, 8]]]) self.assertArrayEqual(a[None, "a"], [[1, 3]]) self.assertArrayEqual(a[:, None], [[[1, 3]], [[6, 8]]]) self.assertArrayEqual(a[None, :, None], [[[[1, 3]], [[6, 8]]]]) self.assertArrayEqual(a[None, 0, None], [[[1, 3]]]) self.assertArrayEqual(a[None, "a", None], [[[1, 3]]]) self.assertArrayEqual(a[None][None], [[[[1, 3], [6, 8]]]]) self.assertArrayEqual(a[None][0], [[1, 3], [6, 8]]) self.assertArrayEqual(a[None][0].a, [1, 3]) self.assertEqual(a[None][0].a[0], 1) self.assertEqual(a[None][0, "b", 1], 8) def test_named_array_multi_second(self): a = named_array.NamedNumpyArray([[1, 3], [6, 8]], [None, ["a", "b"]]) self.assertArrayEqual(a[0], [1, 3]) self.assertEqual(a[0, 1], 3) self.assertEqual(a[0, "a"], 1) self.assertEqual(a[0, "b"], 3) self.assertEqual(a[1, "b"], 8) self.assertEqual(a[0].a, 1) self.assertArrayEqual(a[a > 2], [3, 6, 8]) self.assertArrayEqual(a[a % 3 == 0], [3, 6]) with self.assertRaises(TypeError): a.a # pylint: disable=pointless-statement self.assertArrayEqual(a[None, :, "a"], [[1, 6]]) def test_masking(self): a = named_array.NamedNumpyArray([[1, 2, 3, 4], [5, 6, 7, 8]], [None, list("abcd")]) self.assertArrayEqual(a[a > 2], [3, 4, 5, 6, 7, 8]) self.assertArrayEqual(a[a < 4], [1, 2, 3]) self.assertArrayEqual(a[a % 2 == 0], [2, 4, 6, 8]) self.assertArrayEqual(a[a % 3 == 0], [3, 6]) def test_slicing(self): a = named_array.NamedNumpyArray([1, 2, 3, 4, 5], list("abcde")) self.assertArrayEqual(a[:], [1, 2, 3, 4, 5]) self.assertArrayEqual(a[::], [1, 2, 3, 4, 5]) self.assertArrayEqual(a[::2], [1, 3, 5]) self.assertArrayEqual(a[::-1], [5, 4, 3, 2, 1]) self.assertEqual(a[:].a, 1) self.assertEqual(a[::].b, 2) self.assertEqual(a[::2].c, 3) with self.assertRaises(AttributeError): a[::2].d # pylint: disable=pointless-statement self.assertEqual(a[::-1].e, 5) self.assertArrayEqual(a[a % 2 == 0], [2, 4]) self.assertEqual(a[a % 2 == 0].b, 2) a = named_array.NamedNumpyArray([[1, 2, 3, 4], [5, 6, 7, 8]], [None, list("abcd")]) self.assertArrayEqual(a[:], [[1, 2, 3, 4], [5, 6, 7, 8]]) self.assertArrayEqual(a[::], [[1, 2, 3, 4], [5, 6, 7, 8]]) self.assertArrayEqual(a[:, :], [[1, 2, 3, 4], [5, 6, 7, 8]]) self.assertArrayEqual(a[:, ...], [[1, 2, 3, 4], [5, 6, 7, 8]]) self.assertArrayEqual(a[..., ::], [[1, 2, 3, 4], [5, 6, 7, 8]]) self.assertArrayEqual(a[:, ::2], [[1, 3], [5, 7]]) self.assertArrayEqual(a[::-1], [[5, 6, 7, 8], [1, 2, 3, 4]]) self.assertArrayEqual(a[..., ::-1], [[4, 3, 2, 1], [8, 7, 6, 5]]) self.assertArrayEqual(a[:, ::-1], [[4, 3, 2, 1], [8, 7, 6, 5]]) self.assertArrayEqual(a[:, ::-2], [[4, 2], [8, 6]]) self.assertArrayEqual(a[:, -2::-2], [[3, 1], [7, 5]]) self.assertArrayEqual(a[::-1, -2::-2], [[7, 5], [3, 1]]) self.assertArrayEqual(a[..., 0, 0], 1) # weird scalar arrays... a = named_array.NamedNumpyArray( [[[[0, 1], [2, 3]], [[4, 5], [6, 7]]], [[[8, 9], [10, 11]], [[12, 13], [14, 15]]]], [["a", "b"], ["c", "d"], ["e", "f"], ["g", "h"]]) self.assertEqual(a.a.c.e.g, 0) self.assertEqual(a.b.c.f.g, 10) self.assertEqual(a.b.d.f.h, 15) self.assertArrayEqual(a[0, ..., 0], [[0, 2], [4, 6]]) self.assertArrayEqual(a[0, ..., 1], [[1, 3], [5, 7]]) self.assertArrayEqual(a[0, 0, ..., 1], [1, 3]) self.assertArrayEqual(a[0, ..., 1, 1], [3, 7]) self.assertArrayEqual(a[..., 1, 1], [[3, 7], [11, 15]]) self.assertArrayEqual(a[1, 0, ...], [[8, 9], [10, 11]]) self.assertArrayEqual(a["a", ..., "g"], [[0, 2], [4, 6]]) self.assertArrayEqual(a["a", ...], [[[0, 1], [2, 3]], [[4, 5], [6, 7]]]) self.assertArrayEqual(a[..., "g"], [[[0, 2], [4, 6]], [[8, 10], [12, 14]]]) self.assertArrayEqual(a["a", "c"], [[0, 1], [2, 3]]) self.assertArrayEqual(a["a", ...].c, [[0, 1], [2, 3]]) self.assertArrayEqual(a["a", ..., "g"].c, [0, 2]) with self.assertRaises(TypeError): a[np.array([[0, 1], [0, 1]])] # pylint: disable=pointless-statement, expression-not-assigned with self.assertRaises(IndexError): a[..., 0, ...] # pylint: disable=pointless-statement def test_string(self): a = named_array.NamedNumpyArray([1, 3, 6], ["a", "b", "c"], dtype=np.int32) self.assertEqual(str(a), "[1 3 6]") self.assertEqual(repr(a), ("NamedNumpyArray([1, 3, 6], ['a', 'b', 'c'], " "dtype=int32)")) a = named_array.NamedNumpyArray([[1, 3], [6, 8]], [None, ["a", "b"]]) self.assertEqual(str(a), "[[1 3]\n [6 8]]") self.assertEqual(repr(a), ("NamedNumpyArray([[1, 3],\n" " [6, 8]], [None, ['a', 'b']])")) a = named_array.NamedNumpyArray([[1, 3], [6, 8]], [["a", "b"], None]) self.assertEqual(str(a), "[[1 3]\n [6 8]]") self.assertEqual(repr(a), ("NamedNumpyArray([[1, 3],\n" " [6, 8]], [['a', 'b'], None])")) a = named_array.NamedNumpyArray([0, 0, 0, 50, 0, 0, 0, 0, 0, 0, 0, 0, 0], [str(i) for i in range(13)], dtype=np.int32) numpy_repr = np.array_repr(a) if "\n" in numpy_repr: # ie numpy > 1.14 self.assertEqual(repr(a), """ NamedNumpyArray([ 0, 0, 0, 50, 0, 0, 0, 0, 0, 0, 0, 0, 0], ['0', '1', '2', '3', '4', '...', '8', '9', '10', '11', '12'], dtype=int32)""".strip()) # Keep the middle newlines. else: self.assertEqual(repr(a), ( "NamedNumpyArray(" "[ 0, 0, 0, 50, 0, 0, 0, 0, 0, 0, 0, 0, 0], " "['0', '1', '2', '3', '4', '...', '8', '9', '10', '11', '12'], " "dtype=int32)")) # Note the lack of newlines. a = named_array.NamedNumpyArray([list(range(50))] * 50, [None, ["a%s" % i for i in range(50)]]) self.assertIn("49", str(a)) self.assertIn("49", repr(a)) self.assertIn("a4", repr(a)) self.assertIn("a49", repr(a)) a = named_array.NamedNumpyArray([list(range(50))] * 50, [["a%s" % i for i in range(50)], None]) self.assertIn("49", str(a)) self.assertIn("49", repr(a)) self.assertIn("a4", repr(a)) self.assertIn("a49", repr(a)) def test_pickle(self): arr = named_array.NamedNumpyArray([1, 3, 6], ["a", "b", "c"]) pickled = pickle.loads(pickle.dumps(arr)) self.assertTrue(np.all(arr == pickled)) self.assertEqual(repr(pickled), "NamedNumpyArray([1, 3, 6], ['a', 'b', 'c'])") if __name__ == "__main__": absltest.main()
#!/usr/bin/env python # -*- coding: utf-8 -*- # # fsfs-reshard.py REPOS_PATH MAX_FILES_PER_SHARD # # Perform an offline conversion of an FSFS repository between linear (format # 2, usable by Subversion 1.4+) and sharded (format 3, usable by Subversion # 1.5+) layouts. # # The MAX_FILES_PER_SHARD argument specifies the maximum number of files # that will be stored in each shard (directory), or zero to specify a linear # layout. Subversion 1.5 uses a default value of 1000 files per shard. # # As the repository will not be valid while the conversion is in progress, # the repository administrator must ensure that access to the repository is # blocked for the duration of the conversion. # # In the event that the conversion is interrupted, the repository will be in # an inconsistent state. The repository administrator should then re-run # this tool to completion. # # # Note that, currently, resharding from one sharded layout to another is # likely to be an extremely slow process. To reshard, we convert from a # sharded to linear layout and then to the new sharded layout. The problem # is that the initial conversion to the linear layout triggers exactly the # same 'large number of files in a directory' problem that sharding is # intended to solve. # # ==================================================================== # Licensed to the Apache Software Foundation (ASF) under one # or more contributor license agreements. See the NOTICE file # distributed with this work for additional information # regarding copyright ownership. The ASF licenses this file # to you under the Apache License, Version 2.0 (the # "License"); you may not use this file except in compliance # with the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the License for the # specific language governing permissions and limitations # under the License. # ==================================================================== # # $HeadURL$ # $LastChangedDate$ # $LastChangedBy$ # $LastChangedRevision$ import os, stat, sys from errno import EEXIST def usage(): """Print a usage message and exit.""" print("""usage: %s REPOS_PATH MAX_FILES_PER_SHARD [START END] Perform an offline conversion of an FSFS repository between linear (readable by Subversion 1.4 or later) and sharded (readable by Subversion 1.5 or later) layouts. The MAX_FILES_PER_SHARD argument specifies the maximum number of files that will be stored in each shard (directory), or zero to specify a linear layout. Subversion 1.5 uses a default value of 1000 files per shard. Convert revisions START through END inclusive if specified, or all revisions if unspecified. """ % sys.argv[0]) sys.exit(1) def incompatible_repos_format(repos_path, format): """Print an error saying that REPOS_PATH is a repository with an incompatible repository format FORMAT, then exit.""" sys.stderr.write("""error: unable to convert repository '%s'. This repository is not compatible with this tool. Valid repository formats are '3' or '5'; this repository is format '%s'. """ % (repos_path, format)) sys.stderr.flush() sys.exit(1) def incompatible_fs_format(repos_path, format): """Print an error saying that REPOS_PATH is a repository with an incompatible filesystem format FORMAT, then exit.""" sys.stderr.write("""error: unable to convert repository '%s'. This repository contains a filesystem that is not compatible with this tool. Valid filesystem formats are '1', '2', or '3'; this repository contains a filesystem with format '%s'. """ % (repos_path, format)) sys.stderr.flush() sys.exit(1) def unexpected_fs_format_options(repos_path): """Print an error saying that REPOS_PATH is a repository with unexpected filesystem format options, then exit.""" sys.stderr.write("""error: unable to convert repository '%s'. This repository contains a filesystem that appears to be invalid - there is unexpected data after the filesystem format number. """ % repos_path) sys.stderr.flush() sys.exit(1) def incompatible_fs_format_option(repos_path, option): """Print an error saying that REPOS_PATH is a repository with an incompatible filesystem format option OPTION, then exit.""" sys.stderr.write("""error: unable to convert repository '%s'. This repository contains a filesystem that is not compatible with this tool. This tool recognises the 'layout' option but the filesystem uses the '%s' option. """ % (repos_path, option)) sys.stderr.flush() sys.exit(1) def warn_about_fs_format_1(repos_path, format_path): """Print a warning saying that REPOS_PATH contains a format 1 FSFS filesystem that we can't reconstruct, then exit.""" sys.stderr.write("""warning: conversion of '%s' will be one-way. This repository is currently readable by Subversion 1.1 or later. This tool can convert this repository to one that is readable by either Subversion 1.4 (or later) or Subversion 1.5 (or later), but it is not able to convert it back to the original format - a separate dump/load step would be required. If you would like to upgrade this repository anyway, delete the file '%s' and re-run this tool. """ % (repos_path, format_path)) sys.stderr.flush() sys.exit(1) def check_repos_format(repos_path): """Check that REPOS_PATH contains a repository with a suitable format; print a message and exit if not.""" format_path = os.path.join(repos_path, 'format') try: format_file = open(format_path) format = format_file.readline() if not format.endswith('\n'): incompatible_repos_format(repos_path, format + ' <missing newline>') format = format.rstrip('\n') if format == '3' or format == '5': pass else: incompatible_repos_format(repos_path, format) except IOError: # In all likelihood, the file doesn't exist. incompatible_repos_format(repos_path, '<unreadable>') def check_fs_format(repos_path): """Check that REPOS_PATH contains a filesystem with a suitable format, or that it contains no format file; print a message and exit if neither is true. Return bool whether the filesystem is sharded.""" sharded = False db_path = os.path.join(repos_path, 'db') format_path = os.path.join(db_path, 'format') try: format_file = open(format_path) format = format_file.readline() if not format.endswith('\n'): incompatible_fs_format(repos_path, format + ' <missing newline>') format = format.rstrip('\n') if format == '1': # This is a format 1 (svndiff0 only) filesystem. We can upgrade it, # but we can't downgrade again (since we can't uncompress any of the # svndiff1 deltas that may have been written). Warn the user and exit. warn_about_fs_format_1(repos_path, format_path) if format == '2': pass elif format == '3': pass else: incompatible_fs_format(repos_path, format) for line in format_file: if format == '2': unexpected_fs_format_options(repos_path) line = line.rstrip('\n') if line == 'layout linear': pass elif line.startswith('layout sharded '): sharded = True else: incompatible_fs_format_option(repos_path, line) format_file.close() except IOError: # The format file might not exist if we've previously been interrupted, # or if the user is following our advice about upgrading a format 1 # repository. In both cases, we'll just assume the format was # compatible. pass return sharded def current_file(repos_path): """Return triple of (revision, next_node_id, next_copy_id) from REPOS_PATH/db/current .""" return open(os.path.join(repos_path, 'db', 'current')).readline().split() def remove_fs_format(repos_path): """Remove the filesystem format file for repository REPOS_PATH. Do not raise an error if the file is already missing.""" format_path = os.path.join(repos_path, 'db', 'format') try: statinfo = os.stat(format_path) except OSError: # The file probably doesn't exist. return # On Windows, we need to ensure the file is writable before we can # remove it. os.chmod(format_path, statinfo.st_mode | stat.S_IWUSR) os.remove(format_path) def write_fs_format(repos_path, contents): """Write a new filesystem format file for repository REPOS_PATH containing CONTENTS.""" format_path = os.path.join(repos_path, 'db', 'format') f = open(format_path, 'wb') f.write(contents) f.close() os.chmod(format_path, stat.S_IRUSR | stat.S_IRGRP) def linearise(path): """Move all the files in subdirectories of PATH into PATH, and remove the subdirectories. Handle conflicts between subdirectory names and files contained in subdirectories by ensuring subdirectories have a '.shard' suffix prior to moving (the files are assumed not to have this suffix. Abort if a subdirectory is found to contain another subdirectory.""" # First enumerate all subdirectories of DIR and rename where necessary # to include a .shard suffix. for name in os.listdir(path): if name.endswith('.shard'): continue subdir_path = os.path.join(path, name) if not os.path.isdir(subdir_path): continue os.rename(subdir_path, subdir_path + '.shard') # Now move all the subdirectory contents into the parent and remove # the subdirectories. for root_path, dirnames, filenames in os.walk(path): if root_path == path: continue if len(dirnames) > 0: sys.stderr.write("error: directory '%s' contains other unexpected directories.\n" \ % root_path) sys.stderr.flush() sys.exit(1) for name in filenames: from_path = os.path.join(root_path, name) to_path = os.path.join(path, name) os.rename(from_path, to_path) os.rmdir(root_path) def shard(path, max_files_per_shard, start, end): """Move the files for revisions START to END inclusive in PATH into subdirectories of PATH named such that subdirectory '0' contains at most MAX_FILES_PER_SHARD files, those named [0, MAX_FILES_PER_SHARD). Abort if PATH is found to contain any entries with non-numeric names.""" tmp = path + '.reshard' try: os.mkdir(tmp) except OSError, e: if e.errno != EEXIST: raise # Move all entries into shards named N.shard. for rev in range(start, end + 1): name = str(rev) shard = rev // max_files_per_shard shard_name = str(shard) + '.shard' from_path = os.path.join(path, name) to_path = os.path.join(tmp, shard_name, name) try: os.rename(from_path, to_path) except OSError: # The most likely explanation is that the shard directory doesn't # exist. Let's create it and retry the rename. os.mkdir(os.path.join(tmp, shard_name)) os.rename(from_path, to_path) # Now rename all the shards to remove the suffix. skipped = 0 for name in os.listdir(tmp): if not name.endswith('.shard'): sys.stderr.write("warning: ignoring unexpected subdirectory '%s'.\n" \ % os.path.join(tmp, name)) sys.stderr.flush() skipped += 1 continue from_path = os.path.join(tmp, name) to_path = os.path.join(path, os.path.basename(from_path)[:-6]) os.rename(from_path, to_path) skipped == 0 and os.rmdir(tmp) def main(): if len(sys.argv) < 3: usage() repos_path = sys.argv[1] max_files_per_shard = sys.argv[2] try: start = int(sys.argv[3]) end = int(sys.argv[4]) except IndexError: start = 0 end = int(current_file(repos_path)[0]) # Validate the command-line arguments. db_path = os.path.join(repos_path, 'db') current_path = os.path.join(db_path, 'current') if not os.path.exists(current_path): sys.stderr.write("error: '%s' doesn't appear to be a Subversion FSFS repository.\n" \ % repos_path) sys.stderr.flush() sys.exit(1) try: max_files_per_shard = int(max_files_per_shard) except ValueError, OverflowError: sys.stderr.write("error: maximum files per shard ('%s') is not a valid number.\n" \ % max_files_per_shard) sys.stderr.flush() sys.exit(1) if max_files_per_shard < 0: sys.stderr.write("error: maximum files per shard ('%d') must not be negative.\n" \ % max_files_per_shard) sys.stderr.flush() sys.exit(1) # Check the format of the repository. check_repos_format(repos_path) sharded = check_fs_format(repos_path) # Let the user know what's going on. if max_files_per_shard > 0: print("Converting '%s' to a sharded structure with %d files per directory" \ % (repos_path, max_files_per_shard)) if sharded: print('(will convert to a linear structure first)') else: print("Converting '%s' to a linear structure" % repos_path) # Prevent access to the repository for the duration of the conversion. # There's no clean way to do this, but since the format of the repository # is indeterminate, let's remove the format file while we're converting. print('- marking the repository as invalid') remove_fs_format(repos_path) # First, convert to a linear scheme (this makes recovery easier because # it's easier to reason about the behaviour on restart). if sharded: print('- linearising db/revs') linearise(os.path.join(repos_path, 'db', 'revs')) print('- linearising db/revprops') linearise(os.path.join(repos_path, 'db', 'revprops')) if max_files_per_shard == 0: # We're done. Stamp the filesystem with a format 2 db/format file. print('- marking the repository as a valid linear repository') write_fs_format(repos_path, '2\n') else: print('- sharding db/revs') shard(os.path.join(repos_path, 'db', 'revs'), max_files_per_shard, start, end) print('- sharding db/revprops') shard(os.path.join(repos_path, 'db', 'revprops'), max_files_per_shard, start, end) # We're done. Stamp the filesystem with a format 3 db/format file. print('- marking the repository as a valid sharded repository') write_fs_format(repos_path, '3\nlayout sharded %d\n' % max_files_per_shard) print('- done.') sys.exit(0) if __name__ == '__main__': raise Exception("""This script is unfinished and not ready to be used on live data. Trust us.""") main()
# Waltz # Compare results between wild type and mutant # coding=utf-8 import numpy as np import matplotlib.pyplot as plt import pandas as pd import csv from scipy import stats from pylab import plot, show, savefig, xlim, figure, \ hold, ylim, legend, boxplot, setp, axes import pylab from numpy import * def getColumn(filename, column,deli): results = csv.reader(open(filename), delimiter=deli) return [result[column] for result in results] #import files file_wt = 'waltzresults_wt.csv' file_mut = 'waltzresults_mut.csv' #------------------------------------ # AGGREGATION #------------------------------------ #-------------------------------------- # SCATTER PLOT pred_wt = getColumn(file_wt,3,'\t') pred_mut = getColumn(file_mut,3,'\t') pred_wt.pop(0) pred_mut.pop(0) x,y=[],[] for i in range(0,len(pred_wt)): #max=98.662207 if pred_wt[i]=='NA': x.append(np.nan) else: x.append(float(pred_wt[i])) for i in range(0,len(pred_mut)): #max=99.665552 if pred_mut[i]=='NA': y.append(np.nan) else: y.append(float(pred_mut[i])) fig = plt.figure() a=b=[0,100] plt.scatter(x, y,edgecolor = 'none', c= 'k') plt.plot(a,b,'r-') plt.grid('on') plt.xlim(-1,101) plt.ylim(-1,101) plt.xlabel('Wild types') plt.ylabel('Deleterious DIDA mutants') fig.savefig('waltz_wtVSmut.jpg') #---------------- # PROBABILITY DENSITY CURVE fig = figure() mu1, std1 = stats.norm.fit(x) mu2, std2 = stats.norm.fit(y) xmin1, xmax1 = plt.xlim() xmin2, xmax2 = plt.xlim() x1 = np.linspace(xmin1, 100, 100) x2 = np.linspace(xmin2, 100, 100) p1 = stats.norm.pdf(x1, mu1, std1) p2 = stats.norm.pdf(x2, mu2, std2) plt.plot(x1, p1, 'k',label='Wild types (fit results: mu=%.2f,std=%.2f)'%(mu1, std1)) plt.plot(x2, p2, 'r',label='Deleterious DIDA mutants \n(fit results: mu=%.2f,std=%.2f)'%(mu2, std2)) plt.xlabel('Aggregation conformation predicted values (amylogenic regions)') plt.ylabel('Frequency') plt.xlim(0,100) #plt.ylim(0,0.0) plt.legend(loc='upper right') fig.savefig('histwaltz_missense.png') #missense_wt - missense_mut miss=[] [miss.append(a_i - b_i) for a_i, b_i in zip(x, y)] #KOLMOGOROV-SMINORV: stats.kstest(miss,'norm') # (D,pvalue) = (0.3552063996073398, 0.0) #So we reject H0 -> not normal distribution #WILCOXON TEST: stats.wilcoxon(miss) # (T, pvalue) = (4898.0, 0.29548245005836105) #So we do not reject H0 -> There is no significant difference between wt and mut #-------------------------------------- # AGGREGATION ENVIRONMENT #-------------------------------------- #-------------------------------------- # SCATTER PLOT pred_wt = getColumn(file_wt,4,'\t') pred_mut = getColumn(file_mut,4,'\t') pred_wt.pop(0) pred_mut.pop(0) x,y=[],[] for i in range(0,len(pred_wt)): #max=98.662207 if pred_wt[i]=='NA': x.append(np.nan) else: x.append(float(pred_wt[i])) for i in range(0,len(pred_mut)): #max=98.996656 if pred_mut[i]=='NA': y.append(np.nan) else: y.append(float(pred_mut[i])) fig = plt.figure() a=b=[0,100] plt.scatter(x, y,edgecolor = 'none', c= 'k') plt.plot(a,b,'r-') plt.grid('on') plt.xlim(-1,101) plt.ylim(-1,101) plt.xlabel('Wild types') plt.ylabel('Deleterious DIDA mutants') fig.savefig('waltz_envt_wtVSmut.jpg') #-------------------------------------- # HISTOGRAM fig = figure() mu1, std1 = stats.norm.fit(x) mu2, std2 = stats.norm.fit(y) xmin1, xmax1 = plt.xlim() xmin2, xmax2 = plt.xlim() x1 = np.linspace(xmin1, 100, 100) x2 = np.linspace(xmin2, 100, 100) p1 = stats.norm.pdf(x1, mu1, std1) p2 = stats.norm.pdf(x2, mu2, std2) plt.plot(x1, p1, 'k',label='Wild types (fit results: mu=%.2f,std=%.2f)'%(mu1, std1)) plt.plot(x2, p2, 'r',label='Deleterious DIDA mutants \n(fit results: mu=%.2f,std=%.2f)'%(mu2, std2)) plt.xlabel('Aggregation conformation predicted values (amylogenic regions)') plt.ylabel('Frequency') plt.xlim(0,100) plt.ylim(0,0.06) plt.legend(loc='upper right') fig.savefig('histwaltzenvt_missense.png') #missense_wt - missense_mut miss=[] [miss.append(a_i - b_i) for a_i, b_i in zip(x, y)] #KOLMOGOROV-SMINORV: stats.kstest(miss,'norm') # (D,pvalue) = (0.34964202670995748, 0.0) #So we reject H0 -> not normal distribution #WILCOXON TEST: stats.wilcoxon(miss) #-> (T, pvalue) = (8711.0, 0.55024961096028457) #So we do not reject H0 -> There is no significant difference between wt and mut #----------------------------------------------------------------------------- # OUTLIERS FOR AGGREGATION () #----------------------------------------------------------------------------- pred_wt = getColumn(file_wt,3,'\t') pred_mut = getColumn(file_mut,3,'\t') pred_wt.pop(0) pred_mut.pop(0) pred_envt_wt = getColumn(file_wt,4,'\t') pred_envt_mut = getColumn(file_mut,4,'\t') pred_envt_wt.pop(0) pred_envt_mut.pop(0) variant_liste = getColumn(file_wt,0,'\t') output = open('waltz_outliers.csv','w') output.write('ID,agg_wt,agg_mut,difference,agg_envt_wt,agg_envt_mut,difference_envt\n') for i in range(0,len(pred_wt)): for j in range(0,len(pred_mut)): if i==j: if pred_wt[i]!='NA'and pred_mut[j]!='NA': if (abs(float(pred_wt[i])-float(pred_mut[j]))) > 20: output.write(variant_liste[i+1] + ',' + pred_wt[i] + ',' + pred_mut[j] + ',' + str(abs(float(pred_wt[i])-float(pred_mut[j]))) + ',' + pred_envt_wt[i] + ',' + pred_envt_mut[i] + ',' + str(abs(float(pred_envt_wt[i])-float(pred_envt_mut[j]))) + '\n') output.close() #------------------------------------------------------------------------------- #COMPARISON WITH NETSURFP RSA #------------------------------------------------------------------------------- W_wt = pd.read_csv(file_wt,'\t') W_mut = pd.read_csv(file_mut,'\t') W_wt['DWaltz'] = '' W_wt['DWaltz'] = W_wt.aggregation - W_mut.aggregation W_wt['DWaltz_envt'] = '' W_wt['DWaltz_envt'] = W_wt.aggregation_envt - W_mut.aggregation_envt W_wt = W_wt.drop(['aggregation','aggregation_envt'], 1) W_wt.to_csv('waltzresults_compare.csv', index=False) #RESIDUE waltz = getColumn('waltzresults_compare.csv',3,',') waltz.pop(0) netsurfp = getColumn('netsurfpresults_compare.csv',3,',') netsurfp.pop(0) x,y=[],[] for i in range(0,len(netsurfp)): #min=-0.183 and max=0.302 if netsurfp[i]=='': x.append(np.nan) else: x.append(float(netsurfp[i])) for i in range(0,len(waltz)): #min=-98.862207 and max=98.327759 if waltz[i]=='': y.append(np.nan) else: y.append(float(waltz[i])) fig = plt.figure() plt.scatter(x, y,edgecolor = 'none', c= 'k') plt.grid('on') plt.xlim(-0.4,0.4) plt.ylim(-100,100) plt.xlabel('delta(Solvent accessibility prediction) by NetSurfP') plt.ylabel('delta(Aggregation conformation prediction) by Waltz') fig.savefig('WaltzVSnetsurfp.jpg') #ENVIRONMENT waltz_envt = getColumn('waltzresults_compare.csv',4,',') waltz_envt.pop(0) netsurfp_envt = getColumn('netsurfpresults_compare.csv',4,',') netsurfp_envt.pop(0) x,y=[],[] for i in range(0,len(netsurfp_envt)): #min=-0.183 and max=0.302 if netsurfp_envt[i]=='': x.append(np.nan) else: x.append(float(netsurfp_envt[i])) for i in range(0,len(waltz_envt)): #min=-98.862207 and max=98.327759 if waltz_envt[i]=='': y.append(np.nan) else: y.append(float(waltz_envt[i])) fig = plt.figure() plt.scatter(x, y,edgecolor = 'none', c= 'k') plt.grid('on') plt.xlim(-0.4,0.4) plt.ylim(-100,100) plt.xlabel('delta(Solvent accessibility prediction) by NetSurfP') plt.ylabel('delta(Aggregation conformation prediction) by Waltz') fig.savefig('WaltzVSnetsurfp_envt.jpg')
""" API for the command-line I{pyflakes} tool. """ from __future__ import with_statement import ast import os import platform import re import sys from pyflakes import checker, __version__ from pyflakes import reporter as modReporter __all__ = ['check', 'checkPath', 'checkRecursive', 'iterSourceCode', 'main'] PYTHON_SHEBANG_REGEX = re.compile(br'^#!.*\bpython([23](\.\d+)?|w)?[dmu]?\s') def check(codeString, filename, reporter=None): """ Check the Python source given by C{codeString} for flakes. @param codeString: The Python source to check. @type codeString: C{str} @param filename: The name of the file the source came from, used to report errors. @type filename: C{str} @param reporter: A L{Reporter} instance, where errors and warnings will be reported. @return: The number of warnings emitted. @rtype: C{int} """ if reporter is None: reporter = modReporter._makeDefaultReporter() # First, compile into an AST and handle syntax errors. try: tree = ast.parse(codeString, filename=filename) except SyntaxError: value = sys.exc_info()[1] msg = value.args[0] (lineno, offset, text) = value.lineno, value.offset, value.text if checker.PYPY: if text is None: lines = codeString.splitlines() if len(lines) >= lineno: text = lines[lineno - 1] if sys.version_info >= (3, ) and isinstance(text, bytes): try: text = text.decode('ascii') except UnicodeDecodeError: text = None offset -= 1 # If there's an encoding problem with the file, the text is None. if text is None: # Avoid using msg, since for the only known case, it contains a # bogus message that claims the encoding the file declared was # unknown. reporter.unexpectedError(filename, 'problem decoding source') else: reporter.syntaxError(filename, msg, lineno, offset, text) return 1 except Exception: reporter.unexpectedError(filename, 'problem decoding source') return 1 # Okay, it's syntactically valid. Now check it. file_tokens = checker.make_tokens(codeString) w = checker.Checker(tree, file_tokens=file_tokens, filename=filename) w.messages.sort(key=lambda m: m.lineno) for warning in w.messages: reporter.flake(warning) return len(w.messages) def checkPath(filename, reporter=None): """ Check the given path, printing out any warnings detected. @param reporter: A L{Reporter} instance, where errors and warnings will be reported. @return: the number of warnings printed """ if reporter is None: reporter = modReporter._makeDefaultReporter() try: with open(filename, 'rb') as f: codestr = f.read() except IOError: msg = sys.exc_info()[1] reporter.unexpectedError(filename, msg.args[1]) return 1 return check(codestr, filename, reporter) def isPythonFile(filename): """Return True if filename points to a Python file.""" if filename.endswith('.py'): return True # Avoid obvious Emacs backup files if filename.endswith("~"): return False max_bytes = 128 try: with open(filename, 'rb') as f: text = f.read(max_bytes) if not text: return False except IOError: return False return PYTHON_SHEBANG_REGEX.match(text) def iterSourceCode(paths): """ Iterate over all Python source files in C{paths}. @param paths: A list of paths. Directories will be recursed into and any .py files found will be yielded. Any non-directories will be yielded as-is. """ for path in paths: if os.path.isdir(path): for dirpath, dirnames, filenames in os.walk(path): for filename in filenames: full_path = os.path.join(dirpath, filename) if isPythonFile(full_path): yield full_path else: yield path def checkRecursive(paths, reporter): """ Recursively check all source files in C{paths}. @param paths: A list of paths to Python source files and directories containing Python source files. @param reporter: A L{Reporter} where all of the warnings and errors will be reported to. @return: The number of warnings found. """ warnings = 0 for sourcePath in iterSourceCode(paths): warnings += checkPath(sourcePath, reporter) return warnings def _exitOnSignal(sigName, message): """Handles a signal with sys.exit. Some of these signals (SIGPIPE, for example) don't exist or are invalid on Windows. So, ignore errors that might arise. """ import signal try: sigNumber = getattr(signal, sigName) except AttributeError: # the signal constants defined in the signal module are defined by # whether the C library supports them or not. So, SIGPIPE might not # even be defined. return def handler(sig, f): sys.exit(message) try: signal.signal(sigNumber, handler) except ValueError: # It's also possible the signal is defined, but then it's invalid. In # this case, signal.signal raises ValueError. pass def _get_version(): """ Retrieve and format package version along with python version & OS used """ return ('%s Python %s on %s' % (__version__, platform.python_version(), platform.system())) def main(prog=None, args=None): """Entry point for the script "pyflakes".""" import argparse # Handle "Keyboard Interrupt" and "Broken pipe" gracefully _exitOnSignal('SIGINT', '... stopped') _exitOnSignal('SIGPIPE', 1) parser = argparse.ArgumentParser(prog=prog, description='Check Python source files for errors') parser.add_argument('-V', '--version', action='version', version=_get_version()) parser.add_argument('path', nargs='*', help='Path(s) of Python file(s) to check. STDIN if not given.') args = parser.parse_args(args=args).path reporter = modReporter._makeDefaultReporter() if args: warnings = checkRecursive(args, reporter) else: warnings = check(sys.stdin.read(), '<stdin>', reporter) raise SystemExit(warnings > 0)
# -*- coding: utf-8 -*- """ Synchronisation - Controllers @author: Amer Tahir """ module = "admin" module_name = T("Synchronization") log_table = "sync_log" conflict_table = "sync_conflict" sync_peer = None sync_policy = None import_export_format = "xml" # Options Menu (available in all Functions' Views) # - can Insert/Delete items from default menus within a function, if required. response.menu_options = admin_menu_options # Web2Py Tools functions def call(): "Call an XMLRPC, JSONRPC or RSS service" # Sync webservices don't use sessions, so avoid cluttering up the storage session.forget() return service() # ----------------------------------------------------------------------------- # S3 framework functions def index(): "Module's Home Page" return dict(module_name=module_name) import urllib2 # ----------------------------------------------------------------------------- class RequestWithMethod(urllib2.Request): """ ??? @todo: add doc string """ def __init__(self, method, *args, **kwargs): """ docstring? """ self._method = method urllib2.Request.__init__(self, *args, **kwargs) def get_method(self): """ docstring? """ return self._method # ----------------------------------------------------------------------------- class Error: """ Indicates an HTTP error """ def __init__(self, url, errcode, errmsg, headers, body=None): """ docstring??? """ self.url = url self.errcode = errcode self.errmsg = errmsg self.headers = headers self.body = body def __repr__(self): """ docstring??? """ return ( "Error for %s: %s %s\n Response body: %s" % (self.url, self.errcode, self.errmsg, self.body) ) # ----------------------------------------------------------------------------- class FetchURL: """ docstring ??? """ def fetch(self, request, host, path, data, cookie=None, username=None, password=None): """ docstring??? """ import httplib, base64 http = httplib.HTTPConnection(host) # write header headers = {"Content-type": "application/x-www-form-urlencoded", "Accept": "text/plain"} if cookie: headers["Cookie"] = cookie # auth if username: base64string = base64.encodestring("%s:%s" % (username, password))[:-1] authheader = "Basic %s" % base64string headers["Authorization"] = authheader http.request(request, path, data, headers) # get response response = http.getresponse() retcode = response.status retmsg = response.reason retbody = None if retcode != 200: try: retbody = response.read() except: retbody = None raise Error(str(host) + str(path), retcode, retmsg, headers, retbody) return response.read() # ----------------------------------------------------------------------------- @auth.requires_login() def now(): """ Manual synchronization """ import urllib, urlparse import gluon.contrib.simplejson as json final_status = "" sync_start = False if "start" in request.args: sync_start = True # retrieve sync now state state = db().select(db.sync_now.ALL, limitby=(0, 1)).first() if sync_start: # retrieve sync partners from DB peers = db().select(db.sync_partner.ALL) # retrieve all scheduled jobs set to run manually job = db.sync_schedule jobs = db((job.period == "m") & (job.enabled == True)).select(job.ALL) if not jobs: final_status = "There are no scheduled jobs. Please schedule a sync operation (set to run manually).<br /><br /><a href=\"" + URL(r=request, c="sync", f="schedule") + "\">Click here</a> to go to Sync Schedules page.<br /><br />\n" return dict(module_name=module_name, sync_status=final_status, sync_start=False, sync_state=state) # retrieve settings settings = db().select(db.sync_setting.ALL, limitby=(0, 1)).first() # url fetcher fetcher = FetchURL() final_status = "" # Find primay resources modules = deployment_settings.modules tables = [] for t in db.tables: table = db[t] if t.find("_") == -1: continue prefix, name = t.split("_", 1) if prefix in modules and \ "modified_on" in table.fields and \ "uuid" in table.fields: is_component = False hook = s3xrc.model.components.get(name, None) if hook: link = hook.get("_component", None) if link and link.tablename == t: continue for h in hook.values(): if isinstance(h, dict): link = h.get("_component", None) if link and link.tablename == t: is_component = True break if is_component: continue # No component tables.append(t) if not state: # New now-job res_list = tables # Tables to sync first_job = None job_cmd = None res_list = [] if jobs: first_job = jobs[0] if first_job: if first_job.job_type == 1: job_cmd = json.loads(first_job.job_command) res_list = job_cmd["resources"] # begin new sync now session sync_jobs_enabled_list = [] for job in jobs: if job.enabled: sync_jobs_enabled_list.append(str(job.id)) sync_now_id = db["sync_now"].insert( sync_jobs = ", ".join(map(str, sync_jobs_enabled_list)), started_on = request.utcnow, job_resources_done = "", job_resources_pending = ", ".join(map(str, res_list)), job_sync_errors = "" ) state = db(db.sync_now.id == sync_now_id).select(db.sync_now.ALL, limitby=(0, 1)).first() final_status += "Sync Now started:<br /><br /><br />\n" else: # Now already started sync_now_id = state.id final_status += "Sync Now resumed (originally started on " + state.started_on.strftime("%x %H:%M:%S")+ "):<br /><br /><br />\n" # unlock session - what for? session._unlock(response) # become super-user - what for? session.s3.roles.append(1) # get job from queue sync_jobs_list = state.sync_jobs.split(", ") if "" in sync_jobs_list: sync_jobs_list.remove("") sync_job = db(db.sync_schedule.id == int(sync_jobs_list[0])).select(db.sync_schedule.ALL, limitby=(0, 1)).first() job_cmd = None if sync_job: job_cmd = json.loads(sync_job.job_command) sync_job_partner = job_cmd["partner_uuid"] peer = db(db.sync_partner.uuid == sync_job_partner).select(limitby=(0, 1)).first() # Whether a push was successful push_success = False if sync_job and peer: final_status += "<br />Syncing with: " + \ peer.name + ", " + \ peer.instance_url + \ " (" + peer.instance_type + "):<br />\n\n" peer_sync_success = True last_sync_on = sync_job.last_run complete_sync = False sync_mode = 1 if "complete" in job_cmd and str(job_cmd["complete"]) == "True": complete_sync = True if "policy" in job_cmd: sync_policy = int(job_cmd["policy"]) if "mode" in job_cmd: sync_mode = int(job_cmd["mode"]) sync_resources = [] sync_errors = "" # Keep Session for local URLs cookie = str(response.session_id_name) + "=" + str(response.session_id) if sync_job.job_type == 1: # Eden <-> Eden # Sahana Eden sync # Build msince-query if last_sync_on is not None and complete_sync == False: msince = last_sync_on.strftime("%Y-%m-%dT%H:%M:%SZ") msince_query = "?msince=" + msince else: msince = "" msince_query = "" # Find resources to sync tablenames = state.job_resources_pending.split(",") #for _module, _resource in job_res_list: for tablename in tablenames: if tablename not in db.tables: continue if tablename.find("||") == -1: if tablename.find("_") == -1: continue else: prefix, name = tablename.split("_", 1) else: prefix, name = tablename.split("||", 1) resource = s3xrc.resource(prefix, name) sync_path = "sync/sync/%s/%s.%s" % (prefix, name, import_export_format) remote_url = urlparse.urlparse(peer.instance_url) if remote_url.path[-1] != "/": remote_path = "%s/%s" % (remote_url.path, sync_path) else: remote_path = "%s%s" % (remote_url.path, sync_path) if sync_mode in [1, 3]: # pull params = dict(msince=msince) fetch_url = "%s://%s%s?%s" % (remote_url.scheme, remote_url.netloc, remote_path, urllib.urlencode(params)) try: result = resource.fetch_xml(fetch_url, username=peer.username, password=peer.password) #proxy=settings.proxy) except SyntaxError, e: result = str(e) try: result_json = json.loads(result) except: error = str(result) else: if str(result_json["statuscode"]).startswith("2"): error = None else: error = str(result_json["message"]) if error: tablename_error = "%s (pull error)" sync_errors = "%s\n%s" % (sync_errors, "Error while synchronizing %s: %s" % (tablename, error)) sync_resources.append(tablename_error) final_status += error + "<br /><br />\n" else: sync_resources.append(tablename) final_status += ".........processed %s (Pull Sync)<br />\n" % push_url if sync_mode in [2, 3]: # push params = dict(sync_partner_uuid=settings.uuid) push_url = "%s://%s%s?%s" % (remote_url.scheme, remote_url.netloc, remote_path, urllib.urlencode(params)) try: result = resource.push_xml(push_url, username=peer.username, password=peer.password, #proxy=settings.proxy, msince=msince) except SyntaxError, e: result = str(e) try: result_json = json.loads(result) except: error = str(result) else: if str(result_json["statuscode"]).startswith("2"): error = None else: error = str(result_json["message"]) if error: tablename_error = "%s (push error)" sync_errors = "%s\n%s" % (sync_errors, "Error while synchronizing %s: %s" % (tablename, error)) sync_resources.append(tablename_error) final_status += error + "<br /><br />\n" else: sync_resources.append(tablename) final_status += ".........processed %s (Push Sync)<br />\n" % push_url else: pass # update sync now state if state.job_resources_done: state.job_resources_done += "," state.job_resources_done += ",".join(map(str, sync_resources)) job_res_pending = state.job_resources_pending.split(",") if "" in job_res_pending: job_res_pending.remove("") if sync_job.job_type == 1: for tablename in tablenames: job_res_pending.remove(tablename) state.job_resources_pending = ",".join(map(str, job_res_pending)) state.job_sync_errors += sync_errors vals = {"job_resources_done": state.job_resources_done, "job_resources_pending": state.job_resources_pending, "job_sync_errors": state.job_sync_errors} db(db.sync_now.id == sync_now_id).update(**vals) state = db(db.sync_now.id == sync_now_id).select(db.sync_now.ALL, limitby=(0, 1)).first() # check if all resources are synced for the current job, i.e. is it done? if (not state.job_resources_pending) or sync_job.job_type == 2: # job completed, check if there are any more jobs, if not, then sync now completed # log sync job if sync_mode == 1: sync_method = "Pull" elif sync_mode == 2: sync_method = "Push" elif sync_mode == 3: sync_method = "Pull-Push" log_table_id = db[log_table].insert( partner_uuid = sync_job_partner, timestmp = datetime.datetime.utcnow(), sync_resources = state.job_resources_done, sync_errors = state.job_sync_errors, sync_mode = "online", sync_method = sync_method, complete_sync = complete_sync ) # remove this job from queue and process next sync_jobs_list = state.sync_jobs.split(", ") if "" in sync_jobs_list: sync_jobs_list.remove("") if len(sync_jobs_list) > 0: sync_jobs_list.remove(sync_jobs_list[0]) state.sync_jobs = ", ".join(map(str, sync_jobs_list)) state.job_resources_done = "" state.job_resources_pending = "" if len(sync_jobs_list) > 0: next_job_sel = db(db.sync_schedule.id == int(state.sync_jobs[0])).select(db.sync_schedule.ALL) if next_job_sel: next_job = next_job_sel[0] if next_job.job_type == 1: next_job_cmd = json.loads(next_job.job_command) state.job_resources_pending = ", ".join(map(str, next_job_cmd["resources"])) state.job_sync_errors = "" vals = {"sync_jobs": state.sync_jobs, "job_resources_done": state.job_resources_done, "job_resources_pending": state.job_resources_pending} db(db.sync_now.id == sync_now_id).update(**vals) state = db(db.sync_now.id == sync_now_id).select(db.sync_now.ALL, limitby=(0, 1)).first() # update last_sync_on vals = {"last_sync_on": datetime.datetime.utcnow()} db(db.sync_partner.id == peer.id).update(**vals) vals = {"last_run": datetime.datetime.utcnow()} db(db.sync_schedule.id == sync_job.id).update(**vals) if not state.sync_jobs: # remove sync now session state db(db.sync_now.id == sync_now_id).delete() # we're done final_status += "Sync completed successfully. Logs generated: " + str(A(T("Click here to open log"),_href=URL(r=request, c="sync", f="history"))) + "<br /><br />\n" return dict(module_name=module_name, sync_status=final_status, sync_start=sync_start, sync_state=state) # ----------------------------------------------------------------------------- def sync(): """ Sync interface allows PUT/GET of any resource (universal RESTful controller) """ # @todo: Do not use global variables global sync_peer, sync_policy import gluon.contrib.simplejson as json if len(request.args) < 2: # No resource specified raise HTTP(501, body=s3xrc.ERROR.BAD_RESOURCE) else: prefix = request.args.pop(0) name = request.args.pop(0) if name.find(".") != -1: name, extension = name.rsplit(".", 1) request.extension = extension # Get the sync partner peer_uuid = request.vars.get("sync_partner_uuid", None) if peer_uuid: peer = db.sync_partner sync_peer = db(peer.uuid == peer_uuid).select(limitby=(0,1)).first() if sync_peer and not sync_policy: sync_policy = sync_peer.policy # remote push? method = request.env.request_method if method in ("PUT", "POST"): remote_push = True # Must be registered partner for push: if not sync_peer: raise HTTP(501, body=s3xrc.ERROR.NOT_PERMITTED) elif method == "GET": remote_push = False else: raise HTTP(501, body=s3xrc.ERROR.BAD_METHOD) # Set the sync resolver s3xrc.sync_resolve = lambda vector, peer=sync_peer: sync_res(vector, peer) def prep(r): # Do not allow interactive formats if r.representation in ("html", "popup", "aadata"): return False # Do not allow URL methods if r.method: return False # Neutralize push limit of the resource r.resource.push_limit = None return True response.s3.prep = prep def postp(r, output, sync_peer=sync_peer): try: output_json = Storage(json.loads(output)) except: # No JSON response? pass else: if r.http in ("PUT", "POST"): resource = r.resource sr = [c.component.tablename for c in resource.components.values()] sr.insert(0, resource.tablename) sync_resources = ",".join(sr) if str(output_json["statuscode"]) != "200": sync_resources += " (error)" sync_errors = str(output) else: sync_errors = "" db[log_table].insert( partner_uuid = sync_peer.uuid, timestmp = datetime.datetime.utcnow(), sync_resources = sync_resources, sync_errors = sync_errors, sync_mode = "online", sync_method = "Remote Push", complete_sync = False) return output response.s3.postp = postp # Execute the request output = shn_rest_controller(prefix, name) #return ret_data return output # ----------------------------------------------------------------------------- def sync_res(vector, peer): """ Sync resolver designed as callback for s3xrc.sync_resolve """ import cPickle global sync_policy sync_peer = peer if not sync_policy: sync_policy = sync_peer.policy db_record = vector.db(vector.table.id==vector.id).select(vector.table.ALL, limitby=(0,1)) db_record_mtime = None record_dump = cPickle.dumps(dict(vector.record), 0) if db_record: db_record = db_record.first() if "modified_on" in vector.table.fields: db_record_mtime = db_record.modified_on # based on the sync_policy, make resolution if sync_policy == 0: # No Sync # don't import anything in this case vector.strategy = [] elif sync_policy == 1: # Keep Local vector.resolution = vector.RESOLUTION.THIS if db_record_mtime and vector.mtime > db_record_mtime: # log this as a conflict, local record is older #print "Conflict: local record is kept and is older" db[conflict_table].insert( uuid = vector.record.uuid, resource_table = vector.tablename, remote_record = record_dump, remote_modified_by = vector.element.get("modified_by"), remote_modified_on = vector.mtime, logged_on = datetime.datetime.utcnow(), resolved = False ) elif sync_policy == 2: # Replace with Remote vector.resolution = vector.RESOLUTION.OTHER if db_record_mtime and vector.mtime < db_record_mtime: # log this as a conflict, remote record is older #print "Conflict: remote record is imported and is older" db[conflict_table].insert( uuid = vector.record.uuid, resource_table = vector.tablename, remote_record = record_dump, remote_modified_by = vector.element.get("modified_by"), remote_modified_on = vector.mtime, logged_on = datetime.datetime.utcnow(), resolved = False ) elif db_record_mtime and sync_peer.last_sync_on and db_record_mtime > sync_peer.last_sync_on: # log this as a conflict, local record was modified too, but overwritten #print "Conflict: local record was modified since last sync but overwritten by remote record" db[conflict_table].insert( uuid = vector.record.uuid, resource_table = vector.tablename, remote_record = record_dump, remote_modified_by = vector.element.get("modified_by"), remote_modified_on = vector.mtime, logged_on = datetime.datetime.utcnow(), resolved = False ) elif sync_policy == 3: # Keep with Newer Timestamp vector.resolution = vector.RESOLUTION.NEWER if db_record_mtime and vector.mtime < db_record_mtime: # log this as a conflict, remote record is older #print "Conflict: remote record is imported and is older" db[conflict_table].insert( uuid = vector.record.uuid, resource_table = vector.tablename, remote_record = record_dump, remote_modified_by = vector.element.get("modified_by"), remote_modified_on = vector.mtime, logged_on = datetime.datetime.utcnow(), resolved = False ) elif sync_policy == 4: # Role-based # not implemented, defaulting to "Newer Timestamp" vector.resolution = vector.RESOLUTION.NEWER elif sync_policy == 5: # Choose Manually if db_record_mtime and vector.mtime != db_record_mtime: # just log and skip vector.strategy = [] db[conflict_table].insert( uuid = vector.record.uuid, resource_table = vector.tablename, remote_record = record_dump, remote_modified_by = vector.element.get("modified_by"), remote_modified_on = vector.mtime, logged_on = datetime.datetime.utcnow(), resolved = False ) return # ----------------------------------------------------------------------------- @auth.shn_requires_membership(1) def partner(): """ Synchronisation Partners """ import gluon.contrib.simplejson as json table = db.sync_partner table.uuid.label = "UUID" table.uuid.comment = DIV(SPAN("*", _class="req"), DIV(_class="tooltip", _title="UUID|" + Tstr("The unique identifier of the sync partner. Leave blank if the instance type is not Sahana Eden, it will be auto-assigned in that case."))) table.name.label = T("Name") table.name.comment = DIV(_class="tooltip", _title=Tstr("Name") + "|" + Tstr("The descriptive name of the sync partner.")) table.instance_url.label = T("Instance URL") table.instance_url.comment = DIV(SPAN("*", _class="req"), DIV(_class="tooltip", _title=Tstr("Instance URL") + "|" + Tstr("For Eden instances - this is the application URL, e.g. http://sync.sahanfoundation.org/eden. For non-Eden instances, this is the Full "))) table.instance_type.label = T("Instance Type") table.instance_type.comment = DIV(SPAN("*", _class="req"), DIV(_class="tooltip", _title=Tstr("Instance Type") + "|" + Tstr("Whether this is a Sahana Eden, Sahana Agasti, Ushahidi or Other instance."))) table.username.label = T("Sync Username") table.username.comment = DIV(_class="tooltip", _title=Tstr("Sync Username") + "|" + Tstr("Username used to login when synchronising with this partner. Note that only HTTP Basic authentication is supported.")) table.password.label = T("Sync Password") table.password.comment = DIV(_class="tooltip", _title=Tstr("Sync Password") + "|" + Tstr("Password used to login when synchronising with this partner. Note that only HTTP Basic authentication is supported.")) table.comments.label = T("Comments") table.comments.comment = DIV(_class="tooltip", _title=Tstr("Comments") + "|" + Tstr("Any comments about this sync partner.")) table.policy.label = T("Sync Policy") table.policy.comment = DIV(SPAN("*", _class="req"), DIV(_class="tooltip", _title=Tstr("Sync Policy") + "|" + Tstr("The policy to use while synchronising with this partner. All policies other than 'No Sync' come into effect when conflicts arise."))) table.sync_pools.readable = False table.sync_pools.writable = False table.password.readable = False table.last_sync_on.writable = False # CRUD Strings - @todo: make new style title_create = T("Add Partner") title_display = T("Partner Details") title_list = T("List Partners") title_update = T("Edit Partner") title_search = T("Search Partners") subtitle_create = T("Add New Partner") subtitle_list = T("Partners") label_list_button = T("List Partners") label_create_button = T("Add Partner") label_search_button = T("Search Partners") msg_record_created = T("Partner added") msg_record_modified = T("Partner updated") msg_record_deleted = T("Partner deleted") msg_list_empty = T("No Partners currently registered") s3.crud_strings.sync_partner = Storage(title_create=title_create,title_display=title_display,title_list=title_list,title_update=title_update,title_search=title_search,subtitle_create=subtitle_create,subtitle_list=subtitle_list,label_list_button=label_list_button,label_create_button=label_create_button,msg_record_created=msg_record_created,msg_record_modified=msg_record_modified,msg_record_deleted=msg_record_deleted,msg_list_empty=msg_list_empty) if "delete" in request.args: peer_sel = db(db.sync_partner.id==int(request.args[0])).select(db.sync_partner.ALL) peer_uuid = None if peer_sel: peer_uuid = peer_sel[0].uuid if peer_uuid: sch_jobs_del = [] sch_jobs = db().select(db.sync_schedule.ALL) for sch_job in sch_jobs: sch_job_cmd = json.loads(sch_job.job_command) if sch_job_cmd["partner_uuid"] == peer_uuid: sch_jobs_del.append(sch_job.id) if sch_jobs_del: db(db.sync_schedule.id.belongs(sch_jobs_del)).delete() elif (not "update" in request.args) and len(request.vars) > 0: # add new partner random_uuid = str(uuid.uuid4()) new_instance_type = "" if "instance_type" in request.vars: new_instance_type = request.vars["instance_type"] if new_instance_type != "Sahana Eden": if "uuid" in request.vars: request.vars["uuid"] = random_uuid if "uuid" in request.get_vars: request.get_vars["uuid"] = random_uuid if "uuid" in request.post_vars: request.post_vars["uuid"] = random_uuid elif "uuid" in request.vars and request.vars["uuid"] and "instance_url" in request.vars and request.vars["instance_url"]: # create new default scheduled job for this partner, it's a Sahana Eden instance modules = deployment_settings.modules _db_tables = db.tables db_tables = [] for __table in _db_tables: if "modified_on" in db[__table].fields and "uuid" in db[__table].fields: db_tables.append(__table) sch_resources = [] for _module in modules: for _table in db_tables: if _table.startswith(_module + "_"): sch_resources.append(_module + "||" + _table[len(_module)+1:]) # add job to db new_partner_uuid = request.vars["uuid"] new_partner_instance_type = request.vars["instance_type"] new_partner_policy = int(request.vars["policy"]) new_partner_name = None if "name" in request.vars and request.vars["name"]: new_partner_name = request.vars["name"] sch_comments = "Default manually triggered schedule job for sync partner '" if new_partner_name: sch_comments += new_partner_name else: sch_comments += new_partner_uuid sch_comments += "'" sch_cmd = dict() sch_cmd["partner_uuid"] = new_partner_uuid sch_cmd["policy"] = new_partner_policy sch_cmd["resources"] = sch_resources sch_cmd["complete"] = False sch_cmd["mode"] = 3 db["sync_schedule"].insert( comments = sch_comments, period = "m", hours = None, days_of_week = None, time_of_day = None, runonce_datetime = None, job_type = 1, job_command = json.dumps(sch_cmd), last_run = None, enabled = True, created_on = datetime.datetime.now(), modified_on = datetime.datetime.now() ) return shn_rest_controller("sync", "partner") # ----------------------------------------------------------------------------- @auth.shn_requires_membership(1) def setting(): "Synchronisation Settings" if not "update" in request.args: redirect(URL(r=request, args=["update", 1])) db.sync_setting.uuid.writable = False db.sync_setting.uuid.label = "UUID" db.sync_setting.uuid.comment = DIV(_class="tooltip", _title="UUID|" + Tstr("The unique identifier which identifies this instance to other instances.")) db.sync_setting.comments.label = T("Comments") db.sync_setting.comments.comment = DIV(_class="tooltip", _title=Tstr("Comments") + "|" + Tstr("Any comments for this instance.")) # db.sync_setting.beacon_service_url.label = T("Beacon Service URL") # db.sync_setting.beacon_service_url.comment = DIV(_class="tooltip", # _title=Tstr("Beacon Service URL") + "|" + Tstr("Beacon service allows searching for other instances that wish to synchronise. This is the URL of the beacon service this instance will use.")) db.sync_setting.sync_pools.readable = False db.sync_setting.sync_pools.writable = False db.sync_setting.beacon_service_url.readable = False db.sync_setting.beacon_service_url.writable = False title_update = T("Edit Sync Settings") label_list_button = T("Sync Settings") msg_record_modified = T("Sync Settings updated") s3.crud_strings.sync_setting = Storage(title_update=title_update,label_list_button=label_list_button,msg_record_modified=msg_record_modified) crud.settings.update_next = URL(r=request, args=["update", 1]) return shn_rest_controller("sync", "setting", deletable=False, listadd=False) # ----------------------------------------------------------------------------- @auth.shn_requires_membership(1) def schedule(): """ Synchronisation Schedules """ import gluon.contrib.simplejson as json title = T("Syncronisation Schedules") jobs = None confirmation_msg = None if "create" in request.args: response.view = "sync/schedule_create.html" if "form_action" in request.vars and request.vars["form_action"] == "submit": # create new job - add it to database sch_enabled = True if "job_enabled" in request.vars and request.vars["job_enabled"] == "0": sch_enabled = False sch_comments = None if "comments" in request.vars: sch_comments = request.vars["comments"] sch_source_type = "eden" if "sync_data_source_type" in request.vars: sch_source_type = request.vars["sync_data_source_type"] sch_period = "h" if "sync_schedule_period" in request.vars: sch_period = request.vars["sync_schedule_period"] sch_period_hours = 5 if "sync_schedule_period_hours" in request.vars: sch_period_hours = request.vars["sync_schedule_period_hours"] sch_days_of_week = [] if "sync_schedule_weekly_days" in request.vars and request.vars["sync_schedule_weekly_days"]: sch_days_of_week = request.vars["sync_schedule_weekly_days"] sch_time_of_day = None if sch_period == "d": sch_time_of_day = datetime.datetime.strptime(str(request.vars["sync_schedule_daily_time"]), "%H:%M").time() elif sch_period == "w": sch_time_of_day = datetime.datetime.strptime(str(request.vars["sync_schedule_weekly_time"]), "%H:%M").time() sch_runonce_datetime = None if "sync_schedule_once_datetime" in request.vars and request.vars["sync_schedule_once_datetime"]: sch_runonce_datetime = datetime.datetime.strptime(str(request.vars["sync_schedule_once_datetime"]), "%Y-%m-%d %H:%M:%S") sch_job_type = 1 sch_cmd = dict() sch_cmd["partner_uuid"] = request.vars["sync_partner_uuid"] sch_cmd["policy"] = int(request.vars["sync_policy"]) if sch_source_type == "eden": # eden data source if "sync_resources" in request.vars and request.vars["sync_resources"]: sch_cmd["resources"] = request.vars["sync_resources"] if type(sch_cmd["resources"]) == str: sch_cmd["resources"] = [sch_cmd["resources"]] else: sch_cmd["resources"] = None sch_cmd["complete"] = False if "sync_complete" in request.vars and request.vars["sync_complete"] == "1": sch_cmd["complete"] = True sch_cmd["mode"] = 3 if "sync_mode" in request.vars and request.vars["sync_mode"]: sch_cmd["mode"] = int(request.vars["sync_mode"]) else: # custom data source sch_job_type = 2 sch_cmd["custom_command"] = request.vars["sync_custom"] # add job to db db["sync_schedule"].insert( comments = sch_comments, period = sch_period, hours = sch_period_hours, days_of_week = ",".join(map(str, sch_days_of_week)), time_of_day = sch_time_of_day, runonce_datetime = sch_runonce_datetime, job_type = sch_job_type, job_command = json.dumps(sch_cmd), last_run = None, enabled = sch_enabled, created_on = datetime.datetime.now(), modified_on = datetime.datetime.now() ) confirmation_msg = "New Scheduled job created" response.view = "sync/schedule.html" else: if "form_action" in request.vars and "selected_jobs" in request.vars: sel_jobs = request.vars["selected_jobs"] if request.vars["form_action"] == "enable": for s_job_id in sel_jobs: vals = {"enabled": True} db(db.sync_schedule.id==int(s_job_id)).update(**vals) elif request.vars["form_action"] == "disable": for s_job_id in sel_jobs: vals = {"enabled": False} db(db.sync_schedule.id==int(s_job_id)).update(**vals) elif request.vars["form_action"] == "delete": for s_job_id in sel_jobs: db(db.sync_schedule.id==int(s_job_id)).delete() jobs = db().select(db.sync_schedule.ALL) return dict(title=title, jobs=jobs, confirmation_msg=confirmation_msg) # ----------------------------------------------------------------------------- def schedule_cron(): # only accept requests from local machine if not request.env.remote_addr == "127.0.0.1": return while True: try: # look at each job and run if it it's scheduled time jobs = db(db.sync_schedule.enabled==True).select(db.sync_schedule.ALL) for job in jobs: last_run = job.last_run if not last_run: last_run = job.created_on - datetime.timedelta(days=2) try: if job.period == "h": if datetime.datetime.now() >= (last_run + datetime.timedelta(hours=job.hours)): schedule_process_job(job.id) db.commit() elif job.period == "d": if job.time_of_day and last_run.date() != datetime.datetime.now().date() and datetime.datetime.now().hour >= job.time_of_day.hour and datetime.datetime.now().minute >= job.time_of_day.minute: schedule_process_job(job.id) db.commit() elif job.period == "w": days_of_week = None last_run_weekday = last_run.weekday() + 1 if last_run_weekday == 8: last_run_weekday = 1 now_weekday = datetime.datetime.now().weekday() + 1 if now_weekday == 8: now_weekday = 1 if job.days_of_week: days_of_week = map(int, job.days_of_week.split(",")) if job.time_of_day and now_weekday in days_of_week and last_run_weekday < now_weekday and datetime.datetime.now().hour >= job.time_of_day.hour and datetime.datetime.now().minute >= job.time_of_day.minute: schedule_process_job(job.id) db.commit() elif job.period == "o": if job.runonce_datetime and last_run < job.runonce_datetime and datetime.datetime.now() >= job.runonce_datetime: schedule_process_job(job.id) db.commit() except Error, e: # log scheduler error try: log_file = open("applications/" + request.application + "/cron/scheduler_errors.txt", "a") log_file.write(str(datetime.datetime.now()) + " - error while running job " + str(job.id) + ":\n" + str(e) + "\n\n") log_file.close() except: pass #print "error while appending scheduler error log file!" db.commit() except Error, e: # log scheduler error try: log_file = open("applications/" + request.application + "/cron/scheduler_errors.txt", "a") log_file.write(str(datetime.datetime.now()) + " - error while running job " + str(job.id) + ":\n" + str(e) + "\n\n") log_file.close() except: pass #print "error while appending scheduler error log file!" # pause for 15 seconds time.sleep(15) return # ----------------------------------------------------------------------------- def schedule_process_job(job_id): """ docstring??? """ import gluon.contrib.simplejson as json import urllib, urlparse global sync_policy job_sel = db(db.sync_schedule.id==job_id).select(db.sync_schedule.ALL) if not job_sel: return job = job_sel[0] if not job: return if not job.enabled: return job_cmd = json.loads(job.job_command) # url fetcher fetcher = FetchURL() # retrieve settings settings = db().select(db.sync_setting.ALL)[0] peer_sel = db(db.sync_partner.uuid==str(job_cmd["partner_uuid"])).select(db.sync_partner.ALL) if not peer_sel: return peer = peer_sel[0] peer_sync_success = True last_sync_on = job.last_run complete_sync = False sync_mode = 1 if "complete" in job_cmd and str(job_cmd["complete"]) == "True": complete_sync = True if "policy" in job_cmd: sync_policy = int(job_cmd["policy"]) if "mode" in job_cmd: sync_mode = int(job_cmd["mode"]) sync_resources = [] sync_errors = "" # Keep Session for local URLs cookie = str(response.session_id_name) + "=" + str(response.session_id) if job.job_type == 1: # Sync Eden sync if (not last_sync_on is None) and complete_sync == False: last_sync_on_str = "?msince=" + last_sync_on.strftime("%Y-%m-%dT%H:%M:%SZ") else: last_sync_on_str = "" log_file = open("applications/" + request.application + "/cron/scheduler_log.txt", "a") log_file.write(str(datetime.datetime.now()) + " - running job " + str(job.id) + "\n") log_file.close() for res_item in job_cmd["resources"]: _module, _resource = res_item.split("||") _resource_name = _module + "_" + _resource peer_instance_url = list(urlparse.urlparse(peer.instance_url)) if peer_instance_url[2].endswith("/")==False: peer_instance_url[2] += "/" resource_remote_pull_url = peer.instance_url if resource_remote_pull_url.endswith("/")==False: resource_remote_pull_url += "/" resource_remote_pull_url += "sync/sync." + import_export_format + "/" + _module + "/" + _resource + last_sync_on_str resource_remote_push_url = peer_instance_url[2] + "sync/sync." + import_export_format + "/push/" + _module + "/" + _resource + "?sync_partner_uuid=" + str(settings.uuid) resource_local_pull_url = "/" + request.application + "/sync/sync." + import_export_format + "/" + _module + "/" + _resource + last_sync_on_str resource_local_push_url = "/" + request.application + "/sync/sync." + import_export_format + "/create/" + _module + "/" + _resource if sync_mode in [1, 3]: # Sync -> Pull _request_params = urllib.urlencode({"sync_partner_uuid": str(peer.uuid), "fetchurl": resource_remote_pull_url}) _request_vars_copy = request.vars _request_get_vars_copy = request.get_vars _request_post_vars_copy = request.post_vars _request_args_copy = request.args _request_extension_copy = request.extension _request_env_request_method_copy = request.env.request_method try: #_response = fetcher.fetch("PUT", request.env.http_host, resource_local_push_url, _request_params, cookie) request.vars = Storage() request.vars["sync_partner_uuid"] = str(peer.uuid) request.vars["fetchurl"] = resource_remote_pull_url request.args = ["push", _module, _resource] request.extension = import_export_format request.env.request_method = "PUT" session.auth = Storage() session.auth["user"] = None session.s3.roles.append(1) _response = sync() except Error, e: if not _resource_name + " (error)" in sync_resources and not _resource_name in sync_resources: sync_resources.append(_resource_name + " (error)") error_str = str(e) sync_errors += "Error while syncing => " + _resource_name + ": \n" + error_str + "\n\n" #print "Error while syncing => " + _resource_name + ": \n" + error_str + "\n\n" else: if not _resource_name + " (error)" in sync_resources and not _resource_name in sync_resources: sync_resources.append(_resource_name) request.args = _request_args_copy request.get_vars = _request_get_vars_copy request.post_vars = _request_post_vars_copy request.vars = _request_vars_copy request.extension = _request_extension_copy request.env.request_method = _request_env_request_method_copy if sync_mode in [2, 3]: # Sync -> Push try: _local_data = fetcher.fetch("GET", request.env.http_host, resource_local_pull_url, None, cookie) _response = fetcher.fetch("PUT", peer_instance_url[1], resource_remote_push_url, _local_data, None, peer.username, peer.password) except Error, e: if not _resource_name + " (error)" in sync_resources and not _resource_name in sync_resources: sync_resources.append(_resource_name + " (error)") error_str = str(e) sync_errors += "Error while syncing => " + _resource_name + ": \n" + error_str + "\n\n" else: if not _resource_name + " (error)" in sync_resources and not _resource_name in sync_resources: sync_resources.append(_resource_name) else: # Custom sync sync_mode = 1 _request_vars_copy = request.vars _request_get_vars_copy = request.get_vars _request_post_vars_copy = request.post_vars _request_args_copy = request.args _request_extension_copy = request.extension try: request.vars = Storage() request.vars["sync_partner_uuid"] = str(peer.uuid) request.vars["fetchurl"] = job_cmd["custom_command"] request.args = ["create", "sync", "log"] request.extension = import_export_format _response = sync() except Error, e: error_str = str(e) sync_errors = "Error while syncing job " + str(job.id) + ": \n" + error_str + "\n\n" #print sync_errors request.args = _request_args_copy request.get_vars = _request_get_vars_copy request.post_vars = _request_post_vars_copy request.vars = _request_vars_copy request.extension = _request_extension_copy if sync_mode == 1: sync_method = "Pull" elif sync_mode == 2: sync_method = "Push" elif sync_mode == 3: sync_method = "Pull-Push" # log sync job log_table_id = db[log_table].insert( partner_uuid = peer.uuid, timestmp = datetime.datetime.utcnow(), sync_resources = ", ".join(map(str, sync_resources)), sync_errors = sync_errors, sync_mode = "online", sync_method = sync_method, complete_sync = complete_sync ) # update last_sync_on vals = {"last_sync_on": datetime.datetime.utcnow()} db(db.sync_partner.id==peer.id).update(**vals) vals = {"last_run": datetime.datetime.utcnow()} db(db.sync_schedule.id==job_id).update(**vals) return # ----------------------------------------------------------------------------- @auth.requires_login() def history(): """ Shows history of database synchronisations @todo: argument list processing too vulnerable """ title = T("Synchronisation History") table = db[log_table] if len(request.args) > 0: logs = db(table.id==int(request.args[0])).select(table.ALL, orderby=table.timestmp) else: logs = db().select(table.ALL, orderby=table.timestmp) return dict(title=title, logs=logs) # ----------------------------------------------------------------------------- @auth.shn_requires_membership(1) def conflict(): """ Conflict Resolution UI """ import cPickle title = T("Conflict Resolution") def get_modified_by(user_email): modified_by = user_email user = db(db.auth_user.email == user_email).select().first() if user: modified_by = user.first_name if user.last_name: modified_by += " " + user.last_name return modified_by skip_fields = ["uuid", "id"] field_errors = dict() conflicts = db(db[conflict_table].resolved==False).select(db[conflict_table].ALL, orderby=db[conflict_table].logged_on) for idx in xrange(0, len(conflicts)): if not conflicts[idx].resource_table in db.tables: del conflicts[idx] record_nbr = 1 if "record_nbr" in request.vars: record_nbr = int(request.vars["record_nbr"]) total_conflicts = len(conflicts) if record_nbr < 1 or record_nbr > total_conflicts: record_nbr = 1 if total_conflicts == 0: conflict = None else: conflict = conflicts[record_nbr - 1] remote_record = None local_record = None local_modified_by = None remote_modified_by = None if conflict: remote_record = cPickle.loads(conflict.remote_record) local_record = db(db[conflict.resource_table].uuid==conflict.uuid).select().first() if conflict.remote_modified_by: remote_modified_by = get_modified_by(conflict.remote_modified_by) if "modified_by" in local_record: local_modified_by = get_modified_by(local_record.modified_by.email) if "form_action" in request.vars: if request.vars["form_action"] == "resolve" and conflict: if local_record: # update local record for field in remote_record: if (not field in skip_fields) and (field in db[conflict.resource_table].fields): if "final_"+str(field) in request.vars: vals = {field: request.vars["final_" + str(field)]} else: if db[conflict.resource_table][field].type == "boolean": vals = {field: "False"} else: vals = {field: ""} field_error = db[conflict.resource_table][field].validate(vals[field])[1] if field_error: field_errors[field] = field_error # update only if no errors if len(field_errors) == 0: db(db[conflict.resource_table].uuid==conflict.uuid).update(**vals) # undelete record if "deleted" in db[conflict.resource_table].fields: vals = {"deleted": False} db(db[conflict.resource_table].uuid==conflict.uuid).update(**vals) else: # insert record new_rec = dict() for field in remote_record: if field in db[conflict_table].fields: if "final_"+field in request.vars: new_rec[field] = request.vars["final_"+field] else: new_rec[field] = remote_record[field] field_error = db[conflict.resource_table][field].validate(vals[field])[1] if field_error: field_errors[field] = field_error # insert only if no errors if len(field_errors) == 0: db[conflict.resource_table].insert(**new_rec) # set status to resolved if no errors if len(field_errors) == 0: conflict.update_record(resolved = True) # next conflict conflicts = db(db[conflict_table].resolved==False).select(db[conflict_table].ALL, orderby=db[conflict_table].logged_on) for idx in xrange(0, len(conflicts)): if not conflicts[idx].resource_table in db.tables: del conflicts[idx] total_conflicts = len(conflicts) if record_nbr < 1 or record_nbr > total_conflicts: record_nbr = 1 if total_conflicts == 0: conflict = None else: conflict = conflicts[record_nbr - 1] remote_record = None local_record = None if conflict: remote_record = cPickle.loads(conflict.remote_record) local_record = db(db[conflict.resource_table].uuid==conflict.uuid).select().first() if conflict.remote_modified_by: remote_modified_by = get_modified_by(conflict.remote_modified_by) if "modified_by" in local_record: local_modified_by = get_modified_by(local_record.modified_by.email) form = None if conflict: form = SQLFORM.factory(db[conflict.resource_table]) return dict(title=title, skip_fields=skip_fields, total_conflicts=total_conflicts, conflict=conflict, record_nbr=record_nbr, local_record=local_record, remote_record=remote_record, local_modified_by=local_modified_by, remote_modified_by=remote_modified_by, form=form, field_errors=field_errors) # -----------------------------------------------------------------------------
# -*- coding: utf-8 -*- from south.utils import datetime_utils as datetime from south.db import db from south.v2 import SchemaMigration from django.db import models class Migration(SchemaMigration): def forwards(self, orm): # Adding model 'Email' db.create_table('sentry_email', ( ('id', self.gf('sentry.db.models.fields.bounded.BoundedBigAutoField')(primary_key=True)), ('email', self.gf('sentry.db.models.fields.citext.CIEmailField')(unique=True, max_length=75)), ('date_added', self.gf('django.db.models.fields.DateTimeField')()), )) db.send_create_signal('sentry', ['Email']) def backwards(self, orm): # Deleting model 'Email' db.delete_table('sentry_email') models = { 'sentry.activity': { 'Meta': {'object_name': 'Activity'}, 'data': ('sentry.db.models.fields.gzippeddict.GzippedDictField', [], {'null': 'True'}), 'datetime': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'group': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Group']", 'null': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'ident': ('django.db.models.fields.CharField', [], {'max_length': '64', 'null': 'True'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Project']"}), 'type': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {}), 'user': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.User']", 'null': 'True'}) }, 'sentry.apiapplication': { 'Meta': {'object_name': 'ApiApplication'}, 'allowed_origins': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'client_id': ('django.db.models.fields.CharField', [], {'default': "'ac8eec20ab4f4f9cba2fcfcb6caace5102d30921086f4857b917135d667d1399'", 'unique': 'True', 'max_length': '64'}), 'client_secret': ('sentry.db.models.fields.encrypted.EncryptedTextField', [], {'default': "'b8242a9eb79141a7a3eca88d9ff98f39e0ab40bbe5ac44418dcc68992d0c3bde'"}), 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'homepage_url': ('django.db.models.fields.URLField', [], {'max_length': '200', 'null': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'default': "'Chief Badger'", 'max_length': '64', 'blank': 'True'}), 'owner': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.User']"}), 'privacy_url': ('django.db.models.fields.URLField', [], {'max_length': '200', 'null': 'True'}), 'redirect_uris': ('django.db.models.fields.TextField', [], {}), 'status': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '0', 'db_index': 'True'}), 'terms_url': ('django.db.models.fields.URLField', [], {'max_length': '200', 'null': 'True'}) }, 'sentry.apiauthorization': { 'Meta': {'unique_together': "(('user', 'application'),)", 'object_name': 'ApiAuthorization'}, 'application': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.ApiApplication']", 'null': 'True'}), 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'scope_list': ('sentry.db.models.fields.array.ArrayField', [], {'of': ('django.db.models.fields.TextField', [], {})}), 'scopes': ('django.db.models.fields.BigIntegerField', [], {'default': 'None'}), 'user': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.User']"}) }, 'sentry.apigrant': { 'Meta': {'object_name': 'ApiGrant'}, 'application': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.ApiApplication']"}), 'code': ('django.db.models.fields.CharField', [], {'default': "'9c373033c7964af6a649e4bf8b7e3199'", 'max_length': '64', 'db_index': 'True'}), 'expires_at': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime(2017, 9, 8, 0, 0)', 'db_index': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'redirect_uri': ('django.db.models.fields.CharField', [], {'max_length': '255'}), 'scope_list': ('sentry.db.models.fields.array.ArrayField', [], {'of': ('django.db.models.fields.TextField', [], {})}), 'scopes': ('django.db.models.fields.BigIntegerField', [], {'default': 'None'}), 'user': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.User']"}) }, 'sentry.apikey': { 'Meta': {'object_name': 'ApiKey'}, 'allowed_origins': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'key': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '32'}), 'label': ('django.db.models.fields.CharField', [], {'default': "'Default'", 'max_length': '64', 'blank': 'True'}), 'organization': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'related_name': "'key_set'", 'to': "orm['sentry.Organization']"}), 'scope_list': ('sentry.db.models.fields.array.ArrayField', [], {'of': ('django.db.models.fields.TextField', [], {})}), 'scopes': ('django.db.models.fields.BigIntegerField', [], {'default': 'None'}), 'status': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '0', 'db_index': 'True'}) }, 'sentry.apitoken': { 'Meta': {'object_name': 'ApiToken'}, 'application': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.ApiApplication']", 'null': 'True'}), 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'expires_at': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime(2017, 10, 7, 0, 0)', 'null': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'refresh_token': ('django.db.models.fields.CharField', [], {'default': "'2645fefe1c5b4762b6bdfd60b8c62bbc0702ed6f239e4892b60dd2ad1ead799a'", 'max_length': '64', 'unique': 'True', 'null': 'True'}), 'scope_list': ('sentry.db.models.fields.array.ArrayField', [], {'of': ('django.db.models.fields.TextField', [], {})}), 'scopes': ('django.db.models.fields.BigIntegerField', [], {'default': 'None'}), 'token': ('django.db.models.fields.CharField', [], {'default': "'cb00e6048c2a4b13bab8603c18b8f6e3cdf4c87428d5479f901a853fe171875a'", 'unique': 'True', 'max_length': '64'}), 'user': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.User']"}) }, 'sentry.auditlogentry': { 'Meta': {'object_name': 'AuditLogEntry'}, 'actor': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'blank': 'True', 'related_name': "'audit_actors'", 'null': 'True', 'to': "orm['sentry.User']"}), 'actor_key': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.ApiKey']", 'null': 'True', 'blank': 'True'}), 'actor_label': ('django.db.models.fields.CharField', [], {'max_length': '64', 'null': 'True', 'blank': 'True'}), 'data': ('sentry.db.models.fields.gzippeddict.GzippedDictField', [], {}), 'datetime': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'event': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'ip_address': ('django.db.models.fields.GenericIPAddressField', [], {'max_length': '39', 'null': 'True'}), 'organization': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Organization']"}), 'target_object': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True'}), 'target_user': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'blank': 'True', 'related_name': "'audit_targets'", 'null': 'True', 'to': "orm['sentry.User']"}) }, 'sentry.authenticator': { 'Meta': {'unique_together': "(('user', 'type'),)", 'object_name': 'Authenticator', 'db_table': "'auth_authenticator'"}, 'config': ('sentry.db.models.fields.encrypted.EncryptedPickledObjectField', [], {}), 'created_at': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'id': ('sentry.db.models.fields.bounded.BoundedAutoField', [], {'primary_key': 'True'}), 'last_used_at': ('django.db.models.fields.DateTimeField', [], {'null': 'True'}), 'type': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {}), 'user': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.User']"}) }, 'sentry.authidentity': { 'Meta': {'unique_together': "(('auth_provider', 'ident'), ('auth_provider', 'user'))", 'object_name': 'AuthIdentity'}, 'auth_provider': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.AuthProvider']"}), 'data': ('sentry.db.models.fields.encrypted.EncryptedJsonField', [], {'default': '{}'}), 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'ident': ('django.db.models.fields.CharField', [], {'max_length': '128'}), 'last_synced': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'last_verified': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'user': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.User']"}) }, 'sentry.authprovider': { 'Meta': {'object_name': 'AuthProvider'}, 'config': ('sentry.db.models.fields.encrypted.EncryptedJsonField', [], {'default': '{}'}), 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'default_global_access': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'default_role': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '50'}), 'default_teams': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['sentry.Team']", 'symmetrical': 'False', 'blank': 'True'}), 'flags': ('django.db.models.fields.BigIntegerField', [], {'default': '0'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'last_sync': ('django.db.models.fields.DateTimeField', [], {'null': 'True'}), 'organization': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Organization']", 'unique': 'True'}), 'provider': ('django.db.models.fields.CharField', [], {'max_length': '128'}), 'sync_time': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True'}) }, 'sentry.broadcast': { 'Meta': {'object_name': 'Broadcast'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'date_expires': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime(2017, 9, 14, 0, 0)', 'null': 'True', 'blank': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'is_active': ('django.db.models.fields.BooleanField', [], {'default': 'True', 'db_index': 'True'}), 'link': ('django.db.models.fields.URLField', [], {'max_length': '200', 'null': 'True', 'blank': 'True'}), 'message': ('django.db.models.fields.CharField', [], {'max_length': '256'}), 'title': ('django.db.models.fields.CharField', [], {'max_length': '32'}), 'upstream_id': ('django.db.models.fields.CharField', [], {'max_length': '32', 'null': 'True', 'blank': 'True'}) }, 'sentry.broadcastseen': { 'Meta': {'unique_together': "(('broadcast', 'user'),)", 'object_name': 'BroadcastSeen'}, 'broadcast': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Broadcast']"}), 'date_seen': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'user': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.User']"}) }, 'sentry.commit': { 'Meta': {'unique_together': "(('repository_id', 'key'),)", 'object_name': 'Commit', 'index_together': "(('repository_id', 'date_added'),)"}, 'author': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.CommitAuthor']", 'null': 'True'}), 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'key': ('django.db.models.fields.CharField', [], {'max_length': '64'}), 'message': ('django.db.models.fields.TextField', [], {'null': 'True'}), 'organization_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'db_index': 'True'}), 'repository_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {}) }, 'sentry.commitauthor': { 'Meta': {'unique_together': "(('organization_id', 'email'), ('organization_id', 'external_id'))", 'object_name': 'CommitAuthor'}, 'email': ('django.db.models.fields.EmailField', [], {'max_length': '75'}), 'external_id': ('django.db.models.fields.CharField', [], {'max_length': '164', 'null': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '128', 'null': 'True'}), 'organization_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'db_index': 'True'}) }, 'sentry.commitfilechange': { 'Meta': {'unique_together': "(('commit', 'filename'),)", 'object_name': 'CommitFileChange'}, 'commit': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Commit']"}), 'filename': ('django.db.models.fields.CharField', [], {'max_length': '255'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'organization_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'db_index': 'True'}), 'type': ('django.db.models.fields.CharField', [], {'max_length': '1'}) }, 'sentry.counter': { 'Meta': {'object_name': 'Counter', 'db_table': "'sentry_projectcounter'"}, 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Project']", 'unique': 'True'}), 'value': ('sentry.db.models.fields.bounded.BoundedBigIntegerField', [], {}) }, 'sentry.deploy': { 'Meta': {'object_name': 'Deploy'}, 'date_finished': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'date_started': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'environment_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'db_index': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '64', 'null': 'True', 'blank': 'True'}), 'notified': ('django.db.models.fields.NullBooleanField', [], {'default': 'False', 'null': 'True', 'db_index': 'True', 'blank': 'True'}), 'organization_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'db_index': 'True'}), 'release': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Release']"}), 'url': ('django.db.models.fields.URLField', [], {'max_length': '200', 'null': 'True', 'blank': 'True'}) }, 'sentry.distribution': { 'Meta': {'unique_together': "(('release', 'name'),)", 'object_name': 'Distribution'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '64'}), 'organization_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'db_index': 'True'}), 'release': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Release']"}) }, 'sentry.dsymapp': { 'Meta': {'unique_together': "(('project', 'platform', 'app_id'),)", 'object_name': 'DSymApp'}, 'app_id': ('django.db.models.fields.CharField', [], {'max_length': '64'}), 'data': ('jsonfield.fields.JSONField', [], {'default': '{}'}), 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'last_synced': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'platform': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '0'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Project']"}), 'sync_id': ('django.db.models.fields.CharField', [], {'max_length': '64', 'null': 'True'}) }, 'sentry.email': { 'Meta': {'object_name': 'Email'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'email': ('sentry.db.models.fields.citext.CIEmailField', [], {'unique': 'True', 'max_length': '75'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}) }, 'sentry.environment': { 'Meta': {'unique_together': "(('project_id', 'name'), ('organization_id', 'name'))", 'object_name': 'Environment'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '64'}), 'organization_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {}), 'project_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True'}), 'projects': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['sentry.Project']", 'through': "orm['sentry.EnvironmentProject']", 'symmetrical': 'False'}) }, 'sentry.environmentproject': { 'Meta': {'unique_together': "(('project', 'environment'),)", 'object_name': 'EnvironmentProject'}, 'environment': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Environment']"}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Project']"}) }, 'sentry.event': { 'Meta': {'unique_together': "(('project_id', 'event_id'),)", 'object_name': 'Event', 'db_table': "'sentry_message'", 'index_together': "(('group_id', 'datetime'),)"}, 'data': ('sentry.db.models.fields.node.NodeField', [], {'null': 'True', 'blank': 'True'}), 'datetime': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'db_index': 'True'}), 'event_id': ('django.db.models.fields.CharField', [], {'max_length': '32', 'null': 'True', 'db_column': "'message_id'"}), 'group_id': ('sentry.db.models.fields.bounded.BoundedBigIntegerField', [], {'null': 'True', 'blank': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'message': ('django.db.models.fields.TextField', [], {}), 'platform': ('django.db.models.fields.CharField', [], {'max_length': '64', 'null': 'True'}), 'project_id': ('sentry.db.models.fields.bounded.BoundedBigIntegerField', [], {'null': 'True', 'blank': 'True'}), 'time_spent': ('sentry.db.models.fields.bounded.BoundedIntegerField', [], {'null': 'True'}) }, 'sentry.eventmapping': { 'Meta': {'unique_together': "(('project_id', 'event_id'),)", 'object_name': 'EventMapping'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'event_id': ('django.db.models.fields.CharField', [], {'max_length': '32'}), 'group_id': ('sentry.db.models.fields.bounded.BoundedBigIntegerField', [], {}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'project_id': ('sentry.db.models.fields.bounded.BoundedBigIntegerField', [], {}) }, 'sentry.eventprocessingissue': { 'Meta': {'unique_together': "(('raw_event', 'processing_issue'),)", 'object_name': 'EventProcessingIssue'}, 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'processing_issue': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.ProcessingIssue']"}), 'raw_event': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.RawEvent']"}) }, 'sentry.eventtag': { 'Meta': {'unique_together': "(('event_id', 'key_id', 'value_id'),)", 'object_name': 'EventTag', 'index_together': "(('project_id', 'key_id', 'value_id'), ('group_id', 'key_id', 'value_id'))"}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'db_index': 'True'}), 'event_id': ('sentry.db.models.fields.bounded.BoundedBigIntegerField', [], {}), 'group_id': ('sentry.db.models.fields.bounded.BoundedBigIntegerField', [], {'null': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'key_id': ('sentry.db.models.fields.bounded.BoundedBigIntegerField', [], {}), 'project_id': ('sentry.db.models.fields.bounded.BoundedBigIntegerField', [], {}), 'value_id': ('sentry.db.models.fields.bounded.BoundedBigIntegerField', [], {}) }, 'sentry.eventuser': { 'Meta': {'unique_together': "(('project', 'ident'), ('project', 'hash'))", 'object_name': 'EventUser', 'index_together': "(('project', 'email'), ('project', 'username'), ('project', 'ip_address'))"}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'db_index': 'True'}), 'email': ('django.db.models.fields.EmailField', [], {'max_length': '75', 'null': 'True'}), 'hash': ('django.db.models.fields.CharField', [], {'max_length': '32'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'ident': ('django.db.models.fields.CharField', [], {'max_length': '128', 'null': 'True'}), 'ip_address': ('django.db.models.fields.GenericIPAddressField', [], {'max_length': '39', 'null': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '128', 'null': 'True'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Project']"}), 'username': ('django.db.models.fields.CharField', [], {'max_length': '128', 'null': 'True'}) }, 'sentry.featureadoption': { 'Meta': {'unique_together': "(('organization', 'feature_id'),)", 'object_name': 'FeatureAdoption'}, 'applicable': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'complete': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'data': ('jsonfield.fields.JSONField', [], {'default': '{}'}), 'date_completed': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'feature_id': ('django.db.models.fields.PositiveIntegerField', [], {}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'organization': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Organization']"}) }, 'sentry.file': { 'Meta': {'object_name': 'File'}, 'blob': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'related_name': "'legacy_blob'", 'null': 'True', 'to': "orm['sentry.FileBlob']"}), 'blobs': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['sentry.FileBlob']", 'through': "orm['sentry.FileBlobIndex']", 'symmetrical': 'False'}), 'checksum': ('django.db.models.fields.CharField', [], {'max_length': '40', 'null': 'True'}), 'headers': ('jsonfield.fields.JSONField', [], {'default': '{}'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '128'}), 'path': ('django.db.models.fields.TextField', [], {'null': 'True'}), 'size': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True'}), 'timestamp': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'db_index': 'True'}), 'type': ('django.db.models.fields.CharField', [], {'max_length': '64'}) }, 'sentry.fileblob': { 'Meta': {'object_name': 'FileBlob'}, 'checksum': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '40'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'path': ('django.db.models.fields.TextField', [], {'null': 'True'}), 'size': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True'}), 'timestamp': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'db_index': 'True'}) }, 'sentry.fileblobindex': { 'Meta': {'unique_together': "(('file', 'blob', 'offset'),)", 'object_name': 'FileBlobIndex'}, 'blob': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.FileBlob']"}), 'file': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.File']"}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'offset': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {}) }, 'sentry.group': { 'Meta': {'unique_together': "(('project', 'short_id'),)", 'object_name': 'Group', 'db_table': "'sentry_groupedmessage'", 'index_together': "(('project', 'first_release'),)"}, 'active_at': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'db_index': 'True'}), 'culprit': ('django.db.models.fields.CharField', [], {'max_length': '200', 'null': 'True', 'db_column': "'view'", 'blank': 'True'}), 'data': ('sentry.db.models.fields.gzippeddict.GzippedDictField', [], {'null': 'True', 'blank': 'True'}), 'first_release': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Release']", 'null': 'True', 'on_delete': 'models.PROTECT'}), 'first_seen': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'db_index': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'is_public': ('django.db.models.fields.NullBooleanField', [], {'default': 'False', 'null': 'True', 'blank': 'True'}), 'last_seen': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'db_index': 'True'}), 'level': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '40', 'db_index': 'True', 'blank': 'True'}), 'logger': ('django.db.models.fields.CharField', [], {'default': "''", 'max_length': '64', 'db_index': 'True', 'blank': 'True'}), 'message': ('django.db.models.fields.TextField', [], {}), 'num_comments': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '0', 'null': 'True'}), 'platform': ('django.db.models.fields.CharField', [], {'max_length': '64', 'null': 'True'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Project']", 'null': 'True'}), 'resolved_at': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'db_index': 'True'}), 'score': ('sentry.db.models.fields.bounded.BoundedIntegerField', [], {'default': '0'}), 'short_id': ('sentry.db.models.fields.bounded.BoundedBigIntegerField', [], {'null': 'True'}), 'status': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '0', 'db_index': 'True'}), 'time_spent_count': ('sentry.db.models.fields.bounded.BoundedIntegerField', [], {'default': '0'}), 'time_spent_total': ('sentry.db.models.fields.bounded.BoundedIntegerField', [], {'default': '0'}), 'times_seen': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '1', 'db_index': 'True'}) }, 'sentry.groupassignee': { 'Meta': {'object_name': 'GroupAssignee', 'db_table': "'sentry_groupasignee'"}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'group': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'related_name': "'assignee_set'", 'unique': 'True', 'to': "orm['sentry.Group']"}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'related_name': "'assignee_set'", 'to': "orm['sentry.Project']"}), 'user': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'related_name': "'sentry_assignee_set'", 'to': "orm['sentry.User']"}) }, 'sentry.groupbookmark': { 'Meta': {'unique_together': "(('project', 'user', 'group'),)", 'object_name': 'GroupBookmark'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'null': 'True'}), 'group': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'related_name': "'bookmark_set'", 'to': "orm['sentry.Group']"}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'related_name': "'bookmark_set'", 'to': "orm['sentry.Project']"}), 'user': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'related_name': "'sentry_bookmark_set'", 'to': "orm['sentry.User']"}) }, 'sentry.groupcommitresolution': { 'Meta': {'unique_together': "(('group_id', 'commit_id'),)", 'object_name': 'GroupCommitResolution'}, 'commit_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'db_index': 'True'}), 'datetime': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'db_index': 'True'}), 'group_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}) }, 'sentry.groupemailthread': { 'Meta': {'unique_together': "(('email', 'group'), ('email', 'msgid'))", 'object_name': 'GroupEmailThread'}, 'date': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'db_index': 'True'}), 'email': ('django.db.models.fields.EmailField', [], {'max_length': '75'}), 'group': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'related_name': "'groupemail_set'", 'to': "orm['sentry.Group']"}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'msgid': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'related_name': "'groupemail_set'", 'to': "orm['sentry.Project']"}) }, 'sentry.grouphash': { 'Meta': {'unique_together': "(('project', 'hash'),)", 'object_name': 'GroupHash'}, 'group': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Group']", 'null': 'True'}), 'group_tombstone_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True', 'db_index': 'True'}), 'hash': ('django.db.models.fields.CharField', [], {'max_length': '32'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Project']", 'null': 'True'}), 'state': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True'}) }, 'sentry.groupmeta': { 'Meta': {'unique_together': "(('group', 'key'),)", 'object_name': 'GroupMeta'}, 'group': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Group']"}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'key': ('django.db.models.fields.CharField', [], {'max_length': '64'}), 'value': ('django.db.models.fields.TextField', [], {}) }, 'sentry.groupredirect': { 'Meta': {'object_name': 'GroupRedirect'}, 'group_id': ('sentry.db.models.fields.bounded.BoundedBigIntegerField', [], {'db_index': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'previous_group_id': ('sentry.db.models.fields.bounded.BoundedBigIntegerField', [], {'unique': 'True'}) }, 'sentry.grouprelease': { 'Meta': {'unique_together': "(('group_id', 'release_id', 'environment'),)", 'object_name': 'GroupRelease'}, 'environment': ('django.db.models.fields.CharField', [], {'default': "''", 'max_length': '64'}), 'first_seen': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'group_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'last_seen': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'db_index': 'True'}), 'project_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'db_index': 'True'}), 'release_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'db_index': 'True'}) }, 'sentry.groupresolution': { 'Meta': {'object_name': 'GroupResolution'}, 'actor_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True'}), 'datetime': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'db_index': 'True'}), 'group': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Group']", 'unique': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'release': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Release']"}), 'status': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '0'}), 'type': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True'}) }, 'sentry.grouprulestatus': { 'Meta': {'unique_together': "(('rule', 'group'),)", 'object_name': 'GroupRuleStatus'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'group': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Group']"}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'last_active': ('django.db.models.fields.DateTimeField', [], {'null': 'True'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Project']"}), 'rule': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Rule']"}), 'status': ('django.db.models.fields.PositiveSmallIntegerField', [], {'default': '0'}) }, 'sentry.groupseen': { 'Meta': {'unique_together': "(('user', 'group'),)", 'object_name': 'GroupSeen'}, 'group': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Group']"}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'last_seen': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Project']"}), 'user': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.User']", 'db_index': 'False'}) }, 'sentry.groupsnooze': { 'Meta': {'object_name': 'GroupSnooze'}, 'actor_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True'}), 'count': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True'}), 'group': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Group']", 'unique': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'state': ('jsonfield.fields.JSONField', [], {'null': 'True'}), 'until': ('django.db.models.fields.DateTimeField', [], {'null': 'True'}), 'user_count': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True'}), 'user_window': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True'}), 'window': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True'}) }, 'sentry.groupsubscription': { 'Meta': {'unique_together': "(('group', 'user'),)", 'object_name': 'GroupSubscription'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'null': 'True'}), 'group': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'related_name': "'subscription_set'", 'to': "orm['sentry.Group']"}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'is_active': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'related_name': "'subscription_set'", 'to': "orm['sentry.Project']"}), 'reason': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '0'}), 'user': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.User']"}) }, 'sentry.grouptagkey': { 'Meta': {'unique_together': "(('project_id', 'group_id', 'key'),)", 'object_name': 'GroupTagKey'}, 'group_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'db_index': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'key': ('django.db.models.fields.CharField', [], {'max_length': '32'}), 'project_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True', 'db_index': 'True'}), 'values_seen': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '0'}) }, 'sentry.grouptagvalue': { 'Meta': {'unique_together': "(('group_id', 'key', 'value'),)", 'object_name': 'GroupTagValue', 'db_table': "'sentry_messagefiltervalue'", 'index_together': "(('project_id', 'key', 'value', 'last_seen'),)"}, 'first_seen': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'null': 'True', 'db_index': 'True'}), 'group_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'db_index': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'key': ('django.db.models.fields.CharField', [], {'max_length': '32'}), 'last_seen': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'null': 'True', 'db_index': 'True'}), 'project_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True', 'db_index': 'True'}), 'times_seen': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '0'}), 'value': ('django.db.models.fields.CharField', [], {'max_length': '200'}) }, 'sentry.grouptombstone': { 'Meta': {'object_name': 'GroupTombstone'}, 'actor_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True'}), 'culprit': ('django.db.models.fields.CharField', [], {'max_length': '200', 'null': 'True', 'blank': 'True'}), 'data': ('sentry.db.models.fields.gzippeddict.GzippedDictField', [], {'null': 'True', 'blank': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'level': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '40', 'blank': 'True'}), 'message': ('django.db.models.fields.TextField', [], {}), 'previous_group_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'unique': 'True'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Project']"}) }, 'sentry.integration': { 'Meta': {'unique_together': "(('provider', 'external_id'),)", 'object_name': 'Integration'}, 'config': ('jsonfield.fields.JSONField', [], {'default': '{}'}), 'default_auth_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True', 'db_index': 'True'}), 'external_id': ('django.db.models.fields.CharField', [], {'max_length': '64'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'organizations': ('django.db.models.fields.related.ManyToManyField', [], {'related_name': "'integrations'", 'symmetrical': 'False', 'through': "orm['sentry.OrganizationIntegration']", 'to': "orm['sentry.Organization']"}), 'projects': ('django.db.models.fields.related.ManyToManyField', [], {'related_name': "'integrations'", 'symmetrical': 'False', 'through': "orm['sentry.ProjectIntegration']", 'to': "orm['sentry.Project']"}), 'provider': ('django.db.models.fields.CharField', [], {'max_length': '64'}) }, 'sentry.lostpasswordhash': { 'Meta': {'object_name': 'LostPasswordHash'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'hash': ('django.db.models.fields.CharField', [], {'max_length': '32'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'user': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.User']", 'unique': 'True'}) }, 'sentry.option': { 'Meta': {'object_name': 'Option'}, 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'key': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '64'}), 'last_updated': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'value': ('sentry.db.models.fields.encrypted.EncryptedPickledObjectField', [], {}) }, 'sentry.organization': { 'Meta': {'object_name': 'Organization'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'default_role': ('django.db.models.fields.CharField', [], {'default': "'member'", 'max_length': '32'}), 'flags': ('django.db.models.fields.BigIntegerField', [], {'default': '1'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'members': ('django.db.models.fields.related.ManyToManyField', [], {'related_name': "'org_memberships'", 'symmetrical': 'False', 'through': "orm['sentry.OrganizationMember']", 'to': "orm['sentry.User']"}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '64'}), 'slug': ('django.db.models.fields.SlugField', [], {'unique': 'True', 'max_length': '50'}), 'status': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '0'}) }, 'sentry.organizationaccessrequest': { 'Meta': {'unique_together': "(('team', 'member'),)", 'object_name': 'OrganizationAccessRequest'}, 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'member': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.OrganizationMember']"}), 'team': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Team']"}) }, 'sentry.organizationavatar': { 'Meta': {'object_name': 'OrganizationAvatar'}, 'avatar_type': ('django.db.models.fields.PositiveSmallIntegerField', [], {'default': '0'}), 'file': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.File']", 'unique': 'True', 'null': 'True', 'on_delete': 'models.SET_NULL'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'ident': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '32', 'db_index': 'True'}), 'organization': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'related_name': "'avatar'", 'unique': 'True', 'to': "orm['sentry.Organization']"}) }, 'sentry.organizationintegration': { 'Meta': {'unique_together': "(('organization', 'integration'),)", 'object_name': 'OrganizationIntegration'}, 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'integration': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Integration']"}), 'organization': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Organization']"}) }, 'sentry.organizationmember': { 'Meta': {'unique_together': "(('organization', 'user'), ('organization', 'email'))", 'object_name': 'OrganizationMember'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'email': ('django.db.models.fields.EmailField', [], {'max_length': '75', 'null': 'True', 'blank': 'True'}), 'flags': ('django.db.models.fields.BigIntegerField', [], {'default': '0'}), 'has_global_access': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'organization': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'related_name': "'member_set'", 'to': "orm['sentry.Organization']"}), 'role': ('django.db.models.fields.CharField', [], {'default': "'member'", 'max_length': '32'}), 'teams': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['sentry.Team']", 'symmetrical': 'False', 'through': "orm['sentry.OrganizationMemberTeam']", 'blank': 'True'}), 'token': ('django.db.models.fields.CharField', [], {'max_length': '64', 'unique': 'True', 'null': 'True', 'blank': 'True'}), 'type': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '50', 'blank': 'True'}), 'user': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'blank': 'True', 'related_name': "'sentry_orgmember_set'", 'null': 'True', 'to': "orm['sentry.User']"}) }, 'sentry.organizationmemberteam': { 'Meta': {'unique_together': "(('team', 'organizationmember'),)", 'object_name': 'OrganizationMemberTeam', 'db_table': "'sentry_organizationmember_teams'"}, 'id': ('sentry.db.models.fields.bounded.BoundedAutoField', [], {'primary_key': 'True'}), 'is_active': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'organizationmember': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.OrganizationMember']"}), 'team': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Team']"}) }, 'sentry.organizationonboardingtask': { 'Meta': {'unique_together': "(('organization', 'task'),)", 'object_name': 'OrganizationOnboardingTask'}, 'data': ('jsonfield.fields.JSONField', [], {'default': '{}'}), 'date_completed': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'organization': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Organization']"}), 'project_id': ('sentry.db.models.fields.bounded.BoundedBigIntegerField', [], {'null': 'True', 'blank': 'True'}), 'status': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {}), 'task': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {}), 'user': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.User']", 'null': 'True'}) }, 'sentry.organizationoption': { 'Meta': {'unique_together': "(('organization', 'key'),)", 'object_name': 'OrganizationOption', 'db_table': "'sentry_organizationoptions'"}, 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'key': ('django.db.models.fields.CharField', [], {'max_length': '64'}), 'organization': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Organization']"}), 'value': ('sentry.db.models.fields.encrypted.EncryptedPickledObjectField', [], {}) }, 'sentry.processingissue': { 'Meta': {'unique_together': "(('project', 'checksum', 'type'),)", 'object_name': 'ProcessingIssue'}, 'checksum': ('django.db.models.fields.CharField', [], {'max_length': '40', 'db_index': 'True'}), 'data': ('sentry.db.models.fields.gzippeddict.GzippedDictField', [], {}), 'datetime': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Project']"}), 'type': ('django.db.models.fields.CharField', [], {'max_length': '30'}) }, 'sentry.project': { 'Meta': {'unique_together': "(('team', 'slug'), ('organization', 'slug'))", 'object_name': 'Project'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'first_event': ('django.db.models.fields.DateTimeField', [], {'null': 'True'}), 'flags': ('django.db.models.fields.BigIntegerField', [], {'default': '0', 'null': 'True'}), 'forced_color': ('django.db.models.fields.CharField', [], {'max_length': '6', 'null': 'True', 'blank': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'organization': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Organization']"}), 'platform': ('django.db.models.fields.CharField', [], {'max_length': '64', 'null': 'True'}), 'public': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'slug': ('django.db.models.fields.SlugField', [], {'max_length': '50', 'null': 'True'}), 'status': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '0', 'db_index': 'True'}), 'team': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Team']"}) }, 'sentry.projectbookmark': { 'Meta': {'unique_together': "(('project_id', 'user'),)", 'object_name': 'ProjectBookmark'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'null': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'project_id': ('sentry.db.models.fields.bounded.BoundedBigIntegerField', [], {'null': 'True', 'blank': 'True'}), 'user': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.User']"}) }, 'sentry.projectdsymfile': { 'Meta': {'unique_together': "(('project', 'uuid'),)", 'object_name': 'ProjectDSymFile'}, 'cpu_name': ('django.db.models.fields.CharField', [], {'max_length': '40'}), 'file': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.File']"}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'object_name': ('django.db.models.fields.TextField', [], {}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Project']", 'null': 'True'}), 'uuid': ('django.db.models.fields.CharField', [], {'max_length': '36'}) }, 'sentry.projectintegration': { 'Meta': {'unique_together': "(('project', 'integration'),)", 'object_name': 'ProjectIntegration'}, 'config': ('jsonfield.fields.JSONField', [], {'default': '{}'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'integration': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Integration']"}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Project']"}) }, 