gt
stringclasses
1 value
context
stringlengths
2.49k
119k
import unittest from decimal import Decimal import iso8601 from lxml import etree from pythonic_testcase import assert_equals, assert_raises from soapfish import xsd, xsdspec class Aircraft(xsd.ComplexType): tail_number = xsd.Attribute(xsd.String) class Airport(xsd.ComplexType): type = xsd.Element(xsd.String) code = xsd.Element(xsd.String) @classmethod def create(cls, type, code): airport = Airport() airport.type = type airport.code = code return airport class Pilot(xsd.String): enumeration = ['CAPTAIN', 'FIRST_OFFICER'] class Flight(xsd.ComplexType): tail_number = xsd.Element(xsd.String) takeoff_datetime = xsd.Element(xsd.DateTime, minOccurs=0) takeoff_airport = xsd.Element(Airport) landing_airport = xsd.Element(Airport) takeoff_pilot = xsd.Element(Pilot, minOccurs=0) landing_pilot = xsd.Element(Pilot, minOccurs=0) passengers = xsd.ListElement(xsd.String, 'passenger', maxOccurs=10, minOccurs=0) class ElementTest(unittest.TestCase): # This logic have been moved to post rendering validation uncomment when implemented. # def test_required(self): # tail_number = xsd.Element(xsd.String) # try: # xmlelement = etree.Element('aircraft') # tail_number.render(xmlelement, 'tail_number', None) # except ValueError: # pass # else: # raise AssertionError('Should get here') def test_string_element(self): tail_number = xsd.Element(xsd.String()) xmlelement = etree.Element('aircraft') tail_number.render(xmlelement, 'tail_number', 'LN-KKU') self.assertEqual(b'''<aircraft> <tail_number>LN-KKU</tail_number> </aircraft> ''', etree.tostring(xmlelement, pretty_print=True)) def test_complex_type_element(self): airport = Airport() airport.type = 'IATA' airport.code = 'WAW' xmlelement = etree.Element('takeoff_airport') airport.render(xmlelement, airport) expected_xml = b'''<takeoff_airport> <type>IATA</type> <code>WAW</code> </takeoff_airport> ''' xml = etree.tostring(xmlelement, pretty_print=True) self.assertEqual(expected_xml, xml) def test_tagname_parsexml(self): class TestType(xsd.ComplexType): foo = xsd.Element(xsd.String, tagname='bar') xml = b'<T><bar>coucou</bar></T>' obj = TestType.parsexml(xml) self.assertEquals('coucou', obj.foo) def test_tagname_parse_xmlelement(self): class TestType(xsd.ComplexType): foo = xsd.Element(xsd.String, tagname='bar') xml = b'<T><bar>coucou</bar></T>' xmlelement = etree.fromstring(xml) obj = TestType.parse_xmlelement(xmlelement) self.assertEquals('coucou', obj.foo) def test_tagname_render(self): class TestType(xsd.ComplexType): foo = xsd.Element(xsd.String, tagname='bar') obj = TestType(foo='coucou') xmlelement = etree.Element('T') obj.render(xmlelement, obj) xml = etree.tostring(xmlelement) self.assertEquals(b'<T><bar>coucou</bar></T>', xml) def test_stringify_complextype(self): flight = Flight(takeoff_airport=Airport()) str(flight) class ListElementTest(unittest.TestCase): def test_rendering_simple_type(self): passengers = xsd.ListElement(xsd.String, 'passenger', maxOccurs=10, minOccurs=0) passengers_list = ['abc', '123'] xmlelement = etree.Element('flight') passengers.render(xmlelement, 'passenger', passengers_list) expected_xml = b'''<flight> <passenger>abc</passenger> <passenger>123</passenger> </flight> ''' xml = etree.tostring(xmlelement, pretty_print=True) self.assertEqual(expected_xml, xml) def test_parsing(self): class Test(xsd.ComplexType): values = xsd.ListElement(xsd.Int, 'value') XML = b''' <test> <value>1</value> <value>2</value> </test>''' test = Test.parsexml(XML) self.assertEqual(2, len(test.values)) self.assertEqual(1, test.values[0]) def test_append_restriction(self): l = xsd.ListElement(xsd.String, maxOccurs=1, tagname='toto').empty_value() l.append('a') e = assert_raises(ValueError, lambda: l.append('a')) assert_equals('You must not add more than 1 items to this list.', str(e)) def test_append_with_max_occurs_unbounded(self): l = xsd.ListElement(xsd.String, maxOccurs=xsd.UNBOUNDED, tagname='toto').empty_value() l.append('a') l.append('a') class BooleanTypeTest(unittest.TestCase): def test_element_true(self): mixed = xsd.Element(xsd.Boolean,) xmlelement = etree.Element('complexType') mixed.render(xmlelement, 'mixed', True) expected_xml = b'''<complexType> <mixed>true</mixed> </complexType> ''' xml = etree.tostring(xmlelement, pretty_print=True) self.assertEqual(expected_xml, xml) def test_boolean_correctly_renders_false_value_in_xml(self): # regression test for http://code.google.com/p/soapfish/issues/detail?id=3 # before xsd.Boolean would render [true, false] Python values *both* # to as 'true' in the xml. parent = etree.Element('parent') xsd.Element(xsd.Boolean).render(parent, 'b', True) self.assertEqual(b'<parent><b>true</b></parent>', etree.tostring(parent)) parent = etree.Element('parent') xsd.Element(xsd.Boolean).render(parent, 'b', False) self.assertEqual(b'<parent><b>false</b></parent>', etree.tostring(parent)) def test_attribute_false(self): mixed = xsd.Attribute(xsd.Boolean) xmlelement = etree.Element('complexType') mixed.render(xmlelement, 'mixed', True) expected_xml = b'<complexType mixed="true"/>\n' xml = etree.tostring(xmlelement, pretty_print=True) self.assertEqual(expected_xml, xml) def test_attribute_nil(self): mixed = xsd.Attribute(xsd.Boolean, nillable=True, use=xsd.Use.OPTIONAL) xmlelement = etree.Element('complexType') mixed.render(xmlelement, 'mixed', xsd.NIL) expected_xml = b'<complexType mixed="nil"/>\n' xml = etree.tostring(xmlelement, pretty_print=True) self.assertEqual(expected_xml, xml) class DecimalTypeTest(unittest.TestCase): def test_python_decimal(self): class Test(xsd.ComplexType): float = xsd.Element(xsd.Decimal()) test = Test() test.float = Decimal('2.2') def test_enumeration(self): class Test(xsd.ComplexType): integer = xsd.Element(xsd.Decimal(enumeration=[1, 2, 3])) test = Test() try: test.integer = 4 except ValueError: pass else: self.fail('Should not get here.') def test_fractionDigits(self): class Test(xsd.ComplexType): float = xsd.Element(xsd.Decimal(fractionDigits=2)) test = Test() test.float = 2.22 try: test.float = 2.2 except ValueError: pass else: self.fail('Should not get here.') def test_Inclusive(self): class Test(xsd.ComplexType): value = xsd.Element(xsd.Decimal(minInclusive=0, maxInclusive=100)) test = Test() test.value = 0 test.value = 50 test.value = 100 try: test.value = -1 except ValueError: pass else: self.fail('Should not get here.') try: test.value = 101 except ValueError: pass else: self.fail('Should not get here.') def test_Exclusive(self): class Test(xsd.ComplexType): value = xsd.Element(xsd.Decimal(minExclusive=-100, maxExclusive=0)) test = Test() test.value = -99 test.value = -50 test.value = -1 try: test.value = -100 except ValueError: pass else: self.fail('Should not get here.') try: test.value = 0 except ValueError: pass else: self.fail('Should not get here.') try: test.value = 1 except ValueError: pass else: self.fail('Should not get here.') try: test.value = -101 except ValueError: pass else: self.fail('Should not get here.') def test_pattern(self): class Test(xsd.ComplexType): value = xsd.Element(xsd.Decimal(pattern=r'1+')) test = Test() test.value = 11 test.value = 111 try: test.value = 2 except ValueError: pass else: self.fail('Should not get here.') def test_totalDigits(self): class Test(xsd.ComplexType): value = xsd.Element(xsd.Decimal(totalDigits=4)) test = Test() test.value = 1.2 test.value = 22.22 test.value = 1.234 try: test.value = 12.345 except ValueError: pass else: self.fail('Should not get here.') try: test.value = 12345 except ValueError: pass else: self.fail('Should not get here.') def test_rendring(self): class Test(xsd.ComplexType): value = xsd.Element(xsd.Decimal) test = Test() test.value = 4.13 xml = test.xml('test') self.assertEqual(b'<test>\n <value>4.13</value>\n</test>\n', xml) def test_parsing(self): xml = b'<test><value>3.14</value></test>' class Test(xsd.ComplexType): value = xsd.Element(xsd.Decimal) test = Test.parsexml(xml) self.assertEqual(test.value, 3.14, 'PI value is wrong OMG!') class IntegerTypeTest(unittest.TestCase): def test_rendering_and_parsing(self): class Test(xsd.ComplexType): value = xsd.Element(xsd.Integer(totalDigits=2)) test = Test() test.value = 22 xml = test.xml('test') XML = b'<test>\n <value>22</value>\n</test>\n' self.assertEqual(XML, xml) test1 = Test.parsexml(XML) self.assertEqual(22, test1.value) def test_Int(self): class Test(xsd.ComplexType): value = xsd.Element(xsd.Int) test = Test() test.value = 1 self.assertEqual(1, test.value) try: test.value = 2147483648 except ValueError: pass else: self.fail('Should not get here.') try: test.value = -2147483649 except ValueError: pass else: self.fail('Should not get here.') def test_Long(self): class Test(xsd.ComplexType): value = xsd.Element(xsd.Long) test = Test() test.value = 1 self.assertEqual(1, test.value) try: test.value = 9223372036854775807 + 1 except ValueError: pass else: self.fail('Should not get here.') try: test.value = -9223372036854775808 - 1 except ValueError: pass else: self.fail('Should not get here.') class ComplexTest(unittest.TestCase): def test_rendering(self): airport = Airport() airport.type = 'IATA' airport.code = 'WAW' xmlelement = etree.Element('airport') airport.render(xmlelement, airport) xml = etree.tostring(xmlelement, pretty_print=True) expected_xml = b'''<airport> <type>IATA</type> <code>WAW</code> </airport> ''' self.assertEqual(expected_xml, xml) def test_attribute_rendering(self): aircraft = Aircraft() aircraft.tail_number = 'LN-KKX' xmlelement = etree.Element('aircraft') aircraft.render(xmlelement, aircraft) expected_xml = b'<aircraft tail_number="LN-KKX"/>\n' xml = etree.tostring(xmlelement, pretty_print=True) self.assertEqual(expected_xml, xml) def test_attribute_parsing(self): XML = b'<aircraft tail_number="LN-KKX"/>\n' aircraft = Aircraft.parsexml(XML) self.assertEqual('LN-KKX', aircraft.tail_number) def test_multilayer_complex(self): flight = Flight() flight.tail_number = 'LN-KKA' flight.takeoff_airport = Airport.create('IATA', 'WAW') flight.landing_airport = Airport.create('ICAO', 'EGLL') try: flight.takeoff_pilot = 'ABC' except ValueError: pass else: self.fail() flight.takeoff_pilot = 'CAPTAIN' xmlelement = etree.Element('flight') flight.render(xmlelement, flight) xml = etree.tostring(xmlelement, pretty_print=True) expected_xml = b'''<flight> <tail_number>LN-KKA</tail_number> <takeoff_airport> <type>IATA</type> <code>WAW</code> </takeoff_airport> <landing_airport> <type>ICAO</type> <code>EGLL</code> </landing_airport> <takeoff_pilot>CAPTAIN</takeoff_pilot> </flight> ''' self.assertEqual(expected_xml, xml) def test_complex_with_list(self): flight = Flight() flight.tail_number = 'LN-KKA' flight.takeoff_airport = Airport.create('IATA', 'WAW') flight.landing_airport = Airport.create('ICAO', 'EGLL') flight.passengers.append('abc') flight.passengers.append('123') xmlelement = etree.Element('flight') flight.render(xmlelement, flight) xml = etree.tostring(xmlelement, pretty_print=True) expected_xml = b'''<flight> <tail_number>LN-KKA</tail_number> <takeoff_airport> <type>IATA</type> <code>WAW</code> </takeoff_airport> <landing_airport> <type>ICAO</type> <code>EGLL</code> </landing_airport> <passenger>abc</passenger> <passenger>123</passenger> </flight> ''' self.assertEqual(expected_xml, xml) def test_inheritance_rendering(self): class A(xsd.ComplexType): name = xsd.Attribute(xsd.String) class B(A): type = xsd.Attribute(xsd.String) b = B() b.name = 'b' b.type = 'B' xml = b.xml('inheritance') EXPECTED_XML = b'<inheritance name="b" type="B"/>\n' self.assertEqual(EXPECTED_XML, xml) def test_inheritance_parsing(self): class A(xsd.ComplexType): name = xsd.Attribute(xsd.String) class B(A): type = xsd.Element(xsd.String) XML = b'''<inheritance name="b"> <type>B</type> </inheritance>\n''' b = B.parsexml(XML) self.assertEqual(b.name, 'b') self.assertEqual(b.type, 'B') def test_parsexml_with_soapfish_schema(self): # sometimes it comes handy that soapfish can validate some XML against a # provided soapfish schema (instead of an etree.XMLSchema) especially in # testing. class A(xsd.ComplexType): name = xsd.Element(xsd.String, nillable=True) ns = 'http://foo.example' soapfish_schema = xsd.Schema(ns, imports=[], elementFormDefault=xsd.ElementFormDefault.UNQUALIFIED, simpleTypes=[], attributeGroups=[], groups=[], complexTypes=[A], elements={'foo': xsd.Element(A)}, ) xml = '<test:foo xmlns:test="%s"><name>bar</name></test:foo>' % ns foo = A.parsexml(xml, schema=soapfish_schema) assert_equals('bar', foo.name) class XMLParsingTest(unittest.TestCase): SIMPLE_XML = b'''<flight> <landing_airport> <code>EGLL</code> <type>ICAO</type> </landing_airport> <tail_number>LN-KKA</tail_number> <takeoff_datetime>2001-10-26T21:32:52</takeoff_datetime> <takeoff_airport> <code>WAW</code> <type>IATA</type> </takeoff_airport> </flight> ''' def test_simple_parsing(self): flight = Flight.parse_xmlelement(etree.fromstring(self.SIMPLE_XML)) self.assertEqual('LN-KKA', flight.tail_number) self.assertEqual('WAW', flight.takeoff_airport.code) self.assertEqual('IATA', flight.takeoff_airport.type) self.assertEqual('EGLL', flight.landing_airport.code) self.assertEqual('ICAO', flight.landing_airport.type) self.assertEqual(iso8601.parse_date('2001-10-26T21:32:52Z'), flight.takeoff_datetime) LIST_XML = b'''<flight> <landing_airport> <code>EGLL</code> <type>ICAO</type> </landing_airport> <passenger>abc</passenger> <passenger>123</passenger> <tail_number>LN-KKA</tail_number> <takeoff_airport> <code>WAW</code> <type>IATA</type> </takeoff_airport> </flight> ''' def test_list_parsing(self): flight = Flight.parse_xmlelement(etree.fromstring(self.LIST_XML)) self.assertEqual('LN-KKA', flight.tail_number) self.assertEqual('WAW', flight.takeoff_airport.code) self.assertEqual('IATA', flight.takeoff_airport.type) self.assertEqual('EGLL', flight.landing_airport.code) self.assertEqual('ICAO', flight.landing_airport.type) self.assertEqual(['abc', '123'], flight.passengers) class XSD_Spec_Test(unittest.TestCase): AIRPORT_XML = ''' <xs:complexType name="airport" xmlns:xs="http://www.w3.org/2001/XMLSchema"> <xs:sequence> <xs:element name="code_type"> <xs:simpleType> <xs:restriction base="xs:string"> <xs:enumeration value="ICAO"/> <xs:enumeration value="IATA"/> <xs:enumeration value="FAA"/> </xs:restriction> </xs:simpleType> </xs:element> <xs:element name="code" type="xs:string"/> </xs:sequence> </xs:complexType>''' def test_complexType(self): airport = xsdspec.XSDComplexType.parse_xmlelement(etree.fromstring(self.AIRPORT_XML)) self.assertEqual('airport', airport.name) code_type_element = airport.sequence.elements[0] code_element = airport.sequence.elements[1] self.assertEqual('code_type', code_type_element.name) self.assertEqual('xs:string', code_type_element.simpleType.restriction.base) self.assertEqual(3, len(code_type_element.simpleType.restriction.enumerations)) self.assertEqual('ICAO', code_type_element.simpleType.restriction.enumerations[0].value) self.assertEqual('code', code_element.name) SCHEMA_XML = ''' <xs:schema xmlns:xs="http://www.w3.org/2001/XMLSchema" targetNamespace="http://flightdataservices.com/ops.xsd"> <xs:complexType name="airport"> <xs:sequence> <xs:element name="code_type"> <xs:simpleType> <xs:restriction base="xs:string"> <xs:enumeration value="ICAO"/> <xs:enumeration value="IATA"/> <xs:enumeration value="FAA"/> </xs:restriction> </xs:simpleType> </xs:element> <xs:element name="code" type="xs:string"/> </xs:sequence> </xs:complexType> <xs:complexType name="weight"> <xs:sequence> <xs:element name="value" type="xs:integer"/> <xs:element name="unit"> <xs:simpleType> <xs:restriction base="xs:string"> <xs:enumeration value="kg"/> <xs:enumeration value="lb"/> </xs:restriction> </xs:simpleType> </xs:element> </xs:sequence> </xs:complexType> <xs:simpleType name="pilot"> <xs:restriction base="xs:string"> <xs:enumeration value="CAPTAIN"/> <xs:enumeration value="FIRST_OFFICER"/> </xs:restriction> </xs:simpleType> <xs:complexType name="ops"> <xs:sequence> <xs:element name="aircraft" type="xs:string"/> <xs:element name="flight_number" type="xs:string"/> <xs:element name="type"> <xs:simpleType> <xs:restriction base="xs:string"> <xs:enumeration value="COMMERCIAL"/> <xs:enumeration value="INCOMPLETE"/> <xs:enumeration value="ENGINE_RUN_UP"/> <xs:enumeration value="TEST"/> <xs:enumeration value="TRAINING"/> <xs:enumeration value="FERRY"/> <xs:enumeration value="POSITIONING"/> <xs:enumeration value="LINE_TRAINING"/> </xs:restriction> </xs:simpleType> </xs:element> <xs:element name="takeoff_airport" type="fds:airport"/> <xs:element name="takeoff_gate_datetime" type="xs:dateTime" minOccurs="0"/> <xs:element name="takeoff_datetime" type="xs:dateTime"/> <xs:element name="takeoff_fuel" minOccurs="0" type="fds:weight"/> <xs:element name="takeoff_gross_weight" minOccurs="0" type="fds:weight"/> <xs:element name="takeoff_pilot" minOccurs="0" type="fds:pilot"/> <xs:element name="landing_airport" type="fds:airport"/> <xs:element name="landing_gate_datetime" type="xs:dateTime" minOccurs="0"/> <xs:element name="landing_datetime" type="xs:dateTime"/> <xs:element name="landing_fuel" minOccurs="0" type="fds:weight"/> <xs:element name="landing_pilot" minOccurs="0" type="fds:pilot"/> <xs:element name="destination_airport" minOccurs="0" type="fds:airport"/> <xs:element name="captain_code" minOccurs="0" type="xs:string"/> <xs:element name="first_officer_code" minOccurs="0" type="xs:string"/> </xs:sequence> </xs:complexType> <xs:complexType name="status"> <xs:sequence> <xs:element name="action"> <xs:simpleType> <xs:restriction base="xs:string"> <xs:enumeration value="INSERTED"/> <xs:enumeration value="UPDATED"/> <xs:enumeration value="EXISTS"/> </xs:restriction> </xs:simpleType> </xs:element> <xs:element name="id" type="xs:long"/> </xs:sequence> </xs:complexType> <xs:element name="ops" type="fds:ops"/> <xs:element name="status" type="fds:status"/> </xs:schema>''' class SchemaTest(unittest.TestCase): def test_schema_parsing(self): schema = xsdspec.Schema.parse_xmlelement(etree.fromstring(SCHEMA_XML)) self.assertEqual(4, len(schema.complexTypes)) self.assertEqual(1, len(schema.simpleTypes)) self.assertEqual(2, len(schema.elements)) self.assertEqual('ops', schema.elements[0].name) self.assertEqual('fds:ops', schema.elements[0].type) ops_type = schema.complexTypes[2] self.assertEqual('ops', ops_type.name) self.assertEqual('aircraft', ops_type.sequence.elements[0].name) self.assertEqual('xs:string', ops_type.sequence.elements[0].type) class RequestResponseOperation(xsd.Group): input = xsd.Element(xsd.String, minOccurs=0) output = xsd.Element(xsd.String, minOccurs=0) class Operation(xsd.ComplexType): name = xsd.Element(xsd.String) requestResponseOperation = xsd.Ref(RequestResponseOperation) class GroupTest(unittest.TestCase): XML = b'''<operation> <name>TEST-Operation</name> <input>IN</input> <output>OUT</output> </operation>\n''' def test_rendering(self): operation = Operation() operation.name = 'TEST-Operation' operation.requestResponseOperation.input = 'IN' operation.requestResponseOperation.output = 'OUT' xml = operation.xml('operation') self.assertEqual(self.XML, xml) def test_parsing(self): operation = Operation.parsexml(self.XML) self.assertEqual(operation.name, 'TEST-Operation') self.assertEqual(operation.requestResponseOperation.input, 'IN') self.assertEqual(operation.requestResponseOperation.output, 'OUT') def test_rendering_empty_group(self): operation = Operation() operation.name = 'TEST-Operation' xml = operation.xml('operation') expected_xml = b'''<operation> <name>TEST-Operation</name> </operation>\n''' self.assertEqual(expected_xml, xml) # <xs:attributeGroup name="tHeaderAttributes"> # <xs:attribute name="message" type="xs:QName" use="required"/> # <xs:attribute name="part" type="xs:NMTOKEN" use="required"/> # <xs:attribute name="use" type="soap:useChoice" use="required"/> # <xs:attribute name="encodingStyle" type="soap:encodingStyle" use="optional"/> # <xs:attribute name="namespace" type="xs:anyURI" use="optional"/> # </xs:attributeGroup> class TBodyAttributes(xsd.AttributeGroup): encodingStyle = xsd.Attribute(xsd.String, use=xsd.Use.OPTIONAL) use = xsd.Attribute(xsd.String) namespace = xsd.Attribute(xsd.String) class TBody(xsd.ComplexType): parts = xsd.Attribute(xsd.String) tBodyAttributes = xsd.Ref(TBodyAttributes) class AttributeGroupTest(unittest.TestCase): def test_rendering(self): body = TBody() body.parts = 'Parts' body.tBodyAttributes.use = 'required' body.tBodyAttributes.namespace = 'xs' expected_xml = b'<body parts="Parts" use="required" namespace="xs"/>\n' xml = body.xml('body') self.assertEqual(expected_xml, xml) def test_parsing(self): xml = b'<body parts="Parts" use="required" namespace="xs"/>\n' body = TBody.parsexml(xml) self.assertEqual(body.parts, 'Parts') self.assertEqual(body.tBodyAttributes.use, 'required') self.assertEqual(body.tBodyAttributes.namespace, 'xs') self.assertEqual(body.tBodyAttributes.encodingStyle, None) class AirporttDocument(xsd.Document): airport = xsd.Element(Airport) class DocumentTest(unittest.TestCase): def test_document_rendering(self): document = AirporttDocument() document.airport = Airport(code='XXX', type='IATA') xml = document.render() expected_xml = b'''<airport> <type>IATA</type> <code>XXX</code> </airport>\n''' self.assertEqual(xml, expected_xml) class NillableTest(unittest.TestCase): def test_nilable_element_rendering(self): class Test(xsd.ComplexType): value = xsd.Element(xsd.Integer, nillable=True) notnillable = xsd.Element(xsd.Integer, minOccurs=0) test = Test() test.value = xsd.NIL xml = test.xml('test') EXPECTED_XML = b'''<test> <value xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:nil="true"/> </test>\n''' self.assertEqual(xml, EXPECTED_XML) try: test.notnillable = xsd.NIL except ValueError: pass else: self.fail('Should not get here.') def test_nillable_element_parsing(self): class Test(xsd.ComplexType): value = xsd.Element(xsd.Long, nillable=True) xml = b'<test><value xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:nil="true"/></test>' test = Test.parsexml(xml) self.assertEqual(test.value, xsd.NIL) def test_nillable_list_rendering(self): class Test(xsd.ComplexType): values = xsd.ListElement(xsd.String, 'value', nillable=True) notnillable = xsd.ListElement(xsd.String, 'notnillable', minOccurs=0) test = Test() test.values.append('XXX') test.values.append(xsd.NIL) xml = test.xml('test') EXPECTED_XML = b'''<test> <value>XXX</value> <value xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:nil="true"/> </test>\n''' self.assertEqual(xml, EXPECTED_XML) self.assertRaises(Exception, lambda: test.notnillable.append(xsd.NIL)) def test_nillable_list_parsing(self): class Test(xsd.ComplexType): values = xsd.ListElement(xsd.Int, 'value', nillable=True) XML = b'''<test> <value>1</value> <value xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:nil="true"/> <value xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:nil="true"/> <value>2</value> </test> ''' test = Test.parsexml(XML) self.assertEqual(test.values[0], 1) self.assertEqual(test.values[1], xsd.NIL) self.assertEqual(test.values[2], xsd.NIL) self.assertEqual(test.values[3], 2) def test_nillable_attribute(self): class Test(xsd.ComplexType): value = xsd.Attribute(xsd.String, nillable=True, use=xsd.Use.OPTIONAL) test = Test() self.assertEqual(test.xml('test'), b'<test/>\n') test.value = xsd.NIL self.assertEqual(b'<test value="nil"/>\n', test.xml('test')) class ElementTypeEvaluation(unittest.TestCase): def test_string_type_evalutation(self): class B1(xsd.ComplexType): a = xsd.Element('soapfish.xsd.String') b = xsd.Element('soapfish.xsd.Integer') b = B1() b.a = 'test' b.b = 123 class PatternTest(unittest.TestCase): def test_string_pattern(self): class Test(xsd.ComplexType): value = xsd.Element(xsd.String(pattern=r'^a*$')) test = Test() test.value = 'a' test.value = 'aaa' try: test.value = 'b' except ValueError: pass else: self.fail('Should not get here.') class MaxOccursTest(unittest.TestCase): def test_xmlvalue_simple(self): max_occurs = xsd.MaxOccurs() value = max_occurs.xmlvalue(1) self.assertEqual('1', value) value = max_occurs.xmlvalue(5) self.assertEqual('5', value) def test_xmlvalue_unbounded(self): max_occurs = xsd.MaxOccurs() value = max_occurs.xmlvalue(xsd.UNBOUNDED) self.assertEqual('unbounded', value) def test_pythonvalue_simple(self): max_occurs = xsd.MaxOccurs() value = max_occurs.pythonvalue('1') self.assertEqual(1, value) value = max_occurs.pythonvalue('5') self.assertEqual(5, value) def test_pythonvalue_unbounded(self): max_occurs = xsd.MaxOccurs() value = max_occurs.pythonvalue('unbounded') self.assertEqual(xsd.UNBOUNDED, value) if __name__ == '__main__': unittest.main()
import difflib import pprint import pickle import re import sys import warnings import weakref import inspect from copy import deepcopy from test import support import unittest from .support import ( TestEquality, TestHashing, LoggingResult, ResultWithNoStartTestRunStopTestRun ) class Test(object): "Keep these TestCase classes out of the main namespace" class Foo(unittest.TestCase): def runTest(self): pass def test1(self): pass class Bar(Foo): def test2(self): pass class LoggingTestCase(unittest.TestCase): """A test case which logs its calls.""" def __init__(self, events): super(Test.LoggingTestCase, self).__init__('test') self.events = events def setUp(self): self.events.append('setUp') def test(self): self.events.append('test') def tearDown(self): self.events.append('tearDown') class Test_TestCase(unittest.TestCase, TestEquality, TestHashing): ### Set up attributes used by inherited tests ################################################################ # Used by TestHashing.test_hash and TestEquality.test_eq eq_pairs = [(Test.Foo('test1'), Test.Foo('test1'))] # Used by TestEquality.test_ne ne_pairs = [(Test.Foo('test1'), Test.Foo('runTest')), (Test.Foo('test1'), Test.Bar('test1')), (Test.Foo('test1'), Test.Bar('test2'))] ################################################################ ### /Set up attributes used by inherited tests # "class TestCase([methodName])" # ... # "Each instance of TestCase will run a single test method: the # method named methodName." # ... # "methodName defaults to "runTest"." # # Make sure it really is optional, and that it defaults to the proper # thing. def test_init__no_test_name(self): class Test(unittest.TestCase): def runTest(self): raise MyException() def test(self): pass self.assertEqual(Test().id()[-13:], '.Test.runTest') # test that TestCase can be instantiated with no args # primarily for use at the interactive interpreter test = unittest.TestCase() test.assertEqual(3, 3) with test.assertRaises(test.failureException): test.assertEqual(3, 2) with self.assertRaises(AttributeError): test.run() # "class TestCase([methodName])" # ... # "Each instance of TestCase will run a single test method: the # method named methodName." def test_init__test_name__valid(self): class Test(unittest.TestCase): def runTest(self): raise MyException() def test(self): pass self.assertEqual(Test('test').id()[-10:], '.Test.test') # "class TestCase([methodName])" # ... # "Each instance of TestCase will run a single test method: the # method named methodName." def test_init__test_name__invalid(self): class Test(unittest.TestCase): def runTest(self): raise MyException() def test(self): pass try: Test('testfoo') except ValueError: pass else: self.fail("Failed to raise ValueError") # "Return the number of tests represented by the this test object. For # TestCase instances, this will always be 1" def test_countTestCases(self): class Foo(unittest.TestCase): def test(self): pass self.assertEqual(Foo('test').countTestCases(), 1) # "Return the default type of test result object to be used to run this # test. For TestCase instances, this will always be # unittest.TestResult; subclasses of TestCase should # override this as necessary." def test_defaultTestResult(self): class Foo(unittest.TestCase): def runTest(self): pass result = Foo().defaultTestResult() self.assertEqual(type(result), unittest.TestResult) # "When a setUp() method is defined, the test runner will run that method # prior to each test. Likewise, if a tearDown() method is defined, the # test runner will invoke that method after each test. In the example, # setUp() was used to create a fresh sequence for each test." # # Make sure the proper call order is maintained, even if setUp() raises # an exception. def test_run_call_order__error_in_setUp(self): events = [] result = LoggingResult(events) class Foo(Test.LoggingTestCase): def setUp(self): super(Foo, self).setUp() raise RuntimeError('raised by Foo.setUp') Foo(events).run(result) expected = ['startTest', 'setUp', 'addError', 'stopTest'] self.assertEqual(events, expected) # "With a temporary result stopTestRun is called when setUp errors. def test_run_call_order__error_in_setUp_default_result(self): events = [] class Foo(Test.LoggingTestCase): def defaultTestResult(self): return LoggingResult(self.events) def setUp(self): super(Foo, self).setUp() raise RuntimeError('raised by Foo.setUp') Foo(events).run() expected = ['startTestRun', 'startTest', 'setUp', 'addError', 'stopTest', 'stopTestRun'] self.assertEqual(events, expected) # "When a setUp() method is defined, the test runner will run that method # prior to each test. Likewise, if a tearDown() method is defined, the # test runner will invoke that method after each test. In the example, # setUp() was used to create a fresh sequence for each test." # # Make sure the proper call order is maintained, even if the test raises # an error (as opposed to a failure). def test_run_call_order__error_in_test(self): events = [] result = LoggingResult(events) class Foo(Test.LoggingTestCase): def test(self): super(Foo, self).test() raise RuntimeError('raised by Foo.test') expected = ['startTest', 'setUp', 'test', 'tearDown', 'addError', 'stopTest'] Foo(events).run(result) self.assertEqual(events, expected) # "With a default result, an error in the test still results in stopTestRun # being called." def test_run_call_order__error_in_test_default_result(self): events = [] class Foo(Test.LoggingTestCase): def defaultTestResult(self): return LoggingResult(self.events) def test(self): super(Foo, self).test() raise RuntimeError('raised by Foo.test') expected = ['startTestRun', 'startTest', 'setUp', 'test', 'tearDown', 'addError', 'stopTest', 'stopTestRun'] Foo(events).run() self.assertEqual(events, expected) # "When a setUp() method is defined, the test runner will run that method # prior to each test. Likewise, if a tearDown() method is defined, the # test runner will invoke that method after each test. In the example, # setUp() was used to create a fresh sequence for each test." # # Make sure the proper call order is maintained, even if the test signals # a failure (as opposed to an error). def test_run_call_order__failure_in_test(self): events = [] result = LoggingResult(events) class Foo(Test.LoggingTestCase): def test(self): super(Foo, self).test() self.fail('raised by Foo.test') expected = ['startTest', 'setUp', 'test', 'tearDown', 'addFailure', 'stopTest'] Foo(events).run(result) self.assertEqual(events, expected) # "When a test fails with a default result stopTestRun is still called." def test_run_call_order__failure_in_test_default_result(self): class Foo(Test.LoggingTestCase): def defaultTestResult(self): return LoggingResult(self.events) def test(self): super(Foo, self).test() self.fail('raised by Foo.test') expected = ['startTestRun', 'startTest', 'setUp', 'test', 'tearDown', 'addFailure', 'stopTest', 'stopTestRun'] events = [] Foo(events).run() self.assertEqual(events, expected) # "When a setUp() method is defined, the test runner will run that method # prior to each test. Likewise, if a tearDown() method is defined, the # test runner will invoke that method after each test. In the example, # setUp() was used to create a fresh sequence for each test." # # Make sure the proper call order is maintained, even if tearDown() raises # an exception. def test_run_call_order__error_in_tearDown(self): events = [] result = LoggingResult(events) class Foo(Test.LoggingTestCase): def tearDown(self): super(Foo, self).tearDown() raise RuntimeError('raised by Foo.tearDown') Foo(events).run(result) expected = ['startTest', 'setUp', 'test', 'tearDown', 'addError', 'stopTest'] self.assertEqual(events, expected) # "When tearDown errors with a default result stopTestRun is still called." def test_run_call_order__error_in_tearDown_default_result(self): class Foo(Test.LoggingTestCase): def defaultTestResult(self): return LoggingResult(self.events) def tearDown(self): super(Foo, self).tearDown() raise RuntimeError('raised by Foo.tearDown') events = [] Foo(events).run() expected = ['startTestRun', 'startTest', 'setUp', 'test', 'tearDown', 'addError', 'stopTest', 'stopTestRun'] self.assertEqual(events, expected) # "TestCase.run() still works when the defaultTestResult is a TestResult # that does not support startTestRun and stopTestRun. def test_run_call_order_default_result(self): class Foo(unittest.TestCase): def defaultTestResult(self): return ResultWithNoStartTestRunStopTestRun() def test(self): pass Foo('test').run() # "This class attribute gives the exception raised by the test() method. # If a test framework needs to use a specialized exception, possibly to # carry additional information, it must subclass this exception in # order to ``play fair'' with the framework. The initial value of this # attribute is AssertionError" def test_failureException__default(self): class Foo(unittest.TestCase): def test(self): pass self.assertIs(Foo('test').failureException, AssertionError) # "This class attribute gives the exception raised by the test() method. # If a test framework needs to use a specialized exception, possibly to # carry additional information, it must subclass this exception in # order to ``play fair'' with the framework." # # Make sure TestCase.run() respects the designated failureException def test_failureException__subclassing__explicit_raise(self): events = [] result = LoggingResult(events) class Foo(unittest.TestCase): def test(self): raise RuntimeError() failureException = RuntimeError self.assertIs(Foo('test').failureException, RuntimeError) Foo('test').run(result) expected = ['startTest', 'addFailure', 'stopTest'] self.assertEqual(events, expected) # "This class attribute gives the exception raised by the test() method. # If a test framework needs to use a specialized exception, possibly to # carry additional information, it must subclass this exception in # order to ``play fair'' with the framework." # # Make sure TestCase.run() respects the designated failureException def test_failureException__subclassing__implicit_raise(self): events = [] result = LoggingResult(events) class Foo(unittest.TestCase): def test(self): self.fail("foo") failureException = RuntimeError self.assertIs(Foo('test').failureException, RuntimeError) Foo('test').run(result) expected = ['startTest', 'addFailure', 'stopTest'] self.assertEqual(events, expected) # "The default implementation does nothing." def test_setUp(self): class Foo(unittest.TestCase): def runTest(self): pass # ... and nothing should happen Foo().setUp() # "The default implementation does nothing." def test_tearDown(self): class Foo(unittest.TestCase): def runTest(self): pass # ... and nothing should happen Foo().tearDown() # "Return a string identifying the specific test case." # # Because of the vague nature of the docs, I'm not going to lock this # test down too much. Really all that can be asserted is that the id() # will be a string (either 8-byte or unicode -- again, because the docs # just say "string") def test_id(self): class Foo(unittest.TestCase): def runTest(self): pass self.assertIsInstance(Foo().id(), str) # "If result is omitted or None, a temporary result object is created, # used, and is made available to the caller. As TestCase owns the # temporary result startTestRun and stopTestRun are called. def test_run__uses_defaultTestResult(self): events = [] defaultResult = LoggingResult(events) class Foo(unittest.TestCase): def test(self): events.append('test') def defaultTestResult(self): return defaultResult # Make run() find a result object on its own result = Foo('test').run() self.assertIs(result, defaultResult) expected = ['startTestRun', 'startTest', 'test', 'addSuccess', 'stopTest', 'stopTestRun'] self.assertEqual(events, expected) # "The result object is returned to run's caller" def test_run__returns_given_result(self): class Foo(unittest.TestCase): def test(self): pass result = unittest.TestResult() retval = Foo('test').run(result) self.assertIs(retval, result) # "The same effect [as method run] may be had by simply calling the # TestCase instance." def test_call__invoking_an_instance_delegates_to_run(self): resultIn = unittest.TestResult() resultOut = unittest.TestResult() class Foo(unittest.TestCase): def test(self): pass def run(self, result): self.assertIs(result, resultIn) return resultOut retval = Foo('test')(resultIn) self.assertIs(retval, resultOut) def testShortDescriptionWithoutDocstring(self): self.assertIsNone(self.shortDescription()) @unittest.skipIf(sys.flags.optimize >= 2, "Docstrings are omitted with -O2 and above") def testShortDescriptionWithOneLineDocstring(self): """Tests shortDescription() for a method with a docstring.""" self.assertEqual( self.shortDescription(), 'Tests shortDescription() for a method with a docstring.') @unittest.skipIf(sys.flags.optimize >= 2, "Docstrings are omitted with -O2 and above") def testShortDescriptionWithMultiLineDocstring(self): """Tests shortDescription() for a method with a longer docstring. This method ensures that only the first line of a docstring is returned used in the short description, no matter how long the whole thing is. """ self.assertEqual( self.shortDescription(), 'Tests shortDescription() for a method with a longer ' 'docstring.') def testAddTypeEqualityFunc(self): class SadSnake(object): """Dummy class for test_addTypeEqualityFunc.""" s1, s2 = SadSnake(), SadSnake() self.assertFalse(s1 == s2) def AllSnakesCreatedEqual(a, b, msg=None): return type(a) == type(b) == SadSnake self.addTypeEqualityFunc(SadSnake, AllSnakesCreatedEqual) self.assertEqual(s1, s2) # No this doesn't clean up and remove the SadSnake equality func # from this TestCase instance but since its a local nothing else # will ever notice that. def testAssertIs(self): thing = object() self.assertIs(thing, thing) self.assertRaises(self.failureException, self.assertIs, thing, object()) def testAssertIsNot(self): thing = object() self.assertIsNot(thing, object()) self.assertRaises(self.failureException, self.assertIsNot, thing, thing) def testAssertIsInstance(self): thing = [] self.assertIsInstance(thing, list) self.assertRaises(self.failureException, self.assertIsInstance, thing, dict) def testAssertNotIsInstance(self): thing = [] self.assertNotIsInstance(thing, dict) self.assertRaises(self.failureException, self.assertNotIsInstance, thing, list) def testAssertIn(self): animals = {'monkey': 'banana', 'cow': 'grass', 'seal': 'fish'} self.assertIn('a', 'abc') self.assertIn(2, [1, 2, 3]) self.assertIn('monkey', animals) self.assertNotIn('d', 'abc') self.assertNotIn(0, [1, 2, 3]) self.assertNotIn('otter', animals) self.assertRaises(self.failureException, self.assertIn, 'x', 'abc') self.assertRaises(self.failureException, self.assertIn, 4, [1, 2, 3]) self.assertRaises(self.failureException, self.assertIn, 'elephant', animals) self.assertRaises(self.failureException, self.assertNotIn, 'c', 'abc') self.assertRaises(self.failureException, self.assertNotIn, 1, [1, 2, 3]) self.assertRaises(self.failureException, self.assertNotIn, 'cow', animals) def testAssertDictContainsSubset(self): with warnings.catch_warnings(): warnings.simplefilter("ignore", DeprecationWarning) self.assertDictContainsSubset({}, {}) self.assertDictContainsSubset({}, {'a': 1}) self.assertDictContainsSubset({'a': 1}, {'a': 1}) self.assertDictContainsSubset({'a': 1}, {'a': 1, 'b': 2}) self.assertDictContainsSubset({'a': 1, 'b': 2}, {'a': 1, 'b': 2}) with self.assertRaises(self.failureException): self.assertDictContainsSubset({1: "one"}, {}) with self.assertRaises(self.failureException): self.assertDictContainsSubset({'a': 2}, {'a': 1}) with self.assertRaises(self.failureException): self.assertDictContainsSubset({'c': 1}, {'a': 1}) with self.assertRaises(self.failureException): self.assertDictContainsSubset({'a': 1, 'c': 1}, {'a': 1}) with self.assertRaises(self.failureException): self.assertDictContainsSubset({'a': 1, 'c': 1}, {'a': 1}) one = ''.join(chr(i) for i in range(255)) # this used to cause a UnicodeDecodeError constructing the failure msg with self.assertRaises(self.failureException): self.assertDictContainsSubset({'foo': one}, {'foo': '\uFFFD'}) def testAssertEqual(self): equal_pairs = [ ((), ()), ({}, {}), ([], []), (set(), set()), (frozenset(), frozenset())] for a, b in equal_pairs: # This mess of try excepts is to test the assertEqual behavior # itself. try: self.assertEqual(a, b) except self.failureException: self.fail('assertEqual(%r, %r) failed' % (a, b)) try: self.assertEqual(a, b, msg='foo') except self.failureException: self.fail('assertEqual(%r, %r) with msg= failed' % (a, b)) try: self.assertEqual(a, b, 'foo') except self.failureException: self.fail('assertEqual(%r, %r) with third parameter failed' % (a, b)) unequal_pairs = [ ((), []), ({}, set()), (set([4,1]), frozenset([4,2])), (frozenset([4,5]), set([2,3])), (set([3,4]), set([5,4]))] for a, b in unequal_pairs: self.assertRaises(self.failureException, self.assertEqual, a, b) self.assertRaises(self.failureException, self.assertEqual, a, b, 'foo') self.assertRaises(self.failureException, self.assertEqual, a, b, msg='foo') def testEquality(self): self.assertListEqual([], []) self.assertTupleEqual((), ()) self.assertSequenceEqual([], ()) a = [0, 'a', []] b = [] self.assertRaises(unittest.TestCase.failureException, self.assertListEqual, a, b) self.assertRaises(unittest.TestCase.failureException, self.assertListEqual, tuple(a), tuple(b)) self.assertRaises(unittest.TestCase.failureException, self.assertSequenceEqual, a, tuple(b)) b.extend(a) self.assertListEqual(a, b) self.assertTupleEqual(tuple(a), tuple(b)) self.assertSequenceEqual(a, tuple(b)) self.assertSequenceEqual(tuple(a), b) self.assertRaises(self.failureException, self.assertListEqual, a, tuple(b)) self.assertRaises(self.failureException, self.assertTupleEqual, tuple(a), b) self.assertRaises(self.failureException, self.assertListEqual, None, b) self.assertRaises(self.failureException, self.assertTupleEqual, None, tuple(b)) self.assertRaises(self.failureException, self.assertSequenceEqual, None, tuple(b)) self.assertRaises(self.failureException, self.assertListEqual, 1, 1) self.assertRaises(self.failureException, self.assertTupleEqual, 1, 1) self.assertRaises(self.failureException, self.assertSequenceEqual, 1, 1) self.assertDictEqual({}, {}) c = { 'x': 1 } d = {} self.assertRaises(unittest.TestCase.failureException, self.assertDictEqual, c, d) d.update(c) self.assertDictEqual(c, d) d['x'] = 0 self.assertRaises(unittest.TestCase.failureException, self.assertDictEqual, c, d, 'These are unequal') self.assertRaises(self.failureException, self.assertDictEqual, None, d) self.assertRaises(self.failureException, self.assertDictEqual, [], d) self.assertRaises(self.failureException, self.assertDictEqual, 1, 1) def testAssertSequenceEqualMaxDiff(self): self.assertEqual(self.maxDiff, 80*8) seq1 = 'a' + 'x' * 80**2 seq2 = 'b' + 'x' * 80**2 diff = '\n'.join(difflib.ndiff(pprint.pformat(seq1).splitlines(), pprint.pformat(seq2).splitlines())) # the +1 is the leading \n added by assertSequenceEqual omitted = unittest.case.DIFF_OMITTED % (len(diff) + 1,) self.maxDiff = len(diff)//2 try: self.assertSequenceEqual(seq1, seq2) except self.failureException as e: msg = e.args[0] else: self.fail('assertSequenceEqual did not fail.') self.assertLess(len(msg), len(diff)) self.assertIn(omitted, msg) self.maxDiff = len(diff) * 2 try: self.assertSequenceEqual(seq1, seq2) except self.failureException as e: msg = e.args[0] else: self.fail('assertSequenceEqual did not fail.') self.assertGreater(len(msg), len(diff)) self.assertNotIn(omitted, msg) self.maxDiff = None try: self.assertSequenceEqual(seq1, seq2) except self.failureException as e: msg = e.args[0] else: self.fail('assertSequenceEqual did not fail.') self.assertGreater(len(msg), len(diff)) self.assertNotIn(omitted, msg) def testTruncateMessage(self): self.maxDiff = 1 message = self._truncateMessage('foo', 'bar') omitted = unittest.case.DIFF_OMITTED % len('bar') self.assertEqual(message, 'foo' + omitted) self.maxDiff = None message = self._truncateMessage('foo', 'bar') self.assertEqual(message, 'foobar') self.maxDiff = 4 message = self._truncateMessage('foo', 'bar') self.assertEqual(message, 'foobar') def testAssertDictEqualTruncates(self): test = unittest.TestCase('assertEqual') def truncate(msg, diff): return 'foo' test._truncateMessage = truncate try: test.assertDictEqual({}, {1: 0}) except self.failureException as e: self.assertEqual(str(e), 'foo') else: self.fail('assertDictEqual did not fail') def testAssertMultiLineEqualTruncates(self): test = unittest.TestCase('assertEqual') def truncate(msg, diff): return 'foo' test._truncateMessage = truncate try: test.assertMultiLineEqual('foo', 'bar') except self.failureException as e: self.assertEqual(str(e), 'foo') else: self.fail('assertMultiLineEqual did not fail') def testAssertEqual_diffThreshold(self): # check threshold value self.assertEqual(self._diffThreshold, 2**16) # disable madDiff to get diff markers self.maxDiff = None # set a lower threshold value and add a cleanup to restore it old_threshold = self._diffThreshold self._diffThreshold = 2**8 self.addCleanup(lambda: setattr(self, '_diffThreshold', old_threshold)) # under the threshold: diff marker (^) in error message s = 'x' * (2**7) with self.assertRaises(self.failureException) as cm: self.assertEqual(s + 'a', s + 'b') self.assertIn('^', str(cm.exception)) self.assertEqual(s + 'a', s + 'a') # over the threshold: diff not used and marker (^) not in error message s = 'x' * (2**9) # if the path that uses difflib is taken, _truncateMessage will be # called -- replace it with explodingTruncation to verify that this # doesn't happen def explodingTruncation(message, diff): raise SystemError('this should not be raised') old_truncate = self._truncateMessage self._truncateMessage = explodingTruncation self.addCleanup(lambda: setattr(self, '_truncateMessage', old_truncate)) s1, s2 = s + 'a', s + 'b' with self.assertRaises(self.failureException) as cm: self.assertEqual(s1, s2) self.assertNotIn('^', str(cm.exception)) self.assertEqual(str(cm.exception), '%r != %r' % (s1, s2)) self.assertEqual(s + 'a', s + 'a') def testAssertCountEqual(self): a = object() self.assertCountEqual([1, 2, 3], [3, 2, 1]) self.assertCountEqual(['foo', 'bar', 'baz'], ['bar', 'baz', 'foo']) self.assertCountEqual([a, a, 2, 2, 3], (a, 2, 3, a, 2)) self.assertCountEqual([1, "2", "a", "a"], ["a", "2", True, "a"]) self.assertRaises(self.failureException, self.assertCountEqual, [1, 2] + [3] * 100, [1] * 100 + [2, 3]) self.assertRaises(self.failureException, self.assertCountEqual, [1, "2", "a", "a"], ["a", "2", True, 1]) self.assertRaises(self.failureException, self.assertCountEqual, [10], [10, 11]) self.assertRaises(self.failureException, self.assertCountEqual, [10, 11], [10]) self.assertRaises(self.failureException, self.assertCountEqual, [10, 11, 10], [10, 11]) # Test that sequences of unhashable objects can be tested for sameness: self.assertCountEqual([[1, 2], [3, 4], 0], [False, [3, 4], [1, 2]]) # Test that iterator of unhashable objects can be tested for sameness: self.assertCountEqual(iter([1, 2, [], 3, 4]), iter([1, 2, [], 3, 4])) # hashable types, but not orderable self.assertRaises(self.failureException, self.assertCountEqual, [], [divmod, 'x', 1, 5j, 2j, frozenset()]) # comparing dicts self.assertCountEqual([{'a': 1}, {'b': 2}], [{'b': 2}, {'a': 1}]) # comparing heterogenous non-hashable sequences self.assertCountEqual([1, 'x', divmod, []], [divmod, [], 'x', 1]) self.assertRaises(self.failureException, self.assertCountEqual, [], [divmod, [], 'x', 1, 5j, 2j, set()]) self.assertRaises(self.failureException, self.assertCountEqual, [[1]], [[2]]) # Same elements, but not same sequence length self.assertRaises(self.failureException, self.assertCountEqual, [1, 1, 2], [2, 1]) self.assertRaises(self.failureException, self.assertCountEqual, [1, 1, "2", "a", "a"], ["2", "2", True, "a"]) self.assertRaises(self.failureException, self.assertCountEqual, [1, {'b': 2}, None, True], [{'b': 2}, True, None]) # Same elements which don't reliably compare, in # different order, see issue 10242 a = [{2,4}, {1,2}] b = a[::-1] self.assertCountEqual(a, b) # test utility functions supporting assertCountEqual() diffs = set(unittest.util._count_diff_all_purpose('aaabccd', 'abbbcce')) expected = {(3,1,'a'), (1,3,'b'), (1,0,'d'), (0,1,'e')} self.assertEqual(diffs, expected) diffs = unittest.util._count_diff_all_purpose([[]], []) self.assertEqual(diffs, [(1, 0, [])]) diffs = set(unittest.util._count_diff_hashable('aaabccd', 'abbbcce')) expected = {(3,1,'a'), (1,3,'b'), (1,0,'d'), (0,1,'e')} self.assertEqual(diffs, expected) def testAssertSetEqual(self): set1 = set() set2 = set() self.assertSetEqual(set1, set2) self.assertRaises(self.failureException, self.assertSetEqual, None, set2) self.assertRaises(self.failureException, self.assertSetEqual, [], set2) self.assertRaises(self.failureException, self.assertSetEqual, set1, None) self.assertRaises(self.failureException, self.assertSetEqual, set1, []) set1 = set(['a']) set2 = set() self.assertRaises(self.failureException, self.assertSetEqual, set1, set2) set1 = set(['a']) set2 = set(['a']) self.assertSetEqual(set1, set2) set1 = set(['a']) set2 = set(['a', 'b']) self.assertRaises(self.failureException, self.assertSetEqual, set1, set2) set1 = set(['a']) set2 = frozenset(['a', 'b']) self.assertRaises(self.failureException, self.assertSetEqual, set1, set2) set1 = set(['a', 'b']) set2 = frozenset(['a', 'b']) self.assertSetEqual(set1, set2) set1 = set() set2 = "foo" self.assertRaises(self.failureException, self.assertSetEqual, set1, set2) self.assertRaises(self.failureException, self.assertSetEqual, set2, set1) # make sure any string formatting is tuple-safe set1 = set([(0, 1), (2, 3)]) set2 = set([(4, 5)]) self.assertRaises(self.failureException, self.assertSetEqual, set1, set2) def testInequality(self): # Try ints self.assertGreater(2, 1) self.assertGreaterEqual(2, 1) self.assertGreaterEqual(1, 1) self.assertLess(1, 2) self.assertLessEqual(1, 2) self.assertLessEqual(1, 1) self.assertRaises(self.failureException, self.assertGreater, 1, 2) self.assertRaises(self.failureException, self.assertGreater, 1, 1) self.assertRaises(self.failureException, self.assertGreaterEqual, 1, 2) self.assertRaises(self.failureException, self.assertLess, 2, 1) self.assertRaises(self.failureException, self.assertLess, 1, 1) self.assertRaises(self.failureException, self.assertLessEqual, 2, 1) # Try Floats self.assertGreater(1.1, 1.0) self.assertGreaterEqual(1.1, 1.0) self.assertGreaterEqual(1.0, 1.0) self.assertLess(1.0, 1.1) self.assertLessEqual(1.0, 1.1) self.assertLessEqual(1.0, 1.0) self.assertRaises(self.failureException, self.assertGreater, 1.0, 1.1) self.assertRaises(self.failureException, self.assertGreater, 1.0, 1.0) self.assertRaises(self.failureException, self.assertGreaterEqual, 1.0, 1.1) self.assertRaises(self.failureException, self.assertLess, 1.1, 1.0) self.assertRaises(self.failureException, self.assertLess, 1.0, 1.0) self.assertRaises(self.failureException, self.assertLessEqual, 1.1, 1.0) # Try Strings self.assertGreater('bug', 'ant') self.assertGreaterEqual('bug', 'ant') self.assertGreaterEqual('ant', 'ant') self.assertLess('ant', 'bug') self.assertLessEqual('ant', 'bug') self.assertLessEqual('ant', 'ant') self.assertRaises(self.failureException, self.assertGreater, 'ant', 'bug') self.assertRaises(self.failureException, self.assertGreater, 'ant', 'ant') self.assertRaises(self.failureException, self.assertGreaterEqual, 'ant', 'bug') self.assertRaises(self.failureException, self.assertLess, 'bug', 'ant') self.assertRaises(self.failureException, self.assertLess, 'ant', 'ant') self.assertRaises(self.failureException, self.assertLessEqual, 'bug', 'ant') # Try bytes self.assertGreater(b'bug', b'ant') self.assertGreaterEqual(b'bug', b'ant') self.assertGreaterEqual(b'ant', b'ant') self.assertLess(b'ant', b'bug') self.assertLessEqual(b'ant', b'bug') self.assertLessEqual(b'ant', b'ant') self.assertRaises(self.failureException, self.assertGreater, b'ant', b'bug') self.assertRaises(self.failureException, self.assertGreater, b'ant', b'ant') self.assertRaises(self.failureException, self.assertGreaterEqual, b'ant', b'bug') self.assertRaises(self.failureException, self.assertLess, b'bug', b'ant') self.assertRaises(self.failureException, self.assertLess, b'ant', b'ant') self.assertRaises(self.failureException, self.assertLessEqual, b'bug', b'ant') def testAssertMultiLineEqual(self): sample_text = """\ http://www.python.org/doc/2.3/lib/module-unittest.html test case A test case is the smallest unit of testing. [...] """ revised_sample_text = """\ http://www.python.org/doc/2.4.1/lib/module-unittest.html test case A test case is the smallest unit of testing. [...] You may provide your own implementation that does not subclass from TestCase, of course. """ sample_text_error = """\ - http://www.python.org/doc/2.3/lib/module-unittest.html ? ^ + http://www.python.org/doc/2.4.1/lib/module-unittest.html ? ^^^ test case - A test case is the smallest unit of testing. [...] + A test case is the smallest unit of testing. [...] You may provide your ? +++++++++++++++++++++ + own implementation that does not subclass from TestCase, of course. """ self.maxDiff = None try: self.assertMultiLineEqual(sample_text, revised_sample_text) except self.failureException as e: # need to remove the first line of the error message error = str(e).split('\n', 1)[1] # no fair testing ourself with ourself, and assertEqual is used for strings # so can't use assertEqual either. Just use assertTrue. self.assertTrue(sample_text_error == error) def testAsertEqualSingleLine(self): sample_text = "laden swallows fly slowly" revised_sample_text = "unladen swallows fly quickly" sample_text_error = """\ - laden swallows fly slowly ? ^^^^ + unladen swallows fly quickly ? ++ ^^^^^ """ try: self.assertEqual(sample_text, revised_sample_text) except self.failureException as e: error = str(e).split('\n', 1)[1] self.assertTrue(sample_text_error == error) def testAssertIsNone(self): self.assertIsNone(None) self.assertRaises(self.failureException, self.assertIsNone, False) self.assertIsNotNone('DjZoPloGears on Rails') self.assertRaises(self.failureException, self.assertIsNotNone, None) def testAssertRegex(self): self.assertRegex('asdfabasdf', r'ab+') self.assertRaises(self.failureException, self.assertRegex, 'saaas', r'aaaa') def testAssertRaisesRegex(self): class ExceptionMock(Exception): pass def Stub(): raise ExceptionMock('We expect') self.assertRaisesRegex(ExceptionMock, re.compile('expect$'), Stub) self.assertRaisesRegex(ExceptionMock, 'expect$', Stub) def testAssertNotRaisesRegex(self): self.assertRaisesRegex( self.failureException, '^Exception not raised by <lambda>$', self.assertRaisesRegex, Exception, re.compile('x'), lambda: None) self.assertRaisesRegex( self.failureException, '^Exception not raised by <lambda>$', self.assertRaisesRegex, Exception, 'x', lambda: None) def testAssertRaisesRegexMismatch(self): def Stub(): raise Exception('Unexpected') self.assertRaisesRegex( self.failureException, r'"\^Expected\$" does not match "Unexpected"', self.assertRaisesRegex, Exception, '^Expected$', Stub) self.assertRaisesRegex( self.failureException, r'"\^Expected\$" does not match "Unexpected"', self.assertRaisesRegex, Exception, re.compile('^Expected$'), Stub) def testAssertRaisesExcValue(self): class ExceptionMock(Exception): pass def Stub(foo): raise ExceptionMock(foo) v = "particular value" ctx = self.assertRaises(ExceptionMock) with ctx: Stub(v) e = ctx.exception self.assertIsInstance(e, ExceptionMock) self.assertEqual(e.args[0], v) def testAssertWarnsCallable(self): def _runtime_warn(): warnings.warn("foo", RuntimeWarning) # Success when the right warning is triggered, even several times self.assertWarns(RuntimeWarning, _runtime_warn) self.assertWarns(RuntimeWarning, _runtime_warn) # A tuple of warning classes is accepted self.assertWarns((DeprecationWarning, RuntimeWarning), _runtime_warn) # *args and **kwargs also work self.assertWarns(RuntimeWarning, warnings.warn, "foo", category=RuntimeWarning) # Failure when no warning is triggered with self.assertRaises(self.failureException): self.assertWarns(RuntimeWarning, lambda: 0) # Failure when another warning is triggered with warnings.catch_warnings(): # Force default filter (in case tests are run with -We) warnings.simplefilter("default", RuntimeWarning) with self.assertRaises(self.failureException): self.assertWarns(DeprecationWarning, _runtime_warn) # Filters for other warnings are not modified with warnings.catch_warnings(): warnings.simplefilter("error", RuntimeWarning) with self.assertRaises(RuntimeWarning): self.assertWarns(DeprecationWarning, _runtime_warn) def testAssertWarnsContext(self): # Believe it or not, it is preferable to duplicate all tests above, # to make sure the __warningregistry__ $@ is circumvented correctly. def _runtime_warn(): warnings.warn("foo", RuntimeWarning) _runtime_warn_lineno = inspect.getsourcelines(_runtime_warn)[1] with self.assertWarns(RuntimeWarning) as cm: _runtime_warn() # A tuple of warning classes is accepted with self.assertWarns((DeprecationWarning, RuntimeWarning)) as cm: _runtime_warn() # The context manager exposes various useful attributes self.assertIsInstance(cm.warning, RuntimeWarning) self.assertEqual(cm.warning.args[0], "foo") self.assertIn("test_case.py", cm.filename) self.assertEqual(cm.lineno, _runtime_warn_lineno + 1) # Same with several warnings with self.assertWarns(RuntimeWarning): _runtime_warn() _runtime_warn() with self.assertWarns(RuntimeWarning): warnings.warn("foo", category=RuntimeWarning) # Failure when no warning is triggered with self.assertRaises(self.failureException): with self.assertWarns(RuntimeWarning): pass # Failure when another warning is triggered with warnings.catch_warnings(): # Force default filter (in case tests are run with -We) warnings.simplefilter("default", RuntimeWarning) with self.assertRaises(self.failureException): with self.assertWarns(DeprecationWarning): _runtime_warn() # Filters for other warnings are not modified with warnings.catch_warnings(): warnings.simplefilter("error", RuntimeWarning) with self.assertRaises(RuntimeWarning): with self.assertWarns(DeprecationWarning): _runtime_warn() def testAssertWarnsRegexCallable(self): def _runtime_warn(msg): warnings.warn(msg, RuntimeWarning) self.assertWarnsRegex(RuntimeWarning, "o+", _runtime_warn, "foox") # Failure when no warning is triggered with self.assertRaises(self.failureException): self.assertWarnsRegex(RuntimeWarning, "o+", lambda: 0) # Failure when another warning is triggered with warnings.catch_warnings(): # Force default filter (in case tests are run with -We) warnings.simplefilter("default", RuntimeWarning) with self.assertRaises(self.failureException): self.assertWarnsRegex(DeprecationWarning, "o+", _runtime_warn, "foox") # Failure when message doesn't match with self.assertRaises(self.failureException): self.assertWarnsRegex(RuntimeWarning, "o+", _runtime_warn, "barz") # A little trickier: we ask RuntimeWarnings to be raised, and then # check for some of them. It is implementation-defined whether # non-matching RuntimeWarnings are simply re-raised, or produce a # failureException. with warnings.catch_warnings(): warnings.simplefilter("error", RuntimeWarning) with self.assertRaises((RuntimeWarning, self.failureException)): self.assertWarnsRegex(RuntimeWarning, "o+", _runtime_warn, "barz") def testAssertWarnsRegexContext(self): # Same as above, but with assertWarnsRegex as a context manager def _runtime_warn(msg): warnings.warn(msg, RuntimeWarning) _runtime_warn_lineno = inspect.getsourcelines(_runtime_warn)[1] with self.assertWarnsRegex(RuntimeWarning, "o+") as cm: _runtime_warn("foox") self.assertIsInstance(cm.warning, RuntimeWarning) self.assertEqual(cm.warning.args[0], "foox") self.assertIn("test_case.py", cm.filename) self.assertEqual(cm.lineno, _runtime_warn_lineno + 1) # Failure when no warning is triggered with self.assertRaises(self.failureException): with self.assertWarnsRegex(RuntimeWarning, "o+"): pass # Failure when another warning is triggered with warnings.catch_warnings(): # Force default filter (in case tests are run with -We) warnings.simplefilter("default", RuntimeWarning) with self.assertRaises(self.failureException): with self.assertWarnsRegex(DeprecationWarning, "o+"): _runtime_warn("foox") # Failure when message doesn't match with self.assertRaises(self.failureException): with self.assertWarnsRegex(RuntimeWarning, "o+"): _runtime_warn("barz") # A little trickier: we ask RuntimeWarnings to be raised, and then # check for some of them. It is implementation-defined whether # non-matching RuntimeWarnings are simply re-raised, or produce a # failureException. with warnings.catch_warnings(): warnings.simplefilter("error", RuntimeWarning) with self.assertRaises((RuntimeWarning, self.failureException)): with self.assertWarnsRegex(RuntimeWarning, "o+"): _runtime_warn("barz") def testDeprecatedMethodNames(self): """ Test that the deprecated methods raise a DeprecationWarning. See #9424. """ old = ( (self.failIfEqual, (3, 5)), (self.assertNotEquals, (3, 5)), (self.failUnlessEqual, (3, 3)), (self.assertEquals, (3, 3)), (self.failUnlessAlmostEqual, (2.0, 2.0)), (self.assertAlmostEquals, (2.0, 2.0)), (self.failIfAlmostEqual, (3.0, 5.0)), (self.assertNotAlmostEquals, (3.0, 5.0)), (self.failUnless, (True,)), (self.assert_, (True,)), (self.failUnlessRaises, (TypeError, lambda _: 3.14 + 'spam')), (self.failIf, (False,)), (self.assertDictContainsSubset, (dict(a=1, b=2), dict(a=1, b=2, c=3))), (self.assertRaisesRegexp, (KeyError, 'foo', lambda: {}['foo'])), (self.assertRegexpMatches, ('bar', 'bar')), ) for meth, args in old: with self.assertWarns(DeprecationWarning): meth(*args) # disable this test for now. When the version where the fail* methods will # be removed is decided, re-enable it and update the version def _testDeprecatedFailMethods(self): """Test that the deprecated fail* methods get removed in 3.x""" if sys.version_info[:2] < (3, 3): return deprecated_names = [ 'failIfEqual', 'failUnlessEqual', 'failUnlessAlmostEqual', 'failIfAlmostEqual', 'failUnless', 'failUnlessRaises', 'failIf', 'assertDictContainsSubset', ] for deprecated_name in deprecated_names: with self.assertRaises(AttributeError): getattr(self, deprecated_name) # remove these in 3.x def testDeepcopy(self): # Issue: 5660 class TestableTest(unittest.TestCase): def testNothing(self): pass test = TestableTest('testNothing') # This shouldn't blow up deepcopy(test) def testPickle(self): # Issue 10326 # Can't use TestCase classes defined in Test class as # pickle does not work with inner classes test = unittest.TestCase('run') for protocol in range(pickle.HIGHEST_PROTOCOL + 1): # blew up prior to fix pickled_test = pickle.dumps(test, protocol=protocol) unpickled_test = pickle.loads(pickled_test) self.assertEqual(test, unpickled_test) # exercise the TestCase instance in a way that will invoke # the type equality lookup mechanism unpickled_test.assertEqual(set(), set()) def testKeyboardInterrupt(self): def _raise(self=None): raise KeyboardInterrupt def nothing(self): pass class Test1(unittest.TestCase): test_something = _raise class Test2(unittest.TestCase): setUp = _raise test_something = nothing class Test3(unittest.TestCase): test_something = nothing tearDown = _raise class Test4(unittest.TestCase): def test_something(self): self.addCleanup(_raise) for klass in (Test1, Test2, Test3, Test4): with self.assertRaises(KeyboardInterrupt): klass('test_something').run() def testSkippingEverywhere(self): def _skip(self=None): raise unittest.SkipTest('some reason') def nothing(self): pass class Test1(unittest.TestCase): test_something = _skip class Test2(unittest.TestCase): setUp = _skip test_something = nothing class Test3(unittest.TestCase): test_something = nothing tearDown = _skip class Test4(unittest.TestCase): def test_something(self): self.addCleanup(_skip) for klass in (Test1, Test2, Test3, Test4): result = unittest.TestResult() klass('test_something').run(result) self.assertEqual(len(result.skipped), 1) self.assertEqual(result.testsRun, 1) def testSystemExit(self): def _raise(self=None): raise SystemExit def nothing(self): pass class Test1(unittest.TestCase): test_something = _raise class Test2(unittest.TestCase): setUp = _raise test_something = nothing class Test3(unittest.TestCase): test_something = nothing tearDown = _raise class Test4(unittest.TestCase): def test_something(self): self.addCleanup(_raise) for klass in (Test1, Test2, Test3, Test4): result = unittest.TestResult() klass('test_something').run(result) self.assertEqual(len(result.errors), 1) self.assertEqual(result.testsRun, 1) @support.cpython_only def testNoCycles(self): case = unittest.TestCase() wr = weakref.ref(case) with support.disable_gc(): del case self.assertFalse(wr())
from unittest.case import TestCase from tracker.domain import ContestFactory, Participant, Fact, ContestValidator,\ ValidationException, ContestRanker class TestDomainMuurkeKlop(TestCase): ''' This test case covers how we want to create and keep track of a single game of Muurke Klop. - N-down: N Participants compete in a single game of (N-1) games, where each Participant will receive points depending on his rank - X-strikes out: N Participants compete in ((N - 1) * X) to ((N * X) - 1) games ''' def testBasicNDown(self): # Note: we do not create a GameTemplate, as that's not our core concern. # We'll add a "Competition flow" concept later on! # At this point we just want to store the Facts / Events for a game and be done with it! game = ContestFactory.createContest('Muurke Klop - 10 Down') participants = self.__createParticipants() for p in participants: game.addParticipant(p) # Once all Participants have been added, we can start adding Facts! game.addFact(Fact('Points', 1, participants[2])) game.addFact(Fact('Points', 2, participants[7])) game.addFact(Fact('Points', 3, participants[6])) game.addFact(Fact('Points', 4, participants[5])) game.addFact(Fact('Points', 5, participants[4])) game.addFact(Fact('Points', 6, participants[1])) game.addFact(Fact('Points', 8, participants[0])) game.addFact(Fact('Points', 10, participants[3])) # This is all the input we need in order to create a ranking! self.assertEqual(8, len(game.facts)) self.__assertFact(game, participants[0], 8) self.__assertFact(game, participants[1], 6) self.__assertFact(game, participants[2], 1) def testValidation(self): ''' Make sure that the Game state remains valid while adding or removing Facts. ''' game = ContestFactory.createContest('Muurke Klop - 10 Down') validator = ContestValidator() validator.addRule(ContestValidator.minParticipants('Game', 2)) validator.addRule(ContestValidator.maxParticipants('Game', 8)) def validatePoints(game): ''' Validation function for the "Points" Facts of a game of Muurke Klop ''' validPoints = set([1, 2, 3, 4, 5, 6, 8, 10]) gamePoints = [fact for fact in game.facts if 'Points' == fact.type] # Points value should be within a valid range orderedPoints = set(sorted([points.value for points in gamePoints])) diff = [points for points in orderedPoints if points not in validPoints] if (len(diff) > 0): return 'Invalid Points value(s) have been added: %s' % str(diff) # Points values should be consecutive, no gaps should be left! if (len(orderedPoints) > 0): diff = [points for points in validPoints if points not in orderedPoints] diff = [d for d in diff if d < max(orderedPoints)] # TODO :: put into a single line? if (len(diff) > 0): return 'Invalid Points, missing values: %s' % str(diff) # Each Participant can have only one single Points Fact seen = set() seen_add = seen.add # adds all elements it doesn't know yet to seen and all other to dupes dupes = list(set(f.participant.name for f in gamePoints if f.participant in seen or seen_add(f.participant))) if (len(dupes) > 0): return 'Duplicate Points: Participants %s already have Points assigned' % str(dupes) # Each Points value can be assigned only once! seen = set() seen_add = seen.add # adds all elements it doesn't know yet to seen and all other to dupes dupes = list(set(f.value for f in gamePoints if f.value in seen or seen_add(f.value))) if (len(dupes) > 0): return 'Duplicate Points: Points values %s have already been assigned' % str(dupes) return True validator.addRule(validatePoints) participants = self.__createParticipants() game.addParticipant(participants[0]) try: validator.validate(game) self.fail('Game needs at least 2 Participants!') except ValidationException as e: self.assertEqual(str(e), 'Game needs at least 2 Participants!') game.addParticipant(participants[1]) validator.validate(game) # Points Facts should start by 1 try: game.addFact(Fact('Points', 3, participants[0])) validator.validate(game) self.fail('The first Points assigned should be "1"') except ValidationException as e: self.assertEqual('Invalid Points, missing values: [1, 2]', str(e)) game.addFact(Fact('Points', 1, participants[2])) game.addFact(Fact('Points', 2, participants[4])) # Points Fact has already been added for this game, be it for a different Participant try: game.addFact(Fact('Points', 3, participants[1])) validator.validate(game) self.fail('3 Points have already been added for another Participant!') except ValidationException as e: self.assertEqual('Duplicate Points: Points values [3] have already been assigned', str(e)) game.clearFacts() # Every Participant can have only 1 "Points" Fact per game... try: game.addFact(Fact('Points', 1, participants[0])) game.addFact(Fact('Points', 2, participants[0])) validator.validate(game) self.fail('Duplicate Points: Participant "Player One" already has Points assigned!') except ValidationException as e: self.assertEqual('Duplicate Points: Participants [\'Player One\'] already have Points assigned', str(e)) game.clearFacts() # Each Points Fact value can only occur once! try: game.addFact(Fact('Points', 1, participants[0])) game.addFact(Fact('Points', 1, participants[1])) validator.validate(game) self.fail('Duplicate Points: Points value "1" has already been assigned!') except ValidationException as e: self.assertEqual('Duplicate Points: Points values [1] have already been assigned', str(e)) game.clearFacts() # Adding an invalid Points Fact... try: game.addFact(Fact('Points', 7, participants[0])) validator.validate(game) self.fail('7 is not a valid Points value!') except ValidationException as e: self.assertEqual('Invalid Points value(s) have been added: [7]', str(e)) game.clearFacts() # We need to let the game know what type of Facts are valid. # TODO :: We'll do this by adding some sort of Validator instance... # In the future, we could make this highly configurable through external configuration?? # TODO :: game.addParticipant def testRankingComplete(self): ''' One of the most important things we want from a Contest is to get a (final) ranking of all Participants. For this purpose, we've created the ContestRanker. ''' game = ContestFactory.createContest('Muurke Klop - 10 Down') participants = self.__createParticipants() for p in participants: game.addParticipant(p) expectedRank = 8 expectedRanking = {} for participant, points in zip(participants, [1, 2, 3, 4, 5, 6, 8, 10]): game.addFact(Fact('Points', points, participant)) expectedRanking[expectedRank] = [(participant, points)] expectedRank -= 1 self.assertEqual(8, len(game.facts)) ranker = ContestRanker() ranker.addRule(ContestRanker.byFactTypeValue('Points')) ranking = ranker.rankParticipants(game) # self.__printRanking(expectedRanking) # self.__printRanking(ranking) self.assertEqual(expectedRanking, ranking) def testRankingOngoing(self): ''' In case of an ongoing game, we still want to be able to rank! ''' game = ContestFactory.createContest('Muurke Klop - 10 Down') participants = self.__createParticipants() for p in participants: game.addParticipant(p) expectedRank = 5 expectedRanking = {} for participant, points in zip(participants, [1, 2, 3, 4, 5]): game.addFact(Fact('Points', points, participant)) expectedRanking[expectedRank] = [(participant, points)] expectedRank -= 1 expectedRank = 6 expectedRanking[expectedRank] = [] for i in [5, 6, 7]: # Note: Participants will be ranked by Name (reversed!) in case of a tie... expectedRanking[expectedRank].append((participants[i], 0)) self.assertEqual(5, len(game.facts)) ranker = ContestRanker() ranker.addRule(ContestRanker.byFactTypeValue('Points')) ranking = ranker.rankParticipants(game) # self.__printRanking(expectedRanking) # self.__printRanking(ranking) self.assertEqual(expectedRanking, ranking) def __printRanking(self, ranking): for (r, a) in ranking.items(): for (p, s) in a: print('%d: %s (%d)' % (r, p.name, s)) print('-----') # So what is still missing? # - final score / ranking, but not sure whether or not that's a concern for the Contest class... # - Option to undo the a Fact of a given type, while still maintaining succession rules (so only highest/latest score can be undone) # - validation: cannot add Participants once Scores have been given!? # TODO: add test cases # def __createParticipants(self): ''' Create a list of default Participant value objects. ''' participants = [] participants.append(Participant('Player One')) participants.append(Participant('Player Two')) participants.append(Participant('Player Three')) participants.append(Participant('Player Four')) participants.append(Participant('Player Five')) participants.append(Participant('Player Six')) participants.append(Participant('Player Seven')) participants.append(Participant('Player Eight')) return participants def __assertFact(self, game, participant, points): for f in game.facts: if ('Points' == f.type and participant.name == f.participant.name): self.assertEquals(points, f.value, 'Expected Participant "%s" to have %d Points' % (participant.name, points)) return raise AssertionError('Expected Participant "%s" to have %d Points, but no matching Fact was found' % (participant.name, points))
# huffman.py # Author: Dixon Crews # CSC 505-001, Fall 2016 # Homework 3, #5 ############################################################################### # Import needed libraries import math, sys, binascii ############################################################################### # Node class class Node(): left = None right = None value = None freq = 0 def __init__(self, v, f): self.value = v self.freq = f ############################################################################### # Define the huffman() function def huffman(h): # Algorithm from textbook, p. 431 while len(h) > 1: # Get two smallest nodes x = heapRemoveMin(h) y = heapRemoveMin(h) # Create a new node with the sum of frequencies z = Node(None, x.freq + y.freq) # Set z.left and z.right to x and y z.left = x z.right = y # Re-insert to heap heapInsert(h, z) # Get codes # Code adapted from # http://www.techrepublic.com/article/huffman-coding-in-python/ codes = {} def getCodes(s, node): if(node.value): if(not s): codes[node.value] = "0" else: codes[node.value] = s else: getCodes(s + "0", node.left) getCodes(s + "1", node.right) getCodes("", h[0]) return codes # Tri-nary heap functions # Define the parent() function def parent(i): return math.floor((i-1)/3) # Define the left() function def left(i): return (3*i + 1) # Define the middle() function def middle(i): return (3*i + 2) # Define the right() function def right(i): return (3*i + 3) # Define the minChild() function def minChild(arr, i): # Store some needed values length = len(arr) leftIdx = left(i) middleIdx = middle(i) rightIdx = right(i) # Create boolean indicators for each child hasLeft = (leftIdx < length) hasMiddle = (middleIdx < length) hasRight = (rightIdx < length) # Need to find the minimum child to swap with # Start at the left child if(hasLeft): minVal, minIdx = arr[leftIdx].freq, leftIdx # Check middle (if exists) if(hasMiddle): if(arr[middleIdx].freq < minVal): minVal, minIdx = arr[middleIdx].freq, middleIdx # Check right (if exists) if(hasRight): if(arr[rightIdx].freq < minVal): minVal, minIdx = arr[rightIdx].freq, rightIdx return minIdx else: return 0 # Define the percolateUp() function def percolateUp(arr, i): while i > 0 and arr[parent(i)].freq > arr[i].freq: arr[parent(i)], arr[i] = arr[i], arr[parent(i)] i = parent(i) # Define the percolateDown() function def percolateDown(arr, i): # Find the index of the minimum child (if any, 0 if none) minIdx = minChild(arr, i) # Go through the array and swap if needed while minIdx != 0 and arr[i].freq > arr[minIdx].freq: # Swap arr[i], arr[minIdx] = arr[minIdx], arr[i] # Re-assign i to be the index we swapped to i = minIdx # Find the next minimum child minIdx = minChild(arr, minIdx) # Define the heapInsert() function def heapInsert(arr, value): # Insert new element at the last position in the array arr.append(value) # Move the item into the correct position until the heap # order property is satisfied percolateUp(arr, len(arr) - 1) # Define the heapRemoveMin() function def heapRemoveMin(arr): # Check size if(len(arr) == 0): return None # Store root in temporary variable root = arr[0] # Move last element to root position arr[0] = arr[len(arr) - 1] # Delete last element from heap del arr[len(arr) - 1] # Move the root item into the correct position until the # heap order property is satisfied percolateDown(arr, 0) return root ############################################################################### # Generate all of the hex values from 0 to 255 # and store them in a dictionary with 1 as the value hexDict = {} for hexValue in [hex(x)[2:].zfill(2) for x in range(256)]: hexDict[hexValue] = 1 # Create a dictionary to hold input inputDict = {} # Read input from stdin while 1: # Read 1 byte data = sys.stdin.buffer.read(1) # If we didn't get anything, we're at EOF if(not data): break # Increment count or add to the dictionary if new if(data in inputDict): inputDict[data] += 1 else: inputDict[data] = 1 # Go through the input values we saw and update their counts in hexDict for item in inputDict: hexDict[binascii.hexlify(item).decode('ascii')] = inputDict[item] + 1 # Add special EOF hexDict['EOF'] = 1 # Insert into heap heap = [] for item in hexDict: heapInsert(heap, Node(item, hexDict[item])) # Find Huffman codes huff = huffman(heap) # Print out codes for item in sorted(huff): if(item >= '21' and item <= '7e'): print('{:>3} {}'.format(binascii.unhexlify(item).decode("utf-8"), huff[item])) elif(item != 'EOF'): print('{:>3} {}'.format(item.upper(), huff[item])) print('EOF', huff['EOF'])
""" This is the Django template system. How it works: The Lexer.tokenize() function converts a template string (i.e., a string containing markup with custom template tags) to tokens, which can be either plain text (TOKEN_TEXT), variables (TOKEN_VAR) or block statements (TOKEN_BLOCK). The Parser() class takes a list of tokens in its constructor, and its parse() method returns a compiled template -- which is, under the hood, a list of Node objects. Each Node is responsible for creating some sort of output -- e.g. simple text (TextNode), variable values in a given context (VariableNode), results of basic logic (IfNode), results of looping (ForNode), or anything else. The core Node types are TextNode, VariableNode, IfNode and ForNode, but plugin modules can define their own custom node types. Each Node has a render() method, which takes a Context and returns a string of the rendered node. For example, the render() method of a Variable Node returns the variable's value as a string. The render() method of a ForNode returns the rendered output of whatever was inside the loop, recursively. The Template class is a convenient wrapper that takes care of template compilation and rendering. Usage: The only thing you should ever use directly in this file is the Template class. Create a compiled template object with a template_string, then call render() with a context. In the compilation stage, the TemplateSyntaxError exception will be raised if the template doesn't have proper syntax. Sample code: >>> from django import template >>> s = '<html>{% if test %}<h1>{{ varvalue }}</h1>{% endif %}</html>' >>> t = template.Template(s) (t is now a compiled template, and its render() method can be called multiple times with multiple contexts) >>> c = template.Context({'test':True, 'varvalue': 'Hello'}) >>> t.render(c) '<html><h1>Hello</h1></html>' >>> c = template.Context({'test':False, 'varvalue': 'Hello'}) >>> t.render(c) '<html></html>' """ import inspect import logging import re from django.template.context import ( # NOQA: imported for backwards compatibility BaseContext, Context, ContextPopException, RequestContext, ) from django.utils.formats import localize from django.utils.html import conditional_escape, escape from django.utils.inspect import getargspec from django.utils.safestring import SafeData, mark_safe from django.utils.text import ( get_text_list, smart_split, unescape_string_literal, ) from django.utils.timezone import template_localtime from django.utils.translation import gettext_lazy, pgettext_lazy from .exceptions import TemplateSyntaxError TOKEN_TEXT = 0 TOKEN_VAR = 1 TOKEN_BLOCK = 2 TOKEN_COMMENT = 3 TOKEN_MAPPING = { TOKEN_TEXT: 'Text', TOKEN_VAR: 'Var', TOKEN_BLOCK: 'Block', TOKEN_COMMENT: 'Comment', } # template syntax constants FILTER_SEPARATOR = '|' FILTER_ARGUMENT_SEPARATOR = ':' VARIABLE_ATTRIBUTE_SEPARATOR = '.' BLOCK_TAG_START = '{%' BLOCK_TAG_END = '%}' VARIABLE_TAG_START = '{{' VARIABLE_TAG_END = '}}' COMMENT_TAG_START = '{#' COMMENT_TAG_END = '#}' TRANSLATOR_COMMENT_MARK = 'Translators' SINGLE_BRACE_START = '{' SINGLE_BRACE_END = '}' # what to report as the origin for templates that come from non-loader sources # (e.g. strings) UNKNOWN_SOURCE = '<unknown source>' # match a variable or block tag and capture the entire tag, including start/end # delimiters tag_re = (re.compile('(%s.*?%s|%s.*?%s|%s.*?%s)' % (re.escape(BLOCK_TAG_START), re.escape(BLOCK_TAG_END), re.escape(VARIABLE_TAG_START), re.escape(VARIABLE_TAG_END), re.escape(COMMENT_TAG_START), re.escape(COMMENT_TAG_END)))) logger = logging.getLogger('django.template') class VariableDoesNotExist(Exception): def __init__(self, msg, params=()): self.msg = msg self.params = params def __str__(self): return self.msg % self.params class Origin: def __init__(self, name, template_name=None, loader=None): self.name = name self.template_name = template_name self.loader = loader def __str__(self): return self.name def __eq__(self, other): if not isinstance(other, Origin): return False return ( self.name == other.name and self.loader == other.loader ) @property def loader_name(self): if self.loader: return '%s.%s' % ( self.loader.__module__, self.loader.__class__.__name__, ) class Template: def __init__(self, template_string, origin=None, name=None, engine=None): # If Template is instantiated directly rather than from an Engine and # exactly one Django template engine is configured, use that engine. # This is required to preserve backwards-compatibility for direct use # e.g. Template('...').render(Context({...})) if engine is None: from .engine import Engine engine = Engine.get_default() if origin is None: origin = Origin(UNKNOWN_SOURCE) self.name = name self.origin = origin self.engine = engine self.source = template_string self.nodelist = self.compile_nodelist() def __iter__(self): for node in self.nodelist: for subnode in node: yield subnode def _render(self, context): return self.nodelist.render(context) def render(self, context): "Display stage -- can be called many times" with context.render_context.push_state(self): if context.template is None: with context.bind_template(self): context.template_name = self.name return self._render(context) else: return self._render(context) def compile_nodelist(self): """ Parse and compile the template source into a nodelist. If debug is True and an exception occurs during parsing, the exception is is annotated with contextual line information where it occurred in the template source. """ if self.engine.debug: lexer = DebugLexer(self.source) else: lexer = Lexer(self.source) tokens = lexer.tokenize() parser = Parser( tokens, self.engine.template_libraries, self.engine.template_builtins, self.origin, ) try: return parser.parse() except Exception as e: if self.engine.debug: e.template_debug = self.get_exception_info(e, e.token) raise def get_exception_info(self, exception, token): """ Return a dictionary containing contextual line information of where the exception occurred in the template. The following information is provided: message The message of the exception raised. source_lines The lines before, after, and including the line the exception occurred on. line The line number the exception occurred on. before, during, after The line the exception occurred on split into three parts: 1. The content before the token that raised the error. 2. The token that raised the error. 3. The content after the token that raised the error. total The number of lines in source_lines. top The line number where source_lines starts. bottom The line number where source_lines ends. start The start position of the token in the template source. end The end position of the token in the template source. """ start, end = token.position context_lines = 10 line = 0 upto = 0 source_lines = [] before = during = after = "" for num, next in enumerate(linebreak_iter(self.source)): if start >= upto and end <= next: line = num before = escape(self.source[upto:start]) during = escape(self.source[start:end]) after = escape(self.source[end:next]) source_lines.append((num, escape(self.source[upto:next]))) upto = next total = len(source_lines) top = max(1, line - context_lines) bottom = min(total, line + 1 + context_lines) # In some rare cases exc_value.args can be empty or an invalid # string. try: message = str(exception.args[0]) except (IndexError, UnicodeDecodeError): message = '(Could not get exception message)' return { 'message': message, 'source_lines': source_lines[top:bottom], 'before': before, 'during': during, 'after': after, 'top': top, 'bottom': bottom, 'total': total, 'line': line, 'name': self.origin.name, 'start': start, 'end': end, } def linebreak_iter(template_source): yield 0 p = template_source.find('\n') while p >= 0: yield p + 1 p = template_source.find('\n', p + 1) yield len(template_source) + 1 class Token: def __init__(self, token_type, contents, position=None, lineno=None): """ A token representing a string from the template. token_type One of TOKEN_TEXT, TOKEN_VAR, TOKEN_BLOCK, or TOKEN_COMMENT. contents The token source string. position An optional tuple containing the start and end index of the token in the template source. This is used for traceback information when debug is on. lineno The line number the token appears on in the template source. This is used for traceback information and gettext files. """ self.token_type, self.contents = token_type, contents self.lineno = lineno self.position = position def __str__(self): token_name = TOKEN_MAPPING[self.token_type] return ('<%s token: "%s...">' % (token_name, self.contents[:20].replace('\n', ''))) def split_contents(self): split = [] bits = iter(smart_split(self.contents)) for bit in bits: # Handle translation-marked template pieces if bit.startswith(('_("', "_('")): sentinel = bit[2] + ')' trans_bit = [bit] while not bit.endswith(sentinel): bit = next(bits) trans_bit.append(bit) bit = ' '.join(trans_bit) split.append(bit) return split class Lexer: def __init__(self, template_string): self.template_string = template_string self.verbatim = False def tokenize(self): """ Return a list of tokens from a given template_string. """ in_tag = False lineno = 1 result = [] for bit in tag_re.split(self.template_string): if bit: result.append(self.create_token(bit, None, lineno, in_tag)) in_tag = not in_tag lineno += bit.count('\n') return result def create_token(self, token_string, position, lineno, in_tag): """ Convert the given token string into a new Token object and return it. If in_tag is True, we are processing something that matched a tag, otherwise it should be treated as a literal string. """ if in_tag and token_string.startswith(BLOCK_TAG_START): # The [2:-2] ranges below strip off *_TAG_START and *_TAG_END. # We could do len(BLOCK_TAG_START) to be more "correct", but we've # hard-coded the 2s here for performance. And it's not like # the TAG_START values are going to change anytime, anyway. block_content = token_string[2:-2].strip() if self.verbatim and block_content == self.verbatim: self.verbatim = False if in_tag and not self.verbatim: if token_string.startswith(VARIABLE_TAG_START): token = Token(TOKEN_VAR, token_string[2:-2].strip(), position, lineno) elif token_string.startswith(BLOCK_TAG_START): if block_content[:9] in ('verbatim', 'verbatim '): self.verbatim = 'end%s' % block_content token = Token(TOKEN_BLOCK, block_content, position, lineno) elif token_string.startswith(COMMENT_TAG_START): content = '' if token_string.find(TRANSLATOR_COMMENT_MARK): content = token_string[2:-2].strip() token = Token(TOKEN_COMMENT, content, position, lineno) else: token = Token(TOKEN_TEXT, token_string, position, lineno) return token class DebugLexer(Lexer): def tokenize(self): """ Split a template string into tokens and annotates each token with its start and end position in the source. This is slower than the default lexer so only use it when debug is True. """ lineno = 1 result = [] upto = 0 for match in tag_re.finditer(self.template_string): start, end = match.span() if start > upto: token_string = self.template_string[upto:start] result.append(self.create_token(token_string, (upto, start), lineno, in_tag=False)) lineno += token_string.count('\n') upto = start token_string = self.template_string[start:end] result.append(self.create_token(token_string, (start, end), lineno, in_tag=True)) lineno += token_string.count('\n') upto = end last_bit = self.template_string[upto:] if last_bit: result.append(self.create_token(last_bit, (upto, upto + len(last_bit)), lineno, in_tag=False)) return result class Parser: def __init__(self, tokens, libraries=None, builtins=None, origin=None): self.tokens = tokens self.tags = {} self.filters = {} self.command_stack = [] if libraries is None: libraries = {} if builtins is None: builtins = [] self.libraries = libraries for builtin in builtins: self.add_library(builtin) self.origin = origin def parse(self, parse_until=None): """ Iterate through the parser tokens and compiles each one into a node. If parse_until is provided, parsing will stop once one of the specified tokens has been reached. This is formatted as a list of tokens, e.g. ['elif', 'else', 'endif']. If no matching token is reached, raise an exception with the unclosed block tag details. """ if parse_until is None: parse_until = [] nodelist = NodeList() while self.tokens: token = self.next_token() # Use the raw values here for TOKEN_* for a tiny performance boost. if token.token_type == 0: # TOKEN_TEXT self.extend_nodelist(nodelist, TextNode(token.contents), token) elif token.token_type == 1: # TOKEN_VAR if not token.contents: raise self.error(token, 'Empty variable tag on line %d' % token.lineno) try: filter_expression = self.compile_filter(token.contents) except TemplateSyntaxError as e: raise self.error(token, e) var_node = VariableNode(filter_expression) self.extend_nodelist(nodelist, var_node, token) elif token.token_type == 2: # TOKEN_BLOCK try: command = token.contents.split()[0] except IndexError: raise self.error(token, 'Empty block tag on line %d' % token.lineno) if command in parse_until: # A matching token has been reached. Return control to # the caller. Put the token back on the token list so the # caller knows where it terminated. self.prepend_token(token) return nodelist # Add the token to the command stack. This is used for error # messages if further parsing fails due to an unclosed block # tag. self.command_stack.append((command, token)) # Get the tag callback function from the ones registered with # the parser. try: compile_func = self.tags[command] except KeyError: self.invalid_block_tag(token, command, parse_until) # Compile the callback into a node object and add it to # the node list. try: compiled_result = compile_func(self, token) except Exception as e: raise self.error(token, e) self.extend_nodelist(nodelist, compiled_result, token) # Compile success. Remove the token from the command stack. self.command_stack.pop() if parse_until: self.unclosed_block_tag(parse_until) return nodelist def skip_past(self, endtag): while self.tokens: token = self.next_token() if token.token_type == TOKEN_BLOCK and token.contents == endtag: return self.unclosed_block_tag([endtag]) def extend_nodelist(self, nodelist, node, token): # Check that non-text nodes don't appear before an extends tag. if node.must_be_first and nodelist.contains_nontext: raise self.error( token, '%r must be the first tag in the template.' % node, ) if isinstance(nodelist, NodeList) and not isinstance(node, TextNode): nodelist.contains_nontext = True # Set origin and token here since we can't modify the node __init__() # method. node.token = token node.origin = self.origin nodelist.append(node) def error(self, token, e): """ Return an exception annotated with the originating token. Since the parser can be called recursively, check if a token is already set. This ensures the innermost token is highlighted if an exception occurs, e.g. a compile error within the body of an if statement. """ if not isinstance(e, Exception): e = TemplateSyntaxError(e) if not hasattr(e, 'token'): e.token = token return e def invalid_block_tag(self, token, command, parse_until=None): if parse_until: raise self.error( token, "Invalid block tag on line %d: '%s', expected %s. Did you " "forget to register or load this tag?" % ( token.lineno, command, get_text_list(["'%s'" % p for p in parse_until], 'or'), ), ) raise self.error( token, "Invalid block tag on line %d: '%s'. Did you forget to register " "or load this tag?" % (token.lineno, command) ) def unclosed_block_tag(self, parse_until): command, token = self.command_stack.pop() msg = "Unclosed tag on line %d: '%s'. Looking for one of: %s." % ( token.lineno, command, ', '.join(parse_until), ) raise self.error(token, msg) def next_token(self): return self.tokens.pop(0) def prepend_token(self, token): self.tokens.insert(0, token) def delete_first_token(self): del self.tokens[0] def add_library(self, lib): self.tags.update(lib.tags) self.filters.update(lib.filters) def compile_filter(self, token): """ Convenient wrapper for FilterExpression """ return FilterExpression(token, self) def find_filter(self, filter_name): if filter_name in self.filters: return self.filters[filter_name] else: raise TemplateSyntaxError("Invalid filter: '%s'" % filter_name) # This only matches constant *strings* (things in quotes or marked for # translation). Numbers are treated as variables for implementation reasons # (so that they retain their type when passed to filters). constant_string = r""" (?:%(i18n_open)s%(strdq)s%(i18n_close)s| %(i18n_open)s%(strsq)s%(i18n_close)s| %(strdq)s| %(strsq)s) """ % { 'strdq': r'"[^"\\]*(?:\\.[^"\\]*)*"', # double-quoted string 'strsq': r"'[^'\\]*(?:\\.[^'\\]*)*'", # single-quoted string 'i18n_open': re.escape("_("), 'i18n_close': re.escape(")"), } constant_string = constant_string.replace("\n", "") filter_raw_string = r""" ^(?P<constant>%(constant)s)| ^(?P<var>[%(var_chars)s]+|%(num)s)| (?:\s*%(filter_sep)s\s* (?P<filter_name>\w+) (?:%(arg_sep)s (?: (?P<constant_arg>%(constant)s)| (?P<var_arg>[%(var_chars)s]+|%(num)s) ) )? )""" % { 'constant': constant_string, 'num': r'[-+\.]?\d[\d\.e]*', 'var_chars': r'\w\.', 'filter_sep': re.escape(FILTER_SEPARATOR), 'arg_sep': re.escape(FILTER_ARGUMENT_SEPARATOR), } filter_re = re.compile(filter_raw_string, re.VERBOSE) class FilterExpression: """ Parse a variable token and its optional filters (all as a single string), and return a list of tuples of the filter name and arguments. Sample:: >>> token = 'variable|default:"Default value"|date:"Y-m-d"' >>> p = Parser('') >>> fe = FilterExpression(token, p) >>> len(fe.filters) 2 >>> fe.var <Variable: 'variable'> """ def __init__(self, token, parser): self.token = token matches = filter_re.finditer(token) var_obj = None filters = [] upto = 0 for match in matches: start = match.start() if upto != start: raise TemplateSyntaxError("Could not parse some characters: " "%s|%s|%s" % (token[:upto], token[upto:start], token[start:])) if var_obj is None: var, constant = match.group("var", "constant") if constant: try: var_obj = Variable(constant).resolve({}) except VariableDoesNotExist: var_obj = None elif var is None: raise TemplateSyntaxError("Could not find variable at " "start of %s." % token) else: var_obj = Variable(var) else: filter_name = match.group("filter_name") args = [] constant_arg, var_arg = match.group("constant_arg", "var_arg") if constant_arg: args.append((False, Variable(constant_arg).resolve({}))) elif var_arg: args.append((True, Variable(var_arg))) filter_func = parser.find_filter(filter_name) self.args_check(filter_name, filter_func, args) filters.append((filter_func, args)) upto = match.end() if upto != len(token): raise TemplateSyntaxError("Could not parse the remainder: '%s' " "from '%s'" % (token[upto:], token)) self.filters = filters self.var = var_obj def resolve(self, context, ignore_failures=False): if isinstance(self.var, Variable): try: obj = self.var.resolve(context) except VariableDoesNotExist: if ignore_failures: obj = None else: string_if_invalid = context.template.engine.string_if_invalid if string_if_invalid: if '%s' in string_if_invalid: return string_if_invalid % self.var else: return string_if_invalid else: obj = string_if_invalid else: obj = self.var for func, args in self.filters: arg_vals = [] for lookup, arg in args: if not lookup: arg_vals.append(mark_safe(arg)) else: arg_vals.append(arg.resolve(context)) if getattr(func, 'expects_localtime', False): obj = template_localtime(obj, context.use_tz) if getattr(func, 'needs_autoescape', False): new_obj = func(obj, autoescape=context.autoescape, *arg_vals) else: new_obj = func(obj, *arg_vals) if getattr(func, 'is_safe', False) and isinstance(obj, SafeData): obj = mark_safe(new_obj) else: obj = new_obj return obj def args_check(name, func, provided): provided = list(provided) # First argument, filter input, is implied. plen = len(provided) + 1 # Check to see if a decorator is providing the real function. func = getattr(func, '_decorated_function', func) args, _, _, defaults = getargspec(func) alen = len(args) dlen = len(defaults or []) # Not enough OR Too many if plen < (alen - dlen) or plen > alen: raise TemplateSyntaxError("%s requires %d arguments, %d provided" % (name, alen - dlen, plen)) return True args_check = staticmethod(args_check) def __str__(self): return self.token class Variable: """ A template variable, resolvable against a given context. The variable may be a hard-coded string (if it begins and ends with single or double quote marks):: >>> c = {'article': {'section':'News'}} >>> Variable('article.section').resolve(c) 'News' >>> Variable('article').resolve(c) {'section': 'News'} >>> class AClass: pass >>> c = AClass() >>> c.article = AClass() >>> c.article.section = 'News' (The example assumes VARIABLE_ATTRIBUTE_SEPARATOR is '.') """ def __init__(self, var): self.var = var self.literal = None self.lookups = None self.translate = False self.message_context = None if not isinstance(var, str): raise TypeError( "Variable must be a string or number, got %s" % type(var)) try: # First try to treat this variable as a number. # # Note that this could cause an OverflowError here that we're not # catching. Since this should only happen at compile time, that's # probably OK. self.literal = float(var) # So it's a float... is it an int? If the original value contained a # dot or an "e" then it was a float, not an int. if '.' not in var and 'e' not in var.lower(): self.literal = int(self.literal) # "2." is invalid if var.endswith('.'): raise ValueError except ValueError: # A ValueError means that the variable isn't a number. if var.startswith('_(') and var.endswith(')'): # The result of the lookup should be translated at rendering # time. self.translate = True var = var[2:-1] # If it's wrapped with quotes (single or double), then # we're also dealing with a literal. try: self.literal = mark_safe(unescape_string_literal(var)) except ValueError: # Otherwise we'll set self.lookups so that resolve() knows we're # dealing with a bonafide variable if var.find(VARIABLE_ATTRIBUTE_SEPARATOR + '_') > -1 or var[0] == '_': raise TemplateSyntaxError("Variables and attributes may " "not begin with underscores: '%s'" % var) self.lookups = tuple(var.split(VARIABLE_ATTRIBUTE_SEPARATOR)) def resolve(self, context): """Resolve this variable against a given context.""" if self.lookups is not None: # We're dealing with a variable that needs to be resolved value = self._resolve_lookup(context) else: # We're dealing with a literal, so it's already been "resolved" value = self.literal if self.translate: is_safe = isinstance(value, SafeData) msgid = value.replace('%', '%%') msgid = mark_safe(msgid) if is_safe else msgid if self.message_context: return pgettext_lazy(self.message_context, msgid) else: return gettext_lazy(msgid) return value def __repr__(self): return "<%s: %r>" % (self.__class__.__name__, self.var) def __str__(self): return self.var def _resolve_lookup(self, context): """ Perform resolution of a real variable (i.e. not a literal) against the given context. As indicated by the method's name, this method is an implementation detail and shouldn't be called by external code. Use Variable.resolve() instead. """ current = context try: # catch-all for silent variable failures for bit in self.lookups: try: # dictionary lookup current = current[bit] # ValueError/IndexError are for numpy.array lookup on # numpy < 1.9 and 1.9+ respectively except (TypeError, AttributeError, KeyError, ValueError, IndexError): try: # attribute lookup # Don't return class attributes if the class is the context: if isinstance(current, BaseContext) and getattr(type(current), bit): raise AttributeError current = getattr(current, bit) except (TypeError, AttributeError): # Reraise if the exception was raised by a @property if not isinstance(current, BaseContext) and bit in dir(current): raise try: # list-index lookup current = current[int(bit)] except (IndexError, # list index out of range ValueError, # invalid literal for int() KeyError, # current is a dict without `int(bit)` key TypeError): # unsubscriptable object raise VariableDoesNotExist("Failed lookup for key " "[%s] in %r", (bit, current)) # missing attribute if callable(current): if getattr(current, 'do_not_call_in_templates', False): pass elif getattr(current, 'alters_data', False): current = context.template.engine.string_if_invalid else: try: # method call (assuming no args required) current = current() except TypeError: try: inspect.getcallargs(current) except TypeError: # arguments *were* required current = context.template.engine.string_if_invalid # invalid method call else: raise except Exception as e: template_name = getattr(context, 'template_name', None) or 'unknown' logger.debug( "Exception while resolving variable '%s' in template '%s'.", bit, template_name, exc_info=True, ) if getattr(e, 'silent_variable_failure', False): current = context.template.engine.string_if_invalid else: raise return current class Node: # Set this to True for nodes that must be first in the template (although # they can be preceded by text nodes. must_be_first = False child_nodelists = ('nodelist',) token = None def render(self, context): """ Return the node rendered as a string. """ pass def render_annotated(self, context): """ Render the node. If debug is True and an exception occurs during rendering, the exception is annotated with contextual line information where it occurred in the template. For internal usage this method is preferred over using the render method directly. """ try: return self.render(context) except Exception as e: if context.template.engine.debug and not hasattr(e, 'template_debug'): e.template_debug = context.render_context.template.get_exception_info(e, self.token) raise def __iter__(self): yield self def get_nodes_by_type(self, nodetype): """ Return a list of all nodes (within this node and its nodelist) of the given type """ nodes = [] if isinstance(self, nodetype): nodes.append(self) for attr in self.child_nodelists: nodelist = getattr(self, attr, None) if nodelist: nodes.extend(nodelist.get_nodes_by_type(nodetype)) return nodes class NodeList(list): # Set to True the first time a non-TextNode is inserted by # extend_nodelist(). contains_nontext = False def render(self, context): bits = [] for node in self: if isinstance(node, Node): bit = node.render_annotated(context) else: bit = node bits.append(str(bit)) return mark_safe(''.join(bits)) def get_nodes_by_type(self, nodetype): "Return a list of all nodes of the given type" nodes = [] for node in self: nodes.extend(node.get_nodes_by_type(nodetype)) return nodes class TextNode(Node): def __init__(self, s): self.s = s def __repr__(self): return "<%s: %r>" % (self.__class__.__name__, self.s[:25]) def render(self, context): return self.s def render_value_in_context(value, context): """ Convert any value to a string to become part of a rendered template. This means escaping, if required, and conversion to a string. If value is a string, it's expected to already be translated. """ value = template_localtime(value, use_tz=context.use_tz) value = localize(value, use_l10n=context.use_l10n) if context.autoescape: if not issubclass(type(value), str): value = str(value) return conditional_escape(value) else: return str(value) class VariableNode(Node): def __init__(self, filter_expression): self.filter_expression = filter_expression def __repr__(self): return "<Variable Node: %s>" % self.filter_expression def render(self, context): try: output = self.filter_expression.resolve(context) except UnicodeDecodeError: # Unicode conversion can fail sometimes for reasons out of our # control (e.g. exception rendering). In that case, we fail # quietly. return '' return render_value_in_context(output, context) # Regex for token keyword arguments kwarg_re = re.compile(r"(?:(\w+)=)?(.+)") def token_kwargs(bits, parser, support_legacy=False): """ Parse token keyword arguments and return a dictionary of the arguments retrieved from the ``bits`` token list. `bits` is a list containing the remainder of the token (split by spaces) that is to be checked for arguments. Valid arguments are removed from this list. `support_legacy` - if True, the legacy format ``1 as foo`` is accepted. Otherwise, only the standard ``foo=1`` format is allowed. There is no requirement for all remaining token ``bits`` to be keyword arguments, so return the dictionary as soon as an invalid argument format is reached. """ if not bits: return {} match = kwarg_re.match(bits[0]) kwarg_format = match and match.group(1) if not kwarg_format: if not support_legacy: return {} if len(bits) < 3 or bits[1] != 'as': return {} kwargs = {} while bits: if kwarg_format: match = kwarg_re.match(bits[0]) if not match or not match.group(1): return kwargs key, value = match.groups() del bits[:1] else: if len(bits) < 3 or bits[1] != 'as': return kwargs key, value = bits[2], bits[0] del bits[:3] kwargs[key] = parser.compile_filter(value) if bits and not kwarg_format: if bits[0] != 'and': return kwargs del bits[:1] return kwargs
""" models.py Defines the database models. """ from datetime import datetime from sqlalchemy import event from sqlalchemy.event import listens_for from flask.ext.sqlalchemy import SQLAlchemy from flask.ext.login import UserMixin import bcrypt db = SQLAlchemy() resourcecategory = db.Table( 'resourcecategory', db.Column('resource_id', db.Integer, db.ForeignKey('resource.id'), primary_key=True), db.Column('category_id', db.Integer, db.ForeignKey('category.id'), primary_key=True) ) class Resource(db.Model): """ A resource used to recommend health care providers to L.G.B.T.Q.I.A people. """ id = db.Column(db.Integer, primary_key=True) name = db.Column(db.Unicode(250), nullable=False) organization = db.Column(db.Unicode(500)) description = db.Column(db.UnicodeText) visible = db.Column(db.Boolean, nullable=False, default=True) address = db.Column(db.Unicode(500)) latitude = db.Column(db.Float) longitude = db.Column(db.Float) location = db.Column(db.Unicode(500)) email = db.Column(db.Unicode(250)) phone = db.Column(db.Unicode(50)) fax = db.Column(db.Unicode(50)) url = db.Column(db.Unicode(500)) hours = db.Column(db.UnicodeText) source = db.Column(db.UnicodeText) npi = db.Column(db.Unicode(10)) notes = db.Column(db.UnicodeText) date_created = db.Column(db.DateTime, nullable=False, default=datetime.utcnow) last_updated = db.Column(db.DateTime, nullable=False, default=datetime.utcnow) date_verified = db.Column(db.Date) categories = db.relationship('Category', secondary=resourcecategory, backref=db.backref('resources', lazy='dynamic')) category_text = db.Column(db.UnicodeText) def __unicode__(self): return self.name class Category(db.Model): """ A category to which one or more resources can belong. """ id = db.Column(db.Integer, primary_key=True) name = db.Column(db.Unicode(100), nullable=False, unique=True) description = db.Column(db.UnicodeText) keywords = db.Column(db.UnicodeText) visible = db.Column(db.Boolean, nullable=False, default=True) date_created = db.Column(db.DateTime, nullable=False, default=datetime.utcnow) def __unicode__(self): return self.name class User(UserMixin, db.Model): """ A RAD user. """ id = db.Column(db.Integer, primary_key=True) username = db.Column(db.Unicode(50), nullable=False, unique=True) password = db.Column(db.Unicode(128), nullable=False, server_default="") email = db.Column(db.Unicode(250), nullable=False) admin = db.Column(db.Boolean, nullable=False, default=False) active = db.Column(db.Boolean, nullable=False, default=True) default_location = db.Column(db.Unicode(500)) default_latitude = db.Column(db.Float) default_longitude = db.Column(db.Float) date_created = db.Column(db.DateTime, nullable=False, default=datetime.utcnow) """ The name to display with a user's reviews. """ display_name = db.Column(db.Unicode(100), nullable=False, server_default='') """ Indicates if a user has confirmed their account by clicking the link in the provided email. The confirmation code will be stored in email_code. """ email_activated = db.Column(db.Boolean, nullable=False, default=False, server_default='1') """ The date/time the user requested a password reset. The code to reset the password will be stored in email_code. """ reset_pass_date = db.Column(db.DateTime, nullable=True) """ The code used for email registration and password resets. This will be a string representation of a UUID, in lowercase and without brackets. """ email_code = db.Column(db.Unicode(36), nullable=True) def __init__(self, username=None, email=None, password=None): self.username = username self.email = email if password is not None: self.password = bcrypt.hashpw(password, bcrypt.gensalt()) def verify_password(self, password): return bcrypt.hashpw(password, self.password) == self.password def __unicode__(self): return self.username class Review(db.Model): """ A review of a resource by a user. """ id = db.Column(db.Integer, primary_key=True) text = db.Column(db.UnicodeText, nullable=False) rating = db.Column(db.Integer) intake_rating = db.Column(db.Integer) staff_rating = db.Column(db.Integer) composite_rating = db.Column(db.Float) visible = db.Column(db.Boolean, nullable=False, default=True) date_created = db.Column(db.DateTime, nullable=False, default=datetime.utcnow) ip = db.Column(db.Unicode(45)) resource_id = db.Column(db.Integer, db.ForeignKey('resource.id'), nullable=False) resource = db.relationship('Resource', backref=db.backref('reviews', lazy='dynamic')) user_id = db.Column(db.Integer, db.ForeignKey('user.id'), nullable=False) user = db.relationship('User', backref=db.backref('reviews', lazy='dynamic')) is_old_review = db.Column(db.Boolean, nullable=False, default=False, server_default='0') new_review_id = db.Column(db.Integer, db.ForeignKey('review.id'), nullable=True) # We want to passively delete here because we'll be manually updating # foreign key references in the review service. old_reviews = db.relationship('Review', backref=db.backref("new_review", remote_side=id), lazy="dynamic", passive_deletes=True) def __init__(self, rating=None, text=None, resource=None, user=None): self.text = text self.rating = rating self.resource = resource self.user = user def __unicode__(self): return self.text class LoginHistory(db.Model): """ A recorded login attempt (successful or otherwise) for a user. """ id = db.Column(db.Integer, primary_key=True) login_date = db.Column(db.DateTime, nullable=False, default=datetime.utcnow) ip = db.Column(db.Unicode(45), nullable=False) username = db.Column(db.Unicode(50), nullable=False) successful = db.Column(db.Boolean, nullable=False) failure_reason = db.Column(db.Unicode(20)) @listens_for(Resource, 'before_insert') @listens_for(Resource, 'before_update') def normalize_resource(mapper, connect, target): """ Normalizes a resource before it is saved to the database. This ensures that the resource's categories are properly denormalized in the category_text and that the resource's URL starts with some sort of http:// or https:// prefix if it has been provided. Args: mapper: The mapper that is the target of the event. connection: The database connection being used. target: The resource being persisted to the database. """ # If we have categories, denormalize the category text # so that we can use it in text-based searching if target.categories: target.category_text = ', '.join(c.name + ' ' + (c.keywords or '') for c in target.categories) else: target.category_text = '' # If we have a URL and it doesn't start with http:// # or https://, append http:// to the beginning if target.url and \ not target.url.isspace() and \ not target.url.lower().strip().startswith(('http://', 'https://')): target.url = 'http://' + target.url.strip() @listens_for(Review, 'before_insert') @listens_for(Review, 'before_update') def normalize_review(mapper, connect, target): """ Normalizes a review before it is saved to the database. This ensures that the composite rating is properly calculated. Args: mapper: The mapper that is the target of the event. connection: The database connection being used. target: The resource being persisted to the database. """ composite_rating = 0.0 ratings_count = 0.0 if target.rating is not None and target.rating > 0: composite_rating += target.rating ratings_count += 1.0 if target.staff_rating is not None and target.staff_rating > 0: composite_rating += target.staff_rating ratings_count += 1.0 if target.intake_rating is not None and target.intake_rating > 0: composite_rating += target.intake_rating ratings_count += 1.0 # Create an average based on the number of submitted ratings # and store that in composite_rating if ratings_count > 0.0: target.composite_rating = composite_rating / ratings_count else: target.composite_rating = None
# Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. import io from gbpclient.v2_0 import client as gbp_client from keystoneauth1.identity import v2 from keystoneauth1.identity import v3 from keystoneauth1 import session from keystoneclient.v2_0 import client as identity_client from keystoneclient.v3 import client as keyclientv3 from neutronclient.v2_0 import client as neutron_client from novaclient import client as nova_client from novaclient import exceptions as nova_exc from gbpservice._i18n import _ from gbpservice.nfp.core import log as nfp_logging LOG = nfp_logging.getLogger(__name__) class OpenstackApi(object): """Initializes common attributes for openstack client drivers.""" def __init__(self, config, username=None, password=None, tenant_name=None): self.nova_version = '2' self.config = config self.identity_service = ("%s://%s:%d/%s/" % (config.nfp_keystone_authtoken.auth_protocol, config.nfp_keystone_authtoken.auth_host, config.nfp_keystone_authtoken.auth_port, config.nfp_keystone_authtoken.auth_version)) self.network_service = ("%s://%s:%d/" % (config.nfp_keystone_authtoken.auth_protocol, config.nfp_keystone_authtoken.auth_host, config.bind_port)) self.username = username or config.nfp_keystone_authtoken.admin_user self.password = password or ( config.nfp_keystone_authtoken.admin_password) self.tenant_name = (tenant_name or config.nfp_keystone_authtoken.admin_tenant_name) self.token = None self.admin_tenant_id = None class KeystoneClient(OpenstackApi): """ Keystone Client Apis for orchestrator. """ def get_admin_token(self): try: admin_token = self.get_scoped_keystone_token( self.config.nfp_keystone_authtoken.admin_user, self.config.nfp_keystone_authtoken.admin_password, self.config.nfp_keystone_authtoken.admin_tenant_name) except Exception as ex: err = ("Failed to obtain user token. Error: %s" % ex) LOG.error(err) raise Exception(err) return admin_token def get_scoped_keystone_token(self, user, password, tenant_name, tenant_id=None): """ Get a scoped token from Openstack Keystone service. A scoped token is bound to the specific tenant. :param user: User name :param password: Password :param tenantName: Tenant name :return: A scoped token or None if unable to get """ if not (tenant_name or tenant_id): err = "Tenant Not specified for getting a scoped token" LOG.error(err) raise Exception(err) try: auth = v2.Password(username=user, password=password, tenant_name=tenant_name, auth_url=self.identity_service) sess = session.Session(auth=auth) scoped_token = sess.get_token(auth=auth) except Exception as err: err = ("Failed to get token from" " Openstack Keystone service" " KeyError :: %s" % (err)) self.config.nfp_keystone_authtoken.auth_port, LOG.error(err) raise Exception(err) else: return scoped_token def get_admin_tenant_id(self, token): if not self.admin_tenant_id: self.admin_tenant_id = self.get_tenant_id( token, self.config.nfp_keystone_authtoken.admin_tenant_name) return self.admin_tenant_id def get_tenant_id(self, token, tenant_name): """ Get the tenant UUID associated to tenant name :param token: A scoped token :param tenant: Tenant name :return: Tenant UUID """ try: keystone = self._get_v2_keystone_admin_client() tenant = keystone.tenants.find(name=tenant_name) return tenant.id except Exception as ex: err = ("Failed to read tenant UUID from" " tenant_name %s." " Error :: %s" % (tenant_name, ex)) LOG.error(err) raise Exception(err) err = 'No tenant with name "%s" found in keystone db' % tenant_name LOG.error(err) raise Exception(err) def _get_v2_keystone_admin_client(self): """ Returns keystone v2 client with admin credentials Using this client one can perform CRUD operations over keystone resources. """ keystone_conf = self.config.nfp_keystone_authtoken auth = v2.Password(username=keystone_conf.admin_user, password=keystone_conf.admin_password, tenant_name=keystone_conf.admin_tenant_name, auth_url=self.identity_service) sess = session.Session(auth=auth) v2client = identity_client.Client(session=sess) return v2client def _get_v3_keystone_admin_client(self): """ Returns keystone v3 client with admin credentials Using this client one can perform CRUD operations over keystone resources. """ keystone_conf = self.config.nfp_keystone_authtoken v3_auth_url = ('%s://%s:%s/%s/' % ( keystone_conf.auth_protocol, keystone_conf.auth_host, keystone_conf.auth_port, self.config.heat_driver.keystone_version)) auth = v3.Password(auth_url=v3_auth_url, user_domain_name='Default', username=keystone_conf.admin_user, password=keystone_conf.admin_password, project_domain_name="Default", project_name=keystone_conf.admin_tenant_name) sess = session.Session(auth=auth) v3client = keyclientv3.Client(session=sess) return v3client class NovaClient(OpenstackApi): """ Nova Client Api driver. """ def get_image_id(self, token, tenant_id, image_name): """ Get the image UUID associated to image name :param token: A scoped token :param tenant_id: Tenant UUID :param image_name: Image name :return: Image UUID """ try: nova = nova_client.Client(self.nova_version, auth_token=token, tenant_id=tenant_id, auth_url=self.identity_service) image = nova.images.find(name=image_name) return image.id except Exception as ex: err = ("Failed to get image id from image name %s: %s" % ( image_name, ex)) LOG.error(err) raise Exception(err) def get_image_metadata(self, token, tenant_id, image_name): """ Get the image UUID associated to image name :param token: A scoped token :param tenant_id: Tenant UUID :param image_name: Image name :return: Image UUID """ try: nova = nova_client.Client(self.nova_version, auth_token=token, tenant_id=tenant_id, auth_url=self.identity_service) image = nova.images.find(name=image_name) return image.metadata except Exception as ex: err = ("Failed to get image metadata from image name %s: %s" % ( image_name, ex)) LOG.error(err) raise Exception(err) def get_flavor_id(self, token, tenant_id, flavor_name): """ Get the flavor UUID associated to flavor name :param token: A scoped token :param tenant_id: Tenant UUID :param flavor_name: Flavor name :return: Flavor UUID or None if not found """ try: nova = nova_client.Client(self.nova_version, auth_token=token, tenant_id=tenant_id, auth_url=self.identity_service) flavor = nova.flavors.find(name=flavor_name) return flavor.id except Exception as ex: err = ("Failed to get flavor id from flavor name %s: %s" % ( flavor_name, ex)) LOG.error(err) raise Exception(err) def get_instance(self, token, tenant_id, instance_id): """ Get instance details :param token: A scoped_token :param tenant_id: Tenant UUID :param instance_id: Instance UUID :return: Instance details """ try: nova = nova_client.Client(self.nova_version, auth_token=token, tenant_id=tenant_id, auth_url=self.identity_service) instance = nova.servers.get(instance_id) if instance: return instance.to_dict() raise Exception(_("No instance with id %(id)s " "found in db for tenant %(tenant)s") % {'id': instance_id, 'tenant': tenant_id}) except Exception as ex: err = ("Failed to read instance information from" " Openstack Nova service's response" " KeyError :: %s" % (ex)) LOG.error(err) raise Exception(err) def get_keypair(self, token, tenant_id, keypair_name): """ Get Nova keypair details :param token: A scoped_token :param tenant_id: Tenant UUID :param keypair_name: Nova keypair name :return: Nova keypair details """ tenant_id = str(tenant_id) try: nova = nova_client.Client(self.nova_version, auth_token=token, tenant_id=tenant_id, auth_url=self.identity_service) keypair = nova.keypairs.find(name=keypair_name) return keypair.to_dict() except Exception as ex: err = ("Failed to read keypair information from" " Openstack Nova service's response." " %s" % ex) LOG.error(err) raise Exception(err) def attach_interface(self, token, tenant_id, instance_id, port_id): """ Attaches a port to already created instance :param token: A scoped token :param tenant_id: Tenant UUID :param instance_id: UUID of the instance :param port_id: Port UUID """ try: nova = nova_client.Client(self.nova_version, auth_token=token, tenant_id=tenant_id, auth_url=self.identity_service) instance = nova.servers.interface_attach(instance_id, port_id, None, None) return instance except Exception as ex: err = ("Failed to attach interface %s to instance" " %s %s" % (port_id, instance_id, ex)) LOG.error(err) raise Exception(err) def detach_interface(self, token, tenant_id, instance_id, port_id): """ Detaches a port to already created instance :param token: A scoped token :param tenant_id: Tenant UUID :param instance_id: UUID of the instance :param port_id: Port UUID """ try: nova = nova_client.Client(self.nova_version, auth_token=token, tenant_id=tenant_id, auth_url=self.identity_service) instance = nova.servers.interface_detach(instance_id, port_id) return instance except Exception as ex: err = ("Failed to detach interface %s from instance" " %s %s" % (port_id, instance_id, ex)) LOG.error(err) raise Exception(err) def delete_instance(self, token, tenant_id, instance_id): """ Delete the instance :param token: A scoped token :param tenant_id: Tenant UUID :param instance_id: Instance UUID """ try: nova = nova_client.Client(self.nova_version, auth_token=token, tenant_id=tenant_id, auth_url=self.identity_service) nova.servers.delete(instance_id) except Exception as ex: err = ("Failed to delete instance" " %s %s" % (instance_id, ex)) LOG.error(err) raise Exception(err) def get_instances(self, token, filters=None): """ List instances :param token: A scoped_token :param filters: Parameters for list filter example for filter: {}, tenant_id is mandatory :return: instance List """ if ( not filters or type(filters) != dict or 'tenant_id' not in filters ): err = ("Failed to process get_instances," " filters(type: dict) with tenant_id is mandatory") LOG.error(err) raise Exception(err) tenant_id = filters.get('tenant_id') try: nova = nova_client.Client(self.nova_version, auth_token=token, tenant_id=tenant_id, auth_url=self.identity_service) instances = nova.servers.list(search_opts=filters) data = [instance.to_dict() for instance in instances] return data except Exception as ex: err = ("Failed to list instances under tenant" " %s %s" % (tenant_id, ex)) LOG.error(err) raise Exception(err) def delete_affinity_group(self, token, tenant_id, nf_id): """ Deletes a server group :param token: A scoped token :param tenant_id: Tenant UUID :param nf_id: Network Function UUID Returns: None """ nova_version = 2.15 nova = nova_client.Client(nova_version, auth_token=token, tenant_id=tenant_id, auth_url=self.identity_service) try: affinity_group = nova.server_groups.find(name=nf_id) affinity_group_id = affinity_group.to_dict()['id'] nova.server_groups.delete(affinity_group_id) msg = ("Successfully deleted Nova Server Anti-Affinity " "Group: %s" % nf_id) LOG.info(msg) except nova_exc.NotFound: pass except Exception as err: msg = ("Failed to delete Nova Server Anti-Affinity Group " "with name %s. Error: %s" % (nf_id, err)) LOG.error(msg) def create_affinity_group(self, token, tenant_id, nf_id): """ Creates a server group :param token: A scoped token :param tenant_id: Tenant UUID :param nf_id: Network Function UUID Returns: Nova server-group json object """ nova_version = 2.15 kwargs = dict(name=nf_id, policies=['soft-anti-affinity']) nova = nova_client.Client(nova_version, auth_token=token, tenant_id=tenant_id, auth_url=self.identity_service) try: affinity_group = nova.server_groups.create(**kwargs) affinity_group_id = affinity_group.to_dict()['id'] msg = ("Successfully created Nova Server Anti-Affinity " "Group: %s" % nf_id) LOG.info(msg) return affinity_group_id except Exception as err: msg = ("Failed to create Nova Server Anti-Affinity Group. " "Error: %s" % err) LOG.error(msg) return None def create_instance(self, token, tenant_id, image_id, flavor, nw_port_id_list, name, volume_support, volume_size, secgroup_name=None, metadata=None, files=None, config_drive=False, userdata=None, key_name='', server_grp_id=None, ): """ Launch a VM with given details :param token: A scoped token :param tenant_id: Tenant UUID :param image_id: Image UUID :param flavor: Flavor name :param nw_port_id_list: Network UUID and port UUID list :param name: Service istance name :param secgroup_name: Nova security group name :param metadata: metadata key-value pairs :param files: List of files to be copied. :example files: [{"dst": <detination_path_string>, "src": <file_contents>}] :param userdata: user data to pass to be exposed by the metadata server this can be a file type object as well or a string :param key_name: Nova keypair name :param server_grp_id: Nova server group UUID :param volume_support: volume support to launch instance :param volume_size: cinder volume size in GB :return: VM instance UUID """ try: if files: file_dict = {} for _file in files: with open(_file["src"]) as config_file: data = config_file.read() config_drive = True file_dict.update({_file["dst"]: data}) files = file_dict except Exception as e: msg = ( "Failed while reading file: %r " % e) LOG.error(msg) raise e kwargs = dict() if volume_support: block_device_mapping_v2 = [ { "boot_index": "1", "uuid": image_id, "source_type": "image", "volume_size": volume_size, "destination_type": "volume", "delete_on_termination": True } ] kwargs.update(block_device_mapping_v2=block_device_mapping_v2) if server_grp_id: kwargs.update(scheduler_hints={"group": server_grp_id}) if key_name != '': kwargs.update(key_name=key_name) if config_drive is True: kwargs.update(config_drive=True) if userdata is not None and \ (type(userdata) is str or type(userdata) is io.IOBase): kwargs.update(userdata=userdata) if metadata is not None and type(metadata) is dict and metadata != {}: kwargs.update(meta=metadata) if files is not None: kwargs.update(files=files) if nw_port_id_list: nics = [{"port-id": entry.get("port"), "net-id": entry.get("uuid"), "v4-fixed-ip": entry.get("fixed_ip")} for entry in nw_port_id_list] kwargs.update(nics=nics) if secgroup_name: kwargs.update(security_groups=[secgroup_name]) try: nova = nova_client.Client(self.nova_version, auth_token=token, tenant_id=tenant_id, auth_url=self.identity_service) flavor = nova.flavors.find(name=flavor) instance = nova.servers.create(name, nova.images.get(image_id), flavor, **kwargs) data = instance.to_dict() return data['id'] except Exception as ex: err = ("Failed to create instance under tenant" " %s %s" % (tenant_id, ex)) LOG.error(err) raise Exception(err) class NeutronClient(OpenstackApi): """ Neutron Client Api Driver. """ def get_floating_ip(self, token, floatingip_id): """ Get floatingip details :param token: A scoped_token :param floatingip_id: Port UUID :return: floatingip details """ try: neutron = neutron_client.Client(token=token, endpoint_url=self.network_service) return neutron.show_floatingip(floatingip_id)['floatingip'] except Exception as ex: err = ("Failed to read floatingip from" " Openstack Neutron service's response" " KeyError :: %s" % (ex)) LOG.error(err) raise Exception(err) def get_floating_ips(self, token, **filters): """ Get list of floatingips, associated with port if passed""" try: neutron = neutron_client.Client(token=token, endpoint_url=self.network_service) return neutron.list_floatingips(**filters)['floatingips'] except Exception as ex: err = ("Failed to read floatingips from" " Openstack Neutron service's response" " KeyError :: %s" % (ex)) LOG.error(err) raise Exception(err) def get_security_groups(self, token, tenant_id=None, filters=None): """ Get list of security groups""" try: neutron = neutron_client.Client(token=token, endpoint_url=self.network_service) filters = filters if filters is not None else {} return neutron.list_security_groups(**filters)['security_groups'] except Exception as ex: err = ("Failed to get security groups from" " Openstack Neutron service's response" " KeyError :: %s" % (ex)) LOG.error(err) raise Exception(err) def create_security_group(self, token, attrs=None): """ Create security group""" try: neutron = neutron_client.Client(token=token, endpoint_url=self.network_service) sg_info = {"security_group": attrs} return neutron.create_security_group(body=sg_info)[ 'security_group'] except Exception as ex: err = ("Failed to get security groups from" " Openstack Neutron service's response" " KeyError :: %s" % (ex)) LOG.error(err) raise Exception(err) def create_security_group_rule(self, token, attrs=None): """ Create security group rule""" try: neutron = neutron_client.Client(token=token, endpoint_url=self.network_service) # attrs={'direction': 'egress', 'protocol': 'TCP', # 'security_group_id': 'c90c7b29-f653-4c41-ae1a-0290dc64e020'} sg_rule_info = {"security_group_rule": attrs} return neutron.create_security_group_rule( body=sg_rule_info)['security_group_rule'] except Exception as ex: err = ("Failed to get security groups from" " Openstack Neutron service's response" " KeyError :: %s" % (ex)) LOG.error(err) # raise Exception(err) def get_ports(self, token, filters=None): """ List Ports :param token: A scoped_token :param filters: Parameters for list filter example for filter: ?tenant_id=%s&id=%s :return: Port List """ try: neutron = neutron_client.Client(token=token, endpoint_url=self.network_service) ports = neutron.list_ports(**filters).get('ports', []) return ports except Exception as ex: err = ("Failed to read port list from" " Openstack Neutron service's response" " KeyError :: %s" % (ex)) LOG.error(err) raise Exception(err) def get_port(self, token, port_id): """ Get port details :param token: A scoped_token :param port_id: Port UUID :return: Port details """ try: neutron = neutron_client.Client(token=token, endpoint_url=self.network_service) return neutron.show_port(port_id) except Exception as ex: err = ("Failed to read port information" " Exception :: %s" % (ex)) LOG.error(err) raise Exception(err) def get_subnets(self, token, filters=None): """ List subnets :param token: A scoped_token :param filters: Parameters for list filter example for filter: ?tenant_id=%s&id=%s :return: Subnet List """ try: neutron = neutron_client.Client(token=token, endpoint_url=self.network_service) subnets = neutron.list_subnets(**filters).get('subnets', []) return subnets except Exception as ex: err = ("Failed to read subnet list from" " Openstack Neutron service's response" " KeyError :: %s" % (ex)) LOG.error(err) raise Exception(err) def get_subnet(self, token, subnet_id): """ Get subnet details :param token: A scoped_token :param subnet_id: Subnet UUID :return: Subnet details """ try: neutron = neutron_client.Client(token=token, endpoint_url=self.network_service) return neutron.show_subnet(subnet_id) except Exception as ex: err = ("Failed to read subnet from" " Openstack Neutron service's response" " KeyError :: %s" % (ex)) LOG.error(err) raise Exception(err) def delete_floatingip(self, token, floatingip_id): """ Delete the floatingip :param token: A scoped token :param tenant_id: Tenant UUID :param floatingip_id: Floatingip UUID """ try: neutron = neutron_client.Client(token=token, endpoint_url=self.network_service) return neutron.delete_floatingip(floatingip_id) except Exception as ex: err = ("Failed to delete floatingip from" " Openstack Neutron service's response" " KeyError :: %s" % (ex)) LOG.error(err) raise Exception(err) def update_port(self, token, port_id, **kwargs): """ :param token: :param port_id: :param kwargs: name=<>, allowed_address_pairs={'ip_address': <>, 'mac_address': <>} :return: """ try: neutron = neutron_client.Client(token=token, endpoint_url=self.network_service) port_info = dict(port={}) port_info['port'].update(kwargs) return neutron.update_port(port_id, body=port_info) except Exception as ex: err = ("Failed to update port info" " Error :: %s" % (ex)) LOG.error(err) raise Exception(err) def get_floating_ips_for_ports(self, token, **kwargs): """ :param self: :param token: :param kwargs: :return: """ data = {'floatingips': []} try: neutron = neutron_client.Client(token=token, endpoint_url=self.network_service) data = neutron.list_floatingips(port_id=[kwargs[key] for key in kwargs]) return data except Exception as ex: raise Exception(ex) def _update_floatingip(self, token, floatingip_id, data): """ Update the floatingip :param token: A scoped token :param floatingip_id: Floatingip UUID :param data: data to update """ try: neutron = neutron_client.Client(token=token, endpoint_url=self.network_service) return neutron.update_floatingip(floatingip_id, body=data) except Exception as ex: err = ("Failed to update floatingip from" " Openstack Neutron service's response" " KeyError :: %s" % (ex)) LOG.error(err) raise Exception(err) def disassociate_floating_ip(self, token, floatingip_id): """ :param self: :param token: :param floatingip_id: :return: """ info = { "floatingip": { "port_id": None} } self._update_floatingip(token, floatingip_id, info) LOG.debug("Successfully disassociated floatingip %s", floatingip_id) def associate_floating_ip(self, token, floatingip_id, port_id): """ :param self: :param token: :param floatingip_id: :return: """ info = { "floatingip": { "port_id": port_id} } self._update_floatingip(token, floatingip_id, info) LOG.debug("Successfully associated floatingip %s", floatingip_id) def list_ports(self, token, port_ids=None, **kwargs): """ :param token: :param port_ids: :param kwargs: :return: """ try: neutron = neutron_client.Client(token=token, endpoint_url=self.network_service) port_ids = port_ids if port_ids is not None else [] if port_ids: ports = neutron.list_ports(id=port_ids).get('ports', []) else: ports = neutron.list_ports(**kwargs) return ports except Exception as ex: err = ("Failed to list ports %s" % ex) LOG.error(err) raise Exception(err) def list_subnets(self, token, subnet_ids=None, **kwargs): """ :param token: :param subnet_ids: :param kwargs: :return: """ try: neutron = neutron_client.Client(token=token, endpoint_url=self.network_service) subnet_ids = subnet_ids if subnet_ids is not None else [] subnets = neutron.list_subnets(id=subnet_ids).get('subnets', []) return subnets except Exception as ex: err = ("Failed to list subnets %s" % ex) LOG.error(err) raise Exception(err) def create_port(self, token, tenant_id, net_id, attrs=None): attr = { 'port': { # 'tenant_id': tenant_id, 'network_id': net_id } } if attrs: attr['port'].update(attrs) try: neutron = neutron_client.Client(token=token, endpoint_url=self.network_service) return neutron.create_port(body=attr)['port'] except Exception as ex: raise Exception(_("Port creation failed in network: %(net)r " "of tenant: %(tenant)r Error: %(error)s") % {'net': net_id, 'tenant': tenant_id, 'error': ex}) def delete_port(self, token, port_id): """ :param token: :param port_id: :return: """ try: neutron = neutron_client.Client(token=token, endpoint_url=self.network_service) return neutron.delete_port(port_id) except Exception as ex: err = ("Failed to delete port %s" " Exception :: %s" % (port_id, ex)) LOG.error(err) raise Exception(err) def get_networks(self, token, filters=None): """ List nets :param token: A scoped_token :param filters: Parameters for list filter example for filter: ?tenant_id=%s&id=%s :return: network List """ try: neutron = neutron_client.Client(token=token, endpoint_url=self.network_service) nets = neutron.list_networks(**filters).get('networks', []) return nets except Exception as ex: err = ("Failed to read network list from" " Openstack Neutron service's response" " KeyError :: %s" % (ex)) LOG.error(err) raise Exception(err) def delete_nw(self, token, net_id): """ :param token: :param net_id: :return: """ try: neutron = neutron_client.Client(token=token, endpoint_url=self.network_service) return neutron.delete_network(net_id) except Exception as ex: err = ('Failed to delete network %s . %s' % (net_id, str(ex))) LOG.error(err) def get_pools(self, token, filters=None): """ List Pools :param token: A scoped_token :param filters: Parameters for list filter example for filter: ?tenant_id=%s&id=%s :return: Pool List """ try: neutron = neutron_client.Client(token=token, endpoint_url=self.network_service) pools = neutron.list_pools(**filters).get('pools', []) return pools except Exception as ex: err = ("Failed to read pool list from" " Openstack Neutron service's response" " KeyError :: %s" % (ex)) LOG.error(err) raise Exception(err) def get_loadbalancers(self, token, filters=None): """ List Loadbalancers :param token: A scoped_token :param filters: Parameters for list filter example for filter: ?tenant_id=%s&id=%s :return: Loadbalancers List """ try: neutron = neutron_client.Client(token=token, endpoint_url=self.network_service) loadbalancers = neutron.list_loadbalancers(**filters).get( 'loadbalancers', []) return loadbalancers except Exception as ex: err = ("Failed to read pool list from" " Openstack Neutron service's response" " KeyError :: %s" % (ex)) LOG.error(err) raise Exception(err) def get_vip(self, token, vip_id): """ Get vip details :param token: A scoped_token :param vip_id: Port UUID :return: VIP details """ try: neutron = neutron_client.Client(token=token, endpoint_url=self.network_service) return neutron.show_vip(vip_id) except Exception as ex: err = ("Failed to read vip information" " Exception :: %s" % (ex)) LOG.error(err) raise Exception(err) def get_agents(self, token, filters=None): """ Get neutron agents :param token: A scoped_token :param filters: Parameters for list filter :return: neutron agents List """ try: neutron = neutron_client.Client(token=token, endpoint_url=self.network_service) return neutron.list_agents(**filters).get('agents', []) except Exception as ex: err = ("Failed to read agents information" " Exception :: %s" % (ex)) LOG.error(err) raise Exception(err) class GBPClient(OpenstackApi): """ GBP Client Api Driver. """ def get_policy_target_groups(self, token, filters=None): """ List Policy Target Groups :param token: A scoped_token :param filters: Parameters for list filter example for filter: ?tenant_id=%s&id=%s :return: PTG List """ try: gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) return gbp.list_policy_target_groups( **filters)['policy_target_groups'] except Exception as ex: err = ("Failed to read PTG list from" " Openstack Neutron service's response." " KeyError :: %s" % (ex)) LOG.error(err) raise Exception(err) def get_policy_target_group(self, token, ptg_id, filters=None): """ :param token: A scoped token :param ptg_id: PTG :param filters: Optional :return: """ try: gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) filters = filters if filters is not None else {} return gbp.show_policy_target_group( ptg_id, **filters)['policy_target_group'] except Exception as ex: err = ("Failed to read PTG list from" " Openstack Neutron service's response." " KeyError :: %s" % (ex)) LOG.error(err) raise Exception(err) def update_policy_target_group(self, token, ptg_id, policy_target_group_info): """ Updates a GBP Policy Target Group :param token: A scoped token :param ptg_id: PTG UUID :param policy_target_group_info: PTG info dict :return: PTG dict """ try: gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) return gbp.update_policy_target_group( ptg_id, body=policy_target_group_info)['policy_target_group'] except Exception as ex: err = ("Failed to update policy target group. Error :: %s" % (ex)) LOG.error(err) raise Exception(err) def create_policy_target(self, token, tenant_id, policy_target_group_id, name, port_id=None, description=''): """ Creates a GBP Policy Target :param token: A scoped token :param tenant_id: Tenant UUID :param policy_target_group_id: PTG UUID :param name: PT name :return: PT dict """ policy_target_info = { "policy_target": { "policy_target_group_id": policy_target_group_id, "tenant_id": tenant_id, } } if name: policy_target_info['policy_target'].update({'name': name}) if port_id: policy_target_info["policy_target"]["port_id"] = port_id if description: policy_target_info["policy_target"]["description"] = description try: gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) return gbp.create_policy_target( body=policy_target_info)['policy_target'] except Exception as ex: err = ("Failed to read policy target information from" " Openstack Neutron service's response." " KeyError :: %s" % (ex)) LOG.error(err) raise Exception(err) def delete_policy_target(self, token, policy_target_id): """ Delete the GBP policy_target :param token: A scoped token :param policy_target_id: PT UUID """ try: gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) return gbp.delete_policy_target(policy_target_id) except Exception as ex: err = ("Failed to delete policy target information from" " Openstack Neutron service's response." " KeyError :: %s" % (ex)) LOG.error(err) raise Exception(err) def delete_policy_target_group(self, token, policy_target_group_id): """ Delete the GBP policy_target group :param token: A scoped token :param policy_target_id: PTG UUID """ try: gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) return gbp.delete_policy_target_group(policy_target_group_id) except Exception as ex: err = ("Failed to delete policy target group from" " Openstack." " Error :: %s" % (ex)) LOG.error(err) raise Exception(err) def update_policy_target(self, token, policy_target_id, updated_pt): """ Update the Policy Target :param token: A scoped token :param policy_target_id: PT UUID :param updated_pt: New PT dict {\"policy_target\": {\"description\": \"test123\"}} """ policy_target_info = { "policy_target": updated_pt } try: gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) return gbp.update_policy_target( policy_target_id, body=policy_target_info)['policy_target'] except Exception as ex: err = ("Failed to read updated PT information" ". PT %s." " KeyError :: %s" % (policy_target_id, ex)) LOG.error(err) raise Exception(err) def create_policy_target_group(self, token, tenant_id, name, l2_policy_id=None, ext_data=None): """ Creates a GBP Policy Target Group :param ext_data: :param token: A scoped token :param tenant_id: Tenant UUID :param name: PTG name :return: PTG dict """ policy_target_group_info = { "policy_target_group": { "tenant_id": tenant_id, "name": name, } } ext_data = ext_data or {} if l2_policy_id: policy_target_group_info["policy_target_group"].update( {"l2_policy_id": l2_policy_id}) policy_target_group_info['policy_target_group'].update(ext_data) try: gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) return gbp.create_policy_target_group( body=policy_target_group_info)['policy_target_group'] except Exception as ex: err = ("Failed to create policy target group. %s" " Error :: %s" % (policy_target_group_info, ex)) LOG.error(err) raise Exception(err) def create_l2_policy(self, token, tenant_id, name, l3_policy_id=None, description=''): l2_policy_info = { "l2_policy": { "tenant_id": tenant_id, "name": name } } if l3_policy_id: l2_policy_info["l2_policy"].update({'l3_policy_id': l3_policy_id}) if description: l2_policy_info["description"].update({'description': description}) try: gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) return gbp.create_l2_policy(body=l2_policy_info)['l2_policy'] except Exception as ex: err = ("Failed to create l2 policy under tenant" " %s. Error :: %s" % (tenant_id, ex)) LOG.error(err) raise Exception(err) def delete_l2_policy(self, token, l2policy_id): """ :param token: :param l2policy_id: :return: """ try: gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) return gbp.delete_l2_policy(l2policy_id) except Exception as ex: err = ("Failed to delete l2 policy %s. Reason %s" % (l2policy_id, ex)) LOG.error(err) raise Exception(err) # NOTE: The plural form in the function name is needed in that way # to construct the function generically def get_l2_policys(self, token, filters=None): """ List L2 policies :param token: A scoped_token :param filters: Parameters for list filter example for filter: {} :return: L2 policies List """ try: gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) filters = filters if filters is not None else {} return gbp.list_l2_policies(**filters)['l2_policies'] except Exception as ex: err = ("Failed to list l2 policies. Reason %s" % ex) LOG.error(err) raise Exception(err) def get_l2_policy(self, token, policy_id, filters=None): """ List L2 policies :param token: A scoped_token :param policy_id: l2 policy id :param filters: Parameters for list filter example for filter: {} :return: L2 policies List """ try: gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) filters = filters if filters is not None else {} return gbp.show_l2_policy( policy_id, **filters)['l2_policy'] except Exception as ex: err = ("Failed to read l2 policy list from" " Openstack Neutron service's response." " KeyError :: %s" % (ex)) LOG.error(err) raise Exception(err) def create_network_service_policy(self, token, network_service_policy_info): try: gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) return gbp.create_network_service_policy( body=network_service_policy_info)['network_service_policy'] except Exception as ex: err = ("Failed to create network service policy " "Error :: %s" % (ex)) LOG.error(err) raise Exception(err) def get_network_service_policies(self, token, filters=None): """ List network service policies :param token: A scoped_token :param filters: Parameters for list filter example for filter: {} :return: network service policy List """ try: gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) filters = filters if filters is not None else {} return gbp.list_network_service_policies(**filters)[ 'network_service_policies'] except Exception as ex: err = ("Failed to list network service policies. Reason %s" % ex) LOG.error(err) raise Exception(err) def get_external_policies(self, token, filters=None): """ List external policies :param token: A scoped_token :param filters: Parameters for list filter example for filter: {} :return: external policy List """ try: gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) filters = filters if filters is not None else {} return gbp.list_external_policies(**filters)['external_policies'] except Exception as ex: err = ("Failed to list external policies. Reason %s" % ex) LOG.error(err) raise Exception(err) def get_policy_rule_sets(self, token, filters=None): """ List policy rule sets :param token: A scoped_token :param filters: Parameters for list filter example for filter: {} :return: policy rule set List """ try: gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) filters = filters if filters is not None else {} return gbp.list_policy_rule_sets(**filters)['policy_rule_sets'] except Exception as ex: err = ("Failed to list policy rule sets. Reason %s" % ex) LOG.error(err) raise Exception(err) def get_policy_actions(self, token, filters=None): """ List policy actions :param token: A scoped_token :param filters: Parameters for list filter example for filter: {} :return: policy actions List """ try: gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) filters = filters if filters is not None else {} return gbp.list_policy_actions(**filters)['policy_actions'] except Exception as ex: err = ("Failed to list policy actions. Reason %s" % ex) LOG.error(err) raise Exception(err) def get_policy_rules(self, token, filters=None): """ List policy rules :param token: A scoped_token :param filters: Parameters for list filter example for filter: {} :return: policy rules List """ try: gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) filters = filters if filters is not None else {} return gbp.list_policy_rules(**filters)['policy_rules'] except Exception as ex: err = ("Failed to list policy rules. Reason %s" % ex) LOG.error(err) raise Exception(err) def create_l3_policy(self, token, l3_policy_info): # tenant_id, name): try: gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) return gbp.create_l3_policy(body=l3_policy_info)['l3_policy'] except Exception as ex: err = ("Failed to create l3 policy under tenant" " %s. Error :: %s" % (l3_policy_info['l3_policy']['tenant_id'], ex)) LOG.error(err) raise Exception(err) def get_l3_policy(self, token, policy_id, filters=None): """ List L3 policies :param token: A scoped_token :param filters: Parameters for list filter example for filter: {} :return: L3 policies List """ try: gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) filters = filters if filters is not None else {} return gbp.show_l3_policy( policy_id, **filters)['l3_policy'] except Exception as ex: err = ("Failed to read l3 policy list from" " Openstack Neutron service's response." " KeyError :: %s" % (ex)) LOG.error(err) raise Exception(err) def get_l3_policies(self, token, filters=None): """ List L3 policies :param token: A scoped_token :param filters: Parameters for list filter example for filter: {} :return: L2 policies List """ try: gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) filters = filters if filters is not None else {} return gbp.list_l3_policies(**filters)['l3_policies'] except Exception as ex: err = ("Failed to list l3 policies. Reason %s" % ex) LOG.error(err) raise Exception(err) def get_policy_targets(self, token, filters=None): """ List Policy Targets :param token: A scoped_token :param filters: Parameters for list filter example for filter: {} :return: PT List """ try: gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) filters = filters if filters is not None else {} return gbp.list_policy_targets(**filters)['policy_targets'] except Exception as ex: err = ("Failed to read PT list." " Error :: %s" % (ex)) LOG.error(err) raise Exception(err) def list_pt(self, token, filters=None): filters = filters if filters is not None else {} return self.get_policy_targets(token, filters=filters) def get_policy_target(self, token, pt_id, filters=None): try: gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) filters = filters if filters is not None else {} return gbp.show_policy_target(pt_id, **filters)['policy_target'] except Exception as ex: err = ("Failed to read PT information" ". PT %s." " Error :: %s" % (pt_id, ex)) LOG.error(err) raise Exception(err) def get_service_profile(self, token, service_profile_id): gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) return gbp.show_service_profile(service_profile_id)['service_profile'] def get_servicechain_node(self, token, node_id): gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) return gbp.show_servicechain_node(node_id)['servicechain_node'] def get_servicechain_instance(self, token, instance_id): gbp = gbp_client.Client(token=token, endpoint_url=self.network_service) return gbp.show_servicechain_instance(instance_id)[ 'servicechain_instance']
# -*- coding: utf-8 -*- """ pygments.lexers.html ~~~~~~~~~~~~~~~~~~~~ Lexers for HTML, XML and related markup. :copyright: Copyright 2006-2015 by the Pygments team, see AUTHORS. :license: BSD, see LICENSE for details. """ import re from pygments.lexer import RegexLexer, ExtendedRegexLexer, include, bygroups, \ default, using from pygments.token import Text, Comment, Operator, Keyword, Name, String, \ Punctuation from pygments.util import looks_like_xml, html_doctype_matches from pygments.lexers.javascript import JavascriptLexer from pygments.lexers.jvm import ScalaLexer from pygments.lexers.css import CssLexer, _indentation, _starts_block from pygments.lexers.ruby import RubyLexer __all__ = ['HtmlLexer', 'DtdLexer', 'XmlLexer', 'XsltLexer', 'HamlLexer', 'ScamlLexer', 'JadeLexer'] class HtmlLexer(RegexLexer): """ For HTML 4 and XHTML 1 markup. Nested JavaScript and CSS is highlighted by the appropriate lexer. """ name = 'HTML' aliases = ['html'] filenames = ['*.html', '*.htm', '*.xhtml', '*.xslt'] mimetypes = ['text/html', 'application/xhtml+xml'] flags = re.IGNORECASE | re.DOTALL tokens = { 'root': [ ('[^<&]+', Text), (r'&\S*?;', Name.Entity), (r'\<\!\[CDATA\[.*?\]\]\>', Comment.Preproc), ('<!--', Comment, 'comment'), (r'<\?.*?\?>', Comment.Preproc), ('<![^>]*>', Comment.Preproc), (r'(<)(\s*)(script)(\s*)', bygroups(Punctuation, Text, Name.Tag, Text), ('script-content', 'tag')), (r'(<)(\s*)(style)(\s*)', bygroups(Punctuation, Text, Name.Tag, Text), ('style-content', 'tag')), # note: this allows tag names not used in HTML like <x:with-dash>, # this is to support yet-unknown template engines and the like (r'(<)(\s*)([\w:.-]+)', bygroups(Punctuation, Text, Name.Tag), 'tag'), (r'(<)(\s*)(/)(\s*)([\w:.-]+)(\s*)(>)', bygroups(Punctuation, Text, Punctuation, Text, Name.Tag, Text, Punctuation)), ], 'comment': [ ('[^-]+', Comment), ('-->', Comment, '#pop'), ('-', Comment), ], 'tag': [ (r'\s+', Text), (r'([\w:-]+\s*)(=)(\s*)', bygroups(Name.Attribute, Operator, Text), 'attr'), (r'[\w:-]+', Name.Attribute), (r'(/?)(\s*)(>)', bygroups(Punctuation, Text, Punctuation), '#pop'), ], 'script-content': [ (r'(<)(\s*)(/)(\s*)(script)(\s*)(>)', bygroups(Punctuation, Text, Punctuation, Text, Name.Tag, Text, Punctuation), '#pop'), (r'.+?(?=<\s*/\s*script\s*>)', using(JavascriptLexer)), ], 'style-content': [ (r'(<)(\s*)(/)(\s*)(style)(\s*)(>)', bygroups(Punctuation, Text, Punctuation, Text, Name.Tag, Text, Punctuation),'#pop'), (r'.+?(?=<\s*/\s*style\s*>)', using(CssLexer)), ], 'attr': [ ('".*?"', String, '#pop'), ("'.*?'", String, '#pop'), (r'[^\s>]+', String, '#pop'), ], } def analyse_text(text): if html_doctype_matches(text): return 0.5 class DtdLexer(RegexLexer): """ A lexer for DTDs (Document Type Definitions). .. versionadded:: 1.5 """ flags = re.MULTILINE | re.DOTALL name = 'DTD' aliases = ['dtd'] filenames = ['*.dtd'] mimetypes = ['application/xml-dtd'] tokens = { 'root': [ include('common'), (r'(<!ELEMENT)(\s+)(\S+)', bygroups(Keyword, Text, Name.Tag), 'element'), (r'(<!ATTLIST)(\s+)(\S+)', bygroups(Keyword, Text, Name.Tag), 'attlist'), (r'(<!ENTITY)(\s+)(\S+)', bygroups(Keyword, Text, Name.Entity), 'entity'), (r'(<!NOTATION)(\s+)(\S+)', bygroups(Keyword, Text, Name.Tag), 'notation'), (r'(<!\[)([^\[\s]+)(\s*)(\[)', # conditional sections bygroups(Keyword, Name.Entity, Text, Keyword)), (r'(<!DOCTYPE)(\s+)([^>\s]+)', bygroups(Keyword, Text, Name.Tag)), (r'PUBLIC|SYSTEM', Keyword.Constant), (r'[\[\]>]', Keyword), ], 'common': [ (r'\s+', Text), (r'(%|&)[^;]*;', Name.Entity), ('<!--', Comment, 'comment'), (r'[(|)*,?+]', Operator), (r'"[^"]*"', String.Double), (r'\'[^\']*\'', String.Single), ], 'comment': [ ('[^-]+', Comment), ('-->', Comment, '#pop'), ('-', Comment), ], 'element': [ include('common'), (r'EMPTY|ANY|#PCDATA', Keyword.Constant), (r'[^>\s|()?+*,]+', Name.Tag), (r'>', Keyword, '#pop'), ], 'attlist': [ include('common'), (r'CDATA|IDREFS|IDREF|ID|NMTOKENS|NMTOKEN|ENTITIES|ENTITY|NOTATION', Keyword.Constant), (r'#REQUIRED|#IMPLIED|#FIXED', Keyword.Constant), (r'xml:space|xml:lang', Keyword.Reserved), (r'[^>\s|()?+*,]+', Name.Attribute), (r'>', Keyword, '#pop'), ], 'entity': [ include('common'), (r'SYSTEM|PUBLIC|NDATA', Keyword.Constant), (r'[^>\s|()?+*,]+', Name.Entity), (r'>', Keyword, '#pop'), ], 'notation': [ include('common'), (r'SYSTEM|PUBLIC', Keyword.Constant), (r'[^>\s|()?+*,]+', Name.Attribute), (r'>', Keyword, '#pop'), ], } def analyse_text(text): if not looks_like_xml(text) and \ ('<!ELEMENT' in text or '<!ATTLIST' in text or '<!ENTITY' in text): return 0.8 class XmlLexer(RegexLexer): """ Generic lexer for XML (eXtensible Markup Language). """ flags = re.MULTILINE | re.DOTALL | re.UNICODE name = 'XML' aliases = ['xml'] filenames = ['*.xml', '*.xsl', '*.rss', '*.xslt', '*.xsd', '*.wsdl', '*.wsf'] mimetypes = ['text/xml', 'application/xml', 'image/svg+xml', 'application/rss+xml', 'application/atom+xml'] tokens = { 'root': [ ('[^<&]+', Text), (r'&\S*?;', Name.Entity), (r'\<\!\[CDATA\[.*?\]\]\>', Comment.Preproc), ('<!--', Comment, 'comment'), (r'<\?.*?\?>', Comment.Preproc), ('<![^>]*>', Comment.Preproc), (r'<\s*[\w:.-]+', Name.Tag, 'tag'), (r'<\s*/\s*[\w:.-]+\s*>', Name.Tag), ], 'comment': [ ('[^-]+', Comment), ('-->', Comment, '#pop'), ('-', Comment), ], 'tag': [ (r'\s+', Text), (r'[\w.:-]+\s*=', Name.Attribute, 'attr'), (r'/?\s*>', Name.Tag, '#pop'), ], 'attr': [ ('\s+', Text), ('".*?"', String, '#pop'), ("'.*?'", String, '#pop'), (r'[^\s>]+', String, '#pop'), ], } def analyse_text(text): if looks_like_xml(text): return 0.45 # less than HTML class XsltLexer(XmlLexer): """ A lexer for XSLT. .. versionadded:: 0.10 """ name = 'XSLT' aliases = ['xslt'] filenames = ['*.xsl', '*.xslt', '*.xpl'] # xpl is XProc mimetypes = ['application/xsl+xml', 'application/xslt+xml'] EXTRA_KEYWORDS = set(( 'apply-imports', 'apply-templates', 'attribute', 'attribute-set', 'call-template', 'choose', 'comment', 'copy', 'copy-of', 'decimal-format', 'element', 'fallback', 'for-each', 'if', 'import', 'include', 'key', 'message', 'namespace-alias', 'number', 'otherwise', 'output', 'param', 'preserve-space', 'processing-instruction', 'sort', 'strip-space', 'stylesheet', 'template', 'text', 'transform', 'value-of', 'variable', 'when', 'with-param' )) def get_tokens_unprocessed(self, text): for index, token, value in XmlLexer.get_tokens_unprocessed(self, text): m = re.match('</?xsl:([^>]*)/?>?', value) if token is Name.Tag and m and m.group(1) in self.EXTRA_KEYWORDS: yield index, Keyword, value else: yield index, token, value def analyse_text(text): if looks_like_xml(text) and '<xsl' in text: return 0.8 class HamlLexer(ExtendedRegexLexer): """ For Haml markup. .. versionadded:: 1.3 """ name = 'Haml' aliases = ['haml'] filenames = ['*.haml'] mimetypes = ['text/x-haml'] flags = re.IGNORECASE # Haml can include " |\n" anywhere, # which is ignored and used to wrap long lines. # To accomodate this, use this custom faux dot instead. _dot = r'(?: \|\n(?=.* \|)|.)' # In certain places, a comma at the end of the line # allows line wrapping as well. _comma_dot = r'(?:,\s*\n|' + _dot + ')' tokens = { 'root': [ (r'[ \t]*\n', Text), (r'[ \t]*', _indentation), ], 'css': [ (r'\.[\w:-]+', Name.Class, 'tag'), (r'\#[\w:-]+', Name.Function, 'tag'), ], 'eval-or-plain': [ (r'[&!]?==', Punctuation, 'plain'), (r'([&!]?[=~])(' + _comma_dot + r'*\n)', bygroups(Punctuation, using(RubyLexer)), 'root'), default('plain'), ], 'content': [ include('css'), (r'%[\w:-]+', Name.Tag, 'tag'), (r'!!!' + _dot + r'*\n', Name.Namespace, '#pop'), (r'(/)(\[' + _dot + '*?\])(' + _dot + r'*\n)', bygroups(Comment, Comment.Special, Comment), '#pop'), (r'/' + _dot + r'*\n', _starts_block(Comment, 'html-comment-block'), '#pop'), (r'-#' + _dot + r'*\n', _starts_block(Comment.Preproc, 'haml-comment-block'), '#pop'), (r'(-)(' + _comma_dot + r'*\n)', bygroups(Punctuation, using(RubyLexer)), '#pop'), (r':' + _dot + r'*\n', _starts_block(Name.Decorator, 'filter-block'), '#pop'), include('eval-or-plain'), ], 'tag': [ include('css'), (r'\{(,\n|' + _dot + ')*?\}', using(RubyLexer)), (r'\[' + _dot + '*?\]', using(RubyLexer)), (r'\(', Text, 'html-attributes'), (r'/[ \t]*\n', Punctuation, '#pop:2'), (r'[<>]{1,2}(?=[ \t=])', Punctuation), include('eval-or-plain'), ], 'plain': [ (r'([^#\n]|#[^{\n]|(\\\\)*\\#\{)+', Text), (r'(#\{)(' + _dot + '*?)(\})', bygroups(String.Interpol, using(RubyLexer), String.Interpol)), (r'\n', Text, 'root'), ], 'html-attributes': [ (r'\s+', Text), (r'[\w:-]+[ \t]*=', Name.Attribute, 'html-attribute-value'), (r'[\w:-]+', Name.Attribute), (r'\)', Text, '#pop'), ], 'html-attribute-value': [ (r'[ \t]+', Text), (r'\w+', Name.Variable, '#pop'), (r'@\w+', Name.Variable.Instance, '#pop'), (r'\$\w+', Name.Variable.Global, '#pop'), (r"'(\\\\|\\'|[^'\n])*'", String, '#pop'), (r'"(\\\\|\\"|[^"\n])*"', String, '#pop'), ], 'html-comment-block': [ (_dot + '+', Comment), (r'\n', Text, 'root'), ], 'haml-comment-block': [ (_dot + '+', Comment.Preproc), (r'\n', Text, 'root'), ], 'filter-block': [ (r'([^#\n]|#[^{\n]|(\\\\)*\\#\{)+', Name.Decorator), (r'(#\{)(' + _dot + '*?)(\})', bygroups(String.Interpol, using(RubyLexer), String.Interpol)), (r'\n', Text, 'root'), ], } class ScamlLexer(ExtendedRegexLexer): """ For `Scaml markup <http://scalate.fusesource.org/>`_. Scaml is Haml for Scala. .. versionadded:: 1.4 """ name = 'Scaml' aliases = ['scaml'] filenames = ['*.scaml'] mimetypes = ['text/x-scaml'] flags = re.IGNORECASE # Scaml does not yet support the " |\n" notation to # wrap long lines. Once it does, use the custom faux # dot instead. # _dot = r'(?: \|\n(?=.* \|)|.)' _dot = r'.' tokens = { 'root': [ (r'[ \t]*\n', Text), (r'[ \t]*', _indentation), ], 'css': [ (r'\.[\w:-]+', Name.Class, 'tag'), (r'\#[\w:-]+', Name.Function, 'tag'), ], 'eval-or-plain': [ (r'[&!]?==', Punctuation, 'plain'), (r'([&!]?[=~])(' + _dot + r'*\n)', bygroups(Punctuation, using(ScalaLexer)), 'root'), default('plain'), ], 'content': [ include('css'), (r'%[\w:-]+', Name.Tag, 'tag'), (r'!!!' + _dot + r'*\n', Name.Namespace, '#pop'), (r'(/)(\[' + _dot + '*?\])(' + _dot + r'*\n)', bygroups(Comment, Comment.Special, Comment), '#pop'), (r'/' + _dot + r'*\n', _starts_block(Comment, 'html-comment-block'), '#pop'), (r'-#' + _dot + r'*\n', _starts_block(Comment.Preproc, 'scaml-comment-block'), '#pop'), (r'(-@\s*)(import)?(' + _dot + r'*\n)', bygroups(Punctuation, Keyword, using(ScalaLexer)), '#pop'), (r'(-)(' + _dot + r'*\n)', bygroups(Punctuation, using(ScalaLexer)), '#pop'), (r':' + _dot + r'*\n', _starts_block(Name.Decorator, 'filter-block'), '#pop'), include('eval-or-plain'), ], 'tag': [ include('css'), (r'\{(,\n|' + _dot + ')*?\}', using(ScalaLexer)), (r'\[' + _dot + '*?\]', using(ScalaLexer)), (r'\(', Text, 'html-attributes'), (r'/[ \t]*\n', Punctuation, '#pop:2'), (r'[<>]{1,2}(?=[ \t=])', Punctuation), include('eval-or-plain'), ], 'plain': [ (r'([^#\n]|#[^{\n]|(\\\\)*\\#\{)+', Text), (r'(#\{)(' + _dot + '*?)(\})', bygroups(String.Interpol, using(ScalaLexer), String.Interpol)), (r'\n', Text, 'root'), ], 'html-attributes': [ (r'\s+', Text), (r'[\w:-]+[ \t]*=', Name.Attribute, 'html-attribute-value'), (r'[\w:-]+', Name.Attribute), (r'\)', Text, '#pop'), ], 'html-attribute-value': [ (r'[ \t]+', Text), (r'\w+', Name.Variable, '#pop'), (r'@\w+', Name.Variable.Instance, '#pop'), (r'\$\w+', Name.Variable.Global, '#pop'), (r"'(\\\\|\\'|[^'\n])*'", String, '#pop'), (r'"(\\\\|\\"|[^"\n])*"', String, '#pop'), ], 'html-comment-block': [ (_dot + '+', Comment), (r'\n', Text, 'root'), ], 'scaml-comment-block': [ (_dot + '+', Comment.Preproc), (r'\n', Text, 'root'), ], 'filter-block': [ (r'([^#\n]|#[^{\n]|(\\\\)*\\#\{)+', Name.Decorator), (r'(#\{)(' + _dot + '*?)(\})', bygroups(String.Interpol, using(ScalaLexer), String.Interpol)), (r'\n', Text, 'root'), ], } class JadeLexer(ExtendedRegexLexer): """ For Jade markup. Jade is a variant of Scaml, see: http://scalate.fusesource.org/documentation/scaml-reference.html .. versionadded:: 1.4 """ name = 'Jade' aliases = ['jade'] filenames = ['*.jade'] mimetypes = ['text/x-jade'] flags = re.IGNORECASE _dot = r'.' tokens = { 'root': [ (r'[ \t]*\n', Text), (r'[ \t]*', _indentation), ], 'css': [ (r'\.[\w:-]+', Name.Class, 'tag'), (r'\#[\w:-]+', Name.Function, 'tag'), ], 'eval-or-plain': [ (r'[&!]?==', Punctuation, 'plain'), (r'([&!]?[=~])(' + _dot + r'*\n)', bygroups(Punctuation, using(ScalaLexer)), 'root'), default('plain'), ], 'content': [ include('css'), (r'!!!' + _dot + r'*\n', Name.Namespace, '#pop'), (r'(/)(\[' + _dot + '*?\])(' + _dot + r'*\n)', bygroups(Comment, Comment.Special, Comment), '#pop'), (r'/' + _dot + r'*\n', _starts_block(Comment, 'html-comment-block'), '#pop'), (r'-#' + _dot + r'*\n', _starts_block(Comment.Preproc, 'scaml-comment-block'), '#pop'), (r'(-@\s*)(import)?(' + _dot + r'*\n)', bygroups(Punctuation, Keyword, using(ScalaLexer)), '#pop'), (r'(-)(' + _dot + r'*\n)', bygroups(Punctuation, using(ScalaLexer)), '#pop'), (r':' + _dot + r'*\n', _starts_block(Name.Decorator, 'filter-block'), '#pop'), (r'[\w:-]+', Name.Tag, 'tag'), (r'\|', Text, 'eval-or-plain'), ], 'tag': [ include('css'), (r'\{(,\n|' + _dot + ')*?\}', using(ScalaLexer)), (r'\[' + _dot + '*?\]', using(ScalaLexer)), (r'\(', Text, 'html-attributes'), (r'/[ \t]*\n', Punctuation, '#pop:2'), (r'[<>]{1,2}(?=[ \t=])', Punctuation), include('eval-or-plain'), ], 'plain': [ (r'([^#\n]|#[^{\n]|(\\\\)*\\#\{)+', Text), (r'(#\{)(' + _dot + '*?)(\})', bygroups(String.Interpol, using(ScalaLexer), String.Interpol)), (r'\n', Text, 'root'), ], 'html-attributes': [ (r'\s+', Text), (r'[\w:-]+[ \t]*=', Name.Attribute, 'html-attribute-value'), (r'[\w:-]+', Name.Attribute), (r'\)', Text, '#pop'), ], 'html-attribute-value': [ (r'[ \t]+', Text), (r'\w+', Name.Variable, '#pop'), (r'@\w+', Name.Variable.Instance, '#pop'), (r'\$\w+', Name.Variable.Global, '#pop'), (r"'(\\\\|\\'|[^'\n])*'", String, '#pop'), (r'"(\\\\|\\"|[^"\n])*"', String, '#pop'), ], 'html-comment-block': [ (_dot + '+', Comment), (r'\n', Text, 'root'), ], 'scaml-comment-block': [ (_dot + '+', Comment.Preproc), (r'\n', Text, 'root'), ], 'filter-block': [ (r'([^#\n]|#[^{\n]|(\\\\)*\\#\{)+', Name.Decorator), (r'(#\{)(' + _dot + '*?)(\})', bygroups(String.Interpol, using(ScalaLexer), String.Interpol)), (r'\n', Text, 'root'), ], }
# Copyright 2015: Mirantis Inc. # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. import ddt import mock from rally.common import costilius from rally.task.processing import charts from tests.unit import test CHARTS = "rally.task.processing.charts." class ChartTestCase(test.TestCase): class Chart(charts.Chart): def _map_iteration_values(self, iteration): return [("foo_" + k, iteration[k]) for k in ["a", "b"]] @property def bench_info(self): return {"iterations_count": 42, "atomic": {"a": {}, "b": {}, "c": {}}} def test___init__(self): self.assertRaises(TypeError, charts.Chart, self.bench_info) chart = self.Chart(self.bench_info) self.assertEqual({}, chart._data) self.assertEqual(42, chart.base_size) self.assertEqual(1000, chart.zipped_size) chart = self.Chart(self.bench_info, zipped_size=24) self.assertEqual({}, chart._data) self.assertEqual(42, chart.base_size) self.assertEqual(24, chart.zipped_size) @mock.patch(CHARTS + "utils.GraphZipper") def test_add_iteration_and_render(self, mock_graph_zipper): gzipper_a = mock.Mock(get_zipped_graph=lambda: "a_points") gzipper_b = mock.Mock(get_zipped_graph=lambda: "b_points") mock_graph_zipper.side_effect = [gzipper_a, gzipper_b] chart = self.Chart(self.bench_info, 24) self.assertEqual([], chart.render()) [chart.add_iteration(itr) for itr in [{"a": 1, "b": 2}, {"a": 3, "b": 4}]] self.assertEqual([mock.call(42, 24), mock.call(42, 24)], mock_graph_zipper.mock_calls) self.assertEqual(2, len(chart._data)) self.assertEqual([mock.call(1), mock.call(3)], chart._data["foo_a"].add_point.mock_calls) self.assertEqual([mock.call(2), mock.call(4)], chart._data["foo_b"].add_point.mock_calls) self.assertEqual([("foo_a", "a_points"), ("foo_b", "b_points")], chart.render()) def test__fix_atomic_actions(self): chart = self.Chart(self.bench_info) self.assertEqual( {"atomic_actions": {"a": 5, "b": 6, "c": 0}}, chart._fix_atomic_actions({"atomic_actions": {"a": 5, "b": 6}})) class MainStackedAreaChartTestCase(test.TestCase): def test_add_iteration_and_render(self): chart = charts.MainStackedAreaChart({"iterations_count": 3}, 10) self.assertIsInstance(chart, charts.Chart) [chart.add_iteration(itr) for itr in ( {"duration": 1.1, "idle_duration": 2.2, "error": None}, {"error": True, "duration": 1.1, "idle_duration": 0.5}, {"duration": 1.3, "idle_duration": 3.4, "error": None})] expected = [("duration", [[1, 1.1], [2, 0], [3, 1.3]]), ("idle_duration", [[1, 2.2], [2, 0], [3, 3.4]]), ("failed_duration", [[1, 0], [2, 1.6], [3, 0]])] self.assertEqual(expected, chart.render()) class AtomicStackedAreaChartTestCase(test.TestCase): def test_add_iteration_and_render(self): iterations = ( {"atomic_actions": {"foo": 1.1}, "error": False}, {"atomic_actions": {"foo": 1.1, "bar": 1.2}, "error": True, "duration": 40, "idle_duration": 2}, {"atomic_actions": {"bar": 1.2}, "error": True, "duration": 5.5, "idle_duration": 2.5}) expected = [("bar", [[1, 0], [2, 1.2], [3, 1.2]]), ("failed_duration", [[1, 0], [2, 39.7], [3, 6.8]]), ("foo", [[1, 1.1], [2, 1.1], [3, 0]])] chart = charts.AtomicStackedAreaChart( {"iterations_count": 3, "atomic": {"foo": {}, "bar": {}}}, 10) self.assertIsInstance(chart, charts.Chart) [chart.add_iteration(iteration) for iteration in iterations] self.assertEqual(expected, sorted(chart.render())) class OutputStackedAreaChartTestCase(test.TestCase): def test_add_iteration_and_render(self): chart = charts.OutputStackedAreaChart( {"iterations_count": 3, "output_names": ["foo", "bar"]}, 10) self.assertIsInstance(chart, charts.Chart) [chart.add_iteration({"scenario_output": {"data": x}}) for x in ({"foo": 1.1, "bar": 1.2}, {"foo": 1.3}, {"bar": 1.4})] expected = [("bar", [[1, 1.2], [2, 0], [3, 1.4]]), ("foo", [[1, 1.1], [2, 1.3], [3, 0]])] self.assertEqual(expected, sorted(chart.render())) class AvgChartTestCase(test.TestCase): class AvgChart(charts.AvgChart): def _map_iteration_values(self, iteration): return iteration["foo"].items() def test_add_iteration_and_render(self): self.assertRaises(TypeError, charts.AvgChart, {"iterations_count": 3}) chart = self.AvgChart({"iterations_count": 3}) self.assertIsInstance(chart, charts.AvgChart) [chart.add_iteration({"foo": x}) for x in ({"a": 1.3, "b": 4.3}, {"a": 2.4, "b": 5.4}, {"a": 3.5, "b": 7.7})] self.assertEqual([("a", 2.4), ("b", 5.8)], sorted(chart.render())) class AtomicAvgChartTestCase(test.TestCase): def test_add_iteration_and_render(self): chart = charts.AtomicAvgChart({"iterations_count": 3, "atomic": {"foo": {}, "bar": {}}}) self.assertIsInstance(chart, charts.AvgChart) [chart.add_iteration({"atomic_actions": costilius.OrderedDict(a)}) for a in ([("foo", 2), ("bar", 5)], [("foo", 4)], [("bar", 7)])] self.assertEqual([("bar", 4.0), ("foo", 2.0)], sorted(chart.render())) @ddt.ddt class HistogramChartTestCase(test.TestCase): class HistogramChart(charts.HistogramChart): def __init__(self, benchmark_info): super(HistogramChartTestCase.HistogramChart, self).__init__(benchmark_info) self._data["bar"] = {"views": self._init_views(1.2, 4.2), "disabled": None} def _map_iteration_values(self, iteration): return iteration["foo"].items() def test_add_iteration_and_render(self): self.assertRaises(TypeError, charts.HistogramChart, {"iterations_count": 3}) chart = self.HistogramChart({"iterations_count": 3}) self.assertIsInstance(chart, charts.HistogramChart) [chart.add_iteration({"foo": x}) for x in ({"bar": 1.2}, {"bar": 2.4}, {"bar": 4.2})] expected = [[{"disabled": None, "key": "bar", "values": [{"x": 2.7, "y": 2}, {"x": 4.2, "y": 1}], "view": "Square Root Choice"}, {"disabled": None, "key": "bar", "values": [{"x": 2.2, "y": 1}, {"x": 3.2, "y": 1}, {"x": 4.2, "y": 1}], "view": "Sturges Formula"}, {"disabled": None, "key": "bar", "values": [{"x": 2.2, "y": 1}, {"x": 3.2, "y": 1}, {"x": 4.2, "y": 1}], "view": "Rice Rule"}, {"disabled": None, "key": "bar", "values": [{"x": 2.7, "y": 2}, {"x": 4.2, "y": 1}], "view": "One Half"}]] self.assertEqual(expected, chart.render()) @ddt.data( {"base_size": 2, "min_value": 1, "max_value": 4, "expected": [{"bins": 2, "view": "Square Root Choice", "x": [2.5, 4.0], "y": [0, 0]}, {"bins": 2, "view": "Sturges Formula", "x": [2.5, 4.0], "y": [0, 0]}, {"bins": 3, "view": "Rice Rule", "x": [2.0, 3.0, 4.0], "y": [0, 0, 0]}, {"bins": 1, "view": "One Half", "x": [4.0], "y": [0]}]}, {"base_size": 100, "min_value": 27, "max_value": 42, "expected": [ {"bins": 10, "view": "Square Root Choice", "x": [28.5, 30.0, 31.5, 33.0, 34.5, 36.0, 37.5, 39.0, 40.5, 42.0], "y": [0, 0, 0, 0, 0, 0, 0, 0, 0, 0]}, {"bins": 8, "view": "Sturges Formula", "x": [28.875, 30.75, 32.625, 34.5, 36.375, 38.25, 40.125, 42.0], "y": [0, 0, 0, 0, 0, 0, 0, 0]}, {"bins": 10, "view": "Rice Rule", "x": [28.5, 30.0, 31.5, 33.0, 34.5, 36.0, 37.5, 39.0, 40.5, 42.0], "y": [0, 0, 0, 0, 0, 0, 0, 0, 0, 0]}, {"bins": 50, "view": "One Half", "x": [27.3, 27.6, 27.9, 28.2, 28.5, 28.8, 29.1, 29.4, 29.7, 30.0, 30.3, 30.6, 30.9, 31.2, 31.5, 31.8, 32.1, 32.4, 32.7, 33.0, 33.3, 33.6, 33.9, 34.2, 34.5, 34.8, 35.1, 35.4, 35.7, 36.0, 36.3, 36.6, 36.9, 37.2, 37.5, 37.8, 38.1, 38.4, 38.7, 39.0, 39.3, 39.6, 39.9, 40.2, 40.5, 40.8, 41.1, 41.4, 41.7, 42.0], "y": [0] * 50}]}) @ddt.unpack def test_views(self, base_size=None, min_value=None, max_value=None, expected=None): chart = self.HistogramChart({"iterations_count": base_size}) self.assertEqual(expected, chart._init_views(min_value, max_value)) class MainHistogramChartTestCase(test.TestCase): def test_add_iteration_and_render(self): chart = charts.MainHistogramChart( {"iterations_count": 3, "min_duration": 2, "max_duration": 7}) self.assertIsInstance(chart, charts.HistogramChart) [chart.add_iteration(itr) for itr in ( {"duration": 1.1, "idle_duration": 2.2, "error": None}, {"error": True}, {"duration": 1.3, "idle_duration": 3.4, "error": None})] expected = [ {"disabled": None, "key": "task", "view": "Square Root Choice", "values": [{"x": 4.5, "y": 3}, {"x": 7.0, "y": 0}]}, {"disabled": None, "key": "task", "view": "Sturges Formula", "values": [{"x": 3.666666666666667, "y": 3}, {"x": 5.333333333333334, "y": 0}, {"x": 7.0, "y": 0}]}, {"disabled": None, "key": "task", "view": "Rice Rule", "values": [{"x": 3.666666666666667, "y": 3}, {"x": 5.333333333333334, "y": 0}, {"x": 7.0, "y": 0}]}, {"disabled": None, "key": "task", "view": "One Half", "values": [{"x": 4.5, "y": 3}, {"x": 7.0, "y": 0}]}] self.assertEqual([expected], chart.render()) class AtomicHistogramChartTestCase(test.TestCase): def test_add_iteration_and_render(self): chart = charts.AtomicHistogramChart( {"iterations_count": 3, "atomic": costilius.OrderedDict( [("foo", {"min_duration": 1.6, "max_duration": 2.8}), ("bar", {"min_duration": 3.1, "max_duration": 5.5})])}) self.assertIsInstance(chart, charts.HistogramChart) [chart.add_iteration({"atomic_actions": a}) for a in ({"foo": 1.6, "bar": 3.1}, {"foo": 2.8}, {"bar": 5.5})] expected = [ [{"disabled": 0, "key": "foo", "view": "Square Root Choice", "values": [{"x": 2.2, "y": 2}, {"x": 2.8, "y": 1}]}, {"disabled": 0, "key": "foo", "view": "Sturges Formula", "values": [{"x": 2.0, "y": 2}, {"x": 2.4, "y": 0}, {"x": 2.8, "y": 1}]}, {"disabled": 0, "key": "foo", "view": "Rice Rule", "values": [{"x": 2.0, "y": 2}, {"x": 2.4, "y": 0}, {"x": 2.8, "y": 1}]}, {"disabled": 0, "key": "foo", "view": "One Half", "values": [{"x": 2.2, "y": 2}, {"x": 2.8, "y": 1}]}], [{"disabled": 1, "key": "bar", "view": "Square Root Choice", "values": [{"x": 4.3, "y": 2}, {"x": 5.5, "y": 1}]}, {"disabled": 1, "key": "bar", "view": "Sturges Formula", "values": [{"x": 3.9, "y": 2}, {"x": 4.7, "y": 0}, {"x": 5.5, "y": 1}]}, {"disabled": 1, "key": "bar", "view": "Rice Rule", "values": [{"x": 3.9, "y": 2}, {"x": 4.7, "y": 0}, {"x": 5.5, "y": 1}]}, {"disabled": 1, "key": "bar", "view": "One Half", "values": [{"x": 4.3, "y": 2}, {"x": 5.5, "y": 1}]}]] self.assertEqual(expected, chart.render()) class TableTestCase(test.TestCase): class Table(charts.Table): columns = ["name", "foo", "bar"] foo = mock.Mock() bar = mock.Mock() def _init_columns(self): return costilius.OrderedDict( [("foo", self.foo), ("bar", self.bar)]) def _map_iteration_values(self, iteration): return [("value_" + k, iteration[k]) for k in ["a", "b"]] def render(self): return self._data def setUp(self, *args, **kwargs): super(TableTestCase, self).setUp(*args, **kwargs) self.bench_info = {"iterations_count": 42, "atomic": {"a": {}, "b": {}, "c": {}}} def test_add_iteration_and_render(self): self.assertRaises(TypeError, charts.Table, self.bench_info) table = self.Table(self.bench_info) self.assertEqual(costilius.OrderedDict(), table.render()) [table.add_iteration({"a": i, "b": 43 - i}) for i in range(1, 43)] self.assertEqual( costilius.OrderedDict( [("value_a", costilius.OrderedDict([("foo", table.foo), ("bar", table.bar)])), ("value_b", costilius.OrderedDict([("foo", table.foo), ("bar", table.bar)]))]), table.render()) class MainStatsTableTestCase(test.TestCase): def setUp(self, *args, **kwargs): super(MainStatsTableTestCase, self).setUp(*args, **kwargs) self.bench_info = {"iterations_count": 42, "atomic": {"a": {}, "b": {}, "c": {}}} self.columns = [ "Action", "Min (sec)", "Median (sec)", "90%ile (sec)", "95%ile (sec)", "Max (sec)", "Avg (sec)", "Success", "Count"] def test_add_iteration_and_render(self): table = charts.MainStatsTable({"iterations_count": 42, "atomic": {"foo": {}, "bar": {}}}) [table.add_iteration( {"atomic_actions": costilius.OrderedDict([("foo", i), ("bar", 43 - 1)]), "duration": i, "error": i % 40}) for i in range(1, 43)] expected_rows = [ ["foo", 1.0, 21.5, 38.5, 40.5, 42.0, 21.5, "100.0%", 42.0], ["bar", 42.0, 42.0, 42.0, 42.0, 42.0, 42.0, "100.0%", 42.0], ["total", 0.0, 0.0, 0.0, 0.0, 40.0, 0.952, "100.0%", 42.0]] self.assertEqual({"cols": self.columns, "rows": expected_rows}, table.render())
""" Core OpenBCI object for handling connections and samples from the board. EXAMPLE USE: def handle_sample(sample): print(sample.channel_data) board = OpenBCIBoard() board.print_register_settings() board.start_streaming(handle_sample) NOTE: If daisy modules is enabled, the callback will occur every two samples, hence "packet_id" will only contain even numbers. As a side effect, the sampling rate will be divided by 2. FIXME: at the moment we can just force daisy mode, do not check that the module is detected. TODO: enable impedance """ import serial import struct import numpy as np import time import timeit import atexit import logging import threading import sys import pdb import glob SAMPLE_RATE = 250.0 # Hz START_BYTE = 0xA0 # start of data packet END_BYTE = 0xC0 # end of data packet ADS1299_Vref = 4.5 #reference voltage for ADC in ADS1299. set by its hardware ADS1299_gain = 24.0 #assumed gain setting for ADS1299. set by its Arduino code scale_fac_uVolts_per_count = ADS1299_Vref/float((pow(2,23)-1))/ADS1299_gain*1000000. scale_fac_accel_G_per_count = 0.002 /(pow(2,4)) #assume set to +/4G, so 2 mG ''' #Commands for in SDK http://docs.openbci.com/software/01-Open BCI_SDK: command_stop = "s"; command_startText = "x"; command_startBinary = "b"; command_startBinary_wAux = "n"; command_startBinary_4chan = "v"; command_activateFilters = "F"; command_deactivateFilters = "g"; command_deactivate_channel = {"1", "2", "3", "4", "5", "6", "7", "8"}; command_activate_channel = {"q", "w", "e", "r", "t", "y", "u", "i"}; command_activate_leadoffP_channel = {"!", "@", "#", "$", "%", "^", "&", "*"}; //shift + 1-8 command_deactivate_leadoffP_channel = {"Q", "W", "E", "R", "T", "Y", "U", "I"}; //letters (plus shift) right below 1-8 command_activate_leadoffN_channel = {"A", "S", "D", "F", "G", "H", "J", "K"}; //letters (plus shift) below the letters below 1-8 command_deactivate_leadoffN_channel = {"Z", "X", "C", "V", "B", "N", "M", "<"}; //letters (plus shift) below the letters below the letters below 1-8 command_biasAuto = "`"; command_biasFixed = "~"; ''' class OpenBCIBoard(object): """ Handle a connection to an OpenBCI board. Args: port: The port to connect to. baud: The baud of the serial connection. daisy: Enable or disable daisy module and 16 chans readings aux, impedance: unused, for compatibility with ganglion API """ def __init__(self, port=None, baud=115200, filter_data=True, scaled_output=True, daisy=False, aux=False, impedance=False, log=True, timeout=None): self.log = log # print_incoming_text needs log self.streaming = False self.baudrate = baud self.timeout = timeout if not port: port = self.find_port() self.port = port # might be handy to know API self.board_type = "cyton" print("Connecting to V3 at port %s" %(port)) self.ser = serial.Serial(port= port, baudrate = baud, timeout=timeout) print("Serial established...") time.sleep(2) #Initialize 32-bit board, doesn't affect 8bit board self.ser.write(b'v'); #wait for device to be ready time.sleep(1) self.print_incoming_text() self.streaming = False self.filtering_data = filter_data self.scaling_output = scaled_output self.eeg_channels_per_sample = 8 # number of EEG channels per sample *from the board* self.aux_channels_per_sample = 3 # number of AUX channels per sample *from the board* self.imp_channels_per_sample = 0 # impedance check not supported at the moment self.read_state = 0 self.daisy = daisy self.last_odd_sample = OpenBCISample(-1, [], []) # used for daisy self.log_packet_count = 0 self.attempt_reconnect = False self.last_reconnect = 0 self.reconnect_freq = 5 self.packets_dropped = 0 #Disconnects from board when terminated atexit.register(self.disconnect) def getBoardType(self): """ Returns the version of the board """ return self.board_type def setImpedance(self, flag): """ Enable/disable impedance measure. Not implemented at the moment on Cyton. """ return def ser_write(self, b): """Access serial port object for write""" self.ser.write(b) def ser_read(self): """Access serial port object for read""" return self.ser.read() def ser_inWaiting(self): """Access serial port object for inWaiting""" return self.ser.inWaiting(); def getSampleRate(self): if self.daisy: return SAMPLE_RATE/2 else: return SAMPLE_RATE def getNbEEGChannels(self): if self.daisy: return self.eeg_channels_per_sample*2 else: return self.eeg_channels_per_sample def getNbAUXChannels(self): return self.aux_channels_per_sample def getNbImpChannels(self): return self.imp_channels_per_sample def start_streaming(self, callback, lapse=-1): """ Start handling streaming data from the board. Call a provided callback for every single sample that is processed (every two samples with daisy module). Args: callback: A callback function -- or a list of functions -- that will receive a single argument of the OpenBCISample object captured. """ if not self.streaming: self.ser.write(b'b') self.streaming = True start_time = timeit.default_timer() # Enclose callback funtion in a list if it comes alone if not isinstance(callback, list): callback = [callback] #Initialize check connection self.check_connection() while self.streaming: # read current sample sample = self._read_serial_binary() # if a daisy module is attached, wait to concatenate two samples (main board + daisy) before passing it to callback if self.daisy: # odd sample: daisy sample, save for later if ~sample.id % 2: self.last_odd_sample = sample # even sample: concatenate and send if last sample was the fist part, otherwise drop the packet elif sample.id - 1 == self.last_odd_sample.id: # the aux data will be the average between the two samples, as the channel samples themselves have been averaged by the board avg_aux_data = list((np.array(sample.aux_data) + np.array(self.last_odd_sample.aux_data))/2) whole_sample = OpenBCISample(sample.id, sample.channel_data + self.last_odd_sample.channel_data, avg_aux_data) for call in callback: call(whole_sample) else: for call in callback: call(sample) if(lapse > 0 and timeit.default_timer() - start_time > lapse): self.stop(); if self.log: self.log_packet_count = self.log_packet_count + 1; """ PARSER: Parses incoming data packet into OpenBCISample. Incoming Packet Structure: Start Byte(1)|Sample ID(1)|Channel Data(24)|Aux Data(6)|End Byte(1) 0xA0|0-255|8, 3-byte signed ints|3 2-byte signed ints|0xC0 """ def _read_serial_binary(self, max_bytes_to_skip=3000): def read(n): bb = self.ser.read(n) if not bb: self.warn('Device appears to be stalled. Quitting...') sys.exit() raise Exception('Device Stalled') sys.exit() return '\xFF' else: return bb for rep in range(max_bytes_to_skip): #---------Start Byte & ID--------- if self.read_state == 0: b = read(1) if struct.unpack('B', b)[0] == START_BYTE: if(rep != 0): self.warn('Skipped %d bytes before start found' %(rep)) rep = 0; packet_id = struct.unpack('B', read(1))[0] #packet id goes from 0-255 log_bytes_in = str(packet_id); self.read_state = 1 #---------Channel Data--------- elif self.read_state == 1: channel_data = [] for c in range(self.eeg_channels_per_sample): #3 byte ints literal_read = read(3) unpacked = struct.unpack('3B', literal_read) log_bytes_in = log_bytes_in + '|' + str(literal_read); #3byte int in 2s compliment if (unpacked[0] >= 127): pre_fix = bytes(bytearray.fromhex('FF')) else: pre_fix = bytes(bytearray.fromhex('00')) literal_read = pre_fix + literal_read; #unpack little endian(>) signed integer(i) (makes unpacking platform independent) myInt = struct.unpack('>i', literal_read)[0] if self.scaling_output: channel_data.append(myInt*scale_fac_uVolts_per_count) else: channel_data.append(myInt) self.read_state = 2; #---------Accelerometer Data--------- elif self.read_state == 2: aux_data = [] for a in range(self.aux_channels_per_sample): #short = h acc = struct.unpack('>h', read(2))[0] log_bytes_in = log_bytes_in + '|' + str(acc); if self.scaling_output: aux_data.append(acc*scale_fac_accel_G_per_count) else: aux_data.append(acc) self.read_state = 3; #---------End Byte--------- elif self.read_state == 3: val = struct.unpack('B', read(1))[0] log_bytes_in = log_bytes_in + '|' + str(val); self.read_state = 0 #read next packet if (val == END_BYTE): sample = OpenBCISample(packet_id, channel_data, aux_data) self.packets_dropped = 0 return sample else: self.warn("ID:<%d> <Unexpected END_BYTE found <%s> instead of <%s>" %(packet_id, val, END_BYTE)) logging.debug(log_bytes_in); self.packets_dropped = self.packets_dropped + 1 """ Clean Up (atexit) """ def stop(self): print("Stopping streaming...\nWait for buffer to flush...") self.streaming = False self.ser.write(b's') if self.log: logging.warning('sent <s>: stopped streaming') def disconnect(self): if(self.streaming == True): self.stop() if (self.ser.isOpen()): print("Closing Serial...") self.ser.close() logging.warning('serial closed') """ SETTINGS AND HELPERS """ def warn(self, text): if self.log: #log how many packets where sent succesfully in between warnings if self.log_packet_count: logging.info('Data packets received:'+str(self.log_packet_count)) self.log_packet_count = 0; logging.warning(text) print("Warning: %s" % text) def print_incoming_text(self): """ When starting the connection, print all the debug data until we get to a line with the end sequence '$$$'. """ line = '' #Wait for device to send data time.sleep(1) if self.ser.inWaiting(): line = '' c = '' #Look for end sequence $$$ while '$$$' not in line: c = self.ser.read().decode('utf-8', errors='replace') # we're supposed to get UTF8 text, but the board might behave otherwise line += c print(line); else: self.warn("No Message") def openbci_id(self, serial): """ When automatically detecting port, parse the serial return for the "OpenBCI" ID. """ line = '' #Wait for device to send data time.sleep(2) if serial.inWaiting(): line = '' c = '' #Look for end sequence $$$ while '$$$' not in line: c = serial.read().decode('utf-8', errors='replace') # we're supposed to get UTF8 text, but the board might behave otherwise line += c if "OpenBCI" in line: return True return False def print_register_settings(self): self.ser.write(b'?') time.sleep(0.5) self.print_incoming_text(); #DEBBUGING: Prints individual incoming bytes def print_bytes_in(self): if not self.streaming: self.ser.write(b'b') self.streaming = True while self.streaming: print(struct.unpack('B',self.ser.read())[0]); '''Incoming Packet Structure: Start Byte(1)|Sample ID(1)|Channel Data(24)|Aux Data(6)|End Byte(1) 0xA0|0-255|8, 3-byte signed ints|3 2-byte signed ints|0xC0''' def print_packets_in(self): while self.streaming: b = struct.unpack('B', self.ser.read())[0]; if b == START_BYTE: self.attempt_reconnect = False if skipped_str: logging.debug('SKIPPED\n' + skipped_str + '\nSKIPPED') skipped_str = '' packet_str = "%03d"%(b) + '|'; b = struct.unpack('B', self.ser.read())[0]; packet_str = packet_str + "%03d"%(b) + '|'; #data channels for i in range(24-1): b = struct.unpack('B', self.ser.read())[0]; packet_str = packet_str + '.' + "%03d"%(b); b = struct.unpack('B', self.ser.read())[0]; packet_str = packet_str + '.' + "%03d"%(b) + '|'; #aux channels for i in range(6-1): b = struct.unpack('B', self.ser.read())[0]; packet_str = packet_str + '.' + "%03d"%(b); b = struct.unpack('B', self.ser.read())[0]; packet_str = packet_str + '.' + "%03d"%(b) + '|'; #end byte b = struct.unpack('B', self.ser.read())[0]; #Valid Packet if b == END_BYTE: packet_str = packet_str + '.' + "%03d"%(b) + '|VAL'; print(packet_str) #logging.debug(packet_str) #Invalid Packet else: packet_str = packet_str + '.' + "%03d"%(b) + '|INV'; #Reset self.attempt_reconnect = True else: print(b) if b == END_BYTE: skipped_str = skipped_str + '|END|' else: skipped_str = skipped_str + "%03d"%(b) + '.' if self.attempt_reconnect and (timeit.default_timer()-self.last_reconnect) > self.reconnect_freq: self.last_reconnect = timeit.default_timer() self.warn('Reconnecting') self.reconnect() def check_connection(self, interval = 2, max_packets_to_skip=10): # stop checking when we're no longer streaming if not self.streaming: return #check number of dropped packages and establish connection problem if too large if self.packets_dropped > max_packets_to_skip: #if error, attempt to reconect self.reconnect() # check again again in 2 seconds threading.Timer(interval, self.check_connection).start() def reconnect(self): self.packets_dropped = 0 self.warn('Reconnecting') self.stop() time.sleep(0.5) self.ser.write(b'v') time.sleep(0.5) self.ser.write(b'b') time.sleep(0.5) self.streaming = True #self.attempt_reconnect = False #Adds a filter at 60hz to cancel out ambient electrical noise def enable_filters(self): self.ser.write(b'f') self.filtering_data = True; def disable_filters(self): self.ser.write(b'g') self.filtering_data = False; def test_signal(self, signal): """ Enable / disable test signal """ if signal == 0: self.ser.write(b'0') self.warn("Connecting all pins to ground") elif signal == 1: self.ser.write(b'p') self.warn("Connecting all pins to Vcc") elif signal == 2: self.ser.write(b'-') self.warn("Connecting pins to low frequency 1x amp signal") elif signal == 3: self.ser.write(b'=') self.warn("Connecting pins to high frequency 1x amp signal") elif signal == 4: self.ser.write(b'[') self.warn("Connecting pins to low frequency 2x amp signal") elif signal == 5: self.ser.write(b']') self.warn("Connecting pins to high frequency 2x amp signal") else: self.warn("%s is not a known test signal. Valid signals go from 0-5" %(signal)) def set_channel(self, channel, toggle_position): """ Enable / disable channels """ #Commands to set toggle to on position if toggle_position == 1: if channel is 1: self.ser.write(b'!') if channel is 2: self.ser.write(b'@') if channel is 3: self.ser.write(b'#') if channel is 4: self.ser.write(b'$') if channel is 5: self.ser.write(b'%') if channel is 6: self.ser.write(b'^') if channel is 7: self.ser.write(b'&') if channel is 8: self.ser.write(b'*') if channel is 9 and self.daisy: self.ser.write(b'Q') if channel is 10 and self.daisy: self.ser.write(b'W') if channel is 11 and self.daisy: self.ser.write(b'E') if channel is 12 and self.daisy: self.ser.write(b'R') if channel is 13 and self.daisy: self.ser.write(b'T') if channel is 14 and self.daisy: self.ser.write(b'Y') if channel is 15 and self.daisy: self.ser.write(b'U') if channel is 16 and self.daisy: self.ser.write(b'I') #Commands to set toggle to off position elif toggle_position == 0: if channel is 1: self.ser.write(b'1') if channel is 2: self.ser.write(b'2') if channel is 3: self.ser.write(b'3') if channel is 4: self.ser.write(b'4') if channel is 5: self.ser.write(b'5') if channel is 6: self.ser.write(b'6') if channel is 7: self.ser.write(b'7') if channel is 8: self.ser.write(b'8') if channel is 9 and self.daisy: self.ser.write(b'q') if channel is 10 and self.daisy: self.ser.write(b'w') if channel is 11 and self.daisy: self.ser.write(b'e') if channel is 12 and self.daisy: self.ser.write(b'r') if channel is 13 and self.daisy: self.ser.write(b't') if channel is 14 and self.daisy: self.ser.write(b'y') if channel is 15 and self.daisy: self.ser.write(b'u') if channel is 16 and self.daisy: self.ser.write(b'i') def find_port(self): # Finds the serial port names if sys.platform.startswith('win'): ports = ['COM%s' % (i+1) for i in range(256)] elif sys.platform.startswith('linux') or sys.platform.startswith('cygwin'): ports = glob.glob('/dev/ttyUSB*') elif sys.platform.startswith('darwin'): ports = glob.glob('/dev/tty.usbserial*') else: raise EnvironmentError('Error finding ports on your operating system') openbci_port = '' for port in ports: try: s = serial.Serial(port= port, baudrate = self.baudrate, timeout=self.timeout) s.write(b'v') openbci_serial = self.openbci_id(s) s.close() if openbci_serial: openbci_port = port; except (OSError, serial.SerialException): pass if openbci_port == '': raise OSError('Cannot find OpenBCI port') else: return openbci_port class OpenBCISample(object): """Object encapulsating a single sample from the OpenBCI board. NB: dummy imp for plugin compatiblity""" def __init__(self, packet_id, channel_data, aux_data): self.id = packet_id self.channel_data = channel_data self.aux_data = aux_data self.imp_data = []
# -*- coding: utf-8 -*- # Copyright 2022 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # from collections import OrderedDict import os import re from typing import Dict, Optional, Sequence, Tuple, Type, Union import pkg_resources from google.api_core import client_options as client_options_lib from google.api_core import exceptions as core_exceptions from google.api_core import gapic_v1 from google.api_core import retry as retries from google.auth import credentials as ga_credentials # type: ignore from google.auth.transport import mtls # type: ignore from google.auth.transport.grpc import SslCredentials # type: ignore from google.auth.exceptions import MutualTLSChannelError # type: ignore from google.oauth2 import service_account # type: ignore try: OptionalRetry = Union[retries.Retry, gapic_v1.method._MethodDefault] except AttributeError: # pragma: NO COVER OptionalRetry = Union[retries.Retry, object] # type: ignore from google.cloud.compute_v1.services.licenses import pagers from google.cloud.compute_v1.types import compute from .transports.base import LicensesTransport, DEFAULT_CLIENT_INFO from .transports.rest import LicensesRestTransport class LicensesClientMeta(type): """Metaclass for the Licenses client. This provides class-level methods for building and retrieving support objects (e.g. transport) without polluting the client instance objects. """ _transport_registry = OrderedDict() # type: Dict[str, Type[LicensesTransport]] _transport_registry["rest"] = LicensesRestTransport def get_transport_class(cls, label: str = None,) -> Type[LicensesTransport]: """Returns an appropriate transport class. Args: label: The name of the desired transport. If none is provided, then the first transport in the registry is used. Returns: The transport class to use. """ # If a specific transport is requested, return that one. if label: return cls._transport_registry[label] # No transport is requested; return the default (that is, the first one # in the dictionary). return next(iter(cls._transport_registry.values())) class LicensesClient(metaclass=LicensesClientMeta): """The Licenses API.""" @staticmethod def _get_default_mtls_endpoint(api_endpoint): """Converts api endpoint to mTLS endpoint. Convert "*.sandbox.googleapis.com" and "*.googleapis.com" to "*.mtls.sandbox.googleapis.com" and "*.mtls.googleapis.com" respectively. Args: api_endpoint (Optional[str]): the api endpoint to convert. Returns: str: converted mTLS api endpoint. """ if not api_endpoint: return api_endpoint mtls_endpoint_re = re.compile( r"(?P<name>[^.]+)(?P<mtls>\.mtls)?(?P<sandbox>\.sandbox)?(?P<googledomain>\.googleapis\.com)?" ) m = mtls_endpoint_re.match(api_endpoint) name, mtls, sandbox, googledomain = m.groups() if mtls or not googledomain: return api_endpoint if sandbox: return api_endpoint.replace( "sandbox.googleapis.com", "mtls.sandbox.googleapis.com" ) return api_endpoint.replace(".googleapis.com", ".mtls.googleapis.com") DEFAULT_ENDPOINT = "compute.googleapis.com" DEFAULT_MTLS_ENDPOINT = _get_default_mtls_endpoint.__func__( # type: ignore DEFAULT_ENDPOINT ) @classmethod def from_service_account_info(cls, info: dict, *args, **kwargs): """Creates an instance of this client using the provided credentials info. Args: info (dict): The service account private key info. args: Additional arguments to pass to the constructor. kwargs: Additional arguments to pass to the constructor. Returns: LicensesClient: The constructed client. """ credentials = service_account.Credentials.from_service_account_info(info) kwargs["credentials"] = credentials return cls(*args, **kwargs) @classmethod def from_service_account_file(cls, filename: str, *args, **kwargs): """Creates an instance of this client using the provided credentials file. Args: filename (str): The path to the service account private key json file. args: Additional arguments to pass to the constructor. kwargs: Additional arguments to pass to the constructor. Returns: LicensesClient: The constructed client. """ credentials = service_account.Credentials.from_service_account_file(filename) kwargs["credentials"] = credentials return cls(*args, **kwargs) from_service_account_json = from_service_account_file @property def transport(self) -> LicensesTransport: """Returns the transport used by the client instance. Returns: LicensesTransport: The transport used by the client instance. """ return self._transport @staticmethod def common_billing_account_path(billing_account: str,) -> str: """Returns a fully-qualified billing_account string.""" return "billingAccounts/{billing_account}".format( billing_account=billing_account, ) @staticmethod def parse_common_billing_account_path(path: str) -> Dict[str, str]: """Parse a billing_account path into its component segments.""" m = re.match(r"^billingAccounts/(?P<billing_account>.+?)$", path) return m.groupdict() if m else {} @staticmethod def common_folder_path(folder: str,) -> str: """Returns a fully-qualified folder string.""" return "folders/{folder}".format(folder=folder,) @staticmethod def parse_common_folder_path(path: str) -> Dict[str, str]: """Parse a folder path into its component segments.""" m = re.match(r"^folders/(?P<folder>.+?)$", path) return m.groupdict() if m else {} @staticmethod def common_organization_path(organization: str,) -> str: """Returns a fully-qualified organization string.""" return "organizations/{organization}".format(organization=organization,) @staticmethod def parse_common_organization_path(path: str) -> Dict[str, str]: """Parse a organization path into its component segments.""" m = re.match(r"^organizations/(?P<organization>.+?)$", path) return m.groupdict() if m else {} @staticmethod def common_project_path(project: str,) -> str: """Returns a fully-qualified project string.""" return "projects/{project}".format(project=project,) @staticmethod def parse_common_project_path(path: str) -> Dict[str, str]: """Parse a project path into its component segments.""" m = re.match(r"^projects/(?P<project>.+?)$", path) return m.groupdict() if m else {} @staticmethod def common_location_path(project: str, location: str,) -> str: """Returns a fully-qualified location string.""" return "projects/{project}/locations/{location}".format( project=project, location=location, ) @staticmethod def parse_common_location_path(path: str) -> Dict[str, str]: """Parse a location path into its component segments.""" m = re.match(r"^projects/(?P<project>.+?)/locations/(?P<location>.+?)$", path) return m.groupdict() if m else {} @classmethod def get_mtls_endpoint_and_cert_source( cls, client_options: Optional[client_options_lib.ClientOptions] = None ): """Return the API endpoint and client cert source for mutual TLS. The client cert source is determined in the following order: (1) if `GOOGLE_API_USE_CLIENT_CERTIFICATE` environment variable is not "true", the client cert source is None. (2) if `client_options.client_cert_source` is provided, use the provided one; if the default client cert source exists, use the default one; otherwise the client cert source is None. The API endpoint is determined in the following order: (1) if `client_options.api_endpoint` if provided, use the provided one. (2) if `GOOGLE_API_USE_CLIENT_CERTIFICATE` environment variable is "always", use the default mTLS endpoint; if the environment variabel is "never", use the default API endpoint; otherwise if client cert source exists, use the default mTLS endpoint, otherwise use the default API endpoint. More details can be found at https://google.aip.dev/auth/4114. Args: client_options (google.api_core.client_options.ClientOptions): Custom options for the client. Only the `api_endpoint` and `client_cert_source` properties may be used in this method. Returns: Tuple[str, Callable[[], Tuple[bytes, bytes]]]: returns the API endpoint and the client cert source to use. Raises: google.auth.exceptions.MutualTLSChannelError: If any errors happen. """ if client_options is None: client_options = client_options_lib.ClientOptions() use_client_cert = os.getenv("GOOGLE_API_USE_CLIENT_CERTIFICATE", "false") use_mtls_endpoint = os.getenv("GOOGLE_API_USE_MTLS_ENDPOINT", "auto") if use_client_cert not in ("true", "false"): raise ValueError( "Environment variable `GOOGLE_API_USE_CLIENT_CERTIFICATE` must be either `true` or `false`" ) if use_mtls_endpoint not in ("auto", "never", "always"): raise MutualTLSChannelError( "Environment variable `GOOGLE_API_USE_MTLS_ENDPOINT` must be `never`, `auto` or `always`" ) # Figure out the client cert source to use. client_cert_source = None if use_client_cert == "true": if client_options.client_cert_source: client_cert_source = client_options.client_cert_source elif mtls.has_default_client_cert_source(): client_cert_source = mtls.default_client_cert_source() # Figure out which api endpoint to use. if client_options.api_endpoint is not None: api_endpoint = client_options.api_endpoint elif use_mtls_endpoint == "always" or ( use_mtls_endpoint == "auto" and client_cert_source ): api_endpoint = cls.DEFAULT_MTLS_ENDPOINT else: api_endpoint = cls.DEFAULT_ENDPOINT return api_endpoint, client_cert_source def __init__( self, *, credentials: Optional[ga_credentials.Credentials] = None, transport: Union[str, LicensesTransport, None] = None, client_options: Optional[client_options_lib.ClientOptions] = None, client_info: gapic_v1.client_info.ClientInfo = DEFAULT_CLIENT_INFO, ) -> None: """Instantiates the licenses client. Args: credentials (Optional[google.auth.credentials.Credentials]): The authorization credentials to attach to requests. These credentials identify the application to the service; if none are specified, the client will attempt to ascertain the credentials from the environment. transport (Union[str, LicensesTransport]): The transport to use. If set to None, a transport is chosen automatically. client_options (google.api_core.client_options.ClientOptions): Custom options for the client. It won't take effect if a ``transport`` instance is provided. (1) The ``api_endpoint`` property can be used to override the default endpoint provided by the client. GOOGLE_API_USE_MTLS_ENDPOINT environment variable can also be used to override the endpoint: "always" (always use the default mTLS endpoint), "never" (always use the default regular endpoint) and "auto" (auto switch to the default mTLS endpoint if client certificate is present, this is the default value). However, the ``api_endpoint`` property takes precedence if provided. (2) If GOOGLE_API_USE_CLIENT_CERTIFICATE environment variable is "true", then the ``client_cert_source`` property can be used to provide client certificate for mutual TLS transport. If not provided, the default SSL client certificate will be used if present. If GOOGLE_API_USE_CLIENT_CERTIFICATE is "false" or not set, no client certificate will be used. client_info (google.api_core.gapic_v1.client_info.ClientInfo): The client info used to send a user-agent string along with API requests. If ``None``, then default info will be used. Generally, you only need to set this if you're developing your own client library. Raises: google.auth.exceptions.MutualTLSChannelError: If mutual TLS transport creation failed for any reason. """ if isinstance(client_options, dict): client_options = client_options_lib.from_dict(client_options) if client_options is None: client_options = client_options_lib.ClientOptions() api_endpoint, client_cert_source_func = self.get_mtls_endpoint_and_cert_source( client_options ) api_key_value = getattr(client_options, "api_key", None) if api_key_value and credentials: raise ValueError( "client_options.api_key and credentials are mutually exclusive" ) # Save or instantiate the transport. # Ordinarily, we provide the transport, but allowing a custom transport # instance provides an extensibility point for unusual situations. if isinstance(transport, LicensesTransport): # transport is a LicensesTransport instance. if credentials or client_options.credentials_file or api_key_value: raise ValueError( "When providing a transport instance, " "provide its credentials directly." ) if client_options.scopes: raise ValueError( "When providing a transport instance, provide its scopes " "directly." ) self._transport = transport else: import google.auth._default # type: ignore if api_key_value and hasattr( google.auth._default, "get_api_key_credentials" ): credentials = google.auth._default.get_api_key_credentials( api_key_value ) Transport = type(self).get_transport_class(transport) self._transport = Transport( credentials=credentials, credentials_file=client_options.credentials_file, host=api_endpoint, scopes=client_options.scopes, client_cert_source_for_mtls=client_cert_source_func, quota_project_id=client_options.quota_project_id, client_info=client_info, always_use_jwt_access=True, ) def delete_unary( self, request: Union[compute.DeleteLicenseRequest, dict] = None, *, project: str = None, license_: str = None, retry: OptionalRetry = gapic_v1.method.DEFAULT, timeout: float = None, metadata: Sequence[Tuple[str, str]] = (), ) -> compute.Operation: r"""Deletes the specified license. *Caution* This resource is intended for use only by third-party partners who are creating Cloud Marketplace images. Args: request (Union[google.cloud.compute_v1.types.DeleteLicenseRequest, dict]): The request object. A request message for Licenses.Delete. See the method description for details. project (str): Project ID for this request. This corresponds to the ``project`` field on the ``request`` instance; if ``request`` is provided, this should not be set. license_ (str): Name of the license resource to delete. This corresponds to the ``license_`` field on the ``request`` instance; if ``request`` is provided, this should not be set. retry (google.api_core.retry.Retry): Designation of what errors, if any, should be retried. timeout (float): The timeout for this request. metadata (Sequence[Tuple[str, str]]): Strings which should be sent along with the request as metadata. Returns: google.cloud.compute_v1.types.Operation: Represents an Operation resource. Google Compute Engine has three Operation resources: \* [Global](/compute/docs/reference/rest/v1/globalOperations) \* [Regional](/compute/docs/reference/rest/v1/regionOperations) \* [Zonal](/compute/docs/reference/rest/v1/zoneOperations) You can use an operation resource to manage asynchronous API requests. For more information, read Handling API responses. Operations can be global, regional or zonal. - For global operations, use the globalOperations resource. - For regional operations, use the regionOperations resource. - For zonal operations, use the zonalOperations resource. For more information, read Global, Regional, and Zonal Resources. """ # Create or coerce a protobuf request object. # Quick check: If we got a request object, we should *not* have # gotten any keyword arguments that map to the request. has_flattened_params = any([project, license_]) if request is not None and has_flattened_params: raise ValueError( "If the `request` argument is set, then none of " "the individual field arguments should be set." ) # Minor optimization to avoid making a copy if the user passes # in a compute.DeleteLicenseRequest. # There's no risk of modifying the input as we've already verified # there are no flattened fields. if not isinstance(request, compute.DeleteLicenseRequest): request = compute.DeleteLicenseRequest(request) # If we have keyword arguments corresponding to fields on the # request, apply these. if project is not None: request.project = project if license_ is not None: request.license_ = license_ # Wrap the RPC method; this adds retry and timeout information, # and friendly error handling. rpc = self._transport._wrapped_methods[self._transport.delete] # Send the request. response = rpc(request, retry=retry, timeout=timeout, metadata=metadata,) # Done; return the response. return response def get( self, request: Union[compute.GetLicenseRequest, dict] = None, *, project: str = None, license_: str = None, retry: OptionalRetry = gapic_v1.method.DEFAULT, timeout: float = None, metadata: Sequence[Tuple[str, str]] = (), ) -> compute.License: r"""Returns the specified License resource. *Caution* This resource is intended for use only by third-party partners who are creating Cloud Marketplace images. Args: request (Union[google.cloud.compute_v1.types.GetLicenseRequest, dict]): The request object. A request message for Licenses.Get. See the method description for details. project (str): Project ID for this request. This corresponds to the ``project`` field on the ``request`` instance; if ``request`` is provided, this should not be set. license_ (str): Name of the License resource to return. This corresponds to the ``license_`` field on the ``request`` instance; if ``request`` is provided, this should not be set. retry (google.api_core.retry.Retry): Designation of what errors, if any, should be retried. timeout (float): The timeout for this request. metadata (Sequence[Tuple[str, str]]): Strings which should be sent along with the request as metadata. Returns: google.cloud.compute_v1.types.License: Represents a License resource. A License represents billing and aggregate usage data for public and marketplace images. *Caution* This resource is intended for use only by third-party partners who are creating Cloud Marketplace images. """ # Create or coerce a protobuf request object. # Quick check: If we got a request object, we should *not* have # gotten any keyword arguments that map to the request. has_flattened_params = any([project, license_]) if request is not None and has_flattened_params: raise ValueError( "If the `request` argument is set, then none of " "the individual field arguments should be set." ) # Minor optimization to avoid making a copy if the user passes # in a compute.GetLicenseRequest. # There's no risk of modifying the input as we've already verified # there are no flattened fields. if not isinstance(request, compute.GetLicenseRequest): request = compute.GetLicenseRequest(request) # If we have keyword arguments corresponding to fields on the # request, apply these. if project is not None: request.project = project if license_ is not None: request.license_ = license_ # Wrap the RPC method; this adds retry and timeout information, # and friendly error handling. rpc = self._transport._wrapped_methods[self._transport.get] # Send the request. response = rpc(request, retry=retry, timeout=timeout, metadata=metadata,) # Done; return the response. return response def get_iam_policy( self, request: Union[compute.GetIamPolicyLicenseRequest, dict] = None, *, project: str = None, resource: str = None, retry: OptionalRetry = gapic_v1.method.DEFAULT, timeout: float = None, metadata: Sequence[Tuple[str, str]] = (), ) -> compute.Policy: r"""Gets the access control policy for a resource. May be empty if no such policy or resource exists. *Caution* This resource is intended for use only by third-party partners who are creating Cloud Marketplace images. Args: request (Union[google.cloud.compute_v1.types.GetIamPolicyLicenseRequest, dict]): The request object. A request message for Licenses.GetIamPolicy. See the method description for details. project (str): Project ID for this request. This corresponds to the ``project`` field on the ``request`` instance; if ``request`` is provided, this should not be set. resource (str): Name or id of the resource for this request. This corresponds to the ``resource`` field on the ``request`` instance; if ``request`` is provided, this should not be set. retry (google.api_core.retry.Retry): Designation of what errors, if any, should be retried. timeout (float): The timeout for this request. metadata (Sequence[Tuple[str, str]]): Strings which should be sent along with the request as metadata. Returns: google.cloud.compute_v1.types.Policy: An Identity and Access Management (IAM) policy, which specifies access controls for Google Cloud resources. A Policy is a collection of bindings. A binding binds one or more members, or principals, to a single role. Principals can be user accounts, service accounts, Google groups, and domains (such as G Suite). A role is a named list of permissions; each role can be an IAM predefined role or a user-created custom role. For some types of Google Cloud resources, a binding can also specify a condition, which is a logical expression that allows access to a resource only if the expression evaluates to true. A condition can add constraints based on attributes of the request, the resource, or both. To learn which resources support conditions in their IAM policies, see the [IAM documentation](\ https://cloud.google.com/iam/help/conditions/resource-policies). **JSON example:** { "bindings": [ { "role": "roles/resourcemanager.organizationAdmin", "members": [ "user:mike@example.com", "group:admins@example.com", "domain:google.com", "serviceAccount:my-project-id@appspot.gserviceaccount.com" ] }, { "role": "roles/resourcemanager.organizationViewer", "members": [ "user:eve@example.com" ], "condition": { "title": "expirable access", "description": "Does not grant access after Sep 2020", "expression": "request.time < timestamp('2020-10-01T00:00:00.000Z')", } } ], "etag": "BwWWja0YfJA=", "version": 3 } **YAML example:** bindings: - members: - user:\ mike@example.com - group:\ admins@example.com - domain:google.com - serviceAccount:\ my-project-id@appspot.gserviceaccount.com role: roles/resourcemanager.organizationAdmin - members: - user:\ eve@example.com role: roles/resourcemanager.organizationViewer condition: title: expirable access description: Does not grant access after Sep 2020 expression: request.time < timestamp('2020-10-01T00:00:00.000Z') etag: BwWWja0YfJA= version: 3 For a description of IAM and its features, see the [IAM documentation](\ https://cloud.google.com/iam/docs/). """ # Create or coerce a protobuf request object. # Quick check: If we got a request object, we should *not* have # gotten any keyword arguments that map to the request. has_flattened_params = any([project, resource]) if request is not None and has_flattened_params: raise ValueError( "If the `request` argument is set, then none of " "the individual field arguments should be set." ) # Minor optimization to avoid making a copy if the user passes # in a compute.GetIamPolicyLicenseRequest. # There's no risk of modifying the input as we've already verified # there are no flattened fields. if not isinstance(request, compute.GetIamPolicyLicenseRequest): request = compute.GetIamPolicyLicenseRequest(request) # If we have keyword arguments corresponding to fields on the # request, apply these. if project is not None: request.project = project if resource is not None: request.resource = resource # Wrap the RPC method; this adds retry and timeout information, # and friendly error handling. rpc = self._transport._wrapped_methods[self._transport.get_iam_policy] # Send the request. response = rpc(request, retry=retry, timeout=timeout, metadata=metadata,) # Done; return the response. return response def insert_unary( self, request: Union[compute.InsertLicenseRequest, dict] = None, *, project: str = None, license_resource: compute.License = None, retry: OptionalRetry = gapic_v1.method.DEFAULT, timeout: float = None, metadata: Sequence[Tuple[str, str]] = (), ) -> compute.Operation: r"""Create a License resource in the specified project. *Caution* This resource is intended for use only by third-party partners who are creating Cloud Marketplace images. Args: request (Union[google.cloud.compute_v1.types.InsertLicenseRequest, dict]): The request object. A request message for Licenses.Insert. See the method description for details. project (str): Project ID for this request. This corresponds to the ``project`` field on the ``request`` instance; if ``request`` is provided, this should not be set. license_resource (google.cloud.compute_v1.types.License): The body resource for this request This corresponds to the ``license_resource`` field on the ``request`` instance; if ``request`` is provided, this should not be set. retry (google.api_core.retry.Retry): Designation of what errors, if any, should be retried. timeout (float): The timeout for this request. metadata (Sequence[Tuple[str, str]]): Strings which should be sent along with the request as metadata. Returns: google.cloud.compute_v1.types.Operation: Represents an Operation resource. Google Compute Engine has three Operation resources: \* [Global](/compute/docs/reference/rest/v1/globalOperations) \* [Regional](/compute/docs/reference/rest/v1/regionOperations) \* [Zonal](/compute/docs/reference/rest/v1/zoneOperations) You can use an operation resource to manage asynchronous API requests. For more information, read Handling API responses. Operations can be global, regional or zonal. - For global operations, use the globalOperations resource. - For regional operations, use the regionOperations resource. - For zonal operations, use the zonalOperations resource. For more information, read Global, Regional, and Zonal Resources. """ # Create or coerce a protobuf request object. # Quick check: If we got a request object, we should *not* have # gotten any keyword arguments that map to the request. has_flattened_params = any([project, license_resource]) if request is not None and has_flattened_params: raise ValueError( "If the `request` argument is set, then none of " "the individual field arguments should be set." ) # Minor optimization to avoid making a copy if the user passes # in a compute.InsertLicenseRequest. # There's no risk of modifying the input as we've already verified # there are no flattened fields. if not isinstance(request, compute.InsertLicenseRequest): request = compute.InsertLicenseRequest(request) # If we have keyword arguments corresponding to fields on the # request, apply these. if project is not None: request.project = project if license_resource is not None: request.license_resource = license_resource # Wrap the RPC method; this adds retry and timeout information, # and friendly error handling. rpc = self._transport._wrapped_methods[self._transport.insert] # Send the request. response = rpc(request, retry=retry, timeout=timeout, metadata=metadata,) # Done; return the response. return response def list( self, request: Union[compute.ListLicensesRequest, dict] = None, *, project: str = None, retry: OptionalRetry = gapic_v1.method.DEFAULT, timeout: float = None, metadata: Sequence[Tuple[str, str]] = (), ) -> pagers.ListPager: r"""Retrieves the list of licenses available in the specified project. This method does not get any licenses that belong to other projects, including licenses attached to publicly-available images, like Debian 9. If you want to get a list of publicly-available licenses, use this method to make a request to the respective image project, such as debian-cloud or windows-cloud. *Caution* This resource is intended for use only by third-party partners who are creating Cloud Marketplace images. Args: request (Union[google.cloud.compute_v1.types.ListLicensesRequest, dict]): The request object. A request message for Licenses.List. See the method description for details. project (str): Project ID for this request. This corresponds to the ``project`` field on the ``request`` instance; if ``request`` is provided, this should not be set. retry (google.api_core.retry.Retry): Designation of what errors, if any, should be retried. timeout (float): The timeout for this request. metadata (Sequence[Tuple[str, str]]): Strings which should be sent along with the request as metadata. Returns: google.cloud.compute_v1.services.licenses.pagers.ListPager: Iterating over this object will yield results and resolve additional pages automatically. """ # Create or coerce a protobuf request object. # Quick check: If we got a request object, we should *not* have # gotten any keyword arguments that map to the request. has_flattened_params = any([project]) if request is not None and has_flattened_params: raise ValueError( "If the `request` argument is set, then none of " "the individual field arguments should be set." ) # Minor optimization to avoid making a copy if the user passes # in a compute.ListLicensesRequest. # There's no risk of modifying the input as we've already verified # there are no flattened fields. if not isinstance(request, compute.ListLicensesRequest): request = compute.ListLicensesRequest(request) # If we have keyword arguments corresponding to fields on the # request, apply these. if project is not None: request.project = project # Wrap the RPC method; this adds retry and timeout information, # and friendly error handling. rpc = self._transport._wrapped_methods[self._transport.list] # Send the request. response = rpc(request, retry=retry, timeout=timeout, metadata=metadata,) # This method is paged; wrap the response in a pager, which provides # an `__iter__` convenience method. response = pagers.ListPager( method=rpc, request=request, response=response, metadata=metadata, ) # Done; return the response. return response def set_iam_policy( self, request: Union[compute.SetIamPolicyLicenseRequest, dict] = None, *, project: str = None, resource: str = None, global_set_policy_request_resource: compute.GlobalSetPolicyRequest = None, retry: OptionalRetry = gapic_v1.method.DEFAULT, timeout: float = None, metadata: Sequence[Tuple[str, str]] = (), ) -> compute.Policy: r"""Sets the access control policy on the specified resource. Replaces any existing policy. *Caution* This resource is intended for use only by third-party partners who are creating Cloud Marketplace images. Args: request (Union[google.cloud.compute_v1.types.SetIamPolicyLicenseRequest, dict]): The request object. A request message for Licenses.SetIamPolicy. See the method description for details. project (str): Project ID for this request. This corresponds to the ``project`` field on the ``request`` instance; if ``request`` is provided, this should not be set. resource (str): Name or id of the resource for this request. This corresponds to the ``resource`` field on the ``request`` instance; if ``request`` is provided, this should not be set. global_set_policy_request_resource (google.cloud.compute_v1.types.GlobalSetPolicyRequest): The body resource for this request This corresponds to the ``global_set_policy_request_resource`` field on the ``request`` instance; if ``request`` is provided, this should not be set. retry (google.api_core.retry.Retry): Designation of what errors, if any, should be retried. timeout (float): The timeout for this request. metadata (Sequence[Tuple[str, str]]): Strings which should be sent along with the request as metadata. Returns: google.cloud.compute_v1.types.Policy: An Identity and Access Management (IAM) policy, which specifies access controls for Google Cloud resources. A Policy is a collection of bindings. A binding binds one or more members, or principals, to a single role. Principals can be user accounts, service accounts, Google groups, and domains (such as G Suite). A role is a named list of permissions; each role can be an IAM predefined role or a user-created custom role. For some types of Google Cloud resources, a binding can also specify a condition, which is a logical expression that allows access to a resource only if the expression evaluates to true. A condition can add constraints based on attributes of the request, the resource, or both. To learn which resources support conditions in their IAM policies, see the [IAM documentation](\ https://cloud.google.com/iam/help/conditions/resource-policies). **JSON example:** { "bindings": [ { "role": "roles/resourcemanager.organizationAdmin", "members": [ "user:mike@example.com", "group:admins@example.com", "domain:google.com", "serviceAccount:my-project-id@appspot.gserviceaccount.com" ] }, { "role": "roles/resourcemanager.organizationViewer", "members": [ "user:eve@example.com" ], "condition": { "title": "expirable access", "description": "Does not grant access after Sep 2020", "expression": "request.time < timestamp('2020-10-01T00:00:00.000Z')", } } ], "etag": "BwWWja0YfJA=", "version": 3 } **YAML example:** bindings: - members: - user:\ mike@example.com - group:\ admins@example.com - domain:google.com - serviceAccount:\ my-project-id@appspot.gserviceaccount.com role: roles/resourcemanager.organizationAdmin - members: - user:\ eve@example.com role: roles/resourcemanager.organizationViewer condition: title: expirable access description: Does not grant access after Sep 2020 expression: request.time < timestamp('2020-10-01T00:00:00.000Z') etag: BwWWja0YfJA= version: 3 For a description of IAM and its features, see the [IAM documentation](\ https://cloud.google.com/iam/docs/). """ # Create or coerce a protobuf request object. # Quick check: If we got a request object, we should *not* have # gotten any keyword arguments that map to the request. has_flattened_params = any( [project, resource, global_set_policy_request_resource] ) if request is not None and has_flattened_params: raise ValueError( "If the `request` argument is set, then none of " "the individual field arguments should be set." ) # Minor optimization to avoid making a copy if the user passes # in a compute.SetIamPolicyLicenseRequest. # There's no risk of modifying the input as we've already verified # there are no flattened fields. if not isinstance(request, compute.SetIamPolicyLicenseRequest): request = compute.SetIamPolicyLicenseRequest(request) # If we have keyword arguments corresponding to fields on the # request, apply these. if project is not None: request.project = project if resource is not None: request.resource = resource if global_set_policy_request_resource is not None: request.global_set_policy_request_resource = ( global_set_policy_request_resource ) # Wrap the RPC method; this adds retry and timeout information, # and friendly error handling. rpc = self._transport._wrapped_methods[self._transport.set_iam_policy] # Send the request. response = rpc(request, retry=retry, timeout=timeout, metadata=metadata,) # Done; return the response. return response def test_iam_permissions( self, request: Union[compute.TestIamPermissionsLicenseRequest, dict] = None, *, project: str = None, resource: str = None, test_permissions_request_resource: compute.TestPermissionsRequest = None, retry: OptionalRetry = gapic_v1.method.DEFAULT, timeout: float = None, metadata: Sequence[Tuple[str, str]] = (), ) -> compute.TestPermissionsResponse: r"""Returns permissions that a caller has on the specified resource. *Caution* This resource is intended for use only by third-party partners who are creating Cloud Marketplace images. Args: request (Union[google.cloud.compute_v1.types.TestIamPermissionsLicenseRequest, dict]): The request object. A request message for Licenses.TestIamPermissions. See the method description for details. project (str): Project ID for this request. This corresponds to the ``project`` field on the ``request`` instance; if ``request`` is provided, this should not be set. resource (str): Name or id of the resource for this request. This corresponds to the ``resource`` field on the ``request`` instance; if ``request`` is provided, this should not be set. test_permissions_request_resource (google.cloud.compute_v1.types.TestPermissionsRequest): The body resource for this request This corresponds to the ``test_permissions_request_resource`` field on the ``request`` instance; if ``request`` is provided, this should not be set. retry (google.api_core.retry.Retry): Designation of what errors, if any, should be retried. timeout (float): The timeout for this request. metadata (Sequence[Tuple[str, str]]): Strings which should be sent along with the request as metadata. Returns: google.cloud.compute_v1.types.TestPermissionsResponse: """ # Create or coerce a protobuf request object. # Quick check: If we got a request object, we should *not* have # gotten any keyword arguments that map to the request. has_flattened_params = any( [project, resource, test_permissions_request_resource] ) if request is not None and has_flattened_params: raise ValueError( "If the `request` argument is set, then none of " "the individual field arguments should be set." ) # Minor optimization to avoid making a copy if the user passes # in a compute.TestIamPermissionsLicenseRequest. # There's no risk of modifying the input as we've already verified # there are no flattened fields. if not isinstance(request, compute.TestIamPermissionsLicenseRequest): request = compute.TestIamPermissionsLicenseRequest(request) # If we have keyword arguments corresponding to fields on the # request, apply these. if project is not None: request.project = project if resource is not None: request.resource = resource if test_permissions_request_resource is not None: request.test_permissions_request_resource = ( test_permissions_request_resource ) # Wrap the RPC method; this adds retry and timeout information, # and friendly error handling. rpc = self._transport._wrapped_methods[self._transport.test_iam_permissions] # Send the request. response = rpc(request, retry=retry, timeout=timeout, metadata=metadata,) # Done; return the response. return response def __enter__(self): return self def __exit__(self, type, value, traceback): """Releases underlying transport's resources. .. warning:: ONLY use as a context manager if the transport is NOT shared with other clients! Exiting the with block will CLOSE the transport and may cause errors in other clients! """ self.transport.close() try: DEFAULT_CLIENT_INFO = gapic_v1.client_info.ClientInfo( gapic_version=pkg_resources.get_distribution("google-cloud-compute",).version, ) except pkg_resources.DistributionNotFound: DEFAULT_CLIENT_INFO = gapic_v1.client_info.ClientInfo() __all__ = ("LicensesClient",)
#!/usr/bin/env python import os import sys import subprocess import json from pprint import pprint import StringIO import csv import ast from getpass import getpass from hashlib import md5 def generate_nodesfile(vcname, subnet=None): nodescmd = "cm comet cluster {} --format=rest".format(vcname) proc = subprocess.Popen(nodescmd.split(" "), stdout=subprocess.PIPE) (out, err) = proc.communicate() nodesobj = ast.literal_eval(out) frontend = nodesobj[0]['frontend'] fields = ["ip", "mask", "gateway", "dns", "ntp"] with open('vcnet_{}.txt'.format(vcname), 'w') as f: print >> f, "IP:", frontend["pub_ip"] print >> f, "MASK:", frontend["pub_netmask"] print >> f, "GATEWAY:", frontend["gateway"] print >> f, "DNS:", "{} {}".format(frontend["dns1"], frontend["dns2"]) print >> f, "NTP:", frontend["ntp"] nodes = nodesobj[0]['computes'] if not subnet: subnet = "10.0.0." ip_idx = 0 with open('vcnodes_{}.txt'.format(vcname), 'w') as f: for node in nodes: ip_idx += 1 print >> f, "{},{},{}".format(node["name"], node["interface"][0]["mac"], "{}{}".format(subnet, ip_idx) ) def generate_pxefile(nodesfile=None, netfile=None, vc=None): if vc: if not nodesfile: nodesfile = "vcnodes_{}.txt".format(vc) if not netfile: netfile = "vcnet_{}.txt".format(vc) else: if not (nodesfile and netfile): print ("parameters not specified") return pxetemp = "/var/lib/tftpboot/pxelinux.cfg/default.temp" netconfs = {} with open(netfile) as file: lines = file.readlines() for line in lines: row = line.split(": ") netconfs[row[0]] = row[1].strip("\n") with open(nodesfile) as nodes: lines = nodes.readlines() for aline in lines: row = aline.split(",") #print (row) name = row[0] mac = row[1] ip = row[2].strip("\n") filename="01-{}".format(mac.replace(":","-")) #print (filename) replacements = {'$NETIP':ip, '$NODENAME':name, #'$NETMASK':netconfs["MASK"], '$NETMASK':"255.255.255.0", #'$NETGATEWAY':netconfs["GATEWAY"], '$NETGATEWAY':"10.0.0.254", "$DNS":netconfs["DNS"]} #print (replacements) with open('/var/lib/tftpboot/pxelinux.cfg/{}'.format(filename), 'w') as outfile: with open(pxetemp) as infile: for line in infile: for src, target in replacements.iteritems(): line = line.replace(src, target) #print (line) outfile.write(line) #print ("finished writing one file...") def setboot(node, nodesfile=None, vc=None, net=True): if vc: if not nodesfile: nodesfile = "vcnodes_{}.txt".format(vc) else: if not nodesfile: print ("parameters not specified") return filename = None with open(nodesfile) as nodes: lines = nodes.readlines() for aline in lines: row = aline.split(",") name = row[0] mac = row[1] if name == node: filename="01-{}".format(mac.replace(":","-")) break if filename: lines = [] with open('/var/lib/tftpboot/pxelinux.cfg/{}'.format(filename)) as infile: lines = infile.readlines() with open('/var/lib/tftpboot/pxelinux.cfg/{}'.format(filename), 'w') as outfile: netbootline = "default netinstall" localbootline = "default local" for line in lines: if net: line = line.replace(localbootline, netbootline) else: line = line.replace(netbootline, localbootline) outfile.write(line) def addhosts(nodesfile=None, vc=None): if vc: if not nodesfile: nodesfile = "vcnodes_{}.txt".format(vc) else: if not nodesfile: print ("parameters not specified") return with open(nodesfile) as nodes, open("/etc/hosts", "a") as hostfile: lines = nodes.readlines() print >> hostfile for aline in lines: row = aline.split(",") name = row[0] mac = row[1] ip = row[2].strip("\n") print >> hostfile, "{}\t{}.local {}".format(ip, name, name) def setpassword(): print ("Type the root password for the computenodes:") password = md5(getpass()).hexdigest() ksfile = "/var/www/html/ks.cfg" with open(ksfile) as infile: lines = infile.readlines() with open(ksfile, 'w') as outfile: for line in lines: line = line.replace("$ROOT_PASSWORD", password) outfile.write(line) # before installing the compute nodes def setkey(): os.system("ssh-keygen") keyfile = ("{}/.ssh/id_rsa.pub").format(get_sudouser_home()) key = '' with open(keyfile) as f: key = f.readline().strip("\n") scriptfile = "/var/www/html/postscript.sh" with open(scriptfile) as infile: lines = infile.readlines() with open(scriptfile, 'w') as outfile: for line in lines: line = line.replace("$PUBLICKEY", key) outfile.write(line) # call after compute nodes up and running def setknownhosts(nodesfile=None, vc=None): if vc: if not nodesfile: nodesfile = "vcnodes_{}.txt".format(vc) else: if not nodesfile: print ("parameters not specified") return ips = [] iphosts = '\n' with open(nodesfile) as nodes: lines = nodes.readlines() for aline in lines: row = aline.split(",") name = row[0] mac = row[1] ip = row[2].strip("\n") ips.append(ip) iphosts += "{}\t{}\n".format(ip, name) os.system("ssh-keyscan -H {} >> {} 2>/dev/null".format(ip, "{}/.ssh/known_hosts".format(get_sudouser_home()))) os.system("ssh-keyscan -H {} >> {} 2>/dev/null".format(name, "{}/.ssh/known_hosts".format(get_sudouser_home()))) for ip in ips: os.system("scp {}/.ssh/known_hosts root@{}:/root/.ssh/".format(get_sudouser_home(), ip)) os.system("scp {}/.ssh/id_rsa root@{}:/root/.ssh/".format(get_sudouser_home(), ip)) os.system("echo '{}' | ssh root@{} 'cat >> /etc/hosts'".format(iphosts, ip)) # sudo cmutil.py still gets the unprivileged user directory, which breaks # ssh key location def get_sudouser_home(): home = "" if 'root' == os.getenv("USER"): home = "/root" else: home = os.path.expanduser("~") return home def usage(): usagestr = "Usage:\n"\ "./cmutil.py nodesfile\n"\ "./cmutil.py pxefile vc2\n"\ "./cmutil.py setkey\n"\ "./cmutil.py setpassword\n"\ "./cmutil.py setboot vc2 node1 net=false\n"\ "./cmutil.py setboot vc2 node1 net=true\n"\ "./cmutil.py addhosts vc2\n"\ "./cmutil.py setknownhosts vc2\n" print (usagestr) if __name__ == "__main__": argv = sys.argv[1:] commands = ['nodesfile', 'pxefile', 'setkey', 'setpassword', 'setboot', 'addhosts', 'setknownhosts'] if len(argv) >= 1: cmd = argv[0] cluster = '' if len(argv) > 1: cluster = argv[1] if cmd in commands: if cmd == 'nodesfile': generate_nodesfile(cluster) elif cmd == 'pxefile': generate_pxefile(vc=cluster) elif cmd == 'setkey': setkey() elif cmd == 'setpassword': setpassword() elif cmd == 'setboot': node = argv[2] bootparam = argv[3] params = bootparam.split("=") if params[0].lower() == 'net': if params[1].lower() == 'true': netboot = True elif params[1].lower() == 'false': netboot = False else: netboot = False setboot(node, vc=cluster, net=netboot) elif cmd == 'addhosts': addhosts(vc=cluster) elif cmd == 'setknownhosts': setknownhosts(vc=cluster) else: usage() else: usage() else: usage()
# flake8: noqa # pylint: skip-file # noqa: E301,E302 class YeditException(Exception): ''' Exception class for Yedit ''' pass # pylint: disable=too-many-public-methods class Yedit(object): ''' Class to modify yaml files ''' re_valid_key = r"(((\[-?\d+\])|([0-9a-zA-Z%s/_-]+)).?)+$" re_key = r"(?:\[(-?\d+)\])|([0-9a-zA-Z%s/_-]+)" com_sep = set(['.', '#', '|', ':']) # pylint: disable=too-many-arguments def __init__(self, filename=None, content=None, content_type='yaml', separator='.', backup=False): self.content = content self._separator = separator self.filename = filename self.__yaml_dict = content self.content_type = content_type self.backup = backup self.load(content_type=self.content_type) if self.__yaml_dict is None: self.__yaml_dict = {} @property def separator(self): ''' getter method for yaml_dict ''' return self._separator @separator.setter def separator(self): ''' getter method for yaml_dict ''' return self._separator @property def yaml_dict(self): ''' getter method for yaml_dict ''' return self.__yaml_dict @yaml_dict.setter def yaml_dict(self, value): ''' setter method for yaml_dict ''' self.__yaml_dict = value @staticmethod def parse_key(key, sep='.'): '''parse the key allowing the appropriate separator''' common_separators = list(Yedit.com_sep - set([sep])) return re.findall(Yedit.re_key % ''.join(common_separators), key) @staticmethod def valid_key(key, sep='.'): '''validate the incoming key''' common_separators = list(Yedit.com_sep - set([sep])) if not re.match(Yedit.re_valid_key % ''.join(common_separators), key): return False return True @staticmethod def remove_entry(data, key, sep='.'): ''' remove data at location key ''' if key == '' and isinstance(data, dict): data.clear() return True elif key == '' and isinstance(data, list): del data[:] return True if not (key and Yedit.valid_key(key, sep)) and \ isinstance(data, (list, dict)): return None key_indexes = Yedit.parse_key(key, sep) for arr_ind, dict_key in key_indexes[:-1]: if dict_key and isinstance(data, dict): data = data.get(dict_key, None) elif (arr_ind and isinstance(data, list) and int(arr_ind) <= len(data) - 1): data = data[int(arr_ind)] else: return None # process last index for remove # expected list entry if key_indexes[-1][0]: if isinstance(data, list) and int(key_indexes[-1][0]) <= len(data) - 1: # noqa: E501 del data[int(key_indexes[-1][0])] return True # expected dict entry elif key_indexes[-1][1]: if isinstance(data, dict): del data[key_indexes[-1][1]] return True @staticmethod def add_entry(data, key, item=None, sep='.'): ''' Get an item from a dictionary with key notation a.b.c d = {'a': {'b': 'c'}}} key = a#b return c ''' if key == '': pass elif (not (key and Yedit.valid_key(key, sep)) and isinstance(data, (list, dict))): return None key_indexes = Yedit.parse_key(key, sep) for arr_ind, dict_key in key_indexes[:-1]: if dict_key: if isinstance(data, dict) and dict_key in data and data[dict_key]: # noqa: E501 data = data[dict_key] continue elif data and not isinstance(data, dict): return None data[dict_key] = {} data = data[dict_key] elif (arr_ind and isinstance(data, list) and int(arr_ind) <= len(data) - 1): data = data[int(arr_ind)] else: return None if key == '': data = item # process last index for add # expected list entry elif key_indexes[-1][0] and isinstance(data, list) and int(key_indexes[-1][0]) <= len(data) - 1: # noqa: E501 data[int(key_indexes[-1][0])] = item # expected dict entry elif key_indexes[-1][1] and isinstance(data, dict): data[key_indexes[-1][1]] = item return data @staticmethod def get_entry(data, key, sep='.'): ''' Get an item from a dictionary with key notation a.b.c d = {'a': {'b': 'c'}}} key = a.b return c ''' if key == '': pass elif (not (key and Yedit.valid_key(key, sep)) and isinstance(data, (list, dict))): return None key_indexes = Yedit.parse_key(key, sep) for arr_ind, dict_key in key_indexes: if dict_key and isinstance(data, dict): data = data.get(dict_key, None) elif (arr_ind and isinstance(data, list) and int(arr_ind) <= len(data) - 1): data = data[int(arr_ind)] else: return None return data @staticmethod def _write(filename, contents): ''' Actually write the file contents to disk. This helps with mocking. ''' tmp_filename = filename + '.yedit' with open(tmp_filename, 'w') as yfd: yfd.write(contents) os.rename(tmp_filename, filename) def write(self): ''' write to file ''' if not self.filename: raise YeditException('Please specify a filename.') if self.backup and self.file_exists(): shutil.copy(self.filename, self.filename + '.orig') # pylint: disable=no-member if hasattr(self.yaml_dict, 'fa'): self.yaml_dict.fa.set_block_style() Yedit._write(self.filename, yaml.dump(self.yaml_dict, Dumper=yaml.RoundTripDumper)) return (True, self.yaml_dict) def read(self): ''' read from file ''' # check if it exists if self.filename is None or not self.file_exists(): return None contents = None with open(self.filename) as yfd: contents = yfd.read() return contents def file_exists(self): ''' return whether file exists ''' if os.path.exists(self.filename): return True return False def load(self, content_type='yaml'): ''' return yaml file ''' contents = self.read() if not contents and not self.content: return None if self.content: if isinstance(self.content, dict): self.yaml_dict = self.content return self.yaml_dict elif isinstance(self.content, str): contents = self.content # check if it is yaml try: if content_type == 'yaml' and contents: self.yaml_dict = yaml.load(contents, yaml.RoundTripLoader) # pylint: disable=no-member if hasattr(self.yaml_dict, 'fa'): self.yaml_dict.fa.set_block_style() elif content_type == 'json' and contents: self.yaml_dict = json.loads(contents) except yaml.YAMLError as err: # Error loading yaml or json raise YeditException('Problem with loading yaml file. %s' % err) return self.yaml_dict def get(self, key): ''' get a specified key''' try: entry = Yedit.get_entry(self.yaml_dict, key, self.separator) except KeyError: entry = None return entry def pop(self, path, key_or_item): ''' remove a key, value pair from a dict or an item for a list''' try: entry = Yedit.get_entry(self.yaml_dict, path, self.separator) except KeyError: entry = None if entry is None: return (False, self.yaml_dict) if isinstance(entry, dict): # pylint: disable=no-member,maybe-no-member if key_or_item in entry: entry.pop(key_or_item) return (True, self.yaml_dict) return (False, self.yaml_dict) elif isinstance(entry, list): # pylint: disable=no-member,maybe-no-member ind = None try: ind = entry.index(key_or_item) except ValueError: return (False, self.yaml_dict) entry.pop(ind) return (True, self.yaml_dict) return (False, self.yaml_dict) def delete(self, path): ''' remove path from a dict''' try: entry = Yedit.get_entry(self.yaml_dict, path, self.separator) except KeyError: entry = None if entry is None: return (False, self.yaml_dict) result = Yedit.remove_entry(self.yaml_dict, path, self.separator) if not result: return (False, self.yaml_dict) return (True, self.yaml_dict) def exists(self, path, value): ''' check if value exists at path''' try: entry = Yedit.get_entry(self.yaml_dict, path, self.separator) except KeyError: entry = None if isinstance(entry, list): if value in entry: return True return False elif isinstance(entry, dict): if isinstance(value, dict): rval = False for key, val in value.items(): if entry[key] != val: rval = False break else: rval = True return rval return value in entry return entry == value def append(self, path, value): '''append value to a list''' try: entry = Yedit.get_entry(self.yaml_dict, path, self.separator) except KeyError: entry = None if entry is None: self.put(path, []) entry = Yedit.get_entry(self.yaml_dict, path, self.separator) if not isinstance(entry, list): return (False, self.yaml_dict) # pylint: disable=no-member,maybe-no-member entry.append(value) return (True, self.yaml_dict) # pylint: disable=too-many-arguments def update(self, path, value, index=None, curr_value=None): ''' put path, value into a dict ''' try: entry = Yedit.get_entry(self.yaml_dict, path, self.separator) except KeyError: entry = None if isinstance(entry, dict): # pylint: disable=no-member,maybe-no-member if not isinstance(value, dict): raise YeditException('Cannot replace key, value entry in ' + 'dict with non-dict type. value=[%s] [%s]' % (value, type(value))) # noqa: E501 entry.update(value) return (True, self.yaml_dict) elif isinstance(entry, list): # pylint: disable=no-member,maybe-no-member ind = None if curr_value: try: ind = entry.index(curr_value) except ValueError: return (False, self.yaml_dict) elif index is not None: ind = index if ind is not None and entry[ind] != value: entry[ind] = value return (True, self.yaml_dict) # see if it exists in the list try: ind = entry.index(value) except ValueError: # doesn't exist, append it entry.append(value) return (True, self.yaml_dict) # already exists, return if ind is not None: return (False, self.yaml_dict) return (False, self.yaml_dict) def put(self, path, value): ''' put path, value into a dict ''' try: entry = Yedit.get_entry(self.yaml_dict, path, self.separator) except KeyError: entry = None if entry == value: return (False, self.yaml_dict) # deepcopy didn't work tmp_copy = yaml.load(yaml.round_trip_dump(self.yaml_dict, default_flow_style=False), yaml.RoundTripLoader) # pylint: disable=no-member if hasattr(self.yaml_dict, 'fa'): tmp_copy.fa.set_block_style() result = Yedit.add_entry(tmp_copy, path, value, self.separator) if not result: return (False, self.yaml_dict) self.yaml_dict = tmp_copy return (True, self.yaml_dict) def create(self, path, value): ''' create a yaml file ''' if not self.file_exists(): # deepcopy didn't work tmp_copy = yaml.load(yaml.round_trip_dump(self.yaml_dict, default_flow_style=False), # noqa: E501 yaml.RoundTripLoader) # pylint: disable=no-member if hasattr(self.yaml_dict, 'fa'): tmp_copy.fa.set_block_style() result = Yedit.add_entry(tmp_copy, path, value, self.separator) if result: self.yaml_dict = tmp_copy return (True, self.yaml_dict) return (False, self.yaml_dict) @staticmethod def get_curr_value(invalue, val_type): '''return the current value''' if invalue is None: return None curr_value = invalue if val_type == 'yaml': curr_value = yaml.load(invalue) elif val_type == 'json': curr_value = json.loads(invalue) return curr_value @staticmethod def parse_value(inc_value, vtype=''): '''determine value type passed''' true_bools = ['y', 'Y', 'yes', 'Yes', 'YES', 'true', 'True', 'TRUE', 'on', 'On', 'ON', ] false_bools = ['n', 'N', 'no', 'No', 'NO', 'false', 'False', 'FALSE', 'off', 'Off', 'OFF'] # It came in as a string but you didn't specify value_type as string # we will convert to bool if it matches any of the above cases if isinstance(inc_value, str) and 'bool' in vtype: if inc_value not in true_bools and inc_value not in false_bools: raise YeditException('Not a boolean type. str=[%s] vtype=[%s]' % (inc_value, vtype)) elif isinstance(inc_value, bool) and 'str' in vtype: inc_value = str(inc_value) # If vtype is not str then go ahead and attempt to yaml load it. if isinstance(inc_value, str) and 'str' not in vtype: try: inc_value = yaml.load(inc_value) except Exception: raise YeditException('Could not determine type of incoming ' + 'value. value=[%s] vtype=[%s]' % (type(inc_value), vtype)) return inc_value # pylint: disable=too-many-return-statements,too-many-branches @staticmethod def run_ansible(module): '''perform the idempotent crud operations''' yamlfile = Yedit(filename=module.params['src'], backup=module.params['backup'], separator=module.params['separator']) if module.params['src']: rval = yamlfile.load() if yamlfile.yaml_dict is None and \ module.params['state'] != 'present': return {'failed': True, 'msg': 'Error opening file [%s]. Verify that the ' + 'file exists, that it is has correct' + ' permissions, and is valid yaml.'} if module.params['state'] == 'list': if module.params['content']: content = Yedit.parse_value(module.params['content'], module.params['content_type']) yamlfile.yaml_dict = content if module.params['key']: rval = yamlfile.get(module.params['key']) or {} return {'changed': False, 'result': rval, 'state': "list"} elif module.params['state'] == 'absent': if module.params['content']: content = Yedit.parse_value(module.params['content'], module.params['content_type']) yamlfile.yaml_dict = content if module.params['update']: rval = yamlfile.pop(module.params['key'], module.params['value']) else: rval = yamlfile.delete(module.params['key']) if rval[0] and module.params['src']: yamlfile.write() return {'changed': rval[0], 'result': rval[1], 'state': "absent"} elif module.params['state'] == 'present': # check if content is different than what is in the file if module.params['content']: content = Yedit.parse_value(module.params['content'], module.params['content_type']) # We had no edits to make and the contents are the same if yamlfile.yaml_dict == content and \ module.params['value'] is None: return {'changed': False, 'result': yamlfile.yaml_dict, 'state': "present"} yamlfile.yaml_dict = content # we were passed a value; parse it if module.params['value']: value = Yedit.parse_value(module.params['value'], module.params['value_type']) key = module.params['key'] if module.params['update']: # pylint: disable=line-too-long curr_value = Yedit.get_curr_value(Yedit.parse_value(module.params['curr_value']), # noqa: E501 module.params['curr_value_format']) # noqa: E501 rval = yamlfile.update(key, value, module.params['index'], curr_value) # noqa: E501 elif module.params['append']: rval = yamlfile.append(key, value) else: rval = yamlfile.put(key, value) if rval[0] and module.params['src']: yamlfile.write() return {'changed': rval[0], 'result': rval[1], 'state': "present"} # no edits to make if module.params['src']: # pylint: disable=redefined-variable-type rval = yamlfile.write() return {'changed': rval[0], 'result': rval[1], 'state': "present"} return {'failed': True, 'msg': 'Unkown state passed'}
# Copyright 2017 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Abstractions for the head(s) of a model.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function from tensorflow.python.estimator import model_fn from tensorflow.python.estimator import util from tensorflow.python.estimator.canned import head as head_lib from tensorflow.python.estimator.canned import metric_keys from tensorflow.python.estimator.canned import prediction_keys from tensorflow.python.estimator.export import export_output from tensorflow.python.framework import dtypes from tensorflow.python.framework import ops from tensorflow.python.framework import sparse_tensor from tensorflow.python.ops import array_ops from tensorflow.python.ops import control_flow_ops from tensorflow.python.ops import lookup_ops from tensorflow.python.ops import math_ops from tensorflow.python.ops import metrics as metrics_lib from tensorflow.python.ops import sparse_ops from tensorflow.python.ops.losses import losses from tensorflow.python.saved_model import signature_constants from tensorflow.python.summary import summary _DEFAULT_SERVING_KEY = signature_constants.DEFAULT_SERVING_SIGNATURE_DEF_KEY def multi_class_head(n_classes, weight_column=None, label_vocabulary=None, name=None): """Creates a `_Head` for multi class classification. Uses `sparse_softmax_cross_entropy` loss. This head expects to be fed integer labels specifying the class index. Args: n_classes: Number of classes, must be greater than 2 (for 2 classes, use `binary_classification_head`). weight_column: A string or a `_NumericColumn` created by `tf.feature_column.numeric_column` defining feature column representing weights. It is used to down weight or boost examples during training. It will be multiplied by the loss of the example. label_vocabulary: A list of strings represents possible label values. If it is not given, that means labels are already encoded as integer within [0, n_classes). If given, labels must be string type and have any value in `label_vocabulary`. Also there will be errors if vocabulary is not provided and labels are string. name: name of the head. If provided, summary and metrics keys will be suffixed by `"/" + name`. Also used as `name_scope` when creating ops. Returns: An instance of `_Head` for multi class classification. Raises: ValueError: if `n_classes`, `metric_class_ids` or `label_keys` is invalid. """ return head_lib._multi_class_head_with_softmax_cross_entropy_loss( # pylint:disable=protected-access n_classes=n_classes, weight_column=weight_column, label_vocabulary=label_vocabulary, name=name) def binary_classification_head( weight_column=None, thresholds=None, label_vocabulary=None, name=None): """Creates a `_Head` for single label binary classification. This head uses `sigmoid_cross_entropy_with_logits` loss. This head expects to be fed float labels of shape `(batch_size, 1)`. Args: weight_column: A string or a `_NumericColumn` created by `tf.feature_column.numeric_column` defining feature column representing weights. It is used to down weight or boost examples during training. It will be multiplied by the loss of the example. thresholds: Iterable of floats in the range `(0, 1)`. For binary classification metrics such as precision and recall, an eval metric is generated for each threshold value. This threshold is applied to the logistic values to determine the binary classification (i.e., above the threshold is `true`, below is `false`. label_vocabulary: A list of strings represents possible label values. If it is not given, that means labels are already encoded within [0, 1]. If given, labels must be string type and have any value in `label_vocabulary`. Also there will be errors if vocabulary is not provided and labels are string. name: name of the head. If provided, summary and metrics keys will be suffixed by `"/" + name`. Also used as `name_scope` when creating ops. Returns: An instance of `_Head` for binary classification. Raises: ValueError: if `thresholds` contains a value outside of `(0, 1)`. """ return head_lib._binary_logistic_head_with_sigmoid_cross_entropy_loss( # pylint:disable=protected-access weight_column=weight_column, thresholds=thresholds, label_vocabulary=label_vocabulary, name=name) def regression_head(weight_column=None, label_dimension=1, name=None): """Creates a `_Head` for regression using the mean squared loss. Uses `mean_squared_error` loss. Args: weight_column: A string or a `_NumericColumn` created by `tf.feature_column.numeric_column` defining feature column representing weights. It is used to down weight or boost examples during training. It will be multiplied by the loss of the example. label_dimension: Number of regression labels per example. This is the size of the last dimension of the labels `Tensor` (typically, this has shape `[batch_size, label_dimension]`). name: name of the head. If provided, summary and metrics keys will be suffixed by `"/" + name`. Also used as `name_scope` when creating ops. Returns: An instance of `_Head` for linear regression. """ return head_lib._regression_head_with_mean_squared_error_loss( # pylint:disable=protected-access weight_column=weight_column, label_dimension=label_dimension, name=name) def multi_label_head(n_classes, weight_column=None, thresholds=None, label_vocabulary=None, loss_fn=None, name=None): """Creates a `_Head` for multi-label classification. Multi-label classification handles the case where each example may have zero or more associated labels, from a discrete set. This is distinct from `multi_class_head` which has exactly one label per example. Uses `sigmoid_cross_entropy` loss averaged over classes. Expects labels as a multi-hot tensor of shape `[batch_size, n_classes]`, or as an integer `SparseTensor` of class indices. Also supports custom `loss_fn`. `loss_fn` takes `(labels, logits)` or `(labels, logits, features)` as arguments and returns unreduced loss with shape `[batch_size, 1]`. `loss_fn` must support indicator `labels` with shape `[batch_size, n_classes]`. Namely, the head applies `label_vocabulary` to the input labels before passing them to `loss_fn`. Args: n_classes: Number of classes, must be greater than 1 (for 1 class, use `binary_classification_head`). weight_column: A string or a `_NumericColumn` created by `tf.feature_column.numeric_column` defining feature column representing weights. It is used to down weight or boost examples during training. It will be multiplied by the loss of the example. thresholds: Iterable of floats in the range `(0, 1)`. Accuracy, precision and recall metrics are evaluated for each threshold value. The threshold is applied to the predicted probabilities, i.e. above the threshold is `true`, below is `false`. label_vocabulary: A list of strings represents possible label values. If it is not given, that means labels are already encoded as integer within [0, n_classes) or multi-hot Tensor. If given, labels must be SparseTensor string type and have any value in `label_vocabulary`. Also there will be errors if vocabulary is not provided and labels are string. loss_fn: Optional loss function. name: name of the head. If provided, summary and metrics keys will be suffixed by `"/" + name`. Also used as `name_scope` when creating ops. Returns: An instance of `_Head` for multi-label classification. Raises: ValueError: if `n_classes` or `thresholds` is invalid. """ thresholds = tuple(thresholds) if thresholds else tuple() if n_classes is None or n_classes < 2: raise ValueError( 'n_classes must be > 1 for multi-class classification. ' 'Given: {}'.format(n_classes)) for threshold in thresholds: if (threshold <= 0.0) or (threshold >= 1.0): raise ValueError( 'thresholds must be in (0, 1) range. Given: {}'.format(threshold)) if label_vocabulary is not None: if not isinstance(label_vocabulary, (list, tuple)): raise ValueError( 'label_vocabulary must be a list or tuple. ' 'Given type: {}'.format(type(label_vocabulary))) if len(label_vocabulary) != n_classes: raise ValueError( 'Length of label_vocabulary must be n_classes ({}). ' 'Given: {}'.format(n_classes, len(label_vocabulary))) if loss_fn: _validate_loss_fn_args(loss_fn) return _MultiLabelHead( n_classes=n_classes, weight_column=weight_column, thresholds=thresholds, label_vocabulary=label_vocabulary, loss_fn=loss_fn, name=name) class _MultiLabelHead(head_lib._Head): # pylint:disable=protected-access """`_Head` for multi-label classification.""" def __init__(self, n_classes, weight_column=None, thresholds=None, label_vocabulary=None, loss_fn=None, name=None): self._n_classes = n_classes self._weight_column = weight_column self._thresholds = thresholds self._label_vocabulary = label_vocabulary self._loss_fn = loss_fn self._name = name @property def name(self): return self._name @property def logits_dimension(self): return self._n_classes def _process_labels(self, labels): if labels is None: raise ValueError( 'You must provide a labels Tensor. Given: None. ' 'Suggested troubleshooting steps: Check that your data contain ' 'your label feature. Check that your input_fn properly parses and ' 'returns labels.') if isinstance(labels, sparse_tensor.SparseTensor): if labels.dtype == dtypes.string: label_ids_values = lookup_ops.index_table_from_tensor( vocabulary_list=tuple(self._label_vocabulary), name='class_id_lookup').lookup(labels.values) label_ids = sparse_tensor.SparseTensor( indices=labels.indices, values=label_ids_values, dense_shape=labels.dense_shape) else: label_ids = labels return math_ops.to_int64( sparse_ops.sparse_to_indicator(label_ids, self._n_classes)) msg = ('labels shape must be [batch_size, {}]. ' 'Given: ').format(self._n_classes) labels_shape = array_ops.shape(labels) check_rank_op = control_flow_ops.Assert( math_ops.equal(array_ops.rank(labels), 2), data=[msg, labels_shape]) check_label_dim = control_flow_ops.Assert( math_ops.equal(labels_shape[-1], self._n_classes), data=[msg, labels_shape]) with ops.control_dependencies([check_rank_op, check_label_dim]): return array_ops.identity(labels) def create_loss(self, features, mode, logits, labels): """See `Head`.""" del mode # Unused for this head. processed_labels = self._process_labels(labels) if self._loss_fn: unweighted_loss = _call_loss_fn( loss_fn=self._loss_fn, labels=processed_labels, logits=logits, features=features) else: unweighted_loss = losses.sigmoid_cross_entropy( multi_class_labels=processed_labels, logits=logits, reduction=losses.Reduction.NONE) # Averages loss over classes. unweighted_loss = math_ops.reduce_mean( unweighted_loss, axis=-1, keep_dims=True) weights = head_lib._weights(features, self._weight_column) # pylint:disable=protected-access, weighted_sum_loss = losses.compute_weighted_loss( unweighted_loss, weights=weights, reduction=losses.Reduction.SUM) # _weights() can return 1. example_weight_sum = math_ops.reduce_sum( weights * array_ops.ones_like(unweighted_loss)) return head_lib.LossSpec( weighted_sum_loss=weighted_sum_loss, example_weight_sum=example_weight_sum, processed_labels=processed_labels) def create_estimator_spec( self, features, mode, logits, labels=None, train_op_fn=None): """See `Head`.""" with ops.name_scope(self._name, 'head'): logits = head_lib._check_logits(logits, self.logits_dimension) # pylint:disable=protected-access # Predict. pred_keys = prediction_keys.PredictionKeys with ops.name_scope(None, 'predictions', (logits,)): probabilities = math_ops.sigmoid(logits, name=pred_keys.PROBABILITIES) predictions = { pred_keys.LOGITS: logits, pred_keys.PROBABILITIES: probabilities, } if mode == model_fn.ModeKeys.PREDICT: classifier_output = head_lib._classification_output( # pylint:disable=protected-access scores=probabilities, n_classes=self._n_classes, label_vocabulary=self._label_vocabulary) return model_fn.EstimatorSpec( mode=model_fn.ModeKeys.PREDICT, predictions=predictions, export_outputs={ _DEFAULT_SERVING_KEY: classifier_output, head_lib._CLASSIFY_SERVING_KEY: classifier_output, # pylint:disable=protected-access head_lib._PREDICT_SERVING_KEY: ( # pylint:disable=protected-access export_output.PredictOutput(predictions)) }) (weighted_sum_loss, example_weight_sum, processed_labels) = self.create_loss( features=features, mode=mode, logits=logits, labels=labels) # Eval. if mode == model_fn.ModeKeys.EVAL: return model_fn.EstimatorSpec( mode=model_fn.ModeKeys.EVAL, predictions=predictions, loss=weighted_sum_loss, eval_metric_ops=self._eval_metric_ops( labels=processed_labels, probabilities=probabilities, weights=head_lib._weights(features, self._weight_column), # pylint:disable=protected-access, weighted_sum_loss=weighted_sum_loss, example_weight_sum=example_weight_sum)) # Train. if train_op_fn is None: raise ValueError('train_op_fn can not be None.') with ops.name_scope(''): summary.scalar( head_lib._summary_key(self._name, metric_keys.MetricKeys.LOSS), # pylint:disable=protected-access weighted_sum_loss) summary.scalar( head_lib._summary_key( # pylint:disable=protected-access self._name, metric_keys.MetricKeys.LOSS_MEAN), weighted_sum_loss / example_weight_sum) return model_fn.EstimatorSpec( mode=model_fn.ModeKeys.TRAIN, predictions=predictions, loss=weighted_sum_loss, train_op=train_op_fn(weighted_sum_loss)) def _eval_metric_ops(self, labels, probabilities, weights, weighted_sum_loss, example_weight_sum): """Returns a dict of metrics for eval_metric_ops.""" with ops.name_scope( None, 'metrics', [labels, probabilities, weights, weighted_sum_loss, example_weight_sum ]): keys = metric_keys.MetricKeys metric_ops = { # Estimator already adds a metric for loss. head_lib._summary_key(self._name, keys.LOSS_MEAN): # pylint:disable=protected-access metrics_lib.mean( # Both values and weights here are reduced, scalar Tensors. # values is the actual mean we want, but we pass the scalar # example_weight_sum in order to return the correct update_op # alongside the value_op for streaming metrics. values=(weighted_sum_loss / example_weight_sum), weights=example_weight_sum, name=keys.LOSS_MEAN), head_lib._summary_key(self._name, keys.AUC): # pylint:disable=protected-access metrics_lib.auc(labels=labels, predictions=probabilities, weights=weights, name=keys.AUC), head_lib._summary_key(self._name, keys.AUC_PR): # pylint:disable=protected-access metrics_lib.auc(labels=labels, predictions=probabilities, weights=weights, curve='PR', name=keys.AUC_PR), } for threshold in self._thresholds: accuracy_key = keys.ACCURACY_AT_THRESHOLD % threshold metric_ops[head_lib._summary_key(self._name, accuracy_key)] = ( # pylint:disable=protected-access head_lib._accuracy_at_threshold( # pylint:disable=protected-access labels=labels, predictions=probabilities, weights=weights, threshold=threshold, name=accuracy_key)) # Precision for positive examples. precision_key = keys.PRECISION_AT_THRESHOLD % threshold metric_ops[head_lib._summary_key(self._name, precision_key)] = ( # pylint:disable=protected-access head_lib._precision_at_threshold( # pylint:disable=protected-access labels=labels, predictions=probabilities, weights=weights, threshold=threshold, name=precision_key)) # Recall for positive examples. recall_key = keys.RECALL_AT_THRESHOLD % threshold metric_ops[head_lib._summary_key(self._name, recall_key)] = ( # pylint:disable=protected-access head_lib._recall_at_threshold( # pylint:disable=protected-access labels=labels, predictions=probabilities, weights=weights, threshold=threshold, name=recall_key)) return metric_ops def _validate_loss_fn_args(loss_fn): """Validates loss_fn arguments. Required arguments: labels, logits. Optional arguments: features. Args: loss_fn: The loss function. Raises: ValueError: If the signature is unexpected. """ loss_fn_args = util.fn_args(loss_fn) for required_arg in ['labels', 'logits']: if required_arg not in loss_fn_args: raise ValueError( 'loss_fn must contain argument: {}. ' 'Given arguments: {}'.format(required_arg, loss_fn_args)) invalid_args = list(set(loss_fn_args) - set(['labels', 'logits', 'features'])) if invalid_args: raise ValueError('loss_fn has unexpected args: {}'.format(invalid_args)) def _call_loss_fn(loss_fn, labels, logits, features): """Calls loss_fn and checks the returned shape. Args: loss_fn: The loss function. labels: Processed labels Tensor. logits: Logits Tensor of shape [batch_size, logits_dimension]. features: Features dict. Returns: Loss Tensor with shape [batch_size, 1]. """ loss_fn_args = util.fn_args(loss_fn) kwargs = {} if 'features' in loss_fn_args: kwargs['features'] = features unweighted_loss = loss_fn(labels=labels, logits=logits, **kwargs) batch_size = array_ops.shape(logits)[0] loss_shape = array_ops.shape(unweighted_loss) check_shape_op = control_flow_ops.Assert( math_ops.reduce_all(math_ops.equal(loss_shape, [batch_size, 1])), data=[ 'loss_fn must return Tensor of shape [batch_size, 1]. Given: ', loss_shape]) with ops.control_dependencies([check_shape_op]): return array_ops.identity(unweighted_loss)
#!/usr/bin/env python # Copyright (c) 2009, Giampaolo Rodola'. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. """ A test script which attempts to detect memory leaks by calling C functions many times and compare process memory usage before and after the calls. It might produce false positives. """ import functools import gc import os import socket import sys import threading import time import psutil import psutil._common from psutil._compat import xrange, callable from test_psutil import (WINDOWS, POSIX, OSX, LINUX, SUNOS, BSD, TESTFN, RLIMIT_SUPPORT, TRAVIS) from test_psutil import (reap_children, supports_ipv6, safe_remove, get_test_subprocess) if sys.version_info < (2, 7): import unittest2 as unittest # https://pypi.python.org/pypi/unittest2 else: import unittest LOOPS = 1000 TOLERANCE = 4096 SKIP_PYTHON_IMPL = True def skip_if_linux(): return unittest.skipIf(LINUX and SKIP_PYTHON_IMPL, "not worth being tested on LINUX (pure python)") class Base(unittest.TestCase): proc = psutil.Process() def execute(self, function, *args, **kwargs): def call_many_times(): for x in xrange(LOOPS - 1): self.call(function, *args, **kwargs) del x gc.collect() return self.get_mem() self.call(function, *args, **kwargs) self.assertEqual(gc.garbage, []) self.assertEqual(threading.active_count(), 1) # RSS comparison # step 1 rss1 = call_many_times() # step 2 rss2 = call_many_times() difference = rss2 - rss1 if difference > TOLERANCE: # This doesn't necessarily mean we have a leak yet. # At this point we assume that after having called the # function so many times the memory usage is stabilized # and if there are no leaks it should not increase any # more. # Let's keep calling fun for 3 more seconds and fail if # we notice any difference. stop_at = time.time() + 3 while True: self.call(function, *args, **kwargs) if time.time() >= stop_at: break del stop_at gc.collect() rss3 = self.get_mem() difference = rss3 - rss2 if rss3 > rss2: self.fail("rss2=%s, rss3=%s, difference=%s" % (rss2, rss3, difference)) def execute_w_exc(self, exc, function, *args, **kwargs): kwargs['_exc'] = exc self.execute(function, *args, **kwargs) def get_mem(self): return psutil.Process().memory_info()[0] def call(self, function, *args, **kwargs): raise NotImplementedError("must be implemented in subclass") class TestProcessObjectLeaks(Base): """Test leaks of Process class methods and properties""" def setUp(self): gc.collect() def tearDown(self): reap_children() def call(self, function, *args, **kwargs): if callable(function): if '_exc' in kwargs: exc = kwargs.pop('_exc') self.assertRaises(exc, function, *args, **kwargs) else: try: function(*args, **kwargs) except psutil.Error: pass else: meth = getattr(self.proc, function) if '_exc' in kwargs: exc = kwargs.pop('_exc') self.assertRaises(exc, meth, *args, **kwargs) else: try: meth(*args, **kwargs) except psutil.Error: pass @skip_if_linux() def test_name(self): self.execute('name') @skip_if_linux() def test_cmdline(self): self.execute('cmdline') @skip_if_linux() def test_exe(self): self.execute('exe') @skip_if_linux() def test_ppid(self): self.execute('ppid') @unittest.skipUnless(POSIX, "POSIX only") @skip_if_linux() def test_uids(self): self.execute('uids') @unittest.skipUnless(POSIX, "POSIX only") @skip_if_linux() def test_gids(self): self.execute('gids') @skip_if_linux() def test_status(self): self.execute('status') def test_nice_get(self): self.execute('nice') def test_nice_set(self): niceness = psutil.Process().nice() self.execute('nice', niceness) @unittest.skipUnless(hasattr(psutil.Process, 'ionice'), "Linux and Windows Vista only") def test_ionice_get(self): self.execute('ionice') @unittest.skipUnless(hasattr(psutil.Process, 'ionice'), "Linux and Windows Vista only") def test_ionice_set(self): if WINDOWS: value = psutil.Process().ionice() self.execute('ionice', value) else: from psutil._pslinux import cext self.execute('ionice', psutil.IOPRIO_CLASS_NONE) fun = functools.partial(cext.proc_ioprio_set, os.getpid(), -1, 0) self.execute_w_exc(OSError, fun) @unittest.skipIf(OSX or SUNOS, "feature not supported on this platform") @skip_if_linux() def test_io_counters(self): self.execute('io_counters') @unittest.skipUnless(WINDOWS, "not worth being tested on posix") def test_username(self): self.execute('username') @skip_if_linux() def test_create_time(self): self.execute('create_time') @skip_if_linux() def test_num_threads(self): self.execute('num_threads') @unittest.skipUnless(WINDOWS, "Windows only") def test_num_handles(self): self.execute('num_handles') @unittest.skipUnless(POSIX, "POSIX only") @skip_if_linux() def test_num_fds(self): self.execute('num_fds') @skip_if_linux() def test_threads(self): self.execute('threads') @skip_if_linux() def test_cpu_times(self): self.execute('cpu_times') @skip_if_linux() def test_memory_info(self): self.execute('memory_info') @skip_if_linux() def test_memory_info_ex(self): self.execute('memory_info_ex') @unittest.skipUnless(POSIX, "POSIX only") @skip_if_linux() def test_terminal(self): self.execute('terminal') @unittest.skipIf(POSIX and SKIP_PYTHON_IMPL, "not worth being tested on POSIX (pure python)") def test_resume(self): self.execute('resume') @skip_if_linux() def test_cwd(self): self.execute('cwd') @unittest.skipUnless(WINDOWS or LINUX or BSD, "Windows or Linux or BSD only") def test_cpu_affinity_get(self): self.execute('cpu_affinity') @unittest.skipUnless(WINDOWS or LINUX or BSD, "Windows or Linux or BSD only") def test_cpu_affinity_set(self): affinity = psutil.Process().cpu_affinity() self.execute('cpu_affinity', affinity) if not TRAVIS: self.execute_w_exc(ValueError, 'cpu_affinity', [-1]) @skip_if_linux() def test_open_files(self): safe_remove(TESTFN) # needed after UNIX socket test has run with open(TESTFN, 'w'): self.execute('open_files') # OSX implementation is unbelievably slow @unittest.skipIf(OSX, "OSX implementation is too slow") @skip_if_linux() def test_memory_maps(self): self.execute('memory_maps') @unittest.skipUnless(LINUX, "Linux only") @unittest.skipUnless(LINUX and RLIMIT_SUPPORT, "only available on Linux >= 2.6.36") def test_rlimit_get(self): self.execute('rlimit', psutil.RLIMIT_NOFILE) @unittest.skipUnless(LINUX, "Linux only") @unittest.skipUnless(LINUX and RLIMIT_SUPPORT, "only available on Linux >= 2.6.36") def test_rlimit_set(self): limit = psutil.Process().rlimit(psutil.RLIMIT_NOFILE) self.execute('rlimit', psutil.RLIMIT_NOFILE, limit) self.execute_w_exc(OSError, 'rlimit', -1) @skip_if_linux() # Windows implementation is based on a single system-wide function @unittest.skipIf(WINDOWS, "tested later") def test_connections(self): def create_socket(family, type): sock = socket.socket(family, type) sock.bind(('', 0)) if type == socket.SOCK_STREAM: sock.listen(1) return sock socks = [] socks.append(create_socket(socket.AF_INET, socket.SOCK_STREAM)) socks.append(create_socket(socket.AF_INET, socket.SOCK_DGRAM)) if supports_ipv6(): socks.append(create_socket(socket.AF_INET6, socket.SOCK_STREAM)) socks.append(create_socket(socket.AF_INET6, socket.SOCK_DGRAM)) if hasattr(socket, 'AF_UNIX'): safe_remove(TESTFN) s = socket.socket(socket.AF_UNIX, socket.SOCK_STREAM) s.bind(TESTFN) s.listen(1) socks.append(s) kind = 'all' # TODO: UNIX sockets are temporarily implemented by parsing # 'pfiles' cmd output; we don't want that part of the code to # be executed. if SUNOS: kind = 'inet' try: self.execute('connections', kind=kind) finally: for s in socks: s.close() p = get_test_subprocess() DEAD_PROC = psutil.Process(p.pid) DEAD_PROC.kill() DEAD_PROC.wait() del p class TestProcessObjectLeaksZombie(TestProcessObjectLeaks): """Same as above but looks for leaks occurring when dealing with zombie processes raising NoSuchProcess exception. """ proc = DEAD_PROC def call(self, *args, **kwargs): try: TestProcessObjectLeaks.call(self, *args, **kwargs) except psutil.NoSuchProcess: pass if not POSIX: def test_kill(self): self.execute('kill') def test_terminate(self): self.execute('terminate') def test_suspend(self): self.execute('suspend') def test_resume(self): self.execute('resume') def test_wait(self): self.execute('wait') class TestModuleFunctionsLeaks(Base): """Test leaks of psutil module functions.""" def setUp(self): gc.collect() def call(self, function, *args, **kwargs): fun = getattr(psutil, function) fun(*args, **kwargs) @skip_if_linux() def test_cpu_count_logical(self): psutil.cpu_count = psutil._psplatform.cpu_count_logical self.execute('cpu_count') @skip_if_linux() def test_cpu_count_physical(self): psutil.cpu_count = psutil._psplatform.cpu_count_physical self.execute('cpu_count') @skip_if_linux() def test_boot_time(self): self.execute('boot_time') @unittest.skipIf(POSIX and SKIP_PYTHON_IMPL, "not worth being tested on POSIX (pure python)") def test_pid_exists(self): self.execute('pid_exists', os.getpid()) def test_virtual_memory(self): self.execute('virtual_memory') # TODO: remove this skip when this gets fixed @unittest.skipIf(SUNOS, "not worth being tested on SUNOS (uses a subprocess)") def test_swap_memory(self): self.execute('swap_memory') @skip_if_linux() def test_cpu_times(self): self.execute('cpu_times') @skip_if_linux() def test_per_cpu_times(self): self.execute('cpu_times', percpu=True) @unittest.skipIf(POSIX and SKIP_PYTHON_IMPL, "not worth being tested on POSIX (pure python)") def test_disk_usage(self): self.execute('disk_usage', '.') def test_disk_partitions(self): self.execute('disk_partitions') @skip_if_linux() def test_net_io_counters(self): self.execute('net_io_counters') @unittest.skipIf(LINUX and not os.path.exists('/proc/diskstats'), '/proc/diskstats not available on this Linux version') @skip_if_linux() def test_disk_io_counters(self): self.execute('disk_io_counters') # XXX - on Windows this produces a false positive @unittest.skipIf(WINDOWS, "XXX produces a false positive on Windows") def test_users(self): self.execute('users') @unittest.skipIf(LINUX, "not worth being tested on Linux (pure python)") def test_net_connections(self): self.execute('net_connections') def test_net_if_addrs(self): self.execute('net_if_addrs') @unittest.skipIf(TRAVIS, "EPERM on travis") def test_net_if_stats(self): self.execute('net_if_stats') def main(): test_suite = unittest.TestSuite() tests = [TestProcessObjectLeaksZombie, TestProcessObjectLeaks, TestModuleFunctionsLeaks] for test in tests: test_suite.addTest(unittest.makeSuite(test)) result = unittest.TextTestRunner(verbosity=2).run(test_suite) return result.wasSuccessful() if __name__ == '__main__': if not main(): sys.exit(1)
# Lint as: python3 """LIT wrappers for T5, supporting both HuggingFace and SavedModel formats.""" import re from typing import List import attr from lit_nlp.api import model as lit_model from lit_nlp.api import types as lit_types from lit_nlp.examples.models import model_utils from lit_nlp.lib import utils import tensorflow as tf # tensorflow_text is required for T5 SavedModel import tensorflow_text # pylint: disable=unused-import import transformers from rouge_score import rouge_scorer JsonDict = lit_types.JsonDict def masked_token_mean(vectors, masks): """Mean over tokens. Args: vectors: <tf.float32>[batch_size, num_tokens, emb_dim] masks: <tf.int32>[batch_size, num_tokens] Returns: <tf.float32>[batch_size, emb_dim] """ masks = tf.cast(masks, tf.float32) weights = masks / tf.reduce_sum(masks, axis=1, keepdims=True) return tf.reduce_sum(vectors * tf.expand_dims(weights, axis=-1), axis=1) @attr.s(auto_attribs=True, kw_only=True) class T5ModelConfig(object): """Config options for a T5 generation model.""" # Input options inference_batch_size: int = 4 # Generation options beam_size: int = 4 max_gen_length: int = 50 num_to_generate: int = 1 # Decoding options token_top_k: int = 10 output_attention: bool = False def validate_t5_model(model: lit_model.Model) -> lit_model.Model: """Validate that a given model looks like a T5 model. This checks the model spec at runtime; it is intended to be used before server start, such as in the __init__() method of a wrapper class. Args: model: a LIT model Returns: model: the same model Raises: AssertionError: if the model's spec does not match that expected for a T5 model. """ # Check inputs ispec = model.input_spec() assert "input_text" in ispec assert isinstance(ispec["input_text"], lit_types.TextSegment) if "target_text" in ispec: assert isinstance(ispec["target_text"], lit_types.TextSegment) # Check outputs ospec = model.output_spec() assert "output_text" in ospec assert isinstance( ospec["output_text"], (lit_types.GeneratedText, lit_types.GeneratedTextCandidates)) assert ospec["output_text"].parent == "target_text" return model class T5SavedModel(lit_model.Model): """T5 from a TensorFlow SavedModel, for black-box access. To create a SavedModel from a regular T5 checkpoint, see https://github.com/google-research/text-to-text-transfer-transformer#export """ def __init__(self, saved_model_path: str, model=None, **config_kw): super().__init__() # By default, SavedModels from the original T5 codebase have batch_size=1 # hardcoded. Use setdefault here so that the user can still override if # they've fixed this upstream. config_kw.setdefault("inference_batch_size", 1) self.config = T5ModelConfig(**config_kw) self.model = model or tf.saved_model.load(saved_model_path) ## # LIT API implementations def max_minibatch_size(self) -> int: # The lit.Model base class handles batching automatically in the # implementation of predict(), and uses this value as the batch size. return self.config.inference_batch_size def predict_minibatch(self, inputs): """Predict on a single minibatch of examples.""" model_inputs = tf.constant([ex["input_text"] for ex in inputs]) model_outputs = self.model.signatures["serving_default"](model_inputs) return [{ "output_text": m.decode("utf-8") } for m in model_outputs["outputs"].numpy()] def input_spec(self): return { "input_text": lit_types.TextSegment(), "target_text": lit_types.TextSegment(required=False), } def output_spec(self): return {"output_text": lit_types.GeneratedText(parent="target_text")} class T5HFModel(lit_model.Model): """T5 using HuggingFace Transformers and Keras. This version supports embeddings, attention, and force-decoding of the target text, as well as more options to control decoding (such as beam search). """ @property def num_layers(self): return self.model.config.num_layers def __init__(self, model_name="t5-small", model=None, tokenizer=None, **config_kw): super().__init__() self.config = T5ModelConfig(**config_kw) assert self.config.num_to_generate <= self.config.beam_size self.tokenizer = tokenizer or transformers.T5Tokenizer.from_pretrained( model_name) self.model = model or model_utils.load_pretrained( transformers.TFT5ForConditionalGeneration, model_name, output_hidden_states=True, output_attentions=self.config.output_attention) def _encode_texts(self, texts: List[str]): return self.tokenizer.batch_encode_plus( texts, return_tensors="tf", padding="longest", truncation="longest_first") def _force_decode(self, encoded_inputs, encoded_targets): """Get predictions for a batch of tokenized examples. Each forward pass produces the following: logits: batch_size x dec_len x vocab_size decoder_past_key_value_states: tuple with cached outputs. dec_states: tuple[len:dec_layers]: batch_size x dec_len x hid_size dec_attn: [optional] tuple[len:dec_layers+1] batch_size x num_heads x dec_len x dec_len enc_final_state: batch_size x enc_len x hid_size enc_states: tuple[len:enc_layers]: batch_size x enc_len x hid_size enc_attn: [optional] tuple[len:enc_layers+1] batch_size x num_heads x enc_len x enc_len The two optional attention fields are only returned if config.output_attention is set. Args: encoded_inputs: Dict as returned from Tokenizer for inputs. encoded_targets: Dict as returned from Tokenizer for outputs Returns: batched_outputs: Dict[str, tf.Tensor] """ results = self.model( input_ids=encoded_inputs["input_ids"], decoder_input_ids=encoded_targets["input_ids"], attention_mask=encoded_inputs["attention_mask"], decoder_attention_mask=encoded_targets["attention_mask"]) model_probs = tf.nn.softmax(results.logits, axis=-1) top_k = tf.math.top_k( model_probs, k=self.config.token_top_k, sorted=True, name=None) batched_outputs = { "input_ids": encoded_inputs["input_ids"], "input_ntok": tf.reduce_sum(encoded_inputs["attention_mask"], axis=1), "target_ids": encoded_targets["input_ids"], "target_ntok": tf.reduce_sum(encoded_targets["attention_mask"], axis=1), "top_k_indices": top_k.indices, "top_k_probs": top_k.values, } # encoder_last_hidden_state is <float>[batch_size, num_tokens, emb_dim] # take the mean over real tokens to get <float>[batch_size, emb_dim] batched_outputs["encoder_final_embedding"] = masked_token_mean( results.encoder_last_hidden_state, encoded_inputs["attention_mask"]) if self.config.output_attention: for i in range(len(results.decoder_attentions)): batched_outputs[ f"decoder_layer_{i+1:d}_attention"] = results.decoder_attentions[i] for i in range(len(results.encoder_attentions)): batched_outputs[ f"encoder_layer_{i+1:d}_attention"] = results.encoder_attentions[i] return batched_outputs def _postprocess(self, preds): """Post-process single-example preds. Operates on numpy arrays.""" # Return tokenization for input text. input_ntok = preds.pop("input_ntok") input_ids = preds.pop("input_ids")[:input_ntok] preds["input_tokens"] = self.tokenizer.convert_ids_to_tokens(input_ids) # Return tokenization for target text. target_ntok = preds.pop("target_ntok") target_ids = preds.pop("target_ids")[:target_ntok] preds["target_tokens"] = self.tokenizer.convert_ids_to_tokens(target_ids) # Decode predicted top-k tokens. # token_topk_preds will be a List[List[(word, prob)]] # Initialize prediction for 0th token as N/A. token_topk_preds = [[("N/A", 1.)]] pred_ids = preds.pop("top_k_indices")[:target_ntok] # <int>[num_tokens, k] pred_probs = preds.pop( "top_k_probs")[:target_ntok] # <float32>[num_tokens, k] for token_pred_ids, token_pred_probs in zip(pred_ids, pred_probs): token_pred_words = self.tokenizer.convert_ids_to_tokens(token_pred_ids) token_topk_preds.append(list(zip(token_pred_words, token_pred_probs))) preds["pred_tokens"] = token_topk_preds # Decode generated ids candidates = [ self.tokenizer.decode(ids, skip_special_tokens=True) for ids in preds.pop("generated_ids") ] if self.config.num_to_generate > 1: preds["output_text"] = [(s, None) for s in candidates] else: preds["output_text"] = candidates[0] # Process attention fields, if present. for key in preds: if not re.match(r"\w+_layer_(\d+)/attention", key): continue if key.startswith("encoder_"): ntok = input_ntok elif key.startswith("decoder_"): ntok = target_ntok else: raise ValueError(f"Invalid attention key: '{key}'") # Select only real tokens, since most of this matrix is padding. # <float32>[num_heads, max_seq_length, max_seq_length] # -> <float32>[num_heads, num_tokens, num_tokens] preds[key] = preds[key][:, :ntok, :ntok].transpose((0, 2, 1)) # Make a copy of this array to avoid memory leaks, since NumPy otherwise # keeps a pointer around that prevents the source array from being GCed. preds[key] = preds[key].copy() return preds ## # LIT API implementations def max_minibatch_size(self) -> int: # The lit.Model base class handles batching automatically in the # implementation of predict(), and uses this value as the batch size. return self.config.inference_batch_size def predict_minibatch(self, inputs): """Run model on a single batch. Args: inputs: List[Dict] with fields as described by input_spec() Returns: outputs: List[Dict] with fields as described by output_spec() """ # Text as sequence of sentencepiece ID"s. encoded_inputs = self._encode_texts([ex["input_text"] for ex in inputs]) encoded_targets = self._encode_texts( [ex.get("target_text", "") for ex in inputs]) ## # Force-decode on target text, and also get encoder embs and attention. batched_outputs = self._force_decode(encoded_inputs, encoded_targets) # Get the conditional generation from the model. # Workaround for output_hidden not being compatible with generate. # See https://github.com/huggingface/transformers/issues/8361 self.model.config.output_hidden_states = False generated_ids = self.model.generate( encoded_inputs.input_ids, num_beams=self.config.beam_size, attention_mask=encoded_inputs.attention_mask, max_length=self.config.max_gen_length, num_return_sequences=self.config.num_to_generate) # [batch_size*num_return_sequences, num_steps] # -> [batch_size, num_return_sequences, num_steps] batched_outputs["generated_ids"] = tf.reshape( generated_ids, [-1, self.config.num_to_generate, generated_ids.shape[-1]]) self.model.config.output_hidden_states = True # Convert to numpy for post-processing. detached_outputs = {k: v.numpy() for k, v in batched_outputs.items()} # Split up batched outputs, then post-process each example. unbatched_outputs = utils.unbatch_preds(detached_outputs) return list(map(self._postprocess, unbatched_outputs)) def input_spec(self): return { "input_text": lit_types.TextSegment(), "target_text": lit_types.TextSegment(required=False), } def output_spec(self): spec = { "output_text": lit_types.GeneratedText(parent="target_text"), "input_tokens": lit_types.Tokens(parent="input_text"), "encoder_final_embedding": lit_types.Embeddings(), # If target text is given, the following will also be populated. "target_tokens": lit_types.Tokens(parent="target_text"), "pred_tokens": lit_types.TokenTopKPreds(align="target_tokens"), } if self.config.num_to_generate > 1: spec["output_text"] = lit_types.GeneratedTextCandidates( parent="target_text") if self.config.output_attention: # Add attention for each layer. for i in range(self.num_layers): spec[f"encoder_layer_{i+1:d}_attention"] = lit_types.AttentionHeads( align_in="input_tokens", align_out="input_tokens") spec[f"decoder_layer_{i+1:d}_attention"] = lit_types.AttentionHeads( align_in="target_tokens", align_out="target_tokens") return spec ## # Task-specific wrapper classes. class TranslationWrapper(lit_model.ModelWrapper): """Wrapper class for machine translation.""" # Mapping from generic T5 fields to this task FIELD_RENAMES = { "input_text": "source", "target_text": "target", "output_text": "translation", } # From Appendix D of https://arxiv.org/pdf/1910.10683.pdf. # Add more of these if your model supports them. LANGCODE_TO_NAME = { "en": "English", "de": "German", "fr": "French", "ro": "Romanian", } INPUT_TEMPLATE = "translate {source_language} to {target_language}: {source}" def __init__(self, model: lit_model.Model): model = validate_t5_model(model) super().__init__(model) def preprocess(self, ex: JsonDict) -> JsonDict: input_kw = { "source_language": self.LANGCODE_TO_NAME[ex["source_language"]], "target_language": self.LANGCODE_TO_NAME[ex["target_language"]], "source": ex["source"] } ret = {"input_text": self.INPUT_TEMPLATE.format(**input_kw)} if "target" in ex: ret["target_text"] = ex["target"] return ret ## # LIT API implementation def description(self) -> str: return "T5 for machine translation\n" + self.wrapped.description() # TODO(b/170662608): remove these after batching API is cleaned up. def max_minibatch_size(self) -> int: raise NotImplementedError("Use predict() instead.") def predict_minibatch(self, inputs): raise NotImplementedError("Use predict() instead.") def predict(self, inputs): """Predict on a single minibatch of examples.""" model_inputs = (self.preprocess(ex) for ex in inputs) outputs = self.wrapped.predict(model_inputs) return (utils.remap_dict(mo, self.FIELD_RENAMES) for mo in outputs) def predict_with_metadata(self, indexed_inputs): """As predict(), but inputs are IndexedInput.""" return self.predict((ex["data"] for ex in indexed_inputs)) def input_spec(self): spec = lit_types.remap_spec(self.wrapped.input_spec(), self.FIELD_RENAMES) spec["source_language"] = lit_types.CategoryLabel() spec["target_language"] = lit_types.CategoryLabel() return spec def output_spec(self): return lit_types.remap_spec(self.wrapped.output_spec(), self.FIELD_RENAMES) class SummarizationWrapper(lit_model.ModelWrapper): """Wrapper class to perform a summarization task.""" # Mapping from generic T5 fields to this task FIELD_RENAMES = { "input_text": "document", "target_text": "reference", } def __init__(self, model: lit_model.Model): model = validate_t5_model(model) super().__init__(model) # TODO(gehrmann): temp solution for ROUGE. self._scorer = rouge_scorer.RougeScorer(["rougeL"], use_stemmer=True) # If output is List[(str, score)] instead of just str self._multi_output = isinstance(self.output_spec()["output_text"], lit_types.GeneratedTextCandidates) self._get_pred_string = ( lit_types.GeneratedTextCandidates.top_text if self._multi_output else (lambda x: x)) def preprocess(self, ex: JsonDict) -> JsonDict: ret = {"input_text": "summarize: " + ex["document"]} if "reference" in ex: ret["target_text"] = ex["reference"] return ret ## # LIT API implementation def description(self) -> str: return "T5 for summarization\n" + self.wrapped.description() # TODO(b/170662608): remove these after batching API is cleaned up. def max_minibatch_size(self) -> int: raise NotImplementedError("Use predict() instead.") def predict_minibatch(self, inputs): raise NotImplementedError("Use predict() instead.") def predict(self, inputs): """Predict on a single minibatch of examples.""" inputs = list(inputs) # needs to be referenced below, so keep full list model_inputs = (self.preprocess(ex) for ex in inputs) outputs = self.wrapped.predict(model_inputs) outputs = (utils.remap_dict(mo, self.FIELD_RENAMES) for mo in outputs) # TODO(gehrmann): temp solution to get ROUGE scores in data table. for ex, mo in zip(inputs, outputs): score = self._scorer.score( target=ex["reference"], prediction=self._get_pred_string(mo["output_text"])) mo["rougeL"] = float(score["rougeL"].fmeasure) yield mo def predict_with_metadata(self, indexed_inputs): """As predict(), but inputs are IndexedInput.""" return self.predict((ex["data"] for ex in indexed_inputs)) def input_spec(self): return lit_types.remap_spec(self.wrapped.input_spec(), self.FIELD_RENAMES) def output_spec(self): spec = lit_types.remap_spec(self.wrapped.output_spec(), self.FIELD_RENAMES) spec["rougeL"] = lit_types.Scalar() return spec
#!/usr/bin/env python # -*- coding: utf-8 -*- from __future__ import absolute_import from __future__ import division from __future__ import print_function from __future__ import unicode_literals import numpy as np import time import warnings from . import basex from . import hansenlaw from . import dasch from . import onion_bordas from . import direct from . import tools class Transform(object): """Abel transform image class. This class provides whole image forward and inverse Abel transformations, together with preprocessing (centering, symmetrizing) and post processing (integration) functions. The following class attributes are available, depending on the calculation. Attributes ---------- transform : numpy 2D array the 2D forward/reverse Abel transform. angular_integration : tuple radial coordinates, with the radial intensity (speed) distribution. residual : numpy 2D array residual image (not currently implemented). IM: numpy 2D array the input image, re-centered (optional) with an odd-size width method : str transform method, as specified by the input option. direction: str transform direction, as specified by the input option. """ _verbose = False def __init__(self, IM, direction='inverse', method='three_point', center='none', symmetry_axis=None, use_quadrants=(True, True, True, True), symmetrize_method='average', angular_integration=False, transform_options=dict(), center_options=dict(), angular_integration_options=dict(), recast_as_float64=True, verbose=False): """The one stop transform function. Parameters ---------- IM : a NxM numpy array This is the image to be transformed direction : str The type of Abel transform to be performed. ``forward`` A 'forward' Abel transform takes a (2D) slice of a 3D image and returns the 2D projection. ``inverse`` An 'inverse' Abel transform takes a 2D projection and reconstructs a 2D slice of the 3D image. The default is ``inverse``. method : str specifies which numerical approximation to the Abel transform should be employed (see below). The options are ``hansenlaw`` the recursive algorithm described by Hansen and Law. ``basex`` the Gaussian "basis set expansion" method of Dribinski et al. ``direct`` a naive implementation of the analytical formula by Roman Yurchuk. ``two_point`` the two-point transform of Dasch (1992). ``three_point`` the three-point transform of Dasch (1992). ``onion_bordas`` the algorithm of Bordas and co-workers (1996), re-implemented by Rallis, Wells and co-workers (2014). ``onion_peeling`` the onion peeling deconvolution as described by Dasch (1992) center : tuple or str If a tuple (float, float) is provided, this specifies the image center in (y,x) (row, column) format. A value `None` can be supplied if no centering is desired in one dimension, for example 'center=(None, 250)'. If a string is provided, an automatic centering algorithm is used ``image_center`` center is assumed to be the center of the image. ``slice`` the center is found my comparing slices in the horizontal and vertical directions ``com`` the center is calculated as the center of mass ``gaussian`` the center is found using a fit to a Gaussian function. This only makes sense if your data looks like a Gaussian. ``none`` (Default) No centering is performed. An image with an odd number of columns must be provided. symmetry_axis : None, int or tuple Symmetrize the image about the numpy axis 0 (vertical), 1 (horizontal), (0,1) (both axes) use_quadrants : tuple of 4 booleans select quadrants to be used in the analysis: (Q0,Q1,Q2,Q3). Quadrants are numbered counter-clockwide from upper right. See note below for description of quadrants. Default is ``(True, True, True, True)``, which uses all quadrants. symmetrize_method: str Method used for symmetrizing the image. ``average`` average the quadrants, in accordance with the `symmetry_axis` ``fourier`` axial symmetry implies that the Fourier components of the 2-D projection should be real. Removing the imaginary components in reciprocal space leaves a symmetric projection. ref: Overstreet, K., et al. "Multiple scattering and the density distribution of a Cs MOT." Optics express 13.24 (2005): 9672-9682. http://dx.doi.org/10.1364/OPEX.13.009672 angular_integration: boolean integrate the image over angle to give the radial (speed) intensity distribution transform_options : tuple Additional arguments passed to the individual transform functions. See the documentation for the individual transform method for options. center_options : tuple Additional arguments to be passed to the centering function. angular_integration_options : tuple (or dict) Additional arguments passed to the angular_integration transform functions. See the documentation for angular_integration for options. recast_as_float64 : boolean True/False that determines if the input image should be recast to ``float64``. Many images are imported in other formats (such as ``uint8`` or ``uint16``) and this does not always play well with the transorm algorithms. This should probably always be set to True. (Default is True.) verbose : boolean True/False to determine if non-critical output should be printed. .. note:: Quadrant combining The quadrants can be combined (averaged) using the ``use_quadrants`` keyword in order to provide better data quality. The quadrants are numbered starting from Q0 in the upper right and proceeding counter-clockwise: :: +--------+--------+ | Q1 * | * Q0 | | * | * | | * | * | AQ1 | AQ0 +--------o--------+ --(inverse Abel transform)--> ----o---- | * | * | AQ2 | AQ3 | * | * | | Q2 * | * Q3 | AQi == inverse Abel transform +--------+--------+ of quadrant Qi Three cases are possible: 1) symmetry_axis = 0 (vertical): :: Combine: Q01 = Q0 + Q1, Q23 = Q2 + Q3 inverse image AQ01 | AQ01 -----o----- (left and right sides equivalent) AQ23 | AQ23 2) symmetry_axis = 1 (horizontal): :: Combine: Q12 = Q1 + Q2, Q03 = Q0 + Q3 inverse image AQ12 | AQ03 -----o----- (top and bottom equivalent) AQ12 | AQ03 3) symmetry_axis = (0, 1) (both): :: Combine: Q = Q0 + Q1 + Q2 + Q3 inverse image AQ | AQ ---o--- (all quadrants equivalent) AQ | AQ Notes ----- As mentioned above, PyAbel offers several different approximations to the the exact abel transform. All the the methods should produce similar results, but depending on the level and type of noise found in the image, certain methods may perform better than others. Please see the "Transform Methods" section of the documentation for complete information. ``hansenlaw`` This "recursive algorithm" produces reliable results and is quite fast (~0.1 sec for a 1001x1001 image). It makes no assumptions about the data (apart from cylindrical symmetry). It tends to require that the data is finely sampled for good convergence. E. W. Hansen and P.-L. Law "Recursive methods for computing the Abel transform and its inverse" J. Opt. Soc. A*2, 510-520 (1985) http://dx.doi.org/10.1364/JOSAA.2.000510 ``basex`` * The "basis set exapansion" algorithm describes the data in terms of gaussian functions, which themselves can be abel transformed analytically. Because the gaussian functions are approximately the size of each pixel, this method also does not make any assumption about the shape of the data. This method is one of the de-facto standards in photoelectron/photoion imaging. Dribinski et al, 2002 (Rev. Sci. Instrum. 73, 2634) http://dx.doi.org/10.1063/1.1482156 ``direct`` This method attempts a direct integration of the Abel transform integral. It makes no assumptions about the data (apart from cylindrical symmetry), but it typically requires fine sampling to converge. Such methods are typically inefficient, but thanks to this Cython implementation (by Roman Yurchuk), this 'direct' method is competitive with the other methods. ``onion_bordas`` The onion peeling method, also known as "back projection", originates from Bordas *et al.* `Rev. Sci. Instrum. 67, 2257 (1996)`_. .. _Rev. Sci. Instrum. 67, 2257 (1996): <http://scitation.aip.org/content/aip/journal/rsi/67/6/10.1063/1.1147044> The algorithm was subsequently coded in MatLab by Rallis, Wells and co-workers, `Rev. Sci. Instrum. 85, 113105 (2014)`_. .. _Rev. Sci. Instrum. 85, 113105 (2014): <http://scitation.aip.org/content/aip/journal/rsi/85/11/10.1063/1.4899267> which was used as the basis of this Python port. See issue `#56`_. .. _#56: <https://github.com/PyAbel/PyAbel/issues/56> ``onion_peeling`` This is one of the most compact and fast algorithms, with the inverse Abel transfrom achieved in one Python code-line, PR #155. See also ``three_point`` is the onion peeling algorithm as described by Dasch (1992), reference below. ``two_point`` Another Dasch method. Simple, and fast, but not as accurate as the other methods. ``three_point`` * The "Three Point" Abel transform method exploits the observation that the value of the Abel inverted data at any radial position r is primarily determined from changes in the projection data in the neighborhood of r. This method is also very efficient once it has generated the basis sets. Dasch, 1992 (Applied Optics, Vol 31, No 8, March 1992, Pg 1146-1152). ``*`` The methods marked with a * indicate methods that generate basis sets. The first time they are run for a new image size, it takes seconds to minutes to generate the basis set. However, this basis set is saved to disk can can be reloaded, meaning that future transforms are performed much more quickly. """ # public class variables self.IM = IM # (optionally) centered, odd-width image self.method = method self.direction = direction # private internal variables self._symmetry_axis = symmetry_axis self._symmetrize_method = symmetrize_method self._use_quadrants = use_quadrants self._recast_as_float64 = recast_as_float64 _verbose = verbose # image processing self._verify_some_inputs() self._center_image(center, **center_options) self._abel_transform_image(**transform_options) self._integration(angular_integration, transform_options, **angular_integration_options) # end of class instance _verboseprint = print if _verbose else lambda *a, **k: None def _verify_some_inputs(self): if self.IM.ndim == 1 or np.shape(self.IM)[0] <= 2: raise ValueError('Data must be 2-dimensional. \ To transform a single row \ use the individual transform function.') if not np.any(self._use_quadrants): raise ValueError('No image quadrants selected to use') if not isinstance(self._symmetry_axis, (list, tuple)): # if the user supplies an int, make it into a 1-element list: self._symmetry_axis = [self._symmetry_axis] if self._recast_as_float64: self.IM = self.IM.astype('float64') def _center_image(self, center, **center_options): if center != "none": self.IM = tools.center.center_image(self.IM, center, **center_options) def _abel_transform_image(self, **transform_options): abel_transform = { "basex": basex.basex_transform, "direct": direct.direct_transform, "hansenlaw": hansenlaw.hansenlaw_transform, "onion_bordas": onion_bordas.onion_bordas_transform, "onion_peeling": dasch.onion_peeling_transform, "two_point": dasch.two_point_transform, "three_point": dasch.three_point_transform, } self._verboseprint('Calculating {0} Abel transform using {1} method -' .format(self.direction, self.method), '\n image size: {:d}x{:d}'.format(*self.IM.shape)) t0 = time.time() # split image into quadrants Q0, Q1, Q2, Q3 = tools.symmetry.get_image_quadrants( self.IM, reorient=True, symmetry_axis=self._symmetry_axis, symmetrize_method=self._symmetrize_method) def selected_transform(Z): return abel_transform[self.method](Z, direction=self.direction, **transform_options) AQ0 = AQ1 = AQ2 = AQ3 = None # Inverse Abel transform for quadrant 1 (all include Q1) AQ1 = selected_transform(Q1) if 0 in self._symmetry_axis: AQ2 = selected_transform(Q2) if 1 in self._symmetry_axis: AQ0 = selected_transform(Q0) if None in self._symmetry_axis: AQ0 = selected_transform(Q0) AQ2 = selected_transform(Q2) AQ3 = selected_transform(Q3) # reassemble image self.transform = tools.symmetry.put_image_quadrants( (AQ0, AQ1, AQ2, AQ3), original_image_shape=self.IM.shape, symmetry_axis=self._symmetry_axis) self._verboseprint("{:.2f} seconds".format(time.time()-t0)) def _integration(self, angular_integration, transform_options, **angular_integration_options): if angular_integration: if 'dr' in transform_options and\ 'dr' not in angular_integration_options: # assume user forgot to pass grid size angular_integration_options['dr'] = transform_options['dr'] self.angular_integration = tools.vmi.angular_integration( self.transform, **angular_integration_options)
from __future__ import absolute_import from __future__ import division from __future__ import print_function NX_STATUS_QUALIFIER = (0x3FF63000) NX_STATUS_WARNING = (0x00000000) NX_STATUS_ERROR = (0x80000000) NX_WARNING_BASE = (NX_STATUS_QUALIFIER | NX_STATUS_WARNING) NX_ERROR_BASE = (NX_STATUS_QUALIFIER | NX_STATUS_ERROR) NX_SUCCESS = 0 NX_ERR_INTERNAL_ERROR = (NX_ERROR_BASE | 0x001) NX_ERR_SELF_TEST_ERROR1 = (NX_ERROR_BASE | 0x002) NX_ERR_SELF_TEST_ERROR2 = (NX_ERROR_BASE | 0x003) NX_ERR_SELF_TEST_ERROR3 = (NX_ERROR_BASE | 0x004) NX_ERR_SELF_TEST_ERROR4 = (NX_ERROR_BASE | 0x005) NX_ERR_SELF_TEST_ERROR5 = (NX_ERROR_BASE | 0x006) NX_ERR_POWER_SUSPENDED = (NX_ERROR_BASE | 0x007) NX_ERR_OUTPUT_QUEUE_OVERFLOW = (NX_ERROR_BASE | 0x008) NX_ERR_FIRMWARE_NO_RESPONSE = (NX_ERROR_BASE | 0x009) NX_ERR_EVENT_TIMEOUT = (NX_ERROR_BASE | 0x00A) NX_ERR_INPUT_QUEUE_OVERFLOW = (NX_ERROR_BASE | 0x00B) NX_ERR_INPUT_QUEUE_READ_SIZE = (NX_ERROR_BASE | 0x00C) NX_ERR_DUPLICATE_FRAME_OBJECT = (NX_ERROR_BASE | 0x00D) NX_ERR_DUPLICATE_STREAM_OBJECT = (NX_ERROR_BASE | 0x00E) NX_ERR_SELF_TEST_NOT_POSSIBLE = (NX_ERROR_BASE | 0x00F) NX_ERR_MEMORY_FULL = (NX_ERROR_BASE | 0x010) NX_ERR_MAX_SESSIONS = (NX_ERROR_BASE | 0x011) NX_ERR_MAX_FRAMES = (NX_ERROR_BASE | 0x012) NX_ERR_MAX_DEVICES = (NX_ERROR_BASE | 0x013) NX_ERR_MISSING_FILE = (NX_ERROR_BASE | 0x014) NX_ERR_PARAMETER_NULL_OR_EMPTY = (NX_ERROR_BASE | 0x015) NX_ERR_MAX_SCHEDULES = (NX_ERROR_BASE | 0x016) NX_ERR_SELF_TEST_ERROR6 = (NX_ERROR_BASE | 0x017) NX_ERR_SELF_TEST_IN_PROGRESS = (NX_ERROR_BASE | 0x018) NX_ERR_INVALID_SESSION_HANDLE = (NX_ERROR_BASE | 0x020) NX_ERR_INVALID_SYSTEM_HANDLE = (NX_ERROR_BASE | 0x021) NX_ERR_DEVICE_HANDLE_EXPECTED = (NX_ERROR_BASE | 0x022) NX_ERR_INTF_HANDLE_EXPECTED = (NX_ERROR_BASE | 0x023) NX_ERR_PROPERTY_MODE_CONFLICTING = (NX_ERROR_BASE | 0x024) NX_ERR_TIMING_SOURCE_NOT_SUPPORTED = (NX_ERROR_BASE | 0x025) NX_ERR_MULTIPLE_TIMING_SOURCE = (NX_ERROR_BASE | 0x026) NX_ERR_OVERLAPPING_IO = (NX_ERROR_BASE | 0x027) NX_ERR_MISSING_BUS_POWER = (NX_ERROR_BASE | 0x028) NX_ERR_CDAQ_CONNECTION_LOST = (NX_ERROR_BASE | 0x029) NX_ERR_INVALID_TRANSCEIVER = (NX_ERROR_BASE | 0x071) NX_ERR_INVALID_BAUD_RATE = (NX_ERROR_BASE | 0x072) NX_ERR_BAUD_RATE_NOT_CONFIGURED = (NX_ERROR_BASE | 0x073) NX_ERR_INVALID_BIT_TIMINGS = (NX_ERROR_BASE | 0x074) NX_ERR_BAUD_RATE_XCVR_MISMATCH = (NX_ERROR_BASE | 0x075) NX_ERR_UNKNOWN_TIMING_SOURCE = (NX_ERROR_BASE | 0x076) NX_ERR_UNKNOWN_SYNCHRONIZATION_SOURCE = (NX_ERROR_BASE | 0x077) NX_ERR_MISSING_TIMEBASE_SOURCE = (NX_ERROR_BASE | 0x078) NX_ERR_UNKNOWN_TIMEBASE_FREQUENCY = (NX_ERROR_BASE | 0x079) NX_ERR_UNCONNECTED_SYNCHRONIZATION_SOURCE = (NX_ERROR_BASE | 0x07A) NX_ERR_CONNECTED_SYNCHRONIZATION_TERMINAL = (NX_ERROR_BASE | 0x07B) NX_ERR_INVALID_SYNCHRONIZATION_SOURCE = (NX_ERROR_BASE | 0x07C) NX_ERR_INVALID_SYNCHRONIZATION_DESTINATION = (NX_ERROR_BASE | 0x07D) NX_ERR_INVALID_SYNCHRONIZATION_COMBINATION = (NX_ERROR_BASE | 0x07E) NX_ERR_TIMEBASE_DISAPPEARED = (NX_ERROR_BASE | 0x07F) NX_ERR_MACROTICK_DISCONNECTED = (NX_ERROR_BASE | 0x080) NX_ERR_CANNOT_OPEN_DATABASE_FILE = (NX_ERROR_BASE | 0x081) NX_ERR_CLUSTER_NOT_FOUND = (NX_ERROR_BASE | 0x082) NX_ERR_FRAME_NOT_FOUND = (NX_ERROR_BASE | 0x083) NX_ERR_SIGNAL_NOT_FOUND = (NX_ERROR_BASE | 0x084) NX_ERR_UNCONFIGURED_CLUSTER = (NX_ERROR_BASE | 0x085) NX_ERR_UNCONFIGURED_FRAME = (NX_ERROR_BASE | 0x086) NX_ERR_UNCONFIGURED_SIGNAL = (NX_ERROR_BASE | 0x087) NX_ERR_MULTIPLE_CLUSTERS = (NX_ERROR_BASE | 0x088) NX_ERR_SUBORDINATE_NOT_ALLOWED = (NX_ERROR_BASE | 0x089) NX_ERR_INVALID_INTERFACE = (NX_ERROR_BASE | 0x08A) NX_ERR_INVALID_PROTOCOL = (NX_ERROR_BASE | 0x08B) NX_ERR_INPUT_SESSION_MUST_AUTO_START = (NX_ERROR_BASE | 0x08C) NX_ERR_INVALID_PROPERTY_ID = (NX_ERROR_BASE | 0x08D) NX_ERR_INVALID_PROPERTY_SIZE = (NX_ERROR_BASE | 0x08E) NX_ERR_INCORRECT_MODE = (NX_ERROR_BASE | 0x08F) NX_ERR_BUFFER_TOO_SMALL = (NX_ERROR_BASE | 0x090) NX_ERR_MUST_SPECIFY_MULTIPLEXERS = (NX_ERROR_BASE | 0x091) NX_ERR_SESSION_NOT_FOUND = (NX_ERROR_BASE | 0x092) NX_ERR_MULTIPLE_USE_OF_SESSION = (NX_ERROR_BASE | 0x093) NX_ERR_ONLY_ONE_FRAME = (NX_ERROR_BASE | 0x094) NX_ERR_DUPLICATE_ALIAS = (NX_ERROR_BASE | 0x095) NX_ERR_DEPLOYMENT_IN_PROGRESS = (NX_ERROR_BASE | 0x096) NX_ERR_NO_FRAMES_OR_SIGNALS = (NX_ERROR_BASE | 0x097) NX_ERR_INVALID_MODE = (NX_ERROR_BASE | 0x098) NX_ERR_NEED_REFERENCE = (NX_ERROR_BASE | 0x099) NX_ERR_DIFFERENT_CLUSTER_OPEN = (NX_ERROR_BASE | 0x09A) NX_ERR_FLEX_RAY_INVALID_CYCLE_REP = (NX_ERROR_BASE | 0x09B) NX_ERR_SESSION_CLEARED = (NX_ERROR_BASE | 0x09C) NX_ERR_WRONG_MODE_FOR_CREATE_SELECTION = (NX_ERROR_BASE | 0x09D) NX_ERR_INTERFACE_RUNNING = (NX_ERROR_BASE | 0x09E) NX_ERR_FRAME_WRITE_TOO_LARGE = (NX_ERROR_BASE | 0x09F) NX_ERR_TIMEOUT_WITHOUT_NUM_TO_READ = (NX_ERROR_BASE | 0x0A0) NX_ERR_TIMESTAMPS_NOT_SUPPORTED = (NX_ERROR_BASE | 0x0A1) NX_ERR_UNKNOWN_CONDITION = (NX_ERROR_BASE | 0x0A2) NX_ERR_SESSION_NOT_STARTED = (NX_ERROR_BASE | 0x0A3) NX_ERR_MAX_WAITS_EXCEEDED = (NX_ERROR_BASE | 0x0A4) NX_ERR_INVALID_DEVICE = (NX_ERROR_BASE | 0x0A5) NX_ERR_INVALID_TERMINAL_NAME = (NX_ERROR_BASE | 0x0A6) NX_ERR_PORT_LE_DS_BUSY = (NX_ERROR_BASE | 0x0A7) NX_ERR_INVALID_KEYSLOT = (NX_ERROR_BASE | 0x0A8) NX_ERR_MAX_QUEUE_SIZE_EXCEEDED = (NX_ERROR_BASE | 0x0A9) NX_ERR_FRAME_SIZE_MISMATCH = (NX_ERROR_BASE | 0x0AA) NX_ERR_INDEX_TOO_BIG = (NX_ERROR_BASE | 0x0AB) NX_ERR_SESSION_MODE_INCOMPATIBILITY = (NX_ERROR_BASE | 0x0AC) NX_ERR_SESSION_TYPE_FRAME_INCOMPATIBILITY = (NX_ERROR_BASE | 0x15D) NX_ERR_TRIGGER_SIGNAL_NOT_ALLOWED = (NX_ERROR_BASE | 0x0AD) NX_ERR_ONLY_ONE_CLUSTER = (NX_ERROR_BASE | 0x0AE) NX_ERR_CONVERT_INVALID_PAYLOAD = (NX_ERROR_BASE | 0x0AF) NX_ERR_MEMORY_FULL_READ_DATA = (NX_ERROR_BASE | 0x0B0) NX_ERR_MEMORY_FULL_FIRMWARE = (NX_ERROR_BASE | 0x0B1) NX_ERR_COMMUNICATION_LOST = (NX_ERROR_BASE | 0x0B2) NX_ERR_INVALID_PRIORITY = (NX_ERROR_BASE | 0x0B3) NX_ERR_SYNCHRONIZATION_NOT_ALLOWED = (NX_ERROR_BASE | 0x0B4) NX_ERR_TIME_NOT_REACHED = (NX_ERROR_BASE | 0x0B5) NX_ERR_INTERNAL_INPUT_QUEUE_OVERFLOW = (NX_ERROR_BASE | 0x0B6) NX_ERR_BAD_IMAGE_FILE = (NX_ERROR_BASE | 0x0B7) NX_ERR_INVALID_LOGFILE = (NX_ERROR_BASE | 0x0B8) NX_ERR_DONGLE_COMMUNICATION_LOST = (NX_ERROR_BASE | 0xB9) NX_ERR_INVALID_PROPERTY_VALUE = (NX_ERROR_BASE | 0x0C0) NX_ERR_FLEX_RAY_INTEGRATION_FAILED = (NX_ERROR_BASE | 0x0C1) NX_ERR_PDU_NOT_FOUND = (NX_ERROR_BASE | 0x0D0) NX_ERR_UNCONFIGURED_PDU = (NX_ERROR_BASE | 0x0D1) NX_ERR_DUPLICATE_PDU_OBJECT = (NX_ERROR_BASE | 0x0D2) NX_ERR_NEED_PDU = (NX_ERROR_BASE | 0x0D3) NX_ERR_RPC_COMMUNICATION = (NX_ERROR_BASE | 0x100) NX_ERR_FILE_TRANSFER_COMMUNICATION = (NX_ERROR_BASE | 0x101) NX_ERR_FTP_COMMUNICATION = (NX_ERROR_BASE | 0x101) NX_ERR_FILE_TRANSFER_ACCESS = (NX_ERROR_BASE | 0x102) NX_ERR_FTP_FILE_ACCESS = (NX_ERROR_BASE | 0x102) NX_ERR_DATABASE_ALREADY_IN_USE = (NX_ERROR_BASE | 0x103) NX_ERR_INTERNAL_FILE_ACCESS = (NX_ERROR_BASE | 0x104) NX_ERR_FILE_TRANSFER_ACTIVE = (NX_ERROR_BASE | 0x105) NX_ERR_DLL_LOAD = (NX_ERROR_BASE | 0x117) NX_ERR_OBJECT_STARTED = (NX_ERROR_BASE | 0x11E) NX_ERR_DEFAULT_PAYLOAD_NUM_BYTES = (NX_ERROR_BASE | 0x11F) NX_ERR_INVALID_ARBITRATION_ID = (NX_ERROR_BASE | 0x123) NX_ERR_INVALID_LIN_ID = (NX_ERROR_BASE | 0x124) NX_ERR_TOO_MANY_OPEN_FILES = (NX_ERROR_BASE | 0x130) NX_ERR_DATABASE_BAD_REFERENCE = (NX_ERROR_BASE | 0x131) NX_ERR_CREATE_DATABASE_FILE = (NX_ERROR_BASE | 0x132) NX_ERR_DUPLICATE_CLUSTER_NAME = (NX_ERROR_BASE | 0x133) NX_ERR_DUPLICATE_FRAME_NAME = (NX_ERROR_BASE | 0x134) NX_ERR_DUPLICATE_SIGNAL_NAME = (NX_ERROR_BASE | 0x135) NX_ERR_DUPLICATE_ECU_NAME = (NX_ERROR_BASE | 0x136) NX_ERR_DUPLICATE_SUBFRAME_NAME = (NX_ERROR_BASE | 0x137) NX_ERR_IMPROPER_PROTOCOL = (NX_ERROR_BASE | 0x138) NX_ERR_OBJECT_RELATION = (NX_ERROR_BASE | 0x139) NX_ERR_UNCONFIGURED_REQUIRED_PROPERTY = (NX_ERROR_BASE | 0x13B) NX_ERR_NOT_SUPPORTED_ON_RT = (NX_ERROR_BASE | 0x13C) NX_ERR_NAME_SYNTAX = (NX_ERROR_BASE | 0x13D) NX_ERR_FILE_EXTENSION = (NX_ERROR_BASE | 0x13E) NX_ERR_DATABASE_OBJECT_NOT_FOUND = (NX_ERROR_BASE | 0x13F) NX_ERR_REMOVE_DATABASE_CACHE_FILE = (NX_ERROR_BASE | 0x140) NX_ERR_READ_ONLY_PROPERTY = (NX_ERROR_BASE | 0x141) NX_ERR_FRAME_MUX_EXISTS = (NX_ERROR_BASE | 0x142) NX_ERR_UNDEFINED_FIRST_SLOT = (NX_ERROR_BASE | 0x144) NX_ERR_UNDEFINED_FIRST_CHANNELS = (NX_ERROR_BASE | 0x145) NX_ERR_UNDEFINED_PROTOCOL = (NX_ERROR_BASE | 0x146) NX_ERR_OLD_DATABASE_CACHE_FILE = (NX_ERROR_BASE | 0x147) NX_ERR_DB_CONFIG_SIG_OUT_OF_FRAME = (NX_ERROR_BASE | 0x148) NX_ERR_DB_CONFIG_SIG_OVERLAPPED = (NX_ERROR_BASE | 0x149) NX_ERR_DB_CONFIG_SIG52_BIT_INTEGER = (NX_ERROR_BASE | 0x14A) NX_ERR_DB_CONFIG_FRAME_NUM_BYTES = (NX_ERROR_BASE | 0x14B) NX_ERR_MULT_SYNC_STARTUP = (NX_ERROR_BASE | 0x14C) NX_ERR_INVALID_CLUSTER = (NX_ERROR_BASE | 0x14D) NX_ERR_DATABASE_NAME = (NX_ERROR_BASE | 0x14E) NX_ERR_DATABASE_OBJECT_LOCKED = (NX_ERROR_BASE | 0x14F) NX_ERR_ALIAS_NOT_FOUND = (NX_ERROR_BASE | 0x150) NX_ERR_CLUSTER_FRAME_CHANNEL_RELATION = (NX_ERROR_BASE | 0x151) NX_ERR_DYN_FLEX_RAY_FRAME_CHAN_AAND_B = (NX_ERROR_BASE | 0x152) NX_ERR_DATABASE_LOCKED_IN_USE = (NX_ERROR_BASE | 0x153) NX_ERR_AMBIGUOUS_FRAME_NAME = (NX_ERROR_BASE | 0x154) NX_ERR_AMBIGUOUS_SIGNAL_NAME = (NX_ERROR_BASE | 0x155) NX_ERR_AMBIGUOUS_ECU_NAME = (NX_ERROR_BASE | 0x156) NX_ERR_AMBIGUOUS_SUBFRAME_NAME = (NX_ERROR_BASE | 0x157) NX_ERR_AMBIGUOUS_SCHEDULE_NAME = (NX_ERROR_BASE | 0x158) NX_ERR_DUPLICATE_SCHEDULE_NAME = (NX_ERROR_BASE | 0x159) NX_ERR_DIAGNOSTIC_SCHEDULE_NOT_DEFINED = (NX_ERROR_BASE | 0x18F) NX_ERR_PROTOCOL_MUX_NOT_SUPPORTED = (NX_ERROR_BASE | 0x15A) NX_ERR_SAVE_LI_NNOT_SUPPORTED = (NX_ERROR_BASE | 0x15B) NX_ERR_LI_NMASTER_NOT_DEFINED = (NX_ERROR_BASE | 0x15C) NX_ERR_MIX_AUTO_MANUAL_OPEN = (NX_ERROR_BASE | 0x15E) NX_ERR_AUTO_OPEN_NOT_SUPPORTED = (NX_ERROR_BASE | 0x15F) NX_ERR_WRONG_NUM_SIGNALS_WRITTEN = (NX_ERROR_BASE | 0x160) NX_ERR_MULTIPLE_LV_PROJECT = (NX_ERROR_BASE | 0x161) NX_ERR_SESSION_CONFLICT_LV_PROJECT = (NX_ERROR_BASE | 0x162) NX_ERR_DB_OBJECT_NAME_EMPTY = (NX_ERROR_BASE | 0x163) NX_ERR_MISSING_ALIAS_IN_DB_OBJECT_NAME = (NX_ERROR_BASE | 0x164) NX_ERR_FIBEX_IMPORT_VERSION = (NX_ERROR_BASE | 0x165) NX_ERR_EMPTY_SESSION_NAME = (NX_ERROR_BASE | 0x166) NX_ERR_NOT_ENOUGH_MESSAGE_RAM_FOR_OBJECT = (NX_ERROR_BASE | 0x167) NX_ERR_KEY_SLOT_ID_CONFIG = (NX_ERROR_BASE | 0x168) NX_ERR_UNSUPPORTED_SESSION = (NX_ERROR_BASE | 0x169) NX_ERR_OBJECT_CREATED_AFTER_START = (NX_ERROR_BASE | 0x170) NX_ERR_SINGLE_SLOT_ENABLED_AFTER_START = (NX_ERROR_BASE | 0x171) NX_ERR_UNSUPPORTED_NUM_MACROTICKS = (NX_ERROR_BASE | 0x172) NX_ERR_BAD_SYNTAX_IN_DATABASE_OBJECT_NAME = (NX_ERROR_BASE | 0x173) NX_ERR_AMBIGUOUS_SCHEDULE_ENTRY_NAME = (NX_ERROR_BASE | 0x174) NX_ERR_DUPLICATE_SCHEDULE_ENTRY_NAME = (NX_ERROR_BASE | 0x175) NX_ERR_UNDEFINED_FRAME_ID = (NX_ERROR_BASE | 0x176) NX_ERR_UNDEFINED_FRAME_PAYLOAD_LENGTH = (NX_ERROR_BASE | 0x177) NX_ERR_UNDEFINED_SIGNAL_START_BIT = (NX_ERROR_BASE | 0x178) NX_ERR_UNDEFINED_SIGNAL_NUM_BITS = (NX_ERROR_BASE | 0x179) NX_ERR_UNDEFINED_SIGNAL_BYTE_ORDER = (NX_ERROR_BASE | 0x17A) NX_ERR_UNDEFINED_SIGNAL_DATA_TYPE = (NX_ERROR_BASE | 0x17B) NX_ERR_UNDEFINED_SUBF_MUX_VALUE = (NX_ERROR_BASE | 0x17C) NX_ERR_INVALID_LIN_SCHED_INDEX = (NX_ERROR_BASE | 0x17D) NX_ERR_INVALID_LIN_SCHED_NAME = (NX_ERROR_BASE | 0x17E) NX_ERR_INVALID_ACTIVE_FRAME_INDEX = (NX_ERROR_BASE | 0x17F) NX_ERR_INVALID_ACTIVE_FRAME_NAME = (NX_ERROR_BASE | 0x180) NX_ERR_AMBIGUOUS_PDU = (NX_ERROR_BASE | 0x181) NX_ERR_DUPLICATE_PDU = (NX_ERROR_BASE | 0x182) NX_ERR_NUMBER_OF_PD_US = (NX_ERROR_BASE | 0x183) NX_ERR_PD_US_REQUIRED = (NX_ERROR_BASE | 0x184) NX_ERR_MAX_PD_US = (NX_ERROR_BASE | 0x185) NX_ERR_UNSUPPORTED_MODE = (NX_ERROR_BASE | 0x186) NX_ERR_BAD_FPGA_SIGNATURE = (NX_ERROR_BASE | 0x187) NX_ERR_BADC_SERIES_FPGA_SIGNATURE = (NX_ERR_BAD_FPGA_SIGNATURE) NX_ERR_BAD_FPGA_REVISION = (NX_ERROR_BASE | 0x188) NX_ERR_BADC_SERIES_FPGA_REVISION = (NX_ERR_BAD_FPGA_REVISION) NX_ERR_BAD_FPGA_REVISION_ON_TARGET = (NX_ERROR_BASE | 0x189) NX_ERR_ROUTE_IN_USE = (NX_ERROR_BASE | 0x18A) NX_ERR_DA_QMX_INCORRECT_VERSION = (NX_ERROR_BASE | 0x18B) NX_ERR_ADD_ROUTE = (NX_ERROR_BASE | 0x18C) NX_ERR_REMOTE_SLEEP_ON_LIN_SLAVE = (NX_ERROR_BASE | 0x18D) NX_ERR_SLEEP_WAKEUP_NOT_SUPPORTED = (NX_ERROR_BASE | 0x18E) NX_ERR_LIN_TRANSPORT_LAYER = (NX_ERROR_BASE | 0x192) NX_ERR_LOGFILE = (NX_ERROR_BASE | 0x193) NX_ERR_STRM_OUT_TMG_LIN_SCHEDULER_CONFLICT = (NX_ERROR_BASE | 0x200) NX_ERR_SESSN_TYPE_LIN_INTF_PRS_INCOMPATIBLE = (NX_ERROR_BASE | 0x201) NX_ERR_SAVE_CLUSTER_ONLY = (NX_ERROR_BASE | 0x202) NX_ERR_SAVE_LDF_CLUSTER_ONLY = NX_ERR_SAVE_CLUSTER_ONLY NX_ERR_DUPLICATE_INTERFACE_NAME = (NX_ERROR_BASE | 0x203) NX_ERR_INCOMPATIABLE_TRANSCEIVER_REVISION = (NX_ERROR_BASE | 0x204) NX_ERR_INCOMPATIABLE_TRANSCEIVER_IMAGE = (NX_ERROR_BASE | 0x205) NX_ERR_PROPERTY_NOTSUPPORTED = (NX_ERROR_BASE | 0x206) NX_ERR_EXPORT_SEMANTIC = (NX_ERROR_BASE | 0x207) NX_ERR_J1939_QUEUE_OVERFLOW = (NX_ERROR_BASE | 0x0208) NX_ERR_NON_J1939_FRAME_SIZE = (NX_ERROR_BASE | 0x0209) NX_ERR_J1939_MISSING_ADDRESS = (NX_ERROR_BASE | 0x020A) NX_ERR_J1939_ADDRESS_LOST = (NX_ERROR_BASE | 0x020B) NX_ERR_J1939_CTS_NEXT_PCK_LARGER_TOTAL_PCK_NUM = (NX_ERROR_BASE | 0x020C) NX_ERR_J1939_CTS_NEXT_PCK = (NX_ERROR_BASE | 0x020D) NX_ERR_J1939_CTS_NEXT_PCK_NULL = (NX_ERROR_BASE | 0x020E) NX_ERR_J1939_CTS_PGN = (NX_ERROR_BASE | 0x020F) NX_ERR_J1939_UNEXPECTED_SEQ_NUM = (NX_ERROR_BASE | 0x0210) NX_ERR_J1939_MORE_PCK_REQ_THAN_ALLOWED = (NX_ERROR_BASE | 0x0211) NX_ERR_J1939_TIMEOUT_T1 = (NX_ERROR_BASE | 0x0212) NX_ERR_J1939_TIMEOUT_T2 = (NX_ERROR_BASE | 0x0213) NX_ERR_J1939_TIMEOUT_T3 = (NX_ERROR_BASE | 0x0214) NX_ERR_J1939_TIMEOUT_T4 = (NX_ERROR_BASE | 0x0215) NX_ERR_J1939_RTS_DLC = (NX_ERROR_BASE | 0x0216) NX_ERR_J1939_CTS_DLC = (NX_ERROR_BASE | 0x0217) NX_ERR_J1939_BAM_DLC = (NX_ERROR_BASE | 0x0218) NX_ERR_J1939_DT_DLC = (NX_ERROR_BASE | 0x0219) NX_ERR_J1939_ABORT_DLC = (NX_ERROR_BASE | 0x021A) NX_ERR_J1939_EOMA_DLC = (NX_ERROR_BASE | 0x021B) NX_ERR_J1939_ABORT_PGN = (NX_ERROR_BASE | 0x021C) NX_ERR_J1939_CTS_HOLD_MSG = (NX_ERROR_BASE | 0x021D) NX_ERR_J1939_INVALID_TOTAL_SIZE = (NX_ERROR_BASE | 0x021E) NX_ERR_J1939_TOTAL_PCK_NUM = (NX_ERROR_BASE | 0x021F) NX_ERR_J1939_RESERVED_DATA = (NX_ERROR_BASE | 0x0220) NX_ERR_J1939_NOT_ENOUGH_SYS_RES = (NX_ERROR_BASE | 0x0221) NX_ERR_J1939_ABORT_MSG_ACTIVE_CONNECTION = (NX_ERROR_BASE | 0x0222) NX_ERR_J1939_ABORT_MSG_NOT_ENOUGH_SYS_RES = (NX_ERROR_BASE | 0x0223) NX_ERR_J1939_ABORT_MSG_TIMEOUT = (NX_ERROR_BASE | 0x0224) NX_ERR_J1939_ABORT_MSG_CTS_REC = (NX_ERROR_BASE | 0x0225) NX_ERR_J1939_ABORT_MSG_MAX_RETRANSMIT = (NX_ERROR_BASE | 0x0226) NX_ERR_RPC_VERSION = (NX_ERROR_BASE | 0x0227) NX_ERR_FRAME_CAN_IO_MODE = (NX_ERROR_BASE | 0x0228) NX_ERR_INCOMPATIBLE_FLASH = (NX_ERROR_BASE | 0x0229) NX_ERR_TX_IO_MODE = (NX_ERROR_BASE | 0x022A) NX_ERR_XS_DONGLE_UNSUPPORTED_BOARD = (NX_ERROR_BASE | 0x022B) NX_ERR_INVALID_CHAR_IN_DATABASE_ALIAS = (NX_ERROR_BASE | 0x022C) NX_ERR_INVALID_CHAR_IN_DATABASE_FILEPATH = (NX_ERROR_BASE | 0x022D) NX_ERR_INVALID_CAN_FD_PORT_TYPE = (NX_ERROR_BASE | 0x022E) NX_ERR_INV_UNCONDITIONAL_ENTRY = (NX_ERROR_BASE | 0x022F) NX_ERR_EVENT_ENTRY_NO_SCHEDULE = (NX_ERROR_BASE | 0x0230) NX_ERR_UNSUPPORTED_USB_SPEED = (NX_ERROR_BASE | 0x0231) NX_WARN_FD_BAUD_EXCEEDS_CAPABILITY = (NX_WARNING_BASE | 0x40) NX_WARN_DATABASE_IMPORT = (NX_WARNING_BASE | 0x085) NX_WARN_DATABASE_IMPORT_FIBEX_NO_XNET_FILE = (NX_WARNING_BASE | 0x086) NX_WARN_DATABASE_IMPORT_FIBEX_NO_XNET_FILE_PLUS_WARNING = (NX_WARNING_BASE | 0x087) NX_WARN_DATABASE_BAD_REFERENCE = (NX_WARNING_BASE | 0x131) NX_WARN_ADVANCED_PDU = (NX_WARNING_BASE | 0x132) NX_WARN_MUX_EXCEEDS16_BIT = (NX_WARNING_BASE | 0x133) NX_CLASS_DATABASE = 0x00000000 NX_CLASS_CLUSTER = 0x00010000 NX_CLASS_FRAME = 0x00020000 NX_CLASS_SIGNAL = 0x00030000 NX_CLASS_SUBFRAME = 0x00040000 NX_CLASS_ECU = 0x00050000 NX_CLASS_LIN_SCHED = 0x00060000 NX_CLASS_LIN_SCHED_ENTRY = 0x00070000 NX_CLASS_PDU = 0x00080000 NX_CLASS_SESSION = 0x00100000 NX_CLASS_SYSTEM = 0x00110000 NX_CLASS_DEVICE = 0x00120000 NX_CLASS_INTERFACE = 0x00130000 NX_CLASS_ALIAS = 0x00140000 NX_CLASS_MASK = 0x00FF0000 NX_PRPTYPE_U32 = 0x00000000 NX_PRPTYPE_F64 = 0x01000000 NX_PRPTYPE_BOOL = 0x02000000 NX_PRPTYPE_STRING = 0x03000000 NX_PRPTYPE_1_DSTRING = 0x04000000 NX_PRPTYPE_REF = 0x05000000 NX_PRPTYPE_1_DREF = 0x06000000 NX_PRPTYPE_TIME = 0x07000000 NX_PRPTYPE_1_DU32 = 0x08000000 NX_PRPTYPE_U64 = 0x09000000 NX_PRPTYPE_1_DU8 = 0x0A000000 NX_PRPTYPE_MASK = 0xFF000000 NX_PROP_SESSION_APPLICATION_PROTOCOL = (0x00000091 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_AUTO_START = (0x00000001 | NX_CLASS_SESSION | NX_PRPTYPE_BOOL) NX_PROP_SESSION_CLUSTER_NAME = (0x0000000A | NX_CLASS_SESSION | NX_PRPTYPE_STRING) NX_PROP_SESSION_DATABASE_NAME = (0x00000002 | NX_CLASS_SESSION | NX_PRPTYPE_STRING) NX_PROP_SESSION_LIST = (0x00000003 | NX_CLASS_SESSION | NX_PRPTYPE_1_DSTRING) NX_PROP_SESSION_MODE = (0x00000004 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_NUM_FRAMES = (0x0000000D | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_NUM_IN_LIST = (0x00000005 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_NUM_PEND = (0x00000006 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_NUM_UNUSED = (0x0000000B | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_PAYLD_LEN_MAX = (0x00000009 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_PROTOCOL = (0x00000008 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_QUEUE_SIZE = (0x0000000C | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_RESAMP_RATE = (0x00000007 | NX_CLASS_SESSION | NX_PRPTYPE_F64) NX_PROP_SESSION_INTF_BAUD_RATE = (0x00000016 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_BAUD_RATE64 = (0x00000016 | NX_CLASS_SESSION | NX_PRPTYPE_U64) NX_PROP_SESSION_INTF_BUS_ERR_TO_IN_STRM = (0x00000015 | NX_CLASS_SESSION | NX_PRPTYPE_BOOL) NX_PROP_SESSION_INTF_ECHO_TX = (0x00000010 | NX_CLASS_SESSION | NX_PRPTYPE_BOOL) NX_PROP_SESSION_INTF_NAME = (0x00000013 | NX_CLASS_SESSION | NX_PRPTYPE_STRING) NX_PROP_SESSION_INTF_OUT_STRM_LIST = (0x00000011 | NX_CLASS_SESSION | NX_PRPTYPE_1_DREF) NX_PROP_SESSION_INTF_OUT_STRM_TIMNG = (0x00000012 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_START_TRIG_TO_IN_STRM = (0x00000014 | NX_CLASS_SESSION | NX_PRPTYPE_BOOL) NX_PROP_SESSION_INTF_CAN_EXT_TCVR_CONFIG = (0x00000023 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_CAN_LSTN_ONLY = (0x00000022 | NX_CLASS_SESSION | NX_PRPTYPE_BOOL) NX_PROP_SESSION_INTF_CAN_PEND_TX_ORDER = (0x00000020 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_CAN_SING_SHOT = (0x00000024 | NX_CLASS_SESSION | NX_PRPTYPE_BOOL) NX_PROP_SESSION_INTF_CAN_TERM = (0x00000025 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_CAN_TCVR_STATE = (0x00000028 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_CAN_TCVR_TYPE = (0x00000029 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_CAN_OUT_STRM_LIST_BY_ID = (0x00000021 | NX_CLASS_SESSION | NX_PRPTYPE_1_DU32) NX_PROP_SESSION_INTF_CAN_IO_MODE = (0x00000026 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_CAN_FD_BAUD_RATE = (0x00000027 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_CAN_FD_BAUD_RATE64 = (0x00000027 | NX_CLASS_SESSION | NX_PRPTYPE_U64) NX_PROP_SESSION_INTF_CAN_TX_IO_MODE = (0x00000039 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_CAN_FD_ISO_MODE = (0x0000003E | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_ACC_START_RNG = (0x00000030 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_ALW_HLT_CLK = (0x00000031 | NX_CLASS_SESSION | NX_PRPTYPE_BOOL) NX_PROP_SESSION_INTF_FLEX_RAY_ALW_PASS_ACT = (0x00000032 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_AUTO_ASLP_WHN_STP = (0x0000003A | NX_CLASS_SESSION | NX_PRPTYPE_BOOL) NX_PROP_SESSION_INTF_FLEX_RAY_CLST_DRIFT_DMP = (0x00000033 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_COLDSTART = (0x00000034 | NX_CLASS_SESSION | NX_PRPTYPE_BOOL) NX_PROP_SESSION_INTF_FLEX_RAY_DEC_CORR = (0x00000035 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_DELAY_COMP_A = (0x00000036 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_DELAY_COMP_B = (0x00000037 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_KEY_SLOT_ID = (0x00000038 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_LATEST_TX = (0x00000041 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_LIST_TIMO = (0x00000042 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_MAC_INIT_OFF_A = (0x00000043 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_MAC_INIT_OFF_B = (0x00000044 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_MIC_INIT_OFF_A = (0x00000045 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_MIC_INIT_OFF_B = (0x00000046 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_MAX_DRIFT = (0x00000047 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_MICROTICK = (0x00000048 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_NULL_TO_IN_STRM = (0x00000049 | NX_CLASS_SESSION | NX_PRPTYPE_BOOL) NX_PROP_SESSION_INTF_FLEX_RAY_OFF_CORR = (0x00000058 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_OFF_CORR_OUT = (0x00000050 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_RATE_CORR = (0x00000059 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_RATE_CORR_OUT = (0x00000052 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_SAMP_PER_MICRO = (0x00000053 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_SING_SLOT_EN = (0x00000054 | NX_CLASS_SESSION | NX_PRPTYPE_BOOL) NX_PROP_SESSION_INTF_FLEX_RAY_STATISTICS_EN = (0x0000005A | NX_CLASS_SESSION | NX_PRPTYPE_BOOL) NX_PROP_SESSION_INTF_FLEX_RAY_SYM_TO_IN_STRM = (0x0000003D | NX_CLASS_SESSION | NX_PRPTYPE_BOOL) NX_PROP_SESSION_INTF_FLEX_RAY_SYNC_CH_A_EVEN = (0x0000005B | NX_CLASS_SESSION | NX_PRPTYPE_1_DU32) NX_PROP_SESSION_INTF_FLEX_RAY_SYNC_CH_A_ODD = (0x0000005C | NX_CLASS_SESSION | NX_PRPTYPE_1_DU32) NX_PROP_SESSION_INTF_FLEX_RAY_SYNC_CH_B_EVEN = (0x0000005D | NX_CLASS_SESSION | NX_PRPTYPE_1_DU32) NX_PROP_SESSION_INTF_FLEX_RAY_SYNC_CH_B_ODD = (0x0000005E | NX_CLASS_SESSION | NX_PRPTYPE_1_DU32) NX_PROP_SESSION_INTF_FLEX_RAY_SYNC_STATUS = (0x0000005F | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_TERM = (0x00000057 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_WAKEUP_CH = (0x00000055 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_WAKEUP_PTRN = (0x00000056 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_SLEEP = (0x0000003B | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_FLEX_RAY_CONNECTED_CHS = (0x0000003C | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_LIN_BREAK_LENGTH = (0x00000070 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_LIN_MASTER = (0x00000072 | NX_CLASS_SESSION | NX_PRPTYPE_BOOL) NX_PROP_SESSION_INTF_LIN_SCHED_NAMES = (0x00000075 | NX_CLASS_SESSION | NX_PRPTYPE_1_DSTRING) NX_PROP_SESSION_INTF_LIN_SLEEP = (0x00000073 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_LIN_TERM = (0x00000074 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_INTF_LIN_DIAG_P_2MIN = (0x00000077 | NX_CLASS_SESSION | NX_PRPTYPE_F64) NX_PROP_SESSION_INTF_LIN_DIAG_S_TMIN = (0x00000076 | NX_CLASS_SESSION | NX_PRPTYPE_F64) NX_PROP_SESSION_INTF_LIN_ALW_START_WO_BUS_PWR = (0x00000078 | NX_CLASS_SESSION | NX_PRPTYPE_BOOL) NX_PROP_SESSION_INTF_LINO_STR_SLV_RSP_LST_BY_NAD = (0x00000079 | NX_CLASS_SESSION | NX_PRPTYPE_1_DU32) NX_PROP_SESSION_INTF_LIN_NO_RESPONSE_TO_IN_STRM = (0x00000080 | NX_CLASS_SESSION | NX_PRPTYPE_BOOL) NX_PROP_SESSION_INTF_SRC_TERM_START_TRIGGER = (0x00000090 | NX_CLASS_SESSION | NX_PRPTYPE_STRING) NX_PROP_SESSION_J1939_ADDRESS = (0x00000092 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_J1939_NAME = (0x00000094 | NX_CLASS_SESSION | NX_PRPTYPE_U64) NX_PROP_SESSION_J1939ECU = (0x00000093 | NX_CLASS_SESSION | NX_PRPTYPE_REF) NX_PROP_SESSION_J1939_TIMEOUT_T1 = (0x00000095 | NX_CLASS_SESSION | NX_PRPTYPE_F64) NX_PROP_SESSION_J1939_TIMEOUT_T2 = (0x00000096 | NX_CLASS_SESSION | NX_PRPTYPE_F64) NX_PROP_SESSION_J1939_TIMEOUT_T3 = (0x00000097 | NX_CLASS_SESSION | NX_PRPTYPE_F64) NX_PROP_SESSION_J1939_TIMEOUT_T4 = (0x00000098 | NX_CLASS_SESSION | NX_PRPTYPE_F64) NX_PROP_SESSION_J1939_RESPONSE_TIME_TR_SD = (0x00000099 | NX_CLASS_SESSION | NX_PRPTYPE_F64) NX_PROP_SESSION_J1939_RESPONSE_TIME_TR_GD = (0x0000009A | NX_CLASS_SESSION | NX_PRPTYPE_F64) NX_PROP_SESSION_J1939_HOLD_TIME_TH = (0x0000009B | NX_CLASS_SESSION | NX_PRPTYPE_F64) NX_PROP_SESSION_J1939_NUM_PACKETS_RECV = (0x0000009C | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_J1939_NUM_PACKETS_RESP = (0x0000009D | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_J1939_MAX_REPEAT_CTS = (0x0000009E | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_J1939_FILL_BYTE = (0x0000009F | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_J1939_WRITE_QUEUE_SIZE = (0x000000A0 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_J1939ECU_BUSY = (0x000000A1 | NX_CLASS_SESSION | NX_PRPTYPE_BOOL) NX_PROP_SESSION_INTF_CAN_EDGE_FILTER = (0x000000A2 | NX_CLASS_SESSION | NX_PRPTYPE_BOOL) NX_PROP_SESSION_INTF_CAN_TRANSMIT_PAUSE = (0x000000A3 | NX_CLASS_SESSION | NX_PRPTYPE_BOOL) NX_PROP_SESSION_INTF_CAN_DISABLE_PROT_EXCEPTION_HANDLING = (0x000000A4 | NX_CLASS_SESSION | NX_PRPTYPE_BOOL) NX_PROP_SYS_DEV_REFS = (0x00000002 | NX_CLASS_SYSTEM | NX_PRPTYPE_1_DREF) NX_PROP_SYS_INTF_REFS = (0x00000003 | NX_CLASS_SYSTEM | NX_PRPTYPE_1_DREF) NX_PROP_SYS_INTF_REFS_CAN = (0x00000004 | NX_CLASS_SYSTEM | NX_PRPTYPE_1_DREF) NX_PROP_SYS_INTF_REFS_FLEX_RAY = (0x00000005 | NX_CLASS_SYSTEM | NX_PRPTYPE_1_DREF) NX_PROP_SYS_INTF_REFS_LIN = (0x00000007 | NX_CLASS_SYSTEM | NX_PRPTYPE_1_DREF) NX_PROP_SYS_VER_BUILD = (0x00000006 | NX_CLASS_SYSTEM | NX_PRPTYPE_U32) NX_PROP_SYS_VER_MAJOR = (0x00000008 | NX_CLASS_SYSTEM | NX_PRPTYPE_U32) NX_PROP_SYS_VER_MINOR = (0x00000009 | NX_CLASS_SYSTEM | NX_PRPTYPE_U32) NX_PROP_SYS_VER_PHASE = (0x0000000A | NX_CLASS_SYSTEM | NX_PRPTYPE_U32) NX_PROP_SYS_VER_UPDATE = (0x0000000B | NX_CLASS_SYSTEM | NX_PRPTYPE_U32) NX_PROP_SYS_INTF_REFS_ALL = (0x0000000D | NX_CLASS_SYSTEM | NX_PRPTYPE_1_DREF) NX_PROP_DEV_FORM_FAC = (0x00000001 | NX_CLASS_DEVICE | NX_PRPTYPE_U32) NX_PROP_DEV_INTF_REFS = (0x00000002 | NX_CLASS_DEVICE | NX_PRPTYPE_1_DREF) NX_PROP_DEV_NAME = (0x00000003 | NX_CLASS_DEVICE | NX_PRPTYPE_STRING) NX_PROP_DEV_NUM_PORTS = (0x00000004 | NX_CLASS_DEVICE | NX_PRPTYPE_U32) NX_PROP_DEV_PRODUCT_NUM = (0x00000008 | NX_CLASS_DEVICE | NX_PRPTYPE_U32) NX_PROP_DEV_SER_NUM = (0x00000005 | NX_CLASS_DEVICE | NX_PRPTYPE_U32) NX_PROP_DEV_SLOT_NUM = (0x00000006 | NX_CLASS_DEVICE | NX_PRPTYPE_U32) NX_PROP_DEV_NUM_PORTS_ALL = (0x00000007 | NX_CLASS_DEVICE | NX_PRPTYPE_U32) NX_PROP_DEV_INTF_REFS_ALL = (0x00000008 | NX_CLASS_DEVICE | NX_PRPTYPE_1_DREF) NX_PROP_INTF_DEV_REF = (0x00000001 | NX_CLASS_INTERFACE | NX_PRPTYPE_REF) NX_PROP_INTF_NAME = (0x00000002 | NX_CLASS_INTERFACE | NX_PRPTYPE_STRING) NX_PROP_INTF_NUM = (0x00000003 | NX_CLASS_INTERFACE | NX_PRPTYPE_U32) NX_PROP_INTF_PORT_NUM = (0x00000004 | NX_CLASS_INTERFACE | NX_PRPTYPE_U32) NX_PROP_INTF_PROTOCOL = (0x00000005 | NX_CLASS_INTERFACE | NX_PRPTYPE_U32) NX_PROP_INTF_CAN_TERM_CAP = (0x00000008 | NX_CLASS_INTERFACE | NX_PRPTYPE_U32) NX_PROP_INTF_CAN_TCVR_CAP = (0x00000007 | NX_CLASS_INTERFACE | NX_PRPTYPE_U32) NX_PROP_INTF_DONGLE_STATE = (0x00000009 | NX_CLASS_INTERFACE | NX_PRPTYPE_U32) NX_PROP_INTF_DONGLE_ID = (0x0000000A | NX_CLASS_INTERFACE | NX_PRPTYPE_U32) NX_PROP_INTF_DONGLE_REVISION = (0x0000000C | NX_CLASS_INTERFACE | NX_PRPTYPE_U32) NX_PROP_INTF_DONGLE_FIRMWARE_VERSION = (0x0000000D | NX_CLASS_INTERFACE | NX_PRPTYPE_U32) NX_PROP_INTF_DONGLE_COMPATIBLE_REVISION = (0x0000000E | NX_CLASS_INTERFACE | NX_PRPTYPE_U32) NX_PROP_INTF_DONGLE_COMPATIBLE_FIRMWARE_VERSION = (0x0000000F | NX_CLASS_INTERFACE | NX_PRPTYPE_U32) NX_PROP_SESSION_SUB_CAN_START_TIME_OFF = (0x00000081 | NX_CLASS_SESSION | NX_PRPTYPE_F64) NX_PROP_SESSION_SUB_CAN_TX_TIME = (0x00000082 | NX_CLASS_SESSION | NX_PRPTYPE_F64) NX_PROP_SESSION_SUB_SKIP_N_CYCLIC_FRAMES = (0x00000083 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_SUB_OUTPUT_QUEUE_UPDATE_FREQ = (0x00000084 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_SUB_LIN_TX_N_CORRUPTED_CHKSUMS = (0x00000085 | NX_CLASS_SESSION | NX_PRPTYPE_U32) NX_PROP_SESSION_SUB_J1939_ADDR_FILTER = (0x00000086 | NX_CLASS_SESSION | NX_PRPTYPE_STRING) NX_PROP_DATABASE_NAME = (0x00000001 | NX_CLASS_DATABASE | NX_PRPTYPE_STRING) NX_PROP_DATABASE_CLST_REFS = (0x00000002 | NX_CLASS_DATABASE | NX_PRPTYPE_1_DREF) NX_PROP_DATABASE_SHOW_INVALID_FROM_OPEN = (0x00000003 | NX_CLASS_DATABASE | NX_PRPTYPE_BOOL) NX_PROP_CLST_BAUD_RATE = (0x00000001 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_BAUD_RATE64 = (0x00000001 | NX_CLASS_CLUSTER | NX_PRPTYPE_U64) NX_PROP_CLST_COMMENT = (0x00000008 | NX_CLASS_CLUSTER | NX_PRPTYPE_STRING) NX_PROP_CLST_CONFIG_STATUS = (0x00000009 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_DATABASE_REF = (0x00000002 | NX_CLASS_CLUSTER | NX_PRPTYPE_REF) NX_PROP_CLST_ECU_REFS = (0x00000003 | NX_CLASS_CLUSTER | NX_PRPTYPE_1_DREF) NX_PROP_CLST_FRM_REFS = (0x00000004 | NX_CLASS_CLUSTER | NX_PRPTYPE_1_DREF) NX_PROP_CLST_NAME = (0x00000005 | NX_CLASS_CLUSTER | NX_PRPTYPE_STRING) NX_PROP_CLST_PDU_REFS = (0x00000008 | NX_CLASS_CLUSTER | NX_PRPTYPE_1_DREF) NX_PROP_CLST_PD_US_REQD = (0x0000000A | NX_CLASS_CLUSTER | NX_PRPTYPE_BOOL) NX_PROP_CLST_PROTOCOL = (0x00000006 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_SIG_REFS = (0x00000007 | NX_CLASS_CLUSTER | NX_PRPTYPE_1_DREF) NX_PROP_CLST_CAN_IO_MODE = (0x00000010 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_CAN_FD_BAUD_RATE = (0x00000011 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_CAN_FD_BAUD_RATE64 = (0x00000011 | NX_CLASS_CLUSTER | NX_PRPTYPE_U64) NX_PROP_CLST_FLEX_RAY_ACT_PT_OFF = (0x00000020 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_CAS_RX_L_MAX = (0x00000021 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_CHANNELS = (0x00000022 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_CLST_DRIFT_DMP = (0x00000023 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_COLD_ST_ATS = (0x00000024 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_CYCLE = (0x00000025 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_DYN_SEG_START = (0x00000026 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_DYN_SLOT_IDL_PH = (0x00000027 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_LATEST_USABLE_DYN = (0x0000002A | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_LATEST_GUAR_DYN = (0x0000002B | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_LIS_NOISE = (0x00000028 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_MACRO_PER_CYCLE = (0x00000029 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_MACROTICK = (0x00000030 | NX_CLASS_CLUSTER | NX_PRPTYPE_F64) NX_PROP_CLST_FLEX_RAY_MAX_WO_CLK_COR_FAT = (0x00000031 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_MAX_WO_CLK_COR_PAS = (0x00000032 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_MINISLOT_ACT_PT = (0x00000033 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_MINISLOT = (0x00000034 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_NM_VEC_LEN = (0x00000035 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_NIT = (0x00000036 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_NIT_START = (0x00000037 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_NUM_MINISLT = (0x00000038 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_NUM_STAT_SLT = (0x00000039 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_OFF_COR_ST = (0x00000040 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_PAYLD_LEN_DYN_MAX = (0x00000041 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_PAYLD_LEN_MAX = (0x00000042 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_PAYLD_LEN_ST = (0x00000043 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_STAT_SLOT = (0x00000045 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_SYM_WIN = (0x00000046 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_SYM_WIN_START = (0x00000047 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_SYNC_NODE_MAX = (0x00000048 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_TSS_TX = (0x00000049 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_WAKE_SYM_RX_IDL = (0x00000050 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_WAKE_SYM_RX_LOW = (0x00000051 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_WAKE_SYM_RX_WIN = (0x00000052 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_WAKE_SYM_TX_IDL = (0x00000053 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_WAKE_SYM_TX_LOW = (0x00000054 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_FLEX_RAY_USE_WAKEUP = (0x00000055 | NX_CLASS_CLUSTER | NX_PRPTYPE_BOOL) NX_PROP_CLST_LIN_SCHEDULES = (0x00000070 | NX_CLASS_CLUSTER | NX_PRPTYPE_1_DREF) NX_PROP_CLST_LIN_TICK = (0x00000071 | NX_CLASS_CLUSTER | NX_PRPTYPE_F64) NX_PROP_CLST_FLEX_RAY_ALW_PASS_ACT = (0x00000072 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_APPLICATION_PROTOCOL = (0x00000073 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_CLST_CAN_FD_ISO_MODE = (0x00000074 | NX_CLASS_CLUSTER | NX_PRPTYPE_U32) NX_PROP_FRM_APPLICATION_PROTOCOL = (0x00000064 | NX_CLASS_FRAME | NX_PRPTYPE_U32) NX_PROP_FRM_CLUSTER_REF = (0x00000001 | NX_CLASS_FRAME | NX_PRPTYPE_REF) NX_PROP_FRM_COMMENT = (0x00000002 | NX_CLASS_FRAME | NX_PRPTYPE_STRING) NX_PROP_FRM_CONFIG_STATUS = (0x00000009 | NX_CLASS_FRAME | NX_PRPTYPE_U32) NX_PROP_FRM_DEFAULT_PAYLOAD = (0x00000005 | NX_CLASS_FRAME | NX_PRPTYPE_1_DU8) NX_PROP_FRM_ID = (0x00000003 | NX_CLASS_FRAME | NX_PRPTYPE_U32) NX_PROP_FRM_NAME = (0x00000004 | NX_CLASS_FRAME | NX_PRPTYPE_STRING) NX_PROP_FRM_PAYLOAD_LEN = (0x00000007 | NX_CLASS_FRAME | NX_PRPTYPE_U32) NX_PROP_FRM_SIG_REFS = (0x00000008 | NX_CLASS_FRAME | NX_PRPTYPE_1_DREF) NX_PROP_FRM_CAN_EXT_ID = (0x00000010 | NX_CLASS_FRAME | NX_PRPTYPE_BOOL) NX_PROP_FRM_CAN_TIMING_TYPE = (0x00000011 | NX_CLASS_FRAME | NX_PRPTYPE_U32) NX_PROP_FRM_CAN_TX_TIME = (0x00000012 | NX_CLASS_FRAME | NX_PRPTYPE_F64) NX_PROP_FRM_FLEX_RAY_BASE_CYCLE = (0x00000020 | NX_CLASS_FRAME | NX_PRPTYPE_U32) NX_PROP_FRM_FLEX_RAY_CH_ASSIGN = (0x00000021 | NX_CLASS_FRAME | NX_PRPTYPE_U32) NX_PROP_FRM_FLEX_RAY_CYCLE_REP = (0x00000022 | NX_CLASS_FRAME | NX_PRPTYPE_U32) NX_PROP_FRM_FLEX_RAY_PREAMBLE = (0x00000023 | NX_CLASS_FRAME | NX_PRPTYPE_BOOL) NX_PROP_FRM_FLEX_RAY_STARTUP = (0x00000024 | NX_CLASS_FRAME | NX_PRPTYPE_BOOL) NX_PROP_FRM_FLEX_RAY_SYNC = (0x00000025 | NX_CLASS_FRAME | NX_PRPTYPE_BOOL) NX_PROP_FRM_FLEX_RAY_TIMING_TYPE = (0x00000026 | NX_CLASS_FRAME | NX_PRPTYPE_U32) NX_PROP_FRM_FLEX_RAY_IN_CYC_REP_ENABLED = (0x00000030 | NX_CLASS_FRAME | NX_PRPTYPE_BOOL) NX_PROP_FRM_FLEX_RAY_IN_CYC_REP_I_DS = (0x00000031 | NX_CLASS_FRAME | NX_PRPTYPE_1_DU32) NX_PROP_FRM_FLEX_RAY_IN_CYC_REP_CH_ASSIGNS = (0x00000032 | NX_CLASS_FRAME | NX_PRPTYPE_1_DU32) NX_PROP_FRM_LIN_CHECKSUM = (0x00000050 | NX_CLASS_FRAME | NX_PRPTYPE_U32) NX_PROP_FRM_MUX_IS_MUXED = (0x00000040 | NX_CLASS_FRAME | NX_PRPTYPE_BOOL) NX_PROP_FRM_MUX_DATA_MUX_SIG_REF = (0x00000041 | NX_CLASS_FRAME | NX_PRPTYPE_REF) NX_PROP_FRM_MUX_STATIC_SIG_REFS = (0x00000042 | NX_CLASS_FRAME | NX_PRPTYPE_1_DREF) NX_PROP_FRM_MUX_SUBFRAME_REFS = (0x00000043 | NX_CLASS_FRAME | NX_PRPTYPE_1_DREF) NX_PROP_FRM_PDU_REFS = (0x00000060 | NX_CLASS_FRAME | NX_PRPTYPE_1_DREF) NX_PROP_FRM_PDU_START_BITS = (0x00000061 | NX_CLASS_FRAME | NX_PRPTYPE_1_DU32) NX_PROP_FRM_PDU_UPDATE_BITS = (0x00000063 | NX_CLASS_FRAME | NX_PRPTYPE_1_DU32) NX_PROP_FRM_VARIABLE_PAYLOAD = (0x00000065 | NX_CLASS_FRAME | NX_PRPTYPE_BOOL) NX_PROP_FRM_CA_NIO_MODE = (0x00000066 | NX_CLASS_FRAME | NX_PRPTYPE_U32) NX_PROP_PDU_CLUSTER_REF = (0x00000004 | NX_CLASS_PDU | NX_PRPTYPE_REF) NX_PROP_PDU_DEFAULT_PAYLOAD = (0x00000005 | NX_CLASS_PDU | NX_PRPTYPE_1_DU8) NX_PROP_PDU_COMMENT = (0x00000002 | NX_CLASS_PDU | NX_PRPTYPE_STRING) NX_PROP_PDU_CONFIG_STATUS = (0x00000007 | NX_CLASS_PDU | NX_PRPTYPE_U32) NX_PROP_PDU_FRM_REFS = (0x00000006 | NX_CLASS_PDU | NX_PRPTYPE_1_DREF) NX_PROP_PDU_NAME = (0x00000001 | NX_CLASS_PDU | NX_PRPTYPE_STRING) NX_PROP_PDU_PAYLOAD_LEN = (0x00000003 | NX_CLASS_PDU | NX_PRPTYPE_U32) NX_PROP_PDU_SIG_REFS = (0x00000005 | NX_CLASS_PDU | NX_PRPTYPE_1_DREF) NX_PROP_PDU_MUX_IS_MUXED = (0x00000008 | NX_CLASS_PDU | NX_PRPTYPE_BOOL) NX_PROP_PDU_MUX_DATA_MUX_SIG_REF = (0x00000009 | NX_CLASS_PDU | NX_PRPTYPE_REF) NX_PROP_PDU_MUX_STATIC_SIG_REFS = (0x0000000A | NX_CLASS_PDU | NX_PRPTYPE_1_DREF) NX_PROP_PDU_MUX_SUBFRAME_REFS = (0x0000000B | NX_CLASS_PDU | NX_PRPTYPE_1_DREF) NX_PROP_SIG_BYTE_ORDR = (0x00000001 | NX_CLASS_SIGNAL | NX_PRPTYPE_U32) NX_PROP_SIG_COMMENT = (0x00000002 | NX_CLASS_SIGNAL | NX_PRPTYPE_STRING) NX_PROP_SIG_CONFIG_STATUS = (0x00000009 | NX_CLASS_SIGNAL | NX_PRPTYPE_U32) NX_PROP_SIG_DATA_TYPE = (0x00000003 | NX_CLASS_SIGNAL | NX_PRPTYPE_U32) NX_PROP_SIG_DEFAULT = (0x00000004 | NX_CLASS_SIGNAL | NX_PRPTYPE_F64) NX_PROP_SIG_FRAME_REF = (0x00000005 | NX_CLASS_SIGNAL | NX_PRPTYPE_REF) NX_PROP_SIG_MAX = (0x00000006 | NX_CLASS_SIGNAL | NX_PRPTYPE_F64) NX_PROP_SIG_MIN = (0x00000007 | NX_CLASS_SIGNAL | NX_PRPTYPE_F64) NX_PROP_SIG_NAME = (0x00000008 | NX_CLASS_SIGNAL | NX_PRPTYPE_STRING) NX_PROP_SIG_NAME_UNIQUE_TO_CLUSTER = (0x00000010 | NX_CLASS_SIGNAL | NX_PRPTYPE_STRING) NX_PROP_SIG_NUM_BITS = (0x00000012 | NX_CLASS_SIGNAL | NX_PRPTYPE_U32) NX_PROP_SIG_PDU_REF = (0x00000011 | NX_CLASS_SIGNAL | NX_PRPTYPE_REF) NX_PROP_SIG_SCALE_FAC = (0x00000013 | NX_CLASS_SIGNAL | NX_PRPTYPE_F64) NX_PROP_SIG_SCALE_OFF = (0x00000014 | NX_CLASS_SIGNAL | NX_PRPTYPE_F64) NX_PROP_SIG_START_BIT = (0x00000015 | NX_CLASS_SIGNAL | NX_PRPTYPE_U32) NX_PROP_SIG_UNIT = (0x00000016 | NX_CLASS_SIGNAL | NX_PRPTYPE_STRING) NX_PROP_SIG_MUX_IS_DATA_MUX = (0x00000030 | NX_CLASS_SIGNAL | NX_PRPTYPE_BOOL) NX_PROP_SIG_MUX_IS_DYNAMIC = (0x00000031 | NX_CLASS_SIGNAL | NX_PRPTYPE_BOOL) NX_PROP_SIG_MUX_VALUE = (0x00000032 | NX_CLASS_SIGNAL | NX_PRPTYPE_U32) NX_PROP_SIG_MUX_SUBFRM_REF = (0x00000033 | NX_CLASS_SIGNAL | NX_PRPTYPE_REF) NX_PROP_SUBFRM_CONFIG_STATUS = (0x00000009 | NX_CLASS_SUBFRAME | NX_PRPTYPE_U32) NX_PROP_SUBFRM_DYN_SIG_REFS = (0x00000001 | NX_CLASS_SUBFRAME | NX_PRPTYPE_1_DREF) NX_PROP_SUBFRM_FRM_REF = (0x00000002 | NX_CLASS_SUBFRAME | NX_PRPTYPE_REF) NX_PROP_SUBFRM_MUX_VALUE = (0x00000003 | NX_CLASS_SUBFRAME | NX_PRPTYPE_U32) NX_PROP_SUBFRM_NAME = (0x00000004 | NX_CLASS_SUBFRAME | NX_PRPTYPE_STRING) NX_PROP_SUBFRM_PDU_REF = (0x00000005 | NX_CLASS_SUBFRAME | NX_PRPTYPE_REF) NX_PROP_SUBFRM_NAME_UNIQUE_TO_CLUSTER = (0x00000007 | NX_CLASS_SUBFRAME | NX_PRPTYPE_STRING) NX_PROP_ECU_CLST_REF = (0x00000001 | NX_CLASS_ECU | NX_PRPTYPE_REF) NX_PROP_ECU_COMMENT = (0x00000005 | NX_CLASS_ECU | NX_PRPTYPE_STRING) NX_PROP_ECU_CONFIG_STATUS = (0x00000009 | NX_CLASS_ECU | NX_PRPTYPE_U32) NX_PROP_ECU_NAME = (0x00000002 | NX_CLASS_ECU | NX_PRPTYPE_STRING) NX_PROP_ECU_RX_FRM_REFS = (0x00000003 | NX_CLASS_ECU | NX_PRPTYPE_1_DREF) NX_PROP_ECU_TX_FRM_REFS = (0x00000004 | NX_CLASS_ECU | NX_PRPTYPE_1_DREF) NX_PROP_ECU_FLEX_RAY_IS_COLDSTART = (0x00000010 | NX_CLASS_ECU | NX_PRPTYPE_BOOL) NX_PROP_ECU_FLEX_RAY_STARTUP_FRAME_REF = (0x00000011 | NX_CLASS_ECU | NX_PRPTYPE_REF) NX_PROP_ECU_FLEX_RAY_WAKEUP_PTRN = (0x00000012 | NX_CLASS_ECU | NX_PRPTYPE_U32) NX_PROP_ECU_FLEX_RAY_WAKEUP_CHS = (0x00000013 | NX_CLASS_ECU | NX_PRPTYPE_U32) NX_PROP_ECU_FLEX_RAY_CONNECTED_CHS = (0x00000014 | NX_CLASS_ECU | NX_PRPTYPE_U32) NX_PROP_ECU_LIN_MASTER = (0x00000020 | NX_CLASS_ECU | NX_PRPTYPE_BOOL) NX_PROP_ECU_LIN_PROTOCOL_VER = (0x00000021 | NX_CLASS_ECU | NX_PRPTYPE_U32) NX_PROP_ECU_LIN_INITIAL_NAD = (0x00000022 | NX_CLASS_ECU | NX_PRPTYPE_U32) NX_PROP_ECU_LIN_CONFIG_NAD = (0x00000023 | NX_CLASS_ECU | NX_PRPTYPE_U32) NX_PROP_ECU_LIN_SUPPLIER_ID = (0x00000024 | NX_CLASS_ECU | NX_PRPTYPE_U32) NX_PROP_ECU_LIN_FUNCTION_ID = (0x00000025 | NX_CLASS_ECU | NX_PRPTYPE_U32) NX_PROP_ECU_LINP_2MIN = (0x00000026 | NX_CLASS_ECU | NX_PRPTYPE_F64) NX_PROP_ECU_LINS_TMIN = (0x00000027 | NX_CLASS_ECU | NX_PRPTYPE_F64) NX_PROP_ECU_J1939_PREFERRED_ADDRESS = (0x00000028 | NX_CLASS_ECU | NX_PRPTYPE_U32) NX_PROP_ECU_J1939_NODE_NAME = (0x00000029 | NX_CLASS_ECU | NX_PRPTYPE_U64) NX_PROP_LIN_SCHED_CLST_REF = (0x00000005 | NX_CLASS_LIN_SCHED | NX_PRPTYPE_REF) NX_PROP_LIN_SCHED_COMMENT = (0x00000006 | NX_CLASS_LIN_SCHED | NX_PRPTYPE_STRING) NX_PROP_LIN_SCHED_CONFIG_STATUS = (0x00000007 | NX_CLASS_LIN_SCHED | NX_PRPTYPE_U32) NX_PROP_LIN_SCHED_ENTRIES = (0x00000001 | NX_CLASS_LIN_SCHED | NX_PRPTYPE_1_DREF) NX_PROP_LIN_SCHED_NAME = (0x00000002 | NX_CLASS_LIN_SCHED | NX_PRPTYPE_STRING) NX_PROP_LIN_SCHED_PRIORITY = (0x00000003 | NX_CLASS_LIN_SCHED | NX_PRPTYPE_U32) NX_PROP_LIN_SCHED_RUN_MODE = (0x00000004 | NX_CLASS_LIN_SCHED | NX_PRPTYPE_U32) NX_PROP_LIN_SCHED_ENTRY_COLLISION_RES_SCHED = (0x00000001 | NX_CLASS_LIN_SCHED_ENTRY | NX_PRPTYPE_REF) NX_PROP_LIN_SCHED_ENTRY_DELAY = (0x00000002 | NX_CLASS_LIN_SCHED_ENTRY | NX_PRPTYPE_F64) NX_PROP_LIN_SCHED_ENTRY_EVENT_ID = (0x00000003 | NX_CLASS_LIN_SCHED_ENTRY | NX_PRPTYPE_U32) NX_PROP_LIN_SCHED_ENTRY_FRAMES = (0x00000004 | NX_CLASS_LIN_SCHED_ENTRY | NX_PRPTYPE_1_DREF) NX_PROP_LIN_SCHED_ENTRY_NAME = (0x00000006 | NX_CLASS_LIN_SCHED_ENTRY | NX_PRPTYPE_STRING) NX_PROP_LIN_SCHED_ENTRY_NAME_UNIQUE_TO_CLUSTER = (0x00000008 | NX_CLASS_LIN_SCHED_ENTRY | NX_PRPTYPE_STRING) NX_PROP_LIN_SCHED_ENTRY_SCHED = (0x00000007 | NX_CLASS_LIN_SCHED_ENTRY | NX_PRPTYPE_REF) NX_PROP_LIN_SCHED_ENTRY_TYPE = (0x00000005 | NX_CLASS_LIN_SCHED_ENTRY | NX_PRPTYPE_U32) NX_PROP_LIN_SCHED_ENTRY_NC_FF_DATA_BYTES = (0x00000009 | NX_CLASS_LIN_SCHED_ENTRY | NX_PRPTYPE_1_DU8) NX_MODE_SIGNAL_IN_SINGLE_POINT = 0 NX_MODE_SIGNAL_IN_WAVEFORM = 1 NX_MODE_SIGNAL_IN_XY = 2 NX_MODE_SIGNAL_OUT_SINGLE_POINT = 3 NX_MODE_SIGNAL_OUT_WAVEFORM = 4 NX_MODE_SIGNAL_OUT_XY = 5 NX_MODE_FRAME_IN_STREAM = 6 NX_MODE_FRAME_IN_QUEUED = 7 NX_MODE_FRAME_IN_SINGLE_POINT = 8 NX_MODE_FRAME_OUT_STREAM = 9 NX_MODE_FRAME_OUT_QUEUED = 10 NX_MODE_FRAME_OUT_SINGLE_POINT = 11 NX_MODE_SIGNAL_CONVERSION_SINGLE_POINT = 12 NX_START_STOP_NORMAL = 0 NX_START_STOP_SESSION_ONLY = 1 NX_START_STOP_INTERFACE_ONLY = 2 NX_START_STOP_SESSION_ONLY_BLOCKING = 3 NX_BLINK_DISABLE = 0 NX_BLINK_ENABLE = 1 NX_TERM_PXI_TRIG0 = "PXI_Trig0" NX_TERM_PXI_TRIG1 = "PXI_Trig1" NX_TERM_PXI_TRIG2 = "PXI_Trig2" NX_TERM_PXI_TRIG3 = "PXI_Trig3" NX_TERM_PXI_TRIG4 = "PXI_Trig4" NX_TERM_PXI_TRIG5 = "PXI_Trig5" NX_TERM_PXI_TRIG6 = "PXI_Trig6" NX_TERM_PXI_TRIG7 = "PXI_Trig7" NX_TERM_FRONT_PANEL0 = "FrontPanel0" NX_TERM_FRONT_PANEL1 = "FrontPanel1" NX_TERM_PXI_STAR = "PXI_Star" NX_TERM_PXI_CLK10 = "PXI_Clk10" NX_TERM_10_M_HZ_TIMEBASE = "10MHzTimebase" NX_TERM_1_M_HZ_TIMEBASE = "1MHzTimebase" NX_TERM_MASTER_TIMEBASE = "MasterTimebase" NX_TERM_COMM_TRIGGER = "CommTrigger" NX_TERM_START_TRIGGER = "StartTrigger" NX_TERM_FLEX_RAY_START_CYCLE = "FlexRayStartCycle" NX_TERM_FLEX_RAY_MACROTICK = "FlexRayMacrotick" NX_TERM_LOG_TRIGGER = "LogTrigger" NX_STATE_TIME_CURRENT = (0x00000001 | NX_CLASS_INTERFACE | NX_PRPTYPE_TIME) NX_STATE_TIME_COMMUNICATING = (0x00000002 | NX_CLASS_INTERFACE | NX_PRPTYPE_TIME) NX_STATE_TIME_START = (0x00000003 | NX_CLASS_INTERFACE | NX_PRPTYPE_TIME) NX_STATE_SESSION_INFO = (0x00000004 | NX_CLASS_INTERFACE | NX_PRPTYPE_U32) NX_STATE_CAN_COMM = (0x00000010 | NX_CLASS_INTERFACE | NX_PRPTYPE_U32) NX_STATE_FLEX_RAY_COMM = (0x00000020 | NX_CLASS_INTERFACE | NX_PRPTYPE_U32) NX_STATE_FLEX_RAY_STATS = (0x00000021 | NX_CLASS_INTERFACE | NX_PRPTYPE_1_DU32) NX_STATE_LIN_COMM = (0x00000030 | NX_CLASS_INTERFACE | NX_PRPTYPE_U32) NX_STATE_J1939_COMM = (0x00000040 | NX_CLASS_INTERFACE | NX_PRPTYPE_U32) NX_STATE_LIN_SCHEDULE_CHANGE = (0x00000081 | NX_CLASS_INTERFACE | NX_PRPTYPE_U32) NX_STATE_LIN_DIAGNOSTIC_SCHEDULE_CHANGE = (0x00000083 | NX_CLASS_INTERFACE | NX_PRPTYPE_U32) NX_STATE_FLEX_RAY_SYMBOL = (0x00000082 | NX_CLASS_INTERFACE | NX_PRPTYPE_U32) NX_CAN_FD_MODE_ISO = 0 NX_CAN_FD_MODE_NON_ISO = 1 NX_CAN_FD_MODE_ISO_LEGACY = 2 NX_SESSION_INFO_STATE_STOPPED = 0 NX_SESSION_INFO_STATE_STARTED = 1 NX_SESSION_INFO_STATE_MIX = 2 NX_CAN_COMM_STATE_ERROR_ACTIVE = 0 NX_CAN_COMM_STATE_ERROR_PASSIVE = 1 NX_CAN_COMM_STATE_BUS_OFF = 2 NX_CAN_COMM_STATE_INIT = 3 NX_CAN_LAST_ERR_NONE = 0 NX_CAN_LAST_ERR_STUFF = 1 NX_CAN_LAST_ERR_FORM = 2 NX_CAN_LAST_ERR_ACK = 3 NX_CAN_LAST_ERR_BIT1 = 4 NX_CAN_LAST_ERR_BIT0 = 5 NX_CAN_LAST_ERR_CRC = 6 NX_CA_NIO_MODE_CAN = 0 NX_CA_NIO_MODE_CAN_FD = 1 NX_CA_NIO_MODE_CAN_FD_BRS = 2 NX_FLEX_RAY_POC_STATE_DEFAULT_CONFIG = 0 NX_FLEX_RAY_POC_STATE_READY = 1 NX_FLEX_RAY_POC_STATE_NORMAL_ACTIVE = 2 NX_FLEX_RAY_POC_STATE_NORMAL_PASSIVE = 3 NX_FLEX_RAY_POC_STATE_HALT = 4 NX_FLEX_RAY_POC_STATE_MONITOR = 5 NX_FLEX_RAY_POC_STATE_CONFIG = 15 NX_LIN_COMM_STATE_IDLE = 0 NX_LIN_COMM_STATE_ACTIVE = 1 NX_LIN_COMM_STATE_INACTIVE = 2 NX_LIN_DIAGNOSTIC_SCHEDULE_NULL = 0x0000 NX_LIN_DIAGNOSTIC_SCHEDULE_MASTER_REQ = 0x0001 NX_LIN_DIAGNOSTIC_SCHEDULE_SLAVE_RESP = 0x0002 NX_LIN_LAST_ERR_CODE_NONE = 0 NX_LIN_LAST_ERR_CODE_UNKNOWN_ID = 1 NX_LIN_LAST_ERR_CODE_FORM = 2 NX_LIN_LAST_ERR_CODE_FRAMING = 3 NX_LIN_LAST_ERR_CODE_READBACK = 4 NX_LIN_LAST_ERR_CODE_TIMEOUT = 5 NX_LIN_LAST_ERR_CODE_CRC = 6 NX_CONDITION_TRANSMIT_COMPLETE = 0x8001 NX_CONDITION_INTF_COMMUNICATING = 0x8002 NX_CONDITION_INTF_REMOTE_WAKEUP = 0x8003 NX_TIMEOUT_NONE = (0) NX_TIMEOUT_INFINITE = (-1) NX_GET_DBC_MODE_ATTRIBUTE = 0 NX_GET_DBC_MODE_ENUMERATION_LIST = 1 NX_GET_DBC_MODE_ATTRIBUTE_LIST = 2 NX_GET_DBC_MODE_VALUE_TABLE_LIST = 3 NXDB_MERGE_COPY_USE_SOURCE = 0 NXDB_MERGE_COPY_USE_TARGET = 1 NXDB_MERGE_MERGE_USE_SOURCE = 2 NXDB_MERGE_MERGE_USE_TARGET = 3 NX_DONGLE_STATE_NO_DONGLE_NO_EXT_POWER = 1 NX_DONGLE_STATE_NO_DONGLE_EXT_POWER = 2 NX_DONGLE_STATE_DONGLE_NO_EXT_POWER = 3 NX_DONGLE_STATE_READY = 4 NX_DONGLE_STATE_BUSY = 5 NX_DONGLE_STATE_COMM_ERROR = 13 NX_DONGLE_STATE_OVER_CURRENT = 14 NX_DONGLE_ID_LS_CAN = 1 NX_DONGLE_ID_HS_CAN = 2 NX_DONGLE_ID_SW_CAN = 3 NX_DONGLE_ID_XS_CAN = 4 NX_DONGLE_ID_LIN = 6 NX_DONGLE_ID_DONGLE_LESS = 13 NX_DONGLE_ID_UNKNOWN = 14 NX_PHASE_DEVELOPMENT = 0 NX_PHASE_ALPHA = 1 NX_PHASE_BETA = 2 NX_PHASE_RELEASE = 3 NX_DEV_FORM_PXI = 0 NX_DEV_FORM_PCI = 1 NX_DEV_FORM_C_SERIES = 2 NX_DEV_FORM_PX_IE = 3 NX_DEV_FORM_USB = 4 NX_CAN_TERM_CAP_NO = 0 NX_CAN_TERM_CAP_YES = 1 NX_CAN_TCVR_CAP_HS = 0 NX_CAN_TCVR_CAP_LS = 1 NX_CAN_TCVR_CAP_XS = 3 NX_CAN_TCVR_CAP_XS_HS_LS = 4 NX_CAN_TCVR_CAP_UNKNOWN = 0xFFFFFFFF NX_PROTOCOL_UNKNOWN = 0xFFFFFFFE NX_PROTOCOL_CAN = 0 NX_PROTOCOL_FLEX_RAY = 1 NX_PROTOCOL_LIN = 2 NX_APP_PROTOCOL_NONE = 0 NX_APP_PROTOCOL_J1939 = 1 NX_CAN_TERM_OFF = 0 NX_CAN_TERM_ON = 1 NX_CAN_TCVR_STATE_NORMAL = 0 NX_CAN_TCVR_STATE_SLEEP = 1 NX_CAN_TCVR_STATE_SW_WAKEUP = 2 NX_CAN_TCVR_STATE_SW_HIGH_SPEED = 3 NX_CAN_TCVR_TYPE_HS = 0 NX_CAN_TCVR_TYPE_LS = 1 NX_CAN_TCVR_TYPE_SW = 2 NX_CAN_TCVR_TYPE_EXT = 3 NX_CAN_TCVR_TYPE_DISC = 4 NX_FLEX_RAY_SAMP_PER_MICRO_1 = 0 NX_FLEX_RAY_SAMP_PER_MICRO_2 = 1 NX_FLEX_RAY_SAMP_PER_MICRO_4 = 2 NX_FLEX_RAY_TERM_OFF = 0 NX_FLEX_RAY_TERM_ON = 1 NX_LIN_SLEEP_REMOTE_SLEEP = 0 NX_LIN_SLEEP_REMOTE_WAKE = 1 NX_LIN_SLEEP_LOCAL_SLEEP = 2 NX_LIN_SLEEP_LOCAL_WAKE = 3 NX_LIN_TERM_OFF = 0 NX_LIN_TERM_ON = 1 NX_OUT_STRM_TIMNG_IMMEDIATE = 0 NX_OUT_STRM_TIMNG_REPLAY_EXCLUSIVE = 1 NX_OUT_STRM_TIMNG_REPLAY_INCLUSIVE = 2 NX_CAN_PEND_TX_ORDER_AS_SUBMITTED = 0 NX_CAN_PEND_TX_ORDER_BY_IDENTIFIER = 1 NX_FLEX_RAY_SLEEP_LOCAL_SLEEP = 0 NX_FLEX_RAY_SLEEP_LOCAL_WAKE = 1 NX_FLEX_RAY_SLEEP_REMOTE_WAKE = 2 NX_CAN_EXT_TCVR_CONFIG_NORMAL_SUPPORTED = (1 << 2) NX_CAN_EXT_TCVR_CONFIG_SLEEP_SUPPORTED = (1 << 5) NX_CAN_EXT_TCVR_CONFIG_SW_WAKEUP_SUPPORTED = (1 << 8) NX_CAN_EXT_TCVR_CONFIG_SW_HIGH_SPEED_SUPPORTED = (1 << 11) NX_CAN_EXT_TCVR_CONFIG_POWER_ON_SUPPORTED = (1 << 14) NX_CAN_EXT_TCVR_CONFIG_NORMAL_OUTPUT0_SET = (1 << 0) NX_CAN_EXT_TCVR_CONFIG_SLEEP_OUTPUT0_SET = (1 << 3) NX_CAN_EXT_TCVR_CONFIG_SW_WAKEUP_OUTPUT0_SET = (1 << 6) NX_CAN_EXT_TCVR_CONFIG_SW_HIGH_SPEED_OUTPUT0_SET = (1 << 9) NX_CAN_EXT_TCVR_CONFIG_POWER_ON_OUTPUT0_SET = (1 << 12) NX_CAN_EXT_TCVR_CONFIG_NORMAL_OUTPUT1_SET = (1 << 1) NX_CAN_EXT_TCVR_CONFIG_SLEEP_OUTPUT1_SET = (1 << 4) NX_CAN_EXT_TCVR_CONFIG_SW_WAKEUP_OUTPUT1_SET = (1 << 7) NX_CAN_EXT_TCVR_CONFIG_SW_HIGH_SPEED_OUTPUT1_SET = (1 << 10) NX_CAN_EXT_TCVR_CONFIG_POWER_ON_OUTPUT1_SET = (1 << 13) NX_CAN_EXT_TCVR_CONFIG_N_ERR_CONNECTED = (1 << 31) NX_FRM_FLEX_RAY_CH_ASSIGN_A = 1 NX_FRM_FLEX_RAY_CH_ASSIGN_B = 2 NX_FRM_FLEX_RAY_CH_ASSIGN_AAND_B = 3 NX_FRM_FLEX_RAY_CH_ASSIGN_NONE = 4 NX_CLST_FLEX_RAY_SAMP_CLK_PER_P0125US = 0 NX_CLST_FLEX_RAY_SAMP_CLK_PER_P025US = 1 NX_CLST_FLEX_RAY_SAMP_CLK_PER_P05US = 2 NX_FRM_FLEX_RAY_TIMING_CYCLIC = 0 NX_FRM_FLEX_RAY_TIMING_EVENT = 1 NX_FRM_CAN_TIMING_CYCLIC_DATA = 0 NX_FRM_CAN_TIMING_EVENT_DATA = 1 NX_FRM_CAN_TIMING_CYCLIC_REMOTE = 2 NX_FRM_CAN_TIMING_EVENT_REMOTE = 3 NX_FRM_CAN_TIMING_CYCLIC_EVENT = 4 NX_SIG_BYTE_ORDR_LITTLE_ENDIAN = 0 NX_SIG_BYTE_ORDR_BIG_ENDIAN = 1 NX_SIG_DATA_TYPE_SIGNED = 0 NX_SIG_DATA_TYPE_UNSIGNED = 1 NX_SIG_DATA_TYPE_IEEE_FLOAT = 2 NX_LIN_PROTOCOL_VER_1_2 = 2 NX_LIN_PROTOCOL_VER_1_3 = 3 NX_LIN_PROTOCOL_VER_2_0 = 4 NX_LIN_PROTOCOL_VER_2_1 = 5 NX_LIN_PROTOCOL_VER_2_2 = 6 NX_LIN_SCHED_RUN_MODE_CONTINUOUS = 0 NX_LIN_SCHED_RUN_MODE_ONCE = 1 NX_LIN_SCHED_RUN_MODE_NULL = 2 NX_LIN_SCHED_ENTRY_TYPE_UNCONDITIONAL = 0 NX_LIN_SCHED_ENTRY_TYPE_SPORADIC = 1 NX_LIN_SCHED_ENTRY_TYPE_EVENT_TRIGGERED = 2 NX_LIN_SCHED_ENTRY_TYPE_NODE_CONFIG_SERVICE = 3 NX_FRM_LIN_CHECKSUM_CLASSIC = 0 NX_FRM_LIN_CHECKSUM_ENHANCED = 1 NX_FRAME_TYPE_CAN_DATA = 0x00 NX_FRAME_TYPE_CAN_REMOTE = 0x01 NX_FRAME_TYPE_CAN_BUS_ERROR = 0x02 NX_FRAME_TYPE_CAN20_DATA = 0x08 NX_FRAME_TYPE_CANFD_DATA = 0x10 NX_FRAME_TYPE_CANFDBRS_DATA = 0x18 NX_FRAME_TYPE_FLEX_RAY_DATA = 0x20 NX_FRAME_TYPE_FLEX_RAY_NULL = 0x21 NX_FRAME_TYPE_FLEX_RAY_SYMBOL = 0x22 NX_FRAME_TYPE_LIN_DATA = 0x40 NX_FRAME_TYPE_LIN_BUS_ERROR = 0x41 NX_FRAME_TYPE_LIN_NO_RESPONSE = 0x42 NX_FRAME_TYPE_J1939_DATA = 0xC0 NX_FRAME_TYPE_SPECIAL_DELAY = 0xE0 NX_FRAME_TYPE_SPECIAL_LOG_TRIGGER = 0xE1 NX_FRAME_TYPE_SPECIAL_START_TRIGGER = 0xE2 NX_FRAME_ID_CAN_IS_EXTENDED = 0x20000000 NX_FRAME_FLAGS_FLEX_RAY_STARTUP = 0x01 NX_FRAME_FLAGS_FLEX_RAY_SYNC = 0x02 NX_FRAME_FLAGS_FLEX_RAY_PREAMBLE = 0x04 NX_FRAME_FLAGS_FLEX_RAY_CH_A = 0x10 NX_FRAME_FLAGS_FLEX_RAY_CH_B = 0x20 NX_FRAME_FLAGS_LIN_EVENT_SLOT = 0x01 NX_FRAME_FLAGS_TRANSMIT_ECHO = 0x80 NX_FLEX_RAY_SYMBOL_MTS = 0x00 NX_FLEX_RAY_SYMBOL_WAKEUP = 0x01 NX_FRAME_PAYLD_LEN_HIGH_MASK_J1939 = (7) NX_SIZEOF_FRAME_HEADER = (16)
import unicodedata from collections import OrderedDict from django.conf import settings from django.contrib import messages from django.contrib.auth import update_session_auth_hash from django.core.exceptions import FieldDoesNotExist, ValidationError from django.db import models from django.db.models import Q from django.utils.encoding import force_str from django.utils.http import base36_to_int, int_to_base36, urlencode from allauth.account import app_settings, signals from allauth.account.adapter import get_adapter from allauth.exceptions import ImmediateHttpResponse from allauth.utils import ( get_request_param, get_user_model, import_callable, valid_email_or_none, ) def _unicode_ci_compare(s1, s2): """ Perform case-insensitive comparison of two identifiers, using the recommended algorithm from Unicode Technical Report 36, section 2.11.2(B)(2). """ norm_s1 = unicodedata.normalize("NFKC", s1).casefold() norm_s2 = unicodedata.normalize("NFKC", s2).casefold() return norm_s1 == norm_s2 def get_next_redirect_url(request, redirect_field_name="next"): """ Returns the next URL to redirect to, if it was explicitly passed via the request. """ redirect_to = get_request_param(request, redirect_field_name) if not get_adapter(request).is_safe_url(redirect_to): redirect_to = None return redirect_to def get_login_redirect_url(request, url=None, redirect_field_name="next", signup=False): ret = url if url and callable(url): # In order to be able to pass url getters around that depend # on e.g. the authenticated state. ret = url() if not ret: ret = get_next_redirect_url(request, redirect_field_name=redirect_field_name) if not ret: if signup: ret = get_adapter(request).get_signup_redirect_url(request) else: ret = get_adapter(request).get_login_redirect_url(request) return ret _user_display_callable = None def logout_on_password_change(request, user): # Since it is the default behavior of Django to invalidate all sessions on # password change, this function actually has to preserve the session when # logout isn't desired. if not app_settings.LOGOUT_ON_PASSWORD_CHANGE: update_session_auth_hash(request, user) def default_user_display(user): if app_settings.USER_MODEL_USERNAME_FIELD: return getattr(user, app_settings.USER_MODEL_USERNAME_FIELD) else: return force_str(user) def user_display(user): global _user_display_callable if not _user_display_callable: f = getattr(settings, "ACCOUNT_USER_DISPLAY", default_user_display) _user_display_callable = import_callable(f) return _user_display_callable(user) def user_field(user, field, *args): """ Gets or sets (optional) user model fields. No-op if fields do not exist. """ if not field: return User = get_user_model() try: field_meta = User._meta.get_field(field) max_length = field_meta.max_length except FieldDoesNotExist: if not hasattr(user, field): return max_length = None if args: # Setter v = args[0] if v: v = v[0:max_length] setattr(user, field, v) else: # Getter return getattr(user, field) def user_username(user, *args): if args and not app_settings.PRESERVE_USERNAME_CASING and args[0]: args = [args[0].lower()] return user_field(user, app_settings.USER_MODEL_USERNAME_FIELD, *args) def user_email(user, *args): return user_field(user, app_settings.USER_MODEL_EMAIL_FIELD, *args) def has_verified_email(user, email=None): from .models import EmailAddress emailaddress = None if email: ret = False try: emailaddress = EmailAddress.objects.get_for_user(user, email) ret = emailaddress.verified except EmailAddress.DoesNotExist: pass else: ret = EmailAddress.objects.filter(user=user, verified=True).exists() return ret def perform_login( request, user, email_verification, redirect_url=None, signal_kwargs=None, signup=False, email=None, ): """ Keyword arguments: signup -- Indicates whether or not sending the email is essential (during signup), or if it can be skipped (e.g. in case email verification is optional and we are only logging in). """ # Local users are stopped due to form validation checking # is_active, yet, adapter methods could toy with is_active in a # `user_signed_up` signal. Furthermore, social users should be # stopped anyway. adapter = get_adapter(request) try: hook_kwargs = dict( email_verification=email_verification, redirect_url=redirect_url, signal_kwargs=signal_kwargs, signup=signup, email=email, ) response = adapter.pre_login(request, user, **hook_kwargs) if response: return response adapter.login(request, user) response = adapter.post_login(request, user, **hook_kwargs) if response: return response except ImmediateHttpResponse as e: response = e.response return response def complete_signup(request, user, email_verification, success_url, signal_kwargs=None): if signal_kwargs is None: signal_kwargs = {} signals.user_signed_up.send( sender=user.__class__, request=request, user=user, **signal_kwargs ) return perform_login( request, user, email_verification=email_verification, signup=True, redirect_url=success_url, signal_kwargs=signal_kwargs, ) def cleanup_email_addresses(request, addresses): """ Takes a list of EmailAddress instances and cleans it up, making sure only valid ones remain, without multiple primaries etc. Order is important: e.g. if multiple primary e-mail addresses exist, the first one encountered will be kept as primary. """ from .models import EmailAddress adapter = get_adapter(request) # Let's group by `email` e2a = OrderedDict() # maps email to EmailAddress primary_addresses = [] verified_addresses = [] primary_verified_addresses = [] for address in addresses: # Pick up only valid ones... email = valid_email_or_none(address.email) if not email: continue # ... and non-conflicting ones... if ( app_settings.UNIQUE_EMAIL and EmailAddress.objects.filter(email__iexact=email).exists() ): continue a = e2a.get(email.lower()) if a: a.primary = a.primary or address.primary a.verified = a.verified or address.verified else: a = address a.verified = a.verified or adapter.is_email_verified(request, a.email) e2a[email.lower()] = a if a.primary: primary_addresses.append(a) if a.verified: primary_verified_addresses.append(a) if a.verified: verified_addresses.append(a) # Now that we got things sorted out, let's assign a primary if primary_verified_addresses: primary_address = primary_verified_addresses[0] elif verified_addresses: # Pick any verified as primary primary_address = verified_addresses[0] elif primary_addresses: # Okay, let's pick primary then, even if unverified primary_address = primary_addresses[0] elif e2a: # Pick the first primary_address = e2a.keys()[0] else: # Empty primary_address = None # There can only be one primary for a in e2a.values(): a.primary = primary_address.email.lower() == a.email.lower() return list(e2a.values()), primary_address def setup_user_email(request, user, addresses): """ Creates proper EmailAddress for the user that was just signed up. Only sets up, doesn't do any other handling such as sending out email confirmation mails etc. """ from .models import EmailAddress assert not EmailAddress.objects.filter(user=user).exists() priority_addresses = [] # Is there a stashed e-mail? adapter = get_adapter(request) stashed_email = adapter.unstash_verified_email(request) if stashed_email: priority_addresses.append( EmailAddress(user=user, email=stashed_email, primary=True, verified=True) ) email = user_email(user) if email: priority_addresses.append( EmailAddress(user=user, email=email, primary=True, verified=False) ) addresses, primary = cleanup_email_addresses( request, priority_addresses + addresses ) for a in addresses: a.user = user a.save() EmailAddress.objects.fill_cache_for_user(user, addresses) if primary and email and email.lower() != primary.email.lower(): user_email(user, primary.email) user.save() return primary def send_email_confirmation(request, user, signup=False, email=None): """ E-mail verification mails are sent: a) Explicitly: when a user signs up b) Implicitly: when a user attempts to log in using an unverified e-mail while EMAIL_VERIFICATION is mandatory. Especially in case of b), we want to limit the number of mails sent (consider a user retrying a few times), which is why there is a cooldown period before sending a new mail. This cooldown period can be configured in ACCOUNT_EMAIL_CONFIRMATION_COOLDOWN setting. """ from .models import EmailAddress adapter = get_adapter(request) if not email: email = user_email(user) if email: try: email_address = EmailAddress.objects.get_for_user(user, email) if not email_address.verified: send_email = adapter.should_send_confirmation_mail( request, email_address ) if send_email: email_address.send_confirmation(request, signup=signup) else: send_email = False except EmailAddress.DoesNotExist: send_email = True email_address = EmailAddress.objects.add_email( request, user, email, signup=signup, confirm=True ) assert email_address # At this point, if we were supposed to send an email we have sent it. if send_email: adapter.add_message( request, messages.INFO, "account/messages/email_confirmation_sent.txt", {"email": email}, ) if signup: adapter.stash_user(request, user_pk_to_url_str(user)) def sync_user_email_addresses(user): """ Keep user.email in sync with user.emailaddress_set. Under some circumstances the user.email may not have ended up as an EmailAddress record, e.g. in the case of manually created admin users. """ from .models import EmailAddress email = user_email(user) if ( email and not EmailAddress.objects.filter(user=user, email__iexact=email).exists() ): if ( app_settings.UNIQUE_EMAIL and EmailAddress.objects.filter(email__iexact=email).exists() ): # Bail out return # get_or_create() to gracefully handle races EmailAddress.objects.get_or_create( user=user, email=email, defaults={"primary": False, "verified": False} ) def filter_users_by_username(*username): if app_settings.PRESERVE_USERNAME_CASING: qlist = [ Q(**{app_settings.USER_MODEL_USERNAME_FIELD + "__iexact": u}) for u in username ] q = qlist[0] for q2 in qlist[1:]: q = q | q2 ret = get_user_model()._default_manager.filter(q) else: ret = get_user_model()._default_manager.filter( **{ app_settings.USER_MODEL_USERNAME_FIELD + "__in": [u.lower() for u in username] } ) return ret def filter_users_by_email(email, is_active=None): """Return list of users by email address Typically one, at most just a few in length. First we look through EmailAddress table, than customisable User model table. Add results together avoiding SQL joins and deduplicate. """ from .models import EmailAddress User = get_user_model() mails = EmailAddress.objects.filter(email__iexact=email) if is_active is not None: mails = mails.filter(user__is_active=is_active) users = [] for e in mails.prefetch_related("user"): if _unicode_ci_compare(e.email, email): users.append(e.user) if app_settings.USER_MODEL_EMAIL_FIELD: q_dict = {app_settings.USER_MODEL_EMAIL_FIELD + "__iexact": email} user_qs = User.objects.filter(**q_dict) if is_active is not None: user_qs = user_qs.filter(is_active=is_active) for user in user_qs.iterator(): user_email = getattr(user, app_settings.USER_MODEL_EMAIL_FIELD) if _unicode_ci_compare(user_email, email): users.append(user) return list(set(users)) def passthrough_next_redirect_url(request, url, redirect_field_name): assert url.find("?") < 0 # TODO: Handle this case properly next_url = get_next_redirect_url(request, redirect_field_name) if next_url: url = url + "?" + urlencode({redirect_field_name: next_url}) return url def user_pk_to_url_str(user): """ This should return a string. """ User = get_user_model() if issubclass(type(User._meta.pk), models.UUIDField): if isinstance(user.pk, str): return user.pk return user.pk.hex ret = user.pk if isinstance(ret, int): ret = int_to_base36(user.pk) return str(ret) def url_str_to_user_pk(s): User = get_user_model() # TODO: Ugh, isn't there a cleaner way to determine whether or not # the PK is a str-like field? remote_field = getattr(User._meta.pk, "remote_field", None) if remote_field and getattr(remote_field, "to", None): pk_field = User._meta.pk.remote_field.to._meta.pk else: pk_field = User._meta.pk if issubclass(type(pk_field), models.UUIDField): return pk_field.to_python(s) try: pk_field.to_python("a") pk = s except ValidationError: pk = base36_to_int(s) return pk