'sentry.projectkey': { 'Meta': {'object_name': 'ProjectKey'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'null': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'label': ('django.db.models.fields.CharField', [], {'max_length': '64', 'null': 'True', 'blank': 'True'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'related_name': "'key_set'", 'to': "orm['sentry.Project']"}), 'public_key': ('django.db.models.fields.CharField', [], {'max_length': '32', 'unique': 'True', 'null': 'True'}), 'rate_limit_count': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True'}), 'rate_limit_window': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True'}), 'roles': ('django.db.models.fields.BigIntegerField', [], {'default': '1'}), 'secret_key': ('django.db.models.fields.CharField', [], {'max_length': '32', 'unique': 'True', 'null': 'True'}), 'status': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '0', 'db_index': 'True'}) }, 'sentry.projectoption': { 'Meta': {'unique_together': "(('project', 'key'),)", 'object_name': 'ProjectOption', 'db_table': "'sentry_projectoptions'"}, 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'key': ('django.db.models.fields.CharField', [], {'max_length': '64'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Project']"}), 'value': ('sentry.db.models.fields.encrypted.EncryptedPickledObjectField', [], {}) }, 'sentry.projectplatform': { 'Meta': {'unique_together': "(('project_id', 'platform'),)", 'object_name': 'ProjectPlatform'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'last_seen': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'platform': ('django.db.models.fields.CharField', [], {'max_length': '64'}), 'project_id': ('sentry.db.models.fields.bounded.BoundedBigIntegerField', [], {}) }, 'sentry.rawevent': { 'Meta': {'unique_together': "(('project', 'event_id'),)", 'object_name': 'RawEvent'}, 'data': ('sentry.db.models.fields.node.NodeField', [], {'null': 'True', 'blank': 'True'}), 'datetime': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'event_id': ('django.db.models.fields.CharField', [], {'max_length': '32', 'null': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Project']"}) }, 'sentry.release': { 'Meta': {'unique_together': "(('organization', 'version'),)", 'object_name': 'Release'}, 'authors': ('sentry.db.models.fields.array.ArrayField', [], {'of': ('django.db.models.fields.TextField', [], {})}), 'commit_count': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True'}), 'data': ('jsonfield.fields.JSONField', [], {'default': '{}'}), 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'date_released': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'date_started': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'last_commit_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True'}), 'last_deploy_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True'}), 'new_groups': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '0'}), 'organization': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Organization']"}), 'owner': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.User']", 'null': 'True', 'blank': 'True'}), 'project_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True'}), 'projects': ('django.db.models.fields.related.ManyToManyField', [], {'related_name': "'releases'", 'symmetrical': 'False', 'through': "orm['sentry.ReleaseProject']", 'to': "orm['sentry.Project']"}), 'ref': ('django.db.models.fields.CharField', [], {'max_length': '64', 'null': 'True', 'blank': 'True'}), 'total_deploys': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True'}), 'url': ('django.db.models.fields.URLField', [], {'max_length': '200', 'null': 'True', 'blank': 'True'}), 'version': ('django.db.models.fields.CharField', [], {'max_length': '64'}) }, 'sentry.releasecommit': { 'Meta': {'unique_together': "(('release', 'commit'), ('release', 'order'))", 'object_name': 'ReleaseCommit'}, 'commit': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Commit']"}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'order': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {}), 'organization_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'db_index': 'True'}), 'project_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True'}), 'release': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Release']"}) }, 'sentry.releaseenvironment': { 'Meta': {'unique_together': "(('organization_id', 'release_id', 'environment_id'),)", 'object_name': 'ReleaseEnvironment', 'db_table': "'sentry_environmentrelease'"}, 'environment_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'db_index': 'True'}), 'first_seen': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'last_seen': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'db_index': 'True'}), 'organization_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'db_index': 'True'}), 'project_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True'}), 'release_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'db_index': 'True'}) }, 'sentry.releasefile': { 'Meta': {'unique_together': "(('release', 'ident'),)", 'object_name': 'ReleaseFile'}, 'dist': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Distribution']", 'null': 'True'}), 'file': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.File']"}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'ident': ('django.db.models.fields.CharField', [], {'max_length': '40'}), 'name': ('django.db.models.fields.TextField', [], {}), 'organization': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Organization']"}), 'project_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True'}), 'release': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Release']"}) }, 'sentry.releaseheadcommit': { 'Meta': {'unique_together': "(('repository_id', 'release'),)", 'object_name': 'ReleaseHeadCommit'}, 'commit': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Commit']"}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'organization_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'db_index': 'True'}), 'release': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Release']"}), 'repository_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {}) }, 'sentry.releaseproject': { 'Meta': {'unique_together': "(('project', 'release'),)", 'object_name': 'ReleaseProject', 'db_table': "'sentry_release_project'"}, 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'new_groups': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '0', 'null': 'True'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Project']"}), 'release': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Release']"}) }, 'sentry.repository': { 'Meta': {'unique_together': "(('organization_id', 'name'), ('organization_id', 'provider', 'external_id'))", 'object_name': 'Repository'}, 'config': ('jsonfield.fields.JSONField', [], {'default': '{}'}), 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'external_id': ('django.db.models.fields.CharField', [], {'max_length': '64', 'null': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'integration_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True', 'db_index': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '200'}), 'organization_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'db_index': 'True'}), 'provider': ('django.db.models.fields.CharField', [], {'max_length': '64', 'null': 'True'}), 'status': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '0', 'db_index': 'True'}), 'url': ('django.db.models.fields.URLField', [], {'max_length': '200', 'null': 'True'}) }, 'sentry.reprocessingreport': { 'Meta': {'unique_together': "(('project', 'event_id'),)", 'object_name': 'ReprocessingReport'}, 'datetime': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'event_id': ('django.db.models.fields.CharField', [], {'max_length': '32', 'null': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Project']"}) }, 'sentry.rule': { 'Meta': {'object_name': 'Rule'}, 'data': ('sentry.db.models.fields.gzippeddict.GzippedDictField', [], {}), 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'label': ('django.db.models.fields.CharField', [], {'max_length': '64'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Project']"}), 'status': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '0', 'db_index': 'True'}) }, 'sentry.savedsearch': { 'Meta': {'unique_together': "(('project', 'name'),)", 'object_name': 'SavedSearch'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'is_default': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '128'}), 'owner': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.User']", 'null': 'True'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Project']"}), 'query': ('django.db.models.fields.TextField', [], {}) }, 'sentry.savedsearchuserdefault': { 'Meta': {'unique_together': "(('project', 'user'),)", 'object_name': 'SavedSearchUserDefault', 'db_table': "'sentry_savedsearch_userdefault'"}, 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Project']"}), 'savedsearch': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.SavedSearch']"}), 'user': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.User']"}) }, 'sentry.scheduleddeletion': { 'Meta': {'unique_together': "(('app_label', 'model_name', 'object_id'),)", 'object_name': 'ScheduledDeletion'}, 'aborted': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'actor_id': ('sentry.db.models.fields.bounded.BoundedBigIntegerField', [], {'null': 'True'}), 'app_label': ('django.db.models.fields.CharField', [], {'max_length': '64'}), 'data': ('jsonfield.fields.JSONField', [], {'default': '{}'}), 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'date_scheduled': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime(2017, 10, 7, 0, 0)'}), 'guid': ('django.db.models.fields.CharField', [], {'default': "'2bb47b23f4f14c288d9ca0b8eea5cdb6'", 'unique': 'True', 'max_length': '32'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'in_progress': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'model_name': ('django.db.models.fields.CharField', [], {'max_length': '64'}), 'object_id': ('sentry.db.models.fields.bounded.BoundedBigIntegerField', [], {}) }, 'sentry.scheduledjob': { 'Meta': {'object_name': 'ScheduledJob'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'date_scheduled': ('django.db.models.fields.DateTimeField', [], {}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '128'}), 'payload': ('jsonfield.fields.JSONField', [], {'default': '{}'}) }, 'sentry.tagkey': { 'Meta': {'unique_together': "(('project_id', 'key'),)", 'object_name': 'TagKey', 'db_table': "'sentry_filterkey'"}, 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'key': ('django.db.models.fields.CharField', [], {'max_length': '32'}), 'label': ('django.db.models.fields.CharField', [], {'max_length': '64', 'null': 'True'}), 'project_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'db_index': 'True'}), 'status': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '0'}), 'values_seen': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '0'}) }, 'sentry.tagvalue': { 'Meta': {'unique_together': "(('project_id', 'key', 'value'),)", 'object_name': 'TagValue', 'db_table': "'sentry_filtervalue'"}, 'data': ('sentry.db.models.fields.gzippeddict.GzippedDictField', [], {'null': 'True', 'blank': 'True'}), 'first_seen': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'null': 'True', 'db_index': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'key': ('django.db.models.fields.CharField', [], {'max_length': '32'}), 'last_seen': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'null': 'True', 'db_index': 'True'}), 'project_id': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'null': 'True', 'db_index': 'True'}), 'times_seen': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '0'}), 'value': ('django.db.models.fields.CharField', [], {'max_length': '200'}) }, 'sentry.team': { 'Meta': {'unique_together': "(('organization', 'slug'),)", 'object_name': 'Team'}, 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'null': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '64'}), 'organization': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Organization']"}), 'slug': ('django.db.models.fields.SlugField', [], {'max_length': '50'}), 'status': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {'default': '0'}) }, 'sentry.user': { 'Meta': {'object_name': 'User', 'db_table': "'auth_user'"}, 'date_joined': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'email': ('django.db.models.fields.EmailField', [], {'max_length': '75', 'blank': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedAutoField', [], {'primary_key': 'True'}), 'is_active': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'is_managed': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'is_password_expired': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'is_staff': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'is_superuser': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'last_active': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now', 'null': 'True'}), 'last_login': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'last_password_change': ('django.db.models.fields.DateTimeField', [], {'null': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '200', 'db_column': "'first_name'", 'blank': 'True'}), 'password': ('django.db.models.fields.CharField', [], {'max_length': '128'}), 'session_nonce': ('django.db.models.fields.CharField', [], {'max_length': '12', 'null': 'True'}), 'username': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '128'}) }, 'sentry.useravatar': { 'Meta': {'object_name': 'UserAvatar'}, 'avatar_type': ('django.db.models.fields.PositiveSmallIntegerField', [], {'default': '0'}), 'file': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.File']", 'unique': 'True', 'null': 'True', 'on_delete': 'models.SET_NULL'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'ident': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '32', 'db_index': 'True'}), 'user': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'related_name': "'avatar'", 'unique': 'True', 'to': "orm['sentry.User']"}) }, 'sentry.useremail': { 'Meta': {'unique_together': "(('user', 'email'),)", 'object_name': 'UserEmail'}, 'date_hash_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'email': ('django.db.models.fields.EmailField', [], {'max_length': '75'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'is_verified': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'user': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'related_name': "'emails'", 'to': "orm['sentry.User']"}), 'validation_hash': ('django.db.models.fields.CharField', [], {'default': "u'eKXH0O19GnlrYRLwYuXw8f6cCLOGb3ky'", 'max_length': '32'}) }, 'sentry.useroption': { 'Meta': {'unique_together': "(('user', 'project', 'key'), ('user', 'organization', 'key'))", 'object_name': 'UserOption'}, 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'key': ('django.db.models.fields.CharField', [], {'max_length': '64'}), 'organization': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Organization']", 'null': 'True'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Project']", 'null': 'True'}), 'user': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.User']"}), 'value': ('sentry.db.models.fields.encrypted.EncryptedPickledObjectField', [], {}) }, 'sentry.userreport': { 'Meta': {'unique_together': "(('project', 'event_id'),)", 'object_name': 'UserReport', 'index_together': "(('project', 'event_id'), ('project', 'date_added'))"}, 'comments': ('django.db.models.fields.TextField', [], {}), 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'email': ('django.db.models.fields.EmailField', [], {'max_length': '75'}), 'event_id': ('django.db.models.fields.CharField', [], {'max_length': '32'}), 'event_user_id': ('sentry.db.models.fields.bounded.BoundedBigIntegerField', [], {'null': 'True'}), 'group': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Group']", 'null': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '128'}), 'project': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.Project']"}) }, 'sentry.versiondsymfile': { 'Meta': {'unique_together': "(('dsym_file', 'version', 'build'),)", 'object_name': 'VersionDSymFile'}, 'build': ('django.db.models.fields.CharField', [], {'max_length': '32', 'null': 'True'}), 'date_added': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'dsym_app': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.DSymApp']"}), 'dsym_file': ('sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], {'to': "orm['sentry.ProjectDSymFile']", 'null': 'True'}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], {'primary_key': 'True'}), 'version': ('django.db.models.fields.CharField', [], {'max_length': '32'}) } } complete_apps = ['sentry']
# No shebang line, this module is meant to be imported # # Copyright 2014 Oliver Palmer # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """ Configuration ------------- Central module for storing and working with a live configuration objects. This module instances :class:`.ConfigurationWithCallbacks` onto :const:`.config`. Attempting to reload this module will not reinstance the :const:`.config` object. The :const:`.config` object should be directly imported from this module to be used: >>> from pyfarm.agent.config import config """ import os from datetime import datetime from os.path import join, abspath, dirname from logging import _levelNames, getLogger as _getLogger from pyfarm.core.enums import NOTSET, STRING_TYPES from pyfarm.core.config import Configuration from pyfarm.agent.logger import getLogger from pyfarm.agent.sysinfo import memory, cpu, network logger = getLogger("agent.config") class LoggingConfiguration(Configuration): """ Special configuration object which logs when a key is changed in a dictionary. If the reactor is not running then log messages will be queued until they can be emitted so they are not lost. .. automethod:: _expandvars """ MODIFIED = "modified" CREATED = "created" DELETED = "deleted" def __init__(self, data=None, environment=None, load=True): super(LoggingConfiguration, self).__init__("pyfarm.agent") assert data is None or isinstance(data, dict) assert environment is None or isinstance(environment, dict) if environment is None: environment = os.environ if load: self.load(environment=environment) self.update( # A mapping of UUIDs to job type instances. jobtypes={}, # A mapping of tasks to job type instances. current_assignments={}, # The last time we were in touch with the master, # or the last time it was in touch with us. last_master_contact=None, # The last time we announced ourselves to the master. This # may be longer than --master-reannounce if # `last_master_contact` caused us to skip an announcement. last_announce=None) if data is not None: self.update(data) # Load configuration file(s) for jobtypes and then # update the local instance if load: jobtypes_config = Configuration( "pyfarm.jobtypes", version=self.version) jobtypes_config.load(environment=environment) self.update(jobtypes_config) def _map_value(self, key, value): """ Some configuration values have keywords associated with them, this function is responsible for returning the 'fixed' value. """ if value == "auto": if key == "agent_ram": return memory.total_ram() if key == "agent_cpus": return cpu.total_cpus() if key == "agent_hostname": return network.hostname() if key == "agent_static_root": return abspath( join(dirname(__file__), "http", "static")) return value def __setitem__(self, key, value): value = self._map_value(key, value) if key not in self: self.changed(self.CREATED, key, value, NOTSET) elif self[key] != value: self.changed(self.MODIFIED, key, value, self[key]) # Run the base class's method after the above otherwise # the value would already be in the data we're comparing # against super(LoggingConfiguration, self).__setitem__(key, value) def __delitem__(self, key): """ Deletes the provided ``key`` and triggers a ``delete`` event using :meth:`.changed`. """ old_value = self[key] if key in self else NOTSET super(LoggingConfiguration, self).__delitem__(key) self.changed(self.DELETED, key, NOTSET, old_value) def pop(self, key, *args): """ Deletes the provided ``key`` and triggers a ``delete`` event using :meth:`.changed`. """ old_value = self[key] if key in self else NOTSET super(LoggingConfiguration, self).pop(key, *args) self.changed(self.DELETED, key, NOTSET, old_value) def clear(self): """ Deletes all keys in this object and triggers a ``delete`` event using :meth:`.changed` for each one. """ keys = list(self.keys()) # Not quite the same thing as dict.clear() but the effect # is the same as the call to changed() is more real time. for key in keys: old_value = self.pop(key, NOTSET) self.changed(self.DELETED, key, NOTSET, old_value) def update(self, data=None, **kwargs): """ Updates the data held within this object and triggers the appropriate events with :meth:`.changed`. """ def trigger_changed(changed_object): try: items = changed_object.iteritems() except AttributeError: # pragma: no cover items = changed_object.items() for key, value in items: if key not in self: self.changed(self.CREATED, key, value, NOTSET) elif self[key] != value: self.changed(self.MODIFIED, key, value, self[key]) if isinstance(data, dict): for key, value in data.items(): data[key] = self._map_value(key, value) trigger_changed(data) elif data is not None: raise TypeError("Expected None or dict for `data`") elif data is None: data = {} if kwargs: for key, value in kwargs.items(): kwargs[key] = self._map_value(key, value) trigger_changed(kwargs) super(LoggingConfiguration, self).update(data, **kwargs) def changed(self, change_type, key, new_value=NOTSET, old_value=NOTSET): """ This method is run whenever one of the keys in this object changes. """ assert new_value is not NOTSET if change_type != self.DELETED else True assert old_value is NOTSET if change_type == self.CREATED else True if change_type == self.MODIFIED: logger.debug("Modified %r = %r", key, new_value) elif change_type == self.CREATED: logger.debug("Set %r = %r", key, new_value) elif change_type == self.DELETED: logger.debug("Deleted %r", key) else: raise NotImplementedError( "Don't know how to handle change_type %r" % change_type) def master_contacted(self, update=True, announcement=False): """ Simple method that will update the ``last_master_contact`` and then return the result. :param bool update: Setting this value to False will just return the current value instead of updating the value too. """ if not update and "last_master_contact" not in self: return None if announcement: self["last_announce"] = datetime.utcnow() if update: self["last_master_contact"] = datetime.utcnow() return self["last_master_contact"] class ConfigurationWithCallbacks(LoggingConfiguration): """ Subclass of :class:`.LoggingDictionary` that provides the ability to run a function when a value is changed. """ callbacks = {} @classmethod def register_callback(cls, key, callback, append=False): """ Register a function as a callback for ``key``. When ``key`` is set the given ``callback`` will be run by :meth:`.changed` :param string key: the key which when changed in any way will execute ``callback`` :param callable callback: the function or method to register :param boolean append: by default attempting to register a callback which has already been registered will do nothing, setting this to ``True`` overrides this behavior. """ assert callable(callback) callbacks = cls.callbacks.setdefault(key, []) if callback in callbacks and not append: logger.debug( "%r is already a registered callback for %r", callback, key) return callbacks.append(callback) logger.debug("Registered callback %r for %r", callback, key) @classmethod def deregister_callback(cls, key, callback): """ Removes any callback(s) that are registered with the provided ``key`` """ results = cls.callbacks.pop(key, None) if results is None: # pragma: no cover logger.debug( "%r is not a registered callback for %r", callback, key) def clear(self, callbacks=False): """ Performs the same operations as :meth:`dict.clear` except this method can also clear any registered callbacks if requested. """ super(ConfigurationWithCallbacks, self).clear() if callbacks: self.callbacks.clear() def changed(self, change_type, key, new_value=NOTSET, old_value=NOTSET): """ This method is called internally whenever a given ``key`` changes which in turn will pass off the change to any registered callback(s). """ super(ConfigurationWithCallbacks, self).changed( change_type, key, new_value=new_value, old_value=old_value) if key in self.callbacks: for callback in self.callbacks[key]: callback(change_type, key, new_value, old_value) logger.debug( "Key %r was %r, calling callback %s", key, change_type, callback) def configure_logger_level(): """ When called this will set the root logger level based on the ``agent_global_logger_level`` configuration variable. """ # Import here to prevent circular imports and because we # don't want CONFIGURATION in the namespace of this module. from pyfarm.agent.logger.twistd import CONFIGURATION root_level = config["agent_global_logger_level"] if isinstance(root_level, STRING_TYPES): root_level = _levelNames[root_level.upper()] assert isinstance(root_level, int) levels = CONFIGURATION["levels"] for index, (name, level) in enumerate(levels): if name == "": levels[index] = ("", root_level) break else: levels.insert(0, ("", root_level)) # Just to be safe, we also set pf's root level pf = _getLogger("pf") pf.setLevel(root_level) # Prevent a call to reload() from dumping the config object try: config except NameError: config = ConfigurationWithCallbacks() configure_logger_level()
# Licensed to the Apache Software Foundation (ASF) under one # or more contributor license agreements. See the NOTICE file # distributed with this work for additional information # regarding copyright ownership. The ASF licenses this file # to you under the Apache License, Version 2.0 (the # "License"); you may not use this file except in compliance # with the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the License for the # specific language governing permissions and limitations # under the License. # coding: utf-8 # pylint: disable=invalid-name, protected-access, too-many-arguments, no-self-use, too-many-locals, broad-except, too-many-lines, unnecessary-pass """numpy interface for operators.""" import traceback import warnings import collections from array import array from threading import Lock import ctypes from ctypes import CFUNCTYPE, POINTER, Structure, pointer from ctypes import c_void_p, c_int, c_char, c_char_p, cast, c_bool from .base import _LIB, check_call, MXCallbackList, c_array, c_array_buf, mx_int, OpHandle from .base import c_str, mx_uint, mx_float, ctypes2numpy_shared, NDArrayHandle, py_str from . import symbol, context from .ndarray import NDArray, _DTYPE_NP_TO_MX, _DTYPE_MX_TO_NP from .ndarray.ndarray import _STORAGE_TYPE_STR_TO_ID, _STORAGE_TYPE_ID_TO_STR from .ndarray.ndarray import _STORAGE_TYPE_UNDEFINED, _STORAGE_TYPE_DEFAULT from .ndarray.ndarray import _STORAGE_TYPE_CSR, _STORAGE_TYPE_ROW_SPARSE from .ndarray import _ndarray_cls from .numpy.multiarray import _np_ndarray_cls from .util import is_np_array c_int_p = POINTER(c_int) class PythonOp(object): """Base class for operators implemented in Python. Parameters ---------- need_top_grad : bool the default need_top_grad() function returns this value. """ _ref_holder = [] def __init__(self, need_top_grad=True): self.info_ = None self.need_top_grad_ = need_top_grad warnings.warn('PythonOp has been deprecated. Please use CustomOp') def __call__(self, *args, **kwargs): return self.get_symbol(*args, **kwargs) def get_symbol(self, *args, **kwargs): """Create a symbol from numpy operator. This should only be called once per instance if the operator contains internal states. Parameters ---------- args : list a list of input arguments (symbols). Returns ------- sym : mxnet.symbol.Symbol """ raise NotImplementedError("Must override this") def forward(self, in_data, out_data): """Forward interface. Override to create new operators. Parameters ---------- in_data, out_data: list input and output for forward. See document for corresponding arguments of Operator::Forward """ out_data[0][:] = in_data[0] def backward(self, out_grad, in_data, out_data, in_grad): """Backward interface. Can override when creating new operators. Parameters ---------- out_grad, in_data, out_data, in_grad : list input and output for backward. See document for corresponding arguments of Operator::Backward """ # pylint: disable=W0613 in_grad[0][:] = 1.0 def infer_shape(self, in_shape): """Interface for ``infer_shape``. Can override when creating new operators. Parameters ---------- in_shape : list List of argument shapes in the same order as declared in list_arguments. Returns ------- in_shape : list List of argument shapes. Can be modified from in_shape. out_shape : list List of output shapes calculated from in_shape, in the same order as declared in list_arguments. """ return in_shape, [in_shape[0]] def list_outputs(self): """Interface for ``list_outputs``. Can override when creating new operators. Returns ------- outputs : list List of output blob names. """ return ['output'] def list_arguments(self): """Interface for ``list_arguments``. Can override when creating new operators. Returns ------- in_shape : list list of argument shapes in the same order as declared in list_arguments. """ return ['data'] def need_top_grad(self): """Whether this operator needs out_grad for backward. Returns ------- need_top_grad : bool Whether this operator needs out_grad for backward. Should be set to False for loss layers. """ return self.need_top_grad_ class NumpyOp(PythonOp): """Base class for numpy operators. numpy operators allow parts of computation in symbolic graph to be writen in numpy. This feature is intended for quickly hacking out a solution for non performance critical parts. Please consider write a c++ implementation if it becomes a bottleneck. Note that if your operator contains internal states (like arrays), it cannot be used for multi-gpu training. """ def __init__(self, need_top_grad=True): super(NumpyOp, self).__init__(need_top_grad) warnings.warn('NumpyOp has been deprecated. Please use CustomOp') def get_symbol(self, *args, **kwargs): fb_functype = CFUNCTYPE(None, c_int, POINTER(POINTER(mx_float)), POINTER(c_int), POINTER(POINTER(mx_uint)), POINTER(c_int), c_void_p) infer_functype = CFUNCTYPE(None, c_int, POINTER(c_int), POINTER(POINTER(mx_int)), c_void_p) list_functype = CFUNCTYPE(None, POINTER(POINTER(POINTER(c_char))), c_void_p) class NumpyOpInfo(Structure): """Structure that holds Callback information. Passed to NumpyOpProp""" _fields_ = [ ('forward', fb_functype), ('backward', fb_functype), ('infer_shape', infer_functype), ('list_outputs', list_functype), ('list_arguments', list_functype), ('p_forward', c_void_p), ('p_backward', c_void_p), ('p_infer_shape', c_void_p), ('p_list_outputs', c_void_p), ('p_list_arguments', c_void_p), ] def forward_entry(num_tensor, tensor_ptrs, tensor_dims, tensor_shapes, tensor_tags, _): """C Callback for NumpyOp::Forward""" tensors = [[] for i in range(4)] for i in range(num_tensor): shape = [tensor_shapes[i][j] for j in range(tensor_dims[i])] buff = ctypes2numpy_shared(tensor_ptrs[i], shape) tensors[tensor_tags[i]].append(buff) self.forward(in_data=tensors[0], out_data=tensors[1]) def backward_entry(num_tensor, tensor_ptrs, tensor_dims, tensor_shapes, tensor_tags, _): """C Callback for NumpyOp::Backward""" tensors = [[] for i in range(4)] for i in range(num_tensor): shape = [tensor_shapes[i][j] for j in range(tensor_dims[i])] buff = ctypes2numpy_shared(tensor_ptrs[i], shape) tensors[tensor_tags[i]].append(buff) self.backward(in_data=tensors[0], out_data=tensors[1], in_grad=tensors[2], out_grad=tensors[3]) def infer_shape_entry(num_tensor, tensor_dims, tensor_shapes, _): """C Callback for NumpyOpProp::InferShape""" n_in = len(self.list_arguments()) n_out = len(self.list_outputs()) assert num_tensor == n_in + n_out shapes = [[tensor_shapes[i][j] for j in range(tensor_dims[i])] for i in range(n_in)] ishape, oshape = self.infer_shape(shapes) assert len(oshape) == n_out assert len(ishape) == n_in rshape = list(ishape) + list(oshape) for i in range(n_in+n_out): tensor_shapes[i] = cast(c_array_buf(mx_int, array('i', rshape[i])), POINTER(mx_int)) tensor_dims[i] = len(rshape[i]) def list_outputs_entry(out, _): """C Callback for NumpyOpProp::ListOutputs""" ret = self.list_outputs() ret = [c_str(i) for i in ret] + [c_char_p(0)] ret = c_array(c_char_p, ret) out[0] = cast(ret, POINTER(POINTER(c_char))) def list_arguments_entry(out, _): """C Callback for NumpyOpProp::ListArguments""" ret = self.list_arguments() ret = [c_str(i) for i in ret] + [c_char_p(0)] ret = c_array(c_char_p, ret) out[0] = cast(ret, POINTER(POINTER(c_char))) self.info_ = NumpyOpInfo(fb_functype(forward_entry), fb_functype(backward_entry), infer_functype(infer_shape_entry), list_functype(list_outputs_entry), list_functype(list_arguments_entry), None, None, None, None, None) cb_ptr = format(cast(pointer(self.info_), c_void_p).value, 'x') # pylint: disable=E1101 sym = symbol._internal._Native(*args, info=cb_ptr, need_top_grad=self.need_top_grad(), **kwargs) # keep a reference of ourself in PythonOp so we don't get garbage collected. PythonOp._ref_holder.append(self) return sym class NDArrayOp(PythonOp): """Base class for numpy operators. numpy operators allow parts of computation in symbolic graph to be writen in numpy. This feature is intended for quickly hacking out a solution for non performance critical parts. Please consider write a c++ implementation if it becomes a bottleneck. Note that if your operator contains internal states (like arrays), it cannot be used for multi-gpu training. """ def __init__(self, need_top_grad=True): super(NDArrayOp, self).__init__(need_top_grad) warnings.warn('NDArrayOp has been deprecated. Please use CustomOp') def get_symbol(self, *args, **kwargs): fb_functype = CFUNCTYPE(c_bool, c_int, POINTER(c_void_p), POINTER(c_int), c_void_p) infer_functype = CFUNCTYPE(c_bool, c_int, POINTER(c_int), POINTER(POINTER(mx_int)), c_void_p) list_functype = CFUNCTYPE(c_bool, POINTER(POINTER(POINTER(c_char))), c_void_p) deps_functype = CFUNCTYPE(c_bool, c_int_p, c_int_p, c_int_p, c_int_p, POINTER(c_int_p), c_void_p) class NDArrayOpInfo(Structure): """Structure that holds Callback information. Passed to NDArrayOpProp""" _fields_ = [ ('forward', fb_functype), ('backward', fb_functype), ('infer_shape', infer_functype), ('list_outputs', list_functype), ('list_arguments', list_functype), ('declare_backward_dependency', deps_functype), ('p_forward', c_void_p), ('p_backward', c_void_p), ('p_infer_shape', c_void_p), ('p_list_outputs', c_void_p), ('p_list_arguments', c_void_p), ('p_declare_backward_dependency', c_void_p) ] def forward_entry(num_ndarray, ndarraies, tags, _): """C Callback for NDArrayOp::Forward""" try: tensors = [[] for i in range(4)] for i in range(num_ndarray): if tags[i] == 1: tensors[tags[i]].append(NDArray(cast(ndarraies[i], NDArrayHandle), writable=True)) else: tensors[tags[i]].append(NDArray(cast(ndarraies[i], NDArrayHandle), writable=False)) self.forward(in_data=tensors[0], out_data=tensors[1]) except Exception: print('Error in NDArrayOp.forward: %s' % traceback.format_exc()) return False return True def backward_entry(num_ndarray, ndarraies, tags, _): """C Callback for NDArrayOp::Backward""" try: tensors = [[] for i in range(4)] for i in range(num_ndarray): if tags[i] == 2: tensors[tags[i]].append(NDArray(cast(ndarraies[i], NDArrayHandle), writable=True)) else: tensors[tags[i]].append(NDArray(cast(ndarraies[i], NDArrayHandle), writable=False)) self.backward(in_data=tensors[0], out_data=tensors[1], in_grad=tensors[2], out_grad=tensors[3]) except Exception: print('Error in NDArrayOp.backward: %s' % traceback.format_exc()) return False return True def infer_shape_entry(num_tensor, tensor_dims, tensor_shapes, _): """C Callback for NDArrayOpProp::InferShape""" try: n_in = len(self.list_arguments()) n_out = len(self.list_outputs()) assert num_tensor == n_in + n_out shapes = [[tensor_shapes[i][j] for j in range(tensor_dims[i])] for i in range(n_in)] ishape, oshape = self.infer_shape(shapes) assert len(oshape) == n_out assert len(ishape) == n_in rshape = list(ishape) + list(oshape) for i in range(n_in+n_out): tensor_shapes[i] = cast(c_array_buf(mx_int, array('i', rshape[i])), POINTER(mx_int)) tensor_dims[i] = len(rshape[i]) except Exception: print('Error in NDArrayOp.infer_shape: %s' % traceback.format_exc()) return False return True def list_outputs_entry(out, _): """C Callback for NDArrayOpProp::ListOutputs""" try: ret = self.list_outputs() ret = [c_str(i) for i in ret] + [c_char_p(0)] ret = c_array(c_char_p, ret) out[0] = cast(ret, POINTER(POINTER(c_char))) except Exception: print('Error in NDArrayOp.list_outputs: %s' % traceback.format_exc()) return False return True def list_arguments_entry(out, _): """C Callback for NDArrayOpProp::ListArguments""" try: ret = self.list_arguments() ret = [c_str(i) for i in ret] + [c_char_p(0)] ret = c_array(c_char_p, ret) out[0] = cast(ret, POINTER(POINTER(c_char))) except Exception: print('Error in NDArrayOp.list_arguments: %s' % traceback.format_exc()) return False return True def declare_backward_dependency(out_grad, in_data, out_data, num_dep, deps, _): """C Callback for NDArrayOpProp::DeclareBacwardDependency""" try: out_grad = [out_grad[i] for i in range(len(self.list_outputs()))] in_data = [in_data[i] for i in range(len(self.list_arguments()))] out_data = [out_data[i] for i in range(len(self.list_outputs()))] rdeps = self.declare_backward_dependency(out_grad, in_data, out_data) num_dep[0] = len(rdeps) rdeps = cast(c_array_buf(c_int, array('i', rdeps)), c_int_p) deps[0] = rdeps except Exception: print('Error in NDArrayOp.declare_backward_dependency: %s' % traceback.format_exc()) return False return True self.info_ = NDArrayOpInfo(fb_functype(forward_entry), fb_functype(backward_entry), infer_functype(infer_shape_entry), list_functype(list_outputs_entry), list_functype(list_arguments_entry), deps_functype(declare_backward_dependency), None, None, None, None, None, None) cb_ptr = format(cast(pointer(self.info_), c_void_p).value, 'x') # pylint: disable=E1101 sym = symbol._internal._NDArray(*args, info=cb_ptr, **kwargs) # keep a reference of ourself in PythonOp so we don't get garbage collected. PythonOp._ref_holder.append(self) return sym def declare_backward_dependency(self, out_grad, in_data, out_data): """Declare dependencies of this operator for backward pass. Parameters ---------- out_grad : list of int ids of out_grad blobs. in_data : list of int ids of in_data blobs. out_data: list of int ids of out_data blobs. Returns ------- deps : list of int ids of the needed blobs. """ deps = [] if self.need_top_grad(): deps.extend(out_grad) deps.extend(in_data) deps.extend(out_data) return deps class CustomOp(object): """Base class for operators implemented in python""" def __init__(self): pass def forward(self, is_train, req, in_data, out_data, aux): """Forward interface. Can override when creating new operators. Parameters ---------- is_train : bool whether this is for training req : list of str how to assign to out_data. can be 'null', 'write', or 'add'. You can optionally use self.assign(dst, req, src) to handle this. in_data, out_data, aux: list of NDArrays input, output, and auxiliary states for forward. See document for corresponding arguments of Operator::Forward """ # pylint: disable=W0613 pass def backward(self, req, out_grad, in_data, out_data, in_grad, aux): """Backward interface. Can override when creating new operators. Parameters ---------- req : list of str how to assign to in_grad. can be 'null', 'write', or 'add'. You can optionally use self.assign(dst, req, src) to handle this. out_grad, in_data, out_data, in_grad, aux : list of NDArrays input and output for backward. See document for corresponding arguments of Operator::Backward """ # pylint: disable=W0613 pass def assign(self, dst, req, src): """Helper function for assigning into dst depending on requirements.""" if req == 'null': return elif req in ('write', 'inplace'): if is_np_array(): dst[()] = src else: dst[:] = src elif req == 'add': if is_np_array(): dst[()] += src else: dst[:] += src class CustomOpProp(object): """Base class for operator property class implemented in python. Parameters ---------- need_top_grad : bool The default declare_backward_dependency function. Use this value to determine whether this operator needs gradient input. """ def __init__(self, need_top_grad=True): self.need_top_grad_ = need_top_grad def infer_shape(self, in_shape): """infer_shape interface. Can override when creating new operators. Parameters ---------- in_shape : list List of argument shapes in the same order as declared in list_arguments. Returns ------- in_shape : list List of argument shapes. Can be modified from in_shape. out_shape : list List of output shapes calculated from in_shape, in the same order as declared in list_outputs. aux_shape : Optional, list List of aux shapes calculated from in_shape, in the same order as declared in list_auxiliary_states. """ return in_shape, (in_shape[0],)*len(self.list_outputs()), () def infer_type(self, in_type): """infer_type interface. override to create new operators Parameters ---------- in_type : list of np.dtype list of argument types in the same order as declared in list_arguments. Returns ------- in_type : list list of argument types. Can be modified from in_type. out_type : list list of output types calculated from in_type, in the same order as declared in list_outputs. aux_type : Optional, list list of aux types calculated from in_type, in the same order as declared in list_auxiliary_states. """ return in_type, [in_type[0]]*len(self.list_outputs()), \ [in_type[0]]*len(self.list_auxiliary_states()) def infer_storage_type(self, in_stype): """infer_storage_type interface. Used to infer storage type of inputs and outputs in the forward pass. When this interface is not implemented, all stypes will be inferred as default. Parameters ---------- in_stype : list of stypes, valid stypes are default, row_sparse and csr Returns ------- in_stype : list list of argument stypes. out_stype : list list of output types calculated from in_stype, in the same order as declared in list_outputs. aux_type : Optional, list list of aux types calculated from in_stype, in the same order as declared in list_auxiliary_states. """ for i, stype in enumerate(in_stype): assert stype == _STORAGE_TYPE_ID_TO_STR[_STORAGE_TYPE_DEFAULT], \ "Default infer_storage_type implementation doesnt allow non default stypes: " \ "found non default stype '%s' for in_stype[%d]. Please implement " \ "infer_storage_type and infer_storage_type_backward interface " \ "in your custom operator if you have non-default input/output stypes" % (stype, i) return in_stype, \ [_STORAGE_TYPE_ID_TO_STR[_STORAGE_TYPE_DEFAULT]]*len(self.list_outputs()), \ [_STORAGE_TYPE_ID_TO_STR[_STORAGE_TYPE_DEFAULT]]*len(self.list_auxiliary_states()) def infer_storage_type_backward(self, ograd_stype, in_stype, out_stype, igrad_stype, aux_stype): """infer_storage_type_backward interface. Used to infer storage type of inputs and outputs in the backward pass. Will raise an error if undefined storage type is returned. Returned lists have to be the same size as the input lists to infer_storage_type_backward, otherwise an exception will be thrown. When this interface is not implemented, all stypes will be inferred as default. Parameters ---------- ograd_stype : list list of output gradient storage types in_stype : list list of input storage types out_stype : list list of output storage types igrad_stype : list list of input gradient storage types aux_stype : list list of auxiliary storage types Returns ------- ograd_stype : list list of inferred output gradient storage types in_stype : list list of inferred input storage types out_stype : list list of inferred output storage types igrad_stype : list list of inferred input gradient storage types aux_stype : list list of inferred storage types for auxiliary states """ for i, stype in enumerate(ograd_stype): assert stype == _STORAGE_TYPE_ID_TO_STR[_STORAGE_TYPE_DEFAULT], \ "Default infer_storage_type_backward implementation doesnt allow non default stypes: " \ "found non default stype '%s' for ograd_stype[%d]. Please implement " \ "infer_storage_type and infer_storage_type_backward interface " \ "in your custom operator if you have non-default output gradient stypes" % (stype, i) for i, stype in enumerate(igrad_stype): if stype == _STORAGE_TYPE_ID_TO_STR[_STORAGE_TYPE_UNDEFINED]: stype = _STORAGE_TYPE_ID_TO_STR[_STORAGE_TYPE_DEFAULT] assert stype == _STORAGE_TYPE_ID_TO_STR[_STORAGE_TYPE_DEFAULT], \ "Default infer_storage_type_backward implementation doesnt allow non default stypes: " \ "found non default stype '%s' for igrad_stype[%d]. Please implement " \ "infer_storage_type and infer_storage_type_backward interface " \ "in your custom operator if you have non-default input gradient stypes" % (stype, i) stype_lists = [ograd_stype, in_stype, out_stype, igrad_stype, aux_stype] for stype_list in stype_lists: stype_list[:] = len(stype_list) * [_STORAGE_TYPE_ID_TO_STR[_STORAGE_TYPE_DEFAULT]] return stype_lists[0], stype_lists[1], stype_lists[2], stype_lists[3], stype_lists[4] def list_outputs(self): """list_outputs interface. Can override when creating new operators. Returns ------- outputs : list List of output blob names. """ return ['output'] def list_arguments(self): """list_arguments interface. Can override when creating new operators. Returns ------- arguments : list List of argument blob names. """ return ['data'] def list_auxiliary_states(self): """list_auxiliary_states interface. Can override when creating new operators. Returns ------- auxs : list list of auxiliary state blob names. """ return [] def declare_backward_dependency(self, out_grad, in_data, out_data): """Declare dependencies of this operator for backward pass. Parameters ---------- out_grad : list of int ids of out_grad blobs. in_data : list of int ids of in_data blobs. out_data: list of int ids of out_data blobs. Returns ------- deps : list of int ids of the needed blobs. """ deps = [] if self.need_top_grad_: deps.extend(out_grad) deps.extend(in_data) deps.extend(out_data) return deps def create_operator(self, ctx, in_shapes, in_dtypes): """Create an operator that carries out the real computation given the context, input shapes, and input data types.""" # pylint: disable=W0613 return CustomOp() class _Registry(object): """CustomOp registry.""" def __init__(self): self.ref_holder = {} self.counter = 0 self.result_deps = set() self.lock = Lock() def inc(self): """Get index for new entry.""" self.lock.acquire() cur = self.counter self.counter += 1 self.lock.release() return cur _registry = _Registry() def register(reg_name): """Register a subclass of CustomOpProp to the registry with name reg_name.""" def do_register(prop_cls): """Register a subclass of CustomOpProp to the registry.""" fb_functype = CFUNCTYPE(c_int, c_int, POINTER(c_void_p), POINTER(c_int), POINTER(c_int), c_int, c_void_p) del_functype = CFUNCTYPE(c_int, c_void_p) infershape_functype = CFUNCTYPE(c_int, c_int, POINTER(c_int), POINTER(POINTER(mx_int)), c_void_p) infertype_functype = CFUNCTYPE(c_int, c_int, POINTER(c_int), c_void_p) inferstorage_functype = CFUNCTYPE(c_int, c_int, POINTER(c_int), c_void_p) inferstorage_backward_functype = CFUNCTYPE(c_int, c_int, POINTER(c_int), \ POINTER(c_int), c_void_p) list_functype = CFUNCTYPE(c_int, POINTER(POINTER(POINTER(c_char))), c_void_p) deps_functype = CFUNCTYPE(c_int, c_int_p, c_int_p, c_int_p, c_int_p, POINTER(c_int_p), c_void_p) createop_functype = CFUNCTYPE(c_int, c_char_p, c_int, POINTER(POINTER(mx_uint)), POINTER(c_int), POINTER(c_int), POINTER(MXCallbackList), c_void_p) req_enum = ('null', 'write', 'inplace', 'add') create_ndarray_fn = _np_ndarray_cls if is_np_array() else _ndarray_cls def creator(op_type, argc, keys, vals, ret): """internal function""" assert py_str(op_type) == reg_name kwargs = dict([(py_str(keys[i]), py_str(vals[i])) for i in range(argc)]) op_prop = prop_cls(**kwargs) def infer_shape_entry(num_tensor, tensor_dims, tensor_shapes, _): """C Callback for ``CustomOpProp::InferShape``.""" try: n_in = len(op_prop.list_arguments()) n_out = len(op_prop.list_outputs()) n_aux = len(op_prop.list_auxiliary_states()) assert num_tensor == n_in + n_out + n_aux shapes = [[tensor_shapes[i][j] for j in range(tensor_dims[i])] for i in range(n_in)] ret = op_prop.infer_shape(shapes) if len(ret) == 2: ishape, oshape = ret ashape = [] elif len(ret) == 3: ishape, oshape, ashape = ret else: raise AssertionError("infer_shape must return 2 or 3 lists") assert len(oshape) == n_out, \ "InferShape Error: expecting %d entries in returned output " \ "shapes, got %d."%(n_out, len(oshape)) assert len(ishape) == n_in, \ "InferShape Error: expecting %d entries in returned input " \ "shapes, got %d."%(n_in, len(ishape)) assert len(ashape) == n_aux, \ "InferShape Error: expecting %d entries in returned aux state " \ "shapes, got %d."%(n_aux, len(ashape)) rshape = list(ishape) + list(oshape) + list(ashape) for i in range(n_in+n_out+n_aux): tensor_shapes[i] = cast(c_array_buf(mx_int, array('i', rshape[i])), POINTER(mx_int)) tensor_dims[i] = len(rshape[i]) infer_shape_entry._ref_holder = [tensor_shapes] except Exception: print('Error in %s.infer_shape: %s' % (reg_name, traceback.format_exc())) return False return True def infer_storage_type_backward_entry(num_tensor, tensor_stypes, tags, _): # pylint: disable=C0301 """C Callback for CustomOpProp::InferStorageTypeBackward""" try: tensors = [[] for i in range(5)] for i in range(num_tensor): tensors[tags[i]].append(_STORAGE_TYPE_ID_TO_STR[tensor_stypes[i]]) # Ordering of stypes: ograd, input, output, igrad, aux tensors = [tensors[3], tensors[0], tensors[1], tensors[2], tensors[4]] ret = op_prop.infer_storage_type_backward(tensors[0], tensors[1], tensors[2], tensors[3], tensors[4]) if len(ret) == 4: ret += [] elif len(ret) == 5: pass else: raise AssertionError("infer_storage_type_backward must return 4 or 5 lists") assert len(ret[0]) == len(tensors[0]), \ "InferStorageTypeBackward Error: expecting == %d " \ "entries in returned output gradient " \ "stypes, got %d."%(len(tensors[0]), len(ret[0])) assert len(ret[1]) == len(tensors[1]), \ "InferStorageTypeBackward Error: expecting == %d " \ "entries in returned input stypes, " \ "got %d."%(len(tensors[1]), len(ret[1])) assert len(ret[2]) == len(tensors[2]), \ "InferStorageTypeBackward Error: expecting == %d " \ "entries in returned output stypes, " \ "got %d."%(len(tensors[2]), len(ret[2])) assert len(ret[3]) == len(tensors[3]), \ "InferStorageTypeBackward Error: expecting == %d " \ "entries in returned input gradient stypes, " \ "got %d."%(len(tensors[3]), len(ret[3])) assert len(ret[4]) == len(tensors[4]), \ "InferStorageTypeBackward Error: expecting == %d " \ "entries in returned aux stypes, " \ "got %d."%(len(tensors[4]), len(ret[4])) rstype = [] for i, ret_list in enumerate(ret): rstype.extend(ret_list) for i, stype in enumerate(rstype): assert stype != _STORAGE_TYPE_ID_TO_STR[_STORAGE_TYPE_UNDEFINED], \ "stype should not be undefined" assert stype in _STORAGE_TYPE_STR_TO_ID, \ "Provided stype: %s is not valid " \ "valid stypes are %s, %s, %s"%(stype, _STORAGE_TYPE_ID_TO_STR[_STORAGE_TYPE_DEFAULT], _STORAGE_TYPE_ID_TO_STR[_STORAGE_TYPE_ROW_SPARSE], _STORAGE_TYPE_ID_TO_STR[_STORAGE_TYPE_CSR]) tensor_stypes[i] = _STORAGE_TYPE_STR_TO_ID[stype] infer_storage_type_backward_entry._ref_holder = [tensor_stypes] except Exception: print('Error in %s.infer_type: %s' % (reg_name, traceback.format_exc())) return False return True def infer_storage_type_entry(num_tensor, tensor_stypes, _): """C Callback for CustomOpProp::InferStorageType""" try: n_in = len(op_prop.list_arguments()) n_out = len(op_prop.list_outputs()) n_aux = len(op_prop.list_auxiliary_states()) assert num_tensor == n_in + n_out + n_aux stypes = [_STORAGE_TYPE_ID_TO_STR[tensor_stypes[i]] for i in range(n_in)] ret = op_prop.infer_storage_type(stypes) if len(ret) == 2: istype, ostype = ret astype = [] elif len(ret) == 3: istype, ostype, astype = ret else: raise AssertionError("infer_storage_type must return 2 or 3 lists") assert len(ostype) == n_out, \ "InferStorageType Error: expecting %d entries in returned output " \ "stypes, got %d."%(n_out, len(ostype)) assert len(istype) == n_in, \ "InferStorageType Error: expecting %d entries in returned input " \ "stypes, got %d."%(n_in, len(istype)) assert len(astype) == n_aux, \ "InferStorageType Error: expecting %d entries in returned aux state " \ "stypes, got %d."%(n_aux, len(astype)) rtype = list(istype) + list(ostype) + list(astype) for i, dtype in enumerate(rtype): tensor_stypes[i] = _STORAGE_TYPE_STR_TO_ID[dtype] infer_storage_type_entry._ref_holder = [tensor_stypes] except Exception: print('Error in %s.infer_type: %s' % (reg_name, traceback.format_exc())) return False return True def infer_type_entry(num_tensor, tensor_types, _): """C Callback for CustomOpProp::InferType""" try: n_in = len(op_prop.list_arguments()) n_out = len(op_prop.list_outputs()) n_aux = len(op_prop.list_auxiliary_states()) assert num_tensor == n_in + n_out + n_aux types = [_DTYPE_MX_TO_NP[tensor_types[i]] for i in range(n_in)] ret = op_prop.infer_type(types) if len(ret) == 2: itype, otype = ret atype = [] elif len(ret) == 3: itype, otype, atype = ret else: raise AssertionError("infer_type must return 2 or 3 lists") assert len(otype) == n_out, \ "InferType Error: expecting %d entries in returned output " \ "types, got %d."%(n_out, len(otype)) assert len(itype) == n_in, \ "InferType Error: expecting %d entries in returned input " \ "types, got %d."%(n_in, len(itype)) assert len(atype) == n_aux, \ "InferType Error: expecting %d entries in returned aux state " \ "types, got %d."%(n_aux, len(atype)) rtype = list(itype) + list(otype) + list(atype) for i, dtype in enumerate(rtype): tensor_types[i] = _DTYPE_NP_TO_MX[dtype] infer_type_entry._ref_holder = [tensor_types] except Exception: print('Error in %s.infer_type: %s' % (reg_name, traceback.format_exc())) return False return True def list_outputs_entry(out, _): """C Callback for CustomOpProp::ListOutputs""" try: ret = op_prop.list_outputs() ret = [c_str(i) for i in ret] + [c_char_p(0)] ret = c_array(c_char_p, ret) out[0] = cast(ret, POINTER(POINTER(c_char))) list_outputs_entry._ref_holder = [out] except Exception: print('Error in %s.list_outputs: %s' % (reg_name, traceback.format_exc())) return False return True def list_arguments_entry(out, _): """C Callback for CustomOpProp::ListArguments""" try: ret = op_prop.list_arguments() ret = [c_str(i) for i in ret] + [c_char_p(0)] ret = c_array(c_char_p, ret) out[0] = cast(ret, POINTER(POINTER(c_char))) list_arguments_entry._ref_holder = [out] except Exception: print('Error in %s.list_arguments: %s' % (reg_name, traceback.format_exc())) return False return True def list_auxiliary_states_entry(out, _): """C Callback for CustomOpProp::ListAuxiliaryStates""" try: ret = op_prop.list_auxiliary_states() ret = [c_str(i) for i in ret] + [c_char_p(0)] ret = c_array(c_char_p, ret) out[0] = cast(ret, POINTER(POINTER(c_char))) list_auxiliary_states_entry._ref_holder = [out] except Exception: tb = traceback.format_exc() print('Error in %s.list_auxiliary_states: %s' % (reg_name, tb)) return False return True def declare_backward_dependency_entry(out_grad, in_data, out_data, num_dep, deps, _): """C Callback for CustomOpProp::DeclareBacwardDependency""" try: out_grad = [out_grad[i] for i in range(len(op_prop.list_outputs()))] in_data = [in_data[i] for i in range(len(op_prop.list_arguments()))] out_data = [out_data[i] for i in range(len(op_prop.list_outputs()))] rdeps = op_prop.declare_backward_dependency(out_grad, in_data, out_data) num_dep[0] = len(rdeps) _registry.result_deps = set() for dep in rdeps: _registry.result_deps.add(dep) rdeps = cast(c_array_buf(c_int, array('i', rdeps)), c_int_p) deps[0] = rdeps declare_backward_dependency_entry._ref_holder = [deps] except Exception: tb = traceback.format_exc() print('Error in %s.declare_backward_dependency: %s' % (reg_name, tb)) return False return True def create_operator_entry(ctx, num_inputs, shapes, ndims, dtypes, ret, _): """C Callback for CustomOpProp::CreateOperator""" try: ctx = py_str(ctx) sep = ctx.find('(') ctx = context.Context(ctx[:sep], int(ctx[sep+1:-1])) ndims = [ndims[i] for i in range(num_inputs)] shapes = [[shapes[i][j] for j in range(ndims[i])] for i in range(num_inputs)] dtypes = [dtypes[i] for i in range(num_inputs)] op = op_prop.create_operator(ctx, shapes, dtypes) def forward_entry(num_ndarray, ndarraies, tags, reqs, is_train, _): """C Callback for CustomOp::Forward""" try: tensors = [[] for i in range(5)] for i in range(num_ndarray): if tags[i] == 1 or tags[i] == 4: tensors[tags[i]].append( create_ndarray_fn(cast(ndarraies[i], NDArrayHandle), writable=True) ) else: tensors[tags[i]].append( create_ndarray_fn(cast(ndarraies[i], NDArrayHandle), writable=False) ) reqs = [req_enum[reqs[i]] for i in range(len(tensors[1]))] with ctx: op.forward(is_train=is_train, req=reqs, in_data=tensors[0], out_data=tensors[1], aux=tensors[4]) except Exception: print('Error in CustomOp.forward: %s' % traceback.format_exc()) return False return True def backward_entry(num_ndarray, ndarraies, tags, reqs, is_train, _): """C Callback for CustomOp::Backward""" # pylint: disable=W0613 try: tensors = [[] for i in range(5)] num_outputs = len(op_prop.list_outputs()) num_args = len(op_prop.list_arguments()) for i in range(num_ndarray): if i in _registry.result_deps or i >= (num_outputs * 2 + num_args): # If it is a backward dependency or output or aux: # Set stype as undefined so that it returns # ndarray based on existing stype stype = _STORAGE_TYPE_UNDEFINED else: # If it is some input, output or out grad ndarray not part of # backward dependency it is empty and thus the ndarray should # be set to default stype = _STORAGE_TYPE_DEFAULT if tags[i] == 2 or tags[i] == 4: tensors[tags[i]].append( create_ndarray_fn(cast(ndarraies[i], NDArrayHandle), writable=True, stype=stype) ) else: tensors[tags[i]].append( create_ndarray_fn(cast(ndarraies[i], NDArrayHandle), writable=False, stype=stype) ) reqs = [req_enum[reqs[i]] for i in range(len(tensors[2]))] with ctx: op.backward(req=reqs, in_data=tensors[0], out_data=tensors[1], in_grad=tensors[2], out_grad=tensors[3], aux=tensors[4]) except Exception: print('Error in CustomOp.backward: %s' % traceback.format_exc()) return False return True cur = _registry.inc() def delete_entry(_): """C Callback for CustomOp::del""" try: del _registry.ref_holder[cur] except Exception: print('Error in CustomOp.delete: %s' % traceback.format_exc()) return False return True callbacks = [del_functype(delete_entry), fb_functype(forward_entry), fb_functype(backward_entry)] callbacks = [cast(i, CFUNCTYPE(c_int)) for i in callbacks] contexts = [None, None, None] ret[0] = MXCallbackList(c_int(len(callbacks)), cast(c_array(CFUNCTYPE(c_int), callbacks), POINTER(CFUNCTYPE(c_int))), cast(c_array(c_void_p, contexts), POINTER(c_void_p))) op._ref_holder = [ret] _registry.ref_holder[cur] = op except Exception: print('Error in %s.create_operator: %s' % (reg_name, traceback.format_exc())) return False return True cur = _registry.inc() def delete_entry(_): """C Callback for CustomOpProp::del""" try: del _registry.ref_holder[cur] except Exception: print('Error in CustomOpProp.delete: %s' % traceback.format_exc()) return False return True callbacks = [del_functype(delete_entry), list_functype(list_arguments_entry), list_functype(list_outputs_entry), list_functype(list_auxiliary_states_entry), infershape_functype(infer_shape_entry), deps_functype(declare_backward_dependency_entry), createop_functype(create_operator_entry), infertype_functype(infer_type_entry), inferstorage_functype(infer_storage_type_entry), inferstorage_backward_functype(infer_storage_type_backward_entry)] callbacks = [cast(i, CFUNCTYPE(c_int)) for i in callbacks] contexts = [None]*len(callbacks) ret[0] = MXCallbackList(c_int(len(callbacks)), cast(c_array(CFUNCTYPE(c_int), callbacks), POINTER(CFUNCTYPE(c_int))), cast(c_array(c_void_p, contexts), POINTER(c_void_p))) op_prop._ref_holder = [ret] _registry.ref_holder[cur] = op_prop return True creator_functype = CFUNCTYPE(c_int, c_char_p, c_int, POINTER(c_char_p), POINTER(c_char_p), POINTER(MXCallbackList)) creator_func = creator_functype(creator) check_call(_LIB.MXCustomOpRegister(c_str(reg_name), creator_func)) cur = _registry.inc() _registry.ref_holder[cur] = creator_func return prop_cls return do_register register("custom_op")(CustomOpProp) def get_all_registered_operators(): """Get all registered MXNet operator names. Returns ------- operator_names : list of string """ plist = ctypes.POINTER(ctypes.c_char_p)() size = ctypes.c_uint() check_call(_LIB.MXListAllOpNames(ctypes.byref(size), ctypes.byref(plist))) mx_registered_operator_names = [py_str(plist[i]) for i in range(size.value)] return mx_registered_operator_names OperatorArguments = collections.namedtuple('OperatorArguments', ['narg', 'names', 'types']) def get_operator_arguments(op_name): """Given operator name, fetch operator arguments - number of arguments, argument names, argument types. Parameters ---------- op_name: str Handle for the operator Returns ------- operator_arguments : OperatorArguments, namedtuple with number of arguments, names and types """ op_handle = OpHandle() check_call(_LIB.NNGetOpHandle(c_str(op_name), ctypes.byref(op_handle))) real_name = ctypes.c_char_p() desc = ctypes.c_char_p() num_args = mx_uint() arg_names = ctypes.POINTER(ctypes.c_char_p)() arg_types = ctypes.POINTER(ctypes.c_char_p)() arg_descs = ctypes.POINTER(ctypes.c_char_p)() key_var_num_args = ctypes.c_char_p() ret_type = ctypes.c_char_p() check_call(_LIB.MXSymbolGetAtomicSymbolInfo( op_handle, ctypes.byref(real_name), ctypes.byref(desc), ctypes.byref(num_args), ctypes.byref(arg_names), ctypes.byref(arg_types), ctypes.byref(arg_descs), ctypes.byref(key_var_num_args), ctypes.byref(ret_type))) narg = int(num_args.value) arg_names = [py_str(arg_names[i]) for i in range(narg)] arg_types = [py_str(arg_types[i]) for i in range(narg)] return OperatorArguments(narg, arg_names, arg_types)
#!/usr/bin/env python """ @package mi.dataset.parser.flort_dj_dcl @file marine-integrations/mi/dataset/parser/flort_dj_dcl.py @author Steve Myerson @brief Parser for the flort_dj_dcl dataset driver This file contains code for the flort_dj_dcl parsers and code to produce data particles. For telemetered data, there is one parser which produces one type of data particle. For recovered data, there is one parser which produces one type of data particle. The input files and the content of the data particles are the same for both recovered and telemetered. Only the names of the output particle streams are different. The input file is ASCII and contains 2 types of records. Records are separated by a newline. All records start with a timestamp. Metadata records: timestamp [text] more text newline. Sensor Data records: timestamp sensor_data newline. Only sensor data records produce particles if properly formed. Mal-formed sensor data records and all metadata records produce no particles. Release notes: Initial Release """ __author__ = 'Steve Myerson' __license__ = 'Apache 2.0' import calendar import copy from functools import partial import re from mi.core.instrument.chunker import \ StringChunker from mi.core.log import get_logger; log = get_logger() from mi.core.common import BaseEnum from mi.core.exceptions import \ DatasetParserException, \ UnexpectedDataException from mi.core.instrument.data_particle import \ DataParticle, \ DataParticleKey, \ DataParticleValue from mi.dataset.dataset_parser import BufferLoadingParser # Basic patterns ANY_CHARS = r'.*' # Any characters excluding a newline NEW_LINE = r'(?:\r\n|\n)' # any type of new line UINT = r'(\d*)' # unsigned integer as a group SPACE = ' ' TAB = '\t' START_GROUP = '(' END_GROUP = ')' # Timestamp at the start of each record: YYYY/MM/DD HH:MM:SS.mmm # Metadata fields: [text] more text # Sensor data has tab-delimited fields (date, time, integers) # All records end with one of the newlines. DATE = r'(\d{4})/(\d{2})/(\d{2})' # Date: YYYY/MM/DD TIME = r'(\d{2}):(\d{2}):(\d{2})\.\d{3}' # Time: HH:MM:SS.mmm SENSOR_DATE = r'(\d{2}/\d{2}/\d{2})' # Sensor Date: MM/DD/YY SENSOR_TIME = r'(\d{2}:\d{2}:\d{2})' # Sensor Time: HH:MM:SS TIMESTAMP = START_GROUP + DATE + SPACE + TIME + END_GROUP START_METADATA = r'\[' END_METADATA = r'\]' # All flort records are ASCII characters separated by a newline. FLORT_RECORD_PATTERN = ANY_CHARS # Any number of ASCII characters FLORT_RECORD_PATTERN += NEW_LINE # separated by a new line FLORT_RECORD_MATCHER = re.compile(FLORT_RECORD_PATTERN) # Metadata record: # Timestamp [Text]MoreText newline METADATA_PATTERN = TIMESTAMP + SPACE # dcl controller timestamp METADATA_PATTERN += START_METADATA # Metadata record starts with '[' METADATA_PATTERN += ANY_CHARS # followed by text METADATA_PATTERN += END_METADATA # followed by ']' METADATA_PATTERN += ANY_CHARS # followed by more text METADATA_PATTERN += r'\n' # metadata record ends with LF METADATA_MATCHER = re.compile(METADATA_PATTERN) # Sensor data record: # Timestamp Date<tab>Time<tab>SensorData # where SensorData are tab-separated unsigned integer numbers SENSOR_DATA_PATTERN = TIMESTAMP + SPACE # dcl controller timestamp SENSOR_DATA_PATTERN += SENSOR_DATE + TAB # sensor date SENSOR_DATA_PATTERN += SENSOR_TIME + TAB # sensor time SENSOR_DATA_PATTERN += UINT + TAB # measurement wavelength beta SENSOR_DATA_PATTERN += UINT + TAB # raw signal beta SENSOR_DATA_PATTERN += UINT + TAB # measurement wavelength chl SENSOR_DATA_PATTERN += UINT + TAB # raw signal chl SENSOR_DATA_PATTERN += UINT + TAB # measurement wavelength cdom SENSOR_DATA_PATTERN += UINT + TAB # raw signal cdom SENSOR_DATA_PATTERN += UINT # raw internal temperature SENSOR_DATA_PATTERN += r'\r\n' # sensor data ends with CR-LF SENSOR_DATA_MATCHER = re.compile(SENSOR_DATA_PATTERN) # SENSOR_DATA_MATCHER produces the following groups. # The following are indices into groups() produced by SENSOR_DATA_MATCHER. # i.e, match.groups()[INDEX] SENSOR_GROUP_TIMESTAMP = 0 SENSOR_GROUP_YEAR = 1 SENSOR_GROUP_MONTH = 2 SENSOR_GROUP_DAY = 3 SENSOR_GROUP_HOUR = 4 SENSOR_GROUP_MINUTE = 5 SENSOR_GROUP_SECOND = 6 SENSOR_GROUP_SENSOR_DATE = 7 SENSOR_GROUP_SENSOR_TIME = 8 SENSOR_GROUP_WAVELENGTH_BETA = 9 SENSOR_GROUP_RAW_SIGNAL_BETA = 10 SENSOR_GROUP_WAVELENGTH_CHL = 11 SENSOR_GROUP_RAW_SIGNAL_CHL = 12 SENSOR_GROUP_WAVELENGTH_CDOM = 13 SENSOR_GROUP_RAW_SIGNAL_CDOM = 14 SENSOR_GROUP_INTERNAL_TEMPERATURE = 15 # This table is used in the generation of the instrument data particle. # Column 1 - particle parameter name # Column 2 - group number (index into raw_data) # Column 3 - data encoding function (conversion required - int, float, etc) INSTRUMENT_PARTICLE_MAP = [ ('dcl_controller_timestamp', SENSOR_GROUP_TIMESTAMP, str), ('date_string', SENSOR_GROUP_SENSOR_DATE, str), ('time_string', SENSOR_GROUP_SENSOR_TIME, str), ('measurement_wavelength_beta', SENSOR_GROUP_WAVELENGTH_BETA, int), ('raw_signal_beta', SENSOR_GROUP_RAW_SIGNAL_BETA, int), ('measurement_wavelength_chl', SENSOR_GROUP_WAVELENGTH_CHL, int), ('raw_signal_chl', SENSOR_GROUP_RAW_SIGNAL_CHL, int), ('measurement_wavelength_cdom', SENSOR_GROUP_WAVELENGTH_CDOM, int), ('raw_signal_cdom', SENSOR_GROUP_RAW_SIGNAL_CDOM, int), ('raw_internal_temp', SENSOR_GROUP_INTERNAL_TEMPERATURE, int) ] class FlortStateKey(BaseEnum): POSITION = 'position' # position within the input file class DataParticleType(BaseEnum): REC_INSTRUMENT_PARTICLE = 'flort_dj_dcl_instrument_recovered' TEL_INSTRUMENT_PARTICLE = 'flort_dj_dcl_instrument' class FlortDjDclInstrumentDataParticle(DataParticle): """ Class for generating the Flort_dj instrument particle. """ def __init__(self, raw_data, port_timestamp=None, internal_timestamp=None, preferred_timestamp=DataParticleKey.PORT_TIMESTAMP, quality_flag=DataParticleValue.OK, new_sequence=None): super(FlortDjDclInstrumentDataParticle, self).__init__(raw_data, port_timestamp, internal_timestamp, preferred_timestamp, quality_flag, new_sequence) # The particle timestamp is the DCL Controller timestamp. # The individual fields have already been extracted by the parser. timestamp = ( int(self.raw_data[SENSOR_GROUP_YEAR]), int(self.raw_data[SENSOR_GROUP_MONTH]), int(self.raw_data[SENSOR_GROUP_DAY]), int(self.raw_data[SENSOR_GROUP_HOUR]), int(self.raw_data[SENSOR_GROUP_MINUTE]), int(self.raw_data[SENSOR_GROUP_SECOND]), 0, 0, 0) elapsed_seconds = calendar.timegm(timestamp) self.set_internal_timestamp(unix_time=elapsed_seconds) def _build_parsed_values(self): """ Build parsed values for Recovered and Telemetered Instrument Data Particle. """ # Generate a particle by calling encode_value for each entry # in the Instrument Particle Mapping table, # where each entry is a tuple containing the particle field name, # an index into the match groups (which is what has been stored in raw_data), # and a function to use for data conversion. return [self._encode_value(name, self.raw_data[group], function) for name, group, function in INSTRUMENT_PARTICLE_MAP] class FlortDjDclRecoveredInstrumentDataParticle(FlortDjDclInstrumentDataParticle): """ Class for generating Offset Data Particles from Recovered data. """ _data_particle_type = DataParticleType.REC_INSTRUMENT_PARTICLE class FlortDjDclTelemeteredInstrumentDataParticle(FlortDjDclInstrumentDataParticle): """ Class for generating Offset Data Particles from Telemetered data. """ _data_particle_type = DataParticleType.TEL_INSTRUMENT_PARTICLE class FlortDjDclParser(BufferLoadingParser): """ Parser for Flort_dj_dcl data. In addition to the standard constructor parameters, this constructor takes an additional parameter particle_class. """ def __init__(self, config, stream_handle, state, state_callback, publish_callback, exception_callback, particle_class, *args, **kwargs): # No fancy sieve function needed for this parser. # File is ASCII with records separated by newlines. super(FlortDjDclParser, self).__init__(config, stream_handle, state, partial(StringChunker.regex_sieve_function, regex_list=[FLORT_RECORD_MATCHER]), state_callback, publish_callback, exception_callback, *args, **kwargs) # Default the position within the file to the beginning. self._read_state = {FlortStateKey.POSITION: 0} self.input_file = stream_handle self.particle_class = particle_class # If there's an existing state, update to it. if state is not None: self.set_state(state) def handle_non_data(self, non_data, non_end, start): """ Handle any non-data that is found in the file """ # Handle non-data here. # Increment the position within the file. # Use the _exception_callback. if non_data is not None and non_end <= start: self._increment_position(len(non_data)) self._exception_callback(UnexpectedDataException( "Found %d bytes of un-expected non-data %s" % (len(non_data), non_data))) def _increment_position(self, bytes_read): """ Increment the position within the file. @param bytes_read The number of bytes just read """ self._read_state[FlortStateKey.POSITION] += bytes_read def parse_chunks(self): """ Parse out any pending data chunks in the chunker. If it is valid data, build a particle. Go until the chunker has no more valid data. @retval a list of tuples with sample particles encountered in this parsing, plus the state. """ result_particles = [] (nd_timestamp, non_data, non_start, non_end) = self._chunker.get_next_non_data_with_index(clean=False) (timestamp, chunk, start, end) = self._chunker.get_next_data_with_index(clean=True) self.handle_non_data(non_data, non_end, start) while chunk is not None: self._increment_position(len(chunk)) # If this is a valid sensor data record, # use the extracted fields to generate a particle. sensor_match = SENSOR_DATA_MATCHER.match(chunk) if sensor_match is not None: particle = self._extract_sample(self.particle_class, None, sensor_match.groups(), None) if particle is not None: result_particles.append((particle, copy.copy(self._read_state))) # It's not a sensor data record, see if it's a metadata record. else: # If it's a valid metadata record, ignore it. # Otherwise generate warning for unknown data. meta_match = METADATA_MATCHER.match(chunk) if meta_match is None: error_message = 'Unknown data found in chunk %s' % chunk log.warn(error_message) self._exception_callback(UnexpectedDataException(error_message)) (nd_timestamp, non_data, non_start, non_end) = self._chunker.get_next_non_data_with_index(clean=False) (timestamp, chunk, start, end) = self._chunker.get_next_data_with_index(clean=True) self.handle_non_data(non_data, non_end, start) return result_particles def set_state(self, state_obj): """ Set the value of the state object for this parser @param state_obj The object to set the state to. @throws DatasetParserException if there is a bad state structure """ if not isinstance(state_obj, dict): raise DatasetParserException("Invalid state structure") if not (FlortStateKey.POSITION in state_obj): raise DatasetParserException('%s missing in state keys' % FlortStateKey.POSITION) self._record_buffer = [] self._state = state_obj self._read_state = state_obj self.input_file.seek(state_obj[FlortStateKey.POSITION]) class FlortDjDclRecoveredParser(FlortDjDclParser): """ This is the entry point for the Recovered Flort_dj_dcl parser. """ def __init__(self, config, stream_handle, state, state_callback, publish_callback, exception_callback, *args, **kwargs): super(FlortDjDclRecoveredParser, self).__init__(config, stream_handle, state, state_callback, publish_callback, exception_callback, FlortDjDclRecoveredInstrumentDataParticle, *args, **kwargs) class FlortDjDclTelemeteredParser(FlortDjDclParser): """ This is the entry point for the Telemetered Flort_dj_dcl parser. """ def __init__(self, config, stream_handle, state, state_callback, publish_callback, exception_callback, *args, **kwargs): super(FlortDjDclTelemeteredParser, self).__init__(config, stream_handle, state, state_callback, publish_callback, exception_callback, FlortDjDclTelemeteredInstrumentDataParticle, *args, **kwargs)
import warnings warnings.filterwarnings('ignore') import tensorflow as tf import numpy as np import pickle import time import sys import os import nltk sys.path.append(os.path.dirname(os.path.abspath(__file__))+'/../') from dnc import DNC from recurrent_controller import StatelessRecurrentController def bleu_score(target_batch, predict_batch, print_prob=0.995): s=[] for b in range(target_batch.shape[0]): trim_target = [] trim_predict = [] for t in target_batch[b]: if t >1: trim_target.append(t) for t in predict_batch[b]: if t >1: trim_predict.append(t) if np.random.rand()>print_prob: print('{} vs {}'.format(trim_target, trim_predict)) BLEUscore = nltk.translate.bleu_score.sentence_bleu([trim_target], trim_predict, weights=[0.5,0.5]) s.append(BLEUscore) return np.mean(s) def set_score_pre(target_batch, predict_batch): s = [] s2 = [] for b in range(target_batch.shape[0]): trim_target = [] trim_predict = [] for t in target_batch[b]: if t > 1: trim_target.append(t) for t in predict_batch[b]: if t > 1: trim_predict.append(t) if np.random.rand()>0.99: print('{} vs {}'.format(trim_target, trim_predict)) acc = len(set(trim_target).intersection(set(trim_predict)))/len(set(trim_target)) acc2=0 if len(set(trim_predict))>0: acc2 = len(set(trim_target).intersection(set(trim_predict))) / len(trim_predict) s.append(acc) s2.append(acc2) return np.mean(s), np.mean(s2) def set_score_hist(target_batch, predict_batch): acc_label={} guess_label={} count_label={} for b in range(target_batch.shape[0]): for t, t2 in zip(target_batch[b], predict_batch[b]): # print('{} ----- {}'.format(t, t2)) trim_target = [] for tt in t: if tt > 1: trim_target.append(tt) for l in trim_target: if l not in count_label: count_label[l]=0 count_label[l]+=1 trim_predict = [] for tt in t2: if tt > 1: trim_predict.append(tt) if np.random.rand()>0.99: print('{} vs {}'.format(trim_target, trim_predict)) for l in trim_predict: if l not in guess_label: guess_label[l]=0 guess_label[l]+=1 correct = list(set(trim_target).intersection(set(trim_predict))) for c in correct: if c not in acc_label: acc_label[c]=0 acc_label[c]+=1 recall=[] precision=[] fscore=[] for k,v in sorted(count_label.items()): if k in acc_label: rec = acc_label[k] / count_label[k] prec= acc_label[k] / guess_label[k] recall.append(rec) precision.append(prec) fscore.append(2*rec*prec/(rec+prec)) else: recall.append(0) precision.append(0) fscore.append(0) return recall, precision, fscore import editdistance as ed def batch_norm_edit_score(reals, preds, pprint=0.999): avgs=0 c=0 for i,real in enumerate(reals): avgs += norm_edit_score(reals[i],preds[i],pprint) c+=1 return avgs/c def norm_edit_score(real, pred, pprob=0.999): trimpred=[] for p in pred: if p>1: trimpred.append(p) trimreal=[] for r in real: if r>1: trimreal.append(r) if np.random.rand() > pprob: print('{} vs {}'.format(trimreal, trimpred)) if trimpred is []: return 1 #print(trimreal) return ed.eval(trimpred,trimreal)/max(len(trimpred),len(trimreal)) def norm_edit_score_raw(real, pred, pprob=0.999): if np.random.rand() > pprob: print('{} vs {}'.format(real, pred)) return ed.eval(pred,real)/max(len(pred),len(real)) def llprint(message): sys.stdout.write(message) sys.stdout.flush() def write_predict(wfile, list_pred): with open(wfile,'w') as f: for p in list_pred: f.write('[') for n in p[:-1]: f.write(str(n-1)+' ') f.write(str(p[-1]-1)) f.write(']') f.write('\n') def load(path): return pickle.load(open(path, 'rb')) def onehot(index, size): # print('-----') # print(index) vec = np.zeros(size, dtype=np.float32) vec[int(index)] = 1.0 return vec def prepare_sample(dig_list, proc_list, word_space_size_input, word_space_size_output, index=-1): if index<0: index = int(np.random.choice(len(dig_list),1)) # print('\n{}'.format(index)) ins=dig_list[index] ose=proc_list[index] seq_len = len(ins) + 1 + len(ose) input_vec = np.zeros(seq_len) for iii, token in enumerate(ins): input_vec[iii] = token input_vec[len(ins)] = 1 output_vec = np.zeros(seq_len) decoder_point = len(ins) + 1 for iii, token in enumerate(ose): output_vec[decoder_point + iii] = token input_vec = np.array([[onehot(code, word_space_size_input) for code in input_vec]]) output_vec = np.array([[onehot(code, word_space_size_output) for code in output_vec]]) return input_vec, output_vec, seq_len, decoder_point, index def prepare_sample_batch(dig_list,proc_list,word_space_size_input,word_space_size_output, bs, lm_train=False): if isinstance(bs, int): indexs = np.random.choice(len(dig_list),bs,replace=False) else: #print('from {} to {}'.format(bs[0],bs[1])) indexs=list(range(bs[0],bs[1])) minlen=0 moutlne=0 for index in indexs: minlen=max(len(dig_list[index]),minlen) moutlne = max(len(proc_list[index]+[0]), moutlne) # moutlne*=2 input_vecs=[] output_vecs=[] seq_len = minlen + 1 + moutlne decoder_point = minlen + 1 out_list=[] masks=[] for index in indexs: # print('\n{}'.format(index)) ins=dig_list[index] ose=proc_list[index]+[0] out_list.append(ose) input_vec = np.zeros(seq_len) output_vec = np.zeros(seq_len) mask=np.zeros(seq_len, dtype=np.bool) for iii, token in enumerate(ins): input_vec[minlen-len(ins)+iii] = token if lm_train: output_vec[minlen - len(ins) + iii+1] = token mask[minlen - len(ins) + iii+1] = True input_vec[minlen] = 1 for iii, token in enumerate(ose): output_vec[decoder_point + iii] = token mask[decoder_point + iii]=True # print(ins) # print(ose) # print(input_vec) # print(output_vec) # print('====') input_vec = [onehot(code, word_space_size_input) for code in input_vec] output_vec = [onehot(code, word_space_size_output) for code in output_vec] input_vecs.append(input_vec) output_vecs.append(output_vec) masks.append(mask) # raise False return np.asarray(input_vecs), np.asarray(output_vecs), seq_len, decoder_point, np.asarray(masks), out_list def load_dict(dir='./data/BusinessProcess/Moodle'): return pickle.load(open(dir+'/event_vocab.pkl','rb')) def load_single_sequence(fname): seqs=[] rl='' for l in open(fname): if l.strip()[-1]==']': if rl!='': l=rl s=l.strip()[1:-1].strip().split() seqs.append([int(x)+1 for x in s]) rl='' else: rl+=l+' ' return seqs def load_sequence(dir='./data/BusinessProcess/Moodle/'): train_in=dir+'/train_prefixes.txt' train_out=dir+'/train_suffixes.txt' test_in = dir + '/test_prefixes.txt' test_out = dir + '/test_suffixes.txt' str_in=load_single_sequence(train_in) strain_out = load_single_sequence(train_out) stest_in = load_single_sequence(test_in) stest_out = load_single_sequence(test_out) return str_in, strain_out, stest_in, stest_out def moodle_train(): dirname = os.path.dirname(os.path.abspath(__file__)) + '/data/' print(dirname) ckpts_dir = os.path.join(dirname, 'checkpoints_moodle') _,_,_,char2label=load_dict() str_in, strain_out, stest_in, stest_out = load_sequence() print(str_in[:10]) print(strain_out[:10]) print(stest_in[:10]) print(stest_out[:10]) print('num train {}'.format(len(str_in))) print('num test {}'.format(len(stest_in))) print('dim in {}'.format(len(char2label))) print('dim out {}'.format(len(char2label))) input_size = len(char2label)+1 output_size = len(char2label)+1 sequence_max_length = 100 #redundant, not used, use dynamic length batch_size = 10 words_count = 64 word_size = 100 read_heads = 1 iterations = 150000 max_train_iterations = 100000 start_step = 0 graph = tf.Graph() with graph.as_default(): with tf.Session(graph=graph) as session: llprint("Building Computational Graph ... ") ncomputer = DNC( StatelessRecurrentController, input_size, output_size, sequence_max_length, words_count, word_size, read_heads, batch_size, hidden_controller_dim=100, use_emb=False, use_mem=False, decoder_mode=True, dual_controller=False, write_protect=False, dual_emb=True ) output,prob,loss,apply_gradients=ncomputer.build_loss_function_mask() llprint("Done!\n") llprint("Initializing Variables ... ") session.run(tf.global_variables_initializer()) llprint("Done!\n") last_100_losses = [] start = 0 if start_step == 0 else start_step + 1 end = start_step + iterations + 1 minscore=1000 start_time_100 = time.time() avg_100_time = 0. avg_counter = 0 train_writer = tf.summary.FileWriter('./data/log_moddle/', session.graph) for i in range(start, end + 1): try: llprint("\rIteration %d/%d" % (i, end)) input_vec, output_vec, seq_len, decoder_point, masks, _ = \ prepare_sample_batch(str_in, strain_out, input_size, output_size, bs=batch_size, lm_train=False) summerize = (i % 500 == 0) if i<=max_train_iterations: loss_value, _ = session.run([ loss, apply_gradients ], feed_dict={ ncomputer.input_data: input_vec, ncomputer.target_output: output_vec, ncomputer.sequence_length: seq_len, ncomputer.decoder_point: decoder_point, ncomputer.mask:masks }) else: loss_value = session.run(loss, feed_dict={ ncomputer.input_data: input_vec, ncomputer.target_output: output_vec, ncomputer.sequence_length: seq_len, ncomputer.decoder_point: decoder_point, }) last_100_losses.append(loss_value) if summerize: llprint("\n\t episode %d -->Avg. Cross-Entropy: %.7f\n" % (i, np.mean(last_100_losses))) summary = tf.Summary() summary.value.add(tag='batch_train_loss', simple_value=np.mean(last_100_losses)) trscores = [] for ii in range(10): input_vec, output_vec, seq_len, decoder_point, masks, rout_list =\ prepare_sample_batch(str_in, strain_out, input_size, output_size, bs=batch_size, lm_train=False) out = session.run([prob], feed_dict={ncomputer.input_data: input_vec, ncomputer.decoder_point: decoder_point, ncomputer.sequence_length: seq_len, ncomputer.mask:masks}) out = np.reshape(np.asarray(out), [-1, seq_len,output_size]) out = np.argmax(out, axis=-1) bout_list=[] # print('{} vs {}'.format(seq_len,out.shape[1])) for b in range(out.shape[0]): out_list = [] for io in range(decoder_point, out.shape[1]): if out[b][io]==0: break out_list.append(out[b][io]) bout_list.append(out_list) trscores.append(batch_norm_edit_score(rout_list, bout_list,0.95)) print('-----') tescores = [] losses = [] ntb=len(stest_in)//batch_size+1 for ii in range(ntb): if ii*batch_size==len(stest_in): break bs=[ii*batch_size, min((ii+1)*batch_size,len(stest_in))] rs = bs[1] - bs[0] if bs[1]>=len(stest_in): bs=[len(stest_in)-batch_size, len(stest_in)] input_data, target_output, seq_len, decoder_point, masks, rout_list = \ prepare_sample_batch(stest_in, stest_out, input_size, output_size, bs, lm_train=False) out, loss_v = session.run([prob, loss], feed_dict={ncomputer.input_data: input_data, ncomputer.target_output: target_output, ncomputer.sequence_length: seq_len, ncomputer.decoder_point: decoder_point, ncomputer.mask:masks }) losses.append(loss_v) out = np.reshape(np.asarray(out), [-1, seq_len, output_size]) out = np.argmax(out, axis=-1) bout_list = [] for b in range(out.shape[0]): out_list = [] for io in range(decoder_point, out.shape[1]): if out[b][io]==0: break out_list.append(out[b][io]) bout_list.append(out_list) tescores.append(batch_norm_edit_score(rout_list[:rs], bout_list[:rs], 0.995)) #pre, rec = set_score_pre(np.asarray([stest_out[ii]]), np.asarray([out_list])) #tescores2.append(pre) #tescores3.append(rec) # print(pro_list_test) # print(big_out_list) # rec, pre, fsc = set_score_hist(np.asarray([pro_list_test]),np.asarray([big_out_list])) tloss = np.mean(losses) tscore = np.mean(tescores) print('tr edit {} vs te edit {}'.format(np.mean(trscores), np.mean(tescores))) #print('test rec {} prec {}'.format(np.mean(tescores2), np.mean(tescores3))) print('test loss {}'.format(tloss)) summary.value.add(tag='train_edit', simple_value=np.mean(trscores)) summary.value.add(tag='test_edit', simple_value=np.mean(tescores)) summary.value.add(tag='test_loss', simple_value=tloss) #summary.value.add(tag='test_recall', simple_value=np.mean(tescores2)) #summary.value.add(tag='test_precision', simple_value=np.mean(tescores3)) train_writer.add_summary(summary, i) train_writer.flush() end_time_100 = time.time() elapsed_time = (end_time_100 - start_time_100) / 60 avg_counter += 1 avg_100_time += (1. / avg_counter) * (elapsed_time - avg_100_time) estimated_time = (avg_100_time * ((end - i) / 100.)) / 60. print("\tAvg. 100 iterations time: %.2f minutes" % (avg_100_time)) print("\tApprox. time to completion: %.2f hours" % (estimated_time)) start_time_100 = time.time() last_100_losses = [] if minscore>tscore: minscore=tscore llprint("\nSaving Checkpoint ... "), ncomputer.save(session, ckpts_dir, ncomputer.print_config()) except KeyboardInterrupt: llprint("\nSaving Checkpoint ... "), def moodle_test(): dirname = os.path.dirname(os.path.abspath(__file__)) + '/data/' print(dirname) ckpts_dir = os.path.join(dirname, 'checkpoints_moodle') batch_size = 10 main_dir='./data/BusinessProcess/Moodle/' _,_,_,char2label=load_dict() str_in, strain_out, stest_in, stest_out = load_sequence(main_dir) print(str_in[:10]) print(strain_out[:10]) print(stest_in[:10]) print(stest_out[:10]) print('num train {}'.format(len(str_in))) print('num test {}'.format(len(stest_in))) print('dim in {}'.format(len(char2label))) print('dim out {}'.format(len(char2label))) input_size = len(char2label)+1 output_size = len(char2label)+1 sequence_max_length = 100 words_count = 64 word_size = 100 read_heads = 1 graph = tf.Graph() with graph.as_default(): with tf.Session(graph=graph) as session: llprint("Building Computational Graph ... ") ncomputer = DNC( StatelessRecurrentController, input_size, output_size, sequence_max_length, words_count, word_size, read_heads, batch_size, hidden_controller_dim=100, use_emb=False, use_mem=True, decoder_mode=True, dual_controller=False, write_protect=False, dual_emb=True ) output, prob, loss, apply_gradients = ncomputer.build_loss_function_mask() llprint("Done!\n") llprint("Initializing Variables ... ") session.run(tf.global_variables_initializer()) llprint("Done!\n") ncomputer.restore(session, ckpts_dir, ncomputer.print_config()) print('-----') tescores = [] losses = [] ntb=len(stest_in)//batch_size+1 all_preds=[] for ii in range(ntb): if ii*batch_size==len(stest_in): break bs=[ii*batch_size, min((ii+1)*batch_size,len(stest_in))] rs = bs[1] - bs[0] if bs[1]>=len(stest_in): bs=[len(stest_in)-batch_size, len(stest_in)] input_data, target_output, seq_len, decoder_point, masks, rout_list = \ prepare_sample_batch(stest_in, stest_out, input_size, output_size, bs) out, loss_v = session.run([prob, loss], feed_dict={ncomputer.input_data: input_data, ncomputer.target_output: target_output, ncomputer.sequence_length: seq_len, ncomputer.decoder_point: decoder_point, ncomputer.mask:masks }) losses.append(loss_v) out = np.reshape(np.asarray(out), [-1, seq_len, output_size]) out = np.argmax(out, axis=-1) bout_list = [] for b in range(out.shape[0]): out_list = [] for io in range(decoder_point, out.shape[1]): if out[b][io]==0: break out_list.append(out[b][io]) bout_list.append(out_list) for bb in bout_list[:rs]: all_preds.append(bb) tescores.append(batch_norm_edit_score(rout_list[:rs], bout_list[:rs], 0.995)) prefile=main_dir+'/{}.test_predict.txt'.format(ncomputer.print_config()) write_predict(prefile, all_preds) predict_seq=load_single_sequence(prefile) tescores2=[] for rseq,pseq in zip(stest_out, predict_seq): s=norm_edit_score(rseq,pseq) tescores2.append(s) tloss = np.mean(losses) print('test ed {}'.format(np.mean(tescores))) print('test ed {}'.format(np.mean(tescores2))) #print('test rec {} prec {}'.format(np.mean(tescores2), np.mean(tescores3))) print('test loss {}'.format(tloss)) def financial_log_train(): dirname = os.path.dirname(os.path.abspath(__file__)) + '/data/' print(dirname) ckpts_dir = os.path.join(dirname, 'checkpoints_financial_log') batch_size = 10 _,_,_,char2label=load_dict('./data/BusinessProcess/Financial_Log/') str_in, strain_out, stest_in, stest_out = load_sequence('./data/BusinessProcess/Financial_Log/') print(str_in[:10]) print(strain_out[:10]) print(stest_in[:10]) print(stest_out[:10]) print('num train {}'.format(len(str_in))) print('num test {}'.format(len(stest_in))) print('dim in {}'.format(len(char2label))) print('dim out {}'.format(len(char2label))) input_size = len(char2label)+1 output_size = len(char2label)+1 sequence_max_length = 100 words_count = 64 word_size = 64 read_heads = 1 iterations = 10000 max_train_iterations = 100000 start_step = 0 graph = tf.Graph() with graph.as_default(): with tf.Session(graph=graph) as session: llprint("Building Computational Graph ... ") ncomputer = DNC( StatelessRecurrentController, input_size, output_size, sequence_max_length, words_count, word_size, read_heads, batch_size, hidden_controller_dim = 100, use_emb=False, use_mem=True, decoder_mode=True, dual_controller=True, write_protect=True, ) output, prob, loss, apply_gradients = ncomputer.build_loss_function_mask() llprint("Done!\n") llprint("Initializing Variables ... ") session.run(tf.global_variables_initializer()) llprint("Done!\n") last_100_losses = [] start = 0 if start_step == 0 else start_step + 1 end = start_step + iterations + 1 minscore=1000 start_time_100 = time.time() avg_100_time = 0. avg_counter = 0 train_writer = tf.summary.FileWriter('./data/log_financial_log/', session.graph) for i in range(start, end + 1): try: llprint("\rIteration %d/%d" % (i, end)) input_vec, output_vec, seq_len, decoder_point, masks, _ = \ prepare_sample_batch(str_in, strain_out, input_size, output_size, bs=batch_size, lm_train=False) summerize = (i % 100 == 0) if i<=max_train_iterations: loss_value, _ = session.run([ loss, apply_gradients ], feed_dict={ ncomputer.input_data: input_vec, ncomputer.target_output: output_vec, ncomputer.sequence_length: seq_len, ncomputer.decoder_point: decoder_point, ncomputer.mask:masks, }) else: loss_value = session.run(loss, feed_dict={ ncomputer.input_data: input_vec, ncomputer.target_output: output_vec, ncomputer.sequence_length: seq_len, ncomputer.decoder_point: decoder_point, ncomputer.mask:masks, }) last_100_losses.append(loss_value) if summerize: llprint("\n\t episode %d -->Avg. Cross-Entropy: %.7f\n" % (i, np.mean(last_100_losses))) summary = tf.Summary() summary.value.add(tag='batch_train_loss', simple_value=np.mean(last_100_losses)) trscores = [] for ii in range(10): input_vec, output_vec, seq_len, decoder_point, masks, rout_list =\ prepare_sample_batch(str_in, strain_out, input_size, output_size, bs=batch_size, lm_train=False) out = session.run([prob], feed_dict={ncomputer.input_data: input_vec, ncomputer.decoder_point: decoder_point, ncomputer.sequence_length: seq_len, ncomputer.mask:masks, ncomputer.target_output: output_vec, ncomputer.teacher_force: ncomputer.get_bool_rand(seq_len,0)}) out = np.reshape(np.asarray(out), [-1, seq_len,output_size]) out = np.argmax(out, axis=-1) bout_list=[] # print('{} vs {}'.format(seq_len,out.shape[1])) for b in range(out.shape[0]): out_list = [] for io in range(decoder_point, out.shape[1]): if out[b][io]==0: break out_list.append(out[b][io]) bout_list.append(out_list) trscores.append(batch_norm_edit_score(rout_list, bout_list,0.95)) print('-----') tescores = [] losses = [] ntb=len(stest_in)//batch_size+1 for ii in range(ntb): if ii*batch_size==len(stest_in): break bs=[ii*batch_size, min((ii+1)*batch_size,len(stest_in))] rs = bs[1] - bs[0] if bs[1]>=len(stest_in): bs=[len(stest_in)-batch_size, len(stest_in)] input_data, target_output, seq_len, decoder_point, masks, rout_list = \ prepare_sample_batch(stest_in, stest_out, input_size, output_size, bs, lm_train=False) out, loss_v = session.run([prob, loss], feed_dict={ncomputer.input_data: input_data, ncomputer.target_output: target_output, ncomputer.sequence_length: seq_len, ncomputer.decoder_point: decoder_point, ncomputer.mask:masks, }) losses.append(loss_v) out = np.reshape(np.asarray(out), [-1, seq_len, output_size]) out = np.argmax(out, axis=-1) bout_list = [] for b in range(out.shape[0]): out_list = [] for io in range(decoder_point, out.shape[1]): if out[b][io]==0: break out_list.append(out[b][io]) bout_list.append(out_list) tescores.append(batch_norm_edit_score(rout_list[:rs], bout_list[:rs], 0.995)) #pre, rec = set_score_pre(np.asarray([stest_out[ii]]), np.asarray([out_list])) #tescores2.append(pre) #tescores3.append(rec) # print(pro_list_test) # print(big_out_list) # rec, pre, fsc = set_score_hist(np.asarray([pro_list_test]),np.asarray([big_out_list])) tloss = np.mean(losses) tscore = np.mean(tescores) print('tr edit {} vs te edit {}'.format(np.mean(trscores), np.mean(tescores))) #print('test rec {} prec {}'.format(np.mean(tescores2), np.mean(tescores3))) print('test loss {}'.format(tloss)) summary.value.add(tag='train_edit', simple_value=np.mean(trscores)) summary.value.add(tag='test_edit', simple_value=np.mean(tescores)) summary.value.add(tag='test_loss', simple_value=tloss) #summary.value.add(tag='test_recall', simple_value=np.mean(tescores2)) #summary.value.add(tag='test_precision', simple_value=np.mean(tescores3)) train_writer.add_summary(summary, i) train_writer.flush() end_time_100 = time.time() elapsed_time = (end_time_100 - start_time_100) / 60 avg_counter += 1 avg_100_time += (1. / avg_counter) * (elapsed_time - avg_100_time) estimated_time = (avg_100_time * ((end - i) / 100.)) / 60. print("\tAvg. 100 iterations time: %.2f minutes" % (avg_100_time)) print("\tApprox. time to completion: %.2f hours" % (estimated_time)) start_time_100 = time.time() last_100_losses = [] if minscore>tscore: minscore=tscore llprint("\nSaving Checkpoint ... "), ncomputer.save(session, ckpts_dir, ncomputer.print_config()) except KeyboardInterrupt: llprint("\nSaving Checkpoint ... "), def financial_log_test(): dirname = os.path.dirname(os.path.abspath(__file__)) + '/data/' print(dirname) ckpts_dir = os.path.join(dirname, 'checkpoints_Financial_Log') batch_size = 10 main_dir='./data/BusinessProcess/Financial_Log/' _, _, _, char2label = load_dict('./data/BusinessProcess/Financial_Log/') str_in, strain_out, stest_in, stest_out = load_sequence(main_dir) print(str_in[:10]) print(strain_out[:10]) print(stest_in[:10]) print(stest_out[:10]) print('num train {}'.format(len(str_in))) print('num test {}'.format(len(stest_in))) print('dim in {}'.format(len(char2label))) print('dim out {}'.format(len(char2label))) input_size = len(char2label)+1 output_size = len(char2label)+1 sequence_max_length = 100 words_count = 64 word_size = 64 read_heads = 1 graph = tf.Graph() with graph.as_default(): with tf.Session(graph=graph) as session: llprint("Building Computational Graph ... ") ncomputer = DNC( StatelessRecurrentController, input_size, output_size, sequence_max_length, words_count, word_size, read_heads, batch_size, hidden_controller_dim=100, use_emb=False, use_mem=True, decoder_mode=True, dual_controller=True, write_protect=True, dual_emb=True ) output, prob, loss, apply_gradients = ncomputer.build_loss_function_mask() llprint("Done!\n") llprint("Initializing Variables ... ") session.run(tf.global_variables_initializer()) llprint("Done!\n") ncomputer.restore(session, ckpts_dir, ncomputer.print_config()) print('-----') tescores = [] losses = [] ntb=len(stest_in)//batch_size+1 all_preds=[] for ii in range(ntb): if ii*batch_size==len(stest_in): break bs=[ii*batch_size, min((ii+1)*batch_size,len(stest_in))] rs = bs[1] - bs[0] if bs[1]>=len(stest_in): bs=[len(stest_in)-batch_size, len(stest_in)] input_data, target_output, seq_len, decoder_point, masks, rout_list = \ prepare_sample_batch(stest_in, stest_out, input_size, output_size, bs) out, loss_v = session.run([prob, loss], feed_dict={ncomputer.input_data: input_data, ncomputer.target_output: target_output, ncomputer.sequence_length: seq_len, ncomputer.decoder_point: decoder_point, ncomputer.mask:masks }) losses.append(loss_v) out = np.reshape(np.asarray(out), [-1, seq_len, output_size]) out = np.argmax(out, axis=-1) bout_list = [] for b in range(out.shape[0]): out_list = [] for io in range(decoder_point, out.shape[1]): if out[b][io]==0: break out_list.append(out[b][io]) bout_list.append(out_list) for bb in bout_list[:rs]: all_preds.append(bb) tescores.append(batch_norm_edit_score(rout_list[:rs], bout_list[:rs], 0.995)) prefile=main_dir+'/{}.test_predict.txt'.format(ncomputer.print_config()) write_predict(prefile, all_preds) predict_seq=load_single_sequence(prefile) tescores2=[] for rseq,pseq in zip(stest_out, predict_seq): s=norm_edit_score(rseq,pseq) tescores2.append(s) tloss = np.mean(losses) print('test ed {}'.format(np.mean(tescores))) print('test ed {}'.format(np.mean(tescores2))) #print('test rec {} prec {}'.format(np.mean(tescores2), np.mean(tescores3))) print('test loss {}'.format(tloss)) def ibm_train(): dirname = os.path.dirname(os.path.abspath(__file__)) + '/data/' print(dirname) ckpts_dir = os.path.join(dirname, 'checkpoints_ibm') batch_size = 10 _,_,_,char2label=load_dict('./data/BusinessProcess/IBM_Anonymous/') str_in, strain_out, stest_in, stest_out = load_sequence('./data/BusinessProcess/IBM_Anonymous/') print(str_in[:10]) print(strain_out[:10]) print(stest_in[:10]) print(stest_out[:10]) print('num train {}'.format(len(str_in))) print('num test {}'.format(len(stest_in))) print('dim in {}'.format(len(char2label))) print('dim out {}'.format(len(char2label))) input_size = len(char2label)+1 output_size = len(char2label)+1 sequence_max_length = 100 words_count = 64 word_size = 100 read_heads = 1 iterations = 50000 max_train_iterations = 100000 start_step = 0 graph = tf.Graph() with graph.as_default(): with tf.Session(graph=graph) as session: llprint("Building Computational Graph ... ") ncomputer = DNC( StatelessRecurrentController, input_size, output_size, sequence_max_length, words_count, word_size, read_heads, batch_size, hidden_controller_dim = 100, use_emb=False, use_mem=False, decoder_mode=True, dual_controller=False, write_protect=False, ) output, prob, loss, apply_gradients = ncomputer.build_loss_function_mask() llprint("Done!\n") llprint("Initializing Variables ... ") session.run(tf.global_variables_initializer()) llprint("Done!\n") last_100_losses = [] start = 0 if start_step == 0 else start_step + 1 end = start_step + iterations + 1 minscore=1000 start_time_100 = time.time() avg_100_time = 0. avg_counter = 0 train_writer = tf.summary.FileWriter('./data/log_ibm/', session.graph) for i in range(start, end + 1): try: llprint("\rIteration %d/%d" % (i, end)) input_vec, output_vec, seq_len, decoder_point, masks, _ = \ prepare_sample_batch(str_in, strain_out, input_size, output_size, bs=batch_size, lm_train=True) summerize = (i % 100 == 0) if i<=max_train_iterations: loss_value, _ = session.run([ loss, apply_gradients ], feed_dict={ ncomputer.input_data: input_vec, ncomputer.target_output: output_vec, ncomputer.sequence_length: seq_len, ncomputer.decoder_point: decoder_point, ncomputer.mask:masks }) else: loss_value = session.run(loss, feed_dict={ ncomputer.input_data: input_vec, ncomputer.target_output: output_vec, ncomputer.sequence_length: seq_len, ncomputer.decoder_point: decoder_point, ncomputer.mask:masks }) last_100_losses.append(loss_value) if summerize: llprint("\n\t episode %d -->Avg. Cross-Entropy: %.7f\n" % (i, np.mean(last_100_losses))) summary = tf.Summary() summary.value.add(tag='batch_train_loss', simple_value=np.mean(last_100_losses)) trscores = [] for ii in range(10): input_vec, output_vec, seq_len, decoder_point, masks, rout_list =\ prepare_sample_batch(str_in, strain_out, input_size, output_size, bs=batch_size, lm_train=True) out = session.run([prob], feed_dict={ncomputer.input_data: input_vec, ncomputer.decoder_point: decoder_point, ncomputer.sequence_length: seq_len, ncomputer.mask:masks}) out = np.reshape(np.asarray(out), [-1, seq_len,output_size]) out = np.argmax(out, axis=-1) bout_list=[] # print('{} vs {}'.format(seq_len,out.shape[1])) for b in range(out.shape[0]): out_list = [] for io in range(decoder_point, out.shape[1]): if out[b][io]==0: break out_list.append(out[b][io]) bout_list.append(out_list) trscores.append(batch_norm_edit_score(rout_list, bout_list,0.95)) print('-----') tescores = [] losses = [] ntb=len(stest_in)//batch_size+1 for ii in range(ntb): if ii*batch_size==len(stest_in): break bs=[ii*batch_size, min((ii+1)*batch_size,len(stest_in))] rs = bs[1] - bs[0] if bs[1]>=len(stest_in): bs=[len(stest_in)-batch_size, len(stest_in)] input_data, target_output, seq_len, decoder_point, masks, rout_list = \ prepare_sample_batch(stest_in, stest_out, input_size, output_size, bs, lm_train=True) out, loss_v = session.run([prob, loss], feed_dict={ncomputer.input_data: input_data, ncomputer.target_output: target_output, ncomputer.sequence_length: seq_len, ncomputer.decoder_point: decoder_point, ncomputer.mask:masks }) losses.append(loss_v) out = np.reshape(np.asarray(out), [-1, seq_len, output_size]) out = np.argmax(out, axis=-1) bout_list = [] for b in range(out.shape[0]): out_list = [] for io in range(decoder_point, out.shape[1]): if out[b][io]==0: break out_list.append(out[b][io]) bout_list.append(out_list) tescores.append(batch_norm_edit_score(rout_list[:rs], bout_list[:rs], 0.995)) #pre, rec = set_score_pre(np.asarray([stest_out[ii]]), np.asarray([out_list])) #tescores2.append(pre) #tescores3.append(rec) # print(pro_list_test) # print(big_out_list) # rec, pre, fsc = set_score_hist(np.asarray([pro_list_test]),np.asarray([big_out_list])) tloss = np.mean(losses) tscore = np.mean(tescores) print('tr edit {} vs te edit {}'.format(np.mean(trscores), np.mean(tescores))) #print('test rec {} prec {}'.format(np.mean(tescores2), np.mean(tescores3))) print('test loss {}'.format(tloss)) summary.value.add(tag='train_edit', simple_value=np.mean(trscores)) summary.value.add(tag='test_edit', simple_value=np.mean(tescores)) summary.value.add(tag='test_loss', simple_value=tloss) #summary.value.add(tag='test_recall', simple_value=np.mean(tescores2)) #summary.value.add(tag='test_precision', simple_value=np.mean(tescores3)) train_writer.add_summary(summary, i) train_writer.flush() end_time_100 = time.time() elapsed_time = (end_time_100 - start_time_100) / 60 avg_counter += 1 avg_100_time += (1. / avg_counter) * (elapsed_time - avg_100_time) estimated_time = (avg_100_time * ((end - i) / 100.)) / 60. print("\tAvg. 100 iterations time: %.2f minutes" % (avg_100_time)) print("\tApprox. time to completion: %.2f hours" % (estimated_time)) start_time_100 = time.time() last_100_losses = [] if minscore>tscore: minscore=tscore llprint("\nSaving Checkpoint ... "), ncomputer.save(session, ckpts_dir, ncomputer.print_config()) except KeyboardInterrupt: llprint("\nSaving Checkpoint ... ") def ibm_test(): dirname = os.path.dirname(os.path.abspath(__file__)) + '/data/' print(dirname) ckpts_dir = os.path.join(dirname, 'checkpoints_ibm') batch_size = 10 main_dir='./data/BusinessProcess/IBM_Anonymous/' _, _, _, char2label = load_dict('./data/BusinessProcess/IBM_Anonymous/') str_in, strain_out, stest_in, stest_out = load_sequence(main_dir) print(str_in[:10]) print(strain_out[:10]) print(stest_in[:10]) print(stest_out[:10]) print('num train {}'.format(len(str_in))) print('num test {}'.format(len(stest_in))) print('dim in {}'.format(len(char2label))) print('dim out {}'.format(len(char2label))) input_size = len(char2label)+1 output_size = len(char2label)+1 sequence_max_length = 100 words_count = 64 word_size = 100 read_heads = 1 graph = tf.Graph() with graph.as_default(): with tf.Session(graph=graph) as session: llprint("Building Computational Graph ... ") ncomputer = DNC( StatelessRecurrentController, input_size, output_size, sequence_max_length, words_count, word_size, read_heads, batch_size, hidden_controller_dim=100, use_emb=False, use_mem=True, decoder_mode=True, dual_controller=False, write_protect=False, dual_emb=True ) output, prob, loss, apply_gradients = ncomputer.build_loss_function_mask() llprint("Done!\n") llprint("Initializing Variables ... ") session.run(tf.global_variables_initializer()) llprint("Done!\n") ncomputer.restore(session, ckpts_dir, ncomputer.print_config()) print('-----') tescores = [] losses = [] ntb=len(stest_in)//batch_size+1 all_preds=[] for ii in range(ntb): if ii*batch_size==len(stest_in): break bs=[ii*batch_size, min((ii+1)*batch_size,len(stest_in))] rs = bs[1] - bs[0] if bs[1]>=len(stest_in): bs=[len(stest_in)-batch_size, len(stest_in)] input_data, target_output, seq_len, decoder_point, masks, rout_list = \ prepare_sample_batch(stest_in, stest_out, input_size, output_size, bs) out, loss_v = session.run([prob, loss], feed_dict={ncomputer.input_data: input_data, ncomputer.target_output: target_output, ncomputer.sequence_length: seq_len, ncomputer.decoder_point: decoder_point, ncomputer.mask:masks }) losses.append(loss_v) out = np.reshape(np.asarray(out), [-1, seq_len, output_size]) out = np.argmax(out, axis=-1) bout_list = [] for b in range(out.shape[0]): out_list = [] for io in range(decoder_point, out.shape[1]): if out[b][io]==0: break out_list.append(out[b][io]) bout_list.append(out_list) for bb in bout_list[:rs]: all_preds.append(bb) tescores.append(batch_norm_edit_score(rout_list[:rs], bout_list[:rs], 0.995)) prefile=main_dir+'/{}.test_predict.txt'.format(ncomputer.print_config()) write_predict(prefile, all_preds) predict_seq=load_single_sequence(prefile) tescores2=[] for rseq,pseq in zip(stest_out, predict_seq): s=norm_edit_score(rseq,pseq) tescores2.append(s) tloss = np.mean(losses) print('test ed {}'.format(np.mean(tescores))) print('test ed {}'.format(np.mean(tescores2))) #print('test rec {} prec {}'.format(np.mean(tescores2), np.mean(tescores3))) print('test loss {}'.format(tloss)) if __name__ == '__main__': moodle_train() # moodle_test() # financial_log_train() # financial_log_test() # ibm_train # ibm_test()