# -*- coding: utf-8 -*- from operator import attrgetter from pyangbind.lib.yangtypes import RestrictedPrecisionDecimalType from pyangbind.lib.yangtypes import RestrictedClassType from pyangbind.lib.yangtypes import TypedListType from pyangbind.lib.yangtypes import YANGBool from pyangbind.lib.yangtypes import YANGListType from pyangbind.lib.yangtypes import YANGDynClass from pyangbind.lib.yangtypes import ReferenceType from pyangbind.lib.base import PybindBase from collections import OrderedDict from decimal import Decimal from bitarray import bitarray import six # PY3 support of some PY2 keywords (needs improved) if six.PY3: import builtins as __builtin__ long = int elif six.PY2: import __builtin__ class config(PybindBase): """ This class was auto-generated by the PythonClass plugin for PYANG from YANG module openconfig-system - based on the path /system/config. Each member element of the container is represented as a class variable - with a specific YANG type. YANG Description: Global configuration data for the system """ __slots__ = ( "_path_helper", "_extmethods", "__hostname", "__domain_name", "__login_banner", "__motd_banner", ) _yang_name = "config" _pybind_generated_by = "container" def __init__(self, *args, **kwargs): self._path_helper = False self._extmethods = False self.__hostname = YANGDynClass( base=RestrictedClassType( base_type=six.text_type, restriction_dict={ "pattern": "((([a-zA-Z0-9_]([a-zA-Z0-9\\-_]){0,61})?[a-zA-Z0-9]\\.)*([a-zA-Z0-9_]([a-zA-Z0-9\\-_]){0,61})?[a-zA-Z0-9]\\.?)|\\.", "length": ["1..253"], }, ), is_leaf=True, yang_name="hostname", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, namespace="http://openconfig.net/yang/system", defining_module="openconfig-system", yang_type="inet:domain-name", is_config=True, ) self.__domain_name = YANGDynClass( base=RestrictedClassType( base_type=six.text_type, restriction_dict={ "pattern": "((([a-zA-Z0-9_]([a-zA-Z0-9\\-_]){0,61})?[a-zA-Z0-9]\\.)*([a-zA-Z0-9_]([a-zA-Z0-9\\-_]){0,61})?[a-zA-Z0-9]\\.?)|\\.", "length": ["1..253"], }, ), is_leaf=True, yang_name="domain-name", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, namespace="http://openconfig.net/yang/system", defining_module="openconfig-system", yang_type="inet:domain-name", is_config=True, ) self.__login_banner = YANGDynClass( base=six.text_type, is_leaf=True, yang_name="login-banner", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, namespace="http://openconfig.net/yang/system", defining_module="openconfig-system", yang_type="string", is_config=True, ) self.__motd_banner = YANGDynClass( base=six.text_type, is_leaf=True, yang_name="motd-banner", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, namespace="http://openconfig.net/yang/system", defining_module="openconfig-system", yang_type="string", is_config=True, ) load = kwargs.pop("load", None) if args: if len(args) > 1: raise TypeError("cannot create a YANG container with >1 argument") all_attr = True for e in self._pyangbind_elements: if not hasattr(args[0], e): all_attr = False break if not all_attr: raise ValueError("Supplied object did not have the correct attributes") for e in self._pyangbind_elements: nobj = getattr(args[0], e) if nobj._changed() is False: continue setmethod = getattr(self, "_set_%s" % e) if load is None: setmethod(getattr(args[0], e)) else: setmethod(getattr(args[0], e), load=load) def _path(self): if hasattr(self, "_parent"): return self._parent._path() + [self._yang_name] else: return ["system", "config"] def _get_hostname(self): """ Getter method for hostname, mapped from YANG variable /system/config/hostname (inet:domain-name) YANG Description: The hostname of the device -- should be a single domain label, without the domain. """ return self.__hostname def _set_hostname(self, v, load=False): """ Setter method for hostname, mapped from YANG variable /system/config/hostname (inet:domain-name) If this variable is read-only (config: false) in the source YANG file, then _set_hostname is considered as a private method. Backends looking to populate this variable should do so via calling thisObj._set_hostname() directly. YANG Description: The hostname of the device -- should be a single domain label, without the domain. """ if hasattr(v, "_utype"): v = v._utype(v) try: t = YANGDynClass( v, base=RestrictedClassType( base_type=six.text_type, restriction_dict={ "pattern": "((([a-zA-Z0-9_]([a-zA-Z0-9\\-_]){0,61})?[a-zA-Z0-9]\\.)*([a-zA-Z0-9_]([a-zA-Z0-9\\-_]){0,61})?[a-zA-Z0-9]\\.?)|\\.", "length": ["1..253"], }, ), is_leaf=True, yang_name="hostname", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, namespace="http://openconfig.net/yang/system", defining_module="openconfig-system", yang_type="inet:domain-name", is_config=True, ) except (TypeError, ValueError): raise ValueError( { "error-string": """hostname must be of a type compatible with inet:domain-name""", "defined-type": "inet:domain-name", "generated-type": """YANGDynClass(base=RestrictedClassType(base_type=six.text_type, restriction_dict={'pattern': '((([a-zA-Z0-9_]([a-zA-Z0-9\\-_]){0,61})?[a-zA-Z0-9]\\.)*([a-zA-Z0-9_]([a-zA-Z0-9\\-_]){0,61})?[a-zA-Z0-9]\\.?)|\\.', 'length': ['1..253']}), is_leaf=True, yang_name="hostname", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, namespace='http://openconfig.net/yang/system', defining_module='openconfig-system', yang_type='inet:domain-name', is_config=True)""", } ) self.__hostname = t if hasattr(self, "_set"): self._set() def _unset_hostname(self): self.__hostname = YANGDynClass( base=RestrictedClassType( base_type=six.text_type, restriction_dict={ "pattern": "((([a-zA-Z0-9_]([a-zA-Z0-9\\-_]){0,61})?[a-zA-Z0-9]\\.)*([a-zA-Z0-9_]([a-zA-Z0-9\\-_]){0,61})?[a-zA-Z0-9]\\.?)|\\.", "length": ["1..253"], }, ), is_leaf=True, yang_name="hostname", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, namespace="http://openconfig.net/yang/system", defining_module="openconfig-system", yang_type="inet:domain-name", is_config=True, ) def _get_domain_name(self): """ Getter method for domain_name, mapped from YANG variable /system/config/domain_name (inet:domain-name) YANG Description: Specifies the domain name used to form fully qualified name for unqualified hostnames. """ return self.__domain_name def _set_domain_name(self, v, load=False): """ Setter method for domain_name, mapped from YANG variable /system/config/domain_name (inet:domain-name) If this variable is read-only (config: false) in the source YANG file, then _set_domain_name is considered as a private method. Backends looking to populate this variable should do so via calling thisObj._set_domain_name() directly. YANG Description: Specifies the domain name used to form fully qualified name for unqualified hostnames. """ if hasattr(v, "_utype"): v = v._utype(v) try: t = YANGDynClass( v, base=RestrictedClassType( base_type=six.text_type, restriction_dict={ "pattern": "((([a-zA-Z0-9_]([a-zA-Z0-9\\-_]){0,61})?[a-zA-Z0-9]\\.)*([a-zA-Z0-9_]([a-zA-Z0-9\\-_]){0,61})?[a-zA-Z0-9]\\.?)|\\.", "length": ["1..253"], }, ), is_leaf=True, yang_name="domain-name", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, namespace="http://openconfig.net/yang/system", defining_module="openconfig-system", yang_type="inet:domain-name", is_config=True, ) except (TypeError, ValueError): raise ValueError( { "error-string": """domain_name must be of a type compatible with inet:domain-name""", "defined-type": "inet:domain-name", "generated-type": """YANGDynClass(base=RestrictedClassType(base_type=six.text_type, restriction_dict={'pattern': '((([a-zA-Z0-9_]([a-zA-Z0-9\\-_]){0,61})?[a-zA-Z0-9]\\.)*([a-zA-Z0-9_]([a-zA-Z0-9\\-_]){0,61})?[a-zA-Z0-9]\\.?)|\\.', 'length': ['1..253']}), is_leaf=True, yang_name="domain-name", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, namespace='http://openconfig.net/yang/system', defining_module='openconfig-system', yang_type='inet:domain-name', is_config=True)""", } ) self.__domain_name = t if hasattr(self, "_set"): self._set() def _unset_domain_name(self): self.__domain_name = YANGDynClass( base=RestrictedClassType( base_type=six.text_type, restriction_dict={ "pattern": "((([a-zA-Z0-9_]([a-zA-Z0-9\\-_]){0,61})?[a-zA-Z0-9]\\.)*([a-zA-Z0-9_]([a-zA-Z0-9\\-_]){0,61})?[a-zA-Z0-9]\\.?)|\\.", "length": ["1..253"], }, ), is_leaf=True, yang_name="domain-name", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, namespace="http://openconfig.net/yang/system", defining_module="openconfig-system", yang_type="inet:domain-name", is_config=True, ) def _get_login_banner(self): """ Getter method for login_banner, mapped from YANG variable /system/config/login_banner (string) YANG Description: The console login message displayed before the login prompt, i.e., before a user logs into the system. """ return self.__login_banner def _set_login_banner(self, v, load=False): """ Setter method for login_banner, mapped from YANG variable /system/config/login_banner (string) If this variable is read-only (config: false) in the source YANG file, then _set_login_banner is considered as a private method. Backends looking to populate this variable should do so via calling thisObj._set_login_banner() directly. YANG Description: The console login message displayed before the login prompt, i.e., before a user logs into the system. """ if hasattr(v, "_utype"): v = v._utype(v) try: t = YANGDynClass( v, base=six.text_type, is_leaf=True, yang_name="login-banner", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, namespace="http://openconfig.net/yang/system", defining_module="openconfig-system", yang_type="string", is_config=True, ) except (TypeError, ValueError): raise ValueError( { "error-string": """login_banner must be of a type compatible with string""", "defined-type": "string", "generated-type": """YANGDynClass(base=six.text_type, is_leaf=True, yang_name="login-banner", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, namespace='http://openconfig.net/yang/system', defining_module='openconfig-system', yang_type='string', is_config=True)""", } ) self.__login_banner = t if hasattr(self, "_set"): self._set() def _unset_login_banner(self): self.__login_banner = YANGDynClass( base=six.text_type, is_leaf=True, yang_name="login-banner", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, namespace="http://openconfig.net/yang/system", defining_module="openconfig-system", yang_type="string", is_config=True, ) def _get_motd_banner(self): """ Getter method for motd_banner, mapped from YANG variable /system/config/motd_banner (string) YANG Description: The console message displayed after a user logs into the system. They system may append additional standard information such as the current system date and time, uptime, last login timestamp, etc. """ return self.__motd_banner def _set_motd_banner(self, v, load=False): """ Setter method for motd_banner, mapped from YANG variable /system/config/motd_banner (string) If this variable is read-only (config: false) in the source YANG file, then _set_motd_banner is considered as a private method. Backends looking to populate this variable should do so via calling thisObj._set_motd_banner() directly. YANG Description: The console message displayed after a user logs into the system. They system may append additional standard information such as the current system date and time, uptime, last login timestamp, etc. """ if hasattr(v, "_utype"): v = v._utype(v) try: t = YANGDynClass( v, base=six.text_type, is_leaf=True, yang_name="motd-banner", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, namespace="http://openconfig.net/yang/system", defining_module="openconfig-system", yang_type="string", is_config=True, ) except (TypeError, ValueError): raise ValueError( { "error-string": """motd_banner must be of a type compatible with string""", "defined-type": "string", "generated-type": """YANGDynClass(base=six.text_type, is_leaf=True, yang_name="motd-banner", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, namespace='http://openconfig.net/yang/system', defining_module='openconfig-system', yang_type='string', is_config=True)""", } ) self.__motd_banner = t if hasattr(self, "_set"): self._set() def _unset_motd_banner(self): self.__motd_banner = YANGDynClass( base=six.text_type, is_leaf=True, yang_name="motd-banner", parent=self, path_helper=self._path_helper, extmethods=self._extmethods, register_paths=True, namespace="http://openconfig.net/yang/system", defining_module="openconfig-system", yang_type="string", is_config=True, ) hostname = __builtin__.property(_get_hostname, _set_hostname) domain_name = __builtin__.property(_get_domain_name, _set_domain_name) login_banner = __builtin__.property(_get_login_banner, _set_login_banner) motd_banner = __builtin__.property(_get_motd_banner, _set_motd_banner) _pyangbind_elements = OrderedDict( [ ("hostname", hostname), ("domain_name", domain_name), ("login_banner", login_banner), ("motd_banner", motd_banner), ] )
__author__ = 'rencui' from afinn import Afinn import numpy import json from textstat.textstat import textstat from nltk.stem.porter import * from tokenizer import simpleTokenize import logging from scipy.sparse import csr_matrix import matplotlib.pyplot as plt import matplotlib as mat from sklearn.ensemble import ExtraTreesClassifier stemmer = PorterStemmer() logging.basicConfig() dayMapper = {'Mon': 1, 'Tue': 2, 'Wed': 3, 'Thu': 4, 'Fri': 5, 'Sat': 6, 'Sun': 7} def hourMapper(hour): input = int(hour) if 0 <= input < 6: output = 0 elif 6 <= input < 12: output = 1 elif 12 <= input < 18: output = 2 else: output = 3 return output def mapMention(inputFile): mentionFile = open(inputFile, 'r') outputMapper = {} for line in mentionFile: mention = json.loads(line.strip()) if mention['verified'] == 'true': verify = 1 else: verify = 0 outputMapper[mention['screen_name']] = (verify, mention['followers_count']) mentionFile.close() return outputMapper def stemContent(input): words = simpleTokenize(input) out = '' for word in words: temp = stemmer.stem(word) out += temp + ' ' return out.strip() def POSRatio(inputList): out = [] temp = [] for item in inputList: temp.append(float(item)) if sum(temp) == 0: out = [0.0, 0.0, 0.0] else: for item in temp: out.append(item / sum(temp)) return out mentionMapper = mapMention('adData/analysis/ranked/mention.json') featureList = ['Length', 'URL', 'Hashtag', 'Username', 'Sentiment', 'Readability', 'ParseDepth', 'HeadCount', 'POS_N', 'POS_V', 'POS_A', '!', '?', 'Verified', 'FollowerCount'] # happy_log_probs, sad_log_probs = utilities.readSentimentList('twitter_sentiment_list.csv') afinn = Afinn() posFile = open('adData/analysis/groups/totalGroup/group0.pos', 'r') negFile = open('adData/analysis/groups/totalGroup/group0.neg', 'r') posParseLengthFile = open('adData/analysis/groups/totalGroup/parserLength0.pos', 'r') negParseLengthFile = open('adData/analysis/groups/totalGroup/parserLength0.neg', 'r') posHeadCountFile = open('adData/analysis/groups/totalGroup/parserHeadCount0.pos', 'r') negHeadCountFile = open('adData/analysis/groups/totalGroup/parserHeadCount0.neg', 'r') posPOSCountFile = open('adData/analysis/groups/totalGroup/parserPOSCount0.pos', 'r') negPOSCountFile = open('adData/analysis/groups/totalGroup/parserPOSCount0.neg', 'r') ids = [] contents = [] scores = [] days = [] time = [] labels = [] parseLength = [] headCount = [] usernames = [] semanticFeatures = [] classes = [] POScounts = [] print 'loading...' for line in posFile: seg = line.strip().split(' :: ') text = seg[3] username = seg[7].split(';') time.append(hourMapper(seg[2])) day = seg[1] score = float(seg[0]) ids.append(seg[5]) usernames.append(username) days.append(dayMapper[day]) contents.append(text) scores.append(score) labels.append(1) for line in negFile: seg = line.strip().split(' :: ') text = seg[3] username = seg[7].split(';') time.append(hourMapper(seg[2])) day = seg[1] score = float(seg[0]) ids.append(seg[5]) usernames.append(username) days.append(dayMapper[day]) contents.append(text) scores.append(score) labels.append(0) for line in posParseLengthFile: parseLength.append(int(line.strip(' :: ')[0])) for line in negParseLengthFile: parseLength.append(int(line.strip(' :: ')[0])) for line in posHeadCountFile: headCount.append(int(line.strip(' :: ')[0])) for line in negHeadCountFile: headCount.append(int(line.strip(' :: ')[0])) for line in posPOSCountFile: POScounts.append(POSRatio(line.strip().split(' :: ')[0].split(' '))) for line in negPOSCountFile: POScounts.append(POSRatio(line.strip().split(' :: ')[0].split(' '))) posHeadCountFile.close() negHeadCountFile.close() posParseLengthFile.close() negParseLengthFile.close() posPOSCountFile.close() negPOSCountFile.close() posFile.close() negFile.close() print len(contents) for index, content in enumerate(contents): temp = [] words = simpleTokenize(content) twLen = float(len(words)) sentiScore = afinn.score(stemContent(content)) # posProb, negProb = utilities.classifySentiment(words, happy_log_probs, sad_log_probs) readScore = textstat.coleman_liau_index(content) temp.append(twLen) # temp.append(content.count('URRL')) if content.count('URRL') > 0: temp.append(1) else: temp.append(0) # temp.append(content.count('HHTTG')) if content.count('HHTTG') > 0: temp.append(1) else: temp.append(0) # temp.append(content.count('USSERNM')) if content.count('USSERNM') > 0: temp.append(1) else: temp.append(0) temp.append(sentiScore / twLen) temp.append(readScore) temp.append(parseLength[index] / twLen) temp.append(headCount[index] / twLen) # temp.append(days[index]) # temp.append(time[index]) temp += POScounts[index] # temp.append(content.count('!')) if content.count('!') > 0: temp.append(1) else: temp.append(0) # temp.append(content.count('?')) if content.count('?') > 0: temp.append(1) else: temp.append(0) mentionFlag = 0 mentionFollowers = 0 userCount = 0.0 for user in usernames[index]: if user in mentionMapper: userCount += 1 if mentionMapper[user][0] == 1: mentionFlag = 1 mentionFollowers += mentionMapper[user][1] temp.append(mentionFlag) if userCount == 0: temp.append(0.0) else: temp.append(mentionFollowers / userCount) semanticFeatures.append(numpy.array(temp)) classes.append(labels[index]) features = csr_matrix(numpy.array(semanticFeatures)) # Build a forest and compute the feature importances forest = ExtraTreesClassifier(n_estimators=50, random_state=0) forest.fit(features, classes) importances = forest.feature_importances_ std = numpy.std([tree.feature_importances_ for tree in forest.estimators_], axis=0) indices = numpy.argsort(importances)[::-1] labelList = [] for index in indices: labelList.append(featureList[index]) # Print the feature ranking print("Feature ranking:") for f in range(features.shape[1]): print(labelList[f] + '\t' + str(importances[indices[f]])) # Plot the feature importances of the forest font = {'family': 'normal', 'size': 12} mat.rc('font', **font) plt.figure() plt.title("Feature Importances") plt.bar(range(features.shape[1]), importances[indices], color="r", yerr=std[indices], align="center") plt.xticks(range(features.shape[1]), labelList) plt.xlim([-1, features.shape[1]]) plt.show() print 'Feature List: 1. Length; 2.URL; 3.Hashtag; 4.Username; 5.Sentiment; 6.Readability; 7.ParseDepth; 8.HeadCount; 9.POS_N; 10.POS_V; 11.POS_A; 12.!; 13.?; 14.Verified; 15.FollowerCount'
"""GraphLasso: sparse inverse covariance estimation with an l1-penalized estimator. """ # Author: Gael Varoquaux <gael.varoquaux@normalesup.org> # License: BSD 3 clause # Copyright: INRIA import warnings import operator import sys import time import numpy as np from scipy import linalg from .empirical_covariance_ import (empirical_covariance, EmpiricalCovariance, log_likelihood) from ..utils import ConvergenceWarning from ..utils.extmath import pinvh from ..linear_model import lars_path from ..linear_model import cd_fast from ..cross_validation import _check_cv as check_cv, cross_val_score from ..externals.joblib import Parallel, delayed import collections ############################################################################### # Helper functions to compute the objective and dual objective functions # of the l1-penalized estimator def _objective(mle, precision_, alpha): cost = -log_likelihood(mle, precision_) cost += alpha * (np.abs(precision_).sum() - np.abs(np.diag(precision_)).sum()) return cost def _dual_gap(emp_cov, precision_, alpha): """Expression of the dual gap convergence criterion The specific definition is given in Duchi "Projected Subgradient Methods for Learning Sparse Gaussians". """ gap = np.sum(emp_cov * precision_) gap -= precision_.shape[0] gap += alpha * (np.abs(precision_).sum() - np.abs(np.diag(precision_)).sum()) return gap def alpha_max(emp_cov): """Find the maximum alpha for which there are some non-zeros off-diagonal. Parameters ---------- emp_cov : 2D array, (n_features, n_features) The sample covariance matrix Notes ----- This results from the bound for the all the Lasso that are solved in GraphLasso: each time, the row of cov corresponds to Xy. As the bound for alpha is given by `max(abs(Xy))`, the result follows. """ A = np.copy(emp_cov) A.flat[::A.shape[0] + 1] = 0 return np.max(np.abs(A)) ############################################################################### # The g-lasso algorithm def graph_lasso(emp_cov, alpha, cov_init=None, mode='cd', tol=1e-4, max_iter=100, verbose=False, return_costs=False, eps=np.finfo(np.float).eps): """l1-penalized covariance estimator Parameters ---------- emp_cov : 2D ndarray, shape (n_features, n_features) Empirical covariance from which to compute the covariance estimate. alpha : positive float The regularization parameter: the higher alpha, the more regularization, the sparser the inverse covariance. cov_init : 2D array (n_features, n_features), optional The initial guess for the covariance. mode : {'cd', 'lars'} The Lasso solver to use: coordinate descent or LARS. Use LARS for very sparse underlying graphs, where p > n. Elsewhere prefer cd which is more numerically stable. tol : positive float, optional The tolerance to declare convergence: if the dual gap goes below this value, iterations are stopped. max_iter : integer, optional The maximum number of iterations. verbose : boolean, optional If verbose is True, the objective function and dual gap are printed at each iteration. return_costs : boolean, optional If return_costs is True, the objective function and dual gap at each iteration are returned. eps : float, optional The machine-precision regularization in the computation of the Cholesky diagonal factors. Increase this for very ill-conditioned systems. Returns ------- covariance : 2D ndarray, shape (n_features, n_features) The estimated covariance matrix. precision : 2D ndarray, shape (n_features, n_features) The estimated (sparse) precision matrix. costs : list of (objective, dual_gap) pairs The list of values of the objective function and the dual gap at each iteration. Returned only if return_costs is True. See Also -------- GraphLasso, GraphLassoCV Notes ----- The algorithm employed to solve this problem is the GLasso algorithm, from the Friedman 2008 Biostatistics paper. It is the same algorithm as in the R `glasso` package. One possible difference with the `glasso` R package is that the diagonal coefficients are not penalized. """ _, n_features = emp_cov.shape if alpha == 0: return emp_cov, linalg.inv(emp_cov) if cov_init is None: covariance_ = emp_cov.copy() else: covariance_ = cov_init.copy() # As a trivial regularization (Tikhonov like), we scale down the # off-diagonal coefficients of our starting point: This is needed, as # in the cross-validation the cov_init can easily be # ill-conditioned, and the CV loop blows. Beside, this takes # conservative stand-point on the initial conditions, and it tends to # make the convergence go faster. covariance_ *= 0.95 diagonal = emp_cov.flat[::n_features + 1] covariance_.flat[::n_features + 1] = diagonal precision_ = pinvh(covariance_) indices = np.arange(n_features) costs = list() # The different l1 regression solver have different numerical errors if mode == 'cd': errors = dict(over='raise', invalid='ignore') else: errors = dict(invalid='raise') try: for i in range(max_iter): for idx in range(n_features): sub_covariance = covariance_[indices != idx].T[indices != idx] row = emp_cov[idx, indices != idx] with np.errstate(**errors): if mode == 'cd': # Use coordinate descent coefs = -(precision_[indices != idx, idx] / (precision_[idx, idx] + 1000 * eps)) coefs, _, _ = cd_fast.enet_coordinate_descent_gram( coefs, alpha, 0, sub_covariance, row, row, max_iter, tol) else: # Use LARS _, _, coefs = lars_path( sub_covariance, row, Xy=row, Gram=sub_covariance, alpha_min=alpha / (n_features - 1), copy_Gram=True, method='lars') coefs = coefs[:, -1] # Update the precision matrix precision_[idx, idx] = ( 1. / (covariance_[idx, idx] - np.dot(covariance_[indices != idx, idx], coefs))) precision_[indices != idx, idx] = (- precision_[idx, idx] * coefs) precision_[idx, indices != idx] = (- precision_[idx, idx] * coefs) coefs = np.dot(sub_covariance, coefs) covariance_[idx, indices != idx] = coefs covariance_[indices != idx, idx] = coefs d_gap = _dual_gap(emp_cov, precision_, alpha) cost = _objective(emp_cov, precision_, alpha) if verbose: print( '[graph_lasso] Iteration % 3i, cost % 3.2e, dual gap %.3e' % (i, cost, d_gap)) if return_costs: costs.append((cost, d_gap)) if np.abs(d_gap) < tol: break if not np.isfinite(cost) and i > 0: raise FloatingPointError('Non SPD result: the system is ' 'too ill-conditioned for this solver') else: warnings.warn('graph_lasso: did not converge after %i iteration:' ' dual gap: %.3e' % (max_iter, d_gap), ConvergenceWarning) except FloatingPointError as e: e.args = (e.args[0] + '. The system is too ill-conditioned for this solver',) raise e if return_costs: return covariance_, precision_, costs return covariance_, precision_ class GraphLasso(EmpiricalCovariance): """Sparse inverse covariance estimation with an l1-penalized estimator. Parameters ---------- alpha : positive float, optional The regularization parameter: the higher alpha, the more regularization, the sparser the inverse covariance. cov_init : 2D array (n_features, n_features), optional The initial guess for the covariance. mode : {'cd', 'lars'} The Lasso solver to use: coordinate descent or LARS. Use LARS for very sparse underlying graphs, where p > n. Elsewhere prefer cd which is more numerically stable. tol : positive float, optional The tolerance to declare convergence: if the dual gap goes below this value, iterations are stopped. max_iter : integer, optional The maximum number of iterations. verbose : boolean, optional If verbose is True, the objective function and dual gap are plotted at each iteration. Attributes ---------- `covariance_` : array-like, shape (n_features, n_features) Estimated covariance matrix `precision_` : array-like, shape (n_features, n_features) Estimated pseudo inverse matrix. See Also -------- graph_lasso, GraphLassoCV """ def __init__(self, alpha=.01, mode='cd', tol=1e-4, max_iter=100, verbose=False): self.alpha = alpha self.mode = mode self.tol = tol self.max_iter = max_iter self.verbose = verbose # The base class needs this for the score method self.store_precision = True def fit(self, X, y=None): emp_cov = empirical_covariance(X) self.covariance_, self.precision_ = graph_lasso( emp_cov, alpha=self.alpha, mode=self.mode, tol=self.tol, max_iter=self.max_iter, verbose=self.verbose,) return self ############################################################################### # Cross-validation with GraphLasso def graph_lasso_path(X, alphas, cov_init=None, X_test=None, mode='cd', tol=1e-4, max_iter=100, verbose=False): """l1-penalized covariance estimator along a path of decreasing alphas Parameters ---------- X : 2D ndarray, shape (n_samples, n_features) Data from which to compute the covariance estimate. alphas : list of positive floats The list of regularization parameters, decreasing order. X_test : 2D array, shape (n_test_samples, n_features), optional Optional test matrix to measure generalisation error. mode : {'cd', 'lars'} The Lasso solver to use: coordinate descent or LARS. Use LARS for very sparse underlying graphs, where p > n. Elsewhere prefer cd which is more numerically stable. tol : positive float, optional The tolerance to declare convergence: if the dual gap goes below this value, iterations are stopped. max_iter : integer, optional The maximum number of iterations. verbose : integer, optional The higher the verbosity flag, the more information is printed during the fitting. Returns ------- `covariances_` : List of 2D ndarray, shape (n_features, n_features) The estimated covariance matrices. `precisions_` : List of 2D ndarray, shape (n_features, n_features) The estimated (sparse) precision matrices. `scores_` : List of float The generalisation error (log-likelihood) on the test data. Returned only if test data is passed. """ inner_verbose = max(0, verbose - 1) emp_cov = empirical_covariance(X) if cov_init is None: covariance_ = emp_cov.copy() else: covariance_ = cov_init covariances_ = list() precisions_ = list() scores_ = list() if X_test is not None: test_emp_cov = empirical_covariance(X_test) for alpha in alphas: try: # Capture the errors, and move on covariance_, precision_ = graph_lasso( emp_cov, alpha=alpha, cov_init=covariance_, mode=mode, tol=tol, max_iter=max_iter, verbose=inner_verbose) covariances_.append(covariance_) precisions_.append(precision_) if X_test is not None: this_score = log_likelihood(test_emp_cov, precision_) except FloatingPointError: this_score = -np.inf covariances_.append(np.nan) precisions_.append(np.nan) if X_test is not None: if not np.isfinite(this_score): this_score = -np.inf scores_.append(this_score) if verbose == 1: sys.stderr.write('.') elif verbose > 1: if X_test is not None: print('[graph_lasso_path] alpha: %.2e, score: %.2e' % (alpha, this_score)) else: print('[graph_lasso_path] alpha: %.2e' % alpha) if X_test is not None: return covariances_, precisions_, scores_ return covariances_, precisions_ class GraphLassoCV(GraphLasso): """Sparse inverse covariance w/ cross-validated choice of the l1 penalty Parameters ---------- alphas : integer, or list positive float, optional If an integer is given, it fixes the number of points on the grids of alpha to be used. If a list is given, it gives the grid to be used. See the notes in the class docstring for more details. n_refinements: strictly positive integer The number of times the grid is refined. Not used if explicit values of alphas are passed. cv : cross-validation generator, optional see sklearn.cross_validation module. If None is passed, defaults to a 3-fold strategy tol: positive float, optional The tolerance to declare convergence: if the dual gap goes below this value, iterations are stopped. max_iter: integer, optional Maximum number of iterations. mode: {'cd', 'lars'} The Lasso solver to use: coordinate descent or LARS. Use LARS for very sparse underlying graphs, where number of features is greater than number of samples. Elsewhere prefer cd which is more numerically stable. n_jobs: int, optional number of jobs to run in parallel (default 1). verbose: boolean, optional If verbose is True, the objective function and duality gap are printed at each iteration. Attributes ---------- `covariance_` : numpy.ndarray, shape (n_features, n_features) Estimated covariance matrix. `precision_` : numpy.ndarray, shape (n_features, n_features) Estimated precision matrix (inverse covariance). `alpha_`: float Penalization parameter selected. `cv_alphas_`: list of float All penalization parameters explored. `grid_scores`: 2D numpy.ndarray (n_alphas, n_folds) Log-likelihood score on left-out data across folds. See Also -------- graph_lasso, GraphLasso Notes ----- The search for the optimal penalization parameter (alpha) is done on an iteratively refined grid: first the cross-validated scores on a grid are computed, then a new refined grid is centered around the maximum, and so on. One of the challenges which is faced here is that the solvers can fail to converge to a well-conditioned estimate. The corresponding values of alpha then come out as missing values, but the optimum may be close to these missing values. """ def __init__(self, alphas=4, n_refinements=4, cv=None, tol=1e-4, max_iter=100, mode='cd', n_jobs=1, verbose=False): self.alphas = alphas self.n_refinements = n_refinements self.mode = mode self.tol = tol self.max_iter = max_iter self.verbose = verbose self.cv = cv self.n_jobs = n_jobs # The base class needs this for the score method self.store_precision = True def fit(self, X, y=None): X = np.asarray(X) emp_cov = empirical_covariance(X) cv = check_cv(self.cv, X, y, classifier=False) # List of (alpha, scores, covs) path = list() n_alphas = self.alphas inner_verbose = max(0, self.verbose - 1) if isinstance(n_alphas, collections.Sequence): alphas = self.alphas n_refinements = 1 else: n_refinements = self.n_refinements alpha_1 = alpha_max(emp_cov) alpha_0 = 1e-2 * alpha_1 alphas = np.logspace(np.log10(alpha_0), np.log10(alpha_1), n_alphas)[::-1] t0 = time.time() for i in range(n_refinements): with warnings.catch_warnings(): # No need to see the convergence warnings on this grid: # they will always be points that will not converge # during the cross-validation warnings.simplefilter('ignore', ConvergenceWarning) # Compute the cross-validated loss on the current grid # NOTE: Warm-restarting graph_lasso_path has been tried, and # this did not allow to gain anything (same execution time with # or without). this_path = Parallel( n_jobs=self.n_jobs, verbose=self.verbose)( delayed(graph_lasso_path)( X[train], alphas=alphas, X_test=X[test], mode=self.mode, tol=self.tol, max_iter=int(.1 * self.max_iter), verbose=inner_verbose) for train, test in cv) # Little danse to transform the list in what we need covs, _, scores = zip(*this_path) covs = zip(*covs) scores = zip(*scores) path.extend(zip(alphas, scores, covs)) path = sorted(path, key=operator.itemgetter(0), reverse=True) # Find the maximum (avoid using built in 'max' function to # have a fully-reproducible selection of the smallest alpha # in case of equality) best_score = -np.inf last_finite_idx = 0 for index, (alpha, scores, _) in enumerate(path): this_score = np.mean(scores) if this_score >= .1 / np.finfo(np.float).eps: this_score = np.nan if np.isfinite(this_score): last_finite_idx = index if this_score >= best_score: best_score = this_score best_index = index # Refine the grid if best_index == 0: # We do not need to go back: we have chosen # the highest value of alpha for which there are # non-zero coefficients alpha_1 = path[0][0] alpha_0 = path[1][0] elif (best_index == last_finite_idx and not best_index == len(path) - 1): # We have non-converged models on the upper bound of the # grid, we need to refine the grid there alpha_1 = path[best_index][0] alpha_0 = path[best_index + 1][0] elif best_index == len(path) - 1: alpha_1 = path[best_index][0] alpha_0 = 0.01 * path[best_index][0] else: alpha_1 = path[best_index - 1][0] alpha_0 = path[best_index + 1][0] if not isinstance(n_alphas, collections.Sequence): alphas = np.logspace(np.log10(alpha_1), np.log10(alpha_0), n_alphas + 2) alphas = alphas[1:-1] if self.verbose and n_refinements > 1: print('[GraphLassoCV] Done refinement % 2i out of %i: % 3is' % (i + 1, n_refinements, time.time() - t0)) path = list(zip(*path)) grid_scores = list(path[1]) alphas = list(path[0]) # Finally, compute the score with alpha = 0 alphas.append(0) grid_scores.append(cross_val_score(EmpiricalCovariance(), X, cv=cv, n_jobs=self.n_jobs, verbose=inner_verbose)) self.grid_scores = np.array(grid_scores) best_alpha = alphas[best_index] self.alpha_ = best_alpha self.cv_alphas_ = alphas # Finally fit the model with the selected alpha self.covariance_, self.precision_ = graph_lasso( emp_cov, alpha=best_alpha, mode=self.mode, tol=self.tol, max_iter=self.max_iter, verbose=inner_verbose) return self
#!/usr/bin/env python # _*_ coding:utf-8 _*_ import codecs from datetime import datetime import json import logging import time import urllib import subprocess from flask import Markup, g, render_template, request from slimit import minify from smartypants import smartypants import app_config import copytext logging.basicConfig(format=app_config.LOG_FORMAT) logger = logging.getLogger(__name__) logger.setLevel(app_config.LOG_LEVEL) class BetterJSONEncoder(json.JSONEncoder): """ A JSON encoder that intelligently handles datetimes. """ def default(self, obj): if isinstance(obj, datetime): encoded_object = obj.isoformat() else: encoded_object = json.JSONEncoder.default(self, obj) return encoded_object class Includer(object): """ Base class for Javascript and CSS psuedo-template-tags. See `make_context` for an explanation of `asset_depth`. """ def __init__(self, asset_depth=0): self.includes = [] self.tag_string = None self.asset_depth = asset_depth def push(self, path): self.includes.append(path) return '' def _compress(self): raise NotImplementedError() def _relativize_path(self, path): relative_path = path if relative_path.startswith('www/'): relative_path = relative_path[4:] depth = len(request.path.split('/')) - (2 + self.asset_depth) while depth > 0: relative_path = '../%s' % relative_path depth -= 1 return relative_path def render(self, path): if getattr(g, 'compile_includes', False): if path in g.compiled_includes: timestamp_path = g.compiled_includes[path] else: # Add a querystring to the rendered filename to prevent caching timestamp_path = '%s?%i' % (path, int(time.time())) out_path = 'www/%s' % path if path not in g.compiled_includes: logger.info('Rendering %s' % out_path) with codecs.open(out_path, 'w', encoding='utf-8') as f: f.write(self._compress()) # See "fab render" g.compiled_includes[path] = timestamp_path markup = Markup(self.tag_string % self._relativize_path(timestamp_path)) else: response = ','.join(self.includes) response = '\n'.join([ self.tag_string % self._relativize_path(src) for src in self.includes ]) markup = Markup(response) del self.includes[:] return markup class JavascriptIncluder(Includer): """ Psuedo-template tag that handles collecting Javascript and serving appropriate clean or compressed versions. """ def __init__(self, *args, **kwargs): Includer.__init__(self, *args, **kwargs) self.tag_string = '<script type="text/javascript" src="%s"></script>' def _compress(self): output = [] src_paths = [] for src in self.includes: src_paths.append('www/%s' % src) with codecs.open('www/%s' % src, encoding='utf-8') as f: if not src.endswith('.min.js'): logger.info('- compressing %s' % src) output.append(minify(f.read())) else: logger.info('- appending already compressed %s' % src) output.append(f.read()) context = make_context() context['paths'] = src_paths header = render_template('_js_header.js', **context) output.insert(0, header) return '\n'.join(output) class CSSIncluder(Includer): """ Psuedo-template tag that handles collecting CSS and serving appropriate clean or compressed versions. """ def __init__(self, *args, **kwargs): Includer.__init__(self, *args, **kwargs) self.tag_string = '<link rel="stylesheet" type="text/css" href="%s" />' def _compress(self): output = [] src_paths = [] for src in self.includes: src_paths.append('%s' % src) try: compressed_src = subprocess.check_output(["node_modules/less/bin/lessc", "-x", src]) output.append(compressed_src) except: logger.error('It looks like "lessc" isn\'t installed. Try running: "npm install"') raise context = make_context() context['paths'] = src_paths header = render_template('_css_header.css', **context) output.insert(0, header) return '\n'.join(output) def flatten_app_config(): """ Returns a copy of app_config containing only configuration variables. """ config = {} # Only all-caps [constant] vars get included for k, v in app_config.__dict__.items(): if k.upper() == k: config[k] = v return config def make_context(asset_depth=0): """ Create a base-context for rendering views. Includes app_config and JS/CSS includers. `asset_depth` indicates how far into the url hierarchy the assets are hosted. If 0, then they are at the root. If 1 then at /foo/, etc. """ context = flatten_app_config() try: context['COPY'] = copytext.Copy(app_config.COPY_PATH) except copytext.CopyException: pass context['JS'] = JavascriptIncluder(asset_depth=asset_depth) context['CSS'] = CSSIncluder(asset_depth=asset_depth) return context def urlencode_filter(s): """ Filter to urlencode strings. """ if type(s) == 'Markup': s = s.unescape() # Evaulate COPY elements if type(s) is not unicode: s = unicode(s) s = s.encode('utf8') s = urllib.quote_plus(s) return Markup(s) def smarty_filter(s): """ Filter to smartypants strings. """ if type(s) == 'Markup': s = s.unescape() # Evaulate COPY elements if type(s) is not unicode: s = unicode(s) s = s.encode('utf-8') s = smartypants(s) try: return Markup(s) except: logger.error('This string failed to encode: %s' % s) return Markup(s)
""" mbed SDK Copyright (c) 2011-2017 ARM Limited Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. """ from __future__ import print_function, absolute_import from builtins import str from os.path import splitext, basename, relpath, join import shutil from tools.utils import mkdir from tools.export.gnuarmeclipse import GNUARMEclipse from tools.export.gnuarmeclipse import UID from tools.build_api import prepare_toolchain from tools.targets import TARGET_MAP from sys import flags, platform # Global random number generator instance. u = UID() class Sw4STM32(GNUARMEclipse): """ Sw4STM32 class """ NAME = 'Sw4STM32' TOOLCHAIN = 'GCC_ARM' BOARDS = { 'B96B_F446VE': { 'name': 'B96B-F446VE', 'mcuId': 'STM32F446VETx' }, 'DISCO_F051R8': { 'name': 'STM32F0DISCOVERY', 'mcuId': 'STM32F051R8Tx' }, 'DISCO_F303VC': { 'name': 'STM32F3DISCOVERY', 'mcuId': 'STM32F303VCTx' }, 'DISCO_F334C8': { 'name': 'STM32F3348DISCOVERY', 'mcuId': 'STM32F334C8Tx' }, 'DISCO_F401VC': { 'name': 'STM32F401C-DISCO', 'mcuId': 'STM32F401VCTx' }, 'DISCO_F407VG': { 'name': 'STM32F4DISCOVERY', 'mcuId': 'STM32F407VGTx' }, 'DISCO_F413ZH': { 'name': 'DISCO_F413', 'mcuId': 'STM32F413ZHTx' }, 'DISCO_F429ZI': { 'name': 'STM32F429I-DISCO', 'mcuId': 'STM32F429ZITx' }, 'DISCO_F469NI': { 'name': 'DISCO-F469NI', 'mcuId': 'STM32F469NIHx' }, 'DISCO_F746NG': { 'name': 'STM32F746G-DISCO', 'mcuId': 'STM32F746NGHx' }, 'DISCO_F769NI': { 'name': 'DISCO-F769NI', 'mcuId': 'STM32F769NIHx' }, 'DISCO_L053C8': { 'name': 'STM32L0538DISCOVERY', 'mcuId': 'STM32L053C8Tx' }, 'DISCO_L072CZ_LRWAN1': { 'name': 'DISCO-L072CZ-LRWAN1', 'mcuId': 'STM32L072CZTx' }, 'MTB_MURATA_ABZ': { 'name': 'MTB-MURATA-ABZ', 'mcuId': 'STM32L0x2xZ' }, 'DISCO_L475VG_IOT01A': { 'name': 'STM32L475G-DISCO', 'mcuId': 'STM32L475VGTx' }, 'DISCO_L476VG': { 'name': 'STM32L476G-DISCO', 'mcuId': 'STM32L476VGTx' }, 'NUCLEO_F030R8': { 'name': 'NUCLEO-F030R8', 'mcuId': 'STM32F030R8Tx' }, 'NUCLEO_F031K6': { 'name': 'NUCLEO-F031K6', 'mcuId': 'STM32F031K6Tx' }, 'NUCLEO_F042K6': { 'name': 'NUCLEO-F042K6', 'mcuId': 'STM32F042K6Tx' }, 'NUCLEO_F070RB': { 'name': 'NUCLEO-F070RB', 'mcuId': 'STM32F070RBTx' }, 'NUCLEO_F072RB': { 'name': 'NUCLEO-F072RB', 'mcuId': 'STM32F072RBTx' }, 'NUCLEO_F091RC': { 'name': 'NUCLEO-F091RC', 'mcuId': 'STM32F091RCTx' }, 'NUCLEO_F103RB': { 'name': 'NUCLEO-F103RB', 'mcuId': 'STM32F103RBTx' }, 'NUCLEO_F207ZG': { 'name': 'NUCLEO-F207ZG', 'mcuId': 'STM32F207ZGTx' }, 'NUCLEO_F302R8': { 'name': 'NUCLEO-F302R8', 'mcuId': 'STM32F302R8Tx' }, 'NUCLEO_F303K8': { 'name': 'NUCLEO-F303K8', 'mcuId': 'STM32F303K8Tx' }, 'NUCLEO_F303RE': { 'name': 'NUCLEO-F303RE', 'mcuId': 'STM32F303RETx' }, 'NUCLEO_F303ZE': { 'name': 'NUCLEO-F303ZE', 'mcuId': 'STM32F303ZETx' }, 'NUCLEO_F334R8': { 'name': 'NUCLEO-F334R8', 'mcuId': 'STM32F334R8Tx' }, 'NUCLEO_F401RE': { 'name': 'NUCLEO-F401RE', 'mcuId': 'STM32F401RETx' }, 'NUCLEO_F410RB': { 'name': 'NUCLEO-F410RB', 'mcuId': 'STM32F410RBTx' }, 'NUCLEO_F411RE': { 'name': 'NUCLEO-F411RE', 'mcuId': 'STM32F411RETx' }, 'NUCLEO_F413ZH': { 'name': 'NUCLEO-F413ZH', 'mcuId': 'STM32F413ZHTx' }, 'NUCLEO_F429ZI': { 'name': 'NUCLEO-F429ZI', 'mcuId': 'STM32F429ZITx' }, 'NUCLEO_F446RE': { 'name': 'NUCLEO-F446RE', 'mcuId': 'STM32F446RETx' }, 'NUCLEO_F446ZE': { 'name': 'NUCLEO-F446ZE', 'mcuId': 'STM32F446ZETx' }, 'NUCLEO_F746ZG': { 'name': 'NUCLEO-F746ZG', 'mcuId': 'STM32F746ZGTx' }, 'NUCLEO_F767ZI': { 'name': 'NUCLEO-F767ZI', 'mcuId': 'STM32F767ZITx' }, 'NUCLEO_L011K4': { 'name': 'NUCLEO-L011K4', 'mcuId': 'STM32L011K4Tx' }, 'NUCLEO_L031K6': { 'name': 'NUCLEO-L031K6', 'mcuId': 'STM32L031K6Tx' }, 'NUCLEO_L053R8': { 'name': 'NUCLEO-L053R8', 'mcuId': 'STM32L053R8Tx' }, 'NUCLEO_L073RZ': { 'name': 'NUCLEO-L073RZ', 'mcuId': 'STM32L073RZTx' }, 'MTB_RAK811': { 'name': 'MTB-RAK-811', 'mcuId': 'STM32L151CBUxA' }, 'NUCLEO_L152RE': { 'name': 'NUCLEO-L152RE', 'mcuId': 'STM32L152RETx' }, 'NUCLEO_L432KC': { 'name': 'NUCLEO-L432KC', 'mcuId': 'STM32L432KCUx' }, 'MTB_ADV_WISE_1510': { 'name': 'MTB-ADV-WISE-1510', 'mcuId': 'STM32L443xC' }, 'NUCLEO_L476RG': { 'name': 'NUCLEO-L476RG', 'mcuId': 'STM32L476RGTx' }, 'NUCLEO_L486RG': { 'name': 'NUCLEO-L486RG', 'mcuId': 'STM32L486RGTx' }, 'NUCLEO_L496ZG': { 'name': 'NUCLEO-L496ZG', 'mcuId': 'STM32L496ZGTx' }, 'NUCLEO_L496ZG_P': { 'name': 'NUCLEO-L496ZG', 'mcuId': 'STM32L496ZGTx' }, 'NUCLEO_L4R5ZI': { 'name': 'NUCLEO-L4R5ZI', 'mcuId': 'STM32L4R5ZITx' } } @classmethod def is_target_supported(cls, target_name): target = TARGET_MAP[target_name] target_supported = bool(set(target.resolution_order_names) .intersection(set(cls.BOARDS.keys()))) toolchain_supported = cls.TOOLCHAIN in target.supported_toolchains return target_supported and toolchain_supported def __gen_dir(self, dir_name): """ Method that creates directory """ settings = join(self.export_dir, dir_name) mkdir(settings) def get_fpu_hardware(self, fpu_unit): """ Convert fpu unit name into hardware name. """ hw = '' fpus = { 'fpv4spd16': 'fpv4-sp-d16', 'fpv5d16': 'fpv5-d16', 'fpv5spd16': 'fpv5-sp-d16' } if fpu_unit in fpus: hw = fpus[fpu_unit] return hw def process_sw_options(self, opts, flags_in): """ Process System Workbench specific options. System Workbench for STM32 has some compile options, which are not recognized by the GNUARMEclipse exporter. Those are handled in this method. """ opts['c']['preprocess'] = False if '-E' in flags_in['c_flags']: opts['c']['preprocess'] = True opts['cpp']['preprocess'] = False if '-E' in flags_in['cxx_flags']: opts['cpp']['preprocess'] = True opts['c']['slowflashdata'] = False if '-mslow-flash-data' in flags_in['c_flags']: opts['c']['slowflashdata'] = True opts['cpp']['slowflashdata'] = False if '-mslow-flash-data' in flags_in['cxx_flags']: opts['cpp']['slowflashdata'] = True if opts['common']['optimization.messagelength']: opts['common']['optimization.other'] += ' -fmessage-length=0' if opts['common']['optimization.signedchar']: opts['common']['optimization.other'] += ' -fsigned-char' if opts['common']['optimization.nocommon']: opts['common']['optimization.other'] += ' -fno-common' if opts['common']['optimization.noinlinefunctions']: opts['common']['optimization.other'] += ' -fno-inline-functions' if opts['common']['optimization.freestanding']: opts['common']['optimization.other'] += ' -ffreestanding' if opts['common']['optimization.nobuiltin']: opts['common']['optimization.other'] += ' -fno-builtin' if opts['common']['optimization.spconstant']: opts['common']['optimization.other'] += ' -fsingle-precision-constant' if opts['common']['optimization.nomoveloopinvariants']: opts['common']['optimization.other'] += ' -fno-move-loop-invariants' if opts['common']['warnings.unused']: opts['common']['warnings.other'] += ' -Wunused' if opts['common']['warnings.uninitialized']: opts['common']['warnings.other'] += ' -Wuninitialized' if opts['common']['warnings.missingdeclaration']: opts['common']['warnings.other'] += ' -Wmissing-declarations' if opts['common']['warnings.pointerarith']: opts['common']['warnings.other'] += ' -Wpointer-arith' if opts['common']['warnings.padded']: opts['common']['warnings.other'] += ' -Wpadded' if opts['common']['warnings.shadow']: opts['common']['warnings.other'] += ' -Wshadow' if opts['common']['warnings.logicalop']: opts['common']['warnings.other'] += ' -Wlogical-op' if opts['common']['warnings.agreggatereturn']: opts['common']['warnings.other'] += ' -Waggregate-return' if opts['common']['warnings.floatequal']: opts['common']['warnings.other'] += ' -Wfloat-equal' opts['ld']['strip'] = False if '-s' in flags_in['ld_flags']: opts['ld']['strip'] = True opts['ld']['shared'] = False if '-shared' in flags_in['ld_flags']: opts['ld']['shared'] = True opts['ld']['soname'] = '' opts['ld']['implname'] = '' opts['ld']['defname'] = '' for item in flags_in['ld_flags']: if item.startswith('-Wl,-soname='): opts['ld']['soname'] = item[len('-Wl,-soname='):] if item.startswith('-Wl,--out-implib='): opts['ld']['implname'] = item[len('-Wl,--out-implib='):] if item.startswith('-Wl,--output-def='): opts['ld']['defname'] = item[len('-Wl,--output-def='):] opts['common']['arm.target.fpu.hardware'] = self.get_fpu_hardware( opts['common']['arm.target.fpu.unit']) opts['common']['debugging.codecov'] = False if '-fprofile-arcs' in flags_in['common_flags'] and '-ftest-coverage' in flags_in['common_flags']: opts['common']['debugging.codecov'] = True # Passing linker options to linker with '-Wl,'-prefix. for index in range(len(opts['ld']['flags'])): item = opts['ld']['flags'][index] if not item.startswith('-Wl,'): opts['ld']['flags'][index] = '-Wl,' + item # Strange System Workbench feature: If first parameter in Other flags is a # define (-D...), Other flags will be replaced by defines and other flags # are completely ignored. Moving -D parameters to defines. for compiler in ['c', 'cpp', 'as']: tmpList = opts[compiler]['other'].split(' ') otherList = [] for item in tmpList: if item.startswith('-D'): opts[compiler]['defines'].append(str(item[2:])) else: otherList.append(item) opts[compiler]['other'] = ' '.join(otherList) # Assembler options for as_def in opts['as']['defines']: if '=' in as_def: opts['as']['other'] += ' --defsym ' + as_def else: opts['as']['other'] += ' --defsym ' + as_def + '=1' def generate(self): """ Generate the .project and .cproject files. """ options = {} if not self.resources.linker_script: raise NotSupportedException("No linker script found.") print('\nCreate a System Workbench for STM32 managed project') print('Project name: {0}'.format(self.project_name)) print('Target: {0}'.format(self.toolchain.target.name)) print('Toolchain: {0}'.format(self.TOOLCHAIN) + '\n') self.resources.win_to_unix() libraries = [] for lib in self.libraries: library, _ = splitext(basename(lib)) libraries.append(library[3:]) self.system_libraries = [ 'stdc++', 'supc++', 'm', 'c', 'gcc', 'nosys' ] profiles = self.get_all_profiles() self.as_defines = [s.replace('"', '&quot;') for s in self.toolchain.get_symbols(True)] self.c_defines = [s.replace('"', '&quot;') for s in self.toolchain.get_symbols()] self.cpp_defines = self.c_defines self.include_path = [] for s in self.resources.inc_dirs: self.include_path.append("../" + self.filter_dot(s)) print('Include folders: {0}'.format(len(self.include_path))) self.compute_exclusions() print('Exclude folders: {0}'.format(len(self.excluded_folders))) ld_script = self.filter_dot(self.resources.linker_script) print('Linker script: {0}'.format(ld_script)) lib_dirs = [self.filter_dot(s) for s in self.resources.lib_dirs] preproc_cmd = basename(self.toolchain.preproc[0]) + " " + " ".join(self.toolchain.preproc[1:]) for id in ['debug', 'release']: opts = {} opts['common'] = {} opts['as'] = {} opts['c'] = {} opts['cpp'] = {} opts['ld'] = {} opts['id'] = id opts['name'] = opts['id'].capitalize() profile = profiles[id] # A small hack, do not bother with src_path again, # pass an empty string to avoid crashing. src_paths = [''] toolchain = prepare_toolchain( src_paths, "", self.toolchain.target.name, self.TOOLCHAIN, build_profile=[profile]) # Hack to fill in build_dir toolchain.build_dir = self.toolchain.build_dir flags = self.toolchain_flags(toolchain) # Most GNU ARM Eclipse options have a parent, # either debug or release. if '-O0' in flags['common_flags'] or '-Og' in flags['common_flags']: opts['parent_id'] = 'debug' else: opts['parent_id'] = 'release' self.process_options(opts, flags) opts['c']['defines'] = self.c_defines opts['cpp']['defines'] = self.cpp_defines opts['as']['defines'] = self.as_defines self.process_sw_options(opts, flags) opts['ld']['library_paths'] = [ self.filter_dot(s) for s in self.resources.lib_dirs] opts['ld']['user_libraries'] = libraries opts['ld']['system_libraries'] = self.system_libraries opts['ld']['script'] = "linker-script-" + id + ".ld" # Unique IDs used in multiple places. uid = {} uid['config'] = u.id uid['tool_c_compiler'] = u.id uid['tool_c_compiler_input'] = u.id uid['tool_cpp_compiler'] = u.id uid['tool_cpp_compiler_input'] = u.id opts['uid'] = uid options[id] = opts ctx = { 'name': self.project_name, 'platform': platform, 'include_paths': self.include_path, 'config_header': self.config_header_ref.name, 'exclude_paths': '|'.join(self.excluded_folders), 'ld_script': ld_script, 'library_paths': lib_dirs, 'object_files': self.resources.objects, 'libraries': libraries, 'board_name': self.BOARDS[self.target.upper()]['name'], 'mcu_name': self.BOARDS[self.target.upper()]['mcuId'], 'cpp_cmd': preproc_cmd, 'options': options, # id property of 'u' will generate new random identifier every time # when called. 'u': u } self.__gen_dir('.settings') self.gen_file('sw4stm32/language_settings_commom.tmpl', ctx, '.settings/language.settings.xml') self.gen_file('sw4stm32/project_common.tmpl', ctx, '.project') self.gen_file('sw4stm32/cproject_common.tmpl', ctx, '.cproject') self.gen_file('sw4stm32/makefile.targets.tmpl', ctx, 'makefile.targets', trim_blocks=True, lstrip_blocks=True) self.gen_file('sw4stm32/launch.tmpl', ctx, self.project_name + ' ' + options['debug']['name'] + '.launch') @staticmethod def clean(_): shutil.rmtree(".settings")
# Copyright 2019 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # https://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Tests for confusion matrix at thresholds.""" import math from absl.testing import parameterized import apache_beam as beam from apache_beam.testing import util import numpy as np import tensorflow as tf from tensorflow_model_analysis.eval_saved_model import testutil from tensorflow_model_analysis.metrics import binary_confusion_matrices from tensorflow_model_analysis.metrics import confusion_matrix_metrics from tensorflow_model_analysis.metrics import metric_types from tensorflow_model_analysis.metrics import metric_util _TF_MAJOR_VERSION = int(tf.version.VERSION.split('.')[0]) class ConfusionMatrixMetricsTest(testutil.TensorflowModelAnalysisTest, parameterized.TestCase): @parameterized.named_parameters( ('auc', confusion_matrix_metrics.AUC(), 0.26), ('auc_precision_recall', confusion_matrix_metrics.AUCPrecisionRecall(), 0.36205), ('specificity_at_sensitivity', confusion_matrix_metrics.SpecificityAtSensitivity(0.5), 0.2), ('sensitivity_at_specificity', confusion_matrix_metrics.SensitivityAtSpecificity(0.5), 0.0), ('precision_at_recall', confusion_matrix_metrics.PrecisionAtRecall(0.5), 0.5), ('recall_at_precision', confusion_matrix_metrics.RecallAtPrecision(0.5), 1.0), ('true_positives', confusion_matrix_metrics.TruePositives(), 1.0), ('tp', confusion_matrix_metrics.TP(), 1.0), ('false_positives', confusion_matrix_metrics.FalsePositives(), 3.0), ('fp', confusion_matrix_metrics.FP(), 3.0), ('true_negatives', confusion_matrix_metrics.TrueNegatives(), 2.0), ('tn', confusion_matrix_metrics.TN(), 2.0), ('false_negatives', confusion_matrix_metrics.FalseNegatives(), 4.0), ('fn', confusion_matrix_metrics.FN(), 4.0), ('binary_accuracy', confusion_matrix_metrics.BinaryAccuracy(), (1.0 + 2.0) / (1.0 + 2.0 + 3.0 + 4.0)), ('precision', confusion_matrix_metrics.Precision(), 1.0 / (1.0 + 3.0)), ('ppv', confusion_matrix_metrics.PPV(), 1.0 / (1.0 + 3.0)), ('recall', confusion_matrix_metrics.Recall(), 1.0 / (1.0 + 4.0)), ('tpr', confusion_matrix_metrics.TPR(), 1.0 / (1.0 + 4.0)), ('specificity', confusion_matrix_metrics.Specificity(), 2.0 / (2.0 + 3.0)), ('tnr', confusion_matrix_metrics.TNR(), 2.0 / (2.0 + 3.0)), ('fall_out', confusion_matrix_metrics.FallOut(), 3.0 / (3.0 + 2.0)), ('fpr', confusion_matrix_metrics.FPR(), 3.0 / (3.0 + 2.0)), ('miss_rate', confusion_matrix_metrics.MissRate(), 4.0 / (4.0 + 1.0)), ('fnr', confusion_matrix_metrics.FNR(), 4.0 / (4.0 + 1.0)), ('negative_predictive_value', confusion_matrix_metrics.NegativePredictiveValue(), 2.0 / (2.0 + 4.0)), ('npv', confusion_matrix_metrics.NPV(), 2.0 / (2.0 + 4.0)), ('false_discovery_rate', confusion_matrix_metrics.FalseDiscoveryRate(), 3.0 / (3.0 + 1.0)), ('false_omission_rate', confusion_matrix_metrics.FalseOmissionRate(), 4.0 / (4.0 + 2.0)), ('prevalence', confusion_matrix_metrics.Prevalence(), (1.0 + 4.0) / (1.0 + 2.0 + 3.0 + 4.0)), ('prevalence_threshold', confusion_matrix_metrics.PrevalenceThreshold(), (math.sqrt((1.0 / (1.0 + 4.0)) * (1.0 - (2.0 / (2.0 + 3.0)))) + (2.0 / (2.0 + 3.0) - 1.0)) / ((1.0 / (1.0 + 4.0) + (2.0 / (2.0 + 3.0)) - 1.0))), ('threat_score', confusion_matrix_metrics.ThreatScore(), 1.0 / (1.0 + 4.0 + 3.0)), ('balanced_accuracy', confusion_matrix_metrics.BalancedAccuracy(), ((1.0 / (1.0 + 4.0)) + (2.0 / (2.0 + 3.0))) / 2), ('f1_score', confusion_matrix_metrics.F1Score(), 2 * 1.0 / (2 * 1.0 + 3.0 + 4.0)), ('matthews_correlation_coefficient', confusion_matrix_metrics.MatthewsCorrelationCoefficient(), (1.0 * 2.0 - 3.0 * 4.0) / math.sqrt( (1.0 + 3.0) * (1.0 + 4.0) * (2.0 + 3.0) * (2.0 + 4.0))), ('fowlkes_mallows_index', confusion_matrix_metrics.FowlkesMallowsIndex(), math.sqrt(1.0 / (1.0 + 3.0) * 1.0 / (1.0 + 4.0))), ('informedness', confusion_matrix_metrics.Informedness(), (1.0 / (1.0 + 4.0)) + (2.0 / (2.0 + 3.0)) - 1.0), ('markedness', confusion_matrix_metrics.Markedness(), (1.0 / (1.0 + 3.0)) + (2.0 / (2.0 + 4.0)) - 1.0), ('positive_likelihood_ratio', confusion_matrix_metrics.PositiveLikelihoodRatio(), (1.0 / (1.0 + 4.0)) / (3.0 / (3.0 + 2.0))), ('negative_likelihood_ratio', confusion_matrix_metrics.NegativeLikelihoodRatio(), (4.0 / (4.0 + 1.0)) / (2.0 / (2.0 + 3.0))), ('diagnostic_odds_ratio', confusion_matrix_metrics.DiagnosticOddsRatio(), ((1.0 / 3.0)) / (4.0 / 2.0)), ('predicted_positive_rate', confusion_matrix_metrics.PredictedPositiveRate(), (1.0 + 3.0) / (1.0 + 2.0 + 3.0 + 4.0)), ) def testConfusionMatrixMetrics(self, metric, expected_value): if (_TF_MAJOR_VERSION < 2 and metric.__class__.__name__ in ('SpecificityAtSensitivity', 'SensitivityAtSpecificity', 'PrecisionAtRecall', 'RecallAtPrecision')): self.skipTest('Not supported in TFv1.') computations = metric.computations(example_weighted=True) histogram = computations[0] matrices = computations[1] metrics = computations[2] # tp = 1 # tn = 2 # fp = 3 # fn = 4 example1 = { 'labels': np.array([1.0]), 'predictions': np.array([0.6]), 'example_weights': np.array([1.0]), } example2 = { 'labels': np.array([0.0]), 'predictions': np.array([0.3]), 'example_weights': np.array([1.0]), } example3 = { 'labels': np.array([0.0]), 'predictions': np.array([0.2]), 'example_weights': np.array([1.0]), } example4 = { 'labels': np.array([0.0]), 'predictions': np.array([0.6]), 'example_weights': np.array([1.0]), } example5 = { 'labels': np.array([0.0]), 'predictions': np.array([0.7]), 'example_weights': np.array([1.0]), } example6 = { 'labels': np.array([0.0]), 'predictions': np.array([0.8]), 'example_weights': np.array([1.0]), } example7 = { 'labels': np.array([1.0]), 'predictions': np.array([0.1]), 'example_weights': np.array([1.0]), } example8 = { 'labels': np.array([1.0]), 'predictions': np.array([0.2]), 'example_weights': np.array([1.0]), } example9 = { 'labels': np.array([1.0]), 'predictions': np.array([0.3]), 'example_weights': np.array([1.0]), } example10 = { 'labels': np.array([1.0]), 'predictions': np.array([0.4]), 'example_weights': np.array([1.0]), } with beam.Pipeline() as pipeline: # pylint: disable=no-value-for-parameter result = ( pipeline | 'Create' >> beam.Create([ example1, example2, example3, example4, example5, example6, example7, example8, example9, example10 ]) | 'Process' >> beam.Map(metric_util.to_standard_metric_inputs) | 'AddSlice' >> beam.Map(lambda x: ((), x)) | 'ComputeHistogram' >> beam.CombinePerKey(histogram.combiner) | 'ComputeMatrices' >> beam.Map( lambda x: (x[0], matrices.result(x[1]))) # pyformat: ignore | 'ComputeMetrics' >> beam.Map(lambda x: (x[0], metrics.result(x[1]))) ) # pyformat: ignore # pylint: enable=no-value-for-parameter def check_result(got): try: self.assertLen(got, 1) got_slice_key, got_metrics = got[0] self.assertEqual(got_slice_key, ()) self.assertLen(got_metrics, 1) key = metrics.keys[0] self.assertDictElementsAlmostEqual( got_metrics, {key: expected_value}, places=5) except AssertionError as err: raise util.BeamAssertException(err) util.assert_that(result, check_result, label='result') @parameterized.named_parameters( ('auc', confusion_matrix_metrics.AUC(), 0.64286), ('auc_precision_recall', confusion_matrix_metrics.AUCPrecisionRecall(), 0.37467), ('specificity_at_sensitivity', confusion_matrix_metrics.SpecificityAtSensitivity(0.5), 0.642857), ('sensitivity_at_specificity', confusion_matrix_metrics.SensitivityAtSpecificity(0.5), 1.0), ('precision_at_recall', confusion_matrix_metrics.PrecisionAtRecall(0.5), 0.58333), ('recall_at_precision', confusion_matrix_metrics.RecallAtPrecision(0.5), 1.0), ('true_positives', confusion_matrix_metrics.TruePositives(), 0.7), ('false_positives', confusion_matrix_metrics.FalsePositives(), 0.5), ('true_negatives', confusion_matrix_metrics.TrueNegatives(), 0.9), ('false_negatives', confusion_matrix_metrics.FalseNegatives(), 0.0), ('binary_accuracy', confusion_matrix_metrics.BinaryAccuracy(), (0.7 + 0.9) / (0.7 + 0.9 + 0.5 + 0.0)), ('precision', confusion_matrix_metrics.Precision(), 0.7 / (0.7 + 0.5)), ('recall', confusion_matrix_metrics.Recall(), 0.7 / (0.7 + 0.0)), ('specificity', confusion_matrix_metrics.Specificity(), 0.9 / (0.9 + 0.5)), ('fall_out', confusion_matrix_metrics.FallOut(), 0.5 / (0.5 + 0.9)), ('miss_rate', confusion_matrix_metrics.MissRate(), 0.0 / (0.0 + 0.7)), ('negative_predictive_value', confusion_matrix_metrics.NegativePredictiveValue(), 0.9 / (0.9 + 0.0)), ('false_discovery_rate', confusion_matrix_metrics.FalseDiscoveryRate(), 0.5 / (0.5 + 0.7)), ('false_omission_rate', confusion_matrix_metrics.FalseOmissionRate(), 0.0 / (0.0 + 0.9)), ('prevalence', confusion_matrix_metrics.Prevalence(), (0.7 + 0.0) / (0.7 + 0.9 + 0.5 + 0.0)), ('prevalence_threshold', confusion_matrix_metrics.PrevalenceThreshold(), (math.sqrt((0.7 / (0.7 + 0.0)) * (1.0 - (0.9 / (0.9 + 0.5)))) + (0.9 / (0.9 + 0.5) - 1.0)) / ((0.7 / (0.7 + 0.0) + (0.9 / (0.9 + 0.5)) - 1.0))), ('threat_score', confusion_matrix_metrics.ThreatScore(), 0.7 / (0.7 + 0.0 + 0.5)), ('balanced_accuracy', confusion_matrix_metrics.BalancedAccuracy(), ((0.7 / (0.7 + 0.0)) + (0.9 / (0.9 + 0.5))) / 2), ('f1_score', confusion_matrix_metrics.F1Score(), 2 * 0.7 / (2 * 0.7 + 0.5 + 0.0)), ('matthews_correlation_coefficient', confusion_matrix_metrics.MatthewsCorrelationCoefficient(), (0.7 * 0.9 - 0.5 * 0.0) / math.sqrt( (0.7 + 0.5) * (0.7 + 0.0) * (0.9 + 0.5) * (0.9 + 0.0))), ('fowlkes_mallows_index', confusion_matrix_metrics.FowlkesMallowsIndex(), math.sqrt(0.7 / (0.7 + 0.5) * 0.7 / (0.7 + 0.0))), ('informedness', confusion_matrix_metrics.Informedness(), (0.7 / (0.7 + 0.0)) + (0.9 / (0.9 + 0.5)) - 1.0), ('markedness', confusion_matrix_metrics.Markedness(), (0.7 / (0.7 + 0.5)) + (0.9 / (0.9 + 0.0)) - 1.0), ('positive_likelihood_ratio', confusion_matrix_metrics.PositiveLikelihoodRatio(), (0.7 / (0.7 + 0.0)) / (0.5 / (0.5 + 0.9))), ('negative_likelihood_ratio', confusion_matrix_metrics.NegativeLikelihoodRatio(), (0.0 / (0.0 + 0.7)) / (0.9 / (0.9 + 0.5))), ('predicted_positive_rate', confusion_matrix_metrics.PredictedPositiveRate(), (0.7 + 0.5) / (0.7 + 0.9 + 0.5 + 0.0)), ) def testConfusionMatrixMetricsWithWeights(self, metric, expected_value): if (_TF_MAJOR_VERSION < 2 and metric.__class__.__name__ in ('SpecificityAtSensitivity', 'SensitivityAtSpecificity', 'PrecisionAtRecall', 'RecallAtPrecision')): self.skipTest('Not supported in TFv1.') computations = metric.computations(example_weighted=True) histogram = computations[0] matrix = computations[1] derived_metric = computations[2] # tp = 0.7 # tn = 0.9 # fp = 0.5 # fn = 0.0 example1 = { 'labels': np.array([0.0]), 'predictions': np.array([1.0]), 'example_weights': np.array([0.5]), } example2 = { 'labels': np.array([1.0]), 'predictions': np.array([0.7]), 'example_weights': np.array([0.7]), } example3 = { 'labels': np.array([0.0]), 'predictions': np.array([0.5]), 'example_weights': np.array([0.9]), } with beam.Pipeline() as pipeline: # pylint: disable=no-value-for-parameter result = ( pipeline | 'Create' >> beam.Create([example1, example2, example3]) | 'Process' >> beam.Map(metric_util.to_standard_metric_inputs) | 'AddSlice' >> beam.Map(lambda x: ((), x)) | 'ComputeHistogram' >> beam.CombinePerKey(histogram.combiner) | 'ComputeConfusionMatrix' >> beam.Map( lambda x: (x[0], matrix.result(x[1]))) # pyformat: disable | 'ComputeMetric' >> beam.Map( # pyformat: disable lambda x: (x[0], derived_metric.result(x[1])))) # pylint: enable=no-value-for-parameter def check_result(got): try: self.assertLen(got, 1) got_slice_key, got_metrics = got[0] self.assertEqual(got_slice_key, ()) key = metric_types.MetricKey(name=metric.name, example_weighted=True) self.assertDictElementsAlmostEqual( got_metrics, {key: expected_value}, places=5) except AssertionError as err: raise util.BeamAssertException(err) util.assert_that(result, check_result, label='result') @parameterized.named_parameters( ('auc', confusion_matrix_metrics.AUC(), 0.8571428), ('auc_precision_recall', confusion_matrix_metrics.AUCPrecisionRecall(), 0.77369833), ('true_positives', confusion_matrix_metrics.TruePositives(), 1.4), ('false_positives', confusion_matrix_metrics.FalsePositives(), 0.6), ('true_negatives', confusion_matrix_metrics.TrueNegatives(), 1.0), ('false_negatives', confusion_matrix_metrics.FalseNegatives(), 0.0), ) def testConfusionMatrixMetricsWithFractionalLabels(self, metric, expected_value): computations = metric.computations(example_weighted=True) histogram = computations[0] matrix = computations[1] derived_metric = computations[2] # The following examples will be expanded to: # # prediction | label | weight # 0.0 | - | 1.0 # 0.7 | - | 0.4 # 0.7 | + | 0.6 # 1.0 | - | 0.2 # 1.0 | + | 0.8 example1 = { 'labels': np.array([0.0]), 'predictions': np.array([0.0]), 'example_weights': np.array([1.0]), } example2 = { 'labels': np.array([0.6]), 'predictions': np.array([0.7]), 'example_weights': np.array([1.0]), } example3 = { 'labels': np.array([0.8]), 'predictions': np.array([1.0]), 'example_weights': np.array([1.0]), } with beam.Pipeline() as pipeline: # pylint: disable=no-value-for-parameter result = ( pipeline | 'Create' >> beam.Create([example1, example2, example3]) | 'Process' >> beam.Map(metric_util.to_standard_metric_inputs) | 'AddSlice' >> beam.Map(lambda x: ((), x)) | 'ComputeHistogram' >> beam.CombinePerKey(histogram.combiner) | 'ComputeConfusionMatrix' >> beam.Map( lambda x: (x[0], matrix.result(x[1]))) # pyformat: disable | 'ComputeMetric' >> beam.Map( # pyformat: disable lambda x: (x[0], derived_metric.result(x[1])))) # pylint: enable=no-value-for-parameter def check_result(got): try: self.assertLen(got, 1) got_slice_key, got_metrics = got[0] self.assertEqual(got_slice_key, ()) key = metric_types.MetricKey(name=metric.name, example_weighted=True) self.assertDictElementsAlmostEqual( got_metrics, {key: expected_value}, places=5) except AssertionError as err: raise util.BeamAssertException(err) util.assert_that(result, check_result, label='result') @parameterized.named_parameters( ('precision@2 (using sub_key)', confusion_matrix_metrics.Precision(), 2, 1.6 / (1.6 + 3.2)), ('precision@2 (using param)', confusion_matrix_metrics.Precision(top_k=2), None, 1.6 / (1.6 + 3.2)), ('recall@2 (using sub_key)', confusion_matrix_metrics.Recall(), 2, 1.6 / (1.6 + 0.8)), ('recall@2 (using param)', confusion_matrix_metrics.Recall(top_k=2), None, 1.6 / (1.6 + 0.8)), ('precision@3 (using sub_key)', confusion_matrix_metrics.Precision(), 3, 1.9 / (1.9 + 5.3)), ('recall@3 (using sub_key)', confusion_matrix_metrics.Recall(), 3, 1.9 / (1.9 + 0.5)), ) def testConfusionMatrixMetricsWithTopK(self, metric, top_k, expected_value): computations = metric.computations( sub_keys=[metric_types.SubKey(top_k=top_k)], example_weighted=True) histogram = computations[0] matrix = computations[1] derived_metric = computations[2] # top_k = 2 # TP = 0.5*0 + 0.7*1 + 0.9*1 + 0.3*0 = 1.6 # FP = 0.5*2 + 0.7*1 + 0.9*1 + 0.3*2 = 3.2 # FN = 0.5*1 + 0.7*0 + 0.9*0 + 0.3*1 = 0.8 # # top_k = 3 # TP = 0.5*0 + 0.7*1 + 0.9*1 + 0.3*1 = 1.9 # FP = 0.5*3 + 0.7*2 + 0.9*2 + 0.3*2 = 5.3 # FN = 0.5*1 + 0.7*0 + 0.9*0 + 0.3*0 = 0.5 example1 = { 'labels': np.array([2]), 'predictions': np.array([0.1, 0.2, 0.1, 0.25, 0.35]), 'example_weights': np.array([0.5]), } example2 = { 'labels': np.array([1]), 'predictions': np.array([0.2, 0.3, 0.05, 0.15, 0.3]), 'example_weights': np.array([0.7]), } example3 = { 'labels': np.array([3]), 'predictions': np.array([0.01, 0.2, 0.09, 0.5, 0.2]), 'example_weights': np.array([0.9]), } example4 = { 'labels': np.array([1]), 'predictions': np.array([0.3, 0.2, 0.05, 0.4, 0.05]), 'example_weights': np.array([0.3]), } with beam.Pipeline() as pipeline: # pylint: disable=no-value-for-parameter result = ( pipeline | 'Create' >> beam.Create([example1, example2, example3, example4]) | 'Process' >> beam.Map(metric_util.to_standard_metric_inputs) | 'AddSlice' >> beam.Map(lambda x: ((), x)) | 'ComputeHistogram' >> beam.CombinePerKey(histogram.combiner) | 'ComputeConfusionMatrix' >> beam.Map( lambda x: (x[0], matrix.result(x[1]))) # pyformat: disable | 'ComputeMetric' >> beam.Map( # pyformat: disable lambda x: (x[0], derived_metric.result(x[1])))) # pylint: enable=no-value-for-parameter def check_result(got): try: self.assertLen(got, 1) got_slice_key, got_metrics = got[0] self.assertEqual(got_slice_key, ()) if top_k: sub_key = metric_types.SubKey(top_k=top_k) else: sub_key = metric_types.SubKey(top_k=metric.get_config()['top_k']) key = metric_types.MetricKey( name=metric.name, sub_key=sub_key, example_weighted=True) self.assertDictElementsAlmostEqual( got_metrics, {key: expected_value}, places=5) except AssertionError as err: raise util.BeamAssertException(err) util.assert_that(result, check_result, label='result') @parameterized.named_parameters( ('precision (class_id=1 using sub_key)', confusion_matrix_metrics.Precision(thresholds=[0.1]), 1, 0.5 / (0.5 + 1.6)), ('precision (class_id=1 using param)', confusion_matrix_metrics.Precision( class_id=1, thresholds=[0.1]), None, 0.5 / (0.5 + 1.6)), ('recall (class_id=3 using sub_key)', confusion_matrix_metrics.Recall(thresholds=[0.1]), 3, 0.7 / (0.7 + 0.9)), ('recall (class_id=3 using param)', confusion_matrix_metrics.Recall( class_id=3, thresholds=[0.1]), None, 0.7 / (0.7 + 0.9)), ) def testConfusionMatrixMetricsWithClassId(self, metric, class_id, expected_value): computations = metric.computations( sub_keys=[metric_types.SubKey(class_id=class_id)], example_weighted=True) histogram = computations[0] matrix = computations[1] derived_metric = computations[2] # class_id = 1, threshold = 0.1 # TP = 0.5*1 + 0.7*0 + 0.9*0 + 0.3*0 = 0.5 # FP = 0.5*0 + 0.7*1 + 0.9*1 + 0.3*0 = 1.6 # FN = 0.5*0 + 0.7*0 + 0.9*0 + 0.3*1 = 0.3 # # class_id = 3, threshold = 0.1 # TP = 0.5*0 + 0.7*1 + 0.9*0 + 0.3*0 = 0.7 # FP = 0.5*1 + 0.7*0 + 0.9*0 + 0.3*1 = 0.8 # FN = 0.5*0 + 0.7*0 + 0.9*1 + 0.3*0 = 0.9 example1 = { 'labels': np.array([1]), 'predictions': np.array([0.1, 0.2, 0.1, 0.25, 0.35]), 'example_weights': np.array([0.5]), } example2 = { 'labels': np.array([3]), 'predictions': np.array([0.2, 0.3, 0.05, 0.15, 0.3]), 'example_weights': np.array([0.7]), } example3 = { 'labels': np.array([3]), 'predictions': np.array([0.01, 0.2, 0.2, 0.09, 0.5]), 'example_weights': np.array([0.9]), } example4 = { 'labels': np.array([1]), 'predictions': np.array([0.1, 0.05, 0.3, 0.4, 0.05]), 'example_weights': np.array([0.3]), } with beam.Pipeline() as pipeline: # pylint: disable=no-value-for-parameter result = ( pipeline | 'Create' >> beam.Create([example1, example2, example3, example4]) | 'Process' >> beam.Map(metric_util.to_standard_metric_inputs) | 'AddSlice' >> beam.Map(lambda x: ((), x)) | 'ComputeHistogram' >> beam.CombinePerKey(histogram.combiner) | 'ComputeConfusionMatrix' >> beam.Map( lambda x: (x[0], matrix.result(x[1]))) # pyformat: disable | 'ComputeMetric' >> beam.Map( # pyformat: disable lambda x: (x[0], derived_metric.result(x[1])))) # pylint: enable=no-value-for-parameter def check_result(got): try: self.assertLen(got, 1) got_slice_key, got_metrics = got[0] self.assertEqual(got_slice_key, ()) if class_id: sub_key = metric_types.SubKey(class_id=class_id) else: sub_key = metric_types.SubKey( class_id=metric.get_config()['class_id']) key = metric_types.MetricKey( name=metric.name, sub_key=sub_key, example_weighted=True) self.assertDictElementsAlmostEqual( got_metrics, {key: expected_value}, places=5) except AssertionError as err: raise util.BeamAssertException(err) util.assert_that(result, check_result, label='result') def testConfusionMatrixMetricsWithNan(self): computations = confusion_matrix_metrics.Specificity().computations( example_weighted=True) histogram = computations[0] matrices = computations[1] metrics = computations[2] example1 = { 'labels': np.array([1.0]), 'predictions': np.array([1.0]), 'example_weights': np.array([1.0]), } with beam.Pipeline() as pipeline: # pylint: disable=no-value-for-parameter result = ( pipeline | 'Create' >> beam.Create([example1]) | 'Process' >> beam.Map(metric_util.to_standard_metric_inputs) | 'AddSlice' >> beam.Map(lambda x: ((), x)) | 'ComputeHistogram' >> beam.CombinePerKey(histogram.combiner) | 'ComputeMatrices' >> beam.Map( lambda x: (x[0], matrices.result(x[1]))) # pyformat: ignore | 'ComputeMetrics' >> beam.Map(lambda x: (x[0], metrics.result(x[1]))) ) # pyformat: ignore # pylint: enable=no-value-for-parameter def check_result(got): try: self.assertLen(got, 1) got_slice_key, got_metrics = got[0] self.assertEqual(got_slice_key, ()) self.assertLen(got_metrics, 1) key = metrics.keys[0] self.assertIn(key, got_metrics) self.assertTrue(math.isnan(got_metrics[key])) except AssertionError as err: raise util.BeamAssertException(err) util.assert_that(result, check_result, label='result') def testRaisesErrorIfClassIDAndTopKBothUsed(self): with self.assertRaisesRegex( ValueError, 'Metric precision is configured with both class_id=2 and top_k=2 ' 'settings. Only one may be specified at a time.'): confusion_matrix_metrics.Precision( class_id=2, top_k=2).computations(example_weighted=True) @parameterized.named_parameters( ('class_id as param and class_id as sub_key', confusion_matrix_metrics.Precision(class_id=2), 2, None), ('top_k as param and top_k as sub_key', confusion_matrix_metrics.Precision(top_k=2), None, 2), ('class_id as param and top_k as sub_key', confusion_matrix_metrics.Precision(class_id=2), None, 2), ) def testRaisesErrorIfOverlappingSettings(self, metric, class_id, top_k): with self.assertRaisesRegex(ValueError, '.*is configured with overlapping settings.*'): metric.computations( sub_keys=[metric_types.SubKey(class_id=class_id, top_k=top_k)]) def testConfusionMatrixAtThresholds(self): computations = confusion_matrix_metrics.ConfusionMatrixAtThresholds( thresholds=[0.3, 0.5, 0.8]).computations(example_weighted=True) histogram = computations[0] matrices = computations[1] metrics = computations[2] example1 = { 'labels': np.array([0.0]), 'predictions': np.array([0.0]), 'example_weights': np.array([1.0]), } example2 = { 'labels': np.array([0.0]), 'predictions': np.array([0.5]), 'example_weights': np.array([1.0]), } example3 = { 'labels': np.array([1.0]), 'predictions': np.array([0.3]), 'example_weights': np.array([1.0]), } example4 = { 'labels': np.array([1.0]), 'predictions': np.array([0.9]), 'example_weights': np.array([1.0]), } with beam.Pipeline() as pipeline: # pylint: disable=no-value-for-parameter result = ( pipeline | 'Create' >> beam.Create([example1, example2, example3, example4]) | 'Process' >> beam.Map(metric_util.to_standard_metric_inputs) | 'AddSlice' >> beam.Map(lambda x: ((), x)) | 'ComputeHistogram' >> beam.CombinePerKey(histogram.combiner) | 'ComputeMatrices' >> beam.Map( lambda x: (x[0], matrices.result(x[1]))) # pyformat: ignore | 'ComputeMetrics' >> beam.Map(lambda x: (x[0], metrics.result(x[1]))) ) # pyformat: ignore # pylint: enable=no-value-for-parameter def check_result(got): try: self.assertLen(got, 1) got_slice_key, got_metrics = got[0] self.assertEqual(got_slice_key, ()) self.assertLen(got_metrics, 1) key = metric_types.MetricKey( name='confusion_matrix_at_thresholds', example_weighted=True) self.assertIn(key, got_metrics) got_metric = got_metrics[key] self.assertEqual( binary_confusion_matrices.Matrices( thresholds=[0.3, 0.5, 0.8], tp=[1.0, 1.0, 1.0], tn=[1.0, 2.0, 2.0], fp=[1.0, 0.0, 0.0], fn=[1.0, 1.0, 1.0]), got_metric) except AssertionError as err: raise util.BeamAssertException(err) util.assert_that(result, check_result, label='result') if __name__ == '__main__': tf.compat.v1.enable_v2_behavior() tf.test.main()
# Copyright 2017 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Tests for V2 summary ops from summary_ops_v2.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function import os import unittest import six from tensorflow.core.framework import graph_pb2 from tensorflow.core.framework import node_def_pb2 from tensorflow.core.framework import step_stats_pb2 from tensorflow.core.framework import summary_pb2 from tensorflow.core.protobuf import config_pb2 from tensorflow.core.util import event_pb2 from tensorflow.python.eager import context from tensorflow.python.eager import def_function from tensorflow.python.framework import constant_op from tensorflow.python.framework import dtypes from tensorflow.python.framework import errors from tensorflow.python.framework import ops from tensorflow.python.framework import tensor_spec from tensorflow.python.framework import tensor_util from tensorflow.python.framework import test_util from tensorflow.python.keras.engine.sequential import Sequential from tensorflow.python.keras.engine.training import Model from tensorflow.python.keras.layers.core import Activation from tensorflow.python.keras.layers.core import Dense from tensorflow.python.lib.io import tf_record from tensorflow.python.ops import math_ops from tensorflow.python.ops import summary_ops_v2 as summary_ops from tensorflow.python.ops import variables from tensorflow.python.platform import gfile from tensorflow.python.platform import test from tensorflow.python.platform import tf_logging as logging class SummaryOpsCoreTest(test_util.TensorFlowTestCase): def testWrite(self): logdir = self.get_temp_dir() with context.eager_mode(): with summary_ops.create_file_writer_v2(logdir).as_default(): output = summary_ops.write('tag', 42, step=12) self.assertTrue(output.numpy()) events = events_from_logdir(logdir) self.assertEqual(2, len(events)) self.assertEqual(12, events[1].step) value = events[1].summary.value[0] self.assertEqual('tag', value.tag) self.assertEqual(42, to_numpy(value)) def testWrite_fromFunction(self): logdir = self.get_temp_dir() with context.eager_mode(): writer = summary_ops.create_file_writer_v2(logdir) @def_function.function def f(): with writer.as_default(): return summary_ops.write('tag', 42, step=12) output = f() self.assertTrue(output.numpy()) events = events_from_logdir(logdir) self.assertEqual(2, len(events)) self.assertEqual(12, events[1].step) value = events[1].summary.value[0] self.assertEqual('tag', value.tag) self.assertEqual(42, to_numpy(value)) def testWrite_metadata(self): logdir = self.get_temp_dir() metadata = summary_pb2.SummaryMetadata() metadata.plugin_data.plugin_name = 'foo' with context.eager_mode(): with summary_ops.create_file_writer_v2(logdir).as_default(): summary_ops.write('obj', 0, 0, metadata=metadata) summary_ops.write('bytes', 0, 0, metadata=metadata.SerializeToString()) m = constant_op.constant(metadata.SerializeToString()) summary_ops.write('string_tensor', 0, 0, metadata=m) events = events_from_logdir(logdir) self.assertEqual(4, len(events)) self.assertEqual(metadata, events[1].summary.value[0].metadata) self.assertEqual(metadata, events[2].summary.value[0].metadata) self.assertEqual(metadata, events[3].summary.value[0].metadata) def testWrite_name(self): @def_function.function def f(): output = summary_ops.write('tag', 42, step=12, name='anonymous') self.assertTrue(output.name.startswith('anonymous')) f() def testWrite_ndarray(self): logdir = self.get_temp_dir() with context.eager_mode(): with summary_ops.create_file_writer_v2(logdir).as_default(): summary_ops.write('tag', [[1, 2], [3, 4]], step=12) events = events_from_logdir(logdir) value = events[1].summary.value[0] self.assertAllEqual([[1, 2], [3, 4]], to_numpy(value)) def testWrite_tensor(self): logdir = self.get_temp_dir() with context.eager_mode(): t = constant_op.constant([[1, 2], [3, 4]]) with summary_ops.create_file_writer_v2(logdir).as_default(): summary_ops.write('tag', t, step=12) expected = t.numpy() events = events_from_logdir(logdir) value = events[1].summary.value[0] self.assertAllEqual(expected, to_numpy(value)) def testWrite_tensor_fromFunction(self): logdir = self.get_temp_dir() with context.eager_mode(): writer = summary_ops.create_file_writer_v2(logdir) @def_function.function def f(t): with writer.as_default(): summary_ops.write('tag', t, step=12) t = constant_op.constant([[1, 2], [3, 4]]) f(t) expected = t.numpy() events = events_from_logdir(logdir) value = events[1].summary.value[0] self.assertAllEqual(expected, to_numpy(value)) def testWrite_stringTensor(self): logdir = self.get_temp_dir() with context.eager_mode(): with summary_ops.create_file_writer_v2(logdir).as_default(): summary_ops.write('tag', [b'foo', b'bar'], step=12) events = events_from_logdir(logdir) value = events[1].summary.value[0] self.assertAllEqual([b'foo', b'bar'], to_numpy(value)) @test_util.run_gpu_only def testWrite_gpuDeviceContext(self): logdir = self.get_temp_dir() with context.eager_mode(): with summary_ops.create_file_writer(logdir).as_default(): with ops.device('/GPU:0'): value = constant_op.constant(42.0) step = constant_op.constant(12, dtype=dtypes.int64) summary_ops.write('tag', value, step=step).numpy() empty_metadata = summary_pb2.SummaryMetadata() events = events_from_logdir(logdir) self.assertEqual(2, len(events)) self.assertEqual(12, events[1].step) self.assertEqual(42, to_numpy(events[1].summary.value[0])) self.assertEqual(empty_metadata, events[1].summary.value[0].metadata) @test_util.also_run_as_tf_function def testWrite_noDefaultWriter(self): # Use assertAllEqual instead of assertFalse since it works in a defun. self.assertAllEqual(False, summary_ops.write('tag', 42, step=0)) @test_util.also_run_as_tf_function def testWrite_noStep_okayIfAlsoNoDefaultWriter(self): # Use assertAllEqual instead of assertFalse since it works in a defun. self.assertAllEqual(False, summary_ops.write('tag', 42)) @test_util.also_run_as_tf_function def testWrite_noStep(self): logdir = self.get_temp_dir() with summary_ops.create_file_writer(logdir).as_default(): with self.assertRaisesRegex(ValueError, 'No step set'): summary_ops.write('tag', 42) def testWrite_usingDefaultStep(self): logdir = self.get_temp_dir() try: with context.eager_mode(): with summary_ops.create_file_writer(logdir).as_default(): summary_ops.set_step(1) summary_ops.write('tag', 1.0) summary_ops.set_step(2) summary_ops.write('tag', 1.0) mystep = variables.Variable(10, dtype=dtypes.int64) summary_ops.set_step(mystep) summary_ops.write('tag', 1.0) mystep.assign_add(1) summary_ops.write('tag', 1.0) events = events_from_logdir(logdir) self.assertEqual(5, len(events)) self.assertEqual(1, events[1].step) self.assertEqual(2, events[2].step) self.assertEqual(10, events[3].step) self.assertEqual(11, events[4].step) finally: # Reset to default state for other tests. summary_ops.set_step(None) def testWrite_usingDefaultStepConstant_fromFunction(self): logdir = self.get_temp_dir() try: with context.eager_mode(): writer = summary_ops.create_file_writer(logdir) @def_function.function def f(): with writer.as_default(): summary_ops.write('tag', 1.0) summary_ops.set_step(1) f() summary_ops.set_step(2) f() events = events_from_logdir(logdir) self.assertEqual(3, len(events)) self.assertEqual(1, events[1].step) # The step value will still be 1 because the value was captured at the # time the function was first traced. self.assertEqual(1, events[2].step) finally: # Reset to default state for other tests. summary_ops.set_step(None) def testWrite_usingDefaultStepVariable_fromFunction(self): logdir = self.get_temp_dir() try: with context.eager_mode(): writer = summary_ops.create_file_writer(logdir) @def_function.function def f(): with writer.as_default(): summary_ops.write('tag', 1.0) mystep = variables.Variable(0, dtype=dtypes.int64) summary_ops.set_step(mystep) f() mystep.assign_add(1) f() mystep.assign(10) f() events = events_from_logdir(logdir) self.assertEqual(4, len(events)) self.assertEqual(0, events[1].step) self.assertEqual(1, events[2].step) self.assertEqual(10, events[3].step) finally: # Reset to default state for other tests. summary_ops.set_step(None) def testWrite_usingDefaultStepConstant_fromLegacyGraph(self): logdir = self.get_temp_dir() try: with context.graph_mode(): writer = summary_ops.create_file_writer(logdir) summary_ops.set_step(1) with writer.as_default(): write_op = summary_ops.write('tag', 1.0) summary_ops.set_step(2) with self.cached_session() as sess: sess.run(writer.init()) sess.run(write_op) sess.run(write_op) sess.run(writer.flush()) events = events_from_logdir(logdir) self.assertEqual(3, len(events)) self.assertEqual(1, events[1].step) # The step value will still be 1 because the value was captured at the # time the graph was constructed. self.assertEqual(1, events[2].step) finally: # Reset to default state for other tests. summary_ops.set_step(None) def testWrite_usingDefaultStepVariable_fromLegacyGraph(self): logdir = self.get_temp_dir() try: with context.graph_mode(): writer = summary_ops.create_file_writer(logdir) mystep = variables.Variable(0, dtype=dtypes.int64) summary_ops.set_step(mystep) with writer.as_default(): write_op = summary_ops.write('tag', 1.0) first_assign_op = mystep.assign_add(1) second_assign_op = mystep.assign(10) with self.cached_session() as sess: sess.run(writer.init()) sess.run(mystep.initializer) sess.run(write_op) sess.run(first_assign_op) sess.run(write_op) sess.run(second_assign_op) sess.run(write_op) sess.run(writer.flush()) events = events_from_logdir(logdir) self.assertEqual(4, len(events)) self.assertEqual(0, events[1].step) self.assertEqual(1, events[2].step) self.assertEqual(10, events[3].step) finally: # Reset to default state for other tests. summary_ops.set_step(None) def testWrite_recordIf_constant(self): logdir = self.get_temp_dir() with context.eager_mode(): with summary_ops.create_file_writer_v2(logdir).as_default(): self.assertTrue(summary_ops.write('default', 1, step=0)) with summary_ops.record_if(True): self.assertTrue(summary_ops.write('set_on', 1, step=0)) with summary_ops.record_if(False): self.assertFalse(summary_ops.write('set_off', 1, step=0)) events = events_from_logdir(logdir) self.assertEqual(3, len(events)) self.assertEqual('default', events[1].summary.value[0].tag) self.assertEqual('set_on', events[2].summary.value[0].tag) def testWrite_recordIf_constant_fromFunction(self): logdir = self.get_temp_dir() with context.eager_mode(): writer = summary_ops.create_file_writer_v2(logdir) @def_function.function def f(): with writer.as_default(): # Use assertAllEqual instead of assertTrue since it works in a defun. self.assertAllEqual(summary_ops.write('default', 1, step=0), True) with summary_ops.record_if(True): self.assertAllEqual(summary_ops.write('set_on', 1, step=0), True) with summary_ops.record_if(False): self.assertAllEqual(summary_ops.write('set_off', 1, step=0), False) f() events = events_from_logdir(logdir) self.assertEqual(3, len(events)) self.assertEqual('default', events[1].summary.value[0].tag) self.assertEqual('set_on', events[2].summary.value[0].tag) def testWrite_recordIf_callable(self): logdir = self.get_temp_dir() with context.eager_mode(): step = variables.Variable(-1, dtype=dtypes.int64) def record_fn(): step.assign_add(1) return int(step % 2) == 0 with summary_ops.create_file_writer_v2(logdir).as_default(): with summary_ops.record_if(record_fn): self.assertTrue(summary_ops.write('tag', 1, step=step)) self.assertFalse(summary_ops.write('tag', 1, step=step)) self.assertTrue(summary_ops.write('tag', 1, step=step)) self.assertFalse(summary_ops.write('tag', 1, step=step)) self.assertTrue(summary_ops.write('tag', 1, step=step)) events = events_from_logdir(logdir) self.assertEqual(4, len(events)) self.assertEqual(0, events[1].step) self.assertEqual(2, events[2].step) self.assertEqual(4, events[3].step) def testWrite_recordIf_callable_fromFunction(self): logdir = self.get_temp_dir() with context.eager_mode(): writer = summary_ops.create_file_writer_v2(logdir) step = variables.Variable(-1, dtype=dtypes.int64) @def_function.function def record_fn(): step.assign_add(1) return math_ops.equal(step % 2, 0) @def_function.function def f(): with writer.as_default(): with summary_ops.record_if(record_fn): return [ summary_ops.write('tag', 1, step=step), summary_ops.write('tag', 1, step=step), summary_ops.write('tag', 1, step=step)] self.assertAllEqual(f(), [True, False, True]) self.assertAllEqual(f(), [False, True, False]) events = events_from_logdir(logdir) self.assertEqual(4, len(events)) self.assertEqual(0, events[1].step) self.assertEqual(2, events[2].step) self.assertEqual(4, events[3].step) def testWrite_recordIf_tensorInput_fromFunction(self): logdir = self.get_temp_dir() with context.eager_mode(): writer = summary_ops.create_file_writer_v2(logdir) @def_function.function(input_signature=[ tensor_spec.TensorSpec(shape=[], dtype=dtypes.int64)]) def f(step): with writer.as_default(): with summary_ops.record_if(math_ops.equal(step % 2, 0)): return summary_ops.write('tag', 1, step=step) self.assertTrue(f(0)) self.assertFalse(f(1)) self.assertTrue(f(2)) self.assertFalse(f(3)) self.assertTrue(f(4)) events = events_from_logdir(logdir) self.assertEqual(4, len(events)) self.assertEqual(0, events[1].step) self.assertEqual(2, events[2].step) self.assertEqual(4, events[3].step) @test_util.also_run_as_tf_function def testGetSetStep(self): try: self.assertIsNone(summary_ops.get_step()) summary_ops.set_step(1) # Use assertAllEqual instead of assertEqual since it works in a defun. self.assertAllEqual(1, summary_ops.get_step()) summary_ops.set_step(constant_op.constant(2)) self.assertAllEqual(2, summary_ops.get_step()) finally: # Reset to default state for other tests. summary_ops.set_step(None) def testGetSetStep_variable(self): with context.eager_mode(): try: mystep = variables.Variable(0) summary_ops.set_step(mystep) self.assertAllEqual(0, summary_ops.get_step().read_value()) mystep.assign_add(1) self.assertAllEqual(1, summary_ops.get_step().read_value()) # Check that set_step() properly maintains reference to variable. del mystep self.assertAllEqual(1, summary_ops.get_step().read_value()) summary_ops.get_step().assign_add(1) self.assertAllEqual(2, summary_ops.get_step().read_value()) finally: # Reset to default state for other tests. summary_ops.set_step(None) def testGetSetStep_variable_fromFunction(self): with context.eager_mode(): try: @def_function.function def set_step(step): summary_ops.set_step(step) return summary_ops.get_step() @def_function.function def get_and_increment(): summary_ops.get_step().assign_add(1) return summary_ops.get_step() mystep = variables.Variable(0) self.assertAllEqual(0, set_step(mystep)) self.assertAllEqual(0, summary_ops.get_step().read_value()) self.assertAllEqual(1, get_and_increment()) self.assertAllEqual(2, get_and_increment()) # Check that set_step() properly maintains reference to variable. del mystep self.assertAllEqual(3, get_and_increment()) finally: # Reset to default state for other tests. summary_ops.set_step(None) @test_util.also_run_as_tf_function def testSummaryScope(self): with summary_ops.summary_scope('foo') as (tag, scope): self.assertEqual('foo', tag) self.assertEqual('foo/', scope) with summary_ops.summary_scope('bar') as (tag, scope): self.assertEqual('foo/bar', tag) self.assertEqual('foo/bar/', scope) with summary_ops.summary_scope('with/slash') as (tag, scope): self.assertEqual('foo/with/slash', tag) self.assertEqual('foo/with/slash/', scope) with ops.name_scope(None): with summary_ops.summary_scope('unnested') as (tag, scope): self.assertEqual('unnested', tag) self.assertEqual('unnested/', scope) @test_util.also_run_as_tf_function def testSummaryScope_defaultName(self): with summary_ops.summary_scope(None) as (tag, scope): self.assertEqual('summary', tag) self.assertEqual('summary/', scope) with summary_ops.summary_scope(None, 'backup') as (tag, scope): self.assertEqual('backup', tag) self.assertEqual('backup/', scope) @test_util.also_run_as_tf_function def testSummaryScope_handlesCharactersIllegalForScope(self): with summary_ops.summary_scope('f?o?o') as (tag, scope): self.assertEqual('f?o?o', tag) self.assertEqual('foo/', scope) # If all characters aren't legal for a scope name, use default name. with summary_ops.summary_scope('???', 'backup') as (tag, scope): self.assertEqual('???', tag) self.assertEqual('backup/', scope) @test_util.also_run_as_tf_function def testSummaryScope_nameNotUniquifiedForTag(self): constant_op.constant(0, name='foo') with summary_ops.summary_scope('foo') as (tag, _): self.assertEqual('foo', tag) with summary_ops.summary_scope('foo') as (tag, _): self.assertEqual('foo', tag) with ops.name_scope('with'): constant_op.constant(0, name='slash') with summary_ops.summary_scope('with/slash') as (tag, _): self.assertEqual('with/slash', tag) class SummaryWriterTest(test_util.TensorFlowTestCase): def testCreate_withInitAndClose(self): logdir = self.get_temp_dir() with context.eager_mode(): writer = summary_ops.create_file_writer_v2( logdir, max_queue=1000, flush_millis=1000000) get_total = lambda: len(events_from_logdir(logdir)) self.assertEqual(1, get_total()) # file_version Event # Calling init() again while writer is open has no effect writer.init() self.assertEqual(1, get_total()) with writer.as_default(): summary_ops.write('tag', 1, step=0) self.assertEqual(1, get_total()) # Calling .close() should do an implicit flush writer.close() self.assertEqual(2, get_total()) def testCreate_fromFunction(self): logdir = self.get_temp_dir() @def_function.function def f(): # Returned SummaryWriter must be stored in a non-local variable so it # lives throughout the function execution. if not hasattr(f, 'writer'): f.writer = summary_ops.create_file_writer_v2(logdir) with context.eager_mode(): f() event_files = gfile.Glob(os.path.join(logdir, '*')) self.assertEqual(1, len(event_files)) def testCreate_graphTensorArgument_raisesError(self): logdir = self.get_temp_dir() with context.graph_mode(): logdir_tensor = constant_op.constant(logdir) with context.eager_mode(): with self.assertRaisesRegex( ValueError, 'Invalid graph Tensor argument.*logdir'): summary_ops.create_file_writer_v2(logdir_tensor) self.assertEmpty(gfile.Glob(os.path.join(logdir, '*'))) def testCreate_fromFunction_graphTensorArgument_raisesError(self): logdir = self.get_temp_dir() @def_function.function def f(): summary_ops.create_file_writer_v2(constant_op.constant(logdir)) with context.eager_mode(): with self.assertRaisesRegex( ValueError, 'Invalid graph Tensor argument.*logdir'): f() self.assertEmpty(gfile.Glob(os.path.join(logdir, '*'))) def testCreate_fromFunction_unpersistedResource_raisesError(self): logdir = self.get_temp_dir() @def_function.function def f(): with summary_ops.create_file_writer_v2(logdir).as_default(): pass # Calling .as_default() is enough to indicate use. with context.eager_mode(): # TODO(nickfelt): change this to a better error with self.assertRaisesRegex( errors.NotFoundError, 'Resource.*does not exist'): f() # Even though we didn't use it, an event file will have been created. self.assertEqual(1, len(gfile.Glob(os.path.join(logdir, '*')))) def testCreate_immediateSetAsDefault_retainsReference(self): logdir = self.get_temp_dir() try: with context.eager_mode(): summary_ops.create_file_writer_v2(logdir).set_as_default() summary_ops.flush() finally: # Ensure we clean up no matter how the test executes. context.context().summary_writer_resource = None def testCreate_immediateAsDefault_retainsReference(self): logdir = self.get_temp_dir() with context.eager_mode(): with summary_ops.create_file_writer_v2(logdir).as_default(): summary_ops.flush() def testNoSharing(self): # Two writers with the same logdir should not share state. logdir = self.get_temp_dir() with context.eager_mode(): writer1 = summary_ops.create_file_writer_v2(logdir) with writer1.as_default(): summary_ops.write('tag', 1, step=1) event_files = gfile.Glob(os.path.join(logdir, '*')) self.assertEqual(1, len(event_files)) file1 = event_files[0] writer2 = summary_ops.create_file_writer_v2(logdir) with writer2.as_default(): summary_ops.write('tag', 1, step=2) event_files = gfile.Glob(os.path.join(logdir, '*')) self.assertEqual(2, len(event_files)) event_files.remove(file1) file2 = event_files[0] # Extra writes to ensure interleaved usage works. with writer1.as_default(): summary_ops.write('tag', 1, step=1) with writer2.as_default(): summary_ops.write('tag', 1, step=2) events = iter(events_from_file(file1)) self.assertEqual('brain.Event:2', next(events).file_version) self.assertEqual(1, next(events).step) self.assertEqual(1, next(events).step) self.assertRaises(StopIteration, lambda: next(events)) events = iter(events_from_file(file2)) self.assertEqual('brain.Event:2', next(events).file_version) self.assertEqual(2, next(events).step) self.assertEqual(2, next(events).step) self.assertRaises(StopIteration, lambda: next(events)) def testNoSharing_fromFunction(self): logdir = self.get_temp_dir() @def_function.function def f1(): if not hasattr(f1, 'writer'): f1.writer = summary_ops.create_file_writer_v2(logdir) with f1.writer.as_default(): summary_ops.write('tag', 1, step=1) @def_function.function def f2(): if not hasattr(f2, 'writer'): f2.writer = summary_ops.create_file_writer_v2(logdir) with f2.writer.as_default(): summary_ops.write('tag', 1, step=2) with context.eager_mode(): f1() event_files = gfile.Glob(os.path.join(logdir, '*')) self.assertEqual(1, len(event_files)) file1 = event_files[0] f2() event_files = gfile.Glob(os.path.join(logdir, '*')) self.assertEqual(2, len(event_files)) event_files.remove(file1) file2 = event_files[0] # Extra writes to ensure interleaved usage works. f1() f2() events = iter(events_from_file(file1)) self.assertEqual('brain.Event:2', next(events).file_version) self.assertEqual(1, next(events).step) self.assertEqual(1, next(events).step) self.assertRaises(StopIteration, lambda: next(events)) events = iter(events_from_file(file2)) self.assertEqual('brain.Event:2', next(events).file_version) self.assertEqual(2, next(events).step) self.assertEqual(2, next(events).step) self.assertRaises(StopIteration, lambda: next(events)) def testMaxQueue(self): logdir = self.get_temp_dir() with context.eager_mode(): with summary_ops.create_file_writer_v2( logdir, max_queue=1, flush_millis=999999).as_default(): get_total = lambda: len(events_from_logdir(logdir)) # Note: First tf.Event is always file_version. self.assertEqual(1, get_total()) summary_ops.write('tag', 1, step=0) self.assertEqual(1, get_total()) # Should flush after second summary since max_queue = 1 summary_ops.write('tag', 1, step=0) self.assertEqual(3, get_total()) def testWriterFlush(self): logdir = self.get_temp_dir() get_total = lambda: len(events_from_logdir(logdir)) with context.eager_mode(): writer = summary_ops.create_file_writer_v2( logdir, max_queue=1000, flush_millis=1000000) self.assertEqual(1, get_total()) # file_version Event with writer.as_default(): summary_ops.write('tag', 1, step=0) self.assertEqual(1, get_total()) writer.flush() self.assertEqual(2, get_total()) summary_ops.write('tag', 1, step=0) self.assertEqual(2, get_total()) # Exiting the "as_default()" should do an implicit flush self.assertEqual(3, get_total()) def testFlushFunction(self): logdir = self.get_temp_dir() with context.eager_mode(): writer = summary_ops.create_file_writer_v2( logdir, max_queue=999999, flush_millis=999999) with writer.as_default(): get_total = lambda: len(events_from_logdir(logdir)) # Note: First tf.Event is always file_version. self.assertEqual(1, get_total()) summary_ops.write('tag', 1, step=0) summary_ops.write('tag', 1, step=0) self.assertEqual(1, get_total()) summary_ops.flush() self.assertEqual(3, get_total()) # Test "writer" parameter summary_ops.write('tag', 1, step=0) self.assertEqual(3, get_total()) summary_ops.flush(writer=writer) self.assertEqual(4, get_total()) summary_ops.write('tag', 1, step=0) self.assertEqual(4, get_total()) summary_ops.flush(writer=writer._resource) # pylint:disable=protected-access self.assertEqual(5, get_total()) @test_util.assert_no_new_tensors def testNoMemoryLeak_graphMode(self): logdir = self.get_temp_dir() with context.graph_mode(), ops.Graph().as_default(): summary_ops.create_file_writer_v2(logdir) @test_util.assert_no_new_pyobjects_executing_eagerly def testNoMemoryLeak_eagerMode(self): logdir = self.get_temp_dir() with summary_ops.create_file_writer_v2(logdir).as_default(): summary_ops.write('tag', 1, step=0) def testClose_preventsLaterUse(self): logdir = self.get_temp_dir() with context.eager_mode(): writer = summary_ops.create_file_writer_v2(logdir) writer.close() writer.close() # redundant close() is a no-op writer.flush() # redundant flush() is a no-op with self.assertRaisesRegex(RuntimeError, 'already closed'): writer.init() with self.assertRaisesRegex(RuntimeError, 'already closed'): with writer.as_default(): self.fail('should not get here') with self.assertRaisesRegex(RuntimeError, 'already closed'): writer.set_as_default() def testClose_closesOpenFile(self): try: import psutil # pylint: disable=g-import-not-at-top except ImportError: raise unittest.SkipTest('test requires psutil') proc = psutil.Process() get_open_filenames = lambda: set(info[0] for info in proc.open_files()) logdir = self.get_temp_dir() with context.eager_mode(): writer = summary_ops.create_file_writer_v2(logdir) files = gfile.Glob(os.path.join(logdir, '*')) self.assertEqual(1, len(files)) eventfile = files[0] self.assertIn(eventfile, get_open_filenames()) writer.close() self.assertNotIn(eventfile, get_open_filenames()) def testDereference_closesOpenFile(self): try: import psutil # pylint: disable=g-import-not-at-top except ImportError: raise unittest.SkipTest('test requires psutil') proc = psutil.Process() get_open_filenames = lambda: set(info[0] for info in proc.open_files()) logdir = self.get_temp_dir() with context.eager_mode(): writer = summary_ops.create_file_writer_v2(logdir) files = gfile.Glob(os.path.join(logdir, '*')) self.assertEqual(1, len(files)) eventfile = files[0] self.assertIn(eventfile, get_open_filenames()) del writer self.assertNotIn(eventfile, get_open_filenames()) class SummaryOpsTest(test_util.TensorFlowTestCase): def tearDown(self): summary_ops.trace_off() def run_metadata(self, *args, **kwargs): assert context.executing_eagerly() logdir = self.get_temp_dir() writer = summary_ops.create_file_writer(logdir) with writer.as_default(): summary_ops.run_metadata(*args, **kwargs) writer.close() events = events_from_logdir(logdir) return events[1] def run_metadata_graphs(self, *args, **kwargs): assert context.executing_eagerly() logdir = self.get_temp_dir() writer = summary_ops.create_file_writer(logdir) with writer.as_default(): summary_ops.run_metadata_graphs(*args, **kwargs) writer.close() events = events_from_logdir(logdir) return events[1] def create_run_metadata(self): step_stats = step_stats_pb2.StepStats(dev_stats=[ step_stats_pb2.DeviceStepStats( device='cpu:0', node_stats=[step_stats_pb2.NodeExecStats(node_name='hello')]) ]) return config_pb2.RunMetadata( function_graphs=[ config_pb2.RunMetadata.FunctionGraphs( pre_optimization_graph=graph_pb2.GraphDef( node=[node_def_pb2.NodeDef(name='foo')])) ], step_stats=step_stats) def keras_model(self, *args, **kwargs): logdir = self.get_temp_dir() writer = summary_ops.create_file_writer(logdir) with writer.as_default(): summary_ops.keras_model(*args, **kwargs) writer.close() events = events_from_logdir(logdir) # The first event contains no summary values. The written content goes to # the second event. return events[1] def run_trace(self, f, step=1): assert context.executing_eagerly() logdir = self.get_temp_dir() writer = summary_ops.create_file_writer(logdir) summary_ops.trace_on(graph=True, profiler=False) with writer.as_default(): f() summary_ops.trace_export(name='foo', step=step) writer.close() events = events_from_logdir(logdir) return events[1] @test_util.run_v2_only def testRunMetadata_usesNameAsTag(self): meta = config_pb2.RunMetadata() with ops.name_scope('foo'): event = self.run_metadata(name='my_name', data=meta, step=1) first_val = event.summary.value[0] self.assertEqual('foo/my_name', first_val.tag) @test_util.run_v2_only def testRunMetadata_summaryMetadata(self): expected_summary_metadata = """ plugin_data { plugin_name: "graph_run_metadata" content: "1" } """ meta = config_pb2.RunMetadata() event = self.run_metadata(name='my_name', data=meta, step=1) actual_summary_metadata = event.summary.value[0].metadata self.assertProtoEquals(expected_summary_metadata, actual_summary_metadata) @test_util.run_v2_only def testRunMetadata_wholeRunMetadata(self): expected_run_metadata = """ step_stats { dev_stats { device: "cpu:0" node_stats { node_name: "hello" } } } function_graphs { pre_optimization_graph { node { name: "foo" } } } """ meta = self.create_run_metadata() event = self.run_metadata(name='my_name', data=meta, step=1) first_val = event.summary.value[0] actual_run_metadata = config_pb2.RunMetadata.FromString( first_val.tensor.string_val[0]) self.assertProtoEquals(expected_run_metadata, actual_run_metadata) @test_util.run_v2_only def testRunMetadata_usesDefaultStep(self): meta = config_pb2.RunMetadata() try: summary_ops.set_step(42) event = self.run_metadata(name='my_name', data=meta) self.assertEqual(42, event.step) finally: # Reset to default state for other tests. summary_ops.set_step(None) @test_util.run_v2_only def testRunMetadataGraph_usesNameAsTag(self): meta = config_pb2.RunMetadata() with ops.name_scope('foo'): event = self.run_metadata_graphs(name='my_name', data=meta, step=1) first_val = event.summary.value[0] self.assertEqual('foo/my_name', first_val.tag) @test_util.run_v2_only def testRunMetadataGraph_summaryMetadata(self): expected_summary_metadata = """ plugin_data { plugin_name: "graph_run_metadata_graph" content: "1" } """ meta = config_pb2.RunMetadata() event = self.run_metadata_graphs(name='my_name', data=meta, step=1) actual_summary_metadata = event.summary.value[0].metadata self.assertProtoEquals(expected_summary_metadata, actual_summary_metadata) @test_util.run_v2_only def testRunMetadataGraph_runMetadataFragment(self): expected_run_metadata = """ function_graphs { pre_optimization_graph { node { name: "foo" } } } """ meta = self.create_run_metadata() event = self.run_metadata_graphs(name='my_name', data=meta, step=1) first_val = event.summary.value[0] actual_run_metadata = config_pb2.RunMetadata.FromString( first_val.tensor.string_val[0]) self.assertProtoEquals(expected_run_metadata, actual_run_metadata) @test_util.run_v2_only def testRunMetadataGraph_usesDefaultStep(self): meta = config_pb2.RunMetadata() try: summary_ops.set_step(42) event = self.run_metadata_graphs(name='my_name', data=meta) self.assertEqual(42, event.step) finally: # Reset to default state for other tests. summary_ops.set_step(None) @test_util.run_v2_only def testKerasModel(self): model = Sequential( [Dense(10, input_shape=(100,)), Activation('relu', name='my_relu')]) event = self.keras_model(name='my_name', data=model, step=1) first_val = event.summary.value[0] self.assertEqual(model.to_json(), first_val.tensor.string_val[0].decode()) @test_util.run_v2_only def testKerasModel_usesDefaultStep(self): model = Sequential( [Dense(10, input_shape=(100,)), Activation('relu', name='my_relu')]) try: summary_ops.set_step(42) event = self.keras_model(name='my_name', data=model) self.assertEqual(42, event.step) finally: # Reset to default state for other tests. summary_ops.set_step(None) @test_util.run_v2_only def testKerasModel_subclass(self): class SimpleSubclass(Model): def __init__(self): super(SimpleSubclass, self).__init__(name='subclass') self.dense = Dense(10, input_shape=(100,)) self.activation = Activation('relu', name='my_relu') def call(self, inputs): x = self.dense(inputs) return self.activation(x) model = SimpleSubclass() with test.mock.patch.object(logging, 'warn') as mock_log: self.assertFalse( summary_ops.keras_model(name='my_name', data=model, step=1)) self.assertRegexpMatches( str(mock_log.call_args), 'Model failed to serialize as JSON.') @test_util.run_v2_only def testKerasModel_otherExceptions(self): model = Sequential() with test.mock.patch.object(model, 'to_json') as mock_to_json: with test.mock.patch.object(logging, 'warn') as mock_log: mock_to_json.side_effect = Exception('oops') self.assertFalse( summary_ops.keras_model(name='my_name', data=model, step=1)) self.assertRegexpMatches( str(mock_log.call_args), 'Model failed to serialize as JSON. Ignoring... oops') @test_util.run_v2_only def testTrace(self): @def_function.function def f(): x = constant_op.constant(2) y = constant_op.constant(3) return x**y event = self.run_trace(f) first_val = event.summary.value[0] actual_run_metadata = config_pb2.RunMetadata.FromString( first_val.tensor.string_val[0]) # Content of function_graphs is large and, for instance, device can change. self.assertTrue(hasattr(actual_run_metadata, 'function_graphs')) @test_util.run_v2_only def testTrace_cannotEnableTraceInFunction(self): @def_function.function def f(): summary_ops.trace_on(graph=True, profiler=False) x = constant_op.constant(2) y = constant_op.constant(3) return x**y with test.mock.patch.object(logging, 'warn') as mock_log: f() self.assertRegexpMatches( str(mock_log.call_args), 'Cannot enable trace inside a tf.function.') @test_util.run_v2_only def testTrace_cannotEnableTraceInGraphMode(self): with test.mock.patch.object(logging, 'warn') as mock_log: with context.graph_mode(): summary_ops.trace_on(graph=True, profiler=False) self.assertRegexpMatches( str(mock_log.call_args), 'Must enable trace in eager mode.') @test_util.run_v2_only def testTrace_cannotExportTraceWithoutTrace(self): with six.assertRaisesRegex(self, ValueError, 'Must enable trace before export.'): summary_ops.trace_export(name='foo', step=1) @test_util.run_v2_only def testTrace_cannotExportTraceInFunction(self): summary_ops.trace_on(graph=True, profiler=False) @def_function.function def f(): x = constant_op.constant(2) y = constant_op.constant(3) summary_ops.trace_export(name='foo', step=1) return x**y with test.mock.patch.object(logging, 'warn') as mock_log: f() self.assertRegexpMatches( str(mock_log.call_args), 'Cannot export trace inside a tf.function.') @test_util.run_v2_only def testTrace_cannotExportTraceInGraphMode(self): with test.mock.patch.object(logging, 'warn') as mock_log: with context.graph_mode(): summary_ops.trace_export(name='foo', step=1) self.assertRegexpMatches( str(mock_log.call_args), 'Can only export trace while executing eagerly.') @test_util.run_v2_only def testTrace_usesDefaultStep(self): @def_function.function def f(): x = constant_op.constant(2) y = constant_op.constant(3) return x**y try: summary_ops.set_step(42) event = self.run_trace(f, step=None) self.assertEqual(42, event.step) finally: # Reset to default state for other tests. summary_ops.set_step(None) def events_from_file(filepath): """Returns all events in a single event file. Args: filepath: Path to the event file. Returns: A list of all tf.Event protos in the event file. """ records = list(tf_record.tf_record_iterator(filepath)) result = [] for r in records: event = event_pb2.Event() event.ParseFromString(r) result.append(event) return result def events_from_logdir(logdir): """Returns all events in the single eventfile in logdir. Args: logdir: The directory in which the single event file is sought. Returns: A list of all tf.Event protos from the single event file. Raises: AssertionError: If logdir does not contain exactly one file. """ assert gfile.Exists(logdir) files = gfile.ListDirectory(logdir) assert len(files) == 1, 'Found not exactly one file in logdir: %s' % files return events_from_file(os.path.join(logdir, files[0])) def to_numpy(summary_value): return tensor_util.MakeNdarray(summary_value.tensor) if __name__ == '__main__': test.main()
# Copyright (c) 2012 The Chromium Authors. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. """Wrapper for running the test under heapchecker and analyzing the output.""" import datetime import logging import os import re import common import path_utils import suppressions class HeapcheckWrapper(object): TMP_FILE = 'heapcheck.log' SANITY_TEST_SUPPRESSION = "Heapcheck sanity test" LEAK_REPORT_RE = re.compile( 'Leak of ([0-9]*) bytes in ([0-9]*) objects allocated from:') STACK_LINE_RE = re.compile('\s*@\s*(?:0x)?[0-9a-fA-F]+\s*([^\n]*)') BORING_CALLERS = common.BoringCallers(mangled=False, use_re_wildcards=True) def __init__(self, supp_files): self._mode = 'strict' self._timeout = 1800 self._nocleanup_on_exit = False self._suppressions = [] for fname in supp_files: self._suppressions.extend(suppressions.ReadSuppressionsFromFile(fname)) if os.path.exists(self.TMP_FILE): os.remove(self.TMP_FILE) def PutEnvAndLog(self, env_name, env_value): """Sets the env var |env_name| to |env_value| and writes to logging.info. """ os.putenv(env_name, env_value) logging.info('export %s=%s', env_name, env_value) def Execute(self): """Executes the app to be tested.""" logging.info('starting execution...') proc = ['sh', path_utils.ScriptDir() + '/heapcheck_std.sh'] proc += self._args self.PutEnvAndLog('G_SLICE', 'always-malloc') self.PutEnvAndLog('NSS_DISABLE_ARENA_FREE_LIST', '1') self.PutEnvAndLog('NSS_DISABLE_UNLOAD', '1') self.PutEnvAndLog('GTEST_DEATH_TEST_USE_FORK', '1') self.PutEnvAndLog('HEAPCHECK', self._mode) self.PutEnvAndLog('HEAP_CHECK_ERROR_EXIT_CODE', '0') self.PutEnvAndLog('HEAP_CHECK_MAX_LEAKS', '-1') self.PutEnvAndLog('KEEP_SHADOW_STACKS', '1') self.PutEnvAndLog('PPROF_PATH', path_utils.ScriptDir() + '/../../third_party/tcmalloc/chromium/src/pprof') self.PutEnvAndLog('LD_LIBRARY_PATH', '/usr/lib/debug/:/usr/lib32/debug/') # CHROME_DEVEL_SANDBOX causes problems with heapcheck self.PutEnvAndLog('CHROME_DEVEL_SANDBOX', ''); return common.RunSubprocess(proc, self._timeout) def Analyze(self, log_lines, check_sanity=False): """Analyzes the app's output and applies suppressions to the reports. Analyze() searches the logs for leak reports and tries to apply suppressions to them. Unsuppressed reports and other log messages are dumped as is. If |check_sanity| is True, the list of suppressed reports is searched for a report starting with SANITY_TEST_SUPPRESSION. If there isn't one, Analyze returns 2 regardless of the unsuppressed reports. Args: log_lines: An iterator over the app's log lines. check_sanity: A flag that determines whether we should check the tool's sanity. Returns: 2, if the sanity check fails, 1, if unsuppressed reports remain in the output and the sanity check passes, 0, if all the errors are suppressed and the sanity check passes. """ return_code = 0 # leak signature: [number of bytes, number of objects] cur_leak_signature = None cur_stack = [] cur_report = [] reported_hashes = {} # Statistics grouped by suppression description: # [hit count, bytes, objects]. used_suppressions = {} for line in log_lines: line = line.rstrip() # remove the trailing \n match = self.STACK_LINE_RE.match(line) if match: cur_stack.append(match.groups()[0]) cur_report.append(line) continue else: if cur_stack: # Try to find the suppression that applies to the current leak stack. description = '' for supp in self._suppressions: if supp.Match(cur_stack): cur_stack = [] description = supp.description break if cur_stack: if not cur_leak_signature: print 'Missing leak signature for the following stack: ' for frame in cur_stack: print ' ' + frame print 'Aborting...' return 3 # Drop boring callers from the stack to get less redundant info # and fewer unique reports. found_boring = False for i in range(1, len(cur_stack)): for j in self.BORING_CALLERS: if re.match(j, cur_stack[i]): cur_stack = cur_stack[:i] cur_report = cur_report[:i] found_boring = True break if found_boring: break error_hash = hash("".join(cur_stack)) & 0xffffffffffffffff if error_hash not in reported_hashes: reported_hashes[error_hash] = 1 # Print the report and set the return code to 1. print ('Leak of %d bytes in %d objects allocated from:' % tuple(cur_leak_signature)) print '\n'.join(cur_report) return_code = 1 # Generate the suppression iff the stack contains more than one # frame (otherwise it's likely to be broken) if len(cur_stack) > 1 or found_boring: print '\nSuppression (error hash=#%016X#):\n{' % (error_hash) print ' <insert_a_suppression_name_here>' print ' Heapcheck:Leak' for frame in cur_stack: print ' fun:' + frame print '}\n\n' else: print ('This stack may be broken due to omitted frame pointers.' ' It is not recommended to suppress it.\n') else: # Update the suppressions histogram. if description in used_suppressions: hits, bytes, objects = used_suppressions[description] hits += 1 bytes += cur_leak_signature[0] objects += cur_leak_signature[1] used_suppressions[description] = [hits, bytes, objects] else: used_suppressions[description] = [1] + cur_leak_signature cur_stack = [] cur_report = [] cur_leak_signature = None match = self.LEAK_REPORT_RE.match(line) if match: cur_leak_signature = map(int, match.groups()) else: print line # Print the list of suppressions used. is_sane = False if used_suppressions: print print '-----------------------------------------------------' print 'Suppressions used:' print ' count bytes objects name' histo = {} for description in used_suppressions: if description.startswith(HeapcheckWrapper.SANITY_TEST_SUPPRESSION): is_sane = True hits, bytes, objects = used_suppressions[description] line = '%8d %8d %8d %s' % (hits, bytes, objects, description) if hits in histo: histo[hits].append(line) else: histo[hits] = [line] keys = histo.keys() keys.sort() for count in keys: for line in histo[count]: print line print '-----------------------------------------------------' if check_sanity and not is_sane: logging.error("Sanity check failed") return 2 else: return return_code def RunTestsAndAnalyze(self, check_sanity): exec_retcode = self.Execute() log_file = file(self.TMP_FILE, 'r') analyze_retcode = self.Analyze(log_file, check_sanity) log_file.close() if analyze_retcode: logging.error("Analyze failed.") return analyze_retcode if exec_retcode: logging.error("Test execution failed.") return exec_retcode else: logging.info("Test execution completed successfully.") return 0 def Main(self, args, check_sanity=False): self._args = args start = datetime.datetime.now() retcode = -1 retcode = self.RunTestsAndAnalyze(check_sanity) end = datetime.datetime.now() seconds = (end - start).seconds hours = seconds / 3600 seconds %= 3600 minutes = seconds / 60 seconds %= 60 logging.info('elapsed time: %02d:%02d:%02d', hours, minutes, seconds) logging.info('For more information on the Heapcheck bot see ' 'http://dev.chromium.org/developers/how-tos/' 'using-the-heap-leak-checker') return retcode def RunTool(args, supp_files, module): tool = HeapcheckWrapper(supp_files) MODULES_TO_SANITY_CHECK = ["base"] check_sanity = module in MODULES_TO_SANITY_CHECK return tool.Main(args[1:], check_sanity)
import sys, select, time, socket, traceback class SEND: def __init__( self, sock, timeout ): self.fileno = sock.fileno() self.expire = time.time() + timeout def __str__( self ): return 'SEND(%i,%s)' % ( self.fileno, time.strftime( '%H:%M:%S', time.localtime( self.expire ) ) ) class RECV: def __init__( self, sock, timeout ): self.fileno = sock.fileno() self.expire = time.time() + timeout def __str__( self ): return 'RECV(%i,%s)' % ( self.fileno, time.strftime( '%H:%M:%S', time.localtime( self.expire ) ) ) class WAIT: def __init__( self, timeout = None ): self.expire = timeout and time.time() + timeout or None def __str__( self ): return 'WAIT(%s)' % ( self.expire and time.strftime( '%H:%M:%S', time.localtime( self.expire ) ) ) class Fiber: def __init__( self, generator ): self.__generator = generator self.state = WAIT() def step( self, throw=None ): self.state = None try: if throw: assert hasattr( self.__generator, 'throw' ), throw self.__generator.throw( AssertionError, throw ) state = self.__generator.next() assert isinstance( state, (SEND, RECV, WAIT) ), 'invalid waiting state %r' % state self.state = state except KeyboardInterrupt: raise except StopIteration: del self.__generator pass except AssertionError, msg: print 'Error:', msg except: traceback.print_exc() def __repr__( self ): return '%i: %s' % ( self.__generator.gi_frame.f_lineno, self.state ) class GatherFiber( Fiber ): def __init__( self, generator ): Fiber.__init__( self, generator ) self.__chunks = [ '[ 0.00 ] %s\n' % time.ctime() ] self.__start = time.time() self.__newline = True def step( self, throw=None ): stdout = sys.stdout stderr = sys.stderr try: sys.stdout = sys.stderr = self Fiber.step( self, throw ) finally: sys.stdout = stdout sys.stderr = stderr def write( self, string ): if self.__newline: self.__chunks.append( '%6.2f ' % ( time.time() - self.__start ) ) self.__chunks.append( string ) self.__newline = string.endswith( '\n' ) def __del__( self ): sys.stdout.writelines( self.__chunks ) if not self.__newline: sys.stdout.write( '\n' ) class DebugFiber( Fiber ): id = 0 def __init__( self, generator ): Fiber.__init__( self, generator ) self.__id = DebugFiber.id sys.stdout.write( '[ %04X ] %s\n' % ( self.__id, time.ctime() ) ) self.__newline = True self.__stdout = sys.stdout DebugFiber.id = ( self.id + 1 ) % 65535 def step( self, throw=None ): stdout = sys.stdout stderr = sys.stderr try: sys.stdout = sys.stderr = self Fiber.step( self, throw ) if self.state: print 'Waiting at', self finally: sys.stdout = stdout sys.stderr = stderr def write( self, string ): if self.__newline: self.__stdout.write( ' %04X ' % self.__id ) self.__stdout.write( string ) self.__newline = string.endswith( '\n' ) def spawn( generator, port, debug ): try: listener = socket.socket( socket.AF_INET, socket.SOCK_STREAM ) listener.setblocking( 0 ) listener.setsockopt( socket.SOL_SOCKET, socket.SO_REUSEADDR, listener.getsockopt( socket.SOL_SOCKET, socket.SO_REUSEADDR ) | 1 ) listener.bind( ( '', port ) ) listener.listen( 5 ) except Exception, e: print 'error: failed to create socket:', e return False if debug: myFiber = DebugFiber else: myFiber = GatherFiber print ' .... Server started' try: fibers = [] while True: tryrecv = { listener.fileno(): None } trysend = {} expire = None now = time.time() i = len( fibers ) while i: i -= 1 state = fibers[ i ].state if state and now > state.expire: if isinstance( state, WAIT ): fibers[ i ].step() else: fibers[ i ].step( throw='connection timed out' ) state = fibers[ i ].state if not state: del fibers[ i ] continue if isinstance( state, RECV ): tryrecv[ state.fileno ] = fibers[ i ] elif isinstance( state, SEND ): trysend[ state.fileno ] = fibers[ i ] elif state.expire is None: continue if state.expire < expire or expire is None: expire = state.expire if expire is None: print '[ IDLE ]', time.ctime() sys.stdout.flush() canrecv, cansend, dummy = select.select( tryrecv, trysend, [] ) print '[ BUSY ]', time.ctime() sys.stdout.flush() else: canrecv, cansend, dummy = select.select( tryrecv, trysend, [], max( expire - now, 0 ) ) for fileno in canrecv: if fileno is listener.fileno(): fibers.append( myFiber( generator( *listener.accept() ) ) ) else: tryrecv[ fileno ].step() for fileno in cansend: trysend[ fileno ].step() except KeyboardInterrupt: print ' .... Server terminated' return True except: print ' .... Server crashed' traceback.print_exc( file=sys.stdout ) return False
# -*- coding: utf-8 -*- # remimplement gpoline.icn and digest.cin python. # This will implement basic functionality of converting gpo locator codes # to html matching thomas/lis . # import re import logging logging.basicConfig(format='%(levelname)s %(pathname)s %(lineno)s:%(message)s', level=logging.DEBUG) #logging.basicConfig(format='%(levelname)s %(filename)s %(lineno)s:%(message)s', level=logging.DEBUG) logger = logging.getLogger(__name__) from itertools import zip_longest # Globals used in this module. # char(0) char(10) char(13) # char(27) char(28) char(127) REMOVE_CHARS = [b'\x000', b'\x00A', b'\x00D', b'\x01B', b'\x01C', b'\xac', b'\x07F\d+', #seems to appear at the head of a page/section b'\x07S\d+', # subformat codes? #b'\xad', #b'\xa8' ] # translate mapping tab to space MAPPING = {b'\x009': b' ', # tab to space b'\xff09':b'&ndash;' , # b'\xff09': u'\u2013', b'\x19': b' ' , # hex 19 End of Medium? change to space i.e. Page\x19S2128 -> Page S2128 b'\x5f': b'--' , # replace underbar with double hyphen??? TODO: check b'\x18': b'<br />' , # \x18 CANCEL-> <br/> ? b'\x1a': b'<br />' , # \x1a Substitute -> <br/> ? #b'\xff': b'&yuml;' , # y with .. dots over it. used to indicate accents } def grouper(iterable, n, fillvalue=None): '''Collect data into fixed-length chunks or blocks, Modified recipe from http://docs.python.org/3/library/itertools.html#recipes grouper('ABCDEFG', 3, 'x') --> ABC DEF Gxx" ''' args = [ filter( lambda x: x!=b'' , iter(iterable)) ] * n #args = [ iter(iterable) ] * n return zip_longest(*args, fillvalue=fillvalue) def remove_chars(line, remove_chars, to_string=b''): '''Remove a list of chars from a line replacing with empty string by default or passed in variable .''' for character in (remove_chars): m = re.search(character, line) if m: line = re.sub(character, to_string, line) logger.debug(b"Replaced [%s] with [%s] in input", character, to_string) return line def translate_chars(line, mapping): '''Given a mapping dictionary, replace all keys found in the line with the matching values. ''' for k, v in mapping.items(): line = remove_chars(line, [k], v) return line def find_page(data): '''I90.*\{(D\d+)\} ''' page = None #m = re.match(b'.+?\x07I90.+?\{(D\d+)\}.+?', data) m = re.match(b'\x07I90.+?\{(D\d+)\}', data) if m: page = m.group(1) logger.debug("find_page->(%s)", page) return page, m def find_locators(line): '''given a line return a regex match for locator codes in the line. match.start gives position start, match.end gives position end match.group('locator') gives the locator code without the Bell ''' code = None m = re.finditer(b'\x07(?P<locator>I67H|I66F|T\d?|g\d{0,3}|[a-su-zA-SU-Z]\d{0,2})', line) if m: code = m return code def find_escape(line, current_grid=b'G1'): ''' Escape sequences usually replace a preceding char, like an accented e in resume or in foreign accented chars. ''' code = None #m = re.finditer(b'(?P<replace>\w)?\xff(?P<esc>\w{2,3})', line) m = re.finditer(b'(?P<replace>.?)\xff(?P<esc>AE\d|AF\d|0\d|\dA|E\d)', line) if m: code = m return code def translate_locator(locator, grid=b'G2', locator_table=None, font_table=None): ''' A locator code has a start and end conversion (html) and a grid code. The Grid code controls which Font locator code conversion to use. so if the active locator code has a grid G2 we use the font code for grid G2. The default grid is G2. ''' converted_code = locator_table.get(locator) if not converted_code: #check if a font, using passed in grid: font_grid = font_table.get(grid) if font_grid: converted_code= font_grid.get(locator) if converted_code: return converted_code else: return {'start':'', 'end':'', 'grid':grid } import sys def output(input_line, prefix=None, postfix=None, outf=sys.stdout): ''' Print output to filehandle outf or sys.stdout if no filehandle passed in. Attempt to convert bytes from latin1 to utf-8. prefix is printed prior to input_line, postfix is print after input_line. ''' if not postfix: postfix = '' _output(input_line, prefix, postfix, outf) def _output(input_line, prefix=None, postfix=None, outf=sys.stdout): #logger.debug("[%s] %s [%s]", prefix, input_line, postfix) if isinstance(input_line, bytes): line = input_line.decode('latin1').encode('utf-8') else: line = input_line if line and line != b'': if prefix: logger.debug("%s", prefix) if isinstance(prefix, bytes) : outf.write (prefix.decode("utf-8")) else: outf.write (line) if isinstance(line, bytes) : outf.write (line.decode("utf-8")) else: outf.write (line) if postfix: logger.debug("%s", postfix) if isinstance(postfix, bytes) : outf.write (postfix.decode("utf-8")) else: outf.write (postfix) ESCAPE_SEQUENCES = {#esc # action b'1A' : { 'desc' :'Thin space' , 'html':b'&#160;' }, b'09' : { 'desc' :'N dash' , 'html':b'&#150;' }, #TODO: check # 08 not clear what to do All Mark b'AF' : { 'desc' :'copywright' , 'html':b'&#169;' }, b'0A' : { 'desc' :'Multiplication', 'html':b'&#215;' }, # esc # replace # action b'AE0': { 'S': {'desc' :'breve' , 'html':b'&#169;' }, 's': {'desc' :'breve' , 'html':b'&#154;' }, }, b'AE1':{ b'A': {'desc' :'acute' , 'html':b'&#193;' }, b'E': {'desc' :'acute' , 'html':b'&#201;' }, b'I': {'desc' :'acute' , 'html':b'&#205;' }, b'O': {'desc' :'acute' , 'html':b'&#211;' }, b'U': {'desc' :'acute' , 'html':b'&#218;' }, b'Y': {'desc' :'acute' , 'html':b'&#221;' }, b'c': {'desc' :'acute' , 'html':b'c&#180;' }, #TODO check b's': {'desc' :'acute' , 'html':b's&#180;' }, #TODO check b'a': {'desc' :'acute' , 'html':b'&#225;' }, b'e': {'desc' :'acute' , 'html':b'&#233;' }, b'i': {'desc' :'acute' , 'html':b'&#237;' }, b'o': {'desc' :'acute' , 'html':b'&#243;' }, b'u': {'desc' :'acute' , 'html':b'&#250;' }, b'y': {'desc' :'acute' , 'html':b'&#253;' }, } } def process_escapes(found, orig_line, current_start, current_line, current_grid , escape_sequences=ESCAPE_SEQUENCES ): ''' if current_grid > 4 then do something else do our conversions see documentation..found on cornell law site <replace char>\xff<esc> escape_sequences.get(esc).get(<replace_char>).get('html') or \xff<esc> escape_sequences.get(esc).get('html') ''' logger.debug("process esc:%s", current_line) output = current_line logger.debug("Current_grid[1:]:%s ", current_grid[1:]) if int(current_grid[1:]) <= 4: replace = found.group('replace') esc = found.group('esc') if esc: '''2 types of esc sequences: One where we match first the esc char and then the replace char to get the action part of the dictionary. Two: just match the esc char and then we get the action part of the dictionary. ''' temp = escape_sequences.get(esc, {'desc': 'default', 'html': b'' } ) # if the temp action has a dictionary matching the replace char, # make that dictionary the action action = temp.get(replace) keep_replacement = False if not action: # otherwise the action is the dictionary returned by the escape # sequence above (or the default, and empty space) and we keep # the replace char if existing in the output. action = temp keep_replacement= True logger.debug("process esc: esc:%s, replace:%s action:%s", esc, replace, action) replace_with_html = action.get('html') if keep_replacement: output = none2empty(orig_line[current_start:found.start()]) + none2empty(replace) + none2empty(replace_with_html) else : output = orig_line[current_start:found.start()] + replace_with_html if action.get('desc') == 'default': logger.warning("No translation from %s, defaulting to empty space..", esc) current_start = found.end() logger.debug("output:%s", output) return output, current_start def none2empty(input): if input: return input return b'' def process_escapes_in_line(line, current_grid, escape_sequences=None): if not escape_sequences: escape_sequences = ESCAPE_SEQUENCES current_start = 0 current_line = b'' for afound in find_escape(line, current_grid): logger.debug("line:%s", line) a_current_line , current_start = process_escapes(afound, line, current_start, current_line, current_grid , escape_sequences=escape_sequences) current_line = current_line + a_current_line logger.debug("after esc :%s", current_line) if current_start > 0: current_line = current_line + line[current_start:] line = current_line return line def process_lines(line, current_state, outputf=sys.stdout, locator_table=None, font_table=None, postfix=None): '''For every line process it for locator codes, Set the current_state to the action's grid,value unless it is a Font locator (T\d+). We use the grid code of the current locator action to determine which Font action to use. action = { 'start': "<h3><em>",'end': "</em></h3>",'grid':"G2",}, current_state = tuple( action,b'G2') There should only be one locator per line at the begining. ''' state_stack= [] state_stack.append(current_state) line_start = 0 current_grid = current_state[1] for found in find_locators(line): logger.debug("Found locator:%s", found.group('locator')) action = translate_locator(found.group('locator'), grid=current_grid, locator_table=locator_table, font_table=font_table) if action: logger.debug("Found Action:%s" , action) current_action = current_state[0] line, line_start = process_actions(found, line, line_start, current_action, action, outputf=outputf) # Not a font locator code: if found.group('locator')[0] != 'T': # set the current grid equal to the locator codes grid code. current_grid = action.get('grid') current_state = ( action, current_grid ) state_stack.append(current_state) if line: line = process_escapes_in_line(line, current_grid) output_line = line[line_start:] output (output_line, postfix=postfix,outf=outputf) else: output_line = None return state_stack, output_line def process_actions(found, line, line_start, current_state, actions, outputf=None): ''' Process a given locator code according to the actions object an action is the current locator state from FONT_TABLE or LOCATOR_TABLE ''' locator = found.group('locator') if actions.get('start-preprocess'): line = actions.get('start-preprocess')(line) if not line: line_start = None if line: pattern_start = found.start() pattern_end = found.end() output( line[line_start:pattern_start],outf=outputf) line_start = pattern_end if current_state and current_state.get('end'): logger.debug("\tcurrent_state.end:%s" , current_state.get('end')) output (current_state.get('end'),outf=outputf) logger.debug("\tlocator:%s action start:%s", locator, actions.get('start')) output ( actions.get('start'),outf=outputf) output (line[line_start:pattern_start],outf=outputf) return line, line_start
import pytest from plenum.common.messages.internal_messages import NewViewCheckpointsApplied from plenum.common.messages.node_messages import OldViewPrePrepareRequest, OldViewPrePrepareReply from plenum.common.startable import Mode, Status from plenum.server.consensus.consensus_shared_data import ConsensusSharedData from plenum.server.consensus.ordering_service_msg_validator import OrderingServiceMsgValidator from plenum.server.replica_helper import generateName from plenum.server.replica_validator_enums import PROCESS, DISCARD, STASH_CATCH_UP, STASH_WATERMARKS, \ STASH_VIEW_3PC, OLD_VIEW, OUTSIDE_WATERMARKS, ALREADY_ORDERED, CATCHING_UP, FUTURE_VIEW, \ WAITING_FOR_NEW_VIEW, NON_MASTER, INCORRECT_INSTANCE, STASH_WAITING_FIRST_BATCH_IN_VIEW, WAITING_FIRST_BATCH_IN_VIEW from plenum.test.bls.helper import generate_state_root from plenum.test.greek import genNodeNames from plenum.test.helper import create_pre_prepare_no_bls, create_prepare, create_commit_no_bls_sig @pytest.fixture(scope='function', params=[0, 2]) def view_no(request): return request.param @pytest.fixture(scope='function', params=[Mode.starting, Mode.discovering, Mode.discovered, Mode.syncing, Mode.synced, Mode.participating]) def mode(request): return request.param @pytest.fixture(scope='function', params=[True, False]) def waiting_for_new_view(request): return request.param @pytest.fixture(scope='function') def validator(view_no): validators = genNodeNames(4) inst_id = 0 cd = ConsensusSharedData(generateName(validators[0], inst_id), validators, inst_id, True) cd.pp_seq_no = 1 cd.view_no = view_no cd.node_mode = Mode.participating cd.node_status = Status.started cd.prev_view_prepare_cert = cd.last_ordered_3pc[1] return OrderingServiceMsgValidator(data=cd) def pre_prepare(view_no, pp_seq_no, inst_id=0): return create_pre_prepare_no_bls(generate_state_root(), view_no=view_no, pp_seq_no=pp_seq_no, inst_id=inst_id) def prepare(view_no, pp_seq_no, inst_id=0): return create_prepare(req_key=(view_no, pp_seq_no), state_root=generate_state_root(), inst_id=inst_id) def commit(view_no, pp_seq_no, inst_id=0): return create_commit_no_bls_sig(req_key=(view_no, pp_seq_no), inst_id=inst_id) def new_view(view_no): return NewViewCheckpointsApplied(view_no, [], [], []) def old_view_pp_req(): return OldViewPrePrepareRequest(0, [(1, 0, 1, "d1"), (1, 0, 2, "d1")]) def old_view_pp_rep(): pp1 = create_pre_prepare_no_bls(generate_state_root(), view_no=0, pp_seq_no=1, inst_id=0) pp2 = create_pre_prepare_no_bls(generate_state_root(), view_no=0, pp_seq_no=1, inst_id=0) return OldViewPrePrepareReply(0, [pp1, pp2]) def test_process_correct_pre_prepare(validator, view_no): assert validator.validate_pre_prepare( pre_prepare(view_no=view_no, pp_seq_no=1)) == (PROCESS, None) def test_process_correct_prepare(validator, view_no): assert validator.validate_prepare( prepare(view_no=view_no, pp_seq_no=1)) == (PROCESS, None) def test_process_correct_commit(validator, view_no): assert validator.validate_commit( commit(view_no=view_no, pp_seq_no=1)) == (PROCESS, None) def test_process_correct_new_view(validator, view_no): assert validator.validate_new_view(new_view(view_no=view_no)) == (PROCESS, None) def test_process_correct_old_view_pp_req(validator, view_no): assert validator.validate_old_view_prep_prepare_req(old_view_pp_req()) == (PROCESS, None) def test_process_correct_old_view_pp_rep(validator, view_no): assert validator.validate_old_view_prep_prepare_rep(old_view_pp_rep()) == (PROCESS, None) def test_discard_old_view(validator, view_no, mode, waiting_for_new_view): validator._data.node_mode = mode validator._data.waiting_for_new_view = waiting_for_new_view validator._data.view_no = view_no + 2 assert validator.validate_pre_prepare(pre_prepare(view_no, 1)) == (DISCARD, OLD_VIEW) assert validator.validate_prepare(prepare(view_no, 1)) == (DISCARD, OLD_VIEW) assert validator.validate_commit(commit(view_no, 1)) == (DISCARD, OLD_VIEW) assert validator.validate_new_view(new_view(view_no)) == (DISCARD, OLD_VIEW) validator._data.view_no = view_no + 1 assert validator.validate_pre_prepare(pre_prepare(view_no, 1)) == (DISCARD, OLD_VIEW) assert validator.validate_prepare(prepare(view_no, 1)) == (DISCARD, OLD_VIEW) assert validator.validate_commit(commit(view_no, 1)) == (DISCARD, OLD_VIEW) assert validator.validate_new_view(new_view(view_no)) == (DISCARD, OLD_VIEW) @pytest.mark.parametrize('pp_seq_no, result', [ (1, (DISCARD, ALREADY_ORDERED)), (50, (DISCARD, ALREADY_ORDERED)), (99, (DISCARD, ALREADY_ORDERED)), (100, (DISCARD, ALREADY_ORDERED)), (101, (PROCESS, None)), (300, (PROCESS, None)), (399, (PROCESS, None)), ]) def test_discard_below_watermark_3pc(validator, view_no, pp_seq_no, result): validator._data.last_ordered_3pc = (0, 1) validator._data.low_watermark = 100 validator._data.high_watermark = 400 assert validator.validate_pre_prepare(pre_prepare(view_no, pp_seq_no)) == result assert validator.validate_prepare(prepare(view_no, pp_seq_no)) == result assert validator.validate_commit(commit(view_no, pp_seq_no)) == result def test_discard_below_watermark_3pc_no_stash(validator, view_no, mode, waiting_for_new_view): validator._data.node_mode = mode validator._data.waiting_for_new_view = waiting_for_new_view validator._data.low_watermark = 100 validator._data.high_watermark = 400 assert validator.validate_pre_prepare(pre_prepare(view_no, 99)) == (DISCARD, ALREADY_ORDERED) assert validator.validate_prepare(prepare(view_no, 99)) == (DISCARD, ALREADY_ORDERED) assert validator.validate_commit(commit(view_no, 99)) == (DISCARD, ALREADY_ORDERED) def test_discard_incorrect_inst_id(validator, view_no): inst_id = validator._data.inst_id + 1 assert validator.validate_pre_prepare(pre_prepare(view_no, 1, inst_id)) == (DISCARD, INCORRECT_INSTANCE) assert validator.validate_prepare(prepare(view_no, 1, inst_id)) == (DISCARD, INCORRECT_INSTANCE) assert validator.validate_commit(commit(view_no, 1, inst_id)) == (DISCARD, INCORRECT_INSTANCE) @pytest.mark.parametrize('pp_seq_no', [1, 9, 10, 11]) def test_process_ordered_pre_prepare(validator, view_no, pp_seq_no): validator._data.last_ordered_3pc = (view_no, 10) validator._data.prev_view_prepare_cert = 10 assert validator.validate_pre_prepare(pre_prepare(view_no, pp_seq_no)) == (PROCESS, None) @pytest.mark.parametrize('mode, result', [ (Mode.starting, (STASH_CATCH_UP, CATCHING_UP)), (Mode.discovering, (STASH_CATCH_UP, CATCHING_UP)), (Mode.discovered, (STASH_CATCH_UP, CATCHING_UP)), (Mode.syncing, (STASH_CATCH_UP, CATCHING_UP)), (Mode.synced, (STASH_CATCH_UP, CATCHING_UP)), (Mode.participating, (PROCESS, None)), ]) def test_stash_while_catchup(validator, view_no, mode, result): validator._data.node_mode = mode assert validator.validate_pre_prepare(pre_prepare(view_no, 1)) == result assert validator.validate_prepare(prepare(view_no, 1)) == result assert validator.validate_commit(commit(view_no, 1)) == result assert validator.validate_new_view(new_view(view_no)) == result assert validator.validate_old_view_prep_prepare_req(old_view_pp_req()) == result assert validator.validate_old_view_prep_prepare_rep(old_view_pp_rep()) == result def test_stash_future_view(validator, view_no): assert validator.validate_pre_prepare(pre_prepare(view_no + 1, 1)) == (STASH_VIEW_3PC, FUTURE_VIEW) assert validator.validate_prepare(prepare(view_no + 1, 1)) == (STASH_VIEW_3PC, FUTURE_VIEW) assert validator.validate_commit(commit(view_no + 1, 1)) == (STASH_VIEW_3PC, FUTURE_VIEW) assert validator.validate_new_view(new_view(view_no + 1)) == (STASH_VIEW_3PC, FUTURE_VIEW) assert validator.validate_pre_prepare(pre_prepare(view_no + 2, 1)) == (STASH_VIEW_3PC, FUTURE_VIEW) assert validator.validate_prepare(prepare(view_no + 2, 1)) == (STASH_VIEW_3PC, FUTURE_VIEW) assert validator.validate_commit(commit(view_no + 2, 1)) == (STASH_VIEW_3PC, FUTURE_VIEW) assert validator.validate_new_view(new_view(view_no + 2)) == (STASH_VIEW_3PC, FUTURE_VIEW) def test_stash_waiting_for_new_view_3pc(validator, view_no): validator._data.waiting_for_new_view = True assert validator.validate_pre_prepare(pre_prepare(view_no, 1)) == (STASH_VIEW_3PC, WAITING_FOR_NEW_VIEW) assert validator.validate_prepare(prepare(view_no, 1)) == (STASH_VIEW_3PC, WAITING_FOR_NEW_VIEW) assert validator.validate_commit(commit(view_no, 1)) == (STASH_VIEW_3PC, WAITING_FOR_NEW_VIEW) def test_stash_waiting_for_new_view_old_view_pp_rep(validator, view_no): validator._data.waiting_for_new_view = True assert validator.validate_old_view_prep_prepare_rep(old_view_pp_rep()) == ( STASH_VIEW_3PC, WAITING_FOR_NEW_VIEW) def test_process_waiting_for_new_view_old_view_pp_req(validator, view_no): validator._data.waiting_for_new_view = True assert validator.validate_old_view_prep_prepare_req(old_view_pp_req()) == (PROCESS, None) @pytest.mark.parametrize('pp_seq_no, result', [ (101, (PROCESS, None)), (300, (PROCESS, None)), (399, (PROCESS, None)), (400, (PROCESS, None)), (401, (STASH_WATERMARKS, OUTSIDE_WATERMARKS)), (402, (STASH_WATERMARKS, OUTSIDE_WATERMARKS)), (100000, (STASH_WATERMARKS, OUTSIDE_WATERMARKS)), ]) def test_stash_above_watermark_3pc(validator, view_no, pp_seq_no, result): validator._data.last_ordered_3pc = (0, 1) validator._data.low_watermark = 100 validator._data.high_watermark = 400 assert validator.validate_pre_prepare(pre_prepare(view_no, pp_seq_no)) == result assert validator.validate_prepare(prepare(view_no, pp_seq_no)) == result assert validator.validate_commit(commit(view_no, pp_seq_no)) == result def test_process_waiting_for_new_view_new_view(validator, view_no): validator._data.waiting_for_new_view = True assert validator.validate_new_view(new_view(view_no)) == (PROCESS, None) @pytest.mark.parametrize('pp_seq_no', [1, 9, 10, 11]) def test_process_ordered_prepare_commit(validator, view_no, pp_seq_no): validator._data.last_ordered_3pc = (view_no, 10) validator._data.prev_view_prepare_cert = 10 assert validator.validate_prepare(prepare(view_no, pp_seq_no)) == (PROCESS, None) assert validator.validate_commit(commit(view_no, pp_seq_no)) == (PROCESS, None) def test_discard_non_master_old_view_pp_req(validator): old_view_pp_req_msg = old_view_pp_req() validator._data.is_master = False validator._data.inst_id = 1 old_view_pp_req_msg.instId = validator._data.inst_id assert validator.validate_old_view_prep_prepare_req(old_view_pp_req_msg) == (DISCARD, NON_MASTER) def test_discard_non_master_old_view_pp_rep(validator): old_view_pp_rep_msg = old_view_pp_rep() validator._data.is_master = False validator._data.inst_id = 1 old_view_pp_rep_msg.instId = validator._data.inst_id assert validator.validate_old_view_prep_prepare_rep(old_view_pp_rep_msg) == (DISCARD, NON_MASTER) def test_discard_old_view_pp_req_with_incorrect_inst_id(validator): old_view_pp_req_msg = old_view_pp_req() old_view_pp_req_msg.instId = validator._data.inst_id + 1 assert validator.validate_old_view_prep_prepare_req(old_view_pp_req_msg) == (DISCARD, INCORRECT_INSTANCE) def test_discard_old_view_pp_rep_with_incorrect_inst_id(validator): old_view_pp_rep_msg = old_view_pp_rep() old_view_pp_rep_msg.instId = validator._data.inst_id + 1 assert validator.validate_old_view_prep_prepare_rep(old_view_pp_rep_msg) == (DISCARD, INCORRECT_INSTANCE) def test_process_non_master_new_view(validator, view_no): validator._data.is_master = False validator._data.inst_id = 1 assert validator.validate_new_view(new_view(view_no)) == (PROCESS, None) @pytest.mark.parametrize('pp_seq_no, result', [ (10, (PROCESS, None)), (11, (PROCESS, None)), (12, (STASH_WAITING_FIRST_BATCH_IN_VIEW, WAITING_FIRST_BATCH_IN_VIEW)), (13, (STASH_WAITING_FIRST_BATCH_IN_VIEW, WAITING_FIRST_BATCH_IN_VIEW)), (100, (STASH_WAITING_FIRST_BATCH_IN_VIEW, WAITING_FIRST_BATCH_IN_VIEW)), ]) def test_stash_from_new_view_until_first_batch_is_ordered_non_zero_view(validator, pp_seq_no, result): validator._data.view_no = 1 validator._data.prev_view_prepare_cert = 10 validator._data.last_ordered_3pc = (1, 10) assert validator.validate_pre_prepare(pre_prepare(1, pp_seq_no)) == result assert validator.validate_prepare(prepare(1, pp_seq_no)) == result assert validator.validate_commit(commit(1, pp_seq_no)) == result @pytest.mark.parametrize('pp_seq_no, result', [ (10, (PROCESS, None)), (11, (DISCARD, ALREADY_ORDERED)), (12, (PROCESS, None)), (13, (PROCESS, None)), (100, (PROCESS, None)), ]) def test_process_from_new_view_if_first_batch_is_ordered_non_zero_view(validator, pp_seq_no, result): validator._data.view_no = 1 validator._data.prev_view_prepare_cert = 10 validator._data.last_ordered_3pc = (1, 11) assert validator.validate_pre_prepare(pre_prepare(1, pp_seq_no)) == result assert validator.validate_prepare(prepare(1, pp_seq_no)) == result assert validator.validate_commit(commit(1, pp_seq_no)) == result @pytest.mark.parametrize('pp_seq_no, result', [ (10, (PROCESS, None)), (11, (PROCESS, None)), (12, (PROCESS, None)), (13, (PROCESS, None)), (100, (PROCESS, None)), ]) def test_process_from_new_view_if_first_batch_not_ordered_zero_view(validator, pp_seq_no, result): validator._data.view_no = 0 validator._data.prev_view_prepare_cert = 10 validator._data.last_ordered_3pc = (0, 10) assert validator.validate_pre_prepare(pre_prepare(0, pp_seq_no)) == result assert validator.validate_prepare(prepare(0, pp_seq_no)) == result assert validator.validate_commit(commit(0, pp_seq_no)) == result
from time_tracking.forms import ClockForm from time_tracking.templatetags import clockformats from expenses.templatetags import moneyformats from time_tracking.middleware import CurrentUserMiddleware from time_tracking.models import Clock, Project, Activity, ClockOptions, ActivityOptions, TimeTrackingGroup from django import forms from django.conf import settings from django.contrib import admin from django.http import HttpResponse from django.utils.translation import ugettext_lazy as _, ugettext from django.http import HttpResponseRedirect from django.contrib import messages from django.core.exceptions import PermissionDenied class ActivityAdmin(admin.ModelAdmin): list_display = ('__unicode__', 'activity_type', 'time_factor') class ClockOptionsAdmin(admin.ModelAdmin): list_display = ('username', 'display_balance', 'display_closing', 'hours_per_week', 'unpaid_break', 'weekday_1', 'weekday_2', 'weekday_3', 'weekday_4', 'weekday_5', 'weekday_6', 'weekday_7') class ActivityOptionsAdmin(admin.ModelAdmin): list_display = ('activity', 'username', 'rate_formatted') def rate_formatted(self, obj): return moneyformats.money(obj.rate) rate_formatted.short_description = _('rate') rate_formatted.admin_order_field = 'rate' class ClockInForm(forms.Form): def __init__(self, *args, **kwargs): super(ClockInForm, self).__init__(*args, **kwargs) # Field is added on __init__ due to current-user-related queryset self.fields['project'] = forms.ModelChoiceField(label=_('Project'), queryset=Project.get_queryset_for_current_user(), required=False) class ClockAdmin(admin.ModelAdmin): date_hierarchy = 'start' list_display = ('status_icon', 'weekday', 'start_date', 'start_time', 'end_time', 'hours_rounded', 'hours_credited_rounded', 'activity', 'rate_formatted', 'cost_formatted', 'project', 'comment') list_display_links = ('status_icon', 'weekday', 'start_date',) form = ClockForm ordering = ['-start'] if 'billing' in settings.INSTALLED_APPS: actions = ['bill_selected'] def queryset(self, request): """ Filter the objects displayed in the change_list to only display those for the currently signed in user. """ qs = super(ClockAdmin, self).queryset(request) if not request.user.has_perm('time_tracking.can_set_user'): qs = qs.filter(user=request.user) return qs def bill_selected(self, request, queryset): from billing.models import ClockBill bill = ClockBill() bill.save() if queryset.filter(bill=None).count() != queryset.count(): self.message_user(request, _('Some entries were already billed and were not added to this bill.')) for obj in queryset.filter(bill=None): obj.bill = bill if not obj.billed_rate: obj.billed_rate = obj.get_rate() or 0 if not obj.billed_time_factor: obj.billed_time_factor = obj.activity.time_factor obj.save() return HttpResponseRedirect(bill.get_admin_url()) bill_selected.short_description = _('Create bill with selected %(verbose_name_plural)s') def add_view(self, request, form_url='', extra_context=None): if not request.user.has_perm('time_tracking.can_set_user'): self.exclude = ('user',) else: self.exclude = () return super(ClockAdmin, self).add_view(request, form_url, extra_context) def change_view(self, request, object_id, form_url='', extra_context=None): if not request.user.has_perm('time_tracking.can_set_user'): self.exclude = ('user',) else: self.exclude = () return super(ClockAdmin, self).change_view(request, object_id, form_url, extra_context) def changelist_view(self, request, extra_context=None): if not request.user.has_perm('time_tracking.can_set_user'): if 'user' in self.list_display: list_display = list(self.list_display) list_display.remove('user') self.list_display = tuple(list_display) self.list_filter = ['start', 'project', 'activity'] else: if 'user' not in self.list_display: self.list_display += ('user',) self.list_filter = ['start', 'project', 'activity', 'user'] from django.contrib.admin.views.main import ChangeList cl = ChangeList(request, self.model, self.list_display, self.list_display_links, self.list_filter, self.date_hierarchy, self.search_fields, self.list_select_related, self.list_per_page, self.list_max_show_all, self.list_editable, self) clocked_in_time = Clock.clocked_in_time(request.user) if clocked_in_time and clocked_in_time.project: # TODO this is not working initial = {'project': clocked_in_time.project} else: initial = {'project': Project.get_latest_for_current_user()} extra_context = { 'time_info': Clock.summarize(request.user, cl.query_set), 'clock_in_form': ClockInForm(initial=initial), } return super(ClockAdmin, self).changelist_view(request, extra_context) def get_urls(self): from django.conf.urls.defaults import patterns, url urls = super(ClockAdmin, self).get_urls() url_patterns = patterns('', url(r'^in/$', self.admin_site.admin_view(self.clock_in), name="time_tracking_clock_in"), url(r'^out/$', self.admin_site.admin_view(self.clock_out), name="time_tracking_clock_out"), ) url_patterns.extend(urls) return url_patterns def clock_in(self, request): if not self.has_add_permission(request): raise PermissionDenied else: clocked_in_time = Clock.clocked_in_time(request.user) project = None if request.method == 'POST': form = ClockInForm(request.POST) if not form.is_valid(): raise Exception(forms.ValidationError) if form.cleaned_data: project = form.cleaned_data['project'] else: raise forms.ValidationError('Invalid project') can_clock_in = not clocked_in_time if clocked_in_time: if not project or clocked_in_time.project == project: messages.add_message(request, messages.WARNING, _("Please clock out first. Clocked in: %s") % clocked_in_time.__unicode__()) else: clocked_in_time.clock_out() messages.add_message(request, messages.SUCCESS, _("Clocked out: %s") % clocked_in_time.__unicode__()) can_clock_in = True if can_clock_in: try: clock_in_time = Clock.clock_in(request.user, project) if project: messages.add_message(request, messages.SUCCESS, _("Clocked into %(project)s: %(clock)s") % {'clock': clock_in_time.__unicode__(), 'project': project.__unicode__()}) else: messages.add_message(request, messages.SUCCESS, _("Clocked in: %(clock)s") % {'clock': clock_in_time.__unicode__()}) except ValueError: messages.add_message(request, messages.WARNING, _("In order to be able to clock in, you'll have to create a first entry.")) return HttpResponseRedirect('../') def clock_out(self, request): if not self.has_change_permission(request): raise PermissionDenied else: clocked_in_time = Clock.clocked_in_time(request.user) if (clocked_in_time != None): clocked_in_time.clock_out() messages.add_message(request, messages.SUCCESS, _("Clocked out: %s") % clocked_in_time.__unicode__()) else: messages.add_message(request, messages.WARNING, _("Please clock in first.")) return HttpResponseRedirect('../') def cost_formatted(self, obj): return moneyformats.money(obj.get_cost()) cost_formatted.short_description = _('cost') def rate_formatted(self, obj): return moneyformats.money(obj.get_rate()) rate_formatted.short_description = _('rate') class ProjectAdmin(admin.ModelAdmin): list_display = ('name', 'group_names', 'status', 'budget_formatted', 'hours_sum_formatted', 'cost_sum_formatted', 'balance_formatted', 'coverage_formatted') def group_names(self, obj): return ', '.join([group.__unicode__() for group in obj.groups.all()]) group_names.short_description = _('groups') def budget_formatted(self, obj): return moneyformats.money(obj.budget) budget_formatted.short_description = _('budget') budget_formatted.admin_order_field = 'budget' def hours_sum_formatted(self, obj): return clockformats.hours(obj.sum_hours(), units=False) hours_sum_formatted.short_description = _('hours spent') def cost_sum_formatted(self, obj): return moneyformats.money(obj.sum_cost()) cost_sum_formatted.short_description = _('budget spent') def balance_formatted(self, obj): return moneyformats.money(obj.balance()) balance_formatted.short_description = _('balance') def coverage_formatted(self, obj): return moneyformats.percent(obj.coverage()) coverage_formatted.short_description = _('coverage') class TimeTrackingGroupAdmin(admin.ModelAdmin): list_display = ('name', 'user_names', 'clock_sum') def user_names(self, obj): return ', '.join([user.__unicode__() for user in obj.user_set.all()]) user_names.short_description = _('users') def clock_sum(self, obj): return '' #return money(Expense.objects.filter(expense_group=obj).aggregate(Sum('amount'))['amount__sum']) clock_sum.short_description = _('total') admin.site.register(Clock, ClockAdmin) admin.site.register(Project, ProjectAdmin) admin.site.register(ClockOptions, ClockOptionsAdmin) admin.site.register(ActivityOptions, ActivityOptionsAdmin) admin.site.register(Activity, ActivityAdmin) admin.site.register(TimeTrackingGroup, TimeTrackingGroupAdmin)
# -*-python-*- import cgi import os import shutil import tempfile import subprocess import json import re import codecs from threading import Timer import config from cherrypy.lib.static import serve_file from cherrypy.lib.cptools import allow from cherrypy import HTTPRedirect from mako.template import Template from mako.lookup import TemplateLookup lookup = TemplateLookup(directories=['html']) # ============================================================ # Application Entry # ============================================================ class Main(object): # gives access to images/ def images(self, filename, *args, **kwargs): allow(["HEAD", "GET"]) abspath = os.path.abspath("images/" + filename) return serve_file(abspath, "image/png") images.exposed = True def js(self, filename, *args, **kwargs): allow(["HEAD", "GET"]) abspath = os.path.abspath("js/" + filename) return serve_file(abspath, "application/javascript") js.exposed = True def css(self, filename, *args, **kwargs): allow(["HEAD", "GET"]) abspath = os.path.abspath("css/" + filename) return serve_file(abspath, "text/css") css.exposed = True def compile(self, code, verify, *args, **kwargs): allow(["HEAD", "POST"]) # First, create working directory dir = createWorkingDirectory() dir = config.DATA_DIR + "/" + dir # Second, compile the code result = compile(code,verify,dir) # Third, delete working directory shutil.rmtree(dir) # Fouth, return result as JSON if type(result) == str: response = {"result": "error", "error": result} elif len(result) != 0: response = {"result": "errors", "errors": result} else: response = {"result": "success"} return json.dumps(response) compile.exposed = True def save(self, code, *args, **kwargs): allow(["HEAD", "POST"]) # First, create working directory dir = createWorkingDirectory() # Second, save the file save(config.DATA_DIR + "/" + dir + "/tmp.whiley", code, "utf-8") # Fouth, return result as JSON return json.dumps({ "id": dir }) save.exposed = True def run(self, code, *args, **kwargs): allow(["HEAD", "POST"]) # First, create working directory dir = createWorkingDirectory() dir = config.DATA_DIR + "/" + dir # Second, compile the code and then run it result = compile(code,"false",dir) if type(result) == str: response = {"result": "error", "error": result} elif len(result) != 0: response = {"result": "errors", "errors": result} else: response = {"result": "success"} # Run the code if the compilation succeeded. output = run(dir) response["output"] = output # Third, delete working directory shutil.rmtree(dir) # Fourth, return result as JSON return json.dumps(response) run.exposed = True # application root def index(self, id="HelloWorld", *args, **kwargs): allow(["HEAD", "GET"]) error = "" redirect = "NO" try: # Sanitize the ID. safe_id = re.sub("[^a-zA-Z0-9-_]+", "", id) # Load the file code = load(config.DATA_DIR + "/" + safe_id + "/tmp.whiley","utf-8") # Escape the code code = cgi.escape(code) except Exception: code = "" error = "Invalid ID: %s" % id redirect = "YES" template = lookup.get_template("index.html") return template.render(ROOT_URL=config.VIRTUAL_URL,CODE=code,ERROR=error,REDIRECT=redirect) index.exposed = True # exposed # Everything else should redirect to the main page. def default(self, *args, **kwargs): raise HTTPRedirect("/") default.exposed = True # ============================================================ # Compiler Interface # ============================================================ # Load a given JSON file from the filesystem def load(filename,encoding): f = codecs.open(filename,"r",encoding) data = f.read() f.close() return data # Save a given file to the filesystem def save(filename,data,encoding): f = codecs.open(filename,"w",encoding) f.write(data) f.close() return # Compile a snippet of Whiley code. This is done by saving the file # to disk in a temporary location, compiling it using the Whiley2Java # Compiler and then returning the compilation output. def compile(code,verify,dir): filename = dir + "/tmp.whiley" # set required arguments args = [ config.JAVA_CMD, "-jar", config.WYJC_JAR, "-bootpath", config.WYRT_JAR, # set bootpath "-whileydir", dir, # set location of Whiley source file(s) "-classdir", dir, # set location to place class file(s) "-brief" # enable brief compiler output (easier to parse) ] # Configure optional arguments if verify == "true": args.append("-verify") # save the file save(filename, code, "utf-8") args.append(filename) # run the compiler try: proc = subprocess.Popen(args, stdout=subprocess.PIPE, stderr=subprocess.STDOUT, shell=False) # Configure Timeout kill_proc = lambda p: p.kill() timer = Timer(30, kill_proc, [proc]) timer.start() # Run process (out, err) = proc.communicate() timer.cancel() # Check what happened if proc.returncode < 0: return [{ "filename": "", "line": "", "start": "", "end": "", "text": "Compiling / Verifying your program took too long!" }] # Continue if err == None: return splitErrors(out) else: return splitErrors(err) except Exception as ex: # error, so return that return "Compile Error: " + str(ex) def run(dir): try: # run the JVM proc = subprocess.Popen([ config.JAVA_CMD, "-Djava.security.manager", "-Djava.security.policy=whiley.policy", "-cp",config.WYJC_JAR + ":" + dir, "tmp" ], stdout=subprocess.PIPE, stderr=subprocess.STDOUT, shell=False) # Configure Timeout kill_proc = lambda p: p.kill() timer = Timer(20, kill_proc, [proc]) timer.start() # Run process (out, err) = proc.communicate() timer.cancel() # Check what happened if proc.returncode >= 0: return out else: return "Timeout: Your program ran for too long!" except Exception as ex: # error, so return that return "Run Error: " + str(ex) # Split errors output from WyC into a list of JSON records, each of # which includes the filename, the line number, the column start and # end, as well a the text of the error itself. def splitErrors(errors): r = [] for err in errors.split("\n"): if err != "": r.append(splitError(err)) return r def splitError(error): parts = error.split(":", 4) if len(parts) >= 5: context = [] if len(parts) == 6: context = splitContext(parts[5]) return { "filename": parts[0], "line": int(parts[1]), "start": int(parts[2]), "end": int(parts[3]), "text": parts[4], "context": context } else: return { "filename": "", "line": "", "start": "", "end": "", "text": error } def splitContext(context): r = [] cs = context.split(",") for c in cs: parts = c.split(":", 3) r.append({ "filename": parts[0], "line": int(parts[1]), "start": int(parts[2]), "end": int(parts[3]) }) return r # Get the working directory for this request. def createWorkingDirectory(): dir = tempfile.mkdtemp(prefix="",dir=config.DATA_DIR) tail,head = os.path.split(dir) return head
# Copyright 2011 OpenStack Foundation # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. import os.path from lxml import etree from cinder import utils XMLNS_V10 = 'http://docs.rackspacecloud.com/servers/api/v1.0' XMLNS_V11 = 'http://docs.openstack.org/compute/api/v1.1' XMLNS_COMMON_V10 = 'http://docs.openstack.org/common/api/v1.0' XMLNS_ATOM = 'http://www.w3.org/2005/Atom' XMLNS_VOLUME_V1 = 'http://docs.openstack.org/volume/api/v1' XMLNS_VOLUME_V2 = ('http://docs.openstack.org/api/openstack-volume/2.0/' 'content') def validate_schema(xml, schema_name): if isinstance(xml, str): xml = etree.fromstring(xml) base_path = 'cinder/api/schemas/v1.1/' if schema_name in ('atom', 'atom-link'): base_path = 'cinder/api/schemas/' schema_path = os.path.join(utils.cinderdir(), '%s%s.rng' % (base_path, schema_name)) schema_doc = etree.parse(schema_path) relaxng = etree.RelaxNG(schema_doc) relaxng.assertValid(xml) class Selector(object): """Selects datum to operate on from an object.""" def __init__(self, *chain): """Initialize the selector. Each argument is a subsequent index into the object. """ self.chain = chain def __repr__(self): """Return a representation of the selector.""" return "Selector" + repr(self.chain) def __call__(self, obj, do_raise=False): """Select a datum to operate on. Selects the relevant datum within the object. :param obj: The object from which to select the object. :param do_raise: If False (the default), return None if the indexed datum does not exist. Otherwise, raise a KeyError. """ # Walk the selector list for elem in self.chain: # If it's callable, call it if callable(elem): obj = elem(obj) else: # Use indexing try: obj = obj[elem] except (KeyError, IndexError): # No sense going any further if do_raise: # Convert to a KeyError, for consistency raise KeyError(elem) return None # Return the finally-selected object return obj def get_items(obj): """Get items in obj.""" return list(obj.items()) class EmptyStringSelector(Selector): """Returns the empty string if Selector would return None.""" def __call__(self, obj, do_raise=False): """Returns empty string if the selected value does not exist.""" try: return super(EmptyStringSelector, self).__call__(obj, True) except KeyError: return "" class ConstantSelector(object): """Returns a constant.""" def __init__(self, value): """Initialize the selector. :param value: The value to return. """ self.value = value def __repr__(self): """Return a representation of the selector.""" return repr(self.value) def __call__(self, _obj, _do_raise=False): """Select a datum to operate on. Returns a constant value. Compatible with Selector.__call__(). """ return self.value class TemplateElement(object): """Represent an element in the template.""" def __init__(self, tag, attrib=None, selector=None, subselector=None, **extra): """Initialize an element. Initializes an element in the template. Keyword arguments specify attributes to be set on the element; values must be callables. See TemplateElement.set() for more information. :param tag: The name of the tag to create. :param attrib: An optional dictionary of element attributes. :param selector: An optional callable taking an object and optional boolean do_raise indicator and returning the object bound to the element. :param subselector: An optional callable taking an object and optional boolean do_raise indicator and returning the object bound to the element. This is used to further refine the datum object returned by selector in the event that it is a list of objects. """ # Convert selector into a Selector if selector is None: selector = Selector() elif not callable(selector): selector = Selector(selector) # Convert subselector into a Selector if subselector is not None and not callable(subselector): subselector = Selector(subselector) self.tag = tag self.selector = selector self.subselector = subselector self.attrib = {} self._text = None self._children = [] self._childmap = {} # Run the incoming attributes through set() so that they # become selectorized if not attrib: attrib = {} attrib.update(extra) for k, v in attrib.items(): self.set(k, v) def __repr__(self): """Return a representation of the template element.""" return ('<%s.%s %r at %#x>' % (self.__class__.__module__, self.__class__.__name__, self.tag, id(self))) def __len__(self): """Return the number of child elements.""" return len(self._children) def __contains__(self, key): """Determine whether a child node named by key exists.""" return key in self._childmap def __getitem__(self, idx): """Retrieve a child node by index or name.""" if isinstance(idx, basestring): # Allow access by node name return self._childmap[idx] else: return self._children[idx] def append(self, elem): """Append a child to the element.""" # Unwrap templates... elem = elem.unwrap() # Avoid duplications if elem.tag in self._childmap: raise KeyError(elem.tag) self._children.append(elem) self._childmap[elem.tag] = elem def extend(self, elems): """Append children to the element.""" # Pre-evaluate the elements elemmap = {} elemlist = [] for elem in elems: # Unwrap templates... elem = elem.unwrap() # Avoid duplications if elem.tag in self._childmap or elem.tag in elemmap: raise KeyError(elem.tag) elemmap[elem.tag] = elem elemlist.append(elem) # Update the children self._children.extend(elemlist) self._childmap.update(elemmap) def insert(self, idx, elem): """Insert a child element at the given index.""" # Unwrap templates... elem = elem.unwrap() # Avoid duplications if elem.tag in self._childmap: raise KeyError(elem.tag) self._children.insert(idx, elem) self._childmap[elem.tag] = elem def remove(self, elem): """Remove a child element.""" # Unwrap templates... elem = elem.unwrap() # Check if element exists if elem.tag not in self._childmap or self._childmap[elem.tag] != elem: raise ValueError(_('element is not a child')) self._children.remove(elem) del self._childmap[elem.tag] def get(self, key): """Get an attribute. Returns a callable which performs datum selection. :param key: The name of the attribute to get. """ return self.attrib[key] def set(self, key, value=None): """Set an attribute. :param key: The name of the attribute to set. :param value: A callable taking an object and optional boolean do_raise indicator and returning the datum bound to the attribute. If None, a Selector() will be constructed from the key. If a string, a Selector() will be constructed from the string. """ # Convert value to a selector if value is None: value = Selector(key) elif not callable(value): value = Selector(value) self.attrib[key] = value def keys(self): """Return the attribute names.""" return self.attrib.keys() def items(self): """Return the attribute names and values.""" return self.attrib.items() def unwrap(self): """Unwraps a template to return a template element.""" # We are a template element return self def wrap(self): """Wraps a template element to return a template.""" # Wrap in a basic Template return Template(self) def apply(self, elem, obj): """Apply text and attributes to an etree.Element. Applies the text and attribute instructions in the template element to an etree.Element instance. :param elem: An etree.Element instance. :param obj: The base object associated with this template element. """ # Start with the text... if self.text is not None: elem.text = unicode(self.text(obj)) # Now set up all the attributes... for key, value in self.attrib.items(): try: elem.set(key, unicode(value(obj, True))) except KeyError: # Attribute has no value, so don't include it pass def getAttrib(self, obj): """Get attribute.""" tmpattrib = {} #Now set up all the attributes... for key, value in self.attrib.items(): try: tmpattrib[key] = value(obj) except KeyError: # Attribute has no value, so don't include it pass return tmpattrib def _render(self, parent, datum, patches, nsmap): """Internal rendering. Renders the template node into an etree.Element object. Returns the etree.Element object. :param parent: The parent etree.Element instance. :param datum: The datum associated with this template element. :param patches: A list of other template elements that must also be applied. :param nsmap: An optional namespace dictionary to be associated with the etree.Element instance. """ # Allocate a node if callable(self.tag): tagname = self.tag(datum) else: tagname = self.tag # If the datum is None if datum is not None: tmpattrib = self.getAttrib(datum) else: tmpattrib = {} tagnameList = tagname.split(':') insertIndex = 0 #If parent is not none and has same tagname if parent is not None: for i in range(0, len(tagnameList)): tmpInsertPos = parent.find(tagnameList[i]) if tmpInsertPos is None: break elif not cmp(parent.attrib, tmpattrib) == 0: break parent = tmpInsertPos insertIndex = i + 1 if insertIndex >= len(tagnameList): insertIndex = insertIndex - 1 #Create root elem elem = etree.Element(tagnameList[insertIndex], nsmap=nsmap) rootelem = elem subelem = elem #Create subelem for i in range((insertIndex + 1), len(tagnameList)): subelem = etree.SubElement(elem, tagnameList[i]) elem = subelem # If we have a parent, append the node to the parent if parent is not None: #If we can merge this element, then insert if insertIndex > 0: parent.insert(len(list(parent)), rootelem) else: parent.append(rootelem) # If the datum is None, do nothing else if datum is None: return rootelem # Apply this template element to the element self.apply(subelem, datum) # Additionally, apply the patches for patch in patches: patch.apply(subelem, datum) # We have fully rendered the element; return it return rootelem def render(self, parent, obj, patches=[], nsmap=None): """Render an object. Renders an object against this template node. Returns a list of two-item tuples, where the first item is an etree.Element instance and the second item is the datum associated with that instance. :param parent: The parent for the etree.Element instances. :param obj: The object to render this template element against. :param patches: A list of other template elements to apply when rendering this template element. :param nsmap: An optional namespace dictionary to attach to the etree.Element instances. """ # First, get the datum we're rendering data = None if obj is None else self.selector(obj) # Check if we should render at all if not self.will_render(data): return [] elif data is None: return [(self._render(parent, None, patches, nsmap), None)] # Make the data into a list if it isn't already if not isinstance(data, list): data = [data] elif parent is None: raise ValueError(_('root element selecting a list')) # Render all the elements elems = [] for datum in data: if self.subselector is not None: datum = self.subselector(datum) elems.append((self._render(parent, datum, patches, nsmap), datum)) # Return all the elements rendered, as well as the # corresponding datum for the next step down the tree return elems def will_render(self, datum): """Hook method. An overridable hook method to determine whether this template element will be rendered at all. By default, returns False (inhibiting rendering) if the datum is None. :param datum: The datum associated with this template element. """ # Don't render if datum is None return datum is not None def _text_get(self): """Template element text. Either None or a callable taking an object and optional boolean do_raise indicator and returning the datum bound to the text of the template element. """ return self._text def _text_set(self, value): # Convert value to a selector if value is not None and not callable(value): value = Selector(value) self._text = value def _text_del(self): self._text = None text = property(_text_get, _text_set, _text_del) def tree(self): """Return string representation of the template tree. Returns a representation of the template rooted at this element as a string, suitable for inclusion in debug logs. """ # Build the inner contents of the tag... contents = [self.tag, '!selector=%r' % self.selector] # Add the text... if self.text is not None: contents.append('!text=%r' % self.text) # Add all the other attributes for key, value in self.attrib.items(): contents.append('%s=%r' % (key, value)) # If there are no children, return it as a closed tag if len(self) == 0: return '<%s/>' % ' '.join([str(i) for i in contents]) # OK, recurse to our children children = [c.tree() for c in self] # Return the result return ('<%s>%s</%s>' % (' '.join(contents), ''.join(children), self.tag)) def SubTemplateElement(parent, tag, attrib=None, selector=None, subselector=None, **extra): """Create a template element as a child of another. Corresponds to the etree.SubElement interface. Parameters are as for TemplateElement, with the addition of the parent. """ # Convert attributes attrib = attrib or {} attrib.update(extra) # Get a TemplateElement elem = TemplateElement(tag, attrib=attrib, selector=selector, subselector=subselector) # Append the parent safely if parent is not None: parent.append(elem) return elem class Template(object): """Represent a template.""" def __init__(self, root, nsmap=None): """Initialize a template. :param root: The root element of the template. :param nsmap: An optional namespace dictionary to be associated with the root element of the template. """ self.root = root.unwrap() if root is not None else None self.nsmap = nsmap or {} self.serialize_options = dict(encoding='UTF-8', xml_declaration=True) def _serialize(self, parent, obj, siblings, nsmap=None): """Internal serialization. Recursive routine to build a tree of etree.Element instances from an object based on the template. Returns the first etree.Element instance rendered, or None. :param parent: The parent etree.Element instance. Can be None. :param obj: The object to render. :param siblings: The TemplateElement instances against which to render the object. :param nsmap: An optional namespace dictionary to be associated with the etree.Element instance rendered. """ # First step, render the element elems = siblings[0].render(parent, obj, siblings[1:], nsmap) # Now, traverse all child elements seen = set() for idx, sibling in enumerate(siblings): for child in sibling: # Have we handled this child already? if child.tag in seen: continue seen.add(child.tag) # Determine the child's siblings nieces = [child] for sib in siblings[idx + 1:]: if child.tag in sib: nieces.append(sib[child.tag]) # Now call this function for all data elements recursively for elem, datum in elems: self._serialize(elem, datum, nieces) # Return the first element; at the top level, this will be the # root element if elems: return elems[0][0] def serialize(self, obj, *args, **kwargs): """Serialize an object. Serializes an object against the template. Returns a string with the serialized XML. Positional and keyword arguments are passed to etree.tostring(). :param obj: The object to serialize. """ elem = self.make_tree(obj) if elem is None: return '' for k, v in self.serialize_options.items(): kwargs.setdefault(k, v) # Serialize it into XML return etree.tostring(elem, *args, **kwargs) def make_tree(self, obj): """Create a tree. Serializes an object against the template. Returns an Element node with appropriate children. :param obj: The object to serialize. """ # If the template is empty, return the empty string if self.root is None: return None # Get the siblings and nsmap of the root element siblings = self._siblings() nsmap = self._nsmap() # Form the element tree return self._serialize(None, obj, siblings, nsmap) def _siblings(self): """Hook method for computing root siblings. An overridable hook method to return the siblings of the root element. By default, this is the root element itself. """ return [self.root] def _nsmap(self): """Hook method for computing the namespace dictionary. An overridable hook method to return the namespace dictionary. """ return self.nsmap.copy() def unwrap(self): """Unwraps a template to return a template element.""" # Return the root element return self.root def wrap(self): """Wraps a template element to return a template.""" # We are a template return self def apply(self, master): """Hook method for determining slave applicability. An overridable hook method used to determine if this template is applicable as a slave to a given master template. :param master: The master template to test. """ return True def tree(self): """Return string representation of the template tree. Returns a representation of the template as a string, suitable for inclusion in debug logs. """ return "%r: %s" % (self, self.root.tree()) class MasterTemplate(Template): """Represent a master template. Master templates are versioned derivatives of templates that additionally allow slave templates to be attached. Slave templates allow modification of the serialized result without directly changing the master. """ def __init__(self, root, version, nsmap=None): """Initialize a master template. :param root: The root element of the template. :param version: The version number of the template. :param nsmap: An optional namespace dictionary to be associated with the root element of the template. """ super(MasterTemplate, self).__init__(root, nsmap) self.version = version self.slaves = [] def __repr__(self): """Return string representation of the template.""" return ("<%s.%s object version %s at %#x>" % (self.__class__.__module__, self.__class__.__name__, self.version, id(self))) def _siblings(self): """Hook method for computing root siblings. An overridable hook method to return the siblings of the root element. This is the root element plus the root elements of all the slave templates. """ return [self.root] + [slave.root for slave in self.slaves] def _nsmap(self): """Hook method for computing the namespace dictionary. An overridable hook method to return the namespace dictionary. The namespace dictionary is computed by taking the master template's namespace dictionary and updating it from all the slave templates. """ nsmap = self.nsmap.copy() for slave in self.slaves: nsmap.update(slave._nsmap()) return nsmap def attach(self, *slaves): """Attach one or more slave templates. Attaches one or more slave templates to the master template. Slave templates must have a root element with the same tag as the master template. The slave template's apply() method will be called to determine if the slave should be applied to this master; if it returns False, that slave will be skipped. (This allows filtering of slaves based on the version of the master template.) """ slave_list = [] for slave in slaves: slave = slave.wrap() # Make sure we have a tree match if slave.root.tag != self.root.tag: msg = (_("Template tree mismatch; adding slave %(slavetag)s " "to master %(mastertag)s") % {'slavetag': slave.root.tag, 'mastertag': self.root.tag}) raise ValueError(msg) # Make sure slave applies to this template if not slave.apply(self): continue slave_list.append(slave) # Add the slaves self.slaves.extend(slave_list) def copy(self): """Return a copy of this master template.""" # Return a copy of the MasterTemplate tmp = self.__class__(self.root, self.version, self.nsmap) tmp.slaves = self.slaves[:] return tmp class SlaveTemplate(Template): """Represent a slave template. Slave templates are versioned derivatives of templates. Each slave has a minimum version and optional maximum version of the master template to which they can be attached. """ def __init__(self, root, min_vers, max_vers=None, nsmap=None): """Initialize a slave template. :param root: The root element of the template. :param min_vers: The minimum permissible version of the master template for this slave template to apply. :param max_vers: An optional upper bound for the master template version. :param nsmap: An optional namespace dictionary to be associated with the root element of the template. """ super(SlaveTemplate, self).__init__(root, nsmap) self.min_vers = min_vers self.max_vers = max_vers def __repr__(self): """Return string representation of the template.""" return ("<%s.%s object versions %s-%s at %#x>" % (self.__class__.__module__, self.__class__.__name__, self.min_vers, self.max_vers, id(self))) def apply(self, master): """Hook method for determining slave applicability. An overridable hook method used to determine if this template is applicable as a slave to a given master template. This version requires the master template to have a version number between min_vers and max_vers. :param master: The master template to test. """ # Does the master meet our minimum version requirement? if master.version < self.min_vers: return False # How about our maximum version requirement? if self.max_vers is not None and master.version > self.max_vers: return False return True class TemplateBuilder(object): """Template builder. This class exists to allow templates to be lazily built without having to build them each time they are needed. It must be subclassed, and the subclass must implement the construct() method, which must return a Template (or subclass) instance. The constructor will always return the template returned by construct(), or, if it has a copy() method, a copy of that template. """ _tmpl = None def __new__(cls, copy=True): """Construct and return a template. :param copy: If True (the default), a copy of the template will be constructed and returned, if possible. """ # Do we need to construct the template? if cls._tmpl is None: tmp = super(TemplateBuilder, cls).__new__(cls) # Construct the template cls._tmpl = tmp.construct() # If the template has a copy attribute, return the result of # calling it if copy and hasattr(cls._tmpl, 'copy'): return cls._tmpl.copy() # Return the template return cls._tmpl def construct(self): """Construct a template. Called to construct a template instance, which it must return. Only called once. """ raise NotImplementedError(_("subclasses must implement construct()!")) def make_links(parent, selector=None): """Attach an Atom <links> element to the parent.""" elem = SubTemplateElement(parent, '{%s}link' % XMLNS_ATOM, selector=selector) elem.set('rel') elem.set('type') elem.set('href') # Just for completeness... return elem def make_flat_dict(name, selector=None, subselector=None, ns=None): """Utility for simple XML templates. Simple templates are templates that traditionally used XMLDictSerializer with no metadata. Returns a template element where the top-level element has the given tag name, and where sub-elements have tag names derived from the object's keys and text derived from the object's values. This only works for flat dictionary objects, not dictionaries containing nested lists or dictionaries. """ # Set up the names we need... if ns is None: elemname = name tagname = Selector(0) else: elemname = '{%s}%s' % (ns, name) tagname = lambda obj, do_raise=False: '{%s}%s' % (ns, obj[0]) if selector is None: selector = name # Build the root element root = TemplateElement(elemname, selector=selector, subselector=subselector) # Build an element to represent all the keys and values elem = SubTemplateElement(root, tagname, selector=get_items) elem.text = 1 # Return the template return root
""" Copyright (c) 2015 Red Hat, Inc All rights reserved. This software may be modified and distributed under the terms of the BSD license. See the LICENSE file for details. """ from __future__ import unicode_literals import pytest from flexmock import flexmock from dockerfile_parse import DockerfileParser from atomic_reactor.inner import DockerBuildWorkflow from atomic_reactor.plugin import PreBuildPluginsRunner from atomic_reactor.plugins.pre_add_dockerfile import AddDockerfilePlugin from atomic_reactor.plugins.pre_add_labels_in_df import AddLabelsPlugin from atomic_reactor.util import ImageName from tests.constants import MOCK_SOURCE from tests.fixtures import docker_tasker class Y(object): pass class X(object): image_id = "xxx" source = Y() source.dockerfile_path = None source.path = None base_image = ImageName(repo="qwe", tag="asd") def test_adddockerfile_plugin(tmpdir, docker_tasker): df_content = """ FROM fedora RUN yum install -y python-django CMD blabla""" df = DockerfileParser(str(tmpdir)) df.content = df_content workflow = DockerBuildWorkflow(MOCK_SOURCE, 'test-image') workflow.builder = X workflow.builder.df_path = df.dockerfile_path workflow.builder.df_dir = str(tmpdir) runner = PreBuildPluginsRunner( docker_tasker, workflow, [{ 'name': AddDockerfilePlugin.key, 'args': {'nvr': 'rhel-server-docker-7.1-20'} }] ) runner.run() assert AddDockerfilePlugin.key is not None expected_output = """ FROM fedora RUN yum install -y python-django ADD Dockerfile-rhel-server-docker-7.1-20 /root/buildinfo/Dockerfile-rhel-server-docker-7.1-20 CMD blabla""" assert df.content == expected_output def test_adddockerfile_todest(tmpdir, docker_tasker): df_content = """ FROM fedora RUN yum install -y python-django CMD blabla""" df = DockerfileParser(str(tmpdir)) df.content = df_content workflow = DockerBuildWorkflow(MOCK_SOURCE, 'test-image') workflow.builder = X workflow.builder.df_path = df.dockerfile_path workflow.builder.df_dir = str(tmpdir) runner = PreBuildPluginsRunner( docker_tasker, workflow, [{ 'name': AddDockerfilePlugin.key, 'args': {'nvr': 'jboss-eap-6-docker-6.4-77', 'destdir': '/usr/share/doc/'} }] ) runner.run() assert AddDockerfilePlugin.key is not None expected_output = """ FROM fedora RUN yum install -y python-django ADD Dockerfile-jboss-eap-6-docker-6.4-77 /usr/share/doc/Dockerfile-jboss-eap-6-docker-6.4-77 CMD blabla""" assert df.content == expected_output def test_adddockerfile_nvr_from_labels(tmpdir, docker_tasker): df_content = """ FROM fedora RUN yum install -y python-django LABEL Name="jboss-eap-6-docker" "Version"="6.4" "Release"=77 CMD blabla""" df = DockerfileParser(str(tmpdir)) df.content = df_content workflow = DockerBuildWorkflow(MOCK_SOURCE, 'test-image') workflow.builder = X workflow.builder.df_path = df.dockerfile_path workflow.builder.df_dir = str(tmpdir) runner = PreBuildPluginsRunner( docker_tasker, workflow, [{ 'name': AddDockerfilePlugin.key }] ) runner.run() assert AddDockerfilePlugin.key is not None assert "ADD Dockerfile-jboss-eap-6-docker-6.4-77 /root/buildinfo/Dockerfile-jboss-eap-6-docker-6.4-77" in df.content def test_adddockerfile_nvr_from_labels2(tmpdir, docker_tasker): df_content = """ FROM fedora RUN yum install -y python-django CMD blabla""" df = DockerfileParser(str(tmpdir)) df.content = df_content workflow = DockerBuildWorkflow(MOCK_SOURCE, 'test-image') flexmock(workflow, base_image_inspect={"Config": {"Labels": {}}}) workflow.builder = X workflow.builder.df_path = df.dockerfile_path workflow.builder.df_dir = str(tmpdir) runner = PreBuildPluginsRunner( docker_tasker, workflow, [{ 'name': AddLabelsPlugin.key, 'args': {'labels': {'Name': 'jboss-eap-6-docker', 'Version': '6.4', 'Release': '77'}} }, { 'name': AddDockerfilePlugin.key }] ) runner.run() assert AddDockerfilePlugin.key is not None assert "ADD Dockerfile-jboss-eap-6-docker-6.4-77 /root/buildinfo/Dockerfile-jboss-eap-6-docker-6.4-77" in df.content def test_adddockerfile_fails(tmpdir, docker_tasker): df_content = """ FROM fedora RUN yum install -y python-django CMD blabla""" df = DockerfileParser(str(tmpdir)) df.content = df_content workflow = DockerBuildWorkflow(MOCK_SOURCE, 'test-image') workflow.builder = X workflow.builder.df_path = df.dockerfile_path workflow.builder.df_dir = str(tmpdir) runner = PreBuildPluginsRunner( docker_tasker, workflow, [{ 'name': AddDockerfilePlugin.key }] ) with pytest.raises(ValueError): runner.run() def test_adddockerfile_final(tmpdir, docker_tasker): df_content = """ FROM fedora RUN yum install -y python-django CMD blabla""" df = DockerfileParser(str(tmpdir)) df.content = df_content workflow = DockerBuildWorkflow(MOCK_SOURCE, 'test-image') workflow.builder = X workflow.builder.df_path = df.dockerfile_path workflow.builder.df_dir = str(tmpdir) runner = PreBuildPluginsRunner( docker_tasker, workflow, [{ 'name': AddDockerfilePlugin.key, 'args': {'nvr': 'rhel-server-docker-7.1-20', "use_final_dockerfile": True} }] ) runner.run() assert AddDockerfilePlugin.key is not None expected_output = """ FROM fedora RUN yum install -y python-django ADD Dockerfile /root/buildinfo/Dockerfile-rhel-server-docker-7.1-20 CMD blabla""" assert df.content == expected_output
import time import math import sys import pygame import jog2d def simu(ns, shared_regs, change_regs): print "simu started" twopi = 2.0 * math.pi pygame.init() xmax = 1000 ymax = 600 size = (xmax, ymax) screen = pygame.display.set_mode(size) tpict = [] tpictply = [] pict1 = jog2d.Picture(800, 50, 950, 200) tpict.append(pict1) tpictply.append(pict1.ply) tobs = [] tobsply = [] maze = False if maze: obs1 = jog2d.Obstacle(240, 20, 260, 450) tobs.append(obs1) tobsply.append(obs1.ply) obs2 = jog2d.Obstacle(490, 150, 510, 580) tobs.append(obs2) tobsply.append(obs2.ply) obs3 = jog2d.Obstacle(740, 20, 760, 450) tobs.append(obs3) tobsply.append(obs3.ply) obs_l = jog2d.Obstacle(0, 0, 10, ymax) tobs.append(obs_l) tobsply.append(obs_l.ply) obs_r = jog2d.Obstacle(xmax - 10, 0, xmax, ymax) tobs.append(obs_r) tobsply.append(obs_r.ply) obs_t = jog2d.Obstacle(11, 0, xmax - 11, 10) tobs.append(obs_t) tobsply.append(obs_t.ply) obs_b = jog2d.Obstacle(11, ymax - 10, xmax - 11, ymax) tobs.append(obs_b) tobsply.append(obs_b.ply) jog = jog2d.Jog2d() leds = [0, 0, 0, 0] # leds off # init location xjog = 500 yjog = 250 xjogi = int(round(xjog)) yjogi = int(round(yjog)) jog.translate(xjogi, yjogi) # init heading hdjog0 = jog.head hdjog = 110.0 angrot = (hdjog - hdjog0) jog.rotate(angrot) # init sonars sonar_hits = jog.obstacle(tobsply) sonar_set = [] sonar_time = [] for ison in range(5): sonar_set.append(False) sonar_time.append(time.time()) addrs = 0x71 + ison for regs in [0, 2, 3]: st_reg = "i2c_0x%2.2x_%2.2d" % (addrs, regs) shared_regs[st_reg] = 0 # init compass addrs = 0x60 for regs in [1, 2, 3]: st_reg = "i2c_0x%2.2x_%2.2d" % (addrs, regs) shared_regs[st_reg] = 0 # init motion and odometry motors_period_reg = 100 odo_left_actual = 0.0 odo_right_actual = 0.0 motor_left_direction = 1.0 motor_right_direction = 1.0 wheel_diameter = (2.32 * 2.54e-2) wheel_radius = wheel_diameter / 2.0 n_ticks = 576 wheel_dist = 0.2 motor_left_ang_speed = 0.0 motor_right_ang_speed = 0.0 motor_left_lin_speed = 0.0 motor_right_lin_speed = 0.0 motor_left_dead_zone = 17.0 # 11 motor_right_dead_zone = 19.0 # 13 revsec = 4 # revol/sec at maximum PWM motors_alpha = revsec * twopi / motors_period_reg ang_speed = 0.0 shared_regs['fpga_0x06'] = motors_period_reg t = 0.0 d_time = 0.05 while ns.alive: start_time = time.time() for event in pygame.event.get(): if event.type == pygame.QUIT: ns.alive = False print "trying to close pygame window ... no action" sys.exit() # print "vJOG alive ",t #get the changes in JOG configuration # and perform corresponding update_motors = False for keyval in change_regs: key = keyval[0] val = shared_regs[key] #print "vJOG",key,val,t change_regs.remove(keyval) # FPGA registers if key == 'fpga_0x18': # leds #print "vJOG : leds" for il in range(4): leds[il] = (val >> il) & 0x1 elif key == 'fpga_0x20': # odometer 1 shared_regs[key] = int(odo_right_actual) & 65535 #print "vJOG : odo1",shared_regs[key] elif key == 'fpga_0x22': # odometer 2 shared_regs[key] = int(odo_left_actual) & 65535 #print "vJOG : od2",shared_regs[key] elif key == 'fpga_0x06': # period PWM (100 = 0x64) #print "vJOG : period PWM" motors_period_reg = val - 1 motors_alpha = revsec * twopi / motors_period_reg #print "motors_period_reg",motors_period_reg elif key == 'fpga_0x08': # value PWM1 (0 to 99) #print "vJOG : value PWM1" update_motors = True elif key == 'fpga_0x0a': # direction PWM1 (0: forward) #print "vJOG : direction PWM1" update_motors = True elif key == 'fpga_0x0c': # value PWM2 (0 to 99) #print "vJOG : value PWM2" update_motors = True elif key == 'fpga_0x0e': # direction PWM2 (0: forward) #print "vJOG : direction PWM2" update_motors = True if update_motors: motor_left_direction = 1.0 if int(shared_regs['fpga_0x0a']) & 1: motor_left_direction = -1.0 motor_left_ang_speed = shared_regs['fpga_0x08'] motor_left_ang_speed -= motor_left_dead_zone if motor_left_ang_speed < 0: motor_left_ang_speed = 0.0 if motor_left_ang_speed > motors_period_reg: motor_left_ang_speed = motors_period_reg motor_left_ang_speed *= (motors_alpha * motor_left_direction) motor_right_direction = 1.0 if int(shared_regs['fpga_0x0e']) & 1: motor_right_direction = -1.0 motor_right_ang_speed = shared_regs['fpga_0x0c'] motor_right_ang_speed -= motor_right_dead_zone if motor_right_ang_speed < 0: motor_right_ang_speed = 0.0 if motor_right_ang_speed > motors_period_reg: motor_right_ang_speed = motors_period_reg motor_right_ang_speed *= (motors_alpha * motor_right_direction) # Sonar started if key == "i2c_0x73_00": # sonarC (center) cmd if val == 81: sonar_set[2] = True sonar_time[2] = time.time() v = int(round(sonar_hits['beamsonarC'][1])) #print sonar_hits,v shared_regs['i2c_0x73_02'] = (v >> 8) & 0xff shared_regs['i2c_0x73_03'] = v & 0xff if key == "i2c_0x71_00": # sonarL (left) cmd if val == 81: sonar_set[0] = True sonar_time[0] = time.time() v = int(round(sonar_hits['beamsonarL'][1])) #print sonar_hits,v shared_regs['i2c_0x71_02'] = (v >> 8) & 0xff shared_regs['i2c_0x71_03'] = v & 0xff if key == "i2c_0x75_00": # sonarR (right) cmd if val == 81: sonar_set[4] = True sonar_time[0] = time.time() v = int(round(sonar_hits['beamsonarR'][1])) #print sonar_hits,v shared_regs['i2c_0x75_02'] = (v >> 8) & 0xff shared_regs['i2c_0x75_03'] = v & 0xff if sonar_set[2]: if (time.time() - sonar_time[2]) > 0.05: sonar_set[2] = False if sonar_set[0]: if (time.time() - sonar_time[0]) > 0.05: sonar_set[0] = False if sonar_set[4]: if (time.time() - sonar_time[4]) > 0.05: sonar_set[4] = False # update location (display in cm) thd = (90 - jog.head) * math.pi / 180.0 dxy = wheel_radius * (motor_left_ang_speed + motor_right_ang_speed) / 2.0 dx = dxy * math.cos(thd) * d_time dy = dxy * math.sin(thd) * d_time dthd = wheel_radius * (motor_left_ang_speed - motor_right_ang_speed) / wheel_dist dthd *= d_time xjog += (dx * 100.0) yjog -= (dy * 100.0) # check if robot locked stopped = jog.check_stopped(tobsply) # cannot move ... if stopped !! if stopped: #print t,"robot stopped cannot translate ",xjog, yjog, xjogBck, yjogBck xjog -= (dx * 100.0) yjog += (dy * 100.0) if xjog < 0: xjog = 0 if xjog > xmax: xjog = xmax if yjog < 0: yjog = 0 if yjog > xmax: yjog = xmax #rotate jog angrot = dthd * 180.0 / math.pi jog.rotate(angrot) # cannot rotate ... if stopped after rotation !! stopped = jog.check_stopped(tobsply) if stopped: angrot = -dthd * 180.0 / math.pi jog.rotate(angrot) #print "robot stopped cannot rotate ",jog.head #print "heading,rot, vx,vy ",jog.head,angrot,dx*100/d_time,dy*100/d_time #print "motor_left_ang_speed %f revols/s"%(motor_left_ang_speed/twopi) #print "motor_right_ang_speed %f revols/s"%(motor_right_ang_speed/twopi) #print "dmotorLeftAngle %f revol"%(d_time*motor_left_ang_speed/twopi) #print "dmotorRightAngle %f revol"%(d_time*motor_right_ang_speed/twopi) angular = abs(d_time * motor_left_ang_speed / twopi) odo_left_actual += (angular * n_ticks) angular = abs(d_time * motor_right_ang_speed / twopi) odo_right_actual += (angular * n_ticks) #print "odos",odo_left_actual,odo_right_actual keyor = 'fpga_0x20' # odometer 1 shared_regs[keyor] = int(odo_right_actual) & 65535 #print "vJOG : odo1",shared_regs[keyor],odo_right_actual keyol = 'fpga_0x22' # odometer 2 shared_regs[keyol] = int(odo_left_actual) & 65535 #print "vJOG : odo2",shared_regs[keyol],odo_left_actual # update IC2 compass jog.head = (jog.head % 360.0) shared_regs['i2c_0x60_01'] = int(round(jog.head * 256. / 360.0)) hdjog10 = int(round(jog.head * 10.0)) shared_regs['i2c_0x60_02'] = (hdjog10 >> 8) & 0xff shared_regs['i2c_0x60_03'] = hdjog10 & 0xff # translate JOG dxjogi = int(round(xjog - xjogi)) dyjogi = int(round(yjog - yjogi)) xjogi += dxjogi yjogi += dyjogi jog.translate(dxjogi, dyjogi) # display screen.fill((127, 127, 127)) for obs in tobs: obs.draw(screen, (100, 100, 255)) for pict in tpict: pict.draw(screen, (31, 255, 31)) # update sonars sonar_hits = jog.obstacle(tobsply) jog.draw(screen, leds, sonar_hits) # both looks similar #pygame.display.update() pygame.display.flip() #print __name__,": leds" , leds # first pass in simu loop completed -> end of init if not ns.endOfInit: ns.endOfInit = True t += d_time proc_time = time.time() - start_time dtrem = d_time - proc_time #print d_time,proc_time,dtrem if dtrem < 0: dtrem = 0.0 time.sleep(dtrem) print "simu stopped", t