# Copyright 2012 IBM # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. import datetime from lxml import etree import webob from nova.api.openstack.compute.contrib import availability_zone from nova import availability_zones from nova import context from nova import db from nova.openstack.common import jsonutils from nova import servicegroup from nova import test from nova.tests.api.openstack import fakes def fake_service_get_all(context, disabled=None): def __fake_service(binary, availability_zone, created_at, updated_at, host, disabled): return {'binary': binary, 'availability_zone': availability_zone, 'available_zones': availability_zone, 'created_at': created_at, 'updated_at': updated_at, 'host': host, 'disabled': disabled} if disabled: return [__fake_service("nova-compute", "zone-2", datetime.datetime(2012, 11, 14, 9, 53, 25, 0), datetime.datetime(2012, 12, 26, 14, 45, 25, 0), "fake_host-1", True), __fake_service("nova-scheduler", "internal", datetime.datetime(2012, 11, 14, 9, 57, 3, 0), datetime.datetime(2012, 12, 26, 14, 45, 25, 0), "fake_host-1", True), __fake_service("nova-network", "internal", datetime.datetime(2012, 11, 16, 7, 25, 46, 0), datetime.datetime(2012, 12, 26, 14, 45, 24, 0), "fake_host-2", True)] else: return [__fake_service("nova-compute", "zone-1", datetime.datetime(2012, 11, 14, 9, 53, 25, 0), datetime.datetime(2012, 12, 26, 14, 45, 25, 0), "fake_host-1", False), __fake_service("nova-sched", "internal", datetime.datetime(2012, 11, 14, 9, 57, 03, 0), datetime.datetime(2012, 12, 26, 14, 45, 25, 0), "fake_host-1", False), __fake_service("nova-network", "internal", datetime.datetime(2012, 11, 16, 7, 25, 46, 0), datetime.datetime(2012, 12, 26, 14, 45, 24, 0), "fake_host-2", False)] def fake_service_is_up(self, service): return service['binary'] != u"nova-network" def fake_set_availability_zones(context, services): return services class AvailabilityZoneApiTest(test.TestCase): def setUp(self): super(AvailabilityZoneApiTest, self).setUp() self.stubs.Set(db, 'service_get_all', fake_service_get_all) self.stubs.Set(availability_zones, 'set_availability_zones', fake_set_availability_zones) self.stubs.Set(servicegroup.API, 'service_is_up', fake_service_is_up) def test_availability_zone_index(self): req = webob.Request.blank('/v2/fake/os-availability-zone') resp = req.get_response(fakes.wsgi_app()) self.assertEqual(resp.status_int, 200) resp_dict = jsonutils.loads(resp.body) self.assertTrue('availabilityZoneInfo' in resp_dict) zones = resp_dict['availabilityZoneInfo'] self.assertEqual(len(zones), 2) self.assertEqual(zones[0]['zoneName'], u'zone-1') self.assertTrue(zones[0]['zoneState']['available']) self.assertIsNone(zones[0]['hosts']) self.assertEqual(zones[1]['zoneName'], u'zone-2') self.assertFalse(zones[1]['zoneState']['available']) self.assertIsNone(zones[1]['hosts']) def test_availability_zone_detail(self): def _formatZone(zone_dict): result = [] # Zone tree view item result.append({'zoneName': zone_dict['zoneName'], 'zoneState': u'available' if zone_dict['zoneState']['available'] else u'not available'}) if zone_dict['hosts'] is not None: for (host, services) in zone_dict['hosts'].items(): # Host tree view item result.append({'zoneName': u'|- %s' % host, 'zoneState': u''}) for (svc, state) in services.items(): # Service tree view item result.append({'zoneName': u'| |- %s' % svc, 'zoneState': u'%s %s %s' % ( 'enabled' if state['active'] else 'disabled', ':-)' if state['available'] else 'XXX', jsonutils.to_primitive( state['updated_at']))}) return result def _assertZone(zone, name, status): self.assertEqual(zone['zoneName'], name) self.assertEqual(zone['zoneState'], status) availabilityZone = availability_zone.AvailabilityZoneController() req = webob.Request.blank('/v2/fake/os-availability-zone/detail') req.method = 'GET' req.environ['nova.context'] = context.get_admin_context() resp_dict = availabilityZone.detail(req) self.assertTrue('availabilityZoneInfo' in resp_dict) zones = resp_dict['availabilityZoneInfo'] self.assertEqual(len(zones), 3) ''' availabilityZoneInfo field content in response body: [{'zoneName': 'zone-1', 'zoneState': {'available': True}, 'hosts': {'fake_host-1': { 'nova-compute': {'active': True, 'available': True, 'updated_at': datetime(2012, 12, 26, 14, 45, 25)}}}}, {'zoneName': 'internal', 'zoneState': {'available': True}, 'hosts': {'fake_host-1': { 'nova-sched': {'active': True, 'available': True, 'updated_at': datetime(2012, 12, 26, 14, 45, 25)}}, 'fake_host-2': { 'nova-network': {'active': True, 'available': False, 'updated_at': datetime(2012, 12, 26, 14, 45, 24)}}}}, {'zoneName': 'zone-2', 'zoneState': {'available': False}, 'hosts': None}] ''' l0 = [u'zone-1', u'available'] l1 = [u'|- fake_host-1', u''] l2 = [u'| |- nova-compute', u'enabled :-) 2012-12-26T14:45:25.000000'] l3 = [u'internal', u'available'] l4 = [u'|- fake_host-1', u''] l5 = [u'| |- nova-sched', u'enabled :-) 2012-12-26T14:45:25.000000'] l6 = [u'|- fake_host-2', u''] l7 = [u'| |- nova-network', u'enabled XXX 2012-12-26T14:45:24.000000'] l8 = [u'zone-2', u'not available'] z0 = _formatZone(zones[0]) z1 = _formatZone(zones[1]) z2 = _formatZone(zones[2]) self.assertEqual(len(z0), 3) self.assertEqual(len(z1), 5) self.assertEqual(len(z2), 1) _assertZone(z0[0], l0[0], l0[1]) _assertZone(z0[1], l1[0], l1[1]) _assertZone(z0[2], l2[0], l2[1]) _assertZone(z1[0], l3[0], l3[1]) _assertZone(z1[1], l4[0], l4[1]) _assertZone(z1[2], l5[0], l5[1]) _assertZone(z1[3], l6[0], l6[1]) _assertZone(z1[4], l7[0], l7[1]) _assertZone(z2[0], l8[0], l8[1]) class AvailabilityZoneSerializerTest(test.TestCase): def test_availability_zone_index_detail_serializer(self): def _verify_zone(zone_dict, tree): self.assertEqual(tree.tag, 'availabilityZone') self.assertEqual(zone_dict['zoneName'], tree.get('name')) self.assertEqual(str(zone_dict['zoneState']['available']), tree[0].get('available')) for _idx, host_child in enumerate(tree[1]): self.assertTrue(host_child.get('name') in zone_dict['hosts']) svcs = zone_dict['hosts'][host_child.get('name')] for _idx, svc_child in enumerate(host_child[0]): self.assertTrue(svc_child.get('name') in svcs) svc = svcs[svc_child.get('name')] self.assertEqual(len(svc_child), 1) self.assertEqual(str(svc['available']), svc_child[0].get('available')) self.assertEqual(str(svc['active']), svc_child[0].get('active')) self.assertEqual(str(svc['updated_at']), svc_child[0].get('updated_at')) serializer = availability_zone.AvailabilityZonesTemplate() raw_availability_zones = \ [{'zoneName': 'zone-1', 'zoneState': {'available': True}, 'hosts': {'fake_host-1': { 'nova-compute': {'active': True, 'available': True, 'updated_at': datetime.datetime( 2012, 12, 26, 14, 45, 25)}}}}, {'zoneName': 'internal', 'zoneState': {'available': True}, 'hosts': {'fake_host-1': { 'nova-sched': {'active': True, 'available': True, 'updated_at': datetime.datetime( 2012, 12, 26, 14, 45, 25)}}, 'fake_host-2': { 'nova-network': {'active': True, 'available': False, 'updated_at': datetime.datetime( 2012, 12, 26, 14, 45, 24)}}}}, {'zoneName': 'zone-2', 'zoneState': {'available': False}, 'hosts': None}] text = serializer.serialize( dict(availabilityZoneInfo=raw_availability_zones)) tree = etree.fromstring(text) self.assertEqual('availabilityZones', tree.tag) self.assertEqual(len(raw_availability_zones), len(tree)) for idx, child in enumerate(tree): _verify_zone(raw_availability_zones[idx], child)
############################################################################ ## ## Copyright (C) 2006-2008 University of Utah. All rights reserved. ## ## This file is part of VisTrails. ## ## This file may be used under the terms of the GNU General Public ## License version 2.0 as published by the Free Software Foundation ## and appearing in the file LICENSE.GPL included in the packaging of ## this file. Please review the following to ensure GNU General Public ## Licensing requirements will be met: ## http://www.opensource.org/licenses/gpl-license.php ## ## If you are unsure which license is appropriate for your use (for ## instance, you are interested in developing a commercial derivative ## of VisTrails), please contact us at contact@vistrails.org. ## ## This file is provided AS IS with NO WARRANTY OF ANY KIND, INCLUDING THE ## WARRANTY OF DESIGN, MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE. ## ############################################################################ import os, sys sys.path.append('../../../vistrails') from parse_cdat_xml_file import parse_cdat_xml_file from cdat_domain import CDATModule #cdat package identifiers cp_version = '0.2' cp_identifier = 'edu.utah.sci.vistrails.cdat' cp_name = 'CDAT' def write_init(output_file, classes_lines, init_lines): """write_init(output_file: str, classes_lines: list, init_lines: list) -> None Writes the necessary contents for the package init file""" # cdat dependencies init_lines.append("\n\n") init_lines.append("def package_dependencies():\n") #init_lines.append(" return ['edu.utah.sci.vistrails.numpyscipy']\n") init_lines.append(" return []\n") init_lines.append("\n\n") init_lines.append("def package_requirements():\n") init_lines.append(" import core.requirements\n") init_lines.append(" if not core.requirements.python_module_exists('vcs'):\n") init_lines.append(" raise core.requirements.MissingRequirements('vcs')\n") init_lines.append(" if not core.requirements.python_module_exists('cdms2'):\n") init_lines.append(" raise core.requirements.MissingRequirements('cdms2')\n") init_lines.append(" if not core.requirements.python_module_exists('cdutil'):\n") init_lines.append(" raise core.requirements.MissingRequirements('cdutil')\n") init_lines.append(" import vcs, cdms2, cdutil\n") init_lines.append("\n\n") header = open("init_inc.py").readlines() header.append("\n\n") header.append('version = "' + cp_version + '"\n') header.append('identifier = "' + cp_identifier + '"\n') header.append('name = "' + cp_name + '"\n\n') outfile = open(output_file, "w") outfile.writelines(header) outfile.writelines(classes_lines) outfile.writelines(init_lines) outfile.close() def parse_files(input_files): modules = [] for f in input_files: modules.append(parse_cdat_xml_file(f)) return modules def add_canvas_ports_to_canvas_modules(canvas, lines): canvas.add_extra_input_port_to_all_modules(lines, port_name='canvas', port_type='Canvas', doc='Canvas object', optional=False ) canvas.add_extra_output_port_to_all_modules(lines, port_name='canvas', port_type='Canvas', doc='Canvas object', optional=False ) def add_canvas_module(canvas,init_lines,class_lines): canvas.write_extra_module_definition(class_lines,'Canvas') canvas.register_extra_vistrails_module(init_lines,'Canvas') def get_image_compute_method(action, ident=''): lines = [] lines.append(ident + "def compute(self):\n") lines.append(ident + " if self.has_input('canvas'):\n") lines.append(ident + " canvas = self.get_input('canvas')\n") lines.append(ident + " else:\n") lines.append(ident + " canvas = vcs.init()\n") lines.append(ident + " args = []\n") for inp in action._inputs: lines.append(ident + " %s = None\n"%inp._name) for inst in inp._valid_instances: if inp._valid_instances.index(inst) == 0: lines.append(ident + " if self.has_input('%s'):\n" % inst) lines.append(ident + " %s = self.get_input('%s')\n" % (inp._name, inst)) lines.append(ident + " args.append(%s)\n"%inp._name) else: lines.append(ident + " elif self.has_input('%s'):\n" % inst) lines.append(ident + " %s = self.get_input('%s')\n" % (inp._name, inst)) lines.append(ident + " args.append(%s)\n"%inp._name) if inp._required: lines.append("\n"+ ident +" # %s is a required port\n" % inp._name) lines.append(ident + " if %s is None:\n" % inp._name) lines.append(ident + " raise ModuleError(self, \"'%s' is a mandatory port\")\n" % inp._name) lines.append(ident + " ofile = core.modules.basic_modules.File()\n") lines.append(ident + " ofile.name = %s\n"%action._inputs[0]._name) lines.append(ident + " canvas.%s(*args)\n"%action._name) lines.append(ident + " self.set_output('file',ofile)\n") lines.append("\n") return lines def get_cdms2_compute_method(action, ident=''): lines = [] lines.append(ident + "def compute(self):\n") lines.append(ident + " args = []\n") for inp in action._inputs: lines.append(ident + " %s = None\n"%inp._name) for inst in inp._valid_instances: if inp._valid_instances.index(inst) == 0: lines.append(ident + " if self.has_input('%s'):\n" % inst) lines.append(ident + " %s = self.get_input('%s')\n" % (inp._name, inst)) lines.append(ident + " args.append(%s)\n"%inp._name) else: lines.append(ident + " elif self.has_input('%s'):\n" % inst) lines.append(ident + " %s = self.get_input('%s')\n" % (inp._name, inst)) lines.append(ident + " args.append(%s)\n"%inp._name) if inp._required: lines.append("\n"+ ident +" # %s is a required port\n" % inp._name) lines.append(ident + " if %s is None:\n" % inp._name) lines.append(ident + " raise ModuleError(self, \"'%s' is a mandatory port\")\n" % inp._name) lines.append(ident + " res = cdms2.%s(*args)\n"%action._name) lines.append(ident + " self.set_output('%s',res)\n"%action._outputs[0]._name) lines.append("\n") return lines def get_CdmsFile_compute_method(action, ident=''): lines = [] lines.append(ident + "def compute(self):\n") lines.append(ident + " self.check_input('cdmsfile')\n") lines.append(ident + " cdmsfile = self.get_input('cdmsfile')\n") lines.append(ident + " args = []\n") for inp in action._inputs: lines.append(ident + " %s = None\n"%inp._name) for inst in inp._valid_instances: if inp._valid_instances.index(inst) == 0: lines.append(ident + " if self.has_input('%s'):\n" % inst) lines.append(ident + " %s = self.get_input('%s')\n" % (inp._name, inst)) lines.append(ident + " args.append(%s)\n"%inp._name) else: lines.append(ident + " elif self.has_input('%s'):\n" % inst) lines.append(ident + " %s = self.get_input('%s')\n" % (inp._name, inst)) lines.append(ident + " args.append(%s)\n"%inp._name) if inp._required: lines.append("\n"+ ident +" # %s is a required port\n" % inp._name) lines.append(ident + " if %s is None:\n" % inp._name) lines.append(ident + " raise ModuleError(self, \"'%s' is a mandatory port\")\n" % inp._name) lines.append(ident + " res = cdmsfile.%s(*args)\n"%action._name) lines.append(ident + " self.set_output('%s',res)\n"%action._outputs[0]._name) lines.append("\n") return lines if __name__ == '__main__': # usage: args = sys.argv if len(args) > 2: root_dir = args[1] output_file = args[2] else: print "Usage: %s root_dir output_file" % args[0] sys.exit(0) xmlfiles = [] input_files = os.walk(root_dir) for (d, tree, files) in input_files: for f in files: if os.path.isfile(os.path.join(d,f)) and f.endswith(".xml"): xmlfiles.append(os.path.join(d,f)) modules = parse_files(xmlfiles) extra_init_lines = [] init_lines = [] extra_init_lines.append("\ndef initialize(*args, **keywords):\n") extra_init_lines.append(" reg = core.modules.module_registry.get_module_registry()\n\n") class_lines = [] extra_class_lines = [] print "%s xml file(s) found."% len(modules) CDATModule.write_extra_module_definitions_init(extra_class_lines) for m in modules: print "codepath: %s has %s Vistrails Modules."%(m._codepath, len(m._actions)) m.build_vistrails_modules_dict() for m in modules: m.register_vistrails_modules(init_lines) if m._codepath == 'vcs.Canvas.Canvas': for a in m._actions: if a._name == 'png': a.write_module_definition(class_lines, ident='', compute_method=get_image_compute_method(a,ident=" ")) a.register_extra_output_port('file', 'core.modules.basic_modules.File', init_lines, "File output", False) else: a.write_module_definition(class_lines) add_canvas_ports_to_canvas_modules(m,init_lines) add_canvas_module(m,extra_init_lines, extra_class_lines) elif m._codepath == "cdms2.dataset.CdmsFile": for a in m._actions: if a._name == "__call__": a.write_module_definition(class_lines, ident='', compute_method=get_CdmsFile_compute_method(a, ident=" ")) else: a.write_module_definition(class_lines) m.add_extra_input_port_to_all_modules(init_lines, port_name='cdmsfile', port_type='CdmsFile', doc='cdmsfile', optional=False ) elif m._codepath == 'cdms2': for a in m._actions: if a._name == "open": a.write_module_definition(class_lines, ident='', compute_method=get_cdms2_compute_method(a, ident=" ")) else: a.write_module_definition(class_lines) else: m.write_module_definitions(class_lines) CDATModule.write_extra_module_definitions(extra_class_lines) CDATModule.register_extra_vistrails_modules(extra_init_lines) cdatwindow_init_lines = open("cdatwindow_init_inc.py").readlines() extra_init_lines.extend(cdatwindow_init_lines) extra_init_lines.extend(init_lines) extra_class_lines.extend(class_lines) write_init(output_file, extra_class_lines, extra_init_lines)
""" Classes and functions used to visualize data for thermo scientific analyzers """ from pandas import Series, DataFrame import pandas as pd import datetime as dt import matplotlib.pyplot as plt import numpy as np from matplotlib import dates as d import os import math import glob import matplotlib import warnings import sys __all__ = ['diurnal_plot','diurnal_plot_single', 'ThermoPlot'] def diurnal_plot(data, dates=[], shaded=False, title="Diurnal Profile of Trace Gases", xlabel="Local Time: East St. Louis, MO"): ''' If plotting the entire DataFrame (data), choose all_data=True, else choose all_data=False and declare the date or dates to plot as a list. `data` should be a pandas core DataFrame with time index and each trace gas concentration as a column returns a single plot for NOx, SO2, and O3 >>> ''' # Check to make sure the data is a valid dataframe if not isinstance(data, pd.DataFrame): print ("data is not a pandas DataFrame, thus this will not end well for you.") exit # If length of dates is zero, plot everything if len(dates) == 0: # Plot everything, yo! pass elif len(dates) == 1: # Plot just this date data = data[dates[0]] elif len(dates) == 2: # Plot between these dates data = data[dates[0]:dates[1]] else: sys.exit("Dates are not properly configured.") # Add columns for time to enable simple diurnal trends to be found data['Time'] = data.index.map(lambda x: x.strftime("%H:%M")) # Group the data by time and grab the statistics grouped = data.groupby('Time').describe().unstack() # set the index to be a str grouped.index = pd.to_datetime(grouped.index.astype(str)) # Plot fig, (ax1, ax2, ax3) = plt.subplots(3, figsize=(10,9), sharex=True) # Set plot titles and labels ax1.set_title(title, fontsize=14) ax1.set_ylabel(r'$\ [NO_x] (ppb)$', fontsize=14, weight='bold') ax2.set_ylabel(r'$\ [SO_2] (ppb)$', fontsize=14) ax3.set_ylabel(r'$\ [O_3] (ppb)$', fontsize=14) ax3.set_xlabel(xlabel, fontsize=14) # Make the ticks invisible on the first and second plots plt.setp( ax1.get_xticklabels(), visible=False) plt.setp( ax2.get_xticklabels(), visible=False) # Set y min to zero just in case: ax1.set_ylim(0,grouped['nox']['mean'].max()*1.05) ax2.set_ylim(0,grouped['so2']['mean'].max()*1.05) ax3.set_ylim(0,grouped['o3']['mean'].max()*1.05) # Plot means ax1.plot(grouped.index, grouped['nox']['mean'],'g', linewidth=2.0) ax2.plot(grouped.index, grouped['so2']['mean'], 'r', linewidth=2.0) ax3.plot(grouped.index, grouped['o3']['mean'], 'b', linewidth=2.0) # If shaded=true, plot trends if shaded == True: ax1.plot(grouped.index, grouped['nox']['75%'],'g') ax1.plot(grouped.index, grouped['nox']['25%'],'g') ax1.set_ylim(0,grouped['nox']['75%'].max()*1.05) ax1.fill_between(grouped.index, grouped['nox']['mean'], grouped['nox']['75%'], alpha=.5, facecolor='green') ax1.fill_between(grouped.index, grouped['nox']['mean'], grouped['nox']['25%'], alpha=.5, facecolor='green') ax2.plot(grouped.index, grouped['so2']['75%'],'r') ax2.plot(grouped.index, grouped['so2']['25%'],'r') ax2.set_ylim(0,grouped['so2']['75%'].max()*1.05) ax2.fill_between(grouped.index, grouped['so2']['mean'], grouped['so2']['75%'], alpha=.5, facecolor='red') ax2.fill_between(grouped.index, grouped['so2']['mean'], grouped['so2']['25%'], alpha=.5, facecolor='red') ax3.plot(grouped.index, grouped['o3']['75%'],'b') ax3.plot(grouped.index, grouped['o3']['25%'],'b') ax3.set_ylim(0,grouped['o3']['75%'].max()*1.05) ax3.fill_between(grouped.index, grouped['o3']['mean'], grouped['o3']['75%'], alpha=.5, facecolor='blue') ax3.fill_between(grouped.index, grouped['o3']['mean'], grouped['o3']['25%'], alpha=.5, facecolor='blue') # Get/Set xticks ticks = ax1.get_xticks() ax3.set_xticks(np.linspace(ticks[0], d.date2num(d.num2date(ticks[-1]) + dt.timedelta(hours=3)), 5)) ax3.set_xticks(np.linspace(ticks[0], d.date2num(d.num2date(ticks[-1]) + dt.timedelta(hours=3)), 25), minor=True) ax3.xaxis.set_major_formatter(matplotlib.dates.DateFormatter('%I:%M %p')) # Make the layout tight to get rid of some whitespace plt.tight_layout() plt.show() return (fig, (ax1, ax2, ax3)) def diurnal_plot_single(data, model='', dates=[], shaded=False, color1 = 'blue', title="Diurnal Profile of Trace Gases", xlabel="Local Time: East St. Louis, MO", ylabel=r'$\ [NO_x] (ppb)$'): ''' `data` should be a pandas core DataFrame with time index and each trace gas concentration as a column returns a single plot for one of the three analyzers. >>>diurnal_plot_single(data,model='o3', ylabel='O3', shaded=True, color1='green') ''' # Check to make sure the data is a valid dataframe if not isinstance(data, pd.DataFrame): sys.exit("data is not a pandas DataFrame, thus this will not end well for you.") # Check to make sure the model is valid if model.lower() not in ['nox','so2','o3','sox']: sys.exit("Model is not defined correctly: options are ['nox','so2','sox','o3']") # Set model to predefined variable if model.lower() == 'nox': instr = 'nox' elif model.lower() == 'so2' or model.lower() == 'sox': instr = 'sox' else: instr = 'o3' # If not plotting all the data, truncate the dataframe to include only the needed data if len(dates) == 0: # plot everything pass elif len(dates) == 1: # plot just this date data = data[dates[0]] elif len(dates) == 2: # plot between these dates data = data[dates[0]:dates[1]] else: sys.exit("You have an error with how you defined your dates") # Add columns for time to enable simple diurnal trends to be found data['Time'] = data.index.map(lambda x: x.strftime("%H:%M")) # Group the data by time and grab the statistics grouped = data.groupby('Time').describe().unstack() # set the index to be a str grouped.index = pd.to_datetime(grouped.index.astype(str)) # Plot fig, ax = plt.subplots(1, figsize=(8,4)) # Set plot titles and labels ax.set_title(title, fontsize=14) ax.set_ylabel(ylabel, fontsize=14, weight='bold') ax.set_xlabel(xlabel, fontsize=14) # Set y min to zero just in case: ax.set_ylim(0,grouped[instr]['mean'].max()*1.05) # Plot means ax.plot(grouped.index, grouped[instr]['mean'], color1,linewidth=2.0) # If shaded=true, plot trends if shaded == True: ax.plot(grouped.index, grouped[instr]['75%'],color1) ax.plot(grouped.index, grouped[instr]['25%'],color1) ax.set_ylim(0,grouped[instr]['75%'].max()*1.05) ax.fill_between(grouped.index, grouped[instr]['mean'], grouped[instr]['75%'], alpha=.5, facecolor=color1) ax.fill_between(grouped.index, grouped[instr]['mean'], grouped[instr]['25%'], alpha=.5, facecolor=color1) # Get/Set xticks ticks = ax.get_xticks() ax.set_xticks(np.linspace(ticks[0], d.date2num(d.num2date(ticks[-1]) + dt.timedelta(hours=3)), 5)) ax.set_xticks(np.linspace(ticks[0], d.date2num(d.num2date(ticks[-1]) + dt.timedelta(hours=3)), 25), minor=True) ax.xaxis.set_major_formatter(matplotlib.dates.DateFormatter('%I:%M %p')) # Make the layout tight to get rid of some whitespace plt.tight_layout() plt.show() return (fig, ax) class ThermoPlot(): ''' Allows for easy plotting of internal instrument data. Currently supports the following models: - NO, NO2, NOx (42I) - O3 (49I) - SO2 (43I) ''' def __init__(self, data): self.data = data def debug_plot(self, args={}): ''' Plots thermo scientific instrument data for debugging purposes. The top plot contains internal instrument data such as flow rates and temperatures. The bottom plot contains trace gas data for the instrument. instrument must be set to either nox, so2, sox, or o3 >>> nox = ThermoPlot(data) >>> f, (a1, a2, a3) = nox.debug_plot() ''' default_args = { 'xlabel':'Local Time, East St Louis, MO', 'ylabpressure':'Flow (LPM)', 'ylabgas':'Gas Conc. (ppb)', 'ylabtemp':'Temperature (C)', 'title_fontsize':'18', 'labels_fontsize':'14', 'grid':False } # Figure out what model we are trying to plot and set instrument specific default args cols = [i.lower() for i in self.data.columns.values.tolist()] if 'o3' in cols: default_args['instrument'] = 'o3' default_args['title'] = "Debug Plot for " + r'$\ O_{3} $' + ": Model 49I" default_args['color_o3'] = 'blue' elif 'sox' in cols or 'so2' in cols: default_args['instrument'] = 'so2' default_args['title'] = "Debug Plot for " + r'$\ SO_{2} $' + ": Model 43I" default_args['color_so2'] = 'green' elif 'nox' in cols: default_args['instrument'] = 'nox' default_args['title'] = "Debug Plot for " + r'$\ NO_{x} $' + ": Model 42I" default_args['color_no'] = '#FAB923' default_args['color_nox'] = '#FC5603' default_args['color_no2'] = '#FAE823' else: sys.exit("Could not figure out what isntrument this is for") # If kwargs are set, replace the default values for key, val in default_args.iteritems(): if args.has_key(key): default_args[key] = args[key] # Set up Plot and all three axes fig, (ax1, ax3) = plt.subplots(2, figsize=(10,6), sharex=True) ax2 = ax1.twinx() # set up axes labels and titles ax1.set_title(default_args['title'], fontsize=default_args['title_fontsize']) ax1.set_ylabel(default_args['ylabpressure'], fontsize=default_args['labels_fontsize']) ax2.set_ylabel(default_args['ylabtemp'], fontsize=default_args['labels_fontsize']) ax3.set_ylabel(default_args['ylabgas'], fontsize=default_args['labels_fontsize']) ax3.set_xlabel(default_args['xlabel'], fontsize=default_args['labels_fontsize']) # Make the ticks invisible on the first and second plots plt.setp( ax1.get_xticklabels(), visible=False ) # Plot the debug data on the top graph if default_args['instrument'] == 'o3': self.data['bncht'].plot(ax=ax2, label=r'$\ T_{bench}$') self.data['lmpt'].plot(ax=ax2, label=r'$\ T_{lamp}$') self.data['flowa'].plot(ax=ax1, label=r'$\ Q_{A}$', style='--') self.data['flowb'].plot(ax=ax1, label=r'$\ Q_{B}$', style='--') self.data['o3'].plot(ax=ax3, color=default_args['color_o3'], label=r'$\ O_{3}$') elif default_args['instrument'] == 'so2': self.data['intt'].plot(ax=ax2, label=r'$\ T_{internal}$') self.data['rctt'].plot(ax=ax2, label=r'$\ T_{reactor}$') self.data['smplfl'].plot(ax=ax1, label=r'$\ Q_{sample}$', style='--') self.data['so2'].plot(ax=ax3, label=r'$\ SO_2 $', color=default_args['color_so2'], ylim=[0,self.data['so2'].max()*1.05]) else: m = max(self.data['convt'].max(),self.data['intt'].max(),self.data['pmtt'].max()) self.data['convt'].plot(ax=ax2, label=r'$\ T_{converter}$') self.data['intt'].plot(ax=ax2, label=r'$\ T_{internal}$') self.data['rctt'].plot(ax=ax2, label=r'$\ T_{reactor}$') self.data['pmtt'].plot(ax=ax2, label=r'$\ T_{PMT}$') self.data['smplf'].plot(ax=ax1, label=r'$\ Q_{sample}$', style='--') self.data['ozonf'].plot(ax=ax1, label=r'$\ Q_{ozone}$', style='--') self.data['no'].plot(ax=ax3, label=r'$\ NO $', color=default_args['color_no']) self.data['no2'].plot(ax=ax3, label=r'$\ NO_{2}$', color=default_args['color_no2']) self.data['nox'].plot(ax=ax3, label=r'$\ NO_{x}$', color=default_args['color_nox'], ylim=(0,math.ceil(self.data.nox.max()*1.05))) # Legends lines, labels = ax1.get_legend_handles_labels() lines2, labels2 = ax2.get_legend_handles_labels() plt.legend(lines+lines2, labels+labels2, bbox_to_anchor=(1.10, 1), loc=2, borderaxespad=0.) ax3.legend(bbox_to_anchor=(1.10, 1.), loc=2, borderaxespad=0.) # Hide grids? ax1.grid(default_args['grid']) ax2.grid(default_args['grid']) ax3.grid(default_args['grid']) # More of the things.. plt.tight_layout() plt.show() return fig, (ax1, ax2, ax3)
#!/usr/bin/env python3 # Copyright (c) 2017 The Bitcoin Core developers # Distributed under the MIT software license, see the accompanying # file COPYING or http://www.opensource.org/licenses/mit-license.php. """An example functional test The module-level docstring should include a high-level description of what the test is doing. It's the first thing people see when they open the file and should give the reader information about *what* the test is testing and *how* it's being tested """ # Imports should be in PEP8 ordering (std library first, then third party # libraries then local imports). from collections import defaultdict # Avoid wildcard * imports if possible from test_framework.blocktools import (create_block, create_coinbase) from test_framework.mininode import ( CInv, P2PInterface, mininode_lock, msg_block, msg_getdata, network_thread_join, network_thread_start, ) from test_framework.test_framework import VergeTestFramework from test_framework.util import ( assert_equal, connect_nodes, wait_until, ) # P2PInterface is a class containing callbacks to be executed when a P2P # message is received from the node-under-test. Subclass P2PInterface and # override the on_*() methods if you need custom behaviour. class BaseNode(P2PInterface): def __init__(self): """Initialize the P2PInterface Used to initialize custom properties for the Node that aren't included by default in the base class. Be aware that the P2PInterface base class already stores a counter for each P2P message type and the last received message of each type, which should be sufficient for the needs of most tests. Call super().__init__() first for standard initialization and then initialize custom properties.""" super().__init__() # Stores a dictionary of all blocks received self.block_receive_map = defaultdict(int) def on_block(self, message): """Override the standard on_block callback Store the hash of a received block in the dictionary.""" message.block.calc_sha256() self.block_receive_map[message.block.sha256] += 1 def on_inv(self, message): """Override the standard on_inv callback""" pass def custom_function(): """Do some custom behaviour If this function is more generally useful for other tests, consider moving it to a module in test_framework.""" # self.log.info("running custom_function") # Oops! Can't run self.log outside the VergeTestFramework pass class ExampleTest(VergeTestFramework): # Each functional test is a subclass of the VergeTestFramework class. # Override the set_test_params(), add_options(), setup_chain(), setup_network() # and setup_nodes() methods to customize the test setup as required. def set_test_params(self): """Override test parameters for your individual test. This method must be overridden and num_nodes must be exlicitly set.""" self.setup_clean_chain = True self.num_nodes = 3 # Use self.extra_args to change command-line arguments for the nodes self.extra_args = [[], ["-logips"], []] # self.log.info("I've finished set_test_params") # Oops! Can't run self.log before run_test() # Use add_options() to add specific command-line options for your test. # In practice this is not used very much, since the tests are mostly written # to be run in automated environments without command-line options. # def add_options() # pass # Use setup_chain() to customize the node data directories. In practice # this is not used very much since the default behaviour is almost always # fine # def setup_chain(): # pass def setup_network(self): """Setup the test network topology Often you won't need to override this, since the standard network topology (linear: node0 <-> node1 <-> node2 <-> ...) is fine for most tests. If you do override this method, remember to start the nodes, assign them to self.nodes, connect them and then sync.""" self.setup_nodes() # In this test, we're not connecting node2 to node0 or node1. Calls to # sync_all() should not include node2, since we're not expecting it to # sync. connect_nodes(self.nodes[0], 1) self.sync_all([self.nodes[0:1]]) # Use setup_nodes() to customize the node start behaviour (for example if # you don't want to start all nodes at the start of the test). # def setup_nodes(): # pass def custom_method(self): """Do some custom behaviour for this test Define it in a method here because you're going to use it repeatedly. If you think it's useful in general, consider moving it to the base VergeTestFramework class so other tests can use it.""" self.log.info("Running custom_method") def run_test(self): """Main test logic""" # Create P2P connections to two of the nodes self.nodes[0].add_p2p_connection(BaseNode()) # Start up network handling in another thread. This needs to be called # after the P2P connections have been created. network_thread_start() # wait_for_verack ensures that the P2P connection is fully up. self.nodes[0].p2p.wait_for_verack() # Generating a block on one of the nodes will get us out of IBD blocks = [int(self.nodes[0].generate(nblocks=1)[0], 16)] self.sync_all([self.nodes[0:1]]) # Notice above how we called an RPC by calling a method with the same # name on the node object. Notice also how we used a keyword argument # to specify a named RPC argument. Neither of those are defined on the # node object. Instead there's some __getattr__() magic going on under # the covers to dispatch unrecognised attribute calls to the RPC # interface. # Logs are nice. Do plenty of them. They can be used in place of comments for # breaking the test into sub-sections. self.log.info("Starting test!") self.log.info("Calling a custom function") custom_function() self.log.info("Calling a custom method") self.custom_method() self.log.info("Create some blocks") self.tip = int(self.nodes[0].getbestblockhash(), 16) self.block_time = self.nodes[0].getblock(self.nodes[0].getbestblockhash())['time'] + 1 height = 1 for i in range(10): # Use the mininode and blocktools functionality to manually build a block # Calling the generate() rpc is easier, but this allows us to exactly # control the blocks and transactions. block = create_block(self.tip, create_coinbase(height), self.block_time) block.solve() block_message = msg_block(block) # Send message is used to send a P2P message to the node over our P2PInterface self.nodes[0].p2p.send_message(block_message) self.tip = block.sha256 blocks.append(self.tip) self.block_time += 1 height += 1 self.log.info("Wait for node1 to reach current tip (height 11) using RPC") self.nodes[1].waitforblockheight(11) self.log.info("Connect node2 and node1") connect_nodes(self.nodes[1], 2) self.log.info("Add P2P connection to node2") # We can't add additional P2P connections once the network thread has started. Disconnect the connection # to node0, wait for the network thread to terminate, then connect to node2. This is specific to # the current implementation of the network thread and may be improved in future. self.nodes[0].disconnect_p2ps() network_thread_join() self.nodes[2].add_p2p_connection(BaseNode()) network_thread_start() self.nodes[2].p2p.wait_for_verack() self.log.info("Wait for node2 reach current tip. Test that it has propagated all the blocks to us") getdata_request = msg_getdata() for block in blocks: getdata_request.inv.append(CInv(2, block)) self.nodes[2].p2p.send_message(getdata_request) # wait_until() will loop until a predicate condition is met. Use it to test properties of the # P2PInterface objects. wait_until(lambda: sorted(blocks) == sorted(list(self.nodes[2].p2p.block_receive_map.keys())), timeout=5, lock=mininode_lock) self.log.info("Check that each block was received only once") # The network thread uses a global lock on data access to the P2PConnection objects when sending and receiving # messages. The test thread should acquire the global lock before accessing any P2PConnection data to avoid locking # and synchronization issues. Note wait_until() acquires this global lock when testing the predicate. with mininode_lock: for block in self.nodes[2].p2p.block_receive_map.values(): assert_equal(block, 1) if __name__ == '__main__': ExampleTest().main()
# # flightlines_to_single_CHM_pit_free.py # # (c) 2014, martin isenburg - http://rapidlasso.com # rapidlasso GmbH - fast tools to catch reality # # This LAStools pipeline turns a folder full of LAS # or LAZ files (assumed to raw flightlines) into a # single pit-free CHM using the algorithms described # by A. Khosravipour et al. in Silvilaser 2013. The # input file is first tiled using lastile with the # specified tile size. The specified buffer is used # to avoid edge artifacts. All tiles are then ground # classified using lasground marking points as ground # (class 2) and non-ground (class 1). Next the height # of all points above the ground is computed using # lasheight and used to height-normalize all the tiles # in the sense that the height is used to replace the # z coordinates. Using lasthin the tiles are then both # thinned and splatted using the laser beam with in an # attempt to widen the LiDAR returns a little bit. From # these height-normalized and point-splatted tiles # the partial CHMs are computed (as detailed in the # poster, the extended abstract, and the paper) that # are merged into a single CHM in the final step. # # LiDAR input: LAS/LAZ # raster output: TIF/IMG/BIL/DTM/ASC/FLT/XYZ # # for licensing see http://lastools.org/LICENSE.txt # import sys, os, arcgisscripting, subprocess def check_output(command,console): if console == True: process = subprocess.Popen(command) else: process = subprocess.Popen(command, shell=True, stdout=subprocess.PIPE, stderr=subprocess.STDOUT, universal_newlines=True) output,error = process.communicate() returncode = process.poll() return returncode,output ### create the geoprocessor object gp = arcgisscripting.create(9.3) ### report that something is happening gp.AddMessage("Starting flightlines_to_single_CHM_pit_free ...") ### define positions of arguments in argv array arg_input_folder = 1 arg_tile_size = 2 arg_buffer = 3 arg_terrain_type = 4 arg_beam_width = 5 arg_step = 6 arg_cores = 7 arg_empty_temp_dir = 8 arg_output_file = 9 arg_verbose = 10 arg_count_needed = 11 ### get number of arguments argc = len(sys.argv) ### make sure we have right number of arguments if argc != arg_count_needed: gp.AddMessage("Error. Wrong number of arguments. Got " + str(argc) + " expected " + str(arg_count_needed)) sys.exit(1) ### report arguments (for debug) #gp.AddMessage("Arguments:") #for i in range(0, argc): # gp.AddMessage("[" + str(i) + "]" + sys.argv[i]) ### get selected arguments empty_temp_dir = sys.argv[arg_empty_temp_dir] ### get the path to LAStools lastools_path = os.path.dirname(os.path.dirname(os.path.dirname(sys.argv[0]))) ### make sure the path does not contain spaces if lastools_path.count(" ") > 0: gp.AddMessage("Error. Path to .\\lastools installation contains spaces.") gp.AddMessage("This does not work: " + lastools_path) gp.AddMessage("This would work: C:\\software\\lastools") sys.exit(1) ### make sure the path does not contain open or closing brackets if (lastools_path.count("(") > 0) or (lastools_path.count(")") > 0): gp.AddMessage("Error. Path to .\\lastools installation contains brackets.") gp.AddMessage("This does not work: " + lastools_path) gp.AddMessage("This would work: C:\\software\\lastools") sys.exit(1) ### complete the path to where the LAStools executables are lastools_path = lastools_path + "\\bin" ### check if path exists if os.path.exists(lastools_path) == False: gp.AddMessage("Cannot find .\\lastools\\bin at " + lastools_path) sys.exit(1) else: gp.AddMessage("Found " + lastools_path + " ...") ### create the full path to the lastile executable lastile_path = lastools_path+"\\lastile.exe" ### check if the lastile executable exists if os.path.exists(lastile_path) == False: gp.AddMessage("Cannot find lastile.exe at " + lastile_path) sys.exit(1) else: gp.AddMessage("Found " + lastile_path + " ...") ### create the full path to the lasground executable lasground_path = lastools_path+"\\lasground.exe" ### check if the lasground executable exists if os.path.exists(lasground_path) == False: gp.AddMessage("Cannot find lasground.exe at " + lasground_path) sys.exit(1) else: gp.AddMessage("Found " + lasground_path + " ...") ### create the full path to the lasheight executable lasheight_path = lastools_path+"\\lasheight.exe" ### check if the lasheight executable exists if os.path.exists(lasheight_path) == False: gp.AddMessage("Cannot find lasheight.exe at " + lasheight_path) sys.exit(1) else: gp.AddMessage("Found " + lasheight_path + " ...") ### create the full path to the lasheight executable lasthin_path = lastools_path+"\\lasthin.exe" ### check if the lasthin executable exists if os.path.exists(lasthin_path) == False: gp.AddMessage("Cannot find lasthin.exe at " + lasthin_path) sys.exit(1) else: gp.AddMessage("Found " + lasthin_path + " ...") ### create the full path to the las2dem executable las2dem_path = lastools_path+"\\las2dem.exe" ### check if the las2dem executable exists if os.path.exists(las2dem_path) == False: gp.AddMessage("Cannot find las2dem.exe at " + las2dem_path) sys.exit(1) else: gp.AddMessage("Found " + las2dem_path + " ...") ### create the full path to the lasgrid executable lasgrid_path = lastools_path+"\\lasgrid.exe" ### check if the lasgrid executable exists if os.path.exists(lasgrid_path) == False: gp.AddMessage("Cannot find lasgrid.exe at " + lasgrid_path) sys.exit(1) else: gp.AddMessage("Found " + lasgrid_path + " ...") ### check if the empty temp directory exists if os.path.exists(empty_temp_dir) == False: gp.AddMessage("Cannot find empty temp dir " + empty_temp_dir) sys.exit(1) else: gp.AddMessage("Found " + empty_temp_dir + " ...") ### make sure the empty temp directory is emtpy if os.listdir(empty_temp_dir) != []: gp.AddMessage("Empty temp directory '" + empty_temp_dir + "' is not empty") sys.exit(1) else: gp.AddMessage("And it's empty ...") ################################################### ### first step: tile folder of input files ################################################### ### create the command string for lastile.exe command = ['"'+lastile_path+'"'] ### maybe use '-verbose' option if sys.argv[arg_verbose] == "true": command.append("-v") ### add input LiDAR command.append("-i") command.append('"'+sys.argv[arg_input_folder]+'\\*.las"') command.append("-i") command.append('"'+sys.argv[arg_input_folder]+'\\*.laz"') ### maybe use a user-defined tile size if sys.argv[arg_tile_size] != "1000": command.append("-tile_size") command.append(sys.argv[arg_tile_size].replace(",",".")) ### maybe create a buffer around the tiles if sys.argv[arg_buffer] != "0": command.append("-buffer") command.append(sys.argv[arg_buffer].replace(",",".")) ### an empty temp directory must have been selected if empty_temp_dir != "#": command.append("-odir") command.append('"'+empty_temp_dir+'"') else: gp.AddMessage("Error. no empty temp directory was specified.") sys.exit(1) ### give tiles a simple name command.append("-o") command.append("pit_free_temp_tile.laz") ### store temporary tiles in compressed format command.append("-olaz") ### report command string gp.AddMessage("LAStools command line:") command_length = len(command) command_string = str(command[0]) command[0] = command[0].strip('"') for i in range(1, command_length): command_string = command_string + " " + str(command[i]) command[i] = command[i].strip('"') gp.AddMessage(command_string) ### run command returncode,output = check_output(command, False) ### report output of lastile gp.AddMessage(str(output)) ### check return code if returncode != 0: gp.AddMessage("Error. flightlines_to_single_CHM_pit_free failed in lastile step.") sys.exit(1) ### report success gp.AddMessage("lastile step done.") ################################################### ### second step: ground classify each tile ################################################### ### create the command string for lasground.exe command = ['"'+lasground_path+'"'] ### maybe use '-verbose' option if sys.argv[arg_verbose] == "true": command.append("-v") ### add input LiDAR command.append("-i") command.append('"'+empty_temp_dir+"\\pit_free_temp_tile*.laz"+'"') ### what type of terrain do we have if sys.argv[arg_terrain_type] == "wilderness": command.append("-wilderness") elif sys.argv[arg_terrain_type] == "city or warehouses": command.append("-city") command.append("-extra_fine") elif sys.argv[arg_terrain_type] == "towns or flats": command.append("-town") command.append("-fine") elif sys.argv[arg_terrain_type] == "metropolis": command.append("-metro") command.append("-ultra_fine") ### give ground-classified tiles a meaningful appendix command.append("-odix") command.append("_g") ### store ground-classified tiles in compressed format command.append("-olaz") ### maybe we should run on multiple cores if sys.argv[arg_cores] != "1": command.append("-cores") command.append(sys.argv[arg_cores]) ### report command string gp.AddMessage("LAStools command line:") command_length = len(command) command_string = str(command[0]) command[0] = command[0].strip('"') for i in range(1, command_length): command_string = command_string + " " + str(command[i]) command[i] = command[i].strip('"') gp.AddMessage(command_string) ### run command returncode,output = check_output(command, False) ### report output of lasground gp.AddMessage(str(output)) ### check return code if returncode != 0: gp.AddMessage("Error. flightlines_to_single_CHM_pit_free failed in lasground step.") sys.exit(1) ### report success gp.AddMessage("lasground step done.") ################################################### ### third step: height-normalize each tile ################################################### ### create the command string for lasheight.exe command = ['"'+lasheight_path+'"'] ### maybe use '-verbose' option if sys.argv[arg_verbose] == "true": command.append("-v") ### add input LiDAR command.append("-i") command.append('"'+empty_temp_dir+"\\pit_free_temp_tile*_g.laz"+'"') ### height normalize command.append("-replace_z") ### give height-classified tiles a meaningful appendix command.append("-odix") command.append("h") ### store height-classified tiles in compressed format command.append("-olaz") ### maybe we should run on multiple cores if sys.argv[arg_cores] != "1": command.append("-cores") command.append(sys.argv[arg_cores]) ### report command string gp.AddMessage("LAStools command line:") command_length = len(command) command_string = str(command[0]) command[0] = command[0].strip('"') for i in range(1, command_length): command_string = command_string + " " + str(command[i]) command[i] = command[i].strip('"') gp.AddMessage(command_string) ### run command returncode,output = check_output(command, False) ### report output of lasheight gp.AddMessage(str(output)) ### check return code if returncode != 0: gp.AddMessage("Error. flightlines_to_single_CHM_pit_free failed in lasheight step.") sys.exit(1) ### report success gp.AddMessage("lasheight step done.") ################################################### ### fourth step: splat and thin-highest each tile ################################################### ### create the command string for lasheight.exe command = ['"'+lasthin_path+'"'] ### maybe use '-verbose' option if sys.argv[arg_verbose] == "true": command.append("-v") ### add input LiDAR command.append("-i") command.append('"'+empty_temp_dir+"\\pit_free_temp_tile*_gh.laz"+'"') ### keep the highest command.append("-highest") ### on a grid with two by two times the final step size command.append("-step") command.append(str(0.5*float(sys.argv[arg_step].replace(",",".")))) ### maybe splat with half the laser beam width if sys.argv[arg_beam_width] != "#": command.append("-subcircle") command.append(str(0.5*float(sys.argv[arg_beam_width].replace(",",".")))) ### give thin-classified tiles a meaningful appendix command.append("-odix") command.append("t") ### store thin-classified tiles in compressed format command.append("-olaz") ### maybe we should run on multiple cores if sys.argv[arg_cores] != "1": command.append("-cores") command.append(sys.argv[arg_cores]) ### report command string gp.AddMessage("LAStools command line:") command_length = len(command) command_string = str(command[0]) command[0] = command[0].strip('"') for i in range(1, command_length): command_string = command_string + " " + str(command[i]) command[i] = command[i].strip('"') gp.AddMessage(command_string) ### run command returncode,output = check_output(command, False) ### report output of lasthin gp.AddMessage(str(output)) ### check return code if returncode != 0: gp.AddMessage("Error. flightlines_to_single_CHM_pit_free failed in lasthin step.") sys.exit(1) ### report success gp.AddMessage("lasthin step done.") ################################################### ### fifth step: raster all partial CHMs ################################################### ### at level 00 ################################################### ### create the command string for las2dem.exe command = ['"'+las2dem_path+'"'] ### maybe use '-verbose' option if sys.argv[arg_verbose] == "true": command.append("-v") ### add input LiDAR command.append("-i") command.append('"'+empty_temp_dir+"\\pit_free_temp_tile*_ght.laz"+'"') ### raster tile with requested step command.append("-step") command.append(sys.argv[arg_step]) ### raster only tile interiors command.append("-use_tile_bb") ### store rastered tiles in temporary directory command.append("-odir") command.append(empty_temp_dir) ### give the tiles a meaningful appendix command.append("-ocut") command.append("4") command.append("-odix") command.append("_chm00") ### store rastered tiles in BIL format command.append("-obil") ### maybe we should run on multiple cores if sys.argv[arg_cores] != "1": command.append("-cores") command.append(sys.argv[arg_cores]) ### report command string gp.AddMessage("LAStools command line:") command_length = len(command) command_string = str(command[0]) command[0] = command[0].strip('"') for i in range(1, command_length): command_string = command_string + " " + str(command[i]) command[i] = command[i].strip('"') gp.AddMessage(command_string) ### run command returncode,output = check_output(command, False) ### report output of las2dem gp.AddMessage(str(output)) ### check return code if returncode != 0: gp.AddMessage("Error. flightlines_to_single_CHM_pit_free failed in las2dem (CHM00) step.") sys.exit(1) ### report success gp.AddMessage("las2dem (CHM00) step done.") ################################################### ### fifth step: raster all partial CHMs ################################################### ### at level 02 ################################################### ### create the command string for las2dem.exe command = ['"'+las2dem_path+'"'] ### maybe use '-verbose' option if sys.argv[arg_verbose] == "true": command.append("-v") ### add input LiDAR command.append("-i") command.append('"'+empty_temp_dir+"\\pit_free_temp_tile*_ght.laz"+'"') ### remove all points below 2 meters command.append("-drop_z_below") command.append("2") ### raster tile with requested step command.append("-step") command.append(sys.argv[arg_step].replace(",",".")) ### kill triangles that are three times the requested step (or bigger) command.append("-kill") command.append(str(3.0*float(sys.argv[arg_step].replace(",",".")))) ### raster only tile interiors command.append("-use_tile_bb") ### store rastered tiles in temporary directory command.append("-odir") command.append(empty_temp_dir) ### give the tiles a meaningful appendix command.append("-ocut") command.append("4") command.append("-odix") command.append("_chm02") ### store rastered tiles in BIL format command.append("-obil") ### maybe we should run on multiple cores if sys.argv[arg_cores] != "1": command.append("-cores") command.append(sys.argv[arg_cores]) ### report command string gp.AddMessage("LAStools command line:") command_length = len(command) command_string = str(command[0]) command[0] = command[0].strip('"') for i in range(1, command_length): command_string = command_string + " " + str(command[i]) command[i] = command[i].strip('"') gp.AddMessage(command_string) ### run command returncode,output = check_output(command, False) ### report output of las2dem gp.AddMessage(str(output)) ### check return code if returncode != 0: gp.AddMessage("Error. flightlines_to_single_CHM_pit_free failed in las2dem (CHM02) step.") sys.exit(1) ### report success gp.AddMessage("las2dem (CHM02) step done.") ################################################### ### fifth step: raster all partial CHMs ################################################### ### at level 05 ################################################### ### create the command string for las2dem.exe command = ['"'+las2dem_path+'"'] ### maybe use '-verbose' option if sys.argv[arg_verbose] == "true": command.append("-v") ### add input LiDAR command.append("-i") command.append('"'+empty_temp_dir+"\\pit_free_temp_tile*_ght.laz"+'"') ### remove all points below 5 meters command.append("-drop_z_below") command.append("5") ### raster tile with requested step command.append("-step") command.append(sys.argv[arg_step].replace(",",".")) ### kill triangles that are three times the requested step (or bigger) command.append("-kill") command.append(str(3.0*float(sys.argv[arg_step].replace(",",".")))) ### raster only tile interiors command.append("-use_tile_bb") ### store rastered tiles in temporary directory command.append("-odir") command.append(empty_temp_dir) ### give the tiles a meaningful appendix command.append("-ocut") command.append("4") command.append("-odix") command.append("_chm05") ### store rastered tiles in BIL format command.append("-obil") ### maybe we should run on multiple cores if sys.argv[arg_cores] != "1": command.append("-cores") command.append(sys.argv[arg_cores]) ### report command string gp.AddMessage("LAStools command line:") command_length = len(command) command_string = str(command[0]) command[0] = command[0].strip('"') for i in range(1, command_length): command_string = command_string + " " + str(command[i]) command[i] = command[i].strip('"') gp.AddMessage(command_string) ### run command returncode,output = check_output(command, False) ### report output of las2dem gp.AddMessage(str(output)) ### check return code if returncode != 0: gp.AddMessage("Error. flightlines_to_single_CHM_pit_free failed in las2dem (CHM05) step.") sys.exit(1) ### report success gp.AddMessage("las2dem (CHM05) step done.") ################################################### ### fifth step: raster all partial CHMs ################################################### ### at level 10 ################################################### ### create the command string for las2dem.exe command = ['"'+las2dem_path+'"'] ### maybe use '-verbose' option if sys.argv[arg_verbose] == "true": command.append("-v") ### add input LiDAR command.append("-i") command.append('"'+empty_temp_dir+"\\pit_free_temp_tile*_ght.laz"+'"') ### remove all points below 10 meters command.append("-drop_z_below") command.append("10") ### raster tile with requested step command.append("-step") command.append(sys.argv[arg_step].replace(",",".")) ### kill triangles that are three times the requested step (or bigger) command.append("-kill") command.append(str(3.0*float(sys.argv[arg_step].replace(",",".")))) ### raster only tile interiors command.append("-use_tile_bb") ### store rastered tiles in temporary directory command.append("-odir") command.append(empty_temp_dir) ### give the tiles a meaningful appendix command.append("-ocut") command.append("4") command.append("-odix") command.append("_chm10") ### store rastered tiles in BIL format command.append("-obil") ### maybe we should run on multiple cores if sys.argv[arg_cores] != "1": command.append("-cores") command.append(sys.argv[arg_cores]) ### report command string gp.AddMessage("LAStools command line:") command_length = len(command) command_string = str(command[0]) command[0] = command[0].strip('"') for i in range(1, command_length): command_string = command_string + " " + str(command[i]) command[i] = command[i].strip('"') gp.AddMessage(command_string) ### run command returncode,output = check_output(command, False) ### report output of las2dem gp.AddMessage(str(output)) ### check return code if returncode != 0: gp.AddMessage("Error. flightlines_to_single_CHM_pit_free failed in las2dem (CHM10) step.") sys.exit(1) ### report success gp.AddMessage("las2dem (CHM10) step done.") ################################################### ### fifth step: raster all partial CHMs ################################################### ### at level 15 ################################################### ### create the command string for las2dem.exe command = ['"'+las2dem_path+'"'] ### maybe use '-verbose' option if sys.argv[arg_verbose] == "true": command.append("-v") ### add input LiDAR command.append("-i") command.append('"'+empty_temp_dir+"\\pit_free_temp_tile*_ght.laz"+'"') ### remove all points below 15 meters command.append("-drop_z_below") command.append("15") ### raster tile with requested step command.append("-step") command.append(sys.argv[arg_step].replace(",",".")) ### kill triangles that are three times the requested step (or bigger) command.append("-kill") command.append(str(3.0*float(sys.argv[arg_step].replace(",",".")))) ### raster only tile interiors command.append("-use_tile_bb") ### store rastered tiles in temporary directory command.append("-odir") command.append(empty_temp_dir) ### give the tiles a meaningful appendix command.append("-ocut") command.append("4") command.append("-odix") command.append("_chm15") ### store rastered tiles in BIL format command.append("-obil") ### maybe we should run on multiple cores if sys.argv[arg_cores] != "1": command.append("-cores") command.append(sys.argv[arg_cores]) ### report command string gp.AddMessage("LAStools command line:") command_length = len(command) command_string = str(command[0]) command[0] = command[0].strip('"') for i in range(1, command_length): command_string = command_string + " " + str(command[i]) command[i] = command[i].strip('"') gp.AddMessage(command_string) ### run command returncode,output = check_output(command, False) ### report output of las2dem gp.AddMessage(str(output)) ### check return code if returncode != 0: gp.AddMessage("Error. flightlines_to_single_CHM_pit_free failed in las2dem (CHM15) step.") sys.exit(1) ### report success gp.AddMessage("las2dem (CHM15) step done.") ################################################### ### fifth step: raster all partial CHMs ################################################### ### at level 20 ################################################### ### create the command string for las2dem.exe command = ['"'+las2dem_path+'"'] ### maybe use '-verbose' option if sys.argv[arg_verbose] == "true": command.append("-v") ### add input LiDAR command.append("-i") command.append('"'+empty_temp_dir+"\\pit_free_temp_tile*_ght.laz"+'"') ### remove all points below 20 meters command.append("-drop_z_below") command.append("20") ### raster tile with requested step command.append("-step") command.append(sys.argv[arg_step].replace(",",".")) ### kill triangles that are three times the requested step (or bigger) command.append("-kill") command.append(str(3.0*float(sys.argv[arg_step].replace(",",".")))) ### raster only tile interiors command.append("-use_tile_bb") ### store rastered tiles in temporary directory command.append("-odir") command.append(empty_temp_dir) ### give the tiles a meaningful appendix command.append("-ocut") command.append("4") command.append("-odix") command.append("_chm20") ### store rastered tiles in BIL format command.append("-obil") ### maybe we should run on multiple cores if sys.argv[arg_cores] != "1": command.append("-cores") command.append(sys.argv[arg_cores]) ### report command string gp.AddMessage("LAStools command line:") command_length = len(command) command_string = str(command[0]) command[0] = command[0].strip('"') for i in range(1, command_length): command_string = command_string + " " + str(command[i]) command[i] = command[i].strip('"') gp.AddMessage(command_string) ### run command returncode,output = check_output(command, False) ### report output of las2dem gp.AddMessage(str(output)) ### check return code if returncode != 0: gp.AddMessage("Error. flightlines_to_single_CHM_pit_free failed in las2dem (CHM20) step.") sys.exit(1) ### report success gp.AddMessage("las2dem (CHM20) step done.") ################################################### ### sixth step: merge highest rasters to final CHM ################################################### ### create the command string for lasgrid.exe command = ['"'+lasgrid_path+'"'] ### maybe use '-verbose' option if sys.argv[arg_verbose] == "true": command.append("-v") ### add input LiDAR command.append("-i") command.append('"'+empty_temp_dir+"\\pit_free_temp_tile*.bil"+'"') ### merge all files command.append("-merged") ### keep the highest command.append("-highest") ### raster tile with requested step command.append("-step") command.append(sys.argv[arg_step].replace(",",".")) ### store rastered tiles in output file command.append("-o") command.append(sys.argv[arg_output_file]) ### report command string gp.AddMessage("LAStools command line:") command_length = len(command) command_string = str(command[0]) command[0] = command[0].strip('"') for i in range(1, command_length): command_string = command_string + " " + str(command[i]) command[i] = command[i].strip('"') gp.AddMessage(command_string) ### run command returncode,output = check_output(command, False) ### report output of lasgrid gp.AddMessage(str(output)) ### check return code if returncode != 0: gp.AddMessage("Error. flightlines_to_single_CHM_pit_free failed in lasgrid step.") sys.exit(1) ### report success gp.AddMessage("lasgrid step done.") ################################################### ### final step: clean-up all temporary files ################################################### ### create the command string for clean-up command = ["del"] ### add temporary files wildcard command.append('"'+empty_temp_dir+"\\pit_free_temp_tile*.*"+'"') ### report command string gp.AddMessage("clean-up command line:") command_length = len(command) command_string = str(command[0]) command[0] = command[0].strip('"') for i in range(1, command_length): command_string = command_string + " " + str(command[i]) command[i] = command[i].strip('"') gp.AddMessage(command_string) ### run command returncode,output = check_output(command, False) ### report output of clean-up gp.AddMessage(str(output)) ### check return code if returncode != 0: gp.AddMessage("Error. flightlines_to_single_CHM_pit_free failed in clean-up step.") sys.exit(1) ### report success gp.AddMessage("clean-up step done.") ### report happy end gp.AddMessage("Success. flightlines_to_single_CHM_pit_free done.")
# Accelerator for pip, the Python package manager. # # Authors: # - Adam Feuer <adam@adamfeuer.com> # - Peter Odding <peter.odding@paylogic.com> # Last Change: March 4, 2016 # URL: https://github.com/paylogic/pip-accel # # A word of warning: Do *not* use the cached_property decorator here, because # it interacts badly with the metaclass magic performed by the base class. I # wasted about an hour trying to get it to work but it became more and more # apparent that it was never going to work the way I wanted it to :-) """ Amazon S3 cache backend. This module implements a cache backend that stores distribution archives in a user defined `Amazon S3 <http://aws.amazon.com/s3/>`_ bucket. To enable this backend you need to define the configuration option :attr:`~.Config.s3_cache_bucket` and configure your Amazon S3 API credentials (see the readme for details). Using S3 compatible storage services ------------------------------------ The Amazon S3 API has been implemented in several open source projects and dozens of online services. To use pip-accel with an S3 compatible storage service you can override the :attr:`~.Config.s3_cache_url` option. The pip-accel test suite actually uses this option to test the S3 cache backend by running FakeS3_ in the background and pointing pip-accel at the FakeS3 server. Below are some usage notes that may be relevant for people evaluating this option. **Secure connections** Boto_ has to be told whether to make a "secure" connection to the S3 API and pip-accel assumes the ``https://`` URL scheme implies a secure connection while the ``http://`` URL scheme implies a non-secure connection. **Calling formats** Boto_ has the concept of "calling formats" for the S3 API and to connect to the official Amazon S3 API pip-accel needs to specify the "sub-domain calling format" or the API calls will fail. When you specify a nonstandard S3 API URL pip-accel tells Boto to use the "ordinary calling format" instead. This differentiation will undoubtedly not be correct in all cases. If this is bothering you then feel free to open an issue on GitHub to make pip-accel more flexible in this regard. **Credentials** If you don't specify S3 API credentials and the connection attempt to S3 fails with "NoAuthHandlerFound: No handler was ready to authenticate" pip-accel will fall back to an anonymous connection attempt. If that fails as well the S3 cache backend is disabled. It may be useful to note here that the pip-accel test suite uses FakeS3_ and the anonymous connection fall back works fine. A note about robustness ----------------------- The Amazon S3 cache backend implemented in :mod:`pip_accel.caches.s3` is specifically written to gracefully disable itself when it encounters known errors such as: - The configuration option :attr:`~.Config.s3_cache_bucket` is not set (i.e. the user hasn't configured the backend yet). - The :mod:`boto` package is not installed (i.e. the user ran ``pip install pip-accel`` instead of ``pip install 'pip-accel[s3]'``). - The connection to the S3 API can't be established (e.g. because API credentials haven't been correctly configured). - The connection to the configured S3 bucket can't be established (e.g. because the bucket doesn't exist or the configured credentials don't provide access to the bucket). Additionally :class:`~pip_accel.caches.CacheManager` automatically disables cache backends that raise exceptions on :class:`~pip_accel.caches.AbstractCacheBackend.get()` and :class:`~pip_accel.caches.AbstractCacheBackend.put()` operations. The end result is that when the S3 backend fails you will just revert to using the cache on the local file system. Optionally if you are using read only credentials you can disable :class:`~S3CacheBackend.put()` operations by setting the configuration option :attr:`~.Config.s3_cache_readonly`. ---- .. _FakeS3: https://github.com/jubos/fake-s3 .. _Boto: https://github.com/boto/boto """ # Standard library modules. import logging import os # External dependencies. from humanfriendly import coerce_boolean, Timer # Modules included in our package. from pip_accel import PatchedAttribute from pip_accel.caches import AbstractCacheBackend from pip_accel.compat import PY3, urlparse from pip_accel.exceptions import CacheBackendDisabledError, CacheBackendError from pip_accel.utils import AtomicReplace, makedirs # Initialize a logger for this module. logger = logging.getLogger(__name__) # The name of the boto.config configuration section that controls general # settings like the number of retries and the HTTP socket timeout. BOTO_CONFIG_SECTION = 'Boto' # The name of the boto.config option that controls the number of retries. BOTO_CONFIG_NUM_RETRIES_OPTION = 'num_retries' # The name of the boto.config option that controls the HTTP socket timeout. BOTO_CONFIG_SOCKET_TIMEOUT_OPTION = 'http_socket_timeout' # The `coloredlogs' package installs a logging handler on the root logger which # means all loggers automatically write their log messages to the standard # error stream. In the case of Boto this is a bit confusing because Boto logs # messages with the ERROR severity even when nothing is wrong, because it # tries to connect to the Amazon EC2 metadata service which is (obviously) not # available outside of Amazon EC2: # # boto[6851] DEBUG Retrieving credentials from metadata server. # boto[6851] ERROR Caught exception reading instance data # # To avoid confusing users of pip-accel (i.e. this is not an error because it's # properly handled) we silence the Boto logger. To avoid annoying people who # actually want to debug Boto we'll also provide an escape hatch in the form of # an environment variable. if coerce_boolean(os.environ.get('PIP_ACCEL_SILENCE_BOTO', 'true')): logging.getLogger('boto').setLevel(logging.FATAL) class S3CacheBackend(AbstractCacheBackend): """The S3 cache backend stores distribution archives in a user defined Amazon S3 bucket.""" PRIORITY = 20 def get(self, filename): """ Download a distribution archive from the configured Amazon S3 bucket. :param filename: The filename of the distribution archive (a string). :returns: The pathname of a distribution archive on the local file system or :data:`None`. :raises: :exc:`.CacheBackendError` when any underlying method fails. """ timer = Timer() self.check_prerequisites() with PatchedBotoConfig(): # Check if the distribution archive is available. raw_key = self.get_cache_key(filename) logger.info("Checking if distribution archive is available in S3 bucket: %s", raw_key) key = self.s3_bucket.get_key(raw_key) if key is None: logger.debug("Distribution archive is not available in S3 bucket.") else: # Download the distribution archive to the local binary index. # TODO Shouldn't this use LocalCacheBackend.put() instead of # implementing the same steps manually?! logger.info("Downloading distribution archive from S3 bucket ..") file_in_cache = os.path.join(self.config.binary_cache, filename) makedirs(os.path.dirname(file_in_cache)) with AtomicReplace(file_in_cache) as temporary_file: key.get_contents_to_filename(temporary_file) logger.debug("Finished downloading distribution archive from S3 bucket in %s.", timer) return file_in_cache def put(self, filename, handle): """ Upload a distribution archive to the configured Amazon S3 bucket. If the :attr:`~.Config.s3_cache_readonly` configuration option is enabled this method does nothing. :param filename: The filename of the distribution archive (a string). :param handle: A file-like object that provides access to the distribution archive. :raises: :exc:`.CacheBackendError` when any underlying method fails. """ if self.config.s3_cache_readonly: logger.info('Skipping upload to S3 bucket (using S3 in read only mode).') else: timer = Timer() self.check_prerequisites() with PatchedBotoConfig(): from boto.s3.key import Key raw_key = self.get_cache_key(filename) logger.info("Uploading distribution archive to S3 bucket: %s", raw_key) key = Key(self.s3_bucket) key.key = raw_key try: key.set_contents_from_file(handle) except Exception as e: logger.info("Encountered error writing to S3 bucket, " "falling back to read only mode (exception: %s)", e) self.config.s3_cache_readonly = True else: logger.info("Finished uploading distribution archive to S3 bucket in %s.", timer) @property def s3_bucket(self): """ Connect to the user defined Amazon S3 bucket. Called on demand by :func:`get()` and :func:`put()`. Caches its return value so that only a single connection is created. :returns: A :class:`boto.s3.bucket.Bucket` object. :raises: :exc:`.CacheBackendDisabledError` when the user hasn't defined :attr:`.Config.s3_cache_bucket`. :raises: :exc:`.CacheBackendError` when the connection to the Amazon S3 bucket fails. """ if not hasattr(self, 'cached_bucket'): self.check_prerequisites() with PatchedBotoConfig(): from boto.exception import BotoClientError, BotoServerError, S3ResponseError # The following try/except block translates unexpected exceptions # raised by Boto into a CacheBackendError exception. try: # The following try/except block handles the expected exception # raised by Boto when an Amazon S3 bucket does not exist. try: logger.debug("Connecting to Amazon S3 bucket: %s", self.config.s3_cache_bucket) self.cached_bucket = self.s3_connection.get_bucket(self.config.s3_cache_bucket) except S3ResponseError as e: if e.status == 404 and self.config.s3_cache_create_bucket: logger.info("Amazon S3 bucket doesn't exist yet, creating it now: %s", self.config.s3_cache_bucket) self.s3_connection.create_bucket(self.config.s3_cache_bucket) self.cached_bucket = self.s3_connection.get_bucket(self.config.s3_cache_bucket) else: # Don't swallow exceptions we can't handle. raise except (BotoClientError, BotoServerError): raise CacheBackendError(""" Failed to connect to the configured Amazon S3 bucket {bucket}! Are you sure the bucket exists and is accessible using the provided credentials? The Amazon S3 cache backend will be disabled for now. """, bucket=repr(self.config.s3_cache_bucket)) return self.cached_bucket @property def s3_connection(self): """ Connect to the Amazon S3 API. If the connection attempt fails because Boto can't find credentials the attempt is retried once with an anonymous connection. Called on demand by :attr:`s3_bucket`. :returns: A :class:`boto.s3.connection.S3Connection` object. :raises: :exc:`.CacheBackendError` when the connection to the Amazon S3 API fails. """ if not hasattr(self, 'cached_connection'): self.check_prerequisites() with PatchedBotoConfig(): import boto from boto.exception import BotoClientError, BotoServerError, NoAuthHandlerFound from boto.s3.connection import S3Connection, SubdomainCallingFormat, OrdinaryCallingFormat try: # Configure the number of retries and the socket timeout used # by Boto. Based on the snippet given in the following email: # https://groups.google.com/d/msg/boto-users/0osmP0cUl5Y/X4NdlMGWKiEJ if not boto.config.has_section(BOTO_CONFIG_SECTION): boto.config.add_section(BOTO_CONFIG_SECTION) boto.config.set(BOTO_CONFIG_SECTION, BOTO_CONFIG_NUM_RETRIES_OPTION, str(self.config.s3_cache_retries)) boto.config.set(BOTO_CONFIG_SECTION, BOTO_CONFIG_SOCKET_TIMEOUT_OPTION, str(self.config.s3_cache_timeout)) logger.debug("Connecting to Amazon S3 API ..") endpoint = urlparse(self.config.s3_cache_url) host, _, port = endpoint.netloc.partition(':') kw = dict( host=host, port=int(port) if port else None, is_secure=(endpoint.scheme == 'https'), calling_format=(SubdomainCallingFormat() if host == S3Connection.DefaultHost else OrdinaryCallingFormat()), ) try: self.cached_connection = S3Connection(**kw) except NoAuthHandlerFound: logger.debug("Amazon S3 API credentials missing, retrying with anonymous connection ..") self.cached_connection = S3Connection(anon=True, **kw) except (BotoClientError, BotoServerError): raise CacheBackendError(""" Failed to connect to the Amazon S3 API! Most likely your credentials are not correctly configured. The Amazon S3 cache backend will be disabled for now. """) return self.cached_connection def get_cache_key(self, filename): """ Compose an S3 cache key based on :attr:`.Config.s3_cache_prefix` and the given filename. :param filename: The filename of the distribution archive (a string). :returns: The cache key for the given filename (a string). """ return '/'.join(filter(None, [self.config.s3_cache_prefix, filename])) def check_prerequisites(self): """ Validate the prerequisites required to use the Amazon S3 cache backend. Makes sure the Amazon S3 cache backend is configured (:attr:`.Config.s3_cache_bucket` is defined by the user) and :mod:`boto` is available for use. :raises: :exc:`.CacheBackendDisabledError` when a prerequisite fails. """ if not self.config.s3_cache_bucket: raise CacheBackendDisabledError(""" To use Amazon S3 as a cache you have to set the environment variable $PIP_ACCEL_S3_BUCKET and configure your Amazon S3 API credentials (see the documentation for details). """) try: __import__('boto') except ImportError: raise CacheBackendDisabledError(""" Boto is required to use Amazon S3 as a cache but it looks like Boto is not installed! You can resolve this issue by installing pip-accel using the command `pip install pip-accel[s3]'. The Amazon S3 cache backend will be disabled for now. """) class PatchedBotoConfig(PatchedAttribute): """ Monkey patch for Boto's configuration handling. Boto's configuration handling is kind of broken on Python 3 `as documented here <https://github.com/boto/boto/issues/2617>`_. The :class:`PatchedBotoConfig` class implements a context manager that temporarily patches Boto to work around the bug. Without this monkey patch it is impossible to configure the number of retries on Python 3 which makes the pip-accel test suite horribly slow. """ def __init__(self): """Initialize a :class:`PatchedBotoConfig` object.""" from boto import config from boto.pyami.config import Config, ConfigParser self.instance = config self.unbound_method = ConfigParser.get super(PatchedBotoConfig, self).__init__( object=Config, attribute='get', value=self.get, enabled=PY3, ) def get(self, section, name, default=None, **kw): """Replacement for :func:`boto.pyami.config.Config.get()`.""" try: return self.unbound_method(self.instance, section, name, **kw) except Exception: return default
# Copyright (c) 2006-2009 The Trustees of Indiana University. # All rights reserved. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are met: # # - Redistributions of source code must retain the above copyright notice, this # list of conditions and the following disclaimer. # # - Redistributions in binary form must reproduce the above copyright notice, # this list of conditions and the following disclaimer in the documentation # and/or other materials provided with the distribution. # # - Neither the Indiana University nor the names of its contributors may be used # to endorse or promote products derived from this software without specific # prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" # AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE # IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE # DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE LIABLE # FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL # DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR # SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER # CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, # OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE # OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. from corepy.spre.spe import Register, InstructionOperand#, Variable, Label class CALField(InstructionOperand): def __init__(self, name, default = None): InstructionOperand.__init__(self, name, default) return def render(self, value): return value # def __eq__(self, other): # return type(self) == type(other) class CALFlagField(CALField): def __init__(self, name, ilstr, default = None): self.ilstr = ilstr InstructionOperand.__init__(self, name, default) return def check(self, value): return value in (True, False) def render(self, value): if value: return self.ilstr return '' # def __eq__(self, other): # return type(self) == type(other) and self.name == other.name class RegisterField(CALField): def check(self, value): return True def render(self, value): if type(value) == type(Register): return value.render() else: return str(value) class RELOPField(CALField): def check(self, value): return value in ('eq', 'ge', 'gt', 'le', 'lt', 'ne') def render(self, value): return '_relop(' + value + ')' class ZEROOPField(CALField): def check(self, value): return value in ('zero', 'fltmax', 'inf_else_max', 'infinity') def render(self, value): return '_zeroop(' + value + ')' class LOGICOPField(CALField): def check(self, value): return value in ('eq', 'ne') def render(self, value): return '_logicop(' + value + ')' class USAGEField(CALField): def check(self, value): #if value == None: # return True return value in ('backcolor', 'color', 'fog', 'generic', 'pointsize', 'pos', 'wincoord', None) def render(self, value): if value == None: return '' else: return '_usage(' + value + ')' class INTERPField(CALField): def check(self, value): return value in ('constant', 'linear', 'centroid', 'noperspective', 'noper_centroid', 'noper_sample', 'sample', 'notused', 'linear_centroid', 'linear_noperspective', 'linear_noper_centroid', 'linear_noper_sample', 'linear_sample') def render(self, value): if value != 'notused': return '_interp(' + value + ')' else: return '' class SHARINGMODEField(CALField): def check(self, value): return value in ('rel', 'abs', None) def render(self, value): if value == None: return '' else: return '_sharingMode(' + value + ')' class TYPEField(CALField): def check(self, value): return value in (1, 2, 3, '1d', '2d', '2dms_array', '2dmsaa', '3d', 'cubemap', 'cubemaparray', 'unkown', 'buffer') def render(self, value): if type(value)==str: return value else: return str(value) + 'd' # this one is different beccause of UNNORM option - '_type(' and ')' is handled by inst # Furthermore, some instructions handle this differently, such as dclpt which does not # have the unnorm flag class RESOURCEField(CALField): def check(self, value): return isinstance(value, (int, long)) and value >= 0 and value < 256 def render(self, value): return '_resource(' + str(value) + ')' class RESOURCEIDField(CALField): def check(self, value): return isinstance(value, (int, long)) and value >= 0 and value < 256 def render(self, value): return '_id(' + str(value) + ')' class SAMPLERField(CALField): def check(self, value): return isinstance(value, (int, long)) and value >= 0 and value < 16 def render(self, value): return '_sampler(' + str(value) + ')' #class IEEEField(CALFlagField): # def render(self, value): # if value == True: # return '_ieee' # else: # return '' #class UINTField(CALFlagField): # def render(self, value): # if value == True: # return '_uint' # else: # return '' #class REPEATField(CALFlagField): # def render(self, value): # if value == True: # return ' repeat' # else: # return '' #class NEIGHBOREXCHField(CALFlagField): # def render(self, value): # if value == True: # return '_neighborExch' # else: # return '' #class UNNORMField(CALFlagField): # def render(self, value): # if value == True: # return ',unnorm' # else: # return '' #class THREADSField(CALFlagField): # def render(self, value): # if value == True: # return '_threads' # else: # return '' #class LDSField(CALFlagField): # def render(self, value): # if value == True: # return '_lds' # else: # return '' #class MEMORYField(CALFlagField): # def render(self, value): # if value == True: # return '_memory' # else: # return '' #class SRField(CALFlagField): # def render(self, value): # if value == True: # return '_sr' # else: # return '' #class CENTERField(CALFlagField): # def render(self, value): # if value == True: # return '_center' # else: # return '' #class BIASField(CALFlagField): # def render(self, value): # if value == True: # return '_bias' # else: # return '' #class INVERTField(CALFlagField): # def render(self, value): # if value == True: # return '_invert' # else: # return '' #class CENTEREDField(CALFlagField): # def render(self, value): # if value == True: # return '_centered' # else: # return '' class STAGEField(CALField): def check(self, value): if value == None: return True if isinstance(value, (int, long)) and value >= 0 and value < 256: return True return False def render(self, value): if value == None: return '' else: return '_stage(' + value + ')' class LOFFSETField(CALField): def check(self, value): if value == None: return True if value in (0, 4, 8, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, 52, 56, 60): return True return False def render(self, value): if value == None: return '' else: return '_lOffset(' + value + ')' #class SAMPLEField(CALFlagField): # def render(self, value): # if value == True: # return '_sample' # else: # return '' class STREAMField(CALField): def check(self, value): if isinstance(value, (int, long)) and value >= 0 and value < 16: return True return False def render(self, value): return '_exportStream(' + str(value) + ')' class OFFSETField(CALField): def check(self, value): if isinstance(value, (int, long)) and value >= 0 and value < 512: return True return False def render(self, value): return '_elemOffset(' + str(value) + ')' class ELEMField(CALField): def check(self, value): if isinstance(value, (int, long)) and value >= 0 and value < 16: return True return False def render(self, value): return '_elem(' + str(value) + ')' class VELEMField(CALField): def check(self, value): if isinstance(value, (int, long)) and value >= 0 and value < 64: return True return False def render(self, value): return '_elem(' + str(value) + ')' class AOFFIMMIField(CALField): def check(self, value): if value == None or value == (): return True if len(value) != 3: return False p = 2 ** 16 return False not in [isinstance(v, (int, long)) and v >= 0 and v < p for v in value] #try: # valid = True # if len(value) == 3: # if not isinstance(value[0], (int, long)) or value[0] < 0 or value[0] > pow(2, 16): # valid = False # if not isinstance(value[1], (int, long)) or value[1] < 0 or value[1] > pow(2, 16): # valid = False # if not isinstance(value[2], (int, long)) or value[2] < 0 or value[2] > pow(2, 16): # valid = False # return valid # return False #except: # return False def render(self, value): if value == None or value == (): return '' else: return '_aoffimmi(' + str(value[0]) + ',' + str(value[1]) + ',' + str(value[2]) + ')' class FMTField(CALField): def check(self, value): vals = ('float', 'mixed', 'sint', 'snorm', 'srgb', 'uint', 'unkown', 'unorm') if value in vals: return True if len(value) != 4: return False return False not in [v not in vals for v in value] #else: # valid = True # if len(value) == 4: # if not value[0] in vals: # valid = False # if not value[1] in vals: # valid = False # if not value[2] in vals: # valid = False # if not value[3] in vals: # valid = False # return valid # return False def render(self, value): if value == None: return '' else: if type(value) == str: return '_fmtx(' + value + ')_fmty(' + value + ')_fmtz(' + value + ')_fmtw(' + value + ')' else: return '_fmtx(' + value[0] + ')_fmty(' + value[1] + ')_fmtz(' + value[2] + ')_fmtw(' + value[3] + ')' class XYZWDefaultField(CALField): def check(self, value): if len(value) != 4: return False return False not in [v not in (0.0, 1.0, None) for v in value] #valid = True #if not(value[0] == 0.0 or value[0] == 1.0 or value[0] == None): # valid = False #if not(value[1] == 0.0 or value[1] == 1.0 or value[1] == None): # valid = False #if not(value[2] == 0.0 or value[2] == 1.0 or value[2] == None): # valid = False #if not(value[3] == 0.0 or value[3] == 1.0 or value[3] == None): # valid = False #return valid def render(self, value): strvalue = ['' for i in range(4)] for i, val in enumerate(value): if val == None: strvalue[i] = '*' else: strvalue[i] = str(val) return '_x(' + strvalue[0] + ')_y(' + strvalue[1] + ')_z(' + strvalue[2] + ')_w(' + strvalue[3] + ')' class XYZWImportField(CALField): def check(self, value): valid = True if len(value) != 4: return False #return False not in [v not in ('0', '1', '*', '-', None) for v in value] if not(value[0] == '0' or value[0] == '1' or value[0] == '*' or value[0] == '-' or value[0] == None): valid = False if not(value[1] == '0' or value[1] == '1' or value[1] == '*' or value[1] == '-' or value[1] == None): valid = False if not(value[2] == '0' or value[2] == '1' or value[2] == '*' or value[2] == '-' or value[2] == None): valid = False if not(value[3] == '0' or value[3] == '1' or value[3] == '*' or value[3] == '-' or value[3] == None): valid = False return valid def render(self, value): strvalue = ['' for i in range(4)] for i, val in enumerate(value): if val == None: strvalue[i] = '*' else: strvalue[i] = str(val) return '_x(' + strvalue[0] + ')_y(' + strvalue[1] + ')_z(' + strvalue[2] + ')_w(' + strvalue[3] + ')' class TOPOLOGYField(CALField): def check(self, value): return value in ('line', 'line_adj', 'point', 'triangle', 'triangle_adj') def render(self, value): return str(value) class OUTPUTTOPOLOGYField(CALField): def check(self, value): return value in ('linestrip', 'pointlist', 'trianglestrip') def render(self, value): return str(value) class LiteralField(CALField): def check(self, value): return isinstance(value, (int, long, float)) def render(self, value): return str(value) class IntegerLiteralField(CALField): def check(self, value): return isinstance(value, (int, long)) def render(self, value): return str(value) class IntegerLabelField(IntegerLiteralField): def check(self, value): return isinstance(value, (int, long)) and value >= 0 def render(self, value): return str(value) class SHIFTField(CALField): def check(self, value): return value in ('', 'x2', 'x4', 'x8', 'd2', 'd4', 'd8') def render(self, value): if value != '': return '_' + value else: return '' #class SATField(CALFlagField): # def render(self, value): # if value == True: # return '_sat' # else: # return '' class MATRIXField(CALField): def check(self, value): return value in ('3x2', '3x3', '3x4', '4x3', '4x4') def render(self, value): return '_matrix(' + value + ')' class USAGEINDEXField(CALField): def check(self, value): return isinstance(value, (int, long)) and value >= 0 and value < 256 def render(self, value): return '_usageIndex(' + str(value) + ')' class PARAMField(CALField): def check(self, value): return isinstance(value, (int, long)) and value >= 0 and value < 256 def render(self, value): return '_param(' + str(value) + ')' class COORDMODEField(CALField): def check(self, value): return value in ('normalized', 'unkown', 'unnormalized') def render(self, value): return '_coordmode(' + value + ')' class BOOLField(CALField): def check(self, value): return isinstance(value, (int, long)) and value >= 0 and value < 2 def render(self, value): return str(value) class NOISETYPEField(CALField): def check(self, value): return value in ('perlin1D', 'perlin2D', 'perlin3D', 'perlin4D') def render(self, value): return '_type(' + value + ')' class CMPVALField(CALField): def check(self, value): return value in (0.0, 0.5, 1.0, -0.5, -1.0) def render(self, value): return '_cmpval(' + value + ')' OPCD0 = CALField("OPCD0") TRGT = RegisterField("TRGT") SRC0 = RegisterField("SRC0") SRC1 = RegisterField("SRC1") SRC2 = RegisterField("SRC2") SRC3 = RegisterField("SRC3") RELOP = RELOPField("RELOP") ZEROOP = ZEROOPField("ZEROOP", 'inf_else_max') LOGICOP = LOGICOPField("LOGICOP") INTERP = INTERPField("INTERP", 'notused') RESOURCE = RESOURCEField("RESOURCE") RESOURCEID = RESOURCEIDField("RESOURCEID") # this would be binary identical to RESOURCE, but the text name is different for some instructions SAMPLER = SAMPLERField("SAMPLER") LBL = IntegerLabelField("LBL", 0) IEEE = CALFlagField("IEEE", "_ieee", False) UINT = CALFlagField("UINT", "_uint", False) REPEAT = CALFlagField("REPEAT", " repeat", False) STAGE = STAGEField("STAGE", 0) SAMPLE = CALFlagField("SAMPLE", "_sample", False) AOFFIMMI = AOFFIMMIField("AOFFIMMI", ()) USAGE = USAGEField("USAGE", 'interp') TYPE = TYPEField("TYPE") UNNORM = CALFlagField("UNNORM", ",unnorm", False) FMT = FMTField("FMT") STREAM = STREAMField("STREAM") OFFSET = OFFSETField("OFFSET") ELEM = ELEMField("ELEM") VELEM = VELEMField("VELEM") NEIGHBOREXCH = CALFlagField("NEIGHBOREXCH", "_neighborExch", False) SHARINGMODE = SHARINGMODEField("SHARINGMODE", False) LOFFSET = LOFFSETField("LOFFSET", 0) THREADS = CALFlagField("THREADS", "_threads", False) LDS = CALFlagField("LDS", "_lds", False) MEMORY = CALFlagField("MEMORY", "_memory", False) SR = CALFlagField("SR", "_sr", False) XYZWDefault = XYZWDefaultField("XYZWDefault") XYZWImport = XYZWImportField("XYZWImport") TOPOLOGY = TOPOLOGYField("TOPOLOGY") OUTPUTTOPOLOGY = OUTPUTTOPOLOGYField("OUTPUTTOPOLOGY") L0 = LiteralField("L0") L1 = LiteralField("L1") L2 = LiteralField("L2") L3 = LiteralField("L3") IL0 = IntegerLiteralField("IL0") SHIFT = SHIFTField("SHIFT", '') SAT = CALFlagField("SAT", "_sat", False) MATRIX = MATRIXField("MATRIX") CENTER = CALFlagField("CENTER", "_center", True) BIAS = CALFlagField("BIAS", "_bias", False) INVERT = CALFlagField("INVERT", "_invert", False) CENTERED = CALFlagField("CENTERED", "_centered", False) USAGEINDEX = USAGEINDEXField("USAGEINDEX") CENTROID = CALFlagField("CENTROID", "_centroid", False) ORIGIN = CALFlagField("ORIGIN", "_origin", False) # used in dclpin - maybe... PARAM = PARAMField("PARAM") BOOL = BOOLField("BOOL") ROUND = CALFlagField("ROUND", "_round", False) NOISETYPE = NOISETYPEField("NOISETYPE") COORDMODE = NOISETYPEField("COORDMODE") NORMALIZE = CALFlagField("NORMALIZE", "_normalize", False) CMPVAL = CMPVALField("CMPVAL")
"""Tests for sgf_grammar.py.""" import unittest from betago.gosgf import sgf_grammar class SgfGrammarTestCase(unittest.TestCase): def test_is_valid_property_identifier(tc): ivpi = sgf_grammar.is_valid_property_identifier tc.assertIs(ivpi(b"B"), True) tc.assertIs(ivpi(b"PB"), True) tc.assertIs(ivpi(b"ABCDEFGH"), True) tc.assertIs(ivpi(b"ABCDEFGHI"), False) tc.assertIs(ivpi(b""), False) tc.assertIs(ivpi(b"b"), False) tc.assertIs(ivpi(b"Player"), False) tc.assertIs(ivpi(b"P2"), False) tc.assertIs(ivpi(b" PB"), False) tc.assertIs(ivpi(b"PB "), False) tc.assertIs(ivpi(b"P B"), False) tc.assertIs(ivpi(b"PB\x00"), False) def test_is_valid_property_value(tc): ivpv = sgf_grammar.is_valid_property_value tc.assertIs(ivpv(b""), True) tc.assertIs(ivpv(b"hello world"), True) tc.assertIs(ivpv(b"hello\nworld"), True) tc.assertIs(ivpv(b"hello \x00 world"), True) tc.assertIs(ivpv(b"hello \xa3 world"), True) tc.assertIs(ivpv(b"hello \xc2\xa3 world"), True) tc.assertIs(ivpv(b"hello \\-) world"), True) tc.assertIs(ivpv(b"hello (;[) world"), True) tc.assertIs(ivpv(b"[hello world]"), False) tc.assertIs(ivpv(b"hello ] world"), False) tc.assertIs(ivpv(b"hello \\] world"), True) tc.assertIs(ivpv(b"hello world \\"), False) tc.assertIs(ivpv(b"hello world \\\\"), True) tc.assertIs(ivpv(b"x" * 70000), True) def test_tokeniser(tc): tokenise = sgf_grammar.tokenise tc.assertEqual(tokenise(b"(;B[ah][]C[a\xa3b])")[0], [('D', b'('), ('D', b';'), ('I', b'B'), ('V', b'ah'), ('V', b''), ('I', b'C'), ('V', b'a\xa3b'), ('D', b')')]) def check_complete(s, *args): tokens, tail_index = tokenise(s, *args) tc.assertEqual(tail_index, len(s)) return len(tokens) def check_incomplete(s, *args): tokens, tail_index = tokenise(s, *args) return len(tokens), tail_index # check surrounding junk tc.assertEqual(check_complete(b""), 0) tc.assertEqual(check_complete(b"junk (;B[ah])"), 5) tc.assertEqual(check_incomplete(b"junk"), (0, 0)) tc.assertEqual(check_incomplete(b"junk (B[ah])"), (0, 0)) tc.assertEqual(check_incomplete(b"(;B[ah]) junk"), (5, 8)) # check paren-balance count tc.assertEqual(check_incomplete(b"(; ))(([ag]B C[ah])"), (3, 4)) tc.assertEqual(check_incomplete(b"(;( )) (;)"), (5, 6)) tc.assertEqual(check_incomplete(b"(;(()())) (;)"), (9, 9)) # check start_position tc.assertEqual(check_complete(b"(; ))(;B[ah])", 4), 5) tc.assertEqual(check_complete(b"(; ))junk (;B[ah])", 4), 5) tc.assertEqual(check_complete(b"(;XX[abc][def]KO[];B[bc])"), 11) tc.assertEqual(check_complete(b"( ;XX[abc][def]KO[];B[bc])"), 11) tc.assertEqual(check_complete(b"(; XX[abc][def]KO[];B[bc])"), 11) tc.assertEqual(check_complete(b"(;XX [abc][def]KO[];B[bc])"), 11) tc.assertEqual(check_complete(b"(;XX[abc] [def]KO[];B[bc])"), 11) tc.assertEqual(check_complete(b"(;XX[abc][def] KO[];B[bc])"), 11) tc.assertEqual(check_complete(b"(;XX[abc][def]KO [];B[bc])"), 11) tc.assertEqual(check_complete(b"(;XX[abc][def]KO[] ;B[bc])"), 11) tc.assertEqual(check_complete(b"(;XX[abc][def]KO[]; B[bc])"), 11) tc.assertEqual(check_complete(b"(;XX[abc][def]KO[];B [bc])"), 11) tc.assertEqual(check_complete(b"(;XX[abc][def]KO[];B[bc] )"), 11) tc.assertEqual(check_complete(b"( ;\nB\t[ah]\f[ef]\v)"), 6) tc.assertEqual(check_complete(b"(;[Ran\xc2\xa3dom :\nstu@ff][ef]"), 4) tc.assertEqual(check_complete(b"(;[ah)])"), 4) tc.assertEqual(check_incomplete(b"(;B[ag"), (3, 3)) tc.assertEqual(check_incomplete(b"(;B[ag)"), (3, 3)) tc.assertEqual(check_incomplete(b"(;AddBlack[ag])"), (3, 3)) tc.assertEqual(check_incomplete(b"(;+B[ag])"), (2, 2)) tc.assertEqual(check_incomplete(b"(;B+[ag])"), (3, 3)) tc.assertEqual(check_incomplete(b"(;B[ag]+)"), (4, 7)) tc.assertEqual(check_complete(r"(;[ab \] cd][ef]".encode('ascii')), 4) tc.assertEqual(check_complete(r"(;[ab \] cd\\][ef]".encode('ascii')), 4) tc.assertEqual(check_complete(r"(;[ab \] cd\\\\][ef]".encode('ascii')), 4) tc.assertEqual(check_complete(r"(;[ab \] \\\] cd][ef]".encode('ascii')), 4) tc.assertEqual(check_incomplete(r"(;B[ag\])".encode('ascii')), (3, 3)) tc.assertEqual(check_incomplete(r"(;B[ag\\\])".encode('ascii')), (3, 3)) def test_parser_structure(tc): parse_sgf_game = sgf_grammar.parse_sgf_game def shape(s): coarse_game = parse_sgf_game(s) return len(coarse_game.sequence), len(coarse_game.children) tc.assertEqual(shape(b"(;C[abc]KO[];B[bc])"), (2, 0)) tc.assertEqual(shape(b"initial junk (;C[abc]KO[];B[bc])"), (2, 0)) tc.assertEqual(shape(b"(;C[abc]KO[];B[bc]) final junk"), (2, 0)) tc.assertEqual(shape(b"(;C[abc]KO[];B[bc]) (;B[ag])"), (2, 0)) tc.assertRaisesRegexp(ValueError, "no SGF data found", parse_sgf_game, b"") tc.assertRaisesRegexp(ValueError, "no SGF data found", parse_sgf_game, b"junk") tc.assertRaisesRegexp(ValueError, "no SGF data found", parse_sgf_game, b"()") tc.assertRaisesRegexp(ValueError, "no SGF data found", parse_sgf_game, b"(B[ag])") tc.assertRaisesRegexp(ValueError, "no SGF data found", parse_sgf_game, b"B[ag]") tc.assertRaisesRegexp(ValueError, "no SGF data found", parse_sgf_game, b"[ag]") tc.assertEqual(shape(b"(;C[abc]AB[ab][bc];B[bc])"), (2, 0)) tc.assertEqual(shape(b"(;C[abc] AB[ab]\n[bc]\t;B[bc])"), (2, 0)) tc.assertEqual(shape(b"(;C[abc]KO[];;B[bc])"), (3, 0)) tc.assertEqual(shape(b"(;)"), (1, 0)) tc.assertRaisesRegexp(ValueError, "property with no values", parse_sgf_game, b"(;B)") tc.assertRaisesRegexp(ValueError, "unexpected value", parse_sgf_game, b"(;[ag])") tc.assertRaisesRegexp(ValueError, "unexpected value", parse_sgf_game, b"(;[ag][ah])") tc.assertRaisesRegexp(ValueError, "unexpected value", parse_sgf_game, b"(;[B][ag])") tc.assertRaisesRegexp(ValueError, "unexpected end of SGF data", parse_sgf_game, b"(;B[ag]") tc.assertRaisesRegexp(ValueError, "unexpected end of SGF data", parse_sgf_game, b"(;B[ag][)]") tc.assertRaisesRegexp(ValueError, "property with no values", parse_sgf_game, b"(;B;W[ah])") tc.assertRaisesRegexp(ValueError, "unexpected value", parse_sgf_game, b"(;B[ag](;[ah]))") tc.assertRaisesRegexp(ValueError, "property with no values", parse_sgf_game, b"(;B W[ag])") def test_parser_tree_structure(tc): parse_sgf_game = sgf_grammar.parse_sgf_game def shape(s): coarse_game = parse_sgf_game(s) return len(coarse_game.sequence), len(coarse_game.children) tc.assertEqual(shape(b"(;C[abc]AB[ab](;B[bc]))"), (1, 1)) tc.assertEqual(shape(b"(;C[abc]AB[ab](;B[bc])))"), (1, 1)) tc.assertEqual(shape(b"(;C[abc]AB[ab](;B[bc])(;B[bd]))"), (1, 2)) def shapetree(s): def _shapetree(coarse_game): return ( len(coarse_game.sequence), [_shapetree(pg) for pg in coarse_game.children]) return _shapetree(parse_sgf_game(s)) tc.assertEqual(shapetree(b"(;C[abc]AB[ab](;B[bc])))"), (1, [(1, [])]) ) tc.assertEqual(shapetree(b"(;C[abc]AB[ab](;B[bc]))))"), (1, [(1, [])]) ) tc.assertEqual(shapetree(b"(;C[abc]AB[ab](;B[bc])(;B[bd])))"), (1, [(1, []), (1, [])]) ) tc.assertEqual(shapetree(b""" (;C[abc]AB[ab];C[];C[] (;B[bc]) (;B[bd];W[ca] (;B[da])(;B[db];W[ea]) ) )"""), (3, [ (1, []), (2, [(1, []), (2, [])]) ]) ) tc.assertRaisesRegexp(ValueError, "unexpected end of SGF data", parse_sgf_game, b"(;B[ag];W[ah](;B[ai])") tc.assertRaisesRegexp(ValueError, "empty sequence", parse_sgf_game, b"(;B[ag];())") tc.assertRaisesRegexp(ValueError, "empty sequence", parse_sgf_game, b"(;B[ag]())") tc.assertRaisesRegexp(ValueError, "empty sequence", parse_sgf_game, b"(;B[ag]((;W[ah])(;W[ai]))") tc.assertRaisesRegexp(ValueError, "unexpected node", parse_sgf_game, b"(;B[ag];W[ah](;B[ai]);W[bd])") tc.assertRaisesRegexp(ValueError, "property value outside a node", parse_sgf_game, b"(;B[ag];(W[ah];B[ai]))") tc.assertRaisesRegexp(ValueError, "property value outside a node", parse_sgf_game, b"(;B[ag](;W[ah];)B[ai])") tc.assertRaisesRegexp(ValueError, "property value outside a node", parse_sgf_game, b"(;B[ag](;W[ah])(B[ai]))") def test_parser_properties(tc): parse_sgf_game = sgf_grammar.parse_sgf_game def props(s): coarse_game = parse_sgf_game(s) return coarse_game.sequence tc.assertEqual(props(b"(;C[abc]KO[]AB[ai][bh][ee];B[ bc])"), [{b'C': [b'abc'], b'KO': [b''], b'AB': [b'ai', b'bh', b'ee']}, {b'B': [b' bc']}]) tc.assertEqual(props(r"(;C[ab \] \) cd\\])".encode('ascii')), [{b'C': [r"ab \] \) cd\\".encode('ascii')]}]) tc.assertEqual(props(b"(;XX[1]YY[2]XX[3]YY[4])"), [{b'XX': [b'1', b'3'], b'YY' : [b'2', b'4']}]) def test_parse_sgf_collection(tc): parse_sgf_collection = sgf_grammar.parse_sgf_collection tc.assertRaisesRegexp(ValueError, "no SGF data found", parse_sgf_collection, b"") tc.assertRaisesRegexp(ValueError, "no SGF data found", parse_sgf_collection, b"()") games = parse_sgf_collection(b"(;C[abc]AB[ab];X[];X[](;B[bc]))") tc.assertEqual(len(games), 1) tc.assertEqual(len(games[0].sequence), 3) games = parse_sgf_collection(b"(;X[1];X[2];X[3](;B[bc])) (;Y[1];Y[2])") tc.assertEqual(len(games), 2) tc.assertEqual(len(games[0].sequence), 3) tc.assertEqual(len(games[1].sequence), 2) games = parse_sgf_collection( b"dummy (;X[1];X[2];X[3](;B[bc])) junk (;Y[1];Y[2]) Nonsense") tc.assertEqual(len(games), 2) tc.assertEqual(len(games[0].sequence), 3) tc.assertEqual(len(games[1].sequence), 2) games = parse_sgf_collection( b"(( (;X[1];X[2];X[3](;B[bc])) ();) (;Y[1];Y[2]) )(Nonsense") tc.assertEqual(len(games), 2) tc.assertEqual(len(games[0].sequence), 3) tc.assertEqual(len(games[1].sequence), 2) with tc.assertRaises(ValueError) as ar: parse_sgf_collection( b"(( (;X[1];X[2];X[3](;B[bc])) ();) (;Y[1];Y[2]") tc.assertEqual(str(ar.exception), "error parsing game 1: unexpected end of SGF data") def test_parse_compose(tc): pc = sgf_grammar.parse_compose tc.assertEqual(pc(b"word"), (b"word", None)) tc.assertEqual(pc(b"word:"), (b"word", b"")) tc.assertEqual(pc(b"word:?"), (b"word", b"?")) tc.assertEqual(pc(b"word:123"), (b"word", b"123")) tc.assertEqual(pc(b"word:123:456"), (b"word", b"123:456")) tc.assertEqual(pc(b":123"), (b"", b"123")) tc.assertEqual(pc(r"word\:more".encode('ascii')), (r"word\:more".encode('ascii'), None)) tc.assertEqual(pc(r"word\:more:?".encode('ascii')), (r"word\:more".encode('ascii'), b"?")) tc.assertEqual(pc(r"word\\:more:?".encode('ascii')), (b"word\\\\", b"more:?")) tc.assertEqual(pc(r"word\\\:more:?".encode('ascii')), (r"word\\\:more".encode('ascii'), b"?")) tc.assertEqual(pc(b"word\\\nmore:123"), (b"word\\\nmore", b"123")) def test_text_value(tc): text_value = sgf_grammar.text_value tc.assertEqual(text_value(b"abc "), b"abc ") tc.assertEqual(text_value(b"ab c"), b"ab c") tc.assertEqual(text_value(b"ab\tc"), b"ab c") tc.assertEqual(text_value(b"ab \tc"), b"ab c") tc.assertEqual(text_value(b"ab\nc"), b"ab\nc") tc.assertEqual(text_value(b"ab\\\nc"), b"abc") tc.assertEqual(text_value(b"ab\\\\\nc"), b"ab\\\nc") tc.assertEqual(text_value(b"ab\xa0c"), b"ab\xa0c") tc.assertEqual(text_value(b"ab\rc"), b"ab\nc") tc.assertEqual(text_value(b"ab\r\nc"), b"ab\nc") tc.assertEqual(text_value(b"ab\n\rc"), b"ab\nc") tc.assertEqual(text_value(b"ab\r\n\r\nc"), b"ab\n\nc") tc.assertEqual(text_value(b"ab\r\n\r\n\rc"), b"ab\n\n\nc") tc.assertEqual(text_value(b"ab\\\r\nc"), b"abc") tc.assertEqual(text_value(b"ab\\\n\nc"), b"ab\nc") tc.assertEqual(text_value(b"ab\\\tc"), b"ab c") # These can't actually appear as SGF PropValues; anything sane will do tc.assertEqual(text_value(b"abc\\"), b"abc") tc.assertEqual(text_value(b"abc]"), b"abc]") def test_simpletext_value(tc): simpletext_value = sgf_grammar.simpletext_value tc.assertEqual(simpletext_value(b"abc "), b"abc ") tc.assertEqual(simpletext_value(b"ab c"), b"ab c") tc.assertEqual(simpletext_value(b"ab\tc"), b"ab c") tc.assertEqual(simpletext_value(b"ab \tc"), b"ab c") tc.assertEqual(simpletext_value(b"ab\nc"), b"ab c") tc.assertEqual(simpletext_value(b"ab\\\nc"), b"abc") tc.assertEqual(simpletext_value(b"ab\\\\\nc"), b"ab\\ c") tc.assertEqual(simpletext_value(b"ab\xa0c"), b"ab\xa0c") tc.assertEqual(simpletext_value(b"ab\rc"), b"ab c") tc.assertEqual(simpletext_value(b"ab\r\nc"), b"ab c") tc.assertEqual(simpletext_value(b"ab\n\rc"), b"ab c") tc.assertEqual(simpletext_value(b"ab\r\n\r\nc"), b"ab c") tc.assertEqual(simpletext_value(b"ab\r\n\r\n\rc"), b"ab c") tc.assertEqual(simpletext_value(b"ab\\\r\nc"), b"abc") tc.assertEqual(simpletext_value(b"ab\\\n\nc"), b"ab c") tc.assertEqual(simpletext_value(b"ab\\\tc"), b"ab c") # These can't actually appear as SGF PropValues; anything sane will do tc.assertEqual(simpletext_value(b"abc\\"), b"abc") tc.assertEqual(simpletext_value(b"abc]"), b"abc]") def test_escape_text(tc): tc.assertEqual(sgf_grammar.escape_text(b"abc"), b"abc") tc.assertEqual(sgf_grammar.escape_text(r"a\bc".encode('ascii')), r"a\\bc".encode('ascii')) tc.assertEqual(sgf_grammar.escape_text(r"ab[c]".encode('ascii')), r"ab[c\]".encode('ascii')) tc.assertEqual(sgf_grammar.escape_text(r"a\]bc".encode('ascii')), r"a\\\]bc".encode('ascii')) def test_text_roundtrip(tc): def roundtrip(s): return sgf_grammar.text_value(sgf_grammar.escape_text(s)) tc.assertEqual(roundtrip(b"abc"), b"abc") tc.assertEqual(roundtrip(r"a\bc".encode('ascii')), r"a\bc".encode('ascii')) tc.assertEqual(roundtrip(b"abc\\"), b"abc\\") tc.assertEqual(roundtrip(b"ab]c"), b"ab]c") tc.assertEqual(roundtrip(b"abc]"), b"abc]") tc.assertEqual(roundtrip(r"abc\]".encode('ascii')), r"abc\]".encode('ascii')) tc.assertEqual(roundtrip(b"ab\nc"), b"ab\nc") tc.assertEqual(roundtrip(b"ab\n c"), b"ab\n c") tc.assertEqual(roundtrip(b"ab\tc"), b"ab c") tc.assertEqual(roundtrip(b"ab\r\nc\n"), b"ab\nc\n") def test_serialise_game_tree(tc): serialised = (b"(;AB[aa][ab][ac]C[comment \xa3];W[ab];C[];C[]" b"(;B[bc])(;B[bd];W[ca](;B[da])(;B[db];\n" b"W[ea])))\n") coarse_game = sgf_grammar.parse_sgf_game(serialised) tc.assertEqual(sgf_grammar.serialise_game_tree(coarse_game), serialised) tc.assertEqual(sgf_grammar.serialise_game_tree(coarse_game, wrap=None), serialised.replace(b"\n", b"")+b"\n")
#!/usr/bin/env python #=============================================================================== # Copyright (c) 2014 Geoscience Australia # All rights reserved. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are met: # * Redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer. # * Redistributions in binary form must reproduce the above copyright # notice, this list of conditions and the following disclaimer in the # documentation and/or other materials provided with the distribution. # * Neither Geoscience Australia nor the names of its contributors may be # used to endorse or promote products derived from this software # without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND # ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED # WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE # DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE FOR ANY # DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES # (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; # LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND # ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT # (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS # SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. #=============================================================================== ''' Script to list all NBAR datasets in DB which are not loaded into THREDDS GA only - deprecated Created on 25/09/2013 @author: u76345 ''' import xml.dom.minidom import argparse from datetime import datetime import logging, os, re, copy from agdc import DataCube from EOtools.utils import log_multiline #=============================================================================== # # Set top level standard output # console_handler = logging.StreamHandler(sys.stdout) # console_handler.setLevel(logging.INFO) # console_formatter = logging.Formatter('%(message)s') # console_handler.setFormatter(console_formatter) #=============================================================================== logger = logging.getLogger('datacube.' + __name__) class ThreddsChecker(DataCube): ''' classdocs ''' def parse_args(self): """Parse the command line arguments. Returns: argparse namespace object """ logger.debug(' Calling parse_args()') _arg_parser = argparse.ArgumentParser('stacker') # N.B: modtran_root is a direct overrides of config entries # and its variable name must be prefixed with "_" to allow lookup in conf file _arg_parser.add_argument('-C', '--config', dest='config_file', default=os.path.join(self.agdc_root, 'agdc_default.conf'), help='Stacker configuration file') _arg_parser.add_argument('-d', '--debug', dest='debug', default=False, action='store_const', const=True, help='Debug mode flag') _arg_parser.add_argument('-s', '--start_date', dest='start_date', required=False, default=None, help='Start Date in dd/mm/yyyy format') _arg_parser.add_argument('-e', '--end_date', dest='end_date', required=False, default=None, help='End Date in dd/mm/yyyy format') _arg_parser.add_argument('-a', '--satellite', dest='satellite', required=False, default=None, help='Short Satellite name (e.g. LS5, LS7)') _arg_parser.add_argument('-n', '--sensor', dest='sensor', required=False, default=None, help='Sensor Name (e.g. TM, ETM+)') return _arg_parser.parse_args() def __init__(self, source_datacube=None, default_tile_type_id=1): """Constructor Arguments: source_datacube: Optional DataCube object whose connection and data will be shared tile_type_id: Optional tile_type_id value (defaults to 1) """ if source_datacube: # Copy values from source_datacube and then override command line args self.__dict__ = copy(source_datacube.__dict__) args = self.parse_args() # Set instance attributes for every value in command line arguments file for attribute_name in args.__dict__.keys(): attribute_value = args.__dict__[attribute_name] self.__setattr__(attribute_name, attribute_value) else: DataCube.__init__(self) # Call inherited constructor # Attempt to parse dates from command line arguments or config file try: self.start_date = datetime.strptime(self.start_date, '%Y%m%d').date() except: try: self.start_date = datetime.strptime(self.start_date, '%d/%m/%Y').date() except: try: self.start_date = datetime.strptime(self.start_date, '%Y-%m-%d').date() except: self.start_date= None try: self.end_date = datetime.strptime(self.end_date, '%Y%m%d').date() except: try: self.end_date = datetime.strptime(self.end_date, '%d/%m/%Y').date() except: try: self.end_date = datetime.strptime(self.end_date, '%Y-%m-%d').date() except: self.end_date= None # Other variables set from config file only - not used try: self.min_path = int(self.min_path) except: self.min_path = None try: self.max_path = int(self.max_path) except: self.max_path = None try: self.min_row = int(self.min_row) except: self.min_row = None try: self.max_row = int(self.max_row) except: self.max_row = None self.thredds_root = '/g/data1/v27/projects/EOS_delivery/LANDSAT/' def check(self, kml_filename=None, wrs_shapefile='WRS-2_bound_world.kml'): ''' check a KML file ''' self.db_cursor = self.db_connection.cursor() sql = """-- Find all NBAR acquisitions select satellite_name as satellite, sensor_name as sensor, x_ref as path, y_ref as row, start_datetime, end_datetime, dataset_path, ll_lon, ll_lat, lr_lon, lr_lat, ul_lon, ul_lat, ur_lon, ur_lat, cloud_cover::integer, gcp_count::integer from ( select * from dataset where level_id = 2 -- NBAR ) dataset inner join acquisition a using(acquisition_id) inner join satellite using(satellite_id) inner join sensor using(satellite_id, sensor_id) where (%(start_date)s is null or end_datetime::date >= %(start_date)s) and (%(end_date)s is null or end_datetime::date <= %(end_date)s) and (%(satellite)s is null or satellite_tag = %(satellite)s) and (%(sensor)s is null or sensor_name = %(sensor)s) order by end_datetime ; """ params = { 'start_date': self.start_date, 'end_date': self.end_date, 'satellite': self.satellite, 'sensor': self.sensor } log_multiline(logger.debug, self.db_cursor.mogrify(sql, params), 'SQL', '\t') self.db_cursor.execute(sql, params) field_list = ['satellite', 'sensor', 'path', 'row', 'start_datetime', 'end_datetime', 'dataset_path', 'll_lon', 'll_lat', 'lr_lon', 'lr_lat', 'ul_lon', 'ul_lat', 'ur_lon', 'ur_lat', 'cloud_cover', 'gcp_count' ] for record in self.db_cursor: acquisition_info = {} for field_index in range(len(field_list)): acquisition_info[field_list[field_index]] = record[field_index] acquisition_info['year'] = acquisition_info['end_datetime'].year acquisition_info['month'] = acquisition_info['end_datetime'].month acquisition_info['dataset_name'] = re.search('[^/]+$', acquisition_info['dataset_path']).group(0) log_multiline(logger.debug, acquisition_info, 'acquisition_info', '\t') thredds_dataset = '%s/%04d/%02d/%s_BX.nc' % (self.thredds_root, acquisition_info['year'], acquisition_info['month'], acquisition_info['dataset_name']) #=================================================================== # if os.path.exists(thredds_dataset): # print '%s exists' % (acquisition_info['dataset_name']) # else: # print '%s does not exist' % (acquisition_info['dataset_name']) #=================================================================== if not os.path.exists(thredds_dataset): print acquisition_info['dataset_path'] def main(): tc = ThreddsChecker() tc.check() if __name__ == '__main__': main()
from collections import defaultdict from unittest.mock import Mock, patch from ctf_gameserver.lib.database import transaction_cursor from ctf_gameserver.lib.test_util import DatabaseTestCase from ctf_gameserver.controller import controller, database @patch('ctf_gameserver.controller.database.update_scoring') class MainLoopTest(DatabaseTestCase): fixtures = ['tests/controller/fixtures/main_loop.json'] metrics = defaultdict(Mock) @patch('time.sleep') @patch('logging.warning') def test_null(self, warning_mock, sleep_mock, _): controller.main_loop_step(self.connection, self.metrics, False) warning_mock.assert_called_with('Competition start and end time must be configured in the database') sleep_mock.assert_called_once_with(60) @patch('time.sleep') def test_before_game(self, sleep_mock, _): with transaction_cursor(self.connection) as cursor: cursor.execute('UPDATE scoring_gamecontrol SET start = datetime("now", "+1 hour"), ' ' end = datetime("now", "+1 day")') controller.main_loop_step(self.connection, self.metrics, False) sleep_mock.assert_called_once_with(60) with transaction_cursor(self.connection) as cursor: cursor.execute('SELECT current_tick FROM scoring_gamecontrol') new_tick = cursor.fetchone()[0] self.assertEqual(new_tick, -1) with transaction_cursor(self.connection) as cursor: cursor.execute('SELECT COUNT(*) FROM scoring_flag') total_flag_count = cursor.fetchone()[0] self.assertEqual(total_flag_count, 0) @patch('time.sleep') def test_first_tick(self, sleep_mock, _): with transaction_cursor(self.connection) as cursor: cursor.execute('UPDATE scoring_gamecontrol SET start = datetime("now"), ' ' end = datetime("now", "+1 day")') controller.main_loop_step(self.connection, self.metrics, False) sleep_mock.assert_called_once_with(0) with transaction_cursor(self.connection) as cursor: cursor.execute('SELECT current_tick FROM scoring_gamecontrol') new_tick = cursor.fetchone()[0] self.assertEqual(new_tick, 0) with transaction_cursor(self.connection) as cursor: cursor.execute('SELECT COUNT(*) FROM scoring_flag') total_flag_count = cursor.fetchone()[0] self.assertEqual(total_flag_count, 6) with transaction_cursor(self.connection) as cursor: cursor.execute('SELECT COUNT(*) FROM scoring_flag WHERE service_id=1') service_flag_count = cursor.fetchone()[0] self.assertEqual(service_flag_count, 3) with transaction_cursor(self.connection) as cursor: cursor.execute('SELECT COUNT(*) FROM scoring_flag WHERE protecting_team_id=4') team_flag_count = cursor.fetchone()[0] self.assertEqual(team_flag_count, 2) with transaction_cursor(self.connection) as cursor: cursor.execute('SELECT COUNT(*) FROM scoring_flag WHERE tick=0') tick_flag_count = cursor.fetchone()[0] self.assertEqual(tick_flag_count, 6) @patch('time.sleep') def test_next_tick_undue(self, sleep_mock, _): with transaction_cursor(self.connection) as cursor: cursor.execute('UPDATE scoring_gamecontrol SET start = datetime("now", "-1030 seconds"), ' ' end = datetime("now", "+85370 seconds"), ' ' current_tick=5') controller.main_loop_step(self.connection, self.metrics, False) sleep_mock.assert_called_once() sleep_arg = sleep_mock.call_args[0][0] self.assertGreater(sleep_arg, 40) self.assertLessEqual(sleep_arg, 50) with transaction_cursor(self.connection) as cursor: cursor.execute('SELECT current_tick FROM scoring_gamecontrol') new_tick = cursor.fetchone()[0] self.assertEqual(new_tick, 5) with transaction_cursor(self.connection) as cursor: cursor.execute('SELECT COUNT(*) FROM scoring_flag') tick_flag_count = cursor.fetchone()[0] self.assertEqual(tick_flag_count, 0) @patch('time.sleep') def test_next_tick_overdue(self, sleep_mock, _): with transaction_cursor(self.connection) as cursor: cursor.execute('UPDATE scoring_gamecontrol SET start = datetime("now", "-19 minutes"), ' ' end = datetime("now", "+1421 minutes"), ' ' current_tick=5') controller.main_loop_step(self.connection, self.metrics, False) sleep_mock.assert_called_once_with(0) with transaction_cursor(self.connection) as cursor: cursor.execute('SELECT current_tick FROM scoring_gamecontrol') new_tick = cursor.fetchone()[0] self.assertEqual(new_tick, 6) with transaction_cursor(self.connection) as cursor: cursor.execute('SELECT COUNT(*) FROM scoring_flag WHERE tick=6') tick_flag_count = cursor.fetchone()[0] self.assertEqual(tick_flag_count, 6) @patch('time.sleep') def test_last_tick(self, sleep_mock, _): with transaction_cursor(self.connection) as cursor: cursor.execute('UPDATE scoring_gamecontrol SET start = datetime("now", "-1 day"), ' ' end = datetime("now", "+3 minutes"), ' ' current_tick=479') controller.main_loop_step(self.connection, self.metrics, False) sleep_mock.assert_called_once_with(0) with transaction_cursor(self.connection) as cursor: cursor.execute('SELECT current_tick FROM scoring_gamecontrol') new_tick = cursor.fetchone()[0] self.assertEqual(new_tick, 480) with transaction_cursor(self.connection) as cursor: cursor.execute('SELECT COUNT(*) FROM scoring_flag WHERE tick=480') tick_flag_count = cursor.fetchone()[0] self.assertEqual(tick_flag_count, 6) @patch('time.sleep') def test_shortly_after_game(self, sleep_mock, _): with transaction_cursor(self.connection) as cursor: cursor.execute('UPDATE scoring_gamecontrol SET start = datetime("now", "-1441 minutes"), ' ' end = datetime("now"), ' ' current_tick=479') controller.main_loop_step(self.connection, self.metrics, False) self.assertEqual(sleep_mock.call_count, 2) self.assertEqual(sleep_mock.call_args_list[0][0][0], 0) self.assertEqual(sleep_mock.call_args_list[1][0][0], 60) with transaction_cursor(self.connection) as cursor: cursor.execute('SELECT current_tick FROM scoring_gamecontrol') new_tick = cursor.fetchone()[0] self.assertEqual(new_tick, 479) with transaction_cursor(self.connection) as cursor: cursor.execute('SELECT COUNT(*) FROM scoring_flag') total_flag_count = cursor.fetchone()[0] self.assertEqual(total_flag_count, 0) @patch('time.sleep') def test_long_after_game(self, sleep_mock, _): with transaction_cursor(self.connection) as cursor: cursor.execute('UPDATE scoring_gamecontrol SET start = datetime("now", "-1465 minutes"), ' ' end = datetime("now", "-25 minutes"), ' ' current_tick=479') controller.main_loop_step(self.connection, self.metrics, False) self.assertEqual(sleep_mock.call_count, 2) self.assertEqual(sleep_mock.call_args_list[0][0][0], 0) self.assertEqual(sleep_mock.call_args_list[1][0][0], 60) with transaction_cursor(self.connection) as cursor: cursor.execute('SELECT current_tick FROM scoring_gamecontrol') new_tick = cursor.fetchone()[0] self.assertEqual(new_tick, 479) with transaction_cursor(self.connection) as cursor: cursor.execute('SELECT COUNT(*) FROM scoring_flag') total_flag_count = cursor.fetchone()[0] self.assertEqual(total_flag_count, 0) @patch('time.sleep') def test_after_game_nonstop(self, sleep_mock, _): with transaction_cursor(self.connection) as cursor: cursor.execute('UPDATE scoring_gamecontrol SET start = datetime("now", "-1 day"), ' ' end = datetime("now"), ' ' current_tick=479') controller.main_loop_step(self.connection, self.metrics, True) sleep_mock.assert_called_once_with(0) with transaction_cursor(self.connection) as cursor: cursor.execute('SELECT current_tick FROM scoring_gamecontrol') new_tick = cursor.fetchone()[0] self.assertEqual(new_tick, 480) with transaction_cursor(self.connection) as cursor: cursor.execute('SELECT COUNT(*) FROM scoring_flag WHERE tick=480') tick_flag_count = cursor.fetchone()[0] self.assertEqual(tick_flag_count, 6) @patch('ctf_gameserver.controller.database.update_scoring') class DatabaseTest(DatabaseTestCase): """ Tests for the `ctf_gameserver.controller.database` module. Only tests special cases, the general functionality is covered by MainLoopTest. """ fixtures = ['tests/controller/fixtures/main_loop.json'] def test_prohibit_changes(self, _): with transaction_cursor(self.connection) as cursor: cursor.execute('SELECT * FROM scoring_gamecontrol ORDER BY id') old_gamecontrol = cursor.fetchall() cursor.execute('SELECT * FROM scoring_flag ORDER BY id') old_flag = cursor.fetchall() database.get_control_info(self.connection, prohibit_changes=True) database.increase_tick(self.connection, prohibit_changes=True) with transaction_cursor(self.connection) as cursor: cursor.execute('SELECT * FROM scoring_gamecontrol ORDER BY id') new_gamecontrol = cursor.fetchall() cursor.execute('SELECT * FROM scoring_flag ORDER BY id') new_flag = cursor.fetchall() self.assertEqual(old_gamecontrol, new_gamecontrol) self.assertEqual(old_flag, new_flag)