# # The Python Imaging Library. # $Id$ # # JPEG (JFIF) file handling # # See "Digital Compression and Coding of Continous-Tone Still Images, # Part 1, Requirements and Guidelines" (CCITT T.81 / ISO 10918-1) # # History: # 1995-09-09 fl Created # 1995-09-13 fl Added full parser # 1996-03-25 fl Added hack to use the IJG command line utilities # 1996-05-05 fl Workaround Photoshop 2.5 CMYK polarity bug # 1996-05-28 fl Added draft support, JFIF version (0.1) # 1996-12-30 fl Added encoder options, added progression property (0.2) # 1997-08-27 fl Save mode 1 images as BW (0.3) # 1998-07-12 fl Added YCbCr to draft and save methods (0.4) # 1998-10-19 fl Don't hang on files using 16-bit DQT's (0.4.1) # 2001-04-16 fl Extract DPI settings from JFIF files (0.4.2) # 2002-07-01 fl Skip pad bytes before markers; identify Exif files (0.4.3) # 2003-04-25 fl Added experimental EXIF decoder (0.5) # 2003-06-06 fl Added experimental EXIF GPSinfo decoder # 2003-09-13 fl Extract COM markers # 2009-09-06 fl Added icc_profile support (from Florian Hoech) # 2009-03-06 fl Changed CMYK handling; always use Adobe polarity (0.6) # 2009-03-08 fl Added subsampling support (from Justin Huff). # # Copyright (c) 1997-2003 by Secret Labs AB. # Copyright (c) 1995-1996 by Fredrik Lundh. # # See the README file for information on usage and redistribution. # __version__ = "0.6" import array import struct import io from struct import unpack from PIL import Image, ImageFile, TiffImagePlugin, _binary from PIL.JpegPresets import presets from PIL._util import isStringType i8 = _binary.i8 o8 = _binary.o8 i16 = _binary.i16be i32 = _binary.i32be # # Parser def Skip(self, marker): n = i16(self.fp.read(2))-2 ImageFile._safe_read(self.fp, n) def APP(self, marker): # # Application marker. Store these in the APP dictionary. # Also look for well-known application markers. n = i16(self.fp.read(2))-2 s = ImageFile._safe_read(self.fp, n) app = "APP%d" % (marker & 15) self.app[app] = s # compatibility self.applist.append((app, s)) if marker == 0xFFE0 and s[:4] == b"JFIF": # extract JFIF information self.info["jfif"] = version = i16(s, 5) # version self.info["jfif_version"] = divmod(version, 256) # extract JFIF properties try: jfif_unit = i8(s[7]) jfif_density = i16(s, 8), i16(s, 10) except: pass else: if jfif_unit == 1: self.info["dpi"] = jfif_density self.info["jfif_unit"] = jfif_unit self.info["jfif_density"] = jfif_density elif marker == 0xFFE1 and s[:5] == b"Exif\0": # extract Exif information (incomplete) self.info["exif"] = s # FIXME: value will change elif marker == 0xFFE2 and s[:5] == b"FPXR\0": # extract FlashPix information (incomplete) self.info["flashpix"] = s # FIXME: value will change elif marker == 0xFFE2 and s[:12] == b"ICC_PROFILE\0": # Since an ICC profile can be larger than the maximum size of # a JPEG marker (64K), we need provisions to split it into # multiple markers. The format defined by the ICC specifies # one or more APP2 markers containing the following data: # Identifying string ASCII "ICC_PROFILE\0" (12 bytes) # Marker sequence number 1, 2, etc (1 byte) # Number of markers Total of APP2's used (1 byte) # Profile data (remainder of APP2 data) # Decoders should use the marker sequence numbers to # reassemble the profile, rather than assuming that the APP2 # markers appear in the correct sequence. self.icclist.append(s) elif marker == 0xFFEE and s[:5] == b"Adobe": self.info["adobe"] = i16(s, 5) # extract Adobe custom properties try: adobe_transform = i8(s[1]) except: pass else: self.info["adobe_transform"] = adobe_transform elif marker == 0xFFE2 and s[:4] == b"MPF\0": # extract MPO information self.info["mp"] = s[4:] # offset is current location minus buffer size # plus constant header size self.info["mpoffset"] = self.fp.tell() - n + 4 def COM(self, marker): # # Comment marker. Store these in the APP dictionary. n = i16(self.fp.read(2))-2 s = ImageFile._safe_read(self.fp, n) self.app["COM"] = s # compatibility self.applist.append(("COM", s)) def SOF(self, marker): # # Start of frame marker. Defines the size and mode of the # image. JPEG is colour blind, so we use some simple # heuristics to map the number of layers to an appropriate # mode. Note that this could be made a bit brighter, by # looking for JFIF and Adobe APP markers. n = i16(self.fp.read(2))-2 s = ImageFile._safe_read(self.fp, n) self.size = i16(s[3:]), i16(s[1:]) self.bits = i8(s[0]) if self.bits != 8: raise SyntaxError("cannot handle %d-bit layers" % self.bits) self.layers = i8(s[5]) if self.layers == 1: self.mode = "L" elif self.layers == 3: self.mode = "RGB" elif self.layers == 4: self.mode = "CMYK" else: raise SyntaxError("cannot handle %d-layer images" % self.layers) if marker in [0xFFC2, 0xFFC6, 0xFFCA, 0xFFCE]: self.info["progressive"] = self.info["progression"] = 1 if self.icclist: # fixup icc profile self.icclist.sort() # sort by sequence number if i8(self.icclist[0][13]) == len(self.icclist): profile = [] for p in self.icclist: profile.append(p[14:]) icc_profile = b"".join(profile) else: icc_profile = None # wrong number of fragments self.info["icc_profile"] = icc_profile self.icclist = None for i in range(6, len(s), 3): t = s[i:i+3] # 4-tuples: id, vsamp, hsamp, qtable self.layer.append((t[0], i8(t[1])//16, i8(t[1]) & 15, i8(t[2]))) def DQT(self, marker): # # Define quantization table. Support baseline 8-bit tables # only. Note that there might be more than one table in # each marker. # FIXME: The quantization tables can be used to estimate the # compression quality. n = i16(self.fp.read(2))-2 s = ImageFile._safe_read(self.fp, n) while len(s): if len(s) < 65: raise SyntaxError("bad quantization table marker") v = i8(s[0]) if v//16 == 0: self.quantization[v & 15] = array.array("b", s[1:65]) s = s[65:] else: return # FIXME: add code to read 16-bit tables! # raise SyntaxError, "bad quantization table element size" # # JPEG marker table MARKER = { 0xFFC0: ("SOF0", "Baseline DCT", SOF), 0xFFC1: ("SOF1", "Extended Sequential DCT", SOF), 0xFFC2: ("SOF2", "Progressive DCT", SOF), 0xFFC3: ("SOF3", "Spatial lossless", SOF), 0xFFC4: ("DHT", "Define Huffman table", Skip), 0xFFC5: ("SOF5", "Differential sequential DCT", SOF), 0xFFC6: ("SOF6", "Differential progressive DCT", SOF), 0xFFC7: ("SOF7", "Differential spatial", SOF), 0xFFC8: ("JPG", "Extension", None), 0xFFC9: ("SOF9", "Extended sequential DCT (AC)", SOF), 0xFFCA: ("SOF10", "Progressive DCT (AC)", SOF), 0xFFCB: ("SOF11", "Spatial lossless DCT (AC)", SOF), 0xFFCC: ("DAC", "Define arithmetic coding conditioning", Skip), 0xFFCD: ("SOF13", "Differential sequential DCT (AC)", SOF), 0xFFCE: ("SOF14", "Differential progressive DCT (AC)", SOF), 0xFFCF: ("SOF15", "Differential spatial (AC)", SOF), 0xFFD0: ("RST0", "Restart 0", None), 0xFFD1: ("RST1", "Restart 1", None), 0xFFD2: ("RST2", "Restart 2", None), 0xFFD3: ("RST3", "Restart 3", None), 0xFFD4: ("RST4", "Restart 4", None), 0xFFD5: ("RST5", "Restart 5", None), 0xFFD6: ("RST6", "Restart 6", None), 0xFFD7: ("RST7", "Restart 7", None), 0xFFD8: ("SOI", "Start of image", None), 0xFFD9: ("EOI", "End of image", None), 0xFFDA: ("SOS", "Start of scan", Skip), 0xFFDB: ("DQT", "Define quantization table", DQT), 0xFFDC: ("DNL", "Define number of lines", Skip), 0xFFDD: ("DRI", "Define restart interval", Skip), 0xFFDE: ("DHP", "Define hierarchical progression", SOF), 0xFFDF: ("EXP", "Expand reference component", Skip), 0xFFE0: ("APP0", "Application segment 0", APP), 0xFFE1: ("APP1", "Application segment 1", APP), 0xFFE2: ("APP2", "Application segment 2", APP), 0xFFE3: ("APP3", "Application segment 3", APP), 0xFFE4: ("APP4", "Application segment 4", APP), 0xFFE5: ("APP5", "Application segment 5", APP), 0xFFE6: ("APP6", "Application segment 6", APP), 0xFFE7: ("APP7", "Application segment 7", APP), 0xFFE8: ("APP8", "Application segment 8", APP), 0xFFE9: ("APP9", "Application segment 9", APP), 0xFFEA: ("APP10", "Application segment 10", APP), 0xFFEB: ("APP11", "Application segment 11", APP), 0xFFEC: ("APP12", "Application segment 12", APP), 0xFFED: ("APP13", "Application segment 13", APP), 0xFFEE: ("APP14", "Application segment 14", APP), 0xFFEF: ("APP15", "Application segment 15", APP), 0xFFF0: ("JPG0", "Extension 0", None), 0xFFF1: ("JPG1", "Extension 1", None), 0xFFF2: ("JPG2", "Extension 2", None), 0xFFF3: ("JPG3", "Extension 3", None), 0xFFF4: ("JPG4", "Extension 4", None), 0xFFF5: ("JPG5", "Extension 5", None), 0xFFF6: ("JPG6", "Extension 6", None), 0xFFF7: ("JPG7", "Extension 7", None), 0xFFF8: ("JPG8", "Extension 8", None), 0xFFF9: ("JPG9", "Extension 9", None), 0xFFFA: ("JPG10", "Extension 10", None), 0xFFFB: ("JPG11", "Extension 11", None), 0xFFFC: ("JPG12", "Extension 12", None), 0xFFFD: ("JPG13", "Extension 13", None), 0xFFFE: ("COM", "Comment", COM) } def _accept(prefix): return prefix[0:1] == b"\377" ## # Image plugin for JPEG and JFIF images. class JpegImageFile(ImageFile.ImageFile): format = "JPEG" format_description = "JPEG (ISO 10918)" def _open(self): s = self.fp.read(1) if i8(s[0]) != 255: raise SyntaxError("not a JPEG file") # Create attributes self.bits = self.layers = 0 # JPEG specifics (internal) self.layer = [] self.huffman_dc = {} self.huffman_ac = {} self.quantization = {} self.app = {} # compatibility self.applist = [] self.icclist = [] while True: i = i8(s) if i == 0xFF: s = s + self.fp.read(1) i = i16(s) else: # Skip non-0xFF junk s = b"\xff" continue if i in MARKER: name, description, handler = MARKER[i] # print hex(i), name, description if handler is not None: handler(self, i) if i == 0xFFDA: # start of scan rawmode = self.mode if self.mode == "CMYK": rawmode = "CMYK;I" # assume adobe conventions self.tile = [("jpeg", (0, 0) + self.size, 0, (rawmode, ""))] # self.__offset = self.fp.tell() break s = self.fp.read(1) elif i == 0 or i == 0xFFFF: # padded marker or junk; move on s = b"\xff" else: raise SyntaxError("no marker found") def draft(self, mode, size): if len(self.tile) != 1: return d, e, o, a = self.tile[0] scale = 0 if a[0] == "RGB" and mode in ["L", "YCbCr"]: self.mode = mode a = mode, "" if size: scale = max(self.size[0] // size[0], self.size[1] // size[1]) for s in [8, 4, 2, 1]: if scale >= s: break e = e[0], e[1], (e[2]-e[0]+s-1)//s+e[0], (e[3]-e[1]+s-1)//s+e[1] self.size = ((self.size[0]+s-1)//s, (self.size[1]+s-1)//s) scale = s self.tile = [(d, e, o, a)] self.decoderconfig = (scale, 0) return self def load_djpeg(self): # ALTERNATIVE: handle JPEGs via the IJG command line utilities import subprocess import tempfile import os f, path = tempfile.mkstemp() os.close(f) if os.path.exists(self.filename): subprocess.check_call(["djpeg", "-outfile", path, self.filename]) else: raise ValueError("Invalid Filename") try: self.im = Image.core.open_ppm(path) finally: try: os.unlink(path) except: pass self.mode = self.im.mode self.size = self.im.size self.tile = [] def _getexif(self): return _getexif(self) def _getmp(self): return _getmp(self) def _fixup(value): # Helper function for _getexif() and _getmp() if len(value) == 1: return value[0] return value def _getexif(self): # Extract EXIF information. This method is highly experimental, # and is likely to be replaced with something better in a future # version. # The EXIF record consists of a TIFF file embedded in a JPEG # application marker (!). try: data = self.info["exif"] except KeyError: return None file = io.BytesIO(data[6:]) head = file.read(8) exif = {} # process dictionary info = TiffImagePlugin.ImageFileDirectory(head) info.load(file) for key, value in info.items(): exif[key] = _fixup(value) # get exif extension try: file.seek(exif[0x8769]) except KeyError: pass else: info = TiffImagePlugin.ImageFileDirectory(head) info.load(file) for key, value in info.items(): exif[key] = _fixup(value) # get gpsinfo extension try: file.seek(exif[0x8825]) except KeyError: pass else: info = TiffImagePlugin.ImageFileDirectory(head) info.load(file) exif[0x8825] = gps = {} for key, value in info.items(): gps[key] = _fixup(value) return exif def _getmp(self): # Extract MP information. This method was inspired by the "highly # experimental" _getexif version that's been in use for years now, # itself based on the ImageFileDirectory class in the TIFF plug-in. # The MP record essentially consists of a TIFF file embedded in a JPEG # application marker. try: data = self.info["mp"] except KeyError: return None file = io.BytesIO(data) head = file.read(8) endianness = '>' if head[:4] == b'\x4d\x4d\x00\x2a' else '<' mp = {} # process dictionary info = TiffImagePlugin.ImageFileDirectory(head) info.load(file) for key, value in info.items(): mp[key] = _fixup(value) # it's an error not to have a number of images try: quant = mp[0xB001] except KeyError: raise SyntaxError("malformed MP Index (no number of images)") # get MP entries try: mpentries = [] for entrynum in range(0, quant): rawmpentry = mp[0xB002][entrynum * 16:(entrynum + 1) * 16] unpackedentry = unpack('{0}LLLHH'.format(endianness), rawmpentry) labels = ('Attribute', 'Size', 'DataOffset', 'EntryNo1', 'EntryNo2') mpentry = dict(zip(labels, unpackedentry)) mpentryattr = { 'DependentParentImageFlag': bool(mpentry['Attribute'] & (1 << 31)), 'DependentChildImageFlag': bool(mpentry['Attribute'] & (1 << 30)), 'RepresentativeImageFlag': bool(mpentry['Attribute'] & (1 << 29)), 'Reserved': (mpentry['Attribute'] & (3 << 27)) >> 27, 'ImageDataFormat': (mpentry['Attribute'] & (7 << 24)) >> 24, 'MPType': mpentry['Attribute'] & 0x00FFFFFF } if mpentryattr['ImageDataFormat'] == 0: mpentryattr['ImageDataFormat'] = 'JPEG' else: raise SyntaxError("unsupported picture format in MPO") mptypemap = { 0x000000: 'Undefined', 0x010001: 'Large Thumbnail (VGA Equivalent)', 0x010002: 'Large Thumbnail (Full HD Equivalent)', 0x020001: 'Multi-Frame Image (Panorama)', 0x020002: 'Multi-Frame Image: (Disparity)', 0x020003: 'Multi-Frame Image: (Multi-Angle)', 0x030000: 'Baseline MP Primary Image' } mpentryattr['MPType'] = mptypemap.get(mpentryattr['MPType'], 'Unknown') mpentry['Attribute'] = mpentryattr mpentries.append(mpentry) mp[0xB002] = mpentries except KeyError: raise SyntaxError("malformed MP Index (bad MP Entry)") # Next we should try and parse the individual image unique ID list; # we don't because I've never seen this actually used in a real MPO # file and so can't test it. return mp # -------------------------------------------------------------------- # stuff to save JPEG files RAWMODE = { "1": "L", "L": "L", "RGB": "RGB", "RGBA": "RGB", "RGBX": "RGB", "CMYK": "CMYK;I", # assume adobe conventions "YCbCr": "YCbCr", } zigzag_index = ( 0, 1, 5, 6, 14, 15, 27, 28, 2, 4, 7, 13, 16, 26, 29, 42, 3, 8, 12, 17, 25, 30, 41, 43, 9, 11, 18, 24, 31, 40, 44, 53, 10, 19, 23, 32, 39, 45, 52, 54, 20, 22, 33, 38, 46, 51, 55, 60, 21, 34, 37, 47, 50, 56, 59, 61, 35, 36, 48, 49, 57, 58, 62, 63) samplings = {(1, 1, 1, 1, 1, 1): 0, (2, 1, 1, 1, 1, 1): 1, (2, 2, 1, 1, 1, 1): 2, } def convert_dict_qtables(qtables): qtables = [qtables[key] for key in range(len(qtables)) if key in qtables] for idx, table in enumerate(qtables): qtables[idx] = [table[i] for i in zigzag_index] return qtables def get_sampling(im): # There's no subsampling when image have only 1 layer # (grayscale images) or when they are CMYK (4 layers), # so set subsampling to default value. # # NOTE: currently Pillow can't encode JPEG to YCCK format. # If YCCK support is added in the future, subsampling code will have # to be updated (here and in JpegEncode.c) to deal with 4 layers. if not hasattr(im, 'layers') or im.layers in (1, 4): return -1 sampling = im.layer[0][1:3] + im.layer[1][1:3] + im.layer[2][1:3] return samplings.get(sampling, -1) def _save(im, fp, filename): try: rawmode = RAWMODE[im.mode] except KeyError: raise IOError("cannot write mode %s as JPEG" % im.mode) info = im.encoderinfo dpi = info.get("dpi", (0, 0)) quality = info.get("quality", 0) subsampling = info.get("subsampling", -1) qtables = info.get("qtables") if quality == "keep": quality = 0 subsampling = "keep" qtables = "keep" elif quality in presets: preset = presets[quality] quality = 0 subsampling = preset.get('subsampling', -1) qtables = preset.get('quantization') elif not isinstance(quality, int): raise ValueError("Invalid quality setting") else: if subsampling in presets: subsampling = presets[subsampling].get('subsampling', -1) if isStringType(qtables) and qtables in presets: qtables = presets[qtables].get('quantization') if subsampling == "4:4:4": subsampling = 0 elif subsampling == "4:2:2": subsampling = 1 elif subsampling == "4:1:1": subsampling = 2 elif subsampling == "keep": if im.format != "JPEG": raise ValueError( "Cannot use 'keep' when original image is not a JPEG") subsampling = get_sampling(im) def validate_qtables(qtables): if qtables is None: return qtables if isStringType(qtables): try: lines = [int(num) for line in qtables.splitlines() for num in line.split('#', 1)[0].split()] except ValueError: raise ValueError("Invalid quantization table") else: qtables = [lines[s:s+64] for s in range(0, len(lines), 64)] if isinstance(qtables, (tuple, list, dict)): if isinstance(qtables, dict): qtables = convert_dict_qtables(qtables) elif isinstance(qtables, tuple): qtables = list(qtables) if not (0 < len(qtables) < 5): raise ValueError("None or too many quantization tables") for idx, table in enumerate(qtables): try: if len(table) != 64: raise table = array.array('b', table) except TypeError: raise ValueError("Invalid quantization table") else: qtables[idx] = list(table) return qtables if qtables == "keep": if im.format != "JPEG": raise ValueError( "Cannot use 'keep' when original image is not a JPEG") qtables = getattr(im, "quantization", None) qtables = validate_qtables(qtables) extra = b"" icc_profile = info.get("icc_profile") if icc_profile: ICC_OVERHEAD_LEN = 14 MAX_BYTES_IN_MARKER = 65533 MAX_DATA_BYTES_IN_MARKER = MAX_BYTES_IN_MARKER - ICC_OVERHEAD_LEN markers = [] while icc_profile: markers.append(icc_profile[:MAX_DATA_BYTES_IN_MARKER]) icc_profile = icc_profile[MAX_DATA_BYTES_IN_MARKER:] i = 1 for marker in markers: size = struct.pack(">H", 2 + ICC_OVERHEAD_LEN + len(marker)) extra += (b"\xFF\xE2" + size + b"ICC_PROFILE\0" + o8(i) + o8(len(markers)) + marker) i += 1 # get keyword arguments im.encoderconfig = ( quality, # "progressive" is the official name, but older documentation # says "progression" # FIXME: issue a warning if the wrong form is used (post-1.1.7) "progressive" in info or "progression" in info, info.get("smooth", 0), "optimize" in info, info.get("streamtype", 0), dpi[0], dpi[1], subsampling, qtables, extra, info.get("exif", b"") ) # if we optimize, libjpeg needs a buffer big enough to hold the whole image # in a shot. Guessing on the size, at im.size bytes. (raw pizel size is # channels*size, this is a value that's been used in a django patch. # https://github.com/jdriscoll/django-imagekit/issues/50 bufsize = 0 if "optimize" in info or "progressive" in info or "progression" in info: # keep sets quality to 0, but the actual value may be high. if quality >= 95 or quality == 0: bufsize = 2 * im.size[0] * im.size[1] else: bufsize = im.size[0] * im.size[1] # The exif info needs to be written as one block, + APP1, + one spare byte. # Ensure that our buffer is big enough bufsize = max(ImageFile.MAXBLOCK, bufsize, len(info.get("exif", b"")) + 5) ImageFile._save(im, fp, [("jpeg", (0, 0)+im.size, 0, rawmode)], bufsize) def _save_cjpeg(im, fp, filename): # ALTERNATIVE: handle JPEGs via the IJG command line utilities. import os import subprocess tempfile = im._dump() subprocess.check_call(["cjpeg", "-outfile", filename, tempfile]) try: os.unlink(file) except: pass ## # Factory for making JPEG and MPO instances def jpeg_factory(fp=None, filename=None): im = JpegImageFile(fp, filename) mpheader = im._getmp() try: if mpheader[45057] > 1: # It's actually an MPO from .MpoImagePlugin import MpoImageFile im = MpoImageFile(fp, filename) except (TypeError, IndexError): # It is really a JPEG pass return im # -------------------------------------------------------------------q- # Registry stuff Image.register_open("JPEG", jpeg_factory, _accept) Image.register_save("JPEG", _save) Image.register_extension("JPEG", ".jfif") Image.register_extension("JPEG", ".jpe") Image.register_extension("JPEG", ".jpg") Image.register_extension("JPEG", ".jpeg") Image.register_mime("JPEG", "image/jpeg")
# Licensed to the Apache Software Foundation (ASF) under one # or more contributor license agreements. See the NOTICE file # distributed with this work for additional information # regarding copyright ownership. The ASF licenses this file # to you under the Apache License, Version 2.0 (the # "License"); you may not use this file except in compliance # with the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the License for the # specific language governing permissions and limitations # under the License. import shutil import subprocess import tempfile import urllib from distutils.dir_util import copy_tree from threading import current_thread import os import time from config import Config from exception import GitRepositorySynchronizationException from git import * from ...util.asyncscheduledtask import AbstractAsyncScheduledTask, ScheduledExecutor from ...util.log import LogFactory class AgentGitHandler: """ Handles all the git artifact management tasks related to a cartridge """ def __init__(self): pass log = LogFactory().get_log(__name__) __git_repositories = {} # (tenant_id => GitRepository) @staticmethod def sync_initial_local_artifacts(git_repo): # init git repo AgentGitHandler.init(git_repo.local_repo_path) # add remote repos return AgentGitHandler.add_remote(git_repo) @staticmethod def add_remote(git_repo): # add origin remote output, errors = AgentGitHandler.execute_git_command(["remote", "add", "origin", git_repo.repo_url], git_repo.local_repo_path) if len(output) > 0: raise GitRepositorySynchronizationException("Error in adding remote origin %s for local repository %s" % (git_repo.repo_url, git_repo.local_repo_path)) # fetch output, errors = AgentGitHandler.execute_git_command(["fetch"], git_repo.local_repo_path) if "Resolving deltas: 100%" not in output: raise GitRepositorySynchronizationException( "Error in fetching from remote origin %s for local repository %s" % (git_repo.repo_url, git_repo.local_repo_path)) # checkout master output, errors = AgentGitHandler.execute_git_command(["checkout", "master"], git_repo.local_repo_path) if "Branch master set up to track remote branch master from origin." not in output: raise GitRepositorySynchronizationException("Error in checking out master branch %s for local repository %s" % (git_repo.repo_url, git_repo.local_repo_path)) return True @staticmethod def init(path): output, errors = AgentGitHandler.execute_git_command(["init"], path) if "Initialized empty Git repository in" not in output: AgentGitHandler.log.exception("Initializing local repo at %s failed: %s" % (path, output)) raise Exception("Initializing local repo at %s failed" % path) @staticmethod def is_valid_git_repository(git_repo): output, errors = AgentGitHandler.execute_git_command(["show-ref"], git_repo.local_repo_path) if len(output) > 0: refs = output.split("\n") for ref in refs: ref = ref.strip() if len(ref) > 0: ref = ref.split(" ") try: AgentGitHandler.execute_git_command(["show", ref[0].strip()], git_repo.local_repo_path) except RuntimeError: return False return True else: return False @staticmethod def pull(git_repo): # check if modified files are present modified = AgentGitHandler.has_modified_files(git_repo.local_repo_path) if modified: if Config.is_commits_enabled: AgentGitHandler.log.debug( "Un-staged files exist in working directory. Aborting git pull for this iteration...") return else: AgentGitHandler.log.warn("Changes detected in working directory but COMMIT_ENABLED is set to false!") AgentGitHandler.log.warn("Attempting to reset the working directory") AgentGitHandler.execute_git_command(["reset"], repo_path=git_repo.local_repo_path) # HEAD before pull (init_head, init_errors) = AgentGitHandler.execute_git_command(["rev-parse", "HEAD"], git_repo.local_repo_path) repo = Repo(git_repo.local_repo_path) AgentGitHandler.execute_git_command(["pull", "--rebase", "origin", git_repo.branch], git_repo.local_repo_path) AgentGitHandler.log.debug("Git pull rebase executed in checkout job") if repo.is_dirty(): AgentGitHandler.log.error("Git pull operation in checkout job left the repository in dirty state") AgentGitHandler.log.error( "Git pull operation on remote %s for tenant %s failed" % (git_repo.repo_url, git_repo.tenant_id)) # HEAD after pull (end_head, end_errors) = AgentGitHandler.execute_git_command(["rev-parse", "HEAD"], git_repo.local_repo_path) # check if HEAD was updated if init_head != end_head: AgentGitHandler.log.debug("Artifacts were updated as a result of the pull operation, thread: %s - %s" % (current_thread().getName(), current_thread().ident)) return True else: return False @staticmethod def clone(git_repo): try: # create a temporary location to clone temp_repo_path = os.path.join(tempfile.gettempdir(), "pca_temp_" + git_repo.tenant_id) if os.path.isdir(temp_repo_path) and os.listdir(temp_repo_path) != []: GitUtils.delete_folder_tree(temp_repo_path) GitUtils.create_dir(temp_repo_path) # clone the repo to a temporary location first to avoid conflicts AgentGitHandler.log.debug( "Cloning artifacts from URL: %s to temp location: %s" % (git_repo.repo_url, temp_repo_path)) Repo.clone_from(git_repo.auth_url, temp_repo_path, branch=git_repo.branch) # move the cloned dir to application path copy_tree(temp_repo_path, git_repo.local_repo_path) AgentGitHandler.log.info("Git clone operation for tenant %s successful" % git_repo.tenant_id) return git_repo except GitCommandError as e: raise GitRepositorySynchronizationException("Error while cloning repository for tenant %s: %s" % ( git_repo.tenant_id, e)) # @staticmethod # def checkout_remote_branch(git_repo): # try: # # create a temporary location to clone # temp_repo_path = os.path.join(tempfile.gettempdir(), "pca_temp_" + git_repo.tenant_id) # if os.path.isdir(temp_repo_path) and os.listdir(temp_repo_path) != []: # GitUtils.delete_folder_tree(temp_repo_path) # GitUtils.create_dir(temp_repo_path) # # # clone the repo to a temporary location first to avoid conflicts # AgentGitHandler.log.debug( # "Cloning artifacts from URL: %s to temp location: %s" % (git_repo.repo_url, temp_repo_path)) # Repo.clone_from(git_repo.auth_url, temp_repo_path) # # local_repo = Repo.init(temp_repo_path) # origin = local_repo.create_remote('origin', local_repo.auth_url) # assert origin.exists() # # branch name = "tenant_<tenant_id>" # origin.fetch("+refs/heads/" + git_repo.branch + ":refs/remotes/origin/" + git_repo.branch) # AgentGitHandler.execute_git_command(["checkout", git_repo.branch], temp_repo_path) # # # move the cloned dir to application path # copy_tree(temp_repo_path, git_repo.local_repo_path) # AgentGitHandler.log.info("Git clone operation for tenant %s successful" % git_repo.tenant_id) # return git_repo # except GitCommandError as e: # raise GitRepositorySynchronizationException("Error while cloning repository for tenant %s: %s" % ( # git_repo.tenant_id, e)) @staticmethod def retry_clone(git_repo): """Retry 'git clone' operation for defined number of attempts with defined intervals """ git_clone_successful = False # Read properties from agent.conf max_retry_attempts = int(Config.artifact_clone_retry_count) retry_interval = int(Config.artifact_clone_retry_interval) retry_attempts = 0 # Iterate until git clone is successful or reaches max retry attempts while git_clone_successful is False and retry_attempts < max_retry_attempts: try: retry_attempts += 1 AgentGitHandler.clone(git_repo) AgentGitHandler.log.info( "Retrying attempt to git clone operation for tenant %s successful" % git_repo.tenant_id) git_clone_successful = True except GitRepositorySynchronizationException as e: AgentGitHandler.log.exception("Retrying git clone attempt %s failed: %s" % (retry_attempts, e)) if retry_attempts < max_retry_attempts: time.sleep(retry_interval) else: raise GitRepositorySynchronizationException("All attempts failed while retrying git clone: %s" % e) @staticmethod def add_repo(git_repo): AgentGitHandler.__git_repositories[git_repo.tenant_id] = git_repo @staticmethod def get_repo(tenant_id): """ :param int tenant_id: :return: GitRepository object :rtype: GitRepository """ tenant_id = str(tenant_id) if tenant_id in AgentGitHandler.__git_repositories: return AgentGitHandler.__git_repositories[tenant_id] return None @staticmethod def clear_repo(tenant_id): if tenant_id in AgentGitHandler.__git_repositories: del AgentGitHandler.__git_repositories[tenant_id] @staticmethod def create_git_repo(repo_info, branch=None): git_repo = GitRepository() git_repo.tenant_id = repo_info.tenant_id git_repo.local_repo_path = repo_info.repo_path git_repo.repo_url = repo_info.repo_url git_repo.auth_url = AgentGitHandler.create_auth_url(repo_info) git_repo.repo_username = repo_info.repo_username git_repo.repo_password = repo_info.repo_password git_repo.commit_enabled = repo_info.commit_enabled if branch: git_repo.branch = branch else: git_repo.branch = 'master' git_repo.cloned = False return git_repo @staticmethod def create_auth_url(repo_info): # Accepted repo url formats # "https://host.com/path/to/repo.git" # "https://username@host.org/path/to/repo.git" # "https://username:password@host.org/path/to/repo.git" NOT RECOMMENDED # IMPORTANT: if the credentials are provided in the repo url, they must be url encoded if repo_info.repo_username is not None or repo_info.repo_password is not None: # credentials provided, have to modify url repo_url = repo_info.repo_url url_split = repo_url.split("://", 1) # urlencode repo username and password urlencoded_username = urllib.quote(repo_info.repo_username.strip(), safe='') urlencoded_password = urllib.quote(repo_info.repo_password.strip(), safe='') if "@" in url_split[1]: # credentials seem to be in the url, check at_split = url_split[1].split("@", 1) if ":" in at_split[0]: # both username and password are in the url, return as is return repo_info.repo_url else: # only username is provided, need to include password username_in_url = at_split[0].split(":", 1)[0] return str(url_split[0] + "://" + username_in_url + ":" + urlencoded_password + "@" + at_split[1]) else: # no credentials in the url, need to include username and password return str(url_split[0] + "://" + urlencoded_username + ":" + urlencoded_password + "@" + url_split[1]) # no credentials specified, return as is return repo_info.repo_url @staticmethod def has_modified_files(repo_path): (output, errors) = AgentGitHandler.execute_git_command(["status"], repo_path=repo_path) if "nothing to commit" in output: return False else: return True @staticmethod def stage_all(repo_path): (output, errors) = AgentGitHandler.execute_git_command(["add", "--all"], repo_path=repo_path) return True if errors.strip() == "" else False @staticmethod def find_between(s, first, last): try: start = s.index(first) + len(first) end = s.index(last, start) return s[start:end] except ValueError: return "" @staticmethod def schedule_artifact_update_task(repo_info, auto_checkout, auto_commit, update_interval): git_repo = AgentGitHandler.get_repo(repo_info.tenant_id) if git_repo is None: AgentGitHandler.log.error("Unable to schedule artifact sync task, repositoryContext null for tenant %s" % repo_info.tenant_id) return if git_repo.scheduled_update_task is None: AgentGitHandler.log.info( "ADC configuration: [auto-commit] %s, [auto-checkout] %s, [interval] %s", auto_commit, auto_checkout, update_interval) artifact_update_task = ArtifactUpdateTask(repo_info, auto_checkout, auto_commit) async_task = ScheduledExecutor(update_interval, artifact_update_task) AgentGitHandler.log.info("Starting a Scheduled Executor thread for Git polling task") git_repo.scheduled_update_task = async_task async_task.start() AgentGitHandler.log.info("Scheduled artifact synchronization task for path %s" % git_repo.local_repo_path) else: AgentGitHandler.log.debug("Artifact synchronization task for path %s already scheduled" % git_repo.local_repo_path) @staticmethod def remove_repo(tenant_id): git_repo = AgentGitHandler.get_repo(tenant_id) # stop artifact update task git_repo.scheduled_update_task.terminate() # remove git contents try: GitUtils.delete_folder_tree(git_repo.local_repo_path) except GitRepositorySynchronizationException as e: AgentGitHandler.log.exception( "Could not remove repository folder for tenant:%s %s" % (git_repo.tenant_id, e)) AgentGitHandler.clear_repo(tenant_id) AgentGitHandler.log.info("Git repository deleted for tenant %s" % git_repo.tenant_id) return True @staticmethod def execute_git_command(command, repo_path): """ Executes the given command string with given environment parameters :param list command: Command with arguments to be executed :param str repo_path: Repository path to run the command on :return: output and error string tuple, RuntimeError if errors occur :rtype: tuple(str, str) :exception: RuntimeError """ os_env = os.environ.copy() command.insert(0, "/usr/bin/git") AgentGitHandler.log.debug("Executing Git command: %s" % command) p = subprocess.Popen(command, stdout=subprocess.PIPE, stderr=subprocess.PIPE, env=os_env, cwd=repo_path) (output, errors) = p.communicate() AgentGitHandler.log.debug("Git command [output] %s" % str(output)) AgentGitHandler.log.debug("Git command [errors] %s" % str(errors)) return output, errors class ArtifactUpdateTask(AbstractAsyncScheduledTask): """ Checks if the auto-checkout and autocommit are enabled and executes respective tasks """ def __init__(self, repo_info, auto_checkout, auto_commit): self.log = LogFactory().get_log(__name__) self.repo_info = repo_info self.auto_checkout = auto_checkout self.auto_commit = auto_commit def execute_task(self): # DO NOT change this order. The commit job should run first here. # This is because if the cloned location contain any un-tracked files then # those files should be committed and pushed first if self.auto_commit: try: self.log.debug("Running commit job...") Config.artifact_commit_plugin.plugin_object.commit(self.repo_info) except GitRepositorySynchronizationException as e: self.log.exception("Auto commit failed: %s" % e) if self.auto_checkout: try: self.log.debug("Running checkout job...") Config.artifact_checkout_plugin.plugin_object.checkout(self.repo_info) except GitRepositorySynchronizationException as e: self.log.exception("Auto checkout task failed: %s" % e) self.log.debug("ArtifactUpdateTask end of iteration.") class GitRepository: """ Represents a git repository inside a particular instance """ def __init__(self): self.repo_url = None """ :type : str """ self.auth_url = None """ :type : str """ self.local_repo_path = None """ :type : str """ self.cloned = False """ :type : bool """ self.tenant_id = None """ :type : int """ self.repo_username = None """ :type : str """ self.repo_password = None """ :type : str """ """ :type : bool """ self.commit_enabled = False """ :type : bool """ self.scheduled_update_task = None """:type : ScheduledExecutor """ self.branch = None """ :type : str """ class GitUtils: """ Util methods required by the AgentGitHandler """ def __init__(self): pass log = LogFactory().get_log(__name__) @staticmethod def create_dir(path): """ mkdir the provided path :param path: The path to the directory to be made :return: True if mkdir was successful, False if dir already exists :rtype: bool """ try: os.mkdir(path) GitUtils.log.debug("Successfully created directory [%s]" % path) # return True except OSError as e: raise GitRepositorySynchronizationException("Directory creating failed in [%s]. " % e) # return False @staticmethod def delete_folder_tree(path): """ Completely deletes the provided folder :param str path: Full path of the folder :return: void """ try: shutil.rmtree(path) GitUtils.log.debug("Directory [%s] deleted." % path) except OSError as e: raise GitRepositorySynchronizationException("Deletion of folder path %s failed: %s" % (path, e))
import inspect import os from importlib import import_module from django.apps import apps from django.conf import settings from django.contrib import admin from django.contrib.admin.views.decorators import staff_member_required from django.contrib.admindocs import utils from django.contrib.admindocs.utils import ( replace_named_groups, replace_unnamed_groups, ) from django.core.exceptions import ImproperlyConfigured, ViewDoesNotExist from django.db import models from django.http import Http404 from django.template.engine import Engine from django.urls import get_mod_func, get_resolver, get_urlconf, reverse from django.utils.decorators import method_decorator from django.utils.inspect import ( func_accepts_kwargs, func_accepts_var_args, func_has_no_args, get_func_full_args, ) from django.utils.translation import gettext as _ from django.views.generic import TemplateView # Exclude methods starting with these strings from documentation MODEL_METHODS_EXCLUDE = ('_', 'add_', 'delete', 'save', 'set_') class BaseAdminDocsView(TemplateView): """ Base view for admindocs views. """ @method_decorator(staff_member_required) def dispatch(self, request, *args, **kwargs): if not utils.docutils_is_available: # Display an error message for people without docutils self.template_name = 'admin_doc/missing_docutils.html' return self.render_to_response(admin.site.each_context(request)) return super().dispatch(request, *args, **kwargs) def get_context_data(self, **kwargs): kwargs.update({'root_path': reverse('admin:index')}) kwargs.update(admin.site.each_context(self.request)) return super().get_context_data(**kwargs) class BookmarkletsView(BaseAdminDocsView): template_name = 'admin_doc/bookmarklets.html' def get_context_data(self, **kwargs): context = super().get_context_data(**kwargs) context.update({ 'admin_url': "%s://%s%s" % ( self.request.scheme, self.request.get_host(), context['root_path']) }) return context class TemplateTagIndexView(BaseAdminDocsView): template_name = 'admin_doc/template_tag_index.html' def get_context_data(self, **kwargs): tags = [] try: engine = Engine.get_default() except ImproperlyConfigured: # Non-trivial TEMPLATES settings aren't supported (#24125). pass else: app_libs = sorted(engine.template_libraries.items()) builtin_libs = [('', lib) for lib in engine.template_builtins] for module_name, library in builtin_libs + app_libs: for tag_name, tag_func in library.tags.items(): title, body, metadata = utils.parse_docstring(tag_func.__doc__) if title: title = utils.parse_rst(title, 'tag', _('tag:') + tag_name) if body: body = utils.parse_rst(body, 'tag', _('tag:') + tag_name) for key in metadata: metadata[key] = utils.parse_rst(metadata[key], 'tag', _('tag:') + tag_name) tag_library = module_name.split('.')[-1] tags.append({ 'name': tag_name, 'title': title, 'body': body, 'meta': metadata, 'library': tag_library, }) kwargs.update({'tags': tags}) return super().get_context_data(**kwargs) class TemplateFilterIndexView(BaseAdminDocsView): template_name = 'admin_doc/template_filter_index.html' def get_context_data(self, **kwargs): filters = [] try: engine = Engine.get_default() except ImproperlyConfigured: # Non-trivial TEMPLATES settings aren't supported (#24125). pass else: app_libs = sorted(engine.template_libraries.items()) builtin_libs = [('', lib) for lib in engine.template_builtins] for module_name, library in builtin_libs + app_libs: for filter_name, filter_func in library.filters.items(): title, body, metadata = utils.parse_docstring(filter_func.__doc__) if title: title = utils.parse_rst(title, 'filter', _('filter:') + filter_name) if body: body = utils.parse_rst(body, 'filter', _('filter:') + filter_name) for key in metadata: metadata[key] = utils.parse_rst(metadata[key], 'filter', _('filter:') + filter_name) tag_library = module_name.split('.')[-1] filters.append({ 'name': filter_name, 'title': title, 'body': body, 'meta': metadata, 'library': tag_library, }) kwargs.update({'filters': filters}) return super().get_context_data(**kwargs) class ViewIndexView(BaseAdminDocsView): template_name = 'admin_doc/view_index.html' @staticmethod def _get_full_name(func): mod_name = func.__module__ return '%s.%s' % (mod_name, func.__qualname__) def get_context_data(self, **kwargs): views = [] urlconf = import_module(settings.ROOT_URLCONF) view_functions = extract_views_from_urlpatterns(urlconf.urlpatterns) for (func, regex, namespace, name) in view_functions: views.append({ 'full_name': self._get_full_name(func), 'url': simplify_regex(regex), 'url_name': ':'.join((namespace or []) + (name and [name] or [])), 'namespace': ':'.join((namespace or [])), 'name': name, }) kwargs.update({'views': views}) return super().get_context_data(**kwargs) class ViewDetailView(BaseAdminDocsView): template_name = 'admin_doc/view_detail.html' @staticmethod def _get_view_func(view): urlconf = get_urlconf() if get_resolver(urlconf)._is_callback(view): mod, func = get_mod_func(view) try: # Separate the module and function, e.g. # 'mymodule.views.myview' -> 'mymodule.views', 'myview'). return getattr(import_module(mod), func) except ImportError: # Import may fail because view contains a class name, e.g. # 'mymodule.views.ViewContainer.my_view', so mod takes the form # 'mymodule.views.ViewContainer'. Parse it again to separate # the module and class. mod, klass = get_mod_func(mod) return getattr(getattr(import_module(mod), klass), func) def get_context_data(self, **kwargs): view = self.kwargs['view'] view_func = self._get_view_func(view) if view_func is None: raise Http404 title, body, metadata = utils.parse_docstring(view_func.__doc__) if title: title = utils.parse_rst(title, 'view', _('view:') + view) if body: body = utils.parse_rst(body, 'view', _('view:') + view) for key in metadata: metadata[key] = utils.parse_rst(metadata[key], 'model', _('view:') + view) kwargs.update({ 'name': view, 'summary': title, 'body': body, 'meta': metadata, }) return super().get_context_data(**kwargs) class ModelIndexView(BaseAdminDocsView): template_name = 'admin_doc/model_index.html' def get_context_data(self, **kwargs): m_list = [m._meta for m in apps.get_models()] kwargs.update({'models': m_list}) return super().get_context_data(**kwargs) class ModelDetailView(BaseAdminDocsView): template_name = 'admin_doc/model_detail.html' def get_context_data(self, **kwargs): model_name = self.kwargs['model_name'] # Get the model class. try: app_config = apps.get_app_config(self.kwargs['app_label']) except LookupError: raise Http404(_("App %(app_label)r not found") % self.kwargs) try: model = app_config.get_model(model_name) except LookupError: raise Http404(_("Model %(model_name)r not found in app %(app_label)r") % self.kwargs) opts = model._meta title, body, metadata = utils.parse_docstring(model.__doc__) if title: title = utils.parse_rst(title, 'model', _('model:') + model_name) if body: body = utils.parse_rst(body, 'model', _('model:') + model_name) # Gather fields/field descriptions. fields = [] for field in opts.fields: # ForeignKey is a special case since the field will actually be a # descriptor that returns the other object if isinstance(field, models.ForeignKey): data_type = field.remote_field.model.__name__ app_label = field.remote_field.model._meta.app_label verbose = utils.parse_rst( (_("the related `%(app_label)s.%(data_type)s` object") % { 'app_label': app_label, 'data_type': data_type, }), 'model', _('model:') + data_type, ) else: data_type = get_readable_field_data_type(field) verbose = field.verbose_name fields.append({ 'name': field.name, 'data_type': data_type, 'verbose': verbose or '', 'help_text': field.help_text, }) # Gather many-to-many fields. for field in opts.many_to_many: data_type = field.remote_field.model.__name__ app_label = field.remote_field.model._meta.app_label verbose = _("related `%(app_label)s.%(object_name)s` objects") % { 'app_label': app_label, 'object_name': data_type, } fields.append({ 'name': "%s.all" % field.name, "data_type": 'List', 'verbose': utils.parse_rst(_("all %s") % verbose, 'model', _('model:') + opts.model_name), }) fields.append({ 'name': "%s.count" % field.name, 'data_type': 'Integer', 'verbose': utils.parse_rst(_("number of %s") % verbose, 'model', _('model:') + opts.model_name), }) methods = [] # Gather model methods. for func_name, func in model.__dict__.items(): if inspect.isfunction(func): try: for exclude in MODEL_METHODS_EXCLUDE: if func_name.startswith(exclude): raise StopIteration except StopIteration: continue verbose = func.__doc__ if verbose: verbose = utils.parse_rst(utils.trim_docstring(verbose), 'model', _('model:') + opts.model_name) # If a method has no arguments, show it as a 'field', otherwise # as a 'method with arguments'. if func_has_no_args(func) and not func_accepts_kwargs(func) and not func_accepts_var_args(func): fields.append({ 'name': func_name, 'data_type': get_return_data_type(func_name), 'verbose': verbose or '', }) else: arguments = get_func_full_args(func) # Join arguments with ', ' and in case of default value, # join it with '='. Use repr() so that strings will be # correctly displayed. print_arguments = ', '.join([ '='.join(list(arg_el[:1]) + [repr(el) for el in arg_el[1:]]) for arg_el in arguments ]) methods.append({ 'name': func_name, 'arguments': print_arguments, 'verbose': verbose or '', }) # Gather related objects for rel in opts.related_objects: verbose = _("related `%(app_label)s.%(object_name)s` objects") % { 'app_label': rel.related_model._meta.app_label, 'object_name': rel.related_model._meta.object_name, } accessor = rel.get_accessor_name() fields.append({ 'name': "%s.all" % accessor, 'data_type': 'List', 'verbose': utils.parse_rst(_("all %s") % verbose, 'model', _('model:') + opts.model_name), }) fields.append({ 'name': "%s.count" % accessor, 'data_type': 'Integer', 'verbose': utils.parse_rst(_("number of %s") % verbose, 'model', _('model:') + opts.model_name), }) kwargs.update({ 'name': '%s.%s' % (opts.app_label, opts.object_name), 'summary': title, 'description': body, 'fields': fields, 'methods': methods, }) return super().get_context_data(**kwargs) class TemplateDetailView(BaseAdminDocsView): template_name = 'admin_doc/template_detail.html' def get_context_data(self, **kwargs): template = self.kwargs['template'] templates = [] try: default_engine = Engine.get_default() except ImproperlyConfigured: # Non-trivial TEMPLATES settings aren't supported (#24125). pass else: # This doesn't account for template loaders (#24128). for index, directory in enumerate(default_engine.dirs): template_file = os.path.join(directory, template) if os.path.exists(template_file): with open(template_file) as f: template_contents = f.read() else: template_contents = '' templates.append({ 'file': template_file, 'exists': os.path.exists(template_file), 'contents': template_contents, 'order': index, }) kwargs.update({ 'name': template, 'templates': templates, }) return super().get_context_data(**kwargs) #################### # Helper functions # #################### def get_return_data_type(func_name): """Return a somewhat-helpful data type given a function name""" if func_name.startswith('get_'): if func_name.endswith('_list'): return 'List' elif func_name.endswith('_count'): return 'Integer' return '' def get_readable_field_data_type(field): """ Return the description for a given field type, if it exists. Fields' descriptions can contain format strings, which will be interpolated with the values of field.__dict__ before being output. """ return field.description % field.__dict__ def extract_views_from_urlpatterns(urlpatterns, base='', namespace=None): """ Return a list of views from a list of urlpatterns. Each object in the returned list is a two-tuple: (view_func, regex) """ views = [] for p in urlpatterns: if hasattr(p, 'url_patterns'): try: patterns = p.url_patterns except ImportError: continue views.extend(extract_views_from_urlpatterns( patterns, base + p.regex.pattern, (namespace or []) + (p.namespace and [p.namespace] or []) )) elif hasattr(p, 'callback'): try: views.append((p.callback, base + p.regex.pattern, namespace, p.name)) except ViewDoesNotExist: continue else: raise TypeError(_("%s does not appear to be a urlpattern object") % p) return views def simplify_regex(pattern): r""" Clean up urlpattern regexes into something more readable by humans. For example, turn "^(?P<sport_slug>\w+)/athletes/(?P<athlete_slug>\w+)/$" into "/<sport_slug>/athletes/<athlete_slug>/". """ pattern = replace_named_groups(pattern) pattern = replace_unnamed_groups(pattern) # clean up any outstanding regex-y characters. pattern = pattern.replace('^', '').replace('$', '').replace('?', '') if not pattern.startswith('/'): pattern = '/' + pattern return pattern
from django.conf.urls import url from rest_framework import routers from rest_framework.response import Response from rest_framework.reverse import reverse from rest_framework.urlpatterns import format_suffix_patterns from rest_framework.views import APIView from onadata.apps.api.viewsets.charts_viewset import ChartsViewSet from onadata.apps.api.viewsets.connect_viewset import ConnectViewSet from onadata.apps.api.viewsets.data_viewset import DataViewSet from onadata.apps.api.viewsets.metadata_viewset import MetaDataViewSet from onadata.apps.api.viewsets.note_viewset import NoteViewSet from onadata.apps.api.viewsets.organization_profile_viewset import\ OrganizationProfileViewSet from onadata.apps.api.viewsets.project_viewset import ProjectViewSet from onadata.apps.api.viewsets.stats_viewset import StatsViewSet from onadata.apps.api.viewsets.team_viewset import TeamViewSet from onadata.apps.api.viewsets.xform_viewset import XFormViewSet from onadata.apps.api.viewsets.user_profile_viewset import UserProfileViewSet from onadata.apps.api.viewsets.user_viewset import UserViewSet from onadata.apps.api.viewsets.submissionstats_viewset import\ SubmissionStatsViewSet from onadata.apps.api.viewsets.attachment_viewset import AttachmentViewSet from onadata.apps.api.viewsets.xform_list_api import XFormListApi from onadata.apps.api.viewsets.xform_submission_api import XFormSubmissionApi from onadata.apps.api.viewsets.briefcase_api import BriefcaseApi def make_routes(template_text): return routers.Route( url=r'^{prefix}/{%s}{trailing_slash}$' % template_text, mapping={ 'get': 'list', 'post': 'create' }, name='{basename}-list', initkwargs={'suffix': 'List'}) class MultiLookupRouter(routers.DefaultRouter): def __init__(self, *args, **kwargs): super(MultiLookupRouter, self).__init__(*args, **kwargs) self.lookups_routes = [] self.lookups_routes.append(routers.Route( url=r'^{prefix}/{lookups}{trailing_slash}$', mapping={ 'get': 'retrieve', 'put': 'update', 'patch': 'partial_update', 'delete': 'destroy' }, name='{basename}-detail', initkwargs={'suffix': 'Instance'} )) self.lookups_routes.append(make_routes('lookup')) self.lookups_routes.append(make_routes('lookups')) # Dynamically generated routes. # Generated using @action or @link decorators on methods of the viewset self.lookups_routes.append(routers.Route( url=[ r'^{prefix}/{lookups}/{methodname}{trailing_slash}$', r'^{prefix}/{lookups}/{methodname}/{extra}{trailing_slash}$'], mapping={ '{httpmethod}': '{methodname}', }, name='{basename}-{methodnamehyphen}', initkwargs={} )) def get_extra_lookup_regexes(self, route): ret = [] base_regex = '(?P<{lookup_field}>[^/]+)' if 'extra_lookup_fields' in route.initkwargs: for lookup_field in route.initkwargs['extra_lookup_fields']: ret.append(base_regex.format(lookup_field=lookup_field)) return '/'.join(ret) def get_lookup_regexes(self, viewset): ret = [] lookup_fields = getattr(viewset, 'lookup_fields', None) if lookup_fields: for i in range(1, len(lookup_fields)): tmp = [] for lookup_field in lookup_fields[:i + 1]: if lookup_field == lookup_fields[i]: base_regex = '(?P<{lookup_field}>[^/.]+)' else: base_regex = '(?P<{lookup_field}>[^/]+)' tmp.append(base_regex.format(lookup_field=lookup_field)) ret.append(tmp) return ret def get_lookup_routes(self, viewset): ret = [self.routes[0]] # Determine any `@action` or `@link` decorated methods on the viewset dynamic_routes = [] for methodname in dir(viewset): attr = getattr(viewset, methodname) httpmethods = getattr(attr, 'bind_to_methods', None) if httpmethods: httpmethods = [method.lower() for method in httpmethods] dynamic_routes.append((httpmethods, methodname)) for route in self.lookups_routes: if route.mapping == {'{httpmethod}': '{methodname}'}: # Dynamic routes (@link or @action decorator) for httpmethods, methodname in dynamic_routes: initkwargs = route.initkwargs.copy() initkwargs.update(getattr(viewset, methodname).kwargs) mapping = dict( (httpmethod, methodname) for httpmethod in httpmethods) name = routers.replace_methodname(route.name, methodname) if 'extra_lookup_fields' in initkwargs: uri = route.url[1] uri = routers.replace_methodname(uri, methodname) ret.append(routers.Route( url=uri, mapping=mapping, name='%s-extra' % name, initkwargs=initkwargs, )) uri = routers.replace_methodname(route.url[0], methodname) ret.append(routers.Route( url=uri, mapping=mapping, name=name, initkwargs=initkwargs, )) else: # Standard route ret.append(route) return ret def get_routes(self, viewset): ret = [] lookup_fields = getattr(viewset, 'lookup_fields', None) if lookup_fields: ret = self.get_lookup_routes(viewset) else: ret = super(MultiLookupRouter, self).get_routes(viewset) return ret def get_api_root_view(self): """ Return a view to use as the API root. """ api_root_dict = {} list_name = self.routes[0].name for prefix, viewset, basename in self.registry: api_root_dict[prefix] = list_name.format(basename=basename) class OnaApi(APIView): """ ## Ona JSON Rest API endpoints: ### Data * [/api/v1/charts](/api/v1/charts) - List, Retrieve Charts of collected data * [/api/v1/data](/api/v1/data) - List, Retrieve submission data * [/api/v1/stats](/api/v1/stats) - Summary statistics ### Forms * [/api/v1/forms](/api/v1/forms) - List, Retrieve form information * [/api/v1/media](/api/v1/media) - List, Retrieve media attachments * [/api/v1/metadata](/api/v1/metadata) - List, Retrieve form metadata * [/api/v1/projects](/api/v1/projects) - List, Retrieve, Create, Update organization projects, forms * [/api/v1/submissions](/api/v1/submissions) - Submit XForms to a form ### Users and Organizations * [/api/v1/orgs](/api/v1/orgs) - List, Retrieve, Create, Update organization and organization info * [/api/v1/profiles](/api/v1/profiles) - List, Create, Update user information * [/api/v1/teams](/api/v1/teams) - List, Retrieve, Create, Update teams * [/api/v1/user](/api/v1/user) - Return authenticated user profile info * [/api/v1/users](/api/v1/users) - List, Retrieve user data ## Status Codes * **200** - Successful [`GET`, `PATCH`, `PUT`] * **201** - Resource successfully created [`POST`] * **204** - Resouce successfully deleted [`DELETE`] * **403** - Permission denied to resource * **404** - Resource was not found ## Authentication Ona JSON API enpoints support both Basic authentication and API Token Authentication through the `Authorization` header. ### Basic Authentication Example using curl: curl -X GET https://ona.io/api/v1/ -u username:password ### Token Authentication Example using curl: curl -X GET https://ona.io/api/v1/ -H "Authorization: Token TOKEN_KEY" ### Temporary Token Authentication Example using curl: curl -X GET https://ona.io/api/v1/ -H "Authorization: TempToken TOKEN_KEY" ### Ona Tagging API * [Filter form list by tags.]( /api/v1/forms#get-list-of-forms-with-specific-tags) * [List Tags for a specific form.]( /api/v1/forms#get-list-of-tags-for-a-specific-form) * [Tag Forms.](/api/v1/forms#tag-forms) * [Delete a specific tag.](/api/v1/forms#delete-a-specific-tag) * [List form data by tag.]( /api/v1/data#query-submitted-data-of-a-specific-form-using-tags) * [Tag a specific submission](/api/v1/data#tag-a-submission-data-point) ## Using Oauth2 with the Ona API You can learn more about oauth2 [here]( http://tools.ietf.org/html/rfc6749). ### 1. Register your client application with Ona - [register](\ /o/applications/register/) - `name` - name of your application - `client_type` - Client Type: select confidential - `authorization_grant_type` - Authorization grant type: Authorization code - `redirect_uri` - Redirect urls: redirection endpoint Keep note of the `client_id` and the `client_secret`, it is required when requesting for an `access_token`. ### 2. Authorize client application. The authorization url is of the form: <pre class="prettyprint"> <b>GET</b> /o/authorize?client_id=XXXXXX&response_type=code&state=abc</pre> example: http://localhost:8000/o/authorize?client_id=e8&response_type=code&state=xyz Note: Providing the url to any user will prompt for a password and request for read and write permission for the application whose `client_id` is specified. Where: - `client_id` - is the client application id - ensure its urlencoded - `response_type` - should be code - `state` - a random state string that you client application will get when redirection happens What happens: 1. a login page is presented, the username used to login determines the account that provides access. 2. redirection to the client application occurs, the url is of the form: > REDIRECT_URI/?state=abc&code=YYYYYYYYY example redirect uri http://localhost:30000/?state=xyz&code=SWWk2PN6NdCwfpqiDiPRcLmvkw2uWd - `code` - is the code to use to request for `access_token` - `state` - same state string used during authorization request Your client application should use the `code` to request for an access_token. ### 3. Request for access token. You need to make a `POST` request with `grant_type`, `code`, `client_id` and `redirect_uri` as `POST` payload params. You should authenticate the request with `Basic Authentication` using your `client_id` and `client_secret` as `username:password` pair. Request: <pre class="prettyprint"> <b>POST</b>/o/token</pre> Payload: grant_type=authorization_code&code=YYYYYYYYY&client_id=XXXXXX& redirect_uri=http://redirect/uri/path curl example: curl -X POST -d "grant_type=authorization_code& code=PSwrMilnJESZVFfFsyEmEukNv0sGZ8& client_id=e8x4zzJJIyOikDqjPcsCJrmnU22QbpfHQo4HhRnv& redirect_uri=http://localhost:30000" "http://localhost:8000/o/token/" --user "e8:xo7i4LNpMj" Response: { "access_token": "Q6dJBs9Vkf7a2lVI7NKLT8F7c6DfLD", "token_type": "Bearer", "expires_in": 36000, "refresh_token": "53yF3uz79K1fif2TPtNBUFJSFhgnpE", "scope": "read write groups" } Where: - `access_token` - access token - expires - `refresh_token` - token to use to request a new `access_token` in case it has expored. Now that you have an `access_token` you can make API calls. ### 4. Accessing the Ona API using the `access_token`. Example using curl: curl -X GET https://ona.io/api/v1 -H "Authorization: Bearer ACCESS_TOKEN" """ _ignore_model_permissions = True def get(self, request, format=None): ret = {} for key, url_name in api_root_dict.items(): ret[key] = reverse( url_name, request=request, format=format) return Response(ret) return OnaApi.as_view() def get_urls(self): ret = [] if self.include_root_view: root_url = url(r'^$', self.get_api_root_view(), name=self.root_view_name) ret.append(root_url) for prefix, viewset, basename in self.registry: lookup = self.get_lookup_regex(viewset) lookup_list = self.get_lookup_regexes(viewset) if lookup_list: # lookup = lookups[0] lookup_list = [u'/'.join(k) for k in lookup_list] else: lookup_list = [u''] routes = self.get_routes(viewset) for route in routes: mapping = self.get_method_map(viewset, route.mapping) if not mapping: continue for lookups in lookup_list: regex = route.url.format( prefix=prefix, lookup=lookup, lookups=lookups, trailing_slash=self.trailing_slash, extra=self.get_extra_lookup_regexes(route) ) view = viewset.as_view(mapping, **route.initkwargs) name = route.name.format(basename=basename) ret.append(url(regex, view, name=name)) if self.include_format_suffixes: ret = format_suffix_patterns(ret, allowed=['[a-z]+[0-9]*']) return ret router = MultiLookupRouter(trailing_slash=False) router.register(r'users', UserViewSet) router.register(r'user', ConnectViewSet) router.register(r'profiles', UserProfileViewSet) router.register(r'orgs', OrganizationProfileViewSet) router.register(r'forms', XFormViewSet) router.register(r'projects', ProjectViewSet) router.register(r'teams', TeamViewSet) router.register(r'notes', NoteViewSet) router.register(r'data', DataViewSet, base_name='data') router.register(r'stats', StatsViewSet, base_name='stats') router.register(r'stats/submissions', SubmissionStatsViewSet, base_name='submissionstats') router.register(r'charts', ChartsViewSet, base_name='chart') router.register(r'metadata', MetaDataViewSet, base_name='metadata') router.register(r'media', AttachmentViewSet, base_name='attachment') router.register(r'formlist', XFormListApi, base_name='formlist') router.register(r'submissions', XFormSubmissionApi, base_name='submissions') router.register(r'briefcase', BriefcaseApi, base_name='briefcase')
from __future__ import unicode_literals import copy import logging import sys import warnings from django.conf import compat_patch_logging_config, LazySettings from django.core import mail from django.test import TestCase, RequestFactory from django.test.utils import override_settings from django.utils.encoding import force_text from django.utils.log import CallbackFilter, RequireDebugFalse from django.utils.six import StringIO from django.utils.unittest import skipUnless from ..admin_scripts.tests import AdminScriptTestCase PYVERS = sys.version_info[:2] # logging config prior to using filter with mail_admins OLD_LOGGING = { 'version': 1, 'disable_existing_loggers': False, 'handlers': { 'mail_admins': { 'level': 'ERROR', 'class': 'django.utils.log.AdminEmailHandler' } }, 'loggers': { 'django.request': { 'handlers': ['mail_admins'], 'level': 'ERROR', 'propagate': True, }, } } class PatchLoggingConfigTest(TestCase): """ Tests for backward-compat shim for #16288. These tests should be removed in Django 1.6 when that shim and DeprecationWarning are removed. """ def test_filter_added(self): """ Test that debug-false filter is added to mail_admins handler if it has no filters. """ config = copy.deepcopy(OLD_LOGGING) with warnings.catch_warnings(record=True) as w: warnings.simplefilter("always") compat_patch_logging_config(config) self.assertEqual(len(w), 1) self.assertEqual( config["handlers"]["mail_admins"]["filters"], ['require_debug_false']) def test_filter_configuration(self): """ Test that the auto-added require_debug_false filter is an instance of `RequireDebugFalse` filter class. """ config = copy.deepcopy(OLD_LOGGING) with warnings.catch_warnings(record=True): compat_patch_logging_config(config) flt = config["filters"]["require_debug_false"] self.assertEqual(flt["()"], "django.utils.log.RequireDebugFalse") def test_require_debug_false_filter(self): """ Test the RequireDebugFalse filter class. """ filter_ = RequireDebugFalse() with self.settings(DEBUG=True): self.assertEqual(filter_.filter("record is not used"), False) with self.settings(DEBUG=False): self.assertEqual(filter_.filter("record is not used"), True) def test_no_patch_if_filters_key_exists(self): """ Test that the logging configuration is not modified if the mail_admins handler already has a "filters" key. """ config = copy.deepcopy(OLD_LOGGING) config["handlers"]["mail_admins"]["filters"] = [] new_config = copy.deepcopy(config) compat_patch_logging_config(new_config) self.assertEqual(config, new_config) def test_no_patch_if_no_mail_admins_handler(self): """ Test that the logging configuration is not modified if the mail_admins handler is not present. """ config = copy.deepcopy(OLD_LOGGING) config["handlers"].pop("mail_admins") new_config = copy.deepcopy(config) compat_patch_logging_config(new_config) self.assertEqual(config, new_config) class DefaultLoggingTest(TestCase): def setUp(self): self.logger = logging.getLogger('django') self.old_stream = self.logger.handlers[0].stream def tearDown(self): self.logger.handlers[0].stream = self.old_stream def test_django_logger(self): """ The 'django' base logger only output anything when DEBUG=True. """ output = StringIO() self.logger.handlers[0].stream = output self.logger.error("Hey, this is an error.") self.assertEqual(output.getvalue(), '') with self.settings(DEBUG=True): self.logger.error("Hey, this is an error.") self.assertEqual(output.getvalue(), 'Hey, this is an error.\n') @skipUnless(PYVERS > (2,6), "warnings captured only in Python >= 2.7") class WarningLoggerTests(TestCase): """ Tests that warnings output for DeprecationWarnings is enabled and captured to the logging system """ def setUp(self): # If tests are invoke with "-Wall" (or any -W flag actually) then # warning logging gets disabled (see django/conf/__init__.py). However, # these tests expect warnings to be logged, so manually force warnings # to the logs. Use getattr() here because the logging capture state is # undocumented and (I assume) brittle. self._old_capture_state = bool(getattr(logging, '_warnings_showwarning', False)) logging.captureWarnings(True) # this convoluted setup is to avoid printing this deprecation to # stderr during test running - as the test runner forces deprecations # to be displayed at the global py.warnings level self.logger = logging.getLogger('py.warnings') self.outputs = [] self.old_streams = [] for handler in self.logger.handlers: self.old_streams.append(handler.stream) self.outputs.append(StringIO()) handler.stream = self.outputs[-1] def tearDown(self): for i, handler in enumerate(self.logger.handlers): self.logger.handlers[i].stream = self.old_streams[i] # Reset warnings state. logging.captureWarnings(self._old_capture_state) @override_settings(DEBUG=True) def test_warnings_capture(self): warnings.warn('Foo Deprecated', DeprecationWarning) output = force_text(self.outputs[0].getvalue()) self.assertTrue('Foo Deprecated' in output) def test_warnings_capture_debug_false(self): warnings.warn('Foo Deprecated', DeprecationWarning) output = force_text(self.outputs[0].getvalue()) self.assertFalse('Foo Deprecated' in output) class CallbackFilterTest(TestCase): def test_sense(self): f_false = CallbackFilter(lambda r: False) f_true = CallbackFilter(lambda r: True) self.assertEqual(f_false.filter("record"), False) self.assertEqual(f_true.filter("record"), True) def test_passes_on_record(self): collector = [] def _callback(record): collector.append(record) return True f = CallbackFilter(_callback) f.filter("a record") self.assertEqual(collector, ["a record"]) class AdminEmailHandlerTest(TestCase): logger = logging.getLogger('django.request') def get_admin_email_handler(self, logger): # Inspired from regressiontests/views/views.py: send_log() # ensuring the AdminEmailHandler does not get filtered out # even with DEBUG=True. admin_email_handler = [ h for h in logger.handlers if h.__class__.__name__ == "AdminEmailHandler" ][0] return admin_email_handler @override_settings( ADMINS=(('whatever admin', 'admin@example.com'),), EMAIL_SUBJECT_PREFIX='-SuperAwesomeSubject-' ) def test_accepts_args(self): """ Ensure that user-supplied arguments and the EMAIL_SUBJECT_PREFIX setting are used to compose the email subject. Refs #16736. """ message = "Custom message that says '%s' and '%s'" token1 = 'ping' token2 = 'pong' admin_email_handler = self.get_admin_email_handler(self.logger) # Backup then override original filters orig_filters = admin_email_handler.filters try: admin_email_handler.filters = [] self.logger.error(message, token1, token2) self.assertEqual(len(mail.outbox), 1) self.assertEqual(mail.outbox[0].to, ['admin@example.com']) self.assertEqual(mail.outbox[0].subject, "-SuperAwesomeSubject-ERROR: Custom message that says 'ping' and 'pong'") finally: # Restore original filters admin_email_handler.filters = orig_filters @override_settings( ADMINS=(('whatever admin', 'admin@example.com'),), EMAIL_SUBJECT_PREFIX='-SuperAwesomeSubject-', INTERNAL_IPS=('127.0.0.1',), ) def test_accepts_args_and_request(self): """ Ensure that the subject is also handled if being passed a request object. """ message = "Custom message that says '%s' and '%s'" token1 = 'ping' token2 = 'pong' admin_email_handler = self.get_admin_email_handler(self.logger) # Backup then override original filters orig_filters = admin_email_handler.filters try: admin_email_handler.filters = [] rf = RequestFactory() request = rf.get('/') self.logger.error(message, token1, token2, extra={ 'status_code': 403, 'request': request, } ) self.assertEqual(len(mail.outbox), 1) self.assertEqual(mail.outbox[0].to, ['admin@example.com']) self.assertEqual(mail.outbox[0].subject, "-SuperAwesomeSubject-ERROR (internal IP): Custom message that says 'ping' and 'pong'") finally: # Restore original filters admin_email_handler.filters = orig_filters @override_settings( ADMINS=(('admin', 'admin@example.com'),), EMAIL_SUBJECT_PREFIX='', DEBUG=False, ) def test_subject_accepts_newlines(self): """ Ensure that newlines in email reports' subjects are escaped to avoid AdminErrorHandler to fail. Refs #17281. """ message = 'Message \r\n with newlines' expected_subject = 'ERROR: Message \\r\\n with newlines' self.assertEqual(len(mail.outbox), 0) self.logger.error(message) self.assertEqual(len(mail.outbox), 1) self.assertFalse('\n' in mail.outbox[0].subject) self.assertFalse('\r' in mail.outbox[0].subject) self.assertEqual(mail.outbox[0].subject, expected_subject) @override_settings( ADMINS=(('admin', 'admin@example.com'),), EMAIL_SUBJECT_PREFIX='', DEBUG=False, ) def test_truncate_subject(self): """ RFC 2822's hard limit is 998 characters per line. So, minus "Subject: ", the actual subject must be no longer than 989 characters. Refs #17281. """ message = 'a' * 1000 expected_subject = 'ERROR: aa' + 'a' * 980 self.assertEqual(len(mail.outbox), 0) self.logger.error(message) self.assertEqual(len(mail.outbox), 1) self.assertEqual(mail.outbox[0].subject, expected_subject) class SettingsConfigTest(AdminScriptTestCase): """ Test that accessing settings in a custom logging handler does not trigger a circular import error. """ def setUp(self): log_config = """{ 'version': 1, 'handlers': { 'custom_handler': { 'level': 'INFO', 'class': 'logging_tests.logconfig.MyHandler', } } }""" self.write_settings('settings.py', sdict={'LOGGING': log_config}) def tearDown(self): self.remove_settings('settings.py') def test_circular_dependency(self): # validate is just an example command to trigger settings configuration out, err = self.run_manage(['validate']) self.assertNoOutput(err) self.assertOutput(out, "0 errors found") def dictConfig(config): dictConfig.called = True dictConfig.called = False class SettingsConfigureLogging(TestCase): """ Test that calling settings.configure() initializes the logging configuration. """ def test_configure_initializes_logging(self): settings = LazySettings() settings.configure( LOGGING_CONFIG='regressiontests.logging_tests.tests.dictConfig') self.assertTrue(dictConfig.called)
from __future__ import print_function from __future__ import absolute_import from __future__ import unicode_literals # # This file is part of khmer, https://github.com/dib-lab/khmer/, and is # Copyright (C) Michigan State University, 2009-2015. It is licensed under # the three-clause BSD license; see LICENSE. # Contact: khmer-project@idyll.org # pylint: disable=missing-docstring,invalid-name,unused-variable import os import shutil import threading import io import screed import khmer from . import khmer_tst_utils as utils from nose.plugins.attrib import attr from .test_scripts import _make_counting def test_normalize_by_median_indent(): infile = utils.get_test_data('paired-mixed.fa.pe') hashfile = utils.get_test_data('normC20k20.ct') outfile = utils.get_temp_filename('paired-mixed.fa.pe.keep') script = 'normalize-by-median.py' args = ['--loadgraph', hashfile, '-o', outfile, infile] (status, out, err) = utils.runscript(script, args) assert status == 0, (out, err) assert os.path.exists(outfile) def test_normalize_by_median_loadgraph_with_args(): infile = utils.get_test_data("test-abund-read-2.fa") tablefile = utils.get_temp_filename("table") in_dir = os.path.dirname(tablefile) script = "load-into-counting.py" args = [tablefile, infile] (status, out, err) = utils.runscript(script, args) script = "normalize-by-median.py" args = ["--ksize", "7", "--loadgraph", tablefile, infile] (status, out, err) = utils.runscript(script, args, in_dir) assert 'WARNING: You are loading a saved k-mer countgraph from' in err, err def test_normalize_by_median_empty_file(): infile = utils.get_temp_filename('empty') shutil.copyfile(utils.get_test_data('empty-file'), infile) script = 'normalize-by-median.py' in_dir = os.path.dirname(infile) args = [infile] (status, out, err) = utils.runscript(script, args, in_dir) assert 'WARNING:' in err, err assert 'is empty' in err, err assert 'SKIPPED' in err, err def test_normalize_by_median(): CUTOFF = '1' infile = utils.get_temp_filename('test.fa') in_dir = os.path.dirname(infile) shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile) script = 'normalize-by-median.py' args = ['-C', CUTOFF, '-k', '17', infile] (status, out, err) = utils.runscript(script, args, in_dir) assert 'Total number of unique k-mers: 98' in err, err outfile = infile + '.keep' assert os.path.exists(outfile), outfile seqs = [r.sequence for r in screed.open(outfile)] assert len(seqs) == 1, seqs assert seqs[0].startswith('GGTTGACGGGGCTCAGGGGG'), seqs assert "I/O Errors" not in err def test_normalize_by_median_quiet(): CUTOFF = '1' infile = utils.get_temp_filename('test.fa') in_dir = os.path.dirname(infile) shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile) script = 'normalize-by-median.py' args = ['-C', CUTOFF, '-k', '17', '--quiet', '-M', '2e6', infile] (status, out, err) = utils.runscript(script, args, in_dir) assert len(out) == 0, out assert len(err) == 0, err outfile = infile + '.keep' assert os.path.exists(outfile), outfile seqs = [r.sequence for r in screed.open(outfile)] assert len(seqs) == 1, seqs assert seqs[0].startswith('GGTTGACGGGGCTCAGGGGG'), seqs assert "I/O Errors" not in err def test_normalize_by_median_unpaired_final_read(): CUTOFF = '1' infile = utils.get_temp_filename('test.fa') in_dir = os.path.dirname(infile) shutil.copyfile(utils.get_test_data('single-read.fq'), infile) script = 'normalize-by-median.py' args = ['-C', CUTOFF, '-k', '17', '-p', infile] (status, out, err) = utils.runscript(script, args, in_dir, fail_ok=True) assert status != 0 assert "ERROR: Unpaired reads when require_paired" in err, err def test_normalize_by_median_sanity_check_0(): infile = utils.get_temp_filename('test.fa') in_dir = os.path.dirname(infile) shutil.copyfile(utils.get_test_data('single-read.fq'), infile) script = 'normalize-by-median.py' args = ['-U', '1024', '--max-mem', '60', infile] (status, out, err) = utils.runscript(script, args, in_dir, fail_ok=True) assert status != 0, status assert "recommended false positive ceiling of 0.1!" in err, err def test_normalize_by_median_sanity_check_1(): infile = utils.get_temp_filename('test.fa') in_dir = os.path.dirname(infile) shutil.copyfile(utils.get_test_data('test-filter-abund-Ns.fq'), infile) script = 'normalize-by-median.py' args = ['-U', '83', '--max-tablesize', '17', infile] (status, out, err) = utils.runscript(script, args, in_dir, fail_ok=True) assert status != 0 assert "Warning: The given tablesize is too small!" in err, err def test_normalize_by_median_sanity_check_2(): infile = utils.get_temp_filename('test.fa') in_dir = os.path.dirname(infile) shutil.copyfile(utils.get_test_data('test-filter-abund-Ns.fq'), infile) script = 'normalize-by-median.py' args = ['-U', '83', infile] (status, out, err) = utils.runscript(script, args, in_dir) assert "*** INFO: set memory ceiling automatically." in err, err assert "*** Ceiling is: 1e+06 bytes" in err, err def test_normalize_by_median_sanity_check_3(): infile = utils.get_temp_filename('test.fa') in_dir = os.path.dirname(infile) tablefile = utils.get_temp_filename('table', in_dir) shutil.copyfile(utils.get_test_data('test-filter-abund-Ns.fq'), infile) script = 'normalize-by-median.py' args = ['-s', tablefile, '-U', '83', '--fp-rate', '0.7', infile] (status, out, err) = utils.runscript(script, args, in_dir) assert "Overriding default fp 0.1 with new fp: 0.7" in err, err args = ['--loadgraph', tablefile, '-U', '83', infile] (status, out, err) = utils.runscript(script, args, in_dir) assert "WARNING: You have asked that the graph size be auto" in err, err assert "NOT be set automatically" in err, err assert "loading an existing graph" in err, err def test_normalize_by_median_unforced_badfile(): CUTOFF = '1' infile = utils.get_temp_filename("potatoes") outfile = infile + '.keep' in_dir = os.path.dirname(infile) script = 'normalize-by-median.py' args = ['-C', CUTOFF, '-k', '17', infile] (status, out, err) = utils.runscript(script, args, in_dir, fail_ok=True) assert status != 0 assert "ERROR: [Errno 2] No such file or directory:" in err, err if os.path.exists(outfile): assert False, '.keep file should have been removed: ' def test_normalize_by_median_contradictory_args(): infile = utils.get_temp_filename('test.fa') in_dir = os.path.dirname(infile) outfile = utils.get_temp_filename('report.out') shutil.copyfile(utils.get_test_data('test-large.fa'), infile) script = 'normalize-by-median.py' args = ['-C', '1', '-k', '17', '--force-single', '-p', '-R', outfile, infile] (status, out, err) = utils.runscript(script, args, in_dir, fail_ok=True) assert status != 0 assert "cannot both be set" in err, err def test_normalize_by_median_stdout_3(): CUTOFF = '1' infile = utils.get_temp_filename('test.fa') in_dir = os.path.dirname(infile) shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile) script = 'normalize-by-median.py' args = ['-C', CUTOFF, '-k', '17', infile, '--out', '-'] (status, out, err) = utils.runscript(script, args, in_dir) assert 'Total number of unique k-mers: 98' in err, err assert 'in block device' in err, err assert "I/O Errors" not in err @attr('known_failing') def test_normalize_by_median_known_good(): CUTOFF = '2' infile = utils.get_temp_filename('test.fa.gz') in_dir = os.path.dirname(infile) shutil.copyfile(utils.get_test_data('100k-filtered.fa.gz'), infile) script = 'normalize-by-median.py' args = ['-C', CUTOFF, '-k', '20', '-x', '4e6', infile] (status, out, err) = utils.runscript(script, args, in_dir) outfile = infile + '.keep' assert os.path.exists(outfile), outfile iter_known = screed.open(utils.get_test_data('100k-filtered.fa.keep.gz')) iter_out = screed.open(outfile) try: for rknown, rout in zip(iter_known, iter_out): assert rknown.name == rout.name except Exception as e: print(e) assert False def test_normalize_by_median_report_fp(): # this tests basic reporting of diginorm stats => report.out, including # a test of aggregate stats for two input files. infile = utils.get_temp_filename('test.fa') shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile) infile2 = utils.get_temp_filename('test2.fa') shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile2) in_dir = os.path.dirname(infile) outfile = utils.get_temp_filename('report.out') script = 'normalize-by-median.py' args = ['-C', '1', '-k', '17', '-R', outfile, infile, infile2] (status, out, err) = utils.runscript(script, args, in_dir) assert os.path.exists(outfile) report = open(outfile, 'r') line = report.readline().strip() assert line == 'total,kept,f_kept', line line = report.readline().strip() assert line == '1001,1,0.000999', line line = report.readline().strip() assert line == '2002,1,0.0004995', line def test_normalize_by_median_report_fp_hifreq(): # this tests high-frequency reporting of diginorm stats for a single # file => report.out. infile = utils.get_temp_filename('test.fa') shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile) in_dir = os.path.dirname(infile) outfile = utils.get_temp_filename('report.out') script = 'normalize-by-median.py' args = ['-C', '1', '-k', '17', '-R', outfile, infile, '--report-frequency', '100'] (status, out, err) = utils.runscript(script, args, in_dir) assert os.path.exists(outfile) report = open(outfile, 'r') line = report.readline().strip() assert line == 'total,kept,f_kept', line line = report.readline().strip() assert line == '100,1,0.01', line line = report.readline().strip() assert line == '200,1,0.005', line @attr('huge') def test_normalize_by_median_report_fp_huge(): # this tests reporting of diginorm stats => report.out for a large # file, with the default reporting interval of once every 100k. infile = utils.get_temp_filename('test.fa') in_dir = os.path.dirname(infile) outfile = utils.get_temp_filename('report.out') shutil.copyfile(utils.get_test_data('test-large.fa'), infile) script = 'normalize-by-median.py' args = ['-C', '1', '-k', '17', '-R', outfile, infile] (status, out, err) = utils.runscript(script, args, in_dir) assert "fp rate estimated to be 0.623" in err, err report = open(outfile, 'r') line = report.readline() # skip header line = report.readline() assert "100000,25261,0.2526" in line, line def test_normalize_by_median_unpaired_and_paired(): CUTOFF = '1' infile = utils.get_temp_filename('test.fa') in_dir = os.path.dirname(infile) shutil.copyfile(utils.get_test_data('test-abund-read-paired.fa'), infile) unpairedfile = utils.get_temp_filename('test1.fa', tempdir=in_dir) shutil.copyfile(utils.get_test_data('random-20-a.fa'), unpairedfile) script = 'normalize-by-median.py' args = ['-C', CUTOFF, '-k', '17', '-u', unpairedfile, '-p', infile] (status, out, err) = utils.runscript(script, args, in_dir) assert 'Total number of unique k-mers: 4061' in err, err outfile = infile + '.keep' assert os.path.exists(outfile), outfile def test_normalize_by_median_count_kmers_PE(): CUTOFF = '1' infile = utils.get_temp_filename('test.fa') in_dir = os.path.dirname(infile) # The test file has one pair of identical read except for the last base # The 2nd read should be discarded in the unpaired mode # but kept in the paired end mode adding only one more unique kmer shutil.copyfile(utils.get_test_data('paired_one.base.dif.fa'), infile) script = 'normalize-by-median.py' args = ['-C', CUTOFF, '-k', '17', '--force-single', infile] (status, out, err) = utils.runscript(script, args, in_dir) assert 'Total number of unique k-mers: 98' in err, err assert 'kept 1 of 2 or 50.0%' in err, err args = ['-C', CUTOFF, '-k', '17', '-p', infile] (status, out, err) = utils.runscript(script, args, in_dir) assert 'Total number of unique k-mers: 99' in err, err assert 'kept 2 of 2 or 100.0%' in err, err def test_normalize_by_median_double_file_name(): infile = utils.get_temp_filename('test-abund-read-2.fa') in_dir = os.path.dirname(infile) shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile) script = 'normalize-by-median.py' args = [utils.get_test_data('test-abund-read-2.fa'), infile] (status, out, err) = utils.runscript(script, args, in_dir, fail_ok=True) assert status != 0 assert "Duplicate filename--Cannot handle this!" in err, err def test_normalize_by_median_stdin_no_out(): infile = utils.get_temp_filename('test-abund-read-2.fa') in_dir = os.path.dirname(infile) script = 'normalize-by-median.py' args = ["-"] (status, out, err) = utils.runscript(script, args, in_dir, fail_ok=True) assert status != 0 assert "Accepting input from stdin; output filename" in err, err def test_normalize_by_median_overwrite(): outfile = utils.get_temp_filename('test.fa.keep') shutil.copyfile(utils.get_test_data('test-abund-read.fa'), outfile) in_dir = os.path.dirname(outfile) CUTOFF = '1' infile = utils.get_temp_filename('test.fa', in_dir) shutil.copyfile(utils.get_test_data('test-abund-read-3.fa'), infile) script = 'normalize-by-median.py' args = ['-C', CUTOFF, '-k', '17', '-o', outfile, infile] (status, out, err) = utils.runscript(script, args, in_dir) assert os.path.exists(outfile), outfile seqs = [r.sequence for r in screed.open(outfile)] assert len(seqs) == 1, seqs assert 'GACAGCgtgCCGCA' in seqs[0], seqs def test_normalize_by_median_version(): script = 'normalize-by-median.py' args = ['--version'] status, out, err = utils.runscript(script, args) errlines = err.splitlines() for err in errlines: if err.startswith('||') or \ not err.strip(): continue break print(errlines) print(err) assert err.startswith('khmer ') def test_normalize_by_median_2(): CUTOFF = '2' infile = utils.get_temp_filename('test.fa') in_dir = os.path.dirname(infile) shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile) script = 'normalize-by-median.py' args = ['-C', CUTOFF, '-k', '17', infile] utils.runscript(script, args, in_dir) outfile = infile + '.keep' assert os.path.exists(outfile), outfile seqs = [r.sequence for r in screed.open(outfile)] assert len(seqs) == 2, seqs assert seqs[0].startswith('GGTTGACGGGGCTCAGGGGG'), seqs assert seqs[1] == 'GGTTGACGGGGCTCAGGG', seqs def test_normalize_by_median_paired(): CUTOFF = '1' infile = utils.get_temp_filename('test.fa') in_dir = os.path.dirname(infile) shutil.copyfile(utils.get_test_data('test-abund-read-paired.fa'), infile) script = 'normalize-by-median.py' args = ['-C', CUTOFF, '-p', '-k', '17', infile] utils.runscript(script, args, in_dir) outfile = infile + '.keep' assert os.path.exists(outfile), outfile seqs = [r.sequence for r in screed.open(outfile)] assert len(seqs) == 2, seqs assert seqs[0].startswith('GGTTGACGGGGCTCAGGGGG'), seqs assert seqs[1].startswith('GGTTGACGGGGCTCAGGG'), seqs def test_normalize_by_median_paired_fq(): CUTOFF = '20' infile = utils.get_temp_filename('test.fa') in_dir = os.path.dirname(infile) shutil.copyfile(utils.get_test_data('test-abund-read-paired.fq'), infile) script = 'normalize-by-median.py' args = ['-C', CUTOFF, '-p', '-k', '17', infile] _, out, err = utils.runscript(script, args, in_dir) print(out) print(err) outfile = infile + '.keep' assert os.path.exists(outfile), outfile seqs = [r.sequence for r in screed.open(outfile)] assert len(seqs) == 6, len(seqs) assert seqs[0].startswith('GGTTGACGGGGCTCAGGGGG'), seqs assert seqs[1].startswith('GGTTGACGGGGCTCAGGG'), seqs names = [r.name for r in screed.open(outfile)] assert len(names) == 6, names assert '895:1:37:17593:9954 1::FOO' in names, names assert '895:1:37:17593:9954 2::FOO' in names, names def test_normalize_by_median_impaired(): CUTOFF = '1' infile = utils.get_temp_filename('test.fa') in_dir = os.path.dirname(infile) shutil.copyfile(utils.get_test_data('test-abund-read-impaired.fa'), infile) script = 'normalize-by-median.py' args = ['-C', CUTOFF, '-p', '-k', '17', infile] status, out, err = utils.runscript(script, args, in_dir, fail_ok=True) status != 0 assert 'ERROR: Unpaired reads ' in err, err def test_normalize_by_median_force(): CUTOFF = '1' corrupt_infile = utils.get_temp_filename('test-corrupt.fq') good_infile = utils.get_temp_filename('test-good.fq', tempdir=os.path.dirname( corrupt_infile)) in_dir = os.path.dirname(good_infile) shutil.copyfile(utils.get_test_data('test-error-reads.fq'), corrupt_infile) shutil.copyfile(utils.get_test_data('test-fastq-reads.fq'), good_infile) script = 'normalize-by-median.py' args = ['-f', '-C', CUTOFF, '-k', '17', corrupt_infile, good_infile] (status, out, err) = utils.runscript(script, args, in_dir) assert '*** Skipping' in err assert '** I/O Errors' in err def test_normalize_by_median_no_bigcount(): infile = utils.get_temp_filename('test.fa') hashfile = utils.get_temp_filename('test-out.ct') outfile = infile + '.keep' in_dir = os.path.dirname(infile) shutil.copyfile(utils.get_test_data('test-abund-read-2.fa'), infile) counting_ht = _make_counting(infile, K=8) script = 'normalize-by-median.py' args = ['-C', '1000', '-k 8', '--savegraph', hashfile, infile] (status, out, err) = utils.runscript(script, args, in_dir) assert status == 0, (out, err) print((out, err)) assert os.path.exists(hashfile), hashfile kh = khmer.load_countgraph(hashfile) assert kh.get('GGTTGACG') == 255 def test_normalize_by_median_empty(): CUTOFF = '1' infile = utils.get_temp_filename('test.fa') in_dir = os.path.dirname(infile) shutil.copyfile(utils.get_test_data('test-empty.fa'), infile) script = 'normalize-by-median.py' args = ['-C', CUTOFF, '-k', '17', infile] utils.runscript(script, args, in_dir) outfile = infile + '.keep' assert os.path.exists(outfile), outfile def test_normalize_by_median_emptycountgraph(): CUTOFF = '1' infile = utils.get_temp_filename('test.fa') in_dir = os.path.dirname(infile) shutil.copyfile(utils.get_test_data('test-empty.fa'), infile) script = 'normalize-by-median.py' args = ['-C', CUTOFF, '--loadgraph', infile, infile] (status, out, err) = utils.runscript(script, args, in_dir, fail_ok=True) assert status != 0 assert 'ValueError' in err, (status, out, err) def test_normalize_by_median_fpr(): MAX_TABLESIZE_PARAM = 12 infile = utils.get_temp_filename('test-fpr.fq') in_dir = os.path.dirname(infile) shutil.copyfile(utils.get_test_data('test-fastq-reads.fq'), infile) script = 'normalize-by-median.py' args = ['-f', '-k 17', '-x ' + str(MAX_TABLESIZE_PARAM), infile] (status, out, err) = utils.runscript(script, args, in_dir, fail_ok=True) assert status != 0 assert os.path.exists(infile + '.keep'), infile assert '** ERROR: the graph structure is too small' in err, err def write_by_chunks(infile, outfile, CHUNKSIZE=8192): ifile = io.open(infile, 'rb') ofile = io.open(outfile, 'wb') chunk = ifile.read(CHUNKSIZE) while len(chunk) > 0: ofile.write(chunk) chunk = ifile.read(CHUNKSIZE) ifile.close() ofile.close() def test_normalize_by_median_streaming_0(): CUTOFF = '20' infile = utils.get_test_data('100-reads.fq.gz') in_dir = os.path.dirname(infile) fifo = utils.get_temp_filename('fifo') outfile = utils.get_temp_filename('outfile') # Use a fifo to copy stdout to a file for checking os.mkfifo(fifo) thread = threading.Thread(target=write_by_chunks, args=(fifo, outfile)) thread.start() # Execute diginorm script = 'normalize-by-median.py' args = ['-C', CUTOFF, '-k', '17', '-o', fifo, infile] (status, out, err) = utils.runscript(script, args, in_dir) # Merge the thread thread.join() assert os.path.exists(outfile), outfile with open(outfile) as fp: linecount = sum(1 for _ in fp) assert linecount == 400 def test_normalize_by_median_streaming_1(): CUTOFF = '20' infile = utils.get_test_data('test-filter-abund-Ns.fq') in_dir = os.path.dirname(infile) fifo = utils.get_temp_filename('fifo') outfile = utils.get_temp_filename('outfile') # Use a fifo to copy stdout to a file for checking os.mkfifo(fifo) thread = threading.Thread(target=write_by_chunks, args=(infile, fifo)) thread.start() # Execute diginorm script = 'normalize-by-median.py' args = ['-C', CUTOFF, '-k', '17', '-o', outfile, fifo] (status, out, err) = utils.runscript(script, args, in_dir) # Merge the thread thread.join() assert os.path.exists(outfile), outfile assert 'Total number of unique k-mers: 98' in err, err assert 'fifo is empty' not in err, err def test_diginorm_basic_functionality_1(): # each of these pairs has both a multicopy sequence ('ACTTCA...') and # a random sequence. With 'C=1' and '-p', all should be kept. CUTOFF = ['-C', '1'] PAIRING = ['-p'] infile = utils.get_temp_filename('test.fa') in_dir = os.path.dirname(infile) shutil.copyfile(utils.get_test_data('dn-test-all-paired-all-keep.fa'), infile) script = 'normalize-by-median.py' args = list(CUTOFF) + list(PAIRING) + ['-k', '15', infile] _, out, err = utils.runscript(script, args, in_dir) print(out) print(err) outfile = infile + '.keep' assert os.path.exists(outfile), outfile seqs = set([r.name for r in screed.open(outfile)]) assert seqs == set(['a/1', 'a/2', 'b/1', 'b/2', 'c/1', 'c/2', 'd/1', 'd/2']), seqs def test_diginorm_basic_functionality_2(): # each of these pairs has both a multicopy sequence ('ACTTCA...') # and a random sequence ('G...'). With 'C=1' and '--force- # single', only random seqs should be kept, together with one copy # of the multicopy sequence. CUTOFF = ['-C', '1'] PAIRING = ['--force-single'] infile = utils.get_temp_filename('test.fa') in_dir = os.path.dirname(infile) shutil.copyfile(utils.get_test_data('dn-test-all-paired-all-keep.fa'), infile) script = 'normalize-by-median.py' args = list(CUTOFF) + list(PAIRING) + ['-k', '15', infile] _, out, err = utils.runscript(script, args, in_dir) print(out) print(err) outfile = infile + '.keep' assert os.path.exists(outfile), outfile seqs = set([r.name for r in screed.open(outfile)]) assert seqs == set(['a/1', 'a/2', 'b/2', 'c/1', 'd/2']), seqs def test_diginorm_basic_functionality_3(): # This data is entirely unpaired, but with one duplicate ('A...'). # and a random sequence ('G...'). With 'C=1' only three seqs should # be left, with no other complaints. CUTOFF = ['-C', '1'] PAIRING = [] infile = utils.get_temp_filename('test.fa') in_dir = os.path.dirname(infile) shutil.copyfile(utils.get_test_data('dn-test-none-paired.fa'), infile) script = 'normalize-by-median.py' args = list(CUTOFF) + list(PAIRING) + ['-k', '15', infile] _, out, err = utils.runscript(script, args, in_dir) print(out) print(err) outfile = infile + '.keep' assert os.path.exists(outfile), outfile seqs = set([r.name for r in screed.open(outfile)]) assert seqs == set(['a/1', 'b/2', 'd/1']), seqs def test_diginorm_basic_functionality_4(): # This data is mixed paired/unpaired, but with one duplicate ('A...'). # and a random sequence ('G...'). With 'C=2' all of the sequences # should be kept. CUTOFF = ['-C', '1'] infile = utils.get_temp_filename('test.fa') in_dir = os.path.dirname(infile) shutil.copyfile(utils.get_test_data('dn-test-some-paired-all-keep.fa'), infile) script = 'normalize-by-median.py' args = list(CUTOFF) + ['-k', '15', infile] _, out, err = utils.runscript(script, args, in_dir) print(out) print(err) outfile = infile + '.keep' assert os.path.exists(outfile), outfile seqs = set([r.name for r in screed.open(outfile)]) assert seqs == set(['a/1', 'a/2', 'b/2', 'c/1', 'c/2', 'd/2']), seqs def test_diginorm_basic_functionality_5(): # each of these pairs has both a multicopy sequence ('ACTTCA...') and # a random sequence. With 'C=1' and '-p', all should be CUTOFF = ['-C', '1'] PAIRING = ['-p'] infile = utils.get_temp_filename('test.fa') in_dir = os.path.dirname(infile) shutil.copyfile(utils.get_test_data('dn-test-all-paired-all-keep.fa'), infile) script = 'normalize-by-median.py' args = list(CUTOFF) + list(PAIRING) + ['-k', '15', infile] _, out, err = utils.runscript(script, args, in_dir) print(out) print(err) outfile = infile + '.keep' assert os.path.exists(outfile), outfile seqs = set([r.name for r in screed.open(outfile)]) assert seqs == set(['a/1', 'a/2', 'b/1', 'b/2', 'c/1', 'c/2', 'd/1', 'd/2']), seqs
# Copyright 2016 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Tests for fused_batch_norm related functionality in tensorflow.ops.nn.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function import numpy as np from tensorflow.python.framework import constant_op from tensorflow.python.ops import array_ops from tensorflow.python.ops import gradient_checker from tensorflow.python.ops import gradients_impl from tensorflow.python.ops import nn_grad from tensorflow.python.ops import nn_impl from tensorflow.python.platform import test class BatchNormalizationTest(test.TestCase): def _inference_ref(self, x, scale, offset, mean, var, epsilon, data_format): if data_format not in ['NHWC', 'NCHW']: raise ValueError('data_format must be NCHW or NHWC, ' 'got %s.' % data_format) if data_format == 'NCHW': x = array_ops.transpose(x, [0, 2, 3, 1]) y = nn_impl.batch_normalization(x, mean, var, offset, scale, epsilon) if data_format == 'NCHW': y = array_ops.transpose(y, [0, 3, 1, 2]) return y.eval() def _test_inference(self, x_shape, scale_shape, use_gpu=True, data_format='NHWC'): np.random.seed(1) x_val = np.random.random_sample(x_shape).astype(np.float32) scale_val = np.random.random_sample(scale_shape).astype(np.float32) offset_val = np.random.random_sample(scale_shape).astype(np.float32) mean_val = np.random.random_sample(scale_shape).astype(np.float32) var_val = np.random.random_sample(scale_shape).astype(np.float32) with self.test_session(use_gpu=use_gpu) as sess: x = constant_op.constant(x_val, name='x') scale = constant_op.constant(scale_val, name='scale') offset = constant_op.constant(offset_val, name='offset') mean = constant_op.constant(mean_val, name='mean') var = constant_op.constant(var_val, name='variance') epsilon = 0.001 y, _, _ = nn_impl.fused_batch_norm( x, scale, offset, mean=mean, variance=var, epsilon=epsilon, data_format=data_format, is_training=False) y_val = sess.run(y) y_ref = self._inference_ref(x, scale, offset, mean, var, epsilon, data_format) self.assertAllClose(y_ref, y_val, atol=1e-3) def _training_ref(self, x, scale, offset, epsilon, data_format): if data_format not in ['NHWC', 'NCHW']: raise ValueError('data_format must be NCHW or NHWC, ' 'got %s.' % data_format) if data_format == 'NCHW': x = array_ops.transpose(x, [0, 2, 3, 1]) mean, var = nn_impl.moments(x, [0, 1, 2], keep_dims=False) y = nn_impl.batch_normalization(x, mean, var, offset, scale, epsilon) if data_format == 'NCHW': y = array_ops.transpose(y, [0, 3, 1, 2]) return y.eval(), mean.eval(), var.eval() def _test_training(self, x_shape, scale_shape, use_gpu=True, data_format='NHWC'): np.random.seed(1) x_val = np.random.random_sample(x_shape).astype(np.float32) scale_val = np.random.random_sample(scale_shape).astype(np.float32) offset_val = np.random.random_sample(scale_shape).astype(np.float32) with self.test_session(use_gpu=use_gpu) as sess: x = constant_op.constant(x_val, name='x') scale = constant_op.constant(scale_val, name='scale') offset = constant_op.constant(offset_val, name='offset') epsilon = 0.001 y, mean, var = nn_impl.fused_batch_norm( x, scale, offset, epsilon=epsilon, data_format=data_format, is_training=True) y_val, mean_val, var_val = sess.run([y, mean, var]) y_ref, mean_ref, var_ref = self._training_ref(x, scale, offset, epsilon, data_format) self.assertAllClose(y_ref, y_val, atol=1e-3) self.assertAllClose(mean_ref, mean_val, atol=1e-3) # This is for Bessel's correction. tf.nn.moments uses n, instead of n-1, as # the denominator in the formula to calculate variance, while # tf.nn.fused_batch_norm has Bessel's correction built in. sample_size = x_val.size / scale_val.size var_ref = var_ref * sample_size / (max(sample_size - 1.0, 1.0)) self.assertAllClose(var_ref, var_val, atol=1e-3) def _test_gradient(self, x_shape, scale_shape, use_gpu=True, data_format='NHWC', is_training=True): np.random.seed(1) x_val = np.random.random_sample(x_shape).astype(np.float32) scale_val = np.random.random_sample(scale_shape).astype(np.float32) offset_val = np.random.random_sample(scale_shape).astype(np.float32) with self.test_session(use_gpu=use_gpu): x = constant_op.constant(x_val, name='x') scale = constant_op.constant(scale_val, name='scale') offset = constant_op.constant(offset_val, name='offset') if is_training: pop_mean = None pop_var = None else: pop_mean = np.random.random_sample(scale_shape).astype(np.float32) pop_var = np.random.random_sample(scale_shape).astype(np.float32) y, _, _ = nn_impl.fused_batch_norm( x, scale, offset, mean=pop_mean, variance=pop_var, data_format=data_format, is_training=is_training) err_x = gradient_checker.compute_gradient_error(x, x_shape, y, x_shape) err_scale = gradient_checker.compute_gradient_error(scale, scale_shape, y, x_shape) err_offset = gradient_checker.compute_gradient_error(offset, scale_shape, y, x_shape) err_tolerance = 1e-3 self.assertLess(err_x, err_tolerance) self.assertLess(err_scale, err_tolerance) self.assertLess(err_offset, err_tolerance) def _test_grad_grad(self, x_shape, scale_shape, use_gpu=True, data_format='NHWC', is_training=True, err_tolerance=1e-3): np.random.seed(1) x_val = np.random.random_sample(x_shape).astype(np.float32) grad_y_val = np.random.random_sample(x_shape).astype(np.float32) scale_val = np.random.random_sample(scale_shape).astype(np.float32) offset_val = np.random.random_sample(scale_shape).astype(np.float32) with self.test_session(use_gpu=use_gpu) as sess: x = constant_op.constant(x_val, name='x') grad_y = constant_op.constant(grad_y_val, name='grad_y') scale = constant_op.constant(scale_val, name='scale') offset = constant_op.constant(offset_val, name='offset') if is_training: pop_mean = None pop_var = None else: pop_mean = np.random.random_sample(scale_shape).astype(np.float32) pop_var = np.random.random_sample(scale_shape).astype(np.float32) y, _, _ = nn_impl.fused_batch_norm( x, scale, offset, mean=pop_mean, variance=pop_var, data_format=data_format, is_training=is_training) grad_x, grad_scale, grad_offset = gradients_impl.gradients( y, [x, scale, offset], grad_y) if is_training: epsilon = y.op.get_attr('epsilon') data_format = y.op.get_attr('data_format') grad_vals = sess.run([grad_x, grad_scale, grad_offset]) grad_internal = nn_grad._BatchNormGrad(grad_y, x, scale, epsilon, data_format) grad_internal_vals = sess.run(list(grad_internal)) for grad_val, grad_internal_val in zip(grad_vals, grad_internal_vals): self.assertAllClose(grad_val, grad_internal_val, atol=err_tolerance) err_grad_grad_y_1 = gradient_checker.compute_gradient_error( grad_y, x_shape, grad_x, x_shape) err_grad_grad_y_2 = gradient_checker.compute_gradient_error( grad_y, x_shape, grad_scale, scale_shape) err_grad_grad_y_3 = gradient_checker.compute_gradient_error( grad_y, x_shape, grad_offset, scale_shape) # In freeze mode, grad_x is not a function of x. if is_training: err_grad_x_1 = gradient_checker.compute_gradient_error( x, x_shape, grad_x, x_shape) err_grad_x_2 = gradient_checker.compute_gradient_error( x, x_shape, grad_scale, scale_shape) err_grad_scale = gradient_checker.compute_gradient_error( scale, scale_shape, grad_x, x_shape) self.assertLess(err_grad_grad_y_1, err_tolerance) self.assertLess(err_grad_grad_y_2, err_tolerance) self.assertLess(err_grad_grad_y_3, err_tolerance) if is_training: self.assertLess(err_grad_x_1, err_tolerance) self.assertLess(err_grad_x_2, err_tolerance) self.assertLess(err_grad_scale, err_tolerance) def testInference(self): x_shape = [1, 1, 6, 1] if test.is_gpu_available(cuda_only=True): self._test_inference(x_shape, [1], use_gpu=True, data_format='NHWC') self._test_inference(x_shape, [1], use_gpu=True, data_format='NCHW') self._test_inference(x_shape, [1], use_gpu=False, data_format='NHWC') x_shape = [1, 1, 6, 2] if test.is_gpu_available(cuda_only=True): self._test_inference(x_shape, [2], use_gpu=True, data_format='NHWC') self._test_inference(x_shape, [2], use_gpu=False, data_format='NHWC') x_shape = [1, 2, 1, 6] if test.is_gpu_available(cuda_only=True): self._test_inference(x_shape, [2], use_gpu=True, data_format='NCHW') x_shape = [27, 131, 127, 6] if test.is_gpu_available(cuda_only=True): self._test_inference(x_shape, [131], use_gpu=True, data_format='NCHW') self._test_inference(x_shape, [6], use_gpu=True, data_format='NHWC') self._test_inference(x_shape, [6], use_gpu=False, data_format='NHWC') def testTraining(self): x_shape = [1, 1, 6, 1] if test.is_gpu_available(cuda_only=True): self._test_training(x_shape, [1], use_gpu=True, data_format='NHWC') self._test_training(x_shape, [1], use_gpu=True, data_format='NCHW') self._test_training(x_shape, [1], use_gpu=False, data_format='NHWC') x_shape = [1, 1, 6, 2] if test.is_gpu_available(cuda_only=True): self._test_training(x_shape, [2], use_gpu=True, data_format='NHWC') self._test_training(x_shape, [2], use_gpu=False, data_format='NHWC') x_shape = [1, 2, 1, 6] if test.is_gpu_available(cuda_only=True): self._test_training(x_shape, [2], use_gpu=True, data_format='NCHW') x_shape = [27, 131, 127, 6] if test.is_gpu_available(cuda_only=True): self._test_training(x_shape, [131], use_gpu=True, data_format='NCHW') self._test_training(x_shape, [6], use_gpu=True, data_format='NHWC') self._test_training(x_shape, [6], use_gpu=False, data_format='NHWC') def testBatchNormGrad(self): for is_training in [True, False]: x_shape = [1, 1, 6, 1] if test.is_gpu_available(cuda_only=True): self._test_gradient( x_shape, [1], use_gpu=True, data_format='NHWC', is_training=is_training) self._test_gradient( x_shape, [1], use_gpu=True, data_format='NCHW', is_training=is_training) self._test_gradient( x_shape, [1], use_gpu=False, data_format='NHWC', is_training=is_training) x_shape = [1, 1, 6, 2] if test.is_gpu_available(cuda_only=True): self._test_gradient( x_shape, [2], use_gpu=True, data_format='NHWC', is_training=is_training) self._test_gradient( x_shape, [2], use_gpu=False, data_format='NHWC', is_training=is_training) x_shape = [1, 2, 1, 6] if test.is_gpu_available(cuda_only=True): self._test_gradient( x_shape, [2], use_gpu=True, data_format='NCHW', is_training=is_training) x_shape = [7, 9, 13, 6] if test.is_gpu_available(cuda_only=True): self._test_gradient( x_shape, [9], use_gpu=True, data_format='NCHW', is_training=is_training) self._test_gradient( x_shape, [6], use_gpu=True, data_format='NHWC', is_training=is_training) self._test_gradient( x_shape, [6], use_gpu=False, data_format='NHWC', is_training=is_training) def _testBatchNormGradGrad(self, config): shape = config['shape'] err_tolerance = config['err_tolerance'] for is_training in [True, False]: if test.is_gpu_available(cuda_only=True): self._test_grad_grad( shape, [shape[3]], use_gpu=True, data_format='NHWC', is_training=is_training, err_tolerance=err_tolerance) self._test_grad_grad( shape, [shape[1]], use_gpu=True, data_format='NCHW', is_training=is_training, err_tolerance=err_tolerance) self._test_grad_grad( shape, [shape[3]], use_gpu=False, data_format='NHWC', is_training=is_training, err_tolerance=err_tolerance) def testBatchNormGradGrad(self): configs = [{ 'shape': [2, 3, 4, 5], 'err_tolerance': 1e-2 }, { 'shape': [2, 3, 2, 2], 'err_tolerance': 1e-3 }] for config in configs: self._testBatchNormGradGrad(config) if __name__ == '__main__': test.main()
#!/usr/bin/python3.4 # vim:ts=4:sw=4:softtabstop=4:smarttab:expandtab # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # http://www.apache.org/licenses/LICENSE-2.0 # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """ Classes and functions for controlling, reading, and writing to co-processes. """ import sys import os import signal from signal import SIGCHLD, SIGTERM, SIGSTOP, SIGCONT, SIGHUP, SIG_DFL, SIGINT from errno import EBADF, EIO from pycopia import logging from pycopia import shparser from pycopia.aid import NULL from pycopia.OS.procfs import ProcStat from pycopia.OS.exitstatus import ExitStatus from pycopia.OS.procutils import run_as from pycopia.OS import scheduler from pycopia.fileutils import close_on_exec, set_nonblocking class ProcessError(Exception): pass class Process: """Abstract base class for Processes. Handles all process handling, and some common functionality. I/O is handled in subclasses. """ def __init__(self, cmdline, logfile=None, callback=None, async=False): self.cmdline = cmdline self.deadchild = 0 self.closed = False self.callback = callback # called at death of process self._restart = True # restart interrupted system calls self._buf = b'' self._errbuf = b'' self._writebuf = b'' self.exitstatus = None self._environment = None self._async = bool(async) # use asyncio, or not self._authtoken = None self.logfile = logfile def __enter__(self): return self def __exit__(self, extype, exvalue, traceback): self.close() return False # Override in subclass -- close your file descriptors connected to # subprocess. def close(self): self.closed = True def __repr__(self): return "{0}({1!r}, async={2!r})".format( self.__class__.__name__, self.cmdline, self._async) def __str__(self): if self.deadchild: return str(self.exitstatus) else: st = self.stat() try: tty = os.ttyname(self.fileno()) except: tty = "?" return "{:6d} {:7s} ({}) {}".format(st.pid, tty, st.statestr(), self.cmdline) def __int__(self): return self.childpid def __hash__(self): return id(self) def restart(self, flag=1): old = self._restart self._restart = bool(flag) return old def clone(self): """Spawns a copy of this process. Note that the log file is not inherited. """ return self.__class__(self.cmdline, env=self.environment, callback=self.callback, async=self._async) @property def logfile(self): """A bytes file-like object that IO will be written to.""" return self._log @logfile.setter def logfile(self, newlog): if newlog is None: self._log = newlog return newlog.write # asserts newlog has write method try: self._log = newlog.buffer except AttributeError: self._log = newlog @logfile.deleter def logfile(self): self._log = None @property def environment(self): if self._environment is None: ps = ProcStat(self.childpid) self._environment = ps.environment return self._environment @environment.setter def environment(self, env): assert isinstance(env, dict), "Environment must be a dictionary" self._environment = env @environment.deleter def environment(self): self._environment = None @property def basename(self): return os.path.basename(self.cmdline.split()[0]) def kill(self, sig=SIGINT): if not self.deadchild: self.set_callback(None) # explicit kill means no restart os.kill(self.childpid, sig) def killwait(self, sig=SIGINT): self.kill(sig) return self.wait() def stop(self): os.kill(self.childpid, SIGSTOP) def cont(self): os.kill(self.childpid, SIGCONT) self.deadchild = 0 def hangup(self): os.kill(self.childpid, SIGHUP) def wait(self, option=0): """wait() retrieves process exit status. Note that this may block if the process is still running. """ if self.exitstatus is not None: return self.exitstatus else: pm = get_procmanager() return pm.waitproc(self) def setpgid(self, pgid): os.setpgid(self.childpid, pgid) def set_exitstatus(self, exitstatus): self.exitstatus = exitstatus def set_callback(self, cb=None): """set_callback(cb) Sets the callback function that will be called when child dies. """ self.callback = cb def dead(self): """dead() Called when the child dies. Usually only the ProcManager uses this.""" self.deadchild = 1 if self.callback: self.callback(self) def stat(self): return ProcStat(self.childpid) def fstat(self): return os.fstat(self.fileno()) def isdead(self): return self.deadchild # Process object considered true if child alive, false if child dead. def __bool__(self): return not self.deadchild def read(self, amt=2147483646): if amt < 0: amt = 2147483646 bs = len(self._buf) try: while bs < amt: c = self._read(4096) if not c: break self._buf += c bs = len(self._buf) except EOFError: # TODO log an error pass # let it ruturn rest of buffer data = self._buf[:amt] self._buf = self._buf[amt:] return data def readerr(self, amt=2147483646): if amt < 0: amt = 2147483646 rs = 1024 try: while len(self._errbuf) < amt: c = self._readerr(rs) if not c: break self._errbuf += c except EOFError: pass amt = min(amt, len(self._errbuf)) data = self._errbuf[:amt] self._errbuf = self._errbuf[amt:] return data # extra fileobject methods. def readline(self, amt=2147483646): if amt < 0: amt = 2147483646 bufs = [] rs = min(100, amt) while 1: c = self.read(rs) i = c.find(b"\n") if i < 0 and len(c) > amt: i = amt-1 elif amt <= i: i = amt-1 if i >= 0 or c == b'': bufs.append(c[:i+1]) self._unread(c[i+1:]) return b"".join(bufs) bufs.append(c) amt -= len(c) rs = min(amt, rs*2) def readlines(self, sizehint=2147483646): if sizehint < 0: sizehint = 2147483646 rv = [] while sizehint > 0: line = self.readline() if not line: break rv.append(line) sizehint -= len(line) return rv def _write_buf(self): writ = self._write(self._writebuf) self._writebuf = self._writebuf[writ:] return writ def write(self, data): while self._writebuf: writ = self._write(self._writebuf) self._writebuf = data[writ:] writ = self._write(data) self._writebuf = data[writ:] return writ send = write def tell(self): raise IOError((EBADF, "Process object not seekable")) def seek(self, pos, whence=0): raise IOError((EBADF, "Process object not seekable")) def rewind(self): raise IOError((EBADF, "Process object not seekable")) def flush(self): return None def _unread(self, data): self._buf = data + self._buf # Interface for asyncio poller. def readable(self): return True def writable(self): return bool(self._writebuf) def priority(self): return False def read_handler(self): data = self._read(16384) logging.warning("unhandled read from process") def write_handler(self): self._write_buf() def pri_handler(self): pass def hangup_handler(self): logging.info("Hangup: {}.\n".format(self.cmdline)) def error_handler(self): logging.error( "Async handler error occured: {}.\n".format(self.basename)) def exception_handler(self, ex, val, tb): logging.error("Error event: {} ({})\n".format(ex, val)) class ProcessPipe(Process): """Process(<commandline>, [<logfile>], [environ]) Forks and execs a process as given by the command line argument. The process's stdio is connected to this instance via pipes, and can be read and written to by the instances read() and write() methods. """ def __init__(self, cmdline, logfile=None, env=None, callback=None, merge=1, pwent=None, async=False, devnull=None, _pgid=0): super().__init__(cmdline, logfile, callback, async) if env: self.environment = env cmd = split_command_line(self.cmdline) # now, fork the child connected by pipes p2cread, self._p_stdin = os.pipe() os.set_inheritable(p2cread, True) self._p_stdout, c2pwrite = os.pipe() os.set_inheritable(c2pwrite, True) if merge: self._stderr, c2perr = None, None else: self._stderr, c2perr = os.pipe() self.childpid = os.fork() self.childpid2 = None # for compatibility with pipeline if self.childpid == 0: # Child os.setpgid(0, _pgid) os.close(0) os.close(1) os.close(2) os.dup2(p2cread, 0) os.close(p2cread) os.dup2(c2pwrite, 1) if merge: os.dup2(c2pwrite, 2) else: os.dup2(c2perr, 2) os.close(c2perr) os.close(c2pwrite) try: if pwent: run_as(pwent) if env: os.execvpe(cmd[0], cmd, env) else: os.execvp(cmd[0], cmd) finally: os._exit(127) # Shouldn't come here os._exit(127) # parent os.close(p2cread) os.close(c2pwrite) if c2perr: os.close(c2perr) def isatty(self): return os.isatty(self._p_stdin) def fileno(self): if self._p_stdout is None: raise ValueError("I/O operation on closed process") return self._p_stdout def filenos(self): """filenos() Returns tuple of all file descriptors used in this object. """ if self._p_stdout is None: raise ValueError("I/O operation on closed process") return self._p_stdout, self._p_stdin, self._stderr def nonblocking(self, flag=1): for fd in self._p_stdout, self._p_stdin, self._stderr: set_nonblocking(fd, flag) def interrupt(self): self.kill(SIGINT) def close(self): if self.closed: return super(ProcessPipe, self).close() try: os.close(self._p_stdin) except (TypeError, OSError): pass try: os.close(self._p_stdout) except (TypeError, OSError): pass if self._stderr: try: os.close(self._stderr) except (TypeError, OSError): pass self._stderr = None self._p_stdin = None self._p_stdout = None self.callback = None # break a possible reference loop def _write(self, data): return os.write(self._p_stdin, data) def _read_fd(self, fd, length): data = os.read(fd, length) if self._log is not None: self._log.write(data) return data def _read(self, amt=4096): if self._p_stdout is None: return b"" return self._read_fd(self._p_stdout, amt) def _readerr(self, amt): if self._stderr is None: return b"" return self._read_fd(self._stderr, amt) class ProcessPty(Process): """ProcessPty(<commandline>, [<logfilename>], [environ]) Forks and execs a process as given by the command line argument. The process's stdio is connected to this instance via a pty, and can be read and written to by the instances read() and write() methods. That pty becomes the processes controlling terminal. """ def __init__(self, cmdline, logfile=None, env=None, callback=None, merge=1, pwent=None, async=False, devnull=False, _pgid=0): super().__init__(cmdline, logfile, callback, async) if env: self.environment = env cmd = split_command_line(self.cmdline) try: pid, self._fd = os.forkpty() except OSError as err: logging.error("ProcessPty error: {}".format(err)) raise else: if pid == 0: # child sys.excepthook = sys.__excepthook__ if devnull: # Redirect standard file descriptors. sys.stdout.flush() sys.stderr.flush() os.close(sys.__stdin__.fileno()) os.close(sys.__stdout__.fileno()) os.close(sys.__stderr__.fileno()) # stdin always from /dev/null sys.stdin = open("/dev/null", 'r') os.dup2(sys.stdin.fileno(), 0) # log file is stdout and stderr, otherwise /dev/null if logfile is None: sys.stdout = open("/dev/null", 'a+') sys.stderr = open("/dev/null", 'a+', 0) os.dup2(sys.stdout.fileno(), 1) os.dup2(sys.stderr.fileno(), 2) else: so = se = sys.stdout = sys.stderr = logfile os.dup2(so.fileno(), 1) os.dup2(se.fileno(), 2) try: if pwent: run_as(pwent) if env: os.execvpe(cmd[0], cmd, env) else: os.execvp(cmd[0], cmd) finally: os._exit(127) # should not be reached else: # parent close_on_exec(self._fd) self.childpid = pid self.childpid2 = None # for compatibility with pipeline self._intr = None self._eof = None def isatty(self): return os.isatty(self._fd) def fileno(self): if self._fd is None: raise ValueError("I/O operation on closed process") return self._fd def filenos(self): """filenos() Returns tuple of all file descriptors used in this object. """ if self._fd is None: raise ValueError("I/O operation on closed process") return (self._fd,) def nonblocking(self, flag=1): set_nonblocking(self._fd, flag) def interrupt(self): """Like pressing Ctl-C on most terminals.""" if self._intr is None: from pycopia import tty self._intr = tty.get_intr_char(self._fd) self._write(self._intr) def send_eof(self): """Like pressing Ctl-D on most terminals.""" if self._eof is None: from pycopia import tty self._eof = tty.get_eof_char(self._fd) self._write(self._eof) def close(self): if self.closed: return super(ProcessPty, self).close() try: os.close(self._fd) except (TypeError, OSError): pass self._fd = None self.callback = None # break a possible reference loop def _write(self, data): return os.write(self._fd, data) def _read(self, length=100): data = os.read(self._fd, length) if self._log is not None: self._log.write(data) return data class CoProcessPty(ProcessPty): def __init__(self, method, logfile=None, env=None, callback=None, async=False, pwent=None, _pgid=0): super().__init__("python: %s" % (method.__name__,), logfile, callback, async) pid, self._fd = os.forkpty() self.childpid = pid self.childpid2 = None # for compatibility with pipeline if pid == 0 and pwent: run_as(pwent) class CoProcessPipe(ProcessPipe): def __init__(self, method, logfile=None, env=None, callback=None, merge=False, async=False, pwent=None, _pgid=0): super().__init__("python <=> %s" % (method.__name__,), logfile, callback, async) p2cread, self._p_stdin = os.pipe() os.set_inheritable(p2cread, True) self._p_stdout, c2pwrite = os.pipe() os.set_inheritable(c2pwrite, True) if merge: self._stderr, c2perr = None, None else: self._stderr, c2perr = os.pipe() os.set_inheritable(c2perr, True) self.childpid = os.fork() self.childpid2 = None if self.childpid == 0: try: # Child os.close(0) os.close(1) os.close(2) os.dup2(p2cread, 0) # sys.stdin = os.fdopen(0, mode="r") os.dup2(c2pwrite, 1) # sys.stdout = os.fdopen(1, mode="w") if merge: os.dup2(c2pwrite, 2) # sys.stderr = os.fdopen(2, mode="w") else: os.dup2(c2perr, 2) # sys.stderr = os.fdopen(2, mode="w") if pwent: run_as(pwent) except Exception: logging.exception_error("CoProcessPipe") os.close(p2cread) os.close(c2pwrite) if c2perr: os.close(c2perr) # simply forks this python process class SubProcess(Process): def __init__(self, pwent=None, _pgid=0): super().__init__(sys.argv[0]) pid = os.fork() if pid == 0: sys.excepthook = sys.__excepthook__ # remove any debugger hook if pwent: run_as(pwent) self.childpid = pid self.childpid2 = None # for compatibility with pipeline # TODO need a more general pipeline class ProcessPipeline(ProcessPipe): """Connects two commands via a pipe, they appear as one process object.""" def __init__(self, cmdline, logfile=None, env=None, callback=None, merge=None, pwent=None, async=False, devnull=None, _pgid=0): assert cmdline.count("|") == 1 [cmdline1, cmdline2] = cmdline.split("|") if env: self.environment = env super().__init__(cmdline2, logfile, callback, async) self._stderr = None cmd1 = split_command_line(cmdline1) cmd2 = split_command_line(cmdline2) # self._p_stdin -> cmd1 -> p_write|p_read -> cmd2 -> self._p_stdout _p_stdout, self._p_stdin = os.pipe() p_read, p_write = os.pipe() self._p_stdout, _p_stdin = os.pipe() self.childpid = os.fork() # cmd1 if self.childpid == 0: # Child 1 os.dup2(_p_stdout, 0) os.dup2(p_write, 1) self._exec(cmd1, env, pwent) os._exit(127) # cmd2 cmd2pid = os.fork() if cmd2pid == 0: # Child 2 os.dup2(p_read, 0) os.dup2(_p_stdin, 1) self._exec(cmd2, env, pwent) os._exit(127) self.childpid2 = cmd2pid # close our copies os.close(_p_stdout) os.close(_p_stdin) os.close(p_read) os.close(p_write) def _exec(self, cmd, env, pwent): # close all other file descriptors for child. if pwent: run_as(pwent) if env: os.execvpe(cmd[0], cmd, env) else: os.execvp(cmd[0], cmd) class ProcManager(object): """An instance of ProcManager manages a collection of child processes. It is a singleton, and you should use the get_procmanager() factory function to get the instance. """ def __init__(self): self._pgid = os.getpgid(0) self._procs = {} signal.signal(SIGCHLD, self._child_handler) signal.siginterrupt(SIGCHLD, False) def __len__(self): return len(self._procs) def __str__(self): s = [] for p in self.getprocs(): s.append(str(p)) return "\n".join(s) def spawnprocess(self, pklass, cmd, logfile=None, env=None, callback=None, persistent=False, merge=True, pwent=None, async=False, devnull=False): """Start a child process using a user supplied subclass of ProcessPty or ProcessPipe. """ if persistent and (callback is None): callback = self.respawn_callback signal.signal(SIGCHLD, SIG_DFL) # critical area proc = pklass(cmd, logfile=logfile, env=env, callback=callback, merge=merge, pwent=pwent, async=async, devnull=devnull, _pgid=self._pgid) self._procs[proc.childpid] = proc # TODO need a more general pipeline if proc.childpid2: self._procs[proc.childpid2] = proc signal.signal(SIGCHLD, self._child_handler) signal.siginterrupt(SIGCHLD, False) return proc def spawnpipe(self, cmd, logfile=None, env=None, callback=None, persistent=False, merge=True, pwent=None, async=False, devnull=False): """Start a child process, connected by pipes.""" if cmd.find("|") > 0: klass = ProcessPipeline else: klass = ProcessPipe return self.spawnprocess(klass, cmd, logfile, env, callback, persistent, merge, pwent, async, devnull) # default spawn method spawn = spawnpipe def spawnpty(self, cmd, logfile=None, env=None, callback=None, persistent=False, merge=True, pwent=None, async=False, devnull=False): """Start a child process using a pty. The <persistent> variable is the number of times the process will be respawned if the previous invocation dies. """ return self.spawnprocess(ProcessPty, cmd, logfile, env, callback, persistent, merge, pwent, async, devnull) def coprocess(self, method, args=(), logfile=None, env=None, callback=None, async=False): signal.signal(SIGCHLD, SIG_DFL) # critical area proc = CoProcessPipe(method, logfile=logfile, env=env, callback=callback, async=async) if proc.childpid == 0: os.setpgid(0, self._pgid) sys.excepthook = sys.__excepthook__ # child is not managing any of these self._procs.clear() try: rv = method(*args) except SystemExit as val: rv = int(val) except Exception: logging.exception_error("coprocess") rv = 127 if rv is None: rv = 0 try: rv = int(rv) except: rv = 0 os._exit(rv) self._procs[proc.childpid] = proc signal.signal(SIGCHLD, self._child_handler) signal.siginterrupt(SIGCHLD, False) return proc def subprocess(self, _method, *args, **kwargs): return self.submethod(_method, args, kwargs) def submethod(self, _method, args=None, kwargs=None, pwent=None): args = args or () kwargs = kwargs or {} signal.signal(SIGCHLD, SIG_DFL) # critical area proc = SubProcess(pwent=pwent) if proc.childpid == 0: # in child os.setpgid(0, self._pgid) sys.excepthook = sys.__excepthook__ self._procs.clear() try: rv = _method(*args, **kwargs) except SystemExit as val: rv = val.code except: ex, val, tb = sys.exc_info() try: import traceback try: fname = _method.__name__ except AttributeError: try: fname = _method.__class__.__name__ except AttributeError: fname = str(_method) with open("/tmp/" + fname + "_error.log", "w+") as errfile: traceback.print_exception(ex, val, tb, None, errfile) finally: ex = val = tb = None rv = 127 if rv is None: rv = 0 try: rv = int(rv) except: rv = 0 os._exit(rv) else: self._procs[proc.childpid] = proc signal.signal(SIGCHLD, self._child_handler) signal.siginterrupt(SIGCHLD, False) return proc # introspection and query methods def getpids(self): """getpids() Returns a list of managed PIDs (which are integers).""" return list(self._procs.keys()) def getprocs(self): """getprocs() Returns a list of managed process objects.""" return list(self._procs.values()) def getbyname(self, name): """getbyname(procname) Returns a list of process objects that match the given name. """ name = os.path.basename(name) return [p for p in list(self._procs.values()) if p.basename == name] def getbypid(self, pid): """getbypid(pid) Returns the process object that matches the given PID. """ try: return self._procs[pid] except KeyError: return None def getstats(self): """getstats() Returns a list of process status objects (ProcStat) for each managed process. """ return [ProcStat(o) for o in list(self._procs.keys())] def killall(self, name=None, sig=SIGTERM): """Kills all managed processes with the name 'name'. If 'name' not given kill ALL processes. Default signal is SIGTERM. """ if name is None: procs = list(self._procs.values()) else: procs = self.getbyname(name) for p in procs: p.close() p.kill(sig) def kill(self, proc, sig=SIGINT): proc.kill(sig) def stopall(self): """Sends STOP to all managed processes. To restart get the process objects and invoke the cont() method. """ for p in list(self._procs.values()): p.stop() def clone(self, proc=None): """clone([proc]) clones the supplied process object and manages it as well. If no process object is supplied then clone the first managed process found in this ProcManager. """ if proc is None: # default to cloning first process found. procs = list(self._procs.values()) if procs: proc = procs[0] del procs else: return signal.signal(SIGCHLD, SIG_DFL) # critical area newproc = proc.clone() self._procs[newproc.childpid] = newproc signal.signal(SIGCHLD, self._child_handler) signal.siginterrupt(SIGCHLD, False) return newproc def respawn_callback(self, deadproc): """Callback that performs a respawn, for persistent services.""" if deadproc.exitstatus.status == 127: logging.error("process {!r} didn't start (NOT restarting).\n".format( # noqa deadproc.cmdline)) raise ProcessError("Process never started. Check command line.") elif not deadproc.exitstatus: logging.error("process {!r} died: %s (restarting in 1 sec.).\n".format( # noqa deadproc.cmdline, deadproc.exitstatus)) scheduler.add(self._respawn, 1.0, args=(deadproc,)) else: logging.info("process {!r} normal exit (NOT restarting).\n".format( deadproc.cmdline)) return None def _respawn(self, deadproc): new = self.clone(deadproc) new._log = deadproc._log # this is the SIGCHLD signal handler def _child_handler(self, sig, stack): pid, sts = os.waitpid(-1, os.WNOHANG) proc = self._procs.get(pid) if proc is not None: self._proc_status(proc, sts) signal.signal(SIGCHLD, self._child_handler) signal.siginterrupt(SIGCHLD, False) def waitpid(self, pid, option=0): try: proc = self._procs[pid] except KeyError: logging.warning("Wait on unmanaged process (pid: %s)." % pid) cmdline = ProcStat(pid).cmdline pid, sts = os.waitpid(pid, option) return ExitStatus(sts, cmdline.split()[0]) return self.waitproc(proc) def waitproc(self, proc, option=0): # waits for a Process object. """waitproc(process, [option]) Waits for a process object to finish. Depends on signal handler. """ if proc.exitstatus is not None: return proc.exitstatus signal.signal(SIGCHLD, SIG_DFL) try: pid, sts = os.waitpid(proc.childpid, option) finally: signal.signal(SIGCHLD, self._child_handler) signal.siginterrupt(SIGCHLD, False) return self._proc_status(proc, sts) def _proc_status(self, proc, sts): es = ExitStatus(sts, proc.cmdline.split()[0]) proc.set_exitstatus(es) # XXX untested with stopped processes if es.state != ExitStatus.STOPPED: proc.dead() del self._procs[proc.childpid] return es def loop(self, poller, timeout=-1.0, callback=NULL): while self._procs: poller.poll(timeout) callback(self) if scheduler.get_scheduler(): # wait for any restarts scheduler.sleep(1.5) def get_procmanager(): """get_procmanager() returns the procmanager. A ProcManager is a singleton instance. Always use this factory function to get it.""" global procmanager try: return procmanager except NameError: procmanager = ProcManager() return procmanager def remove_procmanager(): global procmanager signal.signal(SIGCHLD, SIG_DFL) del procmanager # Process manager factory functions def spawnpipe(cmd, logfile=None, env=None, callback=None, persistent=False, merge=True, pwent=None, async=False): """Start a child process, connected by pipes. """ pm = get_procmanager() proc = pm.spawnpipe(cmd, logfile, env, callback, persistent, merge, pwent, async) return proc def spawnpty(cmd, logfile=None, env=None, callback=None, persistent=False, merge=True, pwent=None, async=False, devnull=False): """Start a child process using a pty. """ pm = get_procmanager() proc = pm.spawnpty(cmd, logfile, env, callback, persistent, merge, pwent, async, devnull) return proc def coprocess(func, args=(), logfile=None, env=None, callback=None, async=False): """Works like fork(), but connects the childs stdio to a pty. Returns a file-like object connected to the master end of the child pty. """ pm = get_procmanager() cp = pm.coprocess(func, args, logfile, env, callback, async) return cp def waitproc(proc, option=0): pm = get_procmanager() return pm.waitproc(proc, option) def subprocess(method, *args, **kwargs): pm = get_procmanager() return pm.subprocess(method, *args, **kwargs) def submethod(_method, args=None, kwargs=None, pwent=None): pm = get_procmanager() return pm.submethod(_method, args, kwargs, pwent) def getstatusoutput(cmd, logfile=None, env=None, callback=None): p = spawnpipe(cmd, logfile, env, callback) text = p.read() p.wait() return p.exitstatus, text def call(*args, **kwargs): return spawnpipe(*args, **kwargs).wait() def setpgid(pid_or_proc, pgrp): pid = int(pid_or_proc) return os.setpgid(pid, pgrp) split_command_line = shparser.get_command_splitter()
# Copyright 2014 Mellanox Technologies, Ltd # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or # implied. # See the License for the specific language governing permissions and # limitations under the License. import socket import sys import time import eventlet eventlet.monkey_patch() from oslo.config import cfg from oslo import messaging from neutron.agent import rpc as agent_rpc from neutron.agent import securitygroups_rpc as sg_rpc from neutron.common import config as common_config from neutron.common import constants as q_constants from neutron.common import topics from neutron.common import utils as q_utils from neutron import context from neutron.i18n import _LE, _LI from neutron.openstack.common import log as logging from neutron.openstack.common import loopingcall from neutron.plugins.sriovnicagent.common import config # noqa from neutron.plugins.sriovnicagent.common import exceptions as exc from neutron.plugins.sriovnicagent import eswitch_manager as esm LOG = logging.getLogger(__name__) class SriovNicSwitchRpcCallbacks(sg_rpc.SecurityGroupAgentRpcCallbackMixin): # Set RPC API version to 1.0 by default. # history # 1.1 Support Security Group RPC target = messaging.Target(version='1.1') def __init__(self, context, agent): super(SriovNicSwitchRpcCallbacks, self).__init__() self.context = context self.agent = agent self.sg_agent = agent def port_update(self, context, **kwargs): LOG.debug("port_update received") port = kwargs.get('port') # Put the port mac address in the updated_devices set. # Do not store port details, as if they're used for processing # notifications there is no guarantee the notifications are # processed in the same order as the relevant API requests. self.agent.updated_devices.add(port['mac_address']) LOG.debug("port_update RPC received for port: %s", port['id']) class SriovNicSwitchPluginApi(agent_rpc.PluginApi, sg_rpc.SecurityGroupServerRpcApiMixin): pass class SriovNicSwitchAgent(sg_rpc.SecurityGroupAgentRpcMixin): def __init__(self, physical_devices_mappings, exclude_devices, polling_interval, root_helper): self.polling_interval = polling_interval self.root_helper = root_helper self.setup_eswitch_mgr(physical_devices_mappings, exclude_devices) configurations = {'device_mappings': physical_devices_mappings} self.agent_state = { 'binary': 'neutron-sriov-nic-agent', 'host': cfg.CONF.host, 'topic': q_constants.L2_AGENT_TOPIC, 'configurations': configurations, 'agent_type': q_constants.AGENT_TYPE_NIC_SWITCH, 'start_flag': True} # Stores port update notifications for processing in the main loop self.updated_devices = set() self._setup_rpc() self.init_firewall() # Initialize iteration counter self.iter_num = 0 def _setup_rpc(self): self.agent_id = 'nic-switch-agent.%s' % socket.gethostname() LOG.info(_LI("RPC agent_id: %s"), self.agent_id) self.topic = topics.AGENT self.plugin_rpc = SriovNicSwitchPluginApi(topics.PLUGIN) self.state_rpc = agent_rpc.PluginReportStateAPI(topics.PLUGIN) # RPC network init self.context = context.get_admin_context_without_session() # Handle updates from service self.endpoints = [SriovNicSwitchRpcCallbacks(self.context, self)] # Define the listening consumers for the agent consumers = [[topics.PORT, topics.UPDATE], [topics.NETWORK, topics.DELETE], [topics.SECURITY_GROUP, topics.UPDATE]] self.connection = agent_rpc.create_consumers(self.endpoints, self.topic, consumers) report_interval = cfg.CONF.AGENT.report_interval if report_interval: heartbeat = loopingcall.FixedIntervalLoopingCall( self._report_state) heartbeat.start(interval=report_interval) def _report_state(self): try: devices = len(self.eswitch_mgr.get_assigned_devices()) self.agent_state.get('configurations')['devices'] = devices self.state_rpc.report_state(self.context, self.agent_state) self.agent_state.pop('start_flag', None) except Exception: LOG.exception(_LE("Failed reporting state!")) def setup_eswitch_mgr(self, device_mappings, exclude_devices={}): self.eswitch_mgr = esm.ESwitchManager(device_mappings, exclude_devices, self.root_helper) def scan_devices(self, registered_devices, updated_devices): curr_devices = self.eswitch_mgr.get_assigned_devices() device_info = {} device_info['current'] = curr_devices device_info['added'] = curr_devices - registered_devices # we don't want to process updates for devices that don't exist device_info['updated'] = updated_devices & curr_devices # we need to clean up after devices are removed device_info['removed'] = registered_devices - curr_devices return device_info def _device_info_has_changes(self, device_info): return (device_info.get('added') or device_info.get('updated') or device_info.get('removed')) def process_network_devices(self, device_info): resync_a = False resync_b = False self.prepare_devices_filter(device_info.get('added')) if device_info.get('updated'): self.refresh_firewall() # Updated devices are processed the same as new ones, as their # admin_state_up may have changed. The set union prevents duplicating # work when a device is new and updated in the same polling iteration. devices_added_updated = (set(device_info.get('added')) | set(device_info.get('updated'))) if devices_added_updated: resync_a = self.treat_devices_added_updated(devices_added_updated) if device_info.get('removed'): resync_b = self.treat_devices_removed(device_info['removed']) # If one of the above operations fails => resync with plugin return (resync_a | resync_b) def treat_device(self, device, pci_slot, admin_state_up): if self.eswitch_mgr.device_exists(device, pci_slot): try: self.eswitch_mgr.set_device_state(device, pci_slot, admin_state_up) except exc.SriovNicError: LOG.exception(_LE("Failed to set device %s state"), device) return if admin_state_up: # update plugin about port status self.plugin_rpc.update_device_up(self.context, device, self.agent_id, cfg.CONF.host) else: self.plugin_rpc.update_device_down(self.context, device, self.agent_id, cfg.CONF.host) else: LOG.info(_LI("No device with MAC %s defined on agent."), device) def treat_devices_added_updated(self, devices): try: devices_details_list = self.plugin_rpc.get_devices_details_list( self.context, devices, self.agent_id) except Exception as e: LOG.debug("Unable to get port details for devices " "with MAC address %(devices)s: %(e)s", {'devices': devices, 'e': e}) # resync is needed return True for device_details in devices_details_list: device = device_details['device'] LOG.debug("Port with MAC address %s is added", device) if 'port_id' in device_details: LOG.info(_LI("Port %(device)s updated. Details: %(details)s"), {'device': device, 'details': device_details}) profile = device_details['profile'] self.treat_device(device_details['device'], profile.get('pci_slot'), device_details['admin_state_up']) else: LOG.info(_LI("Device with MAC %s not defined on plugin"), device) return False def treat_devices_removed(self, devices): resync = False for device in devices: LOG.info(_LI("Removing device with mac_address %s"), device) try: dev_details = self.plugin_rpc.update_device_down(self.context, device, self.agent_id, cfg.CONF.host) except Exception as e: LOG.debug("Removing port failed for device %(device)s " "due to %(exc)s", {'device': device, 'exc': e}) resync = True continue if dev_details['exists']: LOG.info(_LI("Port %s updated."), device) else: LOG.debug("Device %s not defined on plugin", device) return resync def daemon_loop(self): sync = True devices = set() LOG.info(_LI("SRIOV NIC Agent RPC Daemon Started!")) while True: start = time.time() LOG.debug("Agent rpc_loop - iteration:%d started", self.iter_num) if sync: LOG.info(_LI("Agent out of sync with plugin!")) devices.clear() sync = False device_info = {} # Save updated devices dict to perform rollback in case # resync would be needed, and then clear self.updated_devices. # As the greenthread should not yield between these # two statements, this will should be thread-safe. updated_devices_copy = self.updated_devices self.updated_devices = set() try: device_info = self.scan_devices(devices, updated_devices_copy) if self._device_info_has_changes(device_info): LOG.debug("Agent loop found changes! %s", device_info) # If treat devices fails - indicates must resync with # plugin sync = self.process_network_devices(device_info) devices = device_info['current'] except Exception: LOG.exception(_LE("Error in agent loop. Devices info: %s"), device_info) sync = True # Restore devices that were removed from this set earlier # without overwriting ones that may have arrived since. self.updated_devices |= updated_devices_copy # sleep till end of polling interval elapsed = (time.time() - start) if (elapsed < self.polling_interval): time.sleep(self.polling_interval - elapsed) else: LOG.debug("Loop iteration exceeded interval " "(%(polling_interval)s vs. %(elapsed)s)!", {'polling_interval': self.polling_interval, 'elapsed': elapsed}) self.iter_num = self.iter_num + 1 class SriovNicAgentConfigParser(object): def __init__(self): self.device_mappings = {} self.exclude_devices = {} def parse(self): """Parses device_mappings and exclude_devices. Parse and validate the consistency in both mappings """ self.device_mappings = q_utils.parse_mappings( cfg.CONF.SRIOV_NIC.physical_device_mappings) self.exclude_devices = config.parse_exclude_devices( cfg.CONF.SRIOV_NIC.exclude_devices) self._validate() def _validate(self): """Validate configuration. Validate that network_device in excluded_device exists in device mappings """ dev_net_set = set(self.device_mappings.itervalues()) for dev_name in self.exclude_devices.iterkeys(): if dev_name not in dev_net_set: raise ValueError(_("Device name %(dev_name)s is missing from " "physical_device_mappings") % {'dev_name': dev_name}) def main(): common_config.init(sys.argv[1:]) common_config.setup_logging() try: config_parser = SriovNicAgentConfigParser() config_parser.parse() device_mappings = config_parser.device_mappings exclude_devices = config_parser.exclude_devices except ValueError: LOG.exception(_LE("Failed on Agent configuration parse. " "Agent terminated!")) raise SystemExit(1) LOG.info(_LI("Physical Devices mappings: %s"), device_mappings) LOG.info(_LI("Exclude Devices: %s"), exclude_devices) polling_interval = cfg.CONF.AGENT.polling_interval root_helper = cfg.CONF.AGENT.root_helper try: agent = SriovNicSwitchAgent(device_mappings, exclude_devices, polling_interval, root_helper) except exc.SriovNicError: LOG.exception(_LE("Agent Initialization Failed")) raise SystemExit(1) # Start everything. LOG.info(_LI("Agent initialized successfully, now running... ")) agent.daemon_loop() if __name__ == '__main__': main()
# Copyright 2012 Anton Beloglazov # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """ Multisize sliding window workload estimation functions. """ from contracts import contract from neat.contracts_extra import * from itertools import islice from collections import deque import logging log = logging.getLogger(__name__) @contract def mean(data, window_size): """ Get the data mean according to the window size. :param data: A list of values. :type data: list(number) :param window_size: A window size. :type window_size: int,>0 :return: The mean value. :rtype: float """ return float(sum(data)) / window_size @contract def variance(data, window_size): """ Get the data variance according to the window size. :param data: A list of values. :type data: list(number) :param window_size: A window size. :type window_size: int,>0 :return: The variance value. :rtype: float """ m = mean(data, window_size) return float(sum((x - m) ** 2 for x in data)) / (window_size - 1) @contract def acceptable_variance(probability, window_size): """ Get the acceptable variance. :param probability: The probability to use. :type probability: number,>=0,<=1 :param window_size: A window size. :type window_size: int,>0 :return: The acceptable variance. :rtype: float """ return float(probability * (1 - probability)) / window_size @contract def estimate_probability(data, window_size, state): """ Get the estimated probability. :param data: A list of data values. :type data: list(number) :param window_size: The window size. :type window_size: int,>0 :param state: The current state. :type state: int,>=0 :return: The estimated probability. :rtype: float,>=0 """ return float(data.count(state)) / window_size @contract def update_request_windows(request_windows, previous_state, current_state): """ Update and return the updated request windows. :param request_windows: The previous request windows. :type request_windows: list(deque) :param previous_state: The previous state. :type previous_state: int,>=0 :param current_state: The current state. :type current_state: int,>=0 :return: The updated request windows. :rtype: list(deque) """ request_windows[previous_state].append(current_state) return request_windows @contract def update_estimate_windows(estimate_windows, request_windows, previous_state): """ Update and return the updated estimate windows. :param estimate_windows: The previous estimate windows. :type estimate_windows: list(list(dict)) :param request_windows: The current request windows. :type request_windows: list(deque) :param previous_state: The previous state. :type previous_state: int,>=0 :return: The updated estimate windows. :rtype: list(list(dict)) """ request_window = request_windows[previous_state] state_estimate_windows = estimate_windows[previous_state] for state, estimate_window in enumerate(state_estimate_windows): for window_size, estimates in estimate_window.items(): slice_from = len(request_window) - window_size if slice_from < 0: slice_from = 0 estimates.append( estimate_probability( list(islice(request_window, slice_from, None)), window_size, state)) return estimate_windows @contract def update_variances(variances, estimate_windows, previous_state): """ Updated and return the updated variances. :param variances: The previous variances. :type variances: list(list(dict)) :param estimate_windows: The current estimate windows. :type estimate_windows: list(list(dict)) :param previous_state: The previous state. :type previous_state: int,>=0 :return: The updated variances. :rtype: list(list(dict)) """ estimate_window = estimate_windows[previous_state] for state, variance_map in enumerate(variances[previous_state]): for window_size in variance_map: estimates = estimate_window[state][window_size] if len(estimates) < window_size: variance_map[window_size] = 1.0 else: variance_map[window_size] = variance( list(estimates), window_size) return variances @contract def update_acceptable_variances(acceptable_variances, estimate_windows, previous_state): """ Update and return the updated acceptable variances. :param acceptable_variances: The previous acceptable variances. :type acceptable_variances: list(list(dict)) :param estimate_windows: The current estimate windows. :type estimate_windows: list(list(dict)) :param previous_state: The previous state. :type previous_state: int,>=0 :return: The updated acceptable variances. :rtype: list(list(dict)) """ estimate_window = estimate_windows[previous_state] state_acc_variances = acceptable_variances[previous_state] for state, acceptable_variance_map in enumerate(state_acc_variances): for window_size in acceptable_variance_map: estimates = estimate_window[state][window_size] acceptable_variance_map[window_size] = acceptable_variance( estimates[-1], window_size) return acceptable_variances @contract def select_window(variances, acceptable_variances, window_sizes): """ Select window sizes according to the acceptable variances. :param variances: The variances. :type variances: list(list(dict)) :param acceptable_variances: The acceptable variances. :type acceptable_variances: list(list(dict)) :param window_sizes: The available window sizes. :type window_sizes: list(int) :return: The selected window sizes. :rtype: list(list(int)) """ n = len(variances) selected_windows = [] for i in range(n): selected_windows.append([]) for j in range(n): selected_size = window_sizes[0] for window_size in window_sizes: if variances[i][j][window_size] > \ acceptable_variances[i][j][window_size]: break selected_size = window_size selected_windows[i].append(selected_size) return selected_windows @contract def select_best_estimates(estimate_windows, selected_windows): """ Select the best estimates according to the selected windows. :param estimate_windows: The estimate windows. :type estimate_windows: list(list(dict)) :param selected_windows: The selected window sizes. :type selected_windows: list(list(int)) :return: The selected best estimates. :rtype: list(list(number)) """ n = len(estimate_windows) selected_estimates = [] for i in range(n): selected_estimates.append([]) for j in range(n): estimates = estimate_windows[i][j][selected_windows[i][j]] if estimates: selected_estimates[i].append(estimates[-1]) else: selected_estimates[i].append(0.0) return selected_estimates @contract def init_request_windows(number_of_states, max_window_size): """ Initialize a request window data structure. :param number_of_states: The number of states. :type number_of_states: int,>0 :param max_window_size: The max size of the request windows. :type max_window_size: int,>0 :return: The initialized request windows data structure. :rtype: list(deque) """ return [deque([], max_window_size) for _ in range(number_of_states)] @contract def init_variances(window_sizes, number_of_states): """ Initialize a variances data structure. :param window_sizes: The required window sizes. :type window_sizes: list(int) :param number_of_states: The number of states. :type number_of_states: int,>0 :return: The initialized variances data structure. :rtype: list(list(dict)) """ variances = [] for i in range(number_of_states): variances.append([]) for j in range(number_of_states): variances[i].append(dict(zip(window_sizes, len(window_sizes) * [1.0]))) return variances @contract def init_deque_structure(window_sizes, number_of_states): """ Initialize a 3 level deque data structure. :param window_sizes: The required window sizes. :type window_sizes: list(int) :param number_of_states: The number of states. :type number_of_states: int,>0 :return: The initialized 3 level deque data structure. :rtype: list(list(dict)) """ structure = [] for i in range(number_of_states): structure.append([]) for j in range(number_of_states): structure[i].append(dict((size, deque([], size)) for size in window_sizes)) return structure @contract def init_selected_window_sizes(window_sizes, number_of_states): """ Initialize a selected window sizes data structure. :param window_sizes: The required window sizes. :type window_sizes: list(int) :param number_of_states: The number of states. :type number_of_states: int,>0 :return: The initialized selected window sizes data structure. :rtype: list(list(int)) """ structure = [] for i in range(number_of_states): structure.append([]) for j in range(number_of_states): structure[i].append(window_sizes[0]) return structure
# -*- coding: utf-8 # Copyright 2017-2019 The FIAAS Authors # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # pylint: disable=R0201 from datetime import datetime import pytest import pytz import six import mock from k8s import config from k8s.base import Model, SelfModel from k8s.fields import Field, JSONField, ListField, OnceField, ReadOnlyField, RequiredField from k8s.models.common import ObjectMeta NAME = "my-model-test" class ModelTest(Model): class Meta: url_template = "/apis/v1/modeltests/{name}" metadata = Field(ObjectMeta) field = Field(int) list_field = ListField(int) once_field = OnceField(int) read_only_field = ReadOnlyField(int) alt_type_field = Field(int, alt_type=six.text_type) dict_field = Field(dict) _exec = Field(int) time_field = Field(datetime) json_field = JSONField() self_field = Field(SelfModel) class TestFields(object): @pytest.fixture(autouse=True) def set_config_debug(self, monkeypatch): monkeypatch.setattr(config, "debug", True) @pytest.mark.parametrize("field_name,initial_value,other_value", ( ("field", 1, 2), ("list_field", [1], [1, 2]), ("once_field", 1, 2), ("_exec", 1, 2), ("json_field", 1, [1, 2]), )) def test_field_new(self, field_name, initial_value, other_value): kwargs = {"new": True, field_name: initial_value} model = ModelTest(**kwargs) assert getattr(model, field_name) == initial_value setattr(model, field_name, other_value) assert getattr(model, field_name) == other_value @pytest.mark.parametrize("field_name,initial_value,other_value", ( ("field", 1, 2), ("list_field", [1], [1, 2]), )) def test_field_old(self, field_name, initial_value, other_value): model = ModelTest.from_dict({field_name: initial_value}) assert getattr(model, field_name) == initial_value setattr(model, field_name, other_value) assert getattr(model, field_name) == other_value def test_once_field_old(self): model = ModelTest.from_dict({"once_field": 1}) assert model.once_field == 1 model.once_field = 2 assert model.once_field == 1 def test_exec_field_old(self): model = ModelTest.from_dict({"exec": 1}) assert model._exec == 1 model._exec = 2 assert model._exec == 2 assert model.as_dict()[u"exec"] == 2 def test_read_only_field_new(self): model = ModelTest(new=True, read_only_field=1) assert model.read_only_field is None model.read_only_field = 2 assert model.read_only_field is None def test_read_only_field_old(self): model = ModelTest.from_dict({"read_only_field": 1}) assert model.read_only_field == 1 model.read_only_field = 2 assert model.read_only_field == 1 @pytest.mark.parametrize("value,modifier", [ (1, lambda x: x + 1), (u"string", lambda x: x.upper()) ]) def test_alt_type_field(self, value, modifier): model = ModelTest.from_dict({"alt_type_field": value}) assert model.alt_type_field == value assert model.as_dict()[u"alt_type_field"] == value model.alt_type_field = modifier(value) assert model.alt_type_field == modifier(value) @pytest.mark.parametrize("input,dt", ( ("2009-01-01T17:59:59Z", datetime(2009, 1, 1, 17, 59, 59, tzinfo=pytz.UTC)), ("2009-01-01T17:59:59+01:00", datetime(2009, 1, 1, 16, 59, 59, tzinfo=pytz.UTC)), )) def test_time_field_from_dict(self, input, dt): model = ModelTest.from_dict({"time_field": input}) assert isinstance(model.time_field, datetime) assert model.time_field == dt def test_time_field_as_dict(self): model = ModelTest(time_field=datetime(2009, 1, 1, 17, 59, 59, tzinfo=pytz.UTC)) d = model.as_dict() assert d["time_field"] == "2009-01-01T17:59:59Z" @pytest.mark.parametrize("value,is_valid", ( (None, True), (1, True), (1.1, True), ("string", True), ([1, 2], True), ({"key": "value"}, True), (ModelTest(), False), ([1, None], False), )) def test_json_field_validation(self, value, is_valid): model = ModelTest() if is_valid: setattr(model, "json_field", value) assert model.json_field == value else: with pytest.raises(TypeError): setattr(model, "json_field", value) assert model.json_field is None class RequiredFieldTest(Model): required_field = RequiredField(int) field = Field(int, 100) @pytest.mark.usefixtures("logger") class TestRequiredField(object): @pytest.mark.parametrize("kwargs", [ {"required_field": 1, "field": 2}, {"required_field": 1}, ]) def test_create_with_fields(self, kwargs): instance = RequiredFieldTest(new=True, **kwargs) for key, value in kwargs.items(): assert getattr(instance, key) == value def test_create_fails_when_field_missing(self): with pytest.raises(TypeError): RequiredFieldTest(new=True, field=1) class TestSelfField(object): def test_create_from_dict(self): model = ModelTest.from_dict({"self_field": {"exec": 1}}) assert getattr(model, "self_field") == ModelTest(_exec=1) def test_get_or_create_merge(self, get): get.return_value = _create_mock_response() object_meta = ObjectMeta(name=NAME, labels={"test": "true"}) model = ModelTest.get_or_create(metadata=object_meta, self_field=ModelTest(_exec=1)) assert getattr(model, "self_field") == ModelTest.from_dict({"read_only_field": 1, "exec": 1}) def _create_mock_response(): mock_response = mock.Mock() mock_response.json.return_value = { "apiVersion": "v1", "kind": "ModelTest", "metadata": { "creationTimestamp": "2019-11-23T13:43:42Z", "generation": 7, "labels": { "test": "true" }, "name": NAME, "resourceVersion": "96758807", "selfLink": _uri(NAME), "uid": "d8f1ba26-b182-11e6-a364-fa163ea2a9c4" }, "self_field": { "read_only_field": 1 } } return mock_response def _uri(name=""): return "/apis/v1/modeltests/{name}".format(name=name)
"""Small utilities.""" import functools import operator import string import time from collections.abc import Sequence from pyspark import RDD, SparkContext from sympy import ( sympify, Symbol, Expr, SympifyError, count_ops, default_sort_key, AtomicExpr, Integer, S ) from sympy.core.assumptions import ManagedProperties from sympy.core.sympify import CantSympify # # SymPy utilities # --------------- # def ensure_sympify(obj, role='', expected_type=None): """Sympify the given object with checking and error reporting. This is a shallow wrapper over SymPy sympify function to have error reporting in consistent style and an optional type checking. """ header = 'Invalid {}: '.format(role) try: sympified = sympify(obj) except SympifyError as exc: raise TypeError(header, obj, 'failed to be simpified', exc.args) if expected_type is None or isinstance(sympified, expected_type): return sympified else: raise TypeError(header, sympified, 'expecting', expected_type) def ensure_symb(obj, role=''): """Sympify the given object into a symbol.""" return ensure_sympify(obj, role, Symbol) def ensure_expr(obj, role=''): """Sympify the given object into an expression.""" return ensure_sympify(obj, role, Expr) def sympy_key(expr): """Get the key for ordering SymPy expressions. This function assumes that the given expression is already sympified. """ return count_ops(expr), default_sort_key(expr) def is_higher(obj, priority): """Test if the object has higher operation priority. When the given object does not have defined priority, it is considered lower. """ return getattr(obj, '_op_priority', priority - 1) > priority class NonsympifiableFunc(CantSympify): """Utility for wrapping callable to be used for SymPy. Inside SymPy functions like replace, things will first be attempted to be sympified, which can be very expensive. By wrapping callable inside this class, sympification attempts will be aborted very early on. """ __slots__ = ['_func'] def __init__(self, func): """Initialize the object.""" self._func = func def __call__(self, *args, **kwargs): """Dispatch to the wrapped callable.""" return self._func(*args, **kwargs) class _EnumSymbsMeta(ManagedProperties): """The meta class for enumeration symbols. The primary purpose of this metaclass is to set the concrete singleton values from the enumerated symbols set in the class body. """ SYMBS_INPUT = '_symbs_' def __new__(mcs, name, bases, attrs): """Create the new concrete symbols class.""" cls = super().__new__(mcs, name, bases, attrs) if not hasattr(cls, mcs.SYMBS_INPUT): raise AttributeError('Cannot find attribute ' + mcs.SYMBS_INPUT) symbs = getattr(cls, mcs.SYMBS_INPUT) if symbs is None: # Base class. return cls if not isinstance(symbs, Sequence): raise ValueError('Invalid symbols', symbs, 'expecting a sequence') for i in symbs: invalid = not isinstance(i, Sequence) or len(i) != 2 or any( not isinstance(j, str) for j in i ) if invalid: raise ValueError( 'Invalid symbol', i, 'expecting pairs of identifier and LaTeX form.' ) if len(symbs) < 2: raise ValueError( 'Invalid symbols ', symbs, 'expecting multiple of them' ) for i, v in enumerate(symbs): obj = cls(i) setattr(cls, v[0], obj) continue return cls class EnumSymbs(AtomicExpr, metaclass=_EnumSymbsMeta): """Base class for enumeration symbols. Subclasses can set `_symbs_` inside the class body to be a sequence of string pairs. Then attributes named after the first field of the pairs will be created, with the LaTeX form controlled by the second pair. The resulted values are valid SymPy expressions. They are ordered according to their order in the given enumeration sequence. """ _symbs_ = None _VAL_FIELD = '_val_index' __slots__ = [_VAL_FIELD] def __init__(self, val_index): """Initialize the concrete symbol object. """ if self._symbs_ is None: raise ValueError('Base EnumSymbs class cannot be instantiated') setattr(self, self._VAL_FIELD, val_index) @property def args(self): """The argument for SymPy.""" return Integer(getattr(self, self._VAL_FIELD)), def __str__(self): """Get the string representation of the symbol.""" return self._symbs_[getattr(self, self._VAL_FIELD)][0] def __repr__(self): """Get the machine readable string representation.""" return '.'.join([type(self).__name__, str(self)]) _op_priority = 20.0 def __eq__(self, other): """Test two values for equality.""" return isinstance(other, type(self)) and self.args == other.args def __hash__(self): """Hash the concrete symbol object.""" return hash(repr(self)) def __lt__(self, other): """Test two values for less than order. The order will be based on the order given in the class. """ return self.args < other.args def __gt__(self, other): """Test two values for greater than.""" return self.args > other.args def __sub__(self, other: Expr): """Subtract the current value with another. This method is mainly to be able to work together with the Kronecker delta class from SymPy. The difference is only guaranteed to have correct ``is_zero`` property. The actual difference might not make mathematical sense. """ if isinstance(other, type(self)): return self.args[0] - other.args[0] elif len(other.atoms(Symbol)) == 0: raise ValueError( 'Invalid operation for ', (self, other), 'concrete symbols can only be subtracted for the same type' ) else: # We are having a symbolic value at the other expression. We just # need to make sure that the result is fuzzy. assert other.is_zero is None return other def __rsub__(self, other): """Subtract the current value from the other expression. Only the ``is_zero`` property is guaranteed. """ return self.__sub__(other) def sort_key(self, order=None): return ( self.class_key(), (1, tuple(i.sort_key() for i in self.args)), S.One.sort_key(), S.One ) def _latex(self, _): """Print itself as LaTeX code.""" return self._symbs_[self.args[0]][1] # # Spark utilities # --------------- # class BCastVar: """Automatically broadcast variables. This class is a shallow encapsulation of a variable and its broadcast into the spark context. The variable can be redistributed automatically after any change. """ __slots__ = [ '_ctx', '_var', '_bcast' ] def __init__(self, ctx: SparkContext, var): """Initialize the broadcast variable.""" self._ctx = ctx self._var = var self._bcast = None @property def var(self): """Get the variable to mutate.""" self._bcast = None return self._var @property def ro(self): """Get the variable, read-only. Note that this function only prevents the redistribution of the variable. It cannot force the variable not be mutated. """ return self._var @property def bcast(self): """Get the broadcast variable.""" if self._bcast is None: self._bcast = self._ctx.broadcast(self._var) return self._bcast def nest_bind(rdd: RDD, func, full_balance=True): """Nest the flat map of the given function. When an entry no longer need processing, None can be returned by the call back function. """ if full_balance: return _nest_bind_full_balance(rdd, func) else: return _nest_bind_no_balance(rdd, func) def _nest_bind_full_balance(rdd: RDD, func): """Nest the flat map of the given function with full load balancing. """ ctx = rdd.context def wrapped(obj): """Wrapped function for nest bind.""" vals = func(obj) if vals is None: return [(False, obj)] else: return [(True, i) for i in vals] curr = rdd curr.cache() res = [] while curr.count() > 0: step_res = curr.flatMap(wrapped) step_res.cache() new_entries = step_res.filter(lambda x: not x[0]).map(lambda x: x[1]) new_entries.cache() res.append(new_entries) curr = step_res.filter(lambda x: x[0]).map(lambda x: x[1]) curr.cache() continue return ctx.union(res) def _nest_bind_no_balance(rdd: RDD, func): """Nest the flat map of the given function without load balancing. """ def wrapped(obj): """Wrapped function for nest bind.""" curr = [obj] res = [] while len(curr) > 0: new_curr = [] for i in curr: step_res = func(i) if step_res is None: res.append(i) else: new_curr.extend(step_res) continue curr = new_curr continue return res return rdd.flatMap(wrapped) # # Misc utilities # -------------- # def ensure_pair(obj, role): """Ensures that the given object is a pair.""" if not (isinstance(obj, Sequence) and len(obj) == 2): raise TypeError('Invalid {}: '.format(role), obj, 'expecting pair') return obj _ALNUM = frozenset( j for i in [string.ascii_letters, string.digits] for j in i ) def extract_alnum(inp: str): """Extract the alpha numeric part of the string. This function is mostly for generating valid identifiers for objects with a mathematically formatted name. """ return ''.join(i for i in inp if i in _ALNUM) # # Small user utilities # -------------------- # def sum_(obj): """Sum the values in the given iterable. Different from the built-in summation function, the summation is based on the first item in the iterable. Or a SymPy integer zero is created when the iterator is empty. """ i = iter(obj) try: init = next(i) except StopIteration: return Integer(0) else: return functools.reduce(operator.add, i, init) def prod_(obj): """Product the values in the given iterable. Similar to the summation utility function :py:func:`sum_`, here the initial value for the reduction is the first element. Different from the summation, here a SymPy integer unity will be returned for empty iterator. """ i = iter(obj) try: init = next(i) except StopIteration: return Integer(1) else: return functools.reduce(operator.mul, i, init) class Stopwatch: """Utility class for printing timing information. This class helps to timing the progression of batch jobs. It is capable of getting and formatting the elapsed wall time between consecutive steps. Note that the timing here might not be accurate to one second. """ def __init__(self, print_cb=print): """Initialize the stopwatch. Parameters ---------- print_cb The function will be called with the formatted time-stamp. By default, it will just be written to stdout. """ self._print = print_cb self.tick(total=True) def tick(self, total=False): """Reset the timer. Parameters ---------- total If the total beginning time is going to be reset as well. """ self._prev = time.time() if total: self._begin = self._prev def tock(self, label, tensor=None): """Make a timestamp. The formatted timestamp will be given to the callback of the current stamper. The wall time elapsed since the last :py:meth:`tick` will be printed. Parameters ---------- label The label for the current step. tensor When a tensor is given, it will be cached, counted its number of terms. This method has this parameter since if no reduction is performed on the tensor, it might remain unevaluated inside Spark and give misleading timing information. """ if tensor is not None: tensor.cache() n_terms = '{} terms, '.format(tensor.n_terms) else: n_terms = '' now = time.time() elapse = now - self._prev self._prev = now self._print( '{} done, {}wall time: {:.2f} s'.format(label, n_terms, elapse) ) def tock_total(self): """Make a timestamp for the total time. The total time will be the time elapsed since the **total** time was last reset. """ now = time.time() self._print( 'Total wall time: {:.2f} s'.format(now - self._begin) ) class CallByIndex: """Wrapper over callables such that they can be called by indexing. This wrapper can be helpful for cases where an indexable object is expected but flexibility of a callable is needed. The given object will be wrapped inside and called when the wrapper is indexed. """ __slots__ = ['_callable'] def __init__(self, callable): """Initialize the object.""" self._callable = callable def __getitem__(self, item): """Get the item by calling the given callable.""" return self._callable(item) class InvariantIndexable(CallByIndex): """Objects whose indexing always gives the same constant. This small utility is for cases where we need an indexable object whose indexing result is actually invariant with respect to the given indices. For an instance constructed with value ``v``, all indexing of it gives ``v`` back. """ __slots__ = [] def __init__(self, v): """Initialize the invariant tensor.""" super().__init__(lambda _: v) class SymbResolver: """Resolver based on symbols. It can be given an iterable of range/symbols pairs telling that the symbols are associated with the key ranges. In strict mode, only the given symbols can be resolved to be in the given range. In non-strict mode, all expressions having one of the symbols will be resolved to be in the range of the symbol. Behaviour is undefined if we have non-disjoint symbol sets for different ranges or when we have expression containing symbols for multiple known ranges. """ __slots__ = [ '_known', '_strict' ] def __init__(self, range_symbs, strict): """Initialize the resolver.""" known = {} self._known = known for range_, dumms in range_symbs: for i in dumms: known[i] = range_ continue continue self._strict = strict def __call__(self, expr: Expr): """Try to resolve an expression.""" known = self._known if self._strict: if expr in known: return known[expr] else: for i in expr.atoms(Symbol): if i in known: return known[i] continue return None
# coding: utf-8 """ Talon.One API The Talon.One API is used to manage applications and campaigns, as well as to integrate with your application. The operations in the _Integration API_ section are used to integrate with our platform, while the other operations are used to manage applications and campaigns. ### Where is the API? The API is available at the same hostname as these docs. For example, if you are reading this page at `https://mycompany.talon.one/docs/api/`, the URL for the [updateCustomerProfile][] operation is `https://mycompany.talon.one/v1/customer_profiles/id` [updateCustomerProfile]: #operation--v1-customer_profiles--integrationId--put # noqa: E501 The version of the OpenAPI document: 1.0.0 Generated by: https://openapi-generator.tech """ import pprint import re # noqa: F401 import six from talon_one.configuration import Configuration class NewCustomerSession(object): """NOTE: This class is auto generated by OpenAPI Generator. Ref: https://openapi-generator.tech Do not edit the class manually. """ """ Attributes: openapi_types (dict): The key is attribute name and the value is attribute type. attribute_map (dict): The key is attribute name and the value is json key in definition. """ openapi_types = { 'profile_id': 'str', 'coupon': 'str', 'referral': 'str', 'state': 'str', 'cart_items': 'list[CartItem]', 'identifiers': 'list[str]', 'total': 'float', 'attributes': 'object' } attribute_map = { 'profile_id': 'profileId', 'coupon': 'coupon', 'referral': 'referral', 'state': 'state', 'cart_items': 'cartItems', 'identifiers': 'identifiers', 'total': 'total', 'attributes': 'attributes' } def __init__(self, profile_id=None, coupon=None, referral=None, state='open', cart_items=None, identifiers=None, total=None, attributes=None, local_vars_configuration=None): # noqa: E501 """NewCustomerSession - a model defined in OpenAPI""" # noqa: E501 if local_vars_configuration is None: local_vars_configuration = Configuration() self.local_vars_configuration = local_vars_configuration self._profile_id = None self._coupon = None self._referral = None self._state = None self._cart_items = None self._identifiers = None self._total = None self._attributes = None self.discriminator = None if profile_id is not None: self.profile_id = profile_id if coupon is not None: self.coupon = coupon if referral is not None: self.referral = referral if state is not None: self.state = state if cart_items is not None: self.cart_items = cart_items if identifiers is not None: self.identifiers = identifiers if total is not None: self.total = total if attributes is not None: self.attributes = attributes @property def profile_id(self): """Gets the profile_id of this NewCustomerSession. # noqa: E501 ID of the customers profile as used within this Talon.One account. May be omitted or set to the empty string if the customer does not yet have a known profile ID. # noqa: E501 :return: The profile_id of this NewCustomerSession. # noqa: E501 :rtype: str """ return self._profile_id @profile_id.setter def profile_id(self, profile_id): """Sets the profile_id of this NewCustomerSession. ID of the customers profile as used within this Talon.One account. May be omitted or set to the empty string if the customer does not yet have a known profile ID. # noqa: E501 :param profile_id: The profile_id of this NewCustomerSession. # noqa: E501 :type: str """ self._profile_id = profile_id @property def coupon(self): """Gets the coupon of this NewCustomerSession. # noqa: E501 Any coupon code entered. # noqa: E501 :return: The coupon of this NewCustomerSession. # noqa: E501 :rtype: str """ return self._coupon @coupon.setter def coupon(self, coupon): """Sets the coupon of this NewCustomerSession. Any coupon code entered. # noqa: E501 :param coupon: The coupon of this NewCustomerSession. # noqa: E501 :type: str """ if (self.local_vars_configuration.client_side_validation and coupon is not None and len(coupon) > 100): raise ValueError("Invalid value for `coupon`, length must be less than or equal to `100`") # noqa: E501 self._coupon = coupon @property def referral(self): """Gets the referral of this NewCustomerSession. # noqa: E501 Any referral code entered. # noqa: E501 :return: The referral of this NewCustomerSession. # noqa: E501 :rtype: str """ return self._referral @referral.setter def referral(self, referral): """Sets the referral of this NewCustomerSession. Any referral code entered. # noqa: E501 :param referral: The referral of this NewCustomerSession. # noqa: E501 :type: str """ if (self.local_vars_configuration.client_side_validation and referral is not None and len(referral) > 100): raise ValueError("Invalid value for `referral`, length must be less than or equal to `100`") # noqa: E501 self._referral = referral @property def state(self): """Gets the state of this NewCustomerSession. # noqa: E501 Indicates the current state of the session. All sessions must start in the \"open\" state, after which valid transitions are... 1. open -> closed 2. open -> cancelled 3. closed -> cancelled # noqa: E501 :return: The state of this NewCustomerSession. # noqa: E501 :rtype: str """ return self._state @state.setter def state(self, state): """Sets the state of this NewCustomerSession. Indicates the current state of the session. All sessions must start in the \"open\" state, after which valid transitions are... 1. open -> closed 2. open -> cancelled 3. closed -> cancelled # noqa: E501 :param state: The state of this NewCustomerSession. # noqa: E501 :type: str """ allowed_values = ["open", "closed", "cancelled"] # noqa: E501 if self.local_vars_configuration.client_side_validation and state not in allowed_values: # noqa: E501 raise ValueError( "Invalid value for `state` ({0}), must be one of {1}" # noqa: E501 .format(state, allowed_values) ) self._state = state @property def cart_items(self): """Gets the cart_items of this NewCustomerSession. # noqa: E501 Serialized JSON representation. # noqa: E501 :return: The cart_items of this NewCustomerSession. # noqa: E501 :rtype: list[CartItem] """ return self._cart_items @cart_items.setter def cart_items(self, cart_items): """Sets the cart_items of this NewCustomerSession. Serialized JSON representation. # noqa: E501 :param cart_items: The cart_items of this NewCustomerSession. # noqa: E501 :type: list[CartItem] """ self._cart_items = cart_items @property def identifiers(self): """Gets the identifiers of this NewCustomerSession. # noqa: E501 Identifiers for the customer, this can be used for limits on values such as device ID. # noqa: E501 :return: The identifiers of this NewCustomerSession. # noqa: E501 :rtype: list[str] """ return self._identifiers @identifiers.setter def identifiers(self, identifiers): """Sets the identifiers of this NewCustomerSession. Identifiers for the customer, this can be used for limits on values such as device ID. # noqa: E501 :param identifiers: The identifiers of this NewCustomerSession. # noqa: E501 :type: list[str] """ self._identifiers = identifiers @property def total(self): """Gets the total of this NewCustomerSession. # noqa: E501 The total sum of the cart in one session. # noqa: E501 :return: The total of this NewCustomerSession. # noqa: E501 :rtype: float """ return self._total @total.setter def total(self, total): """Sets the total of this NewCustomerSession. The total sum of the cart in one session. # noqa: E501 :param total: The total of this NewCustomerSession. # noqa: E501 :type: float """ self._total = total @property def attributes(self): """Gets the attributes of this NewCustomerSession. # noqa: E501 A key-value map of the sessions attributes. The potentially valid attributes are configured in your accounts developer settings. # noqa: E501 :return: The attributes of this NewCustomerSession. # noqa: E501 :rtype: object """ return self._attributes @attributes.setter def attributes(self, attributes): """Sets the attributes of this NewCustomerSession. A key-value map of the sessions attributes. The potentially valid attributes are configured in your accounts developer settings. # noqa: E501 :param attributes: The attributes of this NewCustomerSession. # noqa: E501 :type: object """ self._attributes = attributes def to_dict(self): """Returns the model properties as a dict""" result = {} for attr, _ in six.iteritems(self.openapi_types): value = getattr(self, attr) if isinstance(value, list): result[attr] = list(map( lambda x: x.to_dict() if hasattr(x, "to_dict") else x, value )) elif hasattr(value, "to_dict"): result[attr] = value.to_dict() elif isinstance(value, dict): result[attr] = dict(map( lambda item: (item[0], item[1].to_dict()) if hasattr(item[1], "to_dict") else item, value.items() )) else: result[attr] = value return result def to_str(self): """Returns the string representation of the model""" return pprint.pformat(self.to_dict()) def __repr__(self): """For `print` and `pprint`""" return self.to_str() def __eq__(self, other): """Returns true if both objects are equal""" if not isinstance(other, NewCustomerSession): return False return self.to_dict() == other.to_dict() def __ne__(self, other): """Returns true if both objects are not equal""" if not isinstance(other, NewCustomerSession): return True return self.to_dict() != other.to_dict()
# Copyright (c) 2018 PaddlePaddle Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import unittest import paddle import paddle.fluid.core as core import paddle.fluid as fluid from paddle.fluid.backward import append_backward import paddle.fluid.framework as framework from paddle.fluid.framework import Program, switch_main_program import bisect import numpy as np fluid.default_startup_program().random_seed = 1 class TestDyRnnStaticInput(unittest.TestCase): def setUp(self): self._delta = 0.005 self._max_sequence_len = 3 self._program = Program() switch_main_program(self._program) self.output_dim = 10 self.place = core.CPUPlace() self.prepare_x_tensor() self.prepare_static_input_tensor() self.exe = fluid.Executor(self.place) def prepare_x_tensor(self): self.x_tensor_dim = 10 lod = [[2, 1, 3]] shape = [sum(lod[0]), self.x_tensor_dim] self.x_tensor_data = np.random.random(shape).astype('float32') self.x_tensor = core.LoDTensor() self.x_tensor.set_recursive_sequence_lengths(lod) self.x_tensor.set(self.x_tensor_data, self.place) def prepare_static_input_tensor(self): self.static_input_tensor_dim = 4 lod = [[1, 2, 3]] shape = [sum(lod[0]), self.static_input_tensor_dim] self.static_input_data = np.random.random(shape).astype('float32') self.static_input_tensor = core.LoDTensor() self.static_input_tensor.set_recursive_sequence_lengths(lod) self.static_input_tensor.set(self.static_input_data, self.place) def fetch_value(self, var): fetch_outs = self.exe.run(feed={ 'x_tensor': self.x_tensor, 'static_input_tensor': self.static_input_tensor }, fetch_list=[var], return_numpy=False) return self._lodtensor_to_ndarray(fetch_outs[0]) def _lodtensor_to_ndarray(self, lod_tensor): dims = lod_tensor.shape() ndarray = np.zeros(shape=dims).astype('float32') for i in xrange(np.product(dims)): ndarray.ravel()[i] = lod_tensor._get_float_element(i) return ndarray, lod_tensor.recursive_sequence_lengths() def build_graph(self, only_forward=False): x_tensor = fluid.layers.data( name='x_tensor', shape=[self.x_tensor_dim], dtype='float32', lod_level=1) x_tensor.stop_gradient = False static_input_tensor = fluid.layers.data( name='static_input_tensor', shape=[self.static_input_tensor_dim], dtype='float32', lod_level=1) static_input_tensor.stop_gradient = False if only_forward: static_input_out_array = self._program.global_block().create_var( name='static_input_out_array', type=core.VarDesc.VarType.LOD_TENSOR_ARRAY, dtype='float32') static_input_out_array.stop_gradient = True rnn = fluid.layers.DynamicRNN() with rnn.block(): step_x = rnn.step_input(x_tensor) step_static_input = rnn.static_input(static_input_tensor) if only_forward: fluid.layers.array_write( x=step_static_input, i=rnn.step_idx, array=static_input_out_array) last = fluid.layers.sequence_pool( input=step_static_input, pool_type='last') projected = fluid.layers.fc(input=[step_x, last], size=self.output_dim) rnn.output(projected) if only_forward: static_input_step_outs = [] step_idx = fluid.layers.fill_constant( shape=[1], dtype='int64', value=0) step_idx.stop_gradient = True for i in xrange(self._max_sequence_len): step_out = fluid.layers.array_read(static_input_out_array, step_idx) step_out.stop_gradient = True static_input_step_outs.append(step_out) fluid.layers.increment(x=step_idx, value=1.0, in_place=True) if only_forward: return static_input_step_outs last = fluid.layers.sequence_pool(input=rnn(), pool_type='last') loss = fluid.layers.mean(last) append_backward(loss) static_input_grad = self._program.global_block().var( framework.grad_var_name('static_input_tensor')) return static_input_grad, loss def get_expected_static_step_outs(self): x_lod = self.x_tensor.recursive_sequence_lengths() x_seq_len = x_lod[0] x_seq_len_sorted = sorted(x_seq_len) x_sorted_indices = np.argsort(x_seq_len)[::-1] static_lod = self.static_input_tensor.recursive_sequence_lengths() static_sliced = [] cur_offset = 0 for i in xrange(len(static_lod[0])): static_sliced.append(self.static_input_data[cur_offset:( cur_offset + static_lod[0][i])]) cur_offset += static_lod[0][i] static_seq_len = static_lod[0] static_reordered = [] for i in xrange(len(x_sorted_indices)): static_reordered.extend(static_sliced[x_sorted_indices[i]].tolist()) static_seq_len_reordered = [ static_seq_len[x_sorted_indices[i]] for i in xrange(len(x_sorted_indices)) ] static_step_outs = [] static_step_lods = [] for i in xrange(self._max_sequence_len): end = len(x_seq_len) - bisect.bisect_left(x_seq_len_sorted, i + 1) lod = [] total_len = 0 for i in xrange(end): lod.append(static_seq_len_reordered[i]) total_len += lod[-1] static_step_lods.append([lod]) end = total_len static_step_outs.append( np.array(static_reordered[:end]).astype('float32')) return static_step_outs, static_step_lods def test_step_out(self): static_step_outs = self.build_graph(only_forward=True) self.exe.run(framework.default_startup_program()) expected_outs, expected_lods = self.get_expected_static_step_outs() for i in xrange(self._max_sequence_len): step_out, lod = self.fetch_value(static_step_outs[i]) self.assertTrue(np.allclose(step_out, expected_outs[i])) self.assertTrue(np.allclose(lod, expected_lods[i])) def test_network_gradient(self): static_input_grad, loss = self.build_graph() self.exe.run(framework.default_startup_program()) actual_gradients, actual_lod = self.fetch_value(static_input_grad) static_input_shape = self.static_input_tensor.shape() numeric_gradients = np.zeros(shape=static_input_shape).astype('float32') # calculate numeric gradients tensor_size = np.product(static_input_shape) for i in xrange(tensor_size): origin = self.static_input_tensor._get_float_element(i) x_pos = origin + self._delta self.static_input_tensor._set_float_element(i, x_pos) y_pos = self.fetch_value(loss)[0][0] x_neg = origin - self._delta self.static_input_tensor._set_float_element(i, x_neg) y_neg = self.fetch_value(loss)[0][0] self.static_input_tensor._set_float_element(i, origin) numeric_gradients.ravel()[i] = (y_pos - y_neg) / self._delta / 2 self.assertTrue(np.allclose(actual_gradients, numeric_gradients, 0.001)) self.assertTrue( np.allclose(actual_lod, self.static_input_tensor.recursive_sequence_lengths())) if __name__ == '__main__': unittest.main()
# Copyright 2015 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Tests for tensorflow.ops.test_util.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function import random import threading import numpy as np from six.moves import xrange # pylint: disable=redefined-builtin from google.protobuf import text_format from tensorflow.core.framework import graph_pb2 from tensorflow.python.framework import constant_op from tensorflow.python.framework import errors from tensorflow.python.framework import ops from tensorflow.python.framework import test_util from tensorflow.python.ops import control_flow_ops from tensorflow.python.ops import random_ops from tensorflow.python.platform import googletest class TestUtilTest(test_util.TensorFlowTestCase): def test_assert_ops_in_graph(self): with self.test_session(): constant_op.constant(["hello", "taffy"], name="hello") test_util.assert_ops_in_graph({"hello": "Const"}, ops.get_default_graph()) self.assertRaises(ValueError, test_util.assert_ops_in_graph, {"bye": "Const"}, ops.get_default_graph()) self.assertRaises(ValueError, test_util.assert_ops_in_graph, {"hello": "Variable"}, ops.get_default_graph()) def test_assert_equal_graph_def(self): with ops.Graph().as_default() as g: def_empty = g.as_graph_def() constant_op.constant(5, name="five") constant_op.constant(7, name="seven") def_57 = g.as_graph_def() with ops.Graph().as_default() as g: constant_op.constant(7, name="seven") constant_op.constant(5, name="five") def_75 = g.as_graph_def() # Comparing strings is order dependent self.assertNotEqual(str(def_57), str(def_75)) # assert_equal_graph_def doesn't care about order test_util.assert_equal_graph_def(def_57, def_75) # Compare two unequal graphs with self.assertRaisesRegexp(AssertionError, r"^Found unexpected node 'seven"): test_util.assert_equal_graph_def(def_57, def_empty) def testIsGoogleCudaEnabled(self): # The test doesn't assert anything. It ensures the py wrapper # function is generated correctly. if test_util.IsGoogleCudaEnabled(): print("GoogleCuda is enabled") else: print("GoogleCuda is disabled") def testAssertProtoEqualsStr(self): graph_str = "node { name: 'w1' op: 'params' }" graph_def = graph_pb2.GraphDef() text_format.Merge(graph_str, graph_def) # test string based comparison self.assertProtoEquals(graph_str, graph_def) # test original comparison self.assertProtoEquals(graph_def, graph_def) def testNDArrayNear(self): a1 = np.array([[1.0, 2.0, 3.0], [4.0, 5.0, 6.0]]) a2 = np.array([[1.0, 2.0, 3.0], [4.0, 5.0, 6.0]]) a3 = np.array([[10.0, 20.0, 30.0], [40.0, 50.0, 60.0]]) self.assertTrue(self._NDArrayNear(a1, a2, 1e-5)) self.assertFalse(self._NDArrayNear(a1, a3, 1e-5)) def testCheckedThreadSucceeds(self): def noop(ev): ev.set() event_arg = threading.Event() self.assertFalse(event_arg.is_set()) t = self.checkedThread(target=noop, args=(event_arg,)) t.start() t.join() self.assertTrue(event_arg.is_set()) def testCheckedThreadFails(self): def err_func(): return 1 // 0 t = self.checkedThread(target=err_func) t.start() with self.assertRaises(self.failureException) as fe: t.join() self.assertTrue("integer division or modulo by zero" in str(fe.exception)) def testCheckedThreadWithWrongAssertionFails(self): x = 37 def err_func(): self.assertTrue(x < 10) t = self.checkedThread(target=err_func) t.start() with self.assertRaises(self.failureException) as fe: t.join() self.assertTrue("False is not true" in str(fe.exception)) def testMultipleThreadsWithOneFailure(self): def err_func(i): self.assertTrue(i != 7) threads = [ self.checkedThread( target=err_func, args=(i,)) for i in range(10) ] for t in threads: t.start() for i, t in enumerate(threads): if i == 7: with self.assertRaises(self.failureException): t.join() else: t.join() def _WeMustGoDeeper(self, msg): with self.assertRaisesOpError(msg): node_def = ops._NodeDef("op_type", "name") node_def_orig = ops._NodeDef("op_type_orig", "orig") op_orig = ops.Operation(node_def_orig, ops.get_default_graph()) op = ops.Operation(node_def, ops.get_default_graph(), original_op=op_orig) raise errors.UnauthenticatedError(node_def, op, "true_err") def testAssertRaisesOpErrorDoesNotPassMessageDueToLeakedStack(self): with self.assertRaises(AssertionError): self._WeMustGoDeeper("this_is_not_the_error_you_are_looking_for") self._WeMustGoDeeper("true_err") self._WeMustGoDeeper("name") self._WeMustGoDeeper("orig") def testAllCloseScalars(self): self.assertAllClose(7, 7 + 1e-8) with self.assertRaisesRegexp(AssertionError, r"Not equal to tolerance"): self.assertAllClose(7, 8) def testArrayNear(self): a = [1, 2] b = [1, 2, 5] with self.assertRaises(AssertionError): self.assertArrayNear(a, b, 0.001) a = [1, 2] b = [[1, 2], [3, 4]] with self.assertRaises(TypeError): self.assertArrayNear(a, b, 0.001) a = [1, 2] b = [1, 2] self.assertArrayNear(a, b, 0.001) def testForceGPU(self): with self.assertRaisesRegexp(errors.InvalidArgumentError, "Cannot assign a device to node"): with self.test_session(force_gpu=True): # this relies on us not having a GPU implementation for assert, which # seems sensible x = constant_op.constant(True) y = [15] control_flow_ops.Assert(x, y).run() def testAssertAllCloseAccordingToType(self): # test float64 self.assertAllCloseAccordingToType( np.asarray([1e-8], dtype=np.float64), np.asarray([2e-8], dtype=np.float64), rtol=1e-8, atol=1e-8 ) with (self.assertRaises(AssertionError)): self.assertAllCloseAccordingToType( np.asarray([1e-7], dtype=np.float64), np.asarray([2e-7], dtype=np.float64), rtol=1e-8, atol=1e-8 ) # test float32 self.assertAllCloseAccordingToType( np.asarray([1e-7], dtype=np.float32), np.asarray([2e-7], dtype=np.float32), rtol=1e-8, atol=1e-8, float_rtol=1e-7, float_atol=1e-7 ) with (self.assertRaises(AssertionError)): self.assertAllCloseAccordingToType( np.asarray([1e-6], dtype=np.float32), np.asarray([2e-6], dtype=np.float32), rtol=1e-8, atol=1e-8, float_rtol=1e-7, float_atol=1e-7 ) # test float16 self.assertAllCloseAccordingToType( np.asarray([1e-4], dtype=np.float16), np.asarray([2e-4], dtype=np.float16), rtol=1e-8, atol=1e-8, float_rtol=1e-7, float_atol=1e-7, half_rtol=1e-4, half_atol=1e-4 ) with (self.assertRaises(AssertionError)): self.assertAllCloseAccordingToType( np.asarray([1e-3], dtype=np.float16), np.asarray([2e-3], dtype=np.float16), rtol=1e-8, atol=1e-8, float_rtol=1e-7, float_atol=1e-7, half_rtol=1e-4, half_atol=1e-4 ) def testRandomSeed(self): a = random.randint(1, 1000) a_np_rand = np.random.rand(1) with self.test_session(): a_rand = random_ops.random_normal([1]).eval() # ensure that randomness in multiple testCases is deterministic. self.setUp() b = random.randint(1, 1000) b_np_rand = np.random.rand(1) with self.test_session(): b_rand = random_ops.random_normal([1]).eval() self.assertEqual(a, b) self.assertEqual(a_np_rand, b_np_rand) self.assertEqual(a_rand, b_rand) if __name__ == "__main__": googletest.main()
import argparse import csv, os, time import MySQLdb # http://sourceforge.net/projects/mysql-python/ import result from result import Result import gspread, getpass # https://pypi.python.org/pypi/gspread/ (v0.1.0) # Get command line arguments parser = argparse.ArgumentParser(description='Load SNP and locus data') parser.add_argument('--dev', action='store_true', help='Only load chromosome 21 for development testing') parser.add_argument('--path', help='Path to chromosome data') parser.add_argument('--db', type=str, help='MySQL database name') parser.add_argument('--yhost', type=str, help='MySQL host') parser.add_argument('--username', type=str, help='MySQL username') parser.add_argument('--password', type=str, help='MySQL password') parser.add_argument('--tag', type=str, help='Tag to place in results file') parser.add_argument('--remote', action='store_true', help='Enable remote reporting') parser.add_argument('--rkey', help='Google document key') parser.add_argument('--start', type=str, help='Chromosome to start load from') parser.add_argument('--indexes', action='store_true', help='Create indexes') parser.add_argument('--queries', action='store_true', help='Run queries') args = parser.parse_args() # Set script version scriptVersion = "2.0" # Set default variables dev = False remote = False createIndexes = False runQueries = False databaseName = 'snp_research' username = 'dev' password = '' sqlHost = '127.0.0.1' path = '' tag = '' docKey = '' start = '1' # Update any present from CLI if args.dev: # If dev mode, only load chr 21 dev = True if args.remote and args.rkey is not None: # If set to remote log and document key is present, log to GDocs remote = True docKey = args.rkey else: remote = False if args.path is not None: # If set, use as root path for chromosome data path = args.path if args.db is not None: # If set, use as database name for MySQL databaseName = args.db if args.username is not None: # MySQL username username = args.username if args.password is not None: # MySQL password password = args.password if args.yhost is not None: # MySQL host name sqlHost = args.yhost if args.tag is not None: # Tag to place in results file tag = args.tag if args.start is not None: start = args.start if args.indexes is not None: createIndexes = args.indexes if args.queries is not None: runQueries = args.queries # Open results file resultsFileName = 'results-mysql' if resultsFileName != "": resultsFileName += '-' + tag resultsFileName += '.txt' resultsFile = open(resultsFileName, 'w') resultsFile.write(scriptVersion + '\n') result = Result() resultsFile.write(result.toHeader() + '\n') if remote: gusername = raw_input("Enter Google username: ") gpassword = getpass.getpass("Enter Google password: ") gs = gspread.Client(auth=(gusername,gpassword)) gs.login() ss = gs.open_by_key(docKey) ws = ss.add_worksheet(tag + "-" + str(time.time()),1,1) ws.append_row(result.headerArr()) # Data files snpFilePath = 'snpData-chr{0}.txt' lociFilePath = 'lociData-chr{0}.txt' # Chromosome list chromosomes = ["21"] # dev list # If not in dev mode, iterate through all chromosomes if dev is False: chromosomes = ["1","2","3","4","5","6","7","8","9","10","11","12","13","14","15","16","17","18","19","20","21","22","X","Y","MT"] # complete list if start != "1": # Allow restart from anywhere in chromosome list, sequentially as ordered above startList = [] hitMin = False for cur in chromosomes: if cur == start: hitMin = True if hitMin: startList.append(cur) chromosomes = startList # Create MySQL database, tables if not exists mysqlConnection = MySQLdb.connect(host=sqlHost,user=username,passwd=password) createDbCursor = mysqlConnection.cursor() createDbCursor.execute("CREATE DATABASE IF NOT EXISTS " + databaseName + " DEFAULT CHARACTER SET 'utf8'".format(databaseName)) mysqlConnection.commit() mysqlConnection.close() # Reconnect with database name mysqlConnection = MySQLdb.connect(host=sqlHost,user=username,passwd=password,db=databaseName) createDbCursor = mysqlConnection.cursor() TABLES = {} TABLES['snp'] = ( "CREATE TABLE IF NOT EXISTS `snp`(" " `id` int(11) NOT NULL AUTO_INCREMENT," " `rsid` varchar(45) NOT NULL," " `chr` varchar(5) NOT NULL," " `has_sig` binary(1) NOT NULL," " PRIMARY KEY (`id`)" ") ENGINE=InnoDB AUTO_INCREMENT=862719 DEFAULT CHARSET=utf8;") TABLES['locus'] = ( "CREATE TABLE IF NOT EXISTS `locus`(" " `id` int(11) NOT NULL AUTO_INCREMENT," " `mrna_acc` varchar(45) NOT NULL," " `gene` varchar(45) NOT NULL," " `class` varchar(45) NOT NULL," " `snp_id` int(11) NOT NULL," " PRIMARY KEY (`id`)," " CONSTRAINT `idx_snp` FOREIGN KEY (`snp_id`) REFERENCES `snp` (`id`) ON DELETE NO ACTION ON UPDATE NO ACTION" ") ENGINE=InnoDB AUTO_INCREMENT=7564 DEFAULT CHARSET=utf8;") for name, ddl in TABLES.iteritems(): createDbCursor.execute(ddl) mysqlConnection.commit() createDbCursor.execute("SET FOREIGN_KEY_CHECKS = 0;") createDbCursor.execute("SET UNIQUE_CHECKS = 0;") createDbCursor.execute("SET SESSION tx_isolation='READ-UNCOMMITTED'") createDbCursor.execute("SET sql_log_bin = 0;") createDbCursor.close() # Dictionaries and arrays for SQL and MongoDB queries snpInserts = {} # Dictionary for rsid/insert for SNP data lociInserts = [] # Array for loci insert queries rsidList = {} # Dictionary of RSIDs that will also hold the # primary key for each SNP in SQL for curChr in chromosomes: result = Result() result.method = "MySQL" result.tag = tag print "Chromosome " + str(curChr) result.chromosome = str(curChr) # Set file paths for current chromosome curSnpFilePath = snpFilePath.format(curChr) curLociFilePath = lociFilePath.format(curChr) if len(path) > 0: curSnpFilePath = path.rstrip('\\') + '\\' + curSnpFilePath curLociFilePath = path.rsplit('\\') + '\\' + curLociFilePath # Clear dictionaries for loading multiple chromosomes snpInserts.clear() lociInserts = [] rsidList.clear() print "Chromosome " + str(curChr) + ". Reading SNP Data" result.snpLoadStart = time.time() # Read in data from SNP file with open(curSnpFilePath,'r') as csvfile: data = csv.reader(csvfile,delimiter='\t') for row in data: if(len(row) == 3): hasSig = False if row[2] != '' and row[2] != 'false': hasSig = True rsidList[row[0]] = 0 insStr = "INSERT INTO snp (rsid, chr, has_sig) VALUES (\"{0}\", \"{1}\", {2})".format(row[0], row[1], hasSig) snpInserts[row[0]] = insStr # Data for reporting result.snpLoadEnd = time.time() result.totalSnps = len(snpInserts) # Insert SNP data into MySQL mysqlCursor = mysqlConnection.cursor() print "Chromosome " + str(curChr) + ". Inserting SNP Data." # Log current run start time result.snpInsertStart = time.time() # For each snp, insert record and then grab primary key for rsid,snp in snpInserts.iteritems(): mysqlCursor.execute(snp) rsidList[rsid] = mysqlCursor.lastrowid # Commit all inserts to MySQL and grab end time mysqlConnection.commit() # Log completed time, close MySQL cursor result.snpInsertEnd=time.time() mysqlCursor.close() # Clear list of SNPs to free up memory snpInserts.clear() print "Chromosome " + str(curChr) + ". Reading loci Data." result.lociLoadStart = time.time() # Now that we have primary keys for each SNP, read in loci data with open(curLociFilePath,'r') as csvfile: data = csv.reader(csvfile,delimiter='\t') for row in data: if(len(row) == 4): # Load loci in MySQL statements if row[0] in rsidList and rsidList[row[0]] > 0: # If RSID value is present, load with PK insStr = "INSERT INTO locus (mrna_acc, gene, class, snp_id) VALUES (\"{0}\", \"{1}\", \"{2}\", {3})".format(row[1], row[2], row[3], rsidList[row[0]]) lociInserts.append(insStr) # Data for reporting result.lociLoadEnd = time.time() result.totalLoci = len(lociInserts) # Create new cursor, enter loci data into MySQL cursor = mysqlConnection.cursor() print "Chromosome " + str(curChr) + ". Inserting loci data." # Log current run start time and number of loci result.lociInsertStart = time.time() # Insert each locus for locus in lociInserts: cursor.execute(locus) # Commit data to MySQL mysqlConnection.commit() # Log end time and total MySQL time result.lociInsertEnd = time.time() # Close MySQL cursor cursor.close() print result.toTerm() resultsFile.write(result.toString() + '\n') if remote: try: print "Sending to GDocs..." gs.login() ws.append_row(result.stringArr()) except: print "Unable to send to GDocs, continuing..." # Create new cursor, create indexes and run test queries cursor = mysqlConnection.cursor() print "Turning on key checks..." cursor.execute("SET FOREIGN_KEY_CHECKS = 1;") cursor.execute("SET UNIQUE_CHECKS = 1;") if createIndexes: result = Result() result.method = "MySQL-Idx" result.tag = tag rsidIndex = "CREATE UNIQUE INDEX `idx_rsid` ON `snp` (`rsid`)" clinIndex = "CREATE INDEX `idx_clin` ON `snp` (`has_sig`)" geneIndex = "CREATE INDEX `idx_gene` ON `locus` (`gene`)" print "Creating RSID index..." idxStart = time.time() cursor.execute(rsidIndex) idxEnd = time.time() result.idxRsid = idxEnd - idxStart print "Creating ClinSig index..." idxStart = time.time() cursor.execute(clinIndex) idxEnd = time.time() result.idxClinSig = idxEnd - idxStart print "Creating Gene index..." idxStart = time.time() cursor.execute(geneIndex) idxEnd = time.time() result.idxGene = idxEnd - idxStart resultsFile.write(result.toString() + '\n') if remote: try: print "Sending to GDocs..." gs.login() ws.append_row(result.stringArr()) except: print "Unable to send to GDocs, continuing..." if runQueries: for z in range(1,101): result = Result() result.method = "MySQL-Qry" + str(z) result.tag = tag print "Running queries, count " + str(z) idxStart = time.time() cursor.execute("SELECT * FROM locus l, snp s WHERE l.snp_id = s.id AND s.rsid = 'rs8788'") idxEnd = time.time() result.qryByRsid = idxEnd - idxStart idxStart = time.time() cursor.execute("SELECT count(s.id) FROM locus l, snp s WHERE l.snp_id = s.id AND s.has_sig = true") idxEnd = time.time() result.qryByClinSig = idxEnd - idxStart idxStart = time.time() cursor.execute("SELECT count(distinct s.rsid) FROM locus l, snp s WHERE l.snp_id = s.id AND l.gene = 'GRIN2B'") idxEnd = time.time() result.qryByGene = idxEnd - idxStart idxStart = time.time() cursor.execute("SELECT count(distinct s.rsid) FROM locus l, snp s WHERE l.snp_id = s.id AND l.gene = 'GRIN2B' AND s.has_sig = true") idxEnd = time.time() result.qryByGeneSig = idxEnd - idxStart resultsFile.write(result.toString() + '\n') if remote: try: print "Sending to GDocs..." gs.login() ws.append_row(result.stringArr()) except: print "Unable to send to GDocs, continuing..." # Close MySQL cursor cursor.close() resultsFile.close() mysqlConnection.close() print "Run complete."