# Copyright 2015 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Functional tests for slice op.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function import numpy as np from six.moves import xrange # pylint: disable=redefined-builtin from tensorflow.python.framework import constant_op from tensorflow.python.framework import dtypes from tensorflow.python.framework import errors_impl from tensorflow.python.ops import array_ops from tensorflow.python.ops import gradients_impl from tensorflow.python.ops import math_ops from tensorflow.python.platform import test class SliceTest(test.TestCase): def testEmpty(self): inp = np.random.rand(4, 4).astype("f") for k in xrange(4): with self.cached_session(use_gpu=True): a = constant_op.constant(inp, shape=[4, 4], dtype=dtypes.float32) slice_t = a[2, k:k] slice_val = self.evaluate(slice_t) self.assertAllEqual(slice_val, inp[2, k:k]) def testInt32(self): inp = np.random.rand(4, 4).astype("i") for k in xrange(4): with self.cached_session(use_gpu=True): a = constant_op.constant(inp, shape=[4, 4], dtype=dtypes.int32) slice_t = a[2, k:k] slice_val = self.evaluate(slice_t) self.assertAllEqual(slice_val, inp[2, k:k]) def testSlicingWithInt64Index(self): with self.cached_session(force_gpu=test.is_gpu_available()): a = constant_op.constant([0, 1, 2], dtype=dtypes.int32) # Slice using int64 Tensor. i = constant_op.constant(1, dtype=dtypes.int64) slice_t = a[i] slice_val = self.evaluate(slice_t) self.assertAllEqual(1, slice_val) slice_t = a[i:i+1] slice_val = self.evaluate(slice_t) self.assertAllEqual([1], slice_val) # Slice using int64 integer. i = np.asarray(1).astype(np.int64) slice_t = a[i] slice_val = self.evaluate(slice_t) self.assertAllEqual(1, slice_val) slice_t = a[i:i+1] slice_val = self.evaluate(slice_t) self.assertAllEqual([1], slice_val) a_int32 = constant_op.constant([0, 1, 2], dtype=dtypes.int32) slice_t = array_ops.slice(a_int32, np.asarray([1]).astype(np.int64), np.asarray([2]).astype(np.int64)) slice_val = self.evaluate(slice_t) self.assertAllEqual([1, 2], slice_val) a_float32 = constant_op.constant([0, 1, 2], dtype=dtypes.float32) slice_t = array_ops.slice(a_float32, np.asarray([1]).astype(np.int64), np.asarray([2]).astype(np.int64)) slice_val = self.evaluate(slice_t) self.assertAllEqual([1, 2], slice_val) def testSlicingInt64Tensor(self): with self.cached_session(force_gpu=test.is_gpu_available()): a = constant_op.constant([0, 1, 2], dtype=dtypes.int64) # Slice using int32 Tensor. i = constant_op.constant(1, dtype=dtypes.int32) slice_t = a[i] slice_val = self.evaluate(slice_t) self.assertAllEqual(1, slice_val) slice_t = a[i:i + 1] slice_val = self.evaluate(slice_t) self.assertAllEqual([1], slice_val) # Slice using int32 integer. i = np.asarray(1).astype(np.int32) slice_t = a[i] slice_val = self.evaluate(slice_t) self.assertAllEqual(1, slice_val) slice_t = a[i:i + 1] slice_val = self.evaluate(slice_t) self.assertAllEqual([1], slice_val) slice_t = array_ops.slice(a, [1], [2]) slice_val = self.evaluate(slice_t) self.assertAllEqual([1, 2], slice_val) def testSelectAll(self): for _ in range(10): with self.cached_session(use_gpu=True): inp = np.random.rand(4, 4, 4, 4).astype("f") a = constant_op.constant(inp, shape=[4, 4, 4, 4], dtype=dtypes.float32) slice_explicit_t = array_ops.slice(a, [0, 0, 0, 0], [-1, -1, -1, -1]) slice_implicit_t = a[:, :, :, :] self.assertAllEqual(inp, self.evaluate(slice_explicit_t)) self.assertAllEqual(inp, self.evaluate(slice_implicit_t)) self.assertEqual(inp.shape, slice_explicit_t.get_shape()) self.assertEqual(inp.shape, slice_implicit_t.get_shape()) def testSingleDimension(self): for _ in range(10): with self.cached_session(use_gpu=True): inp = np.random.rand(10).astype("f") a = constant_op.constant(inp, shape=[10], dtype=dtypes.float32) hi = np.random.randint(0, 9) scalar_t = a[hi] scalar_val = self.evaluate(scalar_t) self.assertAllEqual(scalar_val, inp[hi]) if hi > 0: lo = np.random.randint(0, hi) else: lo = 0 slice_t = a[lo:hi] slice_val = self.evaluate(slice_t) self.assertAllEqual(slice_val, inp[lo:hi]) def testScalarInput(self): input_val = 0 with self.cached_session() as sess: # Test with constant input; shape inference fails. with self.assertRaisesWithPredicateMatch(ValueError, "out of range"): constant_op.constant(input_val)[:].get_shape() # Test evaluating with non-constant input; kernel execution fails. input_t = array_ops.placeholder(dtypes.int32) slice_t = input_t[:] with self.assertRaisesWithPredicateMatch(errors_impl.InvalidArgumentError, "out of range"): sess.run([slice_t], feed_dict={input_t: input_val}) def testInvalidIndex(self): input_val = [1, 2] with self.cached_session() as sess: # Test with constant input; shape inference fails. with self.assertRaisesWithPredicateMatch(ValueError, "out of range"): constant_op.constant(input_val)[1:, 1:].get_shape() # Test evaluating with non-constant input; kernel execution fails. input_t = array_ops.placeholder(dtypes.int32) slice_t = input_t[1:, 1:] with self.assertRaisesWithPredicateMatch(errors_impl.InvalidArgumentError, "out of range"): sess.run([slice_t], feed_dict={input_t: input_val}) def _testSliceMatrixDim0(self, x, begin, size): with self.cached_session(use_gpu=True): tf_ans = array_ops.slice(x, [begin, 0], [size, x.shape[1]]).eval() np_ans = x[begin:begin + size, :] self.assertAllEqual(tf_ans, np_ans) def testSliceMatrixDim0(self): x = np.random.rand(8, 4).astype("f") self._testSliceMatrixDim0(x, 1, 2) self._testSliceMatrixDim0(x, 3, 3) y = np.random.rand(8, 7).astype("f") # 7 * sizeof(float) is not aligned self._testSliceMatrixDim0(y, 1, 2) self._testSliceMatrixDim0(y, 3, 3) def testSingleElementAll(self): for _ in range(10): with self.cached_session(use_gpu=True): inp = np.random.rand(4, 4).astype("f") a = constant_op.constant(inp, shape=[4, 4], dtype=dtypes.float32) x, y = np.random.randint(0, 3, size=2).tolist() slice_t = a[x, 0:y] slice_val = self.evaluate(slice_t) self.assertAllEqual(slice_val, inp[x, 0:y]) def testSimple(self): with self.session(use_gpu=True) as sess: inp = np.random.rand(4, 4).astype("f") a = constant_op.constant( [float(x) for x in inp.ravel(order="C")], shape=[4, 4], dtype=dtypes.float32) slice_t = array_ops.slice(a, [0, 0], [2, 2]) slice2_t = a[:2, :2] slice_val, slice2_val = sess.run([slice_t, slice2_t]) self.assertAllEqual(slice_val, inp[:2, :2]) self.assertAllEqual(slice2_val, inp[:2, :2]) self.assertEqual(slice_val.shape, slice_t.get_shape()) self.assertEqual(slice2_val.shape, slice2_t.get_shape()) def testComplex(self): with self.session(use_gpu=True): inp = np.random.rand(4, 10, 10, 4).astype("f") a = constant_op.constant(inp, dtype=dtypes.float32) x = np.random.randint(0, 9) z = np.random.randint(0, 9) if z > 0: y = np.random.randint(0, z) else: y = 0 slice_t = a[:, x, y:z, :] self.assertAllEqual(slice_t.eval(), inp[:, x, y:z, :]) def testRandom(self): # Random dims of rank 6 input_shape = np.random.randint(0, 20, size=6) inp = np.random.rand(*input_shape).astype("f") with self.session(use_gpu=True) as sess: a = constant_op.constant( [float(x) for x in inp.ravel(order="C")], shape=input_shape, dtype=dtypes.float32) indices = [0 if x == 0 else np.random.randint(x) for x in input_shape] sizes = [ np.random.randint(0, input_shape[i] - indices[i] + 1) for i in range(6) ] slice_t = array_ops.slice(a, indices, sizes) slice2_t = a[indices[0]:indices[0] + sizes[0], indices[1]:indices[ 1] + sizes[1], indices[2]:indices[2] + sizes[2], indices[3]:indices[3] + sizes[3], indices[4]:indices[4] + sizes[4], indices[5]: indices[5] + sizes[5]] slice_val, slice2_val = sess.run([slice_t, slice2_t]) expected_val = inp[indices[0]:indices[0] + sizes[0], indices[1]:indices[ 1] + sizes[1], indices[2]:indices[2] + sizes[2], indices[3]:indices[ 3] + sizes[3], indices[4]:indices[4] + sizes[4], indices[5]:indices[ 5] + sizes[5]] self.assertAllEqual(slice_val, expected_val) self.assertAllEqual(slice2_val, expected_val) self.assertEqual(expected_val.shape, slice_t.get_shape()) self.assertEqual(expected_val.shape, slice2_t.get_shape()) def testPartialShapeInference(self): z = array_ops.zeros((1, 2, 3)) self.assertAllEqual(z.get_shape().as_list(), [1, 2, 3]) m1 = array_ops.slice(z, [0, 0, 0], [-1, -1, -1]) self.assertAllEqual(m1.get_shape().as_list(), [1, 2, 3]) m2 = array_ops.slice(z, [0, 0, 0], [constant_op.constant(1) + 0, 2, -1]) self.assertAllEqual(m2.get_shape().as_list(), [1, 2, 3]) def _testGradientSlice(self, input_shape, slice_begin, slice_size): with self.cached_session(use_gpu=True): num_inputs = np.prod(input_shape) num_grads = np.prod(slice_size) inp = np.random.rand(num_inputs).astype("f").reshape(input_shape) a = constant_op.constant( [float(x) for x in inp.ravel(order="C")], shape=input_shape, dtype=dtypes.float32) slice_t = array_ops.slice(a, slice_begin, slice_size) grads = np.random.rand(num_grads).astype("f").reshape(slice_size) grad_tensor = constant_op.constant(grads) grad = gradients_impl.gradients(slice_t, [a], grad_tensor)[0] result = self.evaluate(grad) # Create a zero tensor of the input shape ane place # the grads into the right location to compare against TensorFlow. np_ans = np.zeros(input_shape) slices = [] for i in xrange(len(input_shape)): slices.append(slice(slice_begin[i], slice_begin[i] + slice_size[i])) np_ans[slices] = grads self.assertAllClose(np_ans, result) def _testGradientVariableSize(self): with self.cached_session(use_gpu=True): inp = constant_op.constant([1.0, 2.0, 3.0], name="in") out = array_ops.slice(inp, [1], [-1]) grad_actual = gradients_impl.gradients(out, inp)[0].eval() self.assertAllClose([0., 1., 1.], grad_actual) def _testGradientVariableSize2D(self): # Regression test for bug in slice. A low-level bug in Eigen was causing # incorrect results for negative indices in multi-dimensional tensors. # See b/114318298. with self.cached_session(use_gpu=True) as sess: x = constant_op.constant([[1., 2., 3.], [4., 5., 6.], [7., 8., 7]]) loss1 = math_ops.reduce_sum(x[:-1, :-1] * 1.0) loss2 = math_ops.reduce_sum(x[:-1][:, :-1]) g1 = gradients_impl.gradients(loss1, x)[0] g2 = gradients_impl.gradients(loss2, x)[0] g1_val, g2_val = sess.run([g1, g2]) self.assertAllEqual(g1_val, g2_val) def testGradientsAll(self): # Slice the middle square out of a 4x4 input self._testGradientSlice([4, 4], [1, 1], [2, 2]) # Slice the upper left square out of a 4x4 input self._testGradientSlice([4, 4], [0, 0], [2, 2]) # Slice a non-square input starting from (2,1) self._testGradientSlice([4, 4], [2, 1], [1, 2]) # Slice a 3D tensor self._testGradientSlice([3, 3, 3], [0, 1, 0], [2, 1, 1]) # Use -1 as a slice dimension. self._testGradientVariableSize() # Use -1 as a slice dimension on a 2D tensor. self._testGradientVariableSize2D() def testNotIterable(self): # NOTE(mrry): If we register __getitem__ as an overloaded # operator, Python will valiantly attempt to iterate over the # Tensor from 0 to infinity. This test ensures that this # unintended behavior is prevented. c = constant_op.constant(5.0) with self.assertRaisesWithPredicateMatch( TypeError, lambda e: "Tensor objects are only iterable" in str(e)): for _ in c: pass def testComputedShape(self): # NOTE(mrry): We cannot currently handle partially-known values, # because `tf.slice()` uses -1 to specify a wildcard size, and # this can't be handled using the # `tensor_util.constant_value_as_shape()` trick. a = constant_op.constant([[1, 2, 3], [4, 5, 6]]) begin = constant_op.constant(0) size = constant_op.constant(1) b = array_ops.slice(a, [begin, 0], [size, 2]) self.assertEqual([1, 2], b.get_shape()) begin = array_ops.placeholder(dtypes.int32, shape=()) c = array_ops.slice(a, [begin, 0], [-1, 2]) self.assertEqual([None, 2], c.get_shape().as_list()) def testSliceOfSlice(self): with self.session(use_gpu=True): a = constant_op.constant([[1, 2, 3], [4, 5, 6], [7, 8, 9], [10, 11, 12]]) b = a[1:, :] c = b[:-1, :] d = c[1, :] res = 2 * d - c[1, :] + a[2, :] - 2 * b[-2, :] self.assertAllEqual([0, 0, 0], self.evaluate(res)) if __name__ == "__main__": test.main()
"""Default variable filters.""" import re from decimal import Decimal, InvalidOperation, ROUND_HALF_UP import random as random_module try: from functools import wraps except ImportError: from django.utils.functional import wraps # Python 2.4 fallback. from django.template.base import Variable, Library from django.conf import settings from django.utils import formats from django.utils.encoding import force_unicode, iri_to_uri from django.utils.html import conditional_escape from django.utils.safestring import mark_safe, SafeData from django.utils.translation import ugettext, ungettext register = Library() ####################### # STRING DECORATOR # ####################### def stringfilter(func): """ Decorator for filters which should only receive unicode objects. The object passed as the first positional argument will be converted to a unicode object. """ def _dec(*args, **kwargs): if args: args = list(args) args[0] = force_unicode(args[0]) if isinstance(args[0], SafeData) and getattr(func, 'is_safe', False): return mark_safe(func(*args, **kwargs)) return func(*args, **kwargs) # Include a reference to the real function (used to check original # arguments by the template parser). _dec._decorated_function = getattr(func, '_decorated_function', func) for attr in ('is_safe', 'needs_autoescape'): if hasattr(func, attr): setattr(_dec, attr, getattr(func, attr)) return wraps(func)(_dec) ################### # STRINGS # ################### def addslashes(value): """ Adds slashes before quotes. Useful for escaping strings in CSV, for example. Less useful for escaping JavaScript; use the ``escapejs`` filter instead. """ return value.replace('\\', '\\\\').replace('"', '\\"').replace("'", "\\'") addslashes.is_safe = True addslashes = stringfilter(addslashes) def capfirst(value): """Capitalizes the first character of the value.""" return value and value[0].upper() + value[1:] capfirst.is_safe=True capfirst = stringfilter(capfirst) def escapejs(value): """Hex encodes characters for use in JavaScript strings.""" from django.utils.html import escapejs return escapejs(value) escapejs = stringfilter(escapejs) def fix_ampersands(value): """Replaces ampersands with ``&amp;`` entities.""" from django.utils.html import fix_ampersands return fix_ampersands(value) fix_ampersands.is_safe=True fix_ampersands = stringfilter(fix_ampersands) # Values for testing floatformat input against infinity and NaN representations, # which differ across platforms and Python versions. Some (i.e. old Windows # ones) are not recognized by Decimal but we want to return them unchanged vs. # returning an empty string as we do for completley invalid input. Note these # need to be built up from values that are not inf/nan, since inf/nan values do # not reload properly from .pyc files on Windows prior to some level of Python 2.5 # (see Python Issue757815 and Issue1080440). pos_inf = 1e200 * 1e200 neg_inf = -1e200 * 1e200 nan = (1e200 * 1e200) / (1e200 * 1e200) special_floats = [str(pos_inf), str(neg_inf), str(nan)] def floatformat(text, arg=-1): """ Displays a float to a specified number of decimal places. If called without an argument, it displays the floating point number with one decimal place -- but only if there's a decimal place to be displayed: * num1 = 34.23234 * num2 = 34.00000 * num3 = 34.26000 * {{ num1|floatformat }} displays "34.2" * {{ num2|floatformat }} displays "34" * {{ num3|floatformat }} displays "34.3" If arg is positive, it will always display exactly arg number of decimal places: * {{ num1|floatformat:3 }} displays "34.232" * {{ num2|floatformat:3 }} displays "34.000" * {{ num3|floatformat:3 }} displays "34.260" If arg is negative, it will display arg number of decimal places -- but only if there are places to be displayed: * {{ num1|floatformat:"-3" }} displays "34.232" * {{ num2|floatformat:"-3" }} displays "34" * {{ num3|floatformat:"-3" }} displays "34.260" If the input float is infinity or NaN, the (platform-dependent) string representation of that value will be displayed. """ try: input_val = force_unicode(text) d = Decimal(input_val) except UnicodeEncodeError: return u'' except InvalidOperation: if input_val in special_floats: return input_val try: d = Decimal(force_unicode(float(text))) except (ValueError, InvalidOperation, TypeError, UnicodeEncodeError): return u'' try: p = int(arg) except ValueError: return input_val try: m = int(d) - d except (ValueError, OverflowError, InvalidOperation): return input_val if not m and p < 0: return mark_safe(formats.number_format(u'%d' % (int(d)), 0)) if p == 0: exp = Decimal(1) else: exp = Decimal(u'1.0') / (Decimal(10) ** abs(p)) try: # Avoid conversion to scientific notation by accessing `sign`, `digits` # and `exponent` from `Decimal.as_tuple()` directly. sign, digits, exponent = d.quantize(exp, ROUND_HALF_UP).as_tuple() digits = [unicode(digit) for digit in reversed(digits)] while len(digits) <= abs(exponent): digits.append(u'0') digits.insert(-exponent, u'.') if sign: digits.append(u'-') number = u''.join(reversed(digits)) return mark_safe(formats.number_format(number, abs(p))) except InvalidOperation: return input_val floatformat.is_safe = True def iriencode(value): """Escapes an IRI value for use in a URL.""" return force_unicode(iri_to_uri(value)) iriencode.is_safe = True iriencode = stringfilter(iriencode) def linenumbers(value, autoescape=None): """Displays text with line numbers.""" from django.utils.html import escape lines = value.split(u'\n') # Find the maximum width of the line count, for use with zero padding # string format command width = unicode(len(unicode(len(lines)))) if not autoescape or isinstance(value, SafeData): for i, line in enumerate(lines): lines[i] = (u"%0" + width + u"d. %s") % (i + 1, line) else: for i, line in enumerate(lines): lines[i] = (u"%0" + width + u"d. %s") % (i + 1, escape(line)) return mark_safe(u'\n'.join(lines)) linenumbers.is_safe = True linenumbers.needs_autoescape = True linenumbers = stringfilter(linenumbers) def lower(value): """Converts a string into all lowercase.""" return value.lower() lower.is_safe = True lower = stringfilter(lower) def make_list(value): """ Returns the value turned into a list. For an integer, it's a list of digits. For a string, it's a list of characters. """ return list(value) make_list.is_safe = False make_list = stringfilter(make_list) def slugify(value): """ Normalizes string, converts to lowercase, removes non-alpha characters, and converts spaces to hyphens. """ import unicodedata value = unicodedata.normalize('NFKD', value).encode('ascii', 'ignore') value = unicode(re.sub('[^\w\s-]', '', value).strip().lower()) return mark_safe(re.sub('[-\s]+', '-', value)) slugify.is_safe = True slugify = stringfilter(slugify) def stringformat(value, arg): """ Formats the variable according to the arg, a string formatting specifier. This specifier uses Python string formating syntax, with the exception that the leading "%" is dropped. See http://docs.python.org/lib/typesseq-strings.html for documentation of Python string formatting """ try: return (u"%" + unicode(arg)) % value except (ValueError, TypeError): return u"" stringformat.is_safe = True def title(value): """Converts a string into titlecase.""" t = re.sub("([a-z])'([A-Z])", lambda m: m.group(0).lower(), value.title()) return re.sub("\d([A-Z])", lambda m: m.group(0).lower(), t) title.is_safe = True title = stringfilter(title) def truncatewords(value, arg): """ Truncates a string after a certain number of words. Argument: Number of words to truncate after. Newlines within the string are removed. """ from django.utils.text import truncate_words try: length = int(arg) except ValueError: # Invalid literal for int(). return value # Fail silently. return truncate_words(value, length) truncatewords.is_safe = True truncatewords = stringfilter(truncatewords) def truncatewords_html(value, arg): """ Truncates HTML after a certain number of words. Argument: Number of words to truncate after. Newlines in the HTML are preserved. """ from django.utils.text import truncate_html_words try: length = int(arg) except ValueError: # invalid literal for int() return value # Fail silently. return truncate_html_words(value, length) truncatewords_html.is_safe = True truncatewords_html = stringfilter(truncatewords_html) def upper(value): """Converts a string into all uppercase.""" return value.upper() upper.is_safe = False upper = stringfilter(upper) def urlencode(value, safe=None): """ Escapes a value for use in a URL. Takes an optional ``safe`` parameter used to determine the characters which should not be escaped by Django's ``urlquote`` method. If not provided, the default safe characters will be used (but an empty string can be provided when *all* characters should be escaped). """ from django.utils.http import urlquote kwargs = {} if safe is not None: kwargs['safe'] = safe return urlquote(value, **kwargs) urlencode.is_safe = False urlencode = stringfilter(urlencode) def urlize(value, autoescape=None): """Converts URLs in plain text into clickable links.""" from django.utils.html import urlize return mark_safe(urlize(value, nofollow=True, autoescape=autoescape)) urlize.is_safe=True urlize.needs_autoescape = True urlize = stringfilter(urlize) def urlizetrunc(value, limit, autoescape=None): """ Converts URLs into clickable links, truncating URLs to the given character limit, and adding 'rel=nofollow' attribute to discourage spamming. Argument: Length to truncate URLs to. """ from django.utils.html import urlize return mark_safe(urlize(value, trim_url_limit=int(limit), nofollow=True, autoescape=autoescape)) urlizetrunc.is_safe = True urlizetrunc.needs_autoescape = True urlizetrunc = stringfilter(urlizetrunc) def wordcount(value): """Returns the number of words.""" return len(value.split()) wordcount.is_safe = False wordcount = stringfilter(wordcount) def wordwrap(value, arg): """ Wraps words at specified line length. Argument: number of characters to wrap the text at. """ from django.utils.text import wrap return wrap(value, int(arg)) wordwrap.is_safe = True wordwrap = stringfilter(wordwrap) def ljust(value, arg): """ Left-aligns the value in a field of a given width. Argument: field size. """ return value.ljust(int(arg)) ljust.is_safe = True ljust = stringfilter(ljust) def rjust(value, arg): """ Right-aligns the value in a field of a given width. Argument: field size. """ return value.rjust(int(arg)) rjust.is_safe = True rjust = stringfilter(rjust) def center(value, arg): """Centers the value in a field of a given width.""" return value.center(int(arg)) center.is_safe = True center = stringfilter(center) def cut(value, arg): """ Removes all values of arg from the given string. """ safe = isinstance(value, SafeData) value = value.replace(arg, u'') if safe and arg != ';': return mark_safe(value) return value cut = stringfilter(cut) ################### # HTML STRINGS # ################### def escape(value): """ Marks the value as a string that should not be auto-escaped. """ from django.utils.safestring import mark_for_escaping return mark_for_escaping(value) escape.is_safe = True escape = stringfilter(escape) def force_escape(value): """ Escapes a string's HTML. This returns a new string containing the escaped characters (as opposed to "escape", which marks the content for later possible escaping). """ from django.utils.html import escape return mark_safe(escape(value)) force_escape = stringfilter(force_escape) force_escape.is_safe = True def linebreaks(value, autoescape=None): """ Replaces line breaks in plain text with appropriate HTML; a single newline becomes an HTML line break (``<br />``) and a new line followed by a blank line becomes a paragraph break (``</p>``). """ from django.utils.html import linebreaks autoescape = autoescape and not isinstance(value, SafeData) return mark_safe(linebreaks(value, autoescape)) linebreaks.is_safe = True linebreaks.needs_autoescape = True linebreaks = stringfilter(linebreaks) def linebreaksbr(value, autoescape=None): """ Converts all newlines in a piece of plain text to HTML line breaks (``<br />``). """ if autoescape and not isinstance(value, SafeData): from django.utils.html import escape value = escape(value) return mark_safe(value.replace('\n', '<br />')) linebreaksbr.is_safe = True linebreaksbr.needs_autoescape = True linebreaksbr = stringfilter(linebreaksbr) def safe(value): """ Marks the value as a string that should not be auto-escaped. """ return mark_safe(value) safe.is_safe = True safe = stringfilter(safe) def safeseq(value): """ A "safe" filter for sequences. Marks each element in the sequence, individually, as safe, after converting them to unicode. Returns a list with the results. """ return [mark_safe(force_unicode(obj)) for obj in value] safeseq.is_safe = True def removetags(value, tags): """Removes a space separated list of [X]HTML tags from the output.""" tags = [re.escape(tag) for tag in tags.split()] tags_re = u'(%s)' % u'|'.join(tags) starttag_re = re.compile(ur'<%s(/?>|(\s+[^>]*>))' % tags_re, re.U) endtag_re = re.compile(u'</%s>' % tags_re) value = starttag_re.sub(u'', value) value = endtag_re.sub(u'', value) return value removetags.is_safe = True removetags = stringfilter(removetags) def striptags(value): """Strips all [X]HTML tags.""" from django.utils.html import strip_tags return strip_tags(value) striptags.is_safe = True striptags = stringfilter(striptags) ################### # LISTS # ################### def dictsort(value, arg): """ Takes a list of dicts, returns that list sorted by the property given in the argument. """ return sorted(value, key=Variable(arg).resolve) dictsort.is_safe = False def dictsortreversed(value, arg): """ Takes a list of dicts, returns that list sorted in reverse order by the property given in the argument. """ return sorted(value, key=Variable(arg).resolve, reverse=True) dictsortreversed.is_safe = False def first(value): """Returns the first item in a list.""" try: return value[0] except IndexError: return u'' first.is_safe = False def join(value, arg, autoescape=None): """ Joins a list with a string, like Python's ``str.join(list)``. """ value = map(force_unicode, value) if autoescape: value = [conditional_escape(v) for v in value] try: data = conditional_escape(arg).join(value) except AttributeError: # fail silently but nicely return value return mark_safe(data) join.is_safe = True join.needs_autoescape = True def last(value): "Returns the last item in a list" try: return value[-1] except IndexError: return u'' last.is_safe = True def length(value): """Returns the length of the value - useful for lists.""" try: return len(value) except (ValueError, TypeError): return '' length.is_safe = True def length_is(value, arg): """Returns a boolean of whether the value's length is the argument.""" try: return len(value) == int(arg) except (ValueError, TypeError): return '' length_is.is_safe = False def random(value): """Returns a random item from the list.""" return random_module.choice(value) random.is_safe = True def slice_(value, arg): """ Returns a slice of the list. Uses the same syntax as Python's list slicing; see http://diveintopython.org/native_data_types/lists.html#odbchelper.list.slice for an introduction. """ try: bits = [] for x in arg.split(u':'): if len(x) == 0: bits.append(None) else: bits.append(int(x)) return value[slice(*bits)] except (ValueError, TypeError): return value # Fail silently. slice_.is_safe = True def unordered_list(value, autoescape=None): """ Recursively takes a self-nested list and returns an HTML unordered list -- WITHOUT opening and closing <ul> tags. The list is assumed to be in the proper format. For example, if ``var`` contains: ``['States', ['Kansas', ['Lawrence', 'Topeka'], 'Illinois']]``, then ``{{ var|unordered_list }}`` would return:: <li>States <ul> <li>Kansas <ul> <li>Lawrence</li> <li>Topeka</li> </ul> </li> <li>Illinois</li> </ul> </li> """ if autoescape: from django.utils.html import conditional_escape escaper = conditional_escape else: escaper = lambda x: x def convert_old_style_list(list_): """ Converts old style lists to the new easier to understand format. The old list format looked like: ['Item 1', [['Item 1.1', []], ['Item 1.2', []]] And it is converted to: ['Item 1', ['Item 1.1', 'Item 1.2]] """ if not isinstance(list_, (tuple, list)) or len(list_) != 2: return list_, False first_item, second_item = list_ if second_item == []: return [first_item], True try: it = iter(second_item) # see if second item is iterable except TypeError: return list_, False old_style_list = True new_second_item = [] for sublist in second_item: item, old_style_list = convert_old_style_list(sublist) if not old_style_list: break new_second_item.extend(item) if old_style_list: second_item = new_second_item return [first_item, second_item], old_style_list def _helper(list_, tabs=1): indent = u'\t' * tabs output = [] list_length = len(list_) i = 0 while i < list_length: title = list_[i] sublist = '' sublist_item = None if isinstance(title, (list, tuple)): sublist_item = title title = '' elif i < list_length - 1: next_item = list_[i+1] if next_item and isinstance(next_item, (list, tuple)): # The next item is a sub-list. sublist_item = next_item # We've processed the next item now too. i += 1 if sublist_item: sublist = _helper(sublist_item, tabs+1) sublist = '\n%s<ul>\n%s\n%s</ul>\n%s' % (indent, sublist, indent, indent) output.append('%s<li>%s%s</li>' % (indent, escaper(force_unicode(title)), sublist)) i += 1 return '\n'.join(output) value, converted = convert_old_style_list(value) return mark_safe(_helper(value)) unordered_list.is_safe = True unordered_list.needs_autoescape = True ################### # INTEGERS # ################### def add(value, arg): """Adds the arg to the value.""" try: return int(value) + int(arg) except (ValueError, TypeError): try: return value + arg except: return value add.is_safe = False def get_digit(value, arg): """ Given a whole number, returns the requested digit of it, where 1 is the right-most digit, 2 is the second-right-most digit, etc. Returns the original value for invalid input (if input or argument is not an integer, or if argument is less than 1). Otherwise, output is always an integer. """ try: arg = int(arg) value = int(value) except ValueError: return value # Fail silently for an invalid argument if arg < 1: return value try: return int(str(value)[-arg]) except IndexError: return 0 get_digit.is_safe = False ################### # DATES # ################### def date(value, arg=None): """Formats a date according to the given format.""" from django.utils.dateformat import format if not value: return u'' if arg is None: arg = settings.DATE_FORMAT try: return formats.date_format(value, arg) except AttributeError: try: return format(value, arg) except AttributeError: return '' date.is_safe = False def time(value, arg=None): """Formats a time according to the given format.""" from django.utils import dateformat if value in (None, u''): return u'' if arg is None: arg = settings.TIME_FORMAT try: return formats.time_format(value, arg) except AttributeError: try: return dateformat.time_format(value, arg) except AttributeError: return '' time.is_safe = False def timesince(value, arg=None): """Formats a date as the time since that date (i.e. "4 days, 6 hours").""" from django.utils.timesince import timesince if not value: return u'' try: if arg: return timesince(value, arg) return timesince(value) except (ValueError, TypeError): return u'' timesince.is_safe = False def timeuntil(value, arg=None): """Formats a date as the time until that date (i.e. "4 days, 6 hours").""" from django.utils.timesince import timeuntil if not value: return u'' try: return timeuntil(value, arg) except (ValueError, TypeError): return u'' timeuntil.is_safe = False ################### # LOGIC # ################### def default(value, arg): """If value is unavailable, use given default.""" return value or arg default.is_safe = False def default_if_none(value, arg): """If value is None, use given default.""" if value is None: return arg return value default_if_none.is_safe = False def divisibleby(value, arg): """Returns True if the value is devisible by the argument.""" return int(value) % int(arg) == 0 divisibleby.is_safe = False def yesno(value, arg=None): """ Given a string mapping values for true, false and (optionally) None, returns one of those strings accoding to the value: ========== ====================== ================================== Value Argument Outputs ========== ====================== ================================== ``True`` ``"yeah,no,maybe"`` ``yeah`` ``False`` ``"yeah,no,maybe"`` ``no`` ``None`` ``"yeah,no,maybe"`` ``maybe`` ``None`` ``"yeah,no"`` ``"no"`` (converts None to False if no mapping for None is given. ========== ====================== ================================== """ if arg is None: arg = ugettext('yes,no,maybe') bits = arg.split(u',') if len(bits) < 2: return value # Invalid arg. try: yes, no, maybe = bits except ValueError: # Unpack list of wrong size (no "maybe" value provided). yes, no, maybe = bits[0], bits[1], bits[1] if value is None: return maybe if value: return yes return no yesno.is_safe = False ################### # MISC # ################### def filesizeformat(bytes): """ Formats the value like a 'human-readable' file size (i.e. 13 KB, 4.1 MB, 102 bytes, etc). """ try: bytes = float(bytes) except (TypeError,ValueError,UnicodeDecodeError): return ungettext("%(size)d byte", "%(size)d bytes", 0) % {'size': 0} filesize_number_format = lambda value: formats.number_format(round(value, 1), 1) if bytes < 1024: return ungettext("%(size)d byte", "%(size)d bytes", bytes) % {'size': bytes} if bytes < 1024 * 1024: return ugettext("%s KB") % filesize_number_format(bytes / 1024) if bytes < 1024 * 1024 * 1024: return ugettext("%s MB") % filesize_number_format(bytes / (1024 * 1024)) if bytes < 1024 * 1024 * 1024 * 1024: return ugettext("%s GB") % filesize_number_format(bytes / (1024 * 1024 * 1024)) if bytes < 1024 * 1024 * 1024 * 1024 * 1024: return ugettext("%s TB") % filesize_number_format(bytes / (1024 * 1024 * 1024 * 1024)) return ugettext("%s PB") % filesize_number_format(bytes / (1024 * 1024 * 1024 * 1024 * 1024)) filesizeformat.is_safe = True def pluralize(value, arg=u's'): """ Returns a plural suffix if the value is not 1. By default, 's' is used as the suffix: * If value is 0, vote{{ value|pluralize }} displays "0 votes". * If value is 1, vote{{ value|pluralize }} displays "1 vote". * If value is 2, vote{{ value|pluralize }} displays "2 votes". If an argument is provided, that string is used instead: * If value is 0, class{{ value|pluralize:"es" }} displays "0 classes". * If value is 1, class{{ value|pluralize:"es" }} displays "1 class". * If value is 2, class{{ value|pluralize:"es" }} displays "2 classes". If the provided argument contains a comma, the text before the comma is used for the singular case and the text after the comma is used for the plural case: * If value is 0, cand{{ value|pluralize:"y,ies" }} displays "0 candies". * If value is 1, cand{{ value|pluralize:"y,ies" }} displays "1 candy". * If value is 2, cand{{ value|pluralize:"y,ies" }} displays "2 candies". """ if not u',' in arg: arg = u',' + arg bits = arg.split(u',') if len(bits) > 2: return u'' singular_suffix, plural_suffix = bits[:2] try: if int(value) != 1: return plural_suffix except ValueError: # Invalid string that's not a number. pass except TypeError: # Value isn't a string or a number; maybe it's a list? try: if len(value) != 1: return plural_suffix except TypeError: # len() of unsized object. pass return singular_suffix pluralize.is_safe = False def phone2numeric(value): """Takes a phone number and converts it in to its numerical equivalent.""" from django.utils.text import phone2numeric return phone2numeric(value) phone2numeric.is_safe = True def pprint(value): """A wrapper around pprint.pprint -- for debugging, really.""" from pprint import pformat try: return pformat(value) except Exception, e: return u"Error in formatting: %s" % force_unicode(e, errors="replace") pprint.is_safe = True # Syntax: register.filter(name of filter, callback) register.filter(add) register.filter(addslashes) register.filter(capfirst) register.filter(center) register.filter(cut) register.filter(date) register.filter(default) register.filter(default_if_none) register.filter(dictsort) register.filter(dictsortreversed) register.filter(divisibleby) register.filter(escape) register.filter(escapejs) register.filter(filesizeformat) register.filter(first) register.filter(fix_ampersands) register.filter(floatformat) register.filter(force_escape) register.filter(get_digit) register.filter(iriencode) register.filter(join) register.filter(last) register.filter(length) register.filter(length_is) register.filter(linebreaks) register.filter(linebreaksbr) register.filter(linenumbers) register.filter(ljust) register.filter(lower) register.filter(make_list) register.filter(phone2numeric) register.filter(pluralize) register.filter(pprint) register.filter(removetags) register.filter(random) register.filter(rjust) register.filter(safe) register.filter(safeseq) register.filter('slice', slice_) register.filter(slugify) register.filter(stringformat) register.filter(striptags) register.filter(time) register.filter(timesince) register.filter(timeuntil) register.filter(title) register.filter(truncatewords) register.filter(truncatewords_html) register.filter(unordered_list) register.filter(upper) register.filter(urlencode) register.filter(urlize) register.filter(urlizetrunc) register.filter(wordcount) register.filter(wordwrap) register.filter(yesno)
############################################################################### ## ## Copyright (C) 2011-2014 Tavendo GmbH ## ## Licensed under the Apache License, Version 2.0 (the "License"); ## you may not use this file except in compliance with the License. ## You may obtain a copy of the License at ## ## http://www.apache.org/licenses/LICENSE-2.0 ## ## Unless required by applicable law or agreed to in writing, software ## distributed under the License is distributed on an "AS IS" BASIS, ## WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. ## See the License for the specific language governing permissions and ## limitations under the License. ## ############################################################################### ## don't touch: must be first import! import choosereactor import os, json, sys, pkg_resources from twisted.internet import reactor from twisted.python import log, usage from twisted.internet.defer import Deferred ## for versions import autobahn import autobahntestsuite from autobahn.websocket.utf8validator import Utf8Validator from autobahn.websocket.xormasker import XorMaskerNull ## WebSocket testing modes import testee import fuzzing ## WAMP testing modes import wamptestee import wampfuzzing ## Misc testing modes import echo import broadcast import massconnect import wsperfcontrol import wsperfmaster import serializer from spectemplate import SPEC_FUZZINGSERVER, \ SPEC_FUZZINGCLIENT, \ SPEC_FUZZINGWAMPSERVER, \ SPEC_FUZZINGWAMPCLIENT, \ SPEC_WSPERFCONTROL, \ SPEC_MASSCONNECT class WsTestOptions(usage.Options): """ Reads options from the command-line and checks them for plausibility. """ # Available modes, specified with the --mode (or short: -m) flag. MODES = ['echoserver', 'echoclient', 'broadcastclient', 'broadcastserver', 'fuzzingserver', 'fuzzingclient', #'fuzzingwampserver', #'fuzzingwampclient', 'testeeserver', 'testeeclient', #'wsperfcontrol', #'wsperfmaster', #'wampserver', #'wamptesteeserver', #'wampclient', 'massconnect', #'web', #'import', #'export', 'serializer' ] # Modes that need a specification file MODES_NEEDING_SPEC = ['fuzzingclient', 'fuzzingserver', 'fuzzingwampserver', 'fuzzingwampclient', 'wsperfcontrol', 'massconnect', 'import'] # Modes that need a Websocket URI MODES_NEEDING_WSURI = ['echoclient', 'echoserver', 'broadcastclient', 'broadcastserver', 'testeeclient', 'testeeserver', 'wsperfcontrol', 'wampserver', 'wampclient', 'wamptesteeserver'] # Default content of specification files for various modes DEFAULT_SPECIFICATIONS = {'fuzzingclient': SPEC_FUZZINGCLIENT, 'fuzzingserver': SPEC_FUZZINGSERVER, 'wsperfcontrol': SPEC_WSPERFCONTROL, 'massconnect': SPEC_MASSCONNECT, 'fuzzingwampclient': SPEC_FUZZINGWAMPCLIENT, 'fuzzingwampserver': SPEC_FUZZINGWAMPSERVER} optParameters = [ ['mode', 'm', None, 'Test mode, one of: %s [required]' % ', '.join(MODES)], ['testset', 't', None, 'Run a test set from an import test spec.'], ['spec', 's', None, 'Test specification file [required in some modes].'], ['outfile', 'o', None, 'Output filename for modes that generate testdata.'], ['wsuri', 'w', None, 'WebSocket URI [required in some modes].'], ['ident', 'i', None, ('Testee client identifier [optional for client testees].')], ['key', 'k', None, ('Server private key file for secure WebSocket (WSS) [required in server modes for WSS].')], ['cert', 'c', None, ('Server certificate file for secure WebSocket (WSS) [required in server modes for WSS].')] ] optFlags = [ ['debug', 'd', 'Debug output [default: off].'], ['autobahnversion', 'a', 'Print version information for Autobahn and AutobahnTestSuite.'] ] def postOptions(self): """ Process the given options. Perform plausibility checks, etc... """ if self['autobahnversion']: print "Autobahn %s" % autobahn.version print "AutobahnTestSuite %s" % autobahntestsuite.version sys.exit(0) if not self['mode']: raise usage.UsageError, "a mode must be specified to run!" if self['mode'] not in WsTestOptions.MODES: raise usage.UsageError, ( "Mode '%s' is invalid.\nAvailable modes:\n\t- %s" % ( self['mode'], "\n\t- ".join(sorted(WsTestOptions.MODES)))) if (self['mode'] in WsTestOptions.MODES_NEEDING_WSURI and not self['wsuri']): raise usage.UsageError, "mode needs a WebSocket URI!" class WsTestRunner(object): """ Testsuite driver. """ def __init__(self, options, spec = None): self.options = options self.spec = spec self.debug = self.options.get('debug', False) if self.debug: log.startLogging(sys.stdout) self.mode = str(self.options['mode']) def startService(self): """ Start mode specific services. """ print print "Using Twisted reactor class %s" % str(reactor.__class__) print "Using UTF8 Validator class %s" % str(Utf8Validator) print "Using XOR Masker classes %s" % str(XorMaskerNull) #print "Using JSON processor module '%s'" % str(autobahn.wamp.json_lib.__name__) print if self.mode == "import": return self.startImportSpec(self.options['spec']) elif self.mode == "export": return self.startExportSpec(self.options['testset'], self.options.get('spec', None)) elif self.mode == "fuzzingwampclient": return self.startFuzzingWampClient(self.options['testset']) elif self.mode == "web": return self.startWeb(debug = self.debug) elif self.mode == "testeeclient": return testee.startClient(self.options['wsuri'], ident = self.options['ident'], debug = self.debug) elif self.mode == "testeeserver": return testee.startServer(self.options['wsuri'], debug = self.debug) elif self.mode == "broadcastclient": return broadcast.startClient(self.options['wsuri'], debug = self.debug) elif self.mode == "broadcastserver": return broadcast.startServer(self.options['wsuri'], debug = self.debug) elif self.mode == "echoclient": return echo.startClient(self.options['wsuri'], debug = self.debug) elif self.mode == "echoserver": return echo.startServer(self.options['wsuri'], debug = self.debug) elif self.mode == "fuzzingclient": return fuzzing.startClient(self.spec, debug = self.debug) elif self.mode == "fuzzingserver": return fuzzing.startServer(self.spec, debug = self.debug) elif self.mode == "wsperfcontrol": return wsperfcontrol.startClient(self.options['wsuri'], self.spec, debug = self.debug) elif self.mode == "wsperfmaster": return wsperfmaster.startServer(debug = self.debug) elif self.mode == "massconnect": return massconnect.startClient(self.spec, debug = self.debug) elif self.mode == "serializer": return serializer.start(outfilename = self.options['outfile'], debug = self.debug) else: raise Exception("no mode '%s'" % self.mode) def start(options, spec = None): """ Actually startup a wstest run. :param options: Global options controlling wstest. :type options: dict :param spec: Test specification needed for certain modes. If none is given, but a spec is needed, a default spec is used. :type spec: dict """ if options['mode'] in WsTestOptions.MODES_NEEDING_SPEC and spec is None: spec = json.loads(WsTestOptions.DEFAULT_SPECIFICATIONS[options['mode']]) wstest = WsTestRunner(options, spec) res = wstest.startService() ## only start reactor for modes needing it ## if res: ## if mode wants to shutdown reactor after done (e.g. clients), ## hook up machinery to do so ## if isinstance(res, Deferred): def shutdown(_): reactor.stop() res.addBoth(shutdown) reactor.run() def run(): """ Run wstest from command line. This parses command line args etc. """ ## parse wstest command lines options ## cmdOpts = WsTestOptions() try: cmdOpts.parseOptions() except usage.UsageError, errortext: print '%s %s\n' % (sys.argv[0], errortext) print 'Try %s --help for usage details\n' % sys.argv[0] sys.exit(1) else: options = cmdOpts.opts ## check if mode needs a spec .. ## if options['mode'] in WsTestOptions.MODES_NEEDING_SPEC: ## .. if none was given .. ## if not options['spec']: ## .. assume canonical specfile name .. ## filename = "%s.json" % options['mode'] options['spec'] = filename if not os.path.isfile(filename): ## .. if file does not exist, autocreate a spec file ## content = WsTestOptions.DEFAULT_SPECIFICATIONS[options['mode']] print "Auto-generating spec file '%s'" % filename f = open(filename, 'w') f.write(content) f.close() else: ## .. use existing one ## print "Using implicit spec file '%s'" % filename else: ## use explicitly given specfile ## print "Using explicit spec file '%s'" % options['spec'] ## now load the spec .. ## spec_filename = os.path.abspath(options['spec']) print "Loading spec from %s" % spec_filename spec = json.loads(open(spec_filename).read()) else: ## mode does not rely on spec ## spec = None ## now start a wstest run .. ## start(options, spec) if __name__ == '__main__': run()
# Copyright (c) 2019 PaddlePaddle Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from __future__ import print_function import site import sys import os core_suffix = 'so' if os.name == 'nt': core_suffix = 'pyd' has_avx_core = False has_noavx_core = False current_path = os.path.abspath(os.path.dirname(__file__)) if os.path.exists(current_path + os.sep + 'core_avx.' + core_suffix): has_avx_core = True if os.path.exists(current_path + os.sep + 'core_noavx.' + core_suffix): has_noavx_core = True try: if os.name == 'nt': third_lib_path = current_path + os.sep + '..' + os.sep + 'libs' os.environ['path'] = third_lib_path + ';' + os.environ['path'] sys.path.insert(0, third_lib_path) except ImportError as e: from .. import compat as cpt if os.name == 'nt': executable_path = os.path.abspath(os.path.dirname(sys.executable)) raise ImportError( """NOTE: You may need to run \"set PATH=%s;%%PATH%%\" if you encounters \"DLL load failed\" errors. If you have python installed in other directory, replace \"%s\" with your own directory. The original error is: \n %s""" % (executable_path, executable_path, cpt.get_exception_message(e))) else: raise ImportError( """NOTE: You may need to run \"export LD_LIBRARY_PATH=/usr/local/lib:$LD_LIBRARY_PATH\" if you encounters \"libmkldnn.so not found\" errors. If you have python installed in other directory, replace \"/usr/local/lib\" with your own directory. The original error is: \n""" + cpt.get_exception_message(e)) except Exception as e: raise e def avx_supported(): """ Whether current system(Linux, MacOS, Windows) is supported with AVX. """ import platform from .. import compat as cpt sysstr = platform.system().lower() has_avx = False if sysstr == 'linux': try: has_avx = os.popen('cat /proc/cpuinfo | grep -i avx').read() != '' except Exception as e: sys.stderr.write('Can not get the AVX flag from /proc/cpuinfo.\n' 'The original error is: %s\n' % cpt.get_exception_message(e)) return has_avx elif sysstr == 'darwin': try: has_avx = os.popen( 'sysctl machdep.cpu.features | grep -i avx').read() != '' except Exception as e: sys.stderr.write( 'Can not get the AVX flag from machdep.cpu.features.\n' 'The original error is: %s\n' % cpt.get_exception_message(e)) if not has_avx: try: has_avx = os.popen( 'sysctl machdep.cpu.leaf7_features | grep -i avx').read( ) != '' except Exception as e: sys.stderr.write( 'Can not get the AVX flag from machdep.cpu.leaf7_features.\n' 'The original error is: %s\n' % cpt.get_exception_message(e)) return has_avx elif sysstr == 'windows': import ctypes ONE_PAGE = ctypes.c_size_t(0x1000) def asm_func(code_str, restype=ctypes.c_uint32, argtypes=()): # Call the code_str as a function # Alloc 1 page to ensure the protection pfnVirtualAlloc = ctypes.windll.kernel32.VirtualAlloc pfnVirtualAlloc.restype = ctypes.c_void_p MEM_COMMIT = ctypes.c_ulong(0x1000) PAGE_READWRITE = ctypes.c_ulong(0x4) address = pfnVirtualAlloc(None, ONE_PAGE, MEM_COMMIT, PAGE_READWRITE) if not address: raise Exception("Failed to VirtualAlloc") # Copy the code into the memory segment memmove = ctypes.CFUNCTYPE(ctypes.c_void_p, ctypes.c_void_p, ctypes.c_void_p, ctypes.c_size_t)(ctypes._memmove_addr) if memmove(address, code_str, len(code_str)) < 0: raise Exception("Failed to memmove") # Enable execute permissions PAGE_EXECUTE = ctypes.c_ulong(0x10) pfnVirtualProtect = ctypes.windll.kernel32.VirtualProtect res = pfnVirtualProtect( ctypes.c_void_p(address), ONE_PAGE, PAGE_EXECUTE, ctypes.byref(ctypes.c_ulong(0))) if not res: raise Exception("Failed VirtualProtect") # Flush instruction cache pfnGetCurrentProcess = ctypes.windll.kernel32.GetCurrentProcess pfnGetCurrentProcess.restype = ctypes.c_void_p prochandle = ctypes.c_void_p(pfnGetCurrentProcess()) res = ctypes.windll.kernel32.FlushInstructionCache( prochandle, ctypes.c_void_p(address), ONE_PAGE) if not res: raise Exception("Failed FlushInstructionCache") # Cast the memory to function functype = ctypes.CFUNCTYPE(restype, *argtypes) func = functype(address) return func, address # http://en.wikipedia.org/wiki/CPUID#EAX.3D1:_Processor_Info_and_Feature_Bits # mov eax,0x1; cpuid; mov cx, ax; ret code_str = b"\xB8\x01\x00\x00\x00\x0f\xa2\x89\xC8\xC3" avx_bit = 28 retval = 0 try: # Convert the code_str into a function that returns uint func, address = asm_func(code_str) retval = func() ctypes.windll.kernel32.VirtualFree( ctypes.c_void_p(address), ctypes.c_size_t(0), ONE_PAGE) except Exception as e: sys.stderr.write('Failed getting the AVX flag on Windows.\n' 'The original error is: %s\n' % cpt.get_exception_message(e)) return (retval & (1 << avx_bit)) > 0 else: sys.stderr.write('Do not get AVX flag on %s\n' % sysstr) return False load_noavx = False if avx_supported(): try: from .core_avx import * from .core_avx import __doc__, __file__, __name__, __package__ from .core_avx import __unittest_throw_exception__ from .core_avx import _append_python_callable_object_and_return_id from .core_avx import _cleanup, _Scope from .core_avx import _get_use_default_grad_op_desc_maker_ops from .core_avx import _is_program_version_supported from .core_avx import _set_eager_deletion_mode from .core_avx import _set_fuse_parameter_group_size from .core_avx import _set_fuse_parameter_memory_size from .core_avx import _is_dygraph_debug_enabled from .core_avx import _dygraph_debug_level from .core_avx import _set_paddle_lib_path from .core_avx import _save_static_dict from .core_avx import _load_static_dict from .core_avx import _save_dygraph_dict from .core_avx import _load_dygraph_dict from .core_avx import _create_loaded_parameter except Exception as e: if has_avx_core: raise e else: from .. import compat as cpt sys.stderr.write( 'WARNING: Do not have avx core. You may not build with AVX, ' 'but AVX is supported on local machine.\n You could build paddle ' 'WITH_AVX=ON to get better performance.\n' 'The original error is: %s\n' % cpt.get_exception_message(e)) load_noavx = True else: load_noavx = True if load_noavx: try: from .core_noavx import * from .core_noavx import __doc__, __file__, __name__, __package__ from .core_noavx import __unittest_throw_exception__ from .core_noavx import _append_python_callable_object_and_return_id from .core_noavx import _cleanup, _Scope from .core_noavx import _get_use_default_grad_op_desc_maker_ops from .core_noavx import _is_program_version_supported from .core_noavx import _set_eager_deletion_mode from .core_noavx import _set_fuse_parameter_group_size from .core_noavx import _set_fuse_parameter_memory_size from .core_noavx import _is_dygraph_debug_enabled from .core_noavx import _dygraph_debug_level from .core_noavx import _set_paddle_lib_path from .core_noavx import _save_static_dict from .core_noavx import _load_static_dict from .core_noavx import _save_dygraph_dict from .core_noavx import _load_dygraph_dict from .core_noavx import _create_loaded_parameter except Exception as e: if has_noavx_core: sys.stderr.write( 'Error: Can not import noavx core while this file exists ' + current_path + os.sep + 'core_noavx.' + core_suffix + '\n') raise e # set paddle lib path def set_paddle_lib_path(): site_dirs = site.getsitepackages() if hasattr( site, 'getsitepackages') else [x for x in sys.path if 'site-packages' in x] for site_dir in site_dirs: lib_dir = os.path.sep.join([site_dir, 'paddle', 'libs']) if os.path.exists(lib_dir): _set_paddle_lib_path(lib_dir) return if hasattr(site, 'USER_SITE'): lib_dir = os.path.sep.join([site.USER_SITE, 'paddle', 'libs']) if os.path.exists(lib_dir): _set_paddle_lib_path(lib_dir) set_paddle_lib_path()
# Copyright 2017-2018 Google Inc. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS-IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Launch the game and set up communication.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function from absl import logging import os import platform import shutil import subprocess import tempfile import time from absl import flags from future.builtins import range # pylint: disable=redefined-builtin import portpicker from pysc2.lib import remote_controller from pysc2.lib import stopwatch flags.DEFINE_bool( "sc2_verbose", False, "Enable SC2 verbose logging.", allow_hide_cpp=True) flags.DEFINE_bool( "sc2_verbose_mp", False, "Enable SC2 verbose multiplayer logging.") flags.DEFINE_bool("sc2_gdb", False, "Run SC2 in gdb.") flags.DEFINE_bool("sc2_strace", False, "Run SC2 in strace.") flags.DEFINE_integer("sc2_port", None, "If set, connect to the instance on " "localhost:sc2_port instead of launching one.") FLAGS = flags.FLAGS sw = stopwatch.sw class SC2LaunchError(Exception): pass class StarcraftProcess(object): """Launch a starcraft server, initialize a controller, and later, clean up. This is best used from run_configs, which decides which version to run, and where to find it. It is important to call `close` or use it as a context manager, otherwise you'll likely leak temp files and SC2 processes. """ def __init__(self, run_config, exec_path, version, full_screen=False, extra_args=None, verbose=False, host=None, port=None, connect=True, timeout_seconds=None, window_size=(640, 480), window_loc=(50, 50), **kwargs): """Launch the SC2 process. Args: run_config: `run_configs.lib.RunConfig` object. exec_path: Path to the binary to run. version: `run_configs.lib.Version` object. full_screen: Whether to launch the game window full_screen on win/mac. extra_args: List of additional args for the SC2 process. verbose: Whether to have the SC2 process do verbose logging. host: IP for the game to listen on for its websocket. This is usually "127.0.0.1", or "::1", but could be others as well. port: Port SC2 should listen on for the websocket. connect: Whether to create a RemoteController to connect. timeout_seconds: Timeout for the remote controller. window_size: Screen size if not full screen. window_loc: Screen location if not full screen. **kwargs: Extra arguments for _launch (useful for subclasses). """ self._proc = None self._controller = None self._check_exists(exec_path) self._tmp_dir = tempfile.mkdtemp(prefix="sc-", dir=run_config.tmp_dir) self._host = host or "127.0.0.1" self._port = FLAGS.sc2_port or port or portpicker.pick_unused_port() self._version = version args = [ exec_path, "-listen", self._host, "-port", str(self._port), "-dataDir", os.path.join(run_config.data_dir, ""), "-tempDir", os.path.join(self._tmp_dir, ""), ] if ":" in self._host: args += ["-ipv6"] if platform.system() != "Linux": if full_screen: args += ["-displayMode", "1"] else: args += [ "-displayMode", "0", "-windowwidth", str(window_size[0]), "-windowheight", str(window_size[1]), "-windowx", str(window_loc[0]), "-windowy", str(window_loc[1]), ] if verbose or FLAGS.sc2_verbose: args += ["-verbose"] if FLAGS.sc2_verbose_mp: args += ["-verboseMP"] if self._version and self._version.data_version: args += ["-dataVersion", self._version.data_version.upper()] if extra_args: args += extra_args if FLAGS.sc2_gdb: print("Launching: gdb", args[0]) print("GDB run command:") print(" run %s" % " ".join(args[1:])) print("\n") args = ["gdb", args[0]] timeout_seconds = 3600 * 6 elif FLAGS.sc2_strace: strace_out = "/tmp/sc2-strace.txt" print("Launching in strace. Redirecting output to", strace_out) args = ["strace", "-f", "-o", strace_out] + args else: logging.info("Launching SC2: %s", " ".join(args)) try: with sw("startup"): if not FLAGS.sc2_port: self._proc = self._launch(run_config, args, **kwargs) if connect: self._controller = remote_controller.RemoteController( self._host, self._port, self, timeout_seconds=timeout_seconds) except: self.close() raise @sw.decorate def close(self): """Shut down the game and clean up.""" if hasattr(self, "_controller") and self._controller: self._controller.quit() self._controller.close() self._controller = None self._shutdown() if hasattr(self, "_port") and self._port: if not FLAGS.sc2_port: portpicker.return_port(self._port) self._port = None if hasattr(self, "_tmp_dir") and os.path.exists(self._tmp_dir): shutil.rmtree(self._tmp_dir) @property def controller(self): return self._controller @property def host(self): return self._host @property def port(self): return self._port @property def version(self): return self._version def __enter__(self): return self.controller def __exit__(self, unused_exception_type, unused_exc_value, unused_traceback): self.close() def __del__(self): # Prefer using a context manager, but this cleans most other cases. self.close() def _check_exists(self, exec_path): if not os.path.isfile(exec_path): raise RuntimeError("Trying to run '%s', but it doesn't exist" % exec_path) if not os.access(exec_path, os.X_OK): raise RuntimeError( "Trying to run '%s', but it isn't executable." % exec_path) def _launch(self, run_config, args, **kwargs): """Launch the process and return the process object.""" del kwargs try: with sw("popen"): return subprocess.Popen(args, cwd=run_config.cwd, env=run_config.env) except OSError: logging.exception("Failed to launch") raise SC2LaunchError("Failed to launch: %s" % args) def _shutdown(self): """Terminate the sub-process.""" if self._proc: ret = _shutdown_proc(self._proc, 3) logging.info("Shutdown with return code: %s", ret) self._proc = None @property def running(self): if FLAGS.sc2_port: return True # poll returns None if it's running, otherwise the exit code. return self._proc and (self._proc.poll() is None) @property def pid(self): return self._proc.pid if self.running else None def _shutdown_proc(p, timeout): """Wait for a proc to shut down, then terminate or kill it after `timeout`.""" freq = 10 # how often to check per second for _ in range(1 + timeout * freq): p.terminate() ret = p.poll() if ret is not None: logging.info("Shutdown gracefully.") return ret time.sleep(1 / freq) logging.warning("Killing the process.") p.kill() return p.wait()
from django.shortcuts import render, render_to_response, redirect, get_object_or_404 from django.contrib.auth import authenticate, login , logout from .models import Course, Department, User, Student, ExamPaper, Material, Announcement, CourseAllotment, Bookmark, Feedback, Contributor, Stat from .forms import RegisterForm , LoginForm , AnnouncementForm , MaterialForm , ExamPaperForm, FeedbackForm, AvatorForm, ForgetPasswordForm from django.contrib.auth.decorators import login_required from django.core import serializers from django.http import JsonResponse,HttpResponse from django.urls import reverse import datetime import json rewardvalue=5 # Create your views here. def home(request): if request.user.is_anonymous(): return render(request,"feed.html",context={}) bookmarks =Bookmark.objects.filter(user=request.user) bookmarkcourses = Bookmark.objects.select_related('course').filter(user=request.user) courselist=[] for bookmark in bookmarks: courselist.append(bookmark.course) start_from = int(request.GET.get('start_from',0)) announcements = Announcement.objects.select_related('author').filter(course__in=courselist).order_by('-updated_on')[start_from*6:start_from*6+6] return render(request,"feed.html",context={"feed":announcements,"next":start_from+1,"bookmark":bookmarkcourses}) def about(request): stats = Stat.objects.get(tag='initial') return render(request,"about.html",context={'stats':stats}) def _logout(request): logout(request) return redirect('home') def forgetpassword(request): if request.method =='GET': form = ForgetPasswordForm() return render(request,"form.html",context={"form":form}) elif request.method == 'POST': return render(request,"form.html",context={"message":"Check your email for password :)"}) def _login(request): if request.method =='GET': form = LoginForm() return render(request,"login.html",context={"form":form}) elif request.method == 'POST': email = request.POST.get('email') password = request.POST.get('password') user = authenticate(email=email, password=password) if user is not None: if user.is_active: login(request, user) print(user.email) return redirect('home') form = LoginForm() return render(request,"login.html",context={"form":form,"message":"forget password"}) def _register(request,register_as=None): if request.method =='GET': form = RegisterForm() return render(request,"register.html",context={"form":form}) elif request.method == 'POST': form = RegisterForm(request.POST) if form.is_valid(): user = form.save() if(register_as=='student'): user.user_role = 'student' elif(register_as=='instructor'): user.user_role = 'instructor' user.save() stat = Stat.objects.get(tag='initial') stat.user_count +=1 stat.save() return redirect(reverse('login')) return redirect(reverse('register',kwargs={"register_as":register_as})) @login_required def profile(request): if request.method == 'GET': email = request.GET.get('email',request.user) form = AvatorForm() owner = User.objects.get(email=email) contributor,created = Contributor.objects.get_or_create(user=owner) is_owner = True if owner == request.user else False if owner.user_role == "student": student,created = Student.objects.get_or_create(user=owner) return render(request,"profile.html",context={"user":owner,"student":student,'form':form, 'is_owner':is_owner,"contributor":contributor}) return render(request,"profile.html",context={"user":owner,'form':form, 'is_owner':is_owner,"contributor":contributor}) elif request.method =='POST': if 'name' in request.POST.keys(): if request.POST['name'] in ['semester','registration_no','branch']: student = Student.objects.get(user=request.user) if request.POST['name'] == 'semester': print('yeah') student.semester = request.POST['value'] elif request.POST['name'] == 'registration_no': student.registration_no = request.POST['value'] elif request.POST['name'] == 'branch': student.branch = request.POST['value'] student.save() elif request.POST['name'] in ['first_name','last_name']: user = User.objects.get(email = request.user.email) if request.POST['name'] == 'first_name': user.first_name = request.POST['value'] elif request.POST['name'] == 'last_name': user.last_name = request.POST['value'] user.save() else: user = User.objects.get(email=request.user.email) form = AvatorForm(request.POST,request.FILES) if form.is_valid(): user.avatar = form.cleaned_data["avator"] user.save() print(user.avatar) print(form.errors) return redirect(reverse('profile')) # Profile edit to be implemented. def getDepartments(request): if request.method =='GET': dept = serializers.serialize("json",Department.objects.all(),use_natural_foreign_keys=True) data = json.loads(dept) result = {"result":data} return HttpResponse(json.dumps(result),content_type='application/json') def getCourses(request,department=None): if request.method =='GET': dept = get_object_or_404(Department,acronym=department) course = serializers.serialize("json",Course.objects.filter(dept=dept),use_natural_foreign_keys=True) data = json.loads(course) result = {"result":data} return HttpResponse(json.dumps(result),content_type='application/json') def Announcements(request,department=None,coursecode=None): if request.method =='GET': form= AnnouncementForm() return render(request,"form.html",context={"form":form}) elif request.method =="POST": if not request.user.is_authenticated: return redirect(reverse('login')) form = AnnouncementForm(request.POST,request.FILES) if(form.is_valid()): obj=Announcement() obj.files = form.cleaned_data["files"] obj.title = form.cleaned_data["title"] obj.description = form.cleaned_data["description"] obj.author=request.user obj.course= Course.objects.get(code=coursecode) obj.save() if created: stat = Stat.objects.get(tag='initial') stat.contributor_count +=1 stat.save() contributor,created = Contributor.objects.get_or_create(user=request.user) contributor.announcement +=1 contributor.points += rewardvalue contributor.save() stat = Stat.objects.get(tag='initial') stat.announcement_count +=1 stat.save() return redirect(reverse("course", kwargs={'department':department,'coursecode':coursecode})) print(form.errors) return redirect(reverse("course", kwargs={'department':department,'coursecode':coursecode})) def Materials(request,department=None,coursecode=None): if request.method =='GET': form= MaterialForm() return render(request,"form.html",context={"form":form}) elif request.method =="POST": if not request.user.is_authenticated: return redirect(reverse('login')) form = MaterialForm(request.POST,request.FILES) if(form.is_valid()): obj = Material() obj.files = form.cleaned_data["files"] obj.title = form.cleaned_data["title"] obj.author=request.user obj.course= Course.objects.get(code=coursecode) obj.save() contributor,created = Contributor.objects.get_or_create(user=request.user) contributor.material +=1 contributor.points += rewardvalue contributor.save() if created: stat = Stat.objects.get(tag='initial') stat.contributor_count +=1 stat.save() stat = Stat.objects.get(tag='initial') stat.material_count +=1 stat.save() return redirect(reverse("course", kwargs={'department':department,'coursecode':coursecode})) print(form.errors) return redirect(reverse("course", kwargs={'department':department,'coursecode':coursecode})) @login_required def FeedbackView(request): if request.method =='GET': form= FeedbackForm() return render(request,"form.html",context={"form":form}) elif request.method =="POST": form = FeedbackForm(request.POST,request.FILES) if(form.is_valid()): obj = Feedback() obj.files = form.cleaned_data["files"] obj.title = form.cleaned_data["title"] obj.feedback = form.cleaned_data["feedback"] obj.author=request.user obj.save() contributor,created = Contributor.objects.get_or_create(user=request.user) contributor.feedback +=1 contributor.points += 2*rewardvalue contributor.save() if created: stat = Stat.objects.get(tag='initial') stat.contributor_count +=1 stat.save() return render(request,"form.html",context={'feedback':True,'message':"Thanks for your valuable feedback. We will be working on your query."}) print(form.errors) return redirect(reverse("course")) @login_required def ExamPaperView(request,department=None,coursecode=None): if request.method =='GET': form= ExamPaperForm() return render(request,"form.html",context={"form":form}) elif request.method =="POST": form = ExamPaperForm(request.POST,request.FILES) if(form.is_valid()): obj = ExamPaper() obj.files = form.cleaned_data["files"] obj.term = form.cleaned_data["term"] obj.author=request.user obj.course= Course.objects.get(code=coursecode) obj.save() contributor,created = Contributor.objects.get_or_create(user=request.user) contributor.paper +=1 contributor.points += rewardvalue contributor.save() if created: stat = Stat.objects.get(tag='initial') stat.contributor_count +=1 stat.save() stat = Stat.objects.get(tag='initial') stat.paper_count +=1 stat.save() return redirect(reverse("course", kwargs={'department':department,'coursecode':coursecode})) print(form.errors) return redirect(reverse("course", kwargs={'department':department,'coursecode':coursecode})) def DepartmentView(request,department=None,year=0,semester=0): if request.method =='GET': dept = get_object_or_404(Department,acronym=department) year = int(year) semester = int(semester) if year < 1: # course = CourseAllotment.objects.select_related('course').filter(course__dept=dept).order_by('semester') return render(request,"years.html",context={'department':department}) else: if semester == 0 : course = CourseAllotment.objects.select_related('course').filter(course__dept=dept).filter(semester__in=[(2*year -1),(2*year)]) print(course) else: course = CourseAllotment.objects.select_related('course').filter(course__dept=dept).filter(semester=semester) return render(request,"department.html",context={"department":dept,"courses":course}) def CourseView(request,department=None,coursecode=None): if request.method =='GET': dept = get_object_or_404(Department,acronym=department) course = get_object_or_404(Course,code=coursecode) announcements = Announcement.objects.filter(course=course) materials = Material.objects.filter(course=course) papers = ExamPaper.objects.filter(course=course) try: bookmark = Bookmark.objects.get(course=course,user=request.user) except: bookmark = None is_bookmarked = True if bookmark else False return render(request,"course.html",context={"department":dept,"course":course,"announcements":announcements,"materials":materials,"papers":papers,"is_bookmarked":is_bookmarked}) @login_required def FeedView(request): if request.method=='GET': bookmarks =Bookmark.objects.filter(user=request.user) bookmarkcourses = Bookmark.objects.select_related('course').filter(user=request.user) courselist=[] for bookmark in bookmarks: courselist.append(bookmark.course) start_from = int(request.GET.get('start_from',0)) announcements = Announcement.objects.select_related('author').filter(course__in =courselist ).order_by('-updated_on')[start_from*6:start_from*6+6] return render(request,"feed.html",context={"feed":announcements,"next":start_from+1}) @login_required def BookmarkView(request): if request.method =='POST': course = request.POST.get('course') user = request.POST.get('user') course_obj = get_object_or_404(Course,id=course) try: bookmark = Bookmark.objects.get(course=course,user=request.user) except: bookmark = None if bookmark is not None: bookmark.delete() else: obj = Bookmark() obj.course = course_obj obj.user = request.user obj.save() return HttpResponse(json.dumps({"success":True}),content_type='application/json')
import os import matplotlib.pyplot as plt import matplotlib matplotlib.style.use('ggplot') import itertools import pandas as pd import numpy as np from datetime import datetime # This project import stroke_cleaning colors = itertools.cycle(["r", "b", "g", "k", "c", "m", "y"]) #def plot_features_from_audio(audio, featuresXY=('zrc', 'centroid')): def plot_features_from_audio(audio, featuresXY=('cm0', 'sm0')): """Plot the features from the audio sample object""" feature_dic = audio.get_features() features = feature_dic['feature_table'] xfeat, yfeat = featuresXY # Index of features xidx = feature_dic['feature_names'].index(xfeat) yidx = feature_dic['feature_names'].index(yfeat) # Plot plt.scatter(features[:, xidx], features[:, yidx], color=next(colors), s=70, alpha=0.5) #plt.xlabel(feature_dic['feature_names'][0]) #plt.ylabel(feature_dic['feature_names'][1]) plt.xlabel(xfeat) plt.ylabel(yfeat) plt.grid() def plot_features_from_list(audio_list, label_list=None, good_range_list=None, **kwargs): """Plot features for audio signal in the given list.""" if good_range_list is None: good_range_list = [None]*len(audio_list) if label_list is None: label_list = [os.path.basename(x) for x in audio_list] fake_stroke_onset = kwargs.get("fake_stroke_onset", False) featuresXY = kwargs.get('featuresXY', ('zrc', 'centroid')) xfeat, yfeat = featuresXY print('Fake stroke is {}'.format(fake_stroke_onset)) for iaudiofile, ilabel, igood_range in zip( audio_list, label_list, good_range_list): iaudio = stroke_cleaning.audio_sample(iaudiofile, igood_range) # Strokes are either searched or just regular samples if fake_stroke_onset is not False: print('Using fake stroke') iaudio.set_fake_regular_offsets(fake_stroke_onset) else: iaudio.isolate_strokes() # Features ifeature_dic = iaudio.get_features() ifeatures = ifeature_dic['feature_table'] print('features shape: {}'.format(ifeatures.shape)) del(iaudio) # Index of features xidx = ifeature_dic['feature_names'].index(xfeat) yidx = ifeature_dic['feature_names'].index(yfeat) # Plot plt.scatter(ifeatures[:, xidx], ifeatures[:, yidx], color=next(colors), s=70, label=ilabel, alpha=0.5) plt.xlabel(xfeat) plt.ylabel(yfeat) plt.grid() plt.legend(loc='best') def show_features_from_list(audio_list, label_list=None, good_range_list=None, **kwargs): """Plot features for audio signal in the given list.""" fig = plt.figure() plot_features_from_list(audio_list, label_list, good_range_list, **kwargs) fig.show() raw_input('press enter when finished...') def get_features_from_path_list(path_list, goodrange_list, **kwargs): """Return feature dict from path list""" fake_stroke_onset = kwargs.get('fake_stroke_onset', False) feature_dic = {} for iaudiofile, igood_range in zip(path_list, goodrange_list): iaudio = stroke_cleaning.audio_sample(iaudiofile, igood_range) # Strokes are either searched or just regular samples if fake_stroke_onset is not False: print('Using fake stroke') iaudio.set_fake_regular_offsets(fake_stroke_onset) else: iaudio.isolate_strokes() ifeature_dic = iaudio.get_features() if not feature_dic.has_key('feature_names'): feature_dic.update(ifeature_dic) else: feature_dic['feature_table'] =\ np.vstack((feature_dic['feature_table'], ifeature_dic['feature_table'])) return feature_dic def show_grouped_features(group_dict, **kwargs): """Plot the features from the group""" featuresXY = kwargs.get('featuresXY', ('zrc', 'centroid')) xfeat, yfeat = featuresXY fig = plt.figure() for igroup in group_dict.keys(): ifeature_dic =\ get_features_from_path_list(group_dict[igroup]['paths'], group_dict[igroup]['goodranges']) ifeatures = ifeature_dic['feature_table'] print('features shape: {}'.format(ifeatures.shape)) # Index of features xidx = ifeature_dic['feature_names'].index(xfeat) yidx = ifeature_dic['feature_names'].index(yfeat) # Plot plt.scatter(ifeatures[:, xidx], ifeatures[:, yidx], color=next(colors), s=70, label=igroup, alpha=0.5) plt.xlabel(xfeat) plt.ylabel(yfeat) plt.grid() plt.legend(loc='best') fig.show() raw_input('press enter when finished...') def show_features_from_dic(audio_dic, **kwargs): """Plot features for audio signal in the given dict.""" recording_list = [] good_range_list = [] label_list = [] for ilabel, idic in audio_dic.items(): label_list.append(ilabel) recording_list.append(idic['audio_file']) good_range_list.append(idic['good_range']) show_features_from_list(recording_list, label_list, good_range_list, **kwargs) def show_players_features(**kwargs): """Plot the features grouped by file selection""" df_data = pd.read_csv('datainfo.csv', sep=' ', na_values='None') print(df_data.head()) grouping_dict = {} for iplayer in df_data.player.unique(): ipathlist = df_data[df_data.player==iplayer]['path'].tolist() igoodrangelist = df_data[df_data.player==iplayer]['goodrange'].tolist() grouping_dict[iplayer] = {'paths': ipathlist, 'goodranges': igoodrangelist} show_grouped_features(grouping_dict, **kwargs) def audio_report(fname): """Plot summary of the given audio file.""" audio = stroke_cleaning.audio_sample(fname) audio.set_fake_regular_offsets(1) fig_sig = plt.figure() audio.plot_signal(x_axis_type='sample') fig_sig.show() fig_feat = plt.figure() plot_features_from_audio(audio) plt.grid() fig_feat.show() raw_input('press enter when finished...') def show_multiaudio(fnames, good_ranges = None, **kwargs): """Show summary of all the audio files in the given list.""" featuresXY = kwargs.get('featuresXY',('zrc', 'centroid')) xfeat, yfeat = featuresXY if good_ranges is None: good_ranges = [None]*len(fnames) fig_feat = plt.figure(1) fig_raw = plt.figure(2) for idx, (iaudiofile, igood_range) in enumerate(zip(fnames, good_ranges)): print(igood_range) try: igood_range = igood_range.split('-') igood_range = (int(igood_range[0]), int(igood_range[1])) except AttributeError: igood_range = None print(igood_range) iaudio = stroke_cleaning.audio_sample(iaudiofile, igood_range) ilabel = os.path.basename(iaudiofile) iaudio.set_fake_regular_offsets(0.5) # Features ifeature_dic = iaudio.get_features() # Index of features xidx = ifeature_dic['feature_names'].index(xfeat) yidx = ifeature_dic['feature_names'].index(yfeat) plt.figure(2) iax = fig_raw.add_subplot(len(fnames),1,idx) iaudio.plot_signal(label=os.path.basename(iaudiofile).split('.')[0]) iax.text(0.05, 0.95, ilabel, verticalalignment='top', horizontalalignment='left', transform=iax.transAxes, fontsize=15) ifeatures = ifeature_dic['feature_table'] plt.figure(1) plt.scatter(ifeatures[:, xidx], ifeatures[:, yidx], color=next(colors), s=70, label=ilabel, alpha=0.5) plt.xlabel(xfeat) plt.ylabel(yfeat) plt.legend(loc='best') fig_feat.show() fig_raw.show() raw_input('press enter when finished...') def show_day(daystr, **kwargs): """Show summary of all the audiofile from a given day.""" featuresXY = kwargs.get('featuresXY', ('zrc', 'centroid')) df_data = pd.read_csv('datainfo.csv', sep=' ', na_values='None', dtype={'date': datetime}) fnames = df_data[df_data.date == daystr].path.tolist() good_ranges = df_data[df_data.date == daystr].goodrange.tolist() show_multiaudio(fnames, good_ranges, featuresXY=featuresXY) if __name__ == '__main__': #recording_list = ( # '/Users/jean-francoisrajotte/myaudio/marina.m4a', # '/Users/jean-francoisrajotte/myaudio/jfraj.m4a', # ) #show_features_from_list(recording_list) recording_dic = {} recording_dic['marina'] = { 'audio_file': '/Users/jean-francoisrajotte/myaudio/marina.m4a', 'good_range': None} recording_dic['jfraj'] = { 'audio_file': '/Users/jean-francoisrajotte/myaudio/jfraj.m4a', 'good_range': (95000, -400000)} recording_dic['marina_srON'] = { 'audio_file': '/Users/jean-francoisrajotte/myaudio/astring_shoulder_rest_ON.m4a', 'good_range': None} recording_dic['marina_srOFF'] = { 'audio_file': '/Users/jean-francoisrajotte/myaudio/astring_shoulder_rest_OFF.m4a', 'good_range': None} recording_dic['marina_srON'] = { 'audio_file': '/Users/jean-francoisrajotte/myaudio/marina_20150507.m4a', 'good_range': None} recording_dic['marina_srOFF'] = { 'audio_file': '/Users/jean-francoisrajotte/myaudio/marina_20150507_test.m4a', 'good_range': None} #show_features_from_dic(recording_dic) show_players_features(featuresXY=('cm3', 'sm0')) #audio_dir = "/Users/jean-francoisrajotte/myaudio/alto_recordings/" #audioname = os.path.join(audio_dir, 'marina_20150513_halfbow_testbow1.m4a') #audio_report(audioname) #show_day('20150623', featuresXY=('cm3', 'sm0'))
""" LLDB AppKit formatters part of The LLVM Compiler Infrastructure This file is distributed under the University of Illinois Open Source License. See LICENSE.TXT for details. """ # example synthetic children and summary provider for CFString (and related NSString class) # the real code is part of the LLDB core import lldb import lldb.runtime.objc.objc_runtime import lldb.formatters.Logger def CFString_SummaryProvider(valobj, dict): logger = lldb.formatters.Logger.Logger() provider = CFStringSynthProvider(valobj, dict) if not provider.invalid: try: summary = provider.get_child_at_index( provider.get_child_index("content")) if isinstance(summary, lldb.SBValue): summary = summary.GetSummary() else: summary = '"' + summary + '"' except: summary = None if summary is None: summary = '<variable is not NSString>' return '@' + summary return '' def CFAttributedString_SummaryProvider(valobj, dict): logger = lldb.formatters.Logger.Logger() offset = valobj.GetTarget().GetProcess().GetAddressByteSize() pointee = valobj.GetValueAsUnsigned(0) summary = '<variable is not NSAttributedString>' if pointee is not None and pointee != 0: pointee = pointee + offset child_ptr = valobj.CreateValueFromAddress( "string_ptr", pointee, valobj.GetType()) child = child_ptr.CreateValueFromAddress( "string_data", child_ptr.GetValueAsUnsigned(), valobj.GetType()).AddressOf() provider = CFStringSynthProvider(child, dict) if not provider.invalid: try: summary = provider.get_child_at_index( provider.get_child_index("content")).GetSummary() except: summary = '<variable is not NSAttributedString>' if summary is None: summary = '<variable is not NSAttributedString>' return '@' + summary def __lldb_init_module(debugger, dict): debugger.HandleCommand( "type summary add -F CFString.CFString_SummaryProvider NSString CFStringRef CFMutableStringRef") debugger.HandleCommand( "type summary add -F CFString.CFAttributedString_SummaryProvider NSAttributedString") class CFStringSynthProvider: def __init__(self, valobj, dict): logger = lldb.formatters.Logger.Logger() self.valobj = valobj self.update() # children other than "content" are for debugging only and must not be # used in production code def num_children(self): logger = lldb.formatters.Logger.Logger() if self.invalid: return 0 return 6 def read_unicode(self, pointer, max_len=2048): logger = lldb.formatters.Logger.Logger() process = self.valobj.GetTarget().GetProcess() error = lldb.SBError() pystr = u'' # cannot do the read at once because the length value has # a weird encoding. better play it safe here while max_len > 0: content = process.ReadMemory(pointer, 2, error) new_bytes = bytearray(content) b0 = new_bytes[0] b1 = new_bytes[1] pointer = pointer + 2 if b0 == 0 and b1 == 0: break # rearrange bytes depending on endianness # (do we really need this or is Cocoa going to # use Windows-compatible little-endian even # if the target is big endian?) if self.is_little: value = b1 * 256 + b0 else: value = b0 * 256 + b1 pystr = pystr + unichr(value) # read max_len unicode values, not max_len bytes max_len = max_len - 1 return pystr # handle the special case strings # only use the custom code for the tested LP64 case def handle_special(self): logger = lldb.formatters.Logger.Logger() if not self.is_64_bit: # for 32bit targets, use safe ObjC code return self.handle_unicode_string_safe() offset = 12 pointer = self.valobj.GetValueAsUnsigned(0) + offset pystr = self.read_unicode(pointer) return self.valobj.CreateValueFromExpression( "content", "(char*)\"" + pystr.encode('utf-8') + "\"") # last resort call, use ObjC code to read; the final aim is to # be able to strip this call away entirely and only do the read # ourselves def handle_unicode_string_safe(self): return self.valobj.CreateValueFromExpression( "content", "(char*)\"" + self.valobj.GetObjectDescription() + "\"") def handle_unicode_string(self): logger = lldb.formatters.Logger.Logger() # step 1: find offset if self.inline: pointer = self.valobj.GetValueAsUnsigned( 0) + self.size_of_cfruntime_base() if not self.explicit: # untested, use the safe code path return self.handle_unicode_string_safe() else: # a full pointer is skipped here before getting to the live # data pointer = pointer + self.pointer_size else: pointer = self.valobj.GetValueAsUnsigned( 0) + self.size_of_cfruntime_base() # read 8 bytes here and make an address out of them try: char_type = self.valobj.GetType().GetBasicType( lldb.eBasicTypeChar).GetPointerType() vopointer = self.valobj.CreateValueFromAddress( "dummy", pointer, char_type) pointer = vopointer.GetValueAsUnsigned(0) except: return self.valobj.CreateValueFromExpression( "content", '(char*)"@\"invalid NSString\""') # step 2: read Unicode data at pointer pystr = self.read_unicode(pointer) # step 3: return it return pystr.encode('utf-8') def handle_inline_explicit(self): logger = lldb.formatters.Logger.Logger() offset = 3 * self.pointer_size offset = offset + self.valobj.GetValueAsUnsigned(0) return self.valobj.CreateValueFromExpression( "content", "(char*)(" + str(offset) + ")") def handle_mutable_string(self): logger = lldb.formatters.Logger.Logger() offset = 2 * self.pointer_size data = self.valobj.CreateChildAtOffset( "content", offset, self.valobj.GetType().GetBasicType( lldb.eBasicTypeChar).GetPointerType()) data_value = data.GetValueAsUnsigned(0) if self.explicit and self.unicode: return self.read_unicode(data_value).encode('utf-8') else: data_value = data_value + 1 return self.valobj.CreateValueFromExpression( "content", "(char*)(" + str(data_value) + ")") def handle_UTF8_inline(self): logger = lldb.formatters.Logger.Logger() offset = self.valobj.GetValueAsUnsigned( 0) + self.size_of_cfruntime_base() if not self.explicit: offset = offset + 1 return self.valobj.CreateValueFromAddress( "content", offset, self.valobj.GetType().GetBasicType( lldb.eBasicTypeChar)).AddressOf() def handle_UTF8_not_inline(self): logger = lldb.formatters.Logger.Logger() offset = self.size_of_cfruntime_base() return self.valobj.CreateChildAtOffset( "content", offset, self.valobj.GetType().GetBasicType( lldb.eBasicTypeChar).GetPointerType()) def get_child_at_index(self, index): logger = lldb.formatters.Logger.Logger() logger >> "Querying for child [" + str(index) + "]" if index == 0: return self.valobj.CreateValueFromExpression( "mutable", str(int(self.mutable))) if index == 1: return self.valobj.CreateValueFromExpression("inline", str(int(self.inline))) if index == 2: return self.valobj.CreateValueFromExpression( "explicit", str(int(self.explicit))) if index == 3: return self.valobj.CreateValueFromExpression( "unicode", str(int(self.unicode))) if index == 4: return self.valobj.CreateValueFromExpression( "special", str(int(self.special))) if index == 5: # we are handling the several possible combinations of flags. # for each known combination we have a function that knows how to # go fetch the data from memory instead of running code. if a string is not # correctly displayed, one should start by finding a combination of flags that # makes it different from these known cases, and provide a new reader function # if this is not possible, a new flag might have to be made up (like the "special" flag # below, which is not a real flag in CFString), or alternatively one might need to use # the ObjC runtime helper to detect the new class and deal with it accordingly # print 'mutable = ' + str(self.mutable) # print 'inline = ' + str(self.inline) # print 'explicit = ' + str(self.explicit) # print 'unicode = ' + str(self.unicode) # print 'special = ' + str(self.special) if self.mutable: return self.handle_mutable_string() elif self.inline and self.explicit and \ self.unicode == False and self.special == False and \ self.mutable == False: return self.handle_inline_explicit() elif self.unicode: return self.handle_unicode_string() elif self.special: return self.handle_special() elif self.inline: return self.handle_UTF8_inline() else: return self.handle_UTF8_not_inline() def get_child_index(self, name): logger = lldb.formatters.Logger.Logger() logger >> "Querying for child ['" + str(name) + "']" if name == "content": return self.num_children() - 1 if name == "mutable": return 0 if name == "inline": return 1 if name == "explicit": return 2 if name == "unicode": return 3 if name == "special": return 4 # CFRuntimeBase is defined as having an additional # 4 bytes (padding?) on LP64 architectures # to get its size we add up sizeof(pointer)+4 # and then add 4 more bytes if we are on a 64bit system def size_of_cfruntime_base(self): logger = lldb.formatters.Logger.Logger() return self.pointer_size + 4 + (4 if self.is_64_bit else 0) # the info bits are part of the CFRuntimeBase structure # to get at them we have to skip a uintptr_t and then get # at the least-significant byte of a 4 byte array. If we are # on big-endian this means going to byte 3, if we are on # little endian (OSX & iOS), this means reading byte 0 def offset_of_info_bits(self): logger = lldb.formatters.Logger.Logger() offset = self.pointer_size if not self.is_little: offset = offset + 3 return offset def read_info_bits(self): logger = lldb.formatters.Logger.Logger() cfinfo = self.valobj.CreateChildAtOffset( "cfinfo", self.offset_of_info_bits(), self.valobj.GetType().GetBasicType( lldb.eBasicTypeChar)) cfinfo.SetFormat(11) info = cfinfo.GetValue() if info is not None: self.invalid = False return int(info, 0) else: self.invalid = True return None # calculating internal flag bits of the CFString object # this stuff is defined and discussed in CFString.c def is_mutable(self): logger = lldb.formatters.Logger.Logger() return (self.info_bits & 1) == 1 def is_inline(self): logger = lldb.formatters.Logger.Logger() return (self.info_bits & 0x60) == 0 # this flag's name is ambiguous, it turns out # we must skip a length byte to get at the data # when this flag is False def has_explicit_length(self): logger = lldb.formatters.Logger.Logger() return (self.info_bits & (1 | 4)) != 4 # probably a subclass of NSString. obtained this from [str pathExtension] # here info_bits = 0 and Unicode data at the start of the padding word # in the long run using the isa value might be safer as a way to identify this # instead of reading the info_bits def is_special_case(self): logger = lldb.formatters.Logger.Logger() return self.info_bits == 0 def is_unicode(self): logger = lldb.formatters.Logger.Logger() return (self.info_bits & 0x10) == 0x10 # preparing ourselves to read into memory # by adjusting architecture-specific info def adjust_for_architecture(self): logger = lldb.formatters.Logger.Logger() self.pointer_size = self.valobj.GetTarget().GetProcess().GetAddressByteSize() self.is_64_bit = self.pointer_size == 8 self.is_little = self.valobj.GetTarget().GetProcess( ).GetByteOrder() == lldb.eByteOrderLittle # reading info bits out of the CFString and computing # useful values to get at the real data def compute_flags(self): logger = lldb.formatters.Logger.Logger() self.info_bits = self.read_info_bits() if self.info_bits is None: return self.mutable = self.is_mutable() self.inline = self.is_inline() self.explicit = self.has_explicit_length() self.unicode = self.is_unicode() self.special = self.is_special_case() def update(self): logger = lldb.formatters.Logger.Logger() self.adjust_for_architecture() self.compute_flags()
from __future__ import unicode_literals from __future__ import print_function from .context import dataindex from .context.tools import to_expression from .compat import implements_to_string, text_type from .context.missing import is_missing from .interface import unproxy from pyparsing import ( Word, WordEnd, nums, alphas, Combine, oneOf, opAssoc, operatorPrecedence, QuotedString, Literal, ParserElement, ParseException, Forward, Group, Suppress, Optional, Regex, ) from sqlalchemy import and_, or_, func, not_ import operator import re import threading def dbobject(obj): return getattr(obj, "__moyadbobject__", lambda: obj)() @implements_to_string class DBExpressionError(Exception): hide_py_traceback = True error_type = "Database expression error" def __init__(self, exp, msg=None, col=None): self.exp = exp self.msg = msg or "" self.col = col def __str__(self): return self.msg def __moyaconsole__(self, console): indent = "" console(indent + self.exp, bold=True, fg="magenta").nl() if self.col: console(indent)(" " * (self.col - 1) + "^", bold=True, fg="red").nl() class DBEvalError(Exception): pass def pairs(tokenlist): """Converts a list in to a sequence of paired values""" return zip(tokenlist[::2], tokenlist[1::2]) class ExpressionContext(object): def __init__(self, exp): self.exp = exp self._joins = [] super(ExpressionContext, self).__init__() def __repr__(self): return "<expressioncontext '{}'>".format(self.exp) def add_joins(self, joins): self._joins.append(joins) def process_qs(self, qs): # TODO: Is this deprecated now? for j in self._joins: if isinstance(j, (tuple, list)): qs = qs.join(*j) else: qs = qs.join(j) return qs class ExpressionModifiers(object): def abs(self, context, v): return func.abs(v) def count(self, context, v): return func.count(v) def sum(self, context, v): return func.sum(v) def min(self, context, v): return func.min(v) def max(self, context, v): return func.max(v) def lower(self, context, v): return func.lower(v) class EvalModifierOp(object): modifiers = ExpressionModifiers() def __init__(self, tokens): filter, value = tokens[0] self.value = value self._eval = value.eval try: self.filter_func = getattr(self.modifiers, filter[:-1]) except AttributeError: raise DBEvalError("unknown filter type '%s'" % filter) def eval(self, archive, context, app, exp_context): return self.filter_func(context, self._eval(archive, context, app, exp_context)) class EvalMultOp(object): "Class to evaluate multiplication and division expressions" ops = { "*": operator.imul, "/": operator.itruediv, "//": operator.ifloordiv, "%": operator.imod, } def __init__(self, tokens): self.value = tokens[0] self._eval = self.value[0].eval ops = self.ops self.operator_eval = [(ops[op], val.eval) for op, val in pairs(self.value[1:])] def eval(self, archive, context, app, exp_context): prod = self._eval(archive, context, app, exp) for op_func, _eval in self.operator_eval: prod = op_func(prod, _eval(archive, context, app, exp_context)) return prod class EvalAddOp(object): "Class to evaluate addition and subtraction expressions" ops = {"+": operator.add, "-": operator.sub} def __init__(self, tokens): self.value = tokens[0] self._eval = self.value[0].eval ops = self.ops self.operator_eval = [(ops[op], val.eval) for op, val in pairs(self.value[1:])] def eval(self, archive, context, app, exp_context): sum = self._eval(archive, context, app, exp_context) for op_func, _eval in self.operator_eval: sum = op_func(sum, _eval(archive, context, app, exp_context)) return sum class EvalConstant(object): """Evaluates a constant""" constants = {"None": None, "True": True, "False": False, "yes": True, "no": False} def __init__(self, tokens): self.key = tokens[0] self.value = self.constants[self.key] def eval(self, archive, context, app, exp_context): return self.value class EvalInteger(object): "Class to evaluate an integer value" def __init__(self, tokens): self.value = int(tokens[0]) def eval(self, archive, context, app, exp_context): return self.value class EvalReal(object): "Class to evaluate a real number value" def __init__(self, tokens): self.value = float(tokens[0]) def eval(self, archive, context, app, exp_context): return self.value class EvalString(object): "Class to evaluate a string" def __init__(self, tokens): self.value = tokens[0] def eval(self, archive, context, app, exp_context): return self.value def qs(value): if hasattr(value, "__moyadbobject__"): value = value.__moyadbobject__() if hasattr(value, "_get_query_set"): value = value._get_query_set() if isinstance(value, list): return [getattr(v, "id", v) for v in value] return value class EvalVariable(object): "Class to evaluate a parsed variable" def __init__(self, tokens): key = tokens[0] self.index = dataindex.parse(key) def eval(self, archive, context, app, exp_context): value = context[self.index] if is_missing(value): raise DBEvalError( "Database expression value '{}' is missing from the context".format( self.index ) ) return dbobject(unproxy(value)) class EvalModelReference(object): """Gets a model reference""" _ref_model_ref = re.compile("^(.*?#.*?)(?:\.(.*?))?$") def __init__(self, tokens): self.index = tokens[0] def eval(self, archive, context, app, exp_context): model_ref, index = self._ref_model_ref.match(self.index).groups() app = app or context.get(".app", None) if app is None: raise DBEvalError("unable to get app from '{}'".format(self.index)) if index is None: app, model_element = app.get_element(model_ref) try: table_class = model_element.get_table_class(app) except Exception as e: raise DBEvalError(str(e)) return table_class index = list(dataindex.parse(index)) app, model_element = app.get_element(model_ref) try: table_class = model_element.get_table_class(app) except Exception as e: raise DBEvalError(str(e)) try: model_reference_result = table_class._get_index( archive, context, app, exp_context, index ) except (KeyError, AttributeError): raise DBEvalError('no column or object called "{}"'.format(self.index)) else: return model_reference_result class EvalComparisonOp(object): "Class to evaluate comparison expressions" @classmethod def match_re(cls, a, b): return bool(b.match(a)) @classmethod def escape_like(cls, like, _should_escape="\\%_".__contains__): """escape LIKE comparisons""" if not isinstance(like, text_type): return like return "".join("\\" + c if _should_escape(c) else c for c in like) def in_(context, a, b): if hasattr(b, "__moyadbsubselect__"): sub_b = b.__moyadbsubselect__(context) if sub_b is not None: b = sub_b a = qs(a) try: return a.in_(qs(b)) except: raise DBEvalError( "db expression 'in' operator works on columns only (did you mean .id)?" ) def notin_(context, a, b): if hasattr(b, "__moyadbsubselect__"): sub_b = b.__moyadbsubselect__(context) if sub_b is not None: b = sub_b a = qs(a) try: return a.notin_(qs(b)) except: raise DBEvalError( "db expression 'not in' operator works on columns only (did you mean .id)?" ) def contains_(context, a, b): try: return qs(a).contains(qs(b)) except: raise DBEvalError( "value {} is an invalid operand for the 'contains' operator".format( to_expression(context, b) ) ) def icontains_(context, a, b): if not isinstance(b, text_type): raise DBEvalError( "icontains right hand side should be a string, not {}".format( context.to_expr(b) ) ) b = "%{}%".format(EvalComparisonOp.escape_like(b)) try: return qs(a).like(b) except: raise DBEvalError( "{} may not be used with 'icontains' operator".format( context.to_expr(a) ) ) def ieq(context, a, b): if not isinstance(b, text_type): raise DBEvalError( "case insensitive equality operator (~=) right hand side should be a string, not {}".format( context.to_expr(b) ) ) return qs(a).ilike(EvalComparisonOp.escape_like(b), escape="\\") opMap = { "<": lambda c, a, b: qs(a) < qs(b), "lt": lambda c, a, b: qs(a) < qs(b), "<=": lambda c, a, b: qs(a) <= qs(b), "lte": lambda c, a, b: qs(a) <= qs(b), ">": lambda c, a, b: qs(a) > qs(b), "gt": lambda c, a, b: qs(a) > qs(b), ">=": lambda c, a, b: qs(a) >= qs(b), "gte": lambda c, a, b: qs(a) >= qs(b), "!=": lambda c, a, b: qs(a) != qs(b), "==": lambda c, a, b: qs(a) == qs(b), "like": lambda c, a, b: qs(a).like(qs(b)), "ilike": lambda c, a, b: qs(a).ilike(qs(b)), # "~=": lambda c, a, b: qs(a).ilike(qs(EvalComparisonOp.escape_like(b)), escape='\\'), "~=": ieq, "^=": lambda c, a, b: qs(a).startswith(qs(b)), "$=": lambda c, a, b: qs(a).endswith(qs(b)), "in": in_, "not in": notin_, "contains": contains_, "icontains": icontains_, # "icontains": lambda c, a, b: qs(a).like('%' + EvalComparisonOp.escape_like(b) + '%', escape='\\') } def __init__(self, tokens): self.value = tokens[0] self._eval = self.value[0].eval self.operator_eval = [ (self.opMap[op], val.eval) for op, val in pairs(self.value[1:]) ] def eval(self, archive, context, app, exp_context): val1 = self._eval(archive, context, app, exp_context) for op_func, _eval in self.operator_eval: val2 = _eval(archive, context, app, exp_context) val1 = op_func(context, val1, val2) return val1 class EvalLogicOpAND(object): def __init__(self, tokens): self.value = tokens[0] self._eval = self.value[0].eval self.operator_eval = [val.eval for op, val in pairs(self.value[1:])] def eval(self, archive, context, app, exp_context): val1 = self._eval(archive, context, app, exp_context) for _eval in self.operator_eval: val2 = _eval(archive, context, app, exp_context) val1 = and_(val1, val2) return val1 class EvalLogicOpOR(object): def __init__(self, tokens): self.value = tokens[0] self._eval = self.value[0].eval self.operator_eval = [val.eval for op, val in pairs(self.value[1:])] def eval(self, archive, context, app, exp_context): val1 = self._eval(archive, context, app, exp_context) for _eval in self.operator_eval: val2 = _eval(archive, context, app, exp_context) val1 = or_(val1, val2) return val1 class EvalGroupOp(object): def __init__(self, tokens): self._evals = [t.eval for t in tokens[0][0::2]] def eval(self, archive, context, app, exp_context): val = [eval(archive, context, app, exp_context) for eval in self._evals] return val class EvalNotOp(object): """Class to evaluate expressions with logical NOT""" def __init__(self, tokens): self._eval = tokens[0][1].eval def eval(self, archive, context, app, exp_context): return not_(self._eval(archive, context, app, exp_context)) integer = Word(nums) real = Combine(Word(nums) + "." + Word(nums)) constant = ( Literal("True") | Literal("False") | Literal("None") | Literal("yes") | Literal("no") ) + WordEnd() model_reference = Regex(r"([\w\.]*#[\w\.]+)") variable = Regex(r"([a-zA-Z0-9\._]+)") string = QuotedString('"', escChar="\\") | QuotedString("'", escChar="\\") operand = model_reference | real | integer | constant | string | variable plusop = oneOf("+ -") multop = oneOf("* / // %") groupop = Literal(",") expr = Forward() notop = Literal("not") + WordEnd() modifier = Combine(Word(alphas + nums) + ":") integer.setParseAction(EvalInteger) real.setParseAction(EvalReal) string.setParseAction(EvalString) constant.setParseAction(EvalConstant) variable.setParseAction(EvalVariable) model_reference.setParseAction(EvalModelReference) comparisonop = ( oneOf("< <= > >= != == ~= ^= $=") | (Literal("not in") + WordEnd()) | (oneOf("in lt lte gt gte matches contains icontains like ilike") + WordEnd()) ) logicopOR = Literal("or") + WordEnd() logicopAND = Literal("and") + WordEnd() expr << operatorPrecedence( operand, [ (notop, 1, opAssoc.RIGHT, EvalNotOp), (modifier, 1, opAssoc.RIGHT, EvalModifierOp), (multop, 2, opAssoc.LEFT, EvalMultOp), (plusop, 2, opAssoc.LEFT, EvalAddOp), (comparisonop, 2, opAssoc.LEFT, EvalComparisonOp), (logicopAND, 2, opAssoc.LEFT, EvalLogicOpAND), (logicopOR, 2, opAssoc.LEFT, EvalLogicOpOR), (groupop, 2, opAssoc.LEFT, EvalGroupOp), ], ) @implements_to_string class DBExpression(object): exp_cache = {} _lock = threading.Lock() def __init__(self, exp): self.exp = exp def __repr__(self): return '<DBExpression "%s">' % self.exp def __str__(self): return self.exp def eval(self, archive, context, app=None): exp_context = ExpressionContext(self.exp) try: eval = self.compile_cache(self.exp) result = eval(archive, context, app, exp_context) except DBEvalError as e: raise DBExpressionError(self.exp, text_type(e)) return result def eval2(self, archive, context, app=None): exp_context = ExpressionContext(self.exp) try: eval = self.compile_cache(self.exp) result = eval(archive, context, app, exp_context) except DBEvalError as e: raise DBExpressionError(self.exp, text_type(e)) return result, exp_context def compile(self): return self.compile_cache(self.exp) def compile_cache(self, exp): with self._lock: try: return self.exp_cache[exp] except KeyError: try: compiled_exp = expr.parseString(exp, parseAll=True) except ParseException as e: raise DBExpressionError(exp, text_type(e), col=e.col) eval = self.exp_cache[exp] = compiled_exp[0].eval return eval if __name__ == "__main__": """ <db:filter model="#TagDB">#TagDB.name==name and #TagDB.company.pk==company_pk</db:filter> """ exp = DBExpression("moya.auth#User.username=='will'") print(exp.compile()) exp = DBExpression("auth#User.username=='will'") print(exp.compile()) exp = DBExpression( "comments#Comment.namespace == app.name and comments#Comment.object in comment_keys" ) print(exp.compile()) exp = DBExpression("#CommentObject.count + 1") print(exp.compile)
# Copyright (c) 2012 - 2014 EMC Corporation, Inc. # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. import mock from cinder import exception from cinder import test from cinder.tests.unit import fake_snapshot from cinder.volume.drivers.emc import xtremio typ2id = {'volumes': 'vol-id', 'snapshots': 'vol-id', 'initiators': 'initiator-id', 'initiator-groups': 'ig-id', 'lun-maps': 'mapping-id', 'consistency-groups': 'cg-id', 'consistency-group-volumes': 'cg-vol-id', } xms_data = {'xms': {1: {'version': '4.0.0'}}, 'clusters': {1: {'name': 'brick1', 'sys-sw-version': "4.0.0-devel_ba23ee5381eeab73", 'ud-ssd-space': '8146708710', 'ud-ssd-space-in-use': '708710', 'vol-size': '29884416', 'chap-authentication-mode': 'disabled', 'chap-discovery-mode': 'disabled', "index": 1, }, }, 'target-groups': {'Default': {"index": 1, }, }, 'iscsi-portals': {'10.205.68.5/16': {"port-address": "iqn.2008-05.com.xtremio:001e67939c34", "ip-port": 3260, "ip-addr": "10.205.68.5/16", "name": "10.205.68.5/16", "index": 1, }, }, 'targets': {'X1-SC2-fc1': {'index': 1, "name": "X1-SC2-fc1", "port-address": "21:00:00:24:ff:57:b2:36", 'port-state': 'up', }, 'X1-SC2-fc2': {'index': 2, "name": "X1-SC2-fc2", "port-address": "21:00:00:24:ff:57:b2:55", 'port-state': 'up', } }, 'volumes': {}, 'initiator-groups': {}, 'initiators': {}, 'lun-maps': {}, 'consistency-groups': {}, 'consistency-group-volumes': {}, } def get_xms_obj_by_name(typ, name): for item in xms_data[typ].values(): if 'name' in item and item['name'] == name: return item raise exception.NotFound() def clean_xms_data(): xms_data['volumes'] = {} xms_data['initiator-groups'] = {} xms_data['initiators'] = {} xms_data['lun-maps'] = {} xms_data['consistency-group-volumes'] = {} xms_data['consistency-groups'] = {} def fix_data(data, object_type): d = {} for key, value in data.items(): if 'name' in key: key = 'name' d[key] = value if object_type == 'lun-maps': d['lun'] = 1 d[typ2id[object_type]] = ["a91e8c81c2d14ae4865187ce4f866f8a", d.get('name'), len(xms_data.get(object_type, [])) + 1] d['index'] = len(xms_data[object_type]) + 1 return d def get_xms_obj_key(data): for key in data.keys(): if 'name' in key: return key def get_obj(typ, name, idx): if name: return {"content": get_xms_obj_by_name(typ, name)} elif idx: if idx not in xms_data.get(typ, {}): raise exception.NotFound() return {"content": xms_data[typ][idx]} def xms_request(object_type='volumes', request_typ='GET', data=None, name=None, idx=None, ver='v1'): if object_type == 'snapshots': object_type = 'volumes' try: res = xms_data[object_type] except KeyError: raise exception.VolumeDriverException if request_typ == 'GET': if name or idx: return get_obj(object_type, name, idx) else: if data and data.get('full') == 1: return {object_type: list(res.values())} else: return {object_type: [{"href": "/%s/%d" % (object_type, obj['index']), "name": obj.get('name')} for obj in res.values()]} elif request_typ == 'POST': data = fix_data(data, object_type) name_key = get_xms_obj_key(data) try: if name_key and get_xms_obj_by_name(object_type, data[name_key]): raise (exception .VolumeBackendAPIException ('Volume by this name already exists')) except exception.NotFound: pass data['index'] = len(xms_data[object_type]) + 1 xms_data[object_type][data['index']] = data # find the name key if name_key: data['name'] = data[name_key] if object_type == 'lun-maps': data['ig-name'] = data['ig-id'] return {"links": [{"href": "/%s/%d" % (object_type, data[typ2id[object_type]][2])}]} elif request_typ == 'DELETE': if object_type == 'consistency-group-volumes': data = [cgv for cgv in xms_data['consistency-group-volumes'].values() if cgv['vol-id'] == data['vol-id'] and cgv['cg-id'] == data['cg-id']][0] else: data = get_obj(object_type, name, idx)['content'] if data: del xms_data[object_type][data['index']] else: raise exception.NotFound() elif request_typ == 'PUT': obj = get_obj(object_type, name, idx)['content'] data = fix_data(data, object_type) del data['index'] obj.update(data) def xms_bad_request(object_type='volumes', request_typ='GET', data=None, name=None, idx=None, ver='v1'): if request_typ == 'GET': raise exception.NotFound() elif request_typ == 'POST': raise exception.VolumeBackendAPIException('Failed to create ig') def xms_failed_rename_snapshot_request(object_type='volumes', request_typ='GET', data=None, name=None, idx=None, ver='v1'): if request_typ == 'POST': xms_data['volumes'][27] = {} return { "links": [ { "href": "https://host/api/json/v2/types/snapshots/27", "rel": "self"}]} elif request_typ == 'PUT': raise exception.VolumeBackendAPIException(data='Failed to delete') elif request_typ == 'DELETE': del xms_data['volumes'][27] class D(dict): def update(self, *args, **kwargs): self.__dict__.update(*args, **kwargs) return dict.update(self, *args, **kwargs) class CommonData(object): connector = {'ip': '10.0.0.2', 'initiator': 'iqn.1993-08.org.debian:01:222', 'wwpns': ["123456789012345", "123456789054321"], 'wwnns': ["223456789012345", "223456789054321"], 'host': 'fakehost', } test_volume = {'name': 'vol1', 'size': 1, 'volume_name': 'vol1', 'id': '192eb39b-6c2f-420c-bae3-3cfd117f0001', 'provider_auth': None, 'project_id': 'project', 'display_name': 'vol1', 'display_description': 'test volume', 'volume_type_id': None, 'consistencygroup_id': '192eb39b-6c2f-420c-bae3-3cfd117f0345', } test_snapshot = D() test_snapshot.update({'name': 'snapshot1', 'size': 1, 'id': '192eb39b-6c2f-420c-bae3-3cfd117f0002', 'volume_name': 'vol-vol1', 'volume_id': '192eb39b-6c2f-420c-bae3-3cfd117f0001', 'project_id': 'project', 'consistencygroup_id': '192eb39b-6c2f-420c-bae3-3cfd117f0345', }) test_snapshot.__dict__.update(test_snapshot) test_volume2 = {'name': 'vol2', 'size': 1, 'volume_name': 'vol2', 'id': '192eb39b-6c2f-420c-bae3-3cfd117f0004', 'provider_auth': None, 'project_id': 'project', 'display_name': 'vol2', 'display_description': 'test volume 2', 'volume_type_id': None, 'consistencygroup_id': '192eb39b-6c2f-420c-bae3-3cfd117f0345', } test_clone = {'name': 'clone1', 'size': 1, 'volume_name': 'vol3', 'id': '192eb39b-6c2f-420c-bae3-3cfd117f0003', 'provider_auth': None, 'project_id': 'project', 'display_name': 'clone1', 'display_description': 'volume created from snapshot', 'volume_type_id': None, 'consistencygroup_id': '192eb39b-6c2f-420c-bae3-3cfd117f0345', } unmanaged1 = {'id': 'unmanaged1', 'name': 'unmanaged1', 'size': 3, } context = {'user': 'admin', } group = {'id': '192eb39b-6c2f-420c-bae3-3cfd117f0345', 'name': 'cg1', 'status': 'OK', } cgsnapshot = mock.Mock(id='192eb39b-6c2f-420c-bae3-3cfd117f9876', consistencygroup_id=group['id']) def cgsnap_getitem(self, val): return self.__dict__[val] cgsnapshot.__getitem__ = cgsnap_getitem @mock.patch('cinder.volume.drivers.emc.xtremio.XtremIOClient.req') class EMCXIODriverISCSITestCase(test.TestCase): def setUp(self): super(EMCXIODriverISCSITestCase, self).setUp() clean_xms_data() config = mock.Mock() config.san_login = '' config.san_password = '' config.san_ip = '' config.xtremio_cluster_name = 'brick1' config.xtremio_provisioning_factor = 20.0 def safe_get(key): getattr(config, key) config.safe_get = safe_get self.driver = xtremio.XtremIOISCSIDriver(configuration=config) self.driver.client = xtremio.XtremIOClient4(config, config .xtremio_cluster_name) self.data = CommonData() def test_check_for_setup_error(self, req): req.side_effect = xms_request clusters = xms_data['clusters'] del xms_data['clusters'] self.assertRaises(exception.VolumeDriverException, self.driver.check_for_setup_error) xms_data['clusters'] = clusters self.driver.check_for_setup_error() def test_create_extend_delete_volume(self, req): req.side_effect = xms_request self.driver.create_volume(self.data.test_volume) self.driver.extend_volume(self.data.test_volume, 5) self.driver.delete_volume(self.data.test_volume) def test_create_delete_snapshot(self, req): req.side_effect = xms_request self.driver.create_volume(self.data.test_volume) self.driver.create_snapshot(self.data.test_snapshot) self.assertEqual(self.data.test_snapshot['id'], xms_data['volumes'][2]['name']) self.driver.delete_snapshot(self.data.test_snapshot) self.driver.delete_volume(self.data.test_volume) def test_failed_rename_snapshot(self, req): req.side_effect = xms_failed_rename_snapshot_request self.assertRaises(exception.VolumeBackendAPIException, self.driver.create_snapshot, self.data.test_snapshot) self.assertEqual(0, len(xms_data['volumes'])) def test_volume_from_snapshot(self, req): req.side_effect = xms_request xms_data['volumes'] = {} self.driver.create_volume(self.data.test_volume) self.driver.create_snapshot(self.data.test_snapshot) self.driver.create_volume_from_snapshot(self.data.test_volume2, self.data.test_snapshot) self.driver.delete_volume(self.data.test_volume2) self.driver.delete_volume(self.data.test_snapshot) self.driver.delete_volume(self.data.test_volume) def test_clone_volume(self, req): req.side_effect = xms_request self.driver.create_volume(self.data.test_volume) self.driver.create_cloned_volume(self.data.test_clone, self.data.test_volume) self.driver.delete_volume(self.data.test_clone) self.driver.delete_volume(self.data.test_volume) def test_duplicate_volume(self, req): req.side_effect = xms_request self.driver.create_volume(self.data.test_volume) self.assertRaises(exception.VolumeBackendAPIException, self.driver.create_volume, self.data.test_volume) self.driver.delete_volume(self.data.test_volume) def test_no_portals_configured(self, req): req.side_effect = xms_request portals = xms_data['iscsi-portals'].copy() xms_data['iscsi-portals'].clear() lunmap = {'lun': 4} self.assertRaises(exception.VolumeDriverException, self.driver._get_iscsi_properties, lunmap) xms_data['iscsi-portals'] = portals def test_initialize_terminate_connection(self, req): req.side_effect = xms_request self.driver.create_volume(self.data.test_volume) map_data = self.driver.initialize_connection(self.data.test_volume, self.data.connector) self.assertEqual(map_data['data']['target_lun'], 1) i1 = xms_data['initiators'][1] i1['ig-id'] = ['', i1['ig-id'], 1] i1['chap-authentication-initiator-password'] = 'chap_password1' i1['chap-discovery-initiator-password'] = 'chap_password2' map_data = self.driver.initialize_connection(self.data.test_volume2, self.data.connector) self.driver.terminate_connection(self.data.test_volume, self.data.connector) def test_initialize_chap_connection(self, req): req.side_effect = xms_request clean_xms_data() self.driver.create_volume(self.data.test_volume) map_data = self.driver.initialize_connection(self.data.test_volume, self.data.connector) c1 = xms_data['clusters'][1] c1['chap-authentication-mode'] = 'initiator' c1['chap-discovery-mode'] = 'initiator' i1 = xms_data['initiators'][1] i1['ig-id'] = ['', i1['ig-id'], 1] i1['chap-authentication-initiator-password'] = 'chap_password1' i1['chap-discovery-initiator-password'] = 'chap_password2' map_data = self.driver.initialize_connection(self.data.test_volume2, self.data.connector) self.assertEqual('chap_password1', map_data['data']['auth_password']) self.assertEqual('chap_password2', map_data['data']['discovery_auth_password']) i1['chap-authentication-initiator-password'] = None i1['chap-discovery-initiator-password'] = None map_data = self.driver.initialize_connection(self.data.test_volume2, self.data.connector) def test_initialize_connection_bad_ig(self, req): req.side_effect = xms_bad_request self.assertRaises(exception.VolumeBackendAPIException, self.driver.initialize_connection, self.data.test_volume, self.data.connector) self.driver.delete_volume(self.data.test_volume) def test_get_stats(self, req): req.side_effect = xms_request stats = self.driver.get_volume_stats(True) self.assertEqual(stats['volume_backend_name'], self.driver.backend_name) def test_manage_unmanage(self, req): req.side_effect = xms_request xms_data['volumes'] = {1: {'name': 'unmanaged1', 'index': 1, 'vol-size': '3', }, } ref_vol = {"source-name": "unmanaged1"} invalid_ref = {"source-name": "invalid"} self.assertRaises(exception.ManageExistingInvalidReference, self.driver.manage_existing_get_size, self.data.test_volume, invalid_ref) self.driver.manage_existing_get_size(self.data.test_volume, ref_vol) self.assertRaises(exception.ManageExistingInvalidReference, self.driver.manage_existing, self.data.test_volume, invalid_ref) self.driver.manage_existing(self.data.test_volume, ref_vol) self.assertRaises(exception.VolumeNotFound, self.driver.unmanage, self.data.test_volume2) self.driver.unmanage(self.data.test_volume) @mock.patch('cinder.objects.snapshot.SnapshotList.get_all_for_cgsnapshot') def test_cg_operations(self, get_all_for_cgsnapshot, req): req.side_effect = xms_request d = self.data snapshot_obj = fake_snapshot.fake_snapshot_obj(d.context) snapshot_obj.consistencygroup_id = d.group['id'] get_all_for_cgsnapshot.return_value = [snapshot_obj] self.driver.create_consistencygroup(d.context, d.group) self.assertEqual(1, len(xms_data['consistency-groups'])) self.driver.update_consistencygroup(d.context, d.group, add_volumes=[d.test_volume, d.test_volume2]) self.assertEqual(2, len(xms_data['consistency-group-volumes'])) self.driver.update_consistencygroup(d.context, d.group, remove_volumes=[d.test_volume2]) self.assertEqual(1, len(xms_data['consistency-group-volumes'])) self.driver.db = mock.Mock() (self.driver.db. volume_get_all_by_group.return_value) = [mock.MagicMock()] self.driver.create_cgsnapshot(d.context, d.cgsnapshot) snaps_name = self.driver._get_cgsnap_name(d.cgsnapshot) snaps = xms_data['volumes'][1] snaps['index'] = 1 xms_data['snapshot-sets'] = {snaps_name: snaps, 1: snaps} self.assertRaises(exception.InvalidInput, self.driver.create_consistencygroup_from_src, d.context, d.group, []) self.driver.delete_cgsnapshot(d.context, d.cgsnapshot) self.driver.delete_consistencygroup(d.context, d.group) @mock.patch('requests.request') class EMCXIODriverTestCase(test.TestCase): def setUp(self): super(EMCXIODriverTestCase, self).setUp() configuration = mock.Mock() configuration.san_login = '' configuration.san_password = '' configuration.san_ip = '' configuration.xtremio_cluster_name = '' def safe_get(key): getattr(configuration, key) configuration.safe_get = safe_get self.driver = xtremio.XtremIOISCSIDriver(configuration=configuration) self.data = CommonData() def test_retry_request(self, req): busy_response = mock.MagicMock() busy_response.status_code = 400 busy_response.json.return_value = { "message": "system_is_busy", "error_code": 400 } good_response = mock.MagicMock() good_response.status_code = 200 EMCXIODriverTestCase.req_count = 0 def busy_request(*args, **kwargs): if EMCXIODriverTestCase.req_count < 1: EMCXIODriverTestCase.req_count += 1 return busy_response return good_response req.side_effect = busy_request self.driver.create_volume(self.data.test_volume) @mock.patch('cinder.volume.drivers.emc.xtremio.XtremIOClient.req') class EMCXIODriverFibreChannelTestCase(test.TestCase): def setUp(self): super(EMCXIODriverFibreChannelTestCase, self).setUp() clean_xms_data() config = mock.Mock() config.san_login = '' config.san_password = '' config.san_ip = '' config.xtremio_cluster_name = '' config.xtremio_provisioning_factor = 20.0 self.driver = xtremio.XtremIOFibreChannelDriver( configuration=config) self.driver.client = xtremio.XtremIOClient4(config, config. xtremio_cluster_name) self.data = CommonData() def test_initialize_terminate_connection(self, req): req.side_effect = xms_request self.driver.create_volume(self.data.test_volume) map_data = self.driver.initialize_connection(self.data.test_volume, self.data.connector) self.assertEqual(map_data['data']['target_lun'], 1) self.driver.terminate_connection(self.data.test_volume, self.data.connector) self.driver.delete_volume(self.data.test_volume)
import os import numpy import shutil import json from shock import Client as ShockClient from biokbase.CompressionBasedDistance.Helpers import extract_seq, run_command, make_job_dir, timestamp, CommandError from biokbase.userandjobstate.client import UserAndJobState from multiprocessing import Pool from itertools import combinations from biokbase import log # String used to separate components in paired file names. PairSeparator = '-cbdpair-' # Exception thrown when extract sequences failed class ExtractError(Exception): pass # Exception thrown when sorting a sequence file failed class SortError(Exception): pass # Exception thrown when merging sequence files failed class MergeError(Exception): pass # Exception thrown when compressing a sequence file failed class CompressError(Exception): pass # Exception thrown when sequence files have different sequence lengths. class SeqLenError(Exception): pass # Exception thrown when saving a file to Shock failed. class ShockError(Exception): pass class CompressionBasedDistance: ''' Calculate the compression based distance metric and save distance matrix to a file. @param fileList List of paths to compressed files @param scale Scale of distance values, 'std' for 0 to 1, 'inf' for 0 to infinity @param outputFile Path to file with output distance matrix @return Nothing ''' def _cbdCalculator(self, fileList, scale, outputFile): # Parse the files. single_sizes = dict() pair_sizes = dict() for sourceFile in fileList: # Should strip prefix too fbase = os.path.basename(sourceFile) # This works as long as '.sorted.xz' only occurs at the end of the path. fname = fbase.replace('.sorted.xz', '') if PairSeparator in fname: pair_sizes[fname] = os.path.getsize(sourceFile) else: single_sizes[fname] = os.path.getsize(sourceFile) # Map file names to indices. fnames = single_sizes.keys() fnames.sort() indices = dict() for name,i in zip(fnames, range(len(fnames))): indices[name] = i # Compute the distance scores. pair_names = pair_sizes.keys() cbd_array = numpy.zeros((len(fnames), len(fnames)), dtype=float) for pair in pair_names: name1, name2 = pair.split(PairSeparator) c1 = float(single_sizes[name1]) c2 = float(single_sizes[name2]) c12 = float(pair_sizes[pair]) distance = 1.0 - ( 2.0 * ( (c1 + c2 - c12) / (c1 + c2) ) ) if distance > 1.0: part1 = "Distance %f is greater than 1.0. " %(distance) part2 = "Check sequence read lengths and relative number of sequence reads. " part3 = "(c1=%f %s, c2=%f %s c12=%f %s)" %(c1, name1, c2, name2, c12, pair) raise ValueError(part1+part2+part3) if scale == 'inf': distance = distance/(1.0 - distance) cbd_array[indices[name1],indices[name2]] = distance cbd_array[indices[name2],indices[name1]] = distance # Build the output file in CSV format. outf = open(outputFile, 'w') outf.write('ID,' + ','.join(fnames) + '\n') for i in range(len(fnames)): outf.write(fnames[i] + ',' + ','.join(['{0:g}'.format(x) for x in cbd_array[i,:]]) + '\n') outf.close() return ''' Cleanup after running a job. @note All temporary files are removed even when there is an error. @return Nothing ''' def _cleanup(self): # Delete input fasta files from Shock. for nodeId in self.input['node_ids']: try: self.shockClient.delete_node(nodeId) except Exception as e: self._log(log.ERR, 'Error deleting node %s from Shock: %s' %(nodeId, e.message)) # Remove the work directory. shutil.rmtree(self.jobDirectory) # Stop the process pool. self.pool.close() self.pool.join() return ''' Log a message to the system log. @param level Message level (INFO, WARNING, etc.) @param message Message text @return Nothing ''' def _log(self, level, message): # Create a logger if this is the first time the method has been called. if self.logger is None: submod = os.environ.get('KB_SERVICE_NAME', 'CompressionBasedDistance') self.logger = log.log(submod, ip_address=True, authuser=True, module=True, method=True, call_id=True, config=os.getenv('KB_DEPLOYMENT_CONFIG')) # Log the message. self.logger.log_message(level, message, self.context['client_ip'], self.context['user_id'], self.context['module'], self.context['method'], self.context['call_id']) return def __init__(self): self.logger = None ''' Run a job to build a distance matrix. When successful the distance matrix csv file is stored in Shock. @param job Dictionary with configuration variables, context variables, and input variables for job @raise ExtractError: Error extracting sequences from input sequence file @raise SeqLenError: Error with lengths of sequences in input sequence file @raise SortError: Error sorting a raw sequence file @raise MergeError: Error merging a raw sequence file @raise CompressError: Error compressing a raw sequence file @raise ShockError: Error saving file to Shock @return Nothing ''' def runJob(self, job): self.config = job['config'] self.context = job['context'] self.input = job['input'] # Create a shock client and authenticate as the user. self.shockClient = ShockClient(self.config['shock_url'], self.context['token']) # Create a user and job state client and authenticate as the user. ujsClient = UserAndJobState(self.config['userandjobstate_url'], token=self.context['token']) # Create a process pool. self.pool = Pool(processes=int(self.config['num_pool_processes'])) # Create a work directory for storing intermediate files. self.jobDirectory = make_job_dir(self.config['work_folder_path'], job['id']) self._log(log.INFO, 'Job '+job['id']+' running with work folder '+self.jobDirectory) # Download input fasta files from Shock and extract sequences to work directory. try: ujsClient.update_job_progress(job['id'], self.context['token'], 'extracting sequence files', 1, timestamp(3600)) except: pass resultList = [] sequenceList = [] for nodeId in self.input['node_ids']: node = self.shockClient.get_node(nodeId) sourceFile = os.path.join(self.jobDirectory, node['file']['name']) destFile = '%s.sequence' %(os.path.splitext(sourceFile)[0]) if PairSeparator in destFile: # Check for pair separator string in file name and replace as needed. destFile = destFile.replace(PairSeparator, '-') sequenceList.append(destFile) args = dict() # Needs to be scoped here so each process gets its own copy args['format'] = self.input['format'] args['shockUrl'] = self.config['shock_url'] args['auth'] = self.context['token'] args['sequenceLen'] = self.input['sequence_length'] args['minReads'] = self.input['min_reads'] args['maxReads'] = self.input['max_reads'] args['nodeId'] = nodeId args['sourceFile'] = sourceFile args['destFile'] = destFile result = self.pool.apply_async(extract_seq, (args,)) resultList.append(result) for result in resultList: if result.get() != 0: self._cleanup() raise ExtractError("Error extracting sequences from input sequence file, result: %d" %(result.get())) for path in self.input['file_paths']: sourceFile = os.path.basename(path) destFile = '%s/%s.sequence' %(self.jobDirectory, os.path.splitext(sourceFile)[0]) if PairSeparator in destFile: # Check for pair separator string in file name and replace as needed. destFile = destFile.replace(PairSeparator, '-') sequenceList.append(destFile) args = dict() # Needs to be scoped here so each process gets its own copy args['format'] = self.input['format'] args['shockUrl'] = self.config['shock_url'] args['auth'] = self.context['token'] args['sequenceLen'] = self.input['sequence_length'] args['minReads'] = self.input['min_reads'] args['maxReads'] = self.input['max_reads'] args['nodeId'] = None args['sourceFile'] = path args['destFile'] = destFile result = self.pool.apply_async(extract_seq, (args,)) resultList.append(result) for result in resultList: try: result.get() except Exception as e: self._cleanup() raise ExtractError("Error extracting sequences from input sequence file: %s" %(e.message)) # Confirm that each file met the criteria for sequence length and number of sequences. filesToRemove = list() for index in range(len(sequenceList)): # See if the file did not have the minimum number of sequences. if not os.path.exists(sequenceList[index]): filesToRemove.append(index) continue # See if the file has no data. if os.path.getsize(sequenceList[index]) == 0: self._cleanup() raise SeqLenError("Sequence file '%s' has no sequences" %(sequenceList[index])) filteredList = list() for index in range(len(sequenceList)): if index not in filesToRemove: filteredList.append(sequenceList[index]) if len(filteredList) < 2: self._cleanup() raise SeqLenError("There are not enough sequence files that meet the sequence length or number of sequences criteria.") # Sort the sequences. try: ujsClient.update_job_progress(job['id'], self.context['token'], 'sorting sequence files', 1, timestamp(3600)) except: pass resultList = [] sortedList = [] for sourceFile in filteredList: destFile = '%s.sorted' %(os.path.splitext(sourceFile)[0]) sortedList.append(destFile) args = [ '/usr/bin/sort', '--output=%s' %(destFile), sourceFile ] result = self.pool.apply_async(run_command, (args,)) resultList.append(result) for result in resultList: try: result.get() except CommandError as e: self._cleanup() raise SortError("Error sorting sequence file: %s\nCommand: '%s'\nStdout: '%s'\nStderr: '%s'" %(e.message, e.cmd, e.stdout, e.stderr)) # Create combined and sorted files. try: ujsClient.update_job_progress(job['id'], self.context['token'], 'merging all pairs of sequence files', 1, timestamp(3600)) except: pass resultList = [] for p,q in combinations(sortedList, 2): pbase = os.path.basename(p) qbase = os.path.basename(q) dbase = '%s%s%s.sorted' %(os.path.splitext(pbase)[0], PairSeparator, os.path.splitext(qbase)[0]) destFile = os.path.join(self.jobDirectory, dbase) sortedList.append(destFile) args = [ '/usr/bin/sort', '-m', '--output=%s' %(destFile), p, q ] result = self.pool.apply_async(run_command, (args,)) resultList.append(result) for result in resultList: try: result.get() except CommandError as e: self._cleanup() raise MergeError("Error merging sequence file: %s\nCommand: '%s'\nStdout: '%s'\nStderr: '%s'" %(e.message, e.cmd, e.stdout, e.stderr)) # Compress all sorted files. try: ujsClient.update_job_progress(job['id'], self.context['token'], 'compressing sequence files', 1, timestamp(3600)) except: pass resultList = [] compressedList = [] for sourceFile in sortedList: compressedList.append(sourceFile+'.xz') if self.input['extreme']: level = '-9e' else: level = '-9' args = [ '/usr/bin/xz', '--keep', level, '--no-warn', sourceFile ] result = self.pool.apply_async(run_command, (args,)) resultList.append(result) for result in resultList: try: result.get() except CommandError as e: self._cleanup() raise CompressError("Error compressing sequence file: %s\nCommand: '%s'\nStdout: '%s'\nStderr: '%s'" %(e.message, e.cmd, e.stdout, e.stderr)) # Calculate the distance matrix. try: ujsClient.update_job_progress(job['id'], self.context['token'], 'calculating distance matrix', 1, timestamp(3600)) except: pass csvFile = os.path.join(self.jobDirectory, '%s.csv' %(job['id'])) self._cbdCalculator(compressedList, self.input['scale'], csvFile) # Store the output file in shock. try: ujsClient.update_job_progress(job['id'], self.context['token'], 'storing output file in shock', 1, timestamp(3600)) except: pass node = self.shockClient.create_node(csvFile, '') if not node['id']: # Shock let us down. Save the distance matrix in the work directory for possible recovery. os.rename(csvFile, '%s/%s.csv' %(self.config['work_folder_path'], job['id'])) self._cleanup() raise ShockError("Error saving distance matrix file to Shock. A Shock node was not created.") # Mark the job as complete. results = { 'shocknodes': [ node['id'] ], 'shockurl': self.config['shock_url'] } ujsClient.complete_job(job['id'], self.context['token'], 'done', None, results) self._log(log.INFO, 'Job '+job['id']+' completed successfully') # Cleanup after ourselves. self._cleanup() return def calculate(self, listFilePath, scale, csvFile): # Each line of the list file is a path to a compressed file. compressedList = list() listFile = open(listFilePath, 'r') for line in listFile: compressedList.append(line.strip()) listFile.close() # Calculate the distance matrix. self._cbdCalculator(compressedList, scale, csvFile) return
# pylint: disable=W0611 ''' simpleOSC 0.2 ixi software - July, 2006 www.ixi-software.net simple API for the Open SoundControl for Python (by Daniel Holth, Clinton McChesney --> pyKit.tar.gz file at http://wiretap.stetson.edu) Documentation at http://wiretap.stetson.edu/docs/pyKit/ The main aim of this implementation is to provide with a simple way to deal with the OSC implementation that makes life easier to those who don't have understanding of sockets or programming. This would not be on your screen without the help of Daniel Holth. This library is free software; you can redistribute it and/or modify it under the terms of the GNU Lesser General Public License as published by the Free Software Foundation; either version 2.1 of the License, or (at your option) any later version. This library is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU Lesser General Public License for more details. You should have received a copy of the GNU Lesser General Public License along with this library; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA Thanks for the support to Buchsenhausen, Innsbruck, Austria. ''' from . import OSC import socket, os, time, errno, sys from threading import Lock from kivy.logger import Logger try: # multiprocessing support is not good on window if sys.platform in ('win32', 'cygwin'): raise use_multiprocessing = True from multiprocessing import Process, Queue, Value import multiprocessing.synchronize Logger.info('OSC: using <multiprocessing> for socket') except: use_multiprocessing = False from threading import Thread Logger.info('OSC: using <thread> for socket') # globals outSocket = 0 oscThreads = {} oscLock = Lock() if use_multiprocessing: def _readQueue(thread_id=None): global oscThreads for id in oscThreads: if thread_id is not None: if id != thread_id: continue thread = oscThreads[id] try: while True: message = thread.queue.get_nowait() thread.addressManager.handle(message) except: pass class _OSCServer(Process): def __init__(self, **kwargs): self.addressManager = OSC.CallbackManager() self.queue = Queue() Process.__init__(self, args=(self.queue,)) self.daemon = True self._isRunning = Value('b', True) self._haveSocket= Value('b', False) def _queue_message(self, message): self.queue.put(message) def _get_isRunning(self): return self._isRunning.value def _set_isRunning(self, value): self._isRunning.value = value isRunning = property(_get_isRunning, _set_isRunning) def _get_haveSocket(self): return self._haveSocket.value def _set_haveSocket(self, value): self._haveSocket.value = value haveSocket = property(_get_haveSocket, _set_haveSocket) else: def _readQueue(thread_id=None): pass class _OSCServer(Thread): def __init__(self, **kwargs): Thread.__init__(self) self.addressManager = OSC.CallbackManager() self.daemon = True self.isRunning = True self.haveSocket = False def _queue_message(self, message): self.addressManager.handle(message) def init() : '''instantiates address manager and outsocket as globals ''' assert('Not used anymore') def bind(oscid, func, oscaddress): '''bind given oscaddresses with given functions in address manager ''' global oscThreads thread = oscThreads.get(oscid, None) if thread is None: assert('Unknown thread') thread.addressManager.add(func, oscaddress) def sendMsg(oscAddress, dataArray=[], ipAddr='127.0.0.1', port=9000) : '''create and send normal OSC msgs defaults to '127.0.0.1', port 9000 ''' oscLock.acquire() outSocket.sendto( createBinaryMsg(oscAddress, dataArray), (ipAddr, port)) oscLock.release() def createBundle(): '''create bundled type of OSC messages ''' b = OSC.OSCMessage() b.address = "" b.append("#bundle") b.append(0) b.append(0) return b def appendToBundle(bundle, oscAddress, dataArray): '''create OSC mesage and append it to a given bundle ''' bundle.append( createBinaryMsg(oscAddress, dataArray), 'b') def sendBundle(bundle, ipAddr='127.0.0.1', port=9000) : '''convert bundle to a binary and send it ''' oscLock.acquire() outSocket.sendto(bundle.message, (ipAddr, port)) oscLock.release() def createBinaryMsg(oscAddress, dataArray): '''create and return general type binary OSC msg ''' m = OSC.OSCMessage() m.address = oscAddress for x in dataArray: m.append(x) return m.getBinary() def readQueue(thread_id=None): '''Read queues from all threads, and dispatch message. This must be call in the main thread. You can pass the thread id to deque message from a specific thread. This id is returned from the listen() function''' return _readQueue(thread_id) ################################ receive osc from The Other. class OSCServer(_OSCServer): def __init__(self, **kwargs): kwargs.setdefault('ipAddr', '127.0.0.1') kwargs.setdefault('port', 9001) super(OSCServer, self).__init__() self.ipAddr = kwargs.get('ipAddr') self.port = kwargs.get('port') def run(self): self.haveSocket = False # create socket self.socket = socket.socket(socket.AF_INET, socket.SOCK_DGRAM) # fix trouble if python leave without cleaning well the socket # not needed under windows, he can reuse addr even if the socket # are in fin2 or wait state. if os.name in ['posix', 'mac'] and hasattr(socket, 'SO_REUSEADDR'): self.socket.setsockopt(socket.SOL_SOCKET, socket.SO_REUSEADDR, 1) # try to bind the socket, retry if necessary while not self.haveSocket and self.isRunning: try : self.socket.bind((self.ipAddr, self.port)) self.socket.settimeout(0.5) self.haveSocket = True except socket.error as e: error, message = e.args # special handle for EADDRINUSE if error == errno.EADDRINUSE: Logger.error('OSC: Address %s:%i already in use, retry in 2 second' % (self.ipAddr, self.port)) else: self.haveSocket = False # sleep 2 second before retry time.sleep(2) Logger.info('OSC: listening for Tuio on %s:%i' % (self.ipAddr, self.port)) while self.isRunning: try: message = self.socket.recv(65535) self._queue_message(message) except Exception as e: if type(e) == socket.timeout: continue Logger.exception('OSC: Error in Tuio recv()') return 'no data arrived' def listen(ipAddr='127.0.0.1', port=9001): '''Creates a new thread listening to that port defaults to ipAddr='127.0.0.1', port 9001 ''' global oscThreads id = '%s:%d' % (ipAddr, port) if id in oscThreads: return Logger.debug('OSC: Start thread <%s>' % id) oscThreads[id] = OSCServer(ipAddr=ipAddr, port=port) oscThreads[id].start() return id def dontListen(id = None): '''closes the socket and kills the thread ''' global oscThreads if id and id in oscThreads: ids = [id] else: ids = list(oscThreads.keys()) for id in ids: #oscThreads[id].socket.close() Logger.debug('OSC: Stop thread <%s>' % id) oscThreads[id].isRunning = False oscThreads[id].join() Logger.debug('OSC: Stop thread <%s> finished' % id) del oscThreads[id] if __name__ == '__main__': # example of how to use oscAPI init() listen() # defaults to "127.0.0.1", 9001 time.sleep(5) # add addresses to callback manager def printStuff(msg): '''deals with "print" tagged OSC addresses ''' print("printing in the printStuff function ", msg) print("the oscaddress is ", msg[0]) print("the value is ", msg[2]) bind(printStuff, "/test") #send normal msg, two ways sendMsg("/test", [1, 2, 3], "127.0.0.1", 9000) sendMsg("/test2", [1, 2, 3]) # defaults to "127.0.0.1", 9000 sendMsg("/hello") # defaults to [], "127.0.0.1", 9000 # create and send bundle, to ways to send bundle = createBundle() appendToBundle(bundle, "/testing/bundles", [1, 2, 3]) appendToBundle(bundle, "/testing/bundles", [4, 5, 6]) sendBundle(bundle, "127.0.0.1", 9000) sendBundle(bundle) # defaults to "127.0.0.1", 9000 dontListen() # finally close the connection bfore exiting or program
from sqlalchemy.exc import NoSuchTableError from sqlalchemy import schema as sa_schema, types as sqltypes import logging from .. import compat from .render import _render_server_default from sqlalchemy.util import OrderedSet log = logging.getLogger(__name__) def _run_filters(object_, name, type_, reflected, compare_to, object_filters): for fn in object_filters: if not fn(object_, name, type_, reflected, compare_to): return False else: return True def _compare_tables(conn_table_names, metadata_table_names, object_filters, inspector, metadata, diffs, autogen_context): for s, tname in metadata_table_names.difference(conn_table_names): name = '%s.%s' % (s, tname) if s else tname metadata_table = metadata.tables[sa_schema._get_table_key(tname, s)] if _run_filters(metadata_table, tname, "table", False, None, object_filters): diffs.append(("add_table", metadata.tables[name])) log.info("Detected added table %r", name) _compare_indexes_and_uniques(s, tname, object_filters, None, metadata_table, diffs, autogen_context, inspector) removal_metadata = sa_schema.MetaData() for s, tname in conn_table_names.difference(metadata_table_names): name = sa_schema._get_table_key(tname, s) exists = name in removal_metadata.tables t = sa_schema.Table(tname, removal_metadata, schema=s) if not exists: inspector.reflecttable(t, None) if _run_filters(t, tname, "table", True, None, object_filters): diffs.append(("remove_table", t)) log.info("Detected removed table %r", name) existing_tables = conn_table_names.intersection(metadata_table_names) existing_metadata = sa_schema.MetaData() conn_column_info = {} for s, tname in existing_tables: name = sa_schema._get_table_key(tname, s) exists = name in existing_metadata.tables t = sa_schema.Table(tname, existing_metadata, schema=s) if not exists: inspector.reflecttable(t, None) conn_column_info[(s, tname)] = t for s, tname in sorted(existing_tables): name = '%s.%s' % (s, tname) if s else tname metadata_table = metadata.tables[name] conn_table = existing_metadata.tables[name] if _run_filters(metadata_table, tname, "table", False, conn_table, object_filters): _compare_columns(s, tname, object_filters, conn_table, metadata_table, diffs, autogen_context, inspector) _compare_indexes_and_uniques(s, tname, object_filters, conn_table, metadata_table, diffs, autogen_context, inspector) # TODO: # table constraints # sequences def _make_index(params, conn_table): return sa_schema.Index( params['name'], *[conn_table.c[cname] for cname in params['column_names']], unique=params['unique'] ) def _make_unique_constraint(params, conn_table): return sa_schema.UniqueConstraint( *[conn_table.c[cname] for cname in params['column_names']], name=params['name'] ) def _compare_columns(schema, tname, object_filters, conn_table, metadata_table, diffs, autogen_context, inspector): name = '%s.%s' % (schema, tname) if schema else tname metadata_cols_by_name = dict((c.name, c) for c in metadata_table.c) conn_col_names = dict((c.name, c) for c in conn_table.c) metadata_col_names = OrderedSet(sorted(metadata_cols_by_name)) for cname in metadata_col_names.difference(conn_col_names): if _run_filters(metadata_cols_by_name[cname], cname, "column", False, None, object_filters): diffs.append( ("add_column", schema, tname, metadata_cols_by_name[cname]) ) log.info("Detected added column '%s.%s'", name, cname) for cname in set(conn_col_names).difference(metadata_col_names): rem_col = sa_schema.Column( cname, conn_table.c[cname].type, nullable=conn_table.c[cname].nullable, server_default=conn_table.c[cname].server_default ) if _run_filters(rem_col, cname, "column", True, None, object_filters): diffs.append( ("remove_column", schema, tname, rem_col) ) log.info("Detected removed column '%s.%s'", name, cname) for colname in metadata_col_names.intersection(conn_col_names): metadata_col = metadata_cols_by_name[colname] conn_col = conn_table.c[colname] if not _run_filters( metadata_col, colname, "column", False, conn_col, object_filters): continue col_diff = [] _compare_type(schema, tname, colname, conn_col, metadata_col, col_diff, autogen_context ) _compare_nullable(schema, tname, colname, conn_col, metadata_col.nullable, col_diff, autogen_context ) _compare_server_default(schema, tname, colname, conn_col, metadata_col, col_diff, autogen_context ) if col_diff: diffs.append(col_diff) class _constraint_sig(object): def __eq__(self, other): return self.const == other.const def __ne__(self, other): return self.const != other.const def __hash__(self): return hash(self.const) class _uq_constraint_sig(_constraint_sig): is_index = False is_unique = True def __init__(self, const): self.const = const self.name = const.name self.sig = tuple(sorted([col.name for col in const.columns])) @property def column_names(self): return [col.name for col in self.const.columns] class _ix_constraint_sig(_constraint_sig): is_index = True def __init__(self, const): self.const = const self.name = const.name self.sig = tuple(sorted([col.name for col in const.columns])) self.is_unique = bool(const.unique) @property def column_names(self): return _get_index_column_names(self.const) def _get_index_column_names(idx): if compat.sqla_08: return [exp.name for exp in idx.expressions] else: return [col.name for col in idx.columns] def _compare_indexes_and_uniques(schema, tname, object_filters, conn_table, metadata_table, diffs, autogen_context, inspector): is_create_table = conn_table is None # 1a. get raw indexes and unique constraints from metadata ... metadata_unique_constraints = set(uq for uq in metadata_table.constraints if isinstance(uq, sa_schema.UniqueConstraint) ) metadata_indexes = set(metadata_table.indexes) # 1b. ... and from connection if conn_table is not None and hasattr(inspector, "get_unique_constraints"): try: conn_uniques = inspector.get_unique_constraints(tname) except (NotImplementedError, NoSuchTableError): conn_uniques = [] else: conn_uniques = [] try: conn_indexes = inspector.get_indexes(tname) except NoSuchTableError: conn_indexes = [] # 2. convert conn-level objects from raw inspector records # into schema objects conn_uniques = set(_make_unique_constraint(uq_def, conn_table) for uq_def in conn_uniques) conn_indexes = set(_make_index(ix, conn_table) for ix in conn_indexes) # 3. give the dialect a chance to omit indexes and constraints that # we know are either added implicitly by the DB or that the DB # can't accurately report on autogen_context['context'].impl.\ correct_for_autogen_constraints( conn_uniques, conn_indexes, metadata_unique_constraints, metadata_indexes ) # 4. organize the constraints into "signature" collections, the # _constraint_sig() objects provide a consistent facade over both # Index and UniqueConstraint so we can easily work with them # interchangeably metadata_unique_constraints = set(_uq_constraint_sig(uq) for uq in metadata_unique_constraints ) metadata_indexes = set(_ix_constraint_sig(ix) for ix in metadata_indexes) conn_unique_constraints = set(_uq_constraint_sig(uq) for uq in conn_uniques) conn_indexes = set(_ix_constraint_sig(ix) for ix in conn_indexes) # 5. index things by name, for those objects that have names metadata_names = dict( (c.name, c) for c in metadata_unique_constraints.union(metadata_indexes) if c.name is not None) conn_uniques_by_name = dict((c.name, c) for c in conn_unique_constraints) conn_indexes_by_name = dict((c.name, c) for c in conn_indexes) conn_names = dict((c.name, c) for c in conn_unique_constraints.union(conn_indexes) if c.name is not None) doubled_constraints = dict( (name, (conn_uniques_by_name[name], conn_indexes_by_name[name])) for name in set(conn_uniques_by_name).intersection(conn_indexes_by_name) ) # 6. index things by "column signature", to help with unnamed unique # constraints. conn_uniques_by_sig = dict((uq.sig, uq) for uq in conn_unique_constraints) metadata_uniques_by_sig = dict( (uq.sig, uq) for uq in metadata_unique_constraints) metadata_indexes_by_sig = dict( (ix.sig, ix) for ix in metadata_indexes) unnamed_metadata_uniques = dict((uq.sig, uq) for uq in metadata_unique_constraints if uq.name is None) # assumptions: # 1. a unique constraint or an index from the connection *always* # has a name. # 2. an index on the metadata side *always* has a name. # 3. a unique constraint on the metadata side *might* have a name. # 4. The backend may double up indexes as unique constraints and # vice versa (e.g. MySQL, Postgresql) def obj_added(obj): if obj.is_index: diffs.append(("add_index", obj.const)) log.info("Detected added index '%s' on %s", obj.name, ', '.join([ "'%s'" % obj.column_names ]) ) else: if is_create_table: # unique constraints are created inline with table defs return diffs.append(("add_constraint", obj.const)) log.info("Detected added unique constraint '%s' on %s", obj.name, ', '.join([ "'%s'" % obj.column_names ]) ) def obj_removed(obj): if obj.is_index: diffs.append(("remove_index", obj.const)) log.info("Detected removed index '%s' on '%s'", obj.name, tname) else: diffs.append(("remove_constraint", obj.const)) log.info("Detected removed unique constraint '%s' on '%s'", obj.name, tname ) def obj_changed(old, new, msg): if old.is_index: log.info("Detected changed index '%s' on '%s':%s", old.name, tname, ', '.join(msg) ) diffs.append(("remove_index", old.const)) diffs.append(("add_index", new.const)) else: log.info("Detected changed unique constraint '%s' on '%s':%s", old.name, tname, ', '.join(msg) ) diffs.append(("remove_constraint", old.const)) diffs.append(("add_constraint", new.const)) for added_name in sorted(set(metadata_names).difference(conn_names)): obj = metadata_names[added_name] obj_added(obj) for existing_name in sorted(set(metadata_names).intersection(conn_names)): metadata_obj = metadata_names[existing_name] if existing_name in doubled_constraints: conn_uq, conn_idx = doubled_constraints[existing_name] if metadata_obj.is_index: conn_obj = conn_idx else: conn_obj = conn_uq else: conn_obj = conn_names[existing_name] if conn_obj.is_index != metadata_obj.is_index: obj_removed(conn_obj) obj_added(metadata_obj) else: msg = [] if conn_obj.is_unique != metadata_obj.is_unique: msg.append(' unique=%r to unique=%r' % ( conn_obj.is_unique, metadata_obj.is_unique )) if conn_obj.sig != metadata_obj.sig: msg.append(' columns %r to %r' % ( conn_obj.sig, metadata_obj.sig )) if msg: obj_changed(conn_obj, metadata_obj, msg) for removed_name in sorted(set(conn_names).difference(metadata_names)): conn_obj = conn_names[removed_name] if not conn_obj.is_index and conn_obj.sig in unnamed_metadata_uniques: continue elif removed_name in doubled_constraints: if conn_obj.sig not in metadata_indexes_by_sig and \ conn_obj.sig not in metadata_uniques_by_sig: conn_uq, conn_idx = doubled_constraints[removed_name] obj_removed(conn_uq) obj_removed(conn_idx) else: obj_removed(conn_obj) for uq_sig in unnamed_metadata_uniques: if uq_sig not in conn_uniques_by_sig: obj_added(unnamed_metadata_uniques[uq_sig]) def _compare_nullable(schema, tname, cname, conn_col, metadata_col_nullable, diffs, autogen_context): conn_col_nullable = conn_col.nullable if conn_col_nullable is not metadata_col_nullable: diffs.append( ("modify_nullable", schema, tname, cname, { "existing_type": conn_col.type, "existing_server_default": conn_col.server_default, }, conn_col_nullable, metadata_col_nullable), ) log.info("Detected %s on column '%s.%s'", "NULL" if metadata_col_nullable else "NOT NULL", tname, cname ) def _compare_type(schema, tname, cname, conn_col, metadata_col, diffs, autogen_context): conn_type = conn_col.type metadata_type = metadata_col.type if conn_type._type_affinity is sqltypes.NullType: log.info("Couldn't determine database type " "for column '%s.%s'", tname, cname) return if metadata_type._type_affinity is sqltypes.NullType: log.info("Column '%s.%s' has no type within " "the model; can't compare", tname, cname) return isdiff = autogen_context['context']._compare_type(conn_col, metadata_col) if isdiff: diffs.append( ("modify_type", schema, tname, cname, { "existing_nullable": conn_col.nullable, "existing_server_default": conn_col.server_default, }, conn_type, metadata_type), ) log.info("Detected type change from %r to %r on '%s.%s'", conn_type, metadata_type, tname, cname ) def _compare_server_default(schema, tname, cname, conn_col, metadata_col, diffs, autogen_context): metadata_default = metadata_col.server_default conn_col_default = conn_col.server_default if conn_col_default is None and metadata_default is None: return False rendered_metadata_default = _render_server_default( metadata_default, autogen_context) rendered_conn_default = conn_col.server_default.arg.text \ if conn_col.server_default else None isdiff = autogen_context['context']._compare_server_default( conn_col, metadata_col, rendered_metadata_default, rendered_conn_default ) if isdiff: conn_col_default = rendered_conn_default diffs.append( ("modify_default", schema, tname, cname, { "existing_nullable": conn_col.nullable, "existing_type": conn_col.type, }, conn_col_default, metadata_default), ) log.info("Detected server default on column '%s.%s'", tname, cname )
from __future__ import unicode_literals from reviewboard.hostingsvcs.models import HostingServiceAccount from reviewboard.hostingsvcs.service import HostingService from reviewboard.reviews.models import ReviewRequest from reviewboard.scmtools.models import Repository from reviewboard.site.urlresolvers import local_site_reverse from reviewboard.webapi.resources import resources def _normalize_id(value, allowed_cls, id_field='pk', ischecker=isinstance): if ischecker(value, allowed_cls): return getattr(value, id_field) elif isinstance(value, int): return value else: raise ValueError('Expected int or %r, but got %r instead' % (allowed_cls, value)) # # APITokenResource # def get_api_token_list_url(user, local_site_name=None): return resources.api_token.get_list_url( local_site_name=local_site_name, username=user.username) def get_api_token_item_url(token, local_site_name=None): return resources.api_token.get_item_url( local_site_name=local_site_name, username=token.user.username, api_token_id=token.pk) # # ArchivedReviewRequestResource # def get_archived_review_request_list_url(username, local_site_name=None): return resources.archived_review_request.get_list_url( local_site_name=local_site_name, username=username) def get_archived_review_request_item_url(username, object_id, local_site_name=None): return resources.archived_review_request.get_item_url( local_site_name=local_site_name, username=username, review_request_id=object_id) # # ChangeResource # def get_change_list_url(review_request, local_site_name=None): return resources.change.get_list_url( local_site_name=local_site_name, review_request_id=review_request.display_id) def get_change_item_url(changedesc, local_site_name=None): return resources.change.get_item_url( local_site_name=local_site_name, review_request_id=changedesc.review_request.get().display_id, change_id=changedesc.pk) # # DefaultReviewerResource # def get_default_reviewer_list_url(local_site_name=None): return resources.default_reviewer.get_list_url( local_site_name=local_site_name) def get_default_reviewer_item_url(default_reviewer_id, local_site_name=None): return resources.default_reviewer.get_item_url( local_site_name=local_site_name, default_reviewer_id=default_reviewer_id) # # DiffResource # def get_diff_list_url(review_request, local_site_name=None): return resources.diff.get_list_url( local_site_name=local_site_name, review_request_id=review_request.display_id) def get_diff_item_url(review_request, diff_revision, local_site_name=None): return resources.diff.get_item_url( local_site_name=local_site_name, review_request_id=review_request.display_id, diff_revision=diff_revision) # # DiffFileAttachmentResource # def get_diff_file_attachment_list_url(repository, local_site_name=None): return resources.diff_file_attachment.get_list_url( local_site_name=local_site_name, repository_id=repository.pk) def get_diff_file_attachment_item_url(attachment, repository, local_site_name=None): return resources.diff_file_attachment.get_item_url( local_site_name=local_site_name, repository_id=repository.pk, file_attachment_id=attachment.pk) # # DraftDiffResource # def get_draft_diff_list_url(review_request, local_site_name=None): return resources.draft_diff.get_list_url( local_site_name=local_site_name, review_request_id=review_request.display_id) def get_draft_diff_item_url(review_request, diff_revision, local_site_name=None): return resources.draft_diff.get_item_url( local_site_name=local_site_name, review_request_id=review_request.display_id, diff_revision=diff_revision) # # DraftFileAttachmentResource # def get_draft_file_attachment_list_url(review_request, local_site_name=None): return resources.draft_file_attachment.get_list_url( local_site_name=local_site_name, review_request_id=review_request.display_id) def get_draft_file_attachment_item_url(review_request, file_attachment_id, local_site_name=None): return resources.draft_file_attachment.get_item_url( local_site_name=local_site_name, review_request_id=review_request.display_id, file_attachment_id=file_attachment_id) # # DraftFileDiffResource # def get_draft_filediff_list_url(diffset, review_request, local_site_name=None): return resources.draft_filediff.get_list_url( local_site_name=local_site_name, review_request_id=review_request.display_id, diff_revision=diffset.revision) def get_draft_filediff_item_url(filediff, review_request, local_site_name=None): return resources.draft_filediff.get_item_url( local_site_name=local_site_name, review_request_id=review_request.display_id, diff_revision=filediff.diffset.revision, filediff_id=filediff.pk) # # DraftOriginalFileResource # def get_draft_original_file_url(review_request, diffset, filediff, local_site_name=None): return resources.draft_original_file.get_list_url( local_site_name=local_site_name, review_request_id=review_request.display_id, diff_revision=diffset.revision, filediff_id=filediff.pk) # # DraftPatchedFileResource # def get_draft_patched_file_url(review_request, diffset, filediff, local_site_name=None): return resources.draft_patched_file.get_list_url( local_site_name=local_site_name, review_request_id=review_request.display_id, diff_revision=diffset.revision, filediff_id=filediff.pk) # # FileAttachmentResource # def get_file_attachment_list_url(review_request, local_site_name=None): return resources.file_attachment.get_list_url( local_site_name=local_site_name, review_request_id=review_request.display_id) def get_file_attachment_item_url(file_attachment, local_site_name=None): return resources.file_attachment.get_item_url( local_site_name=local_site_name, file_attachment_id=file_attachment.id, review_request_id=file_attachment.review_request.get().display_id) # # FileAttachmentCommentResource # def get_file_attachment_comment_list_url(file_attachment, local_site_name=None): return resources.file_attachment_comment.get_list_url( local_site_name=local_site_name, file_attachment_id=file_attachment.pk, review_request_id=file_attachment.review_request.get().display_id) def get_file_attachment_comment_item_url(file_attachment, comment_id, local_site_name=None): return resources.file_attachment_comment.get_item_url( local_site_name=local_site_name, file_attachment_id=file_attachment.pk, review_request_id=file_attachment.review_request.get().display_id, comment_id=comment_id) # # FileDiffResource # def get_filediff_list_url(diffset, review_request, local_site_name=None): return resources.filediff.get_list_url( local_site_name=local_site_name, review_request_id=review_request.display_id, diff_revision=diffset.revision) def get_filediff_item_url(filediff, review_request, local_site_name=None): return resources.filediff.get_item_url( local_site_name=local_site_name, review_request_id=review_request.display_id, diff_revision=filediff.diffset.revision, filediff_id=filediff.pk) # # FileDiffCommentResource # def get_filediff_comment_list_url(filediff, local_site_name=None): diffset = filediff.diffset review_request = diffset.history.review_request.get() return resources.filediff_comment.get_list_url( local_site_name=local_site_name, review_request_id=review_request.display_id, diff_revision=filediff.diffset.revision, filediff_id=filediff.pk) def get_filediff_comment_item_url(filediff, comment_id, local_site_name=None): diffset = filediff.diffset review_request = diffset.history.review_request.get() return resources.filediff_comment.get_item_url( local_site_name=local_site_name, review_request_id=review_request.display_id, diff_revision=filediff.diffset.revision, filediff_id=filediff.pk, comment_id=comment_id) # # GeneralCommentResource # def get_general_comment_list_url(review_request, local_site_name=None): return resources.base_review_general_comment.get_list_url( local_site_name=local_site_name, review_request_id=review_request.display_id) def get_general_comment_item_url(review_request, comment_id, local_site_name=None): return resources.base_review_general_comment.get_item_url( local_site_name=local_site_name, review_request_id=review_request.display_id, comment_id=comment_id) # # HostingServiceResource # def get_hosting_service_list_url(local_site_name=None): return resources.hosting_service.get_list_url( local_site_name=local_site_name) def get_hosting_service_item_url(hosting_service_or_id, local_site_name=None): hosting_service_id = _normalize_id(hosting_service_or_id, HostingService, id_field='hosting_service_id', ischecker=issubclass) return resources.hosting_service.get_item_url( local_site_name=local_site_name, hosting_service_id=hosting_service_id) # # HostingServiceAccountResource # def get_hosting_service_account_list_url(local_site_name=None): return resources.hosting_service_account.get_list_url( local_site_name=local_site_name) def get_hosting_service_account_item_url(account_or_id, local_site_name=None): account_id = _normalize_id(account_or_id, HostingServiceAccount) return resources.hosting_service_account.get_item_url( local_site_name=local_site_name, account_id=account_id) # # OriginalFileResource # def get_original_file_url(review_request, diffset, filediff, local_site_name=None): return resources.original_file.get_list_url( local_site_name=local_site_name, review_request_id=review_request.display_id, diff_revision=diffset.revision, filediff_id=filediff.pk) # # PatchedFileResource # def get_patched_file_url(review_request, diffset, filediff, local_site_name=None): return resources.patched_file.get_list_url( local_site_name=local_site_name, review_request_id=review_request.display_id, diff_revision=diffset.revision, filediff_id=filediff.pk) # # RemoteRepositoryResource # def get_remote_repository_list_url(account, local_site_name=None): return resources.remote_repository.get_list_url( local_site_name=local_site_name, account_id=account.pk) def get_remote_repository_item_url(remote_repository, local_site_name=None): return resources.remote_repository.get_item_url( local_site_name=local_site_name, account_id=remote_repository.hosting_service_account.pk, repository_id=remote_repository.id) # # RepositoryResource # def get_repository_list_url(local_site_name=None): return resources.repository.get_list_url( local_site_name=local_site_name) def get_repository_item_url(repository_or_id, local_site_name=None): repository_id = _normalize_id(repository_or_id, Repository) return resources.repository.get_item_url( local_site_name=local_site_name, repository_id=repository_id) # # RepositoryBranchesResource # def get_repository_branches_url(repository, local_site_name=None): return resources.repository_branches.get_list_url( local_site_name=local_site_name, repository_id=repository.pk) # # RepositoryCommitsResource # def get_repository_commits_url(repository, local_site_name=None): return resources.repository_commits.get_list_url( local_site_name=local_site_name, repository_id=repository.pk) # # RepositoryInfoResource # def get_repository_info_url(repository, local_site_name=None): return resources.repository_info.get_list_url( local_site_name=local_site_name, repository_id=repository.pk) # # ReviewResource # def get_review_list_url(review_request, local_site_name=None): return resources.review.get_list_url( local_site_name=local_site_name, review_request_id=review_request.display_id) def get_review_item_url(review_request, review_id, local_site_name=None): return resources.review.get_item_url( local_site_name=local_site_name, review_request_id=review_request.display_id, review_id=review_id) # # ReviewDiffCommentResource # def get_review_diff_comment_list_url(review, local_site_name=None): return resources.review_diff_comment.get_list_url( local_site_name=local_site_name, review_request_id=review.review_request.display_id, review_id=review.pk) def get_review_diff_comment_item_url(review, comment_id, local_site_name=None): return resources.review_diff_comment.get_item_url( local_site_name=local_site_name, review_request_id=review.review_request.display_id, review_id=review.pk, comment_id=comment_id) # # FileAttachmentCommentResource # def get_review_file_attachment_comment_list_url(review, local_site_name=None): return resources.review_file_attachment_comment.get_list_url( local_site_name=local_site_name, review_request_id=review.review_request.display_id, review_id=review.pk) def get_review_file_attachment_comment_item_url(review, comment_id, local_site_name=None): return resources.review_file_attachment_comment.get_item_url( local_site_name=local_site_name, review_request_id=review.review_request.display_id, review_id=review.pk, comment_id=comment_id) # # ReviewGeneralCommentResource # def get_review_general_comment_list_url(review, local_site_name=None): return resources.review_general_comment.get_list_url( local_site_name=local_site_name, review_request_id=review.review_request.display_id, review_id=review.pk) def get_review_general_comment_item_url(review, comment_id, local_site_name=None): return resources.review_general_comment.get_item_url( local_site_name=local_site_name, review_request_id=review.review_request.display_id, review_id=review.pk, comment_id=comment_id) # # ReviewGroupResource # def get_review_group_list_url(local_site_name=None): return resources.review_group.get_list_url( local_site_name=local_site_name) def get_review_group_item_url(group_name, local_site_name=None): return resources.review_group.get_item_url( local_site_name=local_site_name, group_name=group_name) # # ReviewGroupUserResource # def get_review_group_user_list_url(group_name, local_site_name=None): return resources.review_group_user.get_list_url( local_site_name=local_site_name, group_name=group_name) def get_review_group_user_item_url(group_name, username, local_site_name=None): return resources.review_group_user.get_item_url( local_site_name=local_site_name, group_name=group_name, username=username) # # ReviewReplyResource # def get_review_reply_list_url(review, local_site_name=None): return resources.review_reply.get_list_url( local_site_name=local_site_name, review_request_id=review.review_request.display_id, review_id=review.pk) def get_review_reply_item_url(review, reply_id, local_site_name=None): return resources.review_reply.get_item_url( local_site_name=local_site_name, review_request_id=review.review_request.display_id, review_id=review.pk, reply_id=reply_id) # # ReviewReplyDiffCommentResource # def get_review_reply_diff_comment_list_url(reply, local_site_name=None): return resources.review_reply_diff_comment.get_list_url( local_site_name=local_site_name, review_request_id=reply.review_request.display_id, review_id=reply.base_reply_to_id, reply_id=reply.pk) def get_review_reply_diff_comment_item_url(reply, comment_id, local_site_name=None): return resources.review_reply_diff_comment.get_item_url( local_site_name=local_site_name, review_request_id=reply.review_request.display_id, review_id=reply.base_reply_to_id, reply_id=reply.pk, comment_id=comment_id) # # ReviewReplyFileAttachmentCommentResource # def get_review_reply_file_attachment_comment_list_url(reply, local_site_name=None): return resources.review_reply_file_attachment_comment.get_list_url( local_site_name=local_site_name, review_request_id=reply.review_request.display_id, review_id=reply.base_reply_to_id, reply_id=reply.pk) def get_review_reply_file_attachment_comment_item_url(reply, comment_id, local_site_name=None): return resources.review_reply_file_attachment_comment.get_item_url( local_site_name=local_site_name, review_request_id=reply.review_request.display_id, review_id=reply.base_reply_to_id, reply_id=reply.pk, comment_id=comment_id) # # ReviewReplyGeneralCommentResource # def get_review_reply_general_comment_list_url(reply, local_site_name=None): return resources.review_reply_general_comment.get_list_url( local_site_name=local_site_name, review_request_id=reply.review_request.display_id, review_id=reply.base_reply_to_id, reply_id=reply.pk) def get_review_reply_general_comment_item_url(reply, comment_id, local_site_name=None): return resources.review_reply_general_comment.get_item_url( local_site_name=local_site_name, review_request_id=reply.review_request.display_id, review_id=reply.base_reply_to_id, reply_id=reply.pk, comment_id=comment_id) # # ReviewReplyScreenshotCommentResource # def get_review_reply_screenshot_comment_list_url(reply, local_site_name=None): return resources.review_reply_screenshot_comment.get_list_url( local_site_name=local_site_name, review_request_id=reply.review_request.display_id, review_id=reply.base_reply_to_id, reply_id=reply.pk) def get_review_reply_screenshot_comment_item_url(reply, comment_id, local_site_name=None): return resources.review_reply_screenshot_comment.get_item_url( local_site_name=local_site_name, review_request_id=reply.review_request.display_id, review_id=reply.base_reply_to_id, reply_id=reply.pk, comment_id=comment_id) # # ReviewRequestResource # def get_review_request_list_url(local_site_name=None): return resources.review_request.get_list_url( local_site_name=local_site_name) def get_review_request_item_url(review_request_id, local_site_name=None): return resources.review_request.get_item_url( local_site_name=local_site_name, review_request_id=review_request_id) # # ReviewRequestDraftResource # def get_review_request_draft_url(review_request, local_site_name=None): return resources.review_request_draft.get_item_url( local_site_name=local_site_name, review_request_id=review_request.display_id) # # ReviewScreenshotCommentResource # def get_review_screenshot_comment_list_url(review, local_site_name=None): return resources.review_screenshot_comment.get_list_url( local_site_name=local_site_name, review_request_id=review.review_request.display_id, review_id=review.pk) def get_review_screenshot_comment_item_url(review, comment_id, local_site_name=None): return resources.review_screenshot_comment.get_item_url( local_site_name=local_site_name, review_request_id=review.review_request.display_id, review_id=review.pk, comment_id=comment_id) # # RootResource # def get_root_url(local_site_name=None): return local_site_reverse('root-resource', local_site_name=local_site_name) # # ScreenshotResource # def get_screenshot_list_url(review_request_or_id, local_site_name=None): review_request_id = _normalize_id(review_request_or_id, ReviewRequest, id_field='display_id') return resources.screenshot.get_list_url( local_site_name=local_site_name, review_request_id=review_request_id) def get_screenshot_item_url(screenshot, local_site_name=None): return resources.screenshot.get_item_url( local_site_name=local_site_name, screenshot_id=screenshot.pk, review_request_id=screenshot.review_request.get().display_id) # # ScreenshotCommentResource # def get_screenshot_comment_list_url(screenshot, local_site_name=None): return resources.screenshot_comment.get_list_url( local_site_name=local_site_name, review_request_id=screenshot.review_request.get().display_id, screenshot_id=screenshot.pk) def get_screenshot_comment_item_url(screenshot, comment_id, local_site_name=None): return resources.screenshot_comment.get_item_url( local_site_name=local_site_name, review_request_id=screenshot.review_request.get().display_id, screenshot_id=screenshot.pk, comment_id=comment_id) # # ScreenshotDraftResource # def get_screenshot_draft_list_url(review_request, local_site_name=None): return resources.draft_screenshot.get_list_url( local_site_name=local_site_name, review_request_id=review_request.display_id) def get_screenshot_draft_item_url(review_request, screenshot_id, local_site_name=None): return resources.draft_screenshot.get_item_url( local_site_name=local_site_name, review_request_id=review_request.display_id, screenshot_id=screenshot_id) # # SearchResource # def get_search_url(local_site_name=None): return resources.search.get_item_url(local_site_name=local_site_name) # # ServerInfoResource # def get_server_info_url(local_site_name=None): return resources.server_info.get_item_url(local_site_name=local_site_name) # # SessionResource # def get_session_url(local_site_name=None): return resources.session.get_list_url(local_site_name=local_site_name) # # StatusResource # def get_status_update_list_url(review_request, local_site_name=None): return resources.status_update.get_list_url( local_site_name=local_site_name, review_request_id=review_request.display_id) def get_status_update_item_url(review_request, status_update_id, local_site_name=None): return resources.status_update.get_item_url( local_site_name=local_site_name, review_request_id=review_request.display_id, status_update_id=status_update_id) # # UserResource # def get_user_list_url(local_site_name=None): return resources.user.get_list_url( local_site_name=local_site_name) def get_user_item_url(username, local_site_name=None): return resources.user.get_item_url( local_site_name=local_site_name, username=username) # # UserFileAttachmentResource # def get_user_file_attachment_list_url(user, local_site_name=None): return resources.user_file_attachment.get_list_url( local_site_name=local_site_name, username=user.username) def get_user_file_attachment_item_url(user, file_attachment, local_site_name=None): return resources.user_file_attachment.get_item_url( local_site_name=local_site_name, username=user.username, file_attachment_id=file_attachment.id) # # ValidateDiffResource # def get_validate_diff_url(local_site_name=None): return resources.validate_diff.get_item_url( local_site_name=local_site_name) # # WatchedReviewGroupResource # def get_watched_review_group_list_url(username, local_site_name=None): return resources.watched_review_group.get_list_url( local_site_name=local_site_name, username=username) def get_watched_review_group_item_url(username, object_id, local_site_name=None): return resources.watched_review_group.get_item_url( local_site_name=local_site_name, username=username, watched_obj_id=object_id) # # WatchedReviewRequestResource # def get_watched_review_request_list_url(username, local_site_name=None): return resources.watched_review_request.get_list_url( local_site_name=local_site_name, username=username) def get_watched_review_request_item_url(username, object_id, local_site_name=None): return resources.watched_review_request.get_item_url( local_site_name=local_site_name, username=username, watched_obj_id=object_id) # # WebHookResource # def get_webhook_list_url(local_site_name=None): return resources.webhook.get_list_url(local_site_name=local_site_name) def get_webhook_item_url(webhook_id, local_site_name=None): return resources.webhook.get_item_url(local_site_name=local_site_name, webhook_id=webhook_id)
# Copyright 2017 Google Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import numpy as np import tensorflow as tf import time import itertools import cPickle import os import matplotlib.pyplot as plt plt.subplots_adjust(wspace=0.01, hspace=0.01, left=0.01, right=0.99, bottom=0.01, top=0.99) import matplotlib.pyplot as plt import matplotlib.pylab as pylab import skimage.transform as trans from skimage.feature import peak_local_max from skimage.morphology import dilation import matplotlib.patches as patches import nn import models import utils def resize(img): return (trans.resize(img, [224, 224]) * 255).astype('uint8') def softmax(x, axis=-1): e_x = np.exp(x - np.max(x)) return e_x / np.sum(e_x, axis=axis, keepdims=True) def IoU(box1, box2): def inter(x1, x2, y1, y2): if y1 < x1: x1, x2, y1, y2 = y1, y2, x1, x2 if y1 > x2: return 0 return min(x2, y2) - y1 def area(box): return (box[2] - box[0]) * (box[3] - box[1]) inter_area = (inter(box1[0], box1[2], box2[0], box2[2]) * inter(box1[1], box1[3], box2[1], box2[3])) return inter_area / float((area(box1) + area(box2) - inter_area)) def get_vg_boxes(a, H, W): a = np.array(a).reshape([2, 4]) objects = a[0, :].astype('float32') subjects = a[1, :].astype('float32') subjects[[2, 3]] += subjects[[0, 1]] subjects[[0, 2]] /= H subjects[[1, 3]] /= W objects[[2, 3]] += objects[[0, 1]] objects[[0, 2]] /= H objects[[1, 3]] /= W return subjects, objects def get_pred_boxes(a): subjects = [np.where(a[0, :, :, 0])[0][0] / 54.0, np.where(a[0, :, :, 0])[1][0] / 54.0, np.where(a[0, :, :, 1])[0][0] / 54.0, np.where(a[0, :, :, 1])[1][0] / 54.0] objects = [np.where(a[0, :, :, 2])[0][0] / 54.0, np.where(a[0, :, :, 2])[1][0] / 54.0, np.where(a[0, :, :, 3])[0][0] / 54.0, np.where(a[0, :, :, 3])[1][0] / 54.0] return subjects, objects def fix_box(b): if b[0] > b[2]: b[0], b[2] = b[2], b[0] if b[1] > b[3]: b[1], b[3] = b[3], b[1] return np.array(b) def dil(x): return dilation(dilation(x)) def model_template(images, labels, boxes, stage): return models.model_detection(images, labels, boxes, stage) model_factory = tf.make_template("detection", model_template) imgs_ph = tf.placeholder(shape=[None, 224, 224, 3], dtype=tf.float32) class_ph = tf.placeholder(shape=[None, 41], dtype=tf.float32) boxes_ph = tf.placeholder(shape=[None, 56, 56, 4], dtype=tf.float32) stage_ph = tf.placeholder(shape=[], dtype=tf.int32) tf.GLOBAL = {} tf.GLOBAL["init"] = True tf.GLOBAL["dropout"] = 0.0 with tf.device("/cpu:0"): _ = model_factory(imgs_ph, [class_ph], boxes_ph, stage_ph) tf.GLOBAL["init"] = False tf.GLOBAL["dropout"] = 0.0 with tf.device("gpu:0"): [label_p_v, point_p_v], loss = model_factory(imgs_ph, [class_ph], boxes_ph, stage_ph) dataset = cPickle.load(open('/VG/pickle/val.pickle')) prefix = '/VG/images/' saver = tf.train.Saver() box_count = 0 pos = 0 guesses = 0 g_list = [] vis = 1 try: os.mkdir('/tmp/results/correct/') except: pass f1 = plt.figure(figsize=(25, 10)) f2 = plt.figure(figsize=(10, 5)) with tf.Session() as sess: # Restore the trained model saver.restore(sess, '') # Loop over validation examples for ex_count, ex in enumerate(dataset): # Unpack example filename, labels_gt, boxes_gt = ex # Read image, check shape, get shape im = pylab.imread(os.path.join(prefix, filename)) if len(im.shape) != 3: continue H, W = im.shape[:2] # Preprocess GT boxes boxes_gt = [get_vg_boxes(b, H, W) for b in np.split(np.array(boxes_gt), len(boxes_gt) / 8)] # Preprocess input image im = (resize(im)[None] - 127.5) / 127.5 # stage 0 # p = sess.run(label_p_v, {imgs_ph: im, # class_ph: label_np, # boxes_ph: boxes_np, # stage_ph: 0})[0] # p = softmax(p) # labels_pred = set(list(np.where(p[0] > (0.2 * np.max(p[0])))[0])) for label in set(labels_gt): label_np = np.zeros((1, 41)) label_np[0, label] = 1 def explore(box_np, corner_np, stage): l = sess.run(point_p_v, {imgs_ph: im, class_ph: label_np, boxes_ph: box_np, stage_ph: stage + 1})[stage] corner_np[0, :, :, stage] = softmax(l, axis=(1, 2))[0, :, :, 0] peaks = peak_local_max(softmax(l, axis=(1, 2))[0, :, :, 0], min_distance=1, threshold_rel=0.1, exclude_border=False, num_peaks=4 - 2 * stage % 2) results = [] for peak in peaks: box_np[:, peak[0], peak[1], stage] = 1 if stage == 3: results.append((np.array(box_np), np.array(corner_np))) box_np[:, peak[0], peak[1], stage] = 0 else: results += explore(np.array(box_np), np.array(corner_np), stage + 1) box_np[:, peak[0], peak[1], stage] = 0 return results box_np = np.zeros((1, 56, 56, 4)) corner_np = np.zeros((1, 56, 56, 4)) result = explore(box_np, corner_np, 0) boxes_pred = [x[0] for x in result] corners_pred = [x[1] for x in result] # Visualize predictions if (200 <= ex_count <= 400): # Create image dir try: os.mkdir('/tmp/results/%03d' % ex_count) except: pass for ii, (box, soft_corner) in enumerate(zip(boxes_pred, corners_pred)): # Get predicted boxes [subject_pred, object_pred] = [np.array(fix_box(b)) for b in get_pred_boxes(box)] # show original image ax = f1.add_subplot(2, 5, 1) ax.grid('off') ax.axis('off') ax.imshow((im[0] * 127.5 + 127.5).astype('uint8')) # show relationship detection ax = f1.add_subplot(2, 5, 6) ax.grid('off') ax.axis('off') ax.imshow((im[0] * 127.5 + 127.5).astype('uint8')) ax.add_patch(patches.Rectangle(object_pred[0:2][::-1] * 224, (object_pred[3] - object_pred[1]) * 224, (object_pred[2] - object_pred[0]) * 224, fill=False, linewidth=7, color='red')) ax.add_patch(patches.Rectangle(subject_pred[0:2][::-1] * 224, (subject_pred[3] - subject_pred[1]) * 224, (subject_pred[2] - subject_pred[0]) * 224, fill=False, linewidth=4, color='blue')) for i in range(4): ax = f1.add_subplot(2, 5, 7 + i) ax.grid('off') ax.axis('off') ax.matshow(dil(box[0, :, :, i]), cmap=plt.get_cmap('jet')) for i in range(4): ax = f1.add_subplot(2, 5, 2 + i) ax.grid('off') ax.axis('off') ax.set_title('Stage %i' % (i + 1)) ax.matshow(soft_corner[0, :, :, i], cmap=plt.get_cmap('jet')) f1.subplots_adjust(wspace=0.01, hspace=0.01, left=0.05, right=0.95, bottom=0.05, top=0.95) f1.savefig('/tmp/results/%03d/%s-%03d.jpg' % (ex_count, utils.LABEL_MAP[label], ii)) f1.clf() correct_detections = np.zeros(len(labels_gt)) guesses += len(boxes_pred) g_list.append(len(boxes_pred)) # For every predicted box for box in boxes_pred: # For every GT box for ii, (label_gt, box_gt) in list(enumerate(zip(labels_gt, boxes_gt))): # Consider only boxes with correct label if label_gt != label: continue subject_gt, object_gt = fix_box(box_gt[0]), fix_box(box_gt[1]) subject_pred, object_pred = get_pred_boxes(box) [subject_pred, object_pred] = [fix_box(b) for b in get_pred_boxes(box)] iou1 = IoU(subject_gt, subject_pred) iou2 = IoU(object_gt, object_pred) if iou1 >= 0.5 and iou2 >= 0.5: if correct_detections[ii] < (iou1 * iou2): correct_detections[ii] = iou1 * iou2 ax = f2.add_subplot(1, 2, 1) ax.imshow((im[0] * 127.5 + 127.5).astype('uint8')) ax.grid('off') ax.axis('off') ax.add_patch(patches.Rectangle(object_gt[0:2][::-1] * 224, (object_gt[3] - object_gt[1]) * 224, (object_gt[2] - object_gt[0]) * 224, fill=False, linewidth=7, color='red')) ax.add_patch(patches.Rectangle(subject_gt[0:2][::-1] * 224, (subject_gt[3] - subject_gt[1]) * 224, (subject_gt[2] - subject_gt[0]) * 224, fill=False, linewidth=4, color='blue')) ax.set_title("Ground truth for '" + utils.LABEL_MAP[label] + "'") ax = f2.add_subplot(1, 2, 2) ax.imshow((im[0] * 127.5 + 127.5).astype('uint8')) ax.grid('off') ax.axis('off') ax.add_patch(patches.Rectangle(object_pred[0:2][::-1] * 224, (object_pred[3] - object_pred[1]) * 224, (object_pred[2] - object_pred[0]) * 224, fill=False, linewidth=7, color='red')) ax.add_patch(patches.Rectangle(subject_pred[0:2][::-1] * 224, (subject_pred[3] - subject_pred[1]) * 224, (subject_pred[2] - subject_pred[0]) * 224, fill=False, linewidth=4, color='blue')) ax.set_title("Prediction for '" + utils.LABEL_MAP[label] + "'") try: os.mkdir('/tmp/results/correct/%s' % utils.LABEL_MAP[label]) except: pass f2.subplots_adjust(wspace=0.01, hspace=0.01, left=0.05, right=0.95, bottom=0.05, top=0.95) f2.savefig('/tmp/results/correct/%s/%s-%i.jpg' % (utils.LABEL_MAP[label], filename[:-4], ii)) f2.clf() box_count += len(labels_gt) pos += np.sum(correct_detections > 0) print(guesses / float(ex_count + 1)) print(pos / float(box_count))
# -*- coding: utf-8 -*- """Test CLR field support.""" import System import pytest from Python.Test import FieldTest def test_public_instance_field(): """Test public instance fields.""" ob = FieldTest() assert ob.PublicField == 0 ob.PublicField = 1 assert ob.PublicField == 1 with pytest.raises(TypeError): del FieldTest().PublicField def test_public_static_field(): """Test public static fields.""" ob = FieldTest() assert FieldTest.PublicStaticField == 0 FieldTest.PublicStaticField = 1 assert FieldTest.PublicStaticField == 1 assert ob.PublicStaticField == 1 ob.PublicStaticField = 0 assert ob.PublicStaticField == 0 with pytest.raises(TypeError): del FieldTest.PublicStaticField with pytest.raises(TypeError): del FieldTest().PublicStaticField def test_protected_instance_field(): """Test protected instance fields.""" ob = FieldTest() assert ob.ProtectedField == 0 ob.ProtectedField = 1 assert ob.ProtectedField == 1 with pytest.raises(TypeError): del FieldTest().ProtectedField def test_protected_static_field(): """Test protected static fields.""" ob = FieldTest() assert FieldTest.ProtectedStaticField == 0 FieldTest.ProtectedStaticField = 1 assert FieldTest.ProtectedStaticField == 1 assert ob.ProtectedStaticField == 1 ob.ProtectedStaticField = 0 assert ob.ProtectedStaticField == 0 with pytest.raises(TypeError): del FieldTest.ProtectedStaticField with pytest.raises(TypeError): del FieldTest().ProtectedStaticField def test_read_only_instance_field(): """Test readonly instance fields.""" assert FieldTest().ReadOnlyField == 0 with pytest.raises(TypeError): FieldTest().ReadOnlyField = 1 with pytest.raises(TypeError): del FieldTest().ReadOnlyField def test_read_only_static_field(): """Test readonly static fields.""" ob = FieldTest() assert FieldTest.ReadOnlyStaticField == 0 assert ob.ReadOnlyStaticField == 0 with pytest.raises(TypeError): FieldTest.ReadOnlyStaticField = 1 with pytest.raises(TypeError): FieldTest().ReadOnlyStaticField = 1 with pytest.raises(TypeError): del FieldTest.ReadOnlyStaticField with pytest.raises(TypeError): del FieldTest().ReadOnlyStaticField def test_constant_field(): """Test const fields.""" ob = FieldTest() assert FieldTest.ConstField == 0 assert ob.ConstField == 0 with pytest.raises(TypeError): FieldTest().ConstField = 1 with pytest.raises(TypeError): FieldTest.ConstField = 1 with pytest.raises(TypeError): del FieldTest().ConstField with pytest.raises(TypeError): del FieldTest.ConstField def test_internal_field(): """Test internal fields.""" with pytest.raises(AttributeError): _ = FieldTest().InternalField with pytest.raises(AttributeError): _ = FieldTest().InternalStaticField with pytest.raises(AttributeError): _ = FieldTest.InternalStaticField def test_private_field(): """Test private fields.""" with pytest.raises(AttributeError): _ = FieldTest().PrivateField with pytest.raises(AttributeError): _ = FieldTest().PrivateStaticField with pytest.raises(AttributeError): _ = FieldTest.PrivateStaticField def test_field_descriptor_get_set(): """Test field descriptor get / set.""" # This test ensures that setting an attribute implemented with # a descriptor actually goes through the descriptor (rather than # silently replacing the descriptor in the instance or type dict. ob = FieldTest() assert FieldTest.PublicStaticField == 0 assert ob.PublicStaticField == 0 descriptor = FieldTest.__dict__['PublicStaticField'] assert type(descriptor) != int ob.PublicStaticField = 0 descriptor = FieldTest.__dict__['PublicStaticField'] assert type(descriptor) != int FieldTest.PublicStaticField = 0 descriptor = FieldTest.__dict__['PublicStaticField'] assert type(descriptor) != int def test_field_descriptor_wrong_type(): """Test setting a field using a value of the wrong type.""" with pytest.raises(TypeError): FieldTest().PublicField = "spam" def test_field_descriptor_abuse(): """Test field descriptor abuse.""" desc = FieldTest.__dict__['PublicField'] with pytest.raises(TypeError): desc.__get__(0, 0) with pytest.raises(TypeError): desc.__set__(0, 0) def test_boolean_field(): """Test boolean fields.""" # change this to true / false later for Python 2.3? ob = FieldTest() assert ob.BooleanField is False ob.BooleanField = True assert ob.BooleanField is True ob.BooleanField = False assert ob.BooleanField is False with pytest.raises(TypeError): ob.BooleanField = 1 with pytest.raises(TypeError): ob.BooleanField = 0 def test_sbyte_field(): """Test sbyte fields.""" ob = FieldTest() assert ob.SByteField == 0 ob.SByteField = 1 assert ob.SByteField == 1 def test_byte_field(): """Test byte fields.""" ob = FieldTest() assert ob.ByteField == 0 ob.ByteField = 1 assert ob.ByteField == 1 def test_char_field(): """Test char fields.""" ob = FieldTest() assert ob.CharField == u'A' assert ob.CharField == 'A' ob.CharField = 'B' assert ob.CharField == u'B' assert ob.CharField == 'B' ob.CharField = u'C' assert ob.CharField == u'C' assert ob.CharField == 'C' def test_int16_field(): """Test int16 fields.""" ob = FieldTest() assert ob.Int16Field == 0 ob.Int16Field = 1 assert ob.Int16Field == 1 def test_int32_field(): """Test int32 fields.""" ob = FieldTest() assert ob.Int32Field == 0 ob.Int32Field = 1 assert ob.Int32Field == 1 def test_int64_field(): """Test int64 fields.""" ob = FieldTest() assert ob.Int64Field == 0 ob.Int64Field = 1 assert ob.Int64Field == 1 def test_uint16_field(): """Test uint16 fields.""" ob = FieldTest() assert ob.UInt16Field == 0 ob.UInt16Field = 1 assert ob.UInt16Field == 1 def test_uint32_field(): """Test uint32 fields.""" ob = FieldTest() assert ob.UInt32Field == 0 ob.UInt32Field = 1 assert ob.UInt32Field == 1 def test_uint64_field(): """Test uint64 fields.""" ob = FieldTest() assert ob.UInt64Field == 0 ob.UInt64Field = 1 assert ob.UInt64Field == 1 def test_single_field(): """Test single fields.""" ob = FieldTest() assert ob.SingleField == 0.0 ob.SingleField = 1.1 assert ob.SingleField == System.Single(1.1) def test_double_field(): """Test double fields.""" ob = FieldTest() assert ob.DoubleField == 0.0 ob.DoubleField = 1.1 assert ob.DoubleField == 1.1 def test_decimal_field(): """Test decimal fields.""" ob = FieldTest() assert ob.DecimalField == System.Decimal(0) ob.DecimalField = System.Decimal(1) assert ob.DecimalField == System.Decimal(1) def test_string_field(): """Test string fields.""" ob = FieldTest() assert ob.StringField == "spam" ob.StringField = "eggs" assert ob.StringField == "eggs" def test_interface_field(): """Test interface fields.""" from Python.Test import Spam, ISpam ob = FieldTest() assert ISpam(ob.SpamField).GetValue() == "spam" assert ob.SpamField.GetValue() == "spam" ob.SpamField = Spam("eggs") assert ISpam(ob.SpamField).GetValue() == "eggs" assert ob.SpamField.GetValue() == "eggs" def test_object_field(): """Test ob fields.""" ob = FieldTest() assert ob.ObjectField is None ob.ObjectField = System.String("spam") assert ob.ObjectField == "spam" ob.ObjectField = System.Int32(1) assert ob.ObjectField == 1 ob.ObjectField = None assert ob.ObjectField is None def test_enum_field(): """Test enum fields.""" from Python.Test import ShortEnum ob = FieldTest() assert ob.EnumField == ShortEnum.Zero ob.EnumField = ShortEnum.One assert ob.EnumField == ShortEnum.One def test_nullable_field(): """Test nullable fields.""" ob = FieldTest() ob.StringField = None assert ob.StringField is None ob.ObjectField = None assert ob.ObjectField is None ob.SpamField = None assert ob.SpamField is None # Primitive types and enums should not be set to null. with pytest.raises(TypeError): FieldTest().Int32Field = None with pytest.raises(TypeError): FieldTest().EnumField = None
# Copyright 2014 Cloudbase Solutions Srl # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. """ Utility class for VHD related operations. Official VHD format specs can be retrieved at: http://technet.microsoft.com/en-us/library/bb676673.aspx See "Download the Specifications Without Registering" Official VHDX format specs can be retrieved at: http://www.microsoft.com/en-us/download/details.aspx?id=34750 VHD related Win32 API reference: http://msdn.microsoft.com/en-us/library/windows/desktop/dd323700.aspx """ import ctypes import os if os.name == 'nt': from ctypes import wintypes kernel32 = ctypes.windll.kernel32 virtdisk = ctypes.windll.virtdisk from oslo_log import log as logging from cinder import exception from cinder.i18n import _ from cinder.volume.drivers.windows import constants LOG = logging.getLogger(__name__) if os.name == 'nt': class Win32_GUID(ctypes.Structure): _fields_ = [("Data1", wintypes.DWORD), ("Data2", wintypes.WORD), ("Data3", wintypes.WORD), ("Data4", wintypes.BYTE * 8)] class Win32_VIRTUAL_STORAGE_TYPE(ctypes.Structure): _fields_ = [ ('DeviceId', wintypes.ULONG), ('VendorId', Win32_GUID) ] class Win32_RESIZE_VIRTUAL_DISK_PARAMETERS(ctypes.Structure): _fields_ = [ ('Version', wintypes.DWORD), ('NewSize', ctypes.c_ulonglong) ] class Win32_OPEN_VIRTUAL_DISK_PARAMETERS_V1(ctypes.Structure): _fields_ = [ ('Version', wintypes.DWORD), ('RWDepth', ctypes.c_ulong), ] class Win32_OPEN_VIRTUAL_DISK_PARAMETERS_V2(ctypes.Structure): _fields_ = [ ('Version', wintypes.DWORD), ('GetInfoOnly', wintypes.BOOL), ('ReadOnly', wintypes.BOOL), ('ResiliencyGuid', Win32_GUID) ] class Win32_MERGE_VIRTUAL_DISK_PARAMETERS(ctypes.Structure): _fields_ = [ ('Version', wintypes.DWORD), ('MergeDepth', ctypes.c_ulong) ] class Win32_CREATE_VIRTUAL_DISK_PARAMETERS(ctypes.Structure): _fields_ = [ ('Version', wintypes.DWORD), ('UniqueId', Win32_GUID), ('MaximumSize', ctypes.c_ulonglong), ('BlockSizeInBytes', wintypes.ULONG), ('SectorSizeInBytes', wintypes.ULONG), ('PhysicalSectorSizeInBytes', wintypes.ULONG), ('ParentPath', wintypes.LPCWSTR), ('SourcePath', wintypes.LPCWSTR), ('OpenFlags', wintypes.DWORD), ('ParentVirtualStorageType', Win32_VIRTUAL_STORAGE_TYPE), ('SourceVirtualStorageType', Win32_VIRTUAL_STORAGE_TYPE), ('ResiliencyGuid', Win32_GUID) ] class Win32_SIZE(ctypes.Structure): _fields_ = [("VirtualSize", wintypes.ULARGE_INTEGER), ("PhysicalSize", wintypes.ULARGE_INTEGER), ("BlockSize", wintypes.ULONG), ("SectorSize", wintypes.ULONG)] class Win32_PARENT_LOCATION(ctypes.Structure): _fields_ = [('ParentResolved', wintypes.BOOL), ('ParentLocationBuffer', wintypes.WCHAR * 512)] class Win32_PHYSICAL_DISK(ctypes.Structure): _fields_ = [("LogicalSectorSize", wintypes.ULONG), ("PhysicalSectorSize", wintypes.ULONG), ("IsRemote", wintypes.BOOL)] class Win32_VHD_INFO(ctypes.Union): _fields_ = [("Size", Win32_SIZE), ("Identifier", Win32_GUID), ("ParentLocation", Win32_PARENT_LOCATION), ("ParentIdentifier", Win32_GUID), ("ParentTimestamp", wintypes.ULONG), ("VirtualStorageType", Win32_VIRTUAL_STORAGE_TYPE), ("ProviderSubtype", wintypes.ULONG), ("Is4kAligned", wintypes.BOOL), ("PhysicalDisk", Win32_PHYSICAL_DISK), ("VhdPhysicalSectorSize", wintypes.ULONG), ("SmallestSafeVirtualSize", wintypes.ULARGE_INTEGER), ("FragmentationPercentage", wintypes.ULONG)] class Win32_GET_VIRTUAL_DISK_INFO_PARAMETERS(ctypes.Structure): _fields_ = [("VERSION", wintypes.UINT), ("VhdInfo", Win32_VHD_INFO)] class Win32_SET_VIRTUAL_DISK_INFO_PARAMETERS(ctypes.Structure): _fields_ = [ ('Version', wintypes.DWORD), ('ParentFilePath', wintypes.LPCWSTR) ] VIRTUAL_STORAGE_TYPE_DEVICE_ISO = 1 VIRTUAL_STORAGE_TYPE_DEVICE_VHD = 2 VIRTUAL_STORAGE_TYPE_DEVICE_VHDX = 3 VIRTUAL_DISK_ACCESS_NONE = 0 VIRTUAL_DISK_ACCESS_ALL = 0x003f0000 VIRTUAL_DISK_ACCESS_CREATE = 0x00100000 VIRTUAL_DISK_ACCESS_GET_INFO = 0x80000 OPEN_VIRTUAL_DISK_FLAG_NONE = 0 OPEN_VIRTUAL_DISK_FLAG_NO_PARENTS = 1 OPEN_VIRTUAL_DISK_VERSION_1 = 1 OPEN_VIRTUAL_DISK_VERSION_2 = 2 RESIZE_VIRTUAL_DISK_FLAG_NONE = 0 RESIZE_VIRTUAL_DISK_VERSION_1 = 1 CREATE_VIRTUAL_DISK_VERSION_2 = 2 CREATE_VHD_PARAMS_DEFAULT_BLOCK_SIZE = 0 CREATE_VIRTUAL_DISK_FLAG_NONE = 0 CREATE_VIRTUAL_DISK_FLAG_FULL_PHYSICAL_ALLOCATION = 1 MERGE_VIRTUAL_DISK_VERSION_1 = 1 MERGE_VIRTUAL_DISK_FLAG_NONE = 0x00000000 GET_VIRTUAL_DISK_INFO_SIZE = 1 GET_VIRTUAL_DISK_INFO_PARENT_LOCATION = 3 GET_VIRTUAL_DISK_INFO_VIRTUAL_STORAGE_TYPE = 6 GET_VIRTUAL_DISK_INFO_PROVIDER_SUBTYPE = 7 SET_VIRTUAL_DISK_INFO_PARENT_PATH = 1 FORMAT_MESSAGE_FROM_SYSTEM = 0x00001000 FORMAT_MESSAGE_ALLOCATE_BUFFER = 0x00000100 FORMAT_MESSAGE_IGNORE_INSERTS = 0x00000200 ERROR_VHD_INVALID_TYPE = 0xC03A001B class VHDUtils(object): def __init__(self): self._ext_device_id_map = { 'vhd': VIRTUAL_STORAGE_TYPE_DEVICE_VHD, 'vhdx': VIRTUAL_STORAGE_TYPE_DEVICE_VHDX} self.create_virtual_disk_flags = { constants.VHD_TYPE_FIXED: ( CREATE_VIRTUAL_DISK_FLAG_FULL_PHYSICAL_ALLOCATION), constants.VHD_TYPE_DYNAMIC: CREATE_VIRTUAL_DISK_FLAG_NONE } self._vhd_info_members = { GET_VIRTUAL_DISK_INFO_SIZE: 'Size', GET_VIRTUAL_DISK_INFO_PARENT_LOCATION: 'ParentLocation', GET_VIRTUAL_DISK_INFO_VIRTUAL_STORAGE_TYPE: 'VirtualStorageType', GET_VIRTUAL_DISK_INFO_PROVIDER_SUBTYPE: 'ProviderSubtype', } if os.name == 'nt': self._msft_vendor_id = ( self.get_WIN32_VIRTUAL_STORAGE_TYPE_VENDOR_MSFT()) def _run_and_check_output(self, func, *args, **kwargs): """Convenience helper method for running Win32 API methods.""" ignored_error_codes = kwargs.pop('ignored_error_codes', []) ret_val = func(*args, **kwargs) # The VHD Win32 API functions return non-zero error codes # in case of failure. if ret_val and ret_val not in ignored_error_codes: error_message = self._get_error_message(ret_val) func_name = getattr(func, '__name__', '') err = (_("Executing Win32 API function %(func_name)s failed. " "Error code: %(error_code)s. " "Error message: %(error_message)s") % {'func_name': func_name, 'error_code': ret_val, 'error_message': error_message}) LOG.exception(err) raise exception.VolumeBackendAPIException(err) @staticmethod def _get_error_message(error_code): message_buffer = ctypes.c_char_p() kernel32.FormatMessageA( FORMAT_MESSAGE_FROM_SYSTEM | FORMAT_MESSAGE_ALLOCATE_BUFFER | FORMAT_MESSAGE_IGNORE_INSERTS, None, error_code, 0, ctypes.byref(message_buffer), 0, None) error_message = message_buffer.value kernel32.LocalFree(message_buffer) return error_message @staticmethod def get_WIN32_VIRTUAL_STORAGE_TYPE_VENDOR_MSFT(): guid = Win32_GUID() guid.Data1 = 0xec984aec guid.Data2 = 0xa0f9 guid.Data3 = 0x47e9 ByteArray8 = wintypes.BYTE * 8 guid.Data4 = ByteArray8(0x90, 0x1f, 0x71, 0x41, 0x5a, 0x66, 0x34, 0x5b) return guid def _open(self, vhd_path, open_flag=OPEN_VIRTUAL_DISK_FLAG_NONE, open_access_mask=VIRTUAL_DISK_ACCESS_ALL, open_params=0): device_id = self._get_device_id_by_path(vhd_path) vst = Win32_VIRTUAL_STORAGE_TYPE() vst.DeviceId = device_id vst.VendorId = self._msft_vendor_id handle = wintypes.HANDLE() self._run_and_check_output(virtdisk.OpenVirtualDisk, ctypes.byref(vst), ctypes.c_wchar_p(vhd_path), open_access_mask, open_flag, open_params, ctypes.byref(handle)) return handle def _close(self, handle): kernel32.CloseHandle(handle) def _get_device_id_by_path(self, vhd_path): ext = os.path.splitext(vhd_path)[1][1:].lower() device_id = self._ext_device_id_map.get(ext) if not device_id: raise exception.VolumeBackendAPIException( _("Unsupported virtual disk extension: %s") % ext) return device_id def resize_vhd(self, vhd_path, new_max_size): handle = self._open(vhd_path) params = Win32_RESIZE_VIRTUAL_DISK_PARAMETERS() params.Version = RESIZE_VIRTUAL_DISK_VERSION_1 params.NewSize = new_max_size try: self._run_and_check_output(virtdisk.ResizeVirtualDisk, handle, RESIZE_VIRTUAL_DISK_FLAG_NONE, ctypes.byref(params), None) finally: self._close(handle) def merge_vhd(self, vhd_path): open_params = Win32_OPEN_VIRTUAL_DISK_PARAMETERS_V1() open_params.Version = OPEN_VIRTUAL_DISK_VERSION_1 open_params.RWDepth = 2 handle = self._open(vhd_path, open_params=ctypes.byref(open_params)) params = Win32_MERGE_VIRTUAL_DISK_PARAMETERS() params.Version = MERGE_VIRTUAL_DISK_VERSION_1 params.MergeDepth = 1 try: self._run_and_check_output(virtdisk.MergeVirtualDisk, handle, MERGE_VIRTUAL_DISK_FLAG_NONE, ctypes.byref(params), None) finally: self._close(handle) def _create_vhd(self, new_vhd_path, new_vhd_type, src_path=None, max_internal_size=0, parent_path=None): new_device_id = self._get_device_id_by_path(new_vhd_path) vst = Win32_VIRTUAL_STORAGE_TYPE() vst.DeviceId = new_device_id vst.VendorId = self._msft_vendor_id params = Win32_CREATE_VIRTUAL_DISK_PARAMETERS() params.Version = CREATE_VIRTUAL_DISK_VERSION_2 params.UniqueId = Win32_GUID() params.BlockSizeInBytes = CREATE_VHD_PARAMS_DEFAULT_BLOCK_SIZE params.SectorSizeInBytes = 0x200 params.PhysicalSectorSizeInBytes = 0x200 params.OpenFlags = OPEN_VIRTUAL_DISK_FLAG_NONE params.ResiliencyGuid = Win32_GUID() params.MaximumSize = max_internal_size params.ParentPath = parent_path params.ParentVirtualStorageType = Win32_VIRTUAL_STORAGE_TYPE() if src_path: src_device_id = self._get_device_id_by_path(src_path) params.SourcePath = src_path params.SourceVirtualStorageType = Win32_VIRTUAL_STORAGE_TYPE() params.SourceVirtualStorageType.DeviceId = src_device_id params.SourceVirtualStorageType.VendorId = self._msft_vendor_id handle = wintypes.HANDLE() create_virtual_disk_flag = self.create_virtual_disk_flags.get( new_vhd_type) try: self._run_and_check_output(virtdisk.CreateVirtualDisk, ctypes.byref(vst), ctypes.c_wchar_p(new_vhd_path), VIRTUAL_DISK_ACCESS_NONE, None, create_virtual_disk_flag, 0, ctypes.byref(params), None, ctypes.byref(handle)) finally: self._close(handle) def get_vhd_info(self, vhd_path, info_members=None): vhd_info = {} info_members = info_members or self._vhd_info_members handle = self._open(vhd_path, open_access_mask=VIRTUAL_DISK_ACCESS_GET_INFO) try: for member in info_members: info = self._get_vhd_info_member(handle, member) vhd_info.update(info) finally: self._close(handle) return vhd_info def _get_vhd_info_member(self, vhd_file, info_member): virt_disk_info = Win32_GET_VIRTUAL_DISK_INFO_PARAMETERS() virt_disk_info.VERSION = ctypes.c_uint(info_member) infoSize = ctypes.sizeof(virt_disk_info) virtdisk.GetVirtualDiskInformation.restype = wintypes.DWORD # Note(lpetrut): If the vhd has no parent image, this will # return an error. No need to raise an exception in this case. ignored_error_codes = [] if info_member == GET_VIRTUAL_DISK_INFO_PARENT_LOCATION: ignored_error_codes.append(ERROR_VHD_INVALID_TYPE) self._run_and_check_output(virtdisk.GetVirtualDiskInformation, vhd_file, ctypes.byref(ctypes.c_ulong(infoSize)), ctypes.byref(virt_disk_info), 0, ignored_error_codes=ignored_error_codes) return self._parse_vhd_info(virt_disk_info, info_member) def _parse_vhd_info(self, virt_disk_info, info_member): vhd_info = {} vhd_info_member = self._vhd_info_members[info_member] info = getattr(virt_disk_info.VhdInfo, vhd_info_member) if hasattr(info, '_fields_'): for field in info._fields_: vhd_info[field[0]] = getattr(info, field[0]) else: vhd_info[vhd_info_member] = info return vhd_info def get_vhd_size(self, vhd_path): """Return vhd size. Returns a dict containing the virtual size, physical size, block size and sector size of the vhd. """ size = self.get_vhd_info(vhd_path, [GET_VIRTUAL_DISK_INFO_SIZE]) return size def get_vhd_parent_path(self, vhd_path): vhd_info = self.get_vhd_info(vhd_path, [GET_VIRTUAL_DISK_INFO_PARENT_LOCATION]) parent_path = vhd_info['ParentLocationBuffer'] if len(parent_path) > 0: return parent_path return None def create_dynamic_vhd(self, path, max_internal_size): self._create_vhd(path, constants.VHD_TYPE_DYNAMIC, max_internal_size=max_internal_size) def convert_vhd(self, src, dest, vhd_type=constants.VHD_TYPE_DYNAMIC): self._create_vhd(dest, vhd_type, src_path=src) def create_differencing_vhd(self, path, parent_path): self._create_vhd(path, constants.VHD_TYPE_DIFFERENCING, parent_path=parent_path) def reconnect_parent(self, child_path, parent_path): open_params = Win32_OPEN_VIRTUAL_DISK_PARAMETERS_V2() open_params.Version = OPEN_VIRTUAL_DISK_VERSION_2 open_params.GetInfoOnly = False handle = self._open( child_path, open_flag=OPEN_VIRTUAL_DISK_FLAG_NO_PARENTS, open_access_mask=VIRTUAL_DISK_ACCESS_NONE, open_params=ctypes.byref(open_params)) params = Win32_SET_VIRTUAL_DISK_INFO_PARAMETERS() params.Version = SET_VIRTUAL_DISK_INFO_PARENT_PATH params.ParentFilePath = parent_path try: self._run_and_check_output(virtdisk.SetVirtualDiskInformation, handle, ctypes.byref(params)) finally: self._close(handle)
#!/usr/bin/env python """Utils exporting data from AFF4 to the rest of the world.""" import os import Queue import stat import time import logging from grr.lib import aff4 from grr.lib import client_index from grr.lib import rdfvalue from grr.lib import sequential_collection from grr.lib import serialize from grr.lib import threadpool from grr.lib import utils from grr.lib.aff4_objects import aff4_grr from grr.lib.aff4_objects import standard from grr.lib.flows.general import collectors from grr.lib.hunts import results from grr.lib.rdfvalues import client as rdf_client from grr.lib.rdfvalues import file_finder as rdf_file_finder from grr.lib.rdfvalues import flows as rdf_flows BUFFER_SIZE = 16 * 1024 * 1024 def GetAllClients(token=None): """Return a list of all client urns.""" index = client_index.CreateClientIndex(token=token) return index.LookupClients(["."]) class IterateAllClientUrns(object): """Class to iterate over all URNs.""" THREAD_POOL_NAME = "ClientUrnIter" QUEUE_TIMEOUT = 30 def __init__(self, func=None, max_threads=10, token=None): """Iterate over all clients in a threadpool. Args: func: A function to call with each client urn. max_threads: Number of threads to use. token: Auth token. Raises: RuntimeError: If function not specified. """ self.thread_pool = threadpool.ThreadPool.Factory(self.THREAD_POOL_NAME, max_threads) self.thread_pool.Start() self.token = token self.func = func self.broken_subjects = [] # Entries that are broken or fail to run. self.out_queue = Queue.Queue() def GetInput(self): """Yield client urns.""" clients = GetAllClients(token=self.token) logging.debug("Got %d clients", len(clients)) return clients def Run(self): """Run the iteration.""" count = 0 for count, input_data in enumerate(self.GetInput()): if count % 2000 == 0: logging.debug("%d processed.", count) args = (input_data, self.out_queue, self.token) self.thread_pool.AddTask( target=self.IterFunction, args=args, name=self.THREAD_POOL_NAME) while count >= 0: try: # We only use the timeout to wait if we got to the end of the Queue but # didn't process everything yet. out = self.out_queue.get(timeout=self.QUEUE_TIMEOUT, block=True) if out: yield out count -= 1 except Queue.Empty: break # Join and stop to clean up the threadpool. self.thread_pool.Stop() def IterFunction(self, *args): """Function to run on each input. This can be overridden.""" self.func(*args) class IterateAllClients(IterateAllClientUrns): """Class to iterate over all GRR Client objects.""" def __init__(self, max_age, client_chunksize=25, **kwargs): """Iterate over all clients in a threadpool. Args: max_age: Maximum age in seconds of clients to check. client_chunksize: A function to call with each client urn. **kwargs: Arguments passed to init. """ super(IterateAllClients, self).__init__(**kwargs) self.client_chunksize = client_chunksize self.max_age = max_age def GetInput(self): """Yield client urns.""" client_list = GetAllClients(token=self.token) logging.debug("Got %d clients", len(client_list)) for client_group in utils.Grouper(client_list, self.client_chunksize): for fd in aff4.FACTORY.MultiOpen( client_group, mode="r", aff4_type=aff4_grr.VFSGRRClient, token=self.token): if isinstance(fd, aff4_grr.VFSGRRClient): # Skip if older than max_age oldest_time = (time.time() - self.max_age) * 1e6 if fd.Get(aff4_grr.VFSGRRClient.SchemaCls.PING) >= oldest_time: yield fd def DownloadFile(file_obj, target_path, buffer_size=BUFFER_SIZE): """Download an aff4 file to the local filesystem overwriting it if it exists. Args: file_obj: An aff4 object that supports the file interface (Read, Seek) target_path: Full path of file to write to. buffer_size: Read in chunks this size. """ logging.info(u"Downloading: %s to: %s", file_obj.urn, target_path) target_file = open(target_path, "wb") file_obj.Seek(0) count = 0 data_buffer = file_obj.Read(buffer_size) while data_buffer: target_file.write(data_buffer) data_buffer = file_obj.Read(buffer_size) count += 1 if not count % 3: logging.debug(u"Downloading: %s: %s done", file_obj.urn, utils.FormatNumberAsString(count * buffer_size)) target_file.close() def RecursiveDownload(dir_obj, target_dir, max_depth=10, depth=1, overwrite=False, max_threads=10): """Recursively downloads a file entry to the target path. Args: dir_obj: An aff4 object that contains children. target_dir: Full path of the directory to write to. max_depth: Depth to download to. 1 means just the directory itself. depth: Current depth of recursion. overwrite: Should we overwrite files that exist. max_threads: Use this many threads to do the downloads. """ if not isinstance(dir_obj, aff4.AFF4Volume): return # Reuse the same threadpool as we call recursively. thread_pool = threadpool.ThreadPool.Factory("Downloader", max_threads) thread_pool.Start() for sub_file_entry in dir_obj.OpenChildren(): path_elements = [target_dir] sub_target_dir = u"/".join(path_elements) try: # Any file-like object with data in AFF4 should inherit AFF4Stream. if isinstance(sub_file_entry, aff4.AFF4Stream): args = (sub_file_entry.urn, sub_target_dir, sub_file_entry.token, overwrite) thread_pool.AddTask( target=CopyAFF4ToLocal, args=args, name="Downloader") elif "Container" in sub_file_entry.behaviours: if depth >= max_depth: # Don't go any deeper. continue try: os.makedirs(sub_target_dir) except OSError: pass RecursiveDownload( sub_file_entry, sub_target_dir, overwrite=overwrite, depth=depth + 1) except IOError: logging.exception("Unable to download %s", sub_file_entry.urn) finally: sub_file_entry.Close() # Join and stop the threadpool. if depth <= 1: thread_pool.Stop() def _OpenCollectionPath(coll_path, token=None): """Tries to open various types of collections at the given path.""" coll = aff4.FACTORY.Open(coll_path, token=token) if coll.__class__.__name__ == "RDFValueCollection": return coll collection = results.HuntResultCollection(coll_path, token=token) if collection and collection[0].payload: return collection collection = sequential_collection.GeneralIndexedCollection( coll_path, token=token) if collection: return collection def DownloadCollection(coll_path, target_path, token=None, overwrite=False, dump_client_info=False, flatten=False, max_threads=10): """Iterate through a Collection object downloading all files. Args: coll_path: Path to an AFF4 collection. target_path: Base directory to write to. token: Token for access. overwrite: If True, overwrite existing files. dump_client_info: If True, this will detect client paths, and dump a yaml version of the client object to the root path. This is useful for seeing the hostname/users of the machine the client id refers to. flatten: If True, produce a "files" flat folder with links to all the found files. max_threads: Use this many threads to do the downloads. """ completed_clients = set() coll = _OpenCollectionPath(coll_path, token=token) if coll is None: logging.error("%s is not a valid collection. Typo? " "Are you sure something was written to it?", coll_path) return thread_pool = threadpool.ThreadPool.Factory("Downloader", max_threads) thread_pool.Start() # Extract the client id from the source urn. This code makes me # quite sad but there is just no concept of passing a client id in # the export tool (and this would be unsafe anyways since the user # could then download files from arbitrary machines easily). The # export tool is on the way to deprecation so we decided to do this # instead of fixing the obsolete code. try: collection_urn = coll.collection_id except AttributeError: collection_urn = coll.urn try: original_client_id = rdf_client.ClientURN(collection_urn.Split()[0]) except IOError: original_client_id = None logging.info("Expecting to download %s files", len(coll)) # Collections can include anything they want, but we only handle RDFURN and # StatEntry entries in this function. for grr_message in coll: source = None # If a raw message, work out the type. if isinstance(grr_message, rdf_flows.GrrMessage): source = grr_message.source grr_message = grr_message.payload if isinstance(grr_message, rdfvalue.RDFURN): urn = grr_message elif isinstance(grr_message, rdf_client.StatEntry): urn = rdfvalue.RDFURN(grr_message.AFF4Path(source or original_client_id)) elif isinstance(grr_message, rdf_file_finder.FileFinderResult): urn = rdfvalue.RDFURN( grr_message.stat_entry.AFF4Path(source or original_client_id)) elif isinstance(grr_message, collectors.ArtifactFilesDownloaderResult): if grr_message.HasField("downloaded_file"): urn = grr_message.downloaded_file.AFF4Path(source or original_client_id) else: continue elif isinstance(grr_message, rdfvalue.RDFBytes): try: os.makedirs(target_path) except OSError: pass try: # We just dump out bytes and carry on. client_id = source.Split()[0] with open(os.path.join(target_path, client_id), "wb") as fd: fd.write(str(grr_message)) except AttributeError: pass continue else: continue # Handle dumping client info, but only once per client. if dump_client_info: client_id = urn.Split()[0] re_match = aff4_grr.VFSGRRClient.CLIENT_ID_RE.match(client_id) if re_match and client_id not in completed_clients: args = (rdf_client.ClientURN(client_id), target_path, token, overwrite) thread_pool.AddTask( target=DumpClientYaml, args=args, name="ClientYamlDownloader") completed_clients.add(client_id) # Now queue downloading the actual files. args = (urn, target_path, token, overwrite) if flatten: target = CopyAndSymlinkAFF4ToLocal else: target = CopyAFF4ToLocal thread_pool.AddTask(target=target, args=args, name="Downloader") # Join and stop the threadpool. thread_pool.Stop() def CopyAFF4ToLocal(aff4_urn, target_dir, token=None, overwrite=False): """Copy an AFF4 object that supports a read interface to local filesystem. Args: aff4_urn: URN of thing to copy. target_dir: Directory to copy the file to. token: Auth token. overwrite: If True overwrite the file if it exists. Returns: If aff4_urn points to a file, returns path to the downloaded file. Otherwise returns None. By default file will only be overwritten if file size differs. """ try: fd = aff4.FACTORY.Open(aff4_urn, token=token) filepath = os.path.join(target_dir, fd.urn.Path()[1:]) # If urn points to a directory, just create it. if isinstance(fd, standard.VFSDirectory): try: os.makedirs(filepath) except OSError: pass return None # If urn points to a file, download it. elif isinstance(fd, aff4.AFF4Stream): if not os.path.isfile(filepath): try: # Ensure directory exists. os.makedirs(os.path.dirname(filepath)) except OSError: pass DownloadFile(fd, filepath) elif (os.stat(filepath)[stat.ST_SIZE] != fd.Get(fd.Schema.SIZE) or overwrite): # We should overwrite because user said, or file sizes differ. DownloadFile(fd, filepath) else: logging.info("File %s exists, skipping", filepath) return filepath else: raise RuntimeError("Opened urn is neither a downloaded file nor a " "directory: %s" % aff4_urn) except IOError as e: logging.exception("Failed to read %s due to %s", aff4_urn, e) raise def CopyAndSymlinkAFF4ToLocal(aff4_urn, target_dir, token=None, overwrite=False): path = CopyAFF4ToLocal(aff4_urn, target_dir, token=token, overwrite=overwrite) if path: files_output_dir = os.path.join(target_dir, "files") try: os.makedirs(files_output_dir) except OSError: pass unique_name = "_".join(aff4_urn.Split()) symlink_path = os.path.join(files_output_dir, unique_name) try: os.symlink(path, symlink_path) except OSError: logging.exception("Can't create symlink to a file: %s -> %s", symlink_path, path) def DumpClientYaml(client_urn, target_dir, token=None, overwrite=False): """Dump a yaml file containing client info.""" fd = aff4.FACTORY.Open(client_urn, aff4_grr.VFSGRRClient, token=token) dirpath = os.path.join(target_dir, fd.urn.Split()[0]) try: # Due to threading this can actually be created by another thread. os.makedirs(dirpath) except OSError: pass filepath = os.path.join(dirpath, "client_info.yaml") if not os.path.isfile(filepath) or overwrite: with open(filepath, "wb") as out_file: out_file.write(serialize.YamlDumper(fd))