from __future__ import unicode_literals import httplib import logging from django.core.exceptions import ValidationError from django.db import IntegrityError from django.db import connection from django.db import transaction from flask import request from framework.auth import Auth from framework.sessions import get_session from framework.exceptions import HTTPError from framework.auth.decorators import must_be_signed, must_be_logged_in from api.caching.tasks import update_storage_usage from osf.exceptions import InvalidTagError, TagNotFoundError from osf.models import FileVersion, OSFUser from osf.utils.permissions import WRITE from osf.utils.requests import check_select_for_update from website.project.decorators import ( must_not_be_registration, must_have_permission ) from website.project.model import has_anonymous_link from website.files import exceptions from addons.osfstorage import utils from addons.osfstorage import decorators from addons.osfstorage.models import OsfStorageFolder from addons.osfstorage import settings as osf_storage_settings logger = logging.getLogger(__name__) def make_error(code, message_short=None, message_long=None): data = {} if message_short: data['message_short'] = message_short if message_long: data['message_long'] = message_long return HTTPError(code, data=data) @must_be_signed def osfstorage_update_metadata(payload, **kwargs): """Metadata received from WaterButler, is built incrementally via latent task calls to this endpoint. The basic metadata response looks like:: { "metadata": { # file upload "name": "file.name", "md5": "d41d8cd98f00b204e9800998ecf8427e", "path": "...", "sha256": "e3b0c44298fc1c149afbf4c8996fb92427ae41e4649b934ca495991b7852b855", "version": "2", "downloads": "1", "checkout": "...", "latestVersionSeen": {"userId": "abc12", "seen": true}, "modified": "a date", "modified_utc": "a date in utc", # glacier vault (optional) "archive": "glacier_key", "vault": "glacier_vault_name", # parity files "parity": { "redundancy": "5", "files": [ {"name": "foo.txt.par2","sha256": "abc123"}, {"name": "foo.txt.vol00+01.par2","sha256": "xyz321"}, ] } }, } """ try: version_id = payload['version'] metadata = payload['metadata'] except KeyError: raise HTTPError(httplib.BAD_REQUEST) if check_select_for_update(): version = FileVersion.objects.filter(_id=version_id).select_for_update().first() else: version = FileVersion.objects.filter(_id=version_id).first() if version is None: raise HTTPError(httplib.NOT_FOUND) version.update_metadata(metadata) return {'status': 'success'} @must_be_signed @decorators.autoload_filenode(must_be='file') def osfstorage_get_revisions(file_node, payload, target, **kwargs): from osf.models import PageCounter, FileVersion # TODO Fix me onces django works is_anon = has_anonymous_link(target, Auth(private_key=request.args.get('view_only'))) counter_prefix = 'download:{}:{}:'.format(file_node.target._id, file_node._id) version_count = file_node.versions.count() # Don't worry. The only % at the end of the LIKE clause, the index is still used counts = dict(PageCounter.objects.filter(_id__startswith=counter_prefix).values_list('_id', 'total')) qs = FileVersion.includable_objects.filter(basefilenode__id=file_node.id).include('creator__guids').order_by('-created') for i, version in enumerate(qs): version._download_count = counts.get('{}{}'.format(counter_prefix, version_count - i - 1), 0) # Return revisions in descending order return { 'revisions': [ utils.serialize_revision(target, file_node, version, index=version_count - idx - 1, anon=is_anon) for idx, version in enumerate(qs) ] } @decorators.waterbutler_opt_hook def osfstorage_copy_hook(source, destination, name=None, **kwargs): ret = source.copy_under(destination, name=name).serialize(), httplib.CREATED update_storage_usage(destination.target) return ret @decorators.waterbutler_opt_hook def osfstorage_move_hook(source, destination, name=None, **kwargs): source_target = source.target try: ret = source.move_under(destination, name=name).serialize(), httplib.OK except exceptions.FileNodeCheckedOutError: raise HTTPError(httplib.METHOD_NOT_ALLOWED, data={ 'message_long': 'Cannot move file as it is checked out.' }) except exceptions.FileNodeIsPrimaryFile: raise HTTPError(httplib.FORBIDDEN, data={ 'message_long': 'Cannot move file as it is the primary file of preprint.' }) # once the move is complete recalculate storage for both targets if it's a inter-target move. if source_target != destination.target: update_storage_usage(destination.target) update_storage_usage(source_target) return ret @must_be_signed @decorators.autoload_filenode(default_root=True) def osfstorage_get_lineage(file_node, **kwargs): lineage = [] while file_node: lineage.append(file_node.serialize()) file_node = file_node.parent return {'data': lineage} @must_be_signed @decorators.autoload_filenode(default_root=True) def osfstorage_get_metadata(file_node, **kwargs): try: # TODO This should change to version as its internal it can be changed anytime version = int(request.args.get('revision')) except (ValueError, TypeError): # If its not a number version = None return file_node.serialize(version=version, include_full=True) @must_be_signed @decorators.autoload_filenode(must_be='folder') def osfstorage_get_children(file_node, **kwargs): from django.contrib.contenttypes.models import ContentType user_id = request.args.get('user_id') user_content_type_id = ContentType.objects.get_for_model(OSFUser).id user_pk = OSFUser.objects.filter(guids___id=user_id, guids___id__isnull=False).values_list('pk', flat=True).first() with connection.cursor() as cursor: # Read the documentation on FileVersion's fields before reading this code cursor.execute(""" SELECT json_agg(CASE WHEN F.type = 'osf.osfstoragefile' THEN json_build_object( 'id', F._id , 'path', '/' || F._id , 'name', F.name , 'kind', 'file' , 'size', LATEST_VERSION.size , 'downloads', COALESCE(DOWNLOAD_COUNT, 0) , 'version', (SELECT COUNT(*) FROM osf_basefilenode_versions WHERE osf_basefilenode_versions.basefilenode_id = F.id) , 'contentType', LATEST_VERSION.content_type , 'modified', LATEST_VERSION.created , 'created', EARLIEST_VERSION.created , 'checkout', CHECKOUT_GUID , 'md5', LATEST_VERSION.metadata ->> 'md5' , 'sha256', LATEST_VERSION.metadata ->> 'sha256' , 'latestVersionSeen', SEEN_LATEST_VERSION.case ) ELSE json_build_object( 'id', F._id , 'path', '/' || F._id || '/' , 'name', F.name , 'kind', 'folder' ) END ) FROM osf_basefilenode AS F LEFT JOIN LATERAL ( SELECT * FROM osf_fileversion JOIN osf_basefilenode_versions ON osf_fileversion.id = osf_basefilenode_versions.fileversion_id WHERE osf_basefilenode_versions.basefilenode_id = F.id ORDER BY created DESC LIMIT 1 ) LATEST_VERSION ON TRUE LEFT JOIN LATERAL ( SELECT * FROM osf_fileversion JOIN osf_basefilenode_versions ON osf_fileversion.id = osf_basefilenode_versions.fileversion_id WHERE osf_basefilenode_versions.basefilenode_id = F.id ORDER BY created ASC LIMIT 1 ) EARLIEST_VERSION ON TRUE LEFT JOIN LATERAL ( SELECT _id from osf_guid WHERE object_id = F.checkout_id AND content_type_id = %s LIMIT 1 ) CHECKOUT_GUID ON TRUE LEFT JOIN LATERAL ( SELECT P.total AS DOWNLOAD_COUNT FROM osf_pagecounter AS P WHERE P._id = 'download:' || %s || ':' || F._id LIMIT 1 ) DOWNLOAD_COUNT ON TRUE LEFT JOIN LATERAL ( SELECT EXISTS( SELECT (1) FROM osf_fileversionusermetadata INNER JOIN osf_fileversion ON osf_fileversionusermetadata.file_version_id = osf_fileversion.id INNER JOIN osf_basefilenode_versions ON osf_fileversion.id = osf_basefilenode_versions.fileversion_id WHERE osf_fileversionusermetadata.user_id = %s AND osf_basefilenode_versions.basefilenode_id = F.id LIMIT 1 ) ) SEEN_FILE ON TRUE LEFT JOIN LATERAL ( SELECT CASE WHEN SEEN_FILE.exists THEN CASE WHEN EXISTS( SELECT (1) FROM osf_fileversionusermetadata WHERE osf_fileversionusermetadata.file_version_id = LATEST_VERSION.fileversion_id AND osf_fileversionusermetadata.user_id = %s LIMIT 1 ) THEN json_build_object('user', %s, 'seen', TRUE) ELSE json_build_object('user', %s, 'seen', FALSE) END ELSE NULL END ) SEEN_LATEST_VERSION ON TRUE WHERE parent_id = %s AND (NOT F.type IN ('osf.trashedfilenode', 'osf.trashedfile', 'osf.trashedfolder')) """, [ user_content_type_id, file_node.target._id, user_pk, user_pk, user_id, user_id, file_node.id ]) return cursor.fetchone()[0] or [] @must_be_signed @decorators.autoload_filenode(must_be='folder') def osfstorage_create_child(file_node, payload, **kwargs): parent = file_node # Just for clarity name = payload.get('name') user = OSFUser.load(payload.get('user')) is_folder = payload.get('kind') == 'folder' if getattr(file_node.target, 'is_registration', False) and not getattr(file_node.target, 'archiving', False): raise HTTPError( httplib.BAD_REQUEST, data={ 'message_short': 'Registered Nodes are immutable', 'message_long': "The operation you're trying to do cannot be applied to registered Nodes, which are immutable", } ) if not (name or user) or '/' in name: raise HTTPError(httplib.BAD_REQUEST) if getattr(file_node.target, 'is_quickfiles', False) and is_folder: raise HTTPError(httplib.BAD_REQUEST, data={'message_long': 'You may not create a folder for QuickFiles'}) try: # Create a save point so that we can rollback and unlock # the parent record with transaction.atomic(): if is_folder: created, file_node = True, parent.append_folder(name) else: created, file_node = True, parent.append_file(name) except (ValidationError, IntegrityError): created, file_node = False, parent.find_child_by_name(name, kind=int(not is_folder)) if not created and is_folder: raise HTTPError(httplib.CONFLICT, data={ 'message_long': 'Cannot create folder "{name}" because a file or folder already exists at path "{path}"'.format( name=file_node.name, path=file_node.materialized_path, ) }) if file_node.checkout and file_node.checkout._id != user._id: raise HTTPError(httplib.FORBIDDEN, data={ 'message_long': 'File cannot be updated due to checkout status.' }) if not is_folder: try: metadata = dict(payload['metadata'], **payload['hashes']) location = dict(payload['settings'], **dict( payload['worker'], **{ 'object': payload['metadata']['name'], 'service': payload['metadata']['provider'], } )) except KeyError: raise HTTPError(httplib.BAD_REQUEST) current_version = file_node.get_version() new_version = file_node.create_version(user, location, metadata) if not current_version or not current_version.is_duplicate(new_version): update_storage_usage(file_node.target) version_id = new_version._id archive_exists = new_version.archive is not None else: version_id = None archive_exists = False return { 'status': 'success', 'archive': not archive_exists, # Should waterbutler also archive this file 'data': file_node.serialize(), 'version': version_id, }, httplib.CREATED if created else httplib.OK @must_be_signed @must_not_be_registration @decorators.autoload_filenode() def osfstorage_delete(file_node, payload, target, **kwargs): user = OSFUser.load(payload['user']) auth = Auth(user) #TODO Auth check? if not auth: raise HTTPError(httplib.BAD_REQUEST) if file_node == OsfStorageFolder.objects.get_root(target=target): raise HTTPError(httplib.BAD_REQUEST) try: file_node.delete(user=user) except exceptions.FileNodeCheckedOutError: raise HTTPError(httplib.FORBIDDEN) except exceptions.FileNodeIsPrimaryFile: raise HTTPError(httplib.FORBIDDEN, data={ 'message_long': 'Cannot delete file as it is the primary file of preprint.' }) update_storage_usage(file_node.target) return {'status': 'success'} @must_be_signed @decorators.autoload_filenode(must_be='file') def osfstorage_download(file_node, payload, **kwargs): # Set user ID in session data for checking if user is contributor # to project. user_id = payload.get('user') if user_id: current_session = get_session() current_session.data['auth_user_id'] = user_id current_session.save() if not request.args.get('version'): version_id = None else: try: version_id = int(request.args['version']) except ValueError: raise make_error(httplib.BAD_REQUEST, message_short='Version must be an integer if not specified') version = file_node.get_version(version_id, required=True) return { 'data': { 'name': file_node.name, 'path': version.location_hash, }, 'settings': { osf_storage_settings.WATERBUTLER_RESOURCE: version.location[osf_storage_settings.WATERBUTLER_RESOURCE], }, } @must_have_permission(WRITE) @decorators.autoload_filenode(must_be='file') def osfstorage_add_tag(file_node, **kwargs): data = request.get_json() if file_node.add_tag(data['tag'], kwargs['auth']): return {'status': 'success'}, httplib.OK return {'status': 'failure'}, httplib.BAD_REQUEST @must_have_permission(WRITE) @decorators.autoload_filenode(must_be='file') def osfstorage_remove_tag(file_node, **kwargs): data = request.get_json() try: file_node.remove_tag(data['tag'], kwargs['auth']) except TagNotFoundError: return {'status': 'failure'}, httplib.CONFLICT except InvalidTagError: return {'status': 'failure'}, httplib.BAD_REQUEST else: return {'status': 'success'}, httplib.OK @must_be_logged_in def update_region(auth, **kwargs): user = auth.user user_settings = user.get_addon('osfstorage') data = request.get_json() try: region_id = data['region_id'] except KeyError: raise HTTPError(httplib.BAD_REQUEST) try: user_settings.set_region(region_id) except ValueError: raise HTTPError(404, data=dict(message_short='Region not found', message_long='A storage region with this id does not exist')) return {'message': 'User region updated.'}
# Copyright (c) 2020, Apple Inc. All rights reserved. # # Use of this source code is governed by a BSD-3-clause license that can be # found in the LICENSE.txt file or at https://opensource.org/licenses/BSD-3-Clause import math from coremltools.converters.mil.mil import get_new_symbol, types from coremltools.converters.mil.mil.types.symbolic import is_symbolic MAX_SIZE_CONSTANT_FOLDING = 1024 * 1024 / 4 # When a fp32 const takes over 1MB, we won't create a const op for that def broadcast_shapes(shape_x, shape_y): """ Check and broadcast given input shapes. :param shape_x: tuple of int or symbols Shape of the first tensor (possibly symbolic). :param shape_y: tuple of int or symbols Shape of the second tensor (possibly symbolic). :return: tuple of int or symbols Result from broadcast. """ shape_x = tuple(shape_x) shape_y = tuple(shape_y) if len(shape_x) < len(shape_y): shape_x = tuple([1] * (len(shape_y) - len(shape_x))) + shape_x if len(shape_y) < len(shape_x): shape_y = tuple([1] * (len(shape_x) - len(shape_y))) + shape_y ret_shapes = list() for i in range(len(shape_x)): x_unknown = is_symbolic(shape_x[i]) y_unknown = is_symbolic(shape_y[i]) if shape_x[i] == 1: ret_shapes.append(shape_y[i]) elif shape_y[i] == 1: ret_shapes.append(shape_x[i]) elif not y_unknown and shape_y[i] > 1: if not x_unknown and shape_x[i] != shape_y[i]: raise ValueError( "Incompatible dim {} in shapes {} vs. {}".format( i, shape_x, shape_y ) ) ret_shapes.append(shape_y[i]) elif not x_unknown and shape_x[i] > 1: if not y_unknown and shape_x[i] != shape_y[i]: raise ValueError( "Incompatible dim {} in shapes {} vs. {}".format( i, shape_x, shape_y ) ) ret_shapes.append(shape_x[i]) elif x_unknown or y_unknown: ret_shapes.append(get_new_symbol()) else: assert shape_x[i] == shape_y[i] ret_shapes.append(shape_x[i]) return tuple(ret_shapes) def promoted_primitive_type(type1, type2): """ Given a pair of tensor or primitive types, find the smallest type that can store an instance of their primitive type. """ ptype1 = type1.get_primitive() if types.is_tensor(type1) else type1 ptype2 = type2.get_primitive() if types.is_tensor(type2) else type2 return types.promote_types(ptype1, ptype2) def effective_kernel(kernel_shape, dilations): """ Args: kernel_shape: tuple[int] representing the kernel shape in each given dimension. dilations: tuple[int] representing the dilation of the kernel in each given dimension. Must be the same length as kernel_shape, and is assumed to give the dimensions in the same order as kernel_shape Returns: tuple[int] representing the effective shape of the kernel in each given dimension, with each dimension in the order given, taking into account dilation. See http://deeplearning.net/software/theano/tutorial/conv_arithmetic.html#dilated-convolutions Note that a dilation of 1 is equivalent to having no dilation. """ if len(kernel_shape) != len(dilations): raise ValueError( "kernel_shape ({}) and dilations ({}) must be the same length".format( len(kernel_shape), len(dilations) ) ) return [(k - 1) * d + 1 for k, d in zip(kernel_shape, dilations)] def aggregated_pad( pad_type, kernel_shape, input_shape=None, strides=None, dilations=None, custom_pad=None, ): """ Args pad_type: string. Must be one of ('same', 'valid', 'custom') kernel_shape: [kH, kW, ...]: spatial kernel dims (excluding channels) input_shape: [iH, iW, ...]: spatial input dims (excluding channels) Required iff pad_type == 'same' strides: [sH, sW, ...]: spatial strides (excluding channels) Required iff pad_type == 'same' dilations: [dH, dW, ...]: dilations (excluding channels) If not provided, defaults to [1, 1, ...], effectively no dilation. custom_pad: Required iff pad_type == 'custom'. custom_pad[2*i], custom_pad[2*i+1] are before/after custom padding for spatial dim i. Returns: A list of total (before + after) padding for each spatial dimension in kernel_shape. """ num_spatial_dims = len(kernel_shape) if dilations is None: dilations = [1] * num_spatial_dims elif len(dilations) != num_spatial_dims: raise ValueError( "dilations must have same length as kernel_shape ({}, but got {})".format( num_spatial_dims, len(dilations) ) ) if pad_type == "same": if input_shape is None or len(input_shape) != num_spatial_dims: raise ValueError( "For SAME padding input_shape must not be None and must have " "same length as kernel_shape ({}, but got {})".format( num_spatial_dims, len(input_shape) if input_shape is not None else "None", ) ) if strides is None or len(strides) != num_spatial_dims: raise ValueError( "For SAME padding strides must not be None and must have " "same length as kernel_shape ({}, but got {})".format( num_spatial_dims, len(strides) if strides is not None else "None" ) ) effective_ks = effective_kernel(kernel_shape, dilations) return [ int(max(0, s * math.ceil(float(i) / float(s)) - i + k - s)) if not is_symbolic(i) else get_new_symbol() for i, k, s in zip(input_shape, effective_ks, strides) ] if pad_type == "valid": return [0] * num_spatial_dims if pad_type == "custom": if custom_pad is None or len(custom_pad) != 2 * num_spatial_dims: raise ValueError("Invalid custom_pad.") return [ custom_pad[2 * d] + custom_pad[2 * d + 1] for d in range(num_spatial_dims) ] raise ValueError('Invalid padding pad_type "{}"'.format(pad_type)) def spatial_dimensions_out_shape( pad_type, input_shape, kernel_shape, strides, dilations=None, custom_pad=None, ceil_mode=False, ): """ Args pad_type: string. Must be one of ('same', 'valid', 'custom') input_shape: [iH, iW, ...]: spatial input dims (excluding channels) Required iff pad_type == 'same' kernel_shape: [kH, kW, ...]: spatial kernel dims (excluding channels) strides: [sH, sW, ...]: spatial strides (excluding channels) Required iff pad_type == 'same' dilations: [dH, dW, ...]: dilations (excluding channels) If not provided, defaults to [1, 1, ...], effectively no dilation. custom_pad: Required iff pad_type == 'custom'. custom_pad[2*i], custom_pad[2*i+1] are before/after custom padding for spatial dim i. ceil_mode: determines the padding and output shape. When ceil mode is True: out_dim = floor((in_dim + pad_l + pad_r - kernel_size + (stride-1)) / stride) + 1 if (out_dim-1) * stride >= in_dim + pad_l and (pad_l > 0 or pad_r > 0): out_dim = out_dim - 1 When ceil mode is False: out_dim = floor((in_dim + pad_l + pad_r - kernel_size) / stride) + 1 Returns: A list of spatial output sizes for each spatial dimension of kernel_shape. """ num_spatial_dims = len(kernel_shape) if dilations is None: dilations = [1] * num_spatial_dims if custom_pad is None: custom_pad = [0] * num_spatial_dims * 2 if not ( len(input_shape) == len(kernel_shape) == len(strides) == len(dilations) == len(custom_pad) / 2 ): raise ValueError( "input_shape (length {}), kernel_shape (length {}), " "strides (length {}), dilations (length {}), and " "custom_pad (length {}) divided by two must all be " "the same length".format( len(input_shape), len(kernel_shape), len(strides), len(dilations), len(custom_pad), ) ) pad = aggregated_pad( pad_type=pad_type, kernel_shape=kernel_shape, input_shape=input_shape, strides=strides, dilations=dilations, custom_pad=custom_pad, ) effective_ks = effective_kernel(kernel_shape, dilations) out_shape = [] for r in range(num_spatial_dims): if is_symbolic(input_shape[r]): out_shape.append(get_new_symbol()) else: if not ceil_mode: out_shape.append(math.floor((input_shape[r] + pad[r] - effective_ks[r]) / strides[r] + 1)) else: out_dim = math.floor((input_shape[r] + pad[r] - effective_ks[r] + strides[r] - 1) / strides[r] + 1) if (out_dim - 1) * strides[r] >= input_shape[r] + pad[r]/2 and pad[r] > 0: out_dim = out_dim - 1 out_shape.append(out_dim) return out_shape def parse_einsum_equation(equation): """ Args equation : str parse the equation in the following manner: (running example: "nchw,nwhr->nchr") step 1: split the equation with delimiter "->" e.g.: this will give "nchw,nwhr" and "nchr" step 2: split the LHS equation string with delimiter "," e.g.: this will give input1 : "nchw", input2: "nwhr" step 3: map each character to a unique integer, which is incremented. Iterate over input1, input2 and output, in that order. e.g.: input 1, i.e., "nchw" will give vector {0,1,2,3} input 2, i.e, "nwhr" will produce {0,3,2,4} output , i.e. "nchr" will produce {0,1,2,4} return vectors corresponding to the 2 inputs and the output """ input_output_str = equation.split('->') assert len(input_output_str) == 2, "unsupported einsum equation {}".format(equation) input_str = input_output_str[0] output_str = input_output_str[1] inputs = input_str.split(',') assert len(inputs) == 2, "unsupported einsum equation {}".format(equation) input1_str = inputs[0] input2_str = inputs[1] input1_vec = [-1 for i in range(len(input1_str))] input2_vec = [-1 for i in range(len(input2_str))] output_vec = [-1 for i in range(len(output_str))] map_char_to_int = {} def _update_vec(str, vec, map_char_to_int, index): for i, s in enumerate(str): if s not in map_char_to_int: map_char_to_int[s] = index index += 1 vec[i] = map_char_to_int[s] return index index = _update_vec(input1_str, input1_vec, map_char_to_int, 0) index = _update_vec(input2_str, input2_vec, map_char_to_int, index) index = _update_vec(output_str, output_vec, map_char_to_int, index) return input1_vec, input2_vec, output_vec
# -*- coding: utf-8 -*- import hashlib import os from hamcrest import ( assert_that, calling, equal_to, has_entries, has_entry, raises ) from pydeform.exceptions import NotFoundError, ValidationError from testutils import ( DeformSessionProjectClientTestCaseMixin, DeformTokenProjectClientTestCaseMixin, TestCase ) from unittest import skip class ProjectClientTestBase__document(object): project_client_attr = None def setUp(self): super(ProjectClientTestBase__document, self).setUp() try: getattr(self, self.project_client_attr).collection.remove( identity='venues' ) except NotFoundError: pass def test_get(self): response = getattr(self, self.project_client_attr).document.get( identity=self.CONFIG['DEFORM']['PROJECT_TOKEN'], collection='_tokens' ) assert_that( response, has_entries({ 'name': 'First project Token', '_id': self.CONFIG['DEFORM']['PROJECT_TOKEN'], }) ) def test_get_not_existing_document(self): assert_that( calling( getattr(self, self.project_client_attr).document.get ).with_args( identity='not_existing_document', collection='_tokens' ), raises(NotFoundError, '^Document not found\.$') ) def test_with_fields(self): response = getattr(self, self.project_client_attr).document.get( identity=self.CONFIG['DEFORM']['PROJECT_TOKEN'], collection='_tokens', fields=['name'] ) assert_that( response, equal_to({ 'name': 'First project Token', '_id': self.CONFIG['DEFORM']['PROJECT_TOKEN'], }) ) def test_with_fields_exclude(self): response = getattr(self, self.project_client_attr).document.get( identity=self.CONFIG['DEFORM']['PROJECT_TOKEN'], collection='_tokens', fields_exclude=['name'] ) assert_that('name' in response, equal_to(False)) def test_create(self): try: getattr(self, self.project_client_attr).document.remove( collection='venues', identity='subway' ) except NotFoundError: pass response = getattr(self, self.project_client_attr).document.create( collection='venues', data={ '_id': 'subway', 'name': 'Subway' } ) assert_that( response, has_entries({ '_id': 'subway', 'name': 'Subway' }) ) @skip('https://github.com/deformio/python-deform/issues/11') def test_get_document_with_id_containing_slash(self): try: getattr(self, self.project_client_attr).document.remove( collection='venues', identity='sub/way' ) except NotFoundError: pass getattr(self, self.project_client_attr).document.create( collection='venues', data={ '_id': 'sub/way', 'name': 'Subway' } ) response = getattr(self, self.project_client_attr).document.get( identity='sub/way', collection='venues' ) assert_that( response, has_entries({ '_id': 'sub/way', 'name': 'Subway' }) ) def test_get_property(self): try: getattr(self, self.project_client_attr).document.remove( collection='venues', identity='subway' ) except NotFoundError: pass response = getattr(self, self.project_client_attr).document.create( collection='venues', data={ '_id': 'subway', 'name': 'Subway', 'comment': { 'user': { 'name': 'gennady', 'surname': 'chibisov' } } } ) response = getattr(self, self.project_client_attr).document.get( collection='venues', identity='subway', property=['comment', 'user'] ) assert_that( response, equal_to({ 'name': 'gennady', 'surname': 'chibisov' }) ) def test_get_not_existing_property(self): try: getattr(self, self.project_client_attr).document.remove( collection='venues', identity='subway' ) except NotFoundError: pass getattr(self, self.project_client_attr).document.create( collection='venues', data={ '_id': 'subway', 'name': 'Subway', 'comment': { 'user': { 'name': 'gennady' } } } ) assert_that( calling( getattr(self, self.project_client_attr).document.get ).with_args( collection='venues', identity='subway', property=['comment', 'user', 'surname'] ), raises(NotFoundError, '^Document property not found\.$') ) def test_save__with_identity(self): try: getattr(self, self.project_client_attr).document.remove( identity='subway', collection='venues' ) except NotFoundError: pass # first save response = getattr(self, self.project_client_attr).document.save( identity='subway', collection='venues', data={ 'name': 'Subway' } ) assert_that(response['created'], equal_to(True)) assert_that( response['result'], has_entries({ '_id': 'subway', 'name': 'Subway' }) ) # second save response = getattr(self, self.project_client_attr).document.save( identity='subway', collection='venues', data={ 'name': 'Subway saved with identity' } ) assert_that(response['created'], equal_to(False)) assert_that( response['result'], has_entries({ '_id': 'subway', 'name': 'Subway saved with identity', }) ) def test_save__without_identity(self): try: getattr(self, self.project_client_attr).document.remove( identity='subway', collection='venues' ) except NotFoundError: pass # first save response = getattr(self, self.project_client_attr).document.save( collection='venues', data={ '_id': 'subway', 'name': 'Subway' } ) assert_that(response['created'], equal_to(True)) assert_that( response['result'], has_entries({ '_id': 'subway', 'name': 'Subway' }) ) # second save response = getattr(self, self.project_client_attr).document.save( collection='venues', data={ '_id': 'subway', 'name': 'Subway saved with identity' } ) assert_that(response['created'], equal_to(False)) assert_that( response['result'], has_entries({ '_id': 'subway', 'name': 'Subway saved with identity', }) ) def test_save_property(self): try: getattr(self, self.project_client_attr).document.remove( identity='subway', collection='venues' ) except NotFoundError: pass getattr(self, self.project_client_attr).document.create( collection='venues', data={ '_id': 'subway', 'name': 'Subway', 'comment': { 'user': { 'name': 'gennady' } } } ) response = getattr(self, self.project_client_attr).document.save( identity='subway', collection='venues', property=['comment', 'user', 'surname'], data='chibisov' ) assert_that(response['created'], equal_to(True)) assert_that(response['result'], equal_to('chibisov')) response = getattr(self, self.project_client_attr).document.get( identity='subway', collection='venues', property=['comment', 'user'] ) assert_that( response, has_entries({ 'name': 'gennady', 'surname': 'chibisov', }) ) # should replace property response = getattr(self, self.project_client_attr).document.save( identity='subway', collection='venues', property=['comment', 'user'], data={ 'name': 'andrey' } ) assert_that(response['created'], equal_to(False)) assert_that(response['result'], equal_to({'name': 'andrey'})) response = getattr(self, self.project_client_attr).document.get( identity='subway', collection='venues', property=['comment', 'user'] ) assert_that( response, equal_to({ 'name': 'andrey' }) ) def test_update(self): try: getattr(self, self.project_client_attr).document.remove( identity='subway', collection='venues' ) except NotFoundError: pass getattr(self, self.project_client_attr).document.create( collection='venues', data={ '_id': 'subway', 'name': 'Subway', 'comment': { 'user': 'gena', 'text': 'good' } } ) response = getattr(self, self.project_client_attr).document.update( identity='subway', collection='venues', data={ 'comment': { 'text': 'bad' } } ) assert_that( response['comment'], equal_to({ 'text': 'bad' }) ) def test_remove(self): getattr(self, self.project_client_attr).document.save( collection='venues', data={ '_id': 'subway', 'name': 'Subway' } ) response = getattr(self, self.project_client_attr).document.remove( identity='subway', collection='venues' ) assert_that(response, equal_to(None)) def test_schema_validation(self): getattr(self, self.project_client_attr).collection.save( identity='venues', data={ 'name': 'Venues', 'schema': { 'properties': { 'name': { 'type': 'string', 'required': True } } } } ) assert_that( calling( getattr(self, self.project_client_attr).document.save ).with_args( collection='venues', data={ '_id': 'subway' } ), raises(ValidationError, '^Validation error') ) response = getattr(self, self.project_client_attr).document.save( collection='venues', data={ '_id': 'subway', 'name': 'Subway' } ) assert_that( response['result'], has_entry('name', 'Subway') ) def test_file(self): # remove all files getattr(self, self.project_client_attr).documents.remove( collection='_files' ) getattr(self, self.project_client_attr).collection.save( identity='venues', data={ 'name': 'Venues', 'schema': { 'properties': { 'name': { 'type': 'string', 'required': True }, 'phones': { 'type': 'array', 'items': { 'type': 'number' } }, 'info': { 'type': 'file', 'required': True }, 'logo': { 'type': 'file', 'required': True } } } } ) text_file = open( os.path.join(self.CONFIG['FILES_PATH'], '1.txt'), 'rt' ) image_file = open( os.path.join(self.CONFIG['FILES_PATH'], '1.png'), 'rb' ) # test upload response = getattr(self, self.project_client_attr).document.save( identity='subway', collection='venues', data={ 'name': 'subway', 'phones': [1234, 5678], 'info': text_file, 'logo': image_file, } ) result = response['result'] text_file.seek(0) image_file.seek(0) text_file_content = text_file.read() image_file_content = image_file.read() assert_that( result, has_entries({ 'name': 'subway', 'phones': [1234, 5678], 'info': has_entries({ 'name': '1.txt', 'content_type': 'text/plain', 'md5': hashlib.md5(text_file_content).hexdigest() }), 'logo': has_entries({ 'name': '1.png', 'content_type': 'image/png', 'md5': hashlib.md5(image_file_content).hexdigest() }) }) ) # test download info_content_response = getattr( self, self.project_client_attr ).document.get( identity='subway', collection='venues', property=['info', 'content'] ) assert_that(info_content_response, equal_to(text_file_content)) logo_content_response = getattr( self, self.project_client_attr ).document.get( identity='subway', collection='venues', property=['logo', 'content'] ) assert_that(logo_content_response, equal_to(image_file_content)) # test getting file object info_content_stream_response = getattr( self, self.project_client_attr ).document.get_file( identity='subway', collection='venues', property=['info'], ) assert_that( info_content_stream_response.read(), equal_to(text_file_content) ) logo_content_stream_response = getattr( self, self.project_client_attr ).document.get_file( identity='subway', collection='venues', property=['logo'], ) assert_that( logo_content_stream_response.read(), equal_to(image_file_content) ) def test_file_upload_directly_to_files_collection(self): getattr(self, self.project_client_attr).documents.remove( collection='_files' ) text_file = open( os.path.join(self.CONFIG['FILES_PATH'], '1.txt'), 'rt' ) image_file = open( os.path.join(self.CONFIG['FILES_PATH'], '1.png'), 'rb' ) # test upload text file response = getattr(self, self.project_client_attr).document.save( identity='text_file', collection='_files', data=text_file ) text_file_result = response['result'] text_file.seek(0) text_file_content = text_file.read() assert_that( text_file_result, has_entries({ '_id': 'text_file', 'collection_id': '_files', 'content_type': 'text/plain', 'document_id': '', 'name': '1.txt', 'md5': hashlib.md5(text_file_content).hexdigest() }) ) # test upload binary file response = getattr(self, self.project_client_attr).document.save( identity='image_file', collection='_files', data=image_file ) text_file_result = response['result'] image_file.seek(0) image_file_content = image_file.read() assert_that( text_file_result, has_entries({ '_id': 'image_file', 'collection_id': '_files', 'content_type': 'image/png', 'document_id': '', 'name': '1.png', 'md5': hashlib.md5(image_file_content).hexdigest() }) ) # test getting text file object text_file_content_stream_response = getattr( self, self.project_client_attr ).document.get_file( identity='text_file', collection='_files' ) assert_that( text_file_content_stream_response.read(), equal_to(text_file_content) ) # test getting image file object image_file_content_stream_response = getattr( self, self.project_client_attr ).document.get_file( identity='image_file', collection='_files' ) assert_that( image_file_content_stream_response.read(), equal_to(image_file_content) ) class SessionProjectClientTest__document( ProjectClientTestBase__document, DeformSessionProjectClientTestCaseMixin, TestCase ): project_client_attr = 'deform_session_project_client' class TokenProjectClientTest__document( ProjectClientTestBase__document, DeformTokenProjectClientTestCaseMixin, TestCase ): project_client_attr = 'deform_token_project_client'
__author__ = 'teemu kanstren' import time import os import unittest import shutil import inspect from elasticsearch import Elasticsearch import pkg_resources from pypro.local.loggers.es_network_logger import ESNetLogger from pypro import utils import pypro.tests.t_assert as t_assert import pypro.local.config as config #weird regex syntax, pattern required, weird errors... #es = Elasticsearch() #config.ES_INDEX = "pypro_tests" #data = es.search(index=config.ES_INDEX) #items = data["hits"]["hits"] #print(str(items[0]["_source"]["bytes_sent"])) # data = self.es.get(config.ES_INDEX, doc_type="system_cpu") #print(str(data)) class TestESLogs(unittest.TestCase): @classmethod def setUpClass(cls): config.DB_NAME = "pypro_tests" config.PRINT_CONSOLE = False def setUp(self): if os.path.exists(utils.log_dir): shutil.rmtree(utils.log_dir, ignore_errors=True) self.es = Elasticsearch() self.es.delete_by_query(config.DB_NAME, body='{"query":{"match_all":{}}}', ignore=[404]) def test_cpu_sys_es(self): log = ESNetLogger() log.cpu_sys(0, 1, 1, 1, 1) log.cpu_sys(1, 3, 2, 5, 6) log.cpu_sys(3, 22, 99, 11, 4) log.cpu_sys(5, 155, 122, 12, 22) log.close() time.sleep(1) data = self.es.search(index=config.DB_NAME, body='{"query":{"match_all":{}}, "sort": { "time": { "order": "asc" }}}') items = data["hits"]["hits"] self.assertEqual(4, len(items), "number of cpu sys items logged") self.assert_cpu_sys(items[0]["_source"], 0, 1, 1, 1, 1) self.assert_cpu_sys(items[1]["_source"], 1, 3, 2, 5, 6) self.assert_cpu_sys(items[2]["_source"], 3, 22, 99, 11, 4) self.assert_cpu_sys(items[3]["_source"], 5, 155, 122, 12, 22) def assert_cpu_sys(self, item, time, user_count, system_count, idle_count, percent): self.assertEqual(5, len(item), "number of properties for a cpu sys item") self.assertEqual(item['time'], time) self.assertEqual(item['percent'], percent) self.assertEqual(item['idle_count'], idle_count) self.assertEqual(item['system_count'], system_count) self.assertEqual(item['user_count'], user_count) def test_cpu_proc_es(self): log = ESNetLogger() log.cpu_proc(0, 1, 1, 1, 1, 1, 1, 1, "p1") log.cpu_proc(1, 2, 1, 3, 4, 2, 3, 1, "p2") log.cpu_proc(2, 3, 2, 122, 7, 5, 8, 11, "p3") log.cpu_proc(10, 1, 1, 1, 1, 1, 1, 1, "p1") log.cpu_proc(11, 2, 1, 3, 4, 2, 3, 1, "p2") log.cpu_proc(12, 3, 2, 122, 7, 5, 8, 11, "p3") log.cpu_proc(20, 1, 1, 5, 1, 4, 3, 2, "p1") log.cpu_proc(21, 3, 2, 555, 7, 11, 55, 32, "p3") log.close() time.sleep(1) data = self.es.search(index=config.DB_NAME, body='{"query":{"match_all":{}}, "sort": { "time": { "order": "asc" }}}') items = data["hits"]["hits"] self.assertEqual(8, len(items), "number of cpu proc items logged") # print(str(items[0]["_source"])) self.assert_cpu_proc(items[0]["_source"], 0, 1, 1, 1, 1, 1, 1, 1, "p1") self.assert_cpu_proc(items[1]["_source"], 1, 2, 1, 3, 4, 2, 3, 1, "p2") self.assert_cpu_proc(items[2]["_source"], 2, 3, 2, 122, 7, 5, 8, 11, "p3") self.assert_cpu_proc(items[3]["_source"], 10, 1, 1, 1, 1, 1, 1, 1, "p1") self.assert_cpu_proc(items[4]["_source"], 11, 2, 1, 3, 4, 2, 3, 1, "p2") self.assert_cpu_proc(items[5]["_source"], 12, 3, 2, 122, 7, 5, 8, 11, "p3") self.assert_cpu_proc(items[6]["_source"], 20, 1, 1, 5, 1, 4, 3, 2, "p1") self.assert_cpu_proc(items[7]["_source"], 21, 3, 2, 555, 7, 11, 55, 32, "p3") def assert_cpu_proc(self, item, time, pid, priority, ctx_count, n_threads, cpu_user, cpu_system, percent, pname): self.assertEqual(9, len(item), "number of properties for a cpu sys item") self.assertEqual(item['time'], time) self.assertEqual(item['pid'], pid) self.assertEqual(item['priority'], priority) self.assertEqual(item['context_switches'], ctx_count) self.assertEqual(item['threads'], n_threads) self.assertEqual(item['cpu_user'], cpu_user) self.assertEqual(item['cpu_system'], cpu_system) self.assertEqual(item['percent'], percent) self.assertEqual(item['pname'], pname) # args = locals().copy() # del args["self"] # del args["item"] # expected_len = len(args) #reduce self and item # actual_len = len(item) # self.assertEqual(expected_len, actual_len, "number of properties for a cpu proc") # for arg in args: # value = args[arg] # if arg == "time": # value *= 1000 # self.assertEqual(item[arg], value) def test_mem_sys_es(self): log = ESNetLogger() log.mem_sys(0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1) log.mem_sys(10, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2) log.mem_sys(12, 34, 654, 24, 33, 23, 442, 1, 13, 21, 44) log.mem_sys(15, 3445, 345, 345, 44, 745, 367, 32, 1111, 33, 55) log.mem_sys(33, 33, 453, 998, 347, 976, 8544, 45, 5555, 66, 33) log.close() time.sleep(1) data = self.es.search(index=config.DB_NAME, body='{"query":{"match_all":{}}, "sort": { "time": { "order": "asc" }}}') items = data["hits"]["hits"] self.assertEqual(5, len(items), "number of mem sys items logged") self.assert_mem_sys(items[0]["_source"], 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1) self.assert_mem_sys(items[1]["_source"], 10, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2) self.assert_mem_sys(items[2]["_source"], 12, 34, 654, 24, 33, 23, 442, 1, 13, 21, 44) self.assert_mem_sys(items[3]["_source"], 15, 3445, 345, 345, 44, 745, 367, 32, 1111, 33, 55) self.assert_mem_sys(items[4]["_source"], 33, 33, 453, 998, 347, 976, 8544, 45, 5555, 66, 33) def assert_mem_sys(self, item, time, available, percent, used, free, swap_total, swap_used, swap_free, swap_in, swap_out, swap_percent): self.assertEqual(11, len(item), "number of properties for a mem sys item") self.assertEqual(item['time'], time) self.assertEqual(item['available'], available) self.assertEqual(item['percent'], percent) self.assertEqual(item['used'], used) self.assertEqual(item['free'], free) self.assertEqual(item['swap_total'], swap_total) self.assertEqual(item['swap_used'], swap_used) self.assertEqual(item['swap_free'], swap_free) self.assertEqual(item['swap_in'], swap_in) self.assertEqual(item['swap_out'], swap_out) self.assertEqual(item['swap_percent'], swap_percent) def test_mem_proc_es(self): log = ESNetLogger() log.mem_proc(0, 1, 11, 15, 5, "p1") log.mem_proc(1, 2, 1, 3, 2, "p2") log.mem_proc(2, 5432, 21, 33, 9, "p3") log.mem_proc(5, 1, 22, 11, 3, "p1") log.mem_proc(6, 5432, 7, 55, 7, "p3") log.mem_proc(66, 1, 11, 15, 5, "p1") log.mem_proc(67, 2, 11, 0, 22, "p2") log.mem_proc(68, 5432, 212, 334, 44, "p3") log.close() time.sleep(1) data = self.es.search(index=config.DB_NAME, body='{"query":{"match_all":{}}, "sort": { "time": { "order": "asc" }}}') items = data["hits"]["hits"] self.assertEqual(8, len(items), "number of mem proc items logged") # print(str(items[0]["_source"])) self.assert_mem_proc(items[0]["_source"], 0, 1, 11, 15, 5, "p1") self.assert_mem_proc(items[1]["_source"], 1, 2, 1, 3, 2, "p2") self.assert_mem_proc(items[2]["_source"], 2, 5432, 21, 33, 9, "p3") self.assert_mem_proc(items[3]["_source"], 5, 1, 22, 11, 3, "p1") self.assert_mem_proc(items[4]["_source"], 6, 5432, 7, 55, 7, "p3") self.assert_mem_proc(items[5]["_source"], 66, 1, 11, 15, 5, "p1") self.assert_mem_proc(items[6]["_source"], 67, 2, 11, 0, 22, "p2") self.assert_mem_proc(items[7]["_source"], 68, 5432, 212, 334, 44, "p3") def assert_mem_proc(self, item, time, pid, rss, vms, percent, pname): self.assertEqual(6, len(item), "number of properties for a mem proc item") self.assertEqual(item['time'], time) self.assertEqual(item['pid'], pid) self.assertEqual(item['rss'], rss) self.assertEqual(item['vms'], vms) self.assertEqual(item['percent'], percent) self.assertEqual(item['pname'], pname) def test_io_sys_es(self): log = ESNetLogger() log.io_sys(11111, 22, 22, 34, 43, 11, 11, 5, 3) log.io_sys(22222, 55, 23, 44, 34, 23, 17, 15, 4) log.io_sys(22233, 65, 23, 777, 44, 28, 18, 35, 5) log.io_sys(25555, 78, 44, 1911, 53, 99434, 43, 43, 21) log.close() time.sleep(1) data = self.es.search(index=config.DB_NAME, body='{"query":{"match_all":{}}, "sort": { "time": { "order": "asc" }}}') items = data["hits"]["hits"] self.assertEqual(4, len(items), "number of mem sys items logged") # print(str(items[0]["_source"])) self.assert_io_sys(items[0]["_source"], 11111, 22, 22, 34, 43, 11, 11, 5, 3) self.assert_io_sys(items[1]["_source"], 22222, 55, 23, 44, 34, 23, 17, 15, 4) self.assert_io_sys(items[2]["_source"], 22233, 65, 23, 777, 44, 28, 18, 35, 5) self.assert_io_sys(items[3]["_source"], 25555, 78, 44, 1911, 53, 99434, 43, 43, 21) def assert_io_sys(self, item, time, bytes_sent, bytes_recv, packets_sent, packets_recv, errin, errout, dropin, dropout): self.assertEqual(9, len(item), "number of properties for a mem proc item") self.assertEqual(item['time'], time) self.assertEqual(item['bytes_sent'], bytes_sent) self.assertEqual(item['bytes_recv'], bytes_recv) self.assertEqual(item['packets_sent'], packets_sent) self.assertEqual(item['packets_received'], packets_recv) self.assertEqual(item['errors_in'], errin) self.assertEqual(item['errors_out'], errout) self.assertEqual(item['dropped_in'], dropin) self.assertEqual(item['dropped_out'], dropout) def test_proc_error_es(self): log = ESNetLogger() log.proc_error(11111, 22, "epic fail") log.proc_error(11112, 9758, "fail") log.proc_error(11113, 7364, "little fail") log.close() time.sleep(1) data = self.es.search(index=config.DB_NAME, body='{"query":{"match_all":{}}, "sort": { "time": { "order": "asc" }}}') items = data["hits"]["hits"] self.assertEqual(3, len(items), "number of mem sys items logged") # print(str(items[0]["_source"])) self.assert_proc_error(items[0]["_source"], 11111, 22, "epic fail") self.assert_proc_error(items[1]["_source"], 11112, 9758, "fail") self.assert_proc_error(items[2]["_source"], 11113, 7364, "little fail") def assert_proc_error(self, item, time, pid, name): self.assertEqual(3, len(item), "number of properties for a proc error item") self.assertEqual(item['time'], time) self.assertEqual(item['pid'], pid) self.assertEqual(item['name'], name) def test_proc_info_es(self): log = ESNetLogger() log.proc_info(11111, 22, "proc1") log.proc_info(11111, 9758, "proc2") log.proc_info(11111, 7364, "proc4") log.proc_info(11111, 3332, "proc3") log.close() time.sleep(1) data = self.es.search(index=config.DB_NAME, body='{"query":{"match_all":{}}, "sort": { "pid": { "order": "asc" }}}') items = data["hits"]["hits"] self.assertEqual(4, len(items), "number of mem sys items logged") # print(str(items[0]["_source"])) self.assert_proc_error(items[0]["_source"], 11111, 22, "proc1") self.assert_proc_error(items[1]["_source"], 11111, 3332, "proc3") self.assert_proc_error(items[2]["_source"], 11111, 7364, "proc4") self.assert_proc_error(items[3]["_source"], 11111, 9758, "proc2") def assert_proc_info(self, item, time, pid, name): self.assertEqual(3, len(item), "number of properties for a proc info item") self.assertEqual(item['time'], time) self.assertEqual(item['pid'], pid) self.assertEqual(item['name'], name)
# vim: tabstop=4 shiftwidth=4 softtabstop=4 # # Copyright (c) 2010 Citrix Systems, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. # #============================================================================ # # Parts of this file are based upon xmlrpclib.py, the XML-RPC client # interface included in the Python distribution. # # Copyright (c) 1999-2002 by Secret Labs AB # Copyright (c) 1999-2002 by Fredrik Lundh # # By obtaining, using, and/or copying this software and/or its # associated documentation, you agree that you have read, understood, # and will comply with the following terms and conditions: # # Permission to use, copy, modify, and distribute this software and # its associated documentation for any purpose and without fee is # hereby granted, provided that the above copyright notice appears in # all copies, and that both that copyright notice and this permission # notice appear in supporting documentation, and that the name of # Secret Labs AB or the author not be used in advertising or publicity # pertaining to distribution of the software without specific, written # prior permission. # # SECRET LABS AB AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD # TO THIS SOFTWARE, INCLUDING ALL IMPLIED WARRANTIES OF MERCHANT- # ABILITY AND FITNESS. IN NO EVENT SHALL SECRET LABS AB OR THE AUTHOR # BE LIABLE FOR ANY SPECIAL, INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY # DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, # WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS # ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE # OF THIS SOFTWARE. # -------------------------------------------------------------------- """ A fake XenAPI SDK. """ import random import uuid from xml.sax import saxutils import pprint from nova import exception from nova.openstack.common import jsonutils from nova.openstack.common import log as logging from nova.openstack.common import timeutils _CLASSES = ['host', 'network', 'session', 'pool', 'SR', 'VBD', 'PBD', 'VDI', 'VIF', 'PIF', 'VM', 'VLAN', 'task'] _db_content = {} LOG = logging.getLogger(__name__) def log_db_contents(msg=None): text = msg or "" content = pprint.pformat(_db_content) LOG.debug(_("%(text)s: _db_content => %(content)s") % locals()) def reset(): for c in _CLASSES: _db_content[c] = {} host = create_host('fake') create_vm('fake', 'Running', is_a_template=False, is_control_domain=True, resident_on=host) def reset_table(table): if not table in _CLASSES: return _db_content[table] = {} def create_pool(name_label): return _create_object('pool', {'name_label': name_label}) def create_host(name_label, hostname='fake_name', address='fake_addr'): return _create_object('host', {'name_label': name_label, 'hostname': hostname, 'address': address}) def create_network(name_label, bridge): return _create_object('network', {'name_label': name_label, 'bridge': bridge}) def create_vm(name_label, status, **kwargs): domid = status == 'Running' and random.randrange(1, 1 << 16) or -1 vm_rec = kwargs.copy() vm_rec.update({'name_label': name_label, 'domid': domid, 'power_state': status}) vm_ref = _create_object('VM', vm_rec) after_VM_create(vm_ref, vm_rec) return vm_ref def destroy_vm(vm_ref): vm_rec = _db_content['VM'][vm_ref] vbd_refs = vm_rec['VBDs'] # NOTE(johannes): Shallow copy since destroy_vbd will remove itself # from the list for vbd_ref in vbd_refs[:]: destroy_vbd(vbd_ref) del _db_content['VM'][vm_ref] def destroy_vbd(vbd_ref): vbd_rec = _db_content['VBD'][vbd_ref] vm_ref = vbd_rec['VM'] vm_rec = _db_content['VM'][vm_ref] vm_rec['VBDs'].remove(vbd_ref) vdi_ref = vbd_rec['VDI'] vdi_rec = _db_content['VDI'][vdi_ref] vdi_rec['VBDs'].remove(vbd_ref) del _db_content['VBD'][vbd_ref] def destroy_vdi(vdi_ref): vdi_rec = _db_content['VDI'][vdi_ref] vbd_refs = vdi_rec['VBDs'] # NOTE(johannes): Shallow copy since destroy_vbd will remove itself # from the list for vbd_ref in vbd_refs[:]: destroy_vbd(vbd_ref) del _db_content['VDI'][vdi_ref] def create_vdi(name_label, sr_ref, **kwargs): vdi_rec = { 'SR': sr_ref, 'read_only': False, 'type': '', 'name_label': name_label, 'name_description': '', 'sharable': False, 'other_config': {}, 'location': '', 'xenstore_data': {}, 'sm_config': {}, 'physical_utilisation': '123', 'managed': True, } vdi_rec.update(kwargs) vdi_ref = _create_object('VDI', vdi_rec) after_VDI_create(vdi_ref, vdi_rec) return vdi_ref def after_VDI_create(vdi_ref, vdi_rec): vdi_rec.setdefault('VBDs', []) def create_vbd(vm_ref, vdi_ref, userdevice=0): vbd_rec = {'VM': vm_ref, 'VDI': vdi_ref, 'userdevice': str(userdevice), 'currently_attached': False} vbd_ref = _create_object('VBD', vbd_rec) after_VBD_create(vbd_ref, vbd_rec) return vbd_ref def after_VBD_create(vbd_ref, vbd_rec): """Create read-only fields and backref from VM and VDI to VBD when VBD is created.""" vbd_rec['currently_attached'] = False vbd_rec['device'] = '' vm_ref = vbd_rec['VM'] vm_rec = _db_content['VM'][vm_ref] vm_rec['VBDs'].append(vbd_ref) vdi_ref = vbd_rec['VDI'] vdi_rec = _db_content['VDI'][vdi_ref] vdi_rec['VBDs'].append(vbd_ref) vm_name_label = _db_content['VM'][vm_ref]['name_label'] vbd_rec['vm_name_label'] = vm_name_label def after_VM_create(vm_ref, vm_rec): """Create read-only fields in the VM record.""" vm_rec.setdefault('is_control_domain', False) vm_rec.setdefault('memory_static_max', str(8 * 1024 * 1024 * 1024)) vm_rec.setdefault('memory_dynamic_max', str(8 * 1024 * 1024 * 1024)) vm_rec.setdefault('VCPUs_max', str(4)) vm_rec.setdefault('VBDs', []) def create_pbd(config, host_ref, sr_ref, attached): return _create_object('PBD', {'device-config': config, 'host': host_ref, 'SR': sr_ref, 'currently-attached': attached}) def create_task(name_label): return _create_object('task', {'name_label': name_label, 'status': 'pending'}) def create_local_pifs(): """Adds a PIF for each to the local database with VLAN=-1. Do this one per host.""" for host_ref in _db_content['host'].keys(): _create_local_pif(host_ref) def create_local_srs(): """Create an SR that looks like the one created on the local disk by default by the XenServer installer. Do this one per host. Also, fake the installation of an ISO SR.""" for host_ref in _db_content['host'].keys(): create_sr(name_label='Local storage', type='lvm', other_config={'i18n-original-value-name_label': 'Local storage', 'i18n-key': 'local-storage'}, physical_utilisation=20000, virtual_allocation=10000, host_ref=host_ref) create_sr(name_label='Local storage ISO', type='iso', other_config={'i18n-original-value-name_label': 'Local storage ISO', 'i18n-key': 'local-storage-iso'}, physical_utilisation=40000, virtual_allocation=80000, host_ref=host_ref) def create_sr(**kwargs): sr_ref = _create_object( 'SR', {'name_label': kwargs.get('name_label'), 'type': kwargs.get('type'), 'content_type': kwargs.get('type', 'user'), 'shared': kwargs.get('shared', False), 'physical_size': kwargs.get('physical_size', str(1 << 30)), 'physical_utilisation': str( kwargs.get('physical_utilisation', 0)), 'virtual_allocation': str(kwargs.get('virtual_allocation', 0)), 'other_config': kwargs.get('other_config', {}), 'VDIs': kwargs.get('VDIs', [])}) pbd_ref = create_pbd('', kwargs.get('host_ref'), sr_ref, True) _db_content['SR'][sr_ref]['PBDs'] = [pbd_ref] return sr_ref def _create_local_pif(host_ref): pif_ref = _create_object('PIF', {'name-label': 'Fake PIF', 'MAC': '00:11:22:33:44:55', 'physical': True, 'VLAN': -1, 'device': 'fake0', 'host_uuid': host_ref}) return pif_ref def _create_object(table, obj): ref = str(uuid.uuid4()) obj['uuid'] = str(uuid.uuid4()) _db_content[table][ref] = obj return ref def _create_sr(table, obj): sr_type = obj[6] # Forces fake to support iscsi only if sr_type != 'iscsi' and sr_type != 'nfs': raise Failure(['SR_UNKNOWN_DRIVER', sr_type]) host_ref = _db_content['host'].keys()[0] sr_ref = _create_object(table, obj[2]) if sr_type == 'iscsi': vdi_ref = create_vdi('', sr_ref) pbd_ref = create_pbd('', host_ref, sr_ref, True) _db_content['SR'][sr_ref]['VDIs'] = [vdi_ref] _db_content['SR'][sr_ref]['PBDs'] = [pbd_ref] _db_content['VDI'][vdi_ref]['SR'] = sr_ref _db_content['PBD'][pbd_ref]['SR'] = sr_ref return sr_ref def _create_vlan(pif_ref, vlan_num, network_ref): pif_rec = get_record('PIF', pif_ref) vlan_pif_ref = _create_object('PIF', {'name-label': 'Fake VLAN PIF', 'MAC': '00:11:22:33:44:55', 'physical': True, 'VLAN': vlan_num, 'device': pif_rec['device'], 'host_uuid': pif_rec['host_uuid']}) return _create_object('VLAN', {'tagged-pif': pif_ref, 'untagged-pif': vlan_pif_ref, 'tag': vlan_num}) def get_all(table): return _db_content[table].keys() def get_all_records(table): return _db_content[table] def get_record(table, ref): if ref in _db_content[table]: return _db_content[table].get(ref) else: raise Failure(['HANDLE_INVALID', table, ref]) def check_for_session_leaks(): if len(_db_content['session']) > 0: raise exception.NovaException('Sessions have leaked: %s' % _db_content['session']) def as_value(s): """Helper function for simulating XenAPI plugin responses. It escapes and wraps the given argument.""" return '<value>%s</value>' % saxutils.escape(s) def as_json(*args, **kwargs): """Helper function for simulating XenAPI plugin responses for those that are returning JSON. If this function is given plain arguments, then these are rendered as a JSON list. If it's given keyword arguments then these are rendered as a JSON dict.""" arg = args or kwargs return jsonutils.dumps(arg) class Failure(Exception): def __init__(self, details): self.details = details def __str__(self): try: return str(self.details) except Exception: return "XenAPI Fake Failure: %s" % str(self.details) def _details_map(self): return dict([(str(i), self.details[i]) for i in range(len(self.details))]) class SessionBase(object): """ Base class for Fake Sessions """ def __init__(self, uri): self._session = None def pool_get_default_SR(self, _1, pool_ref): return 'FAKE DEFAULT SR' def VBD_plug(self, _1, ref): rec = get_record('VBD', ref) if rec['currently_attached']: raise Failure(['DEVICE_ALREADY_ATTACHED', ref]) rec['currently_attached'] = True rec['device'] = rec['userdevice'] def VBD_unplug(self, _1, ref): rec = get_record('VBD', ref) if not rec['currently_attached']: raise Failure(['DEVICE_ALREADY_DETACHED', ref]) rec['currently_attached'] = False rec['device'] = '' def PBD_create(self, _1, pbd_rec): pbd_ref = _create_object('PBD', pbd_rec) _db_content['PBD'][pbd_ref]['currently_attached'] = False return pbd_ref def PBD_plug(self, _1, pbd_ref): rec = get_record('PBD', pbd_ref) if rec['currently_attached']: raise Failure(['DEVICE_ALREADY_ATTACHED', rec]) rec['currently_attached'] = True sr_ref = rec['SR'] _db_content['SR'][sr_ref]['PBDs'] = [pbd_ref] def PBD_unplug(self, _1, pbd_ref): rec = get_record('PBD', pbd_ref) if not rec['currently_attached']: raise Failure(['DEVICE_ALREADY_DETACHED', rec]) rec['currently_attached'] = False sr_ref = pbd_ref['SR'] _db_content['SR'][sr_ref]['PBDs'].remove(pbd_ref) def SR_introduce(self, _1, sr_uuid, label, desc, type, content_type, shared, sm_config): ref = None rec = None for ref, rec in _db_content['SR'].iteritems(): if rec.get('uuid') == sr_uuid: break if rec: # make forgotten = 0 and return ref _db_content['SR'][ref]['forgotten'] = 0 return ref else: # SR not found in db, so we create one params = {} params.update(locals()) del params['self'] sr_ref = _create_object('SR', params) _db_content['SR'][sr_ref]['uuid'] = sr_uuid _db_content['SR'][sr_ref]['forgotten'] = 0 if type in ('iscsi'): # Just to be clear vdi_per_lun = True if vdi_per_lun: # we need to create a vdi because this introduce # is likely meant for a single vdi vdi_ref = create_vdi('', sr_ref) _db_content['SR'][sr_ref]['VDIs'] = [vdi_ref] _db_content['VDI'][vdi_ref]['SR'] = sr_ref return sr_ref def SR_forget(self, _1, sr_ref): _db_content['SR'][sr_ref]['forgotten'] = 1 def SR_scan(self, _1, sr_ref): return def PIF_get_all_records_where(self, _1, _2): # TODO(salvatore-orlando): filter table on _2 return _db_content['PIF'] def VM_get_xenstore_data(self, _1, vm_ref): return _db_content['VM'][vm_ref].get('xenstore_data', {}) def VM_remove_from_xenstore_data(self, _1, vm_ref, key): db_ref = _db_content['VM'][vm_ref] if not 'xenstore_data' in db_ref: return if key in db_ref['xenstore_data']: del db_ref['xenstore_data'][key] def VM_add_to_xenstore_data(self, _1, vm_ref, key, value): db_ref = _db_content['VM'][vm_ref] if not 'xenstore_data' in db_ref: db_ref['xenstore_data'] = {} db_ref['xenstore_data'][key] = value def VM_pool_migrate(self, _1, vm_ref, host_ref, options): pass def VDI_remove_from_other_config(self, _1, vdi_ref, key): db_ref = _db_content['VDI'][vdi_ref] if not 'other_config' in db_ref: return if key in db_ref['other_config']: del db_ref['other_config'][key] def VDI_add_to_other_config(self, _1, vdi_ref, key, value): db_ref = _db_content['VDI'][vdi_ref] if not 'other_config' in db_ref: db_ref['other_config'] = {} if key in db_ref['other_config']: raise Failure(['MAP_DUPLICATE_KEY', 'VDI', 'other_config', vdi_ref, key]) db_ref['other_config'][key] = value def VDI_copy(self, _1, vdi_to_copy_ref, sr_ref): db_ref = _db_content['VDI'][vdi_to_copy_ref] name_label = db_ref['name_label'] read_only = db_ref['read_only'] sharable = db_ref['sharable'] other_config = db_ref['other_config'].copy() return create_vdi(name_label, sr_ref, sharable=sharable, read_only=read_only, other_config=other_config) def VDI_clone(self, _1, vdi_to_clone_ref): db_ref = _db_content['VDI'][vdi_to_clone_ref] sr_ref = db_ref['SR'] return self.VDI_copy(_1, vdi_to_clone_ref, sr_ref) def host_compute_free_memory(self, _1, ref): #Always return 12GB available return 12 * 1024 * 1024 * 1024 def host_call_plugin(self, _1, _2, plugin, method, _5): if (plugin, method) == ('agent', 'version'): return as_json(returncode='0', message='1.0') elif (plugin, method) == ('agent', 'key_init'): return as_json(returncode='D0', message='1') elif (plugin, method) == ('agent', 'password'): return as_json(returncode='0', message='success') elif (plugin, method) == ('agent', 'resetnetwork'): return as_json(returncode='0', message='success') elif (plugin, method) == ('glance', 'upload_vhd'): return '' elif (plugin, method) == ('kernel', 'copy_vdi'): return '' elif (plugin, method) == ('kernel', 'create_kernel_ramdisk'): return '' elif (plugin, method) == ('kernel', 'remove_kernel_ramdisk'): return '' elif (plugin, method) == ('migration', 'move_vhds_into_sr'): return '' elif (plugin, method) == ('migration', 'transfer_vhd'): return '' elif (plugin, method) == ('xenhost', 'host_data'): return jsonutils.dumps({'host_memory': {'total': 10, 'overhead': 20, 'free': 30, 'free-computed': 40}, }) elif (plugin == 'xenhost' and method in ['host_reboot', 'host_startup', 'host_shutdown']): return jsonutils.dumps({"power_action": method[5:]}) elif (plugin, method) == ('xenhost', 'set_host_enabled'): enabled = 'enabled' if _5.get('enabled') == 'true' else 'disabled' return jsonutils.dumps({"status": enabled}) elif (plugin, method) == ('xenhost', 'host_uptime'): return jsonutils.dumps({"uptime": "fake uptime"}) else: raise Exception('No simulation in host_call_plugin for %s,%s' % (plugin, method)) def VDI_get_virtual_size(self, *args): return 1 * 1024 * 1024 * 1024 def VDI_resize_online(self, *args): return 'derp' VDI_resize = VDI_resize_online def _VM_reboot(self, session, vm_ref): db_ref = _db_content['VM'][vm_ref] if db_ref['power_state'] != 'Running': raise Failure(['VM_BAD_POWER_STATE', 'fake-opaque-ref', db_ref['power_state'].lower(), 'halted']) db_ref['power_state'] = 'Running' def VM_clean_reboot(self, session, vm_ref): return self._VM_reboot(session, vm_ref) def VM_hard_reboot(self, session, vm_ref): return self._VM_reboot(session, vm_ref) def VM_hard_shutdown(self, session, vm_ref): db_ref = _db_content['VM'][vm_ref] db_ref['power_state'] = 'Halted' VM_clean_shutdown = VM_hard_shutdown def pool_eject(self, session, host_ref): pass def pool_join(self, session, hostname, username, password): pass def pool_set_name_label(self, session, pool_ref, name): pass def network_get_all_records_where(self, _1, filter): return self.xenapi.network.get_all_records() def xenapi_request(self, methodname, params): if methodname.startswith('login'): self._login(methodname, params) return None elif methodname == 'logout' or methodname == 'session.logout': self._logout() return None else: full_params = (self._session,) + params meth = getattr(self, methodname, None) if meth is None: LOG.debug(_('Raising NotImplemented')) raise NotImplementedError( _('xenapi.fake does not have an implementation for %s') % methodname) return meth(*full_params) def _login(self, method, params): self._session = str(uuid.uuid4()) _session_info = {'uuid': str(uuid.uuid4()), 'this_host': _db_content['host'].keys()[0]} _db_content['session'][self._session] = _session_info def _logout(self): s = self._session self._session = None if s not in _db_content['session']: raise exception.NovaException( "Logging out a session that is invalid or already logged " "out: %s" % s) del _db_content['session'][s] def __getattr__(self, name): if name == 'handle': return self._session elif name == 'xenapi': return _Dispatcher(self.xenapi_request, None) elif name.startswith('login') or name.startswith('slave_local'): return lambda *params: self._login(name, params) elif name.startswith('Async'): return lambda *params: self._async(name, params) elif '.' in name: impl = getattr(self, name.replace('.', '_')) if impl is not None: def callit(*params): localname = name LOG.debug(_('Calling %(localname)s %(impl)s') % locals()) self._check_session(params) return impl(*params) return callit if self._is_gettersetter(name, True): LOG.debug(_('Calling getter %s'), name) return lambda *params: self._getter(name, params) elif self._is_gettersetter(name, False): LOG.debug(_('Calling setter %s'), name) return lambda *params: self._setter(name, params) elif self._is_create(name): return lambda *params: self._create(name, params) elif self._is_destroy(name): return lambda *params: self._destroy(name, params) else: return None def _is_gettersetter(self, name, getter): bits = name.split('.') return (len(bits) == 2 and bits[0] in _CLASSES and bits[1].startswith(getter and 'get_' or 'set_')) def _is_create(self, name): return self._is_method(name, 'create') def _is_destroy(self, name): return self._is_method(name, 'destroy') def _is_method(self, name, meth): bits = name.split('.') return (len(bits) == 2 and bits[0] in _CLASSES and bits[1] == meth) def _getter(self, name, params): self._check_session(params) (cls, func) = name.split('.') if func == 'get_all': self._check_arg_count(params, 1) return get_all(cls) if func == 'get_all_records': self._check_arg_count(params, 1) return get_all_records(cls) if func == 'get_record': self._check_arg_count(params, 2) return get_record(cls, params[1]) if func in ('get_by_name_label', 'get_by_uuid'): self._check_arg_count(params, 2) return_singleton = (func == 'get_by_uuid') return self._get_by_field( _db_content[cls], func[len('get_by_'):], params[1], return_singleton=return_singleton) if len(params) == 2: field = func[len('get_'):] ref = params[1] if (ref in _db_content[cls]): if (field in _db_content[cls][ref]): return _db_content[cls][ref][field] else: raise Failure(['HANDLE_INVALID', cls, ref]) LOG.debug(_('Raising NotImplemented')) raise NotImplementedError( _('xenapi.fake does not have an implementation for %s or it has ' 'been called with the wrong number of arguments') % name) def _setter(self, name, params): self._check_session(params) (cls, func) = name.split('.') if len(params) == 3: field = func[len('set_'):] ref = params[1] val = params[2] if (ref in _db_content[cls] and field in _db_content[cls][ref]): _db_content[cls][ref][field] = val return LOG.debug(_('Raising NotImplemented')) raise NotImplementedError( 'xenapi.fake does not have an implementation for %s or it has ' 'been called with the wrong number of arguments or the database ' 'is missing that field' % name) def _create(self, name, params): self._check_session(params) is_sr_create = name == 'SR.create' is_vlan_create = name == 'VLAN.create' # Storage Repositories have a different API expected = is_sr_create and 10 or is_vlan_create and 4 or 2 self._check_arg_count(params, expected) (cls, _) = name.split('.') ref = (is_sr_create and _create_sr(cls, params) or is_vlan_create and _create_vlan(params[1], params[2], params[3]) or _create_object(cls, params[1])) # Call hook to provide any fixups needed (ex. creating backrefs) after_hook = 'after_%s_create' % cls if after_hook in globals(): globals()[after_hook](ref, params[1]) obj = get_record(cls, ref) # Add RO fields if cls == 'VM': obj['power_state'] = 'Halted' return ref def _destroy(self, name, params): self._check_session(params) self._check_arg_count(params, 2) table = name.split('.')[0] ref = params[1] if ref not in _db_content[table]: raise Failure(['HANDLE_INVALID', table, ref]) # Call destroy function (if exists) destroy_func = globals().get('destroy_%s' % table.lower()) if destroy_func: destroy_func(ref) else: del _db_content[table][ref] def _async(self, name, params): task_ref = create_task(name) task = _db_content['task'][task_ref] func = name[len('Async.'):] try: result = self.xenapi_request(func, params[1:]) if result: result = as_value(result) task['result'] = result task['status'] = 'success' except Failure, exc: task['error_info'] = exc.details task['status'] = 'failed' task['finished'] = timeutils.utcnow() return task_ref def _check_session(self, params): if (self._session is None or self._session not in _db_content['session']): raise Failure(['HANDLE_INVALID', 'session', self._session]) if len(params) == 0 or params[0] != self._session: LOG.debug(_('Raising NotImplemented')) raise NotImplementedError('Call to XenAPI without using .xenapi') def _check_arg_count(self, params, expected): actual = len(params) if actual != expected: raise Failure(['MESSAGE_PARAMETER_COUNT_MISMATCH', expected, actual]) def _get_by_field(self, recs, k, v, return_singleton): result = [] for ref, rec in recs.iteritems(): if rec.get(k) == v: result.append(ref) if return_singleton: try: return result[0] except IndexError: raise Failure(['UUID_INVALID', v, result, recs, k]) return result # Based upon _Method from xmlrpclib. class _Dispatcher: def __init__(self, send, name): self.__send = send self.__name = name def __repr__(self): if self.__name: return '<xenapi.fake._Dispatcher for %s>' % self.__name else: return '<xenapi.fake._Dispatcher>' def __getattr__(self, name): if self.__name is None: return _Dispatcher(self.__send, name) else: return _Dispatcher(self.__send, "%s.%s" % (self.__name, name)) def __call__(self, *args): return self.__send(self.__name, args)
import numpy as np from numpy import array, sqrt from numpy.testing import (assert_array_almost_equal, assert_equal, assert_almost_equal, assert_allclose) from pytest import raises as assert_raises from scipy import integrate import scipy.special as sc from scipy.special import gamma import scipy.special.orthogonal as orth class TestCheby(object): def test_chebyc(self): C0 = orth.chebyc(0) C1 = orth.chebyc(1) olderr = np.seterr(all='ignore') try: C2 = orth.chebyc(2) C3 = orth.chebyc(3) C4 = orth.chebyc(4) C5 = orth.chebyc(5) finally: np.seterr(**olderr) assert_array_almost_equal(C0.c,[2],13) assert_array_almost_equal(C1.c,[1,0],13) assert_array_almost_equal(C2.c,[1,0,-2],13) assert_array_almost_equal(C3.c,[1,0,-3,0],13) assert_array_almost_equal(C4.c,[1,0,-4,0,2],13) assert_array_almost_equal(C5.c,[1,0,-5,0,5,0],13) def test_chebys(self): S0 = orth.chebys(0) S1 = orth.chebys(1) S2 = orth.chebys(2) S3 = orth.chebys(3) S4 = orth.chebys(4) S5 = orth.chebys(5) assert_array_almost_equal(S0.c,[1],13) assert_array_almost_equal(S1.c,[1,0],13) assert_array_almost_equal(S2.c,[1,0,-1],13) assert_array_almost_equal(S3.c,[1,0,-2,0],13) assert_array_almost_equal(S4.c,[1,0,-3,0,1],13) assert_array_almost_equal(S5.c,[1,0,-4,0,3,0],13) def test_chebyt(self): T0 = orth.chebyt(0) T1 = orth.chebyt(1) T2 = orth.chebyt(2) T3 = orth.chebyt(3) T4 = orth.chebyt(4) T5 = orth.chebyt(5) assert_array_almost_equal(T0.c,[1],13) assert_array_almost_equal(T1.c,[1,0],13) assert_array_almost_equal(T2.c,[2,0,-1],13) assert_array_almost_equal(T3.c,[4,0,-3,0],13) assert_array_almost_equal(T4.c,[8,0,-8,0,1],13) assert_array_almost_equal(T5.c,[16,0,-20,0,5,0],13) def test_chebyu(self): U0 = orth.chebyu(0) U1 = orth.chebyu(1) U2 = orth.chebyu(2) U3 = orth.chebyu(3) U4 = orth.chebyu(4) U5 = orth.chebyu(5) assert_array_almost_equal(U0.c,[1],13) assert_array_almost_equal(U1.c,[2,0],13) assert_array_almost_equal(U2.c,[4,0,-1],13) assert_array_almost_equal(U3.c,[8,0,-4,0],13) assert_array_almost_equal(U4.c,[16,0,-12,0,1],13) assert_array_almost_equal(U5.c,[32,0,-32,0,6,0],13) class TestGegenbauer(object): def test_gegenbauer(self): a = 5*np.random.random() - 0.5 if np.any(a == 0): a = -0.2 Ca0 = orth.gegenbauer(0,a) Ca1 = orth.gegenbauer(1,a) Ca2 = orth.gegenbauer(2,a) Ca3 = orth.gegenbauer(3,a) Ca4 = orth.gegenbauer(4,a) Ca5 = orth.gegenbauer(5,a) assert_array_almost_equal(Ca0.c,array([1]),13) assert_array_almost_equal(Ca1.c,array([2*a,0]),13) assert_array_almost_equal(Ca2.c,array([2*a*(a+1),0,-a]),13) assert_array_almost_equal(Ca3.c,array([4*sc.poch(a,3),0,-6*a*(a+1), 0])/3.0,11) assert_array_almost_equal(Ca4.c,array([4*sc.poch(a,4),0,-12*sc.poch(a,3), 0,3*a*(a+1)])/6.0,11) assert_array_almost_equal(Ca5.c,array([4*sc.poch(a,5),0,-20*sc.poch(a,4), 0,15*sc.poch(a,3),0])/15.0,11) class TestHermite(object): def test_hermite(self): H0 = orth.hermite(0) H1 = orth.hermite(1) H2 = orth.hermite(2) H3 = orth.hermite(3) H4 = orth.hermite(4) H5 = orth.hermite(5) assert_array_almost_equal(H0.c,[1],13) assert_array_almost_equal(H1.c,[2,0],13) assert_array_almost_equal(H2.c,[4,0,-2],13) assert_array_almost_equal(H3.c,[8,0,-12,0],13) assert_array_almost_equal(H4.c,[16,0,-48,0,12],12) assert_array_almost_equal(H5.c,[32,0,-160,0,120,0],12) def test_hermitenorm(self): # He_n(x) = 2**(-n/2) H_n(x/sqrt(2)) psub = np.poly1d([1.0/sqrt(2),0]) H0 = orth.hermitenorm(0) H1 = orth.hermitenorm(1) H2 = orth.hermitenorm(2) H3 = orth.hermitenorm(3) H4 = orth.hermitenorm(4) H5 = orth.hermitenorm(5) he0 = orth.hermite(0)(psub) he1 = orth.hermite(1)(psub) / sqrt(2) he2 = orth.hermite(2)(psub) / 2.0 he3 = orth.hermite(3)(psub) / (2*sqrt(2)) he4 = orth.hermite(4)(psub) / 4.0 he5 = orth.hermite(5)(psub) / (4.0*sqrt(2)) assert_array_almost_equal(H0.c,he0.c,13) assert_array_almost_equal(H1.c,he1.c,13) assert_array_almost_equal(H2.c,he2.c,13) assert_array_almost_equal(H3.c,he3.c,13) assert_array_almost_equal(H4.c,he4.c,13) assert_array_almost_equal(H5.c,he5.c,13) class _test_sh_legendre(object): def test_sh_legendre(self): # P*_n(x) = P_n(2x-1) psub = np.poly1d([2,-1]) Ps0 = orth.sh_legendre(0) Ps1 = orth.sh_legendre(1) Ps2 = orth.sh_legendre(2) Ps3 = orth.sh_legendre(3) Ps4 = orth.sh_legendre(4) Ps5 = orth.sh_legendre(5) pse0 = orth.legendre(0)(psub) pse1 = orth.legendre(1)(psub) pse2 = orth.legendre(2)(psub) pse3 = orth.legendre(3)(psub) pse4 = orth.legendre(4)(psub) pse5 = orth.legendre(5)(psub) assert_array_almost_equal(Ps0.c,pse0.c,13) assert_array_almost_equal(Ps1.c,pse1.c,13) assert_array_almost_equal(Ps2.c,pse2.c,13) assert_array_almost_equal(Ps3.c,pse3.c,13) assert_array_almost_equal(Ps4.c,pse4.c,12) assert_array_almost_equal(Ps5.c,pse5.c,12) class _test_sh_chebyt(object): def test_sh_chebyt(self): # T*_n(x) = T_n(2x-1) psub = np.poly1d([2,-1]) Ts0 = orth.sh_chebyt(0) Ts1 = orth.sh_chebyt(1) Ts2 = orth.sh_chebyt(2) Ts3 = orth.sh_chebyt(3) Ts4 = orth.sh_chebyt(4) Ts5 = orth.sh_chebyt(5) tse0 = orth.chebyt(0)(psub) tse1 = orth.chebyt(1)(psub) tse2 = orth.chebyt(2)(psub) tse3 = orth.chebyt(3)(psub) tse4 = orth.chebyt(4)(psub) tse5 = orth.chebyt(5)(psub) assert_array_almost_equal(Ts0.c,tse0.c,13) assert_array_almost_equal(Ts1.c,tse1.c,13) assert_array_almost_equal(Ts2.c,tse2.c,13) assert_array_almost_equal(Ts3.c,tse3.c,13) assert_array_almost_equal(Ts4.c,tse4.c,12) assert_array_almost_equal(Ts5.c,tse5.c,12) class _test_sh_chebyu(object): def test_sh_chebyu(self): # U*_n(x) = U_n(2x-1) psub = np.poly1d([2,-1]) Us0 = orth.sh_chebyu(0) Us1 = orth.sh_chebyu(1) Us2 = orth.sh_chebyu(2) Us3 = orth.sh_chebyu(3) Us4 = orth.sh_chebyu(4) Us5 = orth.sh_chebyu(5) use0 = orth.chebyu(0)(psub) use1 = orth.chebyu(1)(psub) use2 = orth.chebyu(2)(psub) use3 = orth.chebyu(3)(psub) use4 = orth.chebyu(4)(psub) use5 = orth.chebyu(5)(psub) assert_array_almost_equal(Us0.c,use0.c,13) assert_array_almost_equal(Us1.c,use1.c,13) assert_array_almost_equal(Us2.c,use2.c,13) assert_array_almost_equal(Us3.c,use3.c,13) assert_array_almost_equal(Us4.c,use4.c,12) assert_array_almost_equal(Us5.c,use5.c,11) class _test_sh_jacobi(object): def test_sh_jacobi(self): # G^(p,q)_n(x) = n! gamma(n+p)/gamma(2*n+p) * P^(p-q,q-1)_n(2*x-1) conv = lambda n,p: gamma(n+1)*gamma(n+p)/gamma(2*n+p) psub = np.poly1d([2,-1]) q = 4 * np.random.random() p = q-1 + 2*np.random.random() # print("shifted jacobi p,q = ", p, q) G0 = orth.sh_jacobi(0,p,q) G1 = orth.sh_jacobi(1,p,q) G2 = orth.sh_jacobi(2,p,q) G3 = orth.sh_jacobi(3,p,q) G4 = orth.sh_jacobi(4,p,q) G5 = orth.sh_jacobi(5,p,q) ge0 = orth.jacobi(0,p-q,q-1)(psub) * conv(0,p) ge1 = orth.jacobi(1,p-q,q-1)(psub) * conv(1,p) ge2 = orth.jacobi(2,p-q,q-1)(psub) * conv(2,p) ge3 = orth.jacobi(3,p-q,q-1)(psub) * conv(3,p) ge4 = orth.jacobi(4,p-q,q-1)(psub) * conv(4,p) ge5 = orth.jacobi(5,p-q,q-1)(psub) * conv(5,p) assert_array_almost_equal(G0.c,ge0.c,13) assert_array_almost_equal(G1.c,ge1.c,13) assert_array_almost_equal(G2.c,ge2.c,13) assert_array_almost_equal(G3.c,ge3.c,13) assert_array_almost_equal(G4.c,ge4.c,13) assert_array_almost_equal(G5.c,ge5.c,13) class TestCall(object): def test_call(self): poly = [] for n in range(5): poly.extend([x.strip() for x in (""" orth.jacobi(%(n)d,0.3,0.9) orth.sh_jacobi(%(n)d,0.3,0.9) orth.genlaguerre(%(n)d,0.3) orth.laguerre(%(n)d) orth.hermite(%(n)d) orth.hermitenorm(%(n)d) orth.gegenbauer(%(n)d,0.3) orth.chebyt(%(n)d) orth.chebyu(%(n)d) orth.chebyc(%(n)d) orth.chebys(%(n)d) orth.sh_chebyt(%(n)d) orth.sh_chebyu(%(n)d) orth.legendre(%(n)d) orth.sh_legendre(%(n)d) """ % dict(n=n)).split() ]) olderr = np.seterr(all='ignore') try: for pstr in poly: p = eval(pstr) assert_almost_equal(p(0.315), np.poly1d(p.coef)(0.315), err_msg=pstr) finally: np.seterr(**olderr) class TestGenlaguerre(object): def test_regression(self): assert_equal(orth.genlaguerre(1, 1, monic=False)(0), 2.) assert_equal(orth.genlaguerre(1, 1, monic=True)(0), -2.) assert_equal(orth.genlaguerre(1, 1, monic=False), np.poly1d([-1, 2])) assert_equal(orth.genlaguerre(1, 1, monic=True), np.poly1d([1, -2])) def verify_gauss_quad(root_func, eval_func, weight_func, a, b, N, rtol=1e-15, atol=1e-14): # this test is copied from numpy's TestGauss in test_hermite.py x, w, mu = root_func(N, True) n = np.arange(N) v = eval_func(n[:,np.newaxis], x) vv = np.dot(v*w, v.T) vd = 1 / np.sqrt(vv.diagonal()) vv = vd[:, np.newaxis] * vv * vd assert_allclose(vv, np.eye(N), rtol, atol) # check that the integral of 1 is correct assert_allclose(w.sum(), mu, rtol, atol) # compare the results of integrating a function with quad. f = lambda x: x**3 - 3*x**2 + x - 2 resI = integrate.quad(lambda x: f(x)*weight_func(x), a, b) resG = np.vdot(f(x), w) rtol = 1e-6 if 1e-6 < resI[1] else resI[1] * 10 assert_allclose(resI[0], resG, rtol=rtol) def test_roots_jacobi(): rf = lambda a, b: lambda n, mu: sc.roots_jacobi(n, a, b, mu) ef = lambda a, b: lambda n, x: sc.eval_jacobi(n, a, b, x) wf = lambda a, b: lambda x: (1 - x)**a * (1 + x)**b vgq = verify_gauss_quad vgq(rf(-0.5, -0.75), ef(-0.5, -0.75), wf(-0.5, -0.75), -1., 1., 5) vgq(rf(-0.5, -0.75), ef(-0.5, -0.75), wf(-0.5, -0.75), -1., 1., 25, atol=1e-12) vgq(rf(-0.5, -0.75), ef(-0.5, -0.75), wf(-0.5, -0.75), -1., 1., 100, atol=1e-11) vgq(rf(0.5, -0.5), ef(0.5, -0.5), wf(0.5, -0.5), -1., 1., 5) vgq(rf(0.5, -0.5), ef(0.5, -0.5), wf(0.5, -0.5), -1., 1., 25, atol=1.5e-13) vgq(rf(0.5, -0.5), ef(0.5, -0.5), wf(0.5, -0.5), -1., 1., 100, atol=2e-12) vgq(rf(1, 0.5), ef(1, 0.5), wf(1, 0.5), -1., 1., 5, atol=2e-13) vgq(rf(1, 0.5), ef(1, 0.5), wf(1, 0.5), -1., 1., 25, atol=2e-13) vgq(rf(1, 0.5), ef(1, 0.5), wf(1, 0.5), -1., 1., 100, atol=1e-12) vgq(rf(0.9, 2), ef(0.9, 2), wf(0.9, 2), -1., 1., 5) vgq(rf(0.9, 2), ef(0.9, 2), wf(0.9, 2), -1., 1., 25, atol=1e-13) vgq(rf(0.9, 2), ef(0.9, 2), wf(0.9, 2), -1., 1., 100, atol=3e-13) vgq(rf(18.24, 27.3), ef(18.24, 27.3), wf(18.24, 27.3), -1., 1., 5) vgq(rf(18.24, 27.3), ef(18.24, 27.3), wf(18.24, 27.3), -1., 1., 25, atol=1.1e-14) vgq(rf(18.24, 27.3), ef(18.24, 27.3), wf(18.24, 27.3), -1., 1., 100, atol=1e-13) vgq(rf(47.1, -0.2), ef(47.1, -0.2), wf(47.1, -0.2), -1., 1., 5, atol=1e-13) vgq(rf(47.1, -0.2), ef(47.1, -0.2), wf(47.1, -0.2), -1., 1., 25, atol=2e-13) vgq(rf(47.1, -0.2), ef(47.1, -0.2), wf(47.1, -0.2), -1., 1., 100, atol=1e-11) vgq(rf(2.25, 68.9), ef(2.25, 68.9), wf(2.25, 68.9), -1., 1., 5) vgq(rf(2.25, 68.9), ef(2.25, 68.9), wf(2.25, 68.9), -1., 1., 25, atol=1e-13) vgq(rf(2.25, 68.9), ef(2.25, 68.9), wf(2.25, 68.9), -1., 1., 100, atol=1e-13) # when alpha == beta == 0, P_n^{a,b}(x) == P_n(x) xj, wj = sc.roots_jacobi(6, 0.0, 0.0) xl, wl = sc.roots_legendre(6) assert_allclose(xj, xl, 1e-14, 1e-14) assert_allclose(wj, wl, 1e-14, 1e-14) # when alpha == beta != 0, P_n^{a,b}(x) == C_n^{alpha+0.5}(x) xj, wj = sc.roots_jacobi(6, 4.0, 4.0) xc, wc = sc.roots_gegenbauer(6, 4.5) assert_allclose(xj, xc, 1e-14, 1e-14) assert_allclose(wj, wc, 1e-14, 1e-14) x, w = sc.roots_jacobi(5, 2, 3, False) y, v, m = sc.roots_jacobi(5, 2, 3, True) assert_allclose(x, y, 1e-14, 1e-14) assert_allclose(w, v, 1e-14, 1e-14) muI, muI_err = integrate.quad(wf(2,3), -1, 1) assert_allclose(m, muI, rtol=muI_err) assert_raises(ValueError, sc.roots_jacobi, 0, 1, 1) assert_raises(ValueError, sc.roots_jacobi, 3.3, 1, 1) assert_raises(ValueError, sc.roots_jacobi, 3, -2, 1) assert_raises(ValueError, sc.roots_jacobi, 3, 1, -2) assert_raises(ValueError, sc.roots_jacobi, 3, -2, -2) def test_roots_sh_jacobi(): rf = lambda a, b: lambda n, mu: sc.roots_sh_jacobi(n, a, b, mu) ef = lambda a, b: lambda n, x: sc.eval_sh_jacobi(n, a, b, x) wf = lambda a, b: lambda x: (1. - x)**(a - b) * (x)**(b - 1.) vgq = verify_gauss_quad vgq(rf(-0.5, 0.25), ef(-0.5, 0.25), wf(-0.5, 0.25), 0., 1., 5) vgq(rf(-0.5, 0.25), ef(-0.5, 0.25), wf(-0.5, 0.25), 0., 1., 25, atol=1e-12) vgq(rf(-0.5, 0.25), ef(-0.5, 0.25), wf(-0.5, 0.25), 0., 1., 100, atol=1e-11) vgq(rf(0.5, 0.5), ef(0.5, 0.5), wf(0.5, 0.5), 0., 1., 5) vgq(rf(0.5, 0.5), ef(0.5, 0.5), wf(0.5, 0.5), 0., 1., 25, atol=1e-13) vgq(rf(0.5, 0.5), ef(0.5, 0.5), wf(0.5, 0.5), 0., 1., 100, atol=1e-12) vgq(rf(1, 0.5), ef(1, 0.5), wf(1, 0.5), 0., 1., 5) vgq(rf(1, 0.5), ef(1, 0.5), wf(1, 0.5), 0., 1., 25, atol=1.5e-13) vgq(rf(1, 0.5), ef(1, 0.5), wf(1, 0.5), 0., 1., 100, atol=2e-12) vgq(rf(2, 0.9), ef(2, 0.9), wf(2, 0.9), 0., 1., 5) vgq(rf(2, 0.9), ef(2, 0.9), wf(2, 0.9), 0., 1., 25, atol=1e-13) vgq(rf(2, 0.9), ef(2, 0.9), wf(2, 0.9), 0., 1., 100, atol=1e-12) vgq(rf(27.3, 18.24), ef(27.3, 18.24), wf(27.3, 18.24), 0., 1., 5) vgq(rf(27.3, 18.24), ef(27.3, 18.24), wf(27.3, 18.24), 0., 1., 25) vgq(rf(27.3, 18.24), ef(27.3, 18.24), wf(27.3, 18.24), 0., 1., 100, atol=1e-13) vgq(rf(47.1, 0.2), ef(47.1, 0.2), wf(47.1, 0.2), 0., 1., 5, atol=1e-12) vgq(rf(47.1, 0.2), ef(47.1, 0.2), wf(47.1, 0.2), 0., 1., 25, atol=1e-11) vgq(rf(47.1, 0.2), ef(47.1, 0.2), wf(47.1, 0.2), 0., 1., 100, atol=1e-10) vgq(rf(68.9, 2.25), ef(68.9, 2.25), wf(68.9, 2.25), 0., 1., 5, atol=3.5e-14) vgq(rf(68.9, 2.25), ef(68.9, 2.25), wf(68.9, 2.25), 0., 1., 25, atol=2e-13) vgq(rf(68.9, 2.25), ef(68.9, 2.25), wf(68.9, 2.25), 0., 1., 100, atol=1e-12) x, w = sc.roots_sh_jacobi(5, 3, 2, False) y, v, m = sc.roots_sh_jacobi(5, 3, 2, True) assert_allclose(x, y, 1e-14, 1e-14) assert_allclose(w, v, 1e-14, 1e-14) muI, muI_err = integrate.quad(wf(3,2), 0, 1) assert_allclose(m, muI, rtol=muI_err) assert_raises(ValueError, sc.roots_sh_jacobi, 0, 1, 1) assert_raises(ValueError, sc.roots_sh_jacobi, 3.3, 1, 1) assert_raises(ValueError, sc.roots_sh_jacobi, 3, 1, 2) # p - q <= -1 assert_raises(ValueError, sc.roots_sh_jacobi, 3, 2, -1) # q <= 0 assert_raises(ValueError, sc.roots_sh_jacobi, 3, -2, -1) # both def test_roots_hermite(): rootf = sc.roots_hermite evalf = sc.eval_hermite weightf = orth.hermite(5).weight_func verify_gauss_quad(rootf, evalf, weightf, -np.inf, np.inf, 5) verify_gauss_quad(rootf, evalf, weightf, -np.inf, np.inf, 25, atol=1e-13) verify_gauss_quad(rootf, evalf, weightf, -np.inf, np.inf, 100, atol=1e-12) # Golub-Welsch branch x, w = sc.roots_hermite(5, False) y, v, m = sc.roots_hermite(5, True) assert_allclose(x, y, 1e-14, 1e-14) assert_allclose(w, v, 1e-14, 1e-14) muI, muI_err = integrate.quad(weightf, -np.inf, np.inf) assert_allclose(m, muI, rtol=muI_err) # Asymptotic branch (switch over at n >= 150) x, w = sc.roots_hermite(200, False) y, v, m = sc.roots_hermite(200, True) assert_allclose(x, y, 1e-14, 1e-14) assert_allclose(w, v, 1e-14, 1e-14) assert_allclose(sum(v), m, 1e-14, 1e-14) assert_raises(ValueError, sc.roots_hermite, 0) assert_raises(ValueError, sc.roots_hermite, 3.3) def test_roots_hermite_asy(): # Recursion for Hermite functions def hermite_recursion(n, nodes): H = np.zeros((n, nodes.size)) H[0,:] = np.pi**(-0.25) * np.exp(-0.5*nodes**2) if n > 1: H[1,:] = sqrt(2.0) * nodes * H[0,:] for k in range(2, n): H[k,:] = sqrt(2.0/k) * nodes * H[k-1,:] - sqrt((k-1.0)/k) * H[k-2,:] return H # This tests only the nodes def test(N, rtol=1e-15, atol=1e-14): x, w = orth._roots_hermite_asy(N) H = hermite_recursion(N+1, x) assert_allclose(H[-1,:], np.zeros(N), rtol, atol) assert_allclose(sum(w), sqrt(np.pi), rtol, atol) test(150, atol=1e-12) test(151, atol=1e-12) test(300, atol=1e-12) test(301, atol=1e-12) test(500, atol=1e-12) test(501, atol=1e-12) test(999, atol=1e-12) test(1000, atol=1e-12) test(2000, atol=1e-12) test(5000, atol=1e-12) def test_roots_hermitenorm(): rootf = sc.roots_hermitenorm evalf = sc.eval_hermitenorm weightf = orth.hermitenorm(5).weight_func verify_gauss_quad(rootf, evalf, weightf, -np.inf, np.inf, 5) verify_gauss_quad(rootf, evalf, weightf, -np.inf, np.inf, 25, atol=1e-13) verify_gauss_quad(rootf, evalf, weightf, -np.inf, np.inf, 100, atol=1e-12) x, w = sc.roots_hermitenorm(5, False) y, v, m = sc.roots_hermitenorm(5, True) assert_allclose(x, y, 1e-14, 1e-14) assert_allclose(w, v, 1e-14, 1e-14) muI, muI_err = integrate.quad(weightf, -np.inf, np.inf) assert_allclose(m, muI, rtol=muI_err) assert_raises(ValueError, sc.roots_hermitenorm, 0) assert_raises(ValueError, sc.roots_hermitenorm, 3.3) def test_roots_gegenbauer(): rootf = lambda a: lambda n, mu: sc.roots_gegenbauer(n, a, mu) evalf = lambda a: lambda n, x: sc.eval_gegenbauer(n, a, x) weightf = lambda a: lambda x: (1 - x**2)**(a - 0.5) vgq = verify_gauss_quad vgq(rootf(-0.25), evalf(-0.25), weightf(-0.25), -1., 1., 5) vgq(rootf(-0.25), evalf(-0.25), weightf(-0.25), -1., 1., 25, atol=1e-12) vgq(rootf(-0.25), evalf(-0.25), weightf(-0.25), -1., 1., 100, atol=1e-11) vgq(rootf(0.1), evalf(0.1), weightf(0.1), -1., 1., 5) vgq(rootf(0.1), evalf(0.1), weightf(0.1), -1., 1., 25, atol=1e-13) vgq(rootf(0.1), evalf(0.1), weightf(0.1), -1., 1., 100, atol=1e-12) vgq(rootf(1), evalf(1), weightf(1), -1., 1., 5) vgq(rootf(1), evalf(1), weightf(1), -1., 1., 25, atol=1e-13) vgq(rootf(1), evalf(1), weightf(1), -1., 1., 100, atol=1e-12) vgq(rootf(10), evalf(10), weightf(10), -1., 1., 5) vgq(rootf(10), evalf(10), weightf(10), -1., 1., 25, atol=1e-13) vgq(rootf(10), evalf(10), weightf(10), -1., 1., 100, atol=1e-12) vgq(rootf(50), evalf(50), weightf(50), -1., 1., 5, atol=1e-13) vgq(rootf(50), evalf(50), weightf(50), -1., 1., 25, atol=1e-12) vgq(rootf(50), evalf(50), weightf(50), -1., 1., 100, atol=1e-11) # this is a special case that the old code supported. # when alpha = 0, the gegenbauer polynomial is uniformly 0. but it goes # to a scaled down copy of T_n(x) there. vgq(rootf(0), sc.eval_chebyt, weightf(0), -1., 1., 5) vgq(rootf(0), sc.eval_chebyt, weightf(0), -1., 1., 25) vgq(rootf(0), sc.eval_chebyt, weightf(0), -1., 1., 100, atol=1e-12) x, w = sc.roots_gegenbauer(5, 2, False) y, v, m = sc.roots_gegenbauer(5, 2, True) assert_allclose(x, y, 1e-14, 1e-14) assert_allclose(w, v, 1e-14, 1e-14) muI, muI_err = integrate.quad(weightf(2), -1, 1) assert_allclose(m, muI, rtol=muI_err) assert_raises(ValueError, sc.roots_gegenbauer, 0, 2) assert_raises(ValueError, sc.roots_gegenbauer, 3.3, 2) assert_raises(ValueError, sc.roots_gegenbauer, 3, -.75) def test_roots_chebyt(): weightf = orth.chebyt(5).weight_func verify_gauss_quad(sc.roots_chebyt, sc.eval_chebyt, weightf, -1., 1., 5) verify_gauss_quad(sc.roots_chebyt, sc.eval_chebyt, weightf, -1., 1., 25) verify_gauss_quad(sc.roots_chebyt, sc.eval_chebyt, weightf, -1., 1., 100, atol=1e-12) x, w = sc.roots_chebyt(5, False) y, v, m = sc.roots_chebyt(5, True) assert_allclose(x, y, 1e-14, 1e-14) assert_allclose(w, v, 1e-14, 1e-14) muI, muI_err = integrate.quad(weightf, -1, 1) assert_allclose(m, muI, rtol=muI_err) assert_raises(ValueError, sc.roots_chebyt, 0) assert_raises(ValueError, sc.roots_chebyt, 3.3) def test_chebyt_symmetry(): x, w = sc.roots_chebyt(21) pos, neg = x[:10], x[11:] assert_equal(neg, -pos[::-1]) assert_equal(x[10], 0) def test_roots_chebyu(): weightf = orth.chebyu(5).weight_func verify_gauss_quad(sc.roots_chebyu, sc.eval_chebyu, weightf, -1., 1., 5) verify_gauss_quad(sc.roots_chebyu, sc.eval_chebyu, weightf, -1., 1., 25) verify_gauss_quad(sc.roots_chebyu, sc.eval_chebyu, weightf, -1., 1., 100) x, w = sc.roots_chebyu(5, False) y, v, m = sc.roots_chebyu(5, True) assert_allclose(x, y, 1e-14, 1e-14) assert_allclose(w, v, 1e-14, 1e-14) muI, muI_err = integrate.quad(weightf, -1, 1) assert_allclose(m, muI, rtol=muI_err) assert_raises(ValueError, sc.roots_chebyu, 0) assert_raises(ValueError, sc.roots_chebyu, 3.3) def test_roots_chebyc(): weightf = orth.chebyc(5).weight_func verify_gauss_quad(sc.roots_chebyc, sc.eval_chebyc, weightf, -2., 2., 5) verify_gauss_quad(sc.roots_chebyc, sc.eval_chebyc, weightf, -2., 2., 25) verify_gauss_quad(sc.roots_chebyc, sc.eval_chebyc, weightf, -2., 2., 100, atol=1e-12) x, w = sc.roots_chebyc(5, False) y, v, m = sc.roots_chebyc(5, True) assert_allclose(x, y, 1e-14, 1e-14) assert_allclose(w, v, 1e-14, 1e-14) muI, muI_err = integrate.quad(weightf, -2, 2) assert_allclose(m, muI, rtol=muI_err) assert_raises(ValueError, sc.roots_chebyc, 0) assert_raises(ValueError, sc.roots_chebyc, 3.3) def test_roots_chebys(): weightf = orth.chebys(5).weight_func verify_gauss_quad(sc.roots_chebys, sc.eval_chebys, weightf, -2., 2., 5) verify_gauss_quad(sc.roots_chebys, sc.eval_chebys, weightf, -2., 2., 25) verify_gauss_quad(sc.roots_chebys, sc.eval_chebys, weightf, -2., 2., 100) x, w = sc.roots_chebys(5, False) y, v, m = sc.roots_chebys(5, True) assert_allclose(x, y, 1e-14, 1e-14) assert_allclose(w, v, 1e-14, 1e-14) muI, muI_err = integrate.quad(weightf, -2, 2) assert_allclose(m, muI, rtol=muI_err) assert_raises(ValueError, sc.roots_chebys, 0) assert_raises(ValueError, sc.roots_chebys, 3.3) def test_roots_sh_chebyt(): weightf = orth.sh_chebyt(5).weight_func verify_gauss_quad(sc.roots_sh_chebyt, sc.eval_sh_chebyt, weightf, 0., 1., 5) verify_gauss_quad(sc.roots_sh_chebyt, sc.eval_sh_chebyt, weightf, 0., 1., 25) verify_gauss_quad(sc.roots_sh_chebyt, sc.eval_sh_chebyt, weightf, 0., 1., 100, atol=1e-13) x, w = sc.roots_sh_chebyt(5, False) y, v, m = sc.roots_sh_chebyt(5, True) assert_allclose(x, y, 1e-14, 1e-14) assert_allclose(w, v, 1e-14, 1e-14) muI, muI_err = integrate.quad(weightf, 0, 1) assert_allclose(m, muI, rtol=muI_err) assert_raises(ValueError, sc.roots_sh_chebyt, 0) assert_raises(ValueError, sc.roots_sh_chebyt, 3.3) def test_roots_sh_chebyu(): weightf = orth.sh_chebyu(5).weight_func verify_gauss_quad(sc.roots_sh_chebyu, sc.eval_sh_chebyu, weightf, 0., 1., 5) verify_gauss_quad(sc.roots_sh_chebyu, sc.eval_sh_chebyu, weightf, 0., 1., 25) verify_gauss_quad(sc.roots_sh_chebyu, sc.eval_sh_chebyu, weightf, 0., 1., 100, atol=1e-13) x, w = sc.roots_sh_chebyu(5, False) y, v, m = sc.roots_sh_chebyu(5, True) assert_allclose(x, y, 1e-14, 1e-14) assert_allclose(w, v, 1e-14, 1e-14) muI, muI_err = integrate.quad(weightf, 0, 1) assert_allclose(m, muI, rtol=muI_err) assert_raises(ValueError, sc.roots_sh_chebyu, 0) assert_raises(ValueError, sc.roots_sh_chebyu, 3.3) def test_roots_legendre(): weightf = orth.legendre(5).weight_func verify_gauss_quad(sc.roots_legendre, sc.eval_legendre, weightf, -1., 1., 5) verify_gauss_quad(sc.roots_legendre, sc.eval_legendre, weightf, -1., 1., 25, atol=1e-13) verify_gauss_quad(sc.roots_legendre, sc.eval_legendre, weightf, -1., 1., 100, atol=1e-12) x, w = sc.roots_legendre(5, False) y, v, m = sc.roots_legendre(5, True) assert_allclose(x, y, 1e-14, 1e-14) assert_allclose(w, v, 1e-14, 1e-14) muI, muI_err = integrate.quad(weightf, -1, 1) assert_allclose(m, muI, rtol=muI_err) assert_raises(ValueError, sc.roots_legendre, 0) assert_raises(ValueError, sc.roots_legendre, 3.3) def test_roots_sh_legendre(): weightf = orth.sh_legendre(5).weight_func verify_gauss_quad(sc.roots_sh_legendre, sc.eval_sh_legendre, weightf, 0., 1., 5) verify_gauss_quad(sc.roots_sh_legendre, sc.eval_sh_legendre, weightf, 0., 1., 25, atol=1e-13) verify_gauss_quad(sc.roots_sh_legendre, sc.eval_sh_legendre, weightf, 0., 1., 100, atol=1e-12) x, w = sc.roots_sh_legendre(5, False) y, v, m = sc.roots_sh_legendre(5, True) assert_allclose(x, y, 1e-14, 1e-14) assert_allclose(w, v, 1e-14, 1e-14) muI, muI_err = integrate.quad(weightf, 0, 1) assert_allclose(m, muI, rtol=muI_err) assert_raises(ValueError, sc.roots_sh_legendre, 0) assert_raises(ValueError, sc.roots_sh_legendre, 3.3) def test_roots_laguerre(): weightf = orth.laguerre(5).weight_func verify_gauss_quad(sc.roots_laguerre, sc.eval_laguerre, weightf, 0., np.inf, 5) verify_gauss_quad(sc.roots_laguerre, sc.eval_laguerre, weightf, 0., np.inf, 25, atol=1e-13) verify_gauss_quad(sc.roots_laguerre, sc.eval_laguerre, weightf, 0., np.inf, 100, atol=1e-12) x, w = sc.roots_laguerre(5, False) y, v, m = sc.roots_laguerre(5, True) assert_allclose(x, y, 1e-14, 1e-14) assert_allclose(w, v, 1e-14, 1e-14) muI, muI_err = integrate.quad(weightf, 0, np.inf) assert_allclose(m, muI, rtol=muI_err) assert_raises(ValueError, sc.roots_laguerre, 0) assert_raises(ValueError, sc.roots_laguerre, 3.3) def test_roots_genlaguerre(): rootf = lambda a: lambda n, mu: sc.roots_genlaguerre(n, a, mu) evalf = lambda a: lambda n, x: sc.eval_genlaguerre(n, a, x) weightf = lambda a: lambda x: x**a * np.exp(-x) vgq = verify_gauss_quad vgq(rootf(-0.5), evalf(-0.5), weightf(-0.5), 0., np.inf, 5) vgq(rootf(-0.5), evalf(-0.5), weightf(-0.5), 0., np.inf, 25, atol=1e-13) vgq(rootf(-0.5), evalf(-0.5), weightf(-0.5), 0., np.inf, 100, atol=1e-12) vgq(rootf(0.1), evalf(0.1), weightf(0.1), 0., np.inf, 5) vgq(rootf(0.1), evalf(0.1), weightf(0.1), 0., np.inf, 25, atol=1e-13) vgq(rootf(0.1), evalf(0.1), weightf(0.1), 0., np.inf, 100, atol=1.6e-13) vgq(rootf(1), evalf(1), weightf(1), 0., np.inf, 5) vgq(rootf(1), evalf(1), weightf(1), 0., np.inf, 25, atol=1e-13) vgq(rootf(1), evalf(1), weightf(1), 0., np.inf, 100, atol=1.03e-13) vgq(rootf(10), evalf(10), weightf(10), 0., np.inf, 5) vgq(rootf(10), evalf(10), weightf(10), 0., np.inf, 25, atol=1e-13) vgq(rootf(10), evalf(10), weightf(10), 0., np.inf, 100, atol=1e-12) vgq(rootf(50), evalf(50), weightf(50), 0., np.inf, 5) vgq(rootf(50), evalf(50), weightf(50), 0., np.inf, 25, atol=1e-13) vgq(rootf(50), evalf(50), weightf(50), 0., np.inf, 100, rtol=1e-14, atol=2e-13) x, w = sc.roots_genlaguerre(5, 2, False) y, v, m = sc.roots_genlaguerre(5, 2, True) assert_allclose(x, y, 1e-14, 1e-14) assert_allclose(w, v, 1e-14, 1e-14) muI, muI_err = integrate.quad(weightf(2.), 0., np.inf) assert_allclose(m, muI, rtol=muI_err) assert_raises(ValueError, sc.roots_genlaguerre, 0, 2) assert_raises(ValueError, sc.roots_genlaguerre, 3.3, 2) assert_raises(ValueError, sc.roots_genlaguerre, 3, -1.1) def test_gh_6721(): # Regresssion test for gh_6721. This should not raise. sc.chebyt(65)(0.2)
import unittest from os import path import pysam from cigar import Cigar from mock import Mock from pyfasta import Fasta from clrsvsim.simulator import ( make_split_read, modify_read, modify_read_for_insertion, invert_read, unpack_cigar, get_max_clip_len, get_inverse_sequence, overlap ) TEST_DATA_DIR = path.join(path.dirname(path.realpath(__file__)), 'test_data') class SplitReadTest(unittest.TestCase): def test_make_split_read(self): read = Mock() read.seq = 'A' * 20 read.qual = '*' * len(read.seq) read.rlen = len(read.seq) read.qname = read.query_name = 'name' read.reference_start = 100 read.cigarstring = '20M' alternate_seq = 'C' * 10 + 'T' * 10 split_read = make_split_read(read, 5, True, sequence=alternate_seq) self.assertEqual(split_read.seq, 'T' * 5 + 'A' * 15) self.assertEqual(split_read.cigarstring, '5S15M') split_read = make_split_read(read, 5, False, sequence=alternate_seq) self.assertEqual(split_read.seq, 'A' * 5 + 'C' * 10 + 'T' * 5) self.assertEqual(split_read.cigarstring, '5M15S') split_read = make_split_read(read, 5, False, hard_clip_threshold=0.1, sequence=alternate_seq) self.assertEqual(split_read.seq, 'A' * 5 + 'C' * 10 + 'T' * 5) self.assertEqual(split_read.cigarstring, '5M15H') split_read = make_split_read(read, 5, False, hard_clip_threshold=0.9, sequence=alternate_seq) self.assertEqual(split_read.seq, 'A' * 5 + 'C' * 10 + 'T' * 5) self.assertEqual(split_read.cigarstring, '5M15S') def test_make_split_read_bam_file(self): sorted_bam = path.join(TEST_DATA_DIR, 'sorted.bam') with pysam.Samfile(sorted_bam, 'rb') as samfile: for read in samfile: if not read.cigarstring: continue for breakpoint in (10, 50, 100): if breakpoint >= read.rlen: continue for is_left_split in (True, False): split_read = make_split_read(read, breakpoint, is_left_split) cigar_items = list(Cigar(split_read.cigarstring).items()) clipped_item = cigar_items[0] if is_left_split else cigar_items[-1] min_clip_len = breakpoint if is_left_split else read.rlen - breakpoint # Can be longer if adjacent to another clip. self.assertGreaterEqual(clipped_item[0], min_clip_len) self.assertIn(clipped_item[1], ('S', 'H')) # Will be soft-clipped unless already hard-clipped. def test_modify_read(self): read = Mock() read.seq = 'AAAAA' read.qname = 'test' # SNPs modified, changes = modify_read(read, 1, 0, 0) self.assertEqual(changes, len(modified.seq)) self.assertEqual(len(modified.seq), len(read.seq)) self.assertTrue(all([read.seq[i] != modified.seq[i] for i in range(len(read.seq))])) # Insertions modified, changes = modify_read(read, 0, 1, 0) self.assertEqual(changes, len(read.seq)) self.assertEqual(len(modified.seq), len(read.seq) * 2) # Deletions modified, changes = modify_read(read, 0, 0, 1) self.assertEqual(changes, len(read.seq)) self.assertEqual(len(modified.seq), 0) def test_modify_read_for_insertion(self): read = Mock() read.seq = 'AAAAAA' read.qual = '*' * len(read.seq) read.qname = 'test' read.rlen = len(read.seq) read.reference_start = 100 read.cigarstring = '{}M'.format(read.rlen) ins_position = 103 ins_seq = 'CCCCCCCC' modified, changes = modify_read_for_insertion(read, ins_position, ins_seq, 0, 0) self.assertEqual(changes, 0) # Read can either be modified to be on the left or right of the insertion self.assertIn(modified.seq, ('AAACCC', 'CCCAAA')) self.assertIn(modified.cigarstring, ('3M3S', '3S3M')) # Test padding modified, _ = modify_read_for_insertion(read, ins_position, ins_seq, 0, 0, padding=2) self.assertIn(modified.seq, ('AAAACC', 'CCAAAA')) self.assertIn(modified.cigarstring, ('4M2S', '2S4M')) # Insertion positions beyond the read boundaries should not modify it for position in (0, 1000): modified, _ = modify_read_for_insertion(read, position, ins_seq, 0, 0, ) self.assertEqual(read, modified) # Test limiting the maximum clip length modified, _ = modify_read_for_insertion(read, ins_position, ins_seq, 0, 0, max_clip_len=3) self.assertIn(modified.cigarstring, ('3M3S', '3S3M')) # clip len below max - allowed modified, _ = modify_read_for_insertion(read, ins_position, ins_seq, 0, 0, max_clip_len=2) self.assertEqual(read, modified) # clip len above max - insertion should not happen def test_unpack_cigar(self): for bad_cigar_string in (None, '', 'ok', '1', '1s2m', '1S2'): self.assertRaises(ValueError, unpack_cigar, bad_cigar_string) for cigar, unpacked in [ ('1M', ['1M']), ('2M', ['1M', '1M']), ('2M1S', ['1M', '1M', '1S']), ('100S', ['1S'] * 100) ]: self.assertEqual(unpack_cigar(cigar), unpacked) def test_get_max_clip_len(self): read = Mock() read.cigarstring = None self.assertRaises(ValueError, get_max_clip_len, read) for cigar, max_len in [ ('4M', 0), ('1S2M', 1), ('1S1M2S', 2), ('2S1M1S', 2), ('1M1S', 1) ]: read.cigarstring = cigar self.assertEqual(get_max_clip_len(read), max_len) def test_invert_read(self): read = Mock() read.seq = '123456' read.qual = '*' * len(read.seq) read.qname = 'test' read.rlen = len(read.seq) read.reference_start = 100 read.reference_end = read.reference_start + read.rlen read.cigarstring = '{}M'.format(read.rlen) def assert_inversion(read, start, end, sequence, expected_seq, expected_cigar): inv, _ = invert_read(read, start, end, sequence, 0, 0) msg_prefix = 'invert({}, {}--{})'.format(read.seq, start, end) self.assertEqual(inv.seq, expected_seq, '{}: {} != {}'.format(msg_prefix, inv.seq, expected_seq)) self.assertEqual(inv.cigarstring, expected_cigar, '{}: {} != {}'.format(msg_prefix, inv.cigarstring, expected_cigar)) # Inversions that are fully within the read for start, end, expected_seq, expected_cigar in [ # fully contained, away from borders (102, 104, '124356', '2M4S'), (101, 104, '143256', '4S2M'), # fully contained, touching borders (100, 104, '432156', '4S2M'), (102, 106, '126543', '2M4S'), # spanning exactly the read (100, 106, '654321', '6S'), # edge cases (102, 102, '123456', '6M'), (102, 103, '123456', '6M'), ]: assert_inversion(read, start, end, '', expected_seq, expected_cigar) # The sequence that's inverted in the entire genome; only a subset will appear in each read. sequence = '9876543210' for start, expected_seq, expected_cigar in [ # inversion ends before the read (80, '123456', '6M'), (90, '123456', '6M'), # inversion starts before the read, and extends into it (91, '023456', '1S5M'), (92, '103456', '2S4M'), (93, '210456', '3S3M'), (94, '321056', '4S2M'), (95, '432106', '5S1M'), # read is fully contained in the inversion (96, '543210', '6S'), (97, '654321', '6S'), (98, '765432', '6S'), (99, '876543', '6S'), (100, '987654', '6S'), # inversion starts mid-read (101, '198765', '1M5S'), (102, '129876', '2M4S'), (103, '123987', '3M3S'), (104, '123498', '4M2S'), (105, '123459', '5M1S'), # inversion starts past the read (106, '123456', '6M'), (110, '123456', '6M'), ]: assert_inversion(read, start, start + len(sequence), sequence, expected_seq, expected_cigar) def test_get_inverse_sequence(self): # Reads represented in this file (start position = 100): # # ACGTACGTAC # ACGTCCGTAC # CGTCCGTACT # CGTCCGAACT # GTCCGAACTT # TCCGAACTTC # CCGAACTTAA # CCGAACTTAA # CCGAACTTAG # CGAACTTAGC # bam = path.join(TEST_DATA_DIR, 'sv_sim.bam') self.assertEqual(get_inverse_sequence(bam, '1', 100, 102), 'GT') self.assertEqual(get_inverse_sequence(bam, '1', 108, 111), 'AGT') # Inversion of an area with no reads, no ref genome provided self.assertEqual(get_inverse_sequence(bam, '1', 98, 102), 'GTNN') self.assertEqual(get_inverse_sequence(bam, '1', 0, 100), 'N' * 100) # Inversion of an area with no reads, ref genome provided ref_genome_fa = Fasta(path.join(TEST_DATA_DIR, 'sv_sim.fa')) self.assertEqual(get_inverse_sequence(bam, '1', 0, 4, ref_genome_fa), 'AAAA') self.assertEqual(get_inverse_sequence(bam, '1', 98, 102, ref_genome_fa), 'GTAA') def test_overlap(self): self.assertEqual(overlap((0, 0), (0, 0)), 0) self.assertEqual(overlap((0, 1), (0, 1)), 1) self.assertEqual(overlap((0, 1), (1, 1)), 0) self.assertEqual(overlap((0, 1), (0, 2)), 1) self.assertEqual(overlap((0, 1), (1, 2)), 0) self.assertEqual(overlap((0, 2), (1, 2)), 1) self.assertEqual(overlap((0, 2), (1, 3)), 1) self.assertEqual(overlap((0, 2), (0, 3)), 2) self.assertEqual(overlap((0, 2), (2, 4)), 0) self.assertEqual(overlap((0, 3), (1, 2)), 1) self.assertEqual(overlap((0, 4), (1, 3)), 2) self.assertEqual(overlap((0, 4), (2, 4)), 2) self.assertEqual(overlap((0, 4), (0, 2)), 2) # TODO: add tests for: # inversion directly from BAM # inversion of an area that has no reads in the BAM # max clip len
chemdner_sample_base = "corpora/CHEMDNER/CHEMDNER_SAMPLE_JUNE25/" cpatents_sample_base = "corpora/CHEMDNER-patents/chemdner_cemp_sample_v02/" pubmed_test_base = "corpora/pubmed-test/" transmir_base = "corpora/transmir/" chemdner2017_base = "corpora/CHEMDNER2017/" chemdner2017_1k = "corpora/CHEMDNER2017_1k/" mirnacorpus_base = "corpora/miRNACorpus/" mirtex_base = "corpora/miRTex/" jnlpba_base = "corpora/JNLPBA/" paths = {} for i in range(1,11): paths["mirna_ds{}".format(i)] = {'corpus': "corpora/mirna-ds/abstracts_11k.txt_{}.pickle".format(i), 'format': "mirna", 'annotations': ""} paths["mirna_ds_annotated{}".format(i)] = {'corpus': "data/mirna_ds_annotated_{}.pickle".format(i), 'format': "mirna", 'annotations': "" } paths.update({ ### miRNA corpus (Bagewadi 2013) 'miRNACorpus_train': { 'text': mirnacorpus_base + "miRNA-Train-Corpus.xml", 'annotations': mirnacorpus_base + "miRNA-Train-Corpus.xml", 'corpus': "data/miRNA-Train-Corpus.xml.pickle", 'format': "ddi-mirna" }, 'miRNACorpus_test': { 'text': mirnacorpus_base + "miRNA-Test-Corpus.xml", 'annotations': mirnacorpus_base + "miRNA-Test-Corpus.xml", 'corpus': "data/miRNA-Test-Corpus.xml.pickle", 'format': "ddi-mirna" }, ### miRTex corpus (Li 2015) 'miRTex_dev': { 'text': mirtex_base + "development/", 'annotations': mirtex_base + "development/", 'corpus': "data/miRTex-development.txt.pickle", 'format': "mirtex" }, 'miRTex_test': { 'text': mirtex_base + "test/", 'annotations': mirtex_base + "test/", 'corpus': "data/miRTex-test.txt.pickle", 'format': "mirtex" }, 'lurie_train': { 'text': "corpora/luriechildren/train/texts/", 'annotations': "corpora/luriechildren/train/annotations/", 'corpus': "data/luriechildren_train.txt.pickle", 'format': "brat" }, 'lurie_test': { 'text': "corpora/luriechildren/test/texts/", 'annotations': "corpora/luriechildren/test/annotations/", 'corpus': "data/luriechildren_test.txt.pickle", 'format': "brat" }, 'mirna_cf': { 'corpus': "corpora/cf_corpus/abstracts.txt.pickle", 'format': "mirna", 'annotations': "" }, 'mirna_cf_annotated': { 'corpus': "data/mirna_cf_annotated.pickle", 'format': "mirna", 'annotations': "" }, 'mirna_ds': { 'corpus': "corpora/mirna-ds/abstracts_11k.txt.pickle", 'format': "mirna", 'annotations': "" }, 'mirna_ds_annotated': { 'corpus': "corpora/mirna-ds/mirna_ds_annotated.pickle", 'format': "mirna", 'annotations': "" }, ### BioNLP/NLPBA 2004 (GENIA version 3.02) 'jnlpba_train': { 'text': jnlpba_base + "train/Genia4ERtask2.iob2", 'annotations': jnlpba_base + "train/Genia4ERtask2.iob2", 'corpus': "data/Genia4ERtask1.raw.pickle", 'format': "jnlpba" }, 'jnlpba_test': { 'text': jnlpba_base + "test/Genia4EReval2.iob2", 'annotations': jnlpba_base + "test/Genia4EReval2.iob2", 'corpus': "data/Genia4EReval1.raw.pickle", 'format': "jnlpba" }, ### TransmiR corpus 'transmir': { 'text': "data/transmir_v1.2.tsv", 'annotations': "data/transmir_v1.2.tsv", 'corpus': "data/transmir_v1.2.tsv.pickle", 'format': "transmir" }, 'transmir_annotated': { 'text': "data/transmir_v1.2.tsv", 'annotations': "data/transmir_v1.2.tsv", 'corpus': "data/transmir_annotated.pickle", 'format': "transmir" }, 'pubmed_test': { 'text': pubmed_test_base + "pmids_test.txt", 'annotations': "", 'corpus': "data/pmids_test.txt.pickle", 'format': "pubmed" }, ### BioCreative '15 CHEMDNER subtask 'cemp_sample':{ 'text': cpatents_sample_base + "chemdner_patents_sample_text.txt", 'annotations': cpatents_sample_base + "chemdner_cemp_gold_standard_sample.tsv", 'cem': cpatents_sample_base + "chemdner_cemp_gold_standard_sample_eval.tsv", 'corpus': "data/chemdner_patents_sample_text.txt.pickle", 'format': "chemdner", }, 'chemdner2017':{ 'text': chemdner2017_base + "BioCreative V.5 training set.txt", 'annotations': chemdner2017_base + "CEMP_BioCreative V.5 training set annot.tsv", #'cem': chemdner2017 + "chemdner_cemp_gold_standard_sample_eval.tsv", 'corpus': "data/chemdner_v5_text.txt.pickle", 'format': "chemdner", }, 'chemdner2017_train':{ 'text': chemdner2017_base + "chemdner2017_training_set.tsv", 'annotations': chemdner2017_base + "train_annotations.tsv", #'cem': chemdner2017 + "chemdner_cemp_gold_standard_sample_eval.tsv", 'corpus': "data/chemdner_train_text.txt.pickle", 'format': "chemdner", }, 'chemdner2017_dev': { 'text': chemdner2017_base + "chemdner2017_development_set.tsv", 'annotations': chemdner2017_base + "dev_annotations.tsv", # 'cem': chemdner2017 + "chemdner_cemp_gold_standard_sample_eval.tsv", 'corpus': "data/chemdner_dev_text.txt.pickle", 'format': "chemdner", }, 'ensemble_chemdner_dev': { 'text': chemdner2017_base + "chemdner2017_development_set.tsv", 'annotations': chemdner2017_base + "dev_annotations.tsv", # 'cem': chemdner2017 + "chemdner_cemp_gold_standard_sample_eval.tsv", 'corpus': "data/chemdner_dev_ensemble.pickle", 'format': "chemdner", }, 'ensemble_chemdner_dev_ssm': { 'text': chemdner2017_base + "chemdner2017_development_set.tsv", 'annotations': chemdner2017_base + "dev_annotations.tsv", # 'cem': chemdner2017 + "chemdner_cemp_gold_standard_sample_eval.tsv", 'corpus': "data/chemdner_dev_ensemble_ssm.pickle", 'format': "chemdner", }, 'chemdner2017_eval': { 'text': chemdner2017_base + "chemdner2017_eval_set.tsv", 'annotations': chemdner2017_base + "eval_annotations.tsv", 'cem': chemdner2017_base + "eval_annotations.tsv", 'corpus': "data/chemdner_eval_text.txt.pickle", 'format': "chemdner", }, 'ensemble_chemdner_eval': { 'text': chemdner2017_base + "chemdner2017_eval_set.tsv", 'annotations': chemdner2017_base + "eval_annotations.tsv", 'cem': chemdner2017_base + "eval_annotations.tsv", 'corpus': "data/chemdner_eval_ensemble.pickle", 'format': "chemdner", }, 'ensemble_chemdner_eval_ssm': { 'text': chemdner2017_base + "chemdner2017_eval_set.tsv", 'annotations': chemdner2017_base + "eval_annotations.tsv", 'cem': chemdner2017_base + "eval_annotations.tsv", 'corpus': "data/chemdner_eval_ensemble_ssm.pickle", 'format': "chemdner", }, 'chemdner2017_test':{ 'text': chemdner2017_base + "test_set_patents_BioCreative_V.5.tsv", 'annotations': "", #'cem': chemdner2017 + "chemdner_cemp_gold_standard_sample_eval.tsv", 'corpus': "data/chemdner_test_text.txt.pickle", 'format': "chemdner", }, 'ensemble_chemdner_test': { 'text': chemdner2017_base + "test_set_patents_BioCreative_V.5.tsv", 'annotations': "", # 'cem': chemdner2017 + "chemdner_cemp_gold_standard_sample_eval.tsv", 'corpus': "data/chemdner_test_ensemble.pickle", 'format': "chemdner", }, 'ensemble_chemdner_test_ssm': { 'text': chemdner2017_base + "test_set_patents_BioCreative_V.5.tsv", 'annotations': "", # 'cem': chemdner2017 + "chemdner_cemp_gold_standard_sample_eval.tsv", 'corpus': "data/chemdner_test_ensemble_ssm.pickle", 'format': "chemdner", }, })
# -*- coding: utf-8 -*- import datetime from south.db import db from south.v2 import SchemaMigration from django.db import models class Migration(SchemaMigration): def forwards(self, orm): # Adding model 'UserPageView' db.create_table('website_userpageview', ( ('id', self.gf('django.db.models.fields.AutoField')(primary_key=True)), ('user', self.gf('django.db.models.fields.related.ForeignKey')(to=orm['auth.User'], null=True, blank=True)), ('url', self.gf('django.db.models.fields.CharField')(max_length=210, null=True, blank=True)), ('view_datetime', self.gf('django.db.models.fields.DateTimeField')(null=True, blank=True)), )) db.send_create_signal('website', ['UserPageView']) def backwards(self, orm): # Deleting model 'UserPageView' db.delete_table('website_userpageview') models = { 'auth.group': { 'Meta': {'object_name': 'Group'}, 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '80'}), 'permissions': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['auth.Permission']", 'symmetrical': 'False', 'blank': 'True'}) }, 'auth.permission': { 'Meta': {'ordering': "('content_type__app_label', 'content_type__model', 'codename')", 'unique_together': "(('content_type', 'codename'),)", 'object_name': 'Permission'}, 'codename': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'content_type': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['contenttypes.ContentType']"}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '50'}) }, 'auth.user': { 'Meta': {'object_name': 'User'}, 'date_joined': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'email': ('django.db.models.fields.EmailField', [], {'max_length': '75', 'blank': 'True'}), 'first_name': ('django.db.models.fields.CharField', [], {'max_length': '30', 'blank': 'True'}), 'groups': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['auth.Group']", 'symmetrical': 'False', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'is_active': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'is_staff': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'is_superuser': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'last_login': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'last_name': ('django.db.models.fields.CharField', [], {'max_length': '30', 'blank': 'True'}), 'password': ('django.db.models.fields.CharField', [], {'max_length': '128'}), 'user_permissions': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['auth.Permission']", 'symmetrical': 'False', 'blank': 'True'}), 'username': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '30'}) }, 'contenttypes.contenttype': { 'Meta': {'ordering': "('name',)", 'unique_together': "(('app_label', 'model'),)", 'object_name': 'ContentType', 'db_table': "'django_content_type'"}, 'app_label': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'model': ('django.db.models.fields.CharField', [], {'max_length': '100'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '100'}) }, 'website.action': { 'Meta': {'object_name': 'Action'}, 'action_datetime': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'null': 'True', 'blank': 'True'}), 'category': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.ActionCategory']", 'null': 'True', 'blank': 'True'}), 'data': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'entity_id': ('django.db.models.fields.PositiveIntegerField', [], {'null': 'True', 'blank': 'True'}), 'entity_name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '32', 'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'jurisdiction': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Jurisdiction']", 'null': 'True', 'blank': 'True'}), 'level': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.RatingLevel']", 'null': 'True', 'blank': 'True'}), 'organization': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Organization']", 'null': 'True', 'blank': 'True'}), 'question_category': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.QuestionCategory']", 'null': 'True', 'blank': 'True'}), 'scale': ('django.db.models.fields.IntegerField', [], {'db_index': 'True', 'null': 'True', 'blank': 'True'}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']", 'null': 'True', 'blank': 'True'}) }, 'website.actioncategory': { 'Meta': {'object_name': 'ActionCategory'}, 'description': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '64', 'null': 'True', 'blank': 'True'}), 'points': ('django.db.models.fields.IntegerField', [], {'db_index': 'True', 'null': 'True', 'blank': 'True'}), 'rating_category': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.RatingCategory']", 'null': 'True', 'blank': 'True'}) }, 'website.actiontutorial': { 'Meta': {'object_name': 'ActionTutorial'}, 'action_identifier': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '64', 'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'tutorial': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Tutorial']", 'null': 'True', 'blank': 'True'}) }, 'website.address': { 'Meta': {'object_name': 'Address'}, 'address1': ('django.db.models.fields.CharField', [], {'max_length': '255', 'null': 'True', 'blank': 'True'}), 'address2': ('django.db.models.fields.CharField', [], {'max_length': '255', 'null': 'True', 'blank': 'True'}), 'city': ('django.db.models.fields.CharField', [], {'max_length': '128', 'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'latitude': ('django.db.models.fields.DecimalField', [], {'null': 'True', 'max_digits': '10', 'decimal_places': '7', 'blank': 'True'}), 'longitude': ('django.db.models.fields.DecimalField', [], {'null': 'True', 'max_digits': '10', 'decimal_places': '7', 'blank': 'True'}), 'state': ('django.db.models.fields.CharField', [], {'max_length': '8', 'null': 'True', 'blank': 'True'}), 'zip_code': ('django.db.models.fields.CharField', [], {'max_length': '32', 'null': 'True', 'blank': 'True'}) }, 'website.answerchoice': { 'Meta': {'object_name': 'AnswerChoice'}, 'answer_choice_group': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.AnswerChoiceGroup']"}), 'display_order': ('django.db.models.fields.PositiveSmallIntegerField', [], {'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'label': ('django.db.models.fields.CharField', [], {'max_length': '255', 'null': 'True', 'blank': 'True'}), 'value': ('django.db.models.fields.CharField', [], {'max_length': '255', 'null': 'True', 'blank': 'True'}) }, 'website.answerchoicegroup': { 'Meta': {'object_name': 'AnswerChoiceGroup'}, 'description': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '128', 'null': 'True', 'blank': 'True'}) }, 'website.answerreference': { 'Meta': {'object_name': 'AnswerReference'}, 'approval_status': ('django.db.models.fields.CharField', [], {'default': "'P'", 'max_length': '8', 'db_index': 'True', 'blank': 'True'}), 'create_datetime': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'null': 'True', 'blank': 'True'}), 'creator': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']", 'null': 'True', 'blank': 'True'}), 'file_upload': ('django.db.models.fields.files.FileField', [], {'max_length': '100', 'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'is_callout': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'is_current': ('django.db.models.fields.BooleanField', [], {'default': 'True', 'db_index': 'True'}), 'jurisdiction': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Jurisdiction']", 'null': 'True', 'blank': 'True'}), 'migrated_answer_id': ('django.db.models.fields.IntegerField', [], {'null': 'True', 'blank': 'True'}), 'modify_datetime': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'organization': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Organization']", 'null': 'True', 'blank': 'True'}), 'question': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Question']"}), 'rating': ('django.db.models.fields.IntegerField', [], {'db_index': 'True', 'null': 'True', 'blank': 'True'}), 'rating_status': ('django.db.models.fields.CharField', [], {'default': "'U'", 'max_length': '8', 'db_index': 'True', 'blank': 'True'}), 'status_datetime': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'value': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}) }, 'website.applicability': { 'Meta': {'object_name': 'Applicability'}, 'accepted': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'create_datetime': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'null': 'True', 'blank': 'True'}), 'description': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'modify_datetime': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '128', 'null': 'True', 'blank': 'True'}), 'reviewed': ('django.db.models.fields.BooleanField', [], {'default': 'False'}) }, 'website.application': { 'Meta': {'object_name': 'Application'}, 'address': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Address']", 'null': 'True', 'blank': 'True'}), 'applicant': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']", 'null': 'True', 'blank': 'True'}), 'current_status': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '8', 'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'jurisdiction': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Jurisdiction']", 'null': 'True', 'blank': 'True'}), 'status_datetime': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'template': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Template']", 'null': 'True', 'blank': 'True'}) }, 'website.applicationanswer': { 'Meta': {'object_name': 'ApplicationAnswer'}, 'application': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Application']"}), 'create_datetime': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'null': 'True', 'blank': 'True'}), 'file_upload': ('django.db.models.fields.files.FileField', [], {'max_length': '100', 'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'modify_datetime': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'question': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Question']"}), 'template': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Template']"}), 'value': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}) }, 'website.applicationhistory': { 'Meta': {'object_name': 'ApplicationHistory'}, 'application': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Application']"}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'status': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '8', 'null': 'True', 'blank': 'True'}), 'status_by': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']", 'null': 'True', 'blank': 'True'}), 'status_datetime': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'null': 'True', 'blank': 'True'}) }, 'website.comment': { 'Meta': {'object_name': 'Comment'}, 'approval_status': ('django.db.models.fields.CharField', [], {'default': "'P'", 'max_length': '8', 'db_index': 'True', 'blank': 'True'}), 'comment': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'comment_type': ('django.db.models.fields.CharField', [], {'default': "''", 'max_length': '8', 'db_index': 'True', 'blank': 'True'}), 'create_datetime': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'null': 'True', 'blank': 'True'}), 'entity_id': ('django.db.models.fields.PositiveIntegerField', [], {'db_index': 'True', 'null': 'True', 'blank': 'True'}), 'entity_name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '32', 'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'jurisdiction': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Jurisdiction']", 'null': 'True', 'blank': 'True'}), 'parent_comment': ('django.db.models.fields.related.ForeignKey', [], {'blank': 'True', 'related_name': "'parent_reference'", 'null': 'True', 'to': "orm['website.Comment']"}), 'rating': ('django.db.models.fields.IntegerField', [], {'db_index': 'True', 'null': 'True', 'blank': 'True'}), 'rating_status': ('django.db.models.fields.CharField', [], {'default': "'U'", 'max_length': '8', 'db_index': 'True', 'blank': 'True'}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']", 'null': 'True', 'blank': 'True'}) }, 'website.document': { 'Meta': {'object_name': 'Document'}, 'accepted': ('django.db.models.fields.BooleanField', [], {'default': 'False', 'db_index': 'True'}), 'create_datetime': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'null': 'True', 'blank': 'True'}), 'description': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'file_name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '64', 'null': 'True', 'blank': 'True'}), 'file_path': ('django.db.models.fields.files.FileField', [], {'max_length': '100'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'jurisdiction': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Jurisdiction']", 'null': 'True', 'blank': 'True'}), 'modify_datetime': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'region': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Region']", 'null': 'True', 'blank': 'True'}), 'reviewed': ('django.db.models.fields.BooleanField', [], {'default': 'False', 'db_index': 'True'}), 'title': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '128', 'null': 'True', 'blank': 'True'}) }, 'website.documentcategory': { 'Meta': {'object_name': 'DocumentCategory'}, 'description': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '64', 'null': 'True', 'blank': 'True'}) }, 'website.entityview': { 'Meta': {'object_name': 'EntityView'}, 'entity_id': ('django.db.models.fields.PositiveIntegerField', [], {'db_index': 'True', 'null': 'True', 'blank': 'True'}), 'entity_name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '32', 'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'latest_datetime': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'session_key': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '40', 'null': 'True', 'blank': 'True'}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']", 'null': 'True', 'blank': 'True'}) }, 'website.entityviewcount': { 'Meta': {'object_name': 'EntityViewCount'}, 'count_30_days': ('django.db.models.fields.PositiveIntegerField', [], {'db_index': 'True', 'null': 'True', 'blank': 'True'}), 'entity_id': ('django.db.models.fields.PositiveIntegerField', [], {'db_index': 'True', 'null': 'True', 'blank': 'True'}), 'entity_name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '32', 'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'total_count': ('django.db.models.fields.PositiveIntegerField', [], {'db_index': 'True', 'null': 'True', 'blank': 'True'}) }, 'website.jurisdiction': { 'Meta': {'object_name': 'Jurisdiction'}, 'city': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '64', 'null': 'True', 'blank': 'True'}), 'county': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '64', 'null': 'True', 'blank': 'True'}), 'create_datetime': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'null': 'True', 'blank': 'True'}), 'description': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'jurisdiction_type': ('django.db.models.fields.CharField', [], {'max_length': '8', 'null': 'True', 'blank': 'True'}), 'last_contributed': ('django.db.models.fields.DateTimeField', [], {'db_index': 'True', 'null': 'True', 'blank': 'True'}), 'last_contributed_by': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']", 'null': 'True', 'blank': 'True'}), 'last_contributed_by_org': ('django.db.models.fields.related.ForeignKey', [], {'blank': 'True', 'related_name': "'_org_contributor'", 'null': 'True', 'to': "orm['website.Organization']"}), 'latitude': ('django.db.models.fields.DecimalField', [], {'null': 'True', 'max_digits': '10', 'decimal_places': '7', 'blank': 'True'}), 'longitude': ('django.db.models.fields.DecimalField', [], {'null': 'True', 'max_digits': '10', 'decimal_places': '7', 'blank': 'True'}), 'modify_datetime': ('django.db.models.fields.DateTimeField', [], {'db_index': 'True', 'null': 'True', 'blank': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '64', 'null': 'True', 'blank': 'True'}), 'organization': ('django.db.models.fields.related.ForeignKey', [], {'blank': 'True', 'related_name': "'_org_jurisdiction'", 'null': 'True', 'to': "orm['website.Organization']"}), 'parent': ('django.db.models.fields.related.ForeignKey', [], {'blank': 'True', 'related_name': "'parent_jurisdiction'", 'null': 'True', 'to': "orm['website.Jurisdiction']"}), 'region': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Region']", 'null': 'True', 'blank': 'True'}), 'state': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '8', 'null': 'True', 'blank': 'True'}) }, 'website.jurisdictioncontributor': { 'Meta': {'object_name': 'JurisdictionContributor'}, 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'jurisdiction': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Jurisdiction']", 'null': 'True', 'blank': 'True'}), 'organization': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Organization']", 'null': 'True', 'blank': 'True'}), 'points': ('django.db.models.fields.IntegerField', [], {'null': 'True', 'blank': 'True'}), 'question_category': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.QuestionCategory']", 'null': 'True', 'blank': 'True'}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']", 'null': 'True', 'blank': 'True'}) }, 'website.migrationhistory': { 'Meta': {'object_name': 'MigrationHistory'}, 'create_datetime': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'jurisdiction_id': ('django.db.models.fields.IntegerField', [], {'db_index': 'True', 'null': 'True', 'blank': 'True'}), 'modify_datetime': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'notes': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'notes2': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'source_id': ('django.db.models.fields.IntegerField', [], {'db_index': 'True', 'null': 'True', 'blank': 'True'}), 'source_table': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '64', 'null': 'True', 'blank': 'True'}), 'target_id': ('django.db.models.fields.IntegerField', [], {'db_index': 'True', 'null': 'True', 'blank': 'True'}), 'target_table': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '64', 'null': 'True', 'blank': 'True'}) }, 'website.organization': { 'Meta': {'object_name': 'Organization'}, 'category': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.OrganizationCategory']", 'null': 'True', 'blank': 'True'}), 'create_datetime': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'null': 'True', 'blank': 'True'}), 'description': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'email': ('django.db.models.fields.EmailField', [], {'max_length': '75', 'null': 'True', 'blank': 'True'}), 'fax': ('django.contrib.localflavor.us.models.PhoneNumberField', [], {'max_length': '20', 'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'logo': ('django.db.models.fields.files.ImageField', [], {'max_length': '100', 'null': 'True', 'blank': 'True'}), 'logo_scaled': ('django.db.models.fields.files.ImageField', [], {'max_length': '100', 'null': 'True', 'blank': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '64', 'null': 'True', 'blank': 'True'}), 'parent_org': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Organization']", 'null': 'True', 'blank': 'True'}), 'phone': ('django.contrib.localflavor.us.models.PhoneNumberField', [], {'max_length': '20', 'null': 'True', 'blank': 'True'}), 'status': ('django.db.models.fields.CharField', [], {'default': "'A'", 'max_length': '8', 'null': 'True', 'db_index': 'True', 'blank': 'True'}), 'status_datetime': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'website': ('django.db.models.fields.URLField', [], {'max_length': '200', 'null': 'True', 'blank': 'True'}) }, 'website.organizationaddress': { 'Meta': {'object_name': 'OrganizationAddress'}, 'address': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Address']", 'null': 'True', 'blank': 'True'}), 'address_type': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '8', 'null': 'True', 'blank': 'True'}), 'display_order': ('django.db.models.fields.PositiveSmallIntegerField', [], {'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'organization': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Organization']", 'null': 'True', 'blank': 'True'}) }, 'website.organizationcategory': { 'Meta': {'object_name': 'OrganizationCategory'}, 'description': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '64', 'null': 'True', 'blank': 'True'}) }, 'website.organizationmember': { 'Meta': {'object_name': 'OrganizationMember'}, 'display_order': ('django.db.models.fields.PositiveSmallIntegerField', [], {'null': 'True', 'blank': 'True'}), 'email': ('django.db.models.fields.EmailField', [], {'max_length': '75', 'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'invitation_key': ('django.db.models.fields.CharField', [], {'max_length': '128', 'null': 'True', 'blank': 'True'}), 'invitor': ('django.db.models.fields.related.ForeignKey', [], {'blank': 'True', 'related_name': "'_member_invitor'", 'null': 'True', 'to': "orm['auth.User']"}), 'join_date': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'organization': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Organization']", 'null': 'True', 'blank': 'True'}), 'person': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Person']", 'null': 'True', 'blank': 'True'}), 'requested_date': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'role': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.RoleType']", 'null': 'True', 'blank': 'True'}), 'status': ('django.db.models.fields.CharField', [], {'default': "'P'", 'max_length': '8', 'null': 'True', 'db_index': 'True', 'blank': 'True'}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'blank': 'True', 'related_name': "'_member_user'", 'null': 'True', 'to': "orm['auth.User']"}) }, 'website.organizationrating': { 'Meta': {'object_name': 'OrganizationRating'}, 'category': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.RatingCategory']", 'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'level': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.RatingLevel']", 'null': 'True', 'blank': 'True'}), 'organization': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Organization']", 'null': 'True', 'blank': 'True'}), 'scale': ('django.db.models.fields.IntegerField', [], {'db_index': 'True', 'null': 'True', 'blank': 'True'}), 'updated_datetime': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}) }, 'website.person': { 'Meta': {'object_name': 'Person'}, 'email': ('django.db.models.fields.EmailField', [], {'max_length': '75', 'null': 'True', 'blank': 'True'}), 'first_name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '64', 'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'last_name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '64', 'null': 'True', 'blank': 'True'}), 'phone_mobile': ('django.contrib.localflavor.us.models.PhoneNumberField', [], {'max_length': '20', 'null': 'True', 'blank': 'True'}), 'phone_primary': ('django.contrib.localflavor.us.models.PhoneNumberField', [], {'max_length': '20', 'null': 'True', 'blank': 'True'}), 'phone_secondary': ('django.contrib.localflavor.us.models.PhoneNumberField', [], {'max_length': '20', 'null': 'True', 'blank': 'True'}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']", 'null': 'True', 'blank': 'True'}) }, 'website.personaddress': { 'Meta': {'object_name': 'PersonAddress'}, 'address': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Address']", 'null': 'True', 'blank': 'True'}), 'address_type': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '8', 'null': 'True', 'blank': 'True'}), 'display_order': ('django.db.models.fields.PositiveSmallIntegerField', [], {'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'person': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Person']", 'null': 'True', 'blank': 'True'}) }, 'website.question': { 'Meta': {'object_name': 'Question'}, 'accepted': ('django.db.models.fields.BooleanField', [], {'default': 'False', 'db_index': 'True'}), 'answer_choice_group': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.AnswerChoiceGroup']", 'null': 'True', 'blank': 'True'}), 'applicability': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Applicability']", 'null': 'True', 'blank': 'True'}), 'category': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.QuestionCategory']", 'null': 'True', 'blank': 'True'}), 'create_datetime': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'null': 'True', 'blank': 'True'}), 'creator': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']", 'null': 'True', 'blank': 'True'}), 'default_value': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'description': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'display_order': ('django.db.models.fields.PositiveSmallIntegerField', [], {'null': 'True', 'blank': 'True'}), 'display_template': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'field_attributes': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'field_suffix': ('django.db.models.fields.CharField', [], {'max_length': '32', 'null': 'True', 'blank': 'True'}), 'form_type': ('django.db.models.fields.CharField', [], {'max_length': '8', 'null': 'True', 'blank': 'True'}), 'has_multivalues': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'instruction': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'js': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'label': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'migration_type': ('django.db.models.fields.CharField', [], {'max_length': '64', 'null': 'True', 'blank': 'True'}), 'modify_datetime': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'qtemplate': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Template']", 'null': 'True'}), 'question': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'reviewed': ('django.db.models.fields.BooleanField', [], {'default': 'False', 'db_index': 'True'}), 'state_exclusive': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'template': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'terminology': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'validation_class': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}) }, 'website.questioncategory': { 'Meta': {'object_name': 'QuestionCategory'}, 'accepted': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'create_datetime': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'null': 'True', 'blank': 'True'}), 'description': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'display_order': ('django.db.models.fields.PositiveSmallIntegerField', [], {'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'modify_datetime': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '128', 'null': 'True', 'blank': 'True'}), 'reviewed': ('django.db.models.fields.BooleanField', [], {'default': 'False'}) }, 'website.questiondependency': { 'Meta': {'object_name': 'QuestionDependency'}, 'answer_text': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'create_datetime': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'modify_datetime': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'question1': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "'_questionDependency_question1'", 'to': "orm['website.Question']"}), 'question2': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "'_questionDependency_question2'", 'to': "orm['website.Question']"}), 'required': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'strength': ('django.db.models.fields.PositiveSmallIntegerField', [], {'null': 'True', 'blank': 'True'}) }, 'website.ratingcategory': { 'Meta': {'object_name': 'RatingCategory'}, 'description': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '64', 'null': 'True', 'blank': 'True'}), 'rating_type': ('django.db.models.fields.CharField', [], {'max_length': '8', 'null': 'True', 'blank': 'True'}) }, 'website.ratinglevel': { 'Meta': {'object_name': 'RatingLevel'}, 'category': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.RatingCategory']", 'null': 'True', 'blank': 'True'}), 'description': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '64', 'null': 'True', 'blank': 'True'}), 'rank': ('django.db.models.fields.PositiveSmallIntegerField', [], {'db_index': 'True', 'null': 'True', 'blank': 'True'}) }, 'website.reaction': { 'Meta': {'object_name': 'Reaction'}, 'action': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Action']", 'null': 'True', 'blank': 'True'}), 'category': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.ReactionCategory']", 'null': 'True', 'blank': 'True'}), 'data': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'jurisdiction': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Jurisdiction']", 'null': 'True', 'blank': 'True'}), 'level': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.RatingLevel']", 'null': 'True', 'blank': 'True'}), 'question_category': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.QuestionCategory']", 'null': 'True', 'blank': 'True'}), 'reaction_datetime': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'null': 'True', 'blank': 'True'}), 'scale': ('django.db.models.fields.IntegerField', [], {'db_index': 'True', 'null': 'True', 'blank': 'True'}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']", 'null': 'True', 'blank': 'True'}) }, 'website.reactioncategory': { 'Meta': {'object_name': 'ReactionCategory'}, 'description': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '64', 'null': 'True', 'blank': 'True'}), 'points': ('django.db.models.fields.IntegerField', [], {'db_index': 'True', 'null': 'True', 'blank': 'True'}), 'rating_category': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.RatingCategory']", 'null': 'True', 'blank': 'True'}) }, 'website.region': { 'Meta': {'object_name': 'Region'}, 'description': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'latitude': ('django.db.models.fields.DecimalField', [], {'null': 'True', 'max_digits': '10', 'decimal_places': '7', 'blank': 'True'}), 'longitude': ('django.db.models.fields.DecimalField', [], {'null': 'True', 'max_digits': '10', 'decimal_places': '7', 'blank': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '64', 'null': 'True', 'blank': 'True'}), 'state': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '8', 'null': 'True', 'blank': 'True'}) }, 'website.rewardcategory': { 'Meta': {'object_name': 'RewardCategory'}, 'description': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '64', 'null': 'True', 'blank': 'True'}) }, 'website.roletype': { 'Meta': {'object_name': 'RoleType'}, 'description': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '64', 'null': 'True', 'blank': 'True'}) }, 'website.servervariable': { 'Meta': {'object_name': 'ServerVariable'}, 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '64', 'null': 'True', 'blank': 'True'}), 'value': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}) }, 'website.template': { 'Meta': {'object_name': 'Template'}, 'accepted': ('django.db.models.fields.BooleanField', [], {'default': 'False', 'db_index': 'True'}), 'create_datetime': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'null': 'True', 'blank': 'True'}), 'description': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'jurisdiction': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Jurisdiction']", 'null': 'True', 'blank': 'True'}), 'modify_datetime': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '128', 'null': 'True', 'blank': 'True'}), 'reviewed': ('django.db.models.fields.BooleanField', [], {'default': 'False', 'db_index': 'True'}), 'template_type': ('django.db.models.fields.CharField', [], {'default': "''", 'max_length': '8', 'db_index': 'True', 'blank': 'True'}) }, 'website.templatequestion': { 'Meta': {'object_name': 'TemplateQuestion'}, 'create_datetime': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'question': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Question']"}), 'template': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Template']"}) }, 'website.tutorial': { 'Meta': {'object_name': 'Tutorial'}, 'active': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'description': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'end_datetime': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'identifier': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '64', 'null': 'True', 'blank': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '128', 'null': 'True', 'blank': 'True'}), 'start_datetime': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}) }, 'website.tutorialpage': { 'Meta': {'object_name': 'TutorialPage'}, 'display_order': ('django.db.models.fields.SmallIntegerField', [], {'default': '0'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'selector': ('django.db.models.fields.CharField', [], {'max_length': '128', 'null': 'True', 'blank': 'True'}), 'tip': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}), 'tutorial': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Tutorial']", 'null': 'True', 'blank': 'True'}) }, 'website.usercommentview': { 'Meta': {'object_name': 'UserCommentView'}, 'comments_count': ('django.db.models.fields.IntegerField', [], {'null': 'True', 'blank': 'True'}), 'entity_id': ('django.db.models.fields.PositiveIntegerField', [], {'db_index': 'True', 'null': 'True', 'blank': 'True'}), 'entity_name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '32', 'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'jurisdiction': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Jurisdiction']", 'null': 'True', 'blank': 'True'}), 'last_comment': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Comment']", 'null': 'True', 'blank': 'True'}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']", 'null': 'True', 'blank': 'True'}), 'view_datetime': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'null': 'True', 'blank': 'True'}) }, 'website.userdetail': { 'Meta': {'object_name': 'UserDetail'}, 'display_preference': ('django.db.models.fields.CharField', [], {'max_length': '16', 'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'latitude': ('django.db.models.fields.DecimalField', [], {'null': 'True', 'max_digits': '10', 'decimal_places': '7', 'blank': 'True'}), 'longitude': ('django.db.models.fields.DecimalField', [], {'null': 'True', 'max_digits': '10', 'decimal_places': '7', 'blank': 'True'}), 'migrated_id': ('django.db.models.fields.IntegerField', [], {'db_index': 'True', 'null': 'True', 'blank': 'True'}), 'notification_preference': ('django.db.models.fields.CharField', [], {'max_length': '2', 'null': 'True', 'blank': 'True'}), 'old_password': ('django.db.models.fields.CharField', [], {'max_length': '32', 'null': 'True', 'blank': 'True'}), 'reset_password_key': ('django.db.models.fields.CharField', [], {'max_length': '128', 'null': 'True', 'blank': 'True'}), 'title': ('django.db.models.fields.CharField', [], {'max_length': '124', 'null': 'True', 'blank': 'True'}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']", 'null': 'True', 'blank': 'True'}) }, 'website.userfavorite': { 'Meta': {'object_name': 'UserFavorite'}, 'display_order': ('django.db.models.fields.PositiveSmallIntegerField', [], {'null': 'True', 'blank': 'True'}), 'entity_id': ('django.db.models.fields.IntegerField', [], {'db_index': 'True', 'null': 'True', 'blank': 'True'}), 'entity_name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '64', 'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']", 'null': 'True', 'blank': 'True'}) }, 'website.userpageview': { 'Meta': {'object_name': 'UserPageView'}, 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'url': ('django.db.models.fields.CharField', [], {'max_length': '210', 'null': 'True', 'blank': 'True'}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']", 'null': 'True', 'blank': 'True'}), 'view_datetime': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}) }, 'website.userrating': { 'Meta': {'object_name': 'UserRating'}, 'category': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.RatingCategory']", 'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'level': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.RatingLevel']", 'null': 'True', 'blank': 'True'}), 'scale': ('django.db.models.fields.IntegerField', [], {'db_index': 'True', 'null': 'True', 'blank': 'True'}), 'updated_datetime': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']", 'null': 'True', 'blank': 'True'}) }, 'website.userreward': { 'Meta': {'object_name': 'UserReward'}, 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'reward': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.RewardCategory']", 'null': 'True', 'blank': 'True'}), 'reward_datetime': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'null': 'True', 'blank': 'True'}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']", 'null': 'True', 'blank': 'True'}) }, 'website.usersearch': { 'Meta': {'object_name': 'UserSearch'}, 'entity_id': ('django.db.models.fields.IntegerField', [], {'db_index': 'True', 'null': 'True', 'blank': 'True'}), 'entity_name': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '64', 'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'label': ('django.db.models.fields.CharField', [], {'max_length': '64', 'null': 'True', 'blank': 'True'}), 'search_datetime': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'null': 'True', 'blank': 'True'}), 'user': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']", 'null': 'True', 'blank': 'True'}) }, 'website.usertutorialhistory': { 'Meta': {'object_name': 'UserTutorialHistory'}, 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'tutorial': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Tutorial']", 'null': 'True', 'blank': 'True'}), 'user_email': ('django.db.models.fields.EmailField', [], {'db_index': 'True', 'max_length': '75', 'null': 'True', 'blank': 'True'}), 'view_datetime': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}) }, 'website.usertutorialpagehistory': { 'Meta': {'object_name': 'UserTutorialPageHistory'}, 'checked': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'page': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.TutorialPage']", 'null': 'True', 'blank': 'True'}), 'tutorial': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['website.Tutorial']", 'null': 'True', 'blank': 'True'}), 'user_email': ('django.db.models.fields.EmailField', [], {'db_index': 'True', 'max_length': '75', 'null': 'True', 'blank': 'True'}) }, 'website.zipcode': { 'Meta': {'object_name': 'Zipcode'}, 'city': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '64', 'null': 'True', 'blank': 'True'}), 'county': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '64', 'null': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'latitude': ('django.db.models.fields.DecimalField', [], {'db_index': 'True', 'null': 'True', 'max_digits': '10', 'decimal_places': '7', 'blank': 'True'}), 'longitude': ('django.db.models.fields.DecimalField', [], {'db_index': 'True', 'null': 'True', 'max_digits': '10', 'decimal_places': '7', 'blank': 'True'}), 'state': ('django.db.models.fields.CharField', [], {'db_index': 'True', 'max_length': '2', 'null': 'True', 'blank': 'True'}), 'zip_code': ('django.db.models.fields.CharField', [], {'max_length': '10', 'db_index': 'True'}) } } complete_apps = ['website']
############################################################## # These constants are used in various files. # If you need to define a value that will be used in those files, # just define it here rather than copying it across each file, so # that it will be easy to change it if you need to. ############################################################## ######################################################## ## PLAYER SLOTS ############################# ######################################################## slot_player_faction_id = 0 slot_player_spawn_state = 1 # listed below, starting with player_spawn_state_ slot_player_spawn_invulnerable_time = 2 # mission time when the player spawned with temporary invlunerability slot_player_spawn_health_percent = 3 # saved health percentage to be applied when next spawning slot_player_spawn_entry_point = 4 # entry point used at last spawn player_spawn_state_dead = 0 player_spawn_state_invulnerable = 1 # while invlunerable soon after spawning player_spawn_state_at_marker = 2 # set before spawning to indicate that the agent should be shifted to the player's marker scene prop player_spawn_state_alive = 3 slot_player_inactive_index = 5 # index in the inactive players array, if stored slot_player_next_chat_event_type = 6 # next chat event number that the server expects this player's client to use slot_player_list_button_id = 7 # overlay id in the player list presentation slot_player_outlaw_rating = 8 slot_player_is_lord = 9 slot_player_non_lord_troop_id = 10 # the last troop used before changing to a lord only troop, to revert after respawning if someone else is voted lord slot_player_poll_faction_id = 11 # marks whether the player can vote in the current poll slot_player_requested_spawn_point = 12 # the spawn point requested by the player after dying, if any; -1 to indicate a newly connected player that hasn't yet requested to spawn slot_player_has_faction_door_key = 13 slot_player_has_faction_money_key = 14 slot_player_has_faction_item_key = 15 slot_player_teleport_to_ship_no = 16 # instance no of the last ship teleported to with the admin tool slot_player_last_faction_kicked_from = 17 # stores when kicked from a faction, so subsequent kicks can be free of cost slot_player_accessing_instance_id = 18 # stores the instance id of the inventory currently being accessed by the player, for updates if anyone else changes it slot_player_last_action_time = 19 # mission time of the last action that should be prevented from quick repetition slot_player_equip_item_0 = 20 # module equipment slots corresponding to the hard coded ones in header_items starting with ek_ slot_player_equip_item_1 = 21 slot_player_equip_item_2 = 22 slot_player_equip_item_3 = 23 slot_player_equip_head = 24 slot_player_equip_body = 25 slot_player_equip_foot = 26 slot_player_equip_gloves = 27 slot_player_equip_horse = 28 slot_player_equip_end = 29 slot_player_equip_item_0_ammo = 30 slot_player_equip_item_1_ammo = 31 slot_player_equip_item_2_ammo = 32 slot_player_equip_item_3_ammo = 33 slot_player_spawn_food_amount = 34 # saved food for next spawn slot_player_faction_chat_muted = 35 slot_player_kick_at_time = 36 # time to kick a player after the name server has rejected them, to allow time to recieve the message slot_player_can_faction_announce = 37 slot_player_next_spawn_health_percent = 38 # spawn health percentage for the troop applied after death, if that server option is enabled slot_player_accessing_unique_id = 39 # a unique number identifying an inventory scene prop being accessed that could despawn and the instance id be reused, like corpses slot_player_admin_no_panel = 40 # admin permission slots: the default value 0 is permissive so everything works when a name server is not connected slot_player_admin_no_gold = 41 slot_player_admin_no_kick = 42 slot_player_admin_no_temporary_ban = 43 slot_player_admin_no_permanent_ban = 44 slot_player_admin_no_kill_fade = 45 slot_player_admin_no_freeze = 46 slot_player_admin_no_teleport_self = 47 slot_player_admin_no_admin_items = 48 slot_player_admin_no_heal_self = 49 slot_player_admin_no_godlike_troop = 50 slot_player_admin_no_ships = 51 slot_player_admin_no_announce = 52 slot_player_admin_no_override_poll = 53 slot_player_admin_no_all_items = 54 slot_player_admin_no_mute = 55 slot_player_admin_no_animals = 56 slot_player_admin_no_factions = 57 slot_player_admin_end = 58 ######################################################## ## AGENT SLOTS ############################# ######################################################## slot_agent_horse_last_rider = 0 # if a horse, the agent id of the last (or current) rider, or if stray, negative numbers counting down to when the horse will be removed slot_agent_drowning_count = 1 # counts upwards each time an agent is found to be drowning underwater slot_agent_poison_amount = 2 # increases each time the agent is attacked with poison, reduced when healed slot_agent_poisoner_agent_id = 3 # agent id that last poisoned the agent slot_agent_poisoner_player_uid = 4 # player unique id of the poisoner when applicable, to give correct death messages slot_agent_freeze_instance_id = 5 # instance id of the invisible scene prop being used to freeze slot_agent_is_targeted = 6 # mark that the stored target agent id is correct slot_agent_food_amount = 7 slot_agent_fishing_last_school = 8 # last school fished from, to speed up repetitive check slot_agent_last_horse_ridden = 9 slot_agent_money_bag_1_value = 10 # the values of the money bags picked up, in order slot_agent_money_bag_2_value = 11 slot_agent_money_bag_3_value = 12 slot_agent_money_bag_4_value = 13 slot_agent_hunting_last_carcass = 14 # last animal carcass processed, to speed up repetitive checks slot_agent_died_normally = 15 slot_agent_animation_end_time_ms = 16 # mission time in milliseconds slot_agent_last_animation_string_id = 17 slot_agent_recent_animations_delay_ms = 18 # interval in milliseconds slot_agent_storage_corpse_instance_id = 19 # saved when discarding armor slot_agent_animal_herd_manager = 20 # instance id of the herd manager item attached to slot_agent_animal_birth_time = 21 # mission time when the animal was spawned as a child, or extrapolated if spawned as an adult slot_agent_animal_grow_time = 22 # mission time after which the animal will grow to an adult or birth a child slot_agent_animal_move_time = 23 # mission time after which to move slot_agent_animal_last_damage_time = 24 slot_agent_animal_food = 25 slot_agent_animal_carcass_instance_id = 26 slot_agent_animal_times_stuck = 27 slot_agent_animal_end = 28 slot_agent_head_damage_factor = 40 # agent modifier factors for armor slots slot_agent_head_speed_factor = 41 slot_agent_head_accuracy_factor = 42 slot_agent_head_reload_factor = 43 slot_agent_body_damage_factor = 44 slot_agent_body_speed_factor = 45 slot_agent_body_accuracy_factor = 46 slot_agent_body_reload_factor = 47 slot_agent_foot_damage_factor = 48 slot_agent_foot_speed_factor = 49 slot_agent_foot_accuracy_factor = 50 slot_agent_foot_reload_factor = 51 slot_agent_hand_damage_factor = 52 slot_agent_hand_speed_factor = 53 slot_agent_hand_accuracy_factor = 54 slot_agent_hand_reload_factor = 55 slot_agent_armor_damage_factor = 56 # total agent modifier factors for armor slot_agent_armor_speed_factor = 57 slot_agent_armor_accuracy_factor = 58 slot_agent_armor_reload_factor = 59 slot_agent_weapon_damage_factor = 60 # agent modifier factors for the wielded weapon slot_agent_weapon_speed_factor = 61 slot_agent_weapon_accuracy_factor = 62 slot_agent_weapon_reload_factor = 63 slot_agent_cannot_attack = 64 # marks that any attack should be canceled slot_agent_armor_damage_through = 65 # factor of letting damage received bleed through the armor slot_agent_last_apply_factors_item_id = 66 # last item id that modifier factors were last checked for, to avoid duplicating calculations due to trigger activation quirks ######################################################## ## SCENE PROP SLOTS ############################# ######################################################## slot_scene_prop_item_id = 0 # main associated item id, for stockpiles and similar slot_scene_prop_gold_value = 1 # preset gold value, or cached value of the associated item slot_scene_prop_gold_multiplier = 2 # cached price multiplier of the associated item slot_scene_prop_use_string = 3 # string id displayed when players look at the scene prop slot_scene_prop_troop_id = 4 # for troop training stations slot_scene_prop_full_hit_points = 5 slot_scene_prop_is_mercenary = 6 # 1 = stay associated with the faction that owned the castle at mission start, rather than changing with capture slot_scene_prop_required_horse = 7 # horse item required for attaching to a cart slot_scene_prop_average_craft_skill = 8 slot_scene_prop_is_resource_stockpile = 9 # marks stockpiles for raw resources, which have different sell price calculations slot_scene_prop_linked_scene_prop = 10 # instance ids of linked scene props slot_scene_prop_linked_scene_prop_1 = 10 slot_scene_prop_linked_scene_prop_2 = 11 slot_scene_prop_linked_scene_prop_3 = 12 slot_scene_prop_linked_scene_prop_4 = 13 linked_scene_prop_slot_count = 4 slot_scene_prop_linked_sail = slot_scene_prop_linked_scene_prop_1 slot_scene_prop_linked_sail_off = slot_scene_prop_linked_scene_prop_2 slot_scene_prop_linked_ramp = slot_scene_prop_linked_scene_prop_3 slot_scene_prop_linked_hold = slot_scene_prop_linked_scene_prop_4 slot_scene_prop_linked_platform_1 = slot_scene_prop_linked_scene_prop_1 slot_scene_prop_linked_platform_2 = slot_scene_prop_linked_scene_prop_2 slot_scene_prop_linked_ferry_winch = slot_scene_prop_linked_scene_prop_3 slot_scene_prop_position = 15 # multiple meanings, mostly ships and carts - use with care slot_scene_prop_target_position = 16 # used for ships slot_scene_prop_rotation = 17 # multiple meanings, for ships, carts, and doors - use with care slot_scene_prop_target_rotation = 18 # used for ships slot_scene_prop_max_position = slot_scene_prop_rotation slot_scene_prop_max_distance = slot_scene_prop_target_rotation slot_scene_prop_attached_to_agent = 19 # store agent id attached to slot_scene_prop_controlling_agent = 20 # agent id steering the ship slot_scene_prop_length = 21 # multiple meanings - use with care slot_scene_prop_width = 22 # multiple meanings - use with care slot_scene_prop_height = 23 # multiple meanings - use with care slot_scene_prop_collision_kind = 24 # collision testing scene prop kind for ships; set to -1 for scene props that should never be checked for collision with ships slot_scene_prop_speed_limit = 25 # used for ships slot_scene_prop_no_move_physics = 26 # whether to disable physics when moving, so agents can't ride on the prop slot_scene_prop_capture_faction_id = 27 # faction that has captured this prop individually, rather than the castle it belongs to slot_scene_prop_next_resource_hp = 30 # hit points when the next resource item should be produced slot_scene_prop_state = 31 # constants below starting with scene_prop_state_ slot_scene_prop_state_time = 32 # mission time involved with changing state, if appropriate slot_scene_prop_stock_count = 33 slot_scene_prop_stock_count_update_time = 34 # on clients, time of the last stock count update, to prevent quickly repeated requests slot_scene_prop_unlocked = 35 slot_scene_prop_regrow_script = 36 # script id to call when finished regrowing slot_scene_prop_resource_item_id = 37 slot_scene_prop_prune_time = 38 # mission time when a spawned item scene prop will be pruned slot_scene_prop_resources_default_cost = 39 slot_scene_prop_water = 40 slot_scene_prop_seeds = 41 slot_scene_prop_show_linked_hit_points = 45 scene_prop_state_active = 0 scene_prop_state_destroyed = 1 scene_prop_state_hidden = 2 scene_prop_state_regenerating = 3 slot_scene_prop_inventory_targeted = 196 # instance id of targeted inventory, used with item scene props slot_scene_prop_inventory_unique_id = 197 # unique number identifying spawned item scene props slot_scene_prop_inventory_max_length = 198 # maximum length of items inside the container slot_scene_prop_inventory_count = 199 # number of inventory slots for this container slot_scene_prop_inventory_begin = 200 # item ids in container slot_scene_prop_inventory_item_0 = 290 # item ids in player equipment slot_scene_prop_inventory_ammo_begin = 300 # ammo counts in container slot_scene_prop_inventory_mod_begin = 400 # item changes in container needing presentation updates slot_scene_prop_inventory_mod_item_0 = 490 # item changes in player equipment needing presentation updates slot_scene_prop_inventory_obj_begin = 500 # container slot overlay ids slot_scene_prop_inventory_obj_item_0 = 590 # player equipment overlay ids slot_scene_prop_inventory_mesh_begin = 600 # container item mesh overlay ids slot_scene_prop_inventory_mesh_item_0 = 690 # player equipment item mesh overlay ids slot_scene_prop_inventory_end = slot_scene_prop_inventory_ammo_begin slot_scene_prop_inventory_mod_end = slot_scene_prop_inventory_obj_begin slot_scene_prop_inventory_obj_end = slot_scene_prop_inventory_mesh_begin inventory_count_maximum = slot_scene_prop_inventory_item_0 - slot_scene_prop_inventory_begin corpse_inventory_slots = 5 # coded into the module so values are the same on the server and clients corpse_inventory_max_length = 100 slot_animal_herd_manager_adult_item_id= 100 slot_animal_herd_manager_starving = 101 slot_animal_carcass_meat_count = 100 slot_animal_carcass_hide_count = 101 ######################################################## ## ITEM SLOTS ############################# ######################################################## slot_item_difficulty = 0 slot_item_length = 1 slot_item_class = 2 # listed below, starting with item_class_ slot_item_resource_amount = 3 # resource amount of the item class slot_item_gender = 4 # 0 = male or anyone, 1 = female only slot_item_max_ammo = 5 slot_item_bonus_against_wood = 6 slot_item_couchable = 7 slot_item_has_attack_requirements = 8 slot_item_max_raw_damage = 9 # maximum out of swing and thrust damage item_class_none = 0 item_class_repair = 1 item_class_wood_cutting = 2 item_class_wood = 3 item_class_mining = 4 item_class_iron = 5 item_class_lock_pick = 6 item_class_heraldic = 7 # marks the item to be redrawn when the banner changes item_class_precious = 8 item_class_food = 9 item_class_grain_harvesting = 10 item_class_knife = 11 item_class_cloth = 12 item_class_leather = 13 item_class_herding_calm = 14 item_class_herding_rouse = 15 slot_item_animal_adult_item_id = 20 slot_item_animal_child_item_id = 21 slot_item_animal_grow_time = 22 slot_item_animal_max_in_herd = 23 slot_item_animal_attack_reaction = 24 # listed below, starting with animal_reaction_ slot_item_animal_death_sound = 25 slot_item_animal_meat_count = 26 slot_item_animal_hide_count = 27 slot_item_animal_wildness = 28 # higher values have greater unpredictability when herded or attacked animal_reaction_flee = 0 animal_reaction_charge = 1 ######################################################## ## FACTION SLOTS ############################# ######################################################## slot_faction_banner_mesh = 0 slot_faction_name_is_custom = 1 # 1 if the name has been changed from the default slot_faction_is_active = 2 # 1 if the faction has at least one capture point associated with their castle at mission start slot_faction_lord_player_uid = 3 # player unique id of the faction lord slot_faction_lord_last_seen_time = 4 slot_faction_castle_banner_variant = 5 # work around an unwanted engine optimization: change tableau id used when changing faction banners to force them to update slot_faction_list_button_id = 6 # overlay id in the faction list presentation slot_faction_is_locked = 7 # 1 if an adminstrator locked the faction to prevent lord polls slot_faction_poll_end_time = 20 slot_faction_poll_voter_count = 21 slot_faction_poll_yes_votes = 22 slot_faction_poll_no_votes = 23 slot_faction_poll_type = 24 # listed below, starting with poll_type_ slot_faction_poll_value_1 = 25 slot_faction_poll_value_2 = 26 slot_faction_poll_target_unique_id = 27 # when targeting a player, store their unique id to prevent accidentally harming another player reusing their id after they quit poll_type_change_scene = 0 poll_type_kick_player = 1 poll_type_ban_player = 2 poll_type_faction_lord = 10 poll_cost_change_scene = 1000 poll_cost_kick_player = 500 poll_cost_ban_player = 700 poll_cost_faction_lord = 1000 poll_vote_no = 0 poll_vote_yes = 1 poll_vote_admin_no = 2 poll_vote_admin_yes = 3 poll_vote_abstain = 4 poll_result_no = -1 poll_result_yes = -2 poll_result_admin_no = -3 poll_result_admin_yes = -4 poll_result_existing = -5 poll_result_invalid = -6 poll_result_color = 0xFF0000 slot_faction_relations_begin = 30 faction_cost_change_banner = 500 faction_cost_change_name = 500 faction_cost_kick_player = 500 faction_cost_outlaw_player = 1000 ######################################################## ## SCENE SLOTS ############################# ######################################################## ######################################################## ## TROOP SLOTS ############################# ######################################################## troop_slot_count_per_equipment_type = 5 slot_troop_equipment_one_hand_begin = 0 slot_troop_equipment_two_hand_begin = 1 * troop_slot_count_per_equipment_type slot_troop_equipment_ranged_begin = 2 * troop_slot_count_per_equipment_type slot_troop_equipment_ammo_begin = 3 * troop_slot_count_per_equipment_type slot_troop_equipment_shield_begin = 4 * troop_slot_count_per_equipment_type slot_troop_equipment_head_begin = 5 * troop_slot_count_per_equipment_type slot_troop_equipment_body_begin = 6 * troop_slot_count_per_equipment_type slot_troop_equipment_foot_begin = 7 * troop_slot_count_per_equipment_type slot_troop_equipment_hand_begin = 8 * troop_slot_count_per_equipment_type slot_troop_equipment_horse_begin = 9 * troop_slot_count_per_equipment_type slot_troop_ranking = 50 # used for sorting troop types in the player stats chart slot_troop_spawn_health_percent = 51 # respawn health percentage when dying as this troop slot_player_array_size = 0 slot_player_array_begin = 1 player_array_unique_id = 0 player_array_troop_id = 1 player_array_faction_id = 2 player_array_gold_value = 3 player_array_outlaw_rating = 4 player_array_entry_size = 5 # number of values stored in the disconnected players array max_castle_count = 8 slot_mission_data_castle_owner_faction_begin = 0 # owner factions of all castles slot_mission_data_castle_owner_faction_end = 8 slot_mission_data_castle_is_active_begin = 10 # flags of which castles are active, with at least 1 capture point slot_mission_data_castle_is_active_end = 18 slot_mission_data_castle_name_string_begin = 20 # string ids for castle names slot_mission_data_castle_name_string_end = 28 slot_mission_data_castle_money_chest_begin = 30 # instance ids of the main money chest linked to each castle slot_mission_data_castle_money_chest_end = 38 slot_mission_data_castle_allows_training_begin = 40 # flags of which active castles have at least one linked training station slot_mission_data_castle_allows_training_end = 48 slot_mission_data_faction_to_change_name_of = 100 # store the faction id for the next faction name change message slot_last_chat_message_event_type = 0 # for the last chat message sent: network event number, combined with a type from the list below starting with chat_event_type_ slot_last_chat_message_not_recieved = 1 # mark that the server has not notified of receiving the last chat message chat_event_type_local = 0 # for each chat type, holding shift while pressing enter will add 1 to the type chat_event_type_local_shout = 1 chat_event_type_set_faction_name = 2 chat_event_type_faction = 4 chat_event_type_faction_announce = 5 chat_event_type_admin = 6 chat_event_type_admin_announce = 7 slot_chat_overlay_local_color = 0 slot_chat_overlay_faction_color = 1 slot_ship_array_count = 0 # count of ship instance ids in the scene slot_ship_array_begin = 1 # array of ship instance ids slot_ship_array_collision_props_count = 100 # stored instance ids of scene props near water level, for checking collision with ships slot_ship_array_collision_props_begin = 101 slot_array_count = 0 slot_array_begin = 1 ######################################################## ## TEAM SLOTS ############################# ######################################################## ######################################################## spawn_invulnerable_time = 10 # time agents are invlunerable after freshly spawning loop_player_check_outlaw_interval = 60 loop_agent_check_interval = 2 loop_horse_check_interval = 30 loop_health_check_interval = 29 stock_count_check_interval = 5 # don't request stock count updates of the scene prop aimed at more often than this repeat_action_min_interval = 5 # prevent players from repeating certain potentially expensive actions more often than this carcass_search_min_interval = 5 # only search for a different animal carcass to process after this interval from the last poll_time_duration = 60 name_server_kick_delay_interval = 5 # delay before kicking from the server to allow the rejection message to be received def sq(distance): return distance * distance / 100 # get_sq_distance_between_positions always uses fixed point multiplier 100 max_distance_to_play_sound = 10000 max_distance_to_see_labels = 1500 max_distance_horse_rider = 5000 max_distance_local_chat = 3000 max_distance_local_chat_shout = 5000 ambient_distance_local_chat = 1000 ambient_distance_local_chat_shout = 2000 max_distance_local_animation = 2500 z_position_to_hide_object = -4999 # lower values might cause the position to "wrap around" up into the sky z_position_water_level = -30 # approximate visible water level based on tests max_distance_to_use = 300 max_distance_to_loot = 100 max_distance_admin_cart = 2000 # allow admins in their armor to attach carts from greater distances max_distance_to_catch_fish = 2000 fish_school_max_move_distance = 500 fish_school_min_move_distance = 200 fish_school_minimum_depth = 200 # minimum water depth that a fish school will move into fish_spawn_time = 300 # time before pruning fish items spawned max_distance_to_include_in_herd = 5000 # when searching for a herd for an animal castle_tax_gold_percentage = 20 # percentage of item price subtracted for selling price and added to the linked castle chest when bought castle_training_gold_percentage = 50 # percentage of training cost added to the linked castle chest craft_price_gold_reward_percentage = 20 # percentage of item price given to the crafter proportional to difference from target stock count craft_skill_gold_reward_multiplier = 300 # multiplier of crafting skill required given to the crafter proportional to difference from target stock count base_export_percentage = 100 # default percentage of item price for export stations reduction_factor_base = 90 armor_damage_reduction_factor = 10 head_armor_speed_reduction_factor = 10 head_armor_accuracy_reduction_factor = 50 head_armor_reload_reduction_factor = 20 body_armor_speed_reduction_factor = 20 body_armor_accuracy_reduction_factor = 30 body_armor_reload_reduction_factor = 10 foot_armor_speed_reduction_factor = 30 foot_armor_accuracy_reduction_factor = 5 foot_armor_reload_reduction_factor = 5 hand_armor_speed_reduction_factor = 5 hand_armor_accuracy_reduction_factor = 30 hand_armor_reload_reduction_factor = 10 melee_damage_reduction_factor = 25 melee_speed_reduction_factor = 5 crossbow_damage_reduction_factor = 15 crossbow_speed_reduction_factor = 5 crossbow_accuracy_reduction_factor = 30 crossbow_reload_reduction_factor = 30 bow_thrown_damage_reduction_factor = 30 bow_thrown_speed_reduction_factor = 5 bow_thrown_accuracy_reduction_factor = 20 melee_max_level_difference = 3 # max strength difference to be able to swing a melee weapon crossbow_max_level_difference = 4 # max strength difference to be able to shoot a crossbow bow_ranged_max_level_difference = 3 # max power draw or power throw difference to be able to shoot a bow or throw a weapon winch_type_drawbridge = 0 winch_type_portcullis = 1 winch_type_platform = 2 winch_type_sliding_door = 3 repairable_hit = 0 repairable_destroyed = 1 repairable_hit_destroyed = 2 repairable_repairing = 3 repairable_resource_required = 4 repairable_repaired = 5 ship_station_not_on_ship = 0 ship_station_none = 1 ship_station_mast = 2 ship_station_rudder = 3 ship_forwards_maximum = 9 # maximum forwards speed - also limited by ship type and agent skill ship_rotation_maximum = 5 # maximum turning speed ship_forwards_multiplier = 100 ship_rotation_multiplier = 3 player_list_item_height = 20 escape_menu_item_height = 35 admin_panel_item_height = 40 action_menu_item_height = 23 faction_menu_item_height = 120 animation_menu_item_height = 32 chat_overlay_item_height = 17 chat_overlay_ring_buffer_begin = "trp_chat_overlay_ring_buffer_0" chat_overlay_ring_buffer_end = "trp_chat_overlay_ring_buffer_end" chat_overlay_ring_buffer_size = 11 local_chat_color = 0xFFFFDD8A local_chat_shout_color = 0xFFFF8C27 local_animation_color = 0xFFFFBBAA admin_chat_color = 0xFFFF00FF invalid_faction_color = 0xFF888888 outlaw_rating_for_kill = 2 outlaw_rating_for_team_kill = 5 outlaw_rating_for_lord_outlawed = 4 outlaw_rating_outlawed = 15 # outlaw players when they get this rating outlaw_rating_maximum = 30 # don't add increase the rating more than this change_faction_type_respawn = 0 # changing faction when training change_faction_type_no_respawn = 1 # changing faction by clicking the use control, to the same troop type or one that allows it change_faction_type_outlawed = 2 # being forced to change when outlawed, without respawning capture_point_type_primary = 0 # after the required secondary points are captured, take over the castle capture_point_type_secondary_all = 1 # require taking all secondary capture points of this type capture_point_type_secondary_one = 2 # require taking at least one secondary capture point of this type redraw_all_banners = 0 # at mission start on the server redraw_castle_banners = 1 # when a castle is captured redraw_faction_banners = 2 # when a faction lord changes their banner redraw_client_banner_positions = 3 # at mission start on a client, to work around engine quirks with spawned items redraw_single_capture_point_banner = 4 # when a secondary point is captured inventory_slots_per_row = 6 inventory_slot_spacing = 100 inventory_mesh_offset = 50 inventory_container_x_offset = 190 inventory_container_y_offset = 175 scene_prop_hit_points_bar_scale_x = 6230 scene_prop_hit_points_bar_scale_y = 15000 select_agent_max_x = 300 select_agent_max_y = 200 presentation_max_x = 1000 # at fixed point multiplier 1000 presentation_max_y = 750 # at fixed point multiplier 1000 animation_menu_end_offset = 11 max_scene_prop_instance_id = 10000 # when trying to loop over all props in a scene, stop at this limit max_food_amount = 100 max_hit_points_percent = 200 all_items_begin = "itm_tattered_headcloth" all_items_end = "itm_all_items_end" wielded_items_begin = "itm_club" wielded_items_end = "itm_all_items_end" scripted_items_begin = "itm_surgeon_scalpel" # items outside this range are not checked from the ti_on_agent_hit trigger scripted_items_end = "itm_money_bag" herd_animal_items_begin = "itm_deer" # item range used for herd animal spawners herd_animal_items_end = "itm_stick" playable_troops_begin = "trp_peasant" # troops outside this range are treated as storage objects unusable by players playable_troops_end = "trp_playable_troops_end" factions_begin = "fac_commoners" castle_factions_begin = "fac_1" factions_end = "fac_factions_end" castle_names_begin = "str_castle_name_0" castle_names_end = "str_castle_names_end" scenes_begin = "scn_scene_1" scenes_end = "scn_scenes_end" scene_names_begin = "str_scene_name_1" # this range of strings must correspond to the available scene slots scene_names_end = "str_scene_names_end" game_type_mission_templates_begin = "mt_conquest" game_type_mission_templates_end = "mt_edit_scene" game_type_names_begin = "str_game_type_1" game_type_names_end = "str_game_types_end" game_type_info_strings_begin = "str_game_type_1_info" banner_meshes_begin = "mesh_banner_a01" banner_meshes_end = "mesh_banners_default_a" banner_items_begin = "itm_pw_banner_pole_a01" # range of items associated with banner mesh ids banner_items_end = "itm_admin_horse" commands_module_system_names_begin = "str_bot_count" # range of strings associated with hard coded server commands commands_napoleonic_wars_names_begin = "str_use_class_limits" admin_action_log_strings_begin = "str_log_admin_kick" # range of strings associated with admin actions, for the server log ambient_sounds_begin = "snd_fire_loop" # for ambient sound emitter scene props ambient_sounds_end = "snd_sounds_end" action_menu_strings_begin = "str_toggle_name_labels" # range of strings associated with the action menu action_menu_strings_end = "str_action_menu_end" animation_strings_begin = "str_anim_cheer" # range of strings associated with the animation menu animation_strings_end = "str_log_animation" profile_option_strings_begin = "str_display_name_labels" # range of strings for options stored in a player profile from header_common import * profile_options = [ # global flag variables for options stored in a player profile "$g_display_agent_labels", "$g_hide_faction_in_name_labels", "$g_display_chat_overlay", "$g_chat_overlay_type_selected", "$g_disable_automatic_shadow_recalculation", "$g_animation_menu_no_mouse_grab", "$g_mute_global_chat", ] if len(profile_options) >= profile_banner_id_option_bits_end - profile_banner_id_option_bits_begin: raise Exception("Too many profile options: %d, maximum %d" % (len(profile_options), profile_banner_id_option_bits_end - profile_banner_id_option_bits_begin))
#!/usr/bin/env python import sys sys.dont_write_bytecode = True import glob import yaml import json import os import sys import time import logging from argparse import ArgumentParser from slackclient import SlackClient def dbg(debug_string): if debug: logging.info(debug_string) USER_DICT = {} class RtmBot(object): def __init__(self, token): self.last_ping = 0 self.token = token self.bot_plugins = [] self.slack_client = None self.channel = None # only want bot in one channel def connect(self): """Convenience method that creates Server instance""" self.slack_client = SlackClient(self.token) self.slack_client.rtm_connect() def start(self): self.connect() self.load_plugins() while True: for reply in self.slack_client.rtm_read(): self.input(reply) self.crons() self.output() self.autoping() time.sleep(.1) def get_users_in_channel(self): print(self.channel) channel_info = self.slack_client.api_call("channels.info", channel=self.channel) info = json.loads(channel_info) members = info['channel']['members'] print(members) self.create_user_dict(members) def autoping(self): #hardcode the interval to 3 seconds now = int(time.time()) if now > self.last_ping + 3: self.slack_client.server.ping() self.last_ping = now def input(self, data): if "type" in data: function_name = "process_" + data["type"] dbg("got {}".format(function_name)) for plugin in self.bot_plugins: plugin.register_jobs() plugin.do(function_name, data) def output(self): for plugin in self.bot_plugins: limiter = False for output in plugin.do_output(): channel = self.slack_client.server.channels.find(output[0]) if channel != None and output[1] != None: if limiter == True: time.sleep(.1) limiter = False message = output[1].encode('ascii','ignore') channel.send_message("{}".format(message)) limiter = True def crons(self): for plugin in self.bot_plugins: plugin.do_jobs() def load_plugins(self): for plugin in glob.glob(directory+'/plugins/*'): sys.path.insert(0, plugin) sys.path.insert(0, directory+'/plugins/') for plugin in glob.glob(directory+'/plugins/*.py') + glob.glob(directory+'/plugins/*/*.py'): logging.info(plugin) name = plugin.split('/')[-1][:-3] # try: self.bot_plugins.append(Plugin(name)) # except: # print "error loading plugin %s" % name class Plugin(object): def __init__(self, name, plugin_config={}): self.name = name self.jobs = [] self.module = __import__(name) self.register_jobs() self.outputs = [] if name in config: logging.info("config found for: " + name) self.module.config = config[name] if 'setup' in dir(self.module): self.module.setup() def register_jobs(self): if 'crontable' in dir(self.module): for interval, function in self.module.crontable: self.jobs.append(Job(interval, eval("self.module."+function))) logging.info(self.module.crontable) self.module.crontable = [] else: self.module.crontable = [] def do(self, function_name, data): if function_name in dir(self.module): #this makes the plugin fail with stack trace in debug mode if not debug: try: eval("self.module."+function_name)(data) except: dbg("problem in module {} {}".format(function_name, data)) else: eval("self.module."+function_name)(data) if "catch_all" in dir(self.module): try: self.module.catch_all(data) except: dbg("problem in catch all") def do_jobs(self): for job in self.jobs: job.check() def do_output(self): output = [] while True: if 'outputs' in dir(self.module): if len(self.module.outputs) > 0: logging.info("output from {}".format(self.module)) output.append(self.module.outputs.pop(0)) else: break else: self.module.outputs = [] return output class Job(object): def __init__(self, interval, function): self.function = function self.interval = interval self.lastrun = 0 def __str__(self): return "{} {} {}".format(self.function, self.interval, self.lastrun) def __repr__(self): return self.__str__() def check(self): if self.lastrun + self.interval < time.time(): if not debug: try: self.function() except: dbg("problem") else: self.function() self.lastrun = time.time() pass class UnknownChannel(Exception): pass def main_loop(): if "LOGFILE" in config: logging.basicConfig(filename=config["LOGFILE"], level=logging.INFO, format='%(asctime)s %(message)s') logging.info(directory) try: bot.start() except KeyboardInterrupt: sys.exit(0) except: logging.exception('OOPS') def parse_args(): parser = ArgumentParser() parser.add_argument( '-c', '--config', help='Full path to config file.', metavar='path' ) return parser.parse_args() if __name__ == "__main__": args = parse_args() directory = os.path.dirname(sys.argv[0]) if not directory.startswith('/'): directory = os.path.abspath("{}/{}".format(os.getcwd(), directory )) config = yaml.load(file(args.config or 'rtmbot.conf', 'r')) debug = config["DEBUG"] bot = RtmBot(config["SLACK_TOKEN"]) bot.channel = config["CHANNEL"] site_plugins = [] files_currently_downloading = [] job_hash = {} if config.has_key("DAEMON"): if config["DAEMON"]: import daemon with daemon.DaemonContext(): main_loop() main_loop()
import json import logging import re import urllib.parse from urllib.error import HTTPError, URLError from urllib.request import Request, urlopen from django.conf import settings DOMAIN = settings.MATRIX_DOMAIN URL = settings.MATRIX_URL class NoSuchUser(Exception): pass def _auth_header(): return {'Authorization': f'Bearer {settings.MATRIX_ADMIN_TOKEN}'} def _matrix_request(url, *args, **kargs): logger = logging.getLogger('matrix') method = kargs.get('method', 'GET') logger.debug('%s %s', method, url) # convert data from dict to json if len(args) > 0: data = args[0] data = json.dumps(data).encode('utf-8') args[0] = data if 'data' in kargs: data = kargs['data'] data = json.dumps(data).encode('utf-8') kargs['data'] = data req = Request(url, *args, **kargs) try: response = urlopen(req) except HTTPError as e: logger.error( 'The server couldn\'t fulfill the request. Error code: %s', e.code) raise e except URLError as e: logger.error( 'We failed to reach a server. Reason: %s', e.reason) raise e result_bytes = response.read() result_str = str(result_bytes, encoding='utf-8') result_json = json.loads(result_str) logger.debug(json.dumps(result_json, indent=4)) return result_json # ########## # Non-Admin commands # ########## def generate_eventid(): import random letters = '_0123456789ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz' eventid = '$' for _ in range(42): eventid += letters[random.randint(0, len(letters)-1)] return eventid def get_event(eventid): ''' Warning: you need to be in the room, or 403 ''' eventid = urllib.parse.quote(eventid) return _matrix_request( f'{URL}_matrix/client/r0/events/{eventid}', headers=_auth_header(), ) def get_room_event(roomid, eventid): roomid = urllib.parse.quote(roomid) eventid = urllib.parse.quote(eventid) return _matrix_request( f'{URL}_matrix/client/r0/rooms/{roomid}/event/{eventid}', headers=_auth_header(), ) def redact_event(roomid, eventid, txnid=None): if txnid is None: txnid = generate_eventid() roomid = urllib.parse.quote(roomid) eventid = urllib.parse.quote(eventid) txnid = urllib.parse.quote(txnid) data = {'reason': 'test'} return _matrix_request( f'{URL}_matrix/client/r0/rooms/{roomid}/redact/{eventid}/{txnid}', method='PUT', headers=_auth_header(), data=data, ) # ########## # Admin commands # ########## def get_version(): return _matrix_request( f'{URL}_synapse/admin/v1/server_version' ) def get_users_quick(): ''' Yields all users ''' next_token = '0' limit = '10' while next_token: result = _matrix_request( f'{URL}_synapse/admin/v2/users' f'?deactivated=true&limit={limit}&from={next_token}', headers=_auth_header(), ) for user in result['users']: yield user next_token = result.get('next_token', None) def localpart(user_id): re_search = re.compile(f'@(.*):{DOMAIN}') login = re_search.search(user_id).groups()[0] return login def get_users(include_deleted=False): ''' Yields all users, detailed version ''' next_token = '0' limit = '10' while next_token: result = _matrix_request( f'{URL}_synapse/admin/v2/users' f'?deactivated=true&limit={limit}&from={next_token}', headers=_auth_header(), ) for user in result['users']: user_id = user['name'] user = get_user_info(user_id) if not include_deleted: if (( not 'password_hash' in user or not user['password_hash'] ) and not user['threepids']): # logger.debug(f'{login} is disabled') continue yield user next_token = result.get('next_token', None) def get_user_info(user_id): assert user_id.endswith(f':{DOMAIN}') try: return _matrix_request( f'{URL}_synapse/admin/v2/users/{user_id}', headers=_auth_header(), ) except HTTPError as e: if e.code == 404: raise NoSuchUser else: raise e def get_user_rooms(user_id): ''' List the rooms that user is in ''' assert user_id.endswith(f':{DOMAIN}') try: return _matrix_request( f'{URL}_synapse/admin/v1/users/{user_id}/joined_rooms', headers=_auth_header(), ) except HTTPError as e: if e.code == 404: raise NoSuchUser else: raise e def put_user(user_id, data): ''' Low level interface to /_synapse/admin/v2/users/<USER>. ''' assert user_id.endswith(f':{DOMAIN}') return _matrix_request( f'{URL}_synapse/admin/v2/users/{user_id}', headers=_auth_header(), data=data, method='PUT', ) def set_user_info(user_id, name=None, emails=None, admin=None, create=False): ''' High level interface to create/modify account. @returns server new information if changed, None otherwise ''' logger = logging.getLogger('matrix') assert user_id.endswith(f':{DOMAIN}') try: olddata = get_user_info(user_id) except NoSuchUser as e: if not create: logger.error(f"User {user_id} doesn't exists and create=False") raise e olddata = {} data = {} if name is not None: if name != olddata.get('displayname', None): data['displayname'] = name if emails is not None: old_emails = [ threepid['address'] for threepid in olddata.get('threepids', []) if threepid['medium'] == 'email' ] old_emails = set(old_emails) emails = set(emails) # preserve the emails added by the user: emails = old_emails | emails if old_emails != emails: data['threepids'] = [ {'medium': 'email', 'address': email} for email in emails ] if admin is not None: data['admin'] = admin if data: return put_user(user_id, data) else: logger.debug(f'{user_id}: No change.') return None def deactivate_account(user_id, erase=True): assert user_id.endswith(f':{DOMAIN}') try: data = {'erase': erase} return _matrix_request( url=f'{URL}_synapse/admin/v1/deactivate/{user_id}', headers=_auth_header(), data=data, ) except HTTPError as e: if e.code == 404: raise NoSuchUser else: raise e def reset_password(user_id, password): assert user_id.endswith(f':{DOMAIN}') data = { 'new_password': password, 'logout_devices': True, } return _matrix_request( f'{URL}_synapse/admin/v1/reset_password/{user_id}', headers=_auth_header(), data=data, ) def room_join(user_id, room): ''' room is either a id (starting with '!') or an alias (starting with '#') admin must be in the room... ''' assert user_id.endswith(f':{DOMAIN}') data = { 'user_id': user_id, } room = urllib.parse.quote(room) return _matrix_request( f'{URL}_synapse/admin/v1/join/{room}', # Example: !636q39766251:server.com, #niceroom:server.com headers=_auth_header(), data=data, ) def get_rooms_quick(): ''' Yields all rooms ''' next_batch = '0' limit = '10' while next_batch: result = _matrix_request( f'{URL}_synapse/admin/v1/rooms' f'?limit={limit}&from={next_batch}', headers=_auth_header(), ) for room in result['rooms']: yield room next_batch = result.get('next_batch', None) def get_rooms(show_empty=False, show_private=False): ''' Yields all rooms ''' next_batch = '0' limit = '10' while next_batch: result = _matrix_request( f'{URL}_synapse/admin/v1/rooms' f'?limit={limit}&from={next_batch}', headers=_auth_header(), ) for room in result['rooms']: nb_members = room.get('joined_members', 0) if nb_members == 0: if not show_empty: continue elif nb_members <= 2: if not show_private: continue room_id = room['room_id'] room = get_room_info(room_id) state = get_room_state(room_id)['state'] room['state'] = _room_state_clean(state) yield room next_batch = result.get('next_batch', None) def get_room_info(roomid): return _matrix_request( f'{URL}_synapse/admin/v1/rooms/{roomid}', headers=_auth_header(), ) def get_room_state(roomid): ''' consider using _room_state_clean on the return value ''' return _matrix_request( f'{URL}_synapse/admin/v1/rooms/{roomid}/state', headers=_auth_header(), ) def _room_state_clean(states): result = {} for state in states: statetype = state['type'] content = state['content'] content_length = len(content) if content_length == 0: # occurs for redacted events and # some im.vector.modular.widgets events continue if statetype == 'm.room.create': for key in content: assert key in ('room_version', 'creator', 'm.federate', 'type'), ( f'Unsupported key {key} in "m.room.create" event state:' f' {content}') result.update(content) elif statetype == 'm.room.member': if 'members' not in result: result['members'] = [] member = { 'user_id': state['state_key'] } member.update(content) result['members'].append(member) else: result[statetype] = content # elif statetype == 'm.room.power_levels': # result['m.room.power_levels'] = content # elif statetype in ('m.room.topic', 'm.room.name', # 'm.room.history_visibility', # 'm.room.guest_access'): # assert content_length == 1, \ # f"Unexpected keys {content.keys()} in content" # f" for event type {statetype}" # key = statetype.split('.')[-1] # result[statetype] = content[key] # elif statetype == 'm.room.join_rules': # content_length = len(content) # assert content_length == 1, f"Unexpected keys {content.keys()} # in content for event type {statetype}" # result[statetype] = content['join_rule'] # not join_rules # elif statetype == 'm.room.canonical_alias': # for key in content.keys(): # if key not in ('alias', 'alt_aliases'): # logger.warning( # f"Unexpected keys {content.keys()} in content" # f"for event type {statetype}") # result.update(content) # elif statetype == 'm.room.encryption': # assert content_length == 1, f"Unexpected keys # {content.keys()} in content for event type {statetype}" # result[statetype] = content['algorithm'] # not encryption # elif statetype == 'im.vector.modular.widgets': # logger.warning(f'event type {statetype}: {content}') # else: # logger.warning( # f'Unsupported state type {statetype} in room states.') return result def room_get_members(roomid): ''' Return members (invited are NOT included) ''' return _matrix_request( f'{URL}_synapse/admin/v1/rooms/{roomid}/members', headers=_auth_header(), ) def room_delete(room): ''' room is either a id (starting with '!') or an alias (starting with '#') ''' data = { } room = urllib.parse.quote(room) return _matrix_request( f'{URL}_synapse/admin/v1/rooms/{room}', # Example: !636q39766251:server.com, #niceroom:server.com method='DELETE', headers=_auth_header(), data=data, ) def room_makeadmin(room, user_id=None): ''' room is either a id (starting with '!') or an alias (starting with '#') ''' data = {} if user_id: assert user_id.endswith(f':{DOMAIN}') data['user_id'] = user_id room = urllib.parse.quote(room) return _matrix_request( f'{URL}_synapse/admin/v1/rooms/{room}/make_room_admin', # Example: !636q39766251:server.com, #niceroom:server.com method='POST', headers=_auth_header(), data=data, ) # ##################### # Regular user commands # ##################### def room_invite(room, user_id): room = urllib.parse.quote(room) return _matrix_request( f'{URL}_matrix/client/r0/rooms/{room}/invite', method='POST', headers=_auth_header(), data={"user_id": user_id}, ) def room_kick(room, user_id): room = urllib.parse.quote(room) return _matrix_request( f'{URL}_matrix/client/r0/rooms/{room}/kick', method='POST', headers=_auth_header(), data={"user_id": user_id}, )
""" Objective-C runtime wrapper for use by LLDB Python formatters Part of the LLVM Project, under the Apache License v2.0 with LLVM Exceptions. See https://llvm.org/LICENSE.txt for license information. SPDX-License-Identifier: Apache-2.0 WITH LLVM-exception """ import lldb import lldb.formatters.cache import lldb.formatters.attrib_fromdict import functools import lldb.formatters.Logger class Utilities: @staticmethod def read_ascii(process, pointer, max_len=128): logger = lldb.formatters.Logger.Logger() error = lldb.SBError() content = None try: content = process.ReadCStringFromMemory(pointer, max_len, error) except: pass if content is None or len(content) == 0 or error.fail: return None return content @staticmethod def is_valid_pointer(pointer, pointer_size, allow_tagged=0, allow_NULL=0): logger = lldb.formatters.Logger.Logger() if pointer is None: return 0 if pointer == 0: return allow_NULL if allow_tagged and (pointer % 2) == 1: return 1 return ((pointer % pointer_size) == 0) # Objective-C runtime has a rule that pointers in a class_t will only have bits 0 thru 46 set # so if any pointer has bits 47 thru 63 high we know that this is not a # valid isa @staticmethod def is_allowed_pointer(pointer): logger = lldb.formatters.Logger.Logger() if pointer is None: return 0 return ((pointer & 0xFFFF800000000000) == 0) @staticmethod def read_child_of(valobj, offset, type): logger = lldb.formatters.Logger.Logger() if offset == 0 and type.GetByteSize() == valobj.GetByteSize(): return valobj.GetValueAsUnsigned() child = valobj.CreateChildAtOffset("childUNK", offset, type) if child is None or child.IsValid() == 0: return None return child.GetValueAsUnsigned() @staticmethod def is_valid_identifier(name): logger = lldb.formatters.Logger.Logger() if name is None: return None if len(name) == 0: return None # technically, the ObjC runtime does not enforce any rules about what name a class can have # in practice, the commonly used byte values for a class name are the letters, digits and some # symbols: $, %, -, _, . # WARNING: this means that you cannot use this runtime implementation if you need to deal # with class names that use anything but what is allowed here ok_values = dict.fromkeys( "$%_.-ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz1234567890") return all(c in ok_values for c in name) @staticmethod def check_is_osx_lion(target): logger = lldb.formatters.Logger.Logger() # assume the only thing that has a Foundation.framework is a Mac # assume anything < Lion does not even exist try: mod = target.module['Foundation'] except: mod = None if mod is None or mod.IsValid() == 0: return None ver = mod.GetVersion() if ver is None or ver == []: return None return (ver[0] < 900) # a utility method that factors out code common to almost all the formatters # takes in an SBValue and a metrics object # returns a class_data and a wrapper (or None, if the runtime alone can't # decide on a wrapper) @staticmethod def prepare_class_detection(valobj, statistics): logger = lldb.formatters.Logger.Logger() class_data = ObjCRuntime(valobj) if class_data.is_valid() == 0: statistics.metric_hit('invalid_pointer', valobj) wrapper = InvalidPointer_Description( valobj.GetValueAsUnsigned(0) == 0) return class_data, wrapper class_data = class_data.read_class_data() if class_data.is_valid() == 0: statistics.metric_hit('invalid_isa', valobj) wrapper = InvalidISA_Description() return class_data, wrapper if class_data.is_kvo(): class_data = class_data.get_superclass() if class_data.class_name() == '_NSZombie_OriginalClass': wrapper = ThisIsZombie_Description() return class_data, wrapper return class_data, None class RoT_Data: def __init__(self, rot_pointer, params): logger = lldb.formatters.Logger.Logger() if (Utilities.is_valid_pointer(rot_pointer.GetValueAsUnsigned(), params.pointer_size, allow_tagged=0)): self.sys_params = params self.valobj = rot_pointer #self.flags = Utilities.read_child_of(self.valobj,0,self.sys_params.uint32_t) #self.instanceStart = Utilities.read_child_of(self.valobj,4,self.sys_params.uint32_t) self.instanceSize = None # lazy fetching offset = 24 if self.sys_params.is_64_bit else 16 #self.ivarLayoutPtr = Utilities.read_child_of(self.valobj,offset,self.sys_params.addr_ptr_type) self.namePointer = Utilities.read_child_of( self.valobj, offset, self.sys_params.types_cache.addr_ptr_type) self.valid = 1 # self.check_valid() else: logger >> "Marking as invalid - rot is invalid" self.valid = 0 if self.valid: self.name = Utilities.read_ascii( self.valobj.GetTarget().GetProcess(), self.namePointer) if not(Utilities.is_valid_identifier(self.name)): logger >> "Marking as invalid - name is invalid" self.valid = 0 # perform sanity checks on the contents of this class_ro_t def check_valid(self): self.valid = 1 # misaligned pointers seem to be possible for this field # if not(Utilities.is_valid_pointer(self.namePointer,self.sys_params.pointer_size,allow_tagged=0)): # self.valid = 0 # pass def __str__(self): logger = lldb.formatters.Logger.Logger() return \ "instanceSize = " + hex(self.instance_size()) + "\n" + \ "namePointer = " + hex(self.namePointer) + " --> " + self.name def is_valid(self): return self.valid def instance_size(self, align=0): logger = lldb.formatters.Logger.Logger() if self.is_valid() == 0: return None if self.instanceSize is None: self.instanceSize = Utilities.read_child_of( self.valobj, 8, self.sys_params.types_cache.uint32_t) if align: unalign = self.instance_size(0) if self.sys_params.is_64_bit: return ((unalign + 7) & ~7) % 0x100000000 else: return ((unalign + 3) & ~3) % 0x100000000 else: return self.instanceSize class RwT_Data: def __init__(self, rwt_pointer, params): logger = lldb.formatters.Logger.Logger() if (Utilities.is_valid_pointer(rwt_pointer.GetValueAsUnsigned(), params.pointer_size, allow_tagged=0)): self.sys_params = params self.valobj = rwt_pointer #self.flags = Utilities.read_child_of(self.valobj,0,self.sys_params.uint32_t) #self.version = Utilities.read_child_of(self.valobj,4,self.sys_params.uint32_t) self.roPointer = Utilities.read_child_of( self.valobj, 8, self.sys_params.types_cache.addr_ptr_type) self.check_valid() else: logger >> "Marking as invalid - rwt is invald" self.valid = 0 if self.valid: self.rot = self.valobj.CreateValueFromData( "rot", lldb.SBData.CreateDataFromUInt64Array( self.sys_params.endianness, self.sys_params.pointer_size, [ self.roPointer]), self.sys_params.types_cache.addr_ptr_type) # self.rot = self.valobj.CreateValueFromAddress("rot",self.roPointer,self.sys_params.types_cache.addr_ptr_type).AddressOf() self.data = RoT_Data(self.rot, self.sys_params) # perform sanity checks on the contents of this class_rw_t def check_valid(self): logger = lldb.formatters.Logger.Logger() self.valid = 1 if not( Utilities.is_valid_pointer( self.roPointer, self.sys_params.pointer_size, allow_tagged=0)): logger >> "Marking as invalid - ropointer is invalid" self.valid = 0 def __str__(self): logger = lldb.formatters.Logger.Logger() return \ "roPointer = " + hex(self.roPointer) def is_valid(self): logger = lldb.formatters.Logger.Logger() if self.valid: return self.data.is_valid() return 0 class Class_Data_V2: def __init__(self, isa_pointer, params): logger = lldb.formatters.Logger.Logger() if (isa_pointer is not None) and (Utilities.is_valid_pointer( isa_pointer.GetValueAsUnsigned(), params.pointer_size, allow_tagged=0)): self.sys_params = params self.valobj = isa_pointer self.check_valid() else: logger >> "Marking as invalid - isa is invalid or None" self.valid = 0 if self.valid: self.rwt = self.valobj.CreateValueFromData( "rwt", lldb.SBData.CreateDataFromUInt64Array( self.sys_params.endianness, self.sys_params.pointer_size, [ self.dataPointer]), self.sys_params.types_cache.addr_ptr_type) # self.rwt = self.valobj.CreateValueFromAddress("rwt",self.dataPointer,self.sys_params.types_cache.addr_ptr_type).AddressOf() self.data = RwT_Data(self.rwt, self.sys_params) # perform sanity checks on the contents of this class_t # this call tries to minimize the amount of data fetched- as soon as we have "proven" # that we have an invalid object, we stop reading def check_valid(self): logger = lldb.formatters.Logger.Logger() self.valid = 1 self.isaPointer = Utilities.read_child_of( self.valobj, 0, self.sys_params.types_cache.addr_ptr_type) if not( Utilities.is_valid_pointer( self.isaPointer, self.sys_params.pointer_size, allow_tagged=0)): logger >> "Marking as invalid - isaPointer is invalid" self.valid = 0 return if not(Utilities.is_allowed_pointer(self.isaPointer)): logger >> "Marking as invalid - isaPointer is not allowed" self.valid = 0 return self.cachePointer = Utilities.read_child_of( self.valobj, 2 * self.sys_params.pointer_size, self.sys_params.types_cache.addr_ptr_type) if not( Utilities.is_valid_pointer( self.cachePointer, self.sys_params.pointer_size, allow_tagged=0)): logger >> "Marking as invalid - cachePointer is invalid" self.valid = 0 return if not(Utilities.is_allowed_pointer(self.cachePointer)): logger >> "Marking as invalid - cachePointer is not allowed" self.valid = 0 return self.dataPointer = Utilities.read_child_of( self.valobj, 4 * self.sys_params.pointer_size, self.sys_params.types_cache.addr_ptr_type) if not( Utilities.is_valid_pointer( self.dataPointer, self.sys_params.pointer_size, allow_tagged=0)): logger >> "Marking as invalid - dataPointer is invalid" self.valid = 0 return if not(Utilities.is_allowed_pointer(self.dataPointer)): logger >> "Marking as invalid - dataPointer is not allowed" self.valid = 0 return self.superclassIsaPointer = Utilities.read_child_of( self.valobj, 1 * self.sys_params.pointer_size, self.sys_params.types_cache.addr_ptr_type) if not( Utilities.is_valid_pointer( self.superclassIsaPointer, self.sys_params.pointer_size, allow_tagged=0, allow_NULL=1)): logger >> "Marking as invalid - superclassIsa is invalid" self.valid = 0 return if not(Utilities.is_allowed_pointer(self.superclassIsaPointer)): logger >> "Marking as invalid - superclassIsa is not allowed" self.valid = 0 return # in general, KVO is implemented by transparently subclassing # however, there could be exceptions where a class does something else # internally to implement the feature - this method will have no clue that a class # has been KVO'ed unless the standard implementation technique is used def is_kvo(self): logger = lldb.formatters.Logger.Logger() if self.is_valid(): if self.class_name().startswith("NSKVONotifying_"): return 1 return 0 # some CF classes have a valid ObjC isa in their CFRuntimeBase # but instead of being class-specific this isa points to a match-'em-all class # which is __NSCFType (the versions without __ also exists and we are matching to it # just to be on the safe side) def is_cftype(self): logger = lldb.formatters.Logger.Logger() if self.is_valid(): return self.class_name() == '__NSCFType' or self.class_name() == 'NSCFType' def get_superclass(self): logger = lldb.formatters.Logger.Logger() if self.is_valid(): parent_isa_pointer = self.valobj.CreateChildAtOffset( "parent_isa", self.sys_params.pointer_size, self.sys_params.addr_ptr_type) return Class_Data_V2(parent_isa_pointer, self.sys_params) else: return None def class_name(self): logger = lldb.formatters.Logger.Logger() if self.is_valid(): return self.data.data.name else: return None def is_valid(self): logger = lldb.formatters.Logger.Logger() if self.valid: return self.data.is_valid() return 0 def __str__(self): logger = lldb.formatters.Logger.Logger() return 'isaPointer = ' + hex(self.isaPointer) + "\n" + \ "superclassIsaPointer = " + hex(self.superclassIsaPointer) + "\n" + \ "cachePointer = " + hex(self.cachePointer) + "\n" + \ "data = " + hex(self.dataPointer) def is_tagged(self): return 0 def instance_size(self, align=0): logger = lldb.formatters.Logger.Logger() if self.is_valid() == 0: return None return self.rwt.rot.instance_size(align) # runtime v1 is much less intricate than v2 and stores relevant # information directly in the class_t object class Class_Data_V1: def __init__(self, isa_pointer, params): logger = lldb.formatters.Logger.Logger() if (isa_pointer is not None) and (Utilities.is_valid_pointer( isa_pointer.GetValueAsUnsigned(), params.pointer_size, allow_tagged=0)): self.valid = 1 self.sys_params = params self.valobj = isa_pointer self.check_valid() else: logger >> "Marking as invalid - isaPointer is invalid or None" self.valid = 0 if self.valid: self.name = Utilities.read_ascii( self.valobj.GetTarget().GetProcess(), self.namePointer) if not(Utilities.is_valid_identifier(self.name)): logger >> "Marking as invalid - name is not valid" self.valid = 0 # perform sanity checks on the contents of this class_t def check_valid(self): logger = lldb.formatters.Logger.Logger() self.valid = 1 self.isaPointer = Utilities.read_child_of( self.valobj, 0, self.sys_params.types_cache.addr_ptr_type) if not( Utilities.is_valid_pointer( self.isaPointer, self.sys_params.pointer_size, allow_tagged=0)): logger >> "Marking as invalid - isaPointer is invalid" self.valid = 0 return self.superclassIsaPointer = Utilities.read_child_of( self.valobj, 1 * self.sys_params.pointer_size, self.sys_params.types_cache.addr_ptr_type) if not( Utilities.is_valid_pointer( self.superclassIsaPointer, self.sys_params.pointer_size, allow_tagged=0, allow_NULL=1)): logger >> "Marking as invalid - superclassIsa is invalid" self.valid = 0 return self.namePointer = Utilities.read_child_of( self.valobj, 2 * self.sys_params.pointer_size, self.sys_params.types_cache.addr_ptr_type) # if not(Utilities.is_valid_pointer(self.namePointer,self.sys_params.pointer_size,allow_tagged=0,allow_NULL=0)): # self.valid = 0 # return # in general, KVO is implemented by transparently subclassing # however, there could be exceptions where a class does something else # internally to implement the feature - this method will have no clue that a class # has been KVO'ed unless the standard implementation technique is used def is_kvo(self): logger = lldb.formatters.Logger.Logger() if self.is_valid(): if self.class_name().startswith("NSKVONotifying_"): return 1 return 0 # some CF classes have a valid ObjC isa in their CFRuntimeBase # but instead of being class-specific this isa points to a match-'em-all class # which is __NSCFType (the versions without __ also exists and we are matching to it # just to be on the safe side) def is_cftype(self): logger = lldb.formatters.Logger.Logger() if self.is_valid(): return self.class_name() == '__NSCFType' or self.class_name() == 'NSCFType' def get_superclass(self): logger = lldb.formatters.Logger.Logger() if self.is_valid(): parent_isa_pointer = self.valobj.CreateChildAtOffset( "parent_isa", self.sys_params.pointer_size, self.sys_params.addr_ptr_type) return Class_Data_V1(parent_isa_pointer, self.sys_params) else: return None def class_name(self): logger = lldb.formatters.Logger.Logger() if self.is_valid(): return self.name else: return None def is_valid(self): return self.valid def __str__(self): logger = lldb.formatters.Logger.Logger() return 'isaPointer = ' + hex(self.isaPointer) + "\n" + \ "superclassIsaPointer = " + hex(self.superclassIsaPointer) + "\n" + \ "namePointer = " + hex(self.namePointer) + " --> " + self.name + \ "instanceSize = " + hex(self.instanceSize()) + "\n" def is_tagged(self): return 0 def instance_size(self, align=0): logger = lldb.formatters.Logger.Logger() if self.is_valid() == 0: return None if self.instanceSize is None: self.instanceSize = Utilities.read_child_of( self.valobj, 5 * self.sys_params.pointer_size, self.sys_params.types_cache.addr_ptr_type) if align: unalign = self.instance_size(0) if self.sys_params.is_64_bit: return ((unalign + 7) & ~7) % 0x100000000 else: return ((unalign + 3) & ~3) % 0x100000000 else: return self.instanceSize # these are the only tagged pointers values for current versions # of OSX - they might change in future OS releases, and no-one is # advised to rely on these values, or any of the bitmasking formulas # in TaggedClass_Data. doing otherwise is at your own risk TaggedClass_Values_Lion = {1: 'NSNumber', 5: 'NSManagedObject', 6: 'NSDate', 7: 'NSDateTS'} TaggedClass_Values_NMOS = {0: 'NSAtom', 3: 'NSNumber', 4: 'NSDateTS', 5: 'NSManagedObject', 6: 'NSDate'} class TaggedClass_Data: def __init__(self, pointer, params): logger = lldb.formatters.Logger.Logger() global TaggedClass_Values_Lion, TaggedClass_Values_NMOS self.valid = 1 self.name = None self.sys_params = params self.valobj = pointer self.val = (pointer & ~0x0000000000000000FF) >> 8 self.class_bits = (pointer & 0xE) >> 1 self.i_bits = (pointer & 0xF0) >> 4 if self.sys_params.is_lion: if self.class_bits in TaggedClass_Values_Lion: self.name = TaggedClass_Values_Lion[self.class_bits] else: logger >> "Marking as invalid - not a good tagged pointer for Lion" self.valid = 0 else: if self.class_bits in TaggedClass_Values_NMOS: self.name = TaggedClass_Values_NMOS[self.class_bits] else: logger >> "Marking as invalid - not a good tagged pointer for NMOS" self.valid = 0 def is_valid(self): return self.valid def class_name(self): logger = lldb.formatters.Logger.Logger() if self.is_valid(): return self.name else: return 0 def value(self): return self.val if self.is_valid() else None def info_bits(self): return self.i_bits if self.is_valid() else None def is_kvo(self): return 0 def is_cftype(self): return 0 # we would need to go around looking for the superclass or ask the runtime # for now, we seem not to require support for this operation so we will merrily # pretend to be at a root point in the hierarchy def get_superclass(self): return None # anything that is handled here is tagged def is_tagged(self): return 1 # it seems reasonable to say that a tagged pointer is the size of a pointer def instance_size(self, align=0): logger = lldb.formatters.Logger.Logger() if self.is_valid() == 0: return None return self.sys_params.pointer_size class InvalidClass_Data: def __init__(self): pass def is_valid(self): return 0 class Version: def __init__(self, major, minor, release, build_string): self._major = major self._minor = minor self._release = release self._build_string = build_string def get_major(self): return self._major def get_minor(self): return self._minor def get_release(self): return self._release def get_build_string(self): return self._build_string major = property(get_major, None) minor = property(get_minor, None) release = property(get_release, None) build_string = property(get_build_string, None) def __lt__(self, other): if (self.major < other.major): return 1 if (self.minor < other.minor): return 1 if (self.release < other.release): return 1 # build strings are not compared since they are heavily platform-dependent and might not always # be available return 0 def __eq__(self, other): return (self.major == other.major) and \ (self.minor == other.minor) and \ (self.release == other.release) and \ (self.build_string == other.build_string) # Python 2.6 doesn't have functools.total_ordering, so we have to implement # other comparators def __gt__(self, other): return other < self def __le__(self, other): return not other < self def __ge__(self, other): return not self < other runtime_version = lldb.formatters.cache.Cache() os_version = lldb.formatters.cache.Cache() types_caches = lldb.formatters.cache.Cache() isa_caches = lldb.formatters.cache.Cache() class SystemParameters: def __init__(self, valobj): logger = lldb.formatters.Logger.Logger() self.adjust_for_architecture(valobj) self.adjust_for_process(valobj) def adjust_for_process(self, valobj): logger = lldb.formatters.Logger.Logger() global runtime_version global os_version global types_caches global isa_caches process = valobj.GetTarget().GetProcess() # using the unique ID for added guarantees (see svn revision 172628 for # further details) self.pid = process.GetUniqueID() if runtime_version.look_for_key(self.pid): self.runtime_version = runtime_version.get_value(self.pid) else: self.runtime_version = ObjCRuntime.runtime_version(process) runtime_version.add_item(self.pid, self.runtime_version) if os_version.look_for_key(self.pid): self.is_lion = os_version.get_value(self.pid) else: self.is_lion = Utilities.check_is_osx_lion(valobj.GetTarget()) os_version.add_item(self.pid, self.is_lion) if types_caches.look_for_key(self.pid): self.types_cache = types_caches.get_value(self.pid) else: self.types_cache = lldb.formatters.attrib_fromdict.AttributesDictionary( allow_reset=0) self.types_cache.addr_type = valobj.GetType( ).GetBasicType(lldb.eBasicTypeUnsignedLong) self.types_cache.addr_ptr_type = self.types_cache.addr_type.GetPointerType() self.types_cache.uint32_t = valobj.GetType( ).GetBasicType(lldb.eBasicTypeUnsignedInt) types_caches.add_item(self.pid, self.types_cache) if isa_caches.look_for_key(self.pid): self.isa_cache = isa_caches.get_value(self.pid) else: self.isa_cache = lldb.formatters.cache.Cache() isa_caches.add_item(self.pid, self.isa_cache) def adjust_for_architecture(self, valobj): process = valobj.GetTarget().GetProcess() self.pointer_size = process.GetAddressByteSize() self.is_64_bit = (self.pointer_size == 8) self.endianness = process.GetByteOrder() self.is_little = (self.endianness == lldb.eByteOrderLittle) self.cfruntime_size = 16 if self.is_64_bit else 8 # a simple helper function that makes it more explicit that one is calculating # an offset that is made up of X pointers and Y bytes of additional data # taking into account pointer size - if you know there is going to be some padding # you can pass that in and it will be taken into account (since padding may be different between # 32 and 64 bit versions, you can pass padding value for both, the right # one will be used) def calculate_offset( self, num_pointers=0, bytes_count=0, padding32=0, padding64=0): value = bytes_count + num_pointers * self.pointer_size return value + padding64 if self.is_64_bit else value + padding32 class ObjCRuntime: # the ObjC runtime has no explicit "version" field that we can use # instead, we discriminate v1 from v2 by looking for the presence # of a well-known section only present in v1 @staticmethod def runtime_version(process): logger = lldb.formatters.Logger.Logger() if process.IsValid() == 0: logger >> "No process - bailing out" return None target = process.GetTarget() num_modules = target.GetNumModules() module_objc = None for idx in range(num_modules): module = target.GetModuleAtIndex(idx) if module.GetFileSpec().GetFilename() == 'libobjc.A.dylib': module_objc = module break if module_objc is None or module_objc.IsValid() == 0: logger >> "no libobjc - bailing out" return None num_sections = module.GetNumSections() section_objc = None for idx in range(num_sections): section = module.GetSectionAtIndex(idx) if section.GetName() == '__OBJC': section_objc = section break if section_objc is not None and section_objc.IsValid(): logger >> "found __OBJC: v1" return 1 logger >> "no __OBJC: v2" return 2 @staticmethod def runtime_from_isa(isa): logger = lldb.formatters.Logger.Logger() runtime = ObjCRuntime(isa) runtime.isa = isa return runtime def __init__(self, valobj): logger = lldb.formatters.Logger.Logger() self.valobj = valobj self.adjust_for_architecture() self.sys_params = SystemParameters(self.valobj) self.unsigned_value = self.valobj.GetValueAsUnsigned() self.isa_value = None def adjust_for_architecture(self): pass # an ObjC pointer can either be tagged or must be aligned def is_tagged(self): logger = lldb.formatters.Logger.Logger() if self.valobj is None: return 0 return ( Utilities.is_valid_pointer( self.unsigned_value, self.sys_params.pointer_size, allow_tagged=1) and not( Utilities.is_valid_pointer( self.unsigned_value, self.sys_params.pointer_size, allow_tagged=0))) def is_valid(self): logger = lldb.formatters.Logger.Logger() if self.valobj is None: return 0 if self.valobj.IsInScope() == 0: return 0 return Utilities.is_valid_pointer( self.unsigned_value, self.sys_params.pointer_size, allow_tagged=1) def is_nil(self): return self.unsigned_value == 0 def read_isa(self): logger = lldb.formatters.Logger.Logger() if self.isa_value is not None: logger >> "using cached isa" return self.isa_value self.isa_pointer = self.valobj.CreateChildAtOffset( "cfisa", 0, self.sys_params.types_cache.addr_ptr_type) if self.isa_pointer is None or self.isa_pointer.IsValid() == 0: logger >> "invalid isa - bailing out" return None self.isa_value = self.isa_pointer.GetValueAsUnsigned(1) if self.isa_value == 1: logger >> "invalid isa value - bailing out" return None return Ellipsis def read_class_data(self): logger = lldb.formatters.Logger.Logger() global isa_cache if self.is_tagged(): # tagged pointers only exist in ObjC v2 if self.sys_params.runtime_version == 2: logger >> "on v2 and tagged - maybe" # not every odd-valued pointer is actually tagged. most are just plain wrong # we could try and predetect this before even creating a TaggedClass_Data object # but unless performance requires it, this seems a cleaner way # to tackle the task tentative_tagged = TaggedClass_Data( self.unsigned_value, self.sys_params) if tentative_tagged.is_valid(): logger >> "truly tagged" return tentative_tagged else: logger >> "not tagged - error" return InvalidClass_Data() else: logger >> "on v1 and tagged - error" return InvalidClass_Data() if self.is_valid() == 0 or self.read_isa() is None: return InvalidClass_Data() data = self.sys_params.isa_cache.get_value( self.isa_value, default=None) if data is not None: return data if self.sys_params.runtime_version == 2: data = Class_Data_V2(self.isa_pointer, self.sys_params) else: data = Class_Data_V1(self.isa_pointer, self.sys_params) if data is None: return InvalidClass_Data() if data.is_valid(): self.sys_params.isa_cache.add_item( self.isa_value, data, ok_to_replace=1) return data # these classes below can be used by the data formatters to provide a # consistent message that describes a given runtime-generated situation class SpecialSituation_Description: def message(self): return '' class InvalidPointer_Description(SpecialSituation_Description): def __init__(self, nil): self.is_nil = nil def message(self): if self.is_nil: return '@"<nil>"' else: return '<invalid pointer>' class InvalidISA_Description(SpecialSituation_Description): def __init__(self): pass def message(self): return '<not an Objective-C object>' class ThisIsZombie_Description(SpecialSituation_Description): def message(self): return '<freed object>'
#Copyright 2007-2009 WebDriver committers #Copyright 2007-2009 Google Inc. # #Licensed under the Apache License, Version 2.0 (the "License"); #you may not use this file except in compliance with the License. #You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # #Unless required by applicable law or agreed to in writing, software #distributed under the License is distributed on an "AS IS" BASIS, #WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. #See the License for the specific language governing permissions and #limitations under the License. import pytest from selenium.webdriver.common.by import By from selenium.webdriver.support import expected_conditions as EC from selenium.webdriver.support.wait import WebDriverWait from selenium.common.exceptions import ElementNotVisibleException from selenium.common.exceptions import InvalidElementStateException from selenium.common.exceptions import NoAlertPresentException from selenium.common.exceptions import UnexpectedAlertPresentException import unittest @pytest.mark.ignore_opera class AlertsTest(unittest.TestCase): def testShouldBeAbleToOverrideTheWindowAlertMethod(self): self._loadPage("alerts") self.driver.execute_script( "window.alert = function(msg) { document.getElementById('text').innerHTML = msg; }") self.driver.find_element(by=By.ID, value="alert").click() try: self.assertEqual(self.driver.find_element_by_id('text').text, "cheese") except Exception as e: # if we're here, likely the alert is displayed # not dismissing it will affect other tests try: self._waitForAlert().dismiss() except Exception: pass raise e def testShouldAllowUsersToAcceptAnAlertManually(self): self._loadPage("alerts") self.driver.find_element(by=By.ID, value="alert").click() alert = self._waitForAlert() alert.accept() # If we can perform any action, we're good to go self.assertEqual("Testing Alerts", self.driver.title) def testShouldAllowUsersToAcceptAnAlertWithNoTextManually(self): self._loadPage("alerts") self.driver.find_element(By.ID,"empty-alert").click(); alert = self._waitForAlert() alert.accept() # If we can perform any action, we're good to go self.assertEqual("Testing Alerts", self.driver.title) def testShouldGetTextOfAlertOpenedInSetTimeout(self): self._loadPage("alerts") self.driver.find_element_by_id("slow-alert").click() # DO NOT WAIT OR SLEEP HERE # This is a regression test for a bug where only the first switchTo call would throw, # and only if it happens before the alert actually loads. alert = self._waitForAlert() try: self.assertEqual("Slow", alert.text) finally: alert.accept() @pytest.mark.ignore_chrome def testShouldAllowUsersToDismissAnAlertManually(self): self._loadPage("alerts") self.driver.find_element(by=By.ID, value="alert").click() alert = self._waitForAlert() alert.dismiss() # If we can perform any action, we're good to go self.assertEqual("Testing Alerts", self.driver.title) def testShouldAllowAUserToAcceptAPrompt(self): self._loadPage("alerts") self.driver.find_element(by=By.ID, value="prompt").click() alert = self._waitForAlert() alert.accept() # If we can perform any action, we're good to go self.assertEqual("Testing Alerts", self.driver.title) def testShouldAllowAUserToDismissAPrompt(self): self._loadPage("alerts") self.driver.find_element(by=By.ID, value="prompt").click() alert = self._waitForAlert() alert.dismiss() # If we can perform any action, we're good to go self.assertEqual("Testing Alerts", self.driver.title) def testShouldAllowAUserToSetTheValueOfAPrompt(self): self._loadPage("alerts") self.driver.find_element(by=By.ID, value="prompt").click() alert = self._waitForAlert() alert.send_keys("cheese") alert.accept() result = self.driver.find_element(by=By.ID, value="text").text self.assertEqual("cheese", result) def testSettingTheValueOfAnAlertThrows(self): self._loadPage("alerts") self.driver.find_element(By.ID,"alert").click(); alert = self._waitForAlert() try: alert.send_keys("cheese"); self.fail("Expected exception"); except ElementNotVisibleException: pass except InvalidElementStateException: pass finally: alert.accept() def testAlertShouldNotAllowAdditionalCommandsIfDimissed(self): self._loadPage("alerts"); self.driver.find_element(By.ID, "alert").click() alert = self._waitForAlert() alert.dismiss() try: alert.text self.fail("Expected NoAlertPresentException") except NoAlertPresentException: pass def testShouldAllowUsersToAcceptAnAlertInAFrame(self): self._loadPage("alerts") self.driver.switch_to.frame("iframeWithAlert") self.driver.find_element_by_id("alertInFrame").click() alert = self._waitForAlert() alert.accept() self.assertEqual("Testing Alerts", self.driver.title) def testShouldAllowUsersToAcceptAnAlertInANestedFrame(self): self._loadPage("alerts") self.driver.switch_to.frame("iframeWithIframe") self.driver.switch_to.frame("iframeWithAlert") self.driver.find_element_by_id("alertInFrame").click() alert = self._waitForAlert() alert.accept() self.assertEqual("Testing Alerts", self.driver.title) def testShouldThrowAnExceptionIfAnAlertHasNotBeenDealtWithAndDismissTheAlert(self): pass # //TODO(David) Complete this test def testPromptShouldUseDefaultValueIfNoKeysSent(self): self._loadPage("alerts") self.driver.find_element(By.ID, "prompt-with-default").click() alert = self._waitForAlert() alert.accept() txt = self.driver.find_element(By.ID, "text").text self.assertEqual("This is a default value", txt) def testPromptShouldHaveNullValueIfDismissed(self): self._loadPage("alerts") self.driver.find_element(By.ID, "prompt-with-default").click() alert = self._waitForAlert() alert.dismiss() self.assertEqual("null", self.driver.find_element(By.ID, "text").text) def testHandlesTwoAlertsFromOneInteraction(self): self._loadPage("alerts") self.driver.find_element(By.ID, "double-prompt").click() alert1 = self._waitForAlert() alert1.send_keys("brie") alert1.accept() alert2 = self._waitForAlert() alert2.send_keys("cheddar") alert2.accept(); self.assertEqual(self.driver.find_element(By.ID, "text1").text, "brie") self.assertEqual(self.driver.find_element(By.ID, "text2").text, "cheddar") def testShouldHandleAlertOnPageLoad(self): self._loadPage("alerts") self.driver.find_element(By.ID, "open-page-with-onload-alert").click() alert = self._waitForAlert() value = alert.text alert.accept() self.assertEquals("onload", value) def testShouldAllowTheUserToGetTheTextOfAnAlert(self): self._loadPage("alerts") self.driver.find_element(by=By.ID, value="alert").click() alert = self._waitForAlert() value = alert.text alert.accept() self.assertEqual("cheese", value) def testUnexpectedAlertPresentExceptionContainsAlertText(self): self._loadPage("alerts") self.driver.find_element(by=By.ID, value="alert").click() alert = self._waitForAlert() value = alert.text try: self._loadPage("simpleTest") raise Exception("UnexpectedAlertPresentException should have been thrown") except UnexpectedAlertPresentException as uape: self.assertEquals(value, uape.alert_text) self.assertTrue(str(uape).startswith("Alert Text: %s" % value)) def _waitForAlert(self): return WebDriverWait(self.driver, 3).until(EC.alert_is_present()) def _pageURL(self, name): return self.webserver.where_is(name + '.html') def _loadSimplePage(self): self._loadPage("simpleTest") def _loadPage(self, name): try: # just in case a previous test left open an alert self.driver.switch_to.alert().dismiss() except: pass self.driver.get(self._pageURL(name))
# coding: utf-8 # In[ ]: # opengrid imports from opengrid.library import misc, houseprint, caching, analysis from opengrid import config c=config.Config() # other imports import pandas as pd import charts import numpy as np import os # configuration for the plots DEV = c.get('env', 'type') == 'dev' # DEV is True if we are in development environment, False if on the droplet if not DEV: # production environment: don't try to display plots import matplotlib matplotlib.use('Agg') import matplotlib.pyplot as plt from matplotlib.dates import HourLocator, DateFormatter, AutoDateLocator, num2date if DEV: if c.get('env', 'plots') == 'inline': get_ipython().magic(u'matplotlib inline') else: get_ipython().magic(u'matplotlib qt') else: pass # don't try to render plots plt.rcParams['figure.figsize'] = 12,8 # In[ ]: hp = houseprint.Houseprint() sensors = hp.get_sensors(sensortype='electricity') # sensor objects # Remove some sensors exclude = [ '565de0a7dc64d8370aa321491217b85f' # 3E ] solar = [x.key for x in hp.search_sensors(type='electricity', system='solar')] exclude += solar for s in sensors: if s.key in exclude: sensors.remove(s) hp.init_tmpo() # In[ ]: #hp.sync_tmpos() # In[ ]: # The first time, this will take a very looong time to get all the detailed data for building the cache # Afterwards, this is quick caching.cache_results(hp=hp, sensors=sensors, function='daily_min', resultname='elec_daily_min') caching.cache_results(hp=hp, sensors=sensors, function='daily_max', resultname='elec_daily_max') # In[ ]: cache_min = caching.Cache(variable='elec_daily_min') cache_max = caching.Cache(variable='elec_daily_max') dfdaymin = cache_min.get(sensors=sensors) dfdaymax = cache_max.get(sensors=sensors) # The next plot shows that some periods are missing. Due to the cumulative nature of the electricity counter, we still have the total consumption. However, it is spread out of the entire period. So we don't know the standby power during these days, and we have to remove those days. # In[ ]: if DEV: sensor = hp.search_sensors(key='3aa4')[0] df = sensor.get_data(head=pd.Timestamp('20151117'), tail=pd.Timestamp('20160104')) charts.plot(df, stock=True, show='inline') # In[ ]: # Clean out the data: # First remove days with too low values to be realistic dfdaymin[dfdaymin < 10] = np.nan # Now remove days where the minimum=maximum (within 1 Watt difference) dfdaymin[(dfdaymax - dfdaymin) < 1] = np.nan # In[ ]: if DEV: charts.plot(dfdaymin, stock=True, show='inline') # In[ ]: DEV # In[ ]: standby_statistics = dfdaymin.T.describe(percentiles=[0.1,0.5,0.9]).T # In[ ]: if DEV: charts.plot(standby_statistics[['10%', '50%', '90%']], stock=True, show='inline') # In[ ]: # Get detailed profiles for the last day now = pd.Timestamp('now', tz='UTC') start_of_day = now - pd.Timedelta(hours=now.hour, minutes=now.minute, seconds=now.second) sensors = map(hp.find_sensor, dfdaymin.columns) df_details = hp.get_data(sensors = sensors, head=start_of_day) # ### Boxplot approach. Possible for a period of maximum +/- 2 weeks. # In[ ]: # choose a period look_back_days = 10 start = now - pd.Timedelta(days=look_back_days) dfdaymin_period = dfdaymin.ix[start:].dropna(axis=1, how='all') # In[ ]: box = [dfdaymin_period.loc[i,:].dropna().values for i in dfdaymin_period.index] for sensor in dfdaymin_period.columns: plt.figure(figsize=(10,5)) ax1=plt.subplot(121) ax1.boxplot(box, positions=range(len(box)), notch=False) ax1.plot(range(len(box)), dfdaymin_period[sensor], 'rD', ms=10, label='Sluipverbruik') xticks = [x.strftime(format='%d/%m') for x in dfdaymin_period.index] plt.xticks(range(len(box)), xticks, rotation='vertical') plt.title(hp.find_sensor(sensor).device.key + ' - ' + sensor) ax1.grid() ax1.set_ylabel('Watt') plt.legend(numpoints=1, frameon=False) ax2=plt.subplot(122) try: ax2.plot_date(df_details[sensor].index, df_details[sensor].values, 'b-', label='Afgelopen nacht') #ax2.xaxis_date() #Put timeseries plot in local time # rotate the labels plt.xticks(rotation='vertical') ax2.set_ylabel('Watt') ax2.grid() plt.legend(loc='upper right', frameon=False) plt.tight_layout() except Exception as e: print(e) else: plt.savefig(os.path.join(c.get('data', 'folder'), 'figures', 'standby_horizontal_'+sensor+'.png'), dpi=100) pass if not DEV: plt.close() # ### Percentile approach. Useful for longer time periods, but tweaking of graph still needed # In[ ]: # choose a period look_back_days = 40 start = now - pd.Timedelta(days=look_back_days) dfdaymin_period = dfdaymin.ix[start:].dropna(axis=1, how='all') df = dfdaymin_period.join(standby_statistics[['10%', '50%', '90%']], how='left') # In[ ]: for sensor in dfdaymin_period.columns: plt.figure(figsize=(10,8)) ax1=plt.subplot(211) ax1.plot_date(df.index, df[u'10%'], '-', lw=2, color='g', label=u'10% percentile') ax1.plot_date(df.index, df[u'50%'], '-', lw=2, color='orange', label=u'50% percentile') ax1.plot_date(df.index, df[u'90%'], '-', lw=2, color='r', label=u'90% percentile') ax1.plot_date(df.index, df[sensor], 'rD', ms=7, label='Your standby power') ax1.legend() locs, lables=plt.xticks() xticks = [x.strftime(format='%d/%m') for x in num2date(locs)] plt.xticks(locs, xticks, rotation='vertical') plt.title(hp.find_sensor(sensor).device.key + ' - ' + sensor) ax1.grid() ax1.set_ylabel('Watt') ax2=plt.subplot(212) try: ax2.plot_date(df_details[sensor].index, df_details[sensor].values, 'b-', label='Afgelopen nacht') #ax2.xaxis_date() #Put timeseries plot in local time # rotate the labels plt.xticks(rotation='vertical') ax2.set_ylabel('Watt') ax2.grid() plt.legend(loc='upper right', frameon=False) plt.tight_layout() except Exception as e: print(e) else: plt.savefig(os.path.join(c.get('data', 'folder'), 'figures', 'standby_vertical_'+sensor+'.png'), dpi=100) pass if not DEV: plt.close() # In[ ]:
from __future__ import division, unicode_literals import os import re import sys import time from ..compat import compat_str from ..utils import ( encodeFilename, decodeArgument, format_bytes, timeconvert, ) class FileDownloader(object): """File Downloader class. File downloader objects are the ones responsible of downloading the actual video file and writing it to disk. File downloaders accept a lot of parameters. In order not to saturate the object constructor with arguments, it receives a dictionary of options instead. Available options: verbose: Print additional info to stdout. quiet: Do not print messages to stdout. ratelimit: Download speed limit, in bytes/sec. retries: Number of times to retry for HTTP error 5xx buffersize: Size of download buffer in bytes. noresizebuffer: Do not automatically resize the download buffer. continuedl: Try to continue downloads if possible. noprogress: Do not print the progress bar. logtostderr: Log messages to stderr instead of stdout. consoletitle: Display progress in console window's titlebar. nopart: Do not use temporary .part files. updatetime: Use the Last-modified header to set output file timestamps. test: Download only first bytes to test the downloader. min_filesize: Skip files smaller than this size max_filesize: Skip files larger than this size xattr_set_filesize: Set ytdl.filesize user xattribute with expected size. (experimental) external_downloader_args: A list of additional command-line arguments for the external downloader. Subclasses of this one must re-define the real_download method. """ _TEST_FILE_SIZE = 10241 params = None def __init__(self, ydl, params): """Create a FileDownloader object with the given options.""" self.ydl = ydl self._progress_hooks = [] self.params = params self.add_progress_hook(self.report_progress) @staticmethod def format_seconds(seconds): (mins, secs) = divmod(seconds, 60) (hours, mins) = divmod(mins, 60) if hours > 99: return '--:--:--' if hours == 0: return '%02d:%02d' % (mins, secs) else: return '%02d:%02d:%02d' % (hours, mins, secs) @staticmethod def calc_percent(byte_counter, data_len): if data_len is None: return None return float(byte_counter) / float(data_len) * 100.0 @staticmethod def format_percent(percent): if percent is None: return '---.-%' return '%6s' % ('%3.1f%%' % percent) @staticmethod def calc_eta(start, now, total, current): if total is None: return None if now is None: now = time.time() dif = now - start if current == 0 or dif < 0.001: # One millisecond return None rate = float(current) / dif return int((float(total) - float(current)) / rate) @staticmethod def format_eta(eta): if eta is None: return '--:--' return FileDownloader.format_seconds(eta) @staticmethod def calc_speed(start, now, bytes): dif = now - start if bytes == 0 or dif < 0.001: # One millisecond return None return float(bytes) / dif @staticmethod def format_speed(speed): if speed is None: return '%10s' % '---b/s' return '%10s' % ('%s/s' % format_bytes(speed)) @staticmethod def best_block_size(elapsed_time, bytes): new_min = max(bytes / 2.0, 1.0) new_max = min(max(bytes * 2.0, 1.0), 4194304) # Do not surpass 4 MB if elapsed_time < 0.001: return int(new_max) rate = bytes / elapsed_time if rate > new_max: return int(new_max) if rate < new_min: return int(new_min) return int(rate) @staticmethod def parse_bytes(bytestr): """Parse a string indicating a byte quantity into an integer.""" matchobj = re.match(r'(?i)^(\d+(?:\.\d+)?)([kMGTPEZY]?)$', bytestr) if matchobj is None: return None number = float(matchobj.group(1)) multiplier = 1024.0 ** 'bkmgtpezy'.index(matchobj.group(2).lower()) return int(round(number * multiplier)) def to_screen(self, *args, **kargs): self.ydl.to_screen(*args, **kargs) def to_stderr(self, message): self.ydl.to_screen(message) def to_console_title(self, message): self.ydl.to_console_title(message) def trouble(self, *args, **kargs): self.ydl.trouble(*args, **kargs) def report_warning(self, *args, **kargs): self.ydl.report_warning(*args, **kargs) def report_error(self, *args, **kargs): self.ydl.report_error(*args, **kargs) def slow_down(self, start_time, now, byte_counter): """Sleep if the download speed is over the rate limit.""" rate_limit = self.params.get('ratelimit', None) if rate_limit is None or byte_counter == 0: return if now is None: now = time.time() elapsed = now - start_time if elapsed <= 0.0: return speed = float(byte_counter) / elapsed if speed > rate_limit: time.sleep(max((byte_counter // rate_limit) - elapsed, 0)) def temp_name(self, filename): """Returns a temporary filename for the given filename.""" if self.params.get('nopart', False) or filename == '-' or \ (os.path.exists(encodeFilename(filename)) and not os.path.isfile(encodeFilename(filename))): return filename return filename + '.part' def undo_temp_name(self, filename): if filename.endswith('.part'): return filename[:-len('.part')] return filename def try_rename(self, old_filename, new_filename): try: if old_filename == new_filename: return os.rename(encodeFilename(old_filename), encodeFilename(new_filename)) except (IOError, OSError) as err: self.report_error('unable to rename file: %s' % compat_str(err)) def try_utime(self, filename, last_modified_hdr): """Try to set the last-modified time of the given file.""" if last_modified_hdr is None: return if not os.path.isfile(encodeFilename(filename)): return timestr = last_modified_hdr if timestr is None: return filetime = timeconvert(timestr) if filetime is None: return filetime # Ignore obviously invalid dates if filetime == 0: return try: os.utime(filename, (time.time(), filetime)) except Exception: pass return filetime def report_destination(self, filename): """Report destination filename.""" self.to_screen('[download] Destination: ' + filename) def _report_progress_status(self, msg, is_last_line=False): fullmsg = '[download] ' + msg if self.params.get('progress_with_newline', False): self.to_screen(fullmsg) else: if os.name == 'nt': prev_len = getattr(self, '_report_progress_prev_line_length', 0) if prev_len > len(fullmsg): fullmsg += ' ' * (prev_len - len(fullmsg)) self._report_progress_prev_line_length = len(fullmsg) clear_line = '\r' else: clear_line = ('\r\x1b[K' if sys.stderr.isatty() else '\r') self.to_screen(clear_line + fullmsg, skip_eol=not is_last_line) self.to_console_title('youtube-dl ' + msg) def report_progress(self, s): if s['status'] == 'finished': if self.params.get('noprogress', False): self.to_screen('[download] Download completed') else: s['_total_bytes_str'] = format_bytes(s['total_bytes']) if s.get('elapsed') is not None: s['_elapsed_str'] = self.format_seconds(s['elapsed']) msg_template = '100%% of %(_total_bytes_str)s in %(_elapsed_str)s' else: msg_template = '100%% of %(_total_bytes_str)s' self._report_progress_status( msg_template % s, is_last_line=True) if self.params.get('noprogress'): return if s['status'] != 'downloading': return if s.get('eta') is not None: s['_eta_str'] = self.format_eta(s['eta']) else: s['_eta_str'] = 'Unknown ETA' if s.get('total_bytes') and s.get('downloaded_bytes') is not None: s['_percent_str'] = self.format_percent(100 * s['downloaded_bytes'] / s['total_bytes']) elif s.get('total_bytes_estimate') and s.get('downloaded_bytes') is not None: s['_percent_str'] = self.format_percent(100 * s['downloaded_bytes'] / s['total_bytes_estimate']) else: if s.get('downloaded_bytes') == 0: s['_percent_str'] = self.format_percent(0) else: s['_percent_str'] = 'Unknown %' if s.get('speed') is not None: s['_speed_str'] = self.format_speed(s['speed']) else: s['_speed_str'] = 'Unknown speed' if s.get('total_bytes') is not None: s['_total_bytes_str'] = format_bytes(s['total_bytes']) msg_template = '%(_percent_str)s of %(_total_bytes_str)s at %(_speed_str)s ETA %(_eta_str)s' elif s.get('total_bytes_estimate') is not None: s['_total_bytes_estimate_str'] = format_bytes(s['total_bytes_estimate']) msg_template = '%(_percent_str)s of ~%(_total_bytes_estimate_str)s at %(_speed_str)s ETA %(_eta_str)s' else: if s.get('downloaded_bytes') is not None: s['_downloaded_bytes_str'] = format_bytes(s['downloaded_bytes']) if s.get('elapsed'): s['_elapsed_str'] = self.format_seconds(s['elapsed']) msg_template = '%(_downloaded_bytes_str)s at %(_speed_str)s (%(_elapsed_str)s)' else: msg_template = '%(_downloaded_bytes_str)s at %(_speed_str)s' else: msg_template = '%(_percent_str)s % at %(_speed_str)s ETA %(_eta_str)s' self._report_progress_status(msg_template % s) def report_resuming_byte(self, resume_len): """Report attempt to resume at given byte.""" self.to_screen('[download] Resuming download at byte %s' % resume_len) def report_retry(self, count, retries): """Report retry in case of HTTP error 5xx""" self.to_screen('[download] Got server HTTP error. Retrying (attempt %d of %d)...' % (count, retries)) def report_file_already_downloaded(self, file_name): """Report file has already been fully downloaded.""" try: self.to_screen('[download] %s has already been downloaded' % file_name) except UnicodeEncodeError: self.to_screen('[download] The file has already been downloaded') def report_unable_to_resume(self): """Report it was impossible to resume download.""" self.to_screen('[download] Unable to resume') def download(self, filename, info_dict): """Download to a filename using the info from info_dict Return True on success and False otherwise """ nooverwrites_and_exists = ( self.params.get('nooverwrites', False) and os.path.exists(encodeFilename(filename)) ) continuedl_and_exists = ( self.params.get('continuedl', True) and os.path.isfile(encodeFilename(filename)) and not self.params.get('nopart', False) ) # Check file already present if filename != '-' and (nooverwrites_and_exists or continuedl_and_exists): self.report_file_already_downloaded(filename) self._hook_progress({ 'filename': filename, 'status': 'finished', 'total_bytes': os.path.getsize(encodeFilename(filename)), }) return True sleep_interval = self.params.get('sleep_interval') if sleep_interval: self.to_screen('[download] Sleeping %s seconds...' % sleep_interval) time.sleep(sleep_interval) return self.real_download(filename, info_dict) def real_download(self, filename, info_dict): """Real download process. Redefine in subclasses.""" raise NotImplementedError('This method must be implemented by subclasses') def _hook_progress(self, status): for ph in self._progress_hooks: ph(status) def add_progress_hook(self, ph): # See YoutubeDl.py (search for progress_hooks) for a description of # this interface self._progress_hooks.append(ph) def _debug_cmd(self, args, exe=None): if not self.params.get('verbose', False): return str_args = [decodeArgument(a) for a in args] if exe is None: exe = os.path.basename(str_args[0]) try: import pipes shell_quote = lambda args: ' '.join(map(pipes.quote, str_args)) except ImportError: shell_quote = repr self.to_screen('[debug] %s command line: %s' % ( exe, shell_quote(str_args)))
import argparse from pathlib import Path from typing import Union import tflite_runtime.interpreter as tflite from PIL import Image import numpy as np def check_args(args: argparse.Namespace): """Check the values used in the command-line have acceptable values args: - args: argparse.Namespace returns: - None raises: - FileNotFoundError: if passed files do not exist. - IOError: if files are of incorrect format. """ input_image_p = args.input_image if not input_image_p.suffix in (".png", ".jpg", ".jpeg"): raise IOError( "--input_image option should point to an image file of the " "format .jpg, .jpeg, .png" ) if not input_image_p.exists(): raise FileNotFoundError("Cannot find ", input_image_p.name) model_p = args.model_file if not model_p.suffix == ".tflite": raise IOError("--model_file should point to a tflite file.") if not model_p.exists(): raise FileNotFoundError("Cannot find ", model_p.name) label_mapping_p = args.label_file if not label_mapping_p.suffix == ".txt": raise IOError("--label_file expects a .txt file.") if not label_mapping_p.exists(): raise FileNotFoundError("Cannot find ", label_mapping_p.name) # check all args given in preferred backends make sense supported_backends = ["GpuAcc", "CpuAcc", "CpuRef"] if not all([backend in supported_backends for backend in args.preferred_backends]): raise ValueError("Incorrect backends given. Please choose from "\ "'GpuAcc', 'CpuAcc', 'CpuRef'.") return None def load_image(image_path: Path, model_input_dims: Union[tuple, list], grayscale: bool): """load an image and put into correct format for the tensorflow lite model args: - image_path: pathlib.Path - model_input_dims: tuple (or array-like). (height,width) returns: - image: np.array """ height, width = model_input_dims # load and resize image image = Image.open(image_path).resize((width, height)) # convert to greyscale if expected if grayscale: image = image.convert("LA") image = np.expand_dims(image, axis=0) return image def load_delegate(delegate_path: Path, backends: list): """load the armnn delegate. args: - delegate_path: pathlib.Path -> location of you libarmnnDelegate.so - backends: list -> list of backends you want to use in string format returns: - armnn_delegate: tflite.delegate """ # create a command separated string backend_string = ",".join(backends) # load delegate armnn_delegate = tflite.load_delegate( library=delegate_path, options={"backends": backend_string, "logging-severity": "info"}, ) return armnn_delegate def load_tf_model(model_path: Path, armnn_delegate: tflite.Delegate): """load a tflite model for use with the armnn delegate. args: - model_path: pathlib.Path - armnn_delegate: tflite.TfLiteDelegate returns: - interpreter: tflite.Interpreter """ interpreter = tflite.Interpreter( model_path=model_path.as_posix(), experimental_delegates=[armnn_delegate] ) interpreter.allocate_tensors() return interpreter def run_inference(interpreter, input_image): """Run inference on a processed input image and return the output from inference. args: - interpreter: tflite_runtime.interpreter.Interpreter - input_image: np.array returns: - output_data: np.array """ # Get input and output tensors. input_details = interpreter.get_input_details() output_details = interpreter.get_output_details() # Test model on random input data. interpreter.set_tensor(input_details[0]["index"], input_image) interpreter.invoke() output_data = interpreter.get_tensor(output_details[0]["index"]) return output_data def create_mapping(label_mapping_p): """Creates a Python dictionary mapping an index to a label. label_mapping[idx] = label args: - label_mapping_p: pathlib.Path returns: - label_mapping: dict """ idx = 0 label_mapping = {} with open(label_mapping_p) as label_mapping_raw: for line in label_mapping_raw: label_mapping[idx] = line idx += 1 return label_mapping def process_output(output_data, label_mapping): """Process the output tensor into a label from the labelmapping file. Takes the index of the maximum valur from the output array. args: - output_data: np.array - label_mapping: dict returns: - str: labelmapping for max index. """ idx = np.argmax(output_data[0]) return label_mapping[idx] def main(args): """Run the inference for options passed in the command line. args: - args: argparse.Namespace returns: - None """ # sanity check on args check_args(args) # load in the armnn delegate armnn_delegate = load_delegate(args.delegate_path, args.preferred_backends) # load tflite model interpreter = load_tf_model(args.model_file, armnn_delegate) # get input shape for image resizing input_shape = interpreter.get_input_details()[0]["shape"] height, width = input_shape[1], input_shape[2] input_shape = (height, width) # load input image input_image = load_image(args.input_image, input_shape, False) # get label mapping labelmapping = create_mapping(args.label_file) output_tensor = run_inference(interpreter, input_image) output_prediction = process_output(output_tensor, labelmapping) print("Prediction: ", output_prediction) return None if __name__ == "__main__": parser = argparse.ArgumentParser( formatter_class=argparse.ArgumentDefaultsHelpFormatter ) parser.add_argument( "--input_image", help="File path of image file", type=Path, required=True ) parser.add_argument( "--model_file", help="File path of the model tflite file", type=Path, required=True, ) parser.add_argument( "--label_file", help="File path of model labelmapping file", type=Path, required=True, ) parser.add_argument( "--delegate_path", help="File path of ArmNN delegate file", type=Path, required=True, ) parser.add_argument( "--preferred_backends", help="list of backends in order of preference", type=str, nargs="+", required=False, default=["CpuAcc", "CpuRef"], ) args = parser.parse_args() main(args)
from simulux.disks import Disks from lib.utils import jsonify # Global disks var to use in all the tests disks = Disks() def test_init(): ''' Test default load of the Disks class ''' try: disks = Disks() except Exception as e: print "Exception raised: %s" % (e) assert False assert True def test_get_childrens_path(): ''' Test that we can fetch 1st level of children of a path ''' childrens = disks.get_childrens_path('/') childrens.sort() expected = [ unicode(i) for i in [ '/bin', '/boot', '/dev', '/proc', '/home', '/root', '/sbin', '/var', '/etc', '/lost+found', '/lib', '/lib64', '/opt', '/tmp', '/mnt', '/sys', '/usr' ]] expected.sort() assert childrens == expected def test_get_parent_path(): ''' Test that we can fetch the parent path ''' parent = disks.get_parent_path('/') assert parent == unicode('/') parent = disks.get_parent_path('/etc/hosts') assert parent == unicode('/etc') parent = disks.get_parent_path('/some/random/path') assert parent == unicode('/some/random') def test_get_details_of_mount_point(): ''' Test we can fetch the details of a mount point folder ''' details = disks.get_details('/') expected = { 'mount': True, 'size': 1000000, 'owner': 'root', 'group': 'root', 'mode': 755 } assert jsonify(details) == jsonify(expected) def test_get_details_of_good_file(): ''' Test we can fetch the details of a good file ''' details = disks.get_details('/etc/hosts') expected = { 'filetype': 'file', 'size': 11, 'owner': 'root', 'group': 'root', 'mode': 644 } assert jsonify(details) == jsonify(expected) details = disks.get_details('/etc') expected = { 'filetype': 'folder', 'size': 1111, 'owner': 'root', 'group': 'root', 'mode': 755 } assert jsonify(details) == jsonify(expected) def test_get_details_of_bad_file(): ''' Test we can fetch the details of a bad file ''' details = disks.get_details('/some/random/path') expected = {} assert jsonify(details) == jsonify(expected) def test_add_new_file(): ''' Test we can add a new file and the size get propagated ''' disks.add_file('/etc/new_file', size=1000) details = disks.get_details('/etc/new_file') expected = { 'size': 1000, 'owner': 'root', 'group': 'root', 'filetype': 'file', 'mode': 755 } assert jsonify(details) == jsonify(expected) details = disks.get_details('/etc') expected = { 'filetype': 'folder', 'size': 2111, 'owner': 'root', 'group': 'root', 'mode': 755 } assert jsonify(details) == jsonify(expected) details = disks.get_details('/') expected = { 'mount': True, 'size': 1001000, 'owner': 'root', 'group': 'root', 'mode': 755 } assert jsonify(details) == jsonify(expected) def test_update_file(): ''' Test we can update an existing file and the size get propagated ''' disks.update_file('/etc/new_file', size=5000, mode=644, owner='foo', group='bar') details = disks.get_details('/etc/new_file') expected = { 'size': 5000, 'owner': 'foo', 'group': 'bar', 'filetype': 'file', 'mode': 644 } assert jsonify(details) == jsonify(expected) details = disks.get_details('/etc') expected = { 'filetype': 'folder', 'size': 6111, 'owner': 'root', 'group': 'root', 'mode': 755 } assert jsonify(details) == jsonify(expected) details = disks.get_details('/') expected = { 'mount': True, 'size': 1005000, 'owner': 'root', 'group': 'root', 'mode': 755 } assert jsonify(details) == jsonify(expected) def test_remove_file(): ''' Test we can remove a file and get the size propagated ''' disks.remove_file('/etc/new_file') details = disks.get_details('/etc/new_file') expected = {} assert jsonify(details) == jsonify(expected) details = disks.get_details('/etc') expected = { 'filetype': 'folder', 'size': 1111, 'owner': 'root', 'group': 'root', 'mode': 755 } assert jsonify(details) == jsonify(expected) details = disks.get_details('/') expected = { 'mount': True, 'size': 1000000, 'owner': 'root', 'group': 'root', 'mode': 755 } assert jsonify(details) == jsonify(expected) def test_remove_folder(): ''' Test folder removal - fail on non recursive ''' disks.remove_file('/etc') details = disks.get_details('/etc') # Fail - not deleted expected = { 'filetype': 'folder', 'size': 1111, 'owner': 'root', 'group': 'root', 'mode': 755 } assert jsonify(details) == jsonify(expected) disks.remove_file('/etc', recursive=True) details = disks.get_details('/etc') # Fail - not deleted expected = {} assert jsonify(details) == jsonify(expected) details = disks.get_details('/') expected = { 'mount': True, 'size': 998889, 'owner': 'root', 'group': 'root', 'mode': 755 } assert jsonify(details) == jsonify(expected) def test_remove_mount(): ''' Test mount point folder removal - fail ''' disks.remove_file('/boot') details = disks.get_details('/boot') # Fail - not deleted expected = { 'mount': True, 'size': 1111, 'owner': 'root', 'group': 'root', 'mode': 755 } assert jsonify(details) == jsonify(expected) disks.remove_file('/boot', recursive=True) details = disks.get_details('/boot') # Fail - not deleted expected = { 'mount': True, 'size': 1111, 'owner': 'root', 'group': 'root', 'mode': 755 } assert jsonify(details) == jsonify(expected) details = disks.get_details('/') # Unchanged from previous test and not propagated since other mount point expected = { 'mount': True, 'size': 998889, 'owner': 'root', 'group': 'root', 'mode': 755 } assert jsonify(details) == jsonify(expected)
# vim: tabstop=4 shiftwidth=4 softtabstop=4 # Copyright 2012 Canonical Ltd. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. from django import http from mox import IsA # noqa from openstack_dashboard import api from openstack_dashboard.test import helpers as test class CeilometerApiTests(test.APITestCase): def test_sample_list(self): samples = self.samples.list() meter_name = "meter_name" ceilometerclient = self.stub_ceilometerclient() ceilometerclient.samples = self.mox.CreateMockAnything() ceilometerclient.samples.list(meter_name=meter_name, q=[]).\ AndReturn(samples) self.mox.ReplayAll() ret_list = api.ceilometer.sample_list(self.request, meter_name, query=[]) for c in ret_list: self.assertIsInstance(c, api.ceilometer.Sample) def test_meter_list(self): meters = self.meters.list() ceilometerclient = self.stub_ceilometerclient() ceilometerclient.meters = self.mox.CreateMockAnything() ceilometerclient.meters.list([]).AndReturn(meters) self.mox.ReplayAll() ret_list = api.ceilometer.meter_list(self.request, []) for m in ret_list: self.assertIsInstance(m, api.ceilometer.Meter) def test_resource_list(self): resources = self.resources.list() ceilometerclient = self.stub_ceilometerclient() ceilometerclient.resources = self.mox.CreateMockAnything() ceilometerclient.resources.list(q=[]).AndReturn(resources) self.mox.ReplayAll() ret_list = api.ceilometer.resource_list(self.request, query=[]) for r in ret_list: self.assertIsInstance(r, api.ceilometer.Resource) def test_statistic_list(self): statistics = self.statistics.list() meter_name = "meter_name" ceilometerclient = self.stub_ceilometerclient() ceilometerclient.statistics = self.mox.CreateMockAnything() ceilometerclient.statistics.list(meter_name=meter_name, period=None, q=[]).\ AndReturn(statistics) self.mox.ReplayAll() ret_list = api.ceilometer.statistic_list(self.request, meter_name, period=None, query=[]) for s in ret_list: self.assertIsInstance(s, api.ceilometer.Statistic) #TODO(lsmola) #test resource aggregates @test.create_stubs({api.ceilometer.CeilometerUsage: ("get_user", "get_tenant")}) def test_global_data_get(self): class TempUsage(api.base.APIResourceWrapper): _attrs = ["id", "tenant", "user", "resource", "fake_meter_1", "fake_meter_2"] meters = ["fake_meter_1", "fake_meter_2"] default_query = ["Fake query"] stats_attr = "max" resources = self.resources.list() statistics = self.statistics.list() user = self.ceilometer_users.list()[0] tenant = self.ceilometer_tenants.list()[0] ceilometerclient = self.stub_ceilometerclient() ceilometerclient.resources = self.mox.CreateMockAnything() # I am returning only 1 resource ceilometerclient.resources.list(q=IsA(list)).AndReturn(resources[:1]) ceilometerclient.statistics = self.mox.CreateMockAnything() # check that list is called twice for one resource and 2 meters ceilometerclient.statistics.list(meter_name=IsA(str), period=None, q=IsA(list)).\ AndReturn(statistics) ceilometerclient.statistics.list(meter_name=IsA(str), period=None, q=IsA(list)).\ AndReturn(statistics) api.ceilometer.CeilometerUsage\ .get_user(IsA(str)).AndReturn(user) api.ceilometer.CeilometerUsage\ .get_tenant(IsA(str)).AndReturn(tenant) self.mox.ReplayAll() # getting all resources and with statistics ceilometer_usage = api.ceilometer.CeilometerUsage(http.HttpRequest) data = ceilometer_usage.global_data_get( used_cls=TempUsage, query=["fake_query"], with_statistics=True) first = data[0] self.assertEqual(first.id, 'fake_project_id__fake_user_id__' 'fake_resource_id') self.assertEqual(first.user.name, 'user') self.assertEqual(first.tenant.name, 'test_tenant') self.assertEqual(first.resource, 'fake_resource_id') self.assertEqual(first.fake_meter_1, 9) self.assertEqual(first.fake_meter_2, 9) # check that only one resource is returned self.assertEqual(len(data), 1) @test.create_stubs({api.ceilometer.CeilometerUsage: ("get_user", "get_tenant")}) def test_global_data_get_without_statistic_data(self): class TempUsage(api.base.APIResourceWrapper): _attrs = ["id", "tenant", "user", "resource", "fake_meter_1", "fake_meter_2"] meters = ["fake_meter_1", "fake_meter_2"] default_query = ["Fake query"] stats_attr = "max" resources = self.resources.list() user = self.ceilometer_users.list()[0] tenant = self.ceilometer_tenants.list()[0] ceilometerclient = self.stub_ceilometerclient() ceilometerclient.resources = self.mox.CreateMockAnything() ceilometerclient.resources.list(q=IsA(list)).AndReturn(resources) api.ceilometer.CeilometerUsage\ .get_user(IsA(str)).MultipleTimes().AndReturn(user) api.ceilometer.CeilometerUsage\ .get_tenant(IsA(str)).MultipleTimes().AndReturn(tenant) self.mox.ReplayAll() # getting all resources and with statistics ceilometer_usage = api.ceilometer.CeilometerUsage(http.HttpRequest) data = ceilometer_usage.global_data_get( used_cls=TempUsage, query=["fake_query"], with_statistics=False) first = data[0] self.assertEqual(first.id, 'fake_project_id__fake_user_id__' 'fake_resource_id') self.assertEqual(first.user.name, 'user') self.assertEqual(first.tenant.name, 'test_tenant') self.assertEqual(first.resource, 'fake_resource_id') self.assertRaises(AttributeError, getattr, first, 'fake_meter_1') self.assertRaises(AttributeError, getattr, first, 'fake_meter_2') self.assertEqual(len(data), len(resources)) @test.create_stubs({api.ceilometer.CeilometerUsage: ("get_user", "get_tenant")}) def test_global_data_get_all_statistic_data(self): class TempUsage(api.base.APIResourceWrapper): _attrs = ["id", "tenant", "user", "resource", "fake_meter_1", "fake_meter_2"] meters = ["fake_meter_1", "fake_meter_2"] default_query = ["Fake query"] stats_attr = None # have to return dictionary with all stats resources = self.resources.list() statistics = self.statistics.list() user = self.ceilometer_users.list()[0] tenant = self.ceilometer_tenants.list()[0] ceilometerclient = self.stub_ceilometerclient() ceilometerclient.resources = self.mox.CreateMockAnything() ceilometerclient.resources.list(q=IsA(list)).AndReturn(resources) ceilometerclient.statistics = self.mox.CreateMockAnything() ceilometerclient.statistics.list(meter_name=IsA(str), period=None, q=IsA(list)).\ MultipleTimes().\ AndReturn(statistics) api.ceilometer.CeilometerUsage\ .get_user(IsA(str)).MultipleTimes().AndReturn(user) api.ceilometer.CeilometerUsage\ .get_tenant(IsA(str)).MultipleTimes().AndReturn(tenant) self.mox.ReplayAll() # getting all resources and with statistics ceilometer_usage = api.ceilometer.CeilometerUsage(http.HttpRequest) data = ceilometer_usage.global_data_get( used_cls=TempUsage, query=["fake_query"], with_statistics=True) first = data[0] self.assertEqual(first.id, 'fake_project_id__fake_user_id__' 'fake_resource_id') self.assertEqual(first.user.name, 'user') self.assertEqual(first.tenant.name, 'test_tenant') self.assertEqual(first.resource, 'fake_resource_id') statistic_obj = api.ceilometer.Statistic(statistics[0]) # check that it returns whole statistic object self.assertEqual(vars(first.fake_meter_1[0]), vars(statistic_obj)) self.assertEqual(vars(first.fake_meter_2[0]), vars(statistic_obj)) self.assertEqual(len(data), len(resources)) @test.create_stubs({api.ceilometer.CeilometerUsage: ("get_user", "get_tenant")}) def test_global_disk_usage(self): resources = self.resources.list() statistics = self.statistics.list() user = self.ceilometer_users.list()[0] tenant = self.ceilometer_tenants.list()[0] ceilometerclient = self.stub_ceilometerclient() ceilometerclient.resources = self.mox.CreateMockAnything() ceilometerclient.resources.list(q=IsA(list)).AndReturn(resources) ceilometerclient.statistics = self.mox.CreateMockAnything() ceilometerclient.statistics.list(meter_name=IsA(str), period=None, q=IsA(list)).\ MultipleTimes().\ AndReturn(statistics) api.ceilometer.CeilometerUsage\ .get_user(IsA(str)).MultipleTimes().AndReturn(user) api.ceilometer.CeilometerUsage\ .get_tenant(IsA(str)).MultipleTimes().AndReturn(tenant) self.mox.ReplayAll() # getting all resources and with statistics ceilometer_usage = api.ceilometer.CeilometerUsage(http.HttpRequest) data = ceilometer_usage.global_disk_usage(query=["fake_query"], with_statistics=True) first = data[0] self.assertEqual(first.id, 'fake_project_id__fake_user_id__' 'fake_resource_id') self.assertEqual(first.user.name, 'user') self.assertEqual(first.tenant.name, 'test_tenant') self.assertEqual(first.resource, 'fake_resource_id') self.assertEqual(first.disk_read_bytes, 4.55) self.assertEqual(first.disk_write_bytes, 4.55) self.assertEqual(first.disk_read_requests, 4.55) self.assertEqual(first.disk_write_requests, 4.55) self.assertEqual(len(data), len(resources)) @test.create_stubs({api.ceilometer.CeilometerUsage: ("get_user", "get_tenant")}) def test_global_network_traffic_usage(self): resources = self.resources.list() statistics = self.statistics.list() user = self.ceilometer_users.list()[0] tenant = self.ceilometer_tenants.list()[0] ceilometerclient = self.stub_ceilometerclient() ceilometerclient.resources = self.mox.CreateMockAnything() ceilometerclient.resources.list(q=IsA(list)).AndReturn(resources) ceilometerclient.statistics = self.mox.CreateMockAnything() ceilometerclient.statistics.list(meter_name=IsA(str), period=None, q=IsA(list)).\ MultipleTimes().\ AndReturn(statistics) api.ceilometer.CeilometerUsage\ .get_user(IsA(str)).MultipleTimes().AndReturn(user) api.ceilometer.CeilometerUsage\ .get_tenant(IsA(str)).MultipleTimes().AndReturn(tenant) self.mox.ReplayAll() # getting all resources and with statistics ceilometer_usage = api.ceilometer.CeilometerUsage(http.HttpRequest) data = ceilometer_usage.global_network_traffic_usage( query=["fake_query"], with_statistics=True) first = data[0] self.assertEqual(first.id, 'fake_project_id__fake_user_id__' 'fake_resource_id') self.assertEqual(first.user.name, 'user') self.assertEqual(first.tenant.name, 'test_tenant') self.assertEqual(first.resource, 'fake_resource_id') self.assertEqual(first.network_incoming_bytes, 4.55) self.assertEqual(first.network_incoming_packets, 4.55) self.assertEqual(first.network_outgoing_bytes, 4.55) self.assertEqual(first.network_outgoing_packets, 4.55) self.assertEqual(len(data), len(resources)) self.assertIsInstance(first, api.ceilometer.GlobalNetworkTrafficUsage) @test.create_stubs({api.ceilometer.CeilometerUsage: ("get_user", "get_tenant")}) def test_global_network_usage(self): resources = self.resources.list() statistics = self.statistics.list() user = self.ceilometer_users.list()[0] tenant = self.ceilometer_tenants.list()[0] ceilometerclient = self.stub_ceilometerclient() ceilometerclient.resources = self.mox.CreateMockAnything() ceilometerclient.resources.list(q=IsA(list)).AndReturn(resources) ceilometerclient.statistics = self.mox.CreateMockAnything() ceilometerclient.statistics.list(meter_name=IsA(str), period=None, q=IsA(list)).\ MultipleTimes().\ AndReturn(statistics) api.ceilometer.CeilometerUsage\ .get_user(IsA(str)).MultipleTimes().AndReturn(user) api.ceilometer.CeilometerUsage\ .get_tenant(IsA(str)).MultipleTimes().AndReturn(tenant) self.mox.ReplayAll() # getting all resources and with statistics ceilometer_usage = api.ceilometer.CeilometerUsage(http.HttpRequest) data = ceilometer_usage.global_network_usage( query=["fake_query"], with_statistics=True) first = data[0] self.assertEqual(first.id, 'fake_project_id__fake_user_id__' 'fake_resource_id') self.assertEqual(first.user.name, 'user') self.assertEqual(first.tenant.name, 'test_tenant') self.assertEqual(first.resource, 'fake_resource_id') self.assertEqual(first.network, 9) self.assertEqual(first.network_create, 9) self.assertEqual(first.subnet, 9) self.assertEqual(first.subnet_create, 9) self.assertEqual(first.port, 9) self.assertEqual(first.port_create, 9) self.assertEqual(first.router, 9) self.assertEqual(first.router_create, 9) self.assertEqual(first.ip_floating, 9) self.assertEqual(first.ip_floating_create, 9) self.assertEqual(len(data), len(resources)) self.assertIsInstance(first, api.ceilometer.GlobalNetworkUsage) @test.create_stubs({api.ceilometer.CeilometerUsage: ("get_user", "get_tenant")}) def test_global_object_store_usage(self): resources = self.resources.list() statistics = self.statistics.list() user = self.ceilometer_users.list()[0] tenant = self.ceilometer_tenants.list()[0] ceilometerclient = self.stub_ceilometerclient() ceilometerclient.resources = self.mox.CreateMockAnything() ceilometerclient.resources.list(q=IsA(list)).AndReturn(resources) ceilometerclient.statistics = self.mox.CreateMockAnything() ceilometerclient.statistics.list(meter_name=IsA(str), period=None, q=IsA(list)).\ MultipleTimes().\ AndReturn(statistics) api.ceilometer.CeilometerUsage\ .get_user(IsA(str)).MultipleTimes().AndReturn(user) api.ceilometer.CeilometerUsage\ .get_tenant(IsA(str)).MultipleTimes().AndReturn(tenant) self.mox.ReplayAll() # getting all resources and with statistics ceilometer_usage = api.ceilometer.CeilometerUsage(http.HttpRequest) data = ceilometer_usage.global_object_store_usage( query=["fake_query"], with_statistics=True) first = data[0] self.assertEqual(first.id, 'fake_project_id__fake_user_id__' 'fake_resource_id') self.assertEqual(first.user.name, 'user') self.assertEqual(first.tenant.name, 'test_tenant') self.assertEqual(first.resource, 'fake_resource_id') self.assertEqual(first.storage_objects, 4.55) self.assertEqual(first.storage_objects_size, 4.55) self.assertEqual(first.storage_objects_incoming_bytes, 4.55) self.assertEqual(first.storage_objects_outgoing_bytes, 4.55) self.assertEqual(len(data), len(resources)) self.assertIsInstance(first, api.ceilometer.GlobalObjectStoreUsage)
# # Licensed to the Apache Software Foundation (ASF) under one or more # contributor license agreements. See the NOTICE file distributed with # this work for additional information regarding copyright ownership. # The ASF licenses this file to You under the Apache License, Version 2.0 # (the "License"); you may not use this file except in compliance with # the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # """Implements a source for reading Avro files.""" import cStringIO import os import zlib import avro from avro import datafile from avro import io as avroio from avro import schema import apache_beam as beam from apache_beam.io import filebasedsource from apache_beam.io import filebasedsink from apache_beam.io import iobase from apache_beam.io.filesystem import CompressionTypes from apache_beam.io.iobase import Read from apache_beam.transforms import PTransform __all__ = ['ReadFromAvro', 'WriteToAvro'] class ReadFromAvro(PTransform): """A ``PTransform`` for reading avro files.""" def __init__(self, file_pattern=None, min_bundle_size=0, validate=True): """Initializes ``ReadFromAvro``. Uses source '_AvroSource' to read a set of Avro files defined by a given file pattern. If '/mypath/myavrofiles*' is a file-pattern that points to a set of Avro files, a ``PCollection`` for the records in these Avro files can be created in the following manner. p = df.Pipeline(argv=pipeline_args) records = p | 'Read' >> df.io.ReadFromAvro('/mypath/myavrofiles*') Each record of this ``PCollection`` will contain a single record read from a source. Records that are of simple types will be mapped into corresponding Python types. Records that are of Avro type 'RECORD' will be mapped to Python dictionaries that comply with the schema contained in the Avro file that contains those records. In this case, keys of each dictionary will contain the corresponding field names and will be of type ``string`` while the values of the dictionary will be of the type defined in the corresponding Avro schema. For example, if schema of the Avro file is the following. {"namespace": "example.avro","type": "record","name": "User","fields": [{"name": "name", "type": "string"}, {"name": "favorite_number", "type": ["int", "null"]}, {"name": "favorite_color", "type": ["string", "null"]}]} Then records generated by ``AvroSource`` will be dictionaries of the following form. {u'name': u'Alyssa', u'favorite_number': 256, u'favorite_color': None}). Args: file_pattern: the set of files to be read. min_bundle_size: the minimum size in bytes, to be considered when splitting the input into bundles. validate: flag to verify that the files exist during the pipeline creation time. """ super(ReadFromAvro, self).__init__() self._source = _AvroSource(file_pattern, min_bundle_size, validate=validate) def expand(self, pvalue): return pvalue.pipeline | Read(self._source) def display_data(self): return {'source_dd': self._source} class _AvroUtils(object): @staticmethod def read_meta_data_from_file(f): """Reads metadata from a given Avro file. Args: f: Avro file to read. Returns: a tuple containing the codec, schema, and the sync marker of the Avro file. Raises: ValueError: if the file does not start with the byte sequence defined in the specification. """ if f.tell() > 0: f.seek(0) decoder = avroio.BinaryDecoder(f) header = avroio.DatumReader().read_data(datafile.META_SCHEMA, datafile.META_SCHEMA, decoder) if header.get('magic') != datafile.MAGIC: raise ValueError('Not an Avro file. File header should start with %s but' 'started with %s instead.', datafile.MAGIC, header.get('magic')) meta = header['meta'] if datafile.CODEC_KEY in meta: codec = meta[datafile.CODEC_KEY] else: codec = 'null' schema_string = meta[datafile.SCHEMA_KEY] sync_marker = header['sync'] return codec, schema_string, sync_marker @staticmethod def read_block_from_file(f, codec, schema, expected_sync_marker): """Reads a block from a given Avro file. Args: f: Avro file to read. codec: The codec to use for block-level decompression. Supported codecs: 'null', 'deflate', 'snappy' schema: Avro Schema definition represented as JSON string. expected_sync_marker: Avro synchronization marker. If the block's sync marker does not match with this parameter then ValueError is thrown. Returns: A single _AvroBlock. Raises: ValueError: If the block cannot be read properly because the file doesn't match the specification. """ offset = f.tell() decoder = avroio.BinaryDecoder(f) num_records = decoder.read_long() block_size = decoder.read_long() block_bytes = decoder.read(block_size) sync_marker = decoder.read(len(expected_sync_marker)) if sync_marker != expected_sync_marker: raise ValueError('Unexpected sync marker (actual "%s" vs expected "%s"). ' 'Maybe the underlying avro file is corrupted?', sync_marker, expected_sync_marker) size = f.tell() - offset return _AvroBlock(block_bytes, num_records, codec, schema, offset, size) @staticmethod def advance_file_past_next_sync_marker(f, sync_marker): buf_size = 10000 data = f.read(buf_size) while data: pos = data.find(sync_marker) if pos >= 0: # Adjusting the current position to the ending position of the sync # marker. backtrack = len(data) - pos - len(sync_marker) f.seek(-1 * backtrack, os.SEEK_CUR) return True else: if f.tell() >= len(sync_marker): # Backtracking in case we partially read the sync marker during the # previous read. We only have to backtrack if there are at least # len(sync_marker) bytes before current position. We only have to # backtrack (len(sync_marker) - 1) bytes. f.seek(-1 * (len(sync_marker) - 1), os.SEEK_CUR) data = f.read(buf_size) class _AvroBlock(object): """Represents a block of an Avro file.""" def __init__(self, block_bytes, num_records, codec, schema_string, offset, size): # Decompress data early on (if needed) and thus decrease the number of # parallel copies of the data in memory at any given in time during # block iteration. self._decompressed_block_bytes = self._decompress_bytes(block_bytes, codec) self._num_records = num_records self._schema = schema.parse(schema_string) self._offset = offset self._size = size def size(self): return self._size def offset(self): return self._offset @staticmethod def _decompress_bytes(data, codec): if codec == 'null': return data elif codec == 'deflate': # zlib.MAX_WBITS is the window size. '-' sign indicates that this is # raw data (without headers). See zlib and Avro documentations for more # details. return zlib.decompress(data, -zlib.MAX_WBITS) elif codec == 'snappy': # Snappy is an optional avro codec. # See Snappy and Avro documentation for more details. try: import snappy except ImportError: raise ValueError('Snappy does not seem to be installed.') # Compressed data includes a 4-byte CRC32 checksum which we verify. # We take care to avoid extra copies of data while slicing large objects # by use of a buffer. result = snappy.decompress(buffer(data)[:-4]) avroio.BinaryDecoder(cStringIO.StringIO(data[-4:])).check_crc32(result) return result else: raise ValueError('Unknown codec: %r', codec) def num_records(self): return self._num_records def records(self): decoder = avroio.BinaryDecoder( cStringIO.StringIO(self._decompressed_block_bytes)) reader = avroio.DatumReader( writers_schema=self._schema, readers_schema=self._schema) current_record = 0 while current_record < self._num_records: yield reader.read(decoder) current_record += 1 class _AvroSource(filebasedsource.FileBasedSource): """A source for reading Avro files. ``_AvroSource`` is implemented using the file-based source framework available in module 'filebasedsource'. Hence please refer to module 'filebasedsource' to fully understand how this source implements operations common to all file-based sources such as file-pattern expansion and splitting into bundles for parallel processing. """ def read_records(self, file_name, range_tracker): next_block_start = -1 def split_points_unclaimed(stop_position): if next_block_start >= stop_position: # Next block starts at or after the suggested stop position. Hence # there will not be split points to be claimed for the range ending at # suggested stop position. return 0 return iobase.RangeTracker.SPLIT_POINTS_UNKNOWN range_tracker.set_split_points_unclaimed_callback(split_points_unclaimed) start_offset = range_tracker.start_position() if start_offset is None: start_offset = 0 with self.open_file(file_name) as f: codec, schema_string, sync_marker = _AvroUtils.read_meta_data_from_file( f) # We have to start at current position if previous bundle ended at the # end of a sync marker. start_offset = max(0, start_offset - len(sync_marker)) f.seek(start_offset) _AvroUtils.advance_file_past_next_sync_marker(f, sync_marker) while range_tracker.try_claim(f.tell()): block = _AvroUtils.read_block_from_file(f, codec, schema_string, sync_marker) next_block_start = block.offset() + block.size() for record in block.records(): yield record class WriteToAvro(beam.transforms.PTransform): """A ``PTransform`` for writing avro files.""" def __init__(self, file_path_prefix, schema, codec='deflate', file_name_suffix='', num_shards=0, shard_name_template=None, mime_type='application/x-avro'): """Initialize a WriteToAvro transform. Args: file_path_prefix: The file path to write to. The files written will begin with this prefix, followed by a shard identifier (see num_shards), and end in a common extension, if given by file_name_suffix. In most cases, only this argument is specified and num_shards, shard_name_template, and file_name_suffix use default values. schema: The schema to use, as returned by avro.schema.parse codec: The codec to use for block-level compression. Any string supported by the Avro specification is accepted (for example 'null'). file_name_suffix: Suffix for the files written. num_shards: The number of files (shards) used for output. If not set, the service will decide on the optimal number of shards. Constraining the number of shards is likely to reduce the performance of a pipeline. Setting this value is not recommended unless you require a specific number of output files. shard_name_template: A template string containing placeholders for the shard number and shard count. Currently only '' and '-SSSSS-of-NNNNN' are patterns accepted by the service. When constructing a filename for a particular shard number, the upper-case letters 'S' and 'N' are replaced with the 0-padded shard number and shard count respectively. This argument can be '' in which case it behaves as if num_shards was set to 1 and only one file will be generated. The default pattern used is '-SSSSS-of-NNNNN'. mime_type: The MIME type to use for the produced files, if the filesystem supports specifying MIME types. Returns: A WriteToAvro transform usable for writing. """ self._sink = _AvroSink(file_path_prefix, schema, codec, file_name_suffix, num_shards, shard_name_template, mime_type) def expand(self, pcoll): return pcoll | beam.io.iobase.Write(self._sink) def display_data(self): return {'sink_dd': self._sink} class _AvroSink(filebasedsink.FileBasedSink): """A sink to avro files.""" def __init__(self, file_path_prefix, schema, codec, file_name_suffix, num_shards, shard_name_template, mime_type): super(_AvroSink, self).__init__( file_path_prefix, file_name_suffix=file_name_suffix, num_shards=num_shards, shard_name_template=shard_name_template, coder=None, mime_type=mime_type, # Compression happens at the block level using the supplied codec, and # not at the file level. compression_type=CompressionTypes.UNCOMPRESSED) self._schema = schema self._codec = codec def open(self, temp_path): file_handle = super(_AvroSink, self).open(temp_path) return avro.datafile.DataFileWriter( file_handle, avro.io.DatumWriter(), self._schema, self._codec) def write_record(self, writer, value): writer.append(value) def display_data(self): res = super(self.__class__, self).display_data() res['codec'] = str(self._codec) res['schema'] = str(self._schema) return res
# Copyright 2017 Google LLC All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Classes for representing collections for the Google Cloud Firestore API.""" import random import warnings import six from google.cloud.firestore_v1beta1 import _helpers from google.cloud.firestore_v1beta1 import query as query_mod from google.cloud.firestore_v1beta1.proto import document_pb2 from google.cloud.firestore_v1beta1.watch import Watch from google.cloud.firestore_v1beta1 import document _AUTO_ID_CHARS = "ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789" class CollectionReference(object): """A reference to a collection in a Firestore database. The collection may already exist or this class can facilitate creation of documents within the collection. Args: path (Tuple[str, ...]): The components in the collection path. This is a series of strings representing each collection and sub-collection ID, as well as the document IDs for any documents that contain a sub-collection. kwargs (dict): The keyword arguments for the constructor. The only supported keyword is ``client`` and it must be a :class:`~google.cloud.firestore_v1beta1.client.Client` if provided. It represents the client that created this collection reference. Raises: ValueError: if * the ``path`` is empty * there are an even number of elements * a collection ID in ``path`` is not a string * a document ID in ``path`` is not a string TypeError: If a keyword other than ``client`` is used. """ def __init__(self, *path, **kwargs): _helpers.verify_path(path, is_collection=True) self._path = path self._client = kwargs.pop("client", None) if kwargs: raise TypeError( "Received unexpected arguments", kwargs, "Only `client` is supported" ) def __eq__(self, other): if not isinstance(other, self.__class__): return NotImplemented return self._path == other._path and self._client == other._client @property def id(self): """The collection identifier. Returns: str: The last component of the path. """ return self._path[-1] @property def parent(self): """Document that owns the current collection. Returns: Optional[~.firestore_v1beta1.document.DocumentReference]: The parent document, if the current collection is not a top-level collection. """ if len(self._path) == 1: return None else: parent_path = self._path[:-1] return self._client.document(*parent_path) def document(self, document_id=None): """Create a sub-document underneath the current collection. Args: document_id (Optional[str]): The document identifier within the current collection. If not provided, will default to a random 20 character string composed of digits, uppercase and lowercase and letters. Returns: ~.firestore_v1beta1.document.DocumentReference: The child document. """ if document_id is None: document_id = _auto_id() child_path = self._path + (document_id,) return self._client.document(*child_path) def _parent_info(self): """Get fully-qualified parent path and prefix for this collection. Returns: Tuple[str, str]: Pair of * the fully-qualified (with database and project) path to the parent of this collection (will either be the database path or a document path). * the prefix to a document in this collection. """ parent_doc = self.parent if parent_doc is None: parent_path = _helpers.DOCUMENT_PATH_DELIMITER.join( (self._client._database_string, "documents") ) else: parent_path = parent_doc._document_path expected_prefix = _helpers.DOCUMENT_PATH_DELIMITER.join((parent_path, self.id)) return parent_path, expected_prefix def add(self, document_data, document_id=None): """Create a document in the Firestore database with the provided data. Args: document_data (dict): Property names and values to use for creating the document. document_id (Optional[str]): The document identifier within the current collection. If not provided, an ID will be automatically assigned by the server (the assigned ID will be a random 20 character string composed of digits, uppercase and lowercase letters). Returns: Tuple[google.protobuf.timestamp_pb2.Timestamp, \ ~.firestore_v1beta1.document.DocumentReference]: Pair of * The ``update_time`` when the document was created (or overwritten). * A document reference for the created document. Raises: ~google.cloud.exceptions.Conflict: If ``document_id`` is provided and the document already exists. """ if document_id is None: parent_path, expected_prefix = self._parent_info() document_pb = document_pb2.Document() created_document_pb = self._client._firestore_api.create_document( parent_path, collection_id=self.id, document_id=None, document=document_pb, mask=None, metadata=self._client._rpc_metadata, ) new_document_id = _helpers.get_doc_id(created_document_pb, expected_prefix) document_ref = self.document(new_document_id) set_result = document_ref.set(document_data) return set_result.update_time, document_ref else: document_ref = self.document(document_id) write_result = document_ref.create(document_data) return write_result.update_time, document_ref def list_documents(self, page_size=None): """List all subdocuments of the current collection. Args: page_size (Optional[int]]): The maximum number of documents in each page of results from this request. Non-positive values are ignored. Defaults to a sensible value set by the API. Returns: Sequence[~.firestore_v1beta1.collection.DocumentReference]: iterator of subdocuments of the current collection. If the collection does not exist at the time of `snapshot`, the iterator will be empty """ parent, _ = self._parent_info() iterator = self._client._firestore_api.list_documents( parent, self.id, page_size=page_size, show_missing=True, metadata=self._client._rpc_metadata, ) iterator.collection = self iterator.item_to_value = _item_to_document_ref return iterator def select(self, field_paths): """Create a "select" query with this collection as parent. See :meth:`~google.cloud.firestore_v1beta1.query.Query.select` for more information on this method. Args: field_paths (Iterable[str, ...]): An iterable of field paths (``.``-delimited list of field names) to use as a projection of document fields in the query results. Returns: ~.firestore_v1beta1.query.Query: A "projected" query. """ query = query_mod.Query(self) return query.select(field_paths) def where(self, field_path, op_string, value): """Create a "where" query with this collection as parent. See :meth:`~google.cloud.firestore_v1beta1.query.Query.where` for more information on this method. Args: field_path (str): A field path (``.``-delimited list of field names) for the field to filter on. op_string (str): A comparison operation in the form of a string. Acceptable values are ``<``, ``<=``, ``==``, ``>=`` and ``>``. value (Any): The value to compare the field against in the filter. If ``value`` is :data:`None` or a NaN, then ``==`` is the only allowed operation. Returns: ~.firestore_v1beta1.query.Query: A filtered query. """ query = query_mod.Query(self) return query.where(field_path, op_string, value) def order_by(self, field_path, **kwargs): """Create an "order by" query with this collection as parent. See :meth:`~google.cloud.firestore_v1beta1.query.Query.order_by` for more information on this method. Args: field_path (str): A field path (``.``-delimited list of field names) on which to order the query results. kwargs (Dict[str, Any]): The keyword arguments to pass along to the query. The only supported keyword is ``direction``, see :meth:`~google.cloud.firestore_v1beta1.query.Query.order_by` for more information. Returns: ~.firestore_v1beta1.query.Query: An "order by" query. """ query = query_mod.Query(self) return query.order_by(field_path, **kwargs) def limit(self, count): """Create a limited query with this collection as parent. See :meth:`~google.cloud.firestore_v1beta1.query.Query.limit` for more information on this method. Args: count (int): Maximum number of documents to return that match the query. Returns: ~.firestore_v1beta1.query.Query: A limited query. """ query = query_mod.Query(self) return query.limit(count) def offset(self, num_to_skip): """Skip to an offset in a query with this collection as parent. See :meth:`~google.cloud.firestore_v1beta1.query.Query.offset` for more information on this method. Args: num_to_skip (int): The number of results to skip at the beginning of query results. (Must be non-negative.) Returns: ~.firestore_v1beta1.query.Query: An offset query. """ query = query_mod.Query(self) return query.offset(num_to_skip) def start_at(self, document_fields): """Start query at a cursor with this collection as parent. See :meth:`~google.cloud.firestore_v1beta1.query.Query.start_at` for more information on this method. Args: document_fields (Union[~.firestore_v1beta1.\ document.DocumentSnapshot, dict, list, tuple]): a document snapshot or a dictionary/list/tuple of fields representing a query results cursor. A cursor is a collection of values that represent a position in a query result set. Returns: ~.firestore_v1beta1.query.Query: A query with cursor. """ query = query_mod.Query(self) return query.start_at(document_fields) def start_after(self, document_fields): """Start query after a cursor with this collection as parent. See :meth:`~google.cloud.firestore_v1beta1.query.Query.start_after` for more information on this method. Args: document_fields (Union[~.firestore_v1beta1.\ document.DocumentSnapshot, dict, list, tuple]): a document snapshot or a dictionary/list/tuple of fields representing a query results cursor. A cursor is a collection of values that represent a position in a query result set. Returns: ~.firestore_v1beta1.query.Query: A query with cursor. """ query = query_mod.Query(self) return query.start_after(document_fields) def end_before(self, document_fields): """End query before a cursor with this collection as parent. See :meth:`~google.cloud.firestore_v1beta1.query.Query.end_before` for more information on this method. Args: document_fields (Union[~.firestore_v1beta1.\ document.DocumentSnapshot, dict, list, tuple]): a document snapshot or a dictionary/list/tuple of fields representing a query results cursor. A cursor is a collection of values that represent a position in a query result set. Returns: ~.firestore_v1beta1.query.Query: A query with cursor. """ query = query_mod.Query(self) return query.end_before(document_fields) def end_at(self, document_fields): """End query at a cursor with this collection as parent. See :meth:`~google.cloud.firestore_v1beta1.query.Query.end_at` for more information on this method. Args: document_fields (Union[~.firestore_v1beta1.\ document.DocumentSnapshot, dict, list, tuple]): a document snapshot or a dictionary/list/tuple of fields representing a query results cursor. A cursor is a collection of values that represent a position in a query result set. Returns: ~.firestore_v1beta1.query.Query: A query with cursor. """ query = query_mod.Query(self) return query.end_at(document_fields) def get(self, transaction=None): """Deprecated alias for :meth:`stream`.""" warnings.warn( "'Collection.get' is deprecated: please use 'Collection.stream' instead.", DeprecationWarning, stacklevel=2, ) return self.stream(transaction=transaction) def stream(self, transaction=None): """Read the documents in this collection. This sends a ``RunQuery`` RPC and then returns an iterator which consumes each document returned in the stream of ``RunQueryResponse`` messages. .. note:: The underlying stream of responses will time out after the ``max_rpc_timeout_millis`` value set in the GAPIC client configuration for the ``RunQuery`` API. Snapshots not consumed from the iterator before that point will be lost. If a ``transaction`` is used and it already has write operations added, this method cannot be used (i.e. read-after-write is not allowed). Args: transaction (Optional[~.firestore_v1beta1.transaction.\ Transaction]): An existing transaction that the query will run in. Yields: ~.firestore_v1beta1.document.DocumentSnapshot: The next document that fulfills the query. """ query = query_mod.Query(self) return query.stream(transaction=transaction) def on_snapshot(self, callback): """Monitor the documents in this collection. This starts a watch on this collection using a background thread. The provided callback is run on the snapshot of the documents. Args: callback(~.firestore.collection.CollectionSnapshot): a callback to run when a change occurs. Example: from google.cloud import firestore_v1beta1 db = firestore_v1beta1.Client() collection_ref = db.collection(u'users') def on_snapshot(collection_snapshot): for doc in collection_snapshot.documents: print(u'{} => {}'.format(doc.id, doc.to_dict())) # Watch this collection collection_watch = collection_ref.on_snapshot(on_snapshot) # Terminate this watch collection_watch.unsubscribe() """ return Watch.for_query( query_mod.Query(self), callback, document.DocumentSnapshot, document.DocumentReference, ) def _auto_id(): """Generate a "random" automatically generated ID. Returns: str: A 20 character string composed of digits, uppercase and lowercase and letters. """ return "".join(random.choice(_AUTO_ID_CHARS) for _ in six.moves.xrange(20)) def _item_to_document_ref(iterator, item): """Convert Document resource to document ref. Args: iterator (google.api_core.page_iterator.GRPCIterator): iterator response item (dict): document resource """ document_id = item.name.split(_helpers.DOCUMENT_PATH_DELIMITER)[-1] return iterator.collection.document(document_id)
#!/usr/bin/env python3 # Copyright 2013-2014 The Meson development team # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # http://www.apache.org/licenses/LICENSE-2.0 # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import sys, pickle, os, shutil, subprocess, gzip, platform from glob import glob def do_install(datafilename): ifile = open(datafilename, 'rb') d = pickle.load(ifile) destdir_var = 'DESTDIR' if destdir_var in os.environ: d.destdir = os.environ[destdir_var] else: d.destdir = '' d.fullprefix = d.destdir + d.prefix install_subdirs(d) # Must be first, because it needs to delete the old subtree. install_targets(d) install_headers(d) install_man(d) install_data(d) install_po(d) run_install_script(d) def install_subdirs(d): for (src_dir, dst_dir) in d.install_subdirs: if os.path.isabs(dst_dir): dst_dir = d.destdir + dst_dir else: dst_dir = d.fullprefix + dst_dir # Python's copytree works in strange ways. last_level = os.path.split(src_dir)[-1] final_dst = os.path.join(dst_dir, last_level) # Don't do rmtree because final_dst might point to e.g. /var/www # We might need to revert to walking the directory tree by hand. # shutil.rmtree(final_dst, ignore_errors=True) shutil.copytree(src_dir, final_dst, symlinks=True) print('Installing subdir %s to %s.' % (src_dir, dst_dir)) def install_po(d): packagename = d.po_package_name for f in d.po: srcfile = f[0] localedir = f[1] languagename = f[2] outfile = os.path.join(d.fullprefix, localedir, languagename, 'LC_MESSAGES', packagename + '.mo') os.makedirs(os.path.split(outfile)[0], exist_ok=True) shutil.copyfile(srcfile, outfile) shutil.copystat(srcfile, outfile) print('Installing %s to %s.' % (srcfile, outfile)) def install_data(d): for i in d.data: fullfilename = i[0] outfilename = i[1] if os.path.isabs(outfilename): outdir = d.destdir + os.path.split(outfilename)[0] outfilename = d.destdir + outfilename else: outdir = os.path.join(d.fullprefix, os.path.split(outfilename)[0]) outfilename = os.path.join(outdir, os.path.split(outfilename)[1]) os.makedirs(outdir, exist_ok=True) print('Installing %s to %s.' % (fullfilename, outdir)) shutil.copyfile(fullfilename, outfilename) shutil.copystat(fullfilename, outfilename) def install_man(d): for m in d.man: outfileroot = m[1] outfilename = os.path.join(d.fullprefix, outfileroot) full_source_filename = m[0] outdir = os.path.split(outfilename)[0] os.makedirs(outdir, exist_ok=True) print('Installing %s to %s.' % (full_source_filename, outdir)) if outfilename.endswith('.gz') and not full_source_filename.endswith('.gz'): open(outfilename, 'wb').write(gzip.compress(open(full_source_filename, 'rb').read())) else: shutil.copyfile(full_source_filename, outfilename) shutil.copystat(full_source_filename, outfilename) def install_headers(d): for t in d.headers: fullfilename = t[0] outdir = os.path.join(d.fullprefix, t[1]) fname = os.path.split(fullfilename)[1] outfilename = os.path.join(outdir, fname) print('Installing %s to %s' % (fname, outdir)) os.makedirs(outdir, exist_ok=True) shutil.copyfile(fullfilename, outfilename) shutil.copystat(fullfilename, outfilename) def run_install_script(d): env = {'MESON_SOURCE_ROOT' : d.source_dir, 'MESON_BUILD_ROOT' : d.build_dir, 'MESON_INSTALL_PREFIX' : d.prefix } child_env = os.environ.copy() child_env.update(env) for i in d.install_scripts: script = i.cmd_arr[0] print('Running custom install script %s' % script) suffix = os.path.splitext(script)[1].lower() if platform.system().lower() == 'windows' and suffix != '.bat': first_line = open(script).readline().strip() if first_line.startswith('#!'): commands = first_line[2:].split('#')[0].strip().split() commands[0] = shutil.which(commands[0].split('/')[-1]) if commands[0] is None: raise RuntimeError("Don't know how to run script %s." % script) final_command = commands + [script] + i.cmd_arr[1:] else: final_command = i.cmd_arr try: rc = subprocess.call(final_command, env=child_env) if rc != 0: sys.exit(rc) except Exception: print('Failed to run install script:', i.cmd_arr[0]) sys.exit(1) def is_elf_platform(): platname = platform.system().lower() if platname == 'darwin' or platname == 'windows': return False return True def check_for_stampfile(fname): '''Some languages e.g. Rust have output files whose names are not known at configure time. Check if this is the case and return the real file instead.''' if fname.endswith('.so') or fname.endswith('.dll'): if os.stat(fname).st_size == 0: (base, suffix) = os.path.splitext(fname) files = glob(base + '-*' + suffix) if len(files) > 1: print("Stale dynamic library files in build dir. Can't install.") sys.exit(1) if len(files) == 1: return files[0] elif fname.endswith('.a') or fname.endswith('.lib'): if os.stat(fname).st_size == 0: (base, suffix) = os.path.splitext(fname) files = glob(base + '-*' + '.rlib') if len(files) > 1: print("Stale static library files in build dir. Can't install.") sys.exit(1) if len(files) == 1: return files[0] return fname def install_targets(d): for t in d.targets: fname = check_for_stampfile(t[0]) outdir = os.path.join(d.fullprefix, t[1]) aliases = t[2] outname = os.path.join(outdir, os.path.split(fname)[-1]) should_strip = t[3] install_rpath = t[4] print('Installing %s to %s' % (fname, outname)) os.makedirs(outdir, exist_ok=True) shutil.copyfile(fname, outname) shutil.copystat(fname, outname) if should_strip: print('Stripping target') ps = subprocess.Popen(['strip', outname], stdout=subprocess.PIPE, stderr=subprocess.PIPE) (stdo, stde) = ps.communicate() if ps.returncode != 0: print('Could not strip file.\n') print('Stdout:\n%s\n' % stdo.decode()) print('Stderr:\n%s\n' % stde.decode()) sys.exit(1) printed_symlink_error = False for alias in aliases: try: symlinkfilename = os.path.join(outdir, alias) try: os.unlink(symlinkfilename) except FileNotFoundError: pass os.symlink(os.path.split(fname)[-1], symlinkfilename) except (NotImplementedError, OSError): if not printed_symlink_error: print("Symlink creation does not work on this platform.") printed_symlink_error = True if is_elf_platform(): p = subprocess.Popen(d.depfixer + [outname, install_rpath], stdout=subprocess.PIPE, stderr=subprocess.PIPE) (stdo, stde) = p.communicate() if p.returncode != 0: print('Could not fix dependency info.\n') print('Stdout:\n%s\n' % stdo.decode()) print('Stderr:\n%s\n' % stde.decode()) sys.exit(1) def run(args): if len(args) != 1: print('Installer script for Meson. Do not run on your own, mmm\'kay?') print('meson_install.py [install info file]') datafilename = args[0] do_install(datafilename) return 0 if __name__ == '__main__': sys.exit(run(sys.argv[1:]))
"""HTTP server classes. Note: BaseHTTPRequestHandler doesn't implement any HTTP request; see SimpleHTTPRequestHandler for simple implementations of GET, HEAD and POST, and CGIHTTPRequestHandler for CGI scripts. It does, however, optionally implement HTTP/1.1 persistent connections, as of version 0.3. Notes on CGIHTTPRequestHandler ------------------------------ This class implements GET and POST requests to cgi-bin scripts. If the os.fork() function is not present (e.g. on Windows), subprocess.Popen() is used as a fallback, with slightly altered semantics. In all cases, the implementation is intentionally naive -- all requests are executed synchronously. SECURITY WARNING: DON'T USE THIS CODE UNLESS YOU ARE INSIDE A FIREWALL -- it may execute arbitrary Python code or external programs. Note that status code 200 is sent prior to execution of a CGI script, so scripts cannot send other status codes such as 302 (redirect). XXX To do: - log requests even later (to capture byte count) - log user-agent header and other interesting goodies - send error log to separate file """ # See also: # # HTTP Working Group T. Berners-Lee # INTERNET-DRAFT R. T. Fielding # <draft-ietf-http-v10-spec-00.txt> H. Frystyk Nielsen # Expires September 8, 1995 March 8, 1995 # # URL: http://www.ics.uci.edu/pub/ietf/http/draft-ietf-http-v10-spec-00.txt # # and # # Network Working Group R. Fielding # Request for Comments: 2616 et al # Obsoletes: 2068 June 1999 # Category: Standards Track # # URL: http://www.faqs.org/rfcs/rfc2616.html # Log files # --------- # # Here's a quote from the NCSA httpd docs about log file format. # # | The logfile format is as follows. Each line consists of: # | # | host rfc931 authuser [DD/Mon/YYYY:hh:mm:ss] "request" ddd bbbb # | # | host: Either the DNS name or the IP number of the remote client # | rfc931: Any information returned by identd for this person, # | - otherwise. # | authuser: If user sent a userid for authentication, the user name, # | - otherwise. # | DD: Day # | Mon: Month (calendar name) # | YYYY: Year # | hh: hour (24-hour format, the machine's timezone) # | mm: minutes # | ss: seconds # | request: The first line of the HTTP request as sent by the client. # | ddd: the status code returned by the server, - if not available. # | bbbb: the total number of bytes sent, # | *not including the HTTP/1.0 header*, - if not available # | # | You can determine the name of the file accessed through request. # # (Actually, the latter is only true if you know the server configuration # at the time the request was made!) __version__ = "0.6" __all__ = ["HTTPServer", "BaseHTTPRequestHandler"] import html import email.message import email.parser import http.client import io import mimetypes import os import posixpath import select import shutil import socket # For gethostbyaddr() import socketserver import sys import time import urllib.parse import copy # Default error message template DEFAULT_ERROR_MESSAGE = """\ <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd"> <head> <meta http-equiv="Content-Type" content="text/html;charset=utf-8"> <title>Error response</title> </head> <body> <h1>Error response</h1> <p>Error code: %(code)d</p> <p>Message: %(message)s.</p> <p>Error code explanation: %(code)s - %(explain)s.</p> </body> </html> """ DEFAULT_ERROR_CONTENT_TYPE = "text/html;charset=utf-8" def _quote_html(html): return html.replace("&", "&amp;").replace("<", "&lt;").replace(">", "&gt;") class HTTPServer(socketserver.TCPServer): allow_reuse_address = 1 # Seems to make sense in testing environment def server_bind(self): """Override server_bind to store the server name.""" socketserver.TCPServer.server_bind(self) host, port = self.socket.getsockname()[:2] self.server_name = socket.getfqdn(host) self.server_port = port class BaseHTTPRequestHandler(socketserver.StreamRequestHandler): """HTTP request handler base class. The following explanation of HTTP serves to guide you through the code as well as to expose any misunderstandings I may have about HTTP (so you don't need to read the code to figure out I'm wrong :-). HTTP (HyperText Transfer Protocol) is an extensible protocol on top of a reliable stream transport (e.g. TCP/IP). The protocol recognizes three parts to a request: 1. One line identifying the request type and path 2. An optional set of RFC-822-style headers 3. An optional data part The headers and data are separated by a blank line. The first line of the request has the form <command> <path> <version> where <command> is a (case-sensitive) keyword such as GET or POST, <path> is a string containing path information for the request, and <version> should be the string "HTTP/1.0" or "HTTP/1.1". <path> is encoded using the URL encoding scheme (using %xx to signify the ASCII character with hex code xx). The specification specifies that lines are separated by CRLF but for compatibility with the widest range of clients recommends servers also handle LF. Similarly, whitespace in the request line is treated sensibly (allowing multiple spaces between components and allowing trailing whitespace). Similarly, for output, lines ought to be separated by CRLF pairs but most clients grok LF characters just fine. If the first line of the request has the form <command> <path> (i.e. <version> is left out) then this is assumed to be an HTTP 0.9 request; this form has no optional headers and data part and the reply consists of just the data. The reply form of the HTTP 1.x protocol again has three parts: 1. One line giving the response code 2. An optional set of RFC-822-style headers 3. The data Again, the headers and data are separated by a blank line. The response code line has the form <version> <responsecode> <responsestring> where <version> is the protocol version ("HTTP/1.0" or "HTTP/1.1"), <responsecode> is a 3-digit response code indicating success or failure of the request, and <responsestring> is an optional human-readable string explaining what the response code means. This server parses the request and the headers, and then calls a function specific to the request type (<command>). Specifically, a request SPAM will be handled by a method do_SPAM(). If no such method exists the server sends an error response to the client. If it exists, it is called with no arguments: do_SPAM() Note that the request name is case sensitive (i.e. SPAM and spam are different requests). The various request details are stored in instance variables: - client_address is the client IP address in the form (host, port); - command, path and version are the broken-down request line; - headers is an instance of email.message.Message (or a derived class) containing the header information; - rfile is a file object open for reading positioned at the start of the optional input data part; - wfile is a file object open for writing. IT IS IMPORTANT TO ADHERE TO THE PROTOCOL FOR WRITING! The first thing to be written must be the response line. Then follow 0 or more header lines, then a blank line, and then the actual data (if any). The meaning of the header lines depends on the command executed by the server; in most cases, when data is returned, there should be at least one header line of the form Content-type: <type>/<subtype> where <type> and <subtype> should be registered MIME types, e.g. "text/html" or "text/plain". """ # The Python system version, truncated to its first component. sys_version = "Python/" + sys.version.split()[0] # The server software version. You may want to override this. # The format is multiple whitespace-separated strings, # where each string is of the form name[/version]. server_version = "BaseHTTP/" + __version__ error_message_format = DEFAULT_ERROR_MESSAGE error_content_type = DEFAULT_ERROR_CONTENT_TYPE # The default request version. This only affects responses up until # the point where the request line is parsed, so it mainly decides what # the client gets back when sending a malformed request line. # Most web servers default to HTTP 0.9, i.e. don't send a status line. default_request_version = "HTTP/0.9" def parse_request(self): """Parse a request (internal). The request should be stored in self.raw_requestline; the results are in self.command, self.path, self.request_version and self.headers. Return True for success, False for failure; on failure, an error is sent back. """ self.command = None # set in case of error on the first line self.request_version = version = self.default_request_version self.close_connection = 1 requestline = str(self.raw_requestline, 'iso-8859-1') requestline = requestline.rstrip('\r\n') self.requestline = requestline words = requestline.split() if len(words) == 3: command, path, version = words if version[:5] != 'HTTP/': self.send_error(400, "Bad request version (%r)" % version) return False try: base_version_number = version.split('/', 1)[1] version_number = base_version_number.split(".") # RFC 2145 section 3.1 says there can be only one "." and # - major and minor numbers MUST be treated as # separate integers; # - HTTP/2.4 is a lower version than HTTP/2.13, which in # turn is lower than HTTP/12.3; # - Leading zeros MUST be ignored by recipients. if len(version_number) != 2: raise ValueError version_number = int(version_number[0]), int(version_number[1]) except (ValueError, IndexError): self.send_error(400, "Bad request version (%r)" % version) return False if version_number >= (1, 1) and self.protocol_version >= "HTTP/1.1": self.close_connection = 0 if version_number >= (2, 0): self.send_error(505, "Invalid HTTP Version (%s)" % base_version_number) return False elif len(words) == 2: command, path = words self.close_connection = 1 if command != 'GET': self.send_error(400, "Bad HTTP/0.9 request type (%r)" % command) return False elif not words: return False else: self.send_error(400, "Bad request syntax (%r)" % requestline) return False self.command, self.path, self.request_version = command, path, version # Examine the headers and look for a Connection directive. try: self.headers = http.client.parse_headers(self.rfile, _class=self.MessageClass) except http.client.LineTooLong: self.send_error(400, "Line too long") return False conntype = self.headers.get('Connection', "") if conntype.lower() == 'close': self.close_connection = 1 elif (conntype.lower() == 'keep-alive' and self.protocol_version >= "HTTP/1.1"): self.close_connection = 0 # Examine the headers and look for an Expect directive expect = self.headers.get('Expect', "") if (expect.lower() == "100-continue" and self.protocol_version >= "HTTP/1.1" and self.request_version >= "HTTP/1.1"): if not self.handle_expect_100(): return False return True def handle_expect_100(self): """Decide what to do with an "Expect: 100-continue" header. If the client is expecting a 100 Continue response, we must respond with either a 100 Continue or a final response before waiting for the request body. The default is to always respond with a 100 Continue. You can behave differently (for example, reject unauthorized requests) by overriding this method. This method should either return True (possibly after sending a 100 Continue response) or send an error response and return False. """ self.send_response_only(100) return True def handle_one_request(self): """Handle a single HTTP request. You normally don't need to override this method; see the class __doc__ string for information on how to handle specific HTTP commands such as GET and POST. """ try: self.raw_requestline = self.rfile.readline(65537) if len(self.raw_requestline) > 65536: self.requestline = '' self.request_version = '' self.command = '' self.send_error(414) return if not self.raw_requestline: self.close_connection = 1 return if not self.parse_request(): # An error code has been sent, just exit return mname = 'do_' + self.command if not hasattr(self, mname): self.send_error(501, "Unsupported method (%r)" % self.command) return method = getattr(self, mname) method() self.wfile.flush() #actually send the response if not already done. except socket.timeout as e: #a read or a write timed out. Discard this connection self.log_error("Request timed out: %r", e) self.close_connection = 1 return def handle(self): """Handle multiple requests if necessary.""" self.close_connection = 1 self.handle_one_request() while not self.close_connection: self.handle_one_request() def send_error(self, code, message=None): """Send and log an error reply. Arguments are the error code, and a detailed message. The detailed message defaults to the short entry matching the response code. This sends an error response (so it must be called before any output has been generated), logs the error, and finally sends a piece of HTML explaining the error to the user. """ try: shortmsg, longmsg = self.responses[code] except KeyError: shortmsg, longmsg = '???', '???' if message is None: message = shortmsg explain = longmsg self.log_error("code %d, message %s", code, message) # using _quote_html to prevent Cross Site Scripting attacks (see bug #1100201) content = (self.error_message_format % {'code': code, 'message': _quote_html(message), 'explain': explain}) self.send_response(code, message) self.send_header("Content-Type", self.error_content_type) self.send_header('Connection', 'close') self.end_headers() if self.command != 'HEAD' and code >= 200 and code not in (204, 304): self.wfile.write(content.encode('UTF-8', 'replace')) def send_response(self, code, message=None): """Send the response header and log the response code. Also send two standard headers with the server software version and the current date. """ self.log_request(code) self.send_response_only(code, message) self.send_header('Server', self.version_string()) self.send_header('Date', self.date_time_string()) def send_response_only(self, code, message=None): """Send the response header only.""" if message is None: if code in self.responses: message = self.responses[code][0] else: message = '' if self.request_version != 'HTTP/0.9': self.wfile.write(("%s %d %s\r\n" % (self.protocol_version, code, message)).encode('latin1', 'strict')) def send_header(self, keyword, value): """Send a MIME header.""" if self.request_version != 'HTTP/0.9': if not hasattr(self, '_headers_buffer'): self._headers_buffer = [] self._headers_buffer.append( ("%s: %s\r\n" % (keyword, value)).encode('latin1', 'strict')) if keyword.lower() == 'connection': if value.lower() == 'close': self.close_connection = 1 elif value.lower() == 'keep-alive': self.close_connection = 0 def end_headers(self): """Send the blank line ending the MIME headers.""" if self.request_version != 'HTTP/0.9': self._headers_buffer.append(b"\r\n") self.wfile.write(b"".join(self._headers_buffer)) self._headers_buffer = [] def log_request(self, code='-', size='-'): """Log an accepted request. This is called by send_response(). """ self.log_message('"%s" %s %s', self.requestline, str(code), str(size)) def log_error(self, format, *args): """Log an error. This is called when a request cannot be fulfilled. By default it passes the message on to log_message(). Arguments are the same as for log_message(). XXX This should go to the separate error log. """ self.log_message(format, *args) def log_message(self, format, *args): """Log an arbitrary message. This is used by all other logging functions. Override it if you have specific logging wishes. The first argument, FORMAT, is a format string for the message to be logged. If the format string contains any % escapes requiring parameters, they should be specified as subsequent arguments (it's just like printf!). The client host and current date/time are prefixed to every message. """ sys.stderr.write("%s - - [%s] %s\n" % (self.address_string(), self.log_date_time_string(), format%args)) def version_string(self): """Return the server software version string.""" return self.server_version + ' ' + self.sys_version def date_time_string(self, timestamp=None): """Return the current date and time formatted for a message header.""" if timestamp is None: timestamp = time.time() year, month, day, hh, mm, ss, wd, y, z = time.gmtime(timestamp) s = "%s, %02d %3s %4d %02d:%02d:%02d GMT" % ( self.weekdayname[wd], day, self.monthname[month], year, hh, mm, ss) return s def log_date_time_string(self): """Return the current time formatted for logging.""" now = time.time() year, month, day, hh, mm, ss, x, y, z = time.localtime(now) s = "%02d/%3s/%04d %02d:%02d:%02d" % ( day, self.monthname[month], year, hh, mm, ss) return s weekdayname = ['Mon', 'Tue', 'Wed', 'Thu', 'Fri', 'Sat', 'Sun'] monthname = [None, 'Jan', 'Feb', 'Mar', 'Apr', 'May', 'Jun', 'Jul', 'Aug', 'Sep', 'Oct', 'Nov', 'Dec'] def address_string(self): """Return the client address formatted for logging. This version looks up the full hostname using gethostbyaddr(), and tries to find a name that contains at least one dot. """ host, port = self.client_address[:2] return socket.getfqdn(host) # Essentially static class variables # The version of the HTTP protocol we support. # Set this to HTTP/1.1 to enable automatic keepalive protocol_version = "HTTP/1.0" # MessageClass used to parse headers MessageClass = http.client.HTTPMessage # Table mapping response codes to messages; entries have the # form {code: (shortmessage, longmessage)}. # See RFC 2616. responses = { 100: ('Continue', 'Request received, please continue'), 101: ('Switching Protocols', 'Switching to new protocol; obey Upgrade header'), 200: ('OK', 'Request fulfilled, document follows'), 201: ('Created', 'Document created, URL follows'), 202: ('Accepted', 'Request accepted, processing continues off-line'), 203: ('Non-Authoritative Information', 'Request fulfilled from cache'), 204: ('No Content', 'Request fulfilled, nothing follows'), 205: ('Reset Content', 'Clear input form for further input.'), 206: ('Partial Content', 'Partial content follows.'), 300: ('Multiple Choices', 'Object has several resources -- see URI list'), 301: ('Moved Permanently', 'Object moved permanently -- see URI list'), 302: ('Found', 'Object moved temporarily -- see URI list'), 303: ('See Other', 'Object moved -- see Method and URL list'), 304: ('Not Modified', 'Document has not changed since given time'), 305: ('Use Proxy', 'You must use proxy specified in Location to access this ' 'resource.'), 307: ('Temporary Redirect', 'Object moved temporarily -- see URI list'), 400: ('Bad Request', 'Bad request syntax or unsupported method'), 401: ('Unauthorized', 'No permission -- see authorization schemes'), 402: ('Payment Required', 'No payment -- see charging schemes'), 403: ('Forbidden', 'Request forbidden -- authorization will not help'), 404: ('Not Found', 'Nothing matches the given URI'), 405: ('Method Not Allowed', 'Specified method is invalid for this resource.'), 406: ('Not Acceptable', 'URI not available in preferred format.'), 407: ('Proxy Authentication Required', 'You must authenticate with ' 'this proxy before proceeding.'), 408: ('Request Timeout', 'Request timed out; try again later.'), 409: ('Conflict', 'Request conflict.'), 410: ('Gone', 'URI no longer exists and has been permanently removed.'), 411: ('Length Required', 'Client must specify Content-Length.'), 412: ('Precondition Failed', 'Precondition in headers is false.'), 413: ('Request Entity Too Large', 'Entity is too large.'), 414: ('Request-URI Too Long', 'URI is too long.'), 415: ('Unsupported Media Type', 'Entity body in unsupported format.'), 416: ('Requested Range Not Satisfiable', 'Cannot satisfy request range.'), 417: ('Expectation Failed', 'Expect condition could not be satisfied.'), 500: ('Internal Server Error', 'Server got itself in trouble'), 501: ('Not Implemented', 'Server does not support this operation'), 502: ('Bad Gateway', 'Invalid responses from another server/proxy.'), 503: ('Service Unavailable', 'The server cannot process the request due to a high load'), 504: ('Gateway Timeout', 'The gateway server did not receive a timely response'), 505: ('HTTP Version Not Supported', 'Cannot fulfill request.'), } class SimpleHTTPRequestHandler(BaseHTTPRequestHandler): """Simple HTTP request handler with GET and HEAD commands. This serves files from the current directory and any of its subdirectories. The MIME type for files is determined by calling the .guess_type() method. The GET and HEAD requests are identical except that the HEAD request omits the actual contents of the file. """ server_version = "SimpleHTTP/" + __version__ def do_GET(self): """Serve a GET request.""" f = self.send_head() if f: self.copyfile(f, self.wfile) f.close() def do_HEAD(self): """Serve a HEAD request.""" f = self.send_head() if f: f.close() def send_head(self): """Common code for GET and HEAD commands. This sends the response code and MIME headers. Return value is either a file object (which has to be copied to the outputfile by the caller unless the command was HEAD, and must be closed by the caller under all circumstances), or None, in which case the caller has nothing further to do. """ path = self.translate_path(self.path) f = None if os.path.isdir(path): if not self.path.endswith('/'): # redirect browser - doing basically what apache does self.send_response(301) self.send_header("Location", self.path + "/") self.end_headers() return None for index in "index.html", "index.htm": index = os.path.join(path, index) if os.path.exists(index): path = index break else: return self.list_directory(path) ctype = self.guess_type(path) try: f = open(path, 'rb') except IOError: self.send_error(404, "File not found") return None self.send_response(200) self.send_header("Content-type", ctype) fs = os.fstat(f.fileno()) self.send_header("Content-Length", str(fs[6])) self.send_header("Last-Modified", self.date_time_string(fs.st_mtime)) self.end_headers() return f def list_directory(self, path): """Helper to produce a directory listing (absent index.html). Return value is either a file object, or None (indicating an error). In either case, the headers are sent, making the interface the same as for send_head(). """ try: list = os.listdir(path) except os.error: self.send_error(404, "No permission to list directory") return None list.sort(key=lambda a: a.lower()) r = [] displaypath = html.escape(urllib.parse.unquote(self.path)) r.append('<!DOCTYPE html PUBLIC "-//W3C//DTD HTML 3.2 Final//EN">') r.append("<html>\n<title>Directory listing for %s</title>\n" % displaypath) r.append("<body>\n<h2>Directory listing for %s</h2>\n" % displaypath) r.append("<hr>\n<ul>\n") for name in list: fullname = os.path.join(path, name) displayname = linkname = name # Append / for directories or @ for symbolic links if os.path.isdir(fullname): displayname = name + "/" linkname = name + "/" if os.path.islink(fullname): displayname = name + "@" # Note: a link to a directory displays with @ and links with / r.append('<li><a href="%s">%s</a>\n' % (urllib.parse.quote(linkname), html.escape(displayname))) r.append("</ul>\n<hr>\n</body>\n</html>\n") enc = sys.getfilesystemencoding() encoded = ''.join(r).encode(enc) f = io.BytesIO() f.write(encoded) f.seek(0) self.send_response(200) self.send_header("Content-type", "text/html; charset=%s" % enc) self.send_header("Content-Length", str(len(encoded))) self.end_headers() return f def translate_path(self, path): """Translate a /-separated PATH to the local filename syntax. Components that mean special things to the local file system (e.g. drive or directory names) are ignored. (XXX They should probably be diagnosed.) """ # abandon query parameters path = path.split('?',1)[0] path = path.split('#',1)[0] path = posixpath.normpath(urllib.parse.unquote(path)) words = path.split('/') words = filter(None, words) path = os.getcwd() for word in words: drive, word = os.path.splitdrive(word) head, word = os.path.split(word) if word in (os.curdir, os.pardir): continue path = os.path.join(path, word) return path def copyfile(self, source, outputfile): """Copy all data between two file objects. The SOURCE argument is a file object open for reading (or anything with a read() method) and the DESTINATION argument is a file object open for writing (or anything with a write() method). The only reason for overriding this would be to change the block size or perhaps to replace newlines by CRLF -- note however that this the default server uses this to copy binary data as well. """ shutil.copyfileobj(source, outputfile) def guess_type(self, path): """Guess the type of a file. Argument is a PATH (a filename). Return value is a string of the form type/subtype, usable for a MIME Content-type header. The default implementation looks the file's extension up in the table self.extensions_map, using application/octet-stream as a default; however it would be permissible (if slow) to look inside the data to make a better guess. """ base, ext = posixpath.splitext(path) if ext in self.extensions_map: return self.extensions_map[ext] ext = ext.lower() if ext in self.extensions_map: return self.extensions_map[ext] else: return self.extensions_map[''] if not mimetypes.inited: mimetypes.init() # try to read system mime.types extensions_map = mimetypes.types_map.copy() extensions_map.update({ '': 'application/octet-stream', # Default '.py': 'text/plain', '.c': 'text/plain', '.h': 'text/plain', }) # Utilities for CGIHTTPRequestHandler # TODO(gregory.p.smith): Move this into an appropriate library. def _url_collapse_path_split(path): """ Given a URL path, remove extra '/'s and '.' path elements and collapse any '..' references. Implements something akin to RFC-2396 5.2 step 6 to parse relative paths. Returns: A tuple of (head, tail) where tail is everything after the final / and head is everything before it. Head will always start with a '/' and, if it contains anything else, never have a trailing '/'. Raises: IndexError if too many '..' occur within the path. """ # Similar to os.path.split(os.path.normpath(path)) but specific to URL # path semantics rather than local operating system semantics. path_parts = [] for part in path.split('/'): if part == '.': path_parts.append('') else: path_parts.append(part) # Filter out blank non trailing parts before consuming the '..'. path_parts = [part for part in path_parts[:-1] if part] + path_parts[-1:] if path_parts: tail_part = path_parts.pop() else: tail_part = '' head_parts = [] for part in path_parts: if part == '..': head_parts.pop() else: head_parts.append(part) if tail_part and tail_part == '..': head_parts.pop() tail_part = '' return ('/' + '/'.join(head_parts), tail_part) nobody = None def nobody_uid(): """Internal routine to get nobody's uid""" global nobody if nobody: return nobody try: import pwd except ImportError: return -1 try: nobody = pwd.getpwnam('nobody')[2] except KeyError: nobody = 1 + max(x[2] for x in pwd.getpwall()) return nobody def executable(path): """Test for executable file.""" try: st = os.stat(path) except os.error: return False return st.st_mode & 0o111 != 0 class CGIHTTPRequestHandler(SimpleHTTPRequestHandler): """Complete HTTP server with GET, HEAD and POST commands. GET and HEAD also support running CGI scripts. The POST command is *only* implemented for CGI scripts. """ # Determine platform specifics have_fork = hasattr(os, 'fork') # Make rfile unbuffered -- we need to read one line and then pass # the rest to a subprocess, so we can't use buffered input. rbufsize = 0 def do_POST(self): """Serve a POST request. This is only implemented for CGI scripts. """ if self.is_cgi(): self.run_cgi() else: self.send_error(501, "Can only POST to CGI scripts") def send_head(self): """Version of send_head that support CGI scripts""" if self.is_cgi(): return self.run_cgi() else: return SimpleHTTPRequestHandler.send_head(self) def is_cgi(self): """Test whether self.path corresponds to a CGI script. Returns True and updates the cgi_info attribute to the tuple (dir, rest) if self.path requires running a CGI script. Returns False otherwise. If any exception is raised, the caller should assume that self.path was rejected as invalid and act accordingly. The default implementation tests whether the normalized url path begins with one of the strings in self.cgi_directories (and the next character is a '/' or the end of the string). """ splitpath = _url_collapse_path_split(self.path) if splitpath[0] in self.cgi_directories: self.cgi_info = splitpath return True return False cgi_directories = ['/cgi-bin', '/htbin'] def is_executable(self, path): """Test whether argument path is an executable file.""" return executable(path) def is_python(self, path): """Test whether argument path is a Python script.""" head, tail = os.path.splitext(path) return tail.lower() in (".py", ".pyw") def run_cgi(self): """Execute a CGI script.""" path = self.path dir, rest = self.cgi_info i = path.find('/', len(dir) + 1) while i >= 0: nextdir = path[:i] nextrest = path[i+1:] scriptdir = self.translate_path(nextdir) if os.path.isdir(scriptdir): dir, rest = nextdir, nextrest i = path.find('/', len(dir) + 1) else: break # find an explicit query string, if present. i = rest.rfind('?') if i >= 0: rest, query = rest[:i], rest[i+1:] else: query = '' # dissect the part after the directory name into a script name & # a possible additional path, to be stored in PATH_INFO. i = rest.find('/') if i >= 0: script, rest = rest[:i], rest[i:] else: script, rest = rest, '' scriptname = dir + '/' + script scriptfile = self.translate_path(scriptname) if not os.path.exists(scriptfile): self.send_error(404, "No such CGI script (%r)" % scriptname) return if not os.path.isfile(scriptfile): self.send_error(403, "CGI script is not a plain file (%r)" % scriptname) return ispy = self.is_python(scriptname) if not ispy: if not self.is_executable(scriptfile): self.send_error(403, "CGI script is not executable (%r)" % scriptname) return # Reference: http://hoohoo.ncsa.uiuc.edu/cgi/env.html # XXX Much of the following could be prepared ahead of time! env = copy.deepcopy(os.environ) env['SERVER_SOFTWARE'] = self.version_string() env['SERVER_NAME'] = self.server.server_name env['GATEWAY_INTERFACE'] = 'CGI/1.1' env['SERVER_PROTOCOL'] = self.protocol_version env['SERVER_PORT'] = str(self.server.server_port) env['REQUEST_METHOD'] = self.command uqrest = urllib.parse.unquote(rest) env['PATH_INFO'] = uqrest env['PATH_TRANSLATED'] = self.translate_path(uqrest) env['SCRIPT_NAME'] = scriptname if query: env['QUERY_STRING'] = query host = self.address_string() if host != self.client_address[0]: env['REMOTE_HOST'] = host env['REMOTE_ADDR'] = self.client_address[0] authorization = self.headers.get("authorization") if authorization: authorization = authorization.split() if len(authorization) == 2: import base64, binascii env['AUTH_TYPE'] = authorization[0] if authorization[0].lower() == "basic": try: authorization = authorization[1].encode('ascii') authorization = base64.decodebytes(authorization).\ decode('ascii') except (binascii.Error, UnicodeError): pass else: authorization = authorization.split(':') if len(authorization) == 2: env['REMOTE_USER'] = authorization[0] # XXX REMOTE_IDENT if self.headers.get('content-type') is None: env['CONTENT_TYPE'] = self.headers.get_content_type() else: env['CONTENT_TYPE'] = self.headers['content-type'] length = self.headers.get('content-length') if length: env['CONTENT_LENGTH'] = length referer = self.headers.get('referer') if referer: env['HTTP_REFERER'] = referer accept = [] for line in self.headers.getallmatchingheaders('accept'): if line[:1] in "\t\n\r ": accept.append(line.strip()) else: accept = accept + line[7:].split(',') env['HTTP_ACCEPT'] = ','.join(accept) ua = self.headers.get('user-agent') if ua: env['HTTP_USER_AGENT'] = ua co = filter(None, self.headers.get_all('cookie', [])) cookie_str = ', '.join(co) if cookie_str: env['HTTP_COOKIE'] = cookie_str # XXX Other HTTP_* headers # Since we're setting the env in the parent, provide empty # values to override previously set values for k in ('QUERY_STRING', 'REMOTE_HOST', 'CONTENT_LENGTH', 'HTTP_USER_AGENT', 'HTTP_COOKIE', 'HTTP_REFERER'): env.setdefault(k, "") self.send_response(200, "Script output follows") decoded_query = query.replace('+', ' ') if self.have_fork: # Unix -- fork as we should args = [script] if '=' not in decoded_query: args.append(decoded_query) nobody = nobody_uid() self.wfile.flush() # Always flush before forking pid = os.fork() if pid != 0: # Parent pid, sts = os.waitpid(pid, 0) # throw away additional data [see bug #427345] while select.select([self.rfile], [], [], 0)[0]: if not self.rfile.read(1): break if sts: self.log_error("CGI script exit status %#x", sts) return # Child try: try: os.setuid(nobody) except os.error: pass os.dup2(self.rfile.fileno(), 0) os.dup2(self.wfile.fileno(), 1) os.execve(scriptfile, args, env) except: self.server.handle_error(self.request, self.client_address) os._exit(127) else: # Non-Unix -- use subprocess import subprocess cmdline = [scriptfile] if self.is_python(scriptfile): interp = sys.executable if interp.lower().endswith("w.exe"): # On Windows, use python.exe, not pythonw.exe interp = interp[:-5] + interp[-4:] cmdline = [interp, '-u'] + cmdline if '=' not in query: cmdline.append(query) self.log_message("command: %s", subprocess.list2cmdline(cmdline)) try: nbytes = int(length) except (TypeError, ValueError): nbytes = 0 p = subprocess.Popen(cmdline, stdin=subprocess.PIPE, stdout=subprocess.PIPE, stderr=subprocess.PIPE, env = env ) if self.command.lower() == "post" and nbytes > 0: data = self.rfile.read(nbytes) else: data = None # throw away additional data [see bug #427345] while select.select([self.rfile._sock], [], [], 0)[0]: if not self.rfile._sock.recv(1): break stdout, stderr = p.communicate(data) self.wfile.write(stdout) if stderr: self.log_error('%s', stderr) p.stderr.close() p.stdout.close() status = p.returncode if status: self.log_error("CGI script exit status %#x", status) else: self.log_message("CGI script exited OK") def test(HandlerClass = BaseHTTPRequestHandler, ServerClass = HTTPServer, protocol="HTTP/1.0"): """Test the HTTP request handler class. This runs an HTTP server on port 8000 (or the first command line argument). """ if sys.argv[1:]: port = int(sys.argv[1]) else: port = 8000 server_address = ('', port) HandlerClass.protocol_version = protocol httpd = ServerClass(server_address, HandlerClass) sa = httpd.socket.getsockname() print("Serving HTTP on", sa[0], "port", sa[1], "...") try: httpd.serve_forever() except KeyboardInterrupt: print("\nKeyboard interrupt received, exiting.") httpd.server_close() sys.exit(0) if __name__ == '__main__': test(HandlerClass=SimpleHTTPRequestHandler)
import os.path import re import urlparse from bs4 import BeautifulSoup import requests import clarify import unicodecsv from openelex.base.datasource import BaseDatasource from openelex.lib import build_github_url from openelex.lib.text import ocd_type_id class Datasource(BaseDatasource): RESULTS_PORTAL_URL = "http://www.sos.arkansas.gov/electionresults/index.php" CLARITY_PORTAL_URL = "http://results.enr.clarityelections.com/AR/" # There aren't precinct-level results for these, just a CSV file with # summary data for the county. no_precinct_urls = [ "http://results.enr.clarityelections.com/AR/Columbia/42858/111213/en/summary.html", "http://results.enr.clarityelections.com/AR/Ouachita/42896/112694/en/summary.html", "http://results.enr.clarityelections.com/AR/Union/42914/112664/en/summary.html", ] def mappings(self, year=None): mappings = [] for yr, elecs in self.elections(year).items(): mappings.extend(self._build_metadata(yr, elecs)) return mappings def target_urls(self, year=None): return [item['raw_url'] for item in self.mappings(year)] def filename_url_pairs(self, year=None): return [(item['generated_filename'], self._url_for_fetch(item)) for item in self.mappings(year)] def unprocessed_filename_url_pairs(self, year=None): return [(item['generated_filename'].replace(".csv", ".pdf"), item['raw_url']) for item in self.mappings(year) if 'pre_processed_url' in item] def mappings_for_url(self, url): return [mapping for mapping in self.mappings() if mapping['raw_url'] == url] def _build_metadata(self, year, elections): meta_entries = [] for election in elections: meta_entries.extend(self._build_election_metadata(election)) return meta_entries def _build_election_metadata(self, election): """ Return a list of metadata entries for a single election. """ slug = election['slug'] link = election['direct_links'][0] if slug == 'ar-2000-11-07-general': return self._build_election_metadata_2000_general(election) elif slug in ('ar-2000-11-07-special-general', 'ar-2001-09-25-special-primary', 'ar-2001-10-16-special-primary-runoff', 'ar-2001-11-20-special-general'): return self._build_election_metadata_zipped_special(election) elif link.startswith(self.CLARITY_PORTAL_URL): return self._build_election_metadata_clarity(election) else: return self._build_election_metadata_default(election) def _build_election_metadata_default(self, election): link = election['direct_links'][0] filename_kwargs = {} if link.startswith(self.RESULTS_PORTAL_URL): # Report portal results are precinct-level filename_kwargs['reporting_level'] = 'precinct' # And the format is tab-delimited text filename_kwargs['extension'] = '.tsv' generated_filename = self._standardized_filename(election, **filename_kwargs) mapping = { "generated_filename": generated_filename, "raw_url": link, "ocd_id": 'ocd-division/country:us/state:ar', "name": 'Arkansas', "election": election['slug'] } if "2002" in election['slug']: generated_filename = generated_filename.replace('.pdf', '.csv') mapping['pre_processed_url'] = build_github_url(self.state, generated_filename) mapping['generated_filename'] = generated_filename return [mapping] def _build_election_metadata_2000_general(self, election): meta_entries = [] for county in self._counties(): county_name = county['name'] filename = self._standardized_filename(election, jurisdiction=county_name, reporting_level='precinct', extension='.txt') raw_extracted_filename = self._raw_extracted_filename_2000_general(county_name) meta_entries.append({ 'generated_filename': filename, 'raw_url': election['direct_links'][0], 'raw_extracted_filename': raw_extracted_filename, 'ocd_id': county['ocd_id'], 'name': county_name, 'election': election['slug'], }) return meta_entries def _build_election_metadata_zipped_special(self, election): meta_entries = [] url_paths = self._url_paths_for_election(election['slug']) for path in url_paths: filename_kwargs = { 'reporting_level': path['reporting_level'], 'extension': '.txt', 'office': path['office'], 'office_district': path['district'], } if path['reporting_level'] == 'precinct': filename_kwargs['jurisdiction'] = path['jurisdiction'] jurisdiction = path['jurisdiction'] ocd_id = 'ocd-division/country:us/state:ar/county:{}'.format(ocd_type_id(jurisdiction)) else: jurisdiction = 'Arkansas' ocd_id = 'ocd-division/country:us/state:ar' filename = self._standardized_filename(election, **filename_kwargs) meta_entries.append({ 'generated_filename': filename, 'raw_url': path['url'], 'raw_extracted_filename': path['raw_extracted_filename'], 'ocd_id': ocd_id, 'name': jurisdiction, 'election': election['slug'], }) return meta_entries def _raw_extracted_filename_2000_general(self, county_name): county_part = county_name + " County" county_part = county_part.upper().replace(' ', '') return "cty{}.txt".format(county_part[:7]) def _build_election_metadata_clarity(self, election, fmt="xml"): """ Return metadata entries for election results provided by the Clarity system. These results seem to be for elections starting in 2012. Keyword Arguments: * fmt - Format of results file. Can be "xls", "txt" or "xml". Default is "xml". """ base_url = election['direct_links'][0] jurisdiction = clarity.Jurisdiction(url=base_url, level='state') return self._build_election_metadata_clarity_county(election, fmt, jurisdiction) +\ self._build_election_metadata_clarity_precinct(election, fmt, jurisdiction) def _build_election_metadata_clarity_county(self, election, fmt, jurisdiction): return [{ "generated_filename": self._standardized_filename(election, reporting_level='county', extension='.'+fmt), "raw_extracted_filename": "detail.{}".format(fmt), "raw_url": jurisdiction.report_url(fmt), "ocd_id": 'ocd-division/country:us/state:ar', "name": 'Arkansas', "election": election['slug'] }] def _build_election_metadata_clarity_precinct(self, election, fmt, jurisdiction): meta_entries = [] for path in self._clarity_precinct_url_paths(election, fmt, jurisdiction): jurisdiction_name = path['jurisdiction'] ocd_id = 'ocd-division/country:us/state:ar/county:{}'.format(ocd_type_id(jurisdiction_name)) filename = self._standardized_filename(election, jurisdiction=jurisdiction_name, reporting_level='precinct', extension='.'+fmt) meta_entries.append({ "generated_filename": filename, "raw_extracted_filename": "detail.{}".format(fmt), "raw_url": path['url'], "ocd_id": ocd_id, "name": jurisdiction_name, "election": election['slug'], }) return meta_entries def _clarity_precinct_url_paths_filename(self, election): filename = self._standardized_filename(election, ['url_paths'], reporting_level='precinct', extension='.csv') return os.path.join(self.mappings_dir, filename) def _clarity_precinct_url_paths(self, election, fmt, jurisdiction): url_paths_filename = self._clarity_precinct_url_paths_filename(election) if os.path.exists(url_paths_filename): return self._url_paths(url_paths_filename) url_paths = [] for subjurisdiction in jurisdiction.get_subjurisdictions(): if subjurisdiction.url not in self.no_precinct_urls: url_paths.append({ 'date': election['start_date'], 'office': '', 'race_type': election['race_type'], 'party': '', 'special': election['special'], 'url': subjurisdiction.report_url(fmt), 'reporting_level': 'precinct', 'jurisdiction': subjurisdiction.name, }) with open(url_paths_filename, 'wb') as f: fieldnames = ['date', 'office', 'race_type', 'party', 'special', 'url', 'reporting_level', 'jurisdiction'] writer = unicodecsv.DictWriter(f, fieldnames) writer.writeheader() writer.writerows(url_paths) return url_paths def _url_for_fetch(self, mapping): if 'pre_processed_url' in mapping: return mapping['pre_processed_url'] else: return mapping['raw_url']
# -*- coding: utf-8 -*- """ Unit tests for the omf plugin """ # FOGLAMP_BEGIN # See: http://foglamp.readthedocs.io/ # FOGLAMP_END __author__ = "Stefano Simonelli" __copyright__ = "Copyright (c) 2018 OSIsoft, LLC" __license__ = "Apache 2.0" __version__ = "${VERSION}" import asyncio import logging import pytest import json import time import ast import aiohttp from unittest.mock import patch, MagicMock, ANY from foglamp.tasks.north.sending_process import SendingProcess from foglamp.plugins.north.pi_server import pi_server import foglamp.tasks.north.sending_process as module_sp from foglamp.common.storage_client import payload_builder from foglamp.common.storage_client.storage_client import StorageClientAsync _STREAM_ID = 1 # noinspection PyProtectedMember @pytest.fixture def fixture_omf(event_loop): """" Configures the OMF instance for the tests """ _omf = MagicMock() pi_server._logger = MagicMock(spec=logging) pi_server._config_omf_types = {"type-id": {"value": "0001"}} return pi_server # noinspection PyProtectedMember @pytest.fixture def fixture_omf_north(event_loop): """" Configures the OMF instance for the tests """ sending_process_instance = MagicMock() config = [] config_omf_types = [] _logger = MagicMock(spec=logging) omf_north = pi_server.PIServerNorthPlugin(sending_process_instance, config, config_omf_types, _logger) omf_north._sending_process_instance._storage_async = MagicMock(spec=StorageClientAsync) return omf_north async def mock_async_call(p1=ANY): """ mocks a generic async function """ return p1 class MockAiohttpClientSession(MagicMock): """" mock the aiohttp.ClientSession context manager """ def __init__(self, *args, **kwargs): super().__init__(*args, **kwargs) self.code = args[0] self.text = args[1] async def __aenter__(self): mock_response = MagicMock(spec=aiohttp.ClientResponse) mock_response.status = self.code mock_response.text.side_effect = [mock_async_call(self.text)] return mock_response async def __aexit__(self, *args): return None class MockAiohttpClientSessionSuccess(MagicMock): """" mock the aiohttp.ClientSession context manager """ def __init__(self, *args, **kwargs): super().__init__(*args, **kwargs) async def __aenter__(self): mock_response = MagicMock(spec=aiohttp.ClientResponse) mock_response.status = 200 mock_response.text.side_effect = [mock_async_call('SUCCESS')] return mock_response async def __aexit__(self, *args): return None class MockAiohttpClientSessionError(MagicMock): """" mock the aiohttp.ClientSession context manager """ def __init__(self, *args, **kwargs): super().__init__(*args, **kwargs) async def __aenter__(self): mock_response = MagicMock(spec=aiohttp.ClientResponse) mock_response.status = 400 mock_response.text.side_effect = [mock_async_call('ERROR')] return mock_response async def __aexit__(self, *args): return None # noinspection PyUnresolvedReferences @pytest.allure.feature("unit") @pytest.allure.story("plugin", "north", "pi_server") class TestPiServer: """Unit tests related to the public methods of the omf plugin """ def test_plugin_info(self): assert pi_server.plugin_info() == { 'name': "PI Server North", 'version': "1.0.0", 'type': "north", 'interface': "1.0", 'config': pi_server._CONFIG_DEFAULT_OMF } def test_plugin_init_good(self): """Tests plugin_init using a good set of values""" pi_server._logger = MagicMock() # Used to check the conversions data = { "stream_id": {"value": 1}, "_CONFIG_CATEGORY_NAME": module_sp.SendingProcess._CONFIG_CATEGORY_NAME, "URL": {"value": "test_URL"}, "producerToken": {"value": "test_producerToken"}, "OMFMaxRetry": {"value": "100"}, "OMFRetrySleepTime": {"value": "100"}, "OMFHttpTimeout": {"value": "100"}, "StaticData": { "value": json.dumps( { "Location": "Palo Alto", "Company": "Dianomic" } ) }, "destination_type": {"value": "1"}, 'sending_process_instance': MagicMock(spec=SendingProcess), "formatNumber": {"value": "float64"}, "formatInteger": {"value": "int64"}, "notBlockingErrors": {"value": "{'id': 400, 'message': 'none'}"}, "compression": {"value": "true"} } config_default_omf_types = pi_server.CONFIG_DEFAULT_OMF_TYPES config_default_omf_types["type-id"]["value"] = "0001" data["debug_level"] = None data["log_performance"] = None data["destination_id"] = 1 data["stream_id"] = 1 with patch.object(data['sending_process_instance'], '_fetch_configuration', return_value=config_default_omf_types): config = pi_server.plugin_init(data) assert config['_CONFIG_CATEGORY_NAME'] == module_sp.SendingProcess._CONFIG_CATEGORY_NAME assert config['URL'] == "test_URL" assert config['producerToken'] == "test_producerToken" assert config['OMFMaxRetry'] == 100 assert config['OMFRetrySleepTime'] == 100 assert config['OMFHttpTimeout'] == 100 # Check conversion from String to Dict assert isinstance(config['StaticData'], dict) @pytest.mark.parametrize("data", [ # Bad case 1 - StaticData is a python dict instead of a string containing a dict { "stream_id": {"value": 1}, "_CONFIG_CATEGORY_NAME": module_sp.SendingProcess._CONFIG_CATEGORY_NAME, "URL": {"value": "test_URL"}, "producerToken": {"value": "test_producerToken"}, "OMFMaxRetry": {"value": "100"}, "OMFRetrySleepTime": {"value": "100"}, "OMFHttpTimeout": {"value": "100"}, "StaticData": { "value": { "Location": "Palo Alto", "Company": "Dianomic" } }, 'sending_process_instance': MagicMock() }, # Bad case 2 - OMFMaxRetry, bad value expected an int it is a string { "stream_id": {"value": 1}, "_CONFIG_CATEGORY_NAME": module_sp.SendingProcess._CONFIG_CATEGORY_NAME, "URL": {"value": "test_URL"}, "producerToken": {"value": "test_producerToken"}, "OMFMaxRetry": {"value": "xxx"}, "OMFRetrySleepTime": {"value": "100"}, "OMFHttpTimeout": {"value": "100"}, "StaticData": { "value": json.dumps( { "Location": "Palo Alto", "Company": "Dianomic" } ) }, 'sending_process_instance': MagicMock() } ]) def test_plugin_init_bad(self, data): """Tests plugin_init using an invalid set of values""" pi_server._logger = MagicMock() with pytest.raises(Exception): pi_server.plugin_init(data) @pytest.mark.parametrize( "ret_transform_in_memory_data, " "p_raw_data, ", [ ( # ret_transform_in_memory_data # is_data_available - new_position - num_sent [True, 20, 10], # raw_data { "id": 10, "asset_code": "test_asset_code", "reading": {"humidity": 100, "temperature": 1001}, "user_ts": '2018-04-20 09:38:50.163164+00' } ), ( # ret_transform_in_memory_data # is_data_available - new_position - num_sent [False, 20, 10], # raw_data { "id": 10, "asset_code": "test_asset_code", "reading": {"humidity": 100, "temperature": 1001}, "user_ts": '2018-04-20 09:38:50.163164+00' } ), ] ) @pytest.mark.asyncio async def test_plugin_send_success( self, event_loop, fixture_omf, ret_transform_in_memory_data, p_raw_data ): """ Unit test for - plugin_send - successful case """ data = MagicMock() if ret_transform_in_memory_data[0]: # data_available with patch.object(fixture_omf.PIServerNorthPlugin, 'transform_in_memory_data', return_value=ret_transform_in_memory_data): with patch.object(fixture_omf.PIServerNorthPlugin, 'create_omf_objects', return_value=mock_async_call() ) as patched_create_omf_objects: with patch.object(fixture_omf.PIServerNorthPlugin, 'send_in_memory_data_to_picromf', return_value=mock_async_call() ) as patched_send_in_memory_data_to_picromf: data_sent, new_position, num_sent = await fixture_omf.plugin_send(data, p_raw_data, _STREAM_ID) assert patched_create_omf_objects.called assert patched_send_in_memory_data_to_picromf.called assert data_sent assert new_position == ret_transform_in_memory_data[1] assert num_sent == ret_transform_in_memory_data[2] else: # no data_available with patch.object(fixture_omf.PIServerNorthPlugin, 'transform_in_memory_data', return_value=ret_transform_in_memory_data): data_sent, new_position, num_sent = await fixture_omf.plugin_send(data, p_raw_data, _STREAM_ID) assert not data_sent @pytest.mark.parametrize( "ret_transform_in_memory_data, " "p_raw_data, ", [ ( # ret_transform_in_memory_data # is_data_available - new_position - num_sent [True, 20, 10], # raw_data { "id": 10, "asset_code": "test_asset_code", "reading": {"humidity": 100, "temperature": 1001}, "user_ts": '2018-04-20 09:38:50.163164+00' } ) ] ) @pytest.mark.asyncio async def test_plugin_send_error( self, event_loop, fixture_omf, ret_transform_in_memory_data, p_raw_data ): """ Unit test for - plugin_send - error handling case it tests especially if the omf objects are created again in case of a communication error NOTE : the test will print a message to the stderr containing 'mocked object generated an exception' the message is not to be intended an as error as it is part of the successful test. """ data = MagicMock() with patch.object(fixture_omf.PIServerNorthPlugin, 'transform_in_memory_data', return_value=ret_transform_in_memory_data ) as patched_transform_in_memory_data: with patch.object(fixture_omf.PIServerNorthPlugin, 'create_omf_objects', return_value=mock_async_call() ) as patched_create_omf_objects: with patch.object(fixture_omf.PIServerNorthPlugin, 'send_in_memory_data_to_picromf', side_effect=KeyError('mocked object generated an exception') ) as patched_send_in_memory_data_to_picromf: with patch.object(fixture_omf.PIServerNorthPlugin, 'deleted_omf_types_already_created', return_value=mock_async_call() ) as patched_deleted_omf_types_already_created: with pytest.raises(Exception): data_sent, new_position, num_sent = await fixture_omf.plugin_send(data, p_raw_data, _STREAM_ID) if ret_transform_in_memory_data[0]: # data_available assert patched_transform_in_memory_data.calles assert patched_create_omf_objects.called assert patched_send_in_memory_data_to_picromf.called assert patched_deleted_omf_types_already_created.called def test_plugin_shutdown(self): pi_server._logger = MagicMock() data = [] pi_server.plugin_shutdown([data]) def test_plugin_reconfigure(self): pi_server._logger = MagicMock() pi_server.plugin_reconfigure() class TestPIServerNorthPlugin: """Unit tests related to PIServerNorthPlugin, methods used internally to the plugin""" @pytest.mark.parametrize( "p_configuration_key, " "p_type_id, " "p_data_from_storage, " "expected_data, ", [ # Case 1 ( # p_configuration_key "SEND_PR1", # p_type_id "0001", # p_data_from_storage { "rows": [ { "configuration_key": "SEND_PR1", "type_id": "0001", "asset_code": "asset_code_1" }, { "configuration_key": "SEND_PR1", "type_id": "0001", "asset_code": "asset_code_2" } ] }, # expected_data [ "asset_code_1", "asset_code_2" ] ) ] ) @pytest.mark.asyncio async def test_retrieve_omf_types_already_created( self, p_configuration_key, p_type_id, p_data_from_storage, expected_data, fixture_omf_north ): """ Unit test for - _retrieve_omf_types_already_created - successful case """ _payload_builder = MagicMock(spec=payload_builder) @pytest.mark.asyncio async def mock_query_tbl_with_payload(): """ mock _query_tbl_with_payload """ return p_data_from_storage with patch.object(_payload_builder, 'PayloadBuilder', return_value=True): with patch.object(fixture_omf_north._sending_process_instance._storage_async, 'query_tbl_with_payload', return_value=mock_query_tbl_with_payload()): retrieved_rows = await fixture_omf_north._retrieve_omf_types_already_created(p_configuration_key, p_type_id) assert retrieved_rows == expected_data @pytest.mark.parametrize( "p_asset_code, " "expected_asset_code, ", [ # p_asset_code # expected_asset_code ("asset_code_1 ", "asset_code_1"), (" asset_code_2 ", "asset_code_2"), ("asset_ code_3", "asset_code_3"), ] ) def test_generate_omf_asset_id( self, p_asset_code, expected_asset_code, fixture_omf_north ): """Tests _generate_omf_asset_id """ generated_asset_code = fixture_omf_north._generate_omf_asset_id(p_asset_code) assert generated_asset_code == expected_asset_code @pytest.mark.parametrize( "p_type_id, " "p_asset_code, " "expected_measurement_id, ", [ # p_type_id - p_asset_code - expected_asset_code ("0001", "asset_code_1 ", "0001measurement_asset_code_1"), ("0002", " asset_code_2 ", "0002measurement_asset_code_2"), ("0003", "asset_ code_3", "0003measurement_asset_code_3"), ] ) def test_generate_omf_measurement( self, p_type_id, p_asset_code, expected_measurement_id, fixture_omf_north ): """Tests _generate_omf_measurement """ fixture_omf_north._config_omf_types = {"type-id": {"value": p_type_id}} generated_measurement_id = fixture_omf_north._generate_omf_measurement(p_asset_code) assert generated_measurement_id == expected_measurement_id @pytest.mark.parametrize( "p_asset_code, " "expected_typename, ", [ # p_asset_code - expected_asset_code ("asset_code_1 ", "asset_code_1_typename"), (" asset_code_2 ", "asset_code_2_typename"), ("asset_ code_3", "asset_code_3_typename"), ] ) def test_generate_omf_typename_automatic( self, p_asset_code, expected_typename ): """Tests _generate_omf_typename_automatic """ sending_process_instance = MagicMock() config = [] config_omf_types = [] logger = MagicMock() omf_north = pi_server.PIServerNorthPlugin(sending_process_instance, config, config_omf_types, logger) generated_typename = omf_north._generate_omf_typename_automatic(p_asset_code) assert generated_typename == expected_typename @pytest.mark.parametrize( "p_test_data, " "p_type_id, " "p_static_data, " "expected_typename," "expected_omf_type", [ # Case 1 - pressure / Number ( # Origin - Sensor data {"asset_code": "pressure", "asset_data": {"pressure": 921.6}}, # type_id "0001", # Static Data { "Location": "Palo Alto", "Company": "Dianomic" }, # Expected 'pressure_typename', { 'pressure_typename': [ { 'classification': 'static', 'id': '0001_pressure_typename_sensor', 'properties': { 'Company': {'type': 'string'}, 'Name': {'isindex': True, 'type': 'string'}, 'Location': {'type': 'string'} }, 'type': 'object' }, { 'classification': 'dynamic', 'id': '0001_pressure_typename_measurement', 'properties': { 'Time': {'isindex': True, 'format': 'date-time', 'type': 'string'}, 'pressure': {'type': 'number', 'format': 'float64'} }, 'type': 'object' } ] } ), # Case 2 - luxometer / Integer ( # Origin - Sensor data {"asset_code": "luxometer", "asset_data": {"lux": 20}}, # type_id "0002", # Static Data { "Location": "Palo Alto", "Company": "Dianomic" }, # Expected 'luxometer_typename', { 'luxometer_typename': [ { 'classification': 'static', 'id': '0002_luxometer_typename_sensor', 'properties': { 'Company': {'type': 'string'}, 'Name': {'isindex': True, 'type': 'string'}, 'Location': {'type': 'string'} }, 'type': 'object' }, { 'classification': 'dynamic', 'id': '0002_luxometer_typename_measurement', 'properties': { 'Time': {'isindex': True, 'format': 'date-time', 'type': 'string'}, 'lux': {'type': 'number', 'format': 'float64'} }, 'type': 'object' } ] } ), # Case 3 - switch / string ( # Origin - Sensor data {"asset_code": "switch", "asset_data": {"button": "up"}}, # type_id "0002", # Static Data { "Location": "Palo Alto", "Company": "Dianomic" }, # Expected 'switch_typename', { 'switch_typename': [ { 'classification': 'static', 'id': '0002_switch_typename_sensor', 'properties': { 'Company': {'type': 'string'}, 'Name': {'isindex': True, 'type': 'string'}, 'Location': {'type': 'string'} }, 'type': 'object' }, { 'classification': 'dynamic', 'id': '0002_switch_typename_measurement', 'properties': { 'Time': {'isindex': True, 'format': 'date-time', 'type': 'string'}, 'button': {'type': 'string'} }, 'type': 'object' } ] } ) ] ) @pytest.mark.asyncio async def test_create_omf_type_automatic( self, p_test_data, p_type_id, p_static_data, expected_typename, expected_omf_type, fixture_omf_north ): """ Unit test for - _create_omf_type_automatic - successful case Tests the generation of the OMF messages starting from Asset name and data using Automatic OMF Type Mapping """ fixture_omf_north._config_omf_types = {"type-id": {"value": p_type_id}} fixture_omf_north._config = {} fixture_omf_north._config["StaticData"] = p_static_data fixture_omf_north._config["formatNumber"] = "float64" fixture_omf_north._config["formatInteger"] = "int64" with patch.object( fixture_omf_north, 'send_in_memory_data_to_picromf', return_value=mock_async_call() ) as patched_send_in_memory_data_to_picromf: typename, omf_type = await fixture_omf_north._create_omf_type_automatic(p_test_data) assert typename == expected_typename assert omf_type == expected_omf_type patched_send_in_memory_data_to_picromf.assert_called_with ("Type", expected_omf_type[expected_typename]) @pytest.mark.parametrize( "p_type_id, " "p_asset_code_omf_type, " "expected_typename, " "expected_omf_type, ", [ # Case 1 ( # p_type_id "0001", # p_asset_code_omf_type { "typename": "position", "static": { "Name": { "type": "string", "isindex": True }, "Location": { "type": "string" } }, "dynamic": { "Time": { "type": "string", "format": "date-time", "isindex": True }, "x": { "type": "number" }, "y": { "type": "number" }, "z": { "type": "number" } } }, # expected_typename "position", # expected_omf_type { "position": [ { "id": "0001_position_sensor", "type": "object", "classification": "static", "properties": { "Name": { "type": "string", "isindex": True }, "Location": { "type": "string" } } }, { "id": "0001_position_measurement", "type": "object", "classification": "dynamic", "properties": { "Time": { "type": "string", "format": "date-time", "isindex": True }, "x": { "type": "number" }, "y": { "type": "number" }, "z": { "type": "number" } } } ] } ) ] ) @pytest.mark.asyncio async def test_create_omf_type_configuration_based( self, p_type_id, p_asset_code_omf_type, expected_typename, expected_omf_type, fixture_omf_north ): """ Unit test for - _create_omf_type_configuration_based - successful case Tests the generation of the OMF messages using Configuration Based OMF Type Mapping """ fixture_omf_north._config_omf_types = {"type-id": {"value": p_type_id}} with patch.object(fixture_omf_north, 'send_in_memory_data_to_picromf', return_value=mock_async_call() ) as patched_send_to_picromf: generated_typename, \ generated_omf_type = await fixture_omf_north._create_omf_type_configuration_based(p_asset_code_omf_type) assert generated_typename == expected_typename assert generated_omf_type == expected_omf_type patched_send_to_picromf.assert_any_call("Type", expected_omf_type[expected_typename]) @pytest.mark.parametrize( "p_asset," "p_type_id, " "p_static_data, " "p_typename," "p_omf_type, " "expected_container, " "expected_static_data, " "expected_link_data ", [ # Case 1 - pressure / Number ( # p_asset {"asset_code": "pressure", "asset_data": {"pressure": 921.6}}, # type_id "0001", # Static Data { "Location": "Palo Alto", "Company": "Dianomic" }, # p_typename 'pressure_typename', # p_omf_type { 'pressure_typename': [ { 'classification': 'static', 'id': '0001_pressure_typename_sensor', 'properties': { 'Company': {'type': 'string'}, 'Name': {'isindex': True, 'type': 'string'}, 'Location': {'type': 'string'} }, 'type': 'object' }, { 'classification': 'dynamic', 'id': '0001_pressure_typename_measurement', 'properties': { 'Time': {'isindex': True, 'format': 'date-time', 'type': 'string'}, 'pressure': {'type': 'number'} }, 'type': 'object' } ] }, # expected_container [ { 'typeid': '0001_pressure_typename_measurement', 'id': '0001measurement_pressure' } ], # expected_static_data [ { 'typeid': '0001_pressure_typename_sensor', 'values': [ { 'Company': 'Dianomic', 'Location': 'Palo Alto', 'Name': 'pressure' } ] } ], # expected_link_data [ { 'typeid': '__Link', 'values': [ { 'source': {'typeid': '0001_pressure_typename_sensor', 'index': '_ROOT'}, 'target': {'typeid': '0001_pressure_typename_sensor', 'index': 'pressure'} }, { 'source': {'typeid': '0001_pressure_typename_sensor', 'index': 'pressure'}, 'target': {'containerid': '0001measurement_pressure'} } ] } ] ) ] ) @pytest.mark.asyncio async def test_create_omf_object_links( self, p_asset, p_type_id, p_static_data, p_typename, p_omf_type, expected_container, expected_static_data, expected_link_data, fixture_omf_north ): fixture_omf_north._config_omf_types = {"type-id": {"value": p_type_id}} fixture_omf_north._config = {"StaticData": p_static_data} with patch.object(fixture_omf_north, 'send_in_memory_data_to_picromf', side_effect=[asyncio.ensure_future(mock_async_call()) for x in range(3)] ) as patched_send_to_picromf: await fixture_omf_north._create_omf_object_links(p_asset["asset_code"], p_typename, p_omf_type) assert patched_send_to_picromf.call_count == 3 patched_send_to_picromf.assert_any_call("Container", expected_container) patched_send_to_picromf.assert_any_call("Data", expected_static_data) patched_send_to_picromf.assert_any_call("Data", expected_link_data) @pytest.mark.parametrize( "p_creation_type, " "p_data_origin, " "p_asset_codes_already_created, " "p_omf_objects_configuration_based ", [ # Case 1 - automatic ( # p_creation_type "automatic", # Origin [ { "id": 10, "asset_code": "test_asset_code", "reading": {"humidity": 10, "temperature": 20}, "user_ts": '2018-04-20 09:38:50.163164+00' } ], # asset_codes_already_created [ "test_none" ], # omf_objects_configuration_based {"none": "none"} ), # Case 2 - configuration ( # p_creation_type "configuration", # Origin [ { "id": 10, "asset_code": "test_asset_code", "reading": {"humidity": 10, "temperature": 20}, "user_ts": '2018-04-20 09:38:50.163164+00' } ], # asset_codes_already_created [ "test_none" ], # omf_objects_configuration_based {"test_asset_code": {"value": "test_asset_code"}} ) ] ) @pytest.mark.asyncio async def test_create_omf_objects( self, p_creation_type, p_data_origin, p_asset_codes_already_created, p_omf_objects_configuration_based, fixture_omf_north ): """ Unit test for - create_omf_objects - successful case Tests the evaluation of the 2 ways of creating OMF objects: automatic or configuration based """ config_category_name = "SEND_PR" type_id = "0001" fixture_omf_north._config_omf_types = {"type-id": {"value": type_id}} fixture_omf_north._config_omf_types = p_omf_objects_configuration_based if p_creation_type == "automatic": with patch.object(fixture_omf_north, '_retrieve_omf_types_already_created', return_value=mock_async_call(p_asset_codes_already_created)): with patch.object( fixture_omf_north, '_create_omf_objects_automatic', return_value=mock_async_call() ) as patched_create_omf_objects_automatic: with patch.object(fixture_omf_north, '_flag_created_omf_type', return_value=mock_async_call() ) as patched_flag_created_omf_type: await fixture_omf_north.create_omf_objects(p_data_origin, config_category_name, type_id) assert patched_create_omf_objects_automatic.called assert patched_flag_created_omf_type.called elif p_creation_type == "configuration": with patch.object(fixture_omf_north, '_retrieve_omf_types_already_created', return_value=mock_async_call(p_asset_codes_already_created)): with patch.object( fixture_omf_north, '_create_omf_objects_configuration_based', return_value=mock_async_call() ) as patched_create_omf_objects_configuration_based: with patch.object(fixture_omf_north, '_flag_created_omf_type', return_value=mock_async_call() ) as patched_flag_created_omf_type: await fixture_omf_north.create_omf_objects(p_data_origin, config_category_name, type_id) assert patched_create_omf_objects_configuration_based.called assert patched_flag_created_omf_type.called else: raise Exception("ERROR : creation type not defined !") @pytest.mark.parametrize( "p_key, " "p_value, " "expected, ", [ # Good cases ('producerToken', "xxx", "good"), # Bad cases ('NO-producerToken', "", "exception"), ('producerToken', "", "exception") ] ) def test_validate_configuration( self, p_key, p_value, expected): """ Tests the validation of the configurations retrieved from the Configuration Manager handled by _validate_configuration """ pi_server._logger = MagicMock() data = {p_key: {'value': p_value}} if expected == "good": assert not pi_server._logger.error.called elif expected == "exception": with pytest.raises(ValueError): pi_server._validate_configuration(data) assert pi_server._logger.error.called @pytest.mark.parametrize( "p_key, " "p_value, " "expected, ", [ # Good cases ('type-id', "xxx", "good"), # Bad cases ('NO-type-id', "", "exception"), ('type-id', "", "exception") ] ) def test_validate_configuration_omf_type( self, p_key, p_value, expected): """ Tests the validation of the configurations retrieved from the Configuration Manager related to the OMF types """ pi_server._logger = MagicMock() data = {p_key: {'value': p_value}} if expected == "good": assert not pi_server._logger.error.called elif expected == "exception": with pytest.raises(ValueError): pi_server._validate_configuration_omf_type(data) assert pi_server._logger.error.called @pytest.mark.parametrize( "p_test_data ", [ # Case 1 - pressure / Number ( { 'dummy': 'dummy' } ), ] ) @pytest.mark.asyncio async def test_send_in_memory_data_to_picromf_success( self, p_test_data, fixture_omf_north): """ Unit test for - send_in_memory_data_to_picromf - successful case Tests a successful communication """ fixture_omf_north._config = dict(producerToken="dummy_producerToken") fixture_omf_north._config["URL"] = "dummy_URL" fixture_omf_north._config["OMFRetrySleepTime"] = 1 fixture_omf_north._config["OMFHttpTimeout"] = 1 fixture_omf_north._config["OMFMaxRetry"] = 1 fixture_omf_north._config["compression"] = "false" with patch.object(aiohttp.ClientSession, 'post', return_value=MockAiohttpClientSessionSuccess() ) as patched_aiohttp: await fixture_omf_north.send_in_memory_data_to_picromf("Type", p_test_data) assert patched_aiohttp.called assert patched_aiohttp.call_count == 1 @pytest.mark.parametrize( "p_is_error, " "p_code, " "p_text, " "p_test_data ", [ ( False, 400, 'Invalid value type for the property', {'dummy': 'dummy'} ), ( False, 400, 'Redefinition of the type with the same ID is not allowed', {'dummy': 'dummy'} ), ( True, 400, 'None', {'dummy': 'dummy'} ), ( True, 404, 'None', {'dummy': 'dummy'} ), ( True, 404, 'Invalid value type for the property', {'dummy': 'dummy'} ), ] ) @pytest.mark.asyncio async def test_send_in_memory_data_to_picromf_success_not_blocking_error( self, p_is_error, p_code, p_text, p_test_data, fixture_omf_north): """ Unit test for - send_in_memory_data_to_picromf test cases of blocking error (exception raised) and not blocking error """ fixture_omf_north._config = dict(producerToken="dummy_producerToken") fixture_omf_north._config["URL"] = "dummy_URL" fixture_omf_north._config["OMFRetrySleepTime"] = 1 fixture_omf_north._config["OMFHttpTimeout"] = 1 fixture_omf_north._config["OMFMaxRetry"] = 1 fixture_omf_north._config["compression"] = "false" fixture_omf_north._config["notBlockingErrors"] = ast.literal_eval(pi_server._CONFIG_DEFAULT_OMF["notBlockingErrors"]["default"]) with patch.object(aiohttp.ClientSession, 'post', return_value=MockAiohttpClientSession(p_code, p_text) ) as patched_aiohttp: if p_is_error: # blocking error (exception raised) with pytest.raises(Exception): await fixture_omf_north.send_in_memory_data_to_picromf("Data", p_test_data) else: # not blocking error, operation terminated successfully await fixture_omf_north.send_in_memory_data_to_picromf("Data", p_test_data) assert patched_aiohttp.called # as OMFMaxRetry is set to 1 assert patched_aiohttp.call_count == 1 @pytest.mark.parametrize( "p_type, " "p_test_data ", [ # Case 1 - pressure / Number ( "Type", { 'pressure_typename': [ { 'classification': 'static', 'id': '0001_pressure_typename_sensor', 'properties': { 'Company': {'type': 'string'}, 'Name': {'isindex': True, 'type': 'string'}, 'Location': {'type': 'string'} }, 'type': 'object' }, { 'classification': 'dynamic', 'id': '0001_pressure_typename_measurement', 'properties': { 'Time': {'isindex': True, 'format': 'date-time', 'type': 'string'}, 'pressure': {'type': 'number'} }, 'type': 'object' } ] } ), ] ) @pytest.mark.asyncio async def test_send_in_memory_data_to_picromf_data( self, p_type, p_test_data, fixture_omf_north): """ Unit test for - send_in_memory_data_to_picromf - successful case Tests the data sent to the PI Server in relation of an OMF type """ # Values for the test test_url = "test_URL" test_producer_token = "test_producerToken" test_omf_http_timeout = 1 test_headers = { 'producertoken': test_producer_token, 'messagetype': p_type, 'action': 'create', 'messageformat': 'JSON', 'omfversion': '1.0'} fixture_omf_north._config = dict(producerToken=test_producer_token) fixture_omf_north._config["URL"] = test_url fixture_omf_north._config["OMFRetrySleepTime"] = 1 fixture_omf_north._config["OMFHttpTimeout"] = test_omf_http_timeout fixture_omf_north._config["OMFMaxRetry"] = 1 fixture_omf_north._config["compression"] = "false" # To avoid the wait time with patch.object(time, 'sleep', return_value=True): with patch.object(aiohttp.ClientSession, 'post', return_value=MockAiohttpClientSessionSuccess() ) as patched_aiohttp: await fixture_omf_north.send_in_memory_data_to_picromf(p_type, p_test_data) str_data = json.dumps(p_test_data) assert patched_aiohttp.call_count == 1 patched_aiohttp.assert_called_with( url=test_url, headers=test_headers, data=str_data, timeout=test_omf_http_timeout) @pytest.mark.parametrize( "p_test_data ", [ # Case 1 - pressure / Number ( { 'dummy': 'dummy' } ), ] ) @pytest.mark.asyncio async def test_send_in_memory_data_to_picromf_error( self, p_test_data, fixture_omf_north): """ Unit test for - send_in_memory_data_to_picromf - successful case Tests the behaviour in case of communication error: exception erased, message logged and number of retries """ max_retry = 3 fixture_omf_north._config = dict(producerToken="dummy_producerToken") fixture_omf_north._config["URL"] = "dummy_URL" fixture_omf_north._config["OMFRetrySleepTime"] = 1 fixture_omf_north._config["OMFHttpTimeout"] = 1 fixture_omf_north._config["OMFMaxRetry"] = max_retry fixture_omf_north._config["compression"] = "false" fixture_omf_north._config["notBlockingErrors"] = [{'id': 400, 'message': 'none'}] # To avoid the wait time with patch.object(time, 'sleep', return_value=True): with patch.object(aiohttp.ClientSession, 'post', return_value=MockAiohttpClientSessionError() ) as patched_aiohttp: # Tests the raising of the exception with pytest.raises(Exception): await fixture_omf_north.send_in_memory_data_to_picromf("Type", p_test_data) assert patched_aiohttp.call_count == max_retry @pytest.mark.parametrize( "p_data_origin, " "type_id, " "expected_data_to_send, " "expected_is_data_available, " "expected_new_position, " "expected_num_sent", [ # Case 1 ( # Origin [ { "id": 10, "asset_code": "test_asset_code", "reading": {"humidity": 11, "temperature": 38}, "user_ts": '2018-04-20 09:38:50.163164+00' } ], "0001", # Transformed [ { "containerid": "0001measurement_test_asset_code", "values": [ { "Time": "2018-04-20T09:38:50.163Z", "humidity": 11, "temperature": 38 } ] } ], True, 10, 1 ), # Case 2 ( # Origin [ { "id": 11, "asset_code": "test_asset_code", "reading": {"tick": "tock"}, "user_ts": '2018-04-20 09:38:50.163164+00' } ], "0001", # Transformed [ { "containerid": "0001measurement_test_asset_code", "values": [ { "Time": "2018-04-20T09:38:50.163Z", "tick": "tock" } ] } ], True, 11, 1 ), # Case 3 - 2 rows ( # Origin [ { "id": 12, "asset_code": "test_asset_code", "reading": {"pressure": 957.2}, "user_ts": '2018-04-20 09:38:50.163164+00' }, { "id": 20, "asset_code": "test_asset_code", "reading": {"y": 34, "z": 114, "x": -174}, "user_ts": '2018-04-20 09:38:50.163164+00' } ], "0001", # Transformed [ { "containerid": "0001measurement_test_asset_code", "values": [ { "Time": "2018-04-20T09:38:50.163Z", "pressure": 957.2 } ] }, { "containerid": "0001measurement_test_asset_code", "values": [ { "Time": "2018-04-20T09:38:50.163Z", "y": 34, "z": 114, "x": -174, } ] }, ], True, 20, 2 ) ]) def test_plugin_transform_in_memory_data(self, p_data_origin, type_id, expected_data_to_send, expected_is_data_available, expected_new_position, expected_num_sent, fixture_omf_north): """Tests the plugin in memory transformations """ generated_data_to_send = [None for x in range( len(expected_data_to_send) )] fixture_omf_north._config_omf_types = {"type-id": {"value": type_id}} is_data_available, new_position, num_sent = fixture_omf_north.transform_in_memory_data(generated_data_to_send, p_data_origin) assert generated_data_to_send == expected_data_to_send assert is_data_available == expected_is_data_available assert new_position == expected_new_position assert num_sent == expected_num_sent
# "High performance data structures # " # copied from pypy repo # # Copied and completed from the sandbox of CPython # (nondist/sandbox/collections/pydeque.py rev 1.1, Raymond Hettinger) # # edited for Brython line 558 : catch ImportError instead of AttributeError import operator #try: # from thread import get_ident as _thread_ident #except ImportError: def _thread_ident(): return -1 n = 30 LFTLNK = n RGTLNK = n+1 BLOCKSIZ = n+2 # The deque's size limit is d.maxlen. The limit can be zero or positive, or # None. After an item is added to a deque, we check to see if the size has # grown past the limit. If it has, we get the size back down to the limit by # popping an item off of the opposite end. The methods that can trigger this # are append(), appendleft(), extend(), and extendleft(). #class deque(object): class deque: def __new__(cls, iterable=(), *args, **kw): #fixme #self = super(deque, cls).__new__(cls, *args, **kw) self=object.__new__(cls, *args, **kw) self.clear() return self def __init__(self, iterable=(), maxlen=None): object.__init__(self) self.clear() if maxlen is not None: if maxlen < 0: raise ValueError("maxlen must be non-negative") self._maxlen = maxlen add = self.append for elem in iterable: add(elem) @property def maxlen(self): return self._maxlen def clear(self): self.right = self.left = [None] * BLOCKSIZ self.rightndx = n//2 # points to last written element self.leftndx = n//2+1 self.length = 0 self.state = 0 def append(self, x): self.state += 1 self.rightndx += 1 if self.rightndx == n: newblock = [None] * BLOCKSIZ self.right[RGTLNK] = newblock newblock[LFTLNK] = self.right self.right = newblock self.rightndx = 0 self.length += 1 self.right[self.rightndx] = x if self.maxlen is not None and self.length > self.maxlen: self.popleft() def appendleft(self, x): self.state += 1 self.leftndx -= 1 if self.leftndx == -1: newblock = [None] * BLOCKSIZ self.left[LFTLNK] = newblock newblock[RGTLNK] = self.left self.left = newblock self.leftndx = n-1 self.length += 1 self.left[self.leftndx] = x if self.maxlen is not None and self.length > self.maxlen: self.pop() def extend(self, iterable): if iterable is self: iterable = list(iterable) for elem in iterable: self.append(elem) def extendleft(self, iterable): if iterable is self: iterable = list(iterable) for elem in iterable: self.appendleft(elem) def pop(self): if self.left is self.right and self.leftndx > self.rightndx: #raise IndexError, "pop from an empty deque" # does not work in brython raise IndexError("pop from an empty deque") x = self.right[self.rightndx] self.right[self.rightndx] = None self.length -= 1 self.rightndx -= 1 self.state += 1 if self.rightndx == -1: prevblock = self.right[LFTLNK] if prevblock is None: # the deque has become empty; recenter instead of freeing block self.rightndx = n//2 self.leftndx = n//2+1 else: prevblock[RGTLNK] = None self.right[LFTLNK] = None self.right = prevblock self.rightndx = n-1 return x def popleft(self): if self.left is self.right and self.leftndx > self.rightndx: #raise IndexError, "pop from an empty deque" raise IndexError("pop from an empty deque") x = self.left[self.leftndx] self.left[self.leftndx] = None self.length -= 1 self.leftndx += 1 self.state += 1 if self.leftndx == n: prevblock = self.left[RGTLNK] if prevblock is None: # the deque has become empty; recenter instead of freeing block self.rightndx = n//2 self.leftndx = n//2+1 else: prevblock[LFTLNK] = None self.left[RGTLNK] = None self.left = prevblock self.leftndx = 0 return x def count(self, value): c = 0 for item in self: if item == value: c += 1 return c def remove(self, value): # Need to be defensive for mutating comparisons for i in range(len(self)): if self[i] == value: del self[i] return raise ValueError("deque.remove(x): x not in deque") def rotate(self, n=1): length = len(self) if length == 0: return halflen = (length+1) >> 1 if n > halflen or n < -halflen: n %= length if n > halflen: n -= length elif n < -halflen: n += length while n > 0: self.appendleft(self.pop()) n -= 1 while n < 0: self.append(self.popleft()) n += 1 def reverse(self): "reverse *IN PLACE*" leftblock = self.left rightblock = self.right leftindex = self.leftndx rightindex = self.rightndx for i in range(self.length // 2): # Validate that pointers haven't met in the middle assert leftblock != rightblock or leftindex < rightindex # Swap (rightblock[rightindex], leftblock[leftindex]) = ( leftblock[leftindex], rightblock[rightindex]) # Advance left block/index pair leftindex += 1 if leftindex == n: leftblock = leftblock[RGTLNK] assert leftblock is not None leftindex = 0 # Step backwards with the right block/index pair rightindex -= 1 if rightindex == -1: rightblock = rightblock[LFTLNK] assert rightblock is not None rightindex = n - 1 def __repr__(self): threadlocalattr = '__repr' + str(_thread_ident()) if threadlocalattr in self.__dict__: return 'deque([...])' else: self.__dict__[threadlocalattr] = True try: if self.maxlen is not None: return 'deque(%r, maxlen=%s)' % (list(self), self.maxlen) else: return 'deque(%r)' % (list(self),) finally: del self.__dict__[threadlocalattr] def __iter__(self): return deque_iterator(self, self._iter_impl) def _iter_impl(self, original_state, giveup): if self.state != original_state: giveup() block = self.left while block: l, r = 0, n if block is self.left: l = self.leftndx if block is self.right: r = self.rightndx + 1 for elem in block[l:r]: yield elem if self.state != original_state: giveup() block = block[RGTLNK] def __reversed__(self): return deque_iterator(self, self._reversed_impl) def _reversed_impl(self, original_state, giveup): if self.state != original_state: giveup() block = self.right while block: l, r = 0, n if block is self.left: l = self.leftndx if block is self.right: r = self.rightndx + 1 for elem in reversed(block[l:r]): yield elem if self.state != original_state: giveup() block = block[LFTLNK] def __len__(self): #sum = 0 #block = self.left #while block: # sum += n # block = block[RGTLNK] #return sum + self.rightndx - self.leftndx + 1 - n return self.length def __getref(self, index): if index >= 0: block = self.left while block: l, r = 0, n if block is self.left: l = self.leftndx if block is self.right: r = self.rightndx + 1 span = r-l if index < span: return block, l+index index -= span block = block[RGTLNK] else: block = self.right while block: l, r = 0, n if block is self.left: l = self.leftndx if block is self.right: r = self.rightndx + 1 negative_span = l-r if index >= negative_span: return block, r+index index -= negative_span block = block[LFTLNK] raise IndexError("deque index out of range") def __getitem__(self, index): block, index = self.__getref(index) return block[index] def __setitem__(self, index, value): block, index = self.