from typing import Any, Dict, List, Optional, Union from django.conf import settings from django.http import HttpRequest, HttpResponse from django.shortcuts import redirect from django.utils.translation import gettext as _ from zerver.decorator import require_member_or_admin, require_realm_admin from zerver.forms import PASSWORD_TOO_WEAK_ERROR, CreateUserForm from zerver.lib.actions import ( check_change_bot_full_name, check_change_full_name, check_remove_custom_profile_field_value, do_change_avatar_fields, do_change_bot_owner, do_change_default_all_public_streams, do_change_default_events_register_stream, do_change_default_sending_stream, do_change_user_role, do_create_user, do_deactivate_user, do_reactivate_user, do_regenerate_api_key, do_update_bot_config_data, do_update_outgoing_webhook_service, do_update_user_custom_profile_data_if_changed, notify_created_bot, ) from zerver.lib.avatar import avatar_url, get_gravatar_url from zerver.lib.bot_config import set_bot_config from zerver.lib.email_validation import email_allowed_for_realm from zerver.lib.exceptions import ( CannotDeactivateLastUserError, JsonableError, OrganizationOwnerRequired, ) from zerver.lib.integrations import EMBEDDED_BOTS from zerver.lib.request import REQ, has_request_variables from zerver.lib.response import json_success from zerver.lib.streams import access_stream_by_id, access_stream_by_name, subscribed_to_stream from zerver.lib.types import Validator from zerver.lib.upload import upload_avatar_image from zerver.lib.url_encoding import add_query_arg_to_redirect_url from zerver.lib.users import ( access_bot_by_id, access_user_by_id, add_service, check_bot_creation_policy, check_bot_name_available, check_full_name, check_short_name, check_valid_bot_config, check_valid_bot_type, check_valid_interface_type, get_api_key, get_raw_user_data, validate_user_custom_profile_data, ) from zerver.lib.utils import generate_api_key from zerver.lib.validator import ( check_bool, check_dict, check_dict_only, check_int, check_int_in, check_list, check_none_or, check_string, check_union, check_url, ) from zerver.models import ( DisposableEmailError, DomainNotAllowedForRealmError, EmailContainsPlusError, InvalidFakeEmailDomain, Message, Realm, Service, Stream, UserProfile, get_user, get_user_by_delivery_email, get_user_by_id_in_realm_including_cross_realm, get_user_including_cross_realm, get_user_profile_by_id_in_realm, ) from zproject.backends import check_password_strength def check_last_owner(user_profile: UserProfile) -> bool: owners = set(user_profile.realm.get_human_owner_users()) return user_profile.is_realm_owner and not user_profile.is_bot and len(owners) == 1 def deactivate_user_backend( request: HttpRequest, user_profile: UserProfile, user_id: int ) -> HttpResponse: target = access_user_by_id(user_profile, user_id, for_admin=True) if target.is_realm_owner and not user_profile.is_realm_owner: raise OrganizationOwnerRequired() if check_last_owner(target): raise JsonableError(_("Cannot deactivate the only organization owner")) return _deactivate_user_profile_backend(request, user_profile, target) def deactivate_user_own_backend(request: HttpRequest, user_profile: UserProfile) -> HttpResponse: if UserProfile.objects.filter(realm=user_profile.realm, is_active=True).count() == 1: raise CannotDeactivateLastUserError(is_last_owner=False) if user_profile.is_realm_owner and check_last_owner(user_profile): raise CannotDeactivateLastUserError(is_last_owner=True) do_deactivate_user(user_profile, acting_user=user_profile) return json_success() def deactivate_bot_backend( request: HttpRequest, user_profile: UserProfile, bot_id: int ) -> HttpResponse: target = access_bot_by_id(user_profile, bot_id) return _deactivate_user_profile_backend(request, user_profile, target) def _deactivate_user_profile_backend( request: HttpRequest, user_profile: UserProfile, target: UserProfile ) -> HttpResponse: do_deactivate_user(target, acting_user=user_profile) return json_success() def reactivate_user_backend( request: HttpRequest, user_profile: UserProfile, user_id: int ) -> HttpResponse: target = access_user_by_id( user_profile, user_id, allow_deactivated=True, allow_bots=True, for_admin=True ) if target.is_bot: assert target.bot_type is not None check_bot_creation_policy(user_profile, target.bot_type) do_reactivate_user(target, acting_user=user_profile) return json_success() check_profile_data: Validator[List[Dict[str, Optional[Union[int, str, List[int]]]]]] = check_list( check_dict_only( [ ("id", check_int), ( "value", check_none_or( check_union([check_int, check_string, check_list(check_int)]), ), ), ] ), ) @has_request_variables def update_user_backend( request: HttpRequest, user_profile: UserProfile, user_id: int, full_name: Optional[str] = REQ(default=None, json_validator=check_string), role: Optional[int] = REQ( default=None, json_validator=check_int_in( UserProfile.ROLE_TYPES, ), ), profile_data: Optional[List[Dict[str, Optional[Union[int, str, List[int]]]]]] = REQ( default=None, json_validator=check_profile_data, ), ) -> HttpResponse: target = access_user_by_id( user_profile, user_id, allow_deactivated=True, allow_bots=True, for_admin=True ) if role is not None and target.role != role: # Require that the current user has permissions to # grant/remove the role in question. access_user_by_id has # already verified we're an administrator; here we enforce # that only owners can toggle the is_realm_owner flag. if UserProfile.ROLE_REALM_OWNER in [role, target.role] and not user_profile.is_realm_owner: raise OrganizationOwnerRequired() if target.role == UserProfile.ROLE_REALM_OWNER and check_last_owner(user_profile): raise JsonableError( _("The owner permission cannot be removed from the only organization owner.") ) do_change_user_role(target, role, acting_user=user_profile) if full_name is not None and target.full_name != full_name and full_name.strip() != "": # We don't respect `name_changes_disabled` here because the request # is on behalf of the administrator. check_change_full_name(target, full_name, user_profile) if profile_data is not None: clean_profile_data = [] for entry in profile_data: assert isinstance(entry["id"], int) if entry["value"] is None or not entry["value"]: field_id = entry["id"] check_remove_custom_profile_field_value(target, field_id) else: clean_profile_data.append( { "id": entry["id"], "value": entry["value"], } ) validate_user_custom_profile_data(target.realm.id, clean_profile_data) do_update_user_custom_profile_data_if_changed(target, clean_profile_data) return json_success() def avatar( request: HttpRequest, user_profile: UserProfile, email_or_id: str, medium: bool = False ) -> HttpResponse: """Accepts an email address or user ID and returns the avatar""" is_email = False try: int(email_or_id) except ValueError: is_email = True try: realm = user_profile.realm if is_email: avatar_user_profile = get_user_including_cross_realm(email_or_id, realm) else: avatar_user_profile = get_user_by_id_in_realm_including_cross_realm( int(email_or_id), realm ) # If there is a valid user account passed in, use its avatar url = avatar_url(avatar_user_profile, medium=medium) except UserProfile.DoesNotExist: # If there is no such user, treat it as a new gravatar email = email_or_id avatar_version = 1 url = get_gravatar_url(email, avatar_version, medium) # We can rely on the URL already having query parameters. Because # our templates depend on being able to use the ampersand to # add query parameters to our url, get_avatar_url does '?x=x' # hacks to prevent us from having to jump through decode/encode hoops. assert url is not None url = add_query_arg_to_redirect_url(url, request.META["QUERY_STRING"]) return redirect(url) def get_stream_name(stream: Optional[Stream]) -> Optional[str]: if stream: return stream.name return None @require_member_or_admin @has_request_variables def patch_bot_backend( request: HttpRequest, user_profile: UserProfile, bot_id: int, full_name: Optional[str] = REQ(default=None), bot_owner_id: Optional[int] = REQ(json_validator=check_int, default=None), config_data: Optional[Dict[str, str]] = REQ( default=None, json_validator=check_dict(value_validator=check_string) ), service_payload_url: Optional[str] = REQ(json_validator=check_url, default=None), service_interface: int = REQ(json_validator=check_int, default=1), default_sending_stream: Optional[str] = REQ(default=None), default_events_register_stream: Optional[str] = REQ(default=None), default_all_public_streams: Optional[bool] = REQ(default=None, json_validator=check_bool), ) -> HttpResponse: bot = access_bot_by_id(user_profile, bot_id) if full_name is not None: check_change_bot_full_name(bot, full_name, user_profile) if bot_owner_id is not None: try: owner = get_user_profile_by_id_in_realm(bot_owner_id, user_profile.realm) except UserProfile.DoesNotExist: raise JsonableError(_("Failed to change owner, no such user")) if not owner.is_active: raise JsonableError(_("Failed to change owner, user is deactivated")) if owner.is_bot: raise JsonableError(_("Failed to change owner, bots can't own other bots")) previous_owner = bot.bot_owner if previous_owner != owner: do_change_bot_owner(bot, owner, user_profile) if default_sending_stream is not None: if default_sending_stream == "": stream: Optional[Stream] = None else: (stream, sub) = access_stream_by_name(user_profile, default_sending_stream) do_change_default_sending_stream(bot, stream, acting_user=user_profile) if default_events_register_stream is not None: if default_events_register_stream == "": stream = None else: (stream, sub) = access_stream_by_name(user_profile, default_events_register_stream) do_change_default_events_register_stream(bot, stream, acting_user=user_profile) if default_all_public_streams is not None: do_change_default_all_public_streams( bot, default_all_public_streams, acting_user=user_profile ) if service_payload_url is not None: check_valid_interface_type(service_interface) assert service_interface is not None do_update_outgoing_webhook_service(bot, service_interface, service_payload_url) if config_data is not None: do_update_bot_config_data(bot, config_data) if len(request.FILES) == 0: pass elif len(request.FILES) == 1: user_file = list(request.FILES.values())[0] upload_avatar_image(user_file, user_profile, bot) avatar_source = UserProfile.AVATAR_FROM_USER do_change_avatar_fields(bot, avatar_source, acting_user=user_profile) else: raise JsonableError(_("You may only upload one file at a time")) json_result = dict( full_name=bot.full_name, avatar_url=avatar_url(bot), service_interface=service_interface, service_payload_url=service_payload_url, config_data=config_data, default_sending_stream=get_stream_name(bot.default_sending_stream), default_events_register_stream=get_stream_name(bot.default_events_register_stream), default_all_public_streams=bot.default_all_public_streams, ) # Don't include the bot owner in case it is not set. # Default bots have no owner. if bot.bot_owner is not None: json_result["bot_owner"] = bot.bot_owner.email return json_success(json_result) @require_member_or_admin @has_request_variables def regenerate_bot_api_key( request: HttpRequest, user_profile: UserProfile, bot_id: int ) -> HttpResponse: bot = access_bot_by_id(user_profile, bot_id) new_api_key = do_regenerate_api_key(bot, user_profile) json_result = dict( api_key=new_api_key, ) return json_success(json_result) @require_member_or_admin @has_request_variables def add_bot_backend( request: HttpRequest, user_profile: UserProfile, full_name_raw: str = REQ("full_name"), short_name_raw: str = REQ("short_name"), bot_type: int = REQ(json_validator=check_int, default=UserProfile.DEFAULT_BOT), payload_url: str = REQ(json_validator=check_url, default=""), service_name: Optional[str] = REQ(default=None), config_data: Dict[str, str] = REQ( default={}, json_validator=check_dict(value_validator=check_string) ), interface_type: int = REQ(json_validator=check_int, default=Service.GENERIC), default_sending_stream_name: Optional[str] = REQ("default_sending_stream", default=None), default_events_register_stream_name: Optional[str] = REQ( "default_events_register_stream", default=None ), default_all_public_streams: Optional[bool] = REQ(json_validator=check_bool, default=None), ) -> HttpResponse: short_name = check_short_name(short_name_raw) if bot_type != UserProfile.INCOMING_WEBHOOK_BOT: service_name = service_name or short_name short_name += "-bot" full_name = check_full_name(full_name_raw) try: email = f"{short_name}@{user_profile.realm.get_bot_domain()}" except InvalidFakeEmailDomain: raise JsonableError( _( "Can't create bots until FAKE_EMAIL_DOMAIN is correctly configured.\n" "Please contact your server administrator." ) ) form = CreateUserForm({"full_name": full_name, "email": email}) if bot_type == UserProfile.EMBEDDED_BOT: if not settings.EMBEDDED_BOTS_ENABLED: raise JsonableError(_("Embedded bots are not enabled.")) if service_name not in [bot.name for bot in EMBEDDED_BOTS]: raise JsonableError(_("Invalid embedded bot name.")) if not form.is_valid(): # We validate client-side as well raise JsonableError(_("Bad name or username")) try: get_user_by_delivery_email(email, user_profile.realm) raise JsonableError(_("Username already in use")) except UserProfile.DoesNotExist: pass check_bot_name_available( realm_id=user_profile.realm_id, full_name=full_name, ) check_bot_creation_policy(user_profile, bot_type) check_valid_bot_type(user_profile, bot_type) check_valid_interface_type(interface_type) if len(request.FILES) == 0: avatar_source = UserProfile.AVATAR_FROM_GRAVATAR elif len(request.FILES) != 1: raise JsonableError(_("You may only upload one file at a time")) else: avatar_source = UserProfile.AVATAR_FROM_USER default_sending_stream = None if default_sending_stream_name is not None: (default_sending_stream, ignored_sub) = access_stream_by_name( user_profile, default_sending_stream_name ) default_events_register_stream = None if default_events_register_stream_name is not None: (default_events_register_stream, ignored_sub) = access_stream_by_name( user_profile, default_events_register_stream_name ) if bot_type in (UserProfile.INCOMING_WEBHOOK_BOT, UserProfile.EMBEDDED_BOT) and service_name: check_valid_bot_config(bot_type, service_name, config_data) bot_profile = do_create_user( email=email, password=None, realm=user_profile.realm, full_name=full_name, bot_type=bot_type, bot_owner=user_profile, avatar_source=avatar_source, default_sending_stream=default_sending_stream, default_events_register_stream=default_events_register_stream, default_all_public_streams=default_all_public_streams, acting_user=user_profile, ) if len(request.FILES) == 1: user_file = list(request.FILES.values())[0] upload_avatar_image(user_file, user_profile, bot_profile) if bot_type in (UserProfile.OUTGOING_WEBHOOK_BOT, UserProfile.EMBEDDED_BOT): assert isinstance(service_name, str) add_service( name=service_name, user_profile=bot_profile, base_url=payload_url, interface=interface_type, token=generate_api_key(), ) if bot_type == UserProfile.INCOMING_WEBHOOK_BOT and service_name: set_bot_config(bot_profile, "integration_id", service_name) if bot_type in (UserProfile.INCOMING_WEBHOOK_BOT, UserProfile.EMBEDDED_BOT): for key, value in config_data.items(): set_bot_config(bot_profile, key, value) notify_created_bot(bot_profile) api_key = get_api_key(bot_profile) json_result = dict( user_id=bot_profile.id, api_key=api_key, avatar_url=avatar_url(bot_profile), default_sending_stream=get_stream_name(bot_profile.default_sending_stream), default_events_register_stream=get_stream_name(bot_profile.default_events_register_stream), default_all_public_streams=bot_profile.default_all_public_streams, ) return json_success(json_result) @require_member_or_admin def get_bots_backend(request: HttpRequest, user_profile: UserProfile) -> HttpResponse: bot_profiles = UserProfile.objects.filter(is_bot=True, is_active=True, bot_owner=user_profile) bot_profiles = bot_profiles.select_related( "default_sending_stream", "default_events_register_stream" ) bot_profiles = bot_profiles.order_by("date_joined") def bot_info(bot_profile: UserProfile) -> Dict[str, Any]: default_sending_stream = get_stream_name(bot_profile.default_sending_stream) default_events_register_stream = get_stream_name(bot_profile.default_events_register_stream) # Bots are supposed to have only one API key, at least for now. # Therefore we can safely assume that one and only valid API key will be # the first one. api_key = get_api_key(bot_profile) return dict( username=bot_profile.email, full_name=bot_profile.full_name, api_key=api_key, avatar_url=avatar_url(bot_profile), default_sending_stream=default_sending_stream, default_events_register_stream=default_events_register_stream, default_all_public_streams=bot_profile.default_all_public_streams, ) return json_success({"bots": list(map(bot_info, bot_profiles))}) @has_request_variables def get_members_backend( request: HttpRequest, user_profile: UserProfile, user_id: Optional[int] = None, include_custom_profile_fields: bool = REQ(json_validator=check_bool, default=False), client_gravatar: bool = REQ(json_validator=check_bool, default=False), ) -> HttpResponse: """ The client_gravatar field here is set to True if clients can compute their own gravatars, which saves us bandwidth. We want to eventually make this the default behavior, but we have old clients that expect the server to compute this for us. """ realm = user_profile.realm if realm.email_address_visibility != Realm.EMAIL_ADDRESS_VISIBILITY_EVERYONE: # If email addresses are only available to administrators, # clients cannot compute gravatars, so we force-set it to false. client_gravatar = False target_user = None if user_id is not None: target_user = access_user_by_id( user_profile, user_id, allow_deactivated=True, allow_bots=True, for_admin=False ) members = get_raw_user_data( realm, user_profile, target_user=target_user, client_gravatar=client_gravatar, user_avatar_url_field_optional=False, include_custom_profile_fields=include_custom_profile_fields, ) if target_user is not None: data: Dict[str, Any] = {"user": members[target_user.id]} else: data = {"members": [members[k] for k in members]} return json_success(data) @require_realm_admin @has_request_variables def create_user_backend( request: HttpRequest, user_profile: UserProfile, email: str = REQ(), password: str = REQ(), full_name_raw: str = REQ("full_name"), ) -> HttpResponse: if not user_profile.can_create_users: raise JsonableError(_("User not authorized for this query")) full_name = check_full_name(full_name_raw) form = CreateUserForm({"full_name": full_name, "email": email}) if not form.is_valid(): raise JsonableError(_("Bad name or username")) # Check that the new user's email address belongs to the admin's realm # (Since this is an admin API, we don't require the user to have been # invited first.) realm = user_profile.realm try: email_allowed_for_realm(email, user_profile.realm) except DomainNotAllowedForRealmError: raise JsonableError( _("Email '{email}' not allowed in this organization").format( email=email, ) ) except DisposableEmailError: raise JsonableError(_("Disposable email addresses are not allowed in this organization")) except EmailContainsPlusError: raise JsonableError(_("Email addresses containing + are not allowed.")) try: get_user_by_delivery_email(email, user_profile.realm) raise JsonableError(_("Email '{}' already in use").format(email)) except UserProfile.DoesNotExist: pass if not check_password_strength(password): raise JsonableError(PASSWORD_TOO_WEAK_ERROR) target_user = do_create_user(email, password, realm, full_name, acting_user=user_profile) return json_success({"user_id": target_user.id}) def get_profile_backend(request: HttpRequest, user_profile: UserProfile) -> HttpResponse: raw_user_data = get_raw_user_data( user_profile.realm, user_profile, target_user=user_profile, client_gravatar=False, user_avatar_url_field_optional=False, ) result: Dict[str, Any] = raw_user_data[user_profile.id] result["max_message_id"] = -1 messages = Message.objects.filter(usermessage__user_profile=user_profile).order_by("-id")[:1] if messages: result["max_message_id"] = messages[0].id return json_success(result) @has_request_variables def get_subscription_backend( request: HttpRequest, user_profile: UserProfile, user_id: int = REQ(json_validator=check_int, path_only=True), stream_id: int = REQ(json_validator=check_int, path_only=True), ) -> HttpResponse: target_user = access_user_by_id(user_profile, user_id, for_admin=False) (stream, sub) = access_stream_by_id(user_profile, stream_id) subscription_status = {"is_subscribed": subscribed_to_stream(target_user, stream_id)} return json_success(subscription_status) @has_request_variables def get_user_by_email( request: HttpRequest, user_profile: UserProfile, email: str, include_custom_profile_fields: bool = REQ(json_validator=check_bool, default=False), client_gravatar: bool = REQ(json_validator=check_bool, default=False), ) -> HttpResponse: realm = user_profile.realm target_user = None if email is not None: try: target_user = get_user(email, realm) except UserProfile.DoesNotExist: raise JsonableError(_("No such user")) return get_members_backend(request, user_profile, user_id=target_user.id)
# mysql/reflection.py # Copyright (C) 2005-2017 the SQLAlchemy authors and contributors # <see AUTHORS file> # # This module is part of SQLAlchemy and is released under # the MIT License: http://www.opensource.org/licenses/mit-license.php import re from ... import log, util from ... import types as sqltypes from .enumerated import _EnumeratedValues, SET from .types import DATETIME, TIME, TIMESTAMP class ReflectedState(object): """Stores raw information about a SHOW CREATE TABLE statement.""" def __init__(self): self.columns = [] self.table_options = {} self.table_name = None self.keys = [] self.fk_constraints = [] self.ck_constraints = [] @log.class_logger class MySQLTableDefinitionParser(object): """Parses the results of a SHOW CREATE TABLE statement.""" def __init__(self, dialect, preparer): self.dialect = dialect self.preparer = preparer self._prep_regexes() def parse(self, show_create, charset): state = ReflectedState() state.charset = charset for line in re.split(r'\r?\n', show_create): if line.startswith(' ' + self.preparer.initial_quote): self._parse_column(line, state) # a regular table options line elif line.startswith(') '): self._parse_table_options(line, state) # an ANSI-mode table options line elif line == ')': pass elif line.startswith('CREATE '): self._parse_table_name(line, state) # Not present in real reflection, but may be if # loading from a file. elif not line: pass else: type_, spec = self._parse_constraints(line) if type_ is None: util.warn("Unknown schema content: %r" % line) elif type_ == 'key': state.keys.append(spec) elif type_ == 'fk_constraint': state.fk_constraints.append(spec) elif type_ == 'ck_constraint': state.ck_constraints.append(spec) else: pass return state def _parse_constraints(self, line): """Parse a KEY or CONSTRAINT line. :param line: A line of SHOW CREATE TABLE output """ # KEY m = self._re_key.match(line) if m: spec = m.groupdict() # convert columns into name, length pairs spec['columns'] = self._parse_keyexprs(spec['columns']) return 'key', spec # FOREIGN KEY CONSTRAINT m = self._re_fk_constraint.match(line) if m: spec = m.groupdict() spec['table'] = \ self.preparer.unformat_identifiers(spec['table']) spec['local'] = [c[0] for c in self._parse_keyexprs(spec['local'])] spec['foreign'] = [c[0] for c in self._parse_keyexprs(spec['foreign'])] return 'fk_constraint', spec # CHECK constraint m = self._re_ck_constraint.match(line) if m: spec = m.groupdict() return 'ck_constraint', spec # PARTITION and SUBPARTITION m = self._re_partition.match(line) if m: # Punt! return 'partition', line # No match. return (None, line) def _parse_table_name(self, line, state): """Extract the table name. :param line: The first line of SHOW CREATE TABLE """ regex, cleanup = self._pr_name m = regex.match(line) if m: state.table_name = cleanup(m.group('name')) def _parse_table_options(self, line, state): """Build a dictionary of all reflected table-level options. :param line: The final line of SHOW CREATE TABLE output. """ options = {} if not line or line == ')': pass else: rest_of_line = line[:] for regex, cleanup in self._pr_options: m = regex.search(rest_of_line) if not m: continue directive, value = m.group('directive'), m.group('val') if cleanup: value = cleanup(value) options[directive.lower()] = value rest_of_line = regex.sub('', rest_of_line) for nope in ('auto_increment', 'data directory', 'index directory'): options.pop(nope, None) for opt, val in options.items(): state.table_options['%s_%s' % (self.dialect.name, opt)] = val def _parse_column(self, line, state): """Extract column details. Falls back to a 'minimal support' variant if full parse fails. :param line: Any column-bearing line from SHOW CREATE TABLE """ spec = None m = self._re_column.match(line) if m: spec = m.groupdict() spec['full'] = True else: m = self._re_column_loose.match(line) if m: spec = m.groupdict() spec['full'] = False if not spec: util.warn("Unknown column definition %r" % line) return if not spec['full']: util.warn("Incomplete reflection of column definition %r" % line) name, type_, args = spec['name'], spec['coltype'], spec['arg'] try: col_type = self.dialect.ischema_names[type_] except KeyError: util.warn("Did not recognize type '%s' of column '%s'" % (type_, name)) col_type = sqltypes.NullType # Column type positional arguments eg. varchar(32) if args is None or args == '': type_args = [] elif args[0] == "'" and args[-1] == "'": type_args = self._re_csv_str.findall(args) else: type_args = [int(v) for v in self._re_csv_int.findall(args)] # Column type keyword options type_kw = {} if issubclass(col_type, (DATETIME, TIME, TIMESTAMP)): if type_args: type_kw['fsp'] = type_args.pop(0) for kw in ('unsigned', 'zerofill'): if spec.get(kw, False): type_kw[kw] = True for kw in ('charset', 'collate'): if spec.get(kw, False): type_kw[kw] = spec[kw] if issubclass(col_type, _EnumeratedValues): type_args = _EnumeratedValues._strip_values(type_args) if issubclass(col_type, SET) and '' in type_args: type_kw['retrieve_as_bitwise'] = True type_instance = col_type(*type_args, **type_kw) col_kw = {} # NOT NULL col_kw['nullable'] = True # this can be "NULL" in the case of TIMESTAMP if spec.get('notnull', False) == 'NOT NULL': col_kw['nullable'] = False # AUTO_INCREMENT if spec.get('autoincr', False): col_kw['autoincrement'] = True elif issubclass(col_type, sqltypes.Integer): col_kw['autoincrement'] = False # DEFAULT default = spec.get('default', None) if default == 'NULL': # eliminates the need to deal with this later. default = None col_d = dict(name=name, type=type_instance, default=default) col_d.update(col_kw) state.columns.append(col_d) def _describe_to_create(self, table_name, columns): """Re-format DESCRIBE output as a SHOW CREATE TABLE string. DESCRIBE is a much simpler reflection and is sufficient for reflecting views for runtime use. This method formats DDL for columns only- keys are omitted. :param columns: A sequence of DESCRIBE or SHOW COLUMNS 6-tuples. SHOW FULL COLUMNS FROM rows must be rearranged for use with this function. """ buffer = [] for row in columns: (name, col_type, nullable, default, extra) = \ [row[i] for i in (0, 1, 2, 4, 5)] line = [' '] line.append(self.preparer.quote_identifier(name)) line.append(col_type) if not nullable: line.append('NOT NULL') if default: if 'auto_increment' in default: pass elif (col_type.startswith('timestamp') and default.startswith('C')): line.append('DEFAULT') line.append(default) elif default == 'NULL': line.append('DEFAULT') line.append(default) else: line.append('DEFAULT') line.append("'%s'" % default.replace("'", "''")) if extra: line.append(extra) buffer.append(' '.join(line)) return ''.join([('CREATE TABLE %s (\n' % self.preparer.quote_identifier(table_name)), ',\n'.join(buffer), '\n) ']) def _parse_keyexprs(self, identifiers): """Unpack '"col"(2),"col" ASC'-ish strings into components.""" return self._re_keyexprs.findall(identifiers) def _prep_regexes(self): """Pre-compile regular expressions.""" self._re_columns = [] self._pr_options = [] _final = self.preparer.final_quote quotes = dict(zip(('iq', 'fq', 'esc_fq'), [re.escape(s) for s in (self.preparer.initial_quote, _final, self.preparer._escape_identifier(_final))])) self._pr_name = _pr_compile( r'^CREATE (?:\w+ +)?TABLE +' r'%(iq)s(?P<name>(?:%(esc_fq)s|[^%(fq)s])+)%(fq)s +\($' % quotes, self.preparer._unescape_identifier) # `col`,`col2`(32),`col3`(15) DESC # # Note: ASC and DESC aren't reflected, so we'll punt... self._re_keyexprs = _re_compile( r'(?:' r'(?:%(iq)s((?:%(esc_fq)s|[^%(fq)s])+)%(fq)s)' r'(?:\((\d+)\))?(?=\,|$))+' % quotes) # 'foo' or 'foo','bar' or 'fo,o','ba''a''r' self._re_csv_str = _re_compile(r'\x27(?:\x27\x27|[^\x27])*\x27') # 123 or 123,456 self._re_csv_int = _re_compile(r'\d+') # `colname` <type> [type opts] # (NOT NULL | NULL) # DEFAULT ('value' | CURRENT_TIMESTAMP...) # COMMENT 'comment' # COLUMN_FORMAT (FIXED|DYNAMIC|DEFAULT) # STORAGE (DISK|MEMORY) self._re_column = _re_compile( r" " r"%(iq)s(?P<name>(?:%(esc_fq)s|[^%(fq)s])+)%(fq)s +" r"(?P<coltype>\w+)" r"(?:\((?P<arg>(?:\d+|\d+,\d+|" r"(?:'(?:''|[^'])*',?)+))\))?" r"(?: +(?P<unsigned>UNSIGNED))?" r"(?: +(?P<zerofill>ZEROFILL))?" r"(?: +CHARACTER SET +(?P<charset>[\w_]+))?" r"(?: +COLLATE +(?P<collate>[\w_]+))?" r"(?: +(?P<notnull>(?:NOT )?NULL))?" r"(?: +DEFAULT +(?P<default>" r"(?:NULL|'(?:''|[^'])*'|[\w\(\)]+" r"(?: +ON UPDATE [\w\(\)]+)?)" r"))?" r"(?: +(?P<autoincr>AUTO_INCREMENT))?" r"(?: +COMMENT +'(?P<comment>(?:''|[^'])*)')?" r"(?: +COLUMN_FORMAT +(?P<colfmt>\w+))?" r"(?: +STORAGE +(?P<storage>\w+))?" r"(?: +(?P<extra>.*))?" r",?$" % quotes ) # Fallback, try to parse as little as possible self._re_column_loose = _re_compile( r' ' r'%(iq)s(?P<name>(?:%(esc_fq)s|[^%(fq)s])+)%(fq)s +' r'(?P<coltype>\w+)' r'(?:\((?P<arg>(?:\d+|\d+,\d+|\x27(?:\x27\x27|[^\x27])+\x27))\))?' r'.*?(?P<notnull>(?:NOT )NULL)?' % quotes ) # (PRIMARY|UNIQUE|FULLTEXT|SPATIAL) INDEX `name` (USING (BTREE|HASH))? # (`col` (ASC|DESC)?, `col` (ASC|DESC)?) # KEY_BLOCK_SIZE size | WITH PARSER name self._re_key = _re_compile( r' ' r'(?:(?P<type>\S+) )?KEY' r'(?: +%(iq)s(?P<name>(?:%(esc_fq)s|[^%(fq)s])+)%(fq)s)?' r'(?: +USING +(?P<using_pre>\S+))?' r' +\((?P<columns>.+?)\)' r'(?: +USING +(?P<using_post>\S+))?' r'(?: +KEY_BLOCK_SIZE *[ =]? *(?P<keyblock>\S+))?' r'(?: +WITH PARSER +(?P<parser>\S+))?' r'(?: +COMMENT +(?P<comment>(\x27\x27|\x27([^\x27])*?\x27)+))?' r',?$' % quotes ) # CONSTRAINT `name` FOREIGN KEY (`local_col`) # REFERENCES `remote` (`remote_col`) # MATCH FULL | MATCH PARTIAL | MATCH SIMPLE # ON DELETE CASCADE ON UPDATE RESTRICT # # unique constraints come back as KEYs kw = quotes.copy() kw['on'] = 'RESTRICT|CASCADE|SET NULL|NOACTION' self._re_fk_constraint = _re_compile( r' ' r'CONSTRAINT +' r'%(iq)s(?P<name>(?:%(esc_fq)s|[^%(fq)s])+)%(fq)s +' r'FOREIGN KEY +' r'\((?P<local>[^\)]+?)\) REFERENCES +' r'(?P<table>%(iq)s[^%(fq)s]+%(fq)s' r'(?:\.%(iq)s[^%(fq)s]+%(fq)s)?) +' r'\((?P<foreign>[^\)]+?)\)' r'(?: +(?P<match>MATCH \w+))?' r'(?: +ON DELETE (?P<ondelete>%(on)s))?' r'(?: +ON UPDATE (?P<onupdate>%(on)s))?' % kw ) # CONSTRAINT `CONSTRAINT_1` CHECK (`x` > 5)' # testing on MariaDB 10.2 shows that the CHECK constraint # is returned on a line by itself, so to match without worrying # about parenthesis in the expresion we go to the end of the line self._re_ck_constraint = _re_compile( r' ' r'CONSTRAINT +' r'%(iq)s(?P<name>(?:%(esc_fq)s|[^%(fq)s])+)%(fq)s +' r'CHECK +' r'\((?P<sqltext>.+)\),?' % kw ) # PARTITION # # punt! self._re_partition = _re_compile(r'(?:.*)(?:SUB)?PARTITION(?:.*)') # Table-level options (COLLATE, ENGINE, etc.) # Do the string options first, since they have quoted # strings we need to get rid of. for option in _options_of_type_string: self._add_option_string(option) for option in ('ENGINE', 'TYPE', 'AUTO_INCREMENT', 'AVG_ROW_LENGTH', 'CHARACTER SET', 'DEFAULT CHARSET', 'CHECKSUM', 'COLLATE', 'DELAY_KEY_WRITE', 'INSERT_METHOD', 'MAX_ROWS', 'MIN_ROWS', 'PACK_KEYS', 'ROW_FORMAT', 'KEY_BLOCK_SIZE'): self._add_option_word(option) self._add_option_regex('UNION', r'\([^\)]+\)') self._add_option_regex('TABLESPACE', r'.*? STORAGE DISK') self._add_option_regex( 'RAID_TYPE', r'\w+\s+RAID_CHUNKS\s*\=\s*\w+RAID_CHUNKSIZE\s*=\s*\w+') _optional_equals = r'(?:\s*(?:=\s*)|\s+)' def _add_option_string(self, directive): regex = (r'(?P<directive>%s)%s' r"'(?P<val>(?:[^']|'')*?)'(?!')" % (re.escape(directive), self._optional_equals)) self._pr_options.append(_pr_compile( regex, lambda v: v.replace("\\\\", "\\").replace("''", "'") )) def _add_option_word(self, directive): regex = (r'(?P<directive>%s)%s' r'(?P<val>\w+)' % (re.escape(directive), self._optional_equals)) self._pr_options.append(_pr_compile(regex)) def _add_option_regex(self, directive, regex): regex = (r'(?P<directive>%s)%s' r'(?P<val>%s)' % (re.escape(directive), self._optional_equals, regex)) self._pr_options.append(_pr_compile(regex)) _options_of_type_string = ('COMMENT', 'DATA DIRECTORY', 'INDEX DIRECTORY', 'PASSWORD', 'CONNECTION') def _pr_compile(regex, cleanup=None): """Prepare a 2-tuple of compiled regex and callable.""" return (_re_compile(regex), cleanup) def _re_compile(regex): """Compile a string to regex, I and UNICODE.""" return re.compile(regex, re.I | re.UNICODE)
# vim: tabstop=4 shiftwidth=4 softtabstop=4 # Copyright 2010 United States Government as represented by the # Administrator of the National Aeronautics and Space Administration. # All Rights Reserved. # Copyright (c) 2010 Citrix Systems, Inc. # Copyright 2011 Ken Pepple # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. """Built-in instance properties.""" import re import sys import uuid from oslo.config import cfg import six from nova import context from nova import db from nova import exception from nova.openstack.common.db import exception as db_exc from nova.openstack.common.gettextutils import _ from nova.openstack.common import log as logging from nova.openstack.common import strutils from nova.pci import pci_request from nova import utils flavor_opts = [ cfg.StrOpt('default_flavor', default='m1.small', help='default flavor to use for the EC2 API only. The Nova API ' 'does not support a default flavor.'), ] CONF = cfg.CONF CONF.register_opts(flavor_opts) LOG = logging.getLogger(__name__) # NOTE(luisg): Flavor names can include non-ascii characters so that users can # create flavor names in locales that use them, however flavor IDs are limited # to ascii characters. VALID_ID_REGEX = re.compile("^[\w\.\- ]*$") VALID_NAME_REGEX = re.compile("^[\w\.\- ]*$", re.UNICODE) def _int_or_none(val): if val is not None: return int(val) system_metadata_flavor_props = { 'id': int, 'name': str, 'memory_mb': int, 'vcpus': int, 'root_gb': int, 'ephemeral_gb': int, 'flavorid': str, 'swap': int, 'rxtx_factor': float, 'vcpu_weight': _int_or_none, } def create(name, memory, vcpus, root_gb, ephemeral_gb=0, flavorid=None, swap=0, rxtx_factor=1.0, is_public=True): """Creates flavors.""" if not flavorid: flavorid = uuid.uuid4() kwargs = { 'memory_mb': memory, 'vcpus': vcpus, 'root_gb': root_gb, 'ephemeral_gb': ephemeral_gb, 'swap': swap, 'rxtx_factor': rxtx_factor, } if isinstance(name, six.string_types): name = name.strip() # ensure name do not exceed 255 characters utils.check_string_length(name, 'name', min_length=1, max_length=255) # ensure name does not contain any special characters valid_name = VALID_NAME_REGEX.search(name) if not valid_name: msg = _("Flavor names can only contain alphanumeric characters, " "periods, dashes, underscores and spaces.") raise exception.InvalidInput(reason=msg) # NOTE(vish): Internally, flavorid is stored as a string but it comes # in through json as an integer, so we convert it here. flavorid = unicode(flavorid) # ensure leading/trailing whitespaces not present. if flavorid.strip() != flavorid: msg = _("id cannot contain leading and/or trailing whitespace(s)") raise exception.InvalidInput(reason=msg) # ensure flavor id does not exceed 255 characters utils.check_string_length(flavorid, 'id', min_length=1, max_length=255) # ensure flavor id does not contain any special characters valid_flavor_id = VALID_ID_REGEX.search(flavorid) if not valid_flavor_id: msg = _("Flavor id can only contain letters from A-Z (both cases), " "periods, dashes, underscores and spaces.") raise exception.InvalidInput(reason=msg) # Some attributes are positive ( > 0) integers for option in ['memory_mb', 'vcpus']: kwargs[option] = utils.validate_integer(kwargs[option], option, 1, sys.maxint) # Some attributes are non-negative ( >= 0) integers for option in ['root_gb', 'ephemeral_gb', 'swap']: kwargs[option] = utils.validate_integer(kwargs[option], option, 0, sys.maxint) # rxtx_factor should be a positive float try: kwargs['rxtx_factor'] = float(kwargs['rxtx_factor']) if kwargs['rxtx_factor'] <= 0: raise ValueError() except ValueError: msg = _("'rxtx_factor' argument must be a positive float") raise exception.InvalidInput(reason=msg) kwargs['name'] = name kwargs['flavorid'] = flavorid # ensure is_public attribute is boolean try: kwargs['is_public'] = strutils.bool_from_string( is_public, strict=True) except ValueError: raise exception.InvalidInput(reason=_("is_public must be a boolean")) try: return db.flavor_create(context.get_admin_context(), kwargs) except db_exc.DBError as e: LOG.exception(_('DB error: %s') % e) raise exception.FlavorCreateFailed() def destroy(name): """Marks flavor as deleted.""" try: if not name: raise ValueError() db.flavor_destroy(context.get_admin_context(), name) except (ValueError, exception.NotFound): LOG.exception(_('Instance type %s not found for deletion') % name) raise exception.FlavorNotFoundByName(flavor_name=name) def get_all_flavors(ctxt=None, inactive=False, filters=None): """Get all non-deleted flavors as a dict. Pass true as argument if you want deleted flavors returned also. """ if ctxt is None: ctxt = context.get_admin_context() inst_types = db.flavor_get_all( ctxt, inactive=inactive, filters=filters) inst_type_dict = {} for inst_type in inst_types: inst_type_dict[inst_type['id']] = inst_type return inst_type_dict def get_all_flavors_sorted_list(ctxt=None, inactive=False, filters=None, sort_key='flavorid', sort_dir='asc', limit=None, marker=None): """Get all non-deleted flavors as a sorted list. Pass true as argument if you want deleted flavors returned also. """ if ctxt is None: ctxt = context.get_admin_context() return db.flavor_get_all(ctxt, filters=filters, sort_key=sort_key, sort_dir=sort_dir, limit=limit, marker=marker) def get_default_flavor(): """Get the default flavor.""" name = CONF.default_flavor return get_flavor_by_name(name) def get_flavor(instance_type_id, ctxt=None, inactive=False): """Retrieves single flavor by id.""" if instance_type_id is None: return get_default_flavor() if ctxt is None: ctxt = context.get_admin_context() if inactive: ctxt = ctxt.elevated(read_deleted="yes") return db.flavor_get(ctxt, instance_type_id) def get_flavor_by_name(name, ctxt=None): """Retrieves single flavor by name.""" if name is None: return get_default_flavor() if ctxt is None: ctxt = context.get_admin_context() return db.flavor_get_by_name(ctxt, name) # TODO(termie): flavor-specific code should probably be in the API that uses # flavors. def get_flavor_by_flavor_id(flavorid, ctxt=None, read_deleted="yes"): """Retrieve flavor by flavorid. :raises: FlavorNotFound """ if ctxt is None: ctxt = context.get_admin_context(read_deleted=read_deleted) return db.flavor_get_by_flavor_id(ctxt, flavorid, read_deleted) def get_flavor_access_by_flavor_id(flavorid, ctxt=None): """Retrieve flavor access list by flavor id.""" if ctxt is None: ctxt = context.get_admin_context() return db.flavor_access_get_by_flavor_id(ctxt, flavorid) def add_flavor_access(flavorid, projectid, ctxt=None): """Add flavor access for project.""" if ctxt is None: ctxt = context.get_admin_context() return db.flavor_access_add(ctxt, flavorid, projectid) def remove_flavor_access(flavorid, projectid, ctxt=None): """Remove flavor access for project.""" if ctxt is None: ctxt = context.get_admin_context() return db.flavor_access_remove(ctxt, flavorid, projectid) def extract_flavor(instance, prefix=''): """Create an InstanceType-like object from instance's system_metadata information. """ instance_type = {} sys_meta = utils.instance_sys_meta(instance) for key, type_fn in system_metadata_flavor_props.items(): type_key = '%sinstance_type_%s' % (prefix, key) instance_type[key] = type_fn(sys_meta[type_key]) return instance_type def save_flavor_info(metadata, instance_type, prefix=''): """Save properties from instance_type into instance's system_metadata, in the format of: [prefix]instance_type_[key] This can be used to update system_metadata in place from a type, as well as stash information about another instance_type for later use (such as during resize). """ for key in system_metadata_flavor_props.keys(): to_key = '%sinstance_type_%s' % (prefix, key) metadata[to_key] = instance_type[key] pci_request.save_flavor_pci_info(metadata, instance_type, prefix) return metadata def delete_flavor_info(metadata, *prefixes): """Delete flavor instance_type information from instance's system_metadata by prefix. """ for key in system_metadata_flavor_props.keys(): for prefix in prefixes: to_key = '%sinstance_type_%s' % (prefix, key) del metadata[to_key] pci_request.delete_flavor_pci_info(metadata, *prefixes) return metadata
""" python version of the mlayer code in shadow for reflectivity scans TODO: graded multilayers TODO: vectorization """ __author__ = 'srio' # import numpy import scipy.constants as codata tocm = codata.h*codata.c/codata.e*1e2 # 12398.419739640718e-8 from srxraylib.util.h5_simple_writer import H5SimpleWriter # retrieve a bind of xraylib refractive index that accept NIST compounds from orangecontrib.xoppy.util.xoppy_xraylib_util import density, Refractive_Index_Re, Refractive_Index_Im class MLayer(object): def __init__(self): self.using_pre_mlayer = False self.pre_mlayer_dict = None def read_preprocessor_file(self,filename): out_dict = {} fp = open(filename) # Open file on read mode lines = fp.read().split("\n") # Create a list containing all lines fp.close() # Close file index_pointer = 0 np = int(lines[index_pointer]) out_dict['np'] = np energy = numpy.zeros(np) index_pointer += 1 # mylist = lines[index_pointer].split(" ") mylist = lines[index_pointer].split() for i in range(np): energy[i] = float(mylist[i]) out_dict["energy"] = energy delta_s = numpy.zeros_like(energy) beta_s = numpy.zeros_like(energy) delta_e = numpy.zeros_like(energy) beta_e = numpy.zeros_like(energy) delta_o = numpy.zeros_like(energy) beta_o = numpy.zeros_like(energy) for i in range(np): index_pointer += 1 mylist = lines[index_pointer].strip().split() delta_s[i] = float(mylist[0]) beta_s[i] = float(mylist[1]) for i in range(np): index_pointer += 1 mylist = lines[index_pointer].strip().split() delta_e[i] = float(mylist[0]) beta_e[i] = float(mylist[1]) for i in range(np): index_pointer += 1 mylist = lines[index_pointer].strip().split() delta_o[i] = float(mylist[0]) beta_o[i] = float(mylist[1]) out_dict["delta_s"] = delta_s out_dict["beta_s"] = beta_s out_dict["delta_e"] = delta_e out_dict["beta_e"] = beta_e out_dict["delta_o"] = delta_o out_dict["beta_o"] = beta_o # #! srio@esrf.eu 2012-06-07 Nevot-Croce ML roughness model implemented. # #! By convention, starting from the version that includes ML roughness # #! we set NPAR negative, in order to assure compatibility with old # #! versions. If NPAR<0, roughness data are read, if NPAR>0 no roughness. index_pointer += 1 npair = int(lines[index_pointer]) out_dict["npair"] = npair thick = numpy.zeros(numpy.abs(npair)) gamma1 = numpy.zeros_like(thick) mlroughness1 = numpy.zeros_like(thick) mlroughness2 = numpy.zeros_like(thick) for i in range(numpy.abs(npair)): index_pointer += 1 mylist = lines[index_pointer].strip().split() thick[i] = float(mylist[0]) gamma1[i] = float(mylist[1]) mlroughness1[i] = float(mylist[2]) mlroughness2[i] = float(mylist[3]) out_dict["thick"] = thick out_dict["gamma1"] = gamma1 out_dict["mlroughness1"] = mlroughness1 out_dict["mlroughness2"] = mlroughness2 index_pointer += 1 igrade = int(lines[index_pointer]) out_dict["igrade"] = igrade if igrade == 1: index_pointer += 1 fgrade = int(lines[index_pointer]) out_dict["fgrade"] = fgrade elif igrade == 2: # igrade=2, index_pointer += 1 mylist = lines[index_pointer].strip().split(" ") a0 = float(mylist[0]) a1 = float(mylist[1]) a2 = float(mylist[2]) a3 = float(mylist[3]) out_dict["a0"] = a0 out_dict["a1"] = a1 out_dict["a2"] = a2 out_dict["a3"] = a3 self.pre_mlayer_dict = out_dict # # this is copied from shadow3 python preprocessors # @classmethod def pre_mlayer(cls, interactive=False, FILE="pre_mlayer.dat",E_MIN=5000.0,E_MAX=20000.0, S_DENSITY=2.33,S_MATERIAL="Si", E_DENSITY=2.40,E_MATERIAL="B4C", O_DENSITY=9.40,O_MATERIAL="Ru", GRADE_DEPTH=0,N_PAIRS=70,THICKNESS=33.1,GAMMA=0.483, ROUGHNESS_EVEN=3.3,ROUGHNESS_ODD=3.1, FILE_DEPTH="myfile_depth.dat",GRADE_SURFACE=0,FILE_SHADOW="mlayer1.sha", FILE_THICKNESS="mythick.dat",FILE_GAMMA="mygamma.dat",AA0=1.0,AA1=0.0,AA2=0.0,AA3=0.0): """ SHADOW preprocessor for multilayers - python+xraylib version """ import xraylib # input section if interactive: print("pre_mlayer: SHADOW preprocessor for multilayers - python+xraylib version") fileout = input("Name of output file : ") estart = input("Photon energy (eV) from : ") estart = float(estart) efinal = input(" to : ") efinal = float(efinal) print(" ") print("The stack is as follows: ") print(" ") print(" vacuum ") print(" |------------------------------| \ ") print(" | odd (n) | | ") print(" |------------------------------| | BILAYER # n ") print(" | even (n) | | ") print(" |------------------------------| / ") print(" | . | ") print(" | . | ") print(" | . | ") print(" |------------------------------| \ ") print(" | odd (1) | | ") print(" |------------------------------| | BILAYER # 1 ") print(" | even (1) | | ") print(" |------------------------------| / ") print(" | | ") print(" |///////// substrate //////////| ") print(" | | ") print(" ") print(" ") # substrate matSubstrate = input("Specify the substrate material : ") denSubstrate = input("Specify the substrate density [g/cm^3] : ") denSubstrate = float(denSubstrate) print("Right above the substrate is the even layer material") matEven = input("Specify the even layer material : ") denEven = input("Specify the even layer density [g/cm^3] : ") denEven = float(denEven) print("Odd layer material is on top of the even layer.") matOdd = input("Specify the odd layer material : ") denOdd = input("Specify the odd layer density [g/cm^3] : ") denOdd = float(denOdd) #! By convention, starting from the version that includes ML roughness #! we set NPAR negative, in order to assure compatibility with old #! versions. If NPAR<0, roughness data are read, if NPAR>0 no roughness. npair = input("No. of layer pairs : ") npair = int(npair) print(" ") print("Starting from the substrate surface, specify the thickness t :") print(" t = t(odd) + t(even) in Angstroms,") print("and the gamma ratio :") print(" t(even) / (t(odd) + t(even))") print("for EACH bilayer.") print(" ") print("Type two -1 whenever you want the remaining layers ") print("to assume the thickness, gamma ratio and roughnesses of the previous one.") print(" ") #define variables thick=[0e0]*npair gamma1=[0e0]*npair mlroughness1=[0e0]*npair mlroughness2=[0e0]*npair for i in range(npair): tmps = ("thickness [A], gamma ratio, roughness even [A] and roughness odd [A] of bilayer %i: \n"% (i+1) ) tmp = input(tmps) tmp1 = tmp.split() if ((i != 0) and (int(float(tmp1[0])) == -1)): thick[i:(npair-1)] = [thick[i-1]] * (npair-i) gamma1[i:(npair-1)] = [gamma1[i-1]] * (npair-i) mlroughness1[i:(npair-1)] = [mlroughness1[i-1]] * (npair-i) mlroughness2[i:(npair-1)] = [mlroughness2[i-1]] * (npair-i) break else: thick[i] = float(tmp1[0]) gamma1[i] = float(tmp1[1]) mlroughness1[i] = float(tmp1[2]) mlroughness2[i] = float(tmp1[3]) print("***************************************************") print(" Is the multilayer graded over the surface? ") print(" 0: No ") print(" 1: t and/or gamma graded over the surface ") print(" (input spline files with t and gamma gradient") print(" 2: t graded over the surface ") print(" (input quadratic fit to t gradient)") print(" ") igrade = input("Is t and/or gamma graded over the surface [0=No/1=Yes] ? ") igrade = int(igrade) if igrade == 1: print("Generation of the spline coefficients for the t and gamma factors") print("over the surface.") print("Then GRADE_MLAYER should be run to generate the spline ") print("coefficients for the t and gamma factors over the surface.") print("Here just type in the file name that WILL be used to store") print("the spline coefficients :") fgrade = input("File name (output from grade_mlayer: ") elif igrade == 2: # igrade=2, coefficients print("A second degree polynomial fit of the thickness grading") print("must be available:") print("t(y) = BILATER_THICHNESS(y)/BILAYER_THICKNESS(y=0)") print("t(y) = a0 + a1*y + a2*(y^2) + a3*(y^3) ") print("a0 (constant term) ") print("a1 (slope term) ") print("a2 (quadratic term) ") print("a3 (cubic term) ") tmp = input("Enter a0, a1, a2, a3: ") tmp = tmp.split() a0 = float(tmp[0]) a1 = float(tmp[1]) a2 = float(tmp[2]) a3 = float(tmp[3]) else: #--- From input keywords... fileout = FILE estart = float(E_MIN) efinal = float(E_MAX) # substrate matSubstrate = S_MATERIAL denSubstrate = float(S_DENSITY) matEven = E_MATERIAL denEven = float(E_DENSITY) matOdd = O_MATERIAL denOdd = float(O_DENSITY) npair = int(N_PAIRS) #define variables thick=[0e0]*npair gamma1=[0e0]*npair mlroughness1=[0e0]*npair mlroughness2=[0e0]*npair for i in range(npair): thick[i] = float(THICKNESS) gamma1[i] = float(GAMMA) mlroughness1[i] = float(ROUGHNESS_EVEN) mlroughness2[i] = float(ROUGHNESS_ODD) igrade = int(GRADE_SURFACE) #TODO: check if needed file_gamma fgrade = FILE_THICKNESS # raw_input("File name (output from grade_mlayer: ") a0 = float(AA0) a1 = float(AA1) a2 = float(AA2) a3 = float(AA3) elfactor = numpy.log10(1.0e4/30.0)/300.0 istart = int(numpy.log10(estart/30.0e0)/elfactor + 1) ifinal = int(numpy.log10(efinal/30.0e0)/elfactor + 2) np = int(ifinal - istart) + 1 f = open(fileout, 'wt') pre_mlayer_dict = {} f.write("%i \n" % np) pre_mlayer_dict["np"] = np ENERGY = numpy.zeros(np) for i in range(np): energy = 30e0*numpy.power(10,elfactor*(istart+i-1)) f.write("%e " % energy) ENERGY[i] = energy f.write( "\n") pre_mlayer_dict["energy"] = ENERGY DELTA = numpy.zeros(np) BETA = numpy.zeros(np) for i in range(np): #substrate energy = 30e0*numpy.power(10,elfactor*(istart+i-1)) *1e-3 # in keV!! delta = 1e0 - Refractive_Index_Re(matSubstrate,energy,denSubstrate) beta = Refractive_Index_Im(matSubstrate,energy,denSubstrate) DELTA[i] = delta BETA[i] = beta f.write( ("%26.17e "*2+"\n") % tuple([delta,beta]) ) pre_mlayer_dict["delta_s"] = DELTA pre_mlayer_dict["beta_s"] = BETA DELTA = numpy.zeros(np) BETA = numpy.zeros(np) for i in range(np): #even energy = 30e0*numpy.power(10,elfactor*(istart+i-1)) *1e-3 # in keV!! delta = 1e0 - Refractive_Index_Re(matEven,energy,denEven) beta = Refractive_Index_Im(matEven,energy,denEven) DELTA[i] = delta BETA[i] = beta f.write( ("%26.17e "*2+"\n") % tuple([delta,beta]) ) pre_mlayer_dict["delta_e"] = DELTA pre_mlayer_dict["beta_e"] = BETA DELTA = numpy.zeros(np) BETA = numpy.zeros(np) for i in range(np): #odd energy = 30e0*numpy.power(10,elfactor*(istart+i-1)) *1e-3 # in keV!! delta = 1e0 - Refractive_Index_Re(matOdd,energy,denOdd) beta = Refractive_Index_Im(matOdd,energy,denOdd) DELTA[i] = delta BETA[i] = beta f.write( ("%26.17e "*2+"\n") % tuple([delta,beta]) ) pre_mlayer_dict["delta_o"] = DELTA pre_mlayer_dict["beta_o"] = BETA #! srio@esrf.eu 2012-06-07 Nevot-Croce ML roughness model implemented. #! By convention, starting from the version that includes ML roughness #! we set NPAR negative, in order to assure compatibility with old #! versions. If NPAR<0, roughness data are read, if NPAR>0 no roughness. f.write("%i \n" % -npair) pre_mlayer_dict["npair"] = -npair for i in range(npair): f.write( ("%26.17e "*4+"\n") % tuple([thick[i],gamma1[i],mlroughness1[i],mlroughness2[i]]) ) pre_mlayer_dict["thick"] = numpy.array(thick) pre_mlayer_dict["gamma1"] = numpy.array(gamma1) pre_mlayer_dict["mlroughness1"] = numpy.array(mlroughness1) pre_mlayer_dict["mlroughness2"] = numpy.array(mlroughness2) f.write("%i \n" % igrade) pre_mlayer_dict["igrade"] = igrade if igrade == 1: f.write("%s \n" % fgrade) pre_mlayer_dict["fgrade"] = fgrade elif igrade == 2: # igrade=2, coefficients f.write("%f %f %f %f\n"%(a0,a1,a2,a3)) pre_mlayer_dict["a0"] = a0 pre_mlayer_dict["a1"] = a1 pre_mlayer_dict["a2"] = a2 pre_mlayer_dict["a3"] = a3 f.close() print("File written to disk: %s" % fileout) out = MLayer() out.pre_mlayer_dict = pre_mlayer_dict out.using_pre_mlayer = True return out @classmethod def initialize_from_bilayer_stack(cls, material_S="Si", density_S=None, roughness_S=0.0, material_E="B4C",density_E=None, roughness_E=0.0, material_O="Ru", density_O=None, roughness_O=0.0, bilayer_pairs=70, bilayer_thickness=33.1, bilayer_gamma=0.483, ): npair = int(bilayer_pairs) #define variables thick = [] #[0e0]*npair gamma1 = [] #[0e0]*npair mlroughness1 = [] #[0e0]*npair mlroughness2 = [] #[0e0]*npair for i in range(npair): thick.append(bilayer_thickness) # float(BILAYER_THICKNESS) gamma1.append(bilayer_gamma) # float(BILAYER_GAMMA) mlroughness1.append(roughness_E) # float(ROUGHNESS_E) mlroughness2.append(roughness_O) # float(ROUGHNESS_O) pre_mlayer_dict = {} pre_mlayer_dict["np"] = bilayer_pairs #! srio@esrf.eu 2012-06-07 Nevot-Croce ML roughness model implemented. #! By convention, starting from the version that includes ML roughness #! we set NPAR negative, in order to assure compatibility with old #! versions. If NPAR<0, roughness data are read, if NPAR>0 no roughness. pre_mlayer_dict["npair"] = -npair pre_mlayer_dict["thick"] = numpy.array(thick) pre_mlayer_dict["gamma1"] = numpy.array(gamma1) pre_mlayer_dict["mlroughness1"] = numpy.array(mlroughness1) pre_mlayer_dict["mlroughness2"] = numpy.array(mlroughness2) #These keys are not in the original pre_mlayer_dict pre_mlayer_dict["material1"] = material_E pre_mlayer_dict["material2"] = material_O pre_mlayer_dict["materialS"] = material_S pre_mlayer_dict["roughnessS"] = roughness_S pre_mlayer_dict["density1"] = density_E pre_mlayer_dict["density2"] = density_O pre_mlayer_dict["densityS"] = density_S if pre_mlayer_dict["densityS"] is None: pre_mlayer_dict["densityS"] = density(pre_mlayer_dict["materialS"]) print("Using density for substrate (%s): %f"%(pre_mlayer_dict["materialS"], pre_mlayer_dict["densityS"])) if pre_mlayer_dict["density1"] is None: pre_mlayer_dict["density1"] = density(pre_mlayer_dict["material1"]) print("Using density for layer 1 (even) (%s): %f" % (pre_mlayer_dict["material1"], pre_mlayer_dict["density1"])) if pre_mlayer_dict["density2"] is None: pre_mlayer_dict["density2"] = density(pre_mlayer_dict["material2"]) print("Using density for layer 2 (odd) (%s): %f" % (pre_mlayer_dict["material2"], pre_mlayer_dict["density2"])) if isinstance(pre_mlayer_dict["densityS"],str): pre_mlayer_dict["densityS"] = float(pre_mlayer_dict["densityS"]) if isinstance(pre_mlayer_dict["density1"],str): pre_mlayer_dict["density1"] = float(pre_mlayer_dict["density1"]) if isinstance(pre_mlayer_dict["density2"], str): pre_mlayer_dict["density2"] = float(pre_mlayer_dict["density2"]) # fill unused keys pre_mlayer_dict["energy"] = None pre_mlayer_dict["delta_s"] = None pre_mlayer_dict["beta_s"] = None pre_mlayer_dict["delta_e"] = None pre_mlayer_dict["beta_e"] = None pre_mlayer_dict["delta_o"] = None pre_mlayer_dict["beta_o"] = None pre_mlayer_dict["igrade"] = None if pre_mlayer_dict["igrade"] == 1: pre_mlayer_dict["fgrade"] = None elif pre_mlayer_dict["igrade"] == 2: # igrade=2, coefficients pre_mlayer_dict["a0"] = None pre_mlayer_dict["a1"] = None pre_mlayer_dict["a2"] = None pre_mlayer_dict["a3"] = None # return out = MLayer() out.pre_mlayer_dict = pre_mlayer_dict out.using_pre_mlayer = False return out # ! # ! PRE_MLAYER_SCAN # ! # # ! # ! this is a simple routine that computes the multilayer reflectivity # ! with a multilayer defined in a file created by pre_mlayer. # ! # ! It can be used for testing pre_mlayer, or for simple calculations of # ! ML reflectivity. # ! def scan(self,h5file="", energyN = 51,energy1 = 5000.0,energy2 = 20000.0, thetaN = 1,theta1 = 0.75,theta2 = 0.75): if self.pre_mlayer_dict is None: raise Exception("load preprocessor file before!") # !calculate k_what = 1 if (energyN > 1): energyS = (energy2-energy1)/float(energyN-1) else: energyS = 0.0 if (thetaN > 1): thetaS = (theta2-theta1)/float(thetaN-1) else: thetaS = 0.0 R_S_array = numpy.zeros((energyN,thetaN)) R_P_array = numpy.zeros_like(R_S_array) theta_array = numpy.zeros(thetaN) energy_array = numpy.zeros(energyN) for i in range(1,1+thetaN): for j in range(1,1+energyN): theta = theta1 + float(i-1) * thetaS energy = energy1+ float(j-1)*energyS sin_ref = numpy.sin ( theta * numpy.pi/180) wnum = 2 * numpy.pi * energy / tocm COS_POLE = 1.0 R_S,R_P,tmp,phases,phasep = self.reflec(wnum,sin_ref,COS_POLE,k_what) R_S_array[j-1,i-1] = R_S R_P_array[j-1,i-1] = R_P theta_array[i-1] = theta energy_array[j-1] = energy if ( (thetaN == 1) and (energyN == 1) ): print("------------------------------------------------------------------------") print("Inputs: ") print(" for E=",energy1,"eV: ") print(" energy [eV]: ",energy) print(" grazing angle [deg]: ",theta) print(" wavelength [A]: ",(1e0/wnum)*2*numpy.pi*1e8) print(" wavenumber (2 pi/lambda) [cm^-1]: ",wnum) print("Outputs: ") print(" R_S: ",R_S) print(" R_P: ",R_P) print("------------------------------------------------------------------------") if h5file != "": h5_initialize = True if True: #try: if h5_initialize: h5w = H5SimpleWriter.initialize_file(h5file, creator="xoppy_multilayer.py") else: h5w = H5SimpleWriter(h5file, None) h5_entry_name = "MLayer" h5w.create_entry(h5_entry_name,nx_default="reflectivity-s") if energyN == 1: h5w.add_dataset(theta_array, R_S_array[0]**2, dataset_name="reflectivity-s", entry_name=h5_entry_name, title_x="Grazing angle [deg]", title_y="Reflectivity-s") elif thetaN == 1: h5w.add_dataset(energy_array, R_S_array[:,0]**2, dataset_name="reflectivity-s", entry_name=h5_entry_name, title_x="Photon energy [eV]", title_y="Reflectivity-s") else: # h5w.create_entry(h5_entry_name, nx_default="EnergyAngleScan") h5w.add_image(R_S_array**2, energy_array, theta_array, image_name="EnergyAngleScan", entry_name=h5_entry_name, title_x="Photon Energy [eV]", title_y="Grazing Angle [deg]") h5w.create_entry("parameters", root_entry=h5_entry_name, nx_default=None) for key in self.pre_mlayer_dict.keys(): try: h5w.add_key(key, self.pre_mlayer_dict[key], entry_name=h5_entry_name + "/parameters") except: pass print("File written to disk: %s" % h5file) # except: # raise Exception("ERROR writing h5 file") return R_S_array,R_P_array,energy_array,theta_array def reflec(self,WNUM,SIN_REF,COS_POLE,K_WHAT): # ! C+++ # ! C SUBROUTINE REFLEC # ! C # ! C PURPOSE To compute the local reflectivity of a mirror or # ! C multilayer. Also compute filter transmittivity. # ! C # ! C # ! C ARGUMENTS [ I ] PIN : (x,y,z) of the intercept # ! C [ I ] wnum : wavenumber (cm-1) # ! C [ I ] sin_ref : sine of angle from surface # ! C [ I ] cos_pole : cosine of angle of normal from pole # ! C [ O ] R_P : p-pol reflection coefficient # ! C [ O ] R_S : s-pol " " # ! C # ! C--- phases = 0.0 phasep = 0.0 NIN = self.pre_mlayer_dict["np"] PHOT_ENER = WNUM * tocm / (2 * numpy.pi) # eV NPAIR = numpy.abs(self.pre_mlayer_dict["npair"]) XLAM = 2 * numpy.pi / WNUM * 1.0e8 # Angstrom gamma1 = self.pre_mlayer_dict["gamma1"] t_oe = self.pre_mlayer_dict["thick"] # gamma1 = ratio t(even)/(t(odd)+t(even)) of each layer pair t_e = gamma1 * t_oe t_o = (1.0 - gamma1) * t_oe mlroughness1 = self.pre_mlayer_dict["mlroughness1"] mlroughness2 = self.pre_mlayer_dict["mlroughness2"] if self.using_pre_mlayer: ENER = self.pre_mlayer_dict["energy"] wnum = 2 * numpy.pi * ENER / tocm QMIN = wnum[0] QSTEP = wnum[1] - wnum[0] DELTA_S = self.pre_mlayer_dict["delta_s"] DELTA_E = self.pre_mlayer_dict["delta_e"] DELTA_O = self.pre_mlayer_dict["delta_o"] BETA_S = self.pre_mlayer_dict["beta_s"] BETA_E = self.pre_mlayer_dict["beta_e"] BETA_O = self.pre_mlayer_dict["beta_o"] i_grade = self.pre_mlayer_dict["igrade"] # TODO graded ml # ! C # ! C Is the multilayer thickness graded ? # ! C # read (iunit,*) i_grade # ! 0=None # ! 1=spline files # ! 2=quadic coefficients # # ! spline # if (i_grade.eq.1) then # read (iunit,'(a)') file_grade # OPEN (45, FILE=adjustl(FILE_GRADE), STATUS='OLD', & # FORM='UNFORMATTED', IOSTAT=iErr) # ! srio added test # if (iErr /= 0 ) then # print *,"REFLEC: File not found: "//trim(adjustl(file_grade)) # print *,'Error: REFLEC: File not found. Aborted.' # ! stop 'File not found. Aborted.' # end if # # READ (45) NTX, NTY # READ (45) TX,TY # !DO 205 I = 1, NTX # !DO 205 J = 1, NTY # DO I = 1, NTX # DO J = 1, NTY # READ (45) TSPL(1,I,1,J),TSPL(1,I,2,J), & ! spline for t # TSPL(2,I,1,J),TSPL(2,I,2,J) # END DO # END DO # # READ (45) NGX, NGY # READ (45) GX,GY # DO I = 1, NGX # DO J = 1, NGY # READ (45) GSPL(1,I,1,J),GSPL(1,I,2,J), & ! spline for gamma # GSPL(2,I,1,J),GSPL(2,I,2,J) # END DO # END DO # # CLOSE (45) # end if # # if (i_grade.eq.2) then ! quadric coefficients # ! # ! laterally gradded multilayer # ! # # ! srio@esrf.eu added cubic term (requested B Meyer, LNLS) # read(iunit,*,IOSTAT=iErr) lateral_grade_constant,lateral_grade_slope, & # lateral_grade_quadratic,lateral_grade_cubic # # end if # # close(unit=iunit) # tfilm = absor # RETURN # END IF # END IF # ! C # ! C Multilayers reflectivity. # ! C First interpolate for all the refractive indices. # ! C ELFACTOR = numpy.log10(1.0e4/30.0e0)/300.0e0 index1 = numpy.log10(PHOT_ENER/ENER[0])/ELFACTOR index1 = int(index1) DELS = DELTA_S[index1] + (DELTA_S[index1+1] - DELTA_S[index1]) *(PHOT_ENER - ENER[index1])/(ENER[index1+1] - ENER[index1]) BETS = BETA_S[index1] + ( BETA_S[index1+1] - BETA_S[index1]) *(PHOT_ENER - ENER[index1])/(ENER[index1+1] - ENER[index1]) DELE = DELTA_E[index1] + (DELTA_E[index1+1] - DELTA_E[index1]) *(PHOT_ENER - ENER[index1])/(ENER[index1+1] - ENER[index1]) BETE = BETA_E[index1] + ( BETA_E[index1+1] - BETA_E[index1]) *(PHOT_ENER - ENER[index1])/(ENER[index1+1] - ENER[index1]) DELO = DELTA_O[index1] + (DELTA_O[index1+1] - DELTA_O[index1]) *(PHOT_ENER - ENER[index1])/(ENER[index1+1] - ENER[index1]) BETO = BETA_O[index1] + ( BETA_O[index1+1] - BETA_O[index1]) *(PHOT_ENER - ENER[index1])/(ENER[index1+1] - ENER[index1]) else: # not using preprocessor, using xraylib DELS = 1.0 - Refractive_Index_Re(self.pre_mlayer_dict["materialS"],1e-3*PHOT_ENER,self.pre_mlayer_dict["densityS"]) BETS = Refractive_Index_Im(self.pre_mlayer_dict["materialS"],1e-3*PHOT_ENER,self.pre_mlayer_dict["densityS"]) DELE = 1.0 - Refractive_Index_Re(self.pre_mlayer_dict["material1"],1e-3*PHOT_ENER,self.pre_mlayer_dict["density1"]) BETE = Refractive_Index_Im(self.pre_mlayer_dict["material1"],1e-3*PHOT_ENER,self.pre_mlayer_dict["density1"]) DELO = 1.0 - Refractive_Index_Re(self.pre_mlayer_dict["material2"],1e-3*PHOT_ENER,self.pre_mlayer_dict["density2"]) BETO = Refractive_Index_Im(self.pre_mlayer_dict["material2"],1e-3*PHOT_ENER,self.pre_mlayer_dict["density2"]) TFACT = 1.0 GFACT = 1.0 #TODO graded multilayers # IF (I_GRADE.EQ.1) THEN # XIN = PIN(1) # YIN = PIN(2) # CALL DBCEVL (TX,NTX,TY,NTY,TSPL,i101,XIN,YIN,PDS,IER) # IF (IER.NE.0) THEN # CALL MSSG ('REFLEC','Spline error # ',IER) # RETURN # END IF # TFACT = PDS(1) # ! C # CALL DBCEVL (GX,NGX,GY,NGY,GSPL,i101,XIN,YIN,PDS,IER) # IF (IER.NE.0) THEN # CALL MSSG ('REFLEC','Spline error # ',IER) # RETURN # END IF # GFACT = PDS(1) # ELSE IF (I_GRADE.EQ.2) THEN # TFACT = lateral_grade_constant+ & # lateral_grade_slope*pin(2) + & # lateral_grade_quadratic*pin(2)*pin(2) + & # lateral_grade_cubic*pin(2)*pin(2)*pin(2) # ELSE # END IF # # R_S,R_P,PHASES,PHASEP = self.fresnel(TFACT,GFACT,NPAIR,SIN_REF,COS_POLE,XLAM, DELO,DELE,DELS,BETO,BETE,BETS,t_o,t_e,mlroughness1,mlroughness2) return R_S,R_P,0,phases,phasep def fresnel(self,TFACT,GFACT,NPAIR,SIN_REF,COS_POLE,XLAM, delo,dele,dels,beto,bete,bets,t_o,t_e,mlroughness1,mlroughness2): # !C------------------------------------------------------------------------------ # !C subroutine FRESNEL # !C------------------------------------------------------------------------------ # !c compute x-ray/u.v. reflection efficiency of multilayers # !c # !c inputs: # !c tfact : used for ML with graded thickness (thickness coeff) # !c gfact : used for ML with graded thickness (gamma coeff) # !c n : number of bilayers # !c sin_ref : sin of angle of incidence (grazing??) # !c cos_pole: cos of angle of between normal and pole?? # !c # !c delo,dele,dels = parameter delta odd, even, substrate respectively # !c belo,bele,bels = parametro beta odd, even, substrate respectively # !c 1.0 - delo - i*beto = complex refractive index (odd) # !c 1.0 - dele - i*bete = complex refractive index (even) # !c t_o = thickness of odd layers (a) # !c t_e = thickness of even layers (a) # !c outputs: # !c ans = S polarization reflectivity # !c anp = P polarization reflectivity # !c phaseS = change of phase S # !c phaseP = change di phase P # !c # !c---------------------------------------------------------------------------- # !C # !C # !C vacuum # !C |------------------------------| \ # !C | odd (n) | | # !C |------------------------------| | BILAYER # n # !C | even (n) | | # !C |------------------------------| / # !C | . | # !C | . | # !C | . | # !C |------------------------------| \ # !C | odd (1) | | # !C |------------------------------| | BILAYER # 1 # !C | even (1) | | # !C |------------------------------| / # !C | | # !C |///////// substrate //////////| # !C | | # !C # !c---------------------------------------------------------------------------- # !c---------------------------------------------------------------------------- ci = 0.+1.0j # ! (refraction index "odd,even,substrate")**2 ro2 = (1.0 - delo - ci * beto)**2 re2 = (1.0 - dele - ci * bete)**2 rs2 = (1.0 - dels - ci * bets)**2 # ! angles SIN_REF2 = SIN_REF**2 COS_REF2 = 1.0 - SIN_REF2 fo = ro2 - COS_REF2 fe = re2 - COS_REF2 refv = SIN_REF2 xmfv = 0.0 fv = refv + ci * xmfv fs = rs2 - COS_REF2 fo = numpy.sqrt(fo) # complex!! fe = numpy.sqrt(fe) # complex!! fv = numpy.sqrt(fv) # complex!! fs = numpy.sqrt(fs) # complex!! # ! Fresnel formula "S" (in function of incidence angle and critical angle) ffe = (fe-fo)/(fe+fo) ffo = -ffe ffv = (fv-fo)/(fv+fo) ffs = (fe-fs)/(fe+fs) # ! Fresnel formula "P" (in function of incidence angle and critical angle) ffep = (fe/re2-fo/ro2)/(fe/re2+fo/ro2) ffop = -ffep ffvp = (fv-fo/ro2)/(fv+fo/ro2) ffsp = (fe/re2-fs/rs2)/(fe/re2+fs/rs2) if NPAIR == 0: # now there is only substrate and vacuum fe = fv fo = fs # ! Fresnel formula "S" (in function of incidence angle and critical angle) ffe = (fe - fo) / (fe + fo) ffo = -ffe ffv = (fv - fo) / (fv + fo) ffs = (fe - fs) / (fe + fs) # ! Fresnel formula "P" (in function of incidence angle and critical angle) ffep = (fe / re2 - fo / ro2) / (fe / re2 + fo / ro2) ffop = -ffep ffvp = (fv - fo / ro2) / (fv + fo / ro2) ffsp = (fe / re2 - fs / rs2) / (fe / re2 + fs / rs2) # ! another way # ! ro=(1.0D0-delo-ci*beto) # ! re=(1.0D0-dele-ci*bete) # ! rs=(1.0D0-dels-ci*bets) # ! # ! ! # ! cos_ref = sqrt(1.0D0-sin_ref**2) ! in vacuum # ! !!! snell (top to bottom propagation) # ! cos_o = (1.0D0/ro)*cos_ref ! in odd medium # ! cos_e = (ro/re)*cos_o ! in even medium # ! cos_s = (re/rs)*cos_e ! in substrate medium # ! # ! sin_o = mysqrt(1.0d0 - cos_o**2) # ! sin_e = mysqrt(1.0d0 - cos_e**2) # ! sin_s = mysqrt(1.0d0 - cos_s**2) # ! # ! ! even->odd interface # ! ffe = (re*sin_e - ro*sin_o)/ & ! e->o # ! (re*sin_e + ro*sin_o) # ! ffo=-ffe # ! ffv = (sin_ref - ro*sin_o )/ & ! v->o # ! (sin_ref + ro*sin_o ) # ! ! even->substrate interface # ! ffs = (re*sin_e - rs*sin_s )/ & ! e->s # ! (re*sin_e + rs*sin_s) # ! # ! ! p-polarization # ! ffep = (re*sin_o - ro*sin_e)/ & ! e->o # ! (re*sin_o + ro*sin_e) # ! # ! ffop=-ffep # ! ffvp = (sin_o - ro*sin_ref )/& !v->o # ! (sin_o + ro*sin_ref ) # ! # ! ffsp = (re*sin_s - rs*sin_e )/ & ! e->s # ! (re*sin_s + rs*sin_e) r = 0.0 + 0.0j rp = 0.0 + 0.0j prefact = (8.*(numpy.pi**2.)) / (XLAM**2) # !c Nevot-Croce roughness # !c DO NOT include refraction index in the roughness formula sigma_s2 = 0.0 # ! sigma_s**2.0 !roughn. substrate sigma_v2 = 0.0 # ! sigma_v**2.0!roughn. vacuum # ! loop over the bilayers # ! remember that "even" is the bottom sublayer for j in range(NPAIR): # =1,n ! n is the number of bilayers # ! C # ! C compute the thickness for the odd and even material : # ! C ao = -ci * (numpy.pi * fo * t_o[j] * COS_POLE / XLAM) ae = -ci * (numpy.pi * fe * t_e[j] * COS_POLE / XLAM) ao = numpy.exp(ao) ae = numpy.exp(ae) if j != 0: sigma_e2 = mlroughness1[j]**2.0 #!roughn. even layer arg_e = fo * fe * sigma_e2 / (numpy.sqrt(ro2) * numpy.sqrt(re2)) fnevot_e = numpy.exp(-prefact * arg_e) r = (ae**4) * (r + ffe * fnevot_e) / (r * ffe * fnevot_e + 1.0) rp = (ae**4) * (rp + ffep * fnevot_e) / (rp * ffep * fnevot_e + 1.0) else: # ! layer on top of substrate arg_s = fe * fs * sigma_s2 / (numpy.sqrt(re2) * numpy.sqrt(rs2)) fnevot_s = numpy.exp(-prefact * arg_s) r = (ae**4.0) * (r + ffs * fnevot_s) / (r * ffs * fnevot_s + 1.0) rp = (ae**4.0) * (rp + ffsp * fnevot_s) / (rp * ffsp * fnevot_s + 1.0) # ! odd layer (top sublayer) sigma_o2 = mlroughness2[j]**2.0 #!roughn. odd layer arg_o = fo * fe * sigma_o2 / (numpy.sqrt(ro2) * numpy.sqrt(re2)) fnevot_o = numpy.exp(-prefact * arg_o) r = (ao**4.0) * (r + ffo * fnevot_o) / (r * ffo * fnevot_o + 1.0) rp = (ao**4.0) * (rp + ffop * fnevot_o) / (rp * ffop * fnevot_o + 1.0) # ! # ! vacuum interface # ! arg_v = fo * fv * sigma_v2 / numpy.sqrt(ro2) fnevot_v = numpy.exp(-prefact * arg_v) r = (r + ffv * fnevot_v) / (r * ffv * fnevot_v + 1.0) rp = (rp + ffvp * fnevot_v) / (rp * ffvp * fnevot_v + 1.0) # # ! # ! calculate phases # ! PHASES = numpy.arctan2(r.imag,r.real) ans = numpy.abs(r) PHASEP = numpy.arctan2(rp.imag,rp.real) anp = numpy.abs(rp) return ans,anp,PHASES,PHASEP if __name__ == "__main__": from srxraylib.plot.gol import plot a = MLayer.pre_mlayer( interactive=False, FILE="pre_mlayer.dat", E_MIN=100.0, E_MAX=500.0, O_DENSITY=7.19, O_MATERIAL="Cr", #"Water, Liquid", # odd: closer to vacuum E_DENSITY=3.00, E_MATERIAL="Sc", # even: closer to substrate S_DENSITY=2.33, S_MATERIAL="Si", # substrate GRADE_DEPTH=0, N_PAIRS=50, THICKNESS=22.0, GAMMA=10.0/22.0, # gamma ratio = t(even) / (t(odd) + t(even))") ROUGHNESS_EVEN=0.0, ROUGHNESS_ODD=0.0, FILE_DEPTH="myfile_depth.dat", GRADE_SURFACE=0, FILE_SHADOW="mlayer1.sha", FILE_THICKNESS="mythick.dat", FILE_GAMMA="mygamma.dat", AA0=1.0,AA1=0.0,AA2=0.0,AA3=0.0) b = MLayer() b.read_preprocessor_file("pre_mlayer.dat") # # energy scan # rs, rp, e, t = a.scan(h5file="", energyN=100,energy1=300.0,energy2=500.0, thetaN=1,theta1=45.0,theta2=45.0) print(rs.shape,rp.shape,e.shape,t.shape) plot(e,rs[:,0],xtitle="Photon energy [eV]",ytitle="Reflectivity") # # theta scan # rs, rp, e, t = a.scan(h5file="", energyN=1,energy1=400.0,energy2=401.0, thetaN=1000,theta1=40.0,theta2=50.0) print(rs.shape,rp.shape,e.shape,t.shape) plot(t,rs[0],xtitle="angle [deg]",ytitle="Reflectivity",ylog=False) # # single point # a.scan(h5file="", energyN=1,energy1=398.0,thetaN=1,theta1=45.0)
# # Licensed to the Apache Software Foundation (ASF) under one or more # contributor license agreements. See the NOTICE file distributed with # this work for additional information regarding copyright ownership. # The ASF licenses this file to You under the Apache License, Version 2.0 # (the "License"); you may not use this file except in compliance with # the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # from typing import overload, Optional, Dict from py4j.java_gateway import JavaObject, JVMView from pyspark.util import _parse_memory # type: ignore[attr-defined] class ExecutorResourceRequest: """ An Executor resource request. This is used in conjunction with the ResourceProfile to programmatically specify the resources needed for an RDD that will be applied at the stage level. This is used to specify what the resource requirements are for an Executor and how Spark can find out specific details about those resources. Not all the parameters are required for every resource type. Resources like GPUs are supported and have same limitations as using the global spark configs spark.executor.resource.gpu.*. The amount, discoveryScript, and vendor parameters for resources are all the same parameters a user would specify through the configs: spark.executor.resource.{resourceName}.{amount, discoveryScript, vendor}. For instance, a user wants to allocate an Executor with GPU resources on YARN. The user has to specify the resource name (gpu), the amount or number of GPUs per Executor, the discovery script would be specified so that when the Executor starts up it can discovery what GPU addresses are available for it to use because YARN doesn't tell Spark that, then vendor would not be used because its specific for Kubernetes. See the configuration and cluster specific docs for more details. Use :py:class:`pyspark.ExecutorResourceRequests` class as a convenience API. .. versionadded:: 3.1.0 Parameters ---------- resourceName : str Name of the resource amount : str Amount requesting discoveryScript : str, optional Optional script used to discover the resources. This is required on some cluster managers that don't tell Spark the addresses of the resources allocated. The script runs on Executors startup to discover the addresses of the resources available. vendor : str, optional Vendor, required for some cluster managers Notes ----- This API is evolving. """ def __init__( self, resourceName: str, amount: int, discoveryScript: str = "", vendor: str = "", ): self._name = resourceName self._amount = amount self._discovery_script = discoveryScript self._vendor = vendor @property def resourceName(self) -> str: return self._name @property def amount(self) -> int: return self._amount @property def discoveryScript(self) -> str: return self._discovery_script @property def vendor(self) -> str: return self._vendor class ExecutorResourceRequests: """ A set of Executor resource requests. This is used in conjunction with the :class:`pyspark.resource.ResourceProfileBuilder` to programmatically specify the resources needed for an RDD that will be applied at the stage level. .. versionadded:: 3.1.0 Notes ----- This API is evolving. """ _CORES = "cores" _MEMORY = "memory" _OVERHEAD_MEM = "memoryOverhead" _PYSPARK_MEM = "pyspark.memory" _OFFHEAP_MEM = "offHeap" @overload def __init__(self, _jvm: JVMView): ... @overload def __init__( self, _jvm: None = ..., _requests: Optional[Dict[str, ExecutorResourceRequest]] = ..., ): ... def __init__( self, _jvm: Optional[JVMView] = None, _requests: Optional[Dict[str, ExecutorResourceRequest]] = None, ): from pyspark import SparkContext _jvm = _jvm or SparkContext._jvm # type: ignore[attr-defined] if _jvm is not None: self._java_executor_resource_requests = ( _jvm.org.apache.spark.resource.ExecutorResourceRequests() ) if _requests is not None: for k, v in _requests.items(): if k == self._MEMORY: self._java_executor_resource_requests.memory(str(v.amount)) elif k == self._OVERHEAD_MEM: self._java_executor_resource_requests.memoryOverhead(str(v.amount)) elif k == self._PYSPARK_MEM: self._java_executor_resource_requests.pysparkMemory(str(v.amount)) elif k == self._CORES: self._java_executor_resource_requests.cores(v.amount) else: self._java_executor_resource_requests.resource( v.resourceName, v.amount, v.discoveryScript, v.vendor ) else: self._java_executor_resource_requests = None self._executor_resources: Dict[str, ExecutorResourceRequest] = {} def memory(self, amount: str) -> "ExecutorResourceRequests": if self._java_executor_resource_requests is not None: self._java_executor_resource_requests.memory(amount) else: self._executor_resources[self._MEMORY] = ExecutorResourceRequest( self._MEMORY, _parse_memory(amount) ) return self def memoryOverhead(self, amount: str) -> "ExecutorResourceRequests": if self._java_executor_resource_requests is not None: self._java_executor_resource_requests.memoryOverhead(amount) else: self._executor_resources[self._OVERHEAD_MEM] = ExecutorResourceRequest( self._OVERHEAD_MEM, _parse_memory(amount) ) return self def pysparkMemory(self, amount: str) -> "ExecutorResourceRequests": if self._java_executor_resource_requests is not None: self._java_executor_resource_requests.pysparkMemory(amount) else: self._executor_resources[self._PYSPARK_MEM] = ExecutorResourceRequest( self._PYSPARK_MEM, _parse_memory(amount) ) return self def offheapMemory(self, amount: str) -> "ExecutorResourceRequests": if self._java_executor_resource_requests is not None: self._java_executor_resource_requests.offHeapMemory(amount) else: self._executor_resources[self._OFFHEAP_MEM] = ExecutorResourceRequest( self._OFFHEAP_MEM, _parse_memory(amount) ) return self def cores(self, amount: int) -> "ExecutorResourceRequests": if self._java_executor_resource_requests is not None: self._java_executor_resource_requests.cores(amount) else: self._executor_resources[self._CORES] = ExecutorResourceRequest(self._CORES, amount) return self def resource( self, resourceName: str, amount: int, discoveryScript: str = "", vendor: str = "", ) -> "ExecutorResourceRequests": if self._java_executor_resource_requests is not None: self._java_executor_resource_requests.resource( resourceName, amount, discoveryScript, vendor ) else: self._executor_resources[resourceName] = ExecutorResourceRequest( resourceName, amount, discoveryScript, vendor ) return self @property def requests(self) -> Dict[str, ExecutorResourceRequest]: if self._java_executor_resource_requests is not None: result = {} execRes = self._java_executor_resource_requests.requestsJMap() for k, v in execRes.items(): result[k] = ExecutorResourceRequest( v.resourceName(), v.amount(), v.discoveryScript(), v.vendor() ) return result else: return self._executor_resources class TaskResourceRequest: """ A task resource request. This is used in conjunction with the :class:`pyspark.resource.ResourceProfile` to programmatically specify the resources needed for an RDD that will be applied at the stage level. The amount is specified as a Double to allow for saying you want more than 1 task per resource. Valid values are less than or equal to 0.5 or whole numbers. Use :class:`pyspark.resource.TaskResourceRequests` class as a convenience API. Parameters ---------- resourceName : str Name of the resource amount : float Amount requesting as a float to support fractional resource requests. Valid values are less than or equal to 0.5 or whole numbers. .. versionadded:: 3.1.0 Notes ----- This API is evolving. """ def __init__(self, resourceName: str, amount: float): self._name = resourceName self._amount = float(amount) @property def resourceName(self) -> str: return self._name @property def amount(self) -> float: return self._amount class TaskResourceRequests: """ A set of task resource requests. This is used in conjunction with the :class:`pyspark.resource.ResourceProfileBuilder` to programmatically specify the resources needed for an RDD that will be applied at the stage level. .. versionadded:: 3.1.0 Notes ----- This API is evolving. """ _CPUS = "cpus" @overload def __init__(self, _jvm: JVMView): ... @overload def __init__( self, _jvm: None = ..., _requests: Optional[Dict[str, TaskResourceRequest]] = ..., ): ... def __init__( self, _jvm: Optional[JVMView] = None, _requests: Optional[Dict[str, TaskResourceRequest]] = None, ): from pyspark import SparkContext _jvm = _jvm or SparkContext._jvm # type: ignore[attr-defined] if _jvm is not None: self._java_task_resource_requests: Optional[ JavaObject ] = _jvm.org.apache.spark.resource.TaskResourceRequests() if _requests is not None: for k, v in _requests.items(): if k == self._CPUS: self._java_task_resource_requests.cpus(int(v.amount)) else: self._java_task_resource_requests.resource(v.resourceName, v.amount) else: self._java_task_resource_requests = None self._task_resources: Dict[str, TaskResourceRequest] = {} def cpus(self, amount: int) -> "TaskResourceRequests": if self._java_task_resource_requests is not None: self._java_task_resource_requests.cpus(amount) else: self._task_resources[self._CPUS] = TaskResourceRequest(self._CPUS, amount) return self def resource(self, resourceName: str, amount: float) -> "TaskResourceRequests": if self._java_task_resource_requests is not None: self._java_task_resource_requests.resource(resourceName, float(amount)) else: self._task_resources[resourceName] = TaskResourceRequest(resourceName, amount) return self @property def requests(self) -> Dict[str, TaskResourceRequest]: if self._java_task_resource_requests is not None: result = {} taskRes = self._java_task_resource_requests.requestsJMap() for k, v in taskRes.items(): result[k] = TaskResourceRequest(v.resourceName(), v.amount()) return result else: return self._task_resources
""" Cause-effect models. """ # Author: Jose A. R. Fonollosa <jarfo@yahoo.com> # # License: Apache, Version 2.0 from multiprocessing import Pool import numpy as np from sklearn import pipeline from sklearn.base import BaseEstimator from sklearn.ensemble import GradientBoostingClassifier import features as f gbc_params = { 'loss':'deviance', 'learning_rate': 0.1, 'n_estimators': 500, 'subsample': 1.0, 'min_samples_split': 8, 'min_samples_leaf': 1, 'max_depth': 9, 'init': None, 'random_state': 1, 'max_features': None, 'verbose': 0 } selected_features = [ 'Adjusted Mutual Information[A,A type,B,B type]', 'Conditional Distribution Entropy Variance[A,A type,B,B type]', 'Conditional Distribution Entropy Variance[B,B type,A,A type]', 'Conditional Distribution Kurtosis Variance[A,A type,B,B type]', 'Conditional Distribution Kurtosis Variance[B,B type,A,A type]', 'Conditional Distribution Similarity[A,A type,B,B type]', 'Conditional Distribution Similarity[B,B type,A,A type]', 'Conditional Distribution Skewness Variance[A,A type,B,B type]', 'Conditional Distribution Skewness Variance[B,B type,A,A type]', 'Discrete Conditional Entropy[A,A type,B,B type]', 'Discrete Conditional Entropy[B,B type,A,A type]', 'Discrete Entropy[A,A type]', 'Discrete Entropy[B,B type]', 'Discrete Mutual Information[A,A type,B,B type]', 'HSIC[A,A type,B,B type]', 'IGCI[A,A type,B,B type]', 'IGCI[B,B type,A,A type]', 'Kurtosis[A,A type]', 'Kurtosis[B,B type]', 'Log[Number of Samples[A]]', 'Log[Number of Unique Samples[A]]', 'Log[Number of Unique Samples[B]]', 'Moment21[A,A type,B,B type]', 'Moment21[B,B type,A,A type]', 'Moment31[A,A type,B,B type]', 'Moment31[B,B type,A,A type]', 'Normalized Discrete Entropy[A,A type]', 'Normalized Discrete Entropy[B,B type]', 'Normalized Discrete Mutual Information[Discrete Mutual Information[A,A type,B,B type],Discrete Joint Entropy[A,A type,B,B type]]', 'Normalized Discrete Mutual Information[Discrete Mutual Information[A,A type,B,B type],Min[Discrete Entropy[A,A type],Discrete Entropy[B,B type]]]', 'Normalized Entropy[A,A type]', 'Normalized Entropy[B,B type]', 'Normalized Error Probability[A,A type,B,B type]', 'Normalized Error Probability[B,B type,A,A type]', # 'Number of Unique Samples[A]', # 'Number of Unique Samples[B]', 'Pearson R[A,A type,B,B type]', 'Polyfit Error[A,A type,B,B type]', 'Polyfit Error[B,B type,A,A type]', 'Polyfit[A,A type,B,B type]', 'Polyfit[B,B type,A,A type]', 'Skewness[A,A type]', 'Skewness[B,B type]', 'Uniform Divergence[A,A type]', 'Uniform Divergence[B,B type]' ] class Pipeline(pipeline.Pipeline): def predict(self, X): try: p = super(Pipeline, self).predict_proba(X) if p.shape[1] == 2: p = p[:,1] elif p.shape[1] == 3: p = p[:,2] - p[:,0] except AttributeError: p = super(Pipeline, self).predict(X) return p def get_pipeline(features, regressor=None, params=None): steps = [ ("extract_features", f.FeatureMapper(features)), ("regressor", regressor(**params)), ] return Pipeline(steps) class CauseEffectEstimatorOneStep(BaseEstimator): def __init__(self, features=None, regressor=None, params=None, symmetrize=True): self.extractor = f.extract_features self.classifier = get_pipeline(features, regressor, params) self.symmetrize = symmetrize def extract(self, features): return self.extractor(features) def fit(self, X, y=None): self.classifier.fit(X, y) return self def fit_transform(self, X, y=None): return self.classifier.fit_transform(X, y) def transform(self, X): return self.classifier.transform(X) def predict(self, X): predictions = self.classifier.predict(X) if self.symmetrize: predictions[0::2] = (predictions[0::2] - predictions[1::2])/2 predictions[1::2] = -predictions[0::2] return predictions class CauseEffectEstimatorSymmetric(BaseEstimator): def __init__(self, features=None, regressor=None, params=None, symmetrize=True): self.extractor = f.extract_features self.classifier_left = get_pipeline(features, regressor, params) self.classifier_right = get_pipeline(features, regressor, params) self.symmetrize = symmetrize def extract(self, features): return self.extractor(features) def fit(self, X, y=None): target_left = np.array(y) target_left[target_left != 1] = 0 weight_left = np.ones(len(target_left)) weight_left[target_left==0] = sum(target_left==1)/float(sum(target_left==0)) try: self.classifier_left.fit(X, target_left, regressor__sample_weight=weight_left) except TypeError: self.classifier_left.fit(X, target_left) target_right = np.array(y) target_right[target_right != -1] = 0 target_right[target_right == -1] = 1 weight_right = np.ones(len(target_right)) weight_right[target_right==0] = sum(target_right==1)/float(sum(target_right==0)) try: self.classifier_right.fit(X, target_right, regressor__sample_weight=weight_right) except TypeError: self.classifier_right.fit(X, target_right) return self def fit_transform(self, X, y=None): target_left = np.array(y) target_left[target_left != 1] = 0 X_left = self.classifier_left.fit_transform(X, target_left) target_right = np.array(y) target_right[target_right != -1] = 0 target_right[target_right == -1] = 1 X_right = self.classifier_right.fit_transform(X, target_right) return X_left, X_right def transform(self, X): return self.classifier_left.transform(X), self.classifier_right.transform(X) def predict(self, X): predictions_left = self.classifier_left.predict(X) predictions_right = self.classifier_right.predict(X) predictions = predictions_left - predictions_right if self.symmetrize: predictions[0::2] = (predictions[0::2] - predictions[1::2])/2 predictions[1::2] = -predictions[0::2] return predictions class CauseEffectEstimatorID(BaseEstimator): def __init__(self, features_independence=None, features_direction=None, regressor=None, params=None, symmetrize=True): self.extractor = f.extract_features self.classifier_independence = get_pipeline(features_independence, regressor, params) self.classifier_direction = get_pipeline(features_direction, regressor, params) self.symmetrize = symmetrize def extract(self, features): return self.extractor(features) def fit(self, X, y=None): #independence training pairs train_independence = X target_independence = np.array(y) target_independence[target_independence != 0] = 1 weight_independence = np.ones(len(target_independence)) weight_independence[target_independence==0] = sum(target_independence==1)/float(sum(target_independence==0)) try: self.classifier_independence.fit(train_independence, target_independence, regressor__sample_weight=weight_independence) except TypeError: self.classifier_independence.fit(train_independence, target_independence) #direction training pairs direction_filter = y != 0 train_direction = X[direction_filter] target_direction = y[direction_filter] weight_direction = np.ones(len(target_direction)) weight_direction[target_direction==0] = sum(target_direction==1)/float(sum(target_direction==0)) try: self.classifier_direction.fit(train_direction, target_direction, regressor__sample_weight=weight_direction) except TypeError: self.classifier_direction.fit(train_direction, target_direction) return self def fit_transform(self, X, y=None): #independence training pairs train_independence = X target_independence = np.array(y) target_independence[target_independence != 0] = 1 X_ind = self.classifier_independence.fit_transform(train_independence, target_independence) #direction training pairs direction_filter = y != 0 train_direction = X[direction_filter] target_direction = y[direction_filter] self.classifier_direction.fit(train_direction, target_direction) X_dir = self.classifier_direction.transform(X) return X_ind, X_dir def transform(self, X): X_ind = self.classifier_independence.transform(X) X_dir = self.classifier_direction.transform(X) return X_ind, X_dir def predict(self, X): predictions_independence = self.classifier_independence.predict(X) if self.symmetrize: predictions_independence[0::2] = (predictions_independence[0::2] + predictions_independence[1::2])/2 predictions_independence[1::2] = predictions_independence[0::2] assert predictions_independence.min() >= 0 predictions_direction = self.classifier_direction.predict(X) if self.symmetrize: predictions_direction[0::2] = (predictions_direction[0::2] - predictions_direction[1::2])/2 predictions_direction[1::2] = -predictions_direction[0::2] return predictions_independence * predictions_direction def calculate_method(args): obj = args[0] name = args[1] margs = args[2] method = getattr(obj, name) return method(*margs) def pmap(func, mlist, n_jobs): if n_jobs != 1: pool = Pool(n_jobs if n_jobs != -1 else None) mmap = pool.map else: mmap = map return mmap(func, mlist) class CauseEffectSystemCombination(BaseEstimator): def __init__(self, extractor=f.extract_features, weights=None, symmetrize=True, n_jobs=-1): self.extractor = extractor self.features = selected_features self.systems = [ CauseEffectEstimatorID( features_direction=self.features, features_independence=self.features, regressor=GradientBoostingClassifier, params=gbc_params, symmetrize=symmetrize), CauseEffectEstimatorSymmetric( features=self.features, regressor=GradientBoostingClassifier, params=gbc_params, symmetrize=symmetrize), CauseEffectEstimatorOneStep( features=self.features, regressor=GradientBoostingClassifier, params=gbc_params, symmetrize=symmetrize), ] self.weights = weights self.n_jobs = n_jobs def extract(self, features): return self.extractor(features, n_jobs=self.n_jobs) def fit(self, X, y=None): task = [(m, 'fit', (X, y)) for m in self.systems] self.systems = pmap(calculate_method, task, self.n_jobs) return self def fit_transform(self, X, y=None): task = [(m, 'fit_transform', (X, y)) for m in self.systems] return pmap(calculate_method, task, self.n_jobs) def transform(self, X): task = [(m, 'transform', (X,)) for m in self.systems] return pmap(calculate_method, task, self.n_jobs) def predict(self, X): task = [(m, 'predict', (X,)) for m in self.systems] a = np.array(pmap(calculate_method, task, self.n_jobs)) if self.weights is not None: return np.dot(self.weights, a) else: return a
from django.shortcuts import get_object_or_404 from rest_framework import generics, permissions as drf_permissions from rest_framework.exceptions import NotFound, ValidationError, PermissionDenied from api.base.exceptions import Gone from api.base import permissions as base_permissions from api.base.views import JSONAPIBaseView from api.comments.permissions import ( CommentDetailPermissions, CommentReportsPermissions, ) from api.comments.serializers import ( CommentSerializer, NodeCommentDetailSerializer, RegistrationCommentDetailSerializer, CommentReportSerializer, CommentReportDetailSerializer, CommentReport, ) from framework.auth.core import Auth from framework.auth.oauth_scopes import CoreScopes from framework.exceptions import PermissionsError from osf.models import AbstractNode, Comment, BaseFileNode from addons.wiki.models import WikiPage class CommentMixin(object): """Mixin with convenience methods for retrieving the current comment based on the current URL. By default, fetches the comment based on the comment_id kwarg. """ serializer_class = CommentSerializer comment_lookup_url_kwarg = 'comment_id' def get_comment(self, check_permissions=True): pk = self.kwargs[self.comment_lookup_url_kwarg] comment = get_object_or_404(Comment, guids___id=pk, root_target__isnull=False, guids___id__isnull=False) if comment.root_target is None: raise NotFound if check_permissions: # May raise a permission denied self.check_object_permissions(self.request, comment) return comment class CommentDetail(JSONAPIBaseView, generics.RetrieveUpdateDestroyAPIView, CommentMixin): """The documentation for this endpoint can be found [here](https://developer.osf.io/#operation/comments_read). """ permission_classes = ( drf_permissions.IsAuthenticatedOrReadOnly, CommentDetailPermissions, base_permissions.TokenHasScope, ) required_read_scopes = [CoreScopes.NODE_COMMENTS_READ] required_write_scopes = [CoreScopes.NODE_COMMENTS_WRITE] serializer_class = NodeCommentDetailSerializer view_category = 'comments' view_name = 'comment-detail' # overrides RetrieveAPIView def get_object(self): comment = self.get_comment() comment_node = None if isinstance(comment.target.referent, AbstractNode): comment_node = comment.target.referent elif isinstance(comment.target.referent, BaseFileNode): comment_node = comment.target.referent.target elif isinstance(comment.target.referent, WikiPage): comment_node = comment.target.referent.node if comment_node and comment_node.is_registration: self.serializer_class = RegistrationCommentDetailSerializer return comment def perform_destroy(self, instance): auth = Auth(self.request.user) if instance.is_deleted: raise ValidationError('Comment already deleted.') else: try: instance.delete(auth, save=True) except PermissionsError: raise PermissionDenied('Not authorized to delete this comment.') class CommentReportsList(JSONAPIBaseView, generics.ListCreateAPIView, CommentMixin): """List of reports made for a comment. *Writeable*. Paginated list of reports for a comment. Each resource contains the full representation of the report, meaning additional requests to an individual comment's report detail view are not necessary. ###Permissions The comment reports endpoint can only be viewed by users with permission to comment on the node. Users are only shown comment reports that they have made. ##Attributes OSF comment report entities have the "comment_reports" `type`. name type description ===================================================================================== category string the type of spam, must be one of the allowed values message string description of why the comment was reported ##Links See the [JSON-API spec regarding pagination](http://jsonapi.org/format/1.0/#fetching-pagination). ##Actions ###Create Method: POST URL: /links/self Query Params: <none> Body (JSON): { "data": { "type": "comment_reports", # required "attributes": { "category": {category}, # mandatory "message": {text}, # optional } } } Success: 201 CREATED + comment report representation To create a report for this comment, issue a POST request against this endpoint. The `category` field is mandatory, and must be one of the following: "spam", "hate" or "violence" . The `message` field is optional. If the comment report creation is successful the API will return a 201 response with the representation of the new comment report in the body. For the new comment report's canonical URL, see the `/links/self` field of the response. ##Query Params *None*. #This Request/Response """ permission_classes = ( drf_permissions.IsAuthenticated, CommentReportsPermissions, base_permissions.TokenHasScope, ) required_read_scopes = [CoreScopes.COMMENT_REPORTS_READ] required_write_scopes = [CoreScopes.COMMENT_REPORTS_WRITE] serializer_class = CommentReportSerializer view_category = 'comments' view_name = 'comment-reports' ordering = ('-modified',) def get_queryset(self): user_id = self.request.user._id comment = self.get_comment() reports = comment.reports serialized_reports = [] if user_id in reports: report = CommentReport(user_id, reports[user_id]['category'], reports[user_id]['text']) serialized_reports.append(report) return serialized_reports class CommentReportDetail(JSONAPIBaseView, generics.RetrieveUpdateDestroyAPIView, CommentMixin): """Details about a specific comment report. *Writeable*. ###Permissions A comment report detail can only be viewed, edited and removed by the user who created the report. ##Attributes OSF comment report entities have the "comment_reports" `type`. name type description ===================================================================================== category string the type of spam, must be one of the allowed values message string description of why the comment was reported ##Links self: the canonical api endpoint of this comment report ##Actions ###Update Method: PUT / PATCH URL: /links/self Query Params: <none> Body (JSON): { "data": { "type": "comment_reports", # required "id": {user_id}, # required "attributes": { "category": {category}, # mandatory "message": {text}, # optional } } } Success: 200 OK + comment report representation To update a report for this comment, issue a PUT/PATCH request against this endpoint. The `category` field is mandatory for a PUT request and must be one of the following: "spam", "hate" or "violence". The `message` field is optional. Non-string values will be accepted and stringified, but we make no promises about the stringification output. So don't do that. ###Delete Method: DELETE URL: /links/self Query Params: <none> Success: 204 + No content To delete a comment report, issue a DELETE request against `/links/self`. A successful delete will return a 204 No Content response. ##Query Params *None*. #This Request/Response """ permission_classes = ( drf_permissions.IsAuthenticated, CommentReportsPermissions, base_permissions.TokenHasScope, ) required_read_scopes = [CoreScopes.COMMENT_REPORTS_READ] required_write_scopes = [CoreScopes.COMMENT_REPORTS_WRITE] serializer_class = CommentReportDetailSerializer view_category = 'comments' view_name = 'report-detail' # overrides RetrieveUpdateDestroyAPIView def get_object(self): comment = self.get_comment() reports = comment.reports user_id = self.request.user._id reporter_id = self.kwargs['user_id'] if reporter_id != user_id: raise PermissionDenied('Not authorized to comment on this project.') if reporter_id in reports: return CommentReport(user_id, reports[user_id]['category'], reports[user_id]['text']) else: raise Gone(detail='The requested comment report is no longer available.') # overrides RetrieveUpdateDestroyAPIView def perform_destroy(self, instance): user = self.request.user comment = self.get_comment() try: comment.retract_report(user, save=True) except ValueError as error: raise ValidationError(str(error))
from conans.model.options import Options, PackageOptions, OptionsValues from conans.model.requires import Requirements from conans.model.build_info import DepsCppInfo from conans import tools # @UnusedImport KEEP THIS! Needed for pyinstaller to copy to exe. from conans.errors import ConanException from conans.model.env_info import DepsEnvInfo import os def create_options(conanfile): try: package_options = PackageOptions(getattr(conanfile, "options", None)) options = Options(package_options) default_options = getattr(conanfile, "default_options", None) if default_options: if isinstance(default_options, tuple): default_values = OptionsValues.loads("\n".join(default_options)) elif isinstance(default_options, list): default_values = OptionsValues.from_list(default_options) elif isinstance(default_options, str): default_values = OptionsValues.loads(default_options) else: raise ConanException("Please define your default_options as list or " "multiline string") options.values = default_values return options except Exception as e: raise ConanException("Error while initializing options. %s" % str(e)) def create_requirements(conanfile): try: # Actual requirements of this package if not hasattr(conanfile, "requires"): return Requirements() else: if not conanfile.requires: return Requirements() if isinstance(conanfile.requires, tuple): return Requirements(*conanfile.requires) else: return Requirements(conanfile.requires, ) except Exception as e: raise ConanException("Error while initializing requirements. %s" % str(e)) def create_settings(conanfile, settings): try: defined_settings = getattr(conanfile, "settings", None) if isinstance(defined_settings, str): defined_settings = [defined_settings] current = defined_settings or {} settings.constraint(current) return settings except Exception as e: raise ConanException("Error while initializing settings. %s" % str(e)) def create_exports(conanfile): if not hasattr(conanfile, "exports"): return None else: if isinstance(conanfile.exports, str): return (conanfile.exports, ) return conanfile.exports class ConanFile(object): """ The base class for all conans """ name = None version = None # Any str, can be "1.1" or whatever url = None # The URL where this File is located, as github, to collaborate in package # The license of the PACKAGE, just a shortcut, does not replace or # change the actual license of the source code license = None author = None # Main maintainer/responsible for the package, any format build_policy = None short_paths = False def __init__(self, output, runner, settings, conanfile_directory, user=None, channel=None): ''' param settings: Settings ''' # User defined generators self.generators = self.generators if hasattr(self, "generators") else ["txt"] if isinstance(self.generators, str): self.generators = [self.generators] # User defined options self.options = create_options(self) self.requires = create_requirements(self) self.settings = create_settings(self, settings) self.exports = create_exports(self) # needed variables to pack the project self.cpp_info = None # Will be initialized at processing time self.deps_cpp_info = DepsCppInfo() # environment variables declared in the package_info self.env_info = None # Will be initialized at processing time self.deps_env_info = DepsEnvInfo() self.copy = None # initialized at runtime # an output stream (writeln, info, warn error) self.output = output # something that can run commands, as os.sytem self._runner = runner self._conanfile_directory = conanfile_directory self.package_folder = None # Assigned at runtime self._scope = None # user specified env variables self.env = None # Assigned at runtime self._user = user self._channel = channel @property def channel(self): if not self._channel: self._channel = os.getenv("CONAN_CHANNEL") if not self._channel: raise ConanException("CONAN_CHANNEL environment variable not defined, " "but self.channel is used in conanfile") return self._channel @property def user(self): if not self._user: self._user = os.getenv("CONAN_USERNAME") if not self._user: raise ConanException("CONAN_USERNAME environment variable not defined, " "but self.user is used in conanfile") return self._user def collect_libs(self, folder="lib"): if not self.package_folder: return [] lib_folder = os.path.join(self.package_folder, folder) if not os.path.exists(lib_folder): self.output.warn("Package folder doesn't exist, can't collect libraries") return [] files = os.listdir(lib_folder) result = [] for f in files: name, ext = os.path.splitext(f) if ext in (".so", ".lib", ".a", ".dylib"): if ext != ".lib" and name.startswith("lib"): name = name[3:] result.append(name) return result @property def scope(self): return self._scope @scope.setter def scope(self, value): self._scope = value if value.dev: self.requires.allow_dev = True try: if hasattr(self, "dev_requires"): if isinstance(self.dev_requires, tuple): self.requires.add_dev(*self.dev_requires) else: self.requires.add_dev(self.dev_requires, ) except Exception as e: raise ConanException("Error while initializing dev_requirements. %s" % str(e)) @property def conanfile_directory(self): return self._conanfile_directory @property def build_policy_missing(self): return self.build_policy == "missing" @property def build_policy_always(self): return self.build_policy == "always" def source(self): pass def requirements(self): pass def system_requirements(self): """ this method can be overwritten to implement logic for system package managers, as apt-get You can define self.global_system_requirements = True, if you want the installation to be for all packages (not depending on settings/options/requirements) """ def config_options(self): """ modify options, probably conditioned to some settings. This call is executed before config_settings. E.g. if self.settings.os == "Windows": del self.options.shared # shared/static not supported in win """ def configure(self): """ modify settings, probably conditioned to some options. This call is executed after config_options. E.g. if self.options.header_only: self.settings.clear() This is also the place for conditional requirements """ def imports(self): pass def build(self): self.output.warn("This conanfile has no build step") def package(self): self.output.warn("This conanfile has no package step") def package_info(self): """ define cpp_build_info, flags, etc """ def run(self, command, output=True, cwd=None): """ runs such a command in the folder the Conan is defined """ retcode = self._runner(command, output, cwd) if retcode != 0: raise ConanException("Error %d while executing %s" % (retcode, command)) def conan_info(self): """ modify the conans info, typically to narrow values eg.: conaninfo.package_references = [] """ def test(self): raise ConanException("You need to create a method 'test' in your test/conanfile.py") def __repr__(self): result = [] result.append("name: %s" % self.name) result.append("version: %s" % self.version) return '\n'.join(result)
#!/usr/bin/env python from bs4 import BeautifulSoup import glob import json ############################################# # Convert Hearthstone card data XML to JSON # ############################################# __author__ = "Taylor Caldwell - http://github.com/rithms" __copyright__ = "Copyright 2015, Taylor Caldwell" __license__ = "MIT" __version__ = "1.0.0" __maintainer__ = "Taylor Caldwell" __email__ = "tcaldwel@nmsu.edu" __status__ = "Production" # EnumIds - Non-Boolean enum_dict = { 45 : "health", 47 : "attack", 48 : "cost", 183 : "cardSet", 184 : "cardTextInHand", 185 : "cardName", 187 : "durability", 199 : "class", 200 : "race", 201 : "faction", 202 : "cardType", 203 : "rarity", 251 : "attackVisualType", 252 : "cardTextInPlay", 268 : "devState", 325 : "targetingArrowText", 330 : "enchantmentBirthVisual", 331 : "enchantmentIdleVisual", 342 : "artistName", 351 : "flavorText", 365 : "howToGetThisGoldCard", 364 : "howToGetThisCard", #377 : "unknownHasOnDrawEffect", #380 : "unknownBlackrockHeroes", #389 : "unknownDuneMaulShaman", #402 : "unknownIntenseGaze", #401 : "unknownBroodAffliction" } # EnumIds - Boolean bool_dict = { 32 : "Trigger Visual", 114 : "elite", 321 : "collectible", 189 : "Windfury", 190 : "Taunt", 191 : "Stealth", 192 : "Spell Power", 194 : "Divine Shield", 197 : "Charge", 205 : "Summoned", 208 : "Freeze", 212 : "Enrage", 215 : "Overload", 217 : "Deathrattle", 218 : "Battlecry", 219 : "Secret", 220 : "Combo", 240 : "Can't Be Damaged", 293 : "Morph", 335 : "Invisible Deathrattle", 338 : "One Turn Effect", 339 : "Silence", 340 : "Counter", 349 : "Immune To Spell Power", 350 : "Adjacent Buff", 361 : "Heal Target", 362 : "Aura", 363 : "Poisonous", 367 : "AI Must Play", 370 : "Affected By Spell Power", 388 : "Spare Part", } # Card Class IDs class_dict = { 0 : "Developer", 2 : "Druid", 3 : "Hunter", 4 : "Mage", 5 : "Paladin", 6 : "Priest", 7 : "Rogue", 8 : "Shaman", 9 : "Warlock", 10 : "Warrior", 11 : "Dream" } # Card Set IDs set_dict = { 2 : "Basic", 3 : "Classic", 4 : "Reward", 5 : "Missions", 7 : "System", 8 : "Debug", 11 : "Promotion", 12 : "Curse of Naxxramas", 13 : "Goblin vs Gnomes", 14 : "Blackrock Mountain", 16 : "Credits" } # Card Type IDs type_dict = { 3 : "Hero", 4 : "Minion", 5 : "Spell", 6 : "Enchantment", 7 : "Weapon", 10 : "Hero Power" } # Card Race IDs race_dict = { 14 : "Murloc", 15 : "Demon", 17 : "Mechanical", 20 : "Beast", 21 : "Totem", 23 : "Pirate", 24 : "Dragon" } # Card Faction IDs faction_dict = { 1 : "Horde", 2 : "Alliance", 3 : "Neutral" } # Card Rarity IDs rarity_dict = { 0 : "Developer", 1 : "Common", 2 : "Free", 3 : "Rare", 4 : "Epic", 5 : "Legendary" } # Get the name of the corresponding enum ID def get_name(enum_id, d): if enum_id in d: return d[enum_id] for f in glob.glob('cardxml0/CAB-cardxml0/TextAsset/*.txt'): with open(f) as cardfile: file_name = f.split('/')[-1].split('.')[0] cardsoup = BeautifulSoup(cardfile.read(), features="xml") cards = cardsoup.find_all('Entity') json_dict = { 'data' : {} } for card in cards: card_id = card.get('CardID') json_dict['data'][card_id] = { 'id' : card_id, 'mechanics' : [] } tags = card.find_all('Tag') for tag in tags: enum_id = int(tag.get('enumID')) if(tag.get('type') == 'String'): enum_name = tag.text else: enum_name = tag.get('value') if enum_id in enum_dict: field = enum_dict[enum_id] if field == 'class': enum_name = get_name(int(enum_name), class_dict) elif field == 'cardSet': enum_name = enum_name = get_name(int(enum_name), set_dict) elif field == 'cardType': enum_name = get_name(int(enum_name), type_dict) elif field == 'race': enum_name = get_name(int(enum_name), race_dict) elif field == 'faction': enum_name = get_name(int(enum_name), faction_dict) elif field == 'rarity': enum_name = get_name(int(enum_name), rarity_dict) json_dict['data'][card_id][enum_dict[enum_id]] = enum_name elif enum_id in bool_dict: field = bool_dict[enum_id] if field == 'collectible' or field == 'elite': if enum_name == '1': json_dict['data'][card_id][field] = True elif enum_name == '0': json_dict['data'][card_id][field] = False else: if enum_name == '1': json_dict['data'][card_id]['mechanics'].append(field) for key in bool_dict: field = bool_dict[key] if field == 'collectible' or field == 'elite': if field not in json_dict['data'][card_id]: json_dict['data'][card_id][field] = False if not json_dict['data'][card_id]['mechanics']: del json_dict['data'][card_id]['mechanics'] with open(file_name+'.json', 'w') as outfile: json.dump(json_dict, outfile, sort_keys=True)