__getref(index) block[index] = value def __delitem__(self, index): length = len(self) if index >= 0: if index >= length: raise IndexError("deque index out of range") self.rotate(-index) self.popleft() self.rotate(index) else: #index = ~index #todo until bit wise operators are in bython index= index^(2**31) if index >= length: raise IndexError("deque index out of range") self.rotate(index) self.pop() self.rotate(-index) def __reduce_ex__(self, proto): return type(self), (list(self), self.maxlen) def __hash__(self): #raise TypeError, "deque objects are unhashable" raise TypeError("deque objects are unhashable") def __copy__(self): return self.__class__(self, self.maxlen) # XXX make comparison more efficient def __eq__(self, other): if isinstance(other, deque): return list(self) == list(other) else: return NotImplemented def __ne__(self, other): if isinstance(other, deque): return list(self) != list(other) else: return NotImplemented def __lt__(self, other): if isinstance(other, deque): return list(self) < list(other) else: return NotImplemented def __le__(self, other): if isinstance(other, deque): return list(self) <= list(other) else: return NotImplemented def __gt__(self, other): if isinstance(other, deque): return list(self) > list(other) else: return NotImplemented def __ge__(self, other): if isinstance(other, deque): return list(self) >= list(other) else: return NotImplemented def __iadd__(self, other): self.extend(other) return self class deque_iterator(object): def __init__(self, deq, itergen): self.counter = len(deq) def giveup(): self.counter = 0 #raise RuntimeError, "deque mutated during iteration" raise RuntimeError("deque mutated during iteration") self._gen = itergen(deq.state, giveup) def next(self): res = self._gen.next() self.counter -= 1 return res def __iter__(self): return self class defaultdict(dict): def __init__(self, *args, **kwds): if len(args) > 0: default_factory = args[0] args = args[1:] if not callable(default_factory) and default_factory is not None: raise TypeError("first argument must be callable") else: default_factory = None dict.__init__(self, args, kwds) self.default_factory = default_factory self.update(args, kwds) #super(defaultdict, self).__init__(*args, **kwds) #fixme.. had to add this function to get defaultdict working with brython correctly def __getitem__(self, key): if self.__contains__(key): return dict.__getitem__(self,key) return self.__missing__(key) def __missing__(self, key): # from defaultdict docs if self.default_factory is None: raise KeyError(key) self[key] = value = self.default_factory() return value def __repr__(self, recurse=set()): if id(self) in recurse: return "defaultdict(...)" try: recurse.add(id(self)) return "defaultdict(%s, %s)" % (repr(self.default_factory), super(defaultdict, self).__repr__()) finally: recurse.remove(id(self)) def copy(self): return type(self)(self.default_factory, self) def __copy__(self): return self.copy() def __reduce__(self): # #__reduce__ must return a 5-tuple as follows: # # - factory function # - tuple of args for the factory function # - additional state (here None) # - sequence iterator (here None) # - dictionary iterator (yielding successive (key, value) pairs # This API is used by pickle.py and copy.py. # return (type(self), (self.default_factory,), None, None, self.iteritems()) from operator import itemgetter as _itemgetter from keyword import iskeyword as _iskeyword import sys as _sys def namedtuple(typename, field_names, verbose=False, rename=False): """Returns a new subclass of tuple with named fields. >>> Point = namedtuple('Point', 'x y') >>> Point.__doc__ # docstring for the new class 'Point(x, y)' >>> p = Point(11, y=22) # instantiate with positional args or keywords >>> p[0] + p[1] # indexable like a plain tuple 33 >>> x, y = p # unpack like a regular tuple >>> x, y (11, 22) >>> p.x + p.y # fields also accessable by name 33 >>> d = p._asdict() # convert to a dictionary >>> d['x'] 11 >>> Point(**d) # convert from a dictionary Point(x=11, y=22) >>> p._replace(x=100) # _replace() is like str.replace() but targets named fields Point(x=100, y=22) """ # Parse and validate the field names. Validation serves two purposes, # generating informative error messages and preventing template injection attacks. if isinstance(field_names, str): field_names = field_names.replace(',', ' ').split() # names separated by whitespace and/or commas field_names = tuple(map(str, field_names)) if rename: names = list(field_names) seen = set() for i, name in enumerate(names): if (not min(c.isalnum() or c=='_' for c in name) or _iskeyword(name) or not name or name[0].isdigit() or name.startswith('_') or name in seen): names[i] = '_%d' % i seen.add(name) field_names = tuple(names) for name in (typename,) + field_names: if not min(c.isalnum() or c=='_' for c in name): raise ValueError('Type names and field names can only contain alphanumeric characters and underscores: %r' % name) if _iskeyword(name): raise ValueError('Type names and field names cannot be a keyword: %r' % name) if name[0].isdigit(): raise ValueError('Type names and field names cannot start with a number: %r' % name) seen_names = set() for name in field_names: if name.startswith('_') and not rename: raise ValueError('Field names cannot start with an underscore: %r' % name) if name in seen_names: raise ValueError('Encountered duplicate field name: %r' % name) seen_names.add(name) # Create and fill-in the class template numfields = len(field_names) argtxt = repr(field_names).replace("'", "")[1:-1] # tuple repr without parens or quotes reprtxt = ', '.join('%s=%%r' % name for name in field_names) template = '''class %(typename)s(tuple): '%(typename)s(%(argtxt)s)' \n __slots__ = () \n _fields = %(field_names)r \n def __new__(_cls, %(argtxt)s): return tuple.__new__(_cls, (%(argtxt)s)) \n @classmethod def _make(cls, iterable, new=tuple.__new__, len=len): 'Make a new %(typename)s object from a sequence or iterable' result = new(cls, iterable) if len(result) != %(numfields)d: raise TypeError('Expected %(numfields)d arguments, got %%d' %% len(result)) return result \n def __repr__(self): return '%(typename)s(%(reprtxt)s)' %% self \n def _asdict(self): 'Return a new dict which maps field names to their values' return dict(zip(self._fields, self)) \n def _replace(_self, **kwds): 'Return a new %(typename)s object replacing specified fields with new values' result = _self._make(map(kwds.pop, %(field_names)r, _self)) if kwds: raise ValueError('Got unexpected field names: %%r' %% kwds.keys()) return result \n def __getnewargs__(self): return tuple(self) \n\n''' % locals() for i, name in enumerate(field_names): template += ' %s = _property(_itemgetter(%d))\n' % (name, i) if verbose: print(template) # Execute the template string in a temporary namespace namespace = dict(_itemgetter=_itemgetter, __name__='namedtuple_%s' % typename, _property=property, _tuple=tuple) try: exec(template,namespace) except SyntaxError as e: raise SyntaxError(e.message + ':\n' + template) result = namespace[typename] # For pickling to work, the __module__ variable needs to be set to the frame # where the named tuple is created. Bypass this step in enviroments where # sys._getframe is not defined (Jython for example) or sys._getframe is not # defined for arguments greater than 0 (IronPython). try: result.__module__ = _sys._getframe(1).f_globals.get('__name__', '__main__') except (AttributeError, ValueError): pass return result if __name__ == '__main__': Point = namedtuple('Point', ['x', 'y']) p = Point(11, y=22) print(p[0]+p[1]) x,y=p print(x,y) print(p.x+p.y) print(p)
"""XML-RPC Servers. This module can be used to create simple XML-RPC servers by creating a server and either installing functions, a class instance, or by extending the SimpleXMLRPCServer class. It can also be used to handle XML-RPC requests in a CGI environment using CGIXMLRPCRequestHandler. The Doc* classes can be used to create XML-RPC servers that serve pydoc-style documentation in response to HTTP GET requests. This documentation is dynamically generated based on the functions and methods registered with the server. A list of possible usage patterns follows: 1. Install functions: server = SimpleXMLRPCServer(("localhost", 8000)) server.register_function(pow) server.register_function(lambda x,y: x+y, 'add') server.serve_forever() 2. Install an instance: class MyFuncs: def __init__(self): # make all of the sys functions available through sys.func_name import sys self.sys = sys def _listMethods(self): # implement this method so that system.listMethods # knows to advertise the sys methods return list_public_methods(self) + \ ['sys.' + method for method in list_public_methods(self.sys)] def pow(self, x, y): return pow(x, y) def add(self, x, y) : return x + y server = SimpleXMLRPCServer(("localhost", 8000)) server.register_introspection_functions() server.register_instance(MyFuncs()) server.serve_forever() 3. Install an instance with custom dispatch method: class Math: def _listMethods(self): # this method must be present for system.listMethods # to work return ['add', 'pow'] def _methodHelp(self, method): # this method must be present for system.methodHelp # to work if method == 'add': return "add(2,3) => 5" elif method == 'pow': return "pow(x, y[, z]) => number" else: # By convention, return empty # string if no help is available return "" def _dispatch(self, method, params): if method == 'pow': return pow(*params) elif method == 'add': return params[0] + params[1] else: raise ValueError('bad method') server = SimpleXMLRPCServer(("localhost", 8000)) server.register_introspection_functions() server.register_instance(Math()) server.serve_forever() 4. Subclass SimpleXMLRPCServer: class MathServer(SimpleXMLRPCServer): def _dispatch(self, method, params): try: # We are forcing the 'export_' prefix on methods that are # callable through XML-RPC to prevent potential security # problems func = getattr(self, 'export_' + method) except AttributeError: raise Exception('method "%s" is not supported' % method) else: return func(*params) def export_add(self, x, y): return x + y server = MathServer(("localhost", 8000)) server.serve_forever() 5. CGI script: server = CGIXMLRPCRequestHandler() server.register_function(pow) server.handle_request() """ # Written by Brian Quinlan (brian@sweetapp.com). # Based on code written by Fredrik Lundh. from xmlrpc.client import Fault, dumps, loads, gzip_encode, gzip_decode from http.server import BaseHTTPRequestHandler import http.server import socketserver import sys import os import re import pydoc import inspect import traceback try: import fcntl except ImportError: fcntl = None def resolve_dotted_attribute(obj, attr, allow_dotted_names=True): """resolve_dotted_attribute(a, 'b.c.d') => a.b.c.d Resolves a dotted attribute name to an object. Raises an AttributeError if any attribute in the chain starts with a '_'. If the optional allow_dotted_names argument is false, dots are not supported and this function operates similar to getattr(obj, attr). """ if allow_dotted_names: attrs = attr.split('.') else: attrs = [attr] for i in attrs: if i.startswith('_'): raise AttributeError( 'attempt to access private attribute "%s"' % i ) else: obj = getattr(obj,i) return obj def list_public_methods(obj): """Returns a list of attribute strings, found in the specified object, which represent callable attributes""" return [member for member in dir(obj) if not member.startswith('_') and hasattr(getattr(obj, member), '__call__')] class SimpleXMLRPCDispatcher: """Mix-in class that dispatches XML-RPC requests. This class is used to register XML-RPC method handlers and then to dispatch them. This class doesn't need to be instanced directly when used by SimpleXMLRPCServer but it can be instanced when used by the MultiPathXMLRPCServer """ def __init__(self, allow_none=False, encoding=None): self.funcs = {} self.instance = None self.allow_none = allow_none self.encoding = encoding or 'utf-8' def register_instance(self, instance, allow_dotted_names=False): """Registers an instance to respond to XML-RPC requests. Only one instance can be installed at a time. If the registered instance has a _dispatch method then that method will be called with the name of the XML-RPC method and its parameters as a tuple e.g. instance._dispatch('add',(2,3)) If the registered instance does not have a _dispatch method then the instance will be searched to find a matching method and, if found, will be called. Methods beginning with an '_' are considered private and will not be called by SimpleXMLRPCServer. If a registered function matches a XML-RPC request, then it will be called instead of the registered instance. If the optional allow_dotted_names argument is true and the instance does not have a _dispatch method, method names containing dots are supported and resolved, as long as none of the name segments start with an '_'. *** SECURITY WARNING: *** Enabling the allow_dotted_names options allows intruders to access your module's global variables and may allow intruders to execute arbitrary code on your machine. Only use this option on a secure, closed network. """ self.instance = instance self.allow_dotted_names = allow_dotted_names def register_function(self, function, name=None): """Registers a function to respond to XML-RPC requests. The optional name argument can be used to set a Unicode name for the function. """ if name is None: name = function.__name__ self.funcs[name] = function def register_introspection_functions(self): """Registers the XML-RPC introspection methods in the system namespace. see http://xmlrpc.usefulinc.com/doc/reserved.html """ self.funcs.update({'system.listMethods' : self.system_listMethods, 'system.methodSignature' : self.system_methodSignature, 'system.methodHelp' : self.system_methodHelp}) def register_multicall_functions(self): """Registers the XML-RPC multicall method in the system namespace. see http://www.xmlrpc.com/discuss/msgReader$1208""" self.funcs.update({'system.multicall' : self.system_multicall}) def _marshaled_dispatch(self, data, dispatch_method = None, path = None): """Dispatches an XML-RPC method from marshalled (XML) data. XML-RPC methods are dispatched from the marshalled (XML) data using the _dispatch method and the result is returned as marshalled data. For backwards compatibility, a dispatch function can be provided as an argument (see comment in SimpleXMLRPCRequestHandler.do_POST) but overriding the existing method through subclassing is the prefered means of changing method dispatch behavior. """ try: params, method = loads(data) # generate response if dispatch_method is not None: response = dispatch_method(method, params) else: response = self._dispatch(method, params) # wrap response in a singleton tuple response = (response,) response = dumps(response, methodresponse=1, allow_none=self.allow_none, encoding=self.encoding) except Fault as fault: response = dumps(fault, allow_none=self.allow_none, encoding=self.encoding) except: # report exception back to server exc_type, exc_value, exc_tb = sys.exc_info() response = dumps( Fault(1, "%s:%s" % (exc_type, exc_value)), encoding=self.encoding, allow_none=self.allow_none, ) return response.encode(self.encoding) def system_listMethods(self): """system.listMethods() => ['add', 'subtract', 'multiple'] Returns a list of the methods supported by the server.""" methods = set(self.funcs.keys()) if self.instance is not None: # Instance can implement _listMethod to return a list of # methods if hasattr(self.instance, '_listMethods'): methods |= set(self.instance._listMethods()) # if the instance has a _dispatch method then we # don't have enough information to provide a list # of methods elif not hasattr(self.instance, '_dispatch'): methods |= set(list_public_methods(self.instance)) return sorted(methods) def system_methodSignature(self, method_name): """system.methodSignature('add') => [double, int, int] Returns a list describing the signature of the method. In the above example, the add method takes two integers as arguments and returns a double result. This server does NOT support system.methodSignature.""" # See http://xmlrpc.usefulinc.com/doc/sysmethodsig.html return 'signatures not supported' def system_methodHelp(self, method_name): """system.methodHelp('add') => "Adds two integers together" Returns a string containing documentation for the specified method.""" method = None if method_name in self.funcs: method = self.funcs[method_name] elif self.instance is not None: # Instance can implement _methodHelp to return help for a method if hasattr(self.instance, '_methodHelp'): return self.instance._methodHelp(method_name) # if the instance has a _dispatch method then we # don't have enough information to provide help elif not hasattr(self.instance, '_dispatch'): try: method = resolve_dotted_attribute( self.instance, method_name, self.allow_dotted_names ) except AttributeError: pass # Note that we aren't checking that the method actually # be a callable object of some kind if method is None: return "" else: import pydoc return pydoc.getdoc(method) def system_multicall(self, call_list): """system.multicall([{'methodName': 'add', 'params': [2, 2]}, ...]) => \ [[4], ...] Allows the caller to package multiple XML-RPC calls into a single request. See http://www.xmlrpc.com/discuss/msgReader$1208 """ results = [] for call in call_list: method_name = call['methodName'] params = call['params'] try: # XXX A marshalling error in any response will fail the entire # multicall. If someone cares they should fix this. results.append([self._dispatch(method_name, params)]) except Fault as fault: results.append( {'faultCode' : fault.faultCode, 'faultString' : fault.faultString} ) except: exc_type, exc_value, exc_tb = sys.exc_info() results.append( {'faultCode' : 1, 'faultString' : "%s:%s" % (exc_type, exc_value)} ) return results def _dispatch(self, method, params): """Dispatches the XML-RPC method. XML-RPC calls are forwarded to a registered function that matches the called XML-RPC method name. If no such function exists then the call is forwarded to the registered instance, if available. If the registered instance has a _dispatch method then that method will be called with the name of the XML-RPC method and its parameters as a tuple e.g. instance._dispatch('add',(2,3)) If the registered instance does not have a _dispatch method then the instance will be searched to find a matching method and, if found, will be called. Methods beginning with an '_' are considered private and will not be called. """ func = None try: # check to see if a matching function has been registered func = self.funcs[method] except KeyError: if self.instance is not None: # check for a _dispatch method if hasattr(self.instance, '_dispatch'): return self.instance._dispatch(method, params) else: # call instance method directly try: func = resolve_dotted_attribute( self.instance, method, self.allow_dotted_names ) except AttributeError: pass if func is not None: return func(*params) else: raise Exception('method "%s" is not supported' % method) class SimpleXMLRPCRequestHandler(BaseHTTPRequestHandler): """Simple XML-RPC request handler class. Handles all HTTP POST requests and attempts to decode them as XML-RPC requests. """ # Class attribute listing the accessible path components; # paths not on this list will result in a 404 error. rpc_paths = ('/', '/RPC2') #if not None, encode responses larger than this, if possible encode_threshold = 1400 #a common MTU #Override form StreamRequestHandler: full buffering of output #and no Nagle. wbufsize = -1 disable_nagle_algorithm = True # a re to match a gzip Accept-Encoding aepattern = re.compile(r""" \s* ([^\s;]+) \s* #content-coding (;\s* q \s*=\s* ([0-9\.]+))? #q """, re.VERBOSE | re.IGNORECASE) def accept_encodings(self): r = {} ae = self.headers.get("Accept-Encoding", "") for e in ae.split(","): match = self.aepattern.match(e) if match: v = match.group(3) v = float(v) if v else 1.0 r[match.group(1)] = v return r def is_rpc_path_valid(self): if self.rpc_paths: return self.path in self.rpc_paths else: # If .rpc_paths is empty, just assume all paths are legal return True def do_POST(self): """Handles the HTTP POST request. Attempts to interpret all HTTP POST requests as XML-RPC calls, which are forwarded to the server's _dispatch method for handling. """ # Check that the path is legal if not self.is_rpc_path_valid(): self.report_404() return try: # Get arguments by reading body of request. # We read this in chunks to avoid straining # socket.read(); around the 10 or 15Mb mark, some platforms # begin to have problems (bug #792570). max_chunk_size = 10*1024*1024 size_remaining = int(self.headers["content-length"]) L = [] while size_remaining: chunk_size = min(size_remaining, max_chunk_size) L.append(self.rfile.read(chunk_size)) size_remaining -= len(L[-1]) data = b''.join(L) data = self.decode_request_content(data) if data is None: return #response has been sent # In previous versions of SimpleXMLRPCServer, _dispatch # could be overridden in this class, instead of in # SimpleXMLRPCDispatcher. To maintain backwards compatibility, # check to see if a subclass implements _dispatch and dispatch # using that method if present. response = self.server._marshaled_dispatch( data, getattr(self, '_dispatch', None), self.path ) except Exception as e: # This should only happen if the module is buggy # internal error, report as HTTP server error self.send_response(500) # Send information about the exception if requested if hasattr(self.server, '_send_traceback_header') and \ self.server._send_traceback_header: self.send_header("X-exception", str(e)) trace = traceback.format_exc() trace = str(trace.encode('ASCII', 'backslashreplace'), 'ASCII') self.send_header("X-traceback", trace) self.send_header("Content-length", "0") self.end_headers() else: self.send_response(200) self.send_header("Content-type", "text/xml") if self.encode_threshold is not None: if len(response) > self.encode_threshold: q = self.accept_encodings().get("gzip", 0) if q: try: response = gzip_encode(response) self.send_header("Content-Encoding", "gzip") except NotImplementedError: pass self.send_header("Content-length", str(len(response))) self.end_headers() self.wfile.write(response) def decode_request_content(self, data): #support gzip encoding of request encoding = self.headers.get("content-encoding", "identity").lower() if encoding == "identity": return data if encoding == "gzip": try: return gzip_decode(data) except NotImplementedError: self.send_response(501, "encoding %r not supported" % encoding) except ValueError: self.send_response(400, "error decoding gzip content") else: self.send_response(501, "encoding %r not supported" % encoding) self.send_header("Content-length", "0") self.end_headers() def report_404 (self): # Report a 404 error self.send_response(404) response = b'No such page' self.send_header("Content-type", "text/plain") self.send_header("Content-length", str(len(response))) self.end_headers() self.wfile.write(response) def log_request(self, code='-', size='-'): """Selectively log an accepted request.""" if self.server.logRequests: BaseHTTPRequestHandler.log_request(self, code, size) class SimpleXMLRPCServer(socketserver.TCPServer, SimpleXMLRPCDispatcher): """Simple XML-RPC server. Simple XML-RPC server that allows functions and a single instance to be installed to handle requests. The default implementation attempts to dispatch XML-RPC calls to the functions or instance installed in the server. Override the _dispatch method inhereted from SimpleXMLRPCDispatcher to change this behavior. """ allow_reuse_address = True # Warning: this is for debugging purposes only! Never set this to True in # production code, as will be sending out sensitive information (exception # and stack trace details) when exceptions are raised inside # SimpleXMLRPCRequestHandler.do_POST _send_traceback_header = False def __init__(self, addr, requestHandler=SimpleXMLRPCRequestHandler, logRequests=True, allow_none=False, encoding=None, bind_and_activate=True): self.logRequests = logRequests SimpleXMLRPCDispatcher.__init__(self, allow_none, encoding) socketserver.TCPServer.__init__(self, addr, requestHandler, bind_and_activate) # [Bug #1222790] If possible, set close-on-exec flag; if a # method spawns a subprocess, the subprocess shouldn't have # the listening socket open. if fcntl is not None and hasattr(fcntl, 'FD_CLOEXEC'): flags = fcntl.fcntl(self.fileno(), fcntl.F_GETFD) flags |= fcntl.FD_CLOEXEC fcntl.fcntl(self.fileno(), fcntl.F_SETFD, flags) class MultiPathXMLRPCServer(SimpleXMLRPCServer): """Multipath XML-RPC Server This specialization of SimpleXMLRPCServer allows the user to create multiple Dispatcher instances and assign them to different HTTP request paths. This makes it possible to run two or more 'virtual XML-RPC servers' at the same port. Make sure that the requestHandler accepts the paths in question. """ def __init__(self, addr, requestHandler=SimpleXMLRPCRequestHandler, logRequests=True, allow_none=False, encoding=None, bind_and_activate=True): SimpleXMLRPCServer.__init__(self, addr, requestHandler, logRequests, allow_none, encoding, bind_and_activate) self.dispatchers = {} self.allow_none = allow_none self.encoding = encoding def add_dispatcher(self, path, dispatcher): self.dispatchers[path] = dispatcher return dispatcher def get_dispatcher(self, path): return self.dispatchers[path] def _marshaled_dispatch(self, data, dispatch_method = None, path = None): try: response = self.dispatchers[path]._marshaled_dispatch( data, dispatch_method, path) except: # report low level exception back to server # (each dispatcher should have handled their own # exceptions) exc_type, exc_value = sys.exc_info()[:2] response = xmlrpclib.dumps( xmlrpclib.Fault(1, "%s:%s" % (exc_type, exc_value)), encoding=self.encoding, allow_none=self.allow_none) return response class CGIXMLRPCRequestHandler(SimpleXMLRPCDispatcher): """Simple handler for XML-RPC data passed through CGI.""" def __init__(self, allow_none=False, encoding=None): SimpleXMLRPCDispatcher.__init__(self, allow_none, encoding) def handle_xmlrpc(self, request_text): """Handle a single XML-RPC request""" response = self._marshaled_dispatch(request_text) print('Content-Type: text/xml') print('Content-Length: %d' % len(response)) print() sys.stdout.flush() sys.stdout.buffer.write(response) sys.stdout.buffer.flush() def handle_get(self): """Handle a single HTTP GET request. Default implementation indicates an error because XML-RPC uses the POST method. """ code = 400 message, explain = BaseHTTPRequestHandler.responses[code] response = http.server.DEFAULT_ERROR_MESSAGE % \ { 'code' : code, 'message' : message, 'explain' : explain } response = response.encode('utf-8') print('Status: %d %s' % (code, message)) print('Content-Type: %s' % http.server.DEFAULT_ERROR_CONTENT_TYPE) print('Content-Length: %d' % len(response)) print() sys.stdout.flush() sys.stdout.buffer.write(response) sys.stdout.buffer.flush() def handle_request(self, request_text=None): """Handle a single XML-RPC request passed through a CGI post method. If no XML data is given then it is read from stdin. The resulting XML-RPC response is printed to stdout along with the correct HTTP headers. """ if request_text is None and \ os.environ.get('REQUEST_METHOD', None) == 'GET': self.handle_get() else: # POST data is normally available through stdin try: length = int(os.environ.get('CONTENT_LENGTH', None)) except (ValueError, TypeError): length = -1 if request_text is None: request_text = sys.stdin.read(length) self.handle_xmlrpc(request_text) # ----------------------------------------------------------------------------- # Self documenting XML-RPC Server. class ServerHTMLDoc(pydoc.HTMLDoc): """Class used to generate pydoc HTML document for a server""" def markup(self, text, escape=None, funcs={}, classes={}, methods={}): """Mark up some plain text, given a context of symbols to look for. Each context dictionary maps object names to anchor names.""" escape = escape or self.escape results = [] here = 0 # XXX Note that this regular expression does not allow for the # hyperlinking of arbitrary strings being used as method # names. Only methods with names consisting of word characters # and '.'s are hyperlinked. pattern = re.compile(r'\b((http|ftp)://\S+[\w/]|' r'RFC[- ]?(\d+)|' r'PEP[- ]?(\d+)|' r'(self\.)?((?:\w|\.)+))\b') while 1: match = pattern.search(text, here) if not match: break start, end = match.span() results.append(escape(text[here:start])) all, scheme, rfc, pep, selfdot, name = match.groups() if scheme: url = escape(all).replace('"', '&quot;') results.append('<a href="%s">%s</a>' % (url, url)) elif rfc: url = 'http://www.rfc-editor.org/rfc/rfc%d.txt' % int(rfc) results.append('<a href="%s">%s</a>' % (url, escape(all))) elif pep: url = 'http://www.python.org/dev/peps/pep-%04d/' % int(pep) results.append('<a href="%s">%s</a>' % (url, escape(all))) elif text[end:end+1] == '(': results.append(self.namelink(name, methods, funcs, classes)) elif selfdot: results.append('self.<strong>%s</strong>' % name) else: results.append(self.namelink(name, classes)) here = end results.append(escape(text[here:])) return ''.join(results) def docroutine(self, object, name, mod=None, funcs={}, classes={}, methods={}, cl=None): """Produce HTML documentation for a function or method object.""" anchor = (cl and cl.__name__ or '') + '-' + name note = '' title = '<a name="%s"><strong>%s</strong></a>' % ( self.escape(anchor), self.escape(name)) if inspect.ismethod(object): args, varargs, varkw, defaults = inspect.getargspec(object) # exclude the argument bound to the instance, it will be # confusing to the non-Python user argspec = inspect.formatargspec ( args[1:], varargs, varkw, defaults, formatvalue=self.formatvalue ) elif inspect.isfunction(object): args, varargs, varkw, defaults = inspect.getargspec(object) argspec = inspect.formatargspec( args, varargs, varkw, defaults, formatvalue=self.formatvalue) else: argspec = '(...)' if isinstance(object, tuple): argspec = object[0] or argspec docstring = object[1] or "" else: docstring = pydoc.getdoc(object) decl = title + argspec + (note and self.grey( '<font face="helvetica, arial">%s</font>' % note)) doc = self.markup( docstring, self.preformat, funcs, classes, methods) doc = doc and '<dd><tt>%s</tt></dd>' % doc return '<dl><dt>%s</dt>%s</dl>\n' % (decl, doc) def docserver(self, server_name, package_documentation, methods): """Produce HTML documentation for an XML-RPC server.""" fdict = {} for key, value in methods.items(): fdict[key] = '#-' + key fdict[value] = fdict[key] server_name = self.escape(server_name) head = '<big><big><strong>%s</strong></big></big>' % server_name result = self.heading(head, '#ffffff', '#7799ee') doc = self.markup(package_documentation, self.preformat, fdict) doc = doc and '<tt>%s</tt>' % doc result = result + '<p>%s</p>\n' % doc contents = [] method_items = sorted(methods.items()) for key, value in method_items: contents.append(self.docroutine(value, key, funcs=fdict)) result = result + self.bigsection( 'Methods', '#ffffff', '#eeaa77', ''.join(contents)) return result class XMLRPCDocGenerator: """Generates documentation for an XML-RPC server. This class is designed as mix-in and should not be constructed directly. """ def __init__(self): # setup variables used for HTML documentation self.server_name = 'XML-RPC Server Documentation' self.server_documentation = \ "This server exports the following methods through the XML-RPC "\ "protocol." self.server_title = 'XML-RPC Server Documentation' def set_server_title(self, server_title): """Set the HTML title of the generated server documentation""" self.server_title = server_title def set_server_name(self, server_name): """Set the name of the generated HTML server documentation""" self.server_name = server_name def set_server_documentation(self, server_documentation): """Set the documentation string for the entire server.""" self.server_documentation = server_documentation def generate_html_documentation(self): """generate_html_documentation() => html documentation for the server Generates HTML documentation for the server using introspection for installed functions and instances that do not implement the _dispatch method. Alternatively, instances can choose to implement the _get_method_argstring(method_name) method to provide the argument string used in the documentation and the _methodHelp(method_name) method to provide the help text used in the documentation.""" methods = {} for method_name in self.system_listMethods(): if method_name in self.funcs: method = self.funcs[method_name] elif self.instance is not None: method_info = [None, None] # argspec, documentation if hasattr(self.instance, '_get_method_argstring'): method_info[0] = self.instance._get_method_argstring(method_name) if hasattr(self.instance, '_methodHelp'): method_info[1] = self.instance._methodHelp(method_name) method_info = tuple(method_info) if method_info != (None, None): method = method_info elif not hasattr(self.instance, '_dispatch'): try: method = resolve_dotted_attribute( self.instance, method_name ) except AttributeError: method = method_info else: method = method_info else: assert 0, "Could not find method in self.functions and no "\ "instance installed" methods[method_name] = method documenter = ServerHTMLDoc() documentation = documenter.docserver( self.server_name, self.server_documentation, methods ) return documenter.page(self.server_title, documentation) class DocXMLRPCRequestHandler(SimpleXMLRPCRequestHandler): """XML-RPC and documentation request handler class. Handles all HTTP POST requests and attempts to decode them as XML-RPC requests. Handles all HTTP GET requests and interprets them as requests for documentation. """ def do_GET(self): """Handles the HTTP GET request. Interpret all HTTP GET requests as requests for server documentation. """ # Check that the path is legal if not self.is_rpc_path_valid(): self.report_404() return response = self.server.generate_html_documentation().encode('utf-8') self.send_response(200) self.send_header("Content-type", "text/html") self.send_header("Content-length", str(len(response))) self.end_headers() self.wfile.write(response) class DocXMLRPCServer( SimpleXMLRPCServer, XMLRPCDocGenerator): """XML-RPC and HTML documentation server. Adds the ability to serve server documentation to the capabilities of SimpleXMLRPCServer. """ def __init__(self, addr, requestHandler=DocXMLRPCRequestHandler, logRequests=True, allow_none=False, encoding=None, bind_and_activate=True): SimpleXMLRPCServer.__init__(self, addr, requestHandler, logRequests, allow_none, encoding, bind_and_activate) XMLRPCDocGenerator.__init__(self) class DocCGIXMLRPCRequestHandler( CGIXMLRPCRequestHandler, XMLRPCDocGenerator): """Handler for XML-RPC data and documentation requests passed through CGI""" def handle_get(self): """Handles the HTTP GET request. Interpret all HTTP GET requests as requests for server documentation. """ response = self.generate_html_documentation().encode('utf-8') print('Content-Type: text/html') print('Content-Length: %d' % len(response)) print() sys.stdout.flush() sys.stdout.buffer.write(response) sys.stdout.buffer.flush() def __init__(self): CGIXMLRPCRequestHandler.__init__(self) XMLRPCDocGenerator.__init__(self) if __name__ == '__main__': print('Running XML-RPC server on port 8000') server = SimpleXMLRPCServer(("localhost", 8000)) server.register_function(pow) server.register_function(lambda x,y: x+y, 'add') server.serve_forever()
# Standard imports import logging import attrdict as ad import numpy as np import pandas as pd import datetime as pydt # Our imports import emission.analysis.point_features as pf import emission.analysis.intake.segmentation.trip_segmentation as eaist import emission.core.wrapper.location as ecwl class DwellSegmentationTimeFilter(eaist.TripSegmentationMethod): def __init__(self, time_threshold, point_threshold, distance_threshold): """ Determines segmentation points for points that were generated using a time filter (i.e. report points every n seconds). This will *not* work for points generated using a distance filter because it expects to have a cluster of points to detect the trip end, and with a distance filter, we will not get updates while we are still. At least on android, we can get updates at a different frequency than the "n" specified above. In particular: a) we can get updates more frequently than "n" if there are other apps that are requesting updates frequently - for example, while using a routing app. b) we can get updates less frequently than "n" if there are bad/low accuracy points that are filtered out. So we use a combination of a time filter and a "number of points" filter to detect the trip end. The time_threshold indicates the number of seconds that we need to be still before a trip end is detected. The point_threshold indicates the number of prior points (after filtering) that we need to be still for before a trip end is detected The distance_threshold indicates the radius of the circle used to detect that we are still. If all the points within the time_threshold AND all the points within the point_threshold are within the distance_threshold of each other, then we are still. """ self.time_threshold = time_threshold self.point_threshold = point_threshold self.distance_threshold = distance_threshold def segment_into_trips(self, timeseries, time_query): """ Examines the timeseries database for a specific range and returns the segmentation points. Note that the input is the entire timeseries and the time range. This allows algorithms to use whatever combination of data that they want from the sensor streams in order to determine the segmentation points. """ filtered_points_df = timeseries.get_data_df("background/filtered_location", time_query) transition_df = timeseries.get_data_df("statemachine/transition", time_query) logging.debug("transition_df = %s" % transition_df[["fmt_time", "transition"]]) self.last_ts_processed = None logging.info("Last ts processed = %s" % self.last_ts_processed) segmentation_points = [] last_trip_end_point = None curr_trip_start_point = None just_ended = True prevPoint = None for idx, row in filtered_points_df.iterrows(): currPoint = ad.AttrDict(row) currPoint.update({"idx": idx}) logging.debug("-" * 30 + str(currPoint.fmt_time) + "-" * 30) if curr_trip_start_point is None: logging.debug("Appending currPoint because the current start point is None") # segmentation_points.append(currPoint) if just_ended: if self.continue_just_ended(idx, currPoint, filtered_points_df): # We have "processed" the currPoint by deciding to glom it self.last_ts_processed = currPoint.ts continue # else: sel_point = currPoint logging.debug("Setting new trip start point %s with idx %s" % (sel_point, sel_point.idx)) curr_trip_start_point = sel_point just_ended = False last5MinsPoints_df = filtered_points_df[np.logical_and( np.logical_and( filtered_points_df.ts > currPoint.ts - self.time_threshold, filtered_points_df.ts < currPoint.ts), filtered_points_df.ts >= curr_trip_start_point.ts)] # Using .loc here causes problems if we have filtered out some points and so the index is non-consecutive. # Using .iloc just ends up including points after this one. # So we reset_index upstream and use it here. # We are going to use the last 8 points for now. # TODO: Change this back to last 10 points once we normalize phone and this last10Points_df = filtered_points_df.iloc[max(idx-self.point_threshold, curr_trip_start_point.idx):idx+1] distanceToLast = lambda(row): pf.calDistance(ad.AttrDict(row), currPoint) timeToLast = lambda(row): currPoint.ts - ad.AttrDict(row).ts last5MinsDistances = last5MinsPoints_df.apply(distanceToLast, axis=1) logging.debug("last5MinsDistances = %s with length %d" % (last5MinsDistances.as_matrix(), len(last5MinsDistances))) last10PointsDistances = last10Points_df.apply(distanceToLast, axis=1) logging.debug("last10PointsDistances = %s with length %d, shape %s" % (last10PointsDistances.as_matrix(), len(last10PointsDistances), last10PointsDistances.shape)) # Fix for https://github.com/e-mission/e-mission-server/issues/348 last5MinTimes = last5MinsPoints_df.apply(timeToLast, axis=1) logging.debug("len(last10PointsDistances) = %d, len(last5MinsDistances) = %d" % (len(last10PointsDistances), len(last5MinsDistances))) logging.debug("last5MinsTimes.max() = %s, time_threshold = %s" % (last5MinTimes.max() if len(last5MinTimes) > 0 else np.NaN, self.time_threshold)) if self.has_trip_ended(prevPoint, currPoint, last10PointsDistances, last5MinsDistances, last5MinTimes): (ended_before_this, last_trip_end_point) = self.get_last_trip_end_point(filtered_points_df, last10Points_df, last5MinsPoints_df) segmentation_points.append((curr_trip_start_point, last_trip_end_point)) logging.info("Found trip end at %s" % last_trip_end_point.fmt_time) # We have processed everything up to the trip end by marking it as a completed trip self.last_ts_processed = currPoint.ts if ended_before_this: # in this case, we end a trip at the previous point, and the next trip starts at this # point, not the next one just_ended = False prevPoint = currPoint curr_trip_start_point = currPoint logging.debug("Setting new trip start point %s with idx %s" % (currPoint, currPoint.idx)) else: # We end a trip at the current point, and the next trip starts at the next point just_ended = True prevPoint = None else: prevPoint = currPoint if not just_ended and len(transition_df) > 0: stopped_moving_after_last = transition_df[(transition_df.ts > currPoint.ts) & (transition_df.transition == 2)] if len(stopped_moving_after_last) > 0: (unused, last_trip_end_point) = self.get_last_trip_end_point(filtered_points_df, last10Points_df, None) segmentation_points.append((curr_trip_start_point, last_trip_end_point)) logging.debug("Found trip end at %s" % last_trip_end_point.fmt_time) # We have processed everything up to the trip end by marking it as a completed trip self.last_ts_processed = currPoint.ts return segmentation_points def continue_just_ended(self, idx, currPoint, filtered_points_df): """ Normally, since the logic here and the logic on the phone are the same, if we have detected a trip end, any points after this are part of the new trip. However, in some circumstances, notably in my data from 27th August, there appears to be a mismatch and we get a couple of points past the end that we detected here. So let's look for points that are within the distance filter, and are at a delta of a minute, and join them to the just ended trip instead of using them to start the new trip :param idx: Index of the current point :param currPoint: current point :param filtered_points_df: dataframe of filtered points :return: True if we should continue the just ended trip, False otherwise """ if idx == 0: return False else: prev_point = ad.AttrDict(filtered_points_df.iloc[idx - 1]) logging.debug("Comparing with prev_point = %s" % prev_point) if pf.calDistance(prev_point, currPoint) < self.distance_threshold and \ currPoint.ts - prev_point.ts <= 60: logging.info("Points %s and %s are within the distance filter and only 1 min apart so part of the same trip" % (prev_point, currPoint)) return True else: return False def has_trip_ended(self, prev_point, curr_point, last10PointsDistances, last5MinsDistances, last5MinTimes): # Another mismatch between phone and server. Phone stops tracking too soon, # so the distance is still greater than the threshold at the end of the trip. # But then the next point is a long time away, so we can split again (similar to a distance filter) if prev_point is None: logging.debug("prev_point is None, continuing trip") else: timeDelta = curr_point.ts - prev_point.ts distDelta = pf.calDistance(prev_point, curr_point) if timeDelta > 0: speedDelta = distDelta / timeDelta else: speedDelta = np.nan speedThreshold = float(self.distance_threshold) / self.time_threshold if (timeDelta > 2 * self.time_threshold and # We have been here for a while speedDelta < speedThreshold): # we haven't moved very much logging.debug("prev_point.ts = %s, curr_point.ts = %s, threshold = %s, large gap = %s, ending trip" % (prev_point.ts, curr_point.ts,self.time_threshold, curr_point.ts - prev_point.ts)) return True else: logging.debug("prev_point.ts = %s, curr_point.ts = %s, time gap = %s (vs %s), distance_gap = %s (vs %s), speed_gap = %s (vs %s) continuing trip" % (prev_point.ts, curr_point.ts, timeDelta, self.time_threshold, distDelta, self.distance_threshold, speedDelta, speedThreshold)) # The -30 is a fuzz factor intended to compensate for older clients # where data collection stopped after 5 mins, so that we never actually # see 5 mins of data if (len(last10PointsDistances) < self.point_threshold - 1 or len(last5MinsDistances) == 0 or last5MinTimes.max() < self.time_threshold - 30): logging.debug("Too few points to make a decision, continuing") return False # Normal end-of-trip case logging.debug("last5MinsDistances.max() = %s, last10PointsDistance.max() = %s" % (last5MinsDistances.max(), last10PointsDistances.max())) if (last5MinsDistances.max() < self.distance_threshold and last10PointsDistances.max() < self.distance_threshold): return True def get_last_trip_end_point(self, filtered_points_df, last10Points_df, last5MinsPoints_df): ended_before_this = last5MinsPoints_df is None or len(last5MinsPoints_df) == 0 if ended_before_this: logging.debug("trip end transition, so last 10 points are %s" % last10Points_df.index) last10PointsMedian = np.median(last10Points_df.index) last_trip_end_index = int(last10PointsMedian) logging.debug("last5MinsPoints not found, last_trip_end_index = %s" % last_trip_end_index) else: last10PointsMedian = np.median(last10Points_df.index) last5MinsPointsMedian = np.median(last5MinsPoints_df.index) last_trip_end_index = int(min(last5MinsPointsMedian, last10PointsMedian)) logging.debug("last5MinsPoints and last10PointsMedian found, last_trip_end_index = %s" % last_trip_end_index) # logging.debug("last5MinPoints.median = %s (%s), last10Points_df = %s (%s), sel index = %s" % # (np.median(last5MinsPoints_df.index), last5MinsPoints_df.index, # np.median(last10Points_df.index), last10Points_df.index, # last_trip_end_index)) last_trip_end_point_row = filtered_points_df.iloc[last_trip_end_index] last_trip_end_point = ad.AttrDict(filtered_points_df.iloc[last_trip_end_index]) logging.debug("Appending last_trip_end_point %s with index %s " % (last_trip_end_point, last_trip_end_point_row.name)) return (ended_before_this, last_trip_end_point)
# pylint: disable=E0401 # stdlib from functools import partial import logging import time import unittest # 3rd from mock import Mock, patch # project from tests.checks.common import Fixtures from utils.timeout import TimeoutException log = logging.getLogger(__name__) WMISampler = None ProviderArchitecture = None def load_fixture(f, args=None): """ Build a WMI query result from a file and given parameters. """ properties = [] args = args or [] def extract_line(line): """ Extract a property name, value and the qualifiers from a fixture line. Return (property name, property value, property qualifiers) """ property_counter_type = "" try: property_name, property_value, property_counter_type = line.split(" ") except ValueError: property_name, property_value = line.split(" ") property_qualifiers = [Mock(Name='CounterType', Value=int(property_counter_type))] \ if property_counter_type else [] return property_name, property_value, property_qualifiers # Build from file data = Fixtures.read_file(f) for l in data.splitlines(): property_name, property_value, property_qualifiers = extract_line(l) properties.append( Mock(Name=property_name, Value=property_value, Qualifiers_=property_qualifiers) ) # Append extra information args = args if isinstance(args, list) else [args] for arg in args: property_name, property_value = arg properties.append(Mock(Name=property_name, Value=property_value, Qualifiers_=[])) return [Mock(Properties_=properties)] class Counter(object): def __init__(self): self.value = 0 def __iadd__(self, other): self.value += other return self def __eq__(self, other): return self.value == other def __str__(self): return str(self.value) def reset(self): self.value = 0 class SWbemServices(object): """ SWbemServices a.k.a. (mocked) WMI connection. Save connection parameters so it can be tested. """ # `ExecQuery` metadata _exec_query_call_count = Counter() _exec_query_run_time = 0 # Class attr to save the last wmi query and flags _last_wmi_query = None _last_wmi_flags = None def __init__(self, wmi_conn_args): super(SWbemServices, self).__init__() self._wmi_conn_args = wmi_conn_args @classmethod def reset(cls): """ Dirty patch to reset `SWbemServices.ExecQuery.call_count` and `SWbemServices._exec_query_run_time` to 0, and the wmi query params """ cls._exec_query_call_count.reset() cls._exec_query_run_time = 0 cls._last_wmi_query = None cls._last_wmi_flags = None @classmethod def get_last_wmi_query(cls): """ Return the last WMI query submitted via the WMI connection. """ return cls._last_wmi_query @classmethod def get_last_wmi_flags(cls): """ Return the last WMI flags submitted via the WMI connection. """ return cls._last_wmi_flags def get_conn_args(self): """ Return parameters used to set up the WMI connection. """ return self._wmi_conn_args def ExecQuery(self, query, query_language, flags): """ Mocked `SWbemServices.ExecQuery` method. """ # Comply with `ExecQuery` metadata self._exec_query_call_count += 1 time.sleep(self._exec_query_run_time) # Save last passed parameters SWbemServices._last_wmi_query = query SWbemServices._last_wmi_flags = flags # Mock a result results = [] if query in [ "Select AvgDiskBytesPerWrite,FreeMegabytes from Win32_PerfFormattedData_PerfDisk_LogicalDisk", # noqa "Select AvgDiskBytesPerWrite,FreeMegabytes,Name from Win32_PerfFormattedData_PerfDisk_LogicalDisk" # noqa ]: results += load_fixture("win32_perfformatteddata_perfdisk_logicaldisk", ("Name", "C:")) results += load_fixture("win32_perfformatteddata_perfdisk_logicaldisk", ("Name", "D:")) if query == "Select CounterRawCount,CounterCounter,Timestamp_Sys100NS,Frequency_Sys100NS from Win32_PerfRawData_PerfOS_System": # noqa # Mock a previous and a current sample sample_file = "win32_perfrawdata_perfos_system_previous" if flags == 131120\ else "win32_perfrawdata_perfos_system_current" results += load_fixture(sample_file, ("Name", "C:")) results += load_fixture(sample_file, ("Name", "D:")) if query == "Select UnknownCounter,MissingProperty,Timestamp_Sys100NS,Frequency_Sys100NS from Win32_PerfRawData_PerfOS_System": # noqa results += load_fixture("win32_perfrawdata_perfos_system_unknown", ("Name", "C:")) if query in [ "Select NonDigit,FreeMegabytes from Win32_PerfFormattedData_PerfDisk_LogicalDisk", "Select FreeMegabytes,NonDigit from Win32_PerfFormattedData_PerfDisk_LogicalDisk", ]: # noqa results += load_fixture("win32_perfformatteddata_perfdisk_logicaldisk", [("Name", "C:"), ("NonDigit", "Foo")]) # noqa if query == "Select IOReadBytesPerSec,IDProcess from Win32_PerfFormattedData_PerfProc_Process WHERE ( Name = 'chrome' )" \ or query == "Select IOReadBytesPerSec,UnknownProperty from Win32_PerfFormattedData_PerfProc_Process WHERE ( Name = 'chrome' )": # noqa results += load_fixture("win32_perfformatteddata_perfproc_process") if query == "Select IOReadBytesPerSec,ResultNotMatchingAnyTargetProperty from Win32_PerfFormattedData_PerfProc_Process WHERE ( Name = 'chrome' )": # noqa results += load_fixture("win32_perfformatteddata_perfproc_process_alt") if query == "Select CommandLine from Win32_Process WHERE ( Handle = '4036' )" \ or query == "Select UnknownProperty from Win32_Process WHERE ( Handle = '4036' )": results += load_fixture("win32_process") if query == ("Select ServiceUptime,TotalBytesSent,TotalBytesReceived,TotalBytesTransferred,CurrentConnections,TotalFilesSent,TotalFilesReceived," # noqa "TotalConnectionAttemptsAllInstances,TotalGetRequests,TotalPostRequests,TotalHeadRequests,TotalPutRequests,TotalDeleteRequests," # noqa "TotalOptionsRequests,TotalTraceRequests,TotalNotFoundErrors,TotalLockedErrors,TotalAnonymousUsers,TotalNonAnonymousUsers,TotalCGIRequests," # noqa "TotalISAPIExtensionRequests from Win32_PerfFormattedData_W3SVC_WebService WHERE ( Name = 'Failing site' ) OR ( Name = 'Working site' ) OR ( Name = 'Default Web Site' )"): # noqa results += load_fixture("win32_perfformatteddata_w3svc_webservice", ("Name", "Default Web Site")) # noqa results += load_fixture("win32_perfformatteddata_w3svc_webservice", ("Name", "Working site")) # noqa if query == ("Select ServiceUptime,TotalBytesSent,TotalBytesReceived,TotalBytesTransferred,CurrentConnections,TotalFilesSent,TotalFilesReceived," # noqa "TotalConnectionAttemptsAllInstances,TotalGetRequests,TotalPostRequests,TotalHeadRequests,TotalPutRequests,TotalDeleteRequests," # noqa "TotalOptionsRequests,TotalTraceRequests,TotalNotFoundErrors,TotalLockedErrors,TotalAnonymousUsers,TotalNonAnonymousUsers,TotalCGIRequests," # noqa "TotalISAPIExtensionRequests from Win32_PerfFormattedData_W3SVC_WebService WHERE ( Name = '_Total' )"): # noqa results += load_fixture("win32_perfformatteddata_w3svc_webservice", ("Name", "_Total")) # noqa if query == ("Select * from Win32_PerfFormattedData_W3SVC_WebService WHERE ( Name = 'Failing site' ) OR ( Name = 'Working site' ) OR ( Name = 'Default Web Site' )"): # noqa results += load_fixture("win32_perfformatteddata_w3svc_webservice_2008", ("Name", "Default Web Site")) # noqa results += load_fixture("win32_perfformatteddata_w3svc_webservice_2008", ("Name", "Working Site")) # noqa if query == ("Select Name,State from Win32_Service WHERE ( Name = 'WSService' ) OR ( Name = 'WinHttpAutoProxySvc' )"): # noqa results += load_fixture("win32_service_up", ("Name", "WinHttpAutoProxySvc")) results += load_fixture("win32_service_down", ("Name", "WSService")) if query == ("Select EventCode,SourceName,TimeGenerated,Type,InsertionStrings,Message,Logfile from Win32_NTLogEvent WHERE ( ( SourceName = 'MSSQLSERVER' ) " # noqa "AND ( Type = 'Error' OR Type = 'Warning' ) AND TimeGenerated >= '20151224113047.000000-480' )"): # noqa results += load_fixture("win32_ntlogevent") return results ExecQuery.call_count = _exec_query_call_count class Dispatch(object): """ Mock for win32com.client Dispatch class. """ _connect_call_count = Counter() def __init__(self, *args, **kwargs): pass @classmethod def reset(cls): """ FIXME - Dirty patch to reset `ConnectServer.call_count` to 0. """ cls._connect_call_count.reset() def Add(self, *args, **kwargs): """ Add context information. """ pass def ConnectServer(self, *args, **kwargs): """ Return a WMI connection, a.k.a. a SWbemServices object. """ Dispatch._connect_call_count += 1 wmi_conn_args = (args, kwargs) return SWbemServices(wmi_conn_args) ConnectServer.call_count = _connect_call_count def to_time(wmi_ts): "Just return any time struct" return (2015, 12, 24, 11, 30, 47, 0, 0) def from_time(year=0, month=0, day=0, hours=0, minutes=0, seconds=0, microseconds=0, timezone=0): "Just return any WMI date" return "20151224113047.000000-480" class TestCommonWMI(unittest.TestCase): """ Common toolbox for WMI unit testing. """ def setUp(self): """ Mock WMI related Python packages, so it can be tested on any environment. """ self.patcher = patch.dict('sys.modules', { 'pywintypes': Mock(), 'pythoncom': Mock(), 'win32com': Mock(), 'win32com.client': Mock(Dispatch=Dispatch), }) self.patcher.start() def tearDown(self): """ Reset Mock counters """ # Reset counters Dispatch.reset() SWbemServices.reset() def assertWMIConn(self, wmi_sampler, param=None): """ Helper, assertion on the `wmi_sampler`'s WMI connection(s): * `param`: parameters used to establish the connection """ if param: connection = wmi_sampler.get_connection() wmi_conn_args, wmi_conn_kwargs = connection.get_conn_args() if isinstance(param, tuple): key, value = param self.assertIn(key, wmi_conn_kwargs) self.assertEquals(wmi_conn_kwargs[key], value) else: self.assertIn(param, wmi_conn_args) def assertWMIQuery(self, query=None, flags=None): """ Helper, assert that the given WMI query and flags were submitted. """ if query: last_wmi_query = SWbemServices.get_last_wmi_query() self.assertEquals(last_wmi_query, query) if flags: last_wmi_flags = SWbemServices.get_last_wmi_flags() self.assertEquals(last_wmi_flags, flags) def assertWMIObject(self, wmi_obj, properties): """ Assert the WMI object integrity, i.e. contains the given properties. """ for prop_and_value in properties: prop = prop_and_value[0] if isinstance(prop_and_value, tuple) else prop_and_value value = prop_and_value[1] if isinstance(prop_and_value, tuple) else None self.assertIn(prop, wmi_obj) if value is None: continue self.assertEquals(wmi_obj[prop], value) def assertWMISampler(self, wmi_sampler, properties, count=None): """ Assert WMI objects' integrity among the WMI sampler. """ self.assertEquals(len(wmi_sampler), count) for wmi_obj in wmi_sampler: self.assertWMIObject(wmi_obj, properties) def assertIn(self, first, second): """ Assert `first` in `second`. Note: needs to be defined for Python 2.6 """ self.assertTrue(first in second, "{0} not in {1}".format(first, second)) def assertNotIn(self, first, second): """ Assert `first` is not in `second`. Note: needs to be defined for Python 2.6 """ self.assertTrue(first not in second, "{0} in {1}".format(first, second)) def assertInPartial(self, first, second): """ Assert `first` has a key in `second` where it's a prefix. Note: needs to be defined for Python 2.6 """ self.assertTrue(any(key for key in second if key.startswith(first)), "{0} not in {1}".format(first, second)) def getProp(self, dict, prefix): """ Get Property from dictionary `dict` starting with `prefix`. Note: needs to be defined for Python 2.6 """ for key in dict: if key.startswith(prefix): return dict[key] return None class TestUnitWMISampler(TestCommonWMI): """ Unit tests for WMISampler. """ def setUp(self): TestCommonWMI.setUp(self) global WMISampler global ProviderArchitecture # Reload to apply the mocking if the module was already loaded from checks.libs.wmi import sampler reload(sampler) WMISampler = partial(sampler.WMISampler, log) ProviderArchitecture = sampler.ProviderArchitecture def test_wmi_connection(self): """ Establish a WMI connection to the specified host/namespace, with the right credentials. """ wmi_sampler = WMISampler( "Win32_PerfRawData_PerfOS_System", ["ProcessorQueueLength"], host="myhost", namespace="some/namespace", username="datadog", password="password", provider=32, ) # Request a connection but do nothing wmi_sampler.get_connection() # Connection was established with the right parameters self.assertWMIConn(wmi_sampler, param="myhost") self.assertWMIConn(wmi_sampler, param="some/namespace") def test_wmi_provider_architecture(self): """ Validate and set a WMI Provider Architecture. """ # No provider given, default wmi_sampler = WMISampler("Win32_PerfRawData_PerfOS_System", ["ProcessorQueueLength"]) self.assertEquals(wmi_sampler.provider, ProviderArchitecture.DEFAULT) # Invalid provider, default wmi_sampler1 = WMISampler( "Win32_PerfRawData_PerfOS_System", ["ProcessorQueueLength"], provider="foo" ) wmi_sampler2 = WMISampler( "Win32_PerfRawData_PerfOS_System", ["ProcessorQueueLength"], provider=123 ) self.assertEquals(wmi_sampler1.provider, ProviderArchitecture.DEFAULT) self.assertEquals(wmi_sampler2.provider, ProviderArchitecture.DEFAULT) # Valid providers wmi_sampler32 = WMISampler( "Win32_PerfRawData_PerfOS_System", ["ProcessorQueueLength"], provider=32 ) wmi_sampler64 = WMISampler( "Win32_PerfRawData_PerfOS_System", ["ProcessorQueueLength"], provider="64" ) self.assertEquals(wmi_sampler32.provider, ProviderArchitecture._32BIT) self.assertEquals(wmi_sampler64.provider, ProviderArchitecture._64BIT) def test_no_wmi_connection_pooling(self): """ WMI connections are not be shared among WMISampler objects. """ from win32com.client import Dispatch # noqa wmi_sampler_1 = WMISampler("Win32_PerfRawData_PerfOS_System", ["ProcessorQueueLength"]) wmi_sampler_2 = WMISampler("Win32_OperatingSystem", ["TotalVisibleMemorySize"]) wmi_sampler_3 = WMISampler("Win32_PerfRawData_PerfOS_System", ["ProcessorQueueLength"], host="myhost") # noqa wmi_sampler_1.sample() wmi_sampler_2.sample() # 3 conns have been opened, 2 for the raw sampler and 1 for the other sampler self.assertEquals(Dispatch.ConnectServer.call_count, 3, Dispatch.ConnectServer.call_count) wmi_sampler_3.sample() # 5 conns now self.assertEquals(Dispatch.ConnectServer.call_count, 5, Dispatch.ConnectServer.call_count) def test_wql_filtering(self): """ Format the filters to a comprehensive WQL `WHERE` clause. """ from checks.libs.wmi import sampler format_filter = sampler.WMISampler._format_filter # Check `_format_filter` logic no_filters = [] filters = [{'Name': "SomeName", 'Id': "SomeId"}] self.assertEquals("", format_filter(no_filters)) self.assertEquals(" WHERE ( Name = 'SomeName' AND Id = 'SomeId' )", format_filter(filters)) def test_wql_multiquery_filtering(self): """ Format the filters with multiple properties per instance to a comprehensive WQL `WHERE` clause. """ from checks.libs.wmi import sampler format_filter = sampler.WMISampler._format_filter # Check `_format_filter` logic no_filters = [] filters = [{'Name': "SomeName", 'Property1': "foo"}, {'Name': "OtherName", 'Property1': "bar"}] self.assertEquals("", format_filter(no_filters)) self.assertEquals(" WHERE ( Property1 = 'bar' AND Name = 'OtherName' ) OR" " ( Property1 = 'foo' AND Name = 'SomeName' )", format_filter(filters)) def test_wql_empty_list(self): """ Format filters to a comprehensive WQL `WHERE` clause skipping empty lists. """ from checks.libs.wmi import sampler format_filter = sampler.WMISampler._format_filter filters = [] query = {} query['User'] = ('=', 'luser') query['SourceName'] = ('=', 'MSSQL') query['EventCode'] = [] query['SomethingEmpty'] = [] query['MoreNothing'] = [] filters.append(query) self.assertEquals(" WHERE ( SourceName = 'MSSQL' AND User = 'luser' )", format_filter(filters)) def test_wql_filtering_op_adv(self): """ Format the filters to a comprehensive WQL `WHERE` clause w/ mixed filter containing regular and operator modified properties. """ from checks.libs.wmi import sampler format_filter = sampler.WMISampler._format_filter # Check `_format_filter` logic filters = [{'Name': "Foo%"}, {'Name': "Bar%", 'Id': ('>=', "SomeId")}, {'Name': "Zulu"}] self.assertEquals(" WHERE ( Name = 'Zulu' ) OR ( Name LIKE 'Bar%' AND Id >= 'SomeId' ) OR ( Name LIKE 'Foo%' )", format_filter(filters)) def test_wql_eventlog_filtering(self): """ Format filters with the eventlog expected form to a comprehensive WQL `WHERE` clause. """ from checks.libs.wmi import sampler from datetime import datetime from checks.wmi_check import from_time format_filter = sampler.WMISampler._format_filter filters = [] query = {} and_props = ['mEssage'] ltypes = ["Error", "Warning"] source_names = ["MSSQLSERVER", "IIS"] log_files = ["System", "Security"] event_codes = [302, 404, 501] message_filters = ["-foo", "%bar%", "%zen%"] last_ts = datetime(2016, 1, 1, 15, 8, 24, 78915) query['TimeGenerated'] = ('>=', from_time(last_ts)) query['Type'] = ('=', 'footype') query['User'] = ('=', 'luser') query['SourceName'] = ('=', 'MSSQL') query['LogFile'] = ('=', 'thelogfile') query['Type'] = [] for ltype in ltypes: query['Type'].append(('=', ltype)) query['SourceName'] = [] for source_name in source_names: query['SourceName'].append(('=', source_name)) query['LogFile'] = [] for log_file in log_files: query['LogFile'].append(('=', log_file)) query['EventCode'] = [] for code in event_codes: query['EventCode'].append(('=', code)) query['NOT Message'] = [] query['Message'] = [] for filt in message_filters: if filt[0] == '-': query['NOT Message'].append(('LIKE', filt[1:])) else: query['Message'].append(('LIKE', filt)) filters.append(query) self.assertEquals(" WHERE ( NOT Message LIKE 'foo' AND ( EventCode = '302' OR EventCode = '404' OR EventCode = '501' ) " "AND ( SourceName = 'MSSQLSERVER' OR SourceName = 'IIS' ) AND TimeGenerated >= '2016-01-01 15:08:24.078915**********.******+' " "AND User = 'luser' AND Message LIKE '%bar%' AND Message LIKE '%zen%' AND ( LogFile = 'System' OR LogFile = 'Security' ) " "AND ( Type = 'Error' OR Type = 'Warning' ) )", format_filter(filters, and_props)) def test_wql_filtering_inclusive(self): """ Format the filters to a comprehensive and inclusive WQL `WHERE` clause. """ from checks.libs.wmi import sampler format_filter = sampler.WMISampler._format_filter # Check `_format_filter` logic filters = [{'Name': "SomeName"}, {'Id': "SomeId"}] self.assertEquals(" WHERE ( Id = 'SomeId' ) OR ( Name = 'SomeName' )", format_filter(filters, True)) def test_wmi_query(self): """ Query WMI using WMI Query Language (WQL). """ # No filters wmi_sampler = WMISampler("Win32_PerfFormattedData_PerfDisk_LogicalDisk", ["AvgDiskBytesPerWrite", "FreeMegabytes"]) wmi_sampler.sample() self.assertWMIQuery( "Select AvgDiskBytesPerWrite,FreeMegabytes" " from Win32_PerfFormattedData_PerfDisk_LogicalDisk" ) # Single filter wmi_sampler = WMISampler("Win32_PerfFormattedData_PerfDisk_LogicalDisk", ["AvgDiskBytesPerWrite", "FreeMegabytes"], filters=[{'Name': "C:"}]) wmi_sampler.sample() self.assertWMIQuery( "Select AvgDiskBytesPerWrite,FreeMegabytes" " from Win32_PerfFormattedData_PerfDisk_LogicalDisk" " WHERE ( Name = 'C:' )" ) # Multiple filters wmi_sampler = WMISampler("Win32_PerfFormattedData_PerfDisk_LogicalDisk", ["AvgDiskBytesPerWrite", "FreeMegabytes"], filters=[{'Name': "C:", 'Id': "123"}]) wmi_sampler.sample() self.assertWMIQuery( "Select AvgDiskBytesPerWrite,FreeMegabytes" " from Win32_PerfFormattedData_PerfDisk_LogicalDisk" " WHERE ( Name = 'C:' AND Id = '123' )" ) def test_wmi_parser(self): """ Parse WMI objects from WMI query results. """ wmi_sampler = WMISampler("Win32_PerfFormattedData_PerfDisk_LogicalDisk", ["AvgDiskBytesPerWrite", "FreeMegabytes"]) wmi_sampler.sample() # Assert `results` expected_results = [ { 'freemegabytes': 19742.0, 'name': 'C:', 'avgdiskbytesperwrite': 1536.0 }, { 'freemegabytes': 19742.0, 'name': 'D:', 'avgdiskbytesperwrite': 1536.0 } ] self.assertEquals(wmi_sampler, expected_results, wmi_sampler) def test_wmi_sampler_iterator_getter(self): """ Iterate/Get on the WMISampler object iterates/gets on its current sample. """ wmi_sampler = WMISampler("Win32_PerfFormattedData_PerfDisk_LogicalDisk", ["AvgDiskBytesPerWrite", "FreeMegabytes"]) wmi_sampler.sample() self.assertEquals(len(wmi_sampler), 2) # Using an iterator for wmi_obj in wmi_sampler: self.assertWMIObject(wmi_obj, ["AvgDiskBytesPerWrite", "FreeMegabytes", "name"]) # Using an accessor for index in xrange(0, 2): self.assertWMIObject(wmi_sampler[index], ["AvgDiskBytesPerWrite", "FreeMegabytes", "name"]) def test_wmi_sampler_timeout(self): """ Gracefully handle WMI query timeouts. """ from checks.libs.wmi.sampler import WMISampler logger = Mock() # Create a sampler that timeouts wmi_sampler = WMISampler(logger, "Win32_PerfFormattedData_PerfDisk_LogicalDisk", ["AvgDiskBytesPerWrite", "FreeMegabytes"], timeout_duration=0.1) SWbemServices._exec_query_run_time = 0.11 # `TimeoutException` exception is raised, DEBUG message logged self.assertRaises(TimeoutException, wmi_sampler.sample) self.assertTrue(wmi_sampler._sampling) self.assertTrue(logger.debug.called) # Cannot iterate on data self.assertRaises(TypeError, lambda: len(wmi_sampler)) self.assertRaises(TypeError, lambda: sum(1 for _ in wmi_sampler)) # Recover from timeout at next iteration wmi_sampler.sample() self.assertFalse(wmi_sampler._sampling) # The existing query was retrieved self.assertEquals(SWbemServices.ExecQuery.call_count, 1, SWbemServices.ExecQuery.call_count) # Data is populated self.assertEquals(len(wmi_sampler), 2) self.assertEquals(sum(1 for _ in wmi_sampler), 2) def test_raw_perf_properties(self): """ Extend the list of properties to query for RAW Performance classes. """ # Formatted Performance class wmi_sampler = WMISampler("Win32_PerfFormattedData_PerfOS_System", ["ProcessorQueueLength"]) self.assertEquals(len(wmi_sampler.property_names), 1) # Raw Performance class wmi_sampler = WMISampler("Win32_PerfRawData_PerfOS_System", ["CounterRawCount", "CounterCounter"]) # noqa self.assertEquals(len(wmi_sampler.property_names), 4) def test_raw_initial_sampling(self): """ Query for initial sample for RAW Performance classes. """ wmi_sampler = WMISampler("Win32_PerfRawData_PerfOS_System", ["CounterRawCount", "CounterCounter"]) # noqa wmi_sampler.sample() # 2 queries should have been made: one for initialization, one for sampling self.assertEquals(SWbemServices.ExecQuery.call_count, 2, SWbemServices.ExecQuery.call_count) # Repeat wmi_sampler.sample() self.assertEquals(SWbemServices.ExecQuery.call_count, 3, SWbemServices.ExecQuery.call_count) def test_raw_cache_qualifiers(self): """ Cache the qualifiers on the first query against RAW Performance classes. """ # Append `flag_use_amended_qualifiers` flag on the first query wmi_raw_sampler = WMISampler("Win32_PerfRawData_PerfOS_System", ["CounterRawCount", "CounterCounter"]) # noqa wmi_raw_sampler._query() self.assertWMIQuery(flags=131120) wmi_raw_sampler._query() self.assertWMIQuery(flags=48) # Qualifiers are cached self.assertTrue(wmi_raw_sampler._property_counter_types) self.assertIn('CounterRawCount', wmi_raw_sampler._property_counter_types) self.assertIn('CounterCounter', wmi_raw_sampler._property_counter_types) def test_raw_properties_formatting(self): """ WMI Object's RAW data are returned formatted. """ wmi_raw_sampler = WMISampler("Win32_PerfRawData_PerfOS_System", ["CounterRawCount", "CounterCounter"]) # noqa wmi_raw_sampler.sample() self.assertWMISampler( wmi_raw_sampler, [ ("CounterRawCount", 500), ("CounterCounter", 50), "Timestamp_Sys100NS", "Frequency_Sys100NS", "name" ], count=2 ) def test_raw_properties_fallback(self): """ Print a warning on RAW Performance classes if the calculator is undefined. Returns the original RAW value. """ from checks.libs.wmi.sampler import WMISampler logger = Mock() wmi_raw_sampler = WMISampler(logger, "Win32_PerfRawData_PerfOS_System", ["UnknownCounter", "MissingProperty"]) # noqa wmi_raw_sampler.sample() self.assertWMISampler( wmi_raw_sampler, [ ("UnknownCounter", 999), "Timestamp_Sys100NS", "Frequency_Sys100NS", "Name" ], count=1 ) self.assertTrue(logger.warning.called) def test_missing_property(self): """ Do not raise on missing properties but backfill with empty values. """ wmi_raw_sampler = WMISampler("Win32_PerfRawData_PerfOS_System", ["UnknownCounter", "MissingProperty"]) # noqa wmi_raw_sampler.sample() self.assertWMISampler(wmi_raw_sampler, ["MissingProperty"], count=1) class TestIntegrationWMI(unittest.TestCase): """ Integration tests for WMISampler. """ pass
import sys import re import os import json import MarkdownPP ################################################################################ ### @brief length of the swagger definition namespace ################################################################################ defLen = len('#/definitions/') ################################################################################ ### @brief facility to remove leading and trailing html-linebreaks ################################################################################ removeTrailingBR = re.compile("<br>$") removeLeadingBR = re.compile("^<br>") def brTrim(text): return removeLeadingBR.sub("", removeTrailingBR.sub("", text.strip(' '))) swagger = None dokuBlocks = [{},{}] thisVerb = {} route = '' verb = '' def getReference(name, source, verb): try: ref = name['$ref'][defLen:] except Exception as x: print >>sys.stderr, "No reference in: " print >>sys.stderr, name raise if not ref in swagger['definitions']: fn = '' if verb: fn = swagger['paths'][route][verb]['x-filename'] else: fn = swagger['definitions'][source]['x-filename'] print >> sys.stderr, json.dumps(swagger['definitions'], indent=4, separators=(', ',': '), sort_keys=True) raise Exception("invalid reference: " + ref + " in " + fn) return ref def unwrapPostJson(reference, layer): global swagger rc = '' for param in swagger['definitions'][reference]['properties'].keys(): thisParam = swagger['definitions'][reference]['properties'][param] required = ('required' in swagger['definitions'][reference] and param in swagger['definitions'][reference]['required']) if '$ref' in thisParam: subStructRef = getReference(thisParam, reference, None) rc += "<li><strong>" + param + "</strong>: " rc += swagger['definitions'][subStructRef]['description'] + "<ul class=\"swagger-list\">" rc += unwrapPostJson(subStructRef, layer + 1) rc += "</li></ul>" elif thisParam['type'] == 'object': rc += ' ' * layer + "<li><strong>" + param + "</strong>: " + brTrim(thisParam['description']) + "</li>" elif swagger['definitions'][reference]['properties'][param]['type'] == 'array': rc += ' ' * layer + "<li><strong>" + param + "</strong>: " + brTrim(thisParam['description']) if 'type' in thisParam['items']: rc += " of type " + thisParam['items']['type']# else: if len(thisParam['items']) == 0: rc += "anonymous json object" else: try: subStructRef = getReference(thisParam['items'], reference, None) except: print >>sys.stderr, "while analyzing: " + param print >>sys.stderr, thisParam rc += "\n<ul class=\"swagger-list\">" rc += unwrapPostJson(subStructRef, layer + 1) rc += "</ul>" rc += '</li>' else: rc += ' ' * layer + "<li><strong>" + param + "</strong>: " + thisParam['description'] + '</li>' return rc def getRestBodyParam(): rc = "\n**Body Parameters**\n" addText = '' for nParam in range(0, len(thisVerb['parameters'])): if thisVerb['parameters'][nParam]['in'] == 'body': descOffset = thisVerb['parameters'][nParam]['x-description-offset'] addText = '' if 'additionalProperties' in thisVerb['parameters'][nParam]['schema']: addText = "free style json body" else: addText = "<ul class=\"swagger-list\">" + unwrapPostJson( getReference(thisVerb['parameters'][nParam]['schema'], route, verb),0) + "</ul>" rc += addText return rc def getRestReplyBodyParam(param): rc = "\n**Reply Body**\n<ul>" try: rc += unwrapPostJson(getReference(thisVerb['responses'][param]['schema'], route, verb), 0) except Exception: print "failed to search " + param + " in: " print json.dumps(thisVerb, indent=4, separators=(', ',': '), sort_keys=True) raise return rc + "</ul>\n" SIMPL_REPL_DICT = { "@RESTDESCRIPTION" : "", "@RESTURLPARAMETERS" : "\n**URL Parameters**\n", "@RESTQUERYPARAMETERS" : "\n**Query Parameters**\n", "@RESTHEADERPARAMETERS" : "\n**Header Parameters**\n", "@RESTRETURNCODES" : "\n**Return Codes**\n", "@PARAMS" : "\n**Parameters**\n", "@RESTPARAMS" : "", "@RESTURLPARAMS" : "\n**URL Parameters**\n", "@RESTQUERYPARAMS" : "\n**Query Parameters**\n", "@RESTBODYPARAM" : getRestBodyParam, "@RESTREPLYBODY" : getRestReplyBodyParam, "@RESTQUERYPARAM" : "@RESTPARAM", "@RESTURLPARAM" : "@RESTPARAM", "@PARAM" : "@RESTPARAM", "@RESTHEADERPARAM" : "@RESTPARAM", "@EXAMPLES" : "\n**Examples**\n", "@RESTPARAMETERS" : "" } SIMPLE_RX = re.compile( r''' @RESTDESCRIPTION| # -> <empty> @RESTURLPARAMETERS| # -> \n**URL Parameters**\n @RESTQUERYPARAMETERS| # -> \n**Query Parameters**\n @RESTHEADERPARAMETERS| # -> \n**Header Parameters**\n @RESTBODYPARAM| # -> call post body param @RESTRETURNCODES| # -> \n**Return Codes**\n @PARAMS| # -> \n**Parameters**\n @RESTPARAMS| # -> <empty> @RESTURLPARAMS| # -> <empty> @RESTQUERYPARAMS| # -> <empty> @PARAM| # -> @RESTPARAM @RESTURLPARAM| # -> @RESTPARAM @RESTQUERYPARAM| # -> @RESTPARAM @RESTHEADERPARAM| # -> @RESTPARAM @EXAMPLES| # -> \n**Examples**\n @RESTPARAMETERS| # -> <empty> @RESTREPLYBODY\{(.*)\} # -> call body function ''', re.X) def SimpleRepl(match): m = match.group(0) #print 'xxxxx ' + m try: n = SIMPL_REPL_DICT[m] if n == None: raise Exception("failed to find regex while searching for: " + m) else: if type(n) == type(''): return n else: return n() except Exception: pos = m.find('{') if pos > 0: newMatch = m[:pos] param = m[pos + 1 :].rstrip(' }') try: n = SIMPL_REPL_DICT[newMatch] if n == None: raise Exception("failed to find regex while searching for: " + newMatch + " extracted from: " + m) else: if type(n) == type(''): return n else: return n(param) except Exception as x: #raise Exception("failed to find regex while searching for: " + # newMatch + " extracted from: " + m) raise else: raise Exception("failed to find regex while searching for: " + m) RX = [ (re.compile(r"<!--(\s*.+\s)-->"), ""), # remove the placeholder BR's again (re.compile(r"<br />\n"), "\n"), # multi line bullet lists should become one (re.compile(r"\n\n-"), "\n-"), #HTTP API changing code # unwrap multi-line-briefs: (up to 3 lines supported by now ;-) (re.compile(r"@brief(.+)\n(.+)\n(.+)\n\n"), r"@brief\g<1> \g<2> \g<3>\n\n"), (re.compile(r"@brief(.+)\n(.+)\n\n"), r"@brief\g<1> \g<2>\n\n"), # if there is an @brief above a RESTHEADER, swap the sequence (re.compile(r"@brief(.+\n*)\n\n@RESTHEADER{([#\s\w\/\_{}-]*),([\s\w-]*)}"), r"###\g<3>\n\g<1>\n\n`\g<2>`"), # else simply put it into the text (re.compile(r"@brief(.+)"), r"\g<1>"), # there should be no RESTHEADER without brief, so we will fail offensively if by not doing #(re.compile(r"@RESTHEADER{([\s\w\/\_{}-]*),([\s\w-]*)}"), r"###\g<2>\n`\g<1>`"), # Error codes replace (re.compile(r"(####)#+"), r""), # (re.compile(r"- (\w+):\s*@LIT{(.+)}"), r"\n*\g<1>* - **\g<2>**:"), (re.compile(r"(.+),(\d+),\"(.+)\",\"(.+)\""), r"\n*\g<2>* - **\g<3>**: \g<4>"), (re.compile(r"TODOSWAGGER.*"),r"") ] # (re.compile(r"@RESTPARAM{([\s\w-]*),([\s\w\_\|-]*),\s*(\w+)}"), r"* *\g<1>*:"), # (re.compile(r"@RESTRETURNCODE{(.*)}"), r"* *\g<1>*:"), # (re.compile(r"@RESTBODYPARAMS{(.*)}"), r"*(\g<1>)*"), RX2 = [ # parameters - extract their type and whether mandatory or not. (re.compile(r"@RESTPARAM{(\s*[\w\-]*)\s*,\s*([\w\_\|-]*)\s*,\s*(required|optional)}"), r"* *\g<1>* (\g<3>):"), (re.compile(r"@RESTALLBODYPARAM{(\s*[\w\-]*)\s*,\s*([\w\_\|-]*)\s*,\s*(required|optional)}"), r"**Post Body**\n *\g<1>* (\g<3>):"), (re.compile(r"@RESTRETURNCODE{(.*)}"), r"* *\g<1>*:") ] match_RESTHEADER = re.compile(r"@RESTHEADER\{(.*)\}") match_RESTRETURNCODE = re.compile(r"@RESTRETURNCODE\{(.*)\}") have_RESTBODYPARAM = re.compile(r"@RESTBODYPARAM") have_RESTREPLYBODY = re.compile(r"@RESTREPLYBODY") have_RESTSTRUCT = re.compile(r"@RESTSTRUCT") remove_MULTICR = re.compile(r'\n\n\n*') def _mkdir_recursive(path): sub_path = os.path.dirname(path) if not os.path.exists(sub_path): _mkdir_recursive(sub_path) if not os.path.exists(path): os.mkdir(path) def replaceCode(lines, blockName): global swagger, thisVerb, route, verb thisVerb = {} foundRest = False # first find the header: headerMatch = match_RESTHEADER.search(lines) if headerMatch and headerMatch.lastindex > 0: foundRest = True try: (verb,route) = headerMatch.group(1).split(',')[0].split(' ') verb = verb.lower() except: print >> sys.stderr, "failed to parse header from: " + headerMatch.group(1) + " while analysing " + blockName raise try: thisVerb = swagger['paths'][route][verb] except: print >> sys.stderr, "failed to locate route in the swagger json: [" + verb + " " + route + "]" + " while analysing " + blockName print >> sys.stderr, lines raise for (oneRX, repl) in RX: lines = oneRX.sub(repl, lines) if foundRest: rcCode = None foundRestBodyParam = False foundRestReplyBodyParam = False lineR = lines.split('\n') l = len(lineR) r = 0 while (r < l): # remove all but the first RESTBODYPARAM: if have_RESTBODYPARAM.search(lineR[r]): if foundRestBodyParam: lineR[r] = '' else: lineR[r] = '@RESTBODYPARAM' foundRestBodyParam = True r+=1 while (len(lineR[r]) > 1): lineR[r] = '' r+=1 m = match_RESTRETURNCODE.search(lineR[r]) if m and m.lastindex > 0: rcCode = m.group(1) # remove all but the first RESTREPLYBODY: if have_RESTREPLYBODY.search(lineR[r]): if foundRestReplyBodyParam != rcCode: lineR[r] = '@RESTREPLYBODY{' + rcCode + '}\n' else: lineR[r] = '' foundRestReplyBodyParam = rcCode r+=1 while (len(lineR[r]) > 1): lineR[r] = '' r+=1 m = match_RESTRETURNCODE.search(lineR[r]) if m and m.lastindex > 0: rcCode = m.group(1) # remove all RESTSTRUCTS - they're referenced anyways: if have_RESTSTRUCT.search(lineR[r]): while (len(lineR[r]) > 1): lineR[r] = '' r+=1 r+=1 lines = "\n".join(lineR) lines = SIMPLE_RX.sub(SimpleRepl, lines) for (oneRX, repl) in RX2: lines = oneRX.sub(repl, lines) lines = remove_MULTICR.sub("\n\n", lines) #print lines return lines def replaceCodeIndex(lines): lines = re.sub(r"<!--(\s*.+\s)-->","", lines) #HTTP API changing code #lines = re.sub(r"@brief(.+)",r"\g<1>", lines) #lines = re.sub(r"@RESTHEADER{([\s\w\/\_{}-]*),([\s\w-]*)}", r"###\g<2>\n`\g<1>`", lines) return lines RXFinal = [ (re.compile(r"@anchor (.*)"), "<a name=\"\g<1>\">#</a>") ] def replaceCodeFullFile(lines): for (oneRX, repl) in RXFinal: lines = oneRX.sub(repl, lines) return lines ################################################################################ # main loop over all files ################################################################################ def walk_on_files(inDirPath, outDirPath): for root, dirs, files in os.walk(inDirPath): for file in files: if file.endswith(".mdpp"): inFileFull = os.path.join(root, file) outFileFull = os.path.join(outDirPath, re.sub(r'mdpp$', 'md', inFileFull)) print "%s -> %s" % (inFileFull, outFileFull) _mkdir_recursive(os.path.join(outDirPath, root)) mdpp = open(inFileFull, "r") md = open(outFileFull, "w") MarkdownPP.MarkdownPP(input=mdpp, output=md, modules=MarkdownPP.modules.keys()) mdpp.close() md.close() findStartCode(md, outFileFull) def findStartCode(fd,full_path): inFD = open(full_path, "r") textFile =inFD.read() inFD.close() #print "-" * 80 #print textFile matchInline = re.findall(r'@startDocuBlockInline\s*(\w+)', textFile) if matchInline: for find in matchInline: #print "7"*80 print full_path + " " + find textFile = replaceTextInline(textFile, full_path, find) #print textFile match = re.findall(r'@startDocuBlock\s*(\w+)', textFile) if match: for find in match: #print "8"*80 textFile = replaceText(textFile, full_path, find) #print textFile try: textFile = replaceCodeFullFile(textFile) except: print >>sys.stderr, "while parsing :\n" + textFile raise #print "9" * 80 #print textFile outFD = open(full_path, "w") outFD.truncate() outFD.write(textFile) outFD.close() def replaceText(text, pathOfFile, searchText): ''' reads the mdpp and generates the md ''' global dokuBlocks if not searchText in dokuBlocks[0]: print >> sys.stderr, "Failed to locate the docublock '%s' for replacing it into the file '%s'\n have:" % (searchText, pathOfFile) print >> sys.stderr, dokuBlocks[0].keys() print >> sys.stderr, '*' * 80 print >> sys.stderr, text exit(1) #print dokuBlocks[0][searchText] rc= re.sub("@startDocuBlock\s+"+ searchText + "(?:\s+|$)", dokuBlocks[0][searchText], text) return rc def replaceTextInline(text, pathOfFile, searchText): ''' reads the mdpp and generates the md ''' global dokuBlocks if not searchText in dokuBlocks[1]: print >> sys.stderr, "Failed to locate the inline docublock '%s' for replacing it into the file '%s'\n have:" % (searchText, pathOfFile) print dokuBlocks[1].keys() print '*' * 80 print text exit(1) rePattern = r'(?s)\s*@startDocuBlockInline\s+'+ searchText +'.*@endDocuBlock\s' + searchText # (?s) is equivalent to flags=re.DOTALL but works in Python 2.6 match = re.search(rePattern, text) if (match == None): print >> sys.stderr, "failed to match with '%s' for %s in file %s in: \n%s" % (rePattern, searchText, pathOfFile, text) exit(1) subtext = match.group(0) if (len(re.findall('@startDocuBlock', subtext)) > 1): print >> sys.stderr, "failed to snap with '%s' on end docublock for %s in %s our match is:\n%s" % (rePattern, searchText, pathOfFile, subtext) exit(1) return re.sub(rePattern, dokuBlocks[1][searchText], text) ################################################################################ # Read the docublocks into memory ################################################################################ thisBlock = "" thisBlockName = "" thisBlockType = 0 STATE_SEARCH_START = 0 STATE_SEARCH_END = 1 SEARCH_START = re.compile(r" *start[0-9a-zA-Z]*\s\s*([0-9a-zA-Z_ ]*)\s*$") def readStartLine(line): global thisBlockName, thisBlockType, thisBlock, dokuBlocks if ("@startDocuBlock" in line): if "@startDocuBlockInline" in line: thisBlockType = 1 else: thisBlockType = 0 try: thisBlockName = SEARCH_START.search(line).group(1).strip() except: print >> sys.stderr, "failed to read startDocuBlock: [" + line + "]" exit(1) dokuBlocks[thisBlockType][thisBlockName] = "" return STATE_SEARCH_END return STATE_SEARCH_START def readNextLine(line): global thisBlockName, thisBlockType, thisBlock, dokuBlocks if '@endDocuBlock' in line: return STATE_SEARCH_START dokuBlocks[thisBlockType][thisBlockName] += line #print "reading " + thisBlockName #print dokuBlocks[thisBlockType][thisBlockName] return STATE_SEARCH_END def loadDokuBlocks(): state = STATE_SEARCH_START f=open("allComments.txt", 'rU') count = 0 for line in f.readlines(): if state == STATE_SEARCH_START: state = readStartLine(line) elif state == STATE_SEARCH_END: state = readNextLine(line) #if state == STATE_SEARCH_START: # print dokuBlocks[thisBlockType].keys() for oneBlock in dokuBlocks[0]: try: dokuBlocks[0][oneBlock] = replaceCode(dokuBlocks[0][oneBlock], oneBlock) except: print >>sys.stderr, "while parsing :\n" + oneBlock raise for oneBlock in dokuBlocks[1]: try: dokuBlocks[1][oneBlock] = replaceCode(dokuBlocks[1][oneBlock], oneBlock) except: print >>sys.stderr, "while parsing :\n" + oneBlock raise if __name__ == '__main__': if len(sys.argv) < 2: print("usage: input-directory output-directory") exit(1) inDir = sys.argv[1] outDir = sys.argv[2] swaggerJson = sys.argv[3] f=open(swaggerJson, 'rU') swagger= json.load(f) f.close() loadDokuBlocks() print "loaded %d / %d docu blocks" % (len(dokuBlocks[0]), len(dokuBlocks[1])) #print dokuBlocks[0].keys() walk_on_files(inDir, outDir)
#!/usr/bin/python # # Copyright 2015 Google Inc. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """This example adds a sitelinks feed and associates it with a campaign. To add sitelinks using the simpler ExtensionSetting services, see: add_sitelinks.py. The LoadFromStorage method is pulling credentials and properties from a "googleads.yaml" file. By default, it looks for this file in your home directory. For more information, see the "Caching authentication information" section of our README. Tags: CampaignFeedService.mutate, FeedItemService.mutate Tags: FeedMappingService.mutate, FeedService.mutate Api: AdWordsOnly """ __author__ = 'Joseph DiLallo' import re import uuid from googleads import adwords from googleads import errors # See the Placeholder reference page for a list of all the placeholder types and # fields. # https://developers.google.com/adwords/api/docs/appendix/placeholders.html PLACEHOLDER_SITELINKS = '1' PLACEHOLDER_FIELD_SITELINK_LINK_TEXT = '1' PLACEHOLDER_FIELD_SITELINK_FINAL_URLS = '5' PLACEHOLDER_FIELD_LINE_1_TEXT = '3' PLACEHOLDER_FIELD_LINE_2_TEXT = '4' CAMPAIGN_ID = 'INSERT_CAMPAIGN_ID_HERE' def main(client, campaign_id): # Initialize appropriate service. feed_service = client.GetService('FeedService', version='v201502') feed_item_service = client.GetService('FeedItemService', version='v201502') feed_mapping_service = client.GetService( 'FeedMappingService', version='v201502') campaign_feed_service = client.GetService( 'CampaignFeedService', version='v201502') sitelinks_data = {} # Create site links feed first. site_links_feed = { 'name': 'Feed For Site Links #%s' % uuid.uuid4(), 'attributes': [ {'type': 'STRING', 'name': 'Link Text'}, {'type': 'URL_LIST', 'name': 'Link Final URLs'}, {'type': 'STRING', 'name': 'Line 1 Description'}, {'type': 'STRING', 'name': 'Line 2 Description'} ] } response = feed_service.mutate([ {'operator': 'ADD', 'operand': site_links_feed} ]) if 'value' in response: feed = response['value'][0] link_text_feed_attribute_id = feed['attributes'][0]['id'] final_url_feed_attribute_id = feed['attributes'][1]['id'] line_1_feed_attribute_id = feed['attributes'][2]['id'] line_2_feed_attribute_id = feed['attributes'][3]['id'] print ('Feed with name \'%s\' and ID \'%s\' was added with' % (feed['name'], feed['id'])) print ('\tText attribute ID \'%s\' and Final URL attribute ID \'%s\'.' % (link_text_feed_attribute_id, final_url_feed_attribute_id)) print ('\tLine 1 attribute ID \'%s\' and Line 2 attribute ID \'%s\'.' % (line_1_feed_attribute_id, line_2_feed_attribute_id)) sitelinks_data['feedId'] = feed['id'] sitelinks_data['linkTextFeedId'] = link_text_feed_attribute_id sitelinks_data['finalUrlFeedId'] = final_url_feed_attribute_id sitelinks_data['line1FeedId'] = line_1_feed_attribute_id sitelinks_data['line2FeedId'] = line_2_feed_attribute_id else: raise errors.GoogleAdsError('No feeds were added.') # Create site links feed items. items_data = [ {'text': 'Home', 'finalUrls': 'http://www.example.com', 'line1': 'Home line 1', 'line2': 'Home line 2'}, {'text': 'Stores', 'finalUrls': 'http://www.example.com/stores', 'line1': 'Stores line 1', 'line2': 'Stores line 2'}, {'text': 'On Sale', 'finalUrls': 'http://www.example.com/sale', 'line1': 'On Sale line 1', 'line2': 'On Sale line 2'}, {'text': 'Support', 'finalUrls': 'http://www.example.com/support', 'line1': 'Support line 1', 'line2': 'Support line 2'}, {'text': 'Products', 'finalUrls': 'http://www.example.com/products', 'line1': 'Products line 1', 'line2': 'Products line 2'}, {'text': 'About', 'finalUrls': 'http://www.example.com/about', 'line1': 'About line 1', 'line2': 'About line 2'} ] feed_items = [] for item in items_data: feed_items.append({ 'feedId': sitelinks_data['feedId'], 'attributeValues': [ { 'feedAttributeId': sitelinks_data['linkTextFeedId'], 'stringValue': item['text'] }, { 'feedAttributeId': sitelinks_data['finalUrlFeedId'], 'stringValues': [item['finalUrls']] }, { 'feedAttributeId': sitelinks_data['line1FeedId'], 'stringValue': item['line1'] }, { 'feedAttributeId': sitelinks_data['line2FeedId'], 'stringValue': item['line2'] } ], # Optional: use the 'startTime' and 'endTime' keys to specify the time # period for the feed to deliver. The example below will make the feed # start now and stop in one month. # Make sure you specify the datetime in the customer's time zone. You # can retrieve this from customer['dateTimeZone']. # # ['startTime']: datetime.datetime.now().strftime('%Y%m%d %H%M%S') # ['endTime']: (datetime.datetime.now() + # relativedelta(months=1)).strftime('%Y%m%d %H%M%S') # Optional: use the 'scheduling' key to specify time and days of the # week for feed to deliver. This is a Beta feature. }) feed_items_operations = [{'operator': 'ADD', 'operand': item} for item in feed_items] response = feed_item_service.mutate(feed_items_operations) if 'value' in response: sitelinks_data['feedItemIds'] = [] for feed_item in response['value']: print 'Feed item with ID %s was added.' % feed_item['feedItemId'] sitelinks_data['feedItemIds'].append(feed_item['feedItemId']) else: raise errors.GoogleAdsError('No feed items were added.') # Create site links feed mapping. feed_mapping = { 'placeholderType': PLACEHOLDER_SITELINKS, 'feedId': sitelinks_data['feedId'], 'attributeFieldMappings': [ { 'feedAttributeId': sitelinks_data['linkTextFeedId'], 'fieldId': PLACEHOLDER_FIELD_SITELINK_LINK_TEXT }, { 'feedAttributeId': sitelinks_data['finalUrlFeedId'], 'fieldId': PLACEHOLDER_FIELD_SITELINK_FINAL_URLS }, { 'feedAttributeId': sitelinks_data['line1FeedId'], 'fieldId': PLACEHOLDER_FIELD_LINE_1_TEXT }, { 'feedAttributeId': sitelinks_data['line2FeedId'], 'fieldId': PLACEHOLDER_FIELD_LINE_2_TEXT } ] } response = feed_mapping_service.mutate([ {'operator': 'ADD', 'operand': feed_mapping} ]) if 'value' in response: feed_mapping = response['value'][0] print ('Feed mapping with ID %s and placeholder type %s was saved for feed' ' with ID %s.' % (feed_mapping['feedMappingId'], feed_mapping['placeholderType'], feed_mapping['feedId'])) else: raise errors.GoogleAdsError('No feed mappings were added.') # Construct a matching function that associates the sitelink feeditems to the # campaign, and set the device preference to Mobile. For more details, see the # matching function guide: # https://developers.google.com/adwords/api/docs/guides/feed-matching-functions matching_function_string = ( 'AND(IN(FEED_ITEM_ID, {%s}), EQUALS(CONTEXT.DEVICE, \'Mobile\'))' % re.sub(r'\[|\]|L', '', str(sitelinks_data['feedItemIds']))) campaign_feed = { 'feedId': sitelinks_data['feedId'], 'campaignId': campaign_id, 'matchingFunction': {'functionString': matching_function_string}, # Specifying placeholder types on the CampaignFeed allows the same feed # to be used for different placeholders in different Campaigns. 'placeholderTypes': [PLACEHOLDER_SITELINKS] } response = campaign_feed_service.mutate([ {'operator': 'ADD', 'operand': campaign_feed} ]) if 'value' in response: campaign_feed = response['value'][0] print ('Campaign with ID %s was associated with feed with ID %s.' % (campaign_feed['campaignId'], campaign_feed['feedId'])) else: raise errors.GoogleAdsError('No campaign feeds were added.') if __name__ == '__main__': # Initialize client object. adwords_client = adwords.AdWordsClient.LoadFromStorage() main(adwords_client, CAMPAIGN_ID)
# -*- coding: utf-8 -*- """ pygments.lexers.webmisc ~~~~~~~~~~~~~~~~~~~~~~~ Lexers for misc. web stuff. :copyright: Copyright 2006-2017 by the Pygments team, see AUTHORS. :license: BSD, see LICENSE for details. """ import re from pygments.lexer import RegexLexer, ExtendedRegexLexer, include, bygroups, \ default, using from pygments.token import Text, Comment, Operator, Keyword, Name, String, \ Number, Punctuation, Literal from pygments.util import unirange from pygments.lexers.css import _indentation, _starts_block from pygments.lexers.html import HtmlLexer from pygments.lexers.javascript import JavascriptLexer from pygments.lexers.ruby import RubyLexer __all__ = ['DuelLexer', 'SlimLexer', 'XQueryLexer', 'QmlLexer', 'CirruLexer'] class DuelLexer(RegexLexer): """ Lexer for Duel Views Engine (formerly JBST) markup with JavaScript code blocks. See http://duelengine.org/. See http://jsonml.org/jbst/. .. versionadded:: 1.4 """ name = 'Duel' aliases = ['duel', 'jbst', 'jsonml+bst'] filenames = ['*.duel', '*.jbst'] mimetypes = ['text/x-duel', 'text/x-jbst'] flags = re.DOTALL tokens = { 'root': [ (r'(<%[@=#!:]?)(.*?)(%>)', bygroups(Name.Tag, using(JavascriptLexer), Name.Tag)), (r'(<%\$)(.*?)(:)(.*?)(%>)', bygroups(Name.Tag, Name.Function, Punctuation, String, Name.Tag)), (r'(<%--)(.*?)(--%>)', bygroups(Name.Tag, Comment.Multiline, Name.Tag)), (r'(<script.*?>)(.*?)(</script>)', bygroups(using(HtmlLexer), using(JavascriptLexer), using(HtmlLexer))), (r'(.+?)(?=<)', using(HtmlLexer)), (r'.+', using(HtmlLexer)), ], } class XQueryLexer(ExtendedRegexLexer): """ An XQuery lexer, parsing a stream and outputting the tokens needed to highlight xquery code. .. versionadded:: 1.4 """ name = 'XQuery' aliases = ['xquery', 'xqy', 'xq', 'xql', 'xqm'] filenames = ['*.xqy', '*.xquery', '*.xq', '*.xql', '*.xqm'] mimetypes = ['text/xquery', 'application/xquery'] xquery_parse_state = [] # FIX UNICODE LATER # ncnamestartchar = ( # ur"[A-Z]|_|[a-z]|[\u00C0-\u00D6]|[\u00D8-\u00F6]|[\u00F8-\u02FF]|" # ur"[\u0370-\u037D]|[\u037F-\u1FFF]|[\u200C-\u200D]|[\u2070-\u218F]|" # ur"[\u2C00-\u2FEF]|[\u3001-\uD7FF]|[\uF900-\uFDCF]|[\uFDF0-\uFFFD]|" # ur"[\u10000-\uEFFFF]" # ) ncnamestartchar = r"(?:[A-Z]|_|[a-z])" # FIX UNICODE LATER # ncnamechar = ncnamestartchar + (ur"|-|\.|[0-9]|\u00B7|[\u0300-\u036F]|" # ur"[\u203F-\u2040]") ncnamechar = r"(?:" + ncnamestartchar + r"|-|\.|[0-9])" ncname = "(?:%s+%s*)" % (ncnamestartchar, ncnamechar) pitarget_namestartchar = r"(?:[A-KN-WYZ]|_|:|[a-kn-wyz])" pitarget_namechar = r"(?:" + pitarget_namestartchar + r"|-|\.|[0-9])" pitarget = "%s+%s*" % (pitarget_namestartchar, pitarget_namechar) prefixedname = "%s:%s" % (ncname, ncname) unprefixedname = ncname qname = "(?:%s|%s)" % (prefixedname, unprefixedname) entityref = r'(?:&(?:lt|gt|amp|quot|apos|nbsp);)' charref = r'(?:&#[0-9]+;|&#x[0-9a-fA-F]+;)' stringdouble = r'(?:"(?:' + entityref + r'|' + charref + r'|""|[^&"])*")' stringsingle = r"(?:'(?:" + entityref + r"|" + charref + r"|''|[^&'])*')" # FIX UNICODE LATER # elementcontentchar = (ur'\t|\r|\n|[\u0020-\u0025]|[\u0028-\u003b]|' # ur'[\u003d-\u007a]|\u007c|[\u007e-\u007F]') elementcontentchar = r'[A-Za-z]|\s|\d|[!"#$%()*+,\-./:;=?@\[\\\]^_\'`|~]' # quotattrcontentchar = (ur'\t|\r|\n|[\u0020-\u0021]|[\u0023-\u0025]|' # ur'[\u0027-\u003b]|[\u003d-\u007a]|\u007c|[\u007e-\u007F]') quotattrcontentchar = r'[A-Za-z]|\s|\d|[!#$%()*+,\-./:;=?@\[\\\]^_\'`|~]' # aposattrcontentchar = (ur'\t|\r|\n|[\u0020-\u0025]|[\u0028-\u003b]|' # ur'[\u003d-\u007a]|\u007c|[\u007e-\u007F]') aposattrcontentchar = r'[A-Za-z]|\s|\d|[!"#$%()*+,\-./:;=?@\[\\\]^_`|~]' # CHAR elements - fix the above elementcontentchar, quotattrcontentchar, # aposattrcontentchar # x9 | #xA | #xD | [#x20-#xD7FF] | [#xE000-#xFFFD] | [#x10000-#x10FFFF] flags = re.DOTALL | re.MULTILINE | re.UNICODE def punctuation_root_callback(lexer, match, ctx): yield match.start(), Punctuation, match.group(1) # transition to root always - don't pop off stack ctx.stack = ['root'] ctx.pos = match.end() def operator_root_callback(lexer, match, ctx): yield match.start(), Operator, match.group(1) # transition to root always - don't pop off stack ctx.stack = ['root'] ctx.pos = match.end() def popstate_tag_callback(lexer, match, ctx): yield match.start(), Name.Tag, match.group(1) ctx.stack.append(lexer.xquery_parse_state.pop()) ctx.pos = match.end() def popstate_xmlcomment_callback(lexer, match, ctx): yield match.start(), String.Doc, match.group(1) ctx.stack.append(lexer.xquery_parse_state.pop()) ctx.pos = match.end() def popstate_kindtest_callback(lexer, match, ctx): yield match.start(), Punctuation, match.group(1) next_state = lexer.xquery_parse_state.pop() if next_state == 'occurrenceindicator': if re.match("[?*+]+", match.group(2)): yield match.start(), Punctuation, match.group(2) ctx.stack.append('operator') ctx.pos = match.end() else: ctx.stack.append('operator') ctx.pos = match.end(1) else: ctx.stack.append(next_state) ctx.pos = match.end(1) def popstate_callback(lexer, match, ctx): yield match.start(), Punctuation, match.group(1) # if we have run out of our state stack, pop whatever is on the pygments # state stack if len(lexer.xquery_parse_state) == 0: ctx.stack.pop() elif len(ctx.stack) > 1: ctx.stack.append(lexer.xquery_parse_state.pop()) else: # i don't know if i'll need this, but in case, default back to root ctx.stack = ['root'] ctx.pos = match.end() def pushstate_element_content_starttag_callback(lexer, match, ctx): yield match.start(), Name.Tag, match.group(1) lexer.xquery_parse_state.append('element_content') ctx.stack.append('start_tag') ctx.pos = match.end() def pushstate_cdata_section_callback(lexer, match, ctx): yield match.start(), String.Doc, match.group(1) ctx.stack.append('cdata_section') lexer.xquery_parse_state.append(ctx.state.pop) ctx.pos = match.end() def pushstate_starttag_callback(lexer, match, ctx): yield match.start(), Name.Tag, match.group(1) lexer.xquery_parse_state.append(ctx.state.pop) ctx.stack.append('start_tag') ctx.pos = match.end() def pushstate_operator_order_callback(lexer, match, ctx): yield match.start(), Keyword, match.group(1) yield match.start(), Text, match.group(2) yield match.start(), Punctuation, match.group(3) ctx.stack = ['root'] lexer.xquery_parse_state.append('operator') ctx.pos = match.end() def pushstate_operator_map_callback(lexer, match, ctx): yield match.start(), Keyword, match.group(1) yield match.start(), Text, match.group(2) yield match.start(), Punctuation, match.group(3) ctx.stack = ['root'] lexer.xquery_parse_state.append('operator') ctx.pos = match.end() def pushstate_operator_root_validate(lexer, match, ctx): yield match.start(), Keyword, match.group(1) yield match.start(), Text, match.group(2) yield match.start(), Punctuation, match.group(3) ctx.stack = ['root'] lexer.xquery_parse_state.append('operator') ctx.pos = match.end() def pushstate_operator_root_validate_withmode(lexer, match, ctx): yield match.start(), Keyword, match.group(1) yield match.start(), Text, match.group(2) yield match.start(), Keyword, match.group(3) ctx.stack = ['root'] lexer.xquery_parse_state.append('operator') ctx.pos = match.end() def pushstate_operator_processing_instruction_callback(lexer, match, ctx): yield match.start(), String.Doc, match.group(1) ctx.stack.append('processing_instruction') lexer.xquery_parse_state.append('operator') ctx.pos = match.end() def pushstate_element_content_processing_instruction_callback(lexer, match, ctx): yield match.start(), String.Doc, match.group(1) ctx.stack.append('processing_instruction') lexer.xquery_parse_state.append('element_content') ctx.pos = match.end() def pushstate_element_content_cdata_section_callback(lexer, match, ctx): yield match.start(), String.Doc, match.group(1) ctx.stack.append('cdata_section') lexer.xquery_parse_state.append('element_content') ctx.pos = match.end() def pushstate_operator_cdata_section_callback(lexer, match, ctx): yield match.start(), String.Doc, match.group(1) ctx.stack.append('cdata_section') lexer.xquery_parse_state.append('operator') ctx.pos = match.end() def pushstate_element_content_xmlcomment_callback(lexer, match, ctx): yield match.start(), String.Doc, match.group(1) ctx.stack.append('xml_comment') lexer.xquery_parse_state.append('element_content') ctx.pos = match.end() def pushstate_operator_xmlcomment_callback(lexer, match, ctx): yield match.start(), String.Doc, match.group(1) ctx.stack.append('xml_comment') lexer.xquery_parse_state.append('operator') ctx.pos = match.end() def pushstate_kindtest_callback(lexer, match, ctx): yield match.start(), Keyword, match.group(1) yield match.start(), Text, match.group(2) yield match.start(), Punctuation, match.group(3) lexer.xquery_parse_state.append('kindtest') ctx.stack.append('kindtest') ctx.pos = match.end() def pushstate_operator_kindtestforpi_callback(lexer, match, ctx): yield match.start(), Keyword, match.group(1) yield match.start(), Text, match.group(2) yield match.start(), Punctuation, match.group(3) lexer.xquery_parse_state.append('operator') ctx.stack.append('kindtestforpi') ctx.pos = match.end() def pushstate_operator_kindtest_callback(lexer, match, ctx): yield match.start(), Keyword, match.group(1) yield match.start(), Text, match.group(2) yield match.start(), Punctuation, match.group(3) lexer.xquery_parse_state.append('operator') ctx.stack.append('kindtest') ctx.pos = match.end() def pushstate_occurrenceindicator_kindtest_callback(lexer, match, ctx): yield match.start(), Name.Tag, match.group(1) yield match.start(), Text, match.group(2) yield match.start(), Punctuation, match.group(3) lexer.xquery_parse_state.append('occurrenceindicator') ctx.stack.append('kindtest') ctx.pos = match.end() def pushstate_operator_starttag_callback(lexer, match, ctx): yield match.start(), Name.Tag, match.group(1) lexer.xquery_parse_state.append('operator') ctx.stack.append('start_tag') ctx.pos = match.end() def pushstate_operator_root_callback(lexer, match, ctx): yield match.start(), Punctuation, match.group(1) lexer.xquery_parse_state.append('operator') ctx.stack = ['root'] ctx.pos = match.end() def pushstate_operator_root_construct_callback(lexer, match, ctx): yield match.start(), Keyword, match.group(1) yield match.start(), Text, match.group(2) yield match.start(), Punctuation, match.group(3) lexer.xquery_parse_state.append('operator') ctx.stack = ['root'] ctx.pos = match.end() def pushstate_root_callback(lexer, match, ctx): yield match.start(), Punctuation, match.group(1) cur_state = ctx.stack.pop() lexer.xquery_parse_state.append(cur_state) ctx.stack = ['root'] ctx.pos = match.end() def pushstate_operator_attribute_callback(lexer, match, ctx): yield match.start(), Name.Attribute, match.group(1) ctx.stack.append('operator') ctx.pos = match.end() def pushstate_operator_callback(lexer, match, ctx): yield match.start(), Keyword, match.group(1) yield match.start(), Text, match.group(2) yield match.start(), Punctuation, match.group(3) lexer.xquery_parse_state.append('operator') ctx.pos = match.end() tokens = { 'comment': [ # xquery comments (r'(:\))', Comment, '#pop'), (r'(\(:)', Comment, '#push'), (r'[^:)]', Comment), (r'([^:)]|:|\))', Comment), ], 'whitespace': [ (r'\s+', Text), ], 'operator': [ include('whitespace'), (r'(\})', popstate_callback), (r'\(:', Comment, 'comment'), (r'(\{)', pushstate_root_callback), (r'then|else|external|at|div|except', Keyword, 'root'), (r'order by', Keyword, 'root'), (r'group by', Keyword, 'root'), (r'is|mod|order\s+by|stable\s+order\s+by', Keyword, 'root'), (r'and|or', Operator.Word, 'root'), (r'(eq|ge|gt|le|lt|ne|idiv|intersect|in)(?=\b)', Operator.Word, 'root'), (r'return|satisfies|to|union|where|count|preserve\s+strip', Keyword, 'root'), (r'(>=|>>|>|<=|<<|<|-|\*|!=|\+|\|\||\||:=|=|!)', operator_root_callback), (r'(::|:|;|\[|//|/|,)', punctuation_root_callback), (r'(castable|cast)(\s+)(as)\b', bygroups(Keyword, Text, Keyword), 'singletype'), (r'(instance)(\s+)(of)\b', bygroups(Keyword, Text, Keyword), 'itemtype'), (r'(treat)(\s+)(as)\b', bygroups(Keyword, Text, Keyword), 'itemtype'), (r'(case)(\s+)(' + stringdouble + ')', bygroups(Keyword, Text, String.Double), 'itemtype'), (r'(case)(\s+)(' + stringsingle + ')', bygroups(Keyword, Text, String.Single), 'itemtype'), (r'(case|as)\b', Keyword, 'itemtype'), (r'(\))(\s*)(as)', bygroups(Punctuation, Text, Keyword), 'itemtype'), (r'\$', Name.Variable, 'varname'), (r'(for|let|previous|next)(\s+)(\$)', bygroups(Keyword, Text, Name.Variable), 'varname'), (r'(for)(\s+)(tumbling|sliding)(\s+)(window)(\s+)(\$)', bygroups(Keyword, Text, Keyword, Text, Keyword, Text, Name.Variable), 'varname'), # (r'\)|\?|\]', Punctuation, '#push'), (r'\)|\?|\]', Punctuation), (r'(empty)(\s+)(greatest|least)', bygroups(Keyword, Text, Keyword)), (r'ascending|descending|default', Keyword, '#push'), (r'(allowing)(\s+)(empty)', bygroups(Keyword, Text, Keyword)), (r'external', Keyword), (r'(start|when|end)', Keyword, 'root'), (r'(only)(\s+)(end)', bygroups(Keyword, Text, Keyword), 'root'), (r'collation', Keyword, 'uritooperator'), # eXist specific XQUF (r'(into|following|preceding|with)', Keyword, 'root'), # support for current context on rhs of Simple Map Operator (r'\.', Operator), # finally catch all string literals and stay in operator state (stringdouble, String.Double), (stringsingle, String.Single), (r'(catch)(\s*)', bygroups(Keyword, Text), 'root'), ], 'uritooperator': [ (stringdouble, String.Double, '#pop'), (stringsingle, String.Single, '#pop'), ], 'namespacedecl': [ include('whitespace'), (r'\(:', Comment, 'comment'), (r'(at)(\s+)('+stringdouble+')', bygroups(Keyword, Text, String.Double)), (r"(at)(\s+)("+stringsingle+')', bygroups(Keyword, Text, String.Single)), (stringdouble, String.Double), (stringsingle, String.Single), (r',', Punctuation), (r'=', Operator), (r';', Punctuation, 'root'), (ncname, Name.Namespace), ], 'namespacekeyword': [ include('whitespace'), (r'\(:', Comment, 'comment'), (stringdouble, String.Double, 'namespacedecl'), (stringsingle, String.Single, 'namespacedecl'), (r'inherit|no-inherit', Keyword, 'root'), (r'namespace', Keyword, 'namespacedecl'), (r'(default)(\s+)(element)', bygroups(Keyword, Text, Keyword)), (r'preserve|no-preserve', Keyword), (r',', Punctuation), ], 'annotationname': [ (r'\(:', Comment, 'comment'), (qname, Name.Decorator), (r'(\()(' + stringdouble + ')', bygroups(Punctuation, String.Double)), (r'(\()(' + stringsingle + ')', bygroups(Punctuation, String.Single)), (r'(\,)(\s+)(' + stringdouble + ')', bygroups(Punctuation, Text, String.Double)), (r'(\,)(\s+)(' + stringsingle + ')', bygroups(Punctuation, Text, String.Single)), (r'\)', Punctuation), (r'(\s+)(\%)', bygroups(Text, Name.Decorator), 'annotationname'), (r'(\s+)(variable)(\s+)(\$)', bygroups(Text, Keyword.Declaration, Text, Name.Variable), 'varname'), (r'(\s+)(function)(\s+)', bygroups(Text, Keyword.Declaration, Text), 'root') ], 'varname': [ (r'\(:', Comment, 'comment'), (r'(' + qname + r')(\()?', bygroups(Name, Punctuation), 'operator'), ], 'singletype': [ include('whitespace'), (r'\(:', Comment, 'comment'), (ncname + r'(:\*)', Name.Variable, 'operator'), (qname, Name.Variable, 'operator'), ], 'itemtype': [ include('whitespace'), (r'\(:', Comment, 'comment'), (r'\$', Name.Variable, 'varname'), (r'(void)(\s*)(\()(\s*)(\))', bygroups(Keyword, Text, Punctuation, Text, Punctuation), 'operator'), (r'(element|attribute|schema-element|schema-attribute|comment|text|' r'node|binary|document-node|empty-sequence)(\s*)(\()', pushstate_occurrenceindicator_kindtest_callback), # Marklogic specific type? (r'(processing-instruction)(\s*)(\()', bygroups(Keyword, Text, Punctuation), ('occurrenceindicator', 'kindtestforpi')), (r'(item)(\s*)(\()(\s*)(\))(?=[*+?])', bygroups(Keyword, Text, Punctuation, Text, Punctuation), 'occurrenceindicator'), (r'(\(\#)(\s*)', bygroups(Punctuation, Text), 'pragma'), (r';', Punctuation, '#pop'), (r'then|else', Keyword, '#pop'), (r'(at)(\s+)(' + stringdouble + ')', bygroups(Keyword, Text, String.Double), 'namespacedecl'), (r'(at)(\s+)(' + stringsingle + ')', bygroups(Keyword, Text, String.Single), 'namespacedecl'), (r'except|intersect|in|is|return|satisfies|to|union|where|count', Keyword, 'root'), (r'and|div|eq|ge|gt|le|lt|ne|idiv|mod|or', Operator.Word, 'root'), (r':=|=|,|>=|>>|>|\[|\(|<=|<<|<|-|!=|\|\||\|', Operator, 'root'), (r'external|at', Keyword, 'root'), (r'(stable)(\s+)(order)(\s+)(by)', bygroups(Keyword, Text, Keyword, Text, Keyword), 'root'), (r'(castable|cast)(\s+)(as)', bygroups(Keyword, Text, Keyword), 'singletype'), (r'(treat)(\s+)(as)', bygroups(Keyword, Text, Keyword)), (r'(instance)(\s+)(of)', bygroups(Keyword, Text, Keyword)), (r'(case)(\s+)(' + stringdouble + ')', bygroups(Keyword, Text, String.Double), 'itemtype'), (r'(case)(\s+)(' + stringsingle + ')', bygroups(Keyword, Text, String.Single), 'itemtype'), (r'case|as', Keyword, 'itemtype'), (r'(\))(\s*)(as)', bygroups(Operator, Text, Keyword), 'itemtype'), (ncname + r':\*', Keyword.Type, 'operator'), (r'(function|map|array)(\()', bygroups(Keyword.Type, Punctuation)), (qname, Keyword.Type, 'occurrenceindicator'), ], 'kindtest': [ (r'\(:', Comment, 'comment'), (r'\{', Punctuation, 'root'), (r'(\))([*+?]?)', popstate_kindtest_callback), (r'\*', Name, 'closekindtest'), (qname, Name, 'closekindtest'), (r'(element|schema-element)(\s*)(\()', pushstate_kindtest_callback), ], 'kindtestforpi': [ (r'\(:', Comment, 'comment'), (r'\)', Punctuation, '#pop'), (ncname, Name.Variable), (stringdouble, String.Double), (stringsingle, String.Single), ], 'closekindtest': [ (r'\(:', Comment, 'comment'), (r'(\))', popstate_callback), (r',', Punctuation), (r'(\{)', pushstate_operator_root_callback), (r'\?', Punctuation), ], 'xml_comment': [ (r'(-->)', popstate_xmlcomment_callback), (r'[^-]{1,2}', Literal), (u'\\t|\\r|\\n|[\u0020-\uD7FF]|[\uE000-\uFFFD]|' + unirange(0x10000, 0x10ffff), Literal), ], 'processing_instruction': [ (r'\s+', Text, 'processing_instruction_content'), (r'\?>', String.Doc, '#pop'), (pitarget, Name), ], 'processing_instruction_content': [ (r'\?>', String.Doc, '#pop'), (u'\\t|\\r|\\n|[\u0020-\uD7FF]|[\uE000-\uFFFD]|' + unirange(0x10000, 0x10ffff), Literal), ], 'cdata_section': [ (r']]>', String.Doc, '#pop'), (u'\\t|\\r|\\n|[\u0020-\uD7FF]|[\uE000-\uFFFD]|' + unirange(0x10000, 0x10ffff), Literal), ], 'start_tag': [ include('whitespace'), (r'(/>)', popstate_tag_callback), (r'>', Name.Tag, 'element_content'), (r'"', Punctuation, 'quot_attribute_content'), (r"'", Punctuation, 'apos_attribute_content'), (r'=', Operator), (qname, Name.Tag), ], 'quot_attribute_content': [ (r'"', Punctuation, 'start_tag'), (r'(\{)', pushstate_root_callback), (r'""', Name.Attribute), (quotattrcontentchar, Name.Attribute), (entityref, Name.Attribute), (charref, Name.Attribute), (r'\{\{|\}\}', Name.Attribute), ], 'apos_attribute_content': [ (r"'", Punctuation, 'start_tag'), (r'\{', Punctuation, 'root'), (r"''", Name.Attribute), (aposattrcontentchar, Name.Attribute), (entityref, Name.Attribute), (charref, Name.Attribute), (r'\{\{|\}\}', Name.Attribute), ], 'element_content': [ (r'</', Name.Tag, 'end_tag'), (r'(\{)', pushstate_root_callback), (r'(<!--)', pushstate_element_content_xmlcomment_callback), (r'(<\?)', pushstate_element_content_processing_instruction_callback), (r'(<!\[CDATA\[)', pushstate_element_content_cdata_section_callback), (r'(<)', pushstate_element_content_starttag_callback), (elementcontentchar, Literal), (entityref, Literal), (charref, Literal), (r'\{\{|\}\}', Literal), ], 'end_tag': [ include('whitespace'), (r'(>)', popstate_tag_callback), (qname, Name.Tag), ], 'xmlspace_decl': [ include('whitespace'), (r'\(:', Comment, 'comment'), (r'preserve|strip', Keyword, '#pop'), ], 'declareordering': [ (r'\(:', Comment, 'comment'), include('whitespace'), (r'ordered|unordered', Keyword, '#pop'), ], 'xqueryversion': [ include('whitespace'), (r'\(:', Comment, 'comment'), (stringdouble, String.Double), (stringsingle, String.Single), (r'encoding', Keyword), (r';', Punctuation, '#pop'), ], 'pragma': [ (qname, Name.Variable, 'pragmacontents'), ], 'pragmacontents': [ (r'#\)', Punctuation, 'operator'), (u'\\t|\\r|\\n|[\u0020-\uD7FF]|[\uE000-\uFFFD]|' + unirange(0x10000, 0x10ffff), Literal), (r'(\s+)', Text), ], 'occurrenceindicator': [ include('whitespace'), (r'\(:', Comment, 'comment'), (r'\*|\?|\+', Operator, 'operator'), (r':=', Operator, 'root'), default('operator'), ], 'option': [ include('whitespace'), (qname, Name.Variable, '#pop'), ], 'qname_braren': [ include('whitespace'), (r'(\{)', pushstate_operator_root_callback), (r'(\()', Punctuation, 'root'), ], 'element_qname': [ (qname, Name.Variable, 'root'), ], 'attribute_qname': [ (qname, Name.Variable, 'root'), ], 'root': [ include('whitespace'), (r'\(:', Comment, 'comment'), # handle operator state # order on numbers matters - handle most complex first (r'\d+(\.\d*)?[eE][+-]?\d+', Number.Float, 'operator'), (r'(\.\d+)[eE][+-]?\d+', Number.Float, 'operator'), (r'(\.\d+|\d+\.\d*)', Number.Float, 'operator'), (r'(\d+)', Number.Integer, 'operator'), (r'(\.\.|\.|\))', Punctuation, 'operator'), (r'(declare)(\s+)(construction)', bygroups(Keyword.Declaration, Text, Keyword.Declaration), 'operator'), (r'(declare)(\s+)(default)(\s+)(order)', bygroups(Keyword.Declaration, Text, Keyword.Declaration, Text, Keyword.Declaration), 'operator'), (r'(declare)(\s+)(context)(\s+)(item)', bygroups(Keyword.Declaration, Text, Keyword.Declaration, Text, Keyword.Declaration), 'operator'), (ncname + r':\*', Name, 'operator'), (r'\*:'+ncname, Name.Tag, 'operator'), (r'\*', Name.Tag, 'operator'), (stringdouble, String.Double, 'operator'), (stringsingle, String.Single, 'operator'), (r'(\}|\])', popstate_callback), # NAMESPACE DECL (r'(declare)(\s+)(default)(\s+)(collation)', bygroups(Keyword.Declaration, Text, Keyword.Declaration, Text, Keyword.Declaration)), (r'(module|declare)(\s+)(namespace)', bygroups(Keyword.Declaration, Text, Keyword.Declaration), 'namespacedecl'), (r'(declare)(\s+)(base-uri)', bygroups(Keyword.Declaration, Text, Keyword.Declaration), 'namespacedecl'), # NAMESPACE KEYWORD (r'(declare)(\s+)(default)(\s+)(element|function)', bygroups(Keyword.Declaration, Text, Keyword.Declaration, Text, Keyword.Declaration), 'namespacekeyword'), (r'(import)(\s+)(schema|module)', bygroups(Keyword.Pseudo, Text, Keyword.Pseudo), 'namespacekeyword'), (r'(declare)(\s+)(copy-namespaces)', bygroups(Keyword.Declaration, Text, Keyword.Declaration), 'namespacekeyword'), # VARNAMEs (r'(for|let|some|every)(\s+)(\$)', bygroups(Keyword, Text, Name.Variable), 'varname'), (r'(for)(\s+)(tumbling|sliding)(\s+)(window)(\s+)(\$)', bygroups(Keyword, Text, Keyword, Text, Keyword, Text, Name.Variable), 'varname'), (r'\$', Name.Variable, 'varname'), (r'(declare)(\s+)(variable)(\s+)(\$)', bygroups(Keyword.Declaration, Text, Keyword.Declaration, Text, Name.Variable), 'varname'), # ANNOTATED GLOBAL VARIABLES AND FUNCTIONS (r'(declare)(\s+)(\%)', bygroups(Keyword.Declaration, Text, Name.Decorator), 'annotationname'), # ITEMTYPE (r'(\))(\s+)(as)', bygroups(Operator, Text, Keyword), 'itemtype'), (r'(element|attribute|schema-element|schema-attribute|comment|' r'text|node|document-node|empty-sequence)(\s+)(\()', pushstate_operator_kindtest_callback), (r'(processing-instruction)(\s+)(\()', pushstate_operator_kindtestforpi_callback), (r'(<!--)', pushstate_operator_xmlcomment_callback), (r'(<\?)', pushstate_operator_processing_instruction_callback), (r'(<!\[CDATA\[)', pushstate_operator_cdata_section_callback), # (r'</', Name.Tag, 'end_tag'), (r'(<)', pushstate_operator_starttag_callback), (r'(declare)(\s+)(boundary-space)', bygroups(Keyword.Declaration, Text, Keyword.Declaration), 'xmlspace_decl'), (r'(validate)(\s+)(lax|strict)', pushstate_operator_root_validate_withmode), (r'(validate)(\s*)(\{)', pushstate_operator_root_validate), (r'(typeswitch)(\s*)(\()', bygroups(Keyword, Text, Punctuation)), (r'(switch)(\s*)(\()', bygroups(Keyword, Text, Punctuation)), (r'(element|attribute|namespace)(\s*)(\{)', pushstate_operator_root_construct_callback), (r'(document|text|processing-instruction|comment)(\s*)(\{)', pushstate_operator_root_construct_callback), # ATTRIBUTE (r'(attribute)(\s+)(?=' + qname + r')', bygroups(Keyword, Text), 'attribute_qname'), # ELEMENT (r'(element)(\s+)(?=' + qname + r')', bygroups(Keyword, Text), 'element_qname'), # PROCESSING_INSTRUCTION (r'(processing-instruction|namespace)(\s+)(' + ncname + r')(\s*)(\{)', bygroups(Keyword, Text, Name.Variable, Text, Punctuation), 'operator'), (r'(declare|define)(\s+)(function)', bygroups(Keyword.Declaration, Text, Keyword.Declaration)), (r'(\{|\[)', pushstate_operator_root_callback), (r'(unordered|ordered)(\s*)(\{)', pushstate_operator_order_callback), (r'(map|array)(\s*)(\{)', pushstate_operator_map_callback), (r'(declare)(\s+)(ordering)', bygroups(Keyword.Declaration, Text, Keyword.Declaration), 'declareordering'), (r'(xquery)(\s+)(version)', bygroups(Keyword.Pseudo, Text, Keyword.Pseudo), 'xqueryversion'), (r'(\(#)(\s*)', bygroups(Punctuation, Text), 'pragma'), # sometimes return can occur in root state (r'return', Keyword), (r'(declare)(\s+)(option)', bygroups(Keyword.Declaration, Text, Keyword.Declaration), 'option'), # URI LITERALS - single and double quoted (r'(at)(\s+)('+stringdouble+')', String.Double, 'namespacedecl'), (r'(at)(\s+)('+stringsingle+')', String.Single, 'namespacedecl'), (r'(ancestor-or-self|ancestor|attribute|child|descendant-or-self)(::)', bygroups(Keyword, Punctuation)), (r'(descendant|following-sibling|following|parent|preceding-sibling' r'|preceding|self)(::)', bygroups(Keyword, Punctuation)), (r'(if)(\s*)(\()', bygroups(Keyword, Text, Punctuation)), (r'then|else', Keyword), # eXist specific XQUF (r'(update)(\s*)(insert|delete|replace|value|rename)', bygroups(Keyword, Text, Keyword)), (r'(into|following|preceding|with)', Keyword), # Marklogic specific (r'(try)(\s*)', bygroups(Keyword, Text), 'root'), (r'(catch)(\s*)(\()(\$)', bygroups(Keyword, Text, Punctuation, Name.Variable), 'varname'), (r'(@'+qname+')', Name.Attribute, 'operator'), (r'(@'+ncname+')', Name.Attribute, 'operator'), (r'@\*:'+ncname, Name.Attribute, 'operator'), (r'@\*', Name.Attribute, 'operator'), (r'(@)', Name.Attribute, 'operator'), (r'//|/|\+|-|;|,|\(|\)', Punctuation), # STANDALONE QNAMES (qname + r'(?=\s*\{)', Name.Tag, 'qname_braren'), (qname + r'(?=\s*\([^:])', Name.Function, 'qname_braren'), (r'(' + qname + ')(#)([0-9]+)', bygroups(Name.Function, Keyword.Type, Number.Integer)), (qname, Name.Tag, 'operator'), ] } class QmlLexer(RegexLexer): """ For QML files. See http://doc.qt.digia.com/4.7/qdeclarativeintroduction.html. .. versionadded:: 1.6 """ # QML is based on javascript, so much of this is taken from the # JavascriptLexer above. name = 'QML' aliases = ['qml', 'qbs'] filenames = ['*.qml', '*.qbs'] mimetypes = ['application/x-qml', 'application/x-qt.qbs+qml'] # pasted from JavascriptLexer, with some additions flags = re.DOTALL | re.MULTILINE tokens = { 'commentsandwhitespace': [ (r'\s+', Text), (r'<!--', Comment), (r'//.*?\n', Comment.Single), (r'/\*.*?\*/', Comment.Multiline) ], 'slashstartsregex': [ include('commentsandwhitespace'), (r'/(\\.|[^[/\\\n]|\[(\\.|[^\]\\\n])*])+/' r'([gim]+\b|\B)', String.Regex, '#pop'), (r'(?=/)', Text, ('#pop', 'badregex')), default('#pop') ], 'badregex': [ (r'\n', Text, '#pop') ], 'root': [ (r'^(?=\s|/|<!--)', Text, 'slashstartsregex'), include('commentsandwhitespace'), (r'\+\+|--|~|&&|\?|:|\|\||\\(?=\n)|' r'(<<|>>>?|==?|!=?|[-<>+*%&|^/])=?', Operator, 'slashstartsregex'), (r'[{(\[;,]', Punctuation, 'slashstartsregex'), (r'[})\].]', Punctuation), # QML insertions (r'\bid\s*:\s*[A-Za-z][\w.]*', Keyword.Declaration, 'slashstartsregex'), (r'\b[A-Za-z][\w.]*\s*:', Keyword, 'slashstartsregex'), # the rest from JavascriptLexer (r'(for|in|while|do|break|return|continue|switch|case|default|if|else|' r'throw|try|catch|finally|new|delete|typeof|instanceof|void|' r'this)\b', Keyword, 'slashstartsregex'), (r'(var|let|with|function)\b', Keyword.Declaration, 'slashstartsregex'), (r'(abstract|boolean|byte|char|class|const|debugger|double|enum|export|' r'extends|final|float|goto|implements|import|int|interface|long|native|' r'package|private|protected|public|short|static|super|synchronized|throws|' r'transient|volatile)\b', Keyword.Reserved), (r'(true|false|null|NaN|Infinity|undefined)\b', Keyword.Constant), (r'(Array|Boolean|Date|Error|Function|Math|netscape|' r'Number|Object|Packages|RegExp|String|sun|decodeURI|' r'decodeURIComponent|encodeURI|encodeURIComponent|' r'Error|eval|isFinite|isNaN|parseFloat|parseInt|document|this|' r'window)\b', Name.Builtin), (r'[$a-zA-Z_]\w*', Name.Other), (r'[0-9][0-9]*\.[0-9]+([eE][0-9]+)?[fd]?', Number.Float), (r'0x[0-9a-fA-F]+', Number.Hex), (r'[0-9]+', Number.Integer), (r'"(\\\\|\\"|[^"])*"', String.Double), (r"'(\\\\|\\'|[^'])*'", String.Single), ] } class CirruLexer(RegexLexer): r""" Syntax rules of Cirru can be found at: http://cirru.org/ * using ``()`` for expressions, but restricted in a same line * using ``""`` for strings, with ``\`` for escaping chars * using ``$`` as folding operator * using ``,`` as unfolding operator * using indentations for nested blocks .. versionadded:: 2.0 """ name = 'Cirru' aliases = ['cirru'] filenames = ['*.cirru'] mimetypes = ['text/x-cirru'] flags = re.MULTILINE tokens = { 'string': [ (r'[^"\\\n]', String), (r'\\', String.Escape, 'escape'), (r'"', String, '#pop'), ], 'escape': [ (r'.', String.Escape, '#pop'), ], 'function': [ (r'\,', Operator, '#pop'), (r'[^\s"()]+', Name.Function, '#pop'), (r'\)', Operator, '#pop'), (r'(?=\n)', Text, '#pop'), (r'\(', Operator, '#push'), (r'"', String, ('#pop', 'string')), (r'[ ]+', Text.Whitespace), ], 'line': [ (r'(?<!\w)\$(?!\w)', Operator, 'function'), (r'\(', Operator, 'function'), (r'\)', Operator), (r'\n', Text, '#pop'), (r'"', String, 'string'), (r'[ ]+', Text.Whitespace), (r'[+-]?[\d.]+\b', Number), (r'[^\s"()]+', Name.Variable) ], 'root': [ (r'^\n+', Text.Whitespace), default(('line', 'function')), ] } class SlimLexer(ExtendedRegexLexer): """ For Slim markup. .. versionadded:: 2.0 """ name = 'Slim' aliases = ['slim'] filenames = ['*.slim'] mimetypes = ['text/x-slim'] flags = re.IGNORECASE _dot = r'(?: \|\n(?=.* \|)|.)' tokens = { 'root': [ (r'[ \t]*\n', Text), (r'[ \t]*', _indentation), ], 'css': [ (r'\.[\w:-]+', Name.Class, 'tag'), (r'\#[\w:-]+', Name.Function, 'tag'), ], 'eval-or-plain': [ (r'([ \t]*==?)(.*\n)', bygroups(Punctuation, using(RubyLexer)), 'root'), (r'[ \t]+[\w:-]+(?==)', Name.Attribute, 'html-attributes'), default('plain'), ], 'content': [ include('css'), (r'[\w:-]+:[ \t]*\n', Text, 'plain'), (r'(-)(.*\n)', bygroups(Punctuation, using(RubyLexer)), '#pop'), (r'\|' + _dot + r'*\n', _starts_block(Text, 'plain'), '#pop'), (r'/' + _dot + r'*\n', _starts_block(Comment.Preproc, 'slim-comment-block'), '#pop'), (r'[\w:-]+', Name.Tag, 'tag'), include('eval-or-plain'), ], 'tag': [ include('css'), (r'[<>]{1,2}(?=[ \t=])', Punctuation), (r'[ \t]+\n', Punctuation, '#pop:2'), include('eval-or-plain'), ], 'plain': [ (r'([^#\n]|#[^{\n]|(\\\\)*\\#\{)+', Text), (r'(#\{)(.*?)(\})', bygroups(String.Interpol, using(RubyLexer), String.Interpol)), (r'\n', Text, 'root'), ], 'html-attributes': [ (r'=', Punctuation), (r'"[^"]+"', using(RubyLexer), 'tag'), (r'\'[^\']+\'', using(RubyLexer), 'tag'), (r'\w+', Text, 'tag'), ], 'slim-comment-block': [ (_dot + '+', Comment.Preproc), (r'\n', Text, 'root'), ], }
# Copyright (c) 2015-present, Facebook, Inc. # All rights reserved. # # This source code is licensed under the BSD-style license found in the # LICENSE file in the root directory of this source tree. An additional grant # of patent rights can be found in the PATENTS file in the same directory. # from __future__ import print_function import curses import sys import signal import processInput import usageStrings import output import logger from charCodeMapping import CODE_TO_CHAR from colorPrinter import ColorPrinter def signal_handler(signal, frame): # from http://stackoverflow.com/a/1112350/948126 # Lets just quit rather than signal.SIGINT printing the stack sys.exit(0) signal.signal(signal.SIGINT, signal_handler) CHROME_MIN_X = 5 CHROME_MIN_Y = 0 SELECT_MODE = 'SELECT' COMMAND_MODE = 'COMMAND_MODE' SHORT_NAV_USAGE = '[f|A] selection, [down|j|up|k|space|b] navigation, [enter] open, [c] command mode' SHORT_COMMAND_USAGE = 'command examples: | git add | git checkout HEAD~1 -- | mv $F ../here/ |' SHORT_COMMAND_PROMPT = 'Type a command below! Files will be appended or replace $F' SHORT_COMMAND_PROMPT2 = 'Enter a blank line to go back to the selection process' SHORT_FILES_HEADER = 'Files you have selected:' INVISIBLE_CURSOR = 0 BLOCK_CURSOR = 2 class HelperChrome(object): def __init__(self, printer, screenControl): self.printer = printer self.screenControl = screenControl self.WIDTH = 50 if self.getIsSidebarMode(): logger.addEvent('init_wide_mode') else: logger.addEvent('init_narrow_mode') def output(self, mode): self.mode = mode for func in [self.outputSide, self.outputBottom, self.toggleCursor]: try: func() except curses.error: pass def toggleCursor(self): if self.mode == SELECT_MODE: curses.curs_set(INVISIBLE_CURSOR) else: curses.curs_set(BLOCK_CURSOR) def reduceMaxY(self, maxy): if self.getIsSidebarMode(): return maxy return maxy - 4 def reduceMaxX(self, maxx): if not self.getIsSidebarMode(): return maxx return maxx - self.WIDTH def getMinX(self): if self.mode == COMMAND_MODE: return 0 return self.screenControl.getChromeBoundaries()[0] def getMinY(self): return self.screenControl.getChromeBoundaries()[1] def getIsSidebarMode(self): (maxy, maxx) = self.screenControl.getScreenDimensions() return maxx > 200 def outputSide(self): if not self.getIsSidebarMode(): return (maxy, maxx) = self.screenControl.getScreenDimensions() borderX = maxx - self.WIDTH if (self.mode == COMMAND_MODE): borderX = len(SHORT_COMMAND_PROMPT) + 20 usageLines = usageStrings.USAGE_PAGE.split('\n') if self.mode == COMMAND_MODE: usageLines = usageStrings.USAGE_COMMAND.split('\n') for index, usageLine in enumerate(usageLines): self.printer.addstr(self.getMinY() + index, borderX + 2, usageLine) for y in range(self.getMinY(), maxy): self.printer.addstr(y, borderX, '|') def outputBottom(self): if self.getIsSidebarMode(): return (maxy, maxx) = self.screenControl.getScreenDimensions() borderY = maxy - 2 # first output text since we might throw an exception during border usageStr = SHORT_NAV_USAGE if self.mode == SELECT_MODE else SHORT_COMMAND_USAGE borderStr = '_' * (maxx - self.getMinX() - 0) self.printer.addstr(borderY, self.getMinX(), borderStr) self.printer.addstr(borderY + 1, self.getMinX(), usageStr) class ScrollBar(object): def __init__(self, printer, lines, screenControl): self.printer = printer self.screenControl = screenControl self.numLines = len(lines) self.boxStartFraction = 0.0 self.boxStopFraction = 0.0 self.calcBoxFractions() # see if we are activated self.activated = True (maxy, maxx) = self.screenControl.getScreenDimensions() if (self.numLines < maxy): self.activated = False logger.addEvent('no_scrollbar') else: logger.addEvent('needed_scrollbar') def getIsActivated(self): return self.activated def calcBoxFractions(self): # what we can see is basically the fraction of our screen over # total num lines (maxy, maxx) = self.screenControl.getScreenDimensions() fracDisplayed = min(1.0, (maxy / float(self.numLines))) self.boxStartFraction = -self.screenControl.getScrollOffset() / float( self.numLines) self.boxStopFraction = self.boxStartFraction + fracDisplayed def output(self): if not self.activated: return for func in [self.outputCaps, self.outputBase, self.outputBox, self.outputBorder]: try: func() except curses.error: pass def getMinY(self): return self.screenControl.getChromeBoundaries()[1] + 1 def getX(self): return 0 def outputBorder(self): x = self.getX() + 4 (maxy, maxx) = self.screenControl.getScreenDimensions() for y in range(0, maxy): self.printer.addstr(y, x, ' ') def outputBox(self): (maxy, maxx) = self.screenControl.getScreenDimensions() topY = maxy - 2 minY = self.getMinY() diff = topY - minY x = self.getX() boxStartY = int(diff * self.boxStartFraction) + minY boxStopY = int(diff * self.boxStopFraction) + minY self.printer.addstr(boxStartY, x, '/-\\') for y in range(boxStartY + 1, boxStopY): self.printer.addstr(y, x, '|-|') self.printer.addstr(boxStopY, x, '\-/') def outputCaps(self): x = self.getX() (maxy, maxx) = self.screenControl.getScreenDimensions() for y in [self.getMinY() - 1, maxy - 1]: self.printer.addstr(y, x, '===') def outputBase(self): x = self.getX() (maxy, maxx) = self.screenControl.getScreenDimensions() for y in range(self.getMinY(), maxy - 1): self.printer.addstr(y, x, ' . ') class Controller(object): def __init__(self, flags, stdscr, lineObjs, cursesAPI): self.stdscr = stdscr self.cursesAPI = cursesAPI self.cursesAPI.useDefaultColors() self.colorPrinter = ColorPrinter(self.stdscr, cursesAPI) self.flags = flags self.lineObjs = lineObjs self.hoverIndex = 0 self.scrollOffset = 0 self.scrollBar = ScrollBar(self.colorPrinter, lineObjs, self) self.helperChrome = HelperChrome(self.colorPrinter, self) (self.oldmaxy, self.oldmaxx) = self.getScreenDimensions() self.mode = SELECT_MODE self.simpleLines = [] self.lineMatches = [] # lets loop through and split for lineObj in self.lineObjs.values(): lineObj.controller = self if (lineObj.isSimple()): self.simpleLines.append(lineObj) else: self.lineMatches.append(lineObj) self.numLines = len(lineObjs.keys()) self.numMatches = len(self.lineMatches) self.setHover(self.hoverIndex, True) # the scroll offset might not start off # at 0 if our first real match is WAY # down the screen -- so lets init it to # a valid value after we have all our line objects self.updateScrollOffset() logger.addEvent('init') def getScrollOffset(self): return self.scrollOffset def getScreenDimensions(self): return self.stdscr.getmaxyx() def getChromeBoundaries(self): (maxy, maxx) = self.stdscr.getmaxyx() minx = CHROME_MIN_X if self.scrollBar.getIsActivated() else 0 maxy = self.helperChrome.reduceMaxY(maxy) maxx = self.helperChrome.reduceMaxX(maxx) # format of (MINX, MINY, MAXX, MAXY) return (minx, CHROME_MIN_Y, maxx, maxy) def getViewportHeight(self): (minx, miny, maxx, maxy) = self.getChromeBoundaries() return maxy - miny def setHover(self, index, val): self.lineMatches[index].setHover(val) def toggleSelect(self): self.dirtyHoverIndex() self.lineMatches[self.hoverIndex].toggleSelect() def toggleSelectAll(self): files = set() for line in self.lineMatches: if line.getFile() not in files: files.add(line.getFile()) line.toggleSelect() self.dirtyLines() def setSelect(self, val): self.lineMatches[self.hoverIndex].setSelect(val) def control(self): # we start out by printing everything we need to self.printAll() self.resetDirty() self.moveCursor() while True: inKey = self.getKey() self.checkResize() self.processInput(inKey) self.processDirty() self.resetDirty() self.moveCursor() self.stdscr.refresh() def checkResize(self): (maxy, maxx) = self.getScreenDimensions() if (maxy is not self.oldmaxy or maxx is not self.oldmaxx): # we resized so print all! self.printAll() self.resetDirty() self.stdscr.refresh() logger.addEvent('resize') (self.oldmaxy, self.oldmaxx) = self.getScreenDimensions() def updateScrollOffset(self): """ yay scrolling logic! we will start simple here and basically just center the viewport to current matched line """ windowHeight = self.getViewportHeight() halfHeight = int(round(windowHeight / 2.0)) # important, we need to get the real SCREEN position # of the hover index, not its index within our matches hovered = self.lineMatches[self.hoverIndex] desiredTopRow = hovered.getScreenIndex() - halfHeight oldOffset = self.scrollOffset desiredTopRow = max(desiredTopRow, 0) newOffset = -desiredTopRow # lets add in some leeway -- dont bother repositioning # if the old offset is within 1/2 of the window height # of our desired (unless we absolutely have to) if abs(newOffset - oldOffset) > halfHeight / 2 or self.hoverIndex + oldOffset < 0: # need to reassign now we have gone too far self.scrollOffset = newOffset if oldOffset is not self.scrollOffset: self.dirtyLines() # also update our scroll bar self.scrollBar.calcBoxFractions() def pageDown(self): pageHeight = (int)(self.getViewportHeight() * 0.5) self.moveIndex(pageHeight) def pageUp(self): pageHeight = (int)(self.getViewportHeight() * 0.5) self.moveIndex(-pageHeight) def moveIndex(self, delta): newIndex = (self.hoverIndex + delta) % self.numMatches self.jumpToIndex(newIndex) def jumpToIndex(self, newIndex): self.setHover(self.hoverIndex, False) self.dirtyHoverIndex() self.hoverIndex = newIndex self.setHover(self.hoverIndex, True) self.dirtyHoverIndex() self.updateScrollOffset() def processInput(self, key): if key == 'UP' or key == 'k': self.moveIndex(-1) elif key == 'DOWN' or key == 'j': self.moveIndex(1) elif key == 'c': self.beginEnterCommand() elif key == ' ' or key == 'PAGE_DOWN': self.pageDown() elif key == 'b' or key == 'PAGE_UP': self.pageUp() elif key == 'g': self.jumpToIndex(0) elif key == 'G': self.jumpToIndex(self.numMatches - 1) elif key == 'f': self.toggleSelect() elif key == 'A': self.toggleSelectAll() elif key == 'ENTER': self.onEnter() elif key == 'q': output.outputNothing() # this will get the appropriate selection and save it to a file for reuse # before exiting the program self.getFilesToUse() self.cursesAPI.exit() pass def getFilesToUse(self): # if we have select files, those, otherwise hovered toUse = self.getSelectedFiles() if not toUse: toUse = self.getHoveredFiles() # save the selection we are using if self.cursesAPI.allowFileOutput(): output.outputSelection(toUse) return toUse def getSelectedFiles(self): return [lineObj for (index, lineObj) in enumerate(self.lineMatches) if lineObj.getSelected()] def getHoveredFiles(self): return [lineObj for (index, lineObj) in enumerate(self.lineMatches) if index == self.hoverIndex] def showAndGetCommand(self): fileObjs = self.getFilesToUse() files = [fileObj.getFile() for fileObj in fileObjs] (maxy, maxx) = self.getScreenDimensions() halfHeight = int(round(maxy / 2) - len(files) / 2.0) borderLine = '=' * len(SHORT_COMMAND_PROMPT) promptLine = '.' * len(SHORT_COMMAND_PROMPT) # from helper chrome code maxFileLength = maxx - 5 if self.helperChrome.getIsSidebarMode(): # need to be shorter to not go into side bar maxFileLength = len(SHORT_COMMAND_PROMPT) + 18 # first lets print all the files startHeight = halfHeight - 1 - len(files) try: self.stdscr.addstr(startHeight - 3, 0, borderLine) self.stdscr.addstr(startHeight - 2, 0, SHORT_FILES_HEADER) self.stdscr.addstr(startHeight - 1, 0, borderLine) for index, file in enumerate(files): self.stdscr.addstr(startHeight + index, 0, file[0:maxFileLength]) except curses.error: pass # first print prompt try: self.stdscr.addstr(halfHeight, 0, SHORT_COMMAND_PROMPT) self.stdscr.addstr(halfHeight + 1, 0, SHORT_COMMAND_PROMPT2) except curses.error: pass # then line to distinguish and prompt line try: self.stdscr.addstr(halfHeight - 1, 0, borderLine) self.stdscr.addstr(halfHeight + 2, 0, borderLine) self.stdscr.addstr(halfHeight + 3, 0, promptLine) except curses.error: pass self.stdscr.refresh() self.cursesAPI.echo() maxX = int(round(maxx - 1)) command = self.stdscr.getstr(halfHeight + 3, 0, maxX) return command def beginEnterCommand(self): self.stdscr.clear() # first check if they are trying to enter command mode # but already have a command... if len(self.flags.getPresetCommand()): self.helperChrome.output(self.mode) (_, minY, _, maxY) = self.getChromeBoundaries() yStart = (maxY + minY) / 2 - 3 self.printProvidedCommandWarning(yStart) self.getKey() self.mode = SELECT_MODE self.dirtyLines() return self.mode = COMMAND_MODE self.helperChrome.output(self.mode) logger.addEvent('enter_command_mode') command = self.showAndGetCommand() if len(command) == 0: # go back to selection mode and repaint self.mode = SELECT_MODE self.cursesAPI.noecho() self.dirtyLines() logger.addEvent('exit_command_mode') return lineObjs = self.getFilesToUse() output.execComposedCommand(command, lineObjs) sys.exit(0) def onEnter(self): lineObjs = self.getFilesToUse() if not lineObjs: # nothing selected, assume we want hovered lineObjs = self.getHoveredFiles() logger.addEvent('selected_num_files', len(lineObjs)) # commands passed from the command line get used immediately presetCommand = self.flags.getPresetCommand() if len(presetCommand) > 0: output.execComposedCommand(presetCommand, lineObjs) else: output.editFiles(lineObjs) sys.exit(0) def resetDirty(self): # reset all dirty state for our components self.linesDirty = False self.dirtyIndexes = [] def dirtyHoverIndex(self): self.dirtyIndexes.append(self.hoverIndex) def dirtyLines(self): self.linesDirty = True def processDirty(self): if self.linesDirty: self.printAll() for index in self.dirtyIndexes: self.lineMatches[index].output(self.colorPrinter) if self.helperChrome.getIsSidebarMode(): # need to output since lines can override # the sidebar stuff self.printChrome() def printAll(self): self.stdscr.clear() self.printLines() self.printScroll() self.printChrome() def printLines(self): for lineObj in self.lineObjs.values(): lineObj.output(self.colorPrinter) def printScroll(self): self.scrollBar.output() def printProvidedCommandWarning(self, yStart): self.colorPrinter.setAttributes( curses.COLOR_WHITE, curses.COLOR_RED, 0) self.stdscr.addstr(yStart, 0, 'Oh no! You already provided a command so ' + 'you cannot enter command mode.') self.stdscr.attrset(0) self.stdscr.addstr( yStart + 1, 0, 'The command you provided was "%s" ' % self.flags.getPresetCommand()) self.stdscr.addstr( yStart + 2, 0, 'Press any key to go back to selecting files.') def printChrome(self): self.helperChrome.output(self.mode) def moveCursor(self): x = CHROME_MIN_X if self.scrollBar.getIsActivated() else 0 y = self.lineMatches[ self.hoverIndex].getScreenIndex() + self.scrollOffset self.stdscr.move(y, x) def getKey(self): charCode = self.stdscr.getch() return CODE_TO_CHAR.get(charCode, '')
# Copyright 2017 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Reshape bijectors.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function import numpy as np from tensorflow.python.framework import constant_op from tensorflow.python.framework import dtypes from tensorflow.python.framework import ops from tensorflow.python.framework import tensor_util from tensorflow.python.ops import array_ops from tensorflow.python.ops import check_ops from tensorflow.python.ops import control_flow_ops from tensorflow.python.ops import math_ops from tensorflow.python.ops.distributions import bijector from tensorflow.python.util import deprecation __all__ = [ "Reshape", ] @deprecation.deprecated( "2018-10-01", "The TensorFlow Distributions library has moved to " "TensorFlow Probability " "(https://github.com/tensorflow/probability). You " "should update all references to use `tfp.distributions` " "instead of `tf.contrib.distributions`.", warn_once=True) def _static_ndims_from_shape(shape): return shape.shape.with_rank_at_least(1)[0].value @deprecation.deprecated( "2018-10-01", "The TensorFlow Distributions library has moved to " "TensorFlow Probability " "(https://github.com/tensorflow/probability). You " "should update all references to use `tfp.distributions` " "instead of `tf.contrib.distributions`.", warn_once=True) def _ndims_from_shape(shape): return array_ops.shape(shape)[0] class Reshape(bijector.Bijector): """Reshapes the `event_shape` of a `Tensor`. The semantics generally follow that of `tf.reshape()`, with a few differences: * The user must provide both the input and output shape, so that the transformation can be inverted. If an input shape is not specified, the default assumes a vector-shaped input, i.e., event_shape_in = (-1,). * The `Reshape` bijector automatically broadcasts over the leftmost dimensions of its input (`sample_shape` and `batch_shape`); only the rightmost `event_ndims_in` dimensions are reshaped. The number of dimensions to reshape is inferred from the provided `event_shape_in` (`event_ndims_in = len(event_shape_in)`). Example usage: ```python import tensorflow_probability as tfp tfb = tfp.bijectors r = tfb.Reshape(event_shape_out=[1, -1]) r.forward([3., 4.]) # shape [2] # ==> [[3., 4.]] # shape [1, 2] r.forward([[1., 2.], [3., 4.]]) # shape [2, 2] # ==> [[[1., 2.]], # [[3., 4.]]] # shape [2, 1, 2] r.inverse([[3., 4.]]) # shape [1,2] # ==> [3., 4.] # shape [2] r.forward_log_det_jacobian(any_value) # ==> 0. r.inverse_log_det_jacobian(any_value) # ==> 0. ``` """ @deprecation.deprecated( "2018-10-01", "The TensorFlow Distributions library has moved to " "TensorFlow Probability " "(https://github.com/tensorflow/probability). You " "should update all references to use `tfp.distributions` " "instead of `tf.contrib.distributions`.", warn_once=True) def __init__(self, event_shape_out, event_shape_in=(-1,), validate_args=False, name=None): """Creates a `Reshape` bijector. Args: event_shape_out: An `int`-like vector-shaped `Tensor` representing the event shape of the transformed output. event_shape_in: An optional `int`-like vector-shape `Tensor` representing the event shape of the input. This is required in order to define inverse operations; the default of (-1,) assumes a vector-shaped input. validate_args: Python `bool` indicating whether arguments should be checked for correctness. name: Python `str`, name given to ops managed by this object. Raises: TypeError: if either `event_shape_in` or `event_shape_out` has non-integer `dtype`. ValueError: if either of `event_shape_in` or `event_shape_out` has non-vector shape (`rank > 1`), or if their sizes do not match. """ with ops.name_scope(name, "reshape", values=[event_shape_out, event_shape_in]): event_shape_out = ops.convert_to_tensor(event_shape_out, name="event_shape_out", preferred_dtype=dtypes.int32) event_shape_in = ops.convert_to_tensor(event_shape_in, name="event_shape_in", preferred_dtype=dtypes.int32) assertions = [] assertions.extend(self._maybe_check_valid_shape( event_shape_out, validate_args)) assertions.extend(self._maybe_check_valid_shape( event_shape_in, validate_args)) self._assertions = assertions self._event_shape_in = event_shape_in self._event_shape_out = event_shape_out super(Reshape, self).__init__( forward_min_event_ndims=0, is_constant_jacobian=True, validate_args=validate_args, name=name or "reshape") def _maybe_check_valid_shape(self, shape, validate_args): """Check that a shape Tensor is int-type and otherwise sane.""" if not shape.dtype.is_integer: raise TypeError("{} dtype ({}) should be `int`-like.".format( shape, shape.dtype.name)) assertions = [] ndims = array_ops.rank(shape) ndims_ = tensor_util.constant_value(ndims) if ndims_ is not None and ndims_ > 1: raise ValueError("`{}` rank ({}) should be <= 1.".format( shape, ndims_)) elif validate_args: assertions.append(check_ops.assert_less_equal( ndims, 1, message="`{}` rank should be <= 1.".format(shape))) shape_ = tensor_util.constant_value_as_shape(shape) if shape_.is_fully_defined(): es = np.int32(shape_.as_list()) if sum(es == -1) > 1: raise ValueError( "`{}` must have at most one `-1` (given {})" .format(shape, es)) if np.any(es < -1): raise ValueError( "`{}` elements must be either positive integers or `-1`" "(given {})." .format(shape, es)) elif validate_args: assertions.extend([ check_ops.assert_less_equal( math_ops.reduce_sum( math_ops.cast(math_ops.equal(shape, -1), dtypes.int32)), 1, message="`{}` elements must have at most one `-1`." .format(shape)), check_ops.assert_greater_equal( shape, -1, message="`{}` elements must be either positive integers or `-1`." .format(shape)), ]) return assertions def _reshape_helper(self, x, event_shape_in, event_shape_out): """Reshape only the event_shape of an input `Tensor`.""" event_ndims_in_ = _static_ndims_from_shape(event_shape_in) event_ndims_in = _ndims_from_shape(event_shape_in) x_ndims_, x_ndims = x.shape.ndims, array_ops.rank(x) assertions = [] # Ensure x.event_shape is compatible with event_shape_in. if (event_ndims_in_ is not None and x_ndims_ is not None and x.shape.with_rank_at_least(event_ndims_in_)[ x_ndims_-event_ndims_in_:].is_fully_defined()): x_event_shape_, x_event_shape = [ # pylint: disable=unbalanced-tuple-unpacking np.int32(x.shape[x_ndims_-event_ndims_in_:])]*2 else: x_event_shape_, x_event_shape = ( None, array_ops.shape(x)[x_ndims-event_ndims_in:]) event_shape_in_ = tensor_util.constant_value(event_shape_in) if x_event_shape_ is not None and event_shape_in_ is not None: # Compare the shape dimensions that are fully specified in the # input (i.e., for which event_shape_in is not -1). If x_event_shape # matches along all of these dimensions, it is compatible with # the desired input shape and any further mismatches (i.e., # imcompatibility with the desired *output* shape) will be # caught inside of array_ops.reshape() below. x_event_shape_specified_ = x_event_shape_[event_shape_in_ >= 0] event_shape_in_specified_ = event_shape_in_[event_shape_in_ >= 0] if not np.equal(x_event_shape_specified_, event_shape_in_specified_).all(): raise ValueError( "Input `event_shape` does not match `event_shape_in` ({} vs {}).". format(x_event_shape_, event_shape_in_)) elif self.validate_args: # Similarly to the static case, we compare the shape dimensions # that are fully specified in the input. We extract these # dimensions using boolean_mask(), which requires that the mask # have known ndims. We can assume that shape Tensors always have # ndims==1 (this assumption is verified inside of # _maybe_check_valid_shape), so the reshape operation is just a # no-op that formally encodes this fact to make boolean_mask() # happy. event_shape_mask = array_ops.reshape(event_shape_in >= 0, [-1]) x_event_shape_specified = array_ops.boolean_mask(x_event_shape, event_shape_mask) event_shape_in_specified = array_ops.boolean_mask(event_shape_in, event_shape_mask) assertions.append(check_ops.assert_equal( x_event_shape_specified, event_shape_in_specified, message="Input `event_shape` does not match `event_shape_in`.")) if assertions: x = control_flow_ops.with_dependencies(assertions, x) # get the parts of shape(x) that will not change sample_and_batch_shape = array_ops.shape(x) ndims = (x.shape.ndims if x.shape.ndims is not None else array_ops.rank(x)) sample_and_batch_shape = sample_and_batch_shape[ :(ndims - math_ops.abs(event_ndims_in))] if (event_ndims_in_ is not None and x_ndims_ is not None and event_ndims_in_ == x_ndims_): # Hack to allow forward/inverse_event_shape to do shape # inference by calling this helper method with a dummy Tensor of # shape event_shape_in. In this special case, # sample_and_batch_shape will be empty so we can preserve static # shape information by avoiding the concat operation below # (which would be a no-op). new_shape = event_shape_out else: new_shape = array_ops.concat( [sample_and_batch_shape, event_shape_out], axis=0) return array_ops.reshape(x, new_shape) def _forward(self, x): with ops.control_dependencies(self._assertions): return self._reshape_helper(x, self._event_shape_in, self._event_shape_out) def _inverse(self, y): with ops.control_dependencies(self._assertions): return self._reshape_helper(y, self._event_shape_out, self._event_shape_in) def _inverse_log_det_jacobian(self, y): with ops.control_dependencies(self._assertions): return constant_op.constant(0., dtype=y.dtype) def _forward_log_det_jacobian(self, x): with ops.control_dependencies(self._assertions): return constant_op.constant(0., dtype=x.dtype) def _forward_event_shape(self, input_shape): # NOTE: this method and the other *_event_shape* methods # compute shape by explicit transformation of a dummy # variable. This approach is not generally recommended because it # bloats the graph and could in general trigger side effects. # # In this particular case of the Reshape bijector, the # forward and inverse transforms have no side effects, and we # believe the reduction in code complexity from delegating the # heavy lifting to tf.reshape() is worth the added graph ops. # However, you should think hard before implementing this approach # in other Bijectors; it is strongly preferred to compute # shapes explicitly whenever it's feasible to do so. with ops.control_dependencies(self._assertions): dummy = array_ops.zeros(dtype=dtypes.float32, shape=input_shape) dummy_reshaped = self.forward(dummy) return dummy_reshaped.shape def _inverse_event_shape(self, output_shape): with ops.control_dependencies(self._assertions): dummy = array_ops.zeros(dtype=dtypes.float32, shape=output_shape) dummy_reshaped = self.inverse(dummy) return dummy_reshaped.shape def _forward_event_shape_tensor(self, input_shape): with ops.control_dependencies(self._assertions): dummy = array_ops.zeros(dtype=dtypes.float32, shape=input_shape) dummy_reshaped = self.forward(dummy) return array_ops.shape(dummy_reshaped) def _inverse_event_shape_tensor(self, output_shape): with ops.control_dependencies(self._assertions): dummy = array_ops.zeros(dtype=dtypes.float32, shape=output_shape) dummy_reshaped = self.inverse(dummy) return array_ops.shape(dummy_reshaped)
# coding: utf-8 # imports import os import re import itertools from time import gmtime, strftime, localtime, time from PIL import Image, ImageFile # django imports from django.core.files.storage import default_storage from django.utils.encoding import smart_str # filebrowser imports from filebrowser.settings import ( ADMIN_VERSIONS, VERSIONS_BASEDIR, DEBUG, URL_FILEBROWSER_MEDIA, PATH_FILEBROWSER_MEDIA, URL_TINYMCE, PATH_TINYMCE, EXTENSIONS, SELECT_FORMATS, VERSIONS, ADMIN_THUMBNAIL, PREVIEW_VERSION, MAX_UPLOAD_SIZE, CONVERT_FILENAME, STRICT_PIL, IMAGE_MAXBLOCK ) from filebrowser.conf import fb_settings import sys _ver = sys.version_info def url_to_path(value): """ Change URL to PATH. Value has to be an URL relative to MEDIA URL or a full URL (including MEDIA_URL). Returns a PATH relative to MEDIA_ROOT. """ mediaurl_re = re.compile(r'^({0})'.format(fb_settings.MEDIA_URL)) value = mediaurl_re.sub('', value) return value def path_to_url(value): """ Change PATH to URL. Value has to be a PATH relative to MEDIA_ROOT. Return an URL relative to MEDIA_ROOT. """ mediaroot_re = re.compile(r'^({0})'.format(fb_settings.MEDIA_ROOT)) value = mediaroot_re.sub('', value) return url_join(fb_settings.MEDIA_URL, value) def dir_from_url(value): """ Get the relative server directory from a URL. URL has to be an absolute URL including MEDIA_URL or an URL relative to MEDIA_URL. """ mediaurl_re = re.compile(r'^({0})'.format(fb_settings.MEDIA_URL)) value = mediaurl_re.sub('', value) directory_re = re.compile(r'^({0})'.format(fb_settings.DIRECTORY)) value = directory_re.sub('', value) return os.path.split(value)[0] def get_version_path(value, version_prefix): """ Construct the PATH to an Image version. Value has to be server-path, relative to MEDIA_ROOT. version_filename = filename + version_prefix + ext Returns a path relative to MEDIA_ROOT. """ if os.path.isfile(smart_str(os.path.join(fb_settings.MEDIA_ROOT, value))): path, filename = os.path.split(value) filename, ext = os.path.splitext(filename) # check if this file is a version of an other file # to return filename_<version>.ext instead of # filename_<version>_<version>.ext tmp = filename.split("_") if tmp[len(tmp)-1] in ADMIN_VERSIONS: # it seems like the "original" # is actually a version of an other original # so we strip the suffix (aka. version_perfix) new_filename = filename.replace("_" + tmp[len(tmp)-1], "") # check if the version exists when we use the new_filename if os.path.isfile(smart_str(os.path.join(fb_settings.MEDIA_ROOT, path, new_filename + "_" + version_prefix + ext))): # our "original" filename seem to be # filename_<version> construct # so we replace it with the new_filename filename = new_filename # if a VERSIONS_BASEDIR is set we need to strip it # from the path or we get # a <VERSIONS_BASEDIR>/<VERSIONS_BASEDIR>/... construct if VERSIONS_BASEDIR != "": path = path.replace(VERSIONS_BASEDIR + "/", "") version_filename = filename + "_" + version_prefix + ext return os.path.join(VERSIONS_BASEDIR, path, version_filename) else: return None def sort_by_attr(seq, attr): """ Sort the sequence of objects by object's attribute Arguments: seq - the list or any sequence (including immutable one) of objects to sort. attr - the name of attribute to sort by Returns: the sorted list of objects. """ import operator # Use the "Schwartzian transform" # Create the auxiliary list of tuples where every i-th tuple has form # (seq[i].attr, i, seq[i]) and sort it. # The second item of tuple is needed not only to provide stable sorting, # but mainly to eliminate comparison of objects # (which can be expensive or prohibited) in case of equal attribute values. if _ver >= (3, 0): intermed = map( None, map( getattr, seq, (attr,)*len(seq) ), itertools.zip_longest(range(len(seq)), seq) ) try: intermed = sorted(intermed) # does this actually DO anything? print(intermed) return list(map(operator.getitem, intermed, (-1,) * len(intermed))) except TypeError: return seq else: intermed = map( None, map(getattr, seq, (attr,)*len(seq)), range(len(seq)), seq ) intermed.sort() return map(operator.getitem, intermed, (-1,) * len(intermed)) def url_join(*args): """ URL join routine. """ if args[0].startswith("http://"): url = "http://" elif args[0].startswith("https://"): url = "https://" else: url = "/" for arg in args: arg = arg.replace("\\", "/") arg_split = arg.split("/") for elem in arg_split: if elem != "" and elem != "http:" and elem != "https:": url = url + elem + "/" # remove trailing slash for filenames if os.path.splitext(args[-1])[1]: url = url.rstrip("/") return url def get_path(path): """ Get Path. """ if path.startswith('.') or \ os.path.isabs(path) or \ not os.path.isdir(os.path.join(fb_settings.MEDIA_ROOT, fb_settings.DIRECTORY, path)): return None return path def get_file(path, filename): """ Get File. """ converted_path = smart_str( os.path.join( fb_settings.MEDIA_ROOT, fb_settings.DIRECTORY, path, filename ) ) if not os.path.isfile(converted_path) and \ not os.path.isdir(converted_path): return None return filename def get_breadcrumbs(query, path): """ Get breadcrumbs. """ breadcrumbs = [] dir_query = "" if path: for item in path.split(os.sep): dir_query = os.path.join(dir_query, item) breadcrumbs.append([item, dir_query]) return breadcrumbs def get_filterdate(filter_date, date_time): """ Get filterdate. """ returnvalue = '' date_year = strftime("%Y", gmtime(date_time)) date_month = strftime("%m", gmtime(date_time)) date_day = strftime("%d", gmtime(date_time)) if filter_date == 'today' and \ int(date_year) == int(localtime()[0]) and \ int(date_month) == int(localtime()[1]) and \ int(date_day) == int(localtime()[2]): returnvalue = 'true' elif filter_date == 'thismonth' and date_time >= time() - 2592000: returnvalue = 'true' elif filter_date == 'thisyear' and int(date_year) == int(localtime()[0]): returnvalue = 'true' elif filter_date == 'past7days' and date_time >= time()-604800: returnvalue = 'true' elif filter_date == '': returnvalue = 'true' return returnvalue def get_settings_var(): """ Get settings variables used for FileBrowser listing. """ settings_var = { # Main 'DEBUG': DEBUG, 'MEDIA_ROOT': fb_settings.MEDIA_ROOT, 'MEDIA_URL': fb_settings.MEDIA_URL, 'DIRECTORY': fb_settings.DIRECTORY, # FileBrowser 'URL_FILEBROWSER_MEDIA': URL_FILEBROWSER_MEDIA, 'PATH_FILEBROWSER_MEDIA': PATH_FILEBROWSER_MEDIA, # TinyMCE 'URL_TINYMCE': URL_TINYMCE, 'PATH_TINYMCE': PATH_TINYMCE, # Extensions/Formats (for FileBrowseField) 'EXTENSIONS': EXTENSIONS, 'SELECT_FORMATS': SELECT_FORMATS, # Versions 'VERSIONS_BASEDIR': VERSIONS_BASEDIR, 'VERSIONS': VERSIONS, 'ADMIN_VERSIONS': ADMIN_VERSIONS, 'ADMIN_THUMBNAIL': ADMIN_THUMBNAIL, 'PREVIEW_VERSION': PREVIEW_VERSION, # FileBrowser Options 'MAX_UPLOAD_SIZE': MAX_UPLOAD_SIZE, # Convert Filenames 'CONVERT_FILENAME': CONVERT_FILENAME, } return settings_var def handle_file_upload(path, file): """ Handle File Upload. """ file_path = os.path.join(path, file.name) uploadedfile = default_storage.save(file_path, file) return uploadedfile def get_file_type(filename): """ Get file type as defined in EXTENSIONS. """ file_extension = os.path.splitext(filename)[1].lower() file_type = '' for k, v in EXTENSIONS.items(): for extension in v: if file_extension == extension.lower(): file_type = k return file_type def is_selectable(filename, selecttype): """ Get select type as defined in FORMATS. """ file_extension = os.path.splitext(filename)[1].lower() select_types = [] for k, v in SELECT_FORMATS.items(): for extension in v: if file_extension == extension.lower(): select_types.append(k) return select_types def version_generator(value, version_prefix, force=None): """ Generate Version for an Image. value has to be a serverpath relative to MEDIA_ROOT. """ ImageFile.MAXBLOCK = IMAGE_MAXBLOCK # default is 64k try: im = Image.open(smart_str(os.path.join(fb_settings.MEDIA_ROOT, value))) version_path = get_version_path(value, version_prefix) absolute_version_path = smart_str( os.path.join(fb_settings.MEDIA_ROOT, version_path) ) version_dir = os.path.split(absolute_version_path)[0] if not os.path.isdir(version_dir): os.makedirs(version_dir) os.chmod(version_dir, 0o775) version = scale_and_crop( im, VERSIONS[version_prefix]['width'], VERSIONS[version_prefix]['height'], VERSIONS[version_prefix]['opts'] ) try: version.save( absolute_version_path, quality=90, optimize=(os.path.splitext(version_path)[1].lower() != '.gif') ) except IOError: version.save(absolute_version_path, quality=90) return version_path except: return None def scale_and_crop(im, width, height, opts): """ Scale and Crop. """ x, y = [float(v) for v in im.size] if width: xr = float(width) else: xr = float(x * height / y) if height: yr = float(height) else: yr = float(y * width / x) if 'crop' in opts: r = max(xr / x, yr / y) else: r = min(xr / x, yr / y) if r < 1.0 or (r > 1.0 and 'upscale' in opts): im = im.resize((int(x * r), int(y * r)), resample=Image.ANTIALIAS) if 'crop' in opts: x, y = [float(v) for v in im.size] ex, ey = (x - min(x, xr)) / 2, (y - min(y, yr)) / 2 if ex or ey: im = im.crop((int(ex), int(ey), int(x - ex), int(y - ey))) return im scale_and_crop.valid_options = ('crop', 'upscale') def convert_filename(value): """ Convert Filename. """ if CONVERT_FILENAME: return value.replace(" ", "_").lower() else: return value def _template(): if fb_settings.SUIT_TEMPLATE: path = 'suit/' else: path = 'filebrowser/' return path
# 6.00 Problem Set 4 # # Caesar Cipher Skeleton # import string import random import numbers WORDLIST_FILENAME = "words.txt" # ----------------------------------- # Helper code # (you don't need to understand this helper code) def load_words(): """ Returns a list of valid words. Words are strings of lowercase letters. Depending on the size of the word list, this function may take a while to finish. """ print("Loading word list from file...") # inFile: file inFile = open(WORDLIST_FILENAME, 'r') # line: string line = inFile.readline() # wordlist: list of strings wordlist = line.split() print(" ", len(wordlist), "words loaded.") return wordlist wordlist = load_words() def is_word(wordlist, word): """ Determines if word is a valid word. wordlist: list of words in the dictionary. word: a possible word. returns True if word is in wordlist. Example: >>> is_word(wordlist, 'bat') returns True >>> is_word(wordlist, 'asdf') returns False """ word = word.lower() word = word.strip(" !@#$%^&*()-_+={}[]|\:;'<>?,./\"") return word in wordlist def random_word(wordlist): """ Returns a random word. wordlist: list of words returns: a word from wordlist at random """ return random.choice(wordlist) def random_string(wordlist, n): """ Returns a string containing n random words from wordlist wordlist: list of words returns: a string of random words separated by spaces. """ return " ".join([random_word(wordlist) for _ in range(n)]) def random_scrambled(wordlist, n): """ Generates a test string by generating an n-word random string and encrypting it with a sequence of random shifts. wordlist: list of words n: number of random words to generate and scamble returns: a scrambled string of n random words NOTE: This function will ONLY work once you have completed your implementation of apply_shifts! """ s = random_string(wordlist, n) + " " shifts = [(i, random.randint(0, 26)) for i in range(len(s)) if s[i-1] == ' '] return apply_shifts(s, shifts)[:-1] def get_fable_string(): """ Returns a fable in encrypted text. """ f = open("fable.txt", "r") fable = str(f.read()) f.close() return fable # (end of helper code) # ----------------------------------- # # Problem 1: Encryption # def build_coder(shift): """ Returns a dict that can apply a Caesar cipher to a letter. The cipher is defined by the shift value. Ignores non-letter characters like punctuation and numbers. shift: -27 < int < 27 returns: dict Example: >>> build_coder(3) {' ': 'c', 'A': 'D', 'C': 'F', 'B': 'E', 'E': 'H', 'D': 'G', 'G': 'J', 'F': 'I', 'I': 'L', 'H': 'K', 'K': 'N', 'J': 'M', 'M': 'P', 'L': 'O', 'O': 'R', 'N': 'Q', 'Q': 'T', 'P': 'S', 'S': 'V', 'R': 'U', 'U': 'X', 'T': 'W', 'W': 'Z', 'V': 'Y', 'Y': 'A', 'X': ' ', 'Z': 'B', 'a': 'd', 'c': 'f', 'b': 'e', 'e': 'h', 'd': 'g', 'g': 'j', 'f': 'i', 'i': 'l', 'h': 'k', 'k': 'n', 'j': 'm', 'm': 'p', 'l': 'o', 'o': 'r', 'n': 'q', 'q': 't', 'p': 's', 's': 'v', 'r': 'u', 'u': 'x', 't': 'w', 'w': 'z', 'v': 'y', 'y': 'a', 'x': ' ', 'z': 'b'} (The order of the key-value pairs may be different.) """ assert shift >= 0 and shift < 27, 'shift %s is not between 0 and 27' % shift #numbers.Integral used in case of long integers assert isinstance(shift, numbers.Integral), 'shift is not an integer' result = {} upper = list(string.ascii_uppercase) lower = list(string.ascii_lowercase) upper.append(' ') lower.append(' ') for i in range(27): result[lower[i]] = lower[(i + shift) % 27] result[upper[i]] = upper[(i + shift) % 27] return result #print(build_coder(3)) def apply_coder(text, coder): """ Applies the coder to the text. Returns the encoded text. text: string coder: dict with mappings of characters to shifted characters returns: text after mapping coder chars to original text Example: >>> apply_coder("Hello, world!", build_encoder(3)) 'Khoor,czruog!' >>> apply_coder("Khoor,czruog!", build_decoder(3)) 'Hello, world!' """ # Pseudo Code # init empty list # start looping through 'text' # check if current char is a letter .isalpha() or space. # if is alpha or space, append value to temp string or list # if not space or alpha, don't pass element from encoder # return encoded string assert type(text) is str, 'text is not a string' encodedString = [] coderRef = coder i = 0 while i < len(text): if text[i].isalpha() or text[i] == ' ': encodedString.append(coderRef[text[i]]) else: encodedString.append(text[i]) i += 1 return ''.join(encodedString) #print(apply_coder(2, build_coder(4))) #print(apply_coder("Lipps,D svph!", build_coder(23))) def apply_shift(text, shift): """ Given a text, returns a new text Caesar shifted by the given shift offset. The empty space counts as the 27th letter of the alphabet, so spaces should be replaced by a lowercase letter as appropriate. Otherwise, lower case letters should remain lower case, upper case letters should remain upper case, and all other punctuation should stay as it is. text: string to apply the shift to shift: amount to shift the text returns: text after being shifted by specified amount. Example: >>> apply_shift('This is a test.', 8) 'Apq hq hiham a.' """ assert type(text) is str, 'text is not a string' assert shift >= 0 and shift < 27, 'shift %s is not between 0 and 27' % shift return apply_coder(text,build_coder(shift)) # print(apply_shift('This is a test.', 8)) # # Problem 2: Codebreaking. # def find_best_shift(wordlist, text): """ Decrypts the encoded text and returns the plaintext. text: string returns: 0 <= int 27 Example: >>> s = apply_coder('Hello, world!', build_encoder(8)) >>> s 'Pmttw,hdwztl!' >>> find_best_shift(wordlist, s) returns 8 >>> apply_coder(s, build_decoder(8)) returns 'Hello, world!' """ word = "" tempWordList = [] shift = 0 for i in range(27): word = apply_shift(text, i) j = 0 element = '' while j < len(word): if word[j].isalpha(): element += word[j] else: tempWordList.append(element) element = "" tempWordList.append(word[j]) j += 1 for guess in tempWordList: if guess.isalpha(): if guess.lower() in wordlist: print(guess) return i print(tempWordList) tempWordList = [] # s = apply_coder('Hello, world!', build_coder(8)) # print(find_best_shift(wordlist,s)) # # Problem 3: Multi-level encryption. # def apply_shifts(text, shifts): """ Applies a sequence of shifts to an input text. text: A string to apply the Ceasar shifts to shifts: A list of tuples containing the location each shift should begin and the shift offset. Each tuple is of the form (location, shift) The shifts are layered: each one is applied from its starting position all the way through the end of the string. returns: text after applying the shifts to the appropriate positions Example: >>> apply_shifts("Do Androids Dream of Electric Sheep?", [(0,6), (3, 18), (12, 16)]) 'JufYkaolfapxQdrnzmasmRyrpfdvpmEurrb?' """ ### TODO. # # Problem 4: Multi-level decryption. # def find_best_shifts(wordlist, text): """ Given a scrambled string, returns a shift key that will decode the text to words in wordlist, or None if there is no such key. Hint: Make use of the recursive function find_best_shifts_rec(wordlist, text, start) wordlist: list of words text: scambled text to try to find the words for returns: list of tuples. each tuple is (position in text, amount of shift) Examples: >>> s = random_scrambled(wordlist, 3) >>> s 'eqorqukvqtbmultiform wyy ion' >>> shifts = find_best_shifts(wordlist, s) >>> shifts [(0, 25), (11, 2), (21, 5)] >>> apply_shifts(s, shifts) 'compositor multiform accents' >>> s = apply_shifts("Do Androids Dream of Electric Sheep?", [(0,6), (3, 18), (12, 16)]) >>> s 'JufYkaolfapxQdrnzmasmRyrpfdvpmEurrb?' >>> shifts = find_best_shifts(wordlist, s) >>> print apply_shifts(s, shifts) Do Androids Dream of Electric Sheep? """ def find_best_shifts_rec(wordlist, text, start): """ Given a scrambled string and a starting position from which to decode, returns a shift key that will decode the text to words in wordlist, or None if there is no such key. Hint: You will find this function much easier to implement if you use recursion. wordlist: list of words text: scambled text to try to find the words for start: where to start looking at shifts returns: list of tuples. each tuple is (position in text, amount of shift) """ ### TODO. def decrypt_fable(): """ Using the methods you created in this problem set, decrypt the fable given by the function get_fable_string(). Once you decrypt the message, be sure to include as a comment at the end of this problem set how the fable relates to your education at MIT. returns: string - fable in plain text """ ### TODO. #What is the moral of the story? # # # # #
# First we import parts of the frameworks we're using: # # Flask <http://flask.pocoo.org> is a simple framework for building web # applications in Python. It handles basic things like parsing incoming # HTTP requests and generating responses. # # Flask-RESTful <https://flask-restful.readthedocs.io/> is an add-on to Flask # that makes it easier to build web applications that adhere to the REST # architectural style. from flask import (Flask, Response, request, render_template, make_response, redirect) from flask_restful import Api, Resource, reqparse, abort # Next we import some standard Python libraries and functions: # # json <https://docs.python.org/3/library/json.html> for loading a JSON file # from disk (our "database") into memory. # # random <https://docs.python.org/3/library/random.html> and string # <https://docs.python.org/3/library/string.html> to help us generate # unique IDs for help tickets from lowercase letters and digits. # # datetime <https://docs.python.org/3/library/datetime.html> to help us # generate timestamps for help tickets. # # wraps <https://docs.python.org/3/library/functools.html#functools.wraps> # is just a convenience function that will help us implement authentication. import json import random import string from datetime import datetime from functools import wraps # Define some constants for our priority levels. # These are the values that the "priority" property can take on a help ticket. PRIORITIES = ('closed', 'low', 'normal', 'high') # Load data from disk. # This simply loads the data from our "database," which is just a JSON file. with open('data.jsonld') as data: data = json.load(data) # The next three functions implement simple authentication. # Check that username and password are OK; DON'T DO THIS FOR REAL def check_auth(username, password): return username == 'admin' and password == 'secret' # Issue an authentication challenge def authenticate(): return Response( 'Please authenticate yourself', 401, {'WWW-Authenticate': 'Basic realm="helpdesk"'}) # Decorator for methods that require authentication def requires_auth(f): @wraps(f) def decorated(*args, **kwargs): auth = request.authorization if not auth or not check_auth(auth.username, auth.password): return authenticate() return f(*args, **kwargs) return decorated # The following are three helper functions used in our resource classes. # Generate a unique ID for a new help ticket. # By default this will consist of six lowercase numbers and letters. def generate_id(size=6, chars=string.ascii_lowercase + string.digits): return ''.join(random.choice(chars) for _ in range(size)) # Respond with 404 Not Found if no help ticket with the specified ID exists. def error_if_helpticket_not_found(helpticket_id): if helpticket_id not in data['helptickets']: message = "No help ticket with ID: {}".format(helpticket_id) abort(404, message=message) # Filter and sort a list of helptickets. def filter_and_sort_helptickets(query='', sort_by='time'): # Returns True if the query string appears in the help ticket's # title or description. def matches_query(item): (helpticket_id, helpticket) = item text = helpticket['title'] + helpticket['description'] return query.lower() in text # Returns the help ticket's value for the sort property (which by # default is the "time" property). def get_sort_value(item): (helpticket_id, helpticket) = item return helpticket[sort_by] filtered_helptickets = filter(matches_query, data['helptickets'].items()) return sorted(filtered_helptickets, key=get_sort_value, reverse=True) # Now we define three incoming HTTP request parsers using the Flask-RESTful # framework <https://flask-restful.readthedocs.io/en/latest/reqparse.html>. # # The first (new_helpticket_parser) parses incoming POST requests and checks # that they have the required values. # # The second (update_helpticket_parser) parses incoming PATCH requests and # checks that they have the required values. # # The third (query_parser) parses incoming GET requests to get the parameters # for sorting and filtering the list of help tickets. # Helper function new_helpticket_parser. Raises an error if the string x # is empty (has zero length). def nonempty_string(x): s = str(x) if len(x) == 0: raise ValueError('string is empty') return s # Specify the data necessary to create a new help ticket. # "from", "title", and "description" are all required values. new_helpticket_parser = reqparse.RequestParser() for arg in ['from', 'title', 'description']: new_helpticket_parser.add_argument( arg, type=nonempty_string, required=True, help="'{}' is a required value".format(arg)) # Specify the data necessary to update an existing help ticket. # Only the priority and comments can be updated. update_helpticket_parser = reqparse.RequestParser() update_helpticket_parser.add_argument( 'priority', type=int, default=PRIORITIES.index('normal')) update_helpticket_parser.add_argument( 'comment', type=str, default='') # Specify the parameters for filtering and sorting help tickets. # See `filter_and_sort_helptickets` above. query_parser = reqparse.RequestParser() query_parser.add_argument( 'query', type=str, default='') query_parser.add_argument( 'sort_by', type=str, choices=('priority', 'time'), default='time') # Then we define a couple of helper functions for inserting data into HTML # templates (found in the templates/ directory). See # <http://flask.pocoo.org/docs/latest/quickstart/#rendering-templates>. # Given the data for a help ticket, generate an HTML representation # of that help ticket. def render_helpticket_as_html(helpticket): return render_template( 'helpticket+microdata+rdfa.html', helpticket=helpticket, priorities=reversed(list(enumerate(PRIORITIES)))) # Given the data for a list of help tickets, generate an HTML representation # of that list. def render_helpticket_list_as_html(helptickets): return render_template( 'helptickets+microdata+rdfa.html', helptickets=helptickets, priorities=PRIORITIES) # Now we can start defining our resource classes. We define four classes: # HelpTicket, HelpTicketAsJSON, HelpTicketList, and HelpTicketListAsJSON. # All of them accept GET requests. HelpTicket also accepts PATCH requests, # and HelpTicketList also accepts POST requests. # Define our help ticket resource. class HelpTicket(Resource): # If a help ticket with the specified ID does not exist, # respond with a 404, otherwise respond with an HTML representation. def get(self, helpticket_id): error_if_helpticket_not_found(helpticket_id) return make_response( render_helpticket_as_html( data['helptickets'][helpticket_id]), 200) # If a help ticket with the specified ID does not exist, # respond with a 404, otherwise update the help ticket and respond # with the updated HTML representation. def patch(self, helpticket_id): error_if_helpticket_not_found(helpticket_id) helpticket = data['helptickets'][helpticket_id] update = update_helpticket_parser.parse_args() helpticket['priority'] = update['priority'] if len(update['comment'].strip()) > 0: helpticket.setdefault('comments', []).append(update['comment']) return make_response( render_helpticket_as_html(helpticket), 200) # Define a resource for getting a JSON representation of a help ticket. class HelpTicketAsJSON(Resource): # If a help ticket with the specified ID does not exist, # respond with a 404, otherwise respond with a JSON representation. def get(self, helpticket_id): error_if_helpticket_not_found(helpticket_id) helpticket = data['helptickets'][helpticket_id] helpticket['@context'] = data['@context'] return helpticket # Define our help ticket list resource. class HelpTicketList(Resource): # Respond with an HTML representation of the help ticket list, after # applying any filtering and sorting parameters. def get(self): query = query_parser.parse_args() return make_response( render_helpticket_list_as_html( filter_and_sort_helptickets(**query)), 200) # Add a new help ticket to the list, and respond with an HTML # representation of the updated list. def post(self): helpticket = new_helpticket_parser.parse_args() helpticket_id = generate_id() helpticket['@id'] = 'request/' + helpticket_id helpticket['@type'] = 'helpdesk:HelpTicket' helpticket['time'] = datetime.isoformat(datetime.now()) helpticket['priority'] = PRIORITIES.index('normal') data['helptickets'][helpticket_id] = helpticket return make_response( render_helpticket_list_as_html( filter_and_sort_helptickets()), 201) # Define a resource for getting a JSON representation of the help ticket list. class HelpTicketListAsJSON(Resource): def get(self): return data # After defining our resource classes, we define how URLs are assigned to # resources by mapping resource classes to URL patterns. app = Flask(__name__) api = Api(app) api.add_resource(HelpTicketList, '/tickets') api.add_resource(HelpTicketListAsJSON, '/tickets.json') api.add_resource(HelpTicket, '/ticket/<string:helpticket_id>') api.add_resource(HelpTicketAsJSON, '/ticket/<string:helpticket_id>.json') # There is no resource mapped to the root path (/), so if a request comes in # for that, redirect to the HelpTicketList resource. @app.route('/') def index(): return redirect(api.url_for(HelpTicketList), code=303) # Finally we add some headers to all of our HTTP responses which will allow # JavaScript loaded from other domains and running in the browser to load # representations of our resources (for security reasons, this is disabled # by default. @app.after_request def after_request(response): response.headers.add( 'Access-Control-Allow-Origin', '*') response.headers.add( 'Access-Control-Allow-Headers', 'Content-Type,Authorization') response.headers.add( 'Access-Control-Allow-Methods', 'GET,PUT,POST,DELETE') return response # Now we can start the server. if __name__ == '__main__': app.run( host='0.0.0.0', port=5555, debug=True, use_debugger=False, use_reloader=False)
import socket import struct import sys import time import threading from Queue import Queue from msgpack import ( packb as packs, unpackb as unpacks ) __all__ = ['Agent'] class Agent(object): """ Validate and package the metrics for graphdat """ # if the queue gets larger than this, stop adding metrics instead of blocking MAX_QUEUE_SIZE = 100 # The queue will hold all of the messages to be sent to graphdat _queue = Queue() # The background worker push the data to graphdat _backgroundWorker = None def __init__(self, graphdat): if graphdat is None: raise TypeError( "the graphdat parameter should not be None") self.graphdat = graphdat self.log = self.graphdat.log # create the background worker thread if it is not running already if not self._backgroundWorker or not self._backgroundWorker.isAlive(): self._backgroundWorker = _SendToGraphdat(self.graphdat, self._queue) self._backgroundWorker.daemon = True self._backgroundWorker.start() def add(self, metrics): """ Add metrics to your graphdat dashboard """ # if we have no data, no worries, continue on if metrics is None: return # if its a string, we cant do anything with it and we shouldnt # be getting it in the first place, something is probably wrong if isinstance(metrics, str): raise TypeError( "the metrics should not be a string value") # if its a single metric, just wrap it if not hasattr(metrics, "__iter__"): metrics = (metrics) for metric in metrics: # Only HTTP metrics are supported if metric.source != 'HTTP': continue if not metric.route: self.log("graphdat could not get a the route from the trace") continue # send the metric to the queue as long as we have room if self._queue.qsize() < self.MAX_QUEUE_SIZE: self._queue.put(metric) class _SendToGraphdat(threading.Thread): """ Create a separate thread to pull from the queue and send the messages to graphdat. """ # The heartbeat worker keeps the file socket open _heartbeatWorker = None def __init__(self, graphdat, queue): threading.Thread.__init__(self) # the graphdat instance and logger if graphdat is None: raise TypeError( "the graphdat parameter should not be None") self.graphdat = graphdat self.dump = graphdat.dump self.error = graphdat.error self.log = graphdat.log # the queue to pull the messages from if queue is None: raise TypeError( "the queue parameter should not be None") self.queue = queue # keep track of the last time we sent the data or a heartbeart self.lastSentData = time.time() # how we talk to the graphdat agent if hasattr(self.graphdat, "socketFile"): self.transport = _FileSocket(self.graphdat) else: self.transport = _UDPSocket(self.graphdat) # if the transport requires a heartbeat, start it if hasattr(self.transport, 'heartbeatInterval'): if not self._heartbeatWorker or not self._heartbeatWorker.isAlive(): self._heartbeatWorker = _SendHeartbeat(self.graphdat, self, self.transport) self._heartbeatWorker.daemon = True self._heartbeatWorker.start() def run(self): while True: # grab the next message message = self.queue.get(block=True) # we have a message to send, the heart beat # can take a break self.lastSentData = time.time() # msgpack it message = packs(message) # send the message success = self.transport.send(message) # tell the queue we are done self.queue.task_done() if (success): self.log("Message sent") self.dump(unpacks(message, use_list=True)) else: self.error("Sending metrics to Graphdat failed") class _SendHeartbeat(threading.Thread): """ Create a separate thread to send a heartbeat to keep the connection open """ def __init__(self, graphdat, sender, transport): threading.Thread.__init__(self) self.sender = sender self.transport = transport def run(self): while True: time.sleep(self.transport.heartbeatInterval) now = time.time() elapsed = now - self.sender.lastSentData if elapsed > self.transport.heartbeatInterval: self.transport.sendHeartbeat() self.sender.lastSentData = now class _FileSocket(object): """ Use a File socket to talk to the Graphdat Agent """ # the interval we should send heart beats to the file socket HEARTBEAT_INTERVAL = 30 # How many attempts do we use to send to the file socket. SEND_ATTEMPTS = 3 def __init__(self, graphdat, heartbeatInterval=HEARTBEAT_INTERVAL, sendAttempts=SEND_ATTEMPTS): self.error = graphdat.error self.log = graphdat.log # the location of the file socket self.socketFile = graphdat.socketFile # the file socket needs a hearbeat to stay open self.heartbeatInterval = heartbeatInterval # How many attempts do we use to send to the file socket. self.sendAttempts = sendAttempts # the file socket self.sock = None self.isOpen = False def __del__(self): self._disconnect() def send(self, message): """ Send the metrics to graphdat """ sent = False length = len(message) header = struct.pack(">i", length) for i in range(self.sendAttempts): # open the socket if we are not connected if not self.isOpen: self._connect() # if we are still not open, close the socket and try again if not self.isOpen: self._disconnect() continue try: # we send the header first, it tells the agent how long # the message we are sending is headerSent = self.sock.send(header) # was the header received, if not raise the error and try again if headerSent != len(header): raise IOError("Socket connection was broken when sending message header") # empty messages are used as a heartbeat to keep the socket connection open # we only need to send the header if length == 0: sent = True break # send the message totalSent = 0 while totalSent < length: sent = self.sock.send(message[totalSent:]) if sent == 0: raise IOError("Socket connection was broken while sending message") totalSent += sent # success! sent = (totalSent == length) break except IOError, msg: self.error("socket error") self.error(msg) self._disconnect() except Exception, msg: self.error("Unexpected error") self.error(msg) self._disconnect() return sent def sendHeartbeat(self): """ Send a heart beat to the socket to let the agent know we are alive """ # just send an empty message self.send("") def _connect(self): try: self.log("opening socket " + self.socketFile) self.sock = socket.socket(socket.AF_UNIX, socket.SOCK_STREAM) self.sock.settimeout(3) self.sock.connect(self.socketFile) self.isOpen = True except Exception, msg: self.error(msg) self.isOpen = False def _disconnect(self): try: self.log("closing socket %s" % self.socketFile) self.sock.close() self.sock = None except Exception, msg: self.error(msg) self.isOpen = False class _UDPSocket(object): """ Use a UDP socket to talk to the Graphdat Agent """ def __init__(self, graphdat): self.error = graphdat.error self.host = graphdat.socketHost self.port = graphdat.socketPort self.sock = None def send(self, message): """ Send the metrics to graphdat """ try: self.sock = socket.socket(socket.AF_INET, socket.SOCK_DGRAM) self.sock.sendto(message, (self.host, self.port)) return True except: self.error("Unexpected error:", sys.exc_info()[0]) return False
# Copyright (c) 2010 Stephen Paul Weber. Based on work by Joao Prado Maia. # Licensed under the ISC License import MySQLdb import time from mimify import mime_encode_header, mime_decode_header import re import settings import mime import strutil import os.path try: import html2text except ImportError: html2text = None # Optional, GPL # patch by Andreas Wegmann <Andreas.Wegmann@VSA.de> to fix the handling of unusual encodings of messages q_quote_multiline = re.compile("=\?(.*?)\?[qQ]\?(.*?)\?=.*?=\?\\1\?[qQ]\?(.*?)\?=", re.M | re.S) # we don't need to compile the regexps everytime.. doubleline_regexp = re.compile("^\.\.", re.M) singleline_regexp = re.compile("^\.", re.M) from_regexp = re.compile("^From:(.*)<(.*)>", re.M) subject_regexp = re.compile("^Subject:(.*)", re.M) references_regexp = re.compile("^References:(.*)<(.*)>", re.M) lines_regexp = re.compile("^Lines:(.*)", re.M) class Papercut_Storage: """ Storage Backend interface for the Wordpress blog software This is the interface for Wordpress running on a MySQL database. For more information on the structure of the 'storage' package, please refer to the __init__.py available on the 'storage' sub-directory. """ def __init__(self): self.conn = MySQLdb.connect(host=settings.dbhost, db=settings.dbname, user=settings.dbuser, passwd=settings.dbpass, charset='utf8', use_unicode=True) self.cursor = self.conn.cursor() self.cursor.execute("""CREATE TABLE IF NOT EXISTS wp_newsgroup_meta( article_number BIGINT UNSIGNED NOT NULL AUTO_INCREMENT PRIMARY KEY, message_id CHAR(255) UNIQUE NOT NULL, id BIGINT NOT NULL, tbl CHAR(50), newsgroup CHAR(255), CONSTRAINT UNIQUE INDEX id_table (id, tbl), INDEX newsgroup (newsgroup) )""") self.update_newsgroup_meta() def get_message_body(self, headers): """Parses and returns the most appropriate message body possible. The function tries to extract the plaintext version of a MIME based message, and if it is not available then it returns the html version. """ return mime.get_text_message(headers) def quote_string(self, text): """Quotes strings the MySQL way.""" return text.replace("'", "\\'") def group_exists(self, group_name): return (group_name == 'blog.singpolyma') # TODO def update_newsgroup_meta(self): group = 'blog.singpolyma' # TODO meta_table = self.get_table_name(table_name='newsgroup_meta') posts_table = self.get_table_name(table_name='posts') comments_table = self.get_table_name(table_name='comments') stmt = """ INSERT INTO wp_newsgroup_meta (id, tbl, message_id, newsgroup) SELECT ID, tbl, message_id, '%s' FROM ( (SELECT a.ID, 'wp_posts' AS tbl, CONCAT('<post-', a.ID, '@%s>') AS message_id, post_date_gmt AS datestamp FROM wp_posts a LEFT JOIN wp_newsgroup_meta b ON a.ID=b.id AND b.tbl='wp_posts' WHERE isNULL(b.id) AND post_type='post' AND post_status='publish' ) UNION ( SELECT comment_ID as ID, 'wp_comments' AS tbl, CONCAT('<comment-', comment_ID, '@%s>') AS message_id, comment_date_gmt AS datestamp FROM wp_posts c, wp_comments a LEFT JOIN wp_newsgroup_meta b ON comment_ID=b.id AND b.tbl='wp_comments' WHERE a.comment_post_ID=c.ID AND isNULL(b.id) AND comment_approved='1' AND post_type='post' AND post_status='publish' ) ORDER BY datestamp) t """.replace('wp_posts', posts_table).replace('wp_comments', comments_table).replace('wp_newsgroup_meta', meta_table) % (group, settings.nntp_hostname, settings.nntp_hostname) self.cursor.execute(stmt) def article_exists(self, group_name, style, range): self.update_newsgroup_meta() table_name = self.get_table_name(table_name='newsgroup_meta') stmt = """ SELECT COUNT(*) AS total FROM %s WHERE newsgroup='%s' AND """ % (table_name, group_name) if style == 'range': stmt = "%s AND article_number > %s" % (stmt, range[0]) if len(range) == 2: stmt = "%s AND article_number < %s" % (stmt, range[1]) else: stmt = "%s AND article_number = %s" % (stmt, range[0]) self.cursor.execute(stmt) return self.cursor.fetchone()[0] def get_first_article(self, group_name): self.update_newsgroup_meta() table_name = self.get_table_name(table_name='newsgroup_meta') stmt = """ SELECT IF(MIN(message_num) IS NULL, 0, MIN(message_num)) AS first_article FROM %s WHERE newsgroup='%s'""" % (table_name, group_name) num_rows = self.cursor.execute(stmt) return self.cursor.fetchone()[0] def get_group_stats(self, group_name): self.update_newsgroup_meta() table_name = self.get_table_name(table_name='newsgroup_meta') stmt = """ SELECT COUNT(article_number) AS total, IF(MAX(article_number) IS NULL, 0, MAX(article_number)) AS maximum, IF(MIN(article_number) IS NULL, 0, MIN(article_number)) AS minimum FROM %s WHERE newsgroup='%s'""" % (table_name, group_name) self.cursor.execute(stmt) total, maxi, mini = self.cursor.fetchone() return (total, mini, maxi, group_name) def get_table_name(self, group_name=None, table_name=None): if not table_name: table_name = 'posts' return 'wp_' + table_name # TODO def get_message_id(self, msg_num, group, table=None): table_name = self.get_table_name(table_name='newsgroup_meta') compar = table and 'id' or 'article_number' stmt = """ SELECT message_id FROM %s WHERE newsgroup='%s' AND %s=%s """ % (table_name, group, compar, int(msg_num)) if table: stmt += " AND tbl='%s'" % self.get_table_name(table_name=table) self.cursor.execute(stmt) return self.cursor.fetchone()[0] def get_article_sql(self): meta_table = self.get_table_name(table_name='newsgroup_meta') posts_table = self.get_table_name(table_name='posts') comments_table = self.get_table_name(table_name='comments') stmt = """ SELECT M.article_number,S.*,M.message_id FROM ( (SELECT A.ID as ID, display_name, user_email, post_title, UNIX_TIMESTAMP(post_date_gmt) AS datestamp, post_content, post_parent, 0 AS comment_parent FROM wp_posts A, wp_users WHERE A.post_type='post' AND A.post_status='publish' AND A.post_author=wp_users.ID ) UNION ( SELECT comment_ID AS ID, IF(user_id = 0, comment_author, display_name) as display_name, IF(user_id = 0, comment_author_email, user_email) as user_email, CONCAT('Re: ', post_title) as post_title, UNIX_TIMESTAMP(comment_date_gmt) AS datestamp, comment_content AS post_content, comment_post_ID AS post_parent, comment_parent FROM wp_comments A LEFT OUTER JOIN wp_users ON user_id=wp_users.ID, wp_posts WHERE comment_post_ID=wp_posts.ID AND comment_approved='1' AND wp_posts.post_type='post' AND wp_posts.post_status='publish' ) ) S, wp_newsgroup_meta M WHERE M.id=S.ID """.replace('wp_posts', posts_table).replace('wp_comments', comments_table).replace('wp_newsgroup_meta', meta_table) return stmt def get_NEWGROUPS(self, ts, group='%'): return None # TODO def get_NEWNEWS(self, ts, group='*'): self.update_newsgroup_meta() group = 'blog.singpolyma' # TODO meta_table = self.get_table_name(table_name='newsgroup_meta') posts_table = self.get_table_name(table_name='posts') comments_table = self.get_table_name(table_name='comments') ts = int(time.mktime(ts)) stmt = """ (SELECT article_number FROM wp_posts, wp_newsgroup_meta WHERE wp_posts.ID=wp_newsgroup_meta.id AND wp_newsgroup_meta.tbl='wp_posts' AND post_type='post' AND post_status='publish' AND UNIX_TIMESTAMP(post_date_gmt) >= %s ) UNION ( SELECT article_number FROM wp_comments, wp_posts, wp_newsgroup_meta WHERE comment_ID=wp_newsgroup_meta.id AND wp_newsgroup_meta.tbl='wp_comments' AND comment_post_ID=wp_posts.ID AND post_type='post' AND post_status='publish' AND comment_approved = '1' AND UNIX_TIMESTAMP(comment_date_gmt) >= %s ) ORDER BY article_number ASC""" % (ts, ts) stmt = stmt.replace('wp_posts', posts_table).replace('wp_comments', comments_table).replace('wp_newsgroup_meta', meta_table) self.cursor.execute(stmt) result = list(self.cursor.fetchall()) return "\r\n".join(["%s" % k for k in result]) def get_GROUP(self, group_name): stats = self.get_group_stats(group_name) return (stats[0], stats[1], stats[2]) def get_LIST(self, username=""): lists = [] stats = self.get_group_stats('blog.singpolyma') lists.append("%s %s %s y" % ('blog.singpolyma', stats[2], stats[1])) # TODO return "\r\n".join(lists) def get_STAT(self, group_name, id): meta_table = self.get_table_name(table_name='newsgroup_meta') stmt = """ SELECT article_number FROM %s WHERE newsgroup='%s' AND article_number=%s""" % (meta_table, group_name, id) return self.cursor.execute(stmt) def get_ARTICLE(self, group_name, id, headers_only=False, body_only=False): stmt = self.get_article_sql() if str(id).count('<') > 0 or str(id).count('@') > 0: id = self.quote_string(id) stmt += " AND message_id='%s'" % (id,) else: id = int(id) stmt += " AND article_number=%s" % (id,) num_rows = self.cursor.execute(stmt) if num_rows == 0: return None result = list(self.cursor.fetchone()) if not body_only: if len(result[3]) == 0: author = result[2] else: author = "%s <%s>" % (result[2], result[3]) formatted_time = strutil.get_formatted_time(time.localtime(result[5])) headers = [] headers.append("Path: %s" % (settings.nntp_hostname)) headers.append("From: %s" % (author)) headers.append("Newsgroups: %s" % (group_name)) headers.append("Date: %s" % (formatted_time)) headers.append("Subject: %s" % (result[4])) headers.append("Message-ID: %s" % (result[9])) headers.append("Xref: %s %s:%s" % (settings.nntp_hostname, group_name, result[0])) parent = [] if result[7] != 0: parent.append(self.get_message_id(result[7], group_name, 'posts')) if result[8] != 0: parent.append(self.get_message_id(result[8], group_name, 'comments')) if len(parent) > 0: headers.append("References: " + ', '.join(parent)) headers.append("In-Reply-To: " + parent.pop()) headers.append('Content-Type: text/plain; charset=utf-8') if headers_only: return "\r\n".join(headers) if html2text: body = html2text.html2text(result[6].encode('utf-8').replace("\r\n", "\n").replace("\r", "\n").replace("\n\n", "</p><p>")).encode('utf-8') else: body = strutil.format_body(result[6].encode('utf-8')) if body_only: return body return ("\r\n".join(headers).encode('utf-8'), body) def get_LAST(self, group_name, current_id): meta_table = self.get_table_name(table_name='newsgroup_meta') stmt = """ SELECT article_number FROM %s WHERE newsgroup='%s' AND article_number < %s ORDER BY ID DESC LIMIT 0, 1 """ % (meta_table, group_name, current_id) num_rows = self.cursor.execute(stmt) if num_rows == 0: return None return self.cursor.fetchone()[0] def get_NEXT(self, group_name, current_id): meta_table = self.get_table_name(table_name='newsgroup_meta') stmt = """ SELECT article_number FROM %s WHERE newsgroup='%s' AND article_number > %s ORDER BY ID ASC LIMIT 0, 1 """ % (meta_table, group_name, current_id) num_rows = self.cursor.execute(stmt) if num_rows == 0: return None return self.cursor.fetchone()[0] def get_HEAD(self, group_name, id): return self.get_ARTICLE(group_name, id, headers_only=True) def get_BODY(self, group_name, id): return self.get_ARTICLE(group_name, id, body_only=True) def get_XOVER(self, group_name, start_id, end_id='ggg'): self.update_newsgroup_meta() stmt = self.get_article_sql() stmt += " AND article_number >= %s" % (start_id,) if end_id != 'ggg': stmt += " AND article_number <= %s" % (end_id,) self.cursor.execute(stmt) result = list(self.cursor.fetchall()) overviews = [] for row in result: if html2text: body = html2text.html2text(row[6].encode('utf-8')).encode('utf-8') else: body = strutil.format_body(row[6].encode('utf-8')) if row[3] == '': author = row[2] else: author = "%s <%s>" % (row[2], row[3]) formatted_time = strutil.get_formatted_time(time.localtime(row[5])) message_id = row[9] line_count = body.count("\n") xref = 'Xref: %s %s:%s' % (settings.nntp_hostname, group_name, row[0]) parent = [] if row[7] != 0: parent.append(self.get_message_id(row[7], group_name, 'posts')) if row[8] != 0: parent.append(self.get_message_id(row[8], group_name, 'comments')) reference = ', '.join(parent) # message_number <tab> subject <tab> author <tab> date <tab> message_id <tab> reference <tab> bytes <tab> lines <tab> xref overviews.append("%s\t%s\t%s\t%s\t%s\t%s\t%s\t%s\t%s" % (row[0], row[4], author, formatted_time, message_id, reference, len(body), line_count, xref)) return "\r\n".join(overviews) def get_XPAT(self, group_name, header, pattern, start_id, end_id='ggg'): return None # TODO: really broken # XXX: need to actually check for the header values being passed as # XXX: not all header names map to column names on the tables table_name = self.get_table_name(group_name) stmt = """ SELECT A.ID, post_parent, display_name, user_email, post_title, UNIX_TIMESTAMP(post_date_gmt) AS datestamp, post_content FROM %s A, wp_users WHERE A.post_type='post' AND A.post_status='publish' AND %s REGEXP '%s' AND post_author = wp_users.ID AND A.ID >= %s""" % (table_name, header, strutil.format_wildcards(pattern), start_id) if end_id != 'ggg': stmt = "%s AND A.id <= %s" % (stmt, end_id) num_rows = self.cursor.execute(stmt) if num_rows == 0: return None result = list(self.cursor.fetchall()) hdrs = [] for row in result: if header.upper() == 'SUBJECT': hdrs.append('%s %s' % (row[0], row[4])) elif header.upper() == 'FROM': # XXX: totally broken with empty values for the email address hdrs.append('%s %s <%s>' % (row[0], row[2], row[3])) elif header.upper() == 'DATE': hdrs.append('%s %s' % (row[0], strutil.get_formatted_time(time.localtime(result[5])))) elif header.upper() == 'MESSAGE-ID': hdrs.append(row[0] + ' ' + self.get_message_id(row[0], group_name)) elif (header.upper() == 'REFERENCES') and (row[1] != 0): hdrs.append(row[0] + ' ' + self.message_id(row[1], group_name)) elif header.upper() == 'BYTES': hdrs.append('%s %s' % (row[0], len(row[6]))) elif header.upper() == 'LINES': hdrs.append('%s %s' % (row[0], len(row[6].split('\n')))) elif header.upper() == 'XREF': hdrs.append('%s %s %s:%s' % (row[0], settings.nntp_hostname, group_name, row[0])) if len(hdrs) == 0: return "" else: return "\r\n".join(hdrs) def get_LISTGROUP(self, group_name): self.update_newsgroup_meta() meta_table = self.get_table_name(table_name='newsgroup_meta') stmt = """ SELECT article_number FROM %s WHERE newsgroup='%s' """ % (meta_table, group_name) self.cursor.execute(stmt) result = list(self.cursor.fetchall()) return "\r\n".join(["%s" % k for k in result]) def get_XGTITLE(self, pattern=None): return "blog.singpolyma Singpolyma" # TODO def get_XHDR(self, group_name, header, style, range): self.update_newsgroup_meta() stmt = self.get_article_sql() if style == 'range': stmt += ' AND article_number >= %s' % (range[0],) if len(range) == 2: stmt += ' AND article_number <= %s' % (range[1]) else: stmt += ' AND article_number = %s' % (range[0],) if self.cursor.execute(stmt) == 0: return None result = self.cursor.fetchall() hdrs = [] for row in result: parent = [] if row[7] != 0: parent.append(self.get_message_id(row[7], group_name, 'posts')) if row[8] != 0: parent.append(self.get_message_id(row[8], group_name, 'comments')) if header.upper() == 'SUBJECT': hdrs.append('%s %s' % (row[0], row[4])) elif header.upper() == 'FROM': hdrs.append('%s %s <%s>' % (row[0], row[2], row[3])) elif header.upper() == 'DATE': hdrs.append('%s %s' % (row[0], strutil.get_formatted_time(time.localtime(result[5])))) elif header.upper() == 'MESSAGE-ID': hdrs.append(row[0] + ' ' + row[9]) elif (header.upper() == 'REFERENCES') and len(parent) > 0: hdrs.append('%s %s' % (row[0], ', '.join(parent))) elif header.upper() == 'BYTES': hdrs.append('%s %s' % (row[0], len(row[6]))) elif header.upper() == 'LINES': hdrs.append('%s %s' % (row[0], len(row[6].split('\n')))) elif header.upper() == 'XREF': hdrs.append('%s %s %s:%s' % (row[0], settings.nntp_hostname, group_name, row[0])) if len(hdrs) == 0: return "" else: return "\r\n".join(hdrs) def do_POST(self, group_name, lines, ip_address, username=''): return None # TODO, below code from other engine, just for reference table_name = self.get_table_name(group_name) body = self.get_message_body(lines) author, email = from_regexp.search(lines, 0).groups() subject = subject_regexp.search(lines, 0).groups()[0].strip() # patch by Andreas Wegmann <Andreas.Wegmann@VSA.de> to fix the handling of unusual encodings of messages lines = mime_decode_header(re.sub(q_quote_multiline, "=?\\1?Q?\\2\\3?=", lines)) if lines.find('References') != -1: # get the 'modifystamp' value from the parent (if any) references = references_regexp.search(lines, 0).groups() parent_id, void = references[-1].strip().split('@') stmt = """ SELECT IF(MAX(id) IS NULL, 1, MAX(id)+1) AS next_id FROM %s""" % (table_name) num_rows = self.cursor.execute(stmt) if num_rows == 0: new_id = 1 else: new_id = self.cursor.fetchone()[0] stmt = """ SELECT id, thread, modifystamp FROM %s WHERE approved='Y' AND id=%s GROUP BY id""" % (table_name, parent_id) num_rows = self.cursor.execute(stmt) if num_rows == 0: return None parent_id, thread_id, modifystamp = self.cursor.fetchone() else: stmt = """ SELECT IF(MAX(id) IS NULL, 1, MAX(id)+1) AS next_id, UNIX_TIMESTAMP() FROM %s""" % (table_name) self.cursor.execute(stmt) new_id, modifystamp = self.cursor.fetchone() parent_id = 0 thread_id = new_id stmt = """ INSERT INTO %s ( id, datestamp, thread, parent, author, subject, email, host, email_reply, approved, msgid, modifystamp, userid ) VALUES ( %s, NOW(), %s, %s, '%s', '%s', '%s', '%s', 'N', 'Y', '', %s, 0 ) """ % (table_name, new_id, thread_id, parent_id, self.quote_string(author.strip()), self.quote_string(subject), self.quote_string(email), ip_address, modifystamp) if not self.cursor.execute(stmt): return None else: # insert into the '*_bodies' table stmt = """ INSERT INTO %s_bodies ( id, body, thread ) VALUES ( %s, '%s', %s )""" % (table_name, new_id, self.quote_string(body), thread_id) if not self.cursor.execute(stmt): # delete from 'table_name' before returning.. stmt = """ DELETE FROM %s WHERE id=%s""" % (table_name, new_id) self.cursor.execute(stmt) return None else: # alert forum moderators self.send_notifications(group_name, new_id, thread_id, parent_id, author.strip(), email, subject, body) return 1
"""Support for Z-Wave climate devices.""" # Because we do not compile openzwave on CI import logging from typing import Optional, Tuple from homeassistant.components.climate import ClimateDevice from homeassistant.components.climate.const import ( ATTR_TARGET_TEMP_HIGH, ATTR_TARGET_TEMP_LOW, CURRENT_HVAC_COOL, CURRENT_HVAC_FAN, CURRENT_HVAC_HEAT, CURRENT_HVAC_IDLE, CURRENT_HVAC_OFF, DOMAIN, HVAC_MODE_AUTO, HVAC_MODE_COOL, HVAC_MODE_DRY, HVAC_MODE_FAN_ONLY, HVAC_MODE_HEAT, HVAC_MODE_HEAT_COOL, HVAC_MODE_OFF, PRESET_AWAY, PRESET_BOOST, PRESET_NONE, SUPPORT_AUX_HEAT, SUPPORT_FAN_MODE, SUPPORT_PRESET_MODE, SUPPORT_SWING_MODE, SUPPORT_TARGET_TEMPERATURE, SUPPORT_TARGET_TEMPERATURE_RANGE, ) from homeassistant.const import ATTR_TEMPERATURE, TEMP_CELSIUS, TEMP_FAHRENHEIT from homeassistant.core import callback from homeassistant.helpers.dispatcher import async_dispatcher_connect from . import ZWaveDeviceEntity, const _LOGGER = logging.getLogger(__name__) CONF_NAME = "name" DEFAULT_NAME = "Z-Wave Climate" REMOTEC = 0x5254 REMOTEC_ZXT_120 = 0x8377 REMOTEC_ZXT_120_THERMOSTAT = (REMOTEC, REMOTEC_ZXT_120) ATTR_OPERATING_STATE = "operating_state" ATTR_FAN_STATE = "fan_state" ATTR_FAN_ACTION = "fan_action" AUX_HEAT_ZWAVE_MODE = "Aux Heat" # Device is in manufacturer specific mode (e.g. setting the valve manually) PRESET_MANUFACTURER_SPECIFIC = "Manufacturer Specific" WORKAROUND_ZXT_120 = "zxt_120" DEVICE_MAPPINGS = {REMOTEC_ZXT_120_THERMOSTAT: WORKAROUND_ZXT_120} HVAC_STATE_MAPPINGS = { "off": HVAC_MODE_OFF, "heat": HVAC_MODE_HEAT, "heat mode": HVAC_MODE_HEAT, "heat (default)": HVAC_MODE_HEAT, "furnace": HVAC_MODE_HEAT, "fan only": HVAC_MODE_FAN_ONLY, "dry air": HVAC_MODE_DRY, "moist air": HVAC_MODE_DRY, "cool": HVAC_MODE_COOL, "heat_cool": HVAC_MODE_HEAT_COOL, "auto": HVAC_MODE_HEAT_COOL, "auto changeover": HVAC_MODE_HEAT_COOL, } MODE_SETPOINT_MAPPINGS = { "off": (), "heat": ("setpoint_heating",), "cool": ("setpoint_cooling",), "auto": ("setpoint_heating", "setpoint_cooling"), "aux heat": ("setpoint_heating",), "furnace": ("setpoint_furnace",), "dry air": ("setpoint_dry_air",), "moist air": ("setpoint_moist_air",), "auto changeover": ("setpoint_auto_changeover",), "heat econ": ("setpoint_eco_heating",), "cool econ": ("setpoint_eco_cooling",), "away": ("setpoint_away_heating", "setpoint_away_cooling"), "full power": ("setpoint_full_power",), # aliases found in xml configs "comfort": ("setpoint_heating",), "heat mode": ("setpoint_heating",), "heat (default)": ("setpoint_heating",), "dry floor": ("setpoint_dry_air",), "heat eco": ("setpoint_eco_heating",), "energy saving": ("setpoint_eco_heating",), "energy heat": ("setpoint_eco_heating",), "vacation": ("setpoint_away_heating", "setpoint_away_cooling"), # for tests "heat_cool": ("setpoint_heating", "setpoint_cooling"), } HVAC_CURRENT_MAPPINGS = { "idle": CURRENT_HVAC_IDLE, "heat": CURRENT_HVAC_HEAT, "pending heat": CURRENT_HVAC_IDLE, "heating": CURRENT_HVAC_HEAT, "cool": CURRENT_HVAC_COOL, "pending cool": CURRENT_HVAC_IDLE, "cooling": CURRENT_HVAC_COOL, "fan only": CURRENT_HVAC_FAN, "vent / economiser": CURRENT_HVAC_FAN, "off": CURRENT_HVAC_OFF, } PRESET_MAPPINGS = { "away": PRESET_AWAY, "full power": PRESET_BOOST, "manufacturer specific": PRESET_MANUFACTURER_SPECIFIC, } DEFAULT_HVAC_MODES = [ HVAC_MODE_HEAT_COOL, HVAC_MODE_HEAT, HVAC_MODE_COOL, HVAC_MODE_FAN_ONLY, HVAC_MODE_DRY, HVAC_MODE_OFF, HVAC_MODE_AUTO, ] async def async_setup_entry(hass, config_entry, async_add_entities): """Set up Z-Wave Climate device from Config Entry.""" @callback def async_add_climate(climate): """Add Z-Wave Climate Device.""" async_add_entities([climate]) async_dispatcher_connect(hass, "zwave_new_climate", async_add_climate) def get_device(hass, values, **kwargs): """Create Z-Wave entity device.""" temp_unit = hass.config.units.temperature_unit if values.primary.command_class == const.COMMAND_CLASS_THERMOSTAT_SETPOINT: return ZWaveClimateSingleSetpoint(values, temp_unit) if values.primary.command_class == const.COMMAND_CLASS_THERMOSTAT_MODE: return ZWaveClimateMultipleSetpoint(values, temp_unit) return None class ZWaveClimateBase(ZWaveDeviceEntity, ClimateDevice): """Representation of a Z-Wave Climate device.""" def __init__(self, values, temp_unit): """Initialize the Z-Wave climate device.""" ZWaveDeviceEntity.__init__(self, values, DOMAIN) self._target_temperature = None self._target_temperature_range = (None, None) self._current_temperature = None self._hvac_action = None self._hvac_list = None # [zwave_mode] self._hvac_mapping = None # {ha_mode:zwave_mode} self._hvac_mode = None # ha_mode self._aux_heat = None self._default_hvac_mode = None # ha_mode self._preset_mapping = None # {ha_mode:zwave_mode} self._preset_list = None # [zwave_mode] self._preset_mode = None # ha_mode if exists, else zwave_mode self._current_fan_mode = None self._fan_modes = None self._fan_action = None self._current_swing_mode = None self._swing_modes = None self._unit = temp_unit _LOGGER.debug("temp_unit is %s", self._unit) self._zxt_120 = None # Make sure that we have values for the key before converting to int if self.node.manufacturer_id.strip() and self.node.product_id.strip(): specific_sensor_key = ( int(self.node.manufacturer_id, 16), int(self.node.product_id, 16), ) if specific_sensor_key in DEVICE_MAPPINGS: if DEVICE_MAPPINGS[specific_sensor_key] == WORKAROUND_ZXT_120: _LOGGER.debug("Remotec ZXT-120 Zwave Thermostat workaround") self._zxt_120 = 1 self.update_properties() def _mode(self) -> None: """Return thermostat mode Z-Wave value.""" raise NotImplementedError() def _current_mode_setpoints(self) -> Tuple: """Return a tuple of current setpoint Z-Wave value(s).""" raise NotImplementedError() @property def supported_features(self): """Return the list of supported features.""" support = SUPPORT_TARGET_TEMPERATURE if self._hvac_list and HVAC_MODE_HEAT_COOL in self._hvac_list: support |= SUPPORT_TARGET_TEMPERATURE_RANGE if self._preset_list and PRESET_AWAY in self._preset_list: support |= SUPPORT_TARGET_TEMPERATURE_RANGE if self.values.fan_mode: support |= SUPPORT_FAN_MODE if self._zxt_120 == 1 and self.values.zxt_120_swing_mode: support |= SUPPORT_SWING_MODE if self._aux_heat: support |= SUPPORT_AUX_HEAT if self._preset_list: support |= SUPPORT_PRESET_MODE return support def update_properties(self): """Handle the data changes for node values.""" # Operation Mode self._update_operation_mode() # Current Temp self._update_current_temp() # Fan Mode self._update_fan_mode() # Swing mode self._update_swing_mode() # Set point self._update_target_temp() # Operating state self._update_operating_state() # Fan operating state self._update_fan_state() def _update_operation_mode(self): """Update hvac and preset modes.""" if self._mode(): self._hvac_list = [] self._hvac_mapping = {} self._preset_list = [] self._preset_mapping = {} mode_list = self._mode().data_items if mode_list: for mode in mode_list: ha_mode = HVAC_STATE_MAPPINGS.get(str(mode).lower()) ha_preset = PRESET_MAPPINGS.get(str(mode).lower()) if mode == AUX_HEAT_ZWAVE_MODE: # Aux Heat should not be included in any mapping self._aux_heat = True elif ha_mode and ha_mode not in self._hvac_mapping: self._hvac_mapping[ha_mode] = mode self._hvac_list.append(ha_mode) elif ha_preset and ha_preset not in self._preset_mapping: self._preset_mapping[ha_preset] = mode self._preset_list.append(ha_preset) else: # If nothing matches self._preset_list.append(mode) # Default operation mode for mode in DEFAULT_HVAC_MODES: if mode in self._hvac_mapping.keys(): self._default_hvac_mode = mode break if self._preset_list: # Presets are supported self._preset_list.append(PRESET_NONE) current_mode = self._mode().data _LOGGER.debug("current_mode=%s", current_mode) _hvac_temp = next( ( key for key, value in self._hvac_mapping.items() if value == current_mode ), None, ) if _hvac_temp is None: # The current mode is not a hvac mode if ( "heat" in current_mode.lower() and HVAC_MODE_HEAT in self._hvac_mapping.keys() ): # The current preset modes maps to HVAC_MODE_HEAT _LOGGER.debug("Mapped to HEAT") self._hvac_mode = HVAC_MODE_HEAT elif ( "cool" in current_mode.lower() and HVAC_MODE_COOL in self._hvac_mapping.keys() ): # The current preset modes maps to HVAC_MODE_COOL _LOGGER.debug("Mapped to COOL") self._hvac_mode = HVAC_MODE_COOL else: # The current preset modes maps to self._default_hvac_mode _LOGGER.debug("Mapped to DEFAULT") self._hvac_mode = self._default_hvac_mode self._preset_mode = next( ( key for key, value in self._preset_mapping.items() if value == current_mode ), current_mode, ) else: # The current mode is a hvac mode self._hvac_mode = _hvac_temp self._preset_mode = PRESET_NONE _LOGGER.debug("self._hvac_mapping=%s", self._hvac_mapping) _LOGGER.debug("self._hvac_list=%s", self._hvac_list) _LOGGER.debug("self._hvac_mode=%s", self._hvac_mode) _LOGGER.debug("self._default_hvac_mode=%s", self._default_hvac_mode) _LOGGER.debug("self._hvac_action=%s", self._hvac_action) _LOGGER.debug("self._aux_heat=%s", self._aux_heat) _LOGGER.debug("self._preset_mapping=%s", self._preset_mapping) _LOGGER.debug("self._preset_list=%s", self._preset_list) _LOGGER.debug("self._preset_mode=%s", self._preset_mode) def _update_current_temp(self): """Update current temperature.""" if self.values.temperature: self._current_temperature = self.values.temperature.data device_unit = self.values.temperature.units if device_unit is not None: self._unit = device_unit def _update_fan_mode(self): """Update fan mode.""" if self.values.fan_mode: self._current_fan_mode = self.values.fan_mode.data fan_modes = self.values.fan_mode.data_items if fan_modes: self._fan_modes = list(fan_modes) _LOGGER.debug("self._fan_modes=%s", self._fan_modes) _LOGGER.debug("self._current_fan_mode=%s", self._current_fan_mode) def _update_swing_mode(self): """Update swing mode.""" if self._zxt_120 == 1: if self.values.zxt_120_swing_mode: self._current_swing_mode = self.values.zxt_120_swing_mode.data swing_modes = self.values.zxt_120_swing_mode.data_items if swing_modes: self._swing_modes = list(swing_modes) _LOGGER.debug("self._swing_modes=%s", self._swing_modes) _LOGGER.debug("self._current_swing_mode=%s", self._current_swing_mode) def _update_target_temp(self): """Update target temperature.""" current_setpoints = self._current_mode_setpoints() self._target_temperature = None self._target_temperature_range = (None, None) if len(current_setpoints) == 1: (setpoint,) = current_setpoints if setpoint is not None: self._target_temperature = round((float(setpoint.data)), 1) elif len(current_setpoints) == 2: (setpoint_low, setpoint_high) = current_setpoints target_low, target_high = None, None if setpoint_low is not None: target_low = round((float(setpoint_low.data)), 1) if setpoint_high is not None: target_high = round((float(setpoint_high.data)), 1) self._target_temperature_range = (target_low, target_high) def _update_operating_state(self): """Update operating state.""" if self.values.operating_state: mode = self.values.operating_state.data self._hvac_action = HVAC_CURRENT_MAPPINGS.get(str(mode).lower(), mode) def _update_fan_state(self): """Update fan state.""" if self.values.fan_action: self._fan_action = self.values.fan_action.data @property def fan_mode(self): """Return the fan speed set.""" return self._current_fan_mode @property def fan_modes(self): """Return a list of available fan modes.""" return self._fan_modes @property def swing_mode(self): """Return the swing mode set.""" return self._current_swing_mode @property def swing_modes(self): """Return a list of available swing modes.""" return self._swing_modes @property def temperature_unit(self): """Return the unit of measurement.""" if self._unit == "C": return TEMP_CELSIUS if self._unit == "F": return TEMP_FAHRENHEIT return self._unit @property def current_temperature(self): """Return the current temperature.""" return self._current_temperature @property def hvac_mode(self): """Return hvac operation ie. heat, cool mode. Need to be one of HVAC_MODE_*. """ if self._mode(): return self._hvac_mode return self._default_hvac_mode @property def hvac_modes(self): """Return the list of available hvac operation modes. Need to be a subset of HVAC_MODES. """ if self._mode(): return self._hvac_list return [] @property def hvac_action(self): """Return the current running hvac operation if supported. Need to be one of CURRENT_HVAC_*. """ return self._hvac_action @property def is_aux_heat(self): """Return true if aux heater.""" if not self._aux_heat: return None if self._mode().data == AUX_HEAT_ZWAVE_MODE: return True return False @property def preset_mode(self): """Return preset operation ie. eco, away. Need to be one of PRESET_*. """ if self._mode(): return self._preset_mode return PRESET_NONE @property def preset_modes(self): """Return the list of available preset operation modes. Need to be a subset of PRESET_MODES. """ if self._mode(): return self._preset_list return [] @property def target_temperature(self): """Return the temperature we try to reach.""" return self._target_temperature @property def target_temperature_low(self) -> Optional[float]: """Return the lowbound target temperature we try to reach.""" return self._target_temperature_range[0] @property def target_temperature_high(self) -> Optional[float]: """Return the highbound target temperature we try to reach.""" return self._target_temperature_range[1] def set_temperature(self, **kwargs): """Set new target temperature.""" current_setpoints = self._current_mode_setpoints() if len(current_setpoints) == 1: (setpoint,) = current_setpoints target_temp = kwargs.get(ATTR_TEMPERATURE) if setpoint is not None and target_temp is not None: _LOGGER.debug("Set temperature to %s", target_temp) setpoint.data = target_temp elif len(current_setpoints) == 2: (setpoint_low, setpoint_high) = current_setpoints target_temp_low = kwargs.get(ATTR_TARGET_TEMP_LOW) target_temp_high = kwargs.get(ATTR_TARGET_TEMP_HIGH) if setpoint_low is not None and target_temp_low is not None: _LOGGER.debug("Set low temperature to %s", target_temp_low) setpoint_low.data = target_temp_low if setpoint_high is not None and target_temp_high is not None: _LOGGER.debug("Set high temperature to %s", target_temp_high) setpoint_high.data = target_temp_high def set_fan_mode(self, fan_mode): """Set new target fan mode.""" _LOGGER.debug("Set fan mode to %s", fan_mode) if not self.values.fan_mode: return self.values.fan_mode.data = fan_mode def set_hvac_mode(self, hvac_mode): """Set new target hvac mode.""" _LOGGER.debug("Set hvac_mode to %s", hvac_mode) if not self._mode(): return operation_mode = self._hvac_mapping.get(hvac_mode) _LOGGER.debug("Set operation_mode to %s", operation_mode) self._mode().data = operation_mode def turn_aux_heat_on(self): """Turn auxiliary heater on.""" if not self._aux_heat: return operation_mode = AUX_HEAT_ZWAVE_MODE _LOGGER.debug("Aux heat on. Set operation mode to %s", operation_mode) self._mode().data = operation_mode def turn_aux_heat_off(self): """Turn auxiliary heater off.""" if not self._aux_heat: return if HVAC_MODE_HEAT in self._hvac_mapping: operation_mode = self._hvac_mapping.get(HVAC_MODE_HEAT) else: operation_mode = self._hvac_mapping.get(HVAC_MODE_OFF) _LOGGER.debug("Aux heat off. Set operation mode to %s", operation_mode) self._mode().data = operation_mode def set_preset_mode(self, preset_mode): """Set new target preset mode.""" _LOGGER.debug("Set preset_mode to %s", preset_mode) if not self._mode(): return if preset_mode == PRESET_NONE: # Activate the current hvac mode self._update_operation_mode() operation_mode = self._hvac_mapping.get(self.hvac_mode) _LOGGER.debug("Set operation_mode to %s", operation_mode) self._mode().data = operation_mode else: operation_mode = self._preset_mapping.get(preset_mode, preset_mode) _LOGGER.debug("Set operation_mode to %s", operation_mode) self._mode().data = operation_mode def set_swing_mode(self, swing_mode): """Set new target swing mode.""" _LOGGER.debug("Set swing_mode to %s", swing_mode) if self._zxt_120 == 1: if self.values.zxt_120_swing_mode: self.values.zxt_120_swing_mode.data = swing_mode @property def device_state_attributes(self): """Return the optional state attributes.""" data = super().device_state_attributes if self._fan_action: data[ATTR_FAN_ACTION] = self._fan_action return data class ZWaveClimateSingleSetpoint(ZWaveClimateBase): """Representation of a single setpoint Z-Wave thermostat device.""" def __init__(self, values, temp_unit): """Initialize the Z-Wave climate device.""" ZWaveClimateBase.__init__(self, values, temp_unit) def _mode(self) -> None: """Return thermostat mode Z-Wave value.""" return self.values.mode def _current_mode_setpoints(self) -> Tuple: """Return a tuple of current setpoint Z-Wave value(s).""" return (self.values.primary,) class ZWaveClimateMultipleSetpoint(ZWaveClimateBase): """Representation of a multiple setpoint Z-Wave thermostat device.""" def __init__(self, values, temp_unit): """Initialize the Z-Wave climate device.""" ZWaveClimateBase.__init__(self, values, temp_unit) def _mode(self) -> None: """Return thermostat mode Z-Wave value.""" return self.values.primary def _current_mode_setpoints(self) -> Tuple: """Return a tuple of current setpoint Z-Wave value(s).""" current_mode = str(self.values.primary.data).lower() setpoints_names = MODE_SETPOINT_MAPPINGS.get(current_mode, ()) return tuple(getattr(self.values, name, None) for name in setpoints_names)
# Copyright 2014 IBM Corp. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. import os import ddt from eventlet import timeout as etimeout import mock from os_win import constants as os_win_const from os_win import exceptions as os_win_exc from oslo_concurrency import processutils from oslo_config import cfg from oslo_utils import fileutils from oslo_utils import units from nova.compute import vm_states from nova import exception from nova import objects from nova.objects import fields from nova.objects import flavor as flavor_obj from nova.tests.unit import fake_instance from nova.tests.unit.objects import test_flavor from nova.tests.unit.objects import test_virtual_interface from nova.tests.unit.virt.hyperv import test_base from nova.virt import hardware from nova.virt.hyperv import constants from nova.virt.hyperv import vmops from nova.virt.hyperv import volumeops CONF = cfg.CONF @ddt.ddt class VMOpsTestCase(test_base.HyperVBaseTestCase): """Unit tests for the Hyper-V VMOps class.""" _FAKE_TIMEOUT = 2 FAKE_SIZE = 10 FAKE_DIR = 'fake_dir' FAKE_ROOT_PATH = 'C:\\path\\to\\fake.%s' FAKE_CONFIG_DRIVE_ISO = 'configdrive.iso' FAKE_CONFIG_DRIVE_VHD = 'configdrive.vhd' FAKE_UUID = '4f54fb69-d3a2-45b7-bb9b-b6e6b3d893b3' FAKE_LOG = 'fake_log' _WIN_VERSION_6_3 = '6.3.0' _WIN_VERSION_10 = '10.0' ISO9660 = 'iso9660' _FAKE_CONFIGDRIVE_PATH = 'C:/fake_instance_dir/configdrive.vhd' def setUp(self): super(VMOpsTestCase, self).setUp() self.context = 'fake-context' self._vmops = vmops.VMOps(virtapi=mock.MagicMock()) self._vmops._vmutils = mock.MagicMock() self._vmops._metricsutils = mock.MagicMock() self._vmops._vhdutils = mock.MagicMock() self._vmops._pathutils = mock.MagicMock() self._vmops._hostutils = mock.MagicMock() self._vmops._migrutils = mock.MagicMock() self._vmops._serial_console_ops = mock.MagicMock() self._vmops._block_dev_man = mock.MagicMock() self._vmops._vif_driver = mock.MagicMock() def test_list_instances(self): mock_instance = mock.MagicMock() self._vmops._vmutils.list_instances.return_value = [mock_instance] response = self._vmops.list_instances() self._vmops._vmutils.list_instances.assert_called_once_with() self.assertEqual(response, [mock_instance]) def _test_get_info(self, vm_exists): mock_instance = fake_instance.fake_instance_obj(self.context) mock_info = mock.MagicMock(spec_set=dict) fake_info = {'EnabledState': 2, 'MemoryUsage': mock.sentinel.FAKE_MEM_KB, 'NumberOfProcessors': mock.sentinel.FAKE_NUM_CPU, 'UpTime': mock.sentinel.FAKE_CPU_NS} def getitem(key): return fake_info[key] mock_info.__getitem__.side_effect = getitem expected = hardware.InstanceInfo(state=constants.HYPERV_POWER_STATE[2]) self._vmops._vmutils.vm_exists.return_value = vm_exists self._vmops._vmutils.get_vm_summary_info.return_value = mock_info if not vm_exists: self.assertRaises(exception.InstanceNotFound, self._vmops.get_info, mock_instance) else: response = self._vmops.get_info(mock_instance) self._vmops._vmutils.vm_exists.assert_called_once_with( mock_instance.name) self._vmops._vmutils.get_vm_summary_info.assert_called_once_with( mock_instance.name) self.assertEqual(response, expected) def test_get_info(self): self._test_get_info(vm_exists=True) def test_get_info_exception(self): self._test_get_info(vm_exists=False) @mock.patch.object(vmops.VMOps, 'check_vm_image_type') @mock.patch.object(vmops.VMOps, '_create_root_vhd') def test_create_root_device_type_disk(self, mock_create_root_device, mock_check_vm_image_type): mock_instance = fake_instance.fake_instance_obj(self.context) mock_root_disk_info = {'type': constants.DISK} self._vmops._create_root_device(self.context, mock_instance, mock_root_disk_info, mock.sentinel.VM_GEN_1) mock_create_root_device.assert_called_once_with( self.context, mock_instance) mock_check_vm_image_type.assert_called_once_with( mock_instance.uuid, mock.sentinel.VM_GEN_1, mock_create_root_device.return_value) def _prepare_create_root_device_mocks(self, use_cow_images, vhd_format, vhd_size): mock_instance = fake_instance.fake_instance_obj(self.context) mock_instance.flavor.root_gb = self.FAKE_SIZE self.flags(use_cow_images=use_cow_images) self._vmops._vhdutils.get_vhd_info.return_value = {'VirtualSize': vhd_size * units.Gi} self._vmops._vhdutils.get_vhd_format.return_value = vhd_format root_vhd_internal_size = mock_instance.flavor.root_gb * units.Gi get_size = self._vmops._vhdutils.get_internal_vhd_size_by_file_size get_size.return_value = root_vhd_internal_size self._vmops._pathutils.exists.return_value = True return mock_instance @mock.patch('nova.virt.hyperv.imagecache.ImageCache.get_cached_image') def _test_create_root_vhd_exception(self, mock_get_cached_image, vhd_format): mock_instance = self._prepare_create_root_device_mocks( use_cow_images=False, vhd_format=vhd_format, vhd_size=(self.FAKE_SIZE + 1)) fake_vhd_path = self.FAKE_ROOT_PATH % vhd_format mock_get_cached_image.return_value = fake_vhd_path fake_root_path = self._vmops._pathutils.get_root_vhd_path.return_value self.assertRaises(exception.FlavorDiskSmallerThanImage, self._vmops._create_root_vhd, self.context, mock_instance) self.assertFalse(self._vmops._vhdutils.resize_vhd.called) self._vmops._pathutils.exists.assert_called_once_with( fake_root_path) self._vmops._pathutils.remove.assert_called_once_with( fake_root_path) @mock.patch('nova.virt.hyperv.imagecache.ImageCache.get_cached_image') def _test_create_root_vhd_qcow(self, mock_get_cached_image, vhd_format): mock_instance = self._prepare_create_root_device_mocks( use_cow_images=True, vhd_format=vhd_format, vhd_size=(self.FAKE_SIZE - 1)) fake_vhd_path = self.FAKE_ROOT_PATH % vhd_format mock_get_cached_image.return_value = fake_vhd_path fake_root_path = self._vmops._pathutils.get_root_vhd_path.return_value root_vhd_internal_size = mock_instance.flavor.root_gb * units.Gi get_size = self._vmops._vhdutils.get_internal_vhd_size_by_file_size response = self._vmops._create_root_vhd(context=self.context, instance=mock_instance) self.assertEqual(fake_root_path, response) self._vmops._pathutils.get_root_vhd_path.assert_called_with( mock_instance.name, vhd_format, False) differencing_vhd = self._vmops._vhdutils.create_differencing_vhd differencing_vhd.assert_called_with(fake_root_path, fake_vhd_path) self._vmops._vhdutils.get_vhd_info.assert_called_once_with( fake_vhd_path) if vhd_format is constants.DISK_FORMAT_VHD: self.assertFalse(get_size.called) self.assertFalse(self._vmops._vhdutils.resize_vhd.called) else: get_size.assert_called_once_with(fake_vhd_path, root_vhd_internal_size) self._vmops._vhdutils.resize_vhd.assert_called_once_with( fake_root_path, root_vhd_internal_size, is_file_max_size=False) @mock.patch('nova.virt.hyperv.imagecache.ImageCache.get_cached_image') def _test_create_root_vhd(self, mock_get_cached_image, vhd_format, is_rescue_vhd=False): mock_instance = self._prepare_create_root_device_mocks( use_cow_images=False, vhd_format=vhd_format, vhd_size=(self.FAKE_SIZE - 1)) fake_vhd_path = self.FAKE_ROOT_PATH % vhd_format mock_get_cached_image.return_value = fake_vhd_path rescue_image_id = ( mock.sentinel.rescue_image_id if is_rescue_vhd else None) fake_root_path = self._vmops._pathutils.get_root_vhd_path.return_value root_vhd_internal_size = mock_instance.flavor.root_gb * units.Gi get_size = self._vmops._vhdutils.get_internal_vhd_size_by_file_size response = self._vmops._create_root_vhd( context=self.context, instance=mock_instance, rescue_image_id=rescue_image_id) self.assertEqual(fake_root_path, response) mock_get_cached_image.assert_called_once_with(self.context, mock_instance, rescue_image_id) self._vmops._pathutils.get_root_vhd_path.assert_called_with( mock_instance.name, vhd_format, is_rescue_vhd) self._vmops._pathutils.copyfile.assert_called_once_with( fake_vhd_path, fake_root_path) get_size.assert_called_once_with(fake_vhd_path, root_vhd_internal_size) if is_rescue_vhd: self.assertFalse(self._vmops._vhdutils.resize_vhd.called) else: self._vmops._vhdutils.resize_vhd.assert_called_once_with( fake_root_path, root_vhd_internal_size, is_file_max_size=False) def test_create_root_vhd(self): self._test_create_root_vhd(vhd_format=constants.DISK_FORMAT_VHD) def test_create_root_vhdx(self): self._test_create_root_vhd(vhd_format=constants.DISK_FORMAT_VHDX) def test_create_root_vhd_use_cow_images_true(self): self._test_create_root_vhd_qcow(vhd_format=constants.DISK_FORMAT_VHD) def test_create_root_vhdx_use_cow_images_true(self): self._test_create_root_vhd_qcow(vhd_format=constants.DISK_FORMAT_VHDX) def test_create_rescue_vhd(self): self._test_create_root_vhd(vhd_format=constants.DISK_FORMAT_VHD, is_rescue_vhd=True) def test_create_root_vhdx_size_less_than_internal(self): self._test_create_root_vhd_exception( vhd_format=constants.DISK_FORMAT_VHD) def test_is_resize_needed_exception(self): inst = mock.MagicMock() self.assertRaises( exception.FlavorDiskSmallerThanImage, self._vmops._is_resize_needed, mock.sentinel.FAKE_PATH, self.FAKE_SIZE, self.FAKE_SIZE - 1, inst) def test_is_resize_needed_true(self): inst = mock.MagicMock() self.assertTrue(self._vmops._is_resize_needed( mock.sentinel.FAKE_PATH, self.FAKE_SIZE, self.FAKE_SIZE + 1, inst)) def test_is_resize_needed_false(self): inst = mock.MagicMock() self.assertFalse(self._vmops._is_resize_needed( mock.sentinel.FAKE_PATH, self.FAKE_SIZE, self.FAKE_SIZE, inst)) @mock.patch.object(vmops.VMOps, 'create_ephemeral_disk') def test_create_ephemerals(self, mock_create_ephemeral_disk): mock_instance = fake_instance.fake_instance_obj(self.context) fake_ephemerals = [dict(), dict()] self._vmops._vhdutils.get_best_supported_vhd_format.return_value = ( mock.sentinel.format) self._vmops._pathutils.get_ephemeral_vhd_path.side_effect = [ mock.sentinel.FAKE_PATH0, mock.sentinel.FAKE_PATH1] self._vmops._create_ephemerals(mock_instance, fake_ephemerals) self._vmops._pathutils.get_ephemeral_vhd_path.assert_has_calls( [mock.call(mock_instance.name, mock.sentinel.format, 'eph0'), mock.call(mock_instance.name, mock.sentinel.format, 'eph1')]) mock_create_ephemeral_disk.assert_has_calls( [mock.call(mock_instance.name, fake_ephemerals[0]), mock.call(mock_instance.name, fake_ephemerals[1])]) def test_create_ephemeral_disk(self): mock_instance = fake_instance.fake_instance_obj(self.context) mock_ephemeral_info = {'path': 'fake_eph_path', 'size': 10} self._vmops.create_ephemeral_disk(mock_instance.name, mock_ephemeral_info) mock_create_dynamic_vhd = self._vmops._vhdutils.create_dynamic_vhd mock_create_dynamic_vhd.assert_called_once_with('fake_eph_path', 10 * units.Gi) @mock.patch.object(vmops.objects, 'PCIDeviceBus') @mock.patch.object(vmops.objects, 'NetworkInterfaceMetadata') @mock.patch.object(vmops.objects.VirtualInterfaceList, 'get_by_instance_uuid') def test_get_vif_metadata(self, mock_get_by_inst_uuid, mock_NetworkInterfaceMetadata, mock_PCIDevBus): mock_vif = mock.MagicMock(tag='taggy') mock_vif.__contains__.side_effect = ( lambda attr: getattr(mock_vif, attr, None) is not None) mock_get_by_inst_uuid.return_value = [mock_vif, mock.MagicMock(tag=None)] vif_metadata = self._vmops._get_vif_metadata(self.context, mock.sentinel.instance_id) mock_get_by_inst_uuid.assert_called_once_with( self.context, mock.sentinel.instance_id) mock_NetworkInterfaceMetadata.assert_called_once_with( mac=mock_vif.address, bus=mock_PCIDevBus.return_value, tags=[mock_vif.tag]) self.assertEqual([mock_NetworkInterfaceMetadata.return_value], vif_metadata) @mock.patch.object(vmops.objects, 'InstanceDeviceMetadata') @mock.patch.object(vmops.VMOps, '_get_vif_metadata') def test_save_device_metadata(self, mock_get_vif_metadata, mock_InstanceDeviceMetadata): mock_instance = mock.MagicMock() mock_get_vif_metadata.return_value = [mock.sentinel.vif_metadata] self._vmops._block_dev_man.get_bdm_metadata.return_value = [ mock.sentinel.bdm_metadata] self._vmops._save_device_metadata(self.context, mock_instance, mock.sentinel.block_device_info) mock_get_vif_metadata.assert_called_once_with(self.context, mock_instance.uuid) self._vmops._block_dev_man.get_bdm_metadata.assert_called_once_with( self.context, mock_instance, mock.sentinel.block_device_info) expected_metadata = [mock.sentinel.vif_metadata, mock.sentinel.bdm_metadata] mock_InstanceDeviceMetadata.assert_called_once_with( devices=expected_metadata) self.assertEqual(mock_InstanceDeviceMetadata.return_value, mock_instance.device_metadata) def test_set_boot_order(self): self._vmops.set_boot_order(mock.sentinel.instance_name, mock.sentinel.vm_gen, mock.sentinel.bdi) mock_get_boot_order = self._vmops._block_dev_man.get_boot_order mock_get_boot_order.assert_called_once_with( mock.sentinel.vm_gen, mock.sentinel.bdi) self._vmops._vmutils.set_boot_order.assert_called_once_with( mock.sentinel.instance_name, mock_get_boot_order.return_value) @mock.patch.object(vmops.VMOps, 'plug_vifs') @mock.patch('nova.virt.hyperv.vmops.VMOps.destroy') @mock.patch('nova.virt.hyperv.vmops.VMOps.power_on') @mock.patch('nova.virt.hyperv.vmops.VMOps.set_boot_order') @mock.patch('nova.virt.hyperv.vmops.VMOps.attach_config_drive') @mock.patch('nova.virt.hyperv.vmops.VMOps._create_config_drive') @mock.patch('nova.virt.configdrive.required_by') @mock.patch('nova.virt.hyperv.vmops.VMOps._save_device_metadata') @mock.patch('nova.virt.hyperv.vmops.VMOps.create_instance') @mock.patch('nova.virt.hyperv.vmops.VMOps.get_image_vm_generation') @mock.patch('nova.virt.hyperv.vmops.VMOps._create_ephemerals') @mock.patch('nova.virt.hyperv.vmops.VMOps._create_root_device') @mock.patch('nova.virt.hyperv.vmops.VMOps._delete_disk_files') @mock.patch('nova.virt.hyperv.vmops.VMOps._get_neutron_events', return_value=[]) def _test_spawn(self, mock_get_neutron_events, mock_delete_disk_files, mock_create_root_device, mock_create_ephemerals, mock_get_image_vm_gen, mock_create_instance, mock_save_device_metadata, mock_configdrive_required, mock_create_config_drive, mock_attach_config_drive, mock_set_boot_order, mock_power_on, mock_destroy, mock_plug_vifs, exists, configdrive_required, fail, fake_vm_gen=constants.VM_GEN_2): mock_instance = fake_instance.fake_instance_obj(self.context) mock_image_meta = mock.MagicMock() root_device_info = mock.sentinel.ROOT_DEV_INFO mock_get_image_vm_gen.return_value = fake_vm_gen fake_config_drive_path = mock_create_config_drive.return_value block_device_info = {'ephemerals': [], 'root_disk': root_device_info} self._vmops._vmutils.vm_exists.return_value = exists mock_configdrive_required.return_value = configdrive_required mock_create_instance.side_effect = fail if exists: self.assertRaises(exception.InstanceExists, self._vmops.spawn, self.context, mock_instance, mock_image_meta, [mock.sentinel.FILE], mock.sentinel.PASSWORD, mock.sentinel.network_info, block_device_info) elif fail is os_win_exc.HyperVException: self.assertRaises(os_win_exc.HyperVException, self._vmops.spawn, self.context, mock_instance, mock_image_meta, [mock.sentinel.FILE], mock.sentinel.PASSWORD, mock.sentinel.network_info, block_device_info) mock_destroy.assert_called_once_with(mock_instance, mock.sentinel.network_info, block_device_info) else: self._vmops.spawn(self.context, mock_instance, mock_image_meta, [mock.sentinel.FILE], mock.sentinel.PASSWORD, mock.sentinel.network_info, block_device_info) self._vmops._vmutils.vm_exists.assert_called_once_with( mock_instance.name) mock_delete_disk_files.assert_called_once_with( mock_instance.name) mock_validate_and_update_bdi = ( self._vmops._block_dev_man.validate_and_update_bdi) mock_validate_and_update_bdi.assert_called_once_with( mock_instance, mock_image_meta, fake_vm_gen, block_device_info) mock_create_root_device.assert_called_once_with(self.context, mock_instance, root_device_info, fake_vm_gen) mock_create_ephemerals.assert_called_once_with( mock_instance, block_device_info['ephemerals']) mock_get_neutron_events.assert_called_once_with( mock.sentinel.network_info) mock_get_image_vm_gen.assert_called_once_with(mock_instance.uuid, mock_image_meta) mock_create_instance.assert_called_once_with( mock_instance, mock.sentinel.network_info, root_device_info, block_device_info, fake_vm_gen, mock_image_meta) mock_plug_vifs.assert_called_once_with(mock_instance, mock.sentinel.network_info) mock_save_device_metadata.assert_called_once_with( self.context, mock_instance, block_device_info) mock_configdrive_required.assert_called_once_with(mock_instance) if configdrive_required: mock_create_config_drive.assert_called_once_with( self.context, mock_instance, [mock.sentinel.FILE], mock.sentinel.PASSWORD, mock.sentinel.network_info) mock_attach_config_drive.assert_called_once_with( mock_instance, fake_config_drive_path, fake_vm_gen) mock_set_boot_order.assert_called_once_with( mock_instance.name, fake_vm_gen, block_device_info) mock_power_on.assert_called_once_with( mock_instance, network_info=mock.sentinel.network_info, should_plug_vifs=False) def test_spawn(self): self._test_spawn(exists=False, configdrive_required=True, fail=None) def test_spawn_instance_exists(self): self._test_spawn(exists=True, configdrive_required=True, fail=None) def test_spawn_create_instance_exception(self): self._test_spawn(exists=False, configdrive_required=True, fail=os_win_exc.HyperVException) def test_spawn_not_required(self): self._test_spawn(exists=False, configdrive_required=False, fail=None) def test_spawn_no_admin_permissions(self): self._vmops._vmutils.check_admin_permissions.side_effect = ( os_win_exc.HyperVException) self.assertRaises(os_win_exc.HyperVException, self._vmops.spawn, self.context, mock.DEFAULT, mock.DEFAULT, [mock.sentinel.FILE], mock.sentinel.PASSWORD, mock.sentinel.INFO, mock.sentinel.DEV_INFO) @mock.patch.object(vmops.VMOps, '_get_neutron_events') def test_wait_vif_plug_events(self, mock_get_events): self._vmops._virtapi.wait_for_instance_event.side_effect = ( etimeout.Timeout) self.flags(vif_plugging_timeout=1) self.flags(vif_plugging_is_fatal=True) def _context_user(): with self._vmops.wait_vif_plug_events(mock.sentinel.instance, mock.sentinel.network_info): pass self.assertRaises(exception.VirtualInterfaceCreateException, _context_user) mock_get_events.assert_called_once_with(mock.sentinel.network_info) self._vmops._virtapi.wait_for_instance_event.assert_called_once_with( mock.sentinel.instance, mock_get_events.return_value, deadline=CONF.vif_plugging_timeout, error_callback=self._vmops._neutron_failed_callback) @mock.patch.object(vmops.VMOps, '_get_neutron_events') def test_wait_vif_plug_events_port_binding_failed(self, mock_get_events): mock_get_events.side_effect = exception.PortBindingFailed( port_id='fake_id') def _context_user(): with self._vmops.wait_vif_plug_events(mock.sentinel.instance, mock.sentinel.network_info): pass self.assertRaises(exception.PortBindingFailed, _context_user) def test_neutron_failed_callback(self): self.flags(vif_plugging_is_fatal=True) self.assertRaises(exception.VirtualInterfaceCreateException, self._vmops._neutron_failed_callback, mock.sentinel.event_name, mock.sentinel.instance) def test_get_neutron_events(self): network_info = [{'id': mock.sentinel.vif_id1, 'active': True}, {'id': mock.sentinel.vif_id2, 'active': False}, {'id': mock.sentinel.vif_id3}] events = self._vmops._get_neutron_events(network_info) self.assertEqual([('network-vif-plugged', mock.sentinel.vif_id2)], events) def test_get_neutron_events_no_timeout(self): self.flags(vif_plugging_timeout=0) network_info = [{'id': mock.sentinel.vif_id1, 'active': True}] events = self._vmops._get_neutron_events(network_info) self.assertEqual([], events) @mock.patch.object(vmops.VMOps, '_attach_pci_devices') @mock.patch.object(vmops.VMOps, '_requires_secure_boot') @mock.patch.object(vmops.VMOps, '_requires_certificate') @mock.patch.object(vmops.VMOps, '_get_instance_vnuma_config') @mock.patch('nova.virt.hyperv.volumeops.VolumeOps' '.attach_volumes') @mock.patch.object(vmops.VMOps, '_set_instance_disk_qos_specs') @mock.patch.object(vmops.VMOps, '_create_vm_com_port_pipes') @mock.patch.object(vmops.VMOps, '_attach_ephemerals') @mock.patch.object(vmops.VMOps, '_attach_root_device') @mock.patch.object(vmops.VMOps, '_configure_remotefx') def _test_create_instance(self, mock_configure_remotefx, mock_attach_root_device, mock_attach_ephemerals, mock_create_pipes, mock_set_qos_specs, mock_attach_volumes, mock_get_vnuma_config, mock_requires_certificate, mock_requires_secure_boot, mock_attach_pci_devices, enable_instance_metrics, vm_gen=constants.VM_GEN_1, vnuma_enabled=False, pci_requests=None): self.flags(dynamic_memory_ratio=2.0, group='hyperv') self.flags(enable_instance_metrics_collection=enable_instance_metrics, group='hyperv') root_device_info = mock.sentinel.ROOT_DEV_INFO block_device_info = {'ephemerals': [], 'block_device_mapping': []} fake_network_info = {'id': mock.sentinel.ID, 'address': mock.sentinel.ADDRESS} mock_instance = fake_instance.fake_instance_obj(self.context) instance_path = os.path.join(CONF.instances_path, mock_instance.name) mock_requires_secure_boot.return_value = True flavor = flavor_obj.Flavor(**test_flavor.fake_flavor) mock_instance.flavor = flavor instance_pci_requests = objects.InstancePCIRequests( requests=pci_requests or [], instance_uuid=mock_instance.uuid) mock_instance.pci_requests = instance_pci_requests host_shutdown_action = (os_win_const.HOST_SHUTDOWN_ACTION_SHUTDOWN if pci_requests else None) if vnuma_enabled: mock_get_vnuma_config.return_value = ( mock.sentinel.mem_per_numa, mock.sentinel.cpus_per_numa) cpus_per_numa = mock.sentinel.cpus_per_numa mem_per_numa = mock.sentinel.mem_per_numa dynamic_memory_ratio = 1.0 else: mock_get_vnuma_config.return_value = (None, None) mem_per_numa, cpus_per_numa = (None, None) dynamic_memory_ratio = CONF.hyperv.dynamic_memory_ratio self._vmops.create_instance(instance=mock_instance, network_info=[fake_network_info], root_device=root_device_info, block_device_info=block_device_info, vm_gen=vm_gen, image_meta=mock.sentinel.image_meta) mock_get_vnuma_config.assert_called_once_with(mock_instance, mock.sentinel.image_meta) self._vmops._vmutils.create_vm.assert_called_once_with( mock_instance.name, vnuma_enabled, vm_gen, instance_path, [mock_instance.uuid]) self._vmops._vmutils.update_vm.assert_called_once_with( mock_instance.name, mock_instance.flavor.memory_mb, mem_per_numa, mock_instance.flavor.vcpus, cpus_per_numa, CONF.hyperv.limit_cpu_features, dynamic_memory_ratio, host_shutdown_action=host_shutdown_action) mock_configure_remotefx.assert_called_once_with(mock_instance, vm_gen) mock_create_scsi_ctrl = self._vmops._vmutils.create_scsi_controller mock_create_scsi_ctrl.assert_called_once_with(mock_instance.name) mock_attach_root_device.assert_called_once_with(mock_instance.name, root_device_info) mock_attach_ephemerals.assert_called_once_with(mock_instance.name, block_device_info['ephemerals']) mock_attach_volumes.assert_called_once_with( block_device_info['block_device_mapping'], mock_instance.name) self._vmops._vmutils.create_nic.assert_called_once_with( mock_instance.name, mock.sentinel.ID, mock.sentinel.ADDRESS) mock_enable = self._vmops._metricsutils.enable_vm_metrics_collection if enable_instance_metrics: mock_enable.assert_called_once_with(mock_instance.name) mock_set_qos_specs.assert_called_once_with(mock_instance) mock_requires_secure_boot.assert_called_once_with( mock_instance, mock.sentinel.image_meta, vm_gen) mock_requires_certificate.assert_called_once_with( mock.sentinel.image_meta) enable_secure_boot = self._vmops._vmutils.enable_secure_boot enable_secure_boot.assert_called_once_with( mock_instance.name, msft_ca_required=mock_requires_certificate.return_value) mock_attach_pci_devices.assert_called_once_with(mock_instance) def test_create_instance(self): self._test_create_instance(enable_instance_metrics=True) def test_create_instance_enable_instance_metrics_false(self): self._test_create_instance(enable_instance_metrics=False) def test_create_instance_gen2(self): self._test_create_instance(enable_instance_metrics=False, vm_gen=constants.VM_GEN_2) def test_create_instance_vnuma_enabled(self): self._test_create_instance(enable_instance_metrics=False, vnuma_enabled=True) def test_create_instance_pci_requested(self): vendor_id = 'fake_vendor_id' product_id = 'fake_product_id' spec = {'vendor_id': vendor_id, 'product_id': product_id} request = objects.InstancePCIRequest(count=1, spec=[spec]) self._test_create_instance(enable_instance_metrics=False, pci_requests=[request]) def test_attach_pci_devices(self): mock_instance = fake_instance.fake_instance_obj(self.context) vendor_id = 'fake_vendor_id' product_id = 'fake_product_id' spec = {'vendor_id': vendor_id, 'product_id': product_id} request = objects.InstancePCIRequest(count=2, spec=[spec]) instance_pci_requests = objects.InstancePCIRequests( requests=[request], instance_uuid=mock_instance.uuid) mock_instance.pci_requests = instance_pci_requests self._vmops._attach_pci_devices(mock_instance) self._vmops._vmutils.add_pci_device.assert_has_calls( [mock.call(mock_instance.name, vendor_id, product_id)] * 2) @mock.patch.object(vmops.hardware, 'numa_get_constraints') def _check_get_instance_vnuma_config_exception(self, mock_get_numa, numa_cells): flavor = {'extra_specs': {}} mock_instance = mock.MagicMock(flavor=flavor) image_meta = mock.MagicMock(properties={}) numa_topology = objects.InstanceNUMATopology(cells=numa_cells) mock_get_numa.return_value = numa_topology self.assertRaises(exception.InstanceUnacceptable, self._vmops._get_instance_vnuma_config, mock_instance, image_meta) def test_get_instance_vnuma_config_bad_cpuset(self): cell1 = objects.InstanceNUMACell( cpuset=set([0]), pcpuset=set(), memory=1024) cell2 = objects.InstanceNUMACell( cpuset=set([1, 2]), pcpuset=set(), memory=1024) self._check_get_instance_vnuma_config_exception( numa_cells=[cell1, cell2]) def test_get_instance_vnuma_config_bad_memory(self): cell1 = objects.InstanceNUMACell( cpuset=set([0]), pcpuset=set(), memory=1024) cell2 = objects.InstanceNUMACell( cpuset=set([1]), pcpuset=set(), memory=2048) self._check_get_instance_vnuma_config_exception( numa_cells=[cell1, cell2]) def test_get_instance_vnuma_config_cpu_pinning(self): cell1 = objects.InstanceNUMACell( cpuset=set([0]), pcpuset=set(), memory=1024, cpu_policy=fields.CPUAllocationPolicy.DEDICATED) cell2 = objects.InstanceNUMACell( cpuset=set([1]), pcpuset=set(), memory=1024, cpu_policy=fields.CPUAllocationPolicy.DEDICATED) self._check_get_instance_vnuma_config_exception( numa_cells=[cell1, cell2]) @mock.patch.object(vmops.hardware, 'numa_get_constraints') def _check_get_instance_vnuma_config( self, mock_get_numa, numa_topology=None, expected_mem_per_numa=None, expected_cpus_per_numa=None): mock_instance = mock.MagicMock() image_meta = mock.MagicMock() mock_get_numa.return_value = numa_topology result_memory_per_numa, result_cpus_per_numa = ( self._vmops._get_instance_vnuma_config(mock_instance, image_meta)) self.assertEqual(expected_cpus_per_numa, result_cpus_per_numa) self.assertEqual(expected_mem_per_numa, result_memory_per_numa) def test_get_instance_vnuma_config(self): cell1 = objects.InstanceNUMACell( cpuset=set([0]), pcpuset=set(), memory=2048) cell2 = objects.InstanceNUMACell( cpuset=set([1]), pcpuset=set(), memory=2048) numa_topology = objects.InstanceNUMATopology(cells=[cell1, cell2]) self._check_get_instance_vnuma_config(numa_topology=numa_topology, expected_cpus_per_numa=1, expected_mem_per_numa=2048) def test_get_instance_vnuma_config_no_topology(self): self._check_get_instance_vnuma_config() @mock.patch.object(vmops.volumeops.VolumeOps, 'attach_volume') def test_attach_root_device_volume(self, mock_attach_volume): mock_instance = fake_instance.fake_instance_obj(self.context) root_device_info = {'type': constants.VOLUME, 'connection_info': mock.sentinel.CONN_INFO, 'disk_bus': constants.CTRL_TYPE_IDE} self._vmops._attach_root_device(mock_instance.name, root_device_info) mock_attach_volume.assert_called_once_with( root_device_info['connection_info'], mock_instance.name, disk_bus=root_device_info['disk_bus']) @mock.patch.object(vmops.VMOps, '_attach_drive') def test_attach_root_device_disk(self, mock_attach_drive): mock_instance = fake_instance.fake_instance_obj(self.context) root_device_info = {'type': constants.DISK, 'boot_index': 0, 'disk_bus': constants.CTRL_TYPE_IDE, 'path': 'fake_path', 'drive_addr': 0, 'ctrl_disk_addr': 1} self._vmops._attach_root_device(mock_instance.name, root_device_info) mock_attach_drive.assert_called_once_with( mock_instance.name, root_device_info['path'], root_device_info['drive_addr'], root_device_info['ctrl_disk_addr'], root_device_info['disk_bus'], root_device_info['type']) @mock.patch.object(vmops.VMOps, '_attach_drive') def test_attach_ephemerals(self, mock_attach_drive): mock_instance = fake_instance.fake_instance_obj(self.context) ephemerals = [{'path': mock.sentinel.PATH1, 'boot_index': 1, 'disk_bus': constants.CTRL_TYPE_IDE, 'device_type': 'disk', 'drive_addr': 0, 'ctrl_disk_addr': 1}, {'path': mock.sentinel.PATH2, 'boot_index': 2, 'disk_bus': constants.CTRL_TYPE_SCSI, 'device_type': 'disk', 'drive_addr': 0, 'ctrl_disk_addr': 0}, {'path': None}] self._vmops._attach_ephemerals(mock_instance.name, ephemerals) mock_attach_drive.assert_has_calls( [mock.call(mock_instance.name, mock.sentinel.PATH1, 0, 1, constants.CTRL_TYPE_IDE, constants.DISK), mock.call(mock_instance.name, mock.sentinel.PATH2, 0, 0, constants.CTRL_TYPE_SCSI, constants.DISK) ]) def test_attach_drive_vm_to_scsi(self): self._vmops._attach_drive( mock.sentinel.FAKE_VM_NAME, mock.sentinel.FAKE_PATH, mock.sentinel.FAKE_DRIVE_ADDR, mock.sentinel.FAKE_CTRL_DISK_ADDR, constants.CTRL_TYPE_SCSI) self._vmops._vmutils.attach_scsi_drive.assert_called_once_with( mock.sentinel.FAKE_VM_NAME, mock.sentinel.FAKE_PATH, constants.DISK) def test_attach_drive_vm_to_ide(self): self._vmops._attach_drive( mock.sentinel.FAKE_VM_NAME, mock.sentinel.FAKE_PATH, mock.sentinel.FAKE_DRIVE_ADDR, mock.sentinel.FAKE_CTRL_DISK_ADDR, constants.CTRL_TYPE_IDE) self._vmops._vmutils.attach_ide_drive.assert_called_once_with( mock.sentinel.FAKE_VM_NAME, mock.sentinel.FAKE_PATH, mock.sentinel.FAKE_DRIVE_ADDR, mock.sentinel.FAKE_CTRL_DISK_ADDR, constants.DISK) def test_get_image_vm_generation_default(self): image_meta = objects.ImageMeta.from_dict({"properties": {}}) self._vmops._hostutils.get_default_vm_generation.return_value = ( constants.IMAGE_PROP_VM_GEN_1) self._vmops._hostutils.get_supported_vm_types.return_value = [ constants.IMAGE_PROP_VM_GEN_1, constants.IMAGE_PROP_VM_GEN_2] response = self._vmops.get_image_vm_generation( mock.sentinel.instance_id, image_meta) self.assertEqual(constants.VM_GEN_1, response) def test_get_image_vm_generation_gen2(self): image_meta = objects.ImageMeta.from_dict( {"properties": {"hw_machine_type": constants.IMAGE_PROP_VM_GEN_2}}) self._vmops._hostutils.get_supported_vm_types.return_value = [ constants.IMAGE_PROP_VM_GEN_1, constants.IMAGE_PROP_VM_GEN_2] response = self._vmops.get_image_vm_generation( mock.sentinel.instance_id, image_meta) self.assertEqual(constants.VM_GEN_2, response) def test_check_vm_image_type_exception(self): self._vmops._vhdutils.get_vhd_format.return_value = ( constants.DISK_FORMAT_VHD) self.assertRaises(exception.InstanceUnacceptable, self._vmops.check_vm_image_type, mock.sentinel.instance_id, constants.VM_GEN_2, mock.sentinel.FAKE_PATH) def _check_requires_certificate(self, os_type): mock_image_meta = mock.MagicMock() mock_image_meta.properties = {'os_type': os_type} expected_result = os_type == fields.OSType.LINUX result = self._vmops._requires_certificate(mock_image_meta) self.assertEqual(expected_result, result) def test_requires_certificate_windows(self): self._check_requires_certificate(os_type=fields.OSType.WINDOWS) def test_requires_certificate_linux(self): self._check_requires_certificate(os_type=fields.OSType.LINUX) def _check_requires_secure_boot( self, image_prop_os_type=fields.OSType.LINUX, image_prop_secure_boot=fields.SecureBoot.REQUIRED, flavor_secure_boot=fields.SecureBoot.REQUIRED, vm_gen=constants.VM_GEN_2, expected_exception=True): mock_instance = fake_instance.fake_instance_obj(self.context) if flavor_secure_boot: mock_instance.flavor.extra_specs = { constants.FLAVOR_SPEC_SECURE_BOOT: flavor_secure_boot} mock_image_meta = mock.MagicMock() mock_image_meta.properties = {'os_type': image_prop_os_type} if image_prop_secure_boot: mock_image_meta.properties['os_secure_boot'] = ( image_prop_secure_boot) if expected_exception: self.assertRaises(exception.InstanceUnacceptable, self._vmops._requires_secure_boot, mock_instance, mock_image_meta, vm_gen) else: result = self._vmops._requires_secure_boot(mock_instance, mock_image_meta, vm_gen) requires_sb = fields.SecureBoot.REQUIRED in [ flavor_secure_boot, image_prop_secure_boot] self.assertEqual(requires_sb, result) def test_requires_secure_boot_ok(self): self._check_requires_secure_boot( expected_exception=False) def test_requires_secure_boot_image_img_prop_none(self): self._check_requires_secure_boot( image_prop_secure_boot=None, expected_exception=False) def test_requires_secure_boot_image_extra_spec_none(self): self._check_requires_secure_boot( flavor_secure_boot=None, expected_exception=False) def test_requires_secure_boot_flavor_no_os_type(self): self._check_requires_secure_boot( image_prop_os_type=None) def test_requires_secure_boot_flavor_no_os_type_no_exc(self): self._check_requires_secure_boot( image_prop_os_type=None, image_prop_secure_boot=fields.SecureBoot.DISABLED, flavor_secure_boot=fields.SecureBoot.DISABLED, expected_exception=False) def test_requires_secure_boot_flavor_disabled(self): self._check_requires_secure_boot( flavor_secure_boot=fields.SecureBoot.DISABLED) def test_requires_secure_boot_image_disabled(self): self._check_requires_secure_boot( image_prop_secure_boot=fields.SecureBoot.DISABLED) def test_requires_secure_boot_generation_1(self): self._check_requires_secure_boot(vm_gen=constants.VM_GEN_1) @mock.patch('nova.api.metadata.base.InstanceMetadata') @mock.patch('nova.virt.configdrive.ConfigDriveBuilder') @mock.patch('oslo_concurrency.processutils.execute') def _test_create_config_drive(self, mock_execute, mock_ConfigDriveBuilder, mock_InstanceMetadata, config_drive_format, config_drive_cdrom, side_effect, rescue=False): mock_instance = fake_instance.fake_instance_obj(self.context) self.flags(config_drive_format=config_drive_format) self.flags(config_drive_cdrom=config_drive_cdrom, group='hyperv') self.flags(config_drive_inject_password=True, group='hyperv') mock_ConfigDriveBuilder().__enter__().make_drive.side_effect = [ side_effect] path_iso = os.path.join(self.FAKE_DIR, self.FAKE_CONFIG_DRIVE_ISO) path_vhd = os.path.join(self.FAKE_DIR, self.FAKE_CONFIG_DRIVE_VHD) def fake_get_configdrive_path(instance_name, disk_format, rescue=False): return (path_iso if disk_format == constants.DVD_FORMAT else path_vhd) mock_get_configdrive_path = self._vmops._pathutils.get_configdrive_path mock_get_configdrive_path.side_effect = fake_get_configdrive_path expected_get_configdrive_path_calls = [mock.call(mock_instance.name, constants.DVD_FORMAT, rescue=rescue)] if not config_drive_cdrom: expected_call = mock.call(mock_instance.name, constants.DISK_FORMAT_VHD, rescue=rescue) expected_get_configdrive_path_calls.append(expected_call) if config_drive_format != self.ISO9660: self.assertRaises(exception.ConfigDriveUnsupportedFormat, self._vmops._create_config_drive, self.context, mock_instance, [mock.sentinel.FILE], mock.sentinel.PASSWORD, mock.sentinel.NET_INFO, rescue) elif side_effect is processutils.ProcessExecutionError: self.assertRaises(processutils.ProcessExecutionError, self._vmops._create_config_drive, self.context, mock_instance, [mock.sentinel.FILE], mock.sentinel.PASSWORD, mock.sentinel.NET_INFO, rescue) else: path = self._vmops._create_config_drive(self.context, mock_instance, [mock.sentinel.FILE], mock.sentinel.PASSWORD, mock.sentinel.NET_INFO, rescue) mock_InstanceMetadata.assert_called_once_with( mock_instance, content=[mock.sentinel.FILE], extra_md={'admin_pass': mock.sentinel.PASSWORD}, network_info=mock.sentinel.NET_INFO) mock_get_configdrive_path.assert_has_calls( expected_get_configdrive_path_calls) mock_ConfigDriveBuilder.assert_called_with( instance_md=mock_InstanceMetadata.return_value) mock_make_drive = mock_ConfigDriveBuilder().__enter__().make_drive mock_make_drive.assert_called_once_with(path_iso) if not CONF.hyperv.config_drive_cdrom: expected = path_vhd mock_execute.assert_called_once_with( CONF.hyperv.qemu_img_cmd, 'convert', '-f', 'raw', '-O', 'vpc', path_iso, path_vhd, attempts=1) self._vmops._pathutils.remove.assert_called_once_with( os.path.join(self.FAKE_DIR, self.FAKE_CONFIG_DRIVE_ISO)) else: expected = path_iso self.assertEqual(expected, path) def test_create_config_drive_cdrom(self): self._test_create_config_drive(config_drive_format=self.ISO9660, config_drive_cdrom=True, side_effect=None) def test_create_config_drive_vhd(self): self._test_create_config_drive(config_drive_format=self.ISO9660, config_drive_cdrom=False, side_effect=None) def test_create_rescue_config_drive_vhd(self): self._test_create_config_drive(config_drive_format=self.ISO9660, config_drive_cdrom=False, side_effect=None, rescue=True) def test_create_config_drive_execution_error(self): self._test_create_config_drive( config_drive_format=self.ISO9660, config_drive_cdrom=False, side_effect=processutils.ProcessExecutionError) def test_attach_config_drive_exception(self): instance = fake_instance.fake_instance_obj(self.context) self.assertRaises(exception.InvalidDiskFormat, self._vmops.attach_config_drive, instance, 'C:/fake_instance_dir/configdrive.xxx', constants.VM_GEN_1) @mock.patch.object(vmops.VMOps, '_attach_drive') def test_attach_config_drive(self, mock_attach_drive): instance = fake_instance.fake_instance_obj(self.context) self._vmops.attach_config_drive(instance, self._FAKE_CONFIGDRIVE_PATH, constants.VM_GEN_1) mock_attach_drive.assert_called_once_with( instance.name, self._FAKE_CONFIGDRIVE_PATH, 1, 0, constants.CTRL_TYPE_IDE, constants.DISK) @mock.patch.object(vmops.VMOps, '_attach_drive') def test_attach_config_drive_gen2(self, mock_attach_drive): instance = fake_instance.fake_instance_obj(self.context) self._vmops.attach_config_drive(instance, self._FAKE_CONFIGDRIVE_PATH, constants.VM_GEN_2) mock_attach_drive.assert_called_once_with( instance.name, self._FAKE_CONFIGDRIVE_PATH, 1, 0, constants.CTRL_TYPE_SCSI, constants.DISK) def test_detach_config_drive(self): is_rescue_configdrive = True mock_lookup_configdrive = ( self._vmops._pathutils.lookup_configdrive_path) mock_lookup_configdrive.return_value = mock.sentinel.configdrive_path self._vmops._detach_config_drive(mock.sentinel.instance_name, rescue=is_rescue_configdrive, delete=True) mock_lookup_configdrive.assert_called_once_with( mock.sentinel.instance_name, rescue=is_rescue_configdrive) self._vmops._vmutils.detach_vm_disk.assert_called_once_with( mock.sentinel.instance_name, mock.sentinel.configdrive_path, is_physical=False) self._vmops._pathutils.remove.assert_called_once_with( mock.sentinel.configdrive_path) def test_delete_disk_files(self): mock_instance = fake_instance.fake_instance_obj(self.context) self._vmops._delete_disk_files(mock_instance.name) stop_console_handler = ( self._vmops._serial_console_ops.stop_console_handler_unsync) stop_console_handler.assert_called_once_with(mock_instance.name) self._vmops._pathutils.get_instance_dir.assert_called_once_with( mock_instance.name, create_dir=False, remove_dir=True) @ddt.data({}, {'vm_exists': True}, {'planned_vm_exists': True}) @ddt.unpack @mock.patch('nova.virt.hyperv.volumeops.VolumeOps.disconnect_volumes') @mock.patch('nova.virt.hyperv.vmops.VMOps._delete_disk_files') @mock.patch('nova.virt.hyperv.vmops.VMOps.power_off') @mock.patch('nova.virt.hyperv.vmops.VMOps.unplug_vifs') def test_destroy(self, mock_unplug_vifs, mock_power_off, mock_delete_disk_files, mock_disconnect_volumes, vm_exists=False, planned_vm_exists=False): mock_instance = fake_instance.fake_instance_obj(self.context) self._vmops._vmutils.vm_exists.return_value = vm_exists self._vmops._migrutils.planned_vm_exists.return_value = ( planned_vm_exists) self._vmops.destroy(instance=mock_instance, block_device_info=mock.sentinel.FAKE_BD_INFO, network_info=mock.sentinel.fake_network_info) mock_destroy_planned_vms = ( self._vmops._migrutils.destroy_existing_planned_vm) if vm_exists: self._vmops._vmutils.stop_vm_jobs.assert_called_once_with( mock_instance.name) mock_power_off.assert_called_once_with(mock_instance) self._vmops._vmutils.destroy_vm.assert_called_once_with( mock_instance.name) elif planned_vm_exists: self._vmops._migrutils.planned_vm_exists.assert_called_once_with( mock_instance.name) mock_destroy_planned_vms.assert_called_once_with( mock_instance.name) else: self.assertFalse(self._vmops._vmutils.destroy_vm.called) self.assertFalse(mock_destroy_planned_vms.called) self._vmops._vmutils.vm_exists.assert_called_with( mock_instance.name) mock_unplug_vifs.assert_called_once_with( mock_instance, mock.sentinel.fake_network_info) mock_disconnect_volumes.assert_called_once_with( mock.sentinel.FAKE_BD_INFO) mock_delete_disk_files.assert_called_once_with( mock_instance.name) @mock.patch('nova.virt.hyperv.vmops.VMOps.power_off') def test_destroy_exception(self, mock_power_off): mock_instance = fake_instance.fake_instance_obj(self.context) self._vmops._vmutils.destroy_vm.side_effect = ( os_win_exc.HyperVException) self._vmops._vmutils.vm_exists.return_value = True self.assertRaises(os_win_exc.HyperVException, self._vmops.destroy, mock_instance, mock.sentinel.network_info, mock.sentinel.block_device_info) def test_reboot_hard(self): self._test_reboot(vmops.REBOOT_TYPE_HARD, os_win_const.HYPERV_VM_STATE_REBOOT) @mock.patch("nova.virt.hyperv.vmops.VMOps._soft_shutdown") def test_reboot_soft(self, mock_soft_shutdown): mock_soft_shutdown.return_value = True self._test_reboot(vmops.REBOOT_TYPE_SOFT, os_win_const.HYPERV_VM_STATE_ENABLED) @mock.patch("nova.virt.hyperv.vmops.VMOps._soft_shutdown") def test_reboot_soft_failed(self, mock_soft_shutdown): mock_soft_shutdown.return_value = False self._test_reboot(vmops.REBOOT_TYPE_SOFT, os_win_const.HYPERV_VM_STATE_REBOOT) @mock.patch("nova.virt.hyperv.vmops.VMOps.power_on") @mock.patch("nova.virt.hyperv.vmops.VMOps._soft_shutdown") def test_reboot_soft_exception(self, mock_soft_shutdown, mock_power_on): mock_soft_shutdown.return_value = True mock_power_on.side_effect = os_win_exc.HyperVException( "Expected failure") instance = fake_instance.fake_instance_obj(self.context) self.assertRaises(os_win_exc.HyperVException, self._vmops.reboot, instance, {}, vmops.REBOOT_TYPE_SOFT) mock_soft_shutdown.assert_called_once_with(instance) mock_power_on.assert_called_once_with(instance, network_info={}) def _test_reboot(self, reboot_type, vm_state): instance = fake_instance.fake_instance_obj(self.context) with mock.patch.object(self._vmops, '_set_vm_state') as mock_set_state: self._vmops.reboot(instance, {}, reboot_type) mock_set_state.assert_called_once_with(instance, vm_state) @mock.patch("nova.virt.hyperv.vmops.VMOps._wait_for_power_off") def test_soft_shutdown(self, mock_wait_for_power_off): instance = fake_instance.fake_instance_obj(self.context) mock_wait_for_power_off.return_value = True result = self._vmops._soft_shutdown(instance, self._FAKE_TIMEOUT) mock_shutdown_vm = self._vmops._vmutils.soft_shutdown_vm mock_shutdown_vm.assert_called_once_with(instance.name) mock_wait_for_power_off.assert_called_once_with( instance.name, self._FAKE_TIMEOUT) self.assertTrue(result) @mock.patch("time.sleep") def test_soft_shutdown_failed(self, mock_sleep): instance = fake_instance.fake_instance_obj(self.context) mock_shutdown_vm = self._vmops._vmutils.soft_shutdown_vm mock_shutdown_vm.side_effect = os_win_exc.HyperVException( "Expected failure.") result = self._vmops._soft_shutdown(instance, self._FAKE_TIMEOUT) mock_shutdown_vm.assert_called_once_with(instance.name) self.assertFalse(result) @mock.patch("nova.virt.hyperv.vmops.VMOps._wait_for_power_off") def test_soft_shutdown_wait(self, mock_wait_for_power_off): instance = fake_instance.fake_instance_obj(self.context) mock_wait_for_power_off.side_effect = [False, True] result = self._vmops._soft_shutdown(instance, self._FAKE_TIMEOUT, 1) calls = [mock.call(instance.name, 1), mock.call(instance.name, self._FAKE_TIMEOUT - 1)] mock_shutdown_vm = self._vmops._vmutils.soft_shutdown_vm mock_shutdown_vm.assert_called_with(instance.name) mock_wait_for_power_off.assert_has_calls(calls) self.assertTrue(result) @mock.patch("nova.virt.hyperv.vmops.VMOps._wait_for_power_off") def test_soft_shutdown_wait_timeout(self, mock_wait_for_power_off): instance = fake_instance.fake_instance_obj(self.context) mock_wait_for_power_off.return_value = False result = self._vmops._soft_shutdown(instance, self._FAKE_TIMEOUT, 1.5) calls = [mock.call(instance.name, 1.5), mock.call(instance.name, self._FAKE_TIMEOUT - 1.5)] mock_shutdown_vm = self._vmops._vmutils.soft_shutdown_vm mock_shutdown_vm.assert_called_with(instance.name) mock_wait_for_power_off.assert_has_calls(calls) self.assertFalse(result) @mock.patch('nova.virt.hyperv.vmops.VMOps._set_vm_state') def test_pause(self, mock_set_vm_state): mock_instance = fake_instance.fake_instance_obj(self.context) self._vmops.pause(instance=mock_instance) mock_set_vm_state.assert_called_once_with( mock_instance, os_win_const.HYPERV_VM_STATE_PAUSED) @mock.patch('nova.virt.hyperv.vmops.VMOps._set_vm_state') def test_unpause(self, mock_set_vm_state): mock_instance = fake_instance.fake_instance_obj(self.context) self._vmops.unpause(instance=mock_instance) mock_set_vm_state.assert_called_once_with( mock_instance, os_win_const.HYPERV_VM_STATE_ENABLED) @mock.patch('nova.virt.hyperv.vmops.VMOps._set_vm_state') def test_suspend(self, mock_set_vm_state): mock_instance = fake_instance.fake_instance_obj(self.context) self._vmops.suspend(instance=mock_instance) mock_set_vm_state.assert_called_once_with( mock_instance, os_win_const.HYPERV_VM_STATE_SUSPENDED) @mock.patch('nova.virt.hyperv.vmops.VMOps._set_vm_state') def test_resume(self, mock_set_vm_state): mock_instance = fake_instance.fake_instance_obj(self.context) self._vmops.resume(instance=mock_instance) mock_set_vm_state.assert_called_once_with( mock_instance, os_win_const.HYPERV_VM_STATE_ENABLED) def _test_power_off(self, timeout, set_state_expected=True): instance = fake_instance.fake_instance_obj(self.context) with mock.patch.object(self._vmops, '_set_vm_state') as mock_set_state: self._vmops.power_off(instance, timeout) serialops = self._vmops._serial_console_ops serialops.stop_console_handler.assert_called_once_with( instance.name) if set_state_expected: mock_set_state.assert_called_once_with( instance, os_win_const.HYPERV_VM_STATE_DISABLED) def test_power_off_hard(self): self._test_power_off(timeout=0) @mock.patch("nova.virt.hyperv.vmops.VMOps._soft_shutdown") def test_power_off_exception(self, mock_soft_shutdown): mock_soft_shutdown.return_value = False self._test_power_off(timeout=1) @mock.patch("nova.virt.hyperv.vmops.VMOps._set_vm_state") @mock.patch("nova.virt.hyperv.vmops.VMOps._soft_shutdown") def test_power_off_soft(self, mock_soft_shutdown, mock_set_state): instance = fake_instance.fake_instance_obj(self.context) mock_soft_shutdown.return_value = True self._vmops.power_off(instance, 1, 0) serialops = self._vmops._serial_console_ops serialops.stop_console_handler.assert_called_once_with( instance.name) mock_soft_shutdown.assert_called_once_with( instance, 1, vmops.SHUTDOWN_TIME_INCREMENT) self.assertFalse(mock_set_state.called) @mock.patch("nova.virt.hyperv.vmops.VMOps._soft_shutdown") def test_power_off_unexisting_instance(self, mock_soft_shutdown): mock_soft_shutdown.side_effect = os_win_exc.HyperVVMNotFoundException( vm_name=mock.sentinel.vm_name) self._test_power_off(timeout=1, set_state_expected=False) @mock.patch('nova.virt.hyperv.vmops.VMOps._set_vm_state') def test_power_on(self, mock_set_vm_state): mock_instance = fake_instance.fake_instance_obj(self.context) self._vmops.power_on(mock_instance) mock_set_vm_state.assert_called_once_with( mock_instance, os_win_const.HYPERV_VM_STATE_ENABLED) @mock.patch('nova.virt.hyperv.volumeops.VolumeOps' '.fix_instance_volume_disk_paths') @mock.patch('nova.virt.hyperv.vmops.VMOps._set_vm_state') def test_power_on_having_block_devices(self, mock_set_vm_state, mock_fix_instance_vol_paths): mock_instance = fake_instance.fake_instance_obj(self.context) self._vmops.power_on(mock_instance, mock.sentinel.block_device_info) mock_fix_instance_vol_paths.assert_called_once_with( mock_instance.name, mock.sentinel.block_device_info) mock_set_vm_state.assert_called_once_with( mock_instance, os_win_const.HYPERV_VM_STATE_ENABLED) @mock.patch.object(vmops.VMOps, 'plug_vifs') def test_power_on_with_network_info(self, mock_plug_vifs): mock_instance = fake_instance.fake_instance_obj(self.context) self._vmops.power_on(mock_instance, network_info=mock.sentinel.fake_network_info) mock_plug_vifs.assert_called_once_with( mock_instance, mock.sentinel.fake_network_info) @mock.patch.object(vmops.VMOps, 'plug_vifs') def test_power_on_vifs_already_plugged(self, mock_plug_vifs): mock_instance = fake_instance.fake_instance_obj(self.context) self._vmops.power_on(mock_instance, should_plug_vifs=False) self.assertFalse(mock_plug_vifs.called) def _test_set_vm_state(self, state): mock_instance = fake_instance.fake_instance_obj(self.context) self._vmops._set_vm_state(mock_instance, state) self._vmops._vmutils.set_vm_state.assert_called_once_with( mock_instance.name, state) def test_set_vm_state_disabled(self): self._test_set_vm_state(state=os_win_const.HYPERV_VM_STATE_DISABLED) def test_set_vm_state_enabled(self): self._test_set_vm_state(state=os_win_const.HYPERV_VM_STATE_ENABLED) def test_set_vm_state_reboot(self): self._test_set_vm_state(state=os_win_const.HYPERV_VM_STATE_REBOOT) def test_set_vm_state_exception(self): mock_instance = fake_instance.fake_instance_obj(self.context) self._vmops._vmutils.set_vm_state.side_effect = ( os_win_exc.HyperVException) self.assertRaises(os_win_exc.HyperVException, self._vmops._set_vm_state, mock_instance, mock.sentinel.STATE) def test_get_vm_state(self): summary_info = {'EnabledState': os_win_const.HYPERV_VM_STATE_DISABLED} with mock.patch.object(self._vmops._vmutils, 'get_vm_summary_info') as mock_get_summary_info: mock_get_summary_info.return_value = summary_info response = self._vmops._get_vm_state(mock.sentinel.FAKE_VM_NAME) self.assertEqual(response, os_win_const.HYPERV_VM_STATE_DISABLED) @mock.patch.object(vmops.VMOps, '_get_vm_state') def test_wait_for_power_off_true(self, mock_get_state): mock_get_state.return_value = os_win_const.HYPERV_VM_STATE_DISABLED result = self._vmops._wait_for_power_off( mock.sentinel.FAKE_VM_NAME, vmops.SHUTDOWN_TIME_INCREMENT) mock_get_state.assert_called_with(mock.sentinel.FAKE_VM_NAME) self.assertTrue(result) @mock.patch.object(vmops.etimeout, "with_timeout") def test_wait_for_power_off_false(self, mock_with_timeout): mock_with_timeout.side_effect = etimeout.Timeout() result = self._vmops._wait_for_power_off( mock.sentinel.FAKE_VM_NAME, vmops.SHUTDOWN_TIME_INCREMENT) self.assertFalse(result) def test_create_vm_com_port_pipes(self): mock_instance = fake_instance.fake_instance_obj(self.context) mock_serial_ports = { 1: constants.SERIAL_PORT_TYPE_RO, 2: constants.SERIAL_PORT_TYPE_RW } self._vmops._create_vm_com_port_pipes(mock_instance, mock_serial_ports) expected_calls = [] for port_number, port_type in mock_serial_ports.items(): expected_pipe = r'\\.\pipe\%s_%s' % (mock_instance.uuid, port_type) expected_calls.append(mock.call(mock_instance.name, port_number, expected_pipe)) mock_set_conn = self._vmops._vmutils.set_vm_serial_port_connection mock_set_conn.assert_has_calls(expected_calls) def test_list_instance_uuids(self): fake_uuid = '4f54fb69-d3a2-45b7-bb9b-b6e6b3d893b3' with mock.patch.object(self._vmops._vmutils, 'list_instance_notes') as mock_list_notes: mock_list_notes.return_value = [('fake_name', [fake_uuid])] response = self._vmops.list_instance_uuids() mock_list_notes.assert_called_once_with() self.assertEqual(response, [fake_uuid]) def test_copy_vm_dvd_disks(self): fake_paths = [mock.sentinel.FAKE_DVD_PATH1, mock.sentinel.FAKE_DVD_PATH2] mock_copy = self._vmops._pathutils.copyfile mock_get_dvd_disk_paths = self._vmops._vmutils.get_vm_dvd_disk_paths mock_get_dvd_disk_paths.return_value = fake_paths self._vmops._pathutils.get_instance_dir.return_value = ( mock.sentinel.FAKE_DEST_PATH) self._vmops.copy_vm_dvd_disks(mock.sentinel.FAKE_VM_NAME, mock.sentinel.FAKE_DEST_HOST) mock_get_dvd_disk_paths.assert_called_with(mock.sentinel.FAKE_VM_NAME) self._vmops._pathutils.get_instance_dir.assert_called_once_with( mock.sentinel.FAKE_VM_NAME, remote_server=mock.sentinel.FAKE_DEST_HOST) self.assertEqual(2, mock_copy.call_count) mock_copy.assert_has_calls([mock.call(mock.sentinel.FAKE_DVD_PATH1, mock.sentinel.FAKE_DEST_PATH), mock.call(mock.sentinel.FAKE_DVD_PATH2, mock.sentinel.FAKE_DEST_PATH)]) def test_plug_vifs(self): mock_instance = fake_instance.fake_instance_obj(self.context) fake_vif1 = {'id': mock.sentinel.ID1, 'type': mock.sentinel.vif_type1} fake_vif2 = {'id': mock.sentinel.ID2, 'type': mock.sentinel.vif_type2} mock_network_info = [fake_vif1, fake_vif2] calls = [mock.call(mock_instance, fake_vif1), mock.call(mock_instance, fake_vif2)] self._vmops.plug_vifs(mock_instance, network_info=mock_network_info) self._vmops._vif_driver.plug.assert_has_calls(calls) def test_unplug_vifs(self): mock_instance = fake_instance.fake_instance_obj(self.context) fake_vif1 = {'id': mock.sentinel.ID1, 'type': mock.sentinel.vif_type1} fake_vif2 = {'id': mock.sentinel.ID2, 'type': mock.sentinel.vif_type2} mock_network_info = [fake_vif1, fake_vif2] calls = [mock.call(mock_instance, fake_vif1), mock.call(mock_instance, fake_vif2)] self._vmops.unplug_vifs(mock_instance, network_info=mock_network_info) self._vmops._vif_driver.unplug.assert_has_calls(calls) def _setup_remotefx_mocks(self): mock_instance = fake_instance.fake_instance_obj(self.context) mock_instance.flavor.extra_specs = { 'os:resolution': os_win_const.REMOTEFX_MAX_RES_1920x1200, 'os:monitors': '2', 'os:vram': '256'} return mock_instance def test_configure_remotefx_not_required(self): self.flags(enable_remotefx=False, group='hyperv') mock_instance = fake_instance.fake_instance_obj(self.context) self._vmops._configure_remotefx(mock_instance, mock.sentinel.VM_GEN) def test_configure_remotefx_exception_enable_config(self): self.flags(enable_remotefx=False, group='hyperv') mock_instance = self._setup_remotefx_mocks() self.assertRaises(exception.InstanceUnacceptable, self._vmops._configure_remotefx, mock_instance, mock.sentinel.VM_GEN) def test_configure_remotefx_exception_server_feature(self): self.flags(enable_remotefx=True, group='hyperv') mock_instance = self._setup_remotefx_mocks() self._vmops._hostutils.check_server_feature.return_value = False self.assertRaises(exception.InstanceUnacceptable, self._vmops._configure_remotefx, mock_instance, mock.sentinel.VM_GEN) def test_configure_remotefx_exception_vm_gen(self): self.flags(enable_remotefx=True, group='hyperv') mock_instance = self._setup_remotefx_mocks() self._vmops._hostutils.check_server_feature.return_value = True self._vmops._vmutils.vm_gen_supports_remotefx.return_value = False self.assertRaises(exception.InstanceUnacceptable, self._vmops._configure_remotefx, mock_instance, mock.sentinel.VM_GEN) def test_configure_remotefx(self): self.flags(enable_remotefx=True, group='hyperv') mock_instance = self._setup_remotefx_mocks() self._vmops._hostutils.check_server_feature.return_value = True self._vmops._vmutils.vm_gen_supports_remotefx.return_value = True extra_specs = mock_instance.flavor.extra_specs self._vmops._configure_remotefx(mock_instance, constants.VM_GEN_1) mock_enable_remotefx = ( self._vmops._vmutils.enable_remotefx_video_adapter) mock_enable_remotefx.assert_called_once_with( mock_instance.name, int(extra_specs['os:monitors']), extra_specs['os:resolution'], int(extra_specs['os:vram']) * units.Mi) @mock.patch.object(vmops.VMOps, '_get_vm_state') def test_check_hotplug_available_vm_disabled(self, mock_get_vm_state): fake_vm = fake_instance.fake_instance_obj(self.context) mock_get_vm_state.return_value = os_win_const.HYPERV_VM_STATE_DISABLED result = self._vmops._check_hotplug_available(fake_vm) self.assertTrue(result) mock_get_vm_state.assert_called_once_with(fake_vm.name) self.assertFalse( self._vmops._hostutils.check_min_windows_version.called) self.assertFalse(self._vmops._vmutils.get_vm_generation.called) @mock.patch.object(vmops.VMOps, '_get_vm_state') def _test_check_hotplug_available( self, mock_get_vm_state, expected_result=False, vm_gen=constants.VM_GEN_2, windows_version=_WIN_VERSION_10): fake_vm = fake_instance.fake_instance_obj(self.context) mock_get_vm_state.return_value = os_win_const.HYPERV_VM_STATE_ENABLED self._vmops._vmutils.get_vm_generation.return_value = vm_gen fake_check_win_vers = self._vmops._hostutils.check_min_windows_version fake_check_win_vers.return_value = ( windows_version == self._WIN_VERSION_10) result = self._vmops._check_hotplug_available(fake_vm) self.assertEqual(expected_result, result) mock_get_vm_state.assert_called_once_with(fake_vm.name) fake_check_win_vers.assert_called_once_with(10, 0) def test_check_if_hotplug_available(self): self._test_check_hotplug_available(expected_result=True) def test_check_if_hotplug_available_gen1(self): self._test_check_hotplug_available( expected_result=False, vm_gen=constants.VM_GEN_1) def test_check_if_hotplug_available_win_6_3(self): self._test_check_hotplug_available( expected_result=False, windows_version=self._WIN_VERSION_6_3) @mock.patch.object(vmops.VMOps, '_check_hotplug_available') def test_attach_interface(self, mock_check_hotplug_available): mock_check_hotplug_available.return_value = True fake_vm = fake_instance.fake_instance_obj(self.context) fake_vif = test_virtual_interface.fake_vif self._vmops.attach_interface(fake_vm, fake_vif) mock_check_hotplug_available.assert_called_once_with(fake_vm) self._vmops._vif_driver.plug.assert_called_once_with( fake_vm, fake_vif) self._vmops._vmutils.create_nic.assert_called_once_with( fake_vm.name, fake_vif['id'], fake_vif['address']) @mock.patch.object(vmops.VMOps, '_check_hotplug_available') def test_attach_interface_failed(self, mock_check_hotplug_available): mock_check_hotplug_available.return_value = False self.assertRaises(exception.InterfaceAttachFailed, self._vmops.attach_interface, mock.MagicMock(), mock.sentinel.fake_vif) @mock.patch.object(vmops.VMOps, '_check_hotplug_available') def test_detach_interface(self, mock_check_hotplug_available): mock_check_hotplug_available.return_value = True fake_vm = fake_instance.fake_instance_obj(self.context) fake_vif = test_virtual_interface.fake_vif self._vmops.detach_interface(fake_vm, fake_vif) mock_check_hotplug_available.assert_called_once_with(fake_vm) self._vmops._vif_driver.unplug.assert_called_once_with( fake_vm, fake_vif) self._vmops._vmutils.destroy_nic.assert_called_once_with( fake_vm.name, fake_vif['id']) @mock.patch.object(vmops.VMOps, '_check_hotplug_available') def test_detach_interface_failed(self, mock_check_hotplug_available): mock_check_hotplug_available.return_value = False self.assertRaises(exception.InterfaceDetachFailed, self._vmops.detach_interface, mock.MagicMock(), mock.sentinel.fake_vif) @mock.patch.object(vmops.VMOps, '_check_hotplug_available') def test_detach_interface_missing_instance(self, mock_check_hotplug): mock_check_hotplug.side_effect = os_win_exc.HyperVVMNotFoundException( vm_name='fake_vm') self.assertRaises(exception.InterfaceDetachFailed, self._vmops.detach_interface, mock.MagicMock(), mock.sentinel.fake_vif) @mock.patch('nova.virt.configdrive.required_by') @mock.patch.object(vmops.VMOps, '_create_root_vhd') @mock.patch.object(vmops.VMOps, 'get_image_vm_generation') @mock.patch.object(vmops.VMOps, '_attach_drive') @mock.patch.object(vmops.VMOps, '_create_config_drive') @mock.patch.object(vmops.VMOps, 'attach_config_drive') @mock.patch.object(vmops.VMOps, '_detach_config_drive') @mock.patch.object(vmops.VMOps, 'power_on') def test_rescue_instance(self, mock_power_on, mock_detach_config_drive, mock_attach_config_drive, mock_create_config_drive, mock_attach_drive, mock_get_image_vm_gen, mock_create_root_vhd, mock_configdrive_required): mock_image_meta = mock.MagicMock() mock_vm_gen = constants.VM_GEN_2 mock_instance = fake_instance.fake_instance_obj(self.context) mock_configdrive_required.return_value = True mock_create_root_vhd.return_value = mock.sentinel.rescue_vhd_path mock_get_image_vm_gen.return_value = mock_vm_gen self._vmops._vmutils.get_vm_generation.return_value = mock_vm_gen self._vmops._pathutils.lookup_root_vhd_path.return_value = ( mock.sentinel.root_vhd_path) mock_create_config_drive.return_value = ( mock.sentinel.rescue_configdrive_path) self._vmops.rescue_instance(self.context, mock_instance, mock.sentinel.network_info, mock_image_meta, mock.sentinel.rescue_password) mock_get_image_vm_gen.assert_called_once_with( mock_instance.uuid, mock_image_meta) self._vmops._vmutils.detach_vm_disk.assert_called_once_with( mock_instance.name, mock.sentinel.root_vhd_path, is_physical=False) mock_attach_drive.assert_called_once_with( mock_instance.name, mock.sentinel.rescue_vhd_path, 0, self._vmops._ROOT_DISK_CTRL_ADDR, vmops.VM_GENERATIONS_CONTROLLER_TYPES[mock_vm_gen]) self._vmops._vmutils.attach_scsi_drive.assert_called_once_with( mock_instance.name, mock.sentinel.root_vhd_path, drive_type=constants.DISK) mock_detach_config_drive.assert_called_once_with(mock_instance.name) mock_create_config_drive.assert_called_once_with( self.context, mock_instance, injected_files=None, admin_password=mock.sentinel.rescue_password, network_info=mock.sentinel.network_info, rescue=True) mock_attach_config_drive.assert_called_once_with( mock_instance, mock.sentinel.rescue_configdrive_path, mock_vm_gen) @mock.patch.object(vmops.VMOps, '_create_root_vhd') @mock.patch.object(vmops.VMOps, 'get_image_vm_generation') @mock.patch.object(vmops.VMOps, 'unrescue_instance') def _test_rescue_instance_exception(self, mock_unrescue, mock_get_image_vm_gen, mock_create_root_vhd, wrong_vm_gen=False, boot_from_volume=False, expected_exc=None): mock_vm_gen = constants.VM_GEN_1 image_vm_gen = (mock_vm_gen if not wrong_vm_gen else constants.VM_GEN_2) mock_image_meta = mock.MagicMock() mock_instance = fake_instance.fake_instance_obj(self.context) mock_get_image_vm_gen.return_value = image_vm_gen self._vmops._vmutils.get_vm_generation.return_value = mock_vm_gen self._vmops._pathutils.lookup_root_vhd_path.return_value = ( mock.sentinel.root_vhd_path if not boot_from_volume else None) self.assertRaises(expected_exc, self._vmops.rescue_instance, self.context, mock_instance, mock.sentinel.network_info, mock_image_meta, mock.sentinel.rescue_password) mock_unrescue.assert_called_once_with(mock_instance) def test_rescue_instance_wrong_vm_gen(self): # Test the case when the rescue image requires a different # vm generation than the actual rescued instance. self._test_rescue_instance_exception( wrong_vm_gen=True, expected_exc=exception.ImageUnacceptable) def test_rescue_instance_boot_from_volume(self): # Rescuing instances booted from volume is not supported. self._test_rescue_instance_exception( boot_from_volume=True, expected_exc=exception.InstanceNotRescuable) @mock.patch.object(fileutils, 'delete_if_exists') @mock.patch.object(vmops.VMOps, '_attach_drive') @mock.patch.object(vmops.VMOps, 'attach_config_drive') @mock.patch.object(vmops.VMOps, '_detach_config_drive') @mock.patch.object(vmops.VMOps, 'power_on') @mock.patch.object(vmops.VMOps, 'power_off') def test_unrescue_instance(self, mock_power_on, mock_power_off, mock_detach_config_drive, mock_attach_configdrive, mock_attach_drive, mock_delete_if_exists): mock_instance = fake_instance.fake_instance_obj(self.context) mock_vm_gen = constants.VM_GEN_2 self._vmops._vmutils.get_vm_generation.return_value = mock_vm_gen self._vmops._vmutils.is_disk_attached.return_value = False self._vmops._pathutils.lookup_root_vhd_path.side_effect = ( mock.sentinel.root_vhd_path, mock.sentinel.rescue_vhd_path) self._vmops._pathutils.lookup_configdrive_path.return_value = ( mock.sentinel.configdrive_path) self._vmops.unrescue_instance(mock_instance) self._vmops._pathutils.lookup_root_vhd_path.assert_has_calls( [mock.call(mock_instance.name), mock.call(mock_instance.name, rescue=True)]) self._vmops._vmutils.detach_vm_disk.assert_has_calls( [mock.call(mock_instance.name, mock.sentinel.root_vhd_path, is_physical=False), mock.call(mock_instance.name, mock.sentinel.rescue_vhd_path, is_physical=False)]) mock_attach_drive.assert_called_once_with( mock_instance.name, mock.sentinel.root_vhd_path, 0, self._vmops._ROOT_DISK_CTRL_ADDR, vmops.VM_GENERATIONS_CONTROLLER_TYPES[mock_vm_gen]) mock_detach_config_drive.assert_called_once_with(mock_instance.name, rescue=True, delete=True) mock_delete_if_exists.assert_called_once_with( mock.sentinel.rescue_vhd_path) self._vmops._vmutils.is_disk_attached.assert_called_once_with( mock.sentinel.configdrive_path, is_physical=False) mock_attach_configdrive.assert_called_once_with( mock_instance, mock.sentinel.configdrive_path, mock_vm_gen) mock_power_on.assert_called_once_with(mock_instance) @mock.patch.object(vmops.VMOps, 'power_off') def test_unrescue_instance_missing_root_image(self, mock_power_off): mock_instance = fake_instance.fake_instance_obj(self.context) mock_instance.vm_state = vm_states.RESCUED self._vmops._pathutils.lookup_root_vhd_path.return_value = None self.assertRaises(exception.InstanceNotRescuable, self._vmops.unrescue_instance, mock_instance) @mock.patch.object(volumeops.VolumeOps, 'bytes_per_sec_to_iops') @mock.patch.object(vmops.VMOps, '_get_scoped_flavor_extra_specs') @mock.patch.object(vmops.VMOps, '_get_instance_local_disks') def test_set_instance_disk_qos_specs(self, mock_get_local_disks, mock_get_scoped_specs, mock_bytes_per_sec_to_iops): fake_total_bytes_sec = 8 fake_total_iops_sec = 1 mock_instance = fake_instance.fake_instance_obj(self.context) mock_local_disks = [mock.sentinel.root_vhd_path, mock.sentinel.eph_vhd_path] mock_get_local_disks.return_value = mock_local_disks mock_set_qos_specs = self._vmops._vmutils.set_disk_qos_specs mock_get_scoped_specs.return_value = dict( disk_total_bytes_sec=fake_total_bytes_sec) mock_bytes_per_sec_to_iops.return_value = fake_total_iops_sec self._vmops._set_instance_disk_qos_specs(mock_instance) mock_bytes_per_sec_to_iops.assert_called_once_with( fake_total_bytes_sec) mock_get_local_disks.assert_called_once_with(mock_instance.name) expected_calls = [mock.call(disk_path, fake_total_iops_sec) for disk_path in mock_local_disks] mock_set_qos_specs.assert_has_calls(expected_calls) def test_get_instance_local_disks(self): fake_instance_dir = 'fake_instance_dir' fake_local_disks = [os.path.join(fake_instance_dir, disk_name) for disk_name in ['root.vhd', 'configdrive.iso']] fake_instance_disks = ['fake_remote_disk'] + fake_local_disks mock_get_storage_paths = self._vmops._vmutils.get_vm_storage_paths mock_get_storage_paths.return_value = [fake_instance_disks, []] mock_get_instance_dir = self._vmops._pathutils.get_instance_dir mock_get_instance_dir.return_value = fake_instance_dir ret_val = self._vmops._get_instance_local_disks( mock.sentinel.instance_name) self.assertEqual(fake_local_disks, ret_val) def test_get_scoped_flavor_extra_specs(self): # The flavor extra spect dict contains only string values. fake_total_bytes_sec = '8' mock_instance = fake_instance.fake_instance_obj(self.context) mock_instance.flavor.extra_specs = { 'spec_key': 'spec_value', 'quota:total_bytes_sec': fake_total_bytes_sec} ret_val = self._vmops._get_scoped_flavor_extra_specs( mock_instance, scope='quota') expected_specs = { 'total_bytes_sec': fake_total_bytes_sec } self.assertEqual(expected_specs, ret_val)
# -*- coding: utf-8 -*- """ Model tests for artifact """ from cStringIO import StringIO import time from datetime import datetime, timedelta from cgi import FieldStorage from pylons import c, g, request, response from nose.tools import assert_raises, assert_equals, with_setup import mock from mock import patch from ming.orm import session, ThreadLocalORMSession from webob import Request, Response, exc from allura import model as M from allura.lib.app_globals import Globals from allura.lib import helpers as h from allura.tests import TestController from alluratest.controller import setup_global_objects def setUp(): controller = TestController() controller.setUp() controller.app.get('/wiki/Home/') setup_global_objects() ThreadLocalORMSession.close_all() h.set_context('test', 'wiki', neighborhood='Projects') ThreadLocalORMSession.flush_all() ThreadLocalORMSession.close_all() def tearDown(): ThreadLocalORMSession.close_all() @with_setup(setUp, tearDown) def test_discussion_methods(): d = M.Discussion(shortname='test', name='test') assert d.thread_class() == M.Thread assert d.post_class() == M.Post assert d.attachment_class() == M.DiscussionAttachment ThreadLocalORMSession.flush_all() d.update_stats() ThreadLocalORMSession.flush_all() assert d.last_post == None assert d.url().endswith('wiki/_discuss/') assert d.index()['name_s'] == 'test' assert d.subscription() == None assert d.find_posts().count() == 0 jsn = d.__json__() assert jsn['name'] == d.name d.delete() ThreadLocalORMSession.flush_all() ThreadLocalORMSession.close_all() @with_setup(setUp, tearDown) def test_thread_methods(): d = M.Discussion(shortname='test', name='test') t = M.Thread.new(discussion_id=d._id, subject='Test Thread') assert t.discussion_class() == M.Discussion assert t.post_class() == M.Post assert t.attachment_class() == M.DiscussionAttachment p0 = t.post('This is a post') p1 = t.post('This is another post') time.sleep(0.25) p2 = t.post('This is a reply', parent_id=p0._id) ThreadLocalORMSession.flush_all() ThreadLocalORMSession.close_all() d = M.Discussion.query.get(shortname='test') t = d.threads[0] assert d.last_post is not None assert t.last_post is not None t.create_post_threads(t.posts) posts0 = t.find_posts(page=0, limit=10, style='threaded') posts1 = t.find_posts(page=0, limit=10, style='timestamp') assert posts0 != posts1 ts = p0.timestamp.replace( microsecond=int(p0.timestamp.microsecond // 1000) * 1000) posts2 = t.find_posts(page=0, limit=10, style='threaded', timestamp=ts) assert len(posts2) > 0 assert 'wiki/_discuss/' in t.url() assert t.index()['views_i'] == 0 assert not t.subscription t.subscription = True assert t.subscription t.subscription = False assert not t.subscription assert t.top_level_posts().count() == 2 assert t.post_count == 3 jsn = t.__json__() assert '_id' in jsn assert_equals(len(jsn['posts']), 3) (p.approve() for p in (p0, p1)) assert t.num_replies == 2 t.spam() assert t.num_replies == 0 ThreadLocalORMSession.flush_all() assert len(t.find_posts()) == 0 t.delete() @with_setup(setUp, tearDown) def test_thread_new(): with mock.patch('allura.model.discuss.h.nonce') as nonce: nonce.side_effect = ['deadbeef', 'deadbeef', 'beefdead'] d = M.Discussion(shortname='test', name='test') t1 = M.Thread.new(discussion_id=d._id, subject='Test Thread One') t2 = M.Thread.new(discussion_id=d._id, subject='Test Thread Two') ThreadLocalORMSession.flush_all() session(t1).expunge(t1) session(t2).expunge(t2) t1_2 = M.Thread.query.get(_id=t1._id) t2_2 = M.Thread.query.get(_id=t2._id) assert_equals(t1._id, 'deadbeef') assert_equals(t2._id, 'beefdead') assert_equals(t1_2.subject, 'Test Thread One') assert_equals(t2_2.subject, 'Test Thread Two') @with_setup(setUp, tearDown) def test_post_methods(): d = M.Discussion(shortname='test', name='test') t = M.Thread.new(discussion_id=d._id, subject='Test Thread') p = t.post('This is a post') p2 = t.post('This is another post') assert p.discussion_class() == M.Discussion assert p.thread_class() == M.Thread assert p.attachment_class() == M.DiscussionAttachment p.commit() assert p.parent is None assert p.subject == 'Test Thread' assert p.attachments.count() == 0 assert 'Test Admin' in p.summary() assert 'wiki/_discuss' in p.url() assert p.reply_subject() == 'Re: Test Thread' assert p.link_text() == p.subject ss = p.history().first() assert 'Version' in ss.index()['title_s'] assert '#' in ss.shorthand_id() jsn = p.__json__() assert jsn["thread_id"] == t._id (p.approve() for p in (p, p2)) assert t.num_replies == 1 p2.spam() assert t.num_replies == 0 p.spam() assert t.num_replies == 0 p.delete() assert t.num_replies == 0 @with_setup(setUp, tearDown) def test_attachment_methods(): d = M.Discussion(shortname='test', name='test') t = M.Thread.new(discussion_id=d._id, subject='Test Thread') p = t.post('This is a post') p_att = p.attach('foo.text', StringIO('Hello, world!'), discussion_id=d._id, thread_id=t._id, post_id=p._id) t_att = p.attach('foo2.text', StringIO('Hello, thread!'), discussion_id=d._id, thread_id=t._id) d_att = p.attach('foo3.text', StringIO('Hello, discussion!'), discussion_id=d._id) ThreadLocalORMSession.flush_all() assert p_att.post == p assert p_att.thread == t assert p_att.discussion == d for att in (p_att, t_att, d_att): assert 'wiki/_discuss' in att.url() assert 'attachment/' in att.url() # Test notification in mail t = M.Thread.new(discussion_id=d._id, subject='Test comment notification') fs = FieldStorage() fs.name='file_info' fs.filename='fake.txt' fs.type = 'text/plain' fs.file=StringIO('this is the content of the fake file\n') p = t.post(text=u'test message', forum= None, subject= '', file_info=fs) ThreadLocalORMSession.flush_all() n = M.Notification.query.get(subject=u'[test:wiki] Test comment notification') assert_equals(u'test message\n\n\nAttachment: fake.txt (37 Bytes; text/plain)', n.text) @with_setup(setUp, tearDown) def test_discussion_delete(): d = M.Discussion(shortname='test', name='test') t = M.Thread.new(discussion_id=d._id, subject='Test Thread') p = t.post('This is a post') p.attach('foo.text', StringIO(''), discussion_id=d._id, thread_id=t._id, post_id=p._id) r = M.ArtifactReference.from_artifact(d) rid = d.index_id() ThreadLocalORMSession.flush_all() d.delete() ThreadLocalORMSession.flush_all() assert_equals(M.ArtifactReference.query.find(dict(_id=rid)).count(), 0) @with_setup(setUp, tearDown) def test_thread_delete(): d = M.Discussion(shortname='test', name='test') t = M.Thread.new(discussion_id=d._id, subject='Test Thread') p = t.post('This is a post') p.attach('foo.text', StringIO(''), discussion_id=d._id, thread_id=t._id, post_id=p._id) ThreadLocalORMSession.flush_all() t.delete() @with_setup(setUp, tearDown) def test_post_delete(): d = M.Discussion(shortname='test', name='test') t = M.Thread.new(discussion_id=d._id, subject='Test Thread') p = t.post('This is a post') p.attach('foo.text', StringIO(''), discussion_id=d._id, thread_id=t._id, post_id=p._id) ThreadLocalORMSession.flush_all() p.delete() @with_setup(setUp, tearDown) def test_post_permission_check(): d = M.Discussion(shortname='test', name='test') t = M.Thread.new(discussion_id=d._id, subject='Test Thread') c.user = M.User.anonymous() try: p1 = t.post('This post will fail the check.') assert False, "Expected an anonymous post to fail." except exc.HTTPUnauthorized: pass p2 = t.post('This post will pass the check.', ignore_security=True) @with_setup(setUp, tearDown) def test_post_url_paginated(): d = M.Discussion(shortname='test', name='test') t = M.Thread(discussion_id=d._id, subject='Test Thread') p = [] # posts in display order ts = datetime.utcnow() - timedelta(days=1) for i in range(5): ts += timedelta(minutes=1) p.append(t.post('This is a post #%s' % i, timestamp=ts)) ts += timedelta(minutes=1) p.insert(1, t.post( 'This is reply #0 to post #0', parent_id=p[0]._id, timestamp=ts)) ts += timedelta(minutes=1) p.insert(2, t.post( 'This is reply #1 to post #0', parent_id=p[0]._id, timestamp=ts)) ts += timedelta(minutes=1) p.insert(4, t.post( 'This is reply #0 to post #1', parent_id=p[3]._id, timestamp=ts)) ts += timedelta(minutes=1) p.insert(6, t.post( 'This is reply #0 to post #2', parent_id=p[5]._id, timestamp=ts)) ts += timedelta(minutes=1) p.insert(7, t.post( 'This is reply #1 to post #2', parent_id=p[5]._id, timestamp=ts)) ts += timedelta(minutes=1) p.insert(8, t.post( 'This is reply #0 to reply #1 to post #2', parent_id=p[7]._id, timestamp=ts)) # with default paging limit for _p in p: url = t.url() + '?limit=50#' + _p.slug assert _p.url_paginated() == url, _p.url_paginated() # with user paging limit limit = 3 c.user.set_pref('results_per_page', limit) for i, _p in enumerate(p): page = i / limit url = t.url() + '?limit=%s' % limit if page > 0: url += '&page=%s' % page url += '#' + _p.slug assert _p.url_paginated() == url, _p.url_paginated() @with_setup(setUp, tearDown) def test_post_notify(): d = M.Discussion(shortname='test', name='test') d.monitoring_email = 'darthvader@deathstar.org' t = M.Thread.new(discussion_id=d._id, subject='Test Thread') with patch('allura.model.notification.Notification.send_simple') as send: t.post('This is a post') send.assert_called_with(d.monitoring_email) c.app.config.project.notifications_disabled = True with patch('allura.model.notification.Notification.send_simple') as send: t.post('Another post') try: send.assert_called_with(d.monitoring_email) except AssertionError: pass # method not called as expected else: assert False, 'send_simple must not be called'
import os import sys import time import math import numpy as np import theano import theano.tensor as T import theano.tensor.shared_randomstreams from util import datapy, color, paramgraphics from optimization import optimizer from layer import FullyConnected, nonlinearity from layer import GaussianHidden, NoParamsBernoulliVisiable,Pegasos from layer import ConvMaxPool, UnpoolConvNon def cmmva_6layer_dropout_mnist_60000(seed=0, start_layer=0, end_layer=1, dropout_flag=1, drop_inverses_flag=0, learning_rate=3e-5, predir=None, n_batch=144, dataset='mnist.pkl.gz', batch_size=500, nkerns=[20, 50], n_hidden=[500, 50]): """ Implementation of convolutional MMVA """ #cp->cd->cpd->cd->c nkerns=[32, 32, 64, 64, 64] drops=[1, 0, 1, 0, 0, 1] #skerns=[5, 3, 3, 3, 3] #pools=[2, 1, 1, 2, 1] #modes=['same']*5 n_hidden=[500, 50] drop_inverses=[1,] # 28->12->12->5->5/5*5*64->500->50->500->5*5*64/5->5->12->12->28 if dataset=='mnist.pkl.gz': dim_input=(28, 28) colorImg=False D = 1.0 C = 1.0 if os.environ.has_key('C'): C = np.cast['float32'](float((os.environ['C']))) if os.environ.has_key('D'): D = np.cast['float32'](float((os.environ['D']))) color.printRed('D '+str(D)+' C '+str(C)) logdir = 'results/supervised/cmmva/mnist/cmmva_6layer_60000_'+str(nkerns)+str(n_hidden)+'_D_'+str(D)+'_C_'+str(C)+'_'+str(learning_rate)+'_' if predir is not None: logdir +='pre_' if dropout_flag == 1: logdir += ('dropout_'+str(drops)+'_') if drop_inverses_flag==1: logdir += ('inversedropout_'+str(drop_inverses)+'_') logdir += str(int(time.time()))+'/' if not os.path.exists(logdir): os.makedirs(logdir) print 'logdir:', logdir, 'predir', predir print 'cmmva_6layer_mnist_60000', nkerns, n_hidden, seed, drops, drop_inverses, dropout_flag, drop_inverses_flag with open(logdir+'hook.txt', 'a') as f: print >>f, 'logdir:', logdir, 'predir', predir print >>f, 'cmmva_6layer_mnist_60000', nkerns, n_hidden, seed, drops, drop_inverses, dropout_flag, drop_inverses_flag datasets = datapy.load_data_gpu_60000(dataset, have_matrix=True) train_set_x, train_set_y, train_y_matrix = datasets[0] valid_set_x, valid_set_y, valid_y_matrix = datasets[1] test_set_x, test_set_y, test_y_matrix = datasets[2] # compute number of minibatches for training, validation and testing n_train_batches = train_set_x.get_value(borrow=True).shape[0] / batch_size n_valid_batches = valid_set_x.get_value(borrow=True).shape[0] / batch_size n_test_batches = test_set_x.get_value(borrow=True).shape[0] / batch_size ###################### # BUILD ACTUAL MODEL # ###################### print '... building the model' # allocate symbolic variables for the data index = T.lscalar() # index to a [mini]batch x = T.matrix('x') # the data is presented as rasterized images y = T.ivector('y') # the labels are presented as 1D vector of # [int] labels y_matrix = T.imatrix('y_matrix') random_z = T.matrix('random_z') drop = T.iscalar('drop') drop_inverse = T.iscalar('drop_inverse') activation = nonlinearity.relu rng = np.random.RandomState(seed) rng_share = theano.tensor.shared_randomstreams.RandomStreams(0) input_x = x.reshape((batch_size, 1, 28, 28)) recg_layer = [] cnn_output = [] #1 recg_layer.append(ConvMaxPool.ConvMaxPool( rng, image_shape=(batch_size, 1, 28, 28), filter_shape=(nkerns[0], 1, 5, 5), poolsize=(2, 2), border_mode='valid', activation=activation )) if drops[0]==1: cnn_output.append(recg_layer[-1].drop_output(input=input_x, drop=drop, rng=rng_share)) else: cnn_output.append(recg_layer[-1].output(input=input_x)) #2 recg_layer.append(ConvMaxPool.ConvMaxPool( rng, image_shape=(batch_size, nkerns[0], 12, 12), filter_shape=(nkerns[1], nkerns[0], 3, 3), poolsize=(1, 1), border_mode='same', activation=activation )) if drops[1]==1: cnn_output.append(recg_layer[-1].drop_output(cnn_output[-1], drop=drop, rng=rng_share)) else: cnn_output.append(recg_layer[-1].output(cnn_output[-1])) #3 recg_layer.append(ConvMaxPool.ConvMaxPool( rng, image_shape=(batch_size, nkerns[1], 12, 12), filter_shape=(nkerns[2], nkerns[1], 3, 3), poolsize=(2, 2), border_mode='valid', activation=activation )) if drops[2]==1: cnn_output.append(recg_layer[-1].drop_output(cnn_output[-1], drop=drop, rng=rng_share)) else: cnn_output.append(recg_layer[-1].output(cnn_output[-1])) #4 recg_layer.append(ConvMaxPool.ConvMaxPool( rng, image_shape=(batch_size, nkerns[2], 5, 5), filter_shape=(nkerns[3], nkerns[2], 3, 3), poolsize=(1, 1), border_mode='same', activation=activation )) if drops[3]==1: cnn_output.append(recg_layer[-1].drop_output(cnn_output[-1], drop=drop, rng=rng_share)) else: cnn_output.append(recg_layer[-1].output(cnn_output[-1])) #5 recg_layer.append(ConvMaxPool.ConvMaxPool( rng, image_shape=(batch_size, nkerns[3], 5, 5), filter_shape=(nkerns[4], nkerns[3], 3, 3), poolsize=(1, 1), border_mode='same', activation=activation )) if drops[4]==1: cnn_output.append(recg_layer[-1].drop_output(cnn_output[-1], drop=drop, rng=rng_share)) else: cnn_output.append(recg_layer[-1].output(cnn_output[-1])) mlp_input_x = cnn_output[-1].flatten(2) activations = [] #1 recg_layer.append(FullyConnected.FullyConnected( rng=rng, n_in= 5 * 5 * nkerns[-1], n_out=n_hidden[0], activation=activation )) if drops[-1]==1: activations.append(recg_layer[-1].drop_output(input=mlp_input_x, drop=drop, rng=rng_share)) else: activations.append(recg_layer[-1].output(input=mlp_input_x)) features = T.concatenate(activations[start_layer:end_layer], axis=1) color.printRed('feature dimension: '+str(np.sum(n_hidden[start_layer:end_layer]))) classifier = Pegasos.Pegasos( input= features, rng=rng, n_in=np.sum(n_hidden[start_layer:end_layer]), n_out=10, weight_decay=0, loss=1, std=1e-2 ) recg_layer.append(GaussianHidden.GaussianHidden( rng=rng, input=activations[-1], n_in=n_hidden[0], n_out = n_hidden[1], activation=None )) z = recg_layer[-1].sample_z(rng_share) gene_layer = [] z_output = [] random_z_output = [] #1 gene_layer.append(FullyConnected.FullyConnected( rng=rng, n_in=n_hidden[1], n_out = n_hidden[0], activation=activation )) z_output.append(gene_layer[-1].output(input=z)) random_z_output.append(gene_layer[-1].output(input=random_z)) #2 gene_layer.append(FullyConnected.FullyConnected( rng=rng, n_in=n_hidden[0], n_out = 5*5*nkerns[-1], activation=activation )) if drop_inverses[0]==1: z_output.append(gene_layer[-1].drop_output(input=z_output[-1], drop=drop_inverse, rng=rng_share)) random_z_output.append(gene_layer[-1].drop_output(input=random_z_output[-1], drop=drop_inverse, rng=rng_share)) else: z_output.append(gene_layer[-1].output(input=z_output[-1])) random_z_output.append(gene_layer[-1].output(input=random_z_output[-1])) input_z = z_output[-1].reshape((batch_size, nkerns[-1], 5, 5)) input_random_z = random_z_output[-1].reshape((n_batch, nkerns[-1], 5, 5)) #1 gene_layer.append(UnpoolConvNon.UnpoolConvNon( rng, image_shape=(batch_size, nkerns[-1], 5, 5), filter_shape=(nkerns[-2], nkerns[-1], 3, 3), poolsize=(1, 1), border_mode='same', activation=activation )) z_output.append(gene_layer[-1].output(input=input_z)) random_z_output.append(gene_layer[-1].output_random_generation(input=input_random_z, n_batch=n_batch)) #2 gene_layer.append(UnpoolConvNon.UnpoolConvNon( rng, image_shape=(batch_size, nkerns[-2], 5, 5), filter_shape=(nkerns[-3], nkerns[-2], 3, 3), poolsize=(2, 2), border_mode='full', activation=activation )) z_output.append(gene_layer[-1].output(input=z_output[-1])) random_z_output.append(gene_layer[-1].output_random_generation(input=random_z_output[-1], n_batch=n_batch)) #3 gene_layer.append(UnpoolConvNon.UnpoolConvNon( rng, image_shape=(batch_size, nkerns[-3], 12, 12), filter_shape=(nkerns[-4], nkerns[-3], 3, 3), poolsize=(1, 1), border_mode='same', activation=activation )) z_output.append(gene_layer[-1].output(input=z_output[-1])) random_z_output.append(gene_layer[-1].output_random_generation(input=random_z_output[-1], n_batch=n_batch)) #4 gene_layer.append(UnpoolConvNon.UnpoolConvNon( rng, image_shape=(batch_size, nkerns[-4], 12, 12), filter_shape=(nkerns[-5], nkerns[-4], 3, 3), poolsize=(1, 1), border_mode='same', activation=activation )) z_output.append(gene_layer[-1].output(input=z_output[-1])) random_z_output.append(gene_layer[-1].output_random_generation(input=random_z_output[-1], n_batch=n_batch)) #5 stochastic layer # for the last layer, the nonliearity should be sigmoid to achieve mean of Bernoulli gene_layer.append(UnpoolConvNon.UnpoolConvNon( rng, image_shape=(batch_size, nkerns[-5], 12, 12), filter_shape=(1, nkerns[-5], 5, 5), poolsize=(2, 2), border_mode='full', activation=nonlinearity.sigmoid )) z_output.append(gene_layer[-1].output(input=z_output[-1])) random_z_output.append(gene_layer[-1].output_random_generation(input=random_z_output[-1], n_batch=n_batch)) gene_layer.append(NoParamsBernoulliVisiable.NoParamsBernoulliVisiable( #rng=rng, #mean=z_output[-1], #data=input_x, )) logpx = gene_layer[-1].logpx(mean=z_output[-1], data=input_x) # 4-D tensor of random generation random_x_mean = random_z_output[-1] random_x = gene_layer[-1].sample_x(rng_share, random_x_mean) #L = (logpx + logpz - logqz).sum() lowerbound = ( (logpx + recg_layer[-1].logpz - recg_layer[-1].logqz).sum() ) hinge_loss = classifier.hinge_loss(10, y, y_matrix) * batch_size # # D is redundent, you could just set D = 1 and tune C and weight decay parameters # beacuse AdaM is scale-invariant # cost = D * lowerbound - C * hinge_loss #- classifier.L2_reg px = (logpx.sum()) pz = (recg_layer[-1].logpz.sum()) qz = (- recg_layer[-1].logqz.sum()) params=[] for g in gene_layer: params+=g.params for r in recg_layer: params+=r.params params+=classifier.params gparams = [T.grad(cost, param) for param in params] weight_decay=1.0/n_train_batches epsilon=1e-8 #get_optimizer = optimizer.get_adam_optimizer(learning_rate=learning_rate) l_r = theano.shared(np.asarray(learning_rate, dtype=np.float32)) get_optimizer = optimizer.get_adam_optimizer_max(learning_rate=l_r, decay1=0.1, decay2=0.001, weight_decay=weight_decay, epsilon=epsilon) with open(logdir+'hook.txt', 'a') as f: print >>f, 'AdaM', learning_rate, weight_decay, epsilon updates = get_optimizer(params,gparams) # compiling a Theano function that computes the mistakes that are made # by the model on a minibatch test_model = theano.function( inputs=[index], outputs=[classifier.errors(y), lowerbound, hinge_loss, cost], #outputs=layer[-1].errors(y), givens={ x: test_set_x[index * batch_size:(index + 1) * batch_size], y: test_set_y[index * batch_size:(index + 1) * batch_size], y_matrix: test_y_matrix[index * batch_size: (index + 1) * batch_size], drop: np.cast['int32'](0), drop_inverse: np.cast['int32'](0) } ) validate_model = theano.function( inputs=[index], outputs=[classifier.errors(y), lowerbound, hinge_loss, cost], #outputs=layer[-1].errors(y), givens={ x: valid_set_x[index * batch_size:(index + 1) * batch_size], y: valid_set_y[index * batch_size:(index + 1) * batch_size], y_matrix: valid_y_matrix[index * batch_size: (index + 1) * batch_size], drop: np.cast['int32'](0), drop_inverse: np.cast['int32'](0) } ) ''' Save parameters and activations ''' parameters = theano.function( inputs=[], outputs=params, ) train_activations = theano.function( inputs=[index], outputs=T.concatenate(activations, axis=1), givens={ x: train_set_x[index * batch_size: (index + 1) * batch_size], drop: np.cast['int32'](0), #drop_inverse: np.cast['int32'](0) #y: train_set_y[index * batch_size: (index + 1) * batch_size] } ) valid_activations = theano.function( inputs=[index], outputs=T.concatenate(activations, axis=1), givens={ x: valid_set_x[index * batch_size: (index + 1) * batch_size], drop: np.cast['int32'](0), #drop_inverse: np.cast['int32'](0) #y: valid_set_y[index * batch_size: (index + 1) * batch_size] } ) test_activations = theano.function( inputs=[index], outputs=T.concatenate(activations, axis=1), givens={ x: test_set_x[index * batch_size: (index + 1) * batch_size], drop: np.cast['int32'](0), #drop_inverse: np.cast['int32'](0) #y: test_set_y[index * batch_size: (index + 1) * batch_size] } ) # compiling a Theano function `train_model` that returns the cost, but # in the same time updates the parameter of the model based on the rules # defined in `updates` debug_model = theano.function( inputs=[index], outputs=[classifier.errors(y), lowerbound, px, pz, qz, hinge_loss, cost], #updates=updates, givens={ x: train_set_x[index * batch_size: (index + 1) * batch_size], y: train_set_y[index * batch_size: (index + 1) * batch_size], y_matrix: train_y_matrix[index * batch_size: (index + 1) * batch_size], drop: np.cast['int32'](dropout_flag), drop_inverse: np.cast['int32'](drop_inverses_flag) } ) random_generation = theano.function( inputs=[random_z], outputs=[random_x_mean.flatten(2), random_x.flatten(2)], givens={ #drop: np.cast['int32'](0), drop_inverse: np.cast['int32'](0) } ) train_bound_without_dropout = theano.function( inputs=[index], outputs=[classifier.errors(y), lowerbound, hinge_loss, cost], givens={ x: train_set_x[index * batch_size: (index + 1) * batch_size], y: train_set_y[index * batch_size: (index + 1) * batch_size], y_matrix: train_y_matrix[index * batch_size: (index + 1) * batch_size], drop: np.cast['int32'](0), drop_inverse: np.cast['int32'](0) } ) train_model = theano.function( inputs=[index], outputs=[classifier.errors(y), lowerbound, hinge_loss, cost], updates=updates, givens={ x: train_set_x[index * batch_size: (index + 1) * batch_size], y: train_set_y[index * batch_size: (index + 1) * batch_size], y_matrix: train_y_matrix[index * batch_size: (index + 1) * batch_size], drop: np.cast['int32'](dropout_flag), drop_inverse: np.cast['int32'](drop_inverses_flag) } ) # end-snippet-5 ################## # Pretrain MODEL # ################## if predir is not None: color.printBlue('... setting parameters') color.printBlue(predir) pre_train = np.load(predir+'model.npz') pre_train = pre_train['model'] # params include w and b, exclude it for (para, pre) in zip(params[:-2], pre_train): #print pre.shape para.set_value(pre) tmp = [debug_model(i) for i in xrange(n_train_batches)] tmp = (np.asarray(tmp)).mean(axis=0) / float(batch_size) print '------------------', tmp[1:5] # valid_error test_error epochs predy_test_stats = [1, 1, 0] predy_valid_stats = [1, 1, 0] best_validation_bound = -1000000.0 best_iter = 0 test_score = 0. start_time = time.clock() NaN_count = 0 epoch = 0 threshold = 0 validation_frequency = 1 generatition_frequency = 10 if predir is not None: threshold = 0 color.printRed('threshold, '+str(threshold) + ' generatition_frequency, '+str(generatition_frequency) +' validation_frequency, '+str(validation_frequency)) done_looping = False decay_epochs=500 n_epochs=600 ''' print 'test initialization...' pre_model = parameters() for i in xrange(len(pre_model)): pre_model[i] = np.asarray(pre_model[i]) print pre_model[i].shape, np.mean(pre_model[i]), np.var(pre_model[i]) print 'end test...' ''' while (epoch < n_epochs) and (not done_looping): epoch = epoch + 1 train_error = 0 train_lowerbound = 0 train_hinge_loss = 0 train_obj = 0 test_epoch = epoch - decay_epochs if test_epoch > 0 and test_epoch % 10 == 0: print l_r.get_value() with open(logdir+'hook.txt', 'a') as f: print >>f,l_r.get_value() l_r.set_value(np.cast['float32'](l_r.get_value()/3.0)) tmp_start1 = time.clock() for minibatch_index in xrange(n_train_batches): #print n_train_batches e, l, h, o = train_model(minibatch_index) train_error += e train_lowerbound += l train_hinge_loss += h train_obj += o # iteration number iter = (epoch - 1) * n_train_batches + minibatch_index if math.isnan(train_lowerbound): NaN_count+=1 color.printRed("NaN detected. Reverting to saved best parameters") print '---------------NaN_count:', NaN_count with open(logdir+'hook.txt', 'a') as f: print >>f, '---------------NaN_count:', NaN_count tmp = [debug_model(i) for i in xrange(n_train_batches)] tmp = (np.asarray(tmp)).mean(axis=0) / float(batch_size) tmp[0]*=batch_size print '------------------NaN check:', tmp with open(logdir+'hook.txt', 'a') as f: print >>f, '------------------NaN check:', tmp model = parameters() for i in xrange(len(model)): model[i] = np.asarray(model[i]).astype(np.float32) print model[i].shape, np.mean(model[i]), np.var(model[i]) print np.max(model[i]), np.min(model[i]) print np.all(np.isfinite(model[i])), np.any(np.isnan(model[i])) with open(logdir+'hook.txt', 'a') as f: print >>f, model[i].shape, np.mean(model[i]), np.var(model[i]) print >>f, np.max(model[i]), np.min(model[i]) print >>f, np.all(np.isfinite(model[i])), np.any(np.isnan(model[i])) best_before = np.load(logdir+'model.npz') best_before = best_before['model'] for (para, pre) in zip(params, best_before): para.set_value(pre) tmp = [debug_model(i) for i in xrange(n_train_batches)] tmp = (np.asarray(tmp)).mean(axis=0) / float(batch_size) tmp[0]*=batch_size print '------------------', tmp continue n_train=n_train_batches*batch_size #print 'optimization_time', time.clock() - tmp_start1 print epoch, 'stochastic training error', train_error / float(batch_size), train_lowerbound / float(n_train), train_hinge_loss / float(n_train), train_obj / float(n_train) with open(logdir+'hook.txt', 'a') as f: print >>f, epoch, 'stochastic training error', train_error / float(batch_size), train_lowerbound / float(n_train), train_hinge_loss / float(n_train), train_obj / float(n_train) if epoch % validation_frequency == 0: tmp_start2 = time.clock() # compute zero-one loss on validation set #train_stats = [train_bound_without_dropout(i) for i # in xrange(n_train_batches)] #this_train_stats = np.mean(train_stats, axis=0) #this_train_stats[1:] = this_train_stats[1:]/ float(batch_size) test_stats = [test_model(i) for i in xrange(n_test_batches)] this_test_stats = np.mean(test_stats, axis=0) this_test_stats[1:] = this_test_stats[1:]/ float(batch_size) print epoch, 'test error', this_test_stats with open(logdir+'hook.txt', 'a') as f: print >>f, epoch, 'test error', this_test_stats if epoch%100==0: model = parameters() for i in xrange(len(model)): model[i] = np.asarray(model[i]).astype(np.float32) #print model[i].shape, np.mean(model[i]), np.var(model[i]) np.savez(logdir+'model-'+str(epoch), model=model) tmp_start4=time.clock() if epoch % generatition_frequency == 0: tail='-'+str(epoch)+'.png' random_z = np.random.standard_normal((n_batch, n_hidden[-1])).astype(np.float32) _x_mean, _x = random_generation(random_z) #print _x.shape #print _x_mean.shape image = paramgraphics.mat_to_img(_x.T, dim_input, colorImg=colorImg) image.save(logdir+'samples'+tail, 'PNG') image = paramgraphics.mat_to_img(_x_mean.T, dim_input, colorImg=colorImg) image.save(logdir+'mean_samples'+tail, 'PNG') #print 'generation_time', time.clock() - tmp_start4 end_time = time.clock() print >> sys.stderr, ('The code for file ' + os.path.split(__file__)[1] + ' ran for %.2fm' % ((end_time - start_time) / 60.)) if NaN_count > 0: print '---------------NaN_count:', NaN_count with open(logdir+'hook.txt', 'a') as f: print >>f, '---------------NaN_count:', NaN_count if __name__ == '__main__': predir = None if os.environ.has_key('predir'): predir = os.environ['predir'] learning_rate=1e-3 if os.environ.has_key('learning_rate'): learning_rate = float(os.environ['learning_rate']) dropout_flag = 1 if os.environ.has_key('dropout_flag'): dropout_flag = int(os.environ['dropout_flag']) drop_inverses_flag = 0 if os.environ.has_key('drop_inverses_flag'): drop_inverses_flag = int(os.environ['drop_inverses_flag']) cmmva_6layer_dropout_mnist_60000(drop_inverses_flag=drop_inverses_flag, dropout_flag=dropout_flag, predir=predir,learning_rate=learning_rate)
import os from .. import constants, logger from . import ( base_classes, texture, material, geometry, object as object_, utilities, io, api ) class Scene(base_classes.BaseScene): """Class that handles the contruction of a Three scene""" _defaults = { constants.METADATA: constants.DEFAULT_METADATA.copy(), constants.GEOMETRIES: [], constants.MATERIALS: [], constants.IMAGES: [], constants.TEXTURES: [] } def __init__(self, filepath, options=None): logger.debug("Scene().__init__(%s, %s)", filepath, options) base_classes.BaseScene.__init__(self, filepath, options or {}) source_file = api.scene_name() if source_file: self[constants.METADATA][constants.SOURCE_FILE] = source_file @property def valid_types(self): """ :return: list of valid node types """ valid_types = [api.constants.MESH] if self.options.get(constants.CAMERAS): logger.info("Adding cameras to valid object types") valid_types.append(api.constants.CAMERA) if self.options.get(constants.LIGHTS): logger.info("Adding lights to valid object types") valid_types.append(api.constants.LAMP) return valid_types def geometry(self, value): """Find a geometry node that matches either a name or uuid value. :param value: name or uuid :type value: str """ logger.debug("Scene().geometry(%s)", value) return _find_node(value, self[constants.GEOMETRIES]) def image(self, value): """Find a image node that matches either a name or uuid value. :param value: name or uuid :type value: str """ logger.debug("Scene().image%s)", value) return _find_node(value, self[constants.IMAGES]) def material(self, value): """Find a material node that matches either a name or uuid value. :param value: name or uuid :type value: str """ logger.debug("Scene().material(%s)", value) return _find_node(value, self[constants.MATERIALS]) def parse(self): """Execute the parsing of the scene""" logger.debug("Scene().parse()") if self.options.get(constants.MAPS): self._parse_textures() if self.options.get(constants.MATERIALS): self._parse_materials() self._parse_geometries() self._parse_objects() def texture(self, value): """Find a texture node that matches either a name or uuid value. :param value: name or uuid :type value: str """ logger.debug("Scene().texture(%s)", value) return _find_node(value, self[constants.TEXTURES]) def write(self): """Write the parsed scene to disk.""" logger.debug("Scene().write()") data = {} embed_anim = self.options.get(constants.EMBED_ANIMATION, True) embed = self.options.get(constants.EMBED_GEOMETRY, True) compression = self.options.get(constants.COMPRESSION) extension = constants.EXTENSIONS.get( compression, constants.EXTENSIONS[constants.JSON]) export_dir = os.path.dirname(self.filepath) for key, value in self.items(): if key == constants.GEOMETRIES: geometries = [] for geom in value: if not embed_anim: geom.write_animation(export_dir) geom_data = geom.copy() if embed: geometries.append(geom_data) continue geo_type = geom_data[constants.TYPE].lower() if geo_type == constants.GEOMETRY.lower(): geom_data.pop(constants.DATA) elif geo_type == constants.BUFFER_GEOMETRY.lower(): geom_data.pop(constants.ATTRIBUTES) geom_data.pop(constants.METADATA) url = 'geometry.%s%s' % (geom.node, extension) geometry_file = os.path.join(export_dir, url) geom.write(filepath=geometry_file) geom_data[constants.URL] = os.path.basename(url) geometries.append(geom_data) data[key] = geometries elif isinstance(value, list): data[key] = [] for each in value: data[key].append(each.copy()) elif isinstance(value, dict): data[key] = value.copy() io.dump(self.filepath, data, options=self.options) if self.options.get(constants.COPY_TEXTURES): texture_folder = self.options.get(constants.TEXTURE_FOLDER) for geo in self[constants.GEOMETRIES]: logger.info("Copying textures from %s", geo.node) geo.copy_textures(texture_folder) def _parse_geometries(self): """Locate all geometry nodes and parse them""" logger.debug("Scene()._parse_geometries()") # this is an important step. please refer to the doc string # on the function for more information api.object.prep_meshes(self.options) geometries = [] # now iterate over all the extracted mesh nodes and parse each one for mesh in api.object.extracted_meshes(): logger.info("Parsing geometry %s", mesh) geo = geometry.Geometry(mesh, self) geo.parse() geometries.append(geo) logger.info("Added %d geometry nodes", len(geometries)) self[constants.GEOMETRIES] = geometries def _parse_materials(self): """Locate all non-orphaned materials and parse them""" logger.debug("Scene()._parse_materials()") materials = [] for material_name in api.material.used_materials(): logger.info("Parsing material %s", material_name) materials.append(material.Material(material_name, parent=self)) logger.info("Added %d material nodes", len(materials)) self[constants.MATERIALS] = materials def _parse_objects(self): """Locate all valid objects in the scene and parse them""" logger.debug("Scene()._parse_objects()") try: scene_name = self[constants.METADATA][constants.SOURCE_FILE] except KeyError: scene_name = constants.SCENE self[constants.OBJECT] = object_.Object(None, parent=self) self[constants.OBJECT][constants.TYPE] = constants.SCENE.title() self[constants.UUID] = utilities.id_from_name(scene_name) objects = [] for node in api.object.nodes(self.valid_types, self.options): logger.info("Parsing object %s", node) obj = object_.Object(node, parent=self[constants.OBJECT]) objects.append(obj) logger.info("Added %d object nodes", len(objects)) self[constants.OBJECT][constants.CHILDREN] = objects def _parse_textures(self): """Locate all non-orphaned textures and parse them""" logger.debug("Scene()._parse_textures()") textures = [] for texture_name in api.texture.textures(): logger.info("Parsing texture %s", texture_name) tex_inst = texture.Texture(texture_name, self) textures.append(tex_inst) logger.info("Added %d texture nodes", len(textures)) self[constants.TEXTURES] = textures def _find_node(value, manifest): """Find a node that matches either a name or uuid value. :param value: name or uuid :param manifest: manifest of nodes to search :type value: str :type manifest: list """ for index in manifest: uuid = index.get(constants.UUID) == value name = index.node == value if uuid or name: return index else: logger.debug("No matching node for %s", value)
from copy import copy import pytest from diofant import (Dict, ImmutableDenseNDimArray, ImmutableSparseNDimArray, Indexed, IndexedBase, Matrix, Rational, SparseMatrix, Symbol) from diofant.abc import i, j, w, x, y, z __all__ = () def test_ndim_array_initiation(): arr_with_one_element = ImmutableDenseNDimArray([23]) assert len(arr_with_one_element) == 1 assert arr_with_one_element[0] == 23 assert arr_with_one_element[:] == [23] assert arr_with_one_element.rank() == 1 arr_with_symbol_element = ImmutableDenseNDimArray([Symbol('x')]) assert len(arr_with_symbol_element) == 1 assert arr_with_symbol_element[0] == Symbol('x') assert arr_with_symbol_element[:] == [Symbol('x')] assert arr_with_symbol_element.rank() == 1 number5 = 5 vector = ImmutableDenseNDimArray.zeros(number5) assert len(vector) == number5 assert vector.shape == (number5,) assert vector.rank() == 1 vector = ImmutableSparseNDimArray.zeros(number5) assert len(vector) == number5 assert vector.shape == (number5,) assert vector._sparse_array == Dict() assert vector.rank() == 1 n_dim_array = ImmutableDenseNDimArray(range(3**4), (3, 3, 3, 3,)) assert len(n_dim_array) == 3 * 3 * 3 * 3 assert n_dim_array.shape == (3, 3, 3, 3) assert n_dim_array.rank() == 4 array_shape = (3, 3, 3, 3) sparse_array = ImmutableSparseNDimArray.zeros(*array_shape) assert len(sparse_array._sparse_array) == 0 assert len(sparse_array) == 3 * 3 * 3 * 3 assert n_dim_array.shape == array_shape assert n_dim_array.rank() == 4 one_dim_array = ImmutableDenseNDimArray([2, 3, 1]) assert len(one_dim_array) == 3 assert one_dim_array.shape == (3,) assert one_dim_array.rank() == 1 assert one_dim_array.tolist() == [2, 3, 1] shape = (3, 3) array_with_many_args = ImmutableSparseNDimArray.zeros(*shape) assert len(array_with_many_args) == 3 * 3 assert array_with_many_args.shape == shape assert array_with_many_args[0, 0] == 0 assert array_with_many_args.rank() == 2 def test_reshape(): array = ImmutableDenseNDimArray(range(50), 50) assert array.shape == (50,) assert array.rank() == 1 array = array.reshape(5, 5, 2) assert array.shape == (5, 5, 2) assert array.rank() == 3 assert len(array) == 50 pytest.raises(ValueError, lambda: array.reshape(1, 1)) def test_iterator(): array = ImmutableDenseNDimArray(range(4), (2, 2)) j = 0 for i in array: assert i == j j += 1 array = array.reshape(4) j = 0 for i in array: assert i == j j += 1 def test_sparse(): sparse_array = ImmutableSparseNDimArray([0, 0, 0, 1], (2, 2)) assert len(sparse_array) == 2 * 2 # dictionary where all data is, only non-zero entries are actually stored: assert len(sparse_array._sparse_array) == 1 assert list(sparse_array) == [0, 0, 0, 1] for i, j in zip(sparse_array, [0, 0, 0, 1]): assert i == j def sparse_assignment(): sparse_array[0, 0] = 123 assert len(sparse_array._sparse_array) == 1 pytest.raises(TypeError, sparse_assignment) assert len(sparse_array._sparse_array) == 1 assert sparse_array[0, 0] == 0 def test_calculation(): a = ImmutableDenseNDimArray([1]*9, (3, 3)) b = ImmutableDenseNDimArray([9]*9, (3, 3)) c = a + b for i in c: assert i == 10 assert c == ImmutableDenseNDimArray([10]*9, (3, 3)) assert c == ImmutableSparseNDimArray([10]*9, (3, 3)) c = b - a for i in c: assert i == 8 assert c == ImmutableDenseNDimArray([8]*9, (3, 3)) assert c == ImmutableSparseNDimArray([8]*9, (3, 3)) def test_ndim_array_converting(): dense_array = ImmutableDenseNDimArray([1, 2, 3, 4], (2, 2)) alist = dense_array.tolist() alist == [[1, 2], [3, 4]] matrix = dense_array.tomatrix() assert isinstance(matrix, Matrix) for i in range(len(dense_array)): assert dense_array[i] == matrix[i] assert matrix.shape == dense_array.shape assert ImmutableDenseNDimArray(matrix) == dense_array assert ImmutableDenseNDimArray(matrix.as_immutable()) == dense_array assert ImmutableDenseNDimArray(matrix.as_mutable()) == dense_array sparse_array = ImmutableSparseNDimArray([1, 2, 3, 4], (2, 2)) alist = sparse_array.tolist() assert alist == [[1, 2], [3, 4]] matrix = sparse_array.tomatrix() assert isinstance(matrix, SparseMatrix) pytest.raises(ValueError, lambda: ImmutableDenseNDimArray([1]*6, (2, 2, 2)).tomatrix()) for i in range(len(sparse_array)): assert sparse_array[i] == matrix[i] assert matrix.shape == sparse_array.shape assert ImmutableSparseNDimArray(matrix) == sparse_array assert ImmutableSparseNDimArray(matrix.as_immutable()) == sparse_array assert ImmutableSparseNDimArray(matrix.as_mutable()) == sparse_array def test_converting_functions(): arr_list = [1, 2, 3, 4] arr_matrix = Matrix(((1, 2), (3, 4))) # list arr_ndim_array = ImmutableDenseNDimArray(arr_list, (2, 2)) assert isinstance(arr_ndim_array, ImmutableDenseNDimArray) assert arr_matrix.tolist() == arr_ndim_array.tolist() # Matrix arr_ndim_array = ImmutableDenseNDimArray(arr_matrix) assert isinstance(arr_ndim_array, ImmutableDenseNDimArray) assert arr_matrix.tolist() == arr_ndim_array.tolist() assert arr_matrix.shape == arr_ndim_array.shape def test_equality(): first_list = [1, 2, 3, 4] second_list = [1, 2, 3, 4] third_list = [4, 3, 2, 1] assert first_list == second_list assert first_list != third_list first_ndim_array = ImmutableDenseNDimArray(first_list, (2, 2)) second_ndim_array = ImmutableDenseNDimArray(second_list, (2, 2)) fourth_ndim_array = ImmutableDenseNDimArray(first_list, (2, 2)) assert first_ndim_array == second_ndim_array def assignment_attempt(a): a[0, 0] = 0 pytest.raises(TypeError, lambda: assignment_attempt(second_ndim_array)) assert first_ndim_array == second_ndim_array assert first_ndim_array == fourth_ndim_array assert hash(first_ndim_array) == hash(second_ndim_array) def test_arithmetic(): a = ImmutableDenseNDimArray([3 for i in range(9)], (3, 3)) b = ImmutableDenseNDimArray([7 for i in range(9)], (3, 3)) c1 = a + b c2 = b + a assert c1 == c2 d1 = a - b d2 = b - a assert d1 == d2 * (-1) e1 = a * 5 e2 = 5 * a e3 = copy(a) e3 *= 5 assert e1 == e2 == e3 f1 = a / 5 f2 = copy(a) f2 /= 5 assert f1 == f2 assert f1[0, 0] == f1[0, 1] == f1[0, 2] == f1[1, 0] == f1[1, 1] == \ f1[1, 2] == f1[2, 0] == f1[2, 1] == f1[2, 2] == Rational(3, 5) assert type(a) == type(b) == type(c1) == type(c2) == type(d1) == type(d2) \ == type(e1) == type(e2) == type(e3) == type(f1) def test_higher_dimenions(): m3 = ImmutableDenseNDimArray(range(10, 34), (2, 3, 4)) assert m3.tolist() == [[[10, 11, 12, 13], [14, 15, 16, 17], [18, 19, 20, 21]], [[22, 23, 24, 25], [26, 27, 28, 29], [30, 31, 32, 33]]] assert m3._get_tuple_index(0) == (0, 0, 0) assert m3._get_tuple_index(1) == (0, 0, 1) assert m3._get_tuple_index(4) == (0, 1, 0) assert m3._get_tuple_index(12) == (1, 0, 0) assert str(m3) == '[[[10, 11, 12, 13], [14, 15, 16, 17], [18, 19, 20, 21]], [[22, 23, 24, 25], [26, 27, 28, 29], [30, 31, 32, 33]]]' m3_rebuilt = ImmutableDenseNDimArray([[[10, 11, 12, 13], [14, 15, 16, 17], [18, 19, 20, 21]], [[22, 23, 24, 25], [26, 27, 28, 29], [30, 31, 32, 33]]]) assert m3 == m3_rebuilt m3_other = ImmutableDenseNDimArray([[[10, 11, 12, 13], [14, 15, 16, 17], [18, 19, 20, 21]], [[22, 23, 24, 25], [26, 27, 28, 29], [30, 31, 32, 33]]], (2, 3, 4)) assert m3 == m3_other def test_rebuild_immutable_arrays(): sparr = ImmutableSparseNDimArray(range(10, 34), (2, 3, 4)) densarr = ImmutableDenseNDimArray(range(10, 34), (2, 3, 4)) assert sparr == sparr.func(*sparr.args) assert densarr == densarr.func(*densarr.args) def test_slices(): md = ImmutableDenseNDimArray(range(10, 34), (2, 3, 4)) assert md[:] == md._array assert md[:, :, 0].tomatrix() == Matrix([[10, 14, 18], [22, 26, 30]]) assert md[0, 1:2, :].tomatrix() == Matrix([[14, 15, 16, 17]]) assert md[0, 1:3, :].tomatrix() == Matrix([[14, 15, 16, 17], [18, 19, 20, 21]]) assert md[:, :, :] == md sd = ImmutableSparseNDimArray(range(10, 34), (2, 3, 4)) assert sd == ImmutableSparseNDimArray(md) assert sd[:] == md._array assert sd[:] == list(sd) assert sd[:, :, 0].tomatrix() == Matrix([[10, 14, 18], [22, 26, 30]]) assert sd[0, 1:2, :].tomatrix() == Matrix([[14, 15, 16, 17]]) assert sd[0, 1:3, :].tomatrix() == Matrix([[14, 15, 16, 17], [18, 19, 20, 21]]) assert sd[:, :, :] == sd def test_diff_and_applyfunc(): md = ImmutableDenseNDimArray([[x, y], [x*z, x*y*z]]) assert md.diff(x) == ImmutableDenseNDimArray([[1, 0], [z, y*z]]) sd = ImmutableSparseNDimArray(md) assert sd == ImmutableSparseNDimArray([x, y, x*z, x*y*z], (2, 2)) assert sd.diff(x) == ImmutableSparseNDimArray([[1, 0], [z, y*z]]) mdn = md.applyfunc(lambda x: x*3) assert mdn == ImmutableDenseNDimArray([[3*x, 3*y], [3*x*z, 3*x*y*z]]) assert md != mdn sdn = sd.applyfunc(lambda x: x/2) assert sdn == ImmutableSparseNDimArray([[x/2, y/2], [x*z/2, x*y*z/2]]) assert sd != sdn def test_op_priority(): md = ImmutableDenseNDimArray([1, 2, 3]) e1 = (1+x)*md e2 = md*(1+x) assert e1 == ImmutableDenseNDimArray([1+x, 2+2*x, 3+3*x]) assert e1 == e2 e3 = (1+x)*md e4 = md*(1+x) assert e3 == ImmutableDenseNDimArray([1+x, 2+2*x, 3+3*x]) assert e3 == e4 def test_symbolic_indexing(): M = ImmutableDenseNDimArray([[x, y], [z, w]]) Mij = M[i, j] assert isinstance(Mij, Indexed) Ms = ImmutableSparseNDimArray([[2, 3*x], [4, 5]]) msij = Ms[i, j] assert isinstance(msij, Indexed) for oi, oj in [(0, 0), (0, 1), (1, 0), (1, 1)]: assert Mij.subs({i: oi, j: oj}) == M[oi, oj] assert msij.subs({i: oi, j: oj}) == Ms[oi, oj] A = IndexedBase('A', (0, 2)) assert A[0, 0].subs({A: M}) == x assert A[i, j].subs({A: M}) == M[i, j] assert M[i, j].subs({M: A}) == A[i, j] assert isinstance(M[3 * i - 2, j], Indexed) assert M[3 * i - 2, j].subs({i: 1, j: 0}) == M[1, 0] assert isinstance(M[i, 0], Indexed) assert M[i, 0].subs({i: 0}) == M[0, 0] assert M[0, i].subs({i: 1}) == M[0, 1] Mo = ImmutableDenseNDimArray([1, 2, 3]) assert Mo[i].subs({i: 1}) == 2 Mos = ImmutableSparseNDimArray([1, 2, 3]) assert Mos[i].subs({i: 1}) == 2 pytest.raises(ValueError, lambda: M[i, 2]) pytest.raises(ValueError, lambda: M[i, -1]) pytest.raises(ValueError, lambda: M[2, i]) pytest.raises(ValueError, lambda: M[-1, i]) pytest.raises(ValueError, lambda: Ms[i, 2]) pytest.raises(ValueError, lambda: Ms[i, -1]) pytest.raises(ValueError, lambda: Ms[2, i]) pytest.raises(ValueError, lambda: Ms[-1, i])
""" desispec.io.brick ================= I/O routines for working with per-brick files. See ``doc/DESI_SPECTRO_REDUX/SPECPROD/bricks/BRICKID/*-BRICKID.rst`` in desidatamodel for a description of the relevant data models. See :doc:`coadd` and `DESI-doc-1056 <https://desi.lbl.gov/DocDB/cgi-bin/private/ShowDocument?docid=1056>`_ for general information about the coaddition dataflow and algorithms. """ import os import os.path import re import warnings import numpy as np import astropy.io.fits from desiutil.depend import add_dependencies import desispec.io.util #- For backwards compatibility, derive brickname from filename def _parse_brick_filename(filepath): """return (channel, brickname) from /path/to/brick-[brz]-{brickname}.fits """ filename = os.path.basename(filepath) warnings.warn('Deriving channel and brickname from filename {} instead of contents'.format(filename)) m = re.match('brick-([brz])-(\w+).fits', filename) if m is None: raise ValueError('Unable to derive channel and brickname from '+filename) else: return m.groups() #- (channel, brickname) class BrickBase(object): """Represents objects in a single brick and possibly also a single band b,r,z. The constructor will open an existing file and create a new file and parent directory if necessary. The :meth:`close` method must be called for any updates or new data to be recorded. Successful completion of the constructor does not guarantee that :meth:`close` will succeed. Args: path(str): Path to the brick file to open. mode(str): File access mode to use. Should normally be 'readonly' or 'update'. Use 'update' to create a new file and its parent directory if necessary. header: An optional header specification used to create a new file. See :func:`desispec.io.util.fitsheader` for details on allowed values. Raises: RuntimeError: Invalid mode requested. IOError: Unable to open existing file in 'readonly' mode. OSError: Unable to create a new parent directory in 'update' mode. """ def __init__(self,path,mode = 'readonly',header = None): if mode not in ('readonly','update'): raise RuntimeError('Invalid mode %r' % mode) self.path = path self.mode = mode # Create a new file if necessary. if self.mode == 'update' and not os.path.exists(self.path): # BRICKNAM must be in header if creating the file for the first time if header is None or 'BRICKNAM' not in header: raise ValueError('header must have BRICKNAM when creating new brick file') self.brickname = header['BRICKNAM'] if 'CHANNEL' in header: self.channel = header['CHANNEL'] else: self.channel = 'brz' #- could be any spectrograph channel # Create the parent directory, if necessary. head,tail = os.path.split(self.path) if not os.path.exists(head): os.makedirs(head) # Create empty HDUs. It would be good to refactor io.frame to avoid any duplication here. hdr = desispec.io.util.fitsheader(header) add_dependencies(hdr) hdr['EXTNAME'] = ('FLUX', 'no dimension') hdu0 = astropy.io.fits.PrimaryHDU(header = hdr) hdr['EXTNAME'] = ('IVAR', 'no dimension') hdu1 = astropy.io.fits.ImageHDU(header = hdr) hdr['EXTNAME'] = ('WAVELENGTH', '[Angstroms]') hdu2 = astropy.io.fits.ImageHDU(header = hdr) hdr['EXTNAME'] = ('RESOLUTION', 'no dimension') hdu3 = astropy.io.fits.ImageHDU(header = hdr) # Create an HDU4 using the columns from fibermap with a few extras added. columns = desispec.io.fibermap.fibermap_columns[:] columns.extend([ ('NIGHT','i4'), ('EXPID','i4'), ('INDEX','i4'), ]) data = np.empty(shape = (0,),dtype = columns) hdr = desispec.io.util.fitsheader(header) #- ignore incorrect and harmless fits TDIM7 warning for #- FILTER column that is a 2D array of strings with warnings.catch_warnings(): warnings.simplefilter('ignore') hdu4 = astropy.io.fits.BinTableHDU(data=data, header=hdr, name='FIBERMAP') # Add comments for fibermap columns. num_fibermap_columns = len(desispec.io.fibermap.fibermap_comments) for i in range(1,1+num_fibermap_columns): key = 'TTYPE%d' % i name = hdu4.header[key] comment = desispec.io.fibermap.fibermap_comments[name] hdu4.header[key] = (name,comment) # Add comments for our additional columns. hdu4.header['TTYPE%d' % (1+num_fibermap_columns)] = ('NIGHT','Night of exposure YYYYMMDD') hdu4.header['TTYPE%d' % (2+num_fibermap_columns)] = ('EXPID','Exposure ID') hdu4.header['TTYPE%d' % (3+num_fibermap_columns)] = ('INDEX','Index of this object in other HDUs') self.hdu_list = astropy.io.fits.HDUList([hdu0,hdu1,hdu2,hdu3,hdu4]) else: self.hdu_list = astropy.io.fits.open(path,mode = self.mode) try: self.brickname = self.hdu_list[0].header['BRICKNAM'] self.channel = self.hdu_list[0].header['CHANNEL'] except KeyError: self.channel, self.brickname = _parse_brick_filename(path) def add_objects(self,flux,ivar,wave,resolution): """Add a list of objects to this brick file from the same night and exposure. Args: flux(numpy.ndarray): Array of (nobj,nwave) flux values for nobj objects tabulated at nwave wavelengths. ivar(numpy.ndarray): Array of (nobj,nwave) inverse-variance values. wave(numpy.ndarray): Array of (nwave,) wavelength values in Angstroms. All objects are assumed to use the same wavelength grid. resolution(numpy.ndarray): Array of (nobj,nres,nwave) resolution matrix elements. Raises: RuntimeError: Can only add objects in update mode. """ if self.mode != 'update': raise RuntimeError('Can only add objects in update mode.') # Concatenate the new per-object image HDU data or use it to initialize the HDU. # HDU2 contains the wavelength grid shared by all objects so we only add it once. if self.hdu_list[0].data is not None: self.hdu_list[0].data = np.concatenate((self.hdu_list[0].data,flux,)) self.hdu_list[1].data = np.concatenate((self.hdu_list[1].data,ivar,)) assert np.array_equal(self.hdu_list[2].data,wave),'Wavelength arrays do not match.' self.hdu_list[3].data = np.concatenate((self.hdu_list[3].data,resolution,)) else: self.hdu_list[0].data = flux self.hdu_list[1].data = ivar self.hdu_list[2].data = wave self.hdu_list[3].data = resolution def get_wavelength_grid(self): """Return the wavelength grid used in this brick file. """ return self.hdu_list[2].data def get_target(self,target_id): """Get the spectra and info for one target ID. Args: target_id(int): Target ID number to lookup. Returns: tuple: Tuple of numpy arrays (flux,ivar,resolution,info) of data associated with this target ID. The flux,ivar,resolution arrays will have one entry for each spectrum and the info array will have one entry per exposure. The returned arrays are slices into the FITS file HDU data arrays, so this call is relatively cheap (and any changes will be saved to the file if it was opened in update mode.) """ exposures = (self.hdu_list[4].data['TARGETID'] == target_id) index_list = np.unique(self.hdu_list[4].data['INDEX'][exposures]) return (self.hdu_list[0].data[index_list],self.hdu_list[1].data[index_list], self.hdu_list[3].data[index_list],self.hdu_list[4].data[exposures]) def get_target_ids(self): """Return set of unique target IDs in this brick. """ return list(set(self.hdu_list[4].data['TARGETID'])) def get_num_spectra(self): """Get the number of spectra contained in this brick file. Returns: int: Number of objects contained in this brick file. """ return len(self.hdu_list[0].data) def get_num_targets(self): """Get the number of distinct targets with at least one spectrum in this brick file. Returns: int: Number of unique targets represented with spectra in this brick file. """ return len(np.unique(self.hdu_list[4].data['TARGETID'])) def close(self): """Write any updates and close the brick file. """ if self.mode == 'update': self.hdu_list.writeto(self.path,clobber = True) self.hdu_list.close() class Brick(BrickBase): """Represents the combined cframe exposures in a single brick and band. See :class:`BrickBase` for constructor info. """ def __init__(self,path,mode = 'readonly',header = None): BrickBase.__init__(self,path,mode,header) def add_objects(self,flux,ivar,wave,resolution,object_data,night,expid): """Add a list of objects to this brick file from the same night and exposure. Args: flux(numpy.ndarray): Array of (nobj,nwave) flux values for nobj objects tabulated at nwave wavelengths. ivar(numpy.ndarray): Array of (nobj,nwave) inverse-variance values. wave(numpy.ndarray): Array of (nwave,) wavelength values in Angstroms. All objects are assumed to use the same wavelength grid. resolution(numpy.ndarray): Array of (nobj,nres,nwave) resolution matrix elements. object_data(numpy.ndarray): Record array of fibermap rows for the objects to add. night(str): Date string for the night these objects were observed in the format YYYYMMDD. expid(int): Exposure number for these objects. Raises: RuntimeError: Can only add objects in update mode. """ BrickBase.add_objects(self,flux,ivar,wave,resolution) # Augment object_data with constant NIGHT and EXPID columns. augmented_data = np.empty(shape = object_data.shape,dtype = self.hdu_list[4].data.dtype) for column_def in desispec.io.fibermap.fibermap_columns: name = column_def[0] # Special handling for the fibermap FILTER array, which is not output correctly # by astropy.io.fits so we convert it to a comma-separated list. if name == 'FILTER' and augmented_data[name].shape != object_data[name].shape: for i,filters in enumerate(object_data[name]): augmented_data[name][i] = ','.join(filters) else: augmented_data[name] = object_data[name] augmented_data['NIGHT'] = int(night) augmented_data['EXPID'] = expid begin_index = len(self.hdu_list[4].data) end_index = begin_index + len(flux) augmented_data['INDEX'] = np.arange(begin_index,end_index,dtype=int) # Always concatenate to our table since a new file will be created with a zero-length table. self.hdu_list[4].data = np.concatenate((self.hdu_list[4].data,augmented_data,)) class CoAddedBrick(BrickBase): """Represents the co-added exposures in a single brick and, possibly, a single band. See :class:`BrickBase` for constructor info. """ def __init__(self,path,mode = 'readonly',header = None): BrickBase.__init__(self,path,mode,header)
# -*- coding: utf-8 -*- import datetime import sys from reportlab.graphics import renderPDF from reportlab.graphics.barcode.qr import QrCodeWidget from reportlab.graphics.shapes import Drawing from reportlab.lib.pagesizes import A4 from reportlab.pdfgen import canvas from reportlab.lib.units import mm from reportlab.platypus import ( Image, Paragraph, SimpleDocTemplate, Spacer, Table, ) from .letter_design import STYLES from .letter_processor import ProcessedText from .models import Letterhead, ContentTemplate, Letter class NumberedCanvas(canvas.Canvas): def __init__(self, *args, **kwargs): """Constructor""" canvas.Canvas.__init__(self, *args, **kwargs) self._saved_page_states = [] def showPage(self): self._saved_page_states.append(dict(self.__dict__)) self._startPage() def save(self): """add page info to each page (page x of y)""" num_pages = len(self._saved_page_states) for state in self._saved_page_states: self.__dict__.update(state) self.draw_page_number(num_pages) canvas.Canvas.showPage(self) canvas.Canvas.save(self) def draw_page_number(self, page_count): # Change the position of this to wherever you want the page number to be self.drawRightString( 195 * mm, 10 * mm, "Page %d of %d" % (self._pageNumber, page_count) ) class LetterCanvas(object): def __init__(self, letterhead, content_template, letter, response_FLO): """Constructor""" self.letterhead = letterhead self.content_template = content_template self.letter = letter self.response_FLO = response_FLO self.pagesize = A4 self.width, self.height = self.pagesize def run(self): """ Run the report """ self.doc = SimpleDocTemplate( self.response_FLO, rightMargin=self.letterhead.right_margin*mm, leftMargin=self.letterhead.left_margin*mm, topMargin=self.letterhead.top_margin*mm, bottomMargin=self.letterhead.bottom_margin*mm, pagesize=self.pagesize, ) self.elements = [Spacer(1, 67*mm)] self.insert_content() self.doc.build( self.elements, onFirstPage=self.first_page, onLaterPages=self.subsequent_pages, canvasmaker=NumberedCanvas ) def first_page(self, canvas, doc): """ Defines layout for the first page of our letter. """ # Save the state of our canvas so we can draw on it canvas.saveState() # Logo block logo = Image( self.letterhead.logo.image, width=self.letterhead.logo_width*mm, height=self.letterhead.logo_height*mm ) logo.wrapOn(canvas, doc.width/2.0, doc.height) logo.drawOn( canvas, self.letterhead.logo_x*mm, (297-self.letterhead.logo_y-self.letterhead.logo_height)*mm ) # Return address block ptext = "<br/>".join([line for line in self.letterhead.return_contacts.split('\n')]) p = Paragraph(ptext, STYLES['ReturnAddress']) p.wrapOn( canvas, doc.width/3.0, doc.height ) p.drawOn( canvas, self.letterhead.return_contacts_x*mm, (257-self.letterhead.return_contacts_y)*mm ) # Reference block ptext = "Your reference: " + self.letter.your_reference p = Paragraph(ptext, STYLES['ReturnAddress']) p.wrapOn( canvas, doc.width/3.0, doc.height ) p.drawOn( canvas, self.letterhead.your_reference_x*mm, (257-self.letterhead.your_reference_y)*mm ) ptext = "Our reference: " + self.letter.our_reference p = Paragraph(ptext, STYLES['ReturnAddress']) p.wrapOn( canvas, doc.width/3.0, doc.height ) p.drawOn( canvas, self.letterhead.our_reference_x*mm, (257-self.letterhead.our_reference_y)*mm ) # Recipient address block ptext = "<font size=12>" + "<br/>".join( [ (" ").join([ self.letter.addressee_title, self.letter.addressee_first_name, self.letter.addressee_second_name, ]), self.letter.address_1, self.letter.address_2, self.letter.address_3, self.letter.town, self.letter.postcode, "</font>", ] ) p = Paragraph(ptext, STYLES['Normal']) p.wrapOn(canvas, doc.width-300, doc.height) p.drawOn(canvas, 15*mm, 197*mm) # Footer # See http://stackoverflow.com/a/13132282 qr_code = QrCodeWidget(self.letter.barcode) drawing = Drawing(45, 45) drawing.add(qr_code) renderPDF.draw(drawing, canvas, 1, 1) footer = Paragraph(self.letter.barcode, STYLES['Normal']) w, h = footer.wrap(doc.width, doc.bottomMargin) footer.drawOn(canvas, doc.leftMargin+50, h) # Release the canvas canvas.restoreState() def subsequent_pages(self, canvas, doc): """ Defines layout for all pages of our letter but the first. """ # Save the state of our canvas so we can draw on it canvas.saveState() # Header header = Paragraph(self.content_template.name, STYLES['Normal']) w, h = header.wrap(doc.width, doc.topMargin) header.drawOn(canvas, doc.leftMargin, doc.height + doc.topMargin + doc.bottomMargin - h*mm) # Footer qr_code = QrCodeWidget(self.letter.barcode) drawing = Drawing(45, 45) drawing.add(qr_code) renderPDF.draw(drawing, canvas, 1, 1) footer = Paragraph(self.letter.barcode, STYLES['Normal']) w, h = footer.wrap(doc.width, doc.bottomMargin) footer.drawOn(canvas, doc.leftMargin+50, h) # Release the canvas canvas.restoreState() def insert_content(self): """ Inserts the flowable elements into our letter. """ # Draw things on the PDF. Here's where the PDF generation happens. # See the ReportLab documentation for full list of functionality. self.elements.append(Paragraph(self.letter.date_sent.strftime("%d %B %Y"), STYLES['DateLine'])) self.elements.append(Paragraph(self.letter.letter_title, STYLES['LetterTitle'])) if self.letter.addressee_organisation and not self.letter.addressee_title: salutation = "Dear sir or madam," sign_off = "Yours faithfully," else: salutation = (" ").join([ self.letter.addressee_title, self.letter.addressee_second_name, ]) salutation += "," sign_off = "Yours sincerely," self.elements.append(Paragraph(salutation, STYLES['Salutation'])) flowable_text = ProcessedText( self.content_template, self.letter ).process().decode('utf-8') for i, par in enumerate(flowable_text.split('\n')): self.elements.append(Paragraph(par, STYLES['LetterBody'])) self.elements.append(Paragraph(sign_off, STYLES['Salutation'])) self.elements.append(Paragraph(self.letter.sender_name, STYLES['Signature'])) self.elements.append(Paragraph(self.letter.sender_title, STYLES['SignatoryTitle']))
#!/usr/bin/python #Copyright (c) 2016, Justin R. Klesmith #All rights reserved. #QuickStats: Get the statistics from a enrich run from __future__ import division from subprocess import check_output from math import log import StringIO import argparse import time import os __author__ = "Justin R. Klesmith" __copyright__ = "Copyright 2016, Justin R. Klesmith" __credits__ = ["Justin R. Klesmith", "Timothy A. Whitehead"] __license__ = "BSD-3" __version__ = "1.4X, Build: 201507X" __maintainer__ = "Justin R. Klesmith" __email__ = "klesmit3@msu.edu" #Build Notes: #1.3 - 20150616 - Fixed counting bug at the end of the tile in CodonSubs such that it's just less than and not equal to #Get commandline arguments parser = argparse.ArgumentParser(description='Quick Enrich Stats - Note: you must pre-normalize the data using QuickNormalize.py.') parser.add_argument('-f', dest='file', action='store', help='File of your already normalized dataset') parser.add_argument('-p', dest='path', action='store', help='What is the path to the enrich tile directory? ie: ./tile/') parser.add_argument('-l', dest='tilelength', action='store', help='Tile length override') parser.add_argument('-s', dest='tilestart', action='store', help='Tile start override') args = parser.parse_args() #Verify inputs if args.file == None: print "No normalized file given" quit() if args.path == None: print "No enrich path given" quit() #Global vars AA_Table = '*ACDEFGHIKLMNPQRSTVWY' Mutations = {} NumResi = 0 #Tile length NormData = "" StartResidue = 0 def Build_Matrix(): #Populate Mutation Dictionary with None Data for j in xrange(0+StartResidue,NumResi+StartResidue): for i in enumerate(AA_Table): try: #Mutations[ResID][MutID[1]][0 = NormLog2, 1 = Unselected, 2 = Selected] Mutations[j][i[1]] = [None, None, None] except KeyError: Mutations[j] = {} Mutations[j][i[1]] = [None, None, None] return Mutations def ImportNormData(): global NumResi global NormData global StartResidue lines = 0 normdata = "" #Import the previously normalized data with open(args.file) as infile: copy = False for line in infile: if line.strip() == "Location,Mutation,Normalized_ER,Unselected_Reads,Selected_Reads,RawLog2": copy = True elif line.strip() == "Normalized Heatmap": copy = False elif line.startswith("Tile Length: "): if args.tilelength != None: NumResi = int(args.tilelength) else: NumResi = int(line.strip()[13:]) print "Tile length: "+str(NumResi) elif line.startswith("Start residue (-s): "): split = line.split(" ") if args.tilestart != None: StartResidue = int(args.tilestart) else: StartResidue = int(split[3]) #Set the start residue elif copy: NormData = NormData + line lines = lines + 1 #NumResi = int(lines / 21) #Set the tile length return normdata def PopulateMutArrays(): #Loop through the output for line in StringIO.StringIO(NormData): split = line.split(",") location = int(split[0]) identity = str(split[1]) #Ignore if our location is above our number of residues if location > (NumResi + StartResidue - 1): print "Above Tile Length Reject: "+str(location)+"-"+str(identity) continue #Ignore if our location is below our number of residues if location < StartResidue: print "Below Tile Start Reject "+str(location)+"-"+str(identity) continue Mutations[location][identity][0] = split[2] Mutations[location][identity][1] = split[3] Mutations[location][identity][2] = split[4].rstrip('\n') return Mutations def DNAReads(): reads = {} #Initialize the variable for the number of reads 0=unsel, 1=sel SC = 0 UC = 0 selectedcounts = "" unselectedcounts = "" if os.path.isfile(args.path+'data/output/counts_sel_example_F_N_include_filtered_B_DNA_qc'): selectedcounts = check_output(["awk", 'FNR>1{ print $9 }', args.path+'data/output/counts_sel_example_F_N_include_filtered_B_DNA_qc']) elif os.path.isfile(args.path+'data/output/counts_sel_example_F_N_include_filtered_R1_DNA_qc'): selectedcounts = check_output(["awk", 'FNR>1{ print $9 }', args.path+'data/output/counts_sel_example_F_N_include_filtered_R1_DNA_qc']) else: print "Can't find selected DNA counts" quit() if os.path.isfile(args.path+'data/output/counts_unsel_example_F_N_include_filtered_B_DNA_qc'): unselectedcounts = check_output(["awk", 'FNR>1{ print $9 }', args.path+'data/output/counts_unsel_example_F_N_include_filtered_B_DNA_qc']) elif os.path.isfile(args.path+'data/output/counts_unsel_example_F_N_include_filtered_R1_DNA_qc'): unselectedcounts = check_output(["awk", 'FNR>1{ print $9 }', args.path+'data/output/counts_unsel_example_F_N_include_filtered_R1_DNA_qc']) else: print "Can't find unselected DNA counts" quit() #Loop through the output for line in StringIO.StringIO(selectedcounts): split = line.split(" ") SC = SC + int(split[0].rstrip('\n')) for line in StringIO.StringIO(unselectedcounts): split = line.split(" ") UC = UC + int(split[0].rstrip('\n')) reads[0] = str(UC) #Set the unselected reads reads[1] = str(SC) #Set the selected reads return reads def MutationCounts(): muts = {} NM00 = 0 NM10 = 0 NM15 = 0 NM30 = 0 NM50 = 0 NM100 = 0 FiveThreshold = 0 Retained = 0 for j in xrange(0+StartResidue,NumResi+StartResidue): for i in enumerate(AA_Table): if Mutations[j][i[1]][0] != "NS": if float(Mutations[j][i[1]][0]) > 0.00: NM00 += 1 if float(Mutations[j][i[1]][0]) > 0.10: NM10 += 1 if float(Mutations[j][i[1]][0]) > 0.15: NM15 += 1 if float(Mutations[j][i[1]][0]) > 0.30: NM30 += 1 if float(Mutations[j][i[1]][0]) > 0.50: NM50 += 1 if float(Mutations[j][i[1]][0]) > 1.00: NM100 += 1 if Mutations[j][i[1]][1] != "None": if int(Mutations[j][i[1]][1]) >= 5: FiveThreshold += 1 if Mutations[j][i[1]][2] != "None": Retained += 1 muts[0] = NM00 muts[1] = NM10 muts[2] = NM15 muts[3] = NM30 muts[4] = NM50 muts[5] = NM100 muts[6] = FiveThreshold muts[7] = Retained return muts def Nonsynonymous(): reads = {} Total = 0 Single = 0 WT = 0 ALL = "" M1 = "" if os.path.isfile(args.path+'data/output/counts_unsel_example_F_N_include_filtered_B_PRO_qc'): ALL = check_output(["awk", 'FNR>1{ print $1,$9 }', args.path+'data/output/counts_unsel_example_F_N_include_filtered_B_PRO_qc']) elif os.path.isfile(args.path+'data/output/counts_unsel_example_F_N_include_filtered_R1_PRO_qc'): ALL = check_output(["awk", 'FNR>1{ print $1,$9 }', args.path+'data/output/counts_unsel_example_F_N_include_filtered_R1_PRO_qc']) else: print "Unsel protein counts not found" quit() if os.path.isfile(args.path+'data/output/counts_unsel_example_F_N_include_filtered_B_PRO_qc.m1'): M1 = check_output(["awk", 'FNR>1{ print $9 }', args.path+'data/output/counts_unsel_example_F_N_include_filtered_B_PRO_qc.m1']) elif os.path.isfile(args.path+'data/output/counts_unsel_example_F_N_include_filtered_R1_PRO_qc.m1'): M1 = check_output(["awk", 'FNR>1{ print $9 }', args.path+'data/output/counts_unsel_example_F_N_include_filtered_R1_PRO_qc.m1']) else: print "Unsel protein counts.m1 not found" quit() #Loop through the output for line in StringIO.StringIO(ALL): split = line.split(" ") if split[0] == "NA-NA": WT = int(split[1]) Total = Total + int(split[1].rstrip('\n')) for line in StringIO.StringIO(M1): split = line.split(" ") Single = Single + int(split[0].rstrip('\n')) reads[0] = WT #Wild-type reads[1] = Single #.m1 reads[2] = (Total - Single - WT) #all - .m1 - WT return reads def CodonSubs(): codons = {} One = 0 Two = 0 Three = 0 #Get the start of translation TranslateStart = 0 TranslateEnd = 0 with open(args.path+'input/example_local_config') as infile: for line in infile: if line.startswith("<translate_start>"): TSLen = len(line) TranslateStart = int(line[17:TSLen-20]) TranslateEnd = TranslateStart+(3*NumResi) ALL = "" M1 = "" M2 = "" if os.path.isfile(args.path+'data/output/counts_unsel_example_F_N_include_filtered_B_DNA_qc'): ALL = check_output(["awk", 'FNR>1{ print $4,$5 }', args.path+'data/output/counts_unsel_example_F_N_include_filtered_B_DNA_qc']) elif os.path.isfile(args.path+'data/output/counts_unsel_example_F_N_include_filtered_R1_DNA_qc'): ALL = check_output(["awk", 'FNR>1{ print $4,$5 }', args.path+'data/output/counts_unsel_example_F_N_include_filtered_R1_DNA_qc']) else: print "Counts unsel DNA not found." quit() if os.path.isfile(args.path+'data/output/counts_unsel_example_F_N_include_filtered_B_DNA_qc.m1'): M1 = check_output(["awk", 'FNR>1{ print $5 }', args.path+'data/output/counts_unsel_example_F_N_include_filtered_B_DNA_qc.m1']) elif os.path.isfile(args.path+'data/output/counts_unsel_example_F_N_include_filtered_R1_DNA_qc.m1'): M1 = check_output(["awk", 'FNR>1{ print $5 }', args.path+'data/output/counts_unsel_example_F_N_include_filtered_R1_DNA_qc.m1']) else: print "Counts unsel DNA.m1 not found." quit() if os.path.isfile(args.path+'data/output/counts_unsel_example_F_N_include_filtered_B_DNA_qc.m2'): M2 = check_output(["awk", 'FNR>1{ print $5 }', args.path+'data/output/counts_unsel_example_F_N_include_filtered_B_DNA_qc.m2']) elif os.path.isfile(args.path+'data/output/counts_unsel_example_F_N_include_filtered_R1_DNA_qc.m2'): M2 = check_output(["awk", 'FNR>1{ print $5 }', args.path+'data/output/counts_unsel_example_F_N_include_filtered_R1_DNA_qc.m2']) else: print "Counts unsel DNA.m2 not found." quit() #Check for single base mutations for line in StringIO.StringIO(M1): split = line.split(" ") if int(split[0]) >= TranslateStart and int(split[0]) < TranslateEnd: #Check to see that the base is in our tile One = One + 1 #Check for double base mutations for line in StringIO.StringIO(M2): split2 = line.split(" ") location = split2[0].split(",") #Get the individual mutation locations if int(location[0]) >= TranslateStart and int(location[0]) < TranslateEnd: #Check to see that the base is in our tile if int(location[1]) >= TranslateStart and int(location[1]) < TranslateEnd: #Check to see that the base is in our tile codon1 = int((int(location[0]) - int(TranslateStart))/3) codon2 = int((int(location[1]) - int(TranslateStart))/3) if codon1 == codon2: Two = Two + 1 #Check for triple base mutations for line in StringIO.StringIO(ALL): split3 = line.split(" ") if split3[0] == "3": #Test to see that there are three mutations location = split3[1].split(",") #Get the individual mutation locations if int(location[0]) >= TranslateStart and int(location[0]) < TranslateEnd: #Check to see that the base is in our tile if int(location[1]) >= TranslateStart and int(location[1]) < TranslateEnd: #Check to see that the base is in our tile if int(location[2]) >= TranslateStart and int(location[2]) < TranslateEnd: #Check to see that the base is in our tile codon1 = int((int(location[0]) - int(TranslateStart))/3) codon2 = int((int(location[1]) - int(TranslateStart))/3) codon3 = int((int(location[2]) - int(TranslateStart))/3) if codon1 == codon2 and codon2 == codon3: Three = Three + 1 codons[0] = One #1-base sub codons[1] = Two #2-base sub codons[2] = Three #3-base sub return codons def RunStats(): print "Stat run parameters:" print time.strftime("%H:%M:%S") print time.strftime("%m/%d/%Y") print "Nomalized file: "+args.file print "Data path: "+args.path print "Tile length: "+str(NumResi) print "Tile start: "+str(StartResidue) if args.tilelength != None: print "Custom tile length passed on the command line" if args.tilestart != None: print "Custom tile start passed on the command line" reads = DNAReads() print "Unselected DNA sequences (reads) from Enrich: "+reads[0] print "Selected DNA sequences (reads) from Enrich: "+reads[1] mutations = MutationCounts() print "Number of mutations above 0.00: "+str(mutations[0]) print "Number of mutations above 0.10: "+str(mutations[1]) print "Number of mutations above 0.15: "+str(mutations[2]) print "Number of mutations above 0.30: "+str(mutations[3]) print "Number of mutations above 0.50: "+str(mutations[4]) print "Number of mutations above 1.00: "+str(mutations[5]) print "Number unselected mutants above threshold of 5: "+str(mutations[6]) print "Number of mutations retained in the selected population (not given a 1 if significant in unsel): "+str(mutations[7]) codons = CodonSubs() print "Percent of possible codon subsititions observed in the unselected population:" print "1-base substitution (#codons*9): {0:.1f}".format((codons[0]/(9*NumResi)*100))+"% "+str(codons[0])+"/"+str(9*NumResi) print "2-base substitutions (#codons*27): {0:.1f}".format((codons[1]/(27*NumResi)*100))+"% "+str(codons[1])+"/"+str(27*NumResi) print "3-base substitutions (#codons*27): {0:.1f}".format((codons[2]/(27*NumResi)*100))+"% "+str(codons[2])+"/"+str(27*NumResi) print "Total base substitutions: "+str(codons[0]+codons[1]+codons[2])+"/"+str(63*NumResi) nonsynonymous = Nonsynonymous() print "Percent of unselected reads with: " print "No nonsynonymous mutations: {0:.1f}".format((nonsynonymous[0]/int(reads[0]))*100)+"% "+str(nonsynonymous[0])+"/"+reads[0] print "One nonsynonymous mutation: {0:.1f}".format((nonsynonymous[1]/int(reads[0]))*100)+"% "+str(nonsynonymous[1])+"/"+reads[0] print "Multiple nonsynonymous mutations: {0:.1f}".format((nonsynonymous[2]/int(reads[0]))*100)+"% "+str(nonsynonymous[2])+"/"+reads[0] print "Coverage of possible single nonsynonymous amino acid mutations: {0:.1f}".format((mutations[6]/(NumResi*20))*100)+"% "+str(mutations[6])+"/"+str(NumResi*20) return def main(): #Write out preample print "QuickStats" print "Author: "+__author__ print "Contact: "+__email__ print __copyright__ print "License: "+__license__ print "Credits: "+__credits__[0]+", "+__credits__[1] print "" print "Please cite:" print "Github [user: JKlesmith] (www.github.com)" print "Klesmith JR, Bacik J-P, Michalczyk R, Whitehead TA. 2015. Comprehensive sequence-flux mapping of metabolic pathways in living cells." print "Kowalsky CA, Klesmith JR, Stapleton JA, Kelly V, Reichkitzer N, Whitehead TA. 2015. High-Resolution Sequence-Function Mapping of Full-Length Proteins. PLoS ONE 10(3):e0118193. doi:10.1371/journal.pone.0118193." print "" #Print out run stats ImportNormData() Build_Matrix() PopulateMutArrays() RunStats() if __name__ == '__main__': main()
# This code is part of Ansible, but is an independent component. # This particular file snippet, and this file snippet only, is BSD licensed. # Modules you write using this snippet, which is embedded dynamically by Ansible # still belong to the author of the module, and may assign their own license # to the complete work. # # (c) 2018 Red Hat Inc. # # Redistribution and use in source and binary forms, with or without modification, # are permitted provided that the following conditions are met: # # * Redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer. # * Redistributions in binary form must reproduce the above copyright notice, # this list of conditions and the following disclaimer in the documentation # and/or other materials provided with the distribution. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND # ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED # WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. # IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, # INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, # PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS # INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT # LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE # USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. # import os from functools import partial from ansible.module_utils._text import to_native from ansible.module_utils.six import iteritems from ansible.module_utils._text import to_text from ansible.module_utils.basic import env_fallback try: from infoblox_client.connector import Connector from infoblox_client.exceptions import InfobloxException HAS_INFOBLOX_CLIENT = True except ImportError: HAS_INFOBLOX_CLIENT = False # defining nios constants NIOS_DNS_VIEW = 'view' NIOS_NETWORK_VIEW = 'networkview' NIOS_HOST_RECORD = 'record:host' NIOS_IPV4_NETWORK = 'network' NIOS_IPV6_NETWORK = 'ipv6network' NIOS_ZONE = 'zone_auth' NIOS_PTR_RECORD = 'record:ptr' NIOS_A_RECORD = 'record:a' NIOS_AAAA_RECORD = 'record:aaaa' NIOS_CNAME_RECORD = 'record:cname' NIOS_MX_RECORD = 'record:mx' NIOS_SRV_RECORD = 'record:srv' NIOS_NAPTR_RECORD = 'record:naptr' NIOS_TXT_RECORD = 'record:txt' NIOS_NSGROUP = 'nsgroup' NIOS_IPV4_FIXED_ADDRESS = 'fixedaddress' NIOS_IPV6_FIXED_ADDRESS = 'ipv6fixedaddress' NIOS_NEXT_AVAILABLE_IP = 'func:nextavailableip' NIOS_IPV4_NETWORK_CONTAINER = 'networkcontainer' NIOS_IPV6_NETWORK_CONTAINER = 'ipv6networkcontainer' NIOS_MEMBER = 'member' NIOS_PROVIDER_SPEC = { 'host': dict(fallback=(env_fallback, ['INFOBLOX_HOST'])), 'username': dict(fallback=(env_fallback, ['INFOBLOX_USERNAME'])), 'password': dict(fallback=(env_fallback, ['INFOBLOX_PASSWORD']), no_log=True), 'validate_certs': dict(type='bool', default=False, fallback=(env_fallback, ['INFOBLOX_SSL_VERIFY']), aliases=['ssl_verify']), 'silent_ssl_warnings': dict(type='bool', default=True), 'http_request_timeout': dict(type='int', default=10, fallback=(env_fallback, ['INFOBLOX_HTTP_REQUEST_TIMEOUT'])), 'http_pool_connections': dict(type='int', default=10), 'http_pool_maxsize': dict(type='int', default=10), 'max_retries': dict(type='int', default=3, fallback=(env_fallback, ['INFOBLOX_MAX_RETRIES'])), 'wapi_version': dict(default='2.1', fallback=(env_fallback, ['INFOBLOX_WAP_VERSION'])), 'max_results': dict(type='int', default=1000, fallback=(env_fallback, ['INFOBLOX_MAX_RETRIES'])) } def get_connector(*args, **kwargs): ''' Returns an instance of infoblox_client.connector.Connector :params args: positional arguments are silently ignored :params kwargs: dict that is passed to Connector init :returns: Connector ''' if not HAS_INFOBLOX_CLIENT: raise Exception('infoblox-client is required but does not appear ' 'to be installed. It can be installed using the ' 'command `pip install infoblox-client`') if not set(kwargs.keys()).issubset(list(NIOS_PROVIDER_SPEC.keys()) + ['ssl_verify']): raise Exception('invalid or unsupported keyword argument for connector') for key, value in iteritems(NIOS_PROVIDER_SPEC): if key not in kwargs: # apply default values from NIOS_PROVIDER_SPEC since we cannot just # assume the provider values are coming from AnsibleModule if 'default' in value: kwargs[key] = value['default'] # override any values with env variables unless they were # explicitly set env = ('INFOBLOX_%s' % key).upper() if env in os.environ: kwargs[key] = os.environ.get(env) if 'validate_certs' in kwargs.keys(): kwargs['ssl_verify'] = kwargs['validate_certs'] kwargs.pop('validate_certs', None) return Connector(kwargs) def normalize_extattrs(value): ''' Normalize extattrs field to expected format The module accepts extattrs as key/value pairs. This method will transform the key/value pairs into a structure suitable for sending across WAPI in the format of: extattrs: { key: { value: <value> } } ''' return dict([(k, {'value': v}) for k, v in iteritems(value)]) def flatten_extattrs(value): ''' Flatten the key/value struct for extattrs WAPI returns extattrs field as a dict in form of: extattrs: { key: { value: <value> } } This method will flatten the structure to: extattrs: { key: value } ''' return dict([(k, v['value']) for k, v in iteritems(value)]) def member_normalize(member_spec): ''' Transforms the member module arguments into a valid WAPI struct This function will transform the arguments into a structure that is a valid WAPI structure in the format of: { key: <value>, } It will remove any arguments that are set to None since WAPI will error on that condition. The remainder of the value validation is performed by WAPI Some parameters in ib_spec are passed as a list in order to pass the validation for elements. In this function, they are converted to dictionary. ''' member_elements = ['vip_setting', 'ipv6_setting', 'lan2_port_setting', 'mgmt_port_setting', 'pre_provisioning', 'network_setting', 'v6_network_setting', 'ha_port_setting', 'lan_port_setting', 'lan2_physical_setting', 'lan_ha_port_setting', 'mgmt_network_setting', 'v6_mgmt_network_setting'] for key in member_spec.keys(): if key in member_elements and member_spec[key] is not None: member_spec[key] = member_spec[key][0] if isinstance(member_spec[key], dict): member_spec[key] = member_normalize(member_spec[key]) elif isinstance(member_spec[key], list): for x in member_spec[key]: if isinstance(x, dict): x = member_normalize(x) elif member_spec[key] is None: del member_spec[key] return member_spec class WapiBase(object): ''' Base class for implementing Infoblox WAPI API ''' provider_spec = {'provider': dict(type='dict', options=NIOS_PROVIDER_SPEC)} def __init__(self, provider): self.connector = get_connector(**provider) def __getattr__(self, name): try: return self.__dict__[name] except KeyError: if name.startswith('_'): raise AttributeError("'%s' object has no attribute '%s'" % (self.__class__.__name__, name)) return partial(self._invoke_method, name) def _invoke_method(self, name, *args, **kwargs): try: method = getattr(self.connector, name) return method(*args, **kwargs) except InfobloxException as exc: if hasattr(self, 'handle_exception'): self.handle_exception(name, exc) else: raise class WapiLookup(WapiBase): ''' Implements WapiBase for lookup plugins ''' def handle_exception(self, method_name, exc): if ('text' in exc.response): raise Exception(exc.response['text']) else: raise Exception(exc) class WapiInventory(WapiBase): ''' Implements WapiBase for dynamic inventory script ''' pass class WapiModule(WapiBase): ''' Implements WapiBase for executing a NIOS module ''' def __init__(self, module): self.module = module provider = module.params['provider'] try: super(WapiModule, self).__init__(provider) except Exception as exc: self.module.fail_json(msg=to_text(exc)) def handle_exception(self, method_name, exc): ''' Handles any exceptions raised This method will be called if an InfobloxException is raised for any call to the instance of Connector and also, in case of generic exception. This method will then gracefully fail the module. :args exc: instance of InfobloxException ''' if ('text' in exc.response): self.module.fail_json( msg=exc.response['text'], type=exc.response['Error'].split(':')[0], code=exc.response.get('code'), operation=method_name ) else: self.module.fail_json(msg=to_native(exc)) def run(self, ib_obj_type, ib_spec): ''' Runs the module and performans configuration tasks :args ib_obj_type: the WAPI object type to operate against :args ib_spec: the specification for the WAPI object as a dict :returns: a results dict ''' update = new_name = None state = self.module.params['state'] if state not in ('present', 'absent'): self.module.fail_json(msg='state must be one of `present`, `absent`, got `%s`' % state) result = {'changed': False} obj_filter = dict([(k, self.module.params[k]) for k, v in iteritems(ib_spec) if v.get('ib_req')]) # get object reference ib_obj_ref, update, new_name = self.get_object_ref(self.module, ib_obj_type, obj_filter, ib_spec) proposed_object = {} for key, value in iteritems(ib_spec): if self.module.params[key] is not None: if 'transform' in value: proposed_object[key] = value['transform'](self.module) else: proposed_object[key] = self.module.params[key] # If configure_by_dns is set to False, then delete the default dns set in the param else throw exception if not proposed_object.get('configure_for_dns') and proposed_object.get('view') == 'default'\ and ib_obj_type == NIOS_HOST_RECORD: del proposed_object['view'] elif not proposed_object.get('configure_for_dns') and proposed_object.get('view') != 'default'\ and ib_obj_type == NIOS_HOST_RECORD: self.module.fail_json(msg='DNS Bypass is not allowed if DNS view is set other than \'default\'') if ib_obj_ref: if len(ib_obj_ref) > 1: for each in ib_obj_ref: # To check for existing A_record with same name with input A_record by IP if each.get('ipv4addr') and each.get('ipv4addr') == proposed_object.get('ipv4addr'): current_object = each # To check for existing Host_record with same name with input Host_record by IP elif each.get('ipv4addrs')[0].get('ipv4addr') and each.get('ipv4addrs')[0].get('ipv4addr')\ == proposed_object.get('ipv4addrs')[0].get('ipv4addr'): current_object = each # Else set the current_object with input value else: current_object = obj_filter ref = None else: current_object = ib_obj_ref[0] if 'extattrs' in current_object: current_object['extattrs'] = flatten_extattrs(current_object['extattrs']) if current_object.get('_ref'): ref = current_object.pop('_ref') else: current_object = obj_filter ref = None # checks if the object type is member to normalize the attributes being passed if (ib_obj_type == NIOS_MEMBER): proposed_object = member_normalize(proposed_object) # checks if the name's field has been updated if update and new_name: proposed_object['name'] = new_name res = None modified = not self.compare_objects(current_object, proposed_object) if 'extattrs' in proposed_object: proposed_object['extattrs'] = normalize_extattrs(proposed_object['extattrs']) # Checks if nios_next_ip param is passed in ipv4addrs/ipv4addr args proposed_object = self.check_if_nios_next_ip_exists(proposed_object) if state == 'present': if ref is None: if not self.module.check_mode: self.create_object(ib_obj_type, proposed_object) result['changed'] = True # Check if NIOS_MEMBER and the flag to call function create_token is set elif (ib_obj_type == NIOS_MEMBER) and (proposed_object['create_token']): proposed_object = None # the function creates a token that can be used by a pre-provisioned member to join the grid result['api_results'] = self.call_func('create_token', ref, proposed_object) result['changed'] = True elif modified: self.check_if_recordname_exists(obj_filter, ib_obj_ref, ib_obj_type, current_object, proposed_object) if (ib_obj_type in (NIOS_HOST_RECORD, NIOS_NETWORK_VIEW, NIOS_DNS_VIEW)): proposed_object = self.on_update(proposed_object, ib_spec) res = self.update_object(ref, proposed_object) if (ib_obj_type in (NIOS_A_RECORD, NIOS_AAAA_RECORD, NIOS_PTR_RECORD, NIOS_SRV_RECORD)): # popping 'view' key as update of 'view' is not supported with respect to a:record/aaaa:record/srv:record/ptr:record proposed_object = self.on_update(proposed_object, ib_spec) del proposed_object['view'] res = self.update_object(ref, proposed_object) elif 'network_view' in proposed_object: proposed_object.pop('network_view') if not self.module.check_mode and res is None: proposed_object = self.on_update(proposed_object, ib_spec) self.update_object(ref, proposed_object) result['changed'] = True elif state == 'absent': if ref is not None: if not self.module.check_mode: self.delete_object(ref) result['changed'] = True return result def check_if_recordname_exists(self, obj_filter, ib_obj_ref, ib_obj_type, current_object, proposed_object): ''' Send POST request if host record input name and retrieved ref name is same, but input IP and retrieved IP is different''' if 'name' in (obj_filter and ib_obj_ref[0]) and ib_obj_type == NIOS_HOST_RECORD: obj_host_name = obj_filter['name'] ref_host_name = ib_obj_ref[0]['name'] if 'ipv4addrs' in (current_object and proposed_object): current_ip_addr = current_object['ipv4addrs'][0]['ipv4addr'] proposed_ip_addr = proposed_object['ipv4addrs'][0]['ipv4addr'] elif 'ipv6addrs' in (current_object and proposed_object): current_ip_addr = current_object['ipv6addrs'][0]['ipv6addr'] proposed_ip_addr = proposed_object['ipv6addrs'][0]['ipv6addr'] if obj_host_name == ref_host_name and current_ip_addr != proposed_ip_addr: self.create_object(ib_obj_type, proposed_object) def check_if_nios_next_ip_exists(self, proposed_object): ''' Check if nios_next_ip argument is passed in ipaddr while creating host record, if yes then format proposed object ipv4addrs and pass func:nextavailableip and ipaddr range to create hostrecord with next available ip in one call to avoid any race condition ''' if 'ipv4addrs' in proposed_object: if 'nios_next_ip' in proposed_object['ipv4addrs'][0]['ipv4addr']: ip_range = self.module._check_type_dict(proposed_object['ipv4addrs'][0]['ipv4addr'])['nios_next_ip'] proposed_object['ipv4addrs'][0]['ipv4addr'] = NIOS_NEXT_AVAILABLE_IP + ':' + ip_range elif 'ipv4addr' in proposed_object: if 'nios_next_ip' in proposed_object['ipv4addr']: ip_range = self.module._check_type_dict(proposed_object['ipv4addr'])['nios_next_ip'] proposed_object['ipv4addr'] = NIOS_NEXT_AVAILABLE_IP + ':' + ip_range return proposed_object def issubset(self, item, objects): ''' Checks if item is a subset of objects :args item: the subset item to validate :args objects: superset list of objects to validate against :returns: True if item is a subset of one entry in objects otherwise this method will return None ''' for obj in objects: if isinstance(item, dict): if all(entry in obj.items() for entry in item.items()): return True else: if item in obj: return True def compare_objects(self, current_object, proposed_object): for key, proposed_item in iteritems(proposed_object): current_item = current_object.get(key) # if proposed has a key that current doesn't then the objects are # not equal and False will be immediately returned if current_item is None: return False elif isinstance(proposed_item, list): for subitem in proposed_item: if not self.issubset(subitem, current_item): return False elif isinstance(proposed_item, dict): return self.compare_objects(current_item, proposed_item) else: if current_item != proposed_item: return False return True def get_object_ref(self, module, ib_obj_type, obj_filter, ib_spec): ''' this function gets the reference object of pre-existing nios objects ''' update = False old_name = new_name = None if ('name' in obj_filter): # gets and returns the current object based on name/old_name passed try: name_obj = self.module._check_type_dict(obj_filter['name']) old_name = name_obj['old_name'] new_name = name_obj['new_name'] except TypeError: name = obj_filter['name'] if old_name and new_name: if (ib_obj_type == NIOS_HOST_RECORD): test_obj_filter = dict([('name', old_name), ('view', obj_filter['view'])]) elif (ib_obj_type in (NIOS_AAAA_RECORD, NIOS_A_RECORD)): test_obj_filter = obj_filter else: test_obj_filter = dict([('name', old_name)]) # get the object reference ib_obj = self.get_object(ib_obj_type, test_obj_filter, return_fields=ib_spec.keys()) if ib_obj: obj_filter['name'] = new_name else: test_obj_filter['name'] = new_name ib_obj = self.get_object(ib_obj_type, test_obj_filter, return_fields=ib_spec.keys()) update = True return ib_obj, update, new_name if (ib_obj_type == NIOS_HOST_RECORD): # to check only by name if dns bypassing is set if not obj_filter['configure_for_dns']: test_obj_filter = dict([('name', name)]) else: test_obj_filter = dict([('name', name), ('view', obj_filter['view'])]) elif (ib_obj_type == NIOS_IPV4_FIXED_ADDRESS or ib_obj_type == NIOS_IPV6_FIXED_ADDRESS and 'mac' in obj_filter): test_obj_filter = dict([['mac', obj_filter['mac']]]) elif (ib_obj_type == NIOS_A_RECORD): # resolves issue where a_record with uppercase name was returning null and was failing test_obj_filter = obj_filter test_obj_filter['name'] = test_obj_filter['name'].lower() # check if test_obj_filter is empty copy passed obj_filter else: test_obj_filter = obj_filter ib_obj = self.get_object(ib_obj_type, test_obj_filter.copy(), return_fields=ib_spec.keys()) elif (ib_obj_type == NIOS_ZONE): # del key 'restart_if_needed' as nios_zone get_object fails with the key present temp = ib_spec['restart_if_needed'] del ib_spec['restart_if_needed'] ib_obj = self.get_object(ib_obj_type, obj_filter.copy(), return_fields=ib_spec.keys()) # reinstate restart_if_needed if ib_obj is none, meaning there's no existing nios_zone ref if not ib_obj: ib_spec['restart_if_needed'] = temp elif (ib_obj_type == NIOS_MEMBER): # del key 'create_token' as nios_member get_object fails with the key present temp = ib_spec['create_token'] del ib_spec['create_token'] ib_obj = self.get_object(ib_obj_type, obj_filter.copy(), return_fields=ib_spec.keys()) if temp: # reinstate 'create_token' key ib_spec['create_token'] = temp else: ib_obj = self.get_object(ib_obj_type, obj_filter.copy(), return_fields=ib_spec.keys()) return ib_obj, update, new_name def on_update(self, proposed_object, ib_spec): ''' Event called before the update is sent to the API endpoing This method will allow the final proposed object to be changed and/or keys filtered before it is sent to the API endpoint to be processed. :args proposed_object: A dict item that will be encoded and sent the API endpoint with the updated data structure :returns: updated object to be sent to API endpoint ''' keys = set() for key, value in iteritems(proposed_object): update = ib_spec[key].get('update', True) if not update: keys.add(key) return dict([(k, v) for k, v in iteritems(proposed_object) if k not in keys])