# -*- coding: utf-8 -*- # Copyright 2022 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # from google.auth.transport.requests import AuthorizedSession # type: ignore import json # type: ignore import grpc # type: ignore from google.auth.transport.grpc import SslCredentials # type: ignore from google.auth import credentials as ga_credentials # type: ignore from google.api_core import exceptions as core_exceptions from google.api_core import retry as retries from google.api_core import rest_helpers from google.api_core import rest_streaming from google.api_core import path_template from google.api_core import gapic_v1 from requests import __version__ as requests_version import dataclasses import re from typing import Callable, Dict, List, Optional, Sequence, Tuple, Union import warnings try: OptionalRetry = Union[retries.Retry, gapic_v1.method._MethodDefault] except AttributeError: # pragma: NO COVER OptionalRetry = Union[retries.Retry, object] # type: ignore from google.cloud.compute_v1.types import compute from .base import ( RegionCommitmentsTransport, DEFAULT_CLIENT_INFO as BASE_DEFAULT_CLIENT_INFO, ) DEFAULT_CLIENT_INFO = gapic_v1.client_info.ClientInfo( gapic_version=BASE_DEFAULT_CLIENT_INFO.gapic_version, grpc_version=None, rest_version=requests_version, ) class RegionCommitmentsRestInterceptor: """Interceptor for RegionCommitments. Interceptors are used to manipulate requests, request metadata, and responses in arbitrary ways. Example use cases include: * Logging * Verifying requests according to service or custom semantics * Stripping extraneous information from responses These use cases and more can be enabled by injecting an instance of a custom subclass when constructing the RegionCommitmentsRestTransport. .. code-block:: python class MyCustomRegionCommitmentsInterceptor(RegionCommitmentsRestInterceptor): def pre_aggregated_list(request, metadata): logging.log(f"Received request: {request}") return request, metadata def post_aggregated_list(response): logging.log(f"Received response: {response}") def pre_get(request, metadata): logging.log(f"Received request: {request}") return request, metadata def post_get(response): logging.log(f"Received response: {response}") def pre_insert(request, metadata): logging.log(f"Received request: {request}") return request, metadata def post_insert(response): logging.log(f"Received response: {response}") def pre_list(request, metadata): logging.log(f"Received request: {request}") return request, metadata def post_list(response): logging.log(f"Received response: {response}") def pre_update(request, metadata): logging.log(f"Received request: {request}") return request, metadata def post_update(response): logging.log(f"Received response: {response}") transport = RegionCommitmentsRestTransport(interceptor=MyCustomRegionCommitmentsInterceptor()) client = RegionCommitmentsClient(transport=transport) """ def pre_aggregated_list( self, request: compute.AggregatedListRegionCommitmentsRequest, metadata: Sequence[Tuple[str, str]], ) -> Tuple[ compute.AggregatedListRegionCommitmentsRequest, Sequence[Tuple[str, str]] ]: """Pre-rpc interceptor for aggregated_list Override in a subclass to manipulate the request or metadata before they are sent to the RegionCommitments server. """ return request, metadata def post_aggregated_list( self, response: compute.CommitmentAggregatedList ) -> compute.CommitmentAggregatedList: """Post-rpc interceptor for aggregated_list Override in a subclass to manipulate the response after it is returned by the RegionCommitments server but before it is returned to user code. """ return response def pre_get( self, request: compute.GetRegionCommitmentRequest, metadata: Sequence[Tuple[str, str]], ) -> Tuple[compute.GetRegionCommitmentRequest, Sequence[Tuple[str, str]]]: """Pre-rpc interceptor for get Override in a subclass to manipulate the request or metadata before they are sent to the RegionCommitments server. """ return request, metadata def post_get(self, response: compute.Commitment) -> compute.Commitment: """Post-rpc interceptor for get Override in a subclass to manipulate the response after it is returned by the RegionCommitments server but before it is returned to user code. """ return response def pre_insert( self, request: compute.InsertRegionCommitmentRequest, metadata: Sequence[Tuple[str, str]], ) -> Tuple[compute.InsertRegionCommitmentRequest, Sequence[Tuple[str, str]]]: """Pre-rpc interceptor for insert Override in a subclass to manipulate the request or metadata before they are sent to the RegionCommitments server. """ return request, metadata def post_insert(self, response: compute.Operation) -> compute.Operation: """Post-rpc interceptor for insert Override in a subclass to manipulate the response after it is returned by the RegionCommitments server but before it is returned to user code. """ return response def pre_list( self, request: compute.ListRegionCommitmentsRequest, metadata: Sequence[Tuple[str, str]], ) -> Tuple[compute.ListRegionCommitmentsRequest, Sequence[Tuple[str, str]]]: """Pre-rpc interceptor for list Override in a subclass to manipulate the request or metadata before they are sent to the RegionCommitments server. """ return request, metadata def post_list(self, response: compute.CommitmentList) -> compute.CommitmentList: """Post-rpc interceptor for list Override in a subclass to manipulate the response after it is returned by the RegionCommitments server but before it is returned to user code. """ return response def pre_update( self, request: compute.UpdateRegionCommitmentRequest, metadata: Sequence[Tuple[str, str]], ) -> Tuple[compute.UpdateRegionCommitmentRequest, Sequence[Tuple[str, str]]]: """Pre-rpc interceptor for update Override in a subclass to manipulate the request or metadata before they are sent to the RegionCommitments server. """ return request, metadata def post_update(self, response: compute.Operation) -> compute.Operation: """Post-rpc interceptor for update Override in a subclass to manipulate the response after it is returned by the RegionCommitments server but before it is returned to user code. """ return response @dataclasses.dataclass class RegionCommitmentsRestStub: _session: AuthorizedSession _host: str _interceptor: RegionCommitmentsRestInterceptor class RegionCommitmentsRestTransport(RegionCommitmentsTransport): """REST backend transport for RegionCommitments. The RegionCommitments API. This class defines the same methods as the primary client, so the primary client can load the underlying transport implementation and call it. It sends JSON representations of protocol buffers over HTTP/1.1 """ _STUBS: Dict[str, RegionCommitmentsRestStub] = {} def __init__( self, *, host: str = "compute.googleapis.com", credentials: ga_credentials.Credentials = None, credentials_file: str = None, scopes: Sequence[str] = None, client_cert_source_for_mtls: Callable[[], Tuple[bytes, bytes]] = None, quota_project_id: Optional[str] = None, client_info: gapic_v1.client_info.ClientInfo = DEFAULT_CLIENT_INFO, always_use_jwt_access: Optional[bool] = False, url_scheme: str = "https", interceptor: Optional[RegionCommitmentsRestInterceptor] = None, ) -> None: """Instantiate the transport. Args: host (Optional[str]): The hostname to connect to. credentials (Optional[google.auth.credentials.Credentials]): The authorization credentials to attach to requests. These credentials identify the application to the service; if none are specified, the client will attempt to ascertain the credentials from the environment. credentials_file (Optional[str]): A file with credentials that can be loaded with :func:`google.auth.load_credentials_from_file`. This argument is ignored if ``channel`` is provided. scopes (Optional(Sequence[str])): A list of scopes. This argument is ignored if ``channel`` is provided. client_cert_source_for_mtls (Callable[[], Tuple[bytes, bytes]]): Client certificate to configure mutual TLS HTTP channel. It is ignored if ``channel`` is provided. quota_project_id (Optional[str]): An optional project to use for billing and quota. client_info (google.api_core.gapic_v1.client_info.ClientInfo): The client info used to send a user-agent string along with API requests. If ``None``, then default info will be used. Generally, you only need to set this if you are developing your own client library. always_use_jwt_access (Optional[bool]): Whether self signed JWT should be used for service account credentials. url_scheme: the protocol scheme for the API endpoint. Normally "https", but for testing or local servers, "http" can be specified. """ # Run the base constructor # TODO(yon-mg): resolve other ctor params i.e. scopes, quota, etc. # TODO: When custom host (api_endpoint) is set, `scopes` must *also* be set on the # credentials object maybe_url_match = re.match("^(?P<scheme>http(?:s)?://)?(?P<host>.*)$", host) if maybe_url_match is None: raise ValueError( f"Unexpected hostname structure: {host}" ) # pragma: NO COVER url_match_items = maybe_url_match.groupdict() host = f"{url_scheme}://{host}" if not url_match_items["scheme"] else host super().__init__( host=host, credentials=credentials, client_info=client_info, always_use_jwt_access=always_use_jwt_access, ) self._session = AuthorizedSession( self._credentials, default_host=self.DEFAULT_HOST ) if client_cert_source_for_mtls: self._session.configure_mtls_channel(client_cert_source_for_mtls) self._interceptor = interceptor or RegionCommitmentsRestInterceptor() self._prep_wrapped_messages(client_info) class _AggregatedList(RegionCommitmentsRestStub): def __hash__(self): return hash("AggregatedList") __REQUIRED_FIELDS_DEFAULT_VALUES: Dict[str, str] = {} @classmethod def _get_unset_required_fields(cls, message_dict): return { k: v for k, v in cls.__REQUIRED_FIELDS_DEFAULT_VALUES.items() if k not in message_dict } def __call__( self, request: compute.AggregatedListRegionCommitmentsRequest, *, retry: OptionalRetry = gapic_v1.method.DEFAULT, timeout: float = None, metadata: Sequence[Tuple[str, str]] = (), ) -> compute.CommitmentAggregatedList: r"""Call the aggregated list method over HTTP. Args: request (~.compute.AggregatedListRegionCommitmentsRequest): The request object. A request message for RegionCommitments.AggregatedList. See the method description for details. retry (google.api_core.retry.Retry): Designation of what errors, if any, should be retried. timeout (float): The timeout for this request. metadata (Sequence[Tuple[str, str]]): Strings which should be sent along with the request as metadata. Returns: ~.compute.CommitmentAggregatedList: """ http_options: List[Dict[str, str]] = [ { "method": "get", "uri": "/compute/v1/projects/{project}/aggregated/commitments", }, ] request, metadata = self._interceptor.pre_aggregated_list(request, metadata) request_kwargs = compute.AggregatedListRegionCommitmentsRequest.to_dict( request ) transcoded_request = path_template.transcode(http_options, **request_kwargs) uri = transcoded_request["uri"] method = transcoded_request["method"] # Jsonify the query params query_params = json.loads( compute.AggregatedListRegionCommitmentsRequest.to_json( compute.AggregatedListRegionCommitmentsRequest( transcoded_request["query_params"] ), including_default_value_fields=False, use_integers_for_enums=False, ) ) query_params.update(self._get_unset_required_fields(query_params)) # Send the request headers = dict(metadata) headers["Content-Type"] = "application/json" response = getattr(self._session, method)( "{host}{uri}".format(host=self._host, uri=uri), timeout=timeout, headers=headers, params=rest_helpers.flatten_query_params(query_params), ) # In case of error, raise the appropriate core_exceptions.GoogleAPICallError exception # subclass. if response.status_code >= 400: raise core_exceptions.from_http_response(response) # Return the response resp = compute.CommitmentAggregatedList.from_json( response.content, ignore_unknown_fields=True ) resp = self._interceptor.post_aggregated_list(resp) return resp class _Get(RegionCommitmentsRestStub): def __hash__(self): return hash("Get") __REQUIRED_FIELDS_DEFAULT_VALUES: Dict[str, str] = {} @classmethod def _get_unset_required_fields(cls, message_dict): return { k: v for k, v in cls.__REQUIRED_FIELDS_DEFAULT_VALUES.items() if k not in message_dict } def __call__( self, request: compute.GetRegionCommitmentRequest, *, retry: OptionalRetry = gapic_v1.method.DEFAULT, timeout: float = None, metadata: Sequence[Tuple[str, str]] = (), ) -> compute.Commitment: r"""Call the get method over HTTP. Args: request (~.compute.GetRegionCommitmentRequest): The request object. A request message for RegionCommitments.Get. See the method description for details. retry (google.api_core.retry.Retry): Designation of what errors, if any, should be retried. timeout (float): The timeout for this request. metadata (Sequence[Tuple[str, str]]): Strings which should be sent along with the request as metadata. Returns: ~.compute.Commitment: Represents a regional Commitment resource. Creating a commitment resource means that you are purchasing a committed use contract with an explicit start and end time. You can create commitments based on vCPUs and memory usage and receive discounted rates. For full details, read Signing Up for Committed Use Discounts. """ http_options: List[Dict[str, str]] = [ { "method": "get", "uri": "/compute/v1/projects/{project}/regions/{region}/commitments/{commitment}", }, ] request, metadata = self._interceptor.pre_get(request, metadata) request_kwargs = compute.GetRegionCommitmentRequest.to_dict(request) transcoded_request = path_template.transcode(http_options, **request_kwargs) uri = transcoded_request["uri"] method = transcoded_request["method"] # Jsonify the query params query_params = json.loads( compute.GetRegionCommitmentRequest.to_json( compute.GetRegionCommitmentRequest( transcoded_request["query_params"] ), including_default_value_fields=False, use_integers_for_enums=False, ) ) query_params.update(self._get_unset_required_fields(query_params)) # Send the request headers = dict(metadata) headers["Content-Type"] = "application/json" response = getattr(self._session, method)( "{host}{uri}".format(host=self._host, uri=uri), timeout=timeout, headers=headers, params=rest_helpers.flatten_query_params(query_params), ) # In case of error, raise the appropriate core_exceptions.GoogleAPICallError exception # subclass. if response.status_code >= 400: raise core_exceptions.from_http_response(response) # Return the response resp = compute.Commitment.from_json( response.content, ignore_unknown_fields=True ) resp = self._interceptor.post_get(resp) return resp class _Insert(RegionCommitmentsRestStub): def __hash__(self): return hash("Insert") __REQUIRED_FIELDS_DEFAULT_VALUES: Dict[str, str] = {} @classmethod def _get_unset_required_fields(cls, message_dict): return { k: v for k, v in cls.__REQUIRED_FIELDS_DEFAULT_VALUES.items() if k not in message_dict } def __call__( self, request: compute.InsertRegionCommitmentRequest, *, retry: OptionalRetry = gapic_v1.method.DEFAULT, timeout: float = None, metadata: Sequence[Tuple[str, str]] = (), ) -> compute.Operation: r"""Call the insert method over HTTP. Args: request (~.compute.InsertRegionCommitmentRequest): The request object. A request message for RegionCommitments.Insert. See the method description for details. retry (google.api_core.retry.Retry): Designation of what errors, if any, should be retried. timeout (float): The timeout for this request. metadata (Sequence[Tuple[str, str]]): Strings which should be sent along with the request as metadata. Returns: ~.compute.Operation: Represents an Operation resource. Google Compute Engine has three Operation resources: \* `Global </compute/docs/reference/rest/v1/globalOperations>`__ \* `Regional </compute/docs/reference/rest/v1/regionOperations>`__ \* `Zonal </compute/docs/reference/rest/v1/zoneOperations>`__ You can use an operation resource to manage asynchronous API requests. For more information, read Handling API responses. Operations can be global, regional or zonal. - For global operations, use the ``globalOperations`` resource. - For regional operations, use the ``regionOperations`` resource. - For zonal operations, use the ``zonalOperations`` resource. For more information, read Global, Regional, and Zonal Resources. """ http_options: List[Dict[str, str]] = [ { "method": "post", "uri": "/compute/v1/projects/{project}/regions/{region}/commitments", "body": "commitment_resource", }, ] request, metadata = self._interceptor.pre_insert(request, metadata) request_kwargs = compute.InsertRegionCommitmentRequest.to_dict(request) transcoded_request = path_template.transcode(http_options, **request_kwargs) # Jsonify the request body body = compute.Commitment.to_json( compute.Commitment(transcoded_request["body"]), including_default_value_fields=False, use_integers_for_enums=False, ) uri = transcoded_request["uri"] method = transcoded_request["method"] # Jsonify the query params query_params = json.loads( compute.InsertRegionCommitmentRequest.to_json( compute.InsertRegionCommitmentRequest( transcoded_request["query_params"] ), including_default_value_fields=False, use_integers_for_enums=False, ) ) query_params.update(self._get_unset_required_fields(query_params)) # Send the request headers = dict(metadata) headers["Content-Type"] = "application/json" response = getattr(self._session, method)( "{host}{uri}".format(host=self._host, uri=uri), timeout=timeout, headers=headers, params=rest_helpers.flatten_query_params(query_params), data=body, ) # In case of error, raise the appropriate core_exceptions.GoogleAPICallError exception # subclass. if response.status_code >= 400: raise core_exceptions.from_http_response(response) # Return the response resp = compute.Operation.from_json( response.content, ignore_unknown_fields=True ) resp = self._interceptor.post_insert(resp) return resp class _List(RegionCommitmentsRestStub): def __hash__(self): return hash("List") __REQUIRED_FIELDS_DEFAULT_VALUES: Dict[str, str] = {} @classmethod def _get_unset_required_fields(cls, message_dict): return { k: v for k, v in cls.__REQUIRED_FIELDS_DEFAULT_VALUES.items() if k not in message_dict } def __call__( self, request: compute.ListRegionCommitmentsRequest, *, retry: OptionalRetry = gapic_v1.method.DEFAULT, timeout: float = None, metadata: Sequence[Tuple[str, str]] = (), ) -> compute.CommitmentList: r"""Call the list method over HTTP. Args: request (~.compute.ListRegionCommitmentsRequest): The request object. A request message for RegionCommitments.List. See the method description for details. retry (google.api_core.retry.Retry): Designation of what errors, if any, should be retried. timeout (float): The timeout for this request. metadata (Sequence[Tuple[str, str]]): Strings which should be sent along with the request as metadata. Returns: ~.compute.CommitmentList: Contains a list of Commitment resources. """ http_options: List[Dict[str, str]] = [ { "method": "get", "uri": "/compute/v1/projects/{project}/regions/{region}/commitments", }, ] request, metadata = self._interceptor.pre_list(request, metadata) request_kwargs = compute.ListRegionCommitmentsRequest.to_dict(request) transcoded_request = path_template.transcode(http_options, **request_kwargs) uri = transcoded_request["uri"] method = transcoded_request["method"] # Jsonify the query params query_params = json.loads( compute.ListRegionCommitmentsRequest.to_json( compute.ListRegionCommitmentsRequest( transcoded_request["query_params"] ), including_default_value_fields=False, use_integers_for_enums=False, ) ) query_params.update(self._get_unset_required_fields(query_params)) # Send the request headers = dict(metadata) headers["Content-Type"] = "application/json" response = getattr(self._session, method)( "{host}{uri}".format(host=self._host, uri=uri), timeout=timeout, headers=headers, params=rest_helpers.flatten_query_params(query_params), ) # In case of error, raise the appropriate core_exceptions.GoogleAPICallError exception # subclass. if response.status_code >= 400: raise core_exceptions.from_http_response(response) # Return the response resp = compute.CommitmentList.from_json( response.content, ignore_unknown_fields=True ) resp = self._interceptor.post_list(resp) return resp class _Update(RegionCommitmentsRestStub): def __hash__(self): return hash("Update") __REQUIRED_FIELDS_DEFAULT_VALUES: Dict[str, str] = {} @classmethod def _get_unset_required_fields(cls, message_dict): return { k: v for k, v in cls.__REQUIRED_FIELDS_DEFAULT_VALUES.items() if k not in message_dict } def __call__( self, request: compute.UpdateRegionCommitmentRequest, *, retry: OptionalRetry = gapic_v1.method.DEFAULT, timeout: float = None, metadata: Sequence[Tuple[str, str]] = (), ) -> compute.Operation: r"""Call the update method over HTTP. Args: request (~.compute.UpdateRegionCommitmentRequest): The request object. A request message for RegionCommitments.Update. See the method description for details. retry (google.api_core.retry.Retry): Designation of what errors, if any, should be retried. timeout (float): The timeout for this request. metadata (Sequence[Tuple[str, str]]): Strings which should be sent along with the request as metadata. Returns: ~.compute.Operation: Represents an Operation resource. Google Compute Engine has three Operation resources: \* `Global </compute/docs/reference/rest/v1/globalOperations>`__ \* `Regional </compute/docs/reference/rest/v1/regionOperations>`__ \* `Zonal </compute/docs/reference/rest/v1/zoneOperations>`__ You can use an operation resource to manage asynchronous API requests. For more information, read Handling API responses. Operations can be global, regional or zonal. - For global operations, use the ``globalOperations`` resource. - For regional operations, use the ``regionOperations`` resource. - For zonal operations, use the ``zonalOperations`` resource. For more information, read Global, Regional, and Zonal Resources. """ http_options: List[Dict[str, str]] = [ { "method": "patch", "uri": "/compute/v1/projects/{project}/regions/{region}/commitments/{commitment}", "body": "commitment_resource", }, ] request, metadata = self._interceptor.pre_update(request, metadata) request_kwargs = compute.UpdateRegionCommitmentRequest.to_dict(request) transcoded_request = path_template.transcode(http_options, **request_kwargs) # Jsonify the request body body = compute.Commitment.to_json( compute.Commitment(transcoded_request["body"]), including_default_value_fields=False, use_integers_for_enums=False, ) uri = transcoded_request["uri"] method = transcoded_request["method"] # Jsonify the query params query_params = json.loads( compute.UpdateRegionCommitmentRequest.to_json( compute.UpdateRegionCommitmentRequest( transcoded_request["query_params"] ), including_default_value_fields=False, use_integers_for_enums=False, ) ) query_params.update(self._get_unset_required_fields(query_params)) # Send the request headers = dict(metadata) headers["Content-Type"] = "application/json" response = getattr(self._session, method)( "{host}{uri}".format(host=self._host, uri=uri), timeout=timeout, headers=headers, params=rest_helpers.flatten_query_params(query_params), data=body, ) # In case of error, raise the appropriate core_exceptions.GoogleAPICallError exception # subclass. if response.status_code >= 400: raise core_exceptions.from_http_response(response) # Return the response resp = compute.Operation.from_json( response.content, ignore_unknown_fields=True ) resp = self._interceptor.post_update(resp) return resp @property def aggregated_list( self, ) -> Callable[ [compute.AggregatedListRegionCommitmentsRequest], compute.CommitmentAggregatedList, ]: stub = self._STUBS.get("aggregated_list") if not stub: stub = self._STUBS["aggregated_list"] = self._AggregatedList( self._session, self._host, self._interceptor ) # The return type is fine, but mypy isn't sophisticated enough to determine what's going on here. # In C++ this would require a dynamic_cast return stub # type: ignore @property def get(self) -> Callable[[compute.GetRegionCommitmentRequest], compute.Commitment]: stub = self._STUBS.get("get") if not stub: stub = self._STUBS["get"] = self._Get( self._session, self._host, self._interceptor ) # The return type is fine, but mypy isn't sophisticated enough to determine what's going on here. # In C++ this would require a dynamic_cast return stub # type: ignore @property def insert( self, ) -> Callable[[compute.InsertRegionCommitmentRequest], compute.Operation]: stub = self._STUBS.get("insert") if not stub: stub = self._STUBS["insert"] = self._Insert( self._session, self._host, self._interceptor ) # The return type is fine, but mypy isn't sophisticated enough to determine what's going on here. # In C++ this would require a dynamic_cast return stub # type: ignore @property def list( self, ) -> Callable[[compute.ListRegionCommitmentsRequest], compute.CommitmentList]: stub = self._STUBS.get("list") if not stub: stub = self._STUBS["list"] = self._List( self._session, self._host, self._interceptor ) # The return type is fine, but mypy isn't sophisticated enough to determine what's going on here. # In C++ this would require a dynamic_cast return stub # type: ignore @property def update( self, ) -> Callable[[compute.UpdateRegionCommitmentRequest], compute.Operation]: stub = self._STUBS.get("update") if not stub: stub = self._STUBS["update"] = self._Update( self._session, self._host, self._interceptor ) # The return type is fine, but mypy isn't sophisticated enough to determine what's going on here. # In C++ this would require a dynamic_cast return stub # type: ignore def close(self): self._session.close() __all__ = ("RegionCommitmentsRestTransport",)
import re from datetime import datetime from typing import Dict, List, Optional, Tuple from urllib.parse import urlparse import pytest from bs4 import BeautifulSoup from werkzeug.test import Client from backend.common.consts.account_permission import AccountPermission from backend.common.consts.event_type import EventType from backend.common.consts.suggestion_state import SuggestionState from backend.common.models.event import Event from backend.common.models.suggestion import Suggestion from backend.common.models.webcast import Webcast, WebcastType from backend.common.suggestions.suggestion_creator import ( SuggestionCreationStatus, SuggestionCreator, ) from backend.web.handlers.conftest import get_inputs_from_form @pytest.fixture(autouse=True) def create_event(ndb_stub) -> None: event = Event( id="2016necmp", name="New England District Championship", event_type_enum=EventType.OFFSEASON, short_name="New England", event_short="necmp", year=2016, end_date=datetime(2016, 3, 27), official=False, city="Hartford", state_prov="CT", country="USA", venue="Some Venue", venue_address="Some Venue, Hartford, CT, USA", timezone_id="America/New_York", start_date=datetime(2016, 3, 24), webcast_json="", website="http://www.firstsv.org", ) event.put() @pytest.fixture def login_user_with_permission(login_user): login_user.permissions = [AccountPermission.REVIEW_MEDIA] return login_user def get_suggestion_queue_and_fields( web_client: Client, form_id: Optional[str] = None ) -> Tuple[List[str], Dict]: response = web_client.get("/suggest/event/webcast/review") assert response.status_code == 200 soup = BeautifulSoup(response.data, "html.parser") review_form = soup.find(id="review_webcasts") assert review_form is not None suggestions = review_form.find_all(id=re.compile("review_.*")) queue = [] for suggestion in suggestions: queue.append(suggestion["id"].split("review_")[1]) inputs = None if form_id: form = soup.find(id=form_id) assert form is not None inputs = get_inputs_from_form(form) return queue, (inputs or {}) def createSuggestion(logged_in_user) -> str: status = SuggestionCreator.createEventWebcastSuggestion( logged_in_user.account_key, "https://twitch.tv/frcgamesense", "", "2016necmp", ) assert status == SuggestionCreationStatus.SUCCESS return "webcast_2016necmp_twitch_frcgamesense_None" def test_login_redirect(web_client: Client) -> None: response = web_client.get("/suggest/event/webcast/review") assert response.status_code == 302 assert urlparse(response.headers["Location"]).path == "/account/login" def test_no_permissions(login_user, web_client: Client) -> None: response = web_client.get("/suggest/event/webcast/review") assert response.status_code == 401 def test_nothing_to_review(login_user_with_permission, web_client: Client) -> None: queue, _ = get_suggestion_queue_and_fields(web_client) assert queue == [] def test_reject_all(login_user_with_permission, web_client: Client, ndb_stub) -> None: suggestion_id = createSuggestion(login_user_with_permission) queue, reject_fields = get_suggestion_queue_and_fields( web_client, "reject_all_2016necmp" ) assert queue == [suggestion_id] assert reject_fields is not {} reject_fields["verdict"] = "reject_all" response = web_client.post( "/suggest/event/webcast/review", data=reject_fields, follow_redirects=True, ) assert response.status_code == 200 # Make sure we mark the Suggestion as REVIEWED suggestion = Suggestion.get_by_id(suggestion_id) assert suggestion is not None assert suggestion.review_state == SuggestionState.REVIEW_REJECTED # Make sure the Event has no webcasts event = Event.get_by_id("2016necmp") assert event is not None assert event.webcast == [] def test_accept_with_default_details( login_user_with_permission, web_client: Client, ndb_stub, taskqueue_stub, ) -> None: suggestion_id = createSuggestion(login_user_with_permission) queue, form_fields = get_suggestion_queue_and_fields( web_client, f"review_{suggestion_id}" ) assert queue == [suggestion_id] assert form_fields is not {} form_fields["verdict"] = "accept" response = web_client.post( "/suggest/event/webcast/review", data=form_fields, follow_redirects=True, ) assert response.status_code == 200 # Make sure we mark the Suggestion as REVIEWED suggestion = Suggestion.get_by_id(suggestion_id) assert suggestion is not None assert suggestion.review_state == SuggestionState.REVIEW_ACCEPTED # Make sure the Event has a webcast event = Event.get_by_id("2016necmp") assert event is not None assert event.webcast == [Webcast(type=WebcastType.TWITCH, channel="frcgamesense")] def test_accept_with_different_details( login_user_with_permission, web_client: Client, ndb_stub, taskqueue_stub, ) -> None: suggestion_id = createSuggestion(login_user_with_permission) queue, form_fields = get_suggestion_queue_and_fields( web_client, f"review_{suggestion_id}" ) assert queue == [suggestion_id] assert form_fields is not {} form_fields["webcast_type"] = "youtube" form_fields["webcast_channel"] = "foobar" form_fields["webcast_file"] = "meow" form_fields["verdict"] = "accept" form_fields["verdict"] = "accept" response = web_client.post( "/suggest/event/webcast/review", data=form_fields, follow_redirects=True, ) assert response.status_code == 200 # Make sure we mark the Suggestion as REVIEWED suggestion = Suggestion.get_by_id(suggestion_id) assert suggestion is not None assert suggestion.review_state == SuggestionState.REVIEW_ACCEPTED # Make sure the Event has a webcast event = Event.get_by_id("2016necmp") assert event is not None assert event.webcast == [ Webcast( type=WebcastType.YOUTUBE, channel="foobar", file="meow", ) ] def test_reject_single_webcast( login_user_with_permission, web_client: Client, ndb_stub ) -> None: suggestion_id = createSuggestion(login_user_with_permission) queue, form_fields = get_suggestion_queue_and_fields( web_client, f"review_{suggestion_id}" ) assert queue == [suggestion_id] assert form_fields is not {} form_fields["verdict"] = "reject" response = web_client.post( "/suggest/event/webcast/review", data=form_fields, follow_redirects=True, ) assert response.status_code == 200 # Make sure we mark the Suggestion as REVIEWED suggestion = Suggestion.get_by_id(suggestion_id) assert suggestion is not None assert suggestion.review_state == SuggestionState.REVIEW_REJECTED # Make sure the Event has no webcasts event = Event.get_by_id("2016necmp") assert event is not None assert event.webcast == []
# -*- coding: utf-8 -*- # Copyright (C) 2014-2020, imageio contributors # # imageio is distributed under the terms of the (new) BSD License. # The full license can be found in 'license.txt'. # styletest: skip """ Release: * Write release notes * Increase __version__ * git tag the release (and push the tag to Github) * Upload to Pypi: python setup.py sdist bdist_wheel upload * Update conda recipe on conda-forge feedstock """ import os import os.path as op import sys import shutil from distutils.core import Command from distutils.command.sdist import sdist from distutils.command.build_py import build_py from itertools import chain try: from setuptools import setup # Supports wheels except ImportError: from distutils.core import setup # Supports anything else try: from wheel.bdist_wheel import bdist_wheel except ImportError: bdist_wheel = object name = "imageio" description = "Library for reading and writing a wide range of image, video, scientific, and volumetric data formats." THIS_DIR = os.path.dirname(os.path.abspath(__file__)) # Get version and docstring __version__ = None __doc__ = "" docStatus = 0 # Not started, in progress, done initFile = os.path.join(THIS_DIR, "imageio", "__init__.py") for line in open(initFile).readlines(): if line.startswith("__version__"): exec(line.strip()) elif line.startswith('"""'): if docStatus == 0: docStatus = 1 line = line.lstrip('"') elif docStatus == 1: docStatus = 2 if docStatus == 1: __doc__ += line.rstrip() + "\n" # Template for long description. __doc__ gets inserted here long_description = """ .. image:: https://github.com/imageio/imageio/workflows/CI/badge.svg :target: https://github.com/imageio/imageio/actions __doc__ Release notes: https://github.com/imageio/imageio/blob/master/CHANGELOG.md Example: .. code-block:: python >>> import imageio >>> im = imageio.imread('imageio:astronaut.png') >>> im.shape # im is a numpy array (512, 512, 3) >>> imageio.imwrite('astronaut-gray.jpg', im[:, :, 0]) See the `API Reference <https://imageio.readthedocs.io/en/stable/reference/index.html>`_ or `examples <https://imageio.readthedocs.io/en/stable/examples.html>`_ for more information. """ # Prepare resources dir package_data = [ "resources/shipped_resources_go_here", "resources/*.*", "resources/images/*.*", "resources/freeimage/*.*", ] def _set_crossplatform_resources(resource_dir): import imageio # Clear now if op.isdir(resource_dir): shutil.rmtree(resource_dir) os.mkdir(resource_dir) open(op.join(resource_dir, "shipped_resources_go_here"), "wb") # Load images for fname in [ "images/chelsea.png", "images/chelsea.zip", "images/astronaut.png", "images/newtonscradle.gif", "images/cockatoo.mp4", "images/realshort.mp4", "images/stent.npz", ]: imageio.core.get_remote_file(fname, resource_dir, force_download=True) def _set_platform_resources(resource_dir, platform): import imageio # Create file to show platform assert platform open(op.join(resource_dir, "platform_%s" % platform), "wb") # Load freeimage fname = imageio.plugins.freeimage.FNAME_PER_PLATFORM[platform] imageio.core.get_remote_file( "freeimage/" + fname, resource_dir, force_download=True ) class test_command(Command): user_options = [] def initialize_options(self): pass def finalize_options(self): pass def run(self): from imageio import testing os.environ["IMAGEIO_NO_INTERNET"] = "1" # run tests without inet sys.exit(testing.test_unit()) class build_with_fi(build_py): def run(self): # Download images and libs import imageio resource_dir = imageio.core.resource_dirs()[0] _set_crossplatform_resources(resource_dir) _set_platform_resources(resource_dir, imageio.core.get_platform()) # Build as normal build_py.run(self) class build_with_images(sdist): def run(self): # Download images import imageio resource_dir = imageio.core.resource_dirs()[0] _set_crossplatform_resources(resource_dir) # Build as normal sdist.run(self) # pinned to > 8.3.2 due to security vulnerability # See: https://github.com/advisories/GHSA-98vv-pw6r-q6q4 install_requires = ["numpy >= 1.20.0", "pillow >= 8.3.2"] extras_require = { "build": ["wheel"], "linting": ["black", "flake8"], "test": ["invoke", "pytest", "pytest-cov", "fsspec[github]"], "docs": ["sphinx", "numpydoc", "pydata-sphinx-theme"], "itk": ["itk"], "bsdf": [], "dicom": [], "feisem": [], "ffmpeg": ["imageio-ffmpeg", "psutil"], "fits": ["astropy"], "freeimage": [], "gdal": ["gdal"], "lytro": [], "numpy": [], "pillow": [], "simpleitk": [], "spe": [], "swf": [], "tifffile": ["tifffile"], } extras_require["full"] = sorted(set(chain.from_iterable(extras_require.values()))) extras_require["dev"] = extras_require["test"] + extras_require["linting"] setup( cmdclass={ # 'bdist_wheel_all': bdist_wheel_all, # 'sdist_all': sdist_all, "build_with_images": build_with_images, "build_with_fi": build_with_fi, "sdist": build_with_images, "test": test_command, }, name=name, version=__version__, author="imageio contributors", author_email="almar.klein@gmail.com", license="BSD-2-Clause", url="https://github.com/imageio/imageio", download_url="http://pypi.python.org/pypi/imageio", keywords="image video volume imread imwrite io animation ffmpeg", description=description, long_description=long_description.replace("__doc__", __doc__), platforms="any", provides=["imageio"], python_requires=">=3.5", install_requires=install_requires, extras_require=extras_require, packages=["imageio", "imageio.core", "imageio.plugins", "imageio.config"], package_dir={"imageio": "imageio"}, # Data in the package package_data={"imageio": package_data}, entry_points={ "console_scripts": [ "imageio_download_bin=imageio.__main__:download_bin_main", "imageio_remove_bin=imageio.__main__:remove_bin_main", ] }, classifiers=[ "Development Status :: 5 - Production/Stable", "Intended Audience :: Science/Research", "Intended Audience :: Education", "Intended Audience :: Developers", "License :: OSI Approved :: BSD License", "Operating System :: MacOS :: MacOS X", "Operating System :: Microsoft :: Windows", "Operating System :: POSIX", "Programming Language :: Python :: 3", "Programming Language :: Python :: 3.7", "Programming Language :: Python :: 3.8", "Programming Language :: Python :: 3.9", "Programming Language :: Python :: 3.10", ], )
#!/usr/bin/env python import openravepy import unittest import numpy from openravepy import Environment from prpy.clone import CloneException from prpy.planning.base import PlanningError from prpy.planning.cbirrt import CBiRRTPlanner from prpy.planning.ompl import OMPLPlanner, OMPLSimplifier from prpy.planning.retimer import ParabolicRetimer from prpy.planning.mac_smoother import MacSmoother from numpy.testing import assert_allclose VerifyTrajectory = openravepy.planningutils.VerifyTrajectory # Generic test setup # # This class is the base class of all planner tests. It is responsible for # setting up the environment, but does directly not implement any tests. class BasePlannerTest(object): """Generic environment setup. """ active_dof_indices = range(7) # Feasible start/goal pair. config_feasible_start = numpy.array([ +2.35061574, 0.61043555, 0.85000000, 1.80684444, -0.08639935, -0.69750474, 1.31656172 ]) config_feasible_goal = numpy.array([ -0.84085883, 1.44573701, 0.20000000, 1.72620231, -0.81124757, -1.39363597, 1.29233111 ]) # This configuration is in collision with the environment, but is not in # self-collision. config_env_collision = numpy.array([ +3.63026273e-01, -1.54688036e+00, -1.30000000e+00, +2.34703418e+00, 3.28152338e-01, -1.10662864e+00, -2.07807269e-01 ]) # This configuration is in self-collision, but is not in collision with the # environment. config_self_collision = numpy.array([ 2.60643264e+00, 1.97222205e+00, -8.24298541e-16, 2.79154009e+00, 1.30899694e+00, -4.71027738e-16, 0.00000000e+00 ]) # Waypoints that can be pair-wise connected by straight line paths. waypoint1 = numpy.array([ 1.12376031, 0.60576977, -0.05000000, 1.33403907, 0.44772461, -0.31481177, 1.90265540 ]) waypoint2 = numpy.array([ 1.53181533, 0.80270404, -0.05000000, 1.75341989, 0.21348846, -0.91026757, 1.59603932 ]) waypoint3 = numpy.array([ 1.50376031, 0.60576977, -0.05000000, 1.33403907, 0.44772461, -0.31481177, 1.90265540 ]) def setUp(self): self.env = Environment() self.env.Load('data/wamtest2.env.xml') self.robot = self.env.GetRobot('BarrettWAM') self.manipulator = self.robot.GetManipulator('arm') # TODO: Planning should succeed with the floor present if CO_ActiveOnly # is set. self.env.Remove(self.env.GetKinBody('floor')) with self.env: self.robot.SetActiveManipulator(self.manipulator) self.robot.SetActiveDOFs(self.active_dof_indices) self.planner = self.planner_factory() def tearDown(self): self.env.Destroy() def _ValidatePath(self, path): self.assertEquals(path.GetEnv(), self.env) self.assertEquals(self.robot.GetActiveConfigurationSpecification('linear'), path.GetConfigurationSpecification()) self.assertGreaterEqual(path.GetNumWaypoints(), 1) def _CollisionCheckPath(self, traj): # NOTE: This assumes that the trajectory only contains joint_values. OpenStart = openravepy.Interval.OpenStart params = openravepy.Planner.PlannerParameters() params.SetRobotActiveJoints(self.robot) # Check the first waypoint for collision. We do this outside of the # loop so we can run all collision checks with OpenEnd. This prevents # us from collision checking the intermediate waypoints twice. prev_waypoint = traj.GetWaypoint(0) check = params.CheckPathAllConstraints(prev_waypoint, prev_waypoint, [], [], 0., OpenStart) if check != 0: return True # Check the remainder of the path. for iwaypoint in xrange(1, traj.GetNumWaypoints() - 1): curr_waypoint = traj.GetWaypoint(iwaypoint) check = params.CheckPathAllConstraints( prev_waypoint, curr_waypoint, [], [], 0., OpenStart) if check != 0: return True prev_waypoint = curr_waypoint return False def _ComputeArcLength(self, traj): distance = 0. for iwaypoint in xrange(1, traj.GetNumWaypoints()): prev_waypoint = traj.GetWaypoint(iwaypoint - 1) curr_waypoint = traj.GetWaypoint(iwaypoint) distance += numpy.linalg.norm(curr_waypoint - prev_waypoint) return distance def assertTransformClose(self, actual_pose, expected_pose, linear_tol=1e-3, angular_tol=1e-3): rel_pose = numpy.dot(numpy.linalg.inv(actual_pose), expected_pose) distance = numpy.linalg.norm(rel_pose[0:3, 3]) angle = numpy.arccos((numpy.trace(rel_pose[0:3, 0:3]) - 1.) / 2.) self.assertLessEqual(distance, linear_tol) self.assertLessEqual(angle, angular_tol) # Method-specific tests # # Methods from BasePlannerTest are also available in these classes. However, # they should NOT inherit from BasePlannerTest. class PlanToConfigurationTest(object): def test_PlanToConfiguration_GoalIsFeasible_FindsSolution(self): # Setup with self.env: self.robot.SetActiveDOFValues(self.config_feasible_start) # Test path = self.planner.PlanToConfiguration( self.robot, self.config_feasible_goal) # Assert. self.assertEquals(path.GetEnv(), self.env) self.assertEquals(self.robot.GetActiveConfigurationSpecification('linear'), path.GetConfigurationSpecification()) self.assertGreaterEqual(path.GetNumWaypoints(), 1) first_waypoint = path.GetWaypoint(0) last_waypoint = path.GetWaypoint(path.GetNumWaypoints() - 1) self._ValidatePath(path) assert_allclose(first_waypoint, self.config_feasible_start) assert_allclose(last_waypoint, self.config_feasible_goal) self.assertFalse(self._CollisionCheckPath(path)) def test_PlanToConfiguration_StartInCollision_Throws(self): # Setup with self.env: self.robot.SetActiveDOFValues(self.config_env_collision) # Test/Assert with self.assertRaises(PlanningError): self.planner.PlanToConfiguration( self.robot, self.config_feasible_goal) def test_PlanToConfiguration_StartInSelfCollision_Throws(self): # Setup with self.env: self.robot.SetActiveDOFValues(self.config_self_collision) # Test/Assert with self.assertRaises((PlanningError, CloneException)): self.planner.PlanToConfiguration( self.robot, self.config_feasible_goal) def test_PlanToConfiguration_GoalInCollision_Throws(self): # Setup with self.env: self.robot.SetActiveDOFValues(self.config_feasible_start) # Test/Assert with self.assertRaises(PlanningError): self.planner.PlanToConfiguration( self.robot, self.config_env_collision) def test_PlanToConfiguration_GoalInSelfCollision_Throws(self): # Setup with self.env: self.robot.SetActiveDOFValues(self.config_feasible_start) # Test/Assert with self.assertRaises(PlanningError): self.planner.PlanToConfiguration( self.robot, self.config_self_collision) class PlanToEndEffectorPoseTest(object): def test_PlanToEndEffectorPose_GoalIsFeasible_FindsSolution(self): # Setup with self.env: self.robot.SetActiveDOFValues(self.config_feasible_goal) goal_ik = self.manipulator.GetEndEffectorTransform() self.robot.SetActiveDOFValues(self.config_feasible_start) # Test path = self.planner.PlanToEndEffectorPose(self.robot, goal_ik) # Assert self._ValidatePath(path) first_waypoint = path.GetWaypoint(0) assert_allclose(first_waypoint, self.config_feasible_start) with self.env: last_waypoint = path.GetWaypoint(path.GetNumWaypoints() - 1) self.robot.SetActiveDOFValues(last_waypoint) last_ik = self.manipulator.GetEndEffectorTransform() self.assertTransformClose(last_ik, goal_ik) self.assertFalse(self._CollisionCheckPath(path)) def test_PlanToEndEffectorPose_StartInCollision_Throws(self): # Setup with self.env: self.robot.SetActiveDOFValues(self.config_feasible_goal) goal_ik = self.manipulator.GetEndEffectorTransform() self.robot.SetActiveDOFValues(self.config_env_collision) # Test/Assert with self.assertRaises(PlanningError): self.planner.PlanToEndEffectorPose(self.robot, goal_ik) def test_PlanToEndEffectorPose_StartInSelfCollision_Throws(self): # Setup with self.env: self.robot.SetActiveDOFValues(self.config_feasible_goal) goal_ik = self.manipulator.GetEndEffectorTransform() self.robot.SetActiveDOFValues(self.config_self_collision) # Test/Assert with self.assertRaises((PlanningError, CloneException)): self.planner.PlanToEndEffectorPose(self.robot, goal_ik) def test_PlanToEndEffectorPose_GoalInCollision_Throws(self): # Setup with self.env: self.robot.SetActiveDOFValues(self.config_env_collision) goal_ik = self.manipulator.GetEndEffectorTransform() self.robot.SetActiveDOFValues(self.config_feasible_start) # Test/Assert with self.assertRaises(PlanningError): self.planner.PlanToEndEffectorPose(self.robot, goal_ik) def test_PlanToEndEffectorPose_GoalInSelfCollision_Throws(self): # Setup with self.env: self.robot.SetActiveDOFValues(self.config_self_collision) goal_ik = self.manipulator.GetEndEffectorTransform() self.robot.SetActiveDOFValues(self.config_feasible_start) # Test/Assert with self.assertRaises(PlanningError): self.planner.PlanToEndEffectorPose(self.robot, goal_ik) class ShortcutPathTest(object): def setUp(self): self.input_path = openravepy.RaveCreateTrajectory(self.env, '') self.input_path.Init(self.robot.GetActiveConfigurationSpecification('linear')) self.input_path.Insert(0, self.waypoint1) self.input_path.Insert(1, self.waypoint2) self.input_path.Insert(2, self.waypoint3) def test_ShortcutPath_ShortcutExists_ReducesLength(self): # Setup/Test smoothed_path = self.planner.ShortcutPath(self.robot, self.input_path) # Assert self.assertEquals(smoothed_path.GetConfigurationSpecification(), self.input_path.GetConfigurationSpecification()) self.assertGreaterEqual(smoothed_path.GetNumWaypoints(), 2) n = smoothed_path.GetNumWaypoints() assert_allclose(smoothed_path.GetWaypoint(0), self.waypoint1) assert_allclose(smoothed_path.GetWaypoint(n - 1), self.waypoint3) self.assertLess(self._ComputeArcLength(smoothed_path), 0.5 * self._ComputeArcLength(self.input_path)) # TODO: Test some of the error cases. class SmoothTrajectoryTest(object): def setUp(self): cspec = self.robot.GetActiveConfigurationSpecification('linear') self.feasible_path = openravepy.RaveCreateTrajectory(self.env, '') self.feasible_path.Init(cspec) self.feasible_path.Insert(0, self.waypoint1) self.feasible_path.Insert(1, self.waypoint2) self.feasible_path.Insert(2, self.waypoint3) def test_SmoothTrajectory_DoesNotModifyStartPoint(self): # Setup/Test traj = self.planner.RetimeTrajectory(self.robot, self.feasible_path) # Assert cspec = self.robot.GetActiveConfigurationSpecification('linear') self.assertGreaterEqual(traj.GetNumWaypoints(), 2) first_waypoint = traj.GetWaypoint(0, cspec) last_waypoint = traj.GetWaypoint(traj.GetNumWaypoints() - 1, cspec) assert_allclose(first_waypoint, self.waypoint1) assert_allclose(last_waypoint, self.waypoint3) class RetimeTrajectoryTest(object): def setUp(self): cspec = self.robot.GetActiveConfigurationSpecification('linear') self.feasible_path = openravepy.RaveCreateTrajectory(self.env, '') self.feasible_path.Init(cspec) self.feasible_path.Insert(0, self.waypoint1) self.feasible_path.Insert(1, self.waypoint2) self.feasible_path.Insert(2, self.waypoint3) self.dt = 0.01 self.tolerance = 0.1 # 10% error def test_RetimeTrajectory(self): # Setup/Test traj = self.planner.RetimeTrajectory(self.robot, self.feasible_path) # Assert position_cspec = self.feasible_path.GetConfigurationSpecification() velocity_cspec = position_cspec.ConvertToDerivativeSpecification(1) zero_dof_values = numpy.zeros(position_cspec.GetDOF()) # Verify that the trajectory passes through the original waypoints. waypoints = [self.waypoint1, self.waypoint2, self.waypoint3] waypoint_indices = [None] * len(waypoints) for iwaypoint in xrange(traj.GetNumWaypoints()): joint_values = traj.GetWaypoint(iwaypoint, position_cspec) # Compare the waypoint against every input waypoint. for icandidate, candidate_waypoint in enumerate(waypoints): if numpy.allclose(joint_values, candidate_waypoint): self.assertIsNone(waypoint_indices[icandidate]) waypoint_indices[icandidate] = iwaypoint self.assertEquals(waypoint_indices[0], 0) self.assertEquals(waypoint_indices[-1], traj.GetNumWaypoints() - 1) for iwaypoint in waypoint_indices: self.assertIsNotNone(iwaypoint) # Verify that the velocity at the waypoint is zero. joint_velocities = traj.GetWaypoint(iwaypoint, velocity_cspec) assert_allclose(joint_velocities, zero_dof_values) # Verify the trajectory between waypoints. for t in numpy.arange(self.dt, traj.GetDuration(), self.dt): iafter = traj.GetFirstWaypointIndexAfterTime(t) ibefore = iafter - 1 joint_values = traj.Sample(t, position_cspec) joint_values_before = traj.GetWaypoint(ibefore, position_cspec) joint_values_after = traj.GetWaypoint(iafter, position_cspec) distance_full = numpy.linalg.norm( joint_values_after - joint_values_before) distance_before = numpy.linalg.norm( joint_values - joint_values_before) distance_after = numpy.linalg.norm( joint_values - joint_values_after) deviation = distance_before + distance_after - distance_full self.assertLess(deviation, self.tolerance * distance_full) # Check joint limits and dynamic feasibility. params = openravepy.Planner.PlannerParameters() params.SetRobotActiveJoints(self.robot) openravepy.planningutils.VerifyTrajectory(params, traj, self.dt) # TODO: Test failure cases. # Planner-specific tests # # Each of these classes MUST EXTEND BasePlannerTest, one or more # method-specific test classes (e.g. PlanToConfigurationTests), and the # unittest.TestCase class. The unittest.TestCase class MUST APPEAR LAST in the # list of base classes. class CBiRRTPlannerTests(BasePlannerTest, PlanToConfigurationTest, PlanToEndEffectorPoseTest, unittest.TestCase): planner_factory = CBiRRTPlanner class OMPLPlannerTests(BasePlannerTest, PlanToConfigurationTest, unittest.TestCase): planner_factory = OMPLPlanner class OMPLSimplifierTests(BasePlannerTest, ShortcutPathTest, unittest.TestCase): planner_factory = OMPLSimplifier def setUp(self): BasePlannerTest.setUp(self) ShortcutPathTest.setUp(self) class ParabolicRetimerTests(BasePlannerTest, RetimeTrajectoryTest, unittest.TestCase): planner_factory = ParabolicRetimer def setUp(self): BasePlannerTest.setUp(self) RetimeTrajectoryTest.setUp(self) class MacSmootherTests(BasePlannerTest, SmoothTrajectoryTest, unittest.TestCase): planner_factory = MacSmoother def setUp(self): BasePlannerTest.setUp(self) SmoothTrajectoryTest.setUp(self) if __name__ == '__main__': openravepy.RaveInitialize(True) openravepy.misc.InitOpenRAVELogging() openravepy.RaveSetDebugLevel(openravepy.DebugLevel.Warn) unittest.main()
import numpy as np import tensorflow as tf import awesome_gans.modules as t tf.set_random_seed(777) # reproducibility np.random.seed(777) # reproducibility he_normal = tf.contrib.layers.variance_scaling_initializer(factor=1.0, mode='FAN_AVG', uniform=True) l2_reg = tf.contrib.layers.l2_regularizer def pixel_norm(x, eps=1e-8): return x * tf.rsqrt(tf.reduce_mean(tf.square(x), axis=1, keepdims=True) + eps) def resize_nn(x, size): return tf.image.resize_nearest_neighbor(x, size=(int(size), int(size))) def bacth_concat(x, eps=1e-8, averaging='all'): """ ref : https://github.com/zhangqianhui/progressive_growing_of_gans_tensorflow/blob/master/ops.py#L145 """ adj_std = lambda x_, **kwargs: tf.sqrt(tf.reduce_mean((x_ - tf.reduce_mean(x_, **kwargs)) ** 2, **kwargs) + eps) val_ = adj_std(x, axis=0, keepdims=True) if averaging == 'all': val_ = tf.reduce_mean(val_, keepdims=True) val_ = tf.tile(val_, multiples=[tf.shape(x)[0], 4, 4, 1]) return tf.concat([x, val_], axis=3) class PGGAN: def __init__( self, s, batch_size=16, input_height=128, input_width=128, input_channel=3, pg=1, pg_t=False, sample_num=1 * 1, sample_size=1, output_height=128, output_width=128, df_dim=64, gf_dim=64, z_dim=512, lr=1e-4, epsilon=1e-9, ): """ # General Settings :param s: TF Session :param batch_size: training batch size, default 16 :param input_height: input image height, default 128 :param input_width: input image width, default 128 :param input_channel: input image channel, default 3 (RGB) - in case of Celeb-A, image size is 128x128x3(HWC). # Output Settings :param pg: size of the image for model?, default 1 :param pg_t: pg status, default False :param sample_num: the number of output images, default 1 :param sample_size: sample image size, default 1 :param output_height: output images height, default 128 :param output_width: output images width, default 128 # For CNN model :param df_dim: discriminator filter, default 64 :param gf_dim: generator filter, default 64 # Training Option :param z_dim: z dimension (kinda noise), default 512 :param lr: learning rate, default 1e-4 :param epsilon: epsilon, default 1e-9 """ self.s = s self.batch_size = batch_size self.input_height = input_height self.input_width = input_width self.input_channel = input_channel self.image_shape = [self.batch_size, self.input_height, self.input_width, self.input_channel] self.sample_num = sample_num self.sample_size = sample_size self.output_height = output_height self.output_width = output_width self.pg = pg self.pg_t = pg_t self.output_size = 4 * pow(2, self.pg - 1) self.df_dim = df_dim self.gf_dim = gf_dim self.z_dim = z_dim self.beta1 = 0.0 self.beta2 = 0.99 self.lr = lr self.eps = epsilon # pre-defined self.d_real = 0.0 self.d_fake = 0.0 self.g_loss = 0.0 self.d_loss = 0.0 self.gp = 0.0 self.gp_target = 1.0 self.gp_lambda = 10.0 # slower convergence but good self.gp_w = 1e-3 self.g = None self.d_op = None self.g_op = None self.merged = None self.writer = None self.saver = None self.r_saver = None self.out_saver = None # Placeholders self.x = tf.placeholder( tf.float32, shape=[None, self.output_size, self.output_size, self.input_channel], name="x-image" ) self.z = tf.placeholder(tf.float32, shape=[None, self.z_dim], name='z-noise') self.step_pl = tf.placeholder(tf.float32, shape=None) self.alpha_trans = tf.Variable(initial_value=0.0, trainable=False, name='alpha_trans') self.alpha_trans_update = None self.build_pggan() # build PGGAN model def discriminator(self, x, pg=1, pg_t=False, reuse=None): def nf(n): return min(1024 // (2 ** n), self.z_dim) with tf.variable_scope("disc", reuse=reuse): if pg_t: x_out = tf.layers.average_pooling2d(x, pool_size=2, strides=2) x_out = t.conv2d(x_out, nf(pg - 2), k=1, s=1, name='disc_out_conv2d-%d' % x_out.get_shape()[1]) x_out = tf.nn.leaky_relu(x_out) x = t.conv2d(x, nf(pg - 1), k=1, s=1, name='disc_out_conv2d-%d' % x.get_shape()[1]) x = tf.nn.leaky_relu(x) for i in range(pg - 1): x = t.conv2d(x, nf(pg - 1 - i), k=1, s=1, name='disc_n_1_conv2d-%d' % x.get_shape()[1]) x = tf.nn.leaky_relu(x) x = t.conv2d(x, nf(pg - 2 - i), k=1, s=1, name='disc_n_2_conv2d-%d' % x.get_shape()[1]) x = tf.nn.leaky_relu(x) x = tf.layers.average_pooling2d(x, pool_size=2, strides=2) if i == 0 and pg_t: x = (1.0 - self.alpha_trans) * x_out + self.alpha_trans * x x = bacth_concat(x) x = t.conv2d(x, nf(1), k=3, s=1, name='disc_n_1_conv2d-%d' % x.get_shape()[1]) x = tf.nn.leaky_relu(x) x = t.conv2d(x, nf(1), k=4, s=1, pad='VALID', name='disc_n_2_conv2d-%d' % x.get_shape()[1]) x = tf.nn.leaky_relu(x) x = tf.layers.flatten(x) x = tf.layers.dense(x, 1, name='disc_n_fc') return x def generator(self, z, pg=1, pg_t=False, reuse=None): def nf(n): return min(1024 // (2 ** n), self.z_dim) def block(x, fs, name="0"): x = resize_nn(x, x.get_shape()[1] * 2) x = t.conv2d(x, fs, k=3, s=1, name='gen_n_%s_conv2d-%d' % (name, x.get_shape()[1])) x = tf.nn.leaky_relu(x) x = pixel_norm(x) return x with tf.variable_scope("gen", reuse=reuse): x = tf.reshape(z, [-1, 1, 1, nf(1)]) x = t.conv2d(x, nf(1), k=4, s=1, name='gen_n_1_conv2d') x = tf.nn.leaky_relu(x) x = pixel_norm(x) x = tf.reshape(x, [-1, 4, 4, nf(1)]) x = t.conv2d(x, nf(1), k=3, s=1, name='gen_n_2_conv2d') x = tf.nn.leaky_relu(x) x = pixel_norm(x) x_out = None for i in range(pg - 1): if i == pg - 2 and pg_t: x_out = t.conv2d(x, 3, k=1, s=1, name='gen_out_conv2d-%d' % x.get_shape()[1]) # to RGB images x_out = resize_nn(x_out, x_out.get_shape()[1] * 2) # up-sampling x = block(x, nf(i + 1), name="1") x = block(x, nf(i + 1), name="2") x = t.conv2d(x, 3, k=1, s=1, name='gen_out_conv2d-%d' % x.get_shape()[1]) # to RGB images if pg == 1: return x if pg_t: x = (1.0 - self.alpha_trans) * x_out + self.alpha_trans * x return x def build_pggan(self): self.alpha_trans_update = self.alpha_trans.assign(self.step_pl / 32000) # Generator self.g = self.generator(self.z, self.pg, self.pg_t) # Discriminator d_real = self.discriminator(self.x, self.pg, self.pg_t) d_fake = self.discriminator(self.g, self.pg, self.pg_t, reuse=True) # Loss () d_real_loss = tf.reduce_mean(d_real) d_fake_loss = tf.reduce_mean(d_fake) self.d_loss = d_real_loss - d_fake_loss self.g_loss = d_fake_loss # Gradient Penalty diff = self.g - self.x alpha = tf.random_uniform(shape=[self.batch_size, 1, 1, 1], minval=0.0, maxval=1.0) interp = self.x + (alpha * diff) d_interp = self.discriminator(interp, self.pg, self.pg_t, reuse=True) grads = tf.gradients(d_interp, [interp])[0] slopes = tf.sqrt(tf.reduce_sum(tf.square(grads), reduction_indices=[1, 2, 3])) self.gp = tf.reduce_mean(tf.square(slopes - self.gp_target)) self.d_loss += (self.gp_lambda / (self.gp_target ** 2)) * self.gp + self.gp_w * tf.reduce_mean( tf.square(d_real - 0.0) ) # Summary tf.summary.scalar("loss/d_loss", self.d_loss) tf.summary.scalar("loss/d_real_loss", d_real_loss) tf.summary.scalar("loss/d_fake_loss", d_fake_loss) tf.summary.scalar("loss/g_loss", self.g_loss) tf.summary.scalar("misc/gp", self.gp) # Training Parameters t_vars = tf.trainable_variables() d_params = [v for v in t_vars if v.name.startswith('disc')] g_params = [v for v in t_vars if v.name.startswith('gen')] d_n_params = [v for v in d_params if 'disc_n' in v.name] g_n_params = [v for v in g_params if 'gen_n' in v.name] d_n_out_params = [v for v in d_params if 'disc_out' in v.name] g_n_out_params = [v for v in g_params if 'gen_out' in v.name] d_n_nwm_params = [v for v in d_n_params if '%d' % self.output_size not in v.name] # nwm : not new model g_n_nwm_params = [v for v in g_n_params if '%d' % self.output_size not in v.name] # nwm : not new model d_n_out_nwm_params = [v for v in d_n_out_params if '%d' % self.output_size not in v.name] g_n_out_nwm_params = [v for v in g_n_out_params if '%d' % self.output_size not in v.name] # Optimizer self.d_op = tf.train.AdamOptimizer(learning_rate=self.lr, beta1=self.beta1, beta2=self.beta2).minimize( self.d_loss, var_list=d_params ) self.g_op = tf.train.AdamOptimizer(learning_rate=self.lr, beta1=self.beta1, beta2=self.beta2).minimize( self.g_loss, var_list=g_params ) # Merge summary self.merged = tf.summary.merge_all() # Model saver mtk = 2 self.saver = tf.train.Saver(var_list=d_params + g_params, max_to_keep=mtk, name='saver') self.r_saver = tf.train.Saver(var_list=d_n_nwm_params + g_n_nwm_params, max_to_keep=mtk, name='r_saver') if len(d_n_out_nwm_params + g_n_out_nwm_params): self.out_saver = tf.train.Saver( var_list=d_n_out_nwm_params + g_n_out_nwm_params, max_to_keep=mtk, name='out_saver' ) self.writer = tf.summary.FileWriter('./model/', self.s.graph)
# -*- coding: utf-8 -*- from south.utils import datetime_utils as datetime from south.db import db from south.v2 import SchemaMigration from django.db import models class Migration(SchemaMigration): def forwards(self, orm): # Deleting field 'FileBlob.storage_options' db.delete_column(u'sentry_fileblob', 'storage_options') # Deleting field 'FileBlob.storage' db.delete_column(u'sentry_fileblob', 'storage') # Deleting field 'File.storage_options' db.delete_column(u'sentry_file', 'storage_options') # Deleting field 'File.storage' db.delete_column(u'sentry_file', 'storage') def backwards(self, orm): raise RuntimeError( "Cannot reverse this migration. 'FileBlob.storage' and its values cannot be restored." ) models = { 'sentry.activity': { 'Meta': { 'object_name': 'Activity' }, 'data': ('sentry.db.models.fields.gzippeddict.GzippedDictField', [], { 'null': 'True' }), 'datetime': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'event': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Event']", 'null': 'True' } ), 'group': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Group']", 'null': 'True' } ), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'ident': ('django.db.models.fields.CharField', [], { 'max_length': '64', 'null': 'True' }), 'project': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Project']" } ), 'type': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {}), 'user': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.User']", 'null': 'True' } ) }, 'sentry.apikey': { 'Meta': { 'object_name': 'ApiKey' }, 'allowed_origins': ('django.db.models.fields.TextField', [], { 'null': 'True', 'blank': 'True' }), 'date_added': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'key': ('django.db.models.fields.CharField', [], { 'unique': 'True', 'max_length': '32' }), 'label': ( 'django.db.models.fields.CharField', [], { 'default': "'Default'", 'max_length': '64', 'blank': 'True' } ), 'organization': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'related_name': "'key_set'", 'to': "orm['sentry.Organization']" } ), 'scopes': ('django.db.models.fields.BigIntegerField', [], { 'default': 'None' }), 'status': ( 'sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'default': '0', 'db_index': 'True' } ) }, 'sentry.auditlogentry': { 'Meta': { 'object_name': 'AuditLogEntry' }, 'actor': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'blank': 'True', 'related_name': "'audit_actors'", 'null': 'True', 'to': "orm['sentry.User']" } ), 'actor_key': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.ApiKey']", 'null': 'True', 'blank': 'True' } ), 'actor_label': ( 'django.db.models.fields.CharField', [], { 'max_length': '64', 'null': 'True', 'blank': 'True' } ), 'data': ('sentry.db.models.fields.gzippeddict.GzippedDictField', [], {}), 'datetime': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'event': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], {}), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'ip_address': ( 'django.db.models.fields.GenericIPAddressField', [], { 'max_length': '39', 'null': 'True' } ), 'organization': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Organization']" } ), 'target_object': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'null': 'True' }), 'target_user': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'blank': 'True', 'related_name': "'audit_targets'", 'null': 'True', 'to': "orm['sentry.User']" } ) }, 'sentry.authidentity': { 'Meta': { 'unique_together': "(('auth_provider', 'ident'), ('auth_provider', 'user'))", 'object_name': 'AuthIdentity' }, 'auth_provider': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.AuthProvider']" } ), 'data': ('sentry.db.models.fields.jsonfield.JSONField', [], { 'default': '{}' }), 'date_added': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'ident': ('django.db.models.fields.CharField', [], { 'max_length': '128' }), 'last_synced': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'last_verified': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'user': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.User']" } ) }, 'sentry.authprovider': { 'Meta': { 'object_name': 'AuthProvider' }, 'config': ('sentry.db.models.fields.jsonfield.JSONField', [], { 'default': '{}' }), 'date_added': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'default_global_access': ('django.db.models.fields.BooleanField', [], { 'default': 'True' }), 'default_role': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'default': '50' }), 'default_teams': ( 'django.db.models.fields.related.ManyToManyField', [], { 'to': "orm['sentry.Team']", 'symmetrical': 'False', 'blank': 'True' } ), 'flags': ('django.db.models.fields.BigIntegerField', [], { 'default': '0' }), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'last_sync': ('django.db.models.fields.DateTimeField', [], { 'null': 'True' }), 'organization': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Organization']", 'unique': 'True' } ), 'provider': ('django.db.models.fields.CharField', [], { 'max_length': '128' }), 'sync_time': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'null': 'True' }) }, 'sentry.broadcast': { 'Meta': { 'object_name': 'Broadcast' }, 'date_added': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'date_expires': ( 'django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime(2015, 12, 9, 0, 0)', 'null': 'True', 'blank': 'True' } ), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'is_active': ('django.db.models.fields.BooleanField', [], { 'default': 'True', 'db_index': 'True' }), 'link': ( 'django.db.models.fields.URLField', [], { 'max_length': '200', 'null': 'True', 'blank': 'True' } ), 'message': ('django.db.models.fields.CharField', [], { 'max_length': '256' }), 'title': ('django.db.models.fields.CharField', [], { 'max_length': '32' }), 'upstream_id': ( 'django.db.models.fields.CharField', [], { 'max_length': '32', 'null': 'True', 'blank': 'True' } ) }, 'sentry.broadcastseen': { 'Meta': { 'unique_together': "(('broadcast', 'user'),)", 'object_name': 'BroadcastSeen' }, 'broadcast': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Broadcast']" } ), 'date_seen': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'user': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.User']" } ) }, 'sentry.event': { 'Meta': { 'unique_together': "(('project', 'event_id'),)", 'object_name': 'Event', 'db_table': "'sentry_message'", 'index_together': "(('group', 'datetime'),)" }, 'data': ('sentry.db.models.fields.node.NodeField', [], { 'null': 'True', 'blank': 'True' }), 'datetime': ( 'django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now', 'db_index': 'True' } ), 'event_id': ( 'django.db.models.fields.CharField', [], { 'max_length': '32', 'null': 'True', 'db_column': "'message_id'" } ), 'group': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'blank': 'True', 'related_name': "'event_set'", 'null': 'True', 'to': "orm['sentry.Group']" } ), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'message': ('django.db.models.fields.TextField', [], {}), 'num_comments': ( 'sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'default': '0', 'null': 'True' } ), 'platform': ('django.db.models.fields.CharField', [], { 'max_length': '64', 'null': 'True' }), 'project': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Project']", 'null': 'True' } ), 'time_spent': ('sentry.db.models.fields.bounded.BoundedIntegerField', [], { 'null': 'True' }) }, 'sentry.eventmapping': { 'Meta': { 'unique_together': "(('project', 'event_id'),)", 'object_name': 'EventMapping' }, 'date_added': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'event_id': ('django.db.models.fields.CharField', [], { 'max_length': '32' }), 'group': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Group']" } ), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'project': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Project']" } ) }, 'sentry.eventuser': { 'Meta': { 'unique_together': "(('project', 'ident'), ('project', 'hash'))", 'object_name': 'EventUser', 'index_together': "(('project', 'email'), ('project', 'username'), ('project', 'ip_address'))" }, 'date_added': ( 'django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now', 'db_index': 'True' } ), 'email': ('django.db.models.fields.EmailField', [], { 'max_length': '75', 'null': 'True' }), 'hash': ('django.db.models.fields.CharField', [], { 'max_length': '32' }), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'ident': ('django.db.models.fields.CharField', [], { 'max_length': '128', 'null': 'True' }), 'ip_address': ( 'django.db.models.fields.GenericIPAddressField', [], { 'max_length': '39', 'null': 'True' } ), 'project': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Project']" } ), 'username': ('django.db.models.fields.CharField', [], { 'max_length': '128', 'null': 'True' }) }, 'sentry.file': { 'Meta': { 'object_name': 'File' }, 'blob': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.FileBlob']", 'null': 'True' } ), 'checksum': ('django.db.models.fields.CharField', [], { 'max_length': '40', 'null': 'True' }), 'headers': ('sentry.db.models.fields.jsonfield.JSONField', [], { 'default': '{}' }), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'name': ('django.db.models.fields.CharField', [], { 'max_length': '128' }), 'path': ('django.db.models.fields.TextField', [], { 'null': 'True' }), 'size': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'null': 'True' }), 'timestamp': ( 'django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now', 'db_index': 'True' } ), 'type': ('django.db.models.fields.CharField', [], { 'max_length': '64' }) }, 'sentry.fileblob': { 'Meta': { 'object_name': 'FileBlob' }, 'checksum': ('django.db.models.fields.CharField', [], { 'unique': 'True', 'max_length': '40' }), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'path': ('django.db.models.fields.TextField', [], { 'null': 'True' }), 'size': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'null': 'True' }), 'timestamp': ( 'django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now', 'db_index': 'True' } ) }, 'sentry.group': { 'Meta': { 'object_name': 'Group', 'db_table': "'sentry_groupedmessage'", 'index_together': "(('project', 'first_release'),)" }, 'active_at': ('django.db.models.fields.DateTimeField', [], { 'null': 'True', 'db_index': 'True' }), 'culprit': ( 'django.db.models.fields.CharField', [], { 'max_length': '200', 'null': 'True', 'db_column': "'view'", 'blank': 'True' } ), 'data': ( 'sentry.db.models.fields.gzippeddict.GzippedDictField', [], { 'null': 'True', 'blank': 'True' } ), 'first_release': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Release']", 'null': 'True' } ), 'first_seen': ( 'django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now', 'db_index': 'True' } ), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'is_public': ( 'django.db.models.fields.NullBooleanField', [], { 'default': 'False', 'null': 'True', 'blank': 'True' } ), 'last_seen': ( 'django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now', 'db_index': 'True' } ), 'level': ( 'sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'default': '40', 'db_index': 'True', 'blank': 'True' } ), 'logger': ( 'django.db.models.fields.CharField', [], { 'default': "''", 'max_length': '64', 'db_index': 'True', 'blank': 'True' } ), 'message': ('django.db.models.fields.TextField', [], {}), 'num_comments': ( 'sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'default': '0', 'null': 'True' } ), 'platform': ('django.db.models.fields.CharField', [], { 'max_length': '64', 'null': 'True' }), 'project': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Project']", 'null': 'True' } ), 'resolved_at': ('django.db.models.fields.DateTimeField', [], { 'null': 'True', 'db_index': 'True' }), 'score': ('sentry.db.models.fields.bounded.BoundedIntegerField', [], { 'default': '0' }), 'status': ( 'sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'default': '0', 'db_index': 'True' } ), 'time_spent_count': ('sentry.db.models.fields.bounded.BoundedIntegerField', [], { 'default': '0' }), 'time_spent_total': ('sentry.db.models.fields.bounded.BoundedIntegerField', [], { 'default': '0' }), 'times_seen': ( 'sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'default': '1', 'db_index': 'True' } ) }, 'sentry.groupassignee': { 'Meta': { 'object_name': 'GroupAssignee', 'db_table': "'sentry_groupasignee'" }, 'date_added': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'group': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'related_name': "'assignee_set'", 'unique': 'True', 'to': "orm['sentry.Group']" } ), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'project': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'related_name': "'assignee_set'", 'to': "orm['sentry.Project']" } ), 'user': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'related_name': "'sentry_assignee_set'", 'to': "orm['sentry.User']" } ) }, 'sentry.groupbookmark': { 'Meta': { 'unique_together': "(('project', 'user', 'group'),)", 'object_name': 'GroupBookmark' }, 'date_added': ( 'django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now', 'null': 'True' } ), 'group': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'related_name': "'bookmark_set'", 'to': "orm['sentry.Group']" } ), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'project': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'related_name': "'bookmark_set'", 'to': "orm['sentry.Project']" } ), 'user': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'related_name': "'sentry_bookmark_set'", 'to': "orm['sentry.User']" } ) }, 'sentry.groupemailthread': { 'Meta': { 'unique_together': "(('email', 'group'), ('email', 'msgid'))", 'object_name': 'GroupEmailThread' }, 'date': ( 'django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now', 'db_index': 'True' } ), 'email': ('django.db.models.fields.EmailField', [], { 'max_length': '75' }), 'group': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'related_name': "'groupemail_set'", 'to': "orm['sentry.Group']" } ), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'msgid': ('django.db.models.fields.CharField', [], { 'max_length': '100' }), 'project': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'related_name': "'groupemail_set'", 'to': "orm['sentry.Project']" } ) }, 'sentry.grouphash': { 'Meta': { 'unique_together': "(('project', 'hash'),)", 'object_name': 'GroupHash' }, 'group': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Group']", 'null': 'True' } ), 'hash': ('django.db.models.fields.CharField', [], { 'max_length': '32' }), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'project': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Project']", 'null': 'True' } ) }, 'sentry.groupmeta': { 'Meta': { 'unique_together': "(('group', 'key'),)", 'object_name': 'GroupMeta' }, 'group': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Group']" } ), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'key': ('django.db.models.fields.CharField', [], { 'max_length': '64' }), 'value': ('django.db.models.fields.TextField', [], {}) }, 'sentry.groupresolution': { 'Meta': { 'object_name': 'GroupResolution' }, 'datetime': ( 'django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now', 'db_index': 'True' } ), 'group': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Group']", 'unique': 'True' } ), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'release': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Release']" } ), 'status': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'default': '0' }) }, 'sentry.grouprulestatus': { 'Meta': { 'unique_together': "(('rule', 'group'),)", 'object_name': 'GroupRuleStatus' }, 'date_added': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'group': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Group']" } ), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'last_active': ('django.db.models.fields.DateTimeField', [], { 'null': 'True' }), 'project': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Project']" } ), 'rule': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Rule']" } ), 'status': ('django.db.models.fields.PositiveSmallIntegerField', [], { 'default': '0' }) }, 'sentry.groupseen': { 'Meta': { 'unique_together': "(('user', 'group'),)", 'object_name': 'GroupSeen' }, 'group': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Group']" } ), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'last_seen': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'project': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Project']" } ), 'user': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.User']", 'db_index': 'False' } ) }, 'sentry.groupsnooze': { 'Meta': { 'object_name': 'GroupSnooze' }, 'group': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Group']", 'unique': 'True' } ), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'until': ('django.db.models.fields.DateTimeField', [], {}) }, 'sentry.grouptagkey': { 'Meta': { 'unique_together': "(('project', 'group', 'key'),)", 'object_name': 'GroupTagKey' }, 'group': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Group']" } ), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'key': ('django.db.models.fields.CharField', [], { 'max_length': '32' }), 'project': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Project']", 'null': 'True' } ), 'values_seen': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'default': '0' }) }, 'sentry.grouptagvalue': { 'Meta': { 'unique_together': "(('project', 'key', 'value', 'group'),)", 'object_name': 'GroupTagValue', 'db_table': "'sentry_messagefiltervalue'" }, 'first_seen': ( 'django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now', 'null': 'True', 'db_index': 'True' } ), 'group': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'related_name': "'grouptag'", 'to': "orm['sentry.Group']" } ), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'key': ('django.db.models.fields.CharField', [], { 'max_length': '32' }), 'last_seen': ( 'django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now', 'null': 'True', 'db_index': 'True' } ), 'project': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'related_name': "'grouptag'", 'null': 'True', 'to': "orm['sentry.Project']" } ), 'times_seen': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'default': '0' }), 'value': ('django.db.models.fields.CharField', [], { 'max_length': '200' }) }, 'sentry.helppage': { 'Meta': { 'object_name': 'HelpPage' }, 'content': ('django.db.models.fields.TextField', [], {}), 'date_added': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'is_visible': ('django.db.models.fields.BooleanField', [], { 'default': 'True' }), 'key': ( 'django.db.models.fields.CharField', [], { 'max_length': '64', 'unique': 'True', 'null': 'True' } ), 'priority': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'default': '50' }), 'title': ('django.db.models.fields.CharField', [], { 'max_length': '64' }) }, 'sentry.lostpasswordhash': { 'Meta': { 'object_name': 'LostPasswordHash' }, 'date_added': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'hash': ('django.db.models.fields.CharField', [], { 'max_length': '32' }), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'user': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.User']", 'unique': 'True' } ) }, 'sentry.option': { 'Meta': { 'object_name': 'Option' }, 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'key': ('django.db.models.fields.CharField', [], { 'unique': 'True', 'max_length': '64' }), 'last_updated': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'value': ('sentry.db.models.fields.pickle.UnicodePickledObjectField', [], {}) }, 'sentry.organization': { 'Meta': { 'object_name': 'Organization' }, 'date_added': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'default_role': ('django.db.models.fields.CharField', [], { 'default': "'member'", 'max_length': '32' }), 'flags': ('django.db.models.fields.BigIntegerField', [], { 'default': '1' }), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'members': ( 'django.db.models.fields.related.ManyToManyField', [], { 'related_name': "'org_memberships'", 'symmetrical': 'False', 'through': "orm['sentry.OrganizationMember']", 'to': "orm['sentry.User']" } ), 'name': ('django.db.models.fields.CharField', [], { 'max_length': '64' }), 'slug': ('django.db.models.fields.SlugField', [], { 'unique': 'True', 'max_length': '50' }), 'status': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'default': '0' }) }, 'sentry.organizationaccessrequest': { 'Meta': { 'unique_together': "(('team', 'member'),)", 'object_name': 'OrganizationAccessRequest' }, 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'member': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.OrganizationMember']" } ), 'team': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Team']" } ) }, 'sentry.organizationmember': { 'Meta': { 'unique_together': "(('organization', 'user'), ('organization', 'email'))", 'object_name': 'OrganizationMember' }, 'counter': ( 'sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'null': 'True', 'blank': 'True' } ), 'date_added': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'email': ( 'django.db.models.fields.EmailField', [], { 'max_length': '75', 'null': 'True', 'blank': 'True' } ), 'flags': ('django.db.models.fields.BigIntegerField', [], { 'default': '0' }), 'has_global_access': ('django.db.models.fields.BooleanField', [], { 'default': 'True' }), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'organization': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'related_name': "'member_set'", 'to': "orm['sentry.Organization']" } ), 'role': ('django.db.models.fields.CharField', [], { 'default': "'member'", 'max_length': '32' }), 'teams': ( 'django.db.models.fields.related.ManyToManyField', [], { 'to': "orm['sentry.Team']", 'symmetrical': 'False', 'through': "orm['sentry.OrganizationMemberTeam']", 'blank': 'True' } ), 'type': ( 'sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'default': '50', 'blank': 'True' } ), 'user': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'blank': 'True', 'related_name': "'sentry_orgmember_set'", 'null': 'True', 'to': "orm['sentry.User']" } ) }, 'sentry.organizationmemberteam': { 'Meta': { 'unique_together': "(('team', 'organizationmember'),)", 'object_name': 'OrganizationMemberTeam', 'db_table': "'sentry_organizationmember_teams'" }, 'id': ('sentry.db.models.fields.bounded.BoundedAutoField', [], { 'primary_key': 'True' }), 'is_active': ('django.db.models.fields.BooleanField', [], { 'default': 'True' }), 'organizationmember': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.OrganizationMember']" } ), 'team': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Team']" } ) }, 'sentry.organizationoption': { 'Meta': { 'unique_together': "(('organization', 'key'),)", 'object_name': 'OrganizationOption', 'db_table': "'sentry_organizationoptions'" }, 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'key': ('django.db.models.fields.CharField', [], { 'max_length': '64' }), 'organization': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Organization']" } ), 'value': ('sentry.db.models.fields.pickle.UnicodePickledObjectField', [], {}) }, 'sentry.project': { 'Meta': { 'unique_together': "(('team', 'slug'), ('organization', 'slug'))", 'object_name': 'Project' }, 'date_added': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'first_event': ('django.db.models.fields.DateTimeField', [], { 'null': 'True' }), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'name': ('django.db.models.fields.CharField', [], { 'max_length': '200' }), 'organization': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Organization']" } ), 'public': ('django.db.models.fields.BooleanField', [], { 'default': 'False' }), 'slug': ('django.db.models.fields.SlugField', [], { 'max_length': '50', 'null': 'True' }), 'status': ( 'sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'default': '0', 'db_index': 'True' } ), 'team': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Team']" } ) }, 'sentry.projectkey': { 'Meta': { 'object_name': 'ProjectKey' }, 'date_added': ( 'django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now', 'null': 'True' } ), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'label': ( 'django.db.models.fields.CharField', [], { 'max_length': '64', 'null': 'True', 'blank': 'True' } ), 'project': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'related_name': "'key_set'", 'to': "orm['sentry.Project']" } ), 'public_key': ( 'django.db.models.fields.CharField', [], { 'max_length': '32', 'unique': 'True', 'null': 'True' } ), 'roles': ('django.db.models.fields.BigIntegerField', [], { 'default': '1' }), 'secret_key': ( 'django.db.models.fields.CharField', [], { 'max_length': '32', 'unique': 'True', 'null': 'True' } ), 'status': ( 'sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'default': '0', 'db_index': 'True' } ) }, 'sentry.projectoption': { 'Meta': { 'unique_together': "(('project', 'key'),)", 'object_name': 'ProjectOption', 'db_table': "'sentry_projectoptions'" }, 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'key': ('django.db.models.fields.CharField', [], { 'max_length': '64' }), 'project': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Project']" } ), 'value': ('sentry.db.models.fields.pickle.UnicodePickledObjectField', [], {}) }, 'sentry.release': { 'Meta': { 'unique_together': "(('project', 'version'),)", 'object_name': 'Release' }, 'data': ('sentry.db.models.fields.jsonfield.JSONField', [], { 'default': '{}' }), 'date_added': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'date_released': ('django.db.models.fields.DateTimeField', [], { 'null': 'True', 'blank': 'True' }), 'date_started': ('django.db.models.fields.DateTimeField', [], { 'null': 'True', 'blank': 'True' }), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'new_groups': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'default': '0' }), 'owner': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.User']", 'null': 'True', 'blank': 'True' } ), 'project': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Project']" } ), 'ref': ( 'django.db.models.fields.CharField', [], { 'max_length': '64', 'null': 'True', 'blank': 'True' } ), 'url': ( 'django.db.models.fields.URLField', [], { 'max_length': '200', 'null': 'True', 'blank': 'True' } ), 'version': ('django.db.models.fields.CharField', [], { 'max_length': '64' }) }, 'sentry.releasefile': { 'Meta': { 'unique_together': "(('release', 'ident'),)", 'object_name': 'ReleaseFile' }, 'file': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.File']" } ), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'ident': ('django.db.models.fields.CharField', [], { 'max_length': '40' }), 'name': ('django.db.models.fields.TextField', [], {}), 'project': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Project']" } ), 'release': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Release']" } ) }, 'sentry.rule': { 'Meta': { 'object_name': 'Rule' }, 'data': ('sentry.db.models.fields.gzippeddict.GzippedDictField', [], {}), 'date_added': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'label': ('django.db.models.fields.CharField', [], { 'max_length': '64' }), 'project': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Project']" } ) }, 'sentry.savedsearch': { 'Meta': { 'unique_together': "(('project', 'name'),)", 'object_name': 'SavedSearch' }, 'date_added': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'name': ('django.db.models.fields.CharField', [], { 'max_length': '128' }), 'project': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Project']" } ), 'query': ('django.db.models.fields.TextField', [], {}) }, 'sentry.tagkey': { 'Meta': { 'unique_together': "(('project', 'key'),)", 'object_name': 'TagKey', 'db_table': "'sentry_filterkey'" }, 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'key': ('django.db.models.fields.CharField', [], { 'max_length': '32' }), 'label': ('django.db.models.fields.CharField', [], { 'max_length': '64', 'null': 'True' }), 'project': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Project']" } ), 'status': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'default': '0' }), 'values_seen': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'default': '0' }) }, 'sentry.tagvalue': { 'Meta': { 'unique_together': "(('project', 'key', 'value'),)", 'object_name': 'TagValue', 'db_table': "'sentry_filtervalue'" }, 'data': ( 'sentry.db.models.fields.gzippeddict.GzippedDictField', [], { 'null': 'True', 'blank': 'True' } ), 'first_seen': ( 'django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now', 'null': 'True', 'db_index': 'True' } ), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'key': ('django.db.models.fields.CharField', [], { 'max_length': '32' }), 'last_seen': ( 'django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now', 'null': 'True', 'db_index': 'True' } ), 'project': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Project']", 'null': 'True' } ), 'times_seen': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'default': '0' }), 'value': ('django.db.models.fields.CharField', [], { 'max_length': '200' }) }, 'sentry.team': { 'Meta': { 'unique_together': "(('organization', 'slug'),)", 'object_name': 'Team' }, 'date_added': ( 'django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now', 'null': 'True' } ), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'name': ('django.db.models.fields.CharField', [], { 'max_length': '64' }), 'organization': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Organization']" } ), 'slug': ('django.db.models.fields.SlugField', [], { 'max_length': '50' }), 'status': ('sentry.db.models.fields.bounded.BoundedPositiveIntegerField', [], { 'default': '0' }) }, 'sentry.user': { 'Meta': { 'object_name': 'User', 'db_table': "'auth_user'" }, 'date_joined': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'email': ('django.db.models.fields.EmailField', [], { 'max_length': '75', 'blank': 'True' }), 'first_name': ('django.db.models.fields.CharField', [], { 'max_length': '30', 'blank': 'True' }), 'id': ('sentry.db.models.fields.bounded.BoundedAutoField', [], { 'primary_key': 'True' }), 'is_active': ('django.db.models.fields.BooleanField', [], { 'default': 'True' }), 'is_managed': ('django.db.models.fields.BooleanField', [], { 'default': 'False' }), 'is_staff': ('django.db.models.fields.BooleanField', [], { 'default': 'False' }), 'is_superuser': ('django.db.models.fields.BooleanField', [], { 'default': 'False' }), 'last_login': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'last_name': ('django.db.models.fields.CharField', [], { 'max_length': '30', 'blank': 'True' }), 'password': ('django.db.models.fields.CharField', [], { 'max_length': '128' }), 'username': ('django.db.models.fields.CharField', [], { 'unique': 'True', 'max_length': '128' }) }, 'sentry.useroption': { 'Meta': { 'unique_together': "(('user', 'project', 'key'),)", 'object_name': 'UserOption' }, 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'key': ('django.db.models.fields.CharField', [], { 'max_length': '64' }), 'project': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Project']", 'null': 'True' } ), 'user': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.User']" } ), 'value': ('sentry.db.models.fields.pickle.UnicodePickledObjectField', [], {}) }, 'sentry.userreport': { 'Meta': { 'object_name': 'UserReport', 'index_together': "(('project', 'event_id'),)" }, 'comments': ('django.db.models.fields.TextField', [], {}), 'date_added': ('django.db.models.fields.DateTimeField', [], { 'default': 'datetime.datetime.now' }), 'email': ('django.db.models.fields.EmailField', [], { 'max_length': '75' }), 'event_id': ('django.db.models.fields.CharField', [], { 'max_length': '32' }), 'group': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Group']", 'null': 'True' } ), 'id': ('sentry.db.models.fields.bounded.BoundedBigAutoField', [], { 'primary_key': 'True' }), 'name': ('django.db.models.fields.CharField', [], { 'max_length': '128' }), 'project': ( 'sentry.db.models.fields.foreignkey.FlexibleForeignKey', [], { 'to': "orm['sentry.Project']" } ) } } complete_apps = ['sentry']
# Natural Language Toolkit: API for Corpus Readers # # Copyright (C) 2001-2013 NLTK Project # Author: Steven Bird <sb@ldc.upenn.edu> # Edward Loper <edloper@gradient.cis.upenn.edu> # URL: <http://www.nltk.org/> # For license information, see LICENSE.TXT """ API for corpus readers. """ from __future__ import unicode_literals import os import re from collections import defaultdict from nltk import compat from nltk.data import PathPointer, FileSystemPathPointer, ZipFilePathPointer from .util import * @compat.python_2_unicode_compatible class CorpusReader(object): """ A base class for "corpus reader" classes, each of which can be used to read a specific corpus format. Each individual corpus reader instance is used to read a specific corpus, consisting of one or more files under a common root directory. Each file is identified by its ``file identifier``, which is the relative path to the file from the root directory. A separate subclass is be defined for each corpus format. These subclasses define one or more methods that provide 'views' on the corpus contents, such as ``words()`` (for a list of words) and ``parsed_sents()`` (for a list of parsed sentences). Called with no arguments, these methods will return the contents of the entire corpus. For most corpora, these methods define one or more selection arguments, such as ``fileids`` or ``categories``, which can be used to select which portion of the corpus should be returned. """ def __init__(self, root, fileids, encoding='utf8', tag_mapping_function=None): """ :type root: PathPointer or str :param root: A path pointer identifying the root directory for this corpus. If a string is specified, then it will be converted to a ``PathPointer`` automatically. :param fileids: A list of the files that make up this corpus. This list can either be specified explicitly, as a list of strings; or implicitly, as a regular expression over file paths. The absolute path for each file will be constructed by joining the reader's root to each file name. :param encoding: The default unicode encoding for the files that make up the corpus. The value of ``encoding`` can be any of the following: - A string: ``encoding`` is the encoding name for all files. - A dictionary: ``encoding[file_id]`` is the encoding name for the file whose identifier is ``file_id``. If ``file_id`` is not in ``encoding``, then the file contents will be processed using non-unicode byte strings. - A list: ``encoding`` should be a list of ``(regexp, encoding)`` tuples. The encoding for a file whose identifier is ``file_id`` will be the ``encoding`` value for the first tuple whose ``regexp`` matches the ``file_id``. If no tuple's ``regexp`` matches the ``file_id``, the file contents will be processed using non-unicode byte strings. - None: the file contents of all files will be processed using non-unicode byte strings. :param tag_mapping_function: A function for normalizing or simplifying the POS tags returned by the tagged_words() or tagged_sents() methods. """ # Convert the root to a path pointer, if necessary. if isinstance(root, compat.string_types) and not isinstance(root, PathPointer): m = re.match('(.*\.zip)/?(.*)$|', root) zipfile, zipentry = m.groups() if zipfile: root = ZipFilePathPointer(zipfile, zipentry) else: root = FileSystemPathPointer(root) elif not isinstance(root, PathPointer): raise TypeError('CorpusReader: expected a string or a PathPointer') # If `fileids` is a regexp, then expand it. if isinstance(fileids, compat.string_types): fileids = find_corpus_fileids(root, fileids) self._fileids = fileids """A list of the relative paths for the fileids that make up this corpus.""" self._root = root """The root directory for this corpus.""" # If encoding was specified as a list of regexps, then convert # it to a dictionary. if isinstance(encoding, list): encoding_dict = {} for fileid in self._fileids: for x in encoding: (regexp, enc) = x if re.match(regexp, fileid): encoding_dict[fileid] = enc break encoding = encoding_dict self._encoding = encoding """The default unicode encoding for the fileids that make up this corpus. If ``encoding`` is None, then the file contents are processed using byte strings.""" self._tag_mapping_function = tag_mapping_function def __repr__(self): if isinstance(self._root, ZipFilePathPointer): path = '%s/%s' % (self._root.zipfile.filename, self._root.entry) else: path = '%s' % self._root.path return '<%s in %r>' % (self.__class__.__name__, path) def readme(self): """ Return the contents of the corpus README file, if it exists. """ return self.open("README").read() def fileids(self): """ Return a list of file identifiers for the fileids that make up this corpus. """ return self._fileids def abspath(self, fileid): """ Return the absolute path for the given file. :type file: str :param file: The file identifier for the file whose path should be returned. :rtype: PathPointer """ return self._root.join(fileid) def abspaths(self, fileids=None, include_encoding=False, include_fileid=False): """ Return a list of the absolute paths for all fileids in this corpus; or for the given list of fileids, if specified. :type fileids: None or str or list :param fileids: Specifies the set of fileids for which paths should be returned. Can be None, for all fileids; a list of file identifiers, for a specified set of fileids; or a single file identifier, for a single file. Note that the return value is always a list of paths, even if ``fileids`` is a single file identifier. :param include_encoding: If true, then return a list of ``(path_pointer, encoding)`` tuples. :rtype: list(PathPointer) """ if fileids is None: fileids = self._fileids elif isinstance(fileids, compat.string_types): fileids = [fileids] paths = [self._root.join(f) for f in fileids] if include_encoding and include_fileid: return zip(paths, [self.encoding(f) for f in fileids], fileids) elif include_fileid: return zip(paths, fileids) elif include_encoding: return zip(paths, [self.encoding(f) for f in fileids]) else: return paths def open(self, file): """ Return an open stream that can be used to read the given file. If the file's encoding is not None, then the stream will automatically decode the file's contents into unicode. :param file: The file identifier of the file to read. """ encoding = self.encoding(file) stream = self._root.join(file).open(encoding) return stream def encoding(self, file): """ Return the unicode encoding for the given corpus file, if known. If the encoding is unknown, or if the given file should be processed using byte strings (str), then return None. """ if isinstance(self._encoding, dict): return self._encoding.get(file) else: return self._encoding def _get_root(self): return self._root root = property(_get_root, doc=""" The directory where this corpus is stored. :type: PathPointer""") ###################################################################### #{ Corpora containing categorized items ###################################################################### class CategorizedCorpusReader(object): """ A mixin class used to aid in the implementation of corpus readers for categorized corpora. This class defines the method ``categories()``, which returns a list of the categories for the corpus or for a specified set of fileids; and overrides ``fileids()`` to take a ``categories`` argument, restricting the set of fileids to be returned. Subclasses are expected to: - Call ``__init__()`` to set up the mapping. - Override all view methods to accept a ``categories`` parameter, which can be used *instead* of the ``fileids`` parameter, to select which fileids should be included in the returned view. """ def __init__(self, kwargs): """ Initialize this mapping based on keyword arguments, as follows: - cat_pattern: A regular expression pattern used to find the category for each file identifier. The pattern will be applied to each file identifier, and the first matching group will be used as the category label for that file. - cat_map: A dictionary, mapping from file identifiers to category labels. - cat_file: The name of a file that contains the mapping from file identifiers to categories. The argument ``cat_delimiter`` can be used to specify a delimiter. The corresponding argument will be deleted from ``kwargs``. If more than one argument is specified, an exception will be raised. """ self._f2c = None #: file-to-category mapping self._c2f = None #: category-to-file mapping self._pattern = None #: regexp specifying the mapping self._map = None #: dict specifying the mapping self._file = None #: fileid of file containing the mapping self._delimiter = None #: delimiter for ``self._file`` if 'cat_pattern' in kwargs: self._pattern = kwargs['cat_pattern'] del kwargs['cat_pattern'] elif 'cat_map' in kwargs: self._map = kwargs['cat_map'] del kwargs['cat_map'] elif 'cat_file' in kwargs: self._file = kwargs['cat_file'] del kwargs['cat_file'] if 'cat_delimiter' in kwargs: self._delimiter = kwargs['cat_delimiter'] del kwargs['cat_delimiter'] else: raise ValueError('Expected keyword argument cat_pattern or ' 'cat_map or cat_file.') if ('cat_pattern' in kwargs or 'cat_map' in kwargs or 'cat_file' in kwargs): raise ValueError('Specify exactly one of: cat_pattern, ' 'cat_map, cat_file.') def _init(self): self._f2c = defaultdict(set) self._c2f = defaultdict(set) if self._pattern is not None: for file_id in self._fileids: category = re.match(self._pattern, file_id).group(1) self._add(file_id, category) elif self._map is not None: for (file_id, categories) in self._map.items(): for category in categories: self._add(file_id, category) elif self._file is not None: for line in self.open(self._file).readlines(): line = line.strip() file_id, categories = line.split(self._delimiter, 1) if file_id not in self.fileids(): raise ValueError('In category mapping file %s: %s ' 'not found' % (self._file, file_id)) for category in categories.split(self._delimiter): self._add(file_id, category) def _add(self, file_id, category): self._f2c[file_id].add(category) self._c2f[category].add(file_id) def categories(self, fileids=None): """ Return a list of the categories that are defined for this corpus, or for the file(s) if it is given. """ if self._f2c is None: self._init() if fileids is None: return sorted(self._c2f) if isinstance(fileids, compat.string_types): fileids = [fileids] return sorted(set.union(*[self._f2c[d] for d in fileids])) def fileids(self, categories=None): """ Return a list of file identifiers for the files that make up this corpus, or that make up the given category(s) if specified. """ if categories is None: return super(CategorizedCorpusReader, self).fileids() elif isinstance(categories, compat.string_types): if self._f2c is None: self._init() if categories in self._c2f: return sorted(self._c2f[categories]) else: raise ValueError('Category %s not found' % categories) else: if self._f2c is None: self._init() return sorted(set.union(*[self._c2f[c] for c in categories])) ###################################################################### #{ Treebank readers ###################################################################### #[xx] is it worth it to factor this out? class SyntaxCorpusReader(CorpusReader): """ An abstract base class for reading corpora consisting of syntactically parsed text. Subclasses should define: - ``__init__``, which specifies the location of the corpus and a method for detecting the sentence blocks in corpus files. - ``_read_block``, which reads a block from the input stream. - ``_word``, which takes a block and returns a list of list of words. - ``_tag``, which takes a block and returns a list of list of tagged words. - ``_parse``, which takes a block and returns a list of parsed sentences. """ def _parse(self, s): raise NotImplementedError() def _word(self, s): raise NotImplementedError() def _tag(self, s): raise NotImplementedError() def _read_block(self, stream): raise NotImplementedError() def raw(self, fileids=None): if fileids is None: fileids = self._fileids elif isinstance(fileids, compat.string_types): fileids = [fileids] return concat([self.open(f).read() for f in fileids]) def parsed_sents(self, fileids=None): reader = self._read_parsed_sent_block return concat([StreamBackedCorpusView(fileid, reader, encoding=enc) for fileid, enc in self.abspaths(fileids, True)]) def tagged_sents(self, fileids=None, simplify_tags=False): def reader(stream): return self._read_tagged_sent_block(stream, simplify_tags) return concat([StreamBackedCorpusView(fileid, reader, encoding=enc) for fileid, enc in self.abspaths(fileids, True)]) def sents(self, fileids=None): reader = self._read_sent_block return concat([StreamBackedCorpusView(fileid, reader, encoding=enc) for fileid, enc in self.abspaths(fileids, True)]) def tagged_words(self, fileids=None, simplify_tags=False): def reader(stream): return self._read_tagged_word_block(stream, simplify_tags) return concat([StreamBackedCorpusView(fileid, reader, encoding=enc) for fileid, enc in self.abspaths(fileids, True)]) def words(self, fileids=None): return concat([StreamBackedCorpusView(fileid, self._read_word_block, encoding=enc) for fileid, enc in self.abspaths(fileids, True)]) #------------------------------------------------------------ #{ Block Readers def _read_word_block(self, stream): return sum(self._read_sent_block(stream), []) def _read_tagged_word_block(self, stream, simplify_tags=False): return sum(self._read_tagged_sent_block(stream, simplify_tags), []) def _read_sent_block(self, stream): return list(filter(None, [self._word(t) for t in self._read_block(stream)])) def _read_tagged_sent_block(self, stream, simplify_tags=False): return list(filter(None, [self._tag(t, simplify_tags) for t in self._read_block(stream)])) def _read_parsed_sent_block(self, stream): return list(filter(None, [self._parse(t) for t in self._read_block(stream)])) #} End of Block Readers #------------------------------------------------------------
"""Undocumented Module""" __all__ = ['DirectGuiBase', 'DirectGuiWidget'] from panda3d.core import * from panda3d.direct import get_config_showbase from . import DirectGuiGlobals as DGG from .OnscreenText import * from .OnscreenGeom import * from .OnscreenImage import * from direct.directtools.DirectUtil import ROUND_TO from direct.showbase import DirectObject from direct.task import Task import sys if sys.version_info >= (3, 0): stringType = str else: stringType = basestring guiObjectCollector = PStatCollector("Client::GuiObjects") """ Base class for all Direct Gui items. Handles composite widgets and command line argument parsing. """ """ Code Overview: 1 Each widget defines a set of options (optiondefs) as a list of tuples of the form ('name', defaultValue, handler). 'name' is the name of the option (used during construction of configure) handler can be: None, method, or INITOPT. If a method is specified, it will be called during widget construction (via initialiseoptions), if the Handler is specified as an INITOPT, this is an option that can only be set during widget construction. 2) DirectGuiBase.defineoptions is called. defineoption creates: self._constructorKeywords = { keyword: [value, useFlag] } a dictionary of the keyword options specified as part of the constructor keywords can be of the form 'component_option', where component is the name of a widget's component, a component group or a component alias self._dynamicGroups, a list of group names for which it is permissible to specify options before components of that group are created. If a widget is a derived class the order of execution would be: foo.optiondefs = {} foo.defineoptions() fooParent() fooParent.optiondefs = {} fooParent.defineoptions() 3) addoptions is called. This combines options specified as keywords to the widget constructor (stored in self._constuctorKeywords) with the default options (stored in optiondefs). Results are stored in self._optionInfo = { keyword: [default, current, handler] } If a keyword is of the form 'component_option' it is left in the self._constructorKeywords dictionary (for use by component constructors), otherwise it is 'used', and deleted from self._constructorKeywords. Notes: - constructor keywords override the defaults. - derived class default values override parent class defaults - derived class handler functions override parent class functions 4) Superclass initialization methods are called (resulting in nested calls to define options (see 2 above) 5) Widget components are created via calls to self.createcomponent. User can specify aliases and groups for each component created. Aliases are alternate names for components, e.g. a widget may have a component with a name 'entryField', which itself may have a component named 'entry', you could add an alias 'entry' for the 'entryField_entry' These are stored in self.__componentAliases. If an alias is found, all keyword entries which use that alias are expanded to their full form (to avoid conversion later) Groups allow option specifications that apply to all members of the group. If a widget has components: 'text1', 'text2', and 'text3' which all belong to the 'text' group, they can be all configured with keywords of the form: 'text_keyword' (e.g. text_font = 'comic.rgb'). A component's group is stored as the fourth element of its entry in self.__componentInfo Note: the widget constructors have access to all remaining keywords in _constructorKeywords (those not transferred to _optionInfo by define/addoptions). If a component defines an alias that applies to one of the keywords, that keyword is replaced with a new keyword with the alias expanded. If a keyword (or substituted alias keyword) is used during creation of the component, it is deleted from self._constructorKeywords. If a group keyword applies to the component, that keyword is marked as used, but is not deleted from self._constructorKeywords, in case it applies to another component. If any constructor keywords remain at the end of component construction (and initialisation), an error is raised. 5) initialiseoptions is called. This method calls any option handlers to respond to any keyword/default values, then checks to see if any keywords are left unused. If so, an error is raised. """ class DirectGuiBase(DirectObject.DirectObject): def __init__(self): # Default id of all gui object, subclasses should override this self.guiId = 'guiObject' # List of all post initialization functions self.postInitialiseFuncList = [] # To avoid doing things redundantly during initialisation self.fInit = 1 # Mapping from each megawidget option to a list of information # about the option # - default value # - current value # - function to call when the option is initialised in the # call to initialiseoptions() in the constructor or # modified via configure(). If this is INITOPT, the # option is an initialisation option (an option that can # be set by the call to the constructor but can not be # used with configure). # This mapping is not initialised here, but in the call to # defineoptions() which precedes construction of this base class. # # self._optionInfo = {} # Mapping from each component name to a tuple of information # about the component. # - component widget instance # - configure function of widget instance # - the class of the widget (Frame, EntryField, etc) # - cget function of widget instance # - the name of the component group of this component, if any self.__componentInfo = {} # Mapping from alias names to the names of components or # sub-components. self.__componentAliases = {} # Contains information about the keywords provided to the # constructor. It is a mapping from the keyword to a tuple # containing: # - value of keyword # - a boolean indicating if the keyword has been used. # A keyword is used if, during the construction of a megawidget, # - it is defined in a call to defineoptions() or addoptions(), or # - it references, by name, a component of the megawidget, or # - it references, by group, at least one component # At the end of megawidget construction, a call is made to # initialiseoptions() which reports an error if there are # unused options given to the constructor. # # self._constructorKeywords = {} # List of dynamic component groups. If a group is included in # this list, then it not an error if a keyword argument for # the group is given to the constructor or to configure(), but # no components with this group have been created. # self._dynamicGroups = () def defineoptions(self, keywords, optionDefs, dynamicGroups = ()): """ defineoptions(keywords, optionDefs, dynamicGroups = {}) """ # Create options, providing the default value and the method # to call when the value is changed. If any option created by # base classes has the same name as one in <optionDefs>, the # base class's value and function will be overriden. # keywords is a dictionary of keyword/value pairs from the constructor # optionDefs is a dictionary of default options for the widget # dynamicGroups is a tuple of component groups for which you can # specify options even though no components of this group have # been created # This should be called before the constructor of the base # class, so that default values defined in the derived class # override those in the base class. if not hasattr(self, '_constructorKeywords'): tmp = {} for option, value in keywords.items(): tmp[option] = [value, 0] self._constructorKeywords = tmp self._optionInfo = {} # Initialize dictionary of dynamic groups if not hasattr(self, '_dynamicGroups'): self._dynamicGroups = () self._dynamicGroups = self._dynamicGroups + tuple(dynamicGroups) # Reconcile command line and default options self.addoptions(optionDefs, keywords) def addoptions(self, optionDefs, optionkeywords): """ addoptions(optionDefs) - add option def to option info """ # Add additional options, providing the default value and the # method to call when the value is changed. See # "defineoptions" for more details # optimisations: optionInfo = self._optionInfo optionInfo_has_key = optionInfo.__contains__ keywords = self._constructorKeywords keywords_has_key = keywords.__contains__ FUNCTION = DGG._OPT_FUNCTION for name, default, function in optionDefs: if '_' not in name: default = optionkeywords.get(name, default) # The option will already exist if it has been defined # in a derived class. In this case, do not override the # default value of the option or the callback function # if it is not None. if not optionInfo_has_key(name): if keywords_has_key(name): # Overridden by keyword, use keyword value value = keywords[name][0] optionInfo[name] = [default, value, function] # Delete it from self._constructorKeywords del keywords[name] else: # Use optionDefs value optionInfo[name] = [default, default, function] elif optionInfo[name][FUNCTION] is None: # Only override function if not defined by derived class optionInfo[name][FUNCTION] = function else: # This option is of the form "component_option". If this is # not already defined in self._constructorKeywords add it. # This allows a derived class to override the default value # of an option of a component of a base class. if not keywords_has_key(name): keywords[name] = [default, 0] def initialiseoptions(self, myClass): """ Call all initialisation functions to initialize widget options to default of keyword value """ # This is to make sure this method class is only called by # the most specific class in the class hierarchy if self.__class__ is myClass: # Call the configuration callback function for every option. FUNCTION = DGG._OPT_FUNCTION self.fInit = 1 for info in self._optionInfo.values(): func = info[FUNCTION] if func is not None and func is not DGG.INITOPT: func() self.fInit = 0 # Now check if anything is left over unusedOptions = [] keywords = self._constructorKeywords for name in keywords: used = keywords[name][1] if not used: # This keyword argument has not been used. If it # does not refer to a dynamic group, mark it as # unused. index = name.find('_') if index < 0 or name[:index] not in self._dynamicGroups: unusedOptions.append(name) self._constructorKeywords = {} if len(unusedOptions) > 0: if len(unusedOptions) == 1: text = 'Unknown option "' else: text = 'Unknown options "' raise KeyError(text + ', '.join(unusedOptions) + \ '" for ' + myClass.__name__) # Can now call post init func self.postInitialiseFunc() def postInitialiseFunc(self): for func in self.postInitialiseFuncList: func() def isinitoption(self, option): """ Is this opition one that can only be specified at construction? """ return self._optionInfo[option][DGG._OPT_FUNCTION] is DGG.INITOPT def options(self): """ Print out a list of available widget options. Does not include subcomponent options. """ options = [] if hasattr(self, '_optionInfo'): for option, info in self._optionInfo.items(): isinit = info[DGG._OPT_FUNCTION] is DGG.INITOPT default = info[DGG._OPT_DEFAULT] options.append((option, default, isinit)) options.sort() return options def configure(self, option=None, **kw): """ configure(option = None) Query or configure the megawidget options. """ # # If not empty, *kw* is a dictionary giving new # values for some of the options of this gui item # For options defined for this widget, set # the value of the option to the new value and call the # configuration callback function, if any. # # If *option* is None, return all gui item configuration # options and settings. Options are returned as standard 3 # element tuples # # If *option* is a string, return the 3 element tuple for the # given configuration option. # First, deal with the option queries. if len(kw) == 0: # This configure call is querying the values of one or all options. # Return 3-tuples: # (optionName, default, value) if option is None: rtn = {} for option, config in self._optionInfo.items(): rtn[option] = (option, config[DGG._OPT_DEFAULT], config[DGG._OPT_VALUE]) return rtn else: config = self._optionInfo[option] return (option, config[DGG._OPT_DEFAULT], config[DGG._OPT_VALUE]) # optimizations: optionInfo = self._optionInfo optionInfo_has_key = optionInfo.__contains__ componentInfo = self.__componentInfo componentInfo_has_key = componentInfo.__contains__ componentAliases = self.__componentAliases componentAliases_has_key = componentAliases.__contains__ VALUE = DGG._OPT_VALUE FUNCTION = DGG._OPT_FUNCTION # This will contain a list of options in *kw* which # are known to this gui item. directOptions = [] # This will contain information about the options in # *kw* of the form <component>_<option>, where # <component> is a component of this megawidget. It is a # dictionary whose keys are the configure method of each # component and whose values are a dictionary of options and # values for the component. indirectOptions = {} indirectOptions_has_key = indirectOptions.__contains__ for option, value in kw.items(): if optionInfo_has_key(option): # This is one of the options of this gui item. # Check it is an initialisation option. if optionInfo[option][FUNCTION] is DGG.INITOPT: print('Cannot configure initialisation option "' \ + option + '" for ' + self.__class__.__name__) break #raise KeyError, \ # 'Cannot configure initialisation option "' \ # + option + '" for ' + self.__class__.__name__ optionInfo[option][VALUE] = value directOptions.append(option) else: index = option.find('_') if index >= 0: # This option may be of the form <component>_<option>. # e.g. if alias ('efEntry', 'entryField_entry') # and option = efEntry_width # component = efEntry, componentOption = width component = option[:index] componentOption = option[(index + 1):] # Expand component alias if componentAliases_has_key(component): # component = entryField, subcomponent = entry component, subComponent = componentAliases[component] if subComponent is not None: # componentOption becomes entry_width componentOption = subComponent + '_' \ + componentOption # Expand option string to write on error # option = entryField_entry_width option = component + '_' + componentOption # Does this component exist if componentInfo_has_key(component): # Get the configure func for the named component # component = entryField componentConfigFuncs = [componentInfo[component][1]] else: # Check if this is a group name and configure all # components in the group. componentConfigFuncs = [] # For each component for info in componentInfo.values(): # Check if it is a member of this group if info[4] == component: # Yes, append its config func componentConfigFuncs.append(info[1]) if len(componentConfigFuncs) == 0 and \ component not in self._dynamicGroups: raise KeyError('Unknown option "' + option + \ '" for ' + self.__class__.__name__) # Add the configure method(s) (may be more than # one if this is configuring a component group) # and option/value to dictionary. for componentConfigFunc in componentConfigFuncs: if not indirectOptions_has_key(componentConfigFunc): indirectOptions[componentConfigFunc] = {} # Create a dictionary of keyword/values keyed # on configuration function indirectOptions[componentConfigFunc][componentOption] \ = value else: raise KeyError('Unknown option "' + option + \ '" for ' + self.__class__.__name__) # Call the configure methods for any components. # Pass in the dictionary of keyword/values created above for func, options in indirectOptions.items(): func(**options) # Call the configuration callback function for each option. for option in directOptions: info = optionInfo[option] func = info[DGG._OPT_FUNCTION] if func is not None: func() # Allow index style references def __setitem__(self, key, value): self.configure(**{key: value}) def cget(self, option): """ Get current configuration setting for this option """ # Return the value of an option, for example myWidget['font']. if option in self._optionInfo: return self._optionInfo[option][DGG._OPT_VALUE] else: index = option.find('_') if index >= 0: component = option[:index] componentOption = option[(index + 1):] # Expand component alias if component in self.__componentAliases: component, subComponent = self.__componentAliases[ component] if subComponent is not None: componentOption = subComponent + '_' + componentOption # Expand option string to write on error option = component + '_' + componentOption if component in self.__componentInfo: # Call cget on the component. componentCget = self.__componentInfo[component][3] return componentCget(componentOption) else: # If this is a group name, call cget for one of # the components in the group. for info in self.__componentInfo.values(): if info[4] == component: componentCget = info[3] return componentCget(componentOption) # Option not found raise KeyError('Unknown option "' + option + \ '" for ' + self.__class__.__name__) # Allow index style refererences __getitem__ = cget def createcomponent(self, componentName, componentAliases, componentGroup, widgetClass, *widgetArgs, **kw): """ Create a component (during construction or later) for this widget. """ # Check for invalid component name if '_' in componentName: raise ValueError('Component name "%s" must not contain "_"' % componentName) # Get construction keywords if hasattr(self, '_constructorKeywords'): keywords = self._constructorKeywords else: keywords = {} for alias, component in componentAliases: # Create aliases to the component and its sub-components. index = component.find('_') if index < 0: # Just a shorter name for one of this widget's components self.__componentAliases[alias] = (component, None) else: # An alias for a component of one of this widget's components mainComponent = component[:index] subComponent = component[(index + 1):] self.__componentAliases[alias] = (mainComponent, subComponent) # Remove aliases from the constructor keyword arguments by # replacing any keyword arguments that begin with *alias* # with corresponding keys beginning with *component*. alias = alias + '_' aliasLen = len(alias) for option in keywords.copy(): if len(option) > aliasLen and option[:aliasLen] == alias: newkey = component + '_' + option[aliasLen:] keywords[newkey] = keywords[option] del keywords[option] # Find any keyword arguments for this component componentPrefix = componentName + '_' nameLen = len(componentPrefix) # First, walk through the option list looking for arguments # than refer to this component's group. for option in keywords: # Check if this keyword argument refers to the group # of this component. If so, add this to the options # to use when constructing the widget. Mark the # keyword argument as being used, but do not remove it # since it may be required when creating another # component. index = option.find('_') if index >= 0 and componentGroup == option[:index]: rest = option[(index + 1):] kw[rest] = keywords[option][0] keywords[option][1] = 1 # Now that we've got the group arguments, walk through the # option list again and get out the arguments that refer to # this component specifically by name. These are more # specific than the group arguments, above; we walk through # the list afterwards so they will override. for option in keywords.copy(): if len(option) > nameLen and option[:nameLen] == componentPrefix: # The keyword argument refers to this component, so add # this to the options to use when constructing the widget. kw[option[nameLen:]] = keywords[option][0] # And delete it from main construction keywords del keywords[option] # Return None if no widget class is specified if widgetClass is None: return None # Get arguments for widget constructor if len(widgetArgs) == 1 and type(widgetArgs[0]) == tuple: # Arguments to the constructor can be specified as either # multiple trailing arguments to createcomponent() or as a # single tuple argument. widgetArgs = widgetArgs[0] # Create the widget widget = widgetClass(*widgetArgs, **kw) componentClass = widget.__class__.__name__ self.__componentInfo[componentName] = (widget, widget.configure, componentClass, widget.cget, componentGroup) return widget def component(self, name): # Return a component widget of the megawidget given the # component's name # This allows the user of a megawidget to access and configure # widget components directly. # Find the main component and any subcomponents index = name.find('_') if index < 0: component = name remainingComponents = None else: component = name[:index] remainingComponents = name[(index + 1):] # Expand component alias # Example entry which is an alias for entryField_entry if component in self.__componentAliases: # component = entryField, subComponent = entry component, subComponent = self.__componentAliases[component] if subComponent is not None: if remainingComponents is None: # remainingComponents = entry remainingComponents = subComponent else: remainingComponents = subComponent + '_' \ + remainingComponents # Get the component from __componentInfo dictionary widget = self.__componentInfo[component][0] if remainingComponents is None: # Not looking for subcomponent return widget else: # Recursive call on subcomponent return widget.component(remainingComponents) def components(self): # Return a list of all components. names = list(self.__componentInfo.keys()) names.sort() return names def hascomponent(self, component): return component in self.__componentInfo def destroycomponent(self, name): # Remove a megawidget component. # This command is for use by megawidget designers to destroy a # megawidget component. self.__componentInfo[name][0].destroy() del self.__componentInfo[name] def destroy(self): # Clean out any hooks self.ignoreAll() del self._optionInfo del self.__componentInfo del self.postInitialiseFuncList def bind(self, event, command, extraArgs = []): """ Bind the command (which should expect one arg) to the specified event (such as ENTER, EXIT, B1PRESS, B1CLICK, etc.) See DirectGuiGlobals for possible events """ # Need to tack on gui item specific id gEvent = event + self.guiId if get_config_showbase().GetBool('debug-directgui-msgs', False): from direct.showbase.PythonUtil import StackTrace print(gEvent) print(StackTrace()) self.accept(gEvent, command, extraArgs = extraArgs) def unbind(self, event): """ Unbind the specified event """ # Need to tack on gui item specific id gEvent = event + self.guiId self.ignore(gEvent) def toggleGuiGridSnap(): DirectGuiWidget.snapToGrid = 1 - DirectGuiWidget.snapToGrid def setGuiGridSpacing(spacing): DirectGuiWidget.gridSpacing = spacing class DirectGuiWidget(DirectGuiBase, NodePath): # Toggle if you wish widget's to snap to grid when draggin snapToGrid = 0 gridSpacing = 0.05 # Determine the default initial state for inactive (or # unclickable) components. If we are in edit mode, these are # actually clickable by default. guiEdit = get_config_showbase().GetBool('direct-gui-edit', 0) if guiEdit: inactiveInitState = DGG.NORMAL else: inactiveInitState = DGG.DISABLED guiDict = {} def __init__(self, parent = None, **kw): # Direct gui widgets are node paths # Direct gui widgets have: # - stateNodePaths (to hold visible representation of widget) # State node paths can have: # - a frame of type (None, FLAT, RAISED, GROOVE, RIDGE) # - arbitrary geometry for each state # They inherit from DirectGuiWidget # - Can create components (with aliases and groups) # - Can bind to mouse events # They inherit from NodePath # - Can position/scale them optiondefs = ( # Widget's constructor ('pgFunc', PGItem, None), ('numStates', 1, None), ('invertedFrames', (), None), ('sortOrder', 0, None), # Widget's initial state ('state', DGG.NORMAL, self.setState), # Widget's frame characteristics ('relief', DGG.FLAT, self.setRelief), ('borderWidth', (.1, .1), self.setBorderWidth), ('borderUvWidth', (.1, .1), self.setBorderUvWidth), ('frameSize', None, self.setFrameSize), ('frameColor', (.8, .8, .8, 1), self.setFrameColor), ('frameTexture', None, self.setFrameTexture), ('frameVisibleScale', (1, 1), self.setFrameVisibleScale), ('pad', (0, 0), self.resetFrameSize), # Override button id (beware! your name may not be unique!) ('guiId', None, DGG.INITOPT), # Initial pos/scale of the widget ('pos', None, DGG.INITOPT), ('hpr', None, DGG.INITOPT), ('scale', None, DGG.INITOPT), ('color', None, DGG.INITOPT), # Do events pass through this widget? ('suppressMouse', 1, DGG.INITOPT), ('suppressKeys', 0, DGG.INITOPT), ('enableEdit', 1, DGG.INITOPT), ) # Merge keyword options with default options self.defineoptions(kw, optiondefs) # Initialize the base classes (after defining the options). DirectGuiBase.__init__(self) NodePath.__init__(self) # Create a button self.guiItem = self['pgFunc']('') # Override automatically generated guiId if self['guiId']: self.guiItem.setId(self['guiId']) self.guiId = self.guiItem.getId() if __dev__: guiObjectCollector.addLevel(1) guiObjectCollector.flushLevel() # track gui items by guiId for tracking down leaks if hasattr(base, 'guiItems'): if self.guiId in base.guiItems: base.notify.warning('duplicate guiId: %s (%s stomping %s)' % (self.guiId, self, base.guiItems[self.guiId])) base.guiItems[self.guiId] = self if hasattr(base, 'printGuiCreates'): printStack() # Attach button to parent and make that self if (parent == None): parent = aspect2d self.assign(parent.attachNewNode(self.guiItem, self['sortOrder'])) # Update pose to initial values if self['pos']: self.setPos(self['pos']) if self['hpr']: self.setHpr(self['hpr']) if self['scale']: self.setScale(self['scale']) if self['color']: self.setColor(self['color']) # Initialize names # Putting the class name in helps with debugging. self.setName("%s-%s" % (self.__class__.__name__, self.guiId)) # Create self.stateNodePath = [] for i in range(self['numStates']): self.stateNodePath.append(NodePath(self.guiItem.getStateDef(i))) # Initialize frame style self.frameStyle = [] for i in range(self['numStates']): self.frameStyle.append(PGFrameStyle()) # For holding bounds info self.ll = Point3(0) self.ur = Point3(0) # Is drag and drop enabled? if self['enableEdit'] and self.guiEdit: self.enableEdit() # Set up event handling suppressFlags = 0 if self['suppressMouse']: suppressFlags |= MouseWatcherRegion.SFMouseButton suppressFlags |= MouseWatcherRegion.SFMousePosition if self['suppressKeys']: suppressFlags |= MouseWatcherRegion.SFOtherButton self.guiItem.setSuppressFlags(suppressFlags) # Bind destroy hook self.guiDict[self.guiId] = self # self.bind(DGG.DESTROY, self.destroy) # Update frame when everything has been initialized self.postInitialiseFuncList.append(self.frameInitialiseFunc) # Call option initialization functions self.initialiseoptions(DirectGuiWidget) def frameInitialiseFunc(self): # Now allow changes to take effect self.updateFrameStyle() if not self['frameSize']: self.resetFrameSize() def enableEdit(self): self.bind(DGG.B2PRESS, self.editStart) self.bind(DGG.B2RELEASE, self.editStop) self.bind(DGG.PRINT, self.printConfig) # Can we move this to showbase # Certainly we don't need to do this for every button! #mb = base.mouseWatcherNode.getModifierButtons() #mb.addButton(KeyboardButton.control()) #base.mouseWatcherNode.setModifierButtons(mb) def disableEdit(self): self.unbind(DGG.B2PRESS) self.unbind(DGG.B2RELEASE) self.unbind(DGG.PRINT) #mb = base.mouseWatcherNode.getModifierButtons() #mb.removeButton(KeyboardButton.control()) #base.mouseWatcherNode.setModifierButtons(mb) def editStart(self, event): taskMgr.remove('guiEditTask') vWidget2render2d = self.getPos(render2d) vMouse2render2d = Point3(event.getMouse()[0], 0, event.getMouse()[1]) editVec = Vec3(vWidget2render2d - vMouse2render2d) if base.mouseWatcherNode.getModifierButtons().isDown( KeyboardButton.control()): t = taskMgr.add(self.guiScaleTask, 'guiEditTask') t.refPos = vWidget2render2d t.editVecLen = editVec.length() t.initScale = self.getScale() else: t = taskMgr.add(self.guiDragTask, 'guiEditTask') t.editVec = editVec def guiScaleTask(self, state): mwn = base.mouseWatcherNode if mwn.hasMouse(): vMouse2render2d = Point3(mwn.getMouse()[0], 0, mwn.getMouse()[1]) newEditVecLen = Vec3(state.refPos - vMouse2render2d).length() self.setScale(state.initScale * (newEditVecLen/state.editVecLen)) return Task.cont def guiDragTask(self, state): mwn = base.mouseWatcherNode if mwn.hasMouse(): vMouse2render2d = Point3(mwn.getMouse()[0], 0, mwn.getMouse()[1]) newPos = vMouse2render2d + state.editVec self.setPos(render2d, newPos) if DirectGuiWidget.snapToGrid: newPos = self.getPos() newPos.set( ROUND_TO(newPos[0], DirectGuiWidget.gridSpacing), ROUND_TO(newPos[1], DirectGuiWidget.gridSpacing), ROUND_TO(newPos[2], DirectGuiWidget.gridSpacing)) self.setPos(newPos) return Task.cont def editStop(self, event): taskMgr.remove('guiEditTask') def setState(self): if type(self['state']) == type(0): self.guiItem.setActive(self['state']) elif (self['state'] == DGG.NORMAL) or (self['state'] == 'normal'): self.guiItem.setActive(1) else: self.guiItem.setActive(0) def resetFrameSize(self): if not self.fInit: self.setFrameSize(fClearFrame = 1) def setFrameSize(self, fClearFrame = 0): # Use ready state to determine frame Type frameType = self.getFrameType() if self['frameSize']: # Use user specified bounds self.bounds = self['frameSize'] #print "%s bounds = %s" % (self.getName(), self.bounds) bw = (0, 0) else: if fClearFrame and (frameType != PGFrameStyle.TNone): self.frameStyle[0].setType(PGFrameStyle.TNone) self.guiItem.setFrameStyle(0, self.frameStyle[0]) # To force an update of the button self.guiItem.getStateDef(0) # Clear out frame before computing bounds self.getBounds() # Restore frame style if necessary if (frameType != PGFrameStyle.TNone): self.frameStyle[0].setType(frameType) self.guiItem.setFrameStyle(0, self.frameStyle[0]) if ((frameType != PGFrameStyle.TNone) and (frameType != PGFrameStyle.TFlat)): bw = self['borderWidth'] else: bw = (0, 0) # Set frame to new dimensions self.guiItem.setFrame( self.bounds[0] - bw[0], self.bounds[1] + bw[0], self.bounds[2] - bw[1], self.bounds[3] + bw[1]) def getBounds(self, state = 0): self.stateNodePath[state].calcTightBounds(self.ll, self.ur) # Scale bounds to give a pad around graphics vec_right = Vec3.right() vec_up = Vec3.up() left = (vec_right[0] * self.ll[0] + vec_right[1] * self.ll[1] + vec_right[2] * self.ll[2]) right = (vec_right[0] * self.ur[0] + vec_right[1] * self.ur[1] + vec_right[2] * self.ur[2]) bottom = (vec_up[0] * self.ll[0] + vec_up[1] * self.ll[1] + vec_up[2] * self.ll[2]) top = (vec_up[0] * self.ur[0] + vec_up[1] * self.ur[1] + vec_up[2] * self.ur[2]) self.ll = Point3(left, 0.0, bottom) self.ur = Point3(right, 0.0, top) self.bounds = [self.ll[0] - self['pad'][0], self.ur[0] + self['pad'][0], self.ll[2] - self['pad'][1], self.ur[2] + self['pad'][1]] return self.bounds def getWidth(self): return self.bounds[1] - self.bounds[0] def getHeight(self): return self.bounds[3] - self.bounds[2] def getCenter(self): x = self.bounds[0] + (self.bounds[1] - self.bounds[0])/2.0 y = self.bounds[2] + (self.bounds[3] - self.bounds[2])/2.0 return (x, y) def getFrameType(self, state = 0): return self.frameStyle[state].getType() def updateFrameStyle(self): if not self.fInit: for i in range(self['numStates']): self.guiItem.setFrameStyle(i, self.frameStyle[i]) def setRelief(self, fSetStyle = 1): relief = self['relief'] # Convert None, and string arguments if relief == None: relief = PGFrameStyle.TNone elif isinstance(relief, stringType): # Convert string to frame style int relief = DGG.FrameStyleDict[relief] # Set style if relief == DGG.RAISED: for i in range(self['numStates']): if i in self['invertedFrames']: self.frameStyle[1].setType(DGG.SUNKEN) else: self.frameStyle[i].setType(DGG.RAISED) elif relief == DGG.SUNKEN: for i in range(self['numStates']): if i in self['invertedFrames']: self.frameStyle[1].setType(DGG.RAISED) else: self.frameStyle[i].setType(DGG.SUNKEN) else: for i in range(self['numStates']): self.frameStyle[i].setType(relief) # Apply styles self.updateFrameStyle() def setFrameColor(self): # this might be a single color or a list of colors colors = self['frameColor'] if type(colors[0]) == int or \ type(colors[0]) == float: colors = (colors,) for i in range(self['numStates']): if i >= len(colors): color = colors[-1] else: color = colors[i] self.frameStyle[i].setColor(color[0], color[1], color[2], color[3]) self.updateFrameStyle() def setFrameTexture(self): # this might be a single texture or a list of textures textures = self['frameTexture'] if textures == None or \ isinstance(textures, Texture) or \ isinstance(textures, stringType): textures = (textures,) * self['numStates'] for i in range(self['numStates']): if i >= len(textures): texture = textures[-1] else: texture = textures[i] if isinstance(texture, stringType): texture = loader.loadTexture(texture) if texture: self.frameStyle[i].setTexture(texture) else: self.frameStyle[i].clearTexture() self.updateFrameStyle() def setFrameVisibleScale(self): scale = self['frameVisibleScale'] for i in range(self['numStates']): self.frameStyle[i].setVisibleScale(scale[0], scale[1]) self.updateFrameStyle() def setBorderWidth(self): width = self['borderWidth'] for i in range(self['numStates']): self.frameStyle[i].setWidth(width[0], width[1]) self.updateFrameStyle() def setBorderUvWidth(self): uvWidth = self['borderUvWidth'] for i in range(self['numStates']): self.frameStyle[i].setUvWidth(uvWidth[0], uvWidth[1]) self.updateFrameStyle() def destroy(self): if hasattr(self, "frameStyle"): if __dev__: guiObjectCollector.subLevel(1) guiObjectCollector.flushLevel() if hasattr(base, 'guiItems'): if self.guiId in base.guiItems: del base.guiItems[self.guiId] else: base.notify.warning( 'DirectGuiWidget.destroy(): ' 'gui item %s not in base.guiItems' % self.guiId) # Destroy children for child in self.getChildren(): childGui = self.guiDict.get(child.getName()) if childGui: childGui.destroy() else: # RAU since we added the class to the name, try # it with the original name parts = child.getName().split('-') simpleChildGui = self.guiDict.get(parts[-1]) if simpleChildGui: simpleChildGui.destroy() # messenger.send(DESTROY + child.getName()) del self.guiDict[self.guiId] del self.frameStyle # Get rid of node path self.removeNode() for nodePath in self.stateNodePath: nodePath.removeNode() del self.stateNodePath del self.guiItem # Call superclass destruction method (clears out hooks) DirectGuiBase.destroy(self) def printConfig(self, indent = 0): space = ' ' * indent print('%s%s - %s' % (space, self.guiId, self.__class__.__name__)) print('%sPos: %s' % (space, tuple(self.getPos()))) print('%sScale: %s' % (space, tuple(self.getScale()))) # Print out children info for child in self.getChildren(): messenger.send(DGG.PRINT + child.getName(), [indent + 2]) def copyOptions(self, other): """ Copy other's options into our self so we look and feel like other """ for key, value in other._optionInfo.items(): self[key] = value[1] def taskName(self, idString): return (idString + "-" + str(self.guiId)) def uniqueName(self, idString): return (idString + "-" + str(self.guiId)) def setProp(self, propString, value): """ Allows you to set a property like frame['text'] = 'Joe' in a function instead of an assignment. This is useful for setting properties inside function intervals where must input a function and extraArgs, not an assignment. """ self[propString] = value
# Copyright 2020 The Chromium Authors. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. """Test apps for running tests using xcodebuild.""" import os import plistlib import struct import subprocess import time import shard_util import test_runner import test_runner_errors import xcode_util OUTPUT_DISABLED_TESTS_TEST_ARG = '--write-compiled-tests-json-to-writable-path' def get_gtest_filter(tests, invert=False): """Returns the GTest filter to filter the given test cases. Args: tests: List of test cases to filter. invert: Whether to invert the filter or not. Inverted, the filter will match everything except the given test cases. Returns: A string which can be supplied to --gtest_filter. """ # A colon-separated list of tests cases. # e.g. a:b:c matches a, b, c. # e.g. -a:b:c matches everything except a, b, c. test_filter = ':'.join(test for test in tests) if invert: return '-%s' % test_filter return test_filter def get_bundle_id(app_path): """Get bundle identifier for app. Args: app_path: (str) A path to app. """ return subprocess.check_output([ '/usr/libexec/PlistBuddy', '-c', 'Print:CFBundleIdentifier', os.path.join(app_path, 'Info.plist'), ]).rstrip().decode("utf-8") def is_running_rosetta(): """Returns whether Python is being translated by Rosetta. Returns: True if the Python interpreter is being run as an x86_64 binary on an arm64 macOS machine. False if it is running as an arm64 binary, or if it is running on an Intel machine. """ translated = subprocess.check_output( ['sysctl', '-i', '-b', 'sysctl.proc_translated']) # "sysctl -b" is expected to return a 4-byte integer response. 1 means the # current process is running under Rosetta, 0 means it is not. On x86_64 # machines, this variable does not exist at all, so "-i" is used to return a # 0-byte response instead of throwing an error. if len(translated) != 4: return False return struct.unpack('i', translated)[0] > 0 class GTestsApp(object): """Gtests app to run. Stores data about egtests: test_app: full path to an app. """ def __init__(self, test_app, **kwargs): """Initialize Egtests. Args: test_app: (str) full path to egtests app. (Following are potential args in **kwargs) included_tests: (list) Specific tests to run E.g. [ 'TestCaseClass1/testMethod1', 'TestCaseClass2/testMethod2'] excluded_tests: (list) Specific tests not to run E.g. [ 'TestCaseClass1', 'TestCaseClass2/testMethod2'] test_args: List of strings to pass as arguments to the test when launching. env_vars: List of environment variables to pass to the test itself. release: (bool) Whether the app is release build. repeat_count: (int) Number of times to run each test case. inserted_libs: List of libraries to insert when running the test. Raises: AppNotFoundError: If the given app does not exist """ if not os.path.exists(test_app): raise test_runner.AppNotFoundError(test_app) self.test_app_path = test_app self.project_path = os.path.dirname(self.test_app_path) self.test_args = kwargs.get('test_args') or [] self.env_vars = {} for env_var in kwargs.get('env_vars') or []: env_var = env_var.split('=', 1) self.env_vars[env_var[0]] = None if len(env_var) == 1 else env_var[1] # Keep the initial included tests since creating target. Do not modify. self.initial_included_tests = kwargs.get('included_tests') or [] # This may be modified between test launches. self.included_tests = kwargs.get('included_tests') or [] # This may be modified between test launches. self.excluded_tests = kwargs.get('excluded_tests') or [] self.disabled_tests = [] self.module_name = os.path.splitext(os.path.basename(test_app))[0] self.release = kwargs.get('release') self.repeat_count = kwargs.get('repeat_count') or 1 self.host_app_path = kwargs.get('host_app_path') self.inserted_libs = kwargs.get('inserted_libs') or [] def fill_xctest_run(self, out_dir): """Fills xctestrun file by egtests. Args: out_dir: (str) A path where xctestrun will store. Returns: A path to xctestrun file. """ folder = os.path.abspath(os.path.join(out_dir, os.pardir)) if not os.path.exists(folder): os.makedirs(folder) xctestrun = os.path.join(folder, 'run_%d.xctestrun' % int(time.time())) if not os.path.exists(xctestrun): with open(xctestrun, 'w'): pass # Creates a dict with data about egtests to run - fill all required fields: # egtests_module, egtest_app_path, egtests_xctest_path and # filtered tests if filter is specified. # Write data in temp xctest run file. plistlib.writePlist(self.fill_xctestrun_node(), xctestrun) return xctestrun def fill_xctestrun_node(self): """Fills only required nodes for egtests in xctestrun file. Returns: A node with filled required fields about egtests. """ module = self.module_name + '_module' # If --run-with-custom-webkit is passed as a test arg, set up # DYLD_FRAMEWORK_PATH and DYLD_LIBRARY_PATH to load the custom webkit # modules. dyld_path = self.project_path if '--run-with-custom-webkit' in self.test_args: if self.host_app_path: webkit_path = os.path.join(self.host_app_path, 'WebKitFrameworks') else: webkit_path = os.path.join(self.test_app_path, 'WebKitFrameworks') dyld_path = dyld_path + ':' + webkit_path module_data = { 'TestBundlePath': self.test_app_path, 'TestHostPath': self.test_app_path, 'TestHostBundleIdentifier': get_bundle_id(self.test_app_path), 'TestingEnvironmentVariables': { 'DYLD_LIBRARY_PATH': '%s:__PLATFORMS__/iPhoneSimulator.platform/Developer/Library' % dyld_path, 'DYLD_FRAMEWORK_PATH': '%s:__PLATFORMS__/iPhoneSimulator.platform/' 'Developer/Library/Frameworks' % dyld_path, } } if self.inserted_libs: module_data['TestingEnvironmentVariables'][ 'DYLD_INSERT_LIBRARIES'] = ':'.join(self.inserted_libs) xctestrun_data = {module: module_data} gtest_filter = [] if self.included_tests: gtest_filter = get_gtest_filter(self.included_tests, invert=False) elif self.excluded_tests: gtest_filter = get_gtest_filter(self.excluded_tests, invert=True) if gtest_filter: # Removed previous gtest-filter if exists. self.test_args = [el for el in self.test_args if not el.startswith('--gtest_filter=')] self.test_args.append('--gtest_filter=%s' % gtest_filter) if self.repeat_count > 1: self.test_args.append('--gtest_repeat=%s' % self.repeat_count) if self.env_vars: xctestrun_data[module].update({'EnvironmentVariables': self.env_vars}) if self.test_args: xctestrun_data[module].update({'CommandLineArguments': self.test_args}) if self.excluded_tests: xctestrun_data[module].update({ 'SkipTestIdentifiers': self.excluded_tests }) if self.included_tests: xctestrun_data[module].update({ 'OnlyTestIdentifiers': self.included_tests }) return xctestrun_data def command(self, out_dir, destination, shards): """Returns the command that launches tests using xcodebuild. Format of command: xcodebuild test-without-building -xctestrun file.xctestrun \ -parallel-testing-enabled YES -parallel-testing-worker-count %d% \ [-destination "destination"] -resultBundlePath %output_path% Args: out_dir: (str) An output directory. destination: (str) A destination of running simulator. shards: (int) A number of shards. Returns: A list of strings forming the command to launch the test. """ cmd = [] if is_running_rosetta(): cmd.extend(['arch', '-arch', 'arm64']) cmd.extend([ 'xcodebuild', 'test-without-building', '-xctestrun', self.fill_xctest_run(out_dir), '-destination', destination, '-resultBundlePath', out_dir ]) if shards > 1: cmd.extend([ '-parallel-testing-enabled', 'YES', '-parallel-testing-worker-count', str(shards) ]) return cmd def get_all_tests(self): """Gets all tests to run in this object.""" # Method names that starts with test* and also are in *TestCase classes # but they are not test-methods. # TODO(crbug.com/982435): Rename not test methods with test-suffix. non_test_prefixes = [ 'ChromeTestCase/testServer', 'FindInPageTestCase/testURL', 'setUpForTestCase' ] # TODO(crbug.com/1123681): Move all_tests to class var. Set all_tests, # disabled_tests values in initialization to avoid multiple calls to otool. all_tests = [] # Only store the tests when there is the test arg. store_disabled_tests = OUTPUT_DISABLED_TESTS_TEST_ARG in self.test_args self.disabled_tests = [] for test_class, test_method in shard_util.fetch_test_names( self.test_app_path, self.host_app_path, self.release, enabled_tests_only=False): test_name = '%s/%s' % (test_class, test_method) if any(test_name.startswith(prefix) for prefix in non_test_prefixes): continue # |self.initial_included_tests| contains the tests to execute, which # may be a subset of all tests b/c of the iOS test sharding logic in # run.py. Filter by |self.initial_included_tests| if specified. # |self.initial_included_tests| might store test class or full name. included = self.initial_included_tests if not included or test_name in included or test_class in included: if test_method.startswith('test'): all_tests.append(test_name) elif store_disabled_tests: self.disabled_tests.append(test_name) return all_tests class EgtestsApp(GTestsApp): """Egtests to run. Stores data about egtests: egtests_app: full path to egtests app. project_path: root project folder. module_name: egtests module name. included_tests: List of tests to run. excluded_tests: List of tests not to run. """ def __init__(self, egtests_app, **kwargs): """Initialize Egtests. Args: egtests_app: (str) full path to egtests app. (Following are potential args in **kwargs) included_tests: (list) Specific tests to run E.g. [ 'TestCaseClass1/testMethod1', 'TestCaseClass2/testMethod2'] excluded_tests: (list) Specific tests not to run E.g. [ 'TestCaseClass1', 'TestCaseClass2/testMethod2'] test_args: List of strings to pass as arguments to the test when launching. env_vars: List of environment variables to pass to the test itself. host_app_path: (str) full path to host app. inserted_libs: List of libraries to insert when running the test. repeat_count: (int) Number of times to run each test case. Raises: AppNotFoundError: If the given app does not exist """ inserted_libs = list(kwargs.get('inserted_libs') or []) inserted_libs.append('__PLATFORMS__/iPhoneSimulator.platform/Developer/' 'usr/lib/libXCTestBundleInject.dylib') kwargs['inserted_libs'] = inserted_libs super(EgtestsApp, self).__init__(egtests_app, **kwargs) def _xctest_path(self): """Gets xctest-file from egtests/PlugIns folder. Returns: A path for xctest in the format of /PlugIns/file.xctest Raises: PlugInsNotFoundError: If no PlugIns folder found in egtests.app. XCTestPlugInNotFoundError: If no xctest-file found in PlugIns. """ plugins_dir = os.path.join(self.test_app_path, 'PlugIns') if not os.path.exists(plugins_dir): raise test_runner.PlugInsNotFoundError(plugins_dir) plugin_xctest = None if os.path.exists(plugins_dir): for plugin in os.listdir(plugins_dir): if plugin.endswith('.xctest'): plugin_xctest = os.path.join(plugins_dir, plugin) if not plugin_xctest: raise test_runner.XCTestPlugInNotFoundError(plugin_xctest) return plugin_xctest.replace(self.test_app_path, '') def command(self, out_dir, destination, shards): """Returns the command that launches tests for EG Tests. See details in parent class method docstring. This method appends the command line switch if test repeat is required. """ cmd = super(EgtestsApp, self).command(out_dir, destination, shards) if self.repeat_count > 1: if xcode_util.using_xcode_13_or_higher(): cmd += ['-test-iterations', str(self.repeat_count)] else: raise test_runner_errors.XcodeUnsupportedFeatureError( 'Test repeat is only supported in Xcode 13 or higher!') return cmd def fill_xctestrun_node(self): """Fills only required nodes for egtests in xctestrun file. Returns: A node with filled required fields about egtests. """ xctestrun_data = super(EgtestsApp, self).fill_xctestrun_node() module_data = xctestrun_data[self.module_name + '_module'] module_data['TestBundlePath'] = '__TESTHOST__%s' % self._xctest_path() module_data['TestingEnvironmentVariables'][ 'XCInjectBundleInto'] = '__TESTHOST__/%s' % self.module_name if self.host_app_path: # Module data specific to EG2 tests module_data['IsUITestBundle'] = True module_data['IsXCTRunnerHostedTestBundle'] = True module_data['UITargetAppPath'] = '%s' % self.host_app_path # Special handling for Xcode10.2 dependent_products = [ module_data['UITargetAppPath'], module_data['TestBundlePath'], module_data['TestHostPath'] ] module_data['DependentProductPaths'] = dependent_products # Module data specific to EG1 tests else: module_data['IsAppHostedTestBundle'] = True return xctestrun_data class DeviceXCTestUnitTestsApp(GTestsApp): """XCTest hosted unit tests to run on devices. This is for the XCTest framework hosted unit tests running on devices. Stores data about tests: tests_app: full path to tests app. project_path: root project folder. module_name: egtests module name. included_tests: List of tests to run. excluded_tests: List of tests not to run. """ def __init__(self, tests_app, **kwargs): """Initialize the class. Args: tests_app: (str) full path to tests app. (Following are potential args in **kwargs) included_tests: (list) Specific tests to run E.g. [ 'TestCaseClass1/testMethod1', 'TestCaseClass2/testMethod2'] excluded_tests: (list) Specific tests not to run E.g. [ 'TestCaseClass1', 'TestCaseClass2/testMethod2'] test_args: List of strings to pass as arguments to the test when launching. Test arg to run as XCTest based unit test will be appended. env_vars: List of environment variables to pass to the test itself. repeat_count: (int) Number of times to run each test case. Raises: AppNotFoundError: If the given app does not exist """ test_args = list(kwargs.get('test_args') or []) test_args.append('--enable-run-ios-unittests-with-xctest') kwargs['test_args'] = test_args super(DeviceXCTestUnitTestsApp, self).__init__(tests_app, **kwargs) # TODO(crbug.com/1077277): Refactor class structure and remove duplicate code. def _xctest_path(self): """Gets xctest-file from egtests/PlugIns folder. Returns: A path for xctest in the format of /PlugIns/file.xctest Raises: PlugInsNotFoundError: If no PlugIns folder found in egtests.app. XCTestPlugInNotFoundError: If no xctest-file found in PlugIns. """ plugins_dir = os.path.join(self.test_app_path, 'PlugIns') if not os.path.exists(plugins_dir): raise test_runner.PlugInsNotFoundError(plugins_dir) plugin_xctest = None if os.path.exists(plugins_dir): for plugin in os.listdir(plugins_dir): if plugin.endswith('.xctest'): plugin_xctest = os.path.join(plugins_dir, plugin) if not plugin_xctest: raise test_runner.XCTestPlugInNotFoundError(plugin_xctest) return plugin_xctest.replace(self.test_app_path, '') def fill_xctestrun_node(self): """Fills only required nodes for XCTest hosted unit tests in xctestrun file. Returns: A node with filled required fields about tests. """ xctestrun_data = { 'TestTargetName': { 'IsAppHostedTestBundle': True, 'TestBundlePath': '__TESTHOST__%s' % self._xctest_path(), 'TestHostBundleIdentifier': get_bundle_id(self.test_app_path), 'TestHostPath': '%s' % self.test_app_path, 'TestingEnvironmentVariables': { 'DYLD_INSERT_LIBRARIES': '__TESTHOST__/Frameworks/libXCTestBundleInject.dylib', 'DYLD_LIBRARY_PATH': '__PLATFORMS__/iPhoneOS.platform/Developer/Library', 'DYLD_FRAMEWORK_PATH': '__PLATFORMS__/iPhoneOS.platform/Developer/' 'Library/Frameworks', 'XCInjectBundleInto': '__TESTHOST__/%s' % self.module_name } } } if self.env_vars: self.xctestrun_data['TestTargetName'].update( {'EnvironmentVariables': self.env_vars}) gtest_filter = [] if self.included_tests: gtest_filter = get_gtest_filter(self.included_tests, invert=False) elif self.excluded_tests: gtest_filter = get_gtest_filter(self.excluded_tests, invert=True) if gtest_filter: # Removed previous gtest-filter if exists. self.test_args = [ el for el in self.test_args if not el.startswith('--gtest_filter=') ] self.test_args.append('--gtest_filter=%s' % gtest_filter) self.test_args.append('--gmock_verbose=error') xctestrun_data['TestTargetName'].update( {'CommandLineArguments': self.test_args}) return xctestrun_data class SimulatorXCTestUnitTestsApp(GTestsApp): """XCTest hosted unit tests to run on simulators. This is for the XCTest framework hosted unit tests running on simulators. Stores data about tests: tests_app: full path to tests app. project_path: root project folder. module_name: egtests module name. included_tests: List of tests to run. excluded_tests: List of tests not to run. """ def __init__(self, tests_app, **kwargs): """Initialize the class. Args: tests_app: (str) full path to tests app. (Following are potential args in **kwargs) included_tests: (list) Specific tests to run E.g. [ 'TestCaseClass1/testMethod1', 'TestCaseClass2/testMethod2'] excluded_tests: (list) Specific tests not to run E.g. [ 'TestCaseClass1', 'TestCaseClass2/testMethod2'] test_args: List of strings to pass as arguments to the test when launching. Test arg to run as XCTest based unit test will be appended. env_vars: List of environment variables to pass to the test itself. repeat_count: (int) Number of times to run each test case. Raises: AppNotFoundError: If the given app does not exist """ test_args = list(kwargs.get('test_args') or []) test_args.append('--enable-run-ios-unittests-with-xctest') kwargs['test_args'] = test_args super(SimulatorXCTestUnitTestsApp, self).__init__(tests_app, **kwargs) # TODO(crbug.com/1077277): Refactor class structure and remove duplicate code. def _xctest_path(self): """Gets xctest-file from egtests/PlugIns folder. Returns: A path for xctest in the format of /PlugIns/file.xctest Raises: PlugInsNotFoundError: If no PlugIns folder found in egtests.app. XCTestPlugInNotFoundError: If no xctest-file found in PlugIns. """ plugins_dir = os.path.join(self.test_app_path, 'PlugIns') if not os.path.exists(plugins_dir): raise test_runner.PlugInsNotFoundError(plugins_dir) plugin_xctest = None if os.path.exists(plugins_dir): for plugin in os.listdir(plugins_dir): if plugin.endswith('.xctest'): plugin_xctest = os.path.join(plugins_dir, plugin) if not plugin_xctest: raise test_runner.XCTestPlugInNotFoundError(plugin_xctest) return plugin_xctest.replace(self.test_app_path, '') def fill_xctestrun_node(self): """Fills only required nodes for XCTest hosted unit tests in xctestrun file. Returns: A node with filled required fields about tests. """ xctestrun_data = { 'TestTargetName': { 'IsAppHostedTestBundle': True, 'TestBundlePath': '__TESTHOST__%s' % self._xctest_path(), 'TestHostBundleIdentifier': get_bundle_id(self.test_app_path), 'TestHostPath': '%s' % self.test_app_path, 'TestingEnvironmentVariables': { 'DYLD_INSERT_LIBRARIES': '__PLATFORMS__/iPhoneSimulator.platform/Developer/usr/lib/' 'libXCTestBundleInject.dylib', 'DYLD_LIBRARY_PATH': '__PLATFORMS__/iPhoneSimulator.platform/Developer/Library', 'DYLD_FRAMEWORK_PATH': '__PLATFORMS__/iPhoneSimulator.platform/Developer/' 'Library/Frameworks', 'XCInjectBundleInto': '__TESTHOST__/%s' % self.module_name } } } if self.env_vars: self.xctestrun_data['TestTargetName'].update( {'EnvironmentVariables': self.env_vars}) gtest_filter = [] if self.included_tests: gtest_filter = get_gtest_filter(self.included_tests, invert=False) elif self.excluded_tests: gtest_filter = get_gtest_filter(self.excluded_tests, invert=True) if gtest_filter: # Removed previous gtest-filter if exists. self.test_args = [ el for el in self.test_args if not el.startswith('--gtest_filter=') ] self.test_args.append('--gtest_filter=%s' % gtest_filter) self.test_args.append('--gmock_verbose=error') xctestrun_data['TestTargetName'].update( {'CommandLineArguments': self.test_args}) return xctestrun_data
import functools import hashlib import json import random import uuid from operator import attrgetter from django import http from django.conf import settings from django.db.models import Q from django.shortcuts import (get_list_or_404, get_object_or_404, redirect, render) from django.utils.translation import trans_real as translation from django.views.decorators.cache import cache_control from django.views.decorators.csrf import csrf_exempt from django.views.decorators.vary import vary_on_headers import caching.base as caching import jinja2 import commonware.log import session_csrf from tower import ugettext as _, ugettext_lazy as _lazy import waffle from mobility.decorators import mobilized, mobile_template import amo from amo import messages from amo.decorators import post_required from amo.forms import AbuseForm from amo.utils import randslice, sorted_groupby from amo.models import manual_order from amo import urlresolvers from amo.urlresolvers import reverse from abuse.models import send_abuse_report from bandwagon.models import Collection, CollectionFeature, CollectionPromo import paypal from reviews.forms import ReviewForm from reviews.models import Review, GroupedRating from session_csrf import anonymous_csrf_exempt from sharing.views import share as share_redirect from stats.models import Contribution from translations.query import order_by_translation from versions.models import Version from .forms import ContributionForm from .models import Addon, Persona, FrozenAddon from .decorators import addon_view_factory log = commonware.log.getLogger('z.addons') paypal_log = commonware.log.getLogger('z.paypal') addon_view = addon_view_factory(qs=Addon.objects.valid) addon_unreviewed_view = addon_view_factory(qs=Addon.objects.unreviewed) addon_valid_disabled_pending_view = addon_view_factory( qs=Addon.objects.valid_and_disabled_and_pending) def author_addon_clicked(f): """Decorator redirecting clicks on "Other add-ons by author".""" @functools.wraps(f) def decorated(request, *args, **kwargs): redirect_id = request.GET.get('addons-author-addons-select', None) if not redirect_id: return f(request, *args, **kwargs) try: target_id = int(redirect_id) return http.HttpResponsePermanentRedirect(reverse( 'addons.detail', args=[target_id])) except ValueError: return http.HttpResponseBadRequest('Invalid add-on ID.') return decorated @addon_valid_disabled_pending_view def addon_detail(request, addon): """Add-ons details page dispatcher.""" if addon.is_deleted or (addon.is_pending() and not addon.is_persona()): # Allow pending themes to be listed. raise http.Http404 if addon.is_disabled: return render(request, 'addons/impala/disabled.html', {'addon': addon}, status=404) # addon needs to have a version and be valid for this app. if addon.type in request.APP.types: if addon.type == amo.ADDON_PERSONA: return persona_detail(request, addon) else: if not addon.current_version: raise http.Http404 return extension_detail(request, addon) else: # Redirect to an app that supports this type. try: new_app = [a for a in amo.APP_USAGE if addon.type in a.types][0] except IndexError: raise http.Http404 else: prefixer = urlresolvers.get_url_prefix() prefixer.app = new_app.short return http.HttpResponsePermanentRedirect(reverse( 'addons.detail', args=[addon.slug])) @vary_on_headers('X-Requested-With') def extension_detail(request, addon): """Extensions details page.""" # If current version is incompatible with this app, redirect. comp_apps = addon.compatible_apps if comp_apps and request.APP not in comp_apps: prefixer = urlresolvers.get_url_prefix() prefixer.app = comp_apps.keys()[0].short return redirect('addons.detail', addon.slug, permanent=True) # Addon recommendations. recommended = Addon.objects.listed(request.APP).filter( recommended_for__addon=addon)[:6] # Popular collections this addon is part of. collections = Collection.objects.listed().filter( addons=addon, application__id=request.APP.id) ctx = { 'addon': addon, 'src': request.GET.get('src', 'dp-btn-primary'), 'version_src': request.GET.get('src', 'dp-btn-version'), 'tags': addon.tags.not_blacklisted(), 'grouped_ratings': GroupedRating.get(addon.id), 'recommendations': recommended, 'review_form': ReviewForm(), 'reviews': Review.objects.valid().filter(addon=addon, is_latest=True), 'get_replies': Review.get_replies, 'collections': collections.order_by('-subscribers')[:3], 'abuse_form': AbuseForm(request=request), } # details.html just returns the top half of the page for speed. The bottom # does a lot more queries we don't want on the initial page load. if request.is_ajax(): # Other add-ons/apps from the same author(s). ctx['author_addons'] = addon.authors_other_addons(app=request.APP)[:6] return render(request, 'addons/impala/details-more.html', ctx) else: return render(request, 'addons/impala/details.html', ctx) @mobilized(extension_detail) def extension_detail(request, addon): return render(request, 'addons/mobile/details.html', {'addon': addon}) def _category_personas(qs, limit): f = lambda: randslice(qs, limit=limit) key = 'cat-personas:' + qs.query_key() return caching.cached(f, key) @mobile_template('addons/{mobile/}persona_detail.html') def persona_detail(request, addon, template=None): """Details page for Personas.""" if not (addon.is_public() or addon.is_pending()): raise http.Http404 persona = addon.persona # This persona's categories. categories = addon.categories.all() category_personas = None if categories.exists(): qs = Addon.objects.public().filter(categories=categories[0]) category_personas = _category_personas(qs, limit=6) data = { 'addon': addon, 'persona': persona, 'categories': categories, 'author_personas': persona.authors_other_addons()[:3], 'category_personas': category_personas, } try: author = addon.authors.all()[0] except IndexError: author = None else: author = author.get_url_path(src='addon-detail') data['author_gallery'] = author if not request.MOBILE: # tags dev_tags, user_tags = addon.tags_partitioned_by_developer data.update({ 'dev_tags': dev_tags, 'user_tags': user_tags, 'review_form': ReviewForm(), 'reviews': Review.objects.valid().filter(addon=addon, is_latest=True), 'get_replies': Review.get_replies, 'search_cat': 'themes', 'abuse_form': AbuseForm(request=request), }) return render(request, template, data) class BaseFilter(object): """ Filters help generate querysets for add-on listings. You have to define ``opts`` on the subclass as a sequence of (key, title) pairs. The key is used in GET parameters and the title can be used in the view. The chosen filter field is combined with the ``base`` queryset using the ``key`` found in request.GET. ``default`` should be a key in ``opts`` that's used if nothing good is found in request.GET. """ def __init__(self, request, base, key, default, model=Addon): self.opts_dict = dict(self.opts) self.extras_dict = dict(self.extras) if hasattr(self, 'extras') else {} self.request = request self.base_queryset = base self.key = key self.model = model self.field, self.title = self.options(self.request, key, default) self.qs = self.filter(self.field) def options(self, request, key, default): """Get the (option, title) pair we want according to the request.""" if key in request.GET and (request.GET[key] in self.opts_dict or request.GET[key] in self.extras_dict): opt = request.GET[key] else: opt = default if opt in self.opts_dict: title = self.opts_dict[opt] else: title = self.extras_dict[opt] return opt, title def all(self): """Get a full mapping of {option: queryset}.""" return dict((field, self.filter(field)) for field in dict(self.opts)) def filter(self, field): """Get the queryset for the given field.""" filter = self._filter(field) & self.base_queryset order = getattr(self, 'order_%s' % field, None) if order: return order(filter) return filter def _filter(self, field): return getattr(self, 'filter_%s' % field)() def filter_featured(self): ids = self.model.featured_random(self.request.APP, self.request.LANG) return manual_order(self.model.objects, ids, 'addons.id') def filter_free(self): if self.model == Addon: return self.model.objects.top_free(self.request.APP, listed=False) else: return self.model.objects.top_free(listed=False) def filter_paid(self): if self.model == Addon: return self.model.objects.top_paid(self.request.APP, listed=False) else: return self.model.objects.top_paid(listed=False) def filter_popular(self): return (self.model.objects.order_by('-weekly_downloads') .with_index(addons='downloads_type_idx')) def filter_downloads(self): return self.filter_popular() def filter_users(self): return (self.model.objects.order_by('-average_daily_users') .with_index(addons='adus_type_idx')) def filter_created(self): return (self.model.objects.order_by('-created') .with_index(addons='created_type_idx')) def filter_updated(self): return (self.model.objects.order_by('-last_updated') .with_index(addons='last_updated_type_idx')) def filter_rating(self): return (self.model.objects.order_by('-bayesian_rating') .with_index(addons='rating_type_idx')) def filter_hotness(self): return self.model.objects.order_by('-hotness') def filter_name(self): return order_by_translation(self.model.objects.all(), 'name') class ESBaseFilter(BaseFilter): """BaseFilter that uses elasticsearch.""" def __init__(self, request, base, key, default): super(ESBaseFilter, self).__init__(request, base, key, default) def filter(self, field): sorts = {'name': 'name_sort', 'created': '-created', 'updated': '-last_updated', 'popular': '-weekly_downloads', 'users': '-average_daily_users', 'rating': '-bayesian_rating'} return self.base_queryset.order_by(sorts[field]) class HomepageFilter(BaseFilter): opts = (('featured', _lazy(u'Featured')), ('popular', _lazy(u'Popular')), ('new', _lazy(u'Recently Added')), ('updated', _lazy(u'Recently Updated'))) filter_new = BaseFilter.filter_created def home(request): # Add-ons. base = Addon.objects.listed(request.APP).filter(type=amo.ADDON_EXTENSION) # This is lame for performance. Kill it with ES. frozen = list(FrozenAddon.objects.values_list('addon', flat=True)) # Collections. collections = Collection.objects.filter(listed=True, application=request.APP.id, type=amo.COLLECTION_FEATURED) featured = Addon.objects.featured(request.APP, request.LANG, amo.ADDON_EXTENSION)[:18] popular = base.exclude(id__in=frozen).order_by('-average_daily_users')[:10] hotness = base.exclude(id__in=frozen).order_by('-hotness')[:18] personas = Addon.objects.featured(request.APP, request.LANG, amo.ADDON_PERSONA)[:18] return render(request, 'addons/home.html', {'popular': popular, 'featured': featured, 'hotness': hotness, 'personas': personas, 'src': 'homepage', 'collections': collections}) @mobilized(home) def home(request): # Shuffle the list and get 3 items. rand = lambda xs: random.shuffle(xs) or xs[:3] # Get some featured add-ons with randomness. featured = Addon.featured_random(request.APP, request.LANG)[:3] # Get 10 popular add-ons, then pick 3 at random. qs = list(Addon.objects.listed(request.APP) .filter(type=amo.ADDON_EXTENSION) .order_by('-average_daily_users') .values_list('id', flat=True)[:10]) popular = rand(qs) # Do one query and split up the add-ons. addons = (Addon.objects.filter(id__in=featured + popular) .filter(type=amo.ADDON_EXTENSION)) featured = [a for a in addons if a.id in featured] popular = sorted([a for a in addons if a.id in popular], key=attrgetter('average_daily_users'), reverse=True) return render(request, 'addons/mobile/home.html', {'featured': featured, 'popular': popular}) def homepage_promos(request): from discovery.views import promos version, platform = request.GET.get('version'), request.GET.get('platform') if not (platform or version): raise http.Http404 return promos(request, 'home', version, platform) class CollectionPromoBox(object): def __init__(self, request): self.request = request def features(self): return CollectionFeature.objects.all() def collections(self): features = self.features() lang = translation.to_language(translation.get_language()) locale = Q(locale='') | Q(locale=lang) promos = (CollectionPromo.objects.filter(locale) .filter(collection_feature__in=features) .transform(CollectionPromo.transformer)) groups = sorted_groupby(promos, 'collection_feature_id') # We key by feature_id and locale, so we can favor locale specific # promos. promo_dict = {} for feature_id, v in groups: promo = v.next() key = (feature_id, translation.to_language(promo.locale)) promo_dict[key] = promo rv = {} # If we can, we favor locale specific collections. for feature in features: key = (feature.id, lang) if key not in promo_dict: key = (feature.id, '') if key not in promo_dict: continue # We only want to see public add-ons on the front page. c = promo_dict[key].collection c.public_addons = c.addons.all() & Addon.objects.public() rv[feature] = c return rv def __nonzero__(self): return self.request.APP == amo.FIREFOX @addon_view def eula(request, addon, file_id=None): if not addon.eula: return http.HttpResponseRedirect(addon.get_url_path()) if file_id: version = get_object_or_404(addon.versions, files__id=file_id) else: version = addon.current_version return render(request, 'addons/eula.html', {'addon': addon, 'version': version}) @addon_view def privacy(request, addon): if not addon.privacy_policy: return http.HttpResponseRedirect(addon.get_url_path()) return render(request, 'addons/privacy.html', {'addon': addon}) @addon_view def developers(request, addon, page): if addon.is_persona(): raise http.Http404() if 'version' in request.GET: qs = addon.versions.filter(files__status__in=amo.VALID_STATUSES) version = get_list_or_404(qs, version=request.GET['version'])[0] else: version = addon.current_version if 'src' in request.GET: contribution_src = src = request.GET['src'] else: page_srcs = { 'developers': ('developers', 'meet-developers'), 'installed': ('meet-the-developer-post-install', 'post-download'), 'roadblock': ('meetthedeveloper_roadblock', 'roadblock'), } # Download src and contribution_src are different. src, contribution_src = page_srcs.get(page) return render(request, 'addons/impala/developers.html', {'addon': addon, 'page': page, 'src': src, 'contribution_src': contribution_src, 'version': version}) @addon_view @anonymous_csrf_exempt @post_required def contribute(request, addon): contrib_type = request.POST.get('type', 'suggested') is_suggested = contrib_type == 'suggested' source = request.POST.get('source', '') comment = request.POST.get('comment', '') amount = { 'suggested': addon.suggested_amount, 'onetime': request.POST.get('onetime-amount', '') }.get(contrib_type, '') if not amount: amount = settings.DEFAULT_SUGGESTED_CONTRIBUTION # This is all going to get shoved into solitude. Temporary. form = ContributionForm({'amount': amount}) if not form.is_valid(): return http.HttpResponse(json.dumps({'error': 'Invalid data.', 'status': '', 'url': '', 'paykey': ''}), content_type='application/json') contribution_uuid = hashlib.md5(str(uuid.uuid4())).hexdigest() if addon.charity: # TODO(andym): Figure out how to get this in the addon authors # locale, rather than the contributors locale. name, paypal_id = (u'%s: %s' % (addon.name, addon.charity.name), addon.charity.paypal) else: name, paypal_id = addon.name, addon.paypal_id # l10n: {0} is the addon name contrib_for = _(u'Contribution for {0}').format(jinja2.escape(name)) paykey, error, status = '', '', '' try: paykey, status = paypal.get_paykey( dict(amount=amount, email=paypal_id, ip=request.META.get('REMOTE_ADDR'), memo=contrib_for, pattern='addons.paypal', slug=addon.slug, uuid=contribution_uuid)) except paypal.PaypalError as error: paypal.paypal_log_cef(request, addon, contribution_uuid, 'PayKey Failure', 'PAYKEYFAIL', 'There was an error getting the paykey') log.error('Error getting paykey, contribution for addon: %s' % addon.pk, exc_info=True) if paykey: contrib = Contribution(addon_id=addon.id, charity_id=addon.charity_id, amount=amount, source=source, source_locale=request.LANG, annoying=addon.annoying, uuid=str(contribution_uuid), is_suggested=is_suggested, suggested_amount=addon.suggested_amount, comment=comment, paykey=paykey) contrib.save() url = '%s?paykey=%s' % (settings.PAYPAL_FLOW_URL, paykey) if request.GET.get('result_type') == 'json' or request.is_ajax(): # If there was an error getting the paykey, then JSON will # not have a paykey and the JS can cope appropriately. return http.HttpResponse(json.dumps({'url': url, 'paykey': paykey, 'error': str(error), 'status': status}), content_type='application/json') return http.HttpResponseRedirect(url) @csrf_exempt @addon_view def paypal_result(request, addon, status): uuid = request.GET.get('uuid') if not uuid: raise http.Http404() if status == 'cancel': log.info('User cancelled contribution: %s' % uuid) else: log.info('User completed contribution: %s' % uuid) response = render(request, 'addons/paypal_result.html', {'addon': addon, 'status': status}) response['x-frame-options'] = 'allow' return response @addon_view def share(request, addon): """Add-on sharing""" return share_redirect(request, addon, addon.name, addon.summary) @addon_view def license(request, addon, version=None): if version is not None: qs = addon.versions.filter(files__status__in=amo.VALID_STATUSES) version = get_list_or_404(qs, version=version)[0] else: version = addon.current_version if not (version and version.license): raise http.Http404 return render(request, 'addons/impala/license.html', dict(addon=addon, version=version)) def license_redirect(request, version): version = get_object_or_404(Version, pk=version) return redirect(version.license_url(), permanent=True) @session_csrf.anonymous_csrf_exempt @addon_view def report_abuse(request, addon): form = AbuseForm(request.POST or None, request=request) if request.method == "POST" and form.is_valid(): send_abuse_report(request, addon, form.cleaned_data['text']) messages.success(request, _('Abuse reported.')) return http.HttpResponseRedirect(addon.get_url_path()) else: return render(request, 'addons/report_abuse_full.html', {'addon': addon, 'abuse_form': form}) @cache_control(max_age=60 * 60 * 24) def persona_redirect(request, persona_id): if persona_id == 0: # Newer themes have persona_id == 0, doesn't mean anything. return http.HttpResponseNotFound() persona = get_object_or_404(Persona, persona_id=persona_id) try: to = reverse('addons.detail', args=[persona.addon.slug]) except Addon.DoesNotExist: # Would otherwise throw 500. Something funky happened during GP # migration which caused some Personas to be without Addons (problem # with cascading deletes?). Tell GoogleBot these are dead with a 404. return http.HttpResponseNotFound() return http.HttpResponsePermanentRedirect(to)
# Copyright 2011 OpenStack Foundation # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. """Tests the filesystem backend store""" import __builtin__ import errno import hashlib import json import mock import os import StringIO import uuid import fixtures import six from glance.store._drivers.filesystem import ChunkedFile from glance.store._drivers.filesystem import Store from glance.store import exceptions from glance.store.location import get_location_from_uri from glance.store.openstack.common import units from glance.store.tests import base KB = 1024 class TestStore(base.StoreBaseTest): def setUp(self): """Establish a clean test environment.""" super(TestStore, self).setUp() self.orig_chunksize = ChunkedFile.CHUNKSIZE ChunkedFile.CHUNKSIZE = 10 self.store = Store(self.conf) self.config(filesystem_store_datadir=self.test_dir, group="glance_store") self.store.configure() def tearDown(self): """Clear the test environment.""" super(TestStore, self).tearDown() ChunkedFile.CHUNKSIZE = self.orig_chunksize def test_get(self): """Test a "normal" retrieval of an image in chunks.""" # First add an image... image_id = str(uuid.uuid4()) file_contents = "chunk00000remainder" image_file = StringIO.StringIO(file_contents) location, size, checksum, _ = self.store.add(image_id, image_file, len(file_contents)) # Now read it back... uri = "file:///%s/%s" % (self.test_dir, image_id) loc = get_location_from_uri(uri) (image_file, image_size) = self.store.get(loc) expected_data = "chunk00000remainder" expected_num_chunks = 2 data = "" num_chunks = 0 for chunk in image_file: num_chunks += 1 data += chunk self.assertEqual(expected_data, data) self.assertEqual(expected_num_chunks, num_chunks) def test_get_non_existing(self): """ Test that trying to retrieve a file that doesn't exist raises an error """ loc = get_location_from_uri("file:///%s/non-existing" % self.test_dir) self.assertRaises(exceptions.NotFound, self.store.get, loc) def test_add(self): """Test that we can add an image via the filesystem backend""" ChunkedFile.CHUNKSIZE = 1024 expected_image_id = str(uuid.uuid4()) expected_file_size = 5 * KB # 5K expected_file_contents = "*" * expected_file_size expected_checksum = hashlib.md5(expected_file_contents).hexdigest() expected_location = "file://%s/%s" % (self.test_dir, expected_image_id) image_file = StringIO.StringIO(expected_file_contents) location, size, checksum, _ = self.store.add(expected_image_id, image_file, expected_file_size) self.assertEqual(expected_location, location) self.assertEqual(expected_file_size, size) self.assertEqual(expected_checksum, checksum) uri = "file:///%s/%s" % (self.test_dir, expected_image_id) loc = get_location_from_uri(uri) (new_image_file, new_image_size) = self.store.get(loc) new_image_contents = "" new_image_file_size = 0 for chunk in new_image_file: new_image_file_size += len(chunk) new_image_contents += chunk self.assertEqual(expected_file_contents, new_image_contents) self.assertEqual(expected_file_size, new_image_file_size) def test_add_check_metadata_success(self): expected_image_id = str(uuid.uuid4()) in_metadata = {'akey': u'some value', 'list': [u'1', u'2', u'3']} jsonfilename = os.path.join(self.test_dir, "storage_metadata.%s" % expected_image_id) self.config(filesystem_store_metadata_file=jsonfilename, group="glance_store") with open(jsonfilename, 'w') as fptr: json.dump(in_metadata, fptr) expected_file_size = 10 expected_file_contents = "*" * expected_file_size image_file = StringIO.StringIO(expected_file_contents) location, size, checksum, metadata = self.store.add(expected_image_id, image_file, expected_file_size) self.assertEqual(metadata, in_metadata) def test_add_check_metadata_bad_data(self): expected_image_id = str(uuid.uuid4()) in_metadata = {'akey': 10} # only unicode is allowed jsonfilename = os.path.join(self.test_dir, "storage_metadata.%s" % expected_image_id) self.config(filesystem_store_metadata_file=jsonfilename, group="glance_store") with open(jsonfilename, 'w') as fptr: json.dump(in_metadata, fptr) expected_file_size = 10 expected_file_contents = "*" * expected_file_size image_file = StringIO.StringIO(expected_file_contents) location, size, checksum, metadata = self.store.add(expected_image_id, image_file, expected_file_size) self.assertEqual(metadata, {}) def test_add_check_metadata_bad_nosuch_file(self): expected_image_id = str(uuid.uuid4()) jsonfilename = os.path.join(self.test_dir, "storage_metadata.%s" % expected_image_id) self.config(filesystem_store_metadata_file=jsonfilename, group="glance_store") expected_file_size = 10 expected_file_contents = "*" * expected_file_size image_file = StringIO.StringIO(expected_file_contents) location, size, checksum, metadata = self.store.add(expected_image_id, image_file, expected_file_size) self.assertEqual(metadata, {}) def test_add_already_existing(self): """ Tests that adding an image with an existing identifier raises an appropriate exception """ ChunkedFile.CHUNKSIZE = 1024 image_id = str(uuid.uuid4()) file_size = 5 * KB # 5K file_contents = "*" * file_size image_file = StringIO.StringIO(file_contents) location, size, checksum, _ = self.store.add(image_id, image_file, file_size) image_file = StringIO.StringIO("nevergonnamakeit") self.assertRaises(exceptions.Duplicate, self.store.add, image_id, image_file, 0) def _do_test_add_write_failure(self, errno, exception): ChunkedFile.CHUNKSIZE = 1024 image_id = str(uuid.uuid4()) file_size = 5 * KB # 5K file_contents = "*" * file_size path = os.path.join(self.test_dir, image_id) image_file = StringIO.StringIO(file_contents) with mock.patch.object(__builtin__, 'open') as popen: e = IOError() e.errno = errno popen.side_effect = e self.assertRaises(exception, self.store.add, image_id, image_file, 0) self.assertFalse(os.path.exists(path)) def test_add_storage_full(self): """ Tests that adding an image without enough space on disk raises an appropriate exception """ self._do_test_add_write_failure(errno.ENOSPC, exceptions.StorageFull) def test_add_file_too_big(self): """ Tests that adding an excessively large image file raises an appropriate exception """ self._do_test_add_write_failure(errno.EFBIG, exceptions.StorageFull) def test_add_storage_write_denied(self): """ Tests that adding an image with insufficient filestore permissions raises an appropriate exception """ self._do_test_add_write_failure(errno.EACCES, exceptions.StorageWriteDenied) def test_add_other_failure(self): """ Tests that a non-space-related IOError does not raise a StorageFull exceptions. """ self._do_test_add_write_failure(errno.ENOTDIR, IOError) def test_add_cleanup_on_read_failure(self): """ Tests the partial image file is cleaned up after a read failure. """ ChunkedFile.CHUNKSIZE = 1024 image_id = str(uuid.uuid4()) file_size = 5 * KB # 5K file_contents = "*" * file_size path = os.path.join(self.test_dir, image_id) image_file = StringIO.StringIO(file_contents) def fake_Error(size): raise AttributeError() with mock.patch.object(image_file, 'read') as mock_read: mock_read.side_effect = fake_Error self.assertRaises(AttributeError, self.store.add, image_id, image_file, 0) self.assertFalse(os.path.exists(path)) def test_delete(self): """ Test we can delete an existing image in the filesystem store """ # First add an image image_id = str(uuid.uuid4()) file_size = 5 * KB # 5K file_contents = "*" * file_size image_file = StringIO.StringIO(file_contents) location, size, checksum, _ = self.store.add(image_id, image_file, file_size) # Now check that we can delete it uri = "file:///%s/%s" % (self.test_dir, image_id) loc = get_location_from_uri(uri) self.store.delete(loc) self.assertRaises(exceptions.NotFound, self.store.get, loc) def test_delete_non_existing(self): """ Test that trying to delete a file that doesn't exist raises an error """ loc = get_location_from_uri("file:///tmp/glance-tests/non-existing") self.assertRaises(exceptions.NotFound, self.store.delete, loc) def test_configure_add_with_multi_datadirs(self): """ Tests multiple filesystem specified by filesystem_store_datadirs are parsed correctly. """ store_map = [self.useFixture(fixtures.TempDir()).path, self.useFixture(fixtures.TempDir()).path] self.conf.clear_override('filesystem_store_datadir', group='glance_store') self.conf.set_override('filesystem_store_datadirs', [store_map[0] + ":100", store_map[1] + ":200"], group='glance_store') self.store.configure_add() expected_priority_map = {100: [store_map[0]], 200: [store_map[1]]} expected_priority_list = [200, 100] self.assertEqual(self.store.priority_data_map, expected_priority_map) self.assertEqual(self.store.priority_list, expected_priority_list) def test_configure_add_same_dir_multiple_times(self): """ Tests BadStoreConfiguration exception is raised if same directory is specified multiple times in filesystem_store_datadirs. """ store_map = [self.useFixture(fixtures.TempDir()).path, self.useFixture(fixtures.TempDir()).path] self.conf.clear_override('filesystem_store_datadir', group='glance_store') self.conf.set_override('filesystem_store_datadirs', [store_map[0] + ":100", store_map[1] + ":200", store_map[0] + ":300"], group='glance_store') self.assertRaises(exceptions.BadStoreConfiguration, self.store.configure_add) def test_add_with_multiple_dirs(self): """Test adding multiple filesystem directories.""" store_map = [self.useFixture(fixtures.TempDir()).path, self.useFixture(fixtures.TempDir()).path] self.conf.clear_override('filesystem_store_datadir', group='glance_store') self.conf.set_override('filesystem_store_datadirs', [store_map[0] + ":100", store_map[1] + ":200"], group='glance_store') self.store.configure_add() """Test that we can add an image via the filesystem backend""" ChunkedFile.CHUNKSIZE = 1024 expected_image_id = str(uuid.uuid4()) expected_file_size = 5 * units.Ki # 5K expected_file_contents = "*" * expected_file_size expected_checksum = hashlib.md5(expected_file_contents).hexdigest() expected_location = "file://%s/%s" % (store_map[1], expected_image_id) image_file = six.StringIO(expected_file_contents) location, size, checksum, _ = self.store.add(expected_image_id, image_file, expected_file_size) self.assertEqual(expected_location, location) self.assertEqual(expected_file_size, size) self.assertEqual(expected_checksum, checksum) loc = get_location_from_uri(expected_location) (new_image_file, new_image_size) = self.store.get(loc) new_image_contents = "" new_image_file_size = 0 for chunk in new_image_file: new_image_file_size += len(chunk) new_image_contents += chunk self.assertEqual(expected_file_contents, new_image_contents) self.assertEqual(expected_file_size, new_image_file_size) def test_add_with_multiple_dirs_storage_full(self): """ Test StorageFull exception is raised if no filesystem directory is found that can store an image. """ store_map = [self.useFixture(fixtures.TempDir()).path, self.useFixture(fixtures.TempDir()).path] self.conf.clear_override('filesystem_store_datadir', group='glance_store') self.conf.set_override('filesystem_store_datadirs', [store_map[0] + ":100", store_map[1] + ":200"], group='glance_store') self.store.configure_add() def fake_get_capacity_info(mount_point): return 0 with mock.patch.object(self.store, '_get_capacity_info') as capacity: capacity.return_value = 0 ChunkedFile.CHUNKSIZE = 1024 expected_image_id = str(uuid.uuid4()) expected_file_size = 5 * units.Ki # 5K expected_file_contents = "*" * expected_file_size image_file = six.StringIO(expected_file_contents) self.assertRaises(exceptions.StorageFull, self.store.add, expected_image_id, image_file, expected_file_size)
#! /usr/bin/env python3 # # Copyright 2018 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # https://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """The script for family tree or general graphs experiments.""" import copy import collections import functools import os import json import numpy as np import torch import torch.nn as nn import torch.nn.functional as F import jacinle.random as random import jacinle.io as io import jactorch.nn as jacnn from difflogic.cli import format_args from difflogic.dataset.graph import GraphOutDegreeDataset, \ GraphConnectivityDataset, GraphAdjacentDataset, FamilyTreeDataset from difflogic.nn.baselines import MemoryNet from difflogic.nn.neural_logic import LogicMachine, LogicInference, LogitsInference from difflogic.nn.neural_logic.modules._utils import meshgrid_exclude_self from difflogic.nn.rl.reinforce import REINFORCELoss from difflogic.thutils import binary_accuracy from difflogic.train import TrainerBase from jacinle.cli.argument import JacArgumentParser from jacinle.logging import get_logger, set_output_file from jacinle.utils.container import GView from jacinle.utils.meter import GroupMeters from jactorch.data.dataloader import JacDataLoader from jactorch.optim.accum_grad import AccumGrad from jactorch.optim.quickaccess import get_optimizer from jactorch.train.env import TrainerEnv from jactorch.utils.meta import as_cuda, as_numpy, as_tensor TASKS = [ 'outdegree', 'connectivity', 'adjacent', 'adjacent-mnist', 'has-father', 'has-sister', 'grandparents', 'uncle', 'maternal-great-uncle' ] parser = JacArgumentParser() parser.add_argument( '--model', default='nlm', choices=['nlm', 'memnet'], help='model choices, nlm: Neural Logic Machine, memnet: Memory Networks') # NLM parameters, works when model is 'nlm' nlm_group = parser.add_argument_group('Neural Logic Machines') LogicMachine.make_nlm_parser( nlm_group, { 'depth': 4, 'breadth': 3, 'exclude_self': True, 'logic_hidden_dim': [] }, prefix='nlm') nlm_group.add_argument( '--nlm-attributes', type=int, default=8, metavar='N', help='number of output attributes in each group of each layer of the LogicMachine' ) # MemNN parameters, works when model is 'memnet' memnet_group = parser.add_argument_group('Memory Networks') MemoryNet.make_memnet_parser(memnet_group, {}, prefix='memnet') # task related task_group = parser.add_argument_group('Task') task_group.add_argument( '--task', required=True, choices=TASKS, help='tasks choices') task_group.add_argument( '--train-number', type=int, default=10, metavar='N', help='size of training instances') task_group.add_argument( '--adjacent-pred-colors', type=int, default=4, metavar='N') task_group.add_argument('--outdegree-n', type=int, default=2, metavar='N') task_group.add_argument( '--connectivity-dist-limit', type=int, default=4, metavar='N') data_gen_group = parser.add_argument_group('Data Generation') data_gen_group.add_argument( '--gen-graph-method', default='edge', choices=['dnc', 'edge'], help='method use to generate random graph') data_gen_group.add_argument( '--gen-graph-pmin', type=float, default=0.0, metavar='F', help='control parameter p reflecting the graph sparsity') data_gen_group.add_argument( '--gen-graph-pmax', type=float, default=0.3, metavar='F', help='control parameter p reflecting the graph sparsity') data_gen_group.add_argument( '--gen-graph-colors', type=int, default=4, metavar='N', help='number of colors in adjacent task') data_gen_group.add_argument( '--gen-directed', action='store_true', help='directed graph') train_group = parser.add_argument_group('Train') train_group.add_argument( '--seed', type=int, default=None, metavar='SEED', help='seed of jacinle.random') train_group.add_argument( '--use-gpu', action='store_true', help='use GPU or not') train_group.add_argument( '--optimizer', default='AdamW', choices=['SGD', 'Adam', 'AdamW'], help='optimizer choices') train_group.add_argument( '--lr', type=float, default=0.005, metavar='F', help='initial learning rate') train_group.add_argument( '--lr-decay', type=float, default=1.0, metavar='F', help='exponential decay of learning rate per lesson') train_group.add_argument( '--accum-grad', type=int, default=1, metavar='N', help='accumulated gradient for batches (default: 1)') train_group.add_argument( '--ohem-size', type=int, default=0, metavar='N', help='size of online hard negative mining') train_group.add_argument( '--batch-size', type=int, default=4, metavar='N', help='batch size for training') train_group.add_argument( '--test-batch-size', type=int, default=4, metavar='N', help='batch size for testing') train_group.add_argument( '--early-stop-loss-thresh', type=float, default=1e-5, metavar='F', help='threshold of loss for early stop') # Note that nr_examples_per_epoch = epoch_size * batch_size TrainerBase.make_trainer_parser( parser, { 'epochs': 50, 'epoch_size': 250, 'test_epoch_size': 250, 'test_number_begin': 10, 'test_number_step': 10, 'test_number_end': 50, }) io_group = parser.add_argument_group('Input/Output') io_group.add_argument( '--dump-dir', type=str, default=None, metavar='DIR', help='dump dir') io_group.add_argument( '--load-checkpoint', type=str, default=None, metavar='FILE', help='load parameters from checkpoint') schedule_group = parser.add_argument_group('Schedule') schedule_group.add_argument( '--runs', type=int, default=1, metavar='N', help='number of runs') schedule_group.add_argument( '--save-interval', type=int, default=10, metavar='N', help='the interval(number of epochs) to save checkpoint') schedule_group.add_argument( '--test-interval', type=int, default=None, metavar='N', help='the interval(number of epochs) to do test') schedule_group.add_argument( '--test-only', action='store_true', help='test-only mode') logger = get_logger(__file__) args = parser.parse_args() args.use_gpu = args.use_gpu and torch.cuda.is_available() if args.dump_dir is not None: io.mkdir(args.dump_dir) args.log_file = os.path.join(args.dump_dir, 'log.log') set_output_file(args.log_file) else: args.checkpoints_dir = None args.summary_file = None if args.seed is not None: import jacinle.random as random random.reset_global_seed(args.seed) args.task_is_outdegree = args.task in ['outdegree'] args.task_is_connectivity = args.task in ['connectivity'] args.task_is_adjacent = args.task in ['adjacent', 'adjacent-mnist'] args.task_is_family_tree = args.task in [ 'has-father', 'has-sister', 'grandparents', 'uncle', 'maternal-great-uncle' ] args.task_is_mnist_input = args.task in ['adjacent-mnist'] args.task_is_1d_output = args.task in [ 'outdegree', 'adjacent', 'adjacent-mnist', 'has-father', 'has-sister' ] class LeNet(nn.Module): def __init__(self): super().__init__() self.conv1 = jacnn.Conv2dLayer( 1, 10, kernel_size=5, batch_norm=True, activation='relu') self.conv2 = jacnn.Conv2dLayer( 10, 20, kernel_size=5, batch_norm=True, dropout=False, activation='relu') self.fc1 = nn.Linear(320, 50) self.fc2 = nn.Linear(50, 10) def forward(self, x): x = F.max_pool2d(self.conv1(x), 2) x = F.max_pool2d(self.conv2(x), 2) x = x.view(-1, 320) x = F.relu(self.fc1(x)) x = self.fc2(x) return x class Model(nn.Module): """The model for family tree or general graphs path tasks.""" def __init__(self): super().__init__() # inputs input_dim = 4 if args.task_is_family_tree else 1 self.feature_axis = 1 if args.task_is_1d_output else 2 # features if args.model == 'nlm': input_dims = [0 for _ in range(args.nlm_breadth + 1)] if args.task_is_adjacent: input_dims[1] = args.gen_graph_colors if args.task_is_mnist_input: self.lenet = LeNet() input_dims[2] = input_dim self.features = LogicMachine.from_args( input_dims, args.nlm_attributes, args, prefix='nlm') output_dim = self.features.output_dims[self.feature_axis] elif args.model == 'memnet': if args.task_is_adjacent: input_dim += args.gen_graph_colors self.feature = MemoryNet.from_args( input_dim, self.feature_axis, args, prefix='memnet') output_dim = self.feature.get_output_dim() # target target_dim = args.adjacent_pred_colors if args.task_is_adjacent else 1 self.pred = LogicInference(output_dim, target_dim, []) # losses if args.ohem_size > 0: from jactorch.nn.losses import BinaryCrossEntropyLossWithProbs as BCELoss self.loss = BCELoss(average='none') else: self.loss = nn.BCELoss() def forward(self, feed_dict): feed_dict = GView(feed_dict) # properties if args.task_is_adjacent: states = feed_dict.states.float() else: states = None # relations relations = feed_dict.relations.float() batch_size, nr = relations.size()[:2] if args.model == 'nlm': if args.task_is_adjacent and args.task_is_mnist_input: states_shape = states.size() states = states.view((-1,) + states_shape[2:]) states = self.lenet(states) states = states.view(states_shape[:2] + (-1,)) states = F.sigmoid(states) inp = [None for _ in range(args.nlm_breadth + 1)] inp[1] = states inp[2] = relations depth = None if args.nlm_recursion: depth = 1 while 2**depth + 1 < nr: depth += 1 depth = depth * 2 + 1 feature = self.features(inp, depth=depth)[self.feature_axis] elif args.model == 'memnet': feature = self.feature(relations, states) if args.task_is_adjacent and args.task_is_mnist_input: raise NotImplementedError() pred = self.pred(feature) if not args.task_is_adjacent: pred = pred.squeeze(-1) if args.task_is_connectivity: pred = meshgrid_exclude_self(pred) # exclude self-cycle if self.training: monitors = dict() target = feed_dict.target.float() if args.task_is_adjacent: target = target[:, :, :args.adjacent_pred_colors] monitors.update(binary_accuracy(target, pred, return_float=False)) loss = self.loss(pred, target) # ohem loss is unused. if args.ohem_size > 0: loss = loss.view(-1).topk(args.ohem_size)[0].mean() return loss, monitors, dict(pred=pred) else: return dict(pred=pred) def make_dataset(n, epoch_size, is_train): pmin, pmax = args.gen_graph_pmin, args.gen_graph_pmax if args.task_is_outdegree: return GraphOutDegreeDataset( args.outdegree_n, epoch_size, n, pmin=pmin, pmax=pmax, directed=args.gen_directed, gen_method=args.gen_graph_method) elif args.task_is_connectivity: nmin, nmax = n, n if is_train and args.nlm_recursion: nmin = 2 return GraphConnectivityDataset( args.connectivity_dist_limit, epoch_size, nmin, pmin, nmax, pmax, directed=args.gen_directed, gen_method=args.gen_graph_method) elif args.task_is_adjacent: return GraphAdjacentDataset( args.gen_graph_colors, epoch_size, n, pmin=pmin, pmax=pmax, directed=args.gen_directed, gen_method=args.gen_graph_method, is_train=is_train, is_mnist_colors=args.task_is_mnist_input) else: return FamilyTreeDataset(args.task, epoch_size, n, p_marriage=1.0) class MyTrainer(TrainerBase): def save_checkpoint(self, name): if args.checkpoints_dir is not None: checkpoint_file = os.path.join(args.checkpoints_dir, 'checkpoint_{}.pth'.format(name)) super().save_checkpoint(checkpoint_file) def _dump_meters(self, meters, mode): if args.summary_file is not None: meters_kv = meters._canonize_values('avg') meters_kv['mode'] = mode meters_kv['epoch'] = self.current_epoch with open(args.summary_file, 'a') as f: f.write(io.dumps_json(meters_kv)) f.write('\n') data_iterator = {} def _prepare_dataset(self, epoch_size, mode): assert mode in ['train', 'test'] if mode == 'train': batch_size = args.batch_size number = args.train_number else: batch_size = args.test_batch_size number = self.test_number # The actual number of instances in an epoch is epoch_size * batch_size. dataset = make_dataset(number, epoch_size * batch_size, mode == 'train') dataloader = JacDataLoader( dataset, shuffle=True, batch_size=batch_size, num_workers=min(epoch_size, 4)) self.data_iterator[mode] = dataloader.__iter__() def _get_data(self, index, meters, mode): feed_dict = self.data_iterator[mode].next() meters.update(number=feed_dict['n'].data.numpy().mean()) if args.use_gpu: feed_dict = as_cuda(feed_dict) return feed_dict def _get_result(self, index, meters, mode): feed_dict = self._get_data(index, meters, mode) output_dict = self.model(feed_dict) target = feed_dict['target'] if args.task_is_adjacent: target = target[:, :, :args.adjacent_pred_colors] result = binary_accuracy(target, output_dict['pred']) succ = result['accuracy'] == 1.0 meters.update(succ=succ) meters.update(result, n=target.size(0)) message = '> {} iter={iter}, accuracy={accuracy:.4f}, \ balance_acc={balanced_accuracy:.4f}'.format( mode, iter=index, **meters.val) return message, dict(succ=succ, feed_dict=feed_dict) def _get_train_data(self, index, meters): return self._get_data(index, meters, mode='train') def _train_epoch(self, epoch_size): meters = super()._train_epoch(epoch_size) i = self.current_epoch if args.save_interval is not None and i % args.save_interval == 0: self.save_checkpoint(str(i)) if args.test_interval is not None and i % args.test_interval == 0: self.test() return meters def _early_stop(self, meters): return meters.avg['loss'] < args.early_stop_loss_thresh def main(run_id): if args.dump_dir is not None: if args.runs > 1: args.current_dump_dir = os.path.join(args.dump_dir, 'run_{}'.format(run_id)) io.mkdir(args.current_dump_dir) else: args.current_dump_dir = args.dump_dir args.summary_file = os.path.join(args.current_dump_dir, 'summary.json') args.checkpoints_dir = os.path.join(args.current_dump_dir, 'checkpoints') io.mkdir(args.checkpoints_dir) logger.info(format_args(args)) model = Model() if args.use_gpu: model.cuda() optimizer = get_optimizer(args.optimizer, model, args.lr) if args.accum_grad > 1: optimizer = AccumGrad(optimizer, args.accum_grad) trainer = MyTrainer.from_args(model, optimizer, args) if args.load_checkpoint is not None: trainer.load_checkpoint(args.load_checkpoint) if args.test_only: return None, trainer.test() final_meters = trainer.train() trainer.save_checkpoint('last') return trainer.early_stopped, trainer.test() if __name__ == '__main__': stats = [] nr_graduated = 0 for i in range(args.runs): graduated, test_meters = main(i) logger.info('run {}'.format(i + 1)) if test_meters is not None: for j, meters in enumerate(test_meters): if len(stats) <= j: stats.append(GroupMeters()) stats[j].update( number=meters.avg['number'], test_acc=meters.avg['accuracy']) for meters in stats: logger.info('number {}, test_acc {}'.format(meters.avg['number'], meters.avg['test_acc'])) if not args.test_only: nr_graduated += int(graduated) logger.info('graduate_ratio {}'.format(nr_graduated / (i + 1))) if graduated: for j, meters in enumerate(test_meters): stats[j].update(grad_test_acc=meters.avg['accuracy']) if nr_graduated > 0: for meters in stats: logger.info('number {}, grad_test_acc {}'.format( meters.avg['number'], meters.avg['grad_test_acc']))
"""Support for Bluesound devices.""" import asyncio from asyncio import CancelledError from datetime import timedelta import logging from urllib import parse import aiohttp from aiohttp.client_exceptions import ClientError from aiohttp.hdrs import CONNECTION, KEEP_ALIVE import async_timeout import voluptuous as vol import xmltodict from homeassistant.components.media_player import PLATFORM_SCHEMA, MediaPlayerDevice from homeassistant.components.media_player.const import ( ATTR_MEDIA_ENQUEUE, DOMAIN, MEDIA_TYPE_MUSIC, SUPPORT_CLEAR_PLAYLIST, SUPPORT_NEXT_TRACK, SUPPORT_PAUSE, SUPPORT_PLAY, SUPPORT_PLAY_MEDIA, SUPPORT_PREVIOUS_TRACK, SUPPORT_SEEK, SUPPORT_SELECT_SOURCE, SUPPORT_SHUFFLE_SET, SUPPORT_STOP, SUPPORT_VOLUME_MUTE, SUPPORT_VOLUME_SET, SUPPORT_VOLUME_STEP, ) from homeassistant.const import ( ATTR_ENTITY_ID, CONF_HOST, CONF_HOSTS, CONF_NAME, CONF_PORT, EVENT_HOMEASSISTANT_START, EVENT_HOMEASSISTANT_STOP, STATE_IDLE, STATE_OFF, STATE_PAUSED, STATE_PLAYING, ) from homeassistant.core import callback from homeassistant.helpers.aiohttp_client import async_get_clientsession import homeassistant.helpers.config_validation as cv from homeassistant.helpers.event import async_track_time_interval from homeassistant.util import Throttle import homeassistant.util.dt as dt_util _LOGGER = logging.getLogger(__name__) ATTR_BLUESOUND_GROUP = "bluesound_group" ATTR_MASTER = "master" DATA_BLUESOUND = "bluesound" DEFAULT_PORT = 11000 NODE_OFFLINE_CHECK_TIMEOUT = 180 NODE_RETRY_INITIATION = timedelta(minutes=3) SERVICE_CLEAR_TIMER = "bluesound_clear_sleep_timer" SERVICE_JOIN = "bluesound_join" SERVICE_SET_TIMER = "bluesound_set_sleep_timer" SERVICE_UNJOIN = "bluesound_unjoin" STATE_GROUPED = "grouped" SYNC_STATUS_INTERVAL = timedelta(minutes=5) UPDATE_CAPTURE_INTERVAL = timedelta(minutes=30) UPDATE_PRESETS_INTERVAL = timedelta(minutes=30) UPDATE_SERVICES_INTERVAL = timedelta(minutes=30) PLATFORM_SCHEMA = PLATFORM_SCHEMA.extend( { vol.Optional(CONF_HOSTS): vol.All( cv.ensure_list, [ { vol.Required(CONF_HOST): cv.string, vol.Optional(CONF_NAME): cv.string, vol.Optional(CONF_PORT, default=DEFAULT_PORT): cv.port, } ], ) } ) BS_SCHEMA = vol.Schema({vol.Optional(ATTR_ENTITY_ID): cv.entity_ids}) BS_JOIN_SCHEMA = BS_SCHEMA.extend({vol.Required(ATTR_MASTER): cv.entity_id}) SERVICE_TO_METHOD = { SERVICE_JOIN: {"method": "async_join", "schema": BS_JOIN_SCHEMA}, SERVICE_UNJOIN: {"method": "async_unjoin", "schema": BS_SCHEMA}, SERVICE_SET_TIMER: {"method": "async_increase_timer", "schema": BS_SCHEMA}, SERVICE_CLEAR_TIMER: {"method": "async_clear_timer", "schema": BS_SCHEMA}, } def _add_player(hass, async_add_entities, host, port=None, name=None): """Add Bluesound players.""" if host in [x.host for x in hass.data[DATA_BLUESOUND]]: return @callback def _init_player(event=None): """Start polling.""" hass.async_create_task(player.async_init()) @callback def _start_polling(event=None): """Start polling.""" player.start_polling() @callback def _stop_polling(): """Stop polling.""" player.stop_polling() @callback def _add_player_cb(): """Add player after first sync fetch.""" async_add_entities([player]) _LOGGER.info("Added device with name: %s", player.name) if hass.is_running: _start_polling() else: hass.bus.async_listen_once(EVENT_HOMEASSISTANT_START, _start_polling) hass.bus.async_listen_once(EVENT_HOMEASSISTANT_STOP, _stop_polling) player = BluesoundPlayer(hass, host, port, name, _add_player_cb) hass.data[DATA_BLUESOUND].append(player) if hass.is_running: _init_player() else: hass.bus.async_listen_once(EVENT_HOMEASSISTANT_START, _init_player) async def async_setup_platform(hass, config, async_add_entities, discovery_info=None): """Set up the Bluesound platforms.""" if DATA_BLUESOUND not in hass.data: hass.data[DATA_BLUESOUND] = [] if discovery_info: _add_player( hass, async_add_entities, discovery_info.get(CONF_HOST), discovery_info.get(CONF_PORT, None), ) return hosts = config.get(CONF_HOSTS, None) if hosts: for host in hosts: _add_player( hass, async_add_entities, host.get(CONF_HOST), host.get(CONF_PORT), host.get(CONF_NAME), ) async def async_service_handler(service): """Map services to method of Bluesound devices.""" method = SERVICE_TO_METHOD.get(service.service) if not method: return params = { key: value for key, value in service.data.items() if key != ATTR_ENTITY_ID } entity_ids = service.data.get(ATTR_ENTITY_ID) if entity_ids: target_players = [ player for player in hass.data[DATA_BLUESOUND] if player.entity_id in entity_ids ] else: target_players = hass.data[DATA_BLUESOUND] for player in target_players: await getattr(player, method["method"])(**params) for service in SERVICE_TO_METHOD: schema = SERVICE_TO_METHOD[service]["schema"] hass.services.async_register( DOMAIN, service, async_service_handler, schema=schema ) class BluesoundPlayer(MediaPlayerDevice): """Representation of a Bluesound Player.""" def __init__(self, hass, host, port=None, name=None, init_callback=None): """Initialize the media player.""" self.host = host self._hass = hass self.port = port self._polling_session = async_get_clientsession(hass) self._polling_task = None # The actual polling task. self._name = name self._icon = None self._capture_items = [] self._services_items = [] self._preset_items = [] self._sync_status = {} self._status = None self._last_status_update = None self._is_online = False self._retry_remove = None self._lastvol = None self._master = None self._is_master = False self._group_name = None self._group_list = [] self._bluesound_device_name = None self._init_callback = init_callback if self.port is None: self.port = DEFAULT_PORT class _TimeoutException(Exception): pass @staticmethod def _try_get_index(string, search_string): """Get the index.""" try: return string.index(search_string) except ValueError: return -1 async def force_update_sync_status(self, on_updated_cb=None, raise_timeout=False): """Update the internal status.""" resp = await self.send_bluesound_command( "SyncStatus", raise_timeout, raise_timeout ) if not resp: return None self._sync_status = resp["SyncStatus"].copy() if not self._name: self._name = self._sync_status.get("@name", self.host) if not self._bluesound_device_name: self._bluesound_device_name = self._sync_status.get("@name", self.host) if not self._icon: self._icon = self._sync_status.get("@icon", self.host) master = self._sync_status.get("master", None) if master is not None: self._is_master = False master_host = master.get("#text") master_device = [ device for device in self._hass.data[DATA_BLUESOUND] if device.host == master_host ] if master_device and master_host != self.host: self._master = master_device[0] else: self._master = None _LOGGER.error("Master not found %s", master_host) else: if self._master is not None: self._master = None slaves = self._sync_status.get("slave", None) self._is_master = slaves is not None if on_updated_cb: on_updated_cb() return True async def _start_poll_command(self): """Loop which polls the status of the player.""" try: while True: await self.async_update_status() except (asyncio.TimeoutError, ClientError, BluesoundPlayer._TimeoutException): _LOGGER.info("Node %s is offline, retrying later", self._name) await asyncio.sleep(NODE_OFFLINE_CHECK_TIMEOUT) self.start_polling() except CancelledError: _LOGGER.debug("Stopping the polling of node %s", self._name) except Exception: _LOGGER.exception("Unexpected error in %s", self._name) raise def start_polling(self): """Start the polling task.""" self._polling_task = self._hass.async_create_task(self._start_poll_command()) def stop_polling(self): """Stop the polling task.""" self._polling_task.cancel() async def async_init(self, triggered=None): """Initialize the player async.""" try: if self._retry_remove is not None: self._retry_remove() self._retry_remove = None await self.force_update_sync_status(self._init_callback, True) except (asyncio.TimeoutError, ClientError): _LOGGER.info("Node %s is offline, retrying later", self.host) self._retry_remove = async_track_time_interval( self._hass, self.async_init, NODE_RETRY_INITIATION ) except Exception: _LOGGER.exception("Unexpected when initiating error in %s", self.host) raise async def async_update(self): """Update internal status of the entity.""" if not self._is_online: return await self.async_update_sync_status() await self.async_update_presets() await self.async_update_captures() await self.async_update_services() async def send_bluesound_command( self, method, raise_timeout=False, allow_offline=False ): """Send command to the player.""" if not self._is_online and not allow_offline: return if method[0] == "/": method = method[1:] url = f"http://{self.host}:{self.port}/{method}" _LOGGER.debug("Calling URL: %s", url) response = None try: websession = async_get_clientsession(self._hass) with async_timeout.timeout(10): response = await websession.get(url) if response.status == 200: result = await response.text() if result: data = xmltodict.parse(result) else: data = None elif response.status == 595: _LOGGER.info("Status 595 returned, treating as timeout") raise BluesoundPlayer._TimeoutException() else: _LOGGER.error("Error %s on %s", response.status, url) return None except (asyncio.TimeoutError, aiohttp.ClientError): if raise_timeout: _LOGGER.info("Timeout: %s", self.host) raise _LOGGER.debug("Failed communicating: %s", self.host) return None return data async def async_update_status(self): """Use the poll session to always get the status of the player.""" response = None url = "Status" etag = "" if self._status is not None: etag = self._status.get("@etag", "") if etag != "": url = f"Status?etag={etag}&timeout=120.0" url = f"http://{self.host}:{self.port}/{url}" _LOGGER.debug("Calling URL: %s", url) try: with async_timeout.timeout(125): response = await self._polling_session.get( url, headers={CONNECTION: KEEP_ALIVE} ) if response.status == 200: result = await response.text() self._is_online = True self._last_status_update = dt_util.utcnow() self._status = xmltodict.parse(result)["status"].copy() group_name = self._status.get("groupName", None) if group_name != self._group_name: _LOGGER.debug("Group name change detected on device: %s", self.host) self._group_name = group_name # rebuild ordered list of entity_ids that are in the group, master is first self._group_list = self.rebuild_bluesound_group() # the sleep is needed to make sure that the # devices is synced await asyncio.sleep(1) await self.async_trigger_sync_on_all() elif self.is_grouped: # when player is grouped we need to fetch volume from # sync_status. We will force an update if the player is # grouped this isn't a foolproof solution. A better # solution would be to fetch sync_status more often when # the device is playing. This would solve alot of # problems. This change will be done when the # communication is moved to a separate library await self.force_update_sync_status() self.async_schedule_update_ha_state() elif response.status == 595: _LOGGER.info("Status 595 returned, treating as timeout") raise BluesoundPlayer._TimeoutException() else: _LOGGER.error( "Error %s on %s. Trying one more time", response.status, url ) except (asyncio.TimeoutError, ClientError): self._is_online = False self._last_status_update = None self._status = None self.async_schedule_update_ha_state() _LOGGER.info("Client connection error, marking %s as offline", self._name) raise async def async_trigger_sync_on_all(self): """Trigger sync status update on all devices.""" _LOGGER.debug("Trigger sync status on all devices") for player in self._hass.data[DATA_BLUESOUND]: await player.force_update_sync_status() @Throttle(SYNC_STATUS_INTERVAL) async def async_update_sync_status(self, on_updated_cb=None, raise_timeout=False): """Update sync status.""" await self.force_update_sync_status(on_updated_cb, raise_timeout=False) @Throttle(UPDATE_CAPTURE_INTERVAL) async def async_update_captures(self): """Update Capture sources.""" resp = await self.send_bluesound_command("RadioBrowse?service=Capture") if not resp: return self._capture_items = [] def _create_capture_item(item): self._capture_items.append( { "title": item.get("@text", ""), "name": item.get("@text", ""), "type": item.get("@serviceType", "Capture"), "image": item.get("@image", ""), "url": item.get("@URL", ""), } ) if "radiotime" in resp and "item" in resp["radiotime"]: if isinstance(resp["radiotime"]["item"], list): for item in resp["radiotime"]["item"]: _create_capture_item(item) else: _create_capture_item(resp["radiotime"]["item"]) return self._capture_items @Throttle(UPDATE_PRESETS_INTERVAL) async def async_update_presets(self): """Update Presets.""" resp = await self.send_bluesound_command("Presets") if not resp: return self._preset_items = [] def _create_preset_item(item): self._preset_items.append( { "title": item.get("@name", ""), "name": item.get("@name", ""), "type": "preset", "image": item.get("@image", ""), "is_raw_url": True, "url2": item.get("@url", ""), "url": "Preset?id={}".format(item.get("@id", "")), } ) if "presets" in resp and "preset" in resp["presets"]: if isinstance(resp["presets"]["preset"], list): for item in resp["presets"]["preset"]: _create_preset_item(item) else: _create_preset_item(resp["presets"]["preset"]) return self._preset_items @Throttle(UPDATE_SERVICES_INTERVAL) async def async_update_services(self): """Update Services.""" resp = await self.send_bluesound_command("Services") if not resp: return self._services_items = [] def _create_service_item(item): self._services_items.append( { "title": item.get("@displayname", ""), "name": item.get("@name", ""), "type": item.get("@type", ""), "image": item.get("@icon", ""), "url": item.get("@name", ""), } ) if "services" in resp and "service" in resp["services"]: if isinstance(resp["services"]["service"], list): for item in resp["services"]["service"]: _create_service_item(item) else: _create_service_item(resp["services"]["service"]) return self._services_items @property def media_content_type(self): """Content type of current playing media.""" return MEDIA_TYPE_MUSIC @property def state(self): """Return the state of the device.""" if self._status is None: return STATE_OFF if self.is_grouped and not self.is_master: return STATE_GROUPED status = self._status.get("state", None) if status in ("pause", "stop"): return STATE_PAUSED if status in ("stream", "play"): return STATE_PLAYING return STATE_IDLE @property def media_title(self): """Title of current playing media.""" if self._status is None or (self.is_grouped and not self.is_master): return None return self._status.get("title1", None) @property def media_artist(self): """Artist of current playing media (Music track only).""" if self._status is None: return None if self.is_grouped and not self.is_master: return self._group_name artist = self._status.get("artist", None) if not artist: artist = self._status.get("title2", None) return artist @property def media_album_name(self): """Artist of current playing media (Music track only).""" if self._status is None or (self.is_grouped and not self.is_master): return None album = self._status.get("album", None) if not album: album = self._status.get("title3", None) return album @property def media_image_url(self): """Image url of current playing media.""" if self._status is None or (self.is_grouped and not self.is_master): return None url = self._status.get("image", None) if not url: return if url[0] == "/": url = f"http://{self.host}:{self.port}{url}" return url @property def media_position(self): """Position of current playing media in seconds.""" if self._status is None or (self.is_grouped and not self.is_master): return None mediastate = self.state if self._last_status_update is None or mediastate == STATE_IDLE: return None position = self._status.get("secs", None) if position is None: return None position = float(position) if mediastate == STATE_PLAYING: position += (dt_util.utcnow() - self._last_status_update).total_seconds() return position @property def media_duration(self): """Duration of current playing media in seconds.""" if self._status is None or (self.is_grouped and not self.is_master): return None duration = self._status.get("totlen", None) if duration is None: return None return float(duration) @property def media_position_updated_at(self): """Last time status was updated.""" return self._last_status_update @property def volume_level(self): """Volume level of the media player (0..1).""" volume = self._status.get("volume", None) if self.is_grouped: volume = self._sync_status.get("@volume", None) if volume is not None: return int(volume) / 100 return None @property def is_volume_muted(self): """Boolean if volume is currently muted.""" volume = self.volume_level if not volume: return None return 0 <= volume < 0.001 @property def name(self): """Return the name of the device.""" return self._name @property def bluesound_device_name(self): """Return the device name as returned by the device.""" return self._bluesound_device_name @property def icon(self): """Return the icon of the device.""" return self._icon @property def source_list(self): """List of available input sources.""" if self._status is None or (self.is_grouped and not self.is_master): return None sources = [] for source in self._preset_items: sources.append(source["title"]) for source in [ x for x in self._services_items if x["type"] == "LocalMusic" or x["type"] == "RadioService" ]: sources.append(source["title"]) for source in self._capture_items: sources.append(source["title"]) return sources @property def source(self): """Name of the current input source.""" if self._status is None or (self.is_grouped and not self.is_master): return None current_service = self._status.get("service", "") if current_service == "": return "" stream_url = self._status.get("streamUrl", "") if self._status.get("is_preset", "") == "1" and stream_url != "": # This check doesn't work with all presets, for example playlists. # But it works with radio service_items will catch playlists. items = [ x for x in self._preset_items if "url2" in x and parse.unquote(x["url2"]) == stream_url ] if items: return items[0]["title"] # This could be a bit difficult to detect. Bluetooth could be named # different things and there is not any way to match chooses in # capture list to current playing. It's a bit of guesswork. # This method will be needing some tweaking over time. title = self._status.get("title1", "").lower() if title == "bluetooth" or stream_url == "Capture:hw:2,0/44100/16/2": items = [ x for x in self._capture_items if x["url"] == "Capture%3Abluez%3Abluetooth" ] if items: return items[0]["title"] items = [x for x in self._capture_items if x["url"] == stream_url] if items: return items[0]["title"] if stream_url[:8] == "Capture:": stream_url = stream_url[8:] idx = BluesoundPlayer._try_get_index(stream_url, ":") if idx > 0: stream_url = stream_url[:idx] for item in self._capture_items: url = parse.unquote(item["url"]) if url[:8] == "Capture:": url = url[8:] idx = BluesoundPlayer._try_get_index(url, ":") if idx > 0: url = url[:idx] if url.lower() == stream_url.lower(): return item["title"] items = [x for x in self._capture_items if x["name"] == current_service] if items: return items[0]["title"] items = [x for x in self._services_items if x["name"] == current_service] if items: return items[0]["title"] if self._status.get("streamUrl", "") != "": _LOGGER.debug( "Couldn't find source of stream URL: %s", self._status.get("streamUrl", ""), ) return None @property def supported_features(self): """Flag of media commands that are supported.""" if self._status is None: return None if self.is_grouped and not self.is_master: return SUPPORT_VOLUME_STEP | SUPPORT_VOLUME_SET | SUPPORT_VOLUME_MUTE supported = SUPPORT_CLEAR_PLAYLIST if self._status.get("indexing", "0") == "0": supported = ( supported | SUPPORT_PAUSE | SUPPORT_PREVIOUS_TRACK | SUPPORT_NEXT_TRACK | SUPPORT_PLAY_MEDIA | SUPPORT_STOP | SUPPORT_PLAY | SUPPORT_SELECT_SOURCE | SUPPORT_SHUFFLE_SET ) current_vol = self.volume_level if current_vol is not None and current_vol >= 0: supported = ( supported | SUPPORT_VOLUME_STEP | SUPPORT_VOLUME_SET | SUPPORT_VOLUME_MUTE ) if self._status.get("canSeek", "") == "1": supported = supported | SUPPORT_SEEK return supported @property def is_master(self): """Return true if player is a coordinator.""" return self._is_master @property def is_grouped(self): """Return true if player is a coordinator.""" return self._master is not None or self._is_master @property def shuffle(self): """Return true if shuffle is active.""" return self._status.get("shuffle", "0") == "1" async def async_join(self, master): """Join the player to a group.""" master_device = [ device for device in self.hass.data[DATA_BLUESOUND] if device.entity_id == master ] if master_device: _LOGGER.debug( "Trying to join player: %s to master: %s", self.host, master_device[0].host, ) await master_device[0].async_add_slave(self) else: _LOGGER.error("Master not found %s", master_device) @property def device_state_attributes(self): """List members in group.""" attributes = {} if self._group_list: attributes = {ATTR_BLUESOUND_GROUP: self._group_list} attributes[ATTR_MASTER] = self._is_master return attributes def rebuild_bluesound_group(self): """Rebuild the list of entities in speaker group.""" if self._group_name is None: return None bluesound_group = [] device_group = self._group_name.split("+") sorted_entities = sorted( self._hass.data[DATA_BLUESOUND], key=lambda entity: entity.is_master, reverse=True, ) bluesound_group = [ entity.name for entity in sorted_entities if entity.bluesound_device_name in device_group ] return bluesound_group async def async_unjoin(self): """Unjoin the player from a group.""" if self._master is None: return _LOGGER.debug("Trying to unjoin player: %s", self.host) await self._master.async_remove_slave(self) async def async_add_slave(self, slave_device): """Add slave to master.""" return await self.send_bluesound_command( f"/AddSlave?slave={slave_device.host}&port={slave_device.port}" ) async def async_remove_slave(self, slave_device): """Remove slave to master.""" return await self.send_bluesound_command( f"/RemoveSlave?slave={slave_device.host}&port={slave_device.port}" ) async def async_increase_timer(self): """Increase sleep time on player.""" sleep_time = await self.send_bluesound_command("/Sleep") if sleep_time is None: _LOGGER.error("Error while increasing sleep time on player: %s", self.host) return 0 return int(sleep_time.get("sleep", "0")) async def async_clear_timer(self): """Clear sleep timer on player.""" sleep = 1 while sleep > 0: sleep = await self.async_increase_timer() async def async_set_shuffle(self, shuffle): """Enable or disable shuffle mode.""" value = "1" if shuffle else "0" return await self.send_bluesound_command(f"/Shuffle?state={value}") async def async_select_source(self, source): """Select input source.""" if self.is_grouped and not self.is_master: return items = [x for x in self._preset_items if x["title"] == source] if not items: items = [x for x in self._services_items if x["title"] == source] if not items: items = [x for x in self._capture_items if x["title"] == source] if not items: return selected_source = items[0] url = "Play?url={}&preset_id&image={}".format( selected_source["url"], selected_source["image"] ) if "is_raw_url" in selected_source and selected_source["is_raw_url"]: url = selected_source["url"] return await self.send_bluesound_command(url) async def async_clear_playlist(self): """Clear players playlist.""" if self.is_grouped and not self.is_master: return return await self.send_bluesound_command("Clear") async def async_media_next_track(self): """Send media_next command to media player.""" if self.is_grouped and not self.is_master: return cmd = "Skip" if self._status and "actions" in self._status: for action in self._status["actions"]["action"]: if "@name" in action and "@url" in action and action["@name"] == "skip": cmd = action["@url"] return await self.send_bluesound_command(cmd) async def async_media_previous_track(self): """Send media_previous command to media player.""" if self.is_grouped and not self.is_master: return cmd = "Back" if self._status and "actions" in self._status: for action in self._status["actions"]["action"]: if "@name" in action and "@url" in action and action["@name"] == "back": cmd = action["@url"] return await self.send_bluesound_command(cmd) async def async_media_play(self): """Send media_play command to media player.""" if self.is_grouped and not self.is_master: return return await self.send_bluesound_command("Play") async def async_media_pause(self): """Send media_pause command to media player.""" if self.is_grouped and not self.is_master: return return await self.send_bluesound_command("Pause") async def async_media_stop(self): """Send stop command.""" if self.is_grouped and not self.is_master: return return await self.send_bluesound_command("Pause") async def async_media_seek(self, position): """Send media_seek command to media player.""" if self.is_grouped and not self.is_master: return return await self.send_bluesound_command("Play?seek={}".format(float(position))) async def async_play_media(self, media_type, media_id, **kwargs): """ Send the play_media command to the media player. If ATTR_MEDIA_ENQUEUE is True, add `media_id` to the queue. """ if self.is_grouped and not self.is_master: return url = f"Play?url={media_id}" if kwargs.get(ATTR_MEDIA_ENQUEUE): return await self.send_bluesound_command(url) return await self.send_bluesound_command(url) async def async_volume_up(self): """Volume up the media player.""" current_vol = self.volume_level if not current_vol or current_vol < 0: return return self.async_set_volume_level(((current_vol * 100) + 1) / 100) async def async_volume_down(self): """Volume down the media player.""" current_vol = self.volume_level if not current_vol or current_vol < 0: return return self.async_set_volume_level(((current_vol * 100) - 1) / 100) async def async_set_volume_level(self, volume): """Send volume_up command to media player.""" if volume < 0: volume = 0 elif volume > 1: volume = 1 return await self.send_bluesound_command( "Volume?level=" + str(float(volume) * 100) ) async def async_mute_volume(self, mute): """Send mute command to media player.""" if mute: volume = self.volume_level if volume > 0: self._lastvol = volume return await self.send_bluesound_command("Volume?level=0") return await self.send_bluesound_command( "Volume?level=" + str(float(self._lastvol) * 100) )
import pytest from rpyre.interface.lua import compile_re from rpyre.matching import find from rpyre.nfa import ( StateMatch, StateChar, StateSplit, StateDot, StateCharRange, ) class TestLuaPatternsFind(object): def test_simple_or(self): expr = compile_re('(aa|bb)') result = find(expr, 'xyzabbaab', 0) assert list(result) == [(5, 6), (7, 8)] def test_grouped_or_between_chars(self): expr = compile_re('x(aa|bb)x') result = find(expr, 'axaaxaxbxbbxa', 0) assert list(result) == [(2, 5), (9, 12)] def test_chained_grouped_or_match(self): expr = compile_re('x(aa|bb)(cc|dd)x') result = find(expr, 'axaaddaxbbccxxaacx', 0) assert list(result) == [(8, 13)] def test_chained_grouped_or_no_match(self): expr = compile_re('x(aa|bb)(cc|dd)x') result = find(expr, 'xaaccddxxaaddddxxaacc', 0) assert list(result) == [(-1, -1)] def test_grouped_star(self): expr = compile_re('(ab)*') result = find(expr, 'ababababab', 0) assert list(result) == [(1, 10)] def test_grouped_star_between_chars_match(self): expr = compile_re('x(ab)*x') result = find(expr, 'ababxababxabab', 0) assert list(result) == [(5, 10)] def test_grouped_star_between_chars_no_match(self): expr = compile_re('x(ab)*x') result = find(expr, 'ababxabababab', 0) assert list(result) == [(-1, -1)] def test_grouped_star_and_or_match(self): expr = compile_re('x((aa)*|(bb)*)x') result = find(expr, 'xaaaaaaxxx', 0) assert list(result) == [(1, 8), (9, 10)] def test_grouped_star_and_or_no_match(self): expr = compile_re('x((aa)*|(bb)*)x') result = find(expr, 'xaaaaaxbxabxbbbb', 0) assert list(result) == [(-1, -1)] def test_simple_plus(self): expr = compile_re('a+') result = find(expr, 'bxaaaabak', 0) assert list(result) == [(3, 6), (8, 8)] def test_grouped_plus(self): expr = compile_re('(a|b)+c') result = find(expr, 'xxcaababcvbc', 0) assert list(result) == [(4, 9), (11, 12)] def test_or_repetition(self): expr = compile_re('(aa|bb){2}') result = find(expr, 'xabbxaaaaxjkbbajbbaal', 0) assert list(result) == [(6, 9), (17, 20)] def test_match_evil(self): expr = compile_re('(a|b)*a(a|b){5}a(a|b)*') result = find(expr, 'aaaababababba', 0) assert list(result) == [(1, 13)] def test_match_evil_no_match(self): expr = compile_re('(a|b)*a(a|b){5}a(a|b)*') result = find(expr, 'aaaaaaxbbbbaaaaabbbbbbb', 0) assert list(result) == [(-1, -1)] class TestLuaCompile(object): def test_single_char_build_expr(self): expr = compile_re('a') assert isinstance(expr, StateChar) assert expr.start == ord('a') assert expr.stop == ord('a') def test_two_chars_build_expr(self): expr = compile_re('ab') assert isinstance(expr, StateChar) assert expr.start == ord('a') assert isinstance(expr.out, StateChar) assert expr.out.start == ord('b') def test_three_chars_build_expr(self): expr = compile_re('abc') assert isinstance(expr, StateChar) assert expr.start == ord('a') assert isinstance(expr.out, StateChar) assert expr.out.start == ord('b') assert isinstance(expr.out.out, StateChar) assert expr.out.out.start == ord('c') def test_chars_and_dots_build_expr(self): expr = compile_re('a.c.', False) assert isinstance(expr, StateChar) assert expr.start == ord('a') assert isinstance(expr.out, StateDot) assert isinstance(expr.out.out, StateChar) assert expr.out.out.start == ord('c') assert isinstance(expr.out.out.out, StateDot) assert isinstance(expr.out.out.out.out, StateMatch) def test_chars_and_special_a_build_expr(self): expr = compile_re('%aa%a', False) assert isinstance(expr, StateCharRange) assert expr.start == ord('A') assert expr.stop == ord('z') assert isinstance(expr.out, StateChar) assert expr.out.stop == ord('a') assert isinstance(expr.out.out, StateCharRange) assert expr.out.out.start == ord('A') assert expr.out.out.stop == ord('z') assert isinstance(expr.out.out.out, StateMatch) def test_escape_percent_build_expr(self): expr = compile_re('%%', False) assert isinstance(expr, StateChar) assert expr.start == ord('%') assert isinstance(expr.out, StateMatch) def test_build_expr_pattern_with_star(self): expr = compile_re('a*', False) assert isinstance(expr, StateSplit) assert isinstance(expr.out, StateChar) assert expr.out.out == expr assert expr.out.start == ord('a') assert isinstance(expr.out2, StateMatch) def test_build_expr_pattern_with_star_2(self): expr = compile_re('a*b*', False) assert isinstance(expr, StateSplit) assert isinstance(expr.out, StateChar) assert expr.out.out == expr assert expr.out.start == ord('a') assert isinstance(expr.out2, StateSplit) assert isinstance(expr.out2.out, StateChar) assert expr.out2.out.out == expr.out2 assert expr.out2.out.start == ord('b') assert isinstance(expr.out2.out2, StateMatch) def test_build_expr_pattern_with_star_3(self): expr = compile_re('a*cb*', False) assert isinstance(expr, StateSplit) assert isinstance(expr.out, StateChar) assert expr.out.out == expr assert expr.out.start == ord('a') assert isinstance(expr.out2, StateChar) assert expr.out2.start == ord('c') assert isinstance(expr.out2.out, StateSplit) assert isinstance(expr.out2.out.out, StateChar) assert expr.out2.out.out.out == expr.out2.out assert expr.out2.out.out.start == ord('b') assert isinstance(expr.out2.out.out2, StateMatch) def test_build_expr_pattern_with_star_4(self): expr = compile_re('a.*c%a*', False) # a assert isinstance(expr, StateChar) assert expr.start == ord('a') # .* node = expr.out assert isinstance(node, StateSplit) assert isinstance(node.out, StateDot) assert node.out.out == node # c node = node.out2 assert isinstance(node, StateChar) assert node.start == ord('c') # %a* node = node.out assert isinstance(node, StateSplit) assert isinstance(node.out, StateCharRange) assert node.out.start == ord('A') assert node.out.stop == ord('z') assert node.out.out == node # match node = node.out2 assert isinstance(node, StateMatch) def test_build_expr_simple_or(self): expr = compile_re('a|b', False) # | assert isinstance(expr, StateSplit) # a node = expr.out assert isinstance(node, StateChar) assert node.stop == ord('a') assert isinstance(node.out, StateMatch) # b node = expr.out2 assert isinstance(node, StateChar) assert node.stop == ord('b') assert isinstance(node.out, StateMatch) def test_build_group_star(self): expr = compile_re('(ab)*', False) # * assert isinstance(expr, StateSplit) # a node = expr.out assert isinstance(node, StateChar) assert node.stop == ord('a') # b node = node.out assert isinstance(node, StateChar) assert node.stop == ord('b') assert node.out == expr # match assert isinstance(expr.out2, StateMatch) def test_build_group_star_chained(self): expr = compile_re('(ab)*ab', False) # * assert isinstance(expr, StateSplit) # a node = expr.out assert isinstance(node, StateChar) assert node.stop == ord('a') # b node = node.out assert isinstance(node, StateChar) assert node.stop == ord('b') assert node.out == expr # ab node = expr.out2 assert isinstance(node, StateChar) assert node.stop == ord('a') # b node = node.out assert isinstance(node, StateChar) assert node.stop == ord('b') # match assert isinstance(node.out, StateMatch) def test_build_group_or(self): expr = compile_re('(aa|bb)', False) # | assert isinstance(expr, StateSplit) # aa node = expr.out assert isinstance(node, StateChar) assert node.stop == ord('a') node = node.out assert isinstance(node, StateChar) assert node.stop == ord('a') assert isinstance(node.out, StateMatch) # bb node = expr.out2 assert isinstance(node, StateChar) assert node.stop == ord('b') node = node.out assert isinstance(node, StateChar) assert node.stop == ord('b') assert isinstance(node.out, StateMatch) def test_build_group_or_between_chars(self): expr = compile_re('x(aa|bb)x') # xaax assert isinstance(expr, StateChar) assert expr.start == ord('x') # | node = expr.out assert isinstance(node, StateSplit) # aax node = node.out assert isinstance(node, StateChar) assert node.stop == ord('a') node = node.out assert isinstance(node, StateChar) assert node.stop == ord('a') node = node.out assert isinstance(node, StateChar) assert node.stop == ord('x') assert isinstance(node.out, StateMatch) # bbx node = expr.out.out2 assert isinstance(node, StateChar) assert node.stop == ord('b') node = node.out assert isinstance(node, StateChar) assert node.stop == ord('b') node = node.out assert isinstance(node, StateChar) assert node.stop == ord('x') assert isinstance(node.out, StateMatch) def test_build_expr_with_repitition(self): expr = compile_re('a{3}') assert isinstance(expr, StateChar) assert isinstance(expr.out, StateChar) assert isinstance(expr.out.out, StateChar) assert isinstance(expr.out.out.out, StateMatch) def test_build_expr_misplaced_star(self): with pytest.raises(RuntimeError): compile_re('*') def test_build_expr_invalid_special_char(self): with pytest.raises(RuntimeError): compile_re('%,') def test_build_expr_misplaced_percent_1(self): with pytest.raises(RuntimeError): compile_re('%') def test_build_expr_misplaced_percent_2(self): with pytest.raises(RuntimeError): compile_re('a%%%') def test_build_expr_misplaced_percent_3(self): with pytest.raises(RuntimeError): compile_re('a%')