text string |
|---|
GLASTONBURY — The Federal Energy Regulatory Commission has scheduled a hearing in town Tuesday on a plan to expand a gas transmission line.
Spectra Energy and Algonquin Gas Transmission System are hoping to build the Atlantic Bridge Project, which is designed to provide enough pipeline capacity to connect abundant natural gas supplies with markets in New England and Canada's Maritime Provinces.
About 10 miles of new, 36-inch diameter pipeline would be installed from Cromwell under the Connecticut River and across town. The pipeline runs mostly across fields and forests, although it also passes through some residential neighborhoods. The right-of-way along the line has been expanded from 75 feet to 150 feet to accommodate the new pipeline.
The hearing will be held at 6:30 p.m. at the Riverfront Community Center at 300 Welles St. The commission is the federal agency responsible for environmental reviews. It is seeking comments and questions from residents, landowners, government agencies and public officials at meetings across the state.
Marylee Hanley, a spokeswoman for Spectra Energy, said Friday the meeting will be a good opportunity to learn about the pipeline. Experts from Spectra will be there from 5:30 to 6:30 p.m. to answer questions and review maps and other materials.
"For example, if someone has safety concerns about the pipeline," she said, "all the comments and questions will be compiled at the meeting and then we will respond to all the questions and concerns in the final report."
Part of the plan includes an upgrade to the Cromwell compressor station, which helps send gas through the pipeline. The station is across the river from Glastonbury along Shunpike Road. The company has set a target service date of November 2017.
Edward C. Harney, right-of-way project manager for Algonquin, said the commission is required by the National Environmental Policy Act to "evaluate concerns raised by the public and consider the environmental impacts that could result from the proposed facilities." |
By Joseph Leray
“Glitch” was a charming, laid-back, and whimsical indie MMO developed and supported by developer Tiny Speck -- a team founded by Flickr creator Stuart Butterfield and eventually joined by “Katamari Damacy” designer Keita Takahashi -- until late last year. When the game started losing players and funds, its servers had to be shut down.
Part of the game lives on in a music-creation iOS app called “Glitchamaphone,” and Tiny Speck recently uploaded sprite sheets and animations for each of the game’s items and inhabitants under a Creative Commons license. This means that anyone is free to use, or alter these assets free of charge, as long as they don’t profit from them -- amateur game designers now have a huge catalog of freely-accessible whimsy at their fingertips.
“Glitch” was comprised of hundreds of fun, smiling, wiggling, talking, sighing, racing, flying things, and those things are still quite fun on their own,” Tiny Speck wrote on their blog. “We’d like to let you use those things to awaken your inner Giant and imagine something new for them to do.”
“We hope to eventually be able to provide even more assets from the game and to change the licensing terms to something which allows a broader range of uses.”
The assets can be found in the game’s online encyclopedia. |
Managers often face the challenge of how to accurately schedule the correct number of agents based on call volume. That means company money is wasted if the manager schedules too many agents and there are not enough calls coming in. At the same time, customer satisfaction can decline if there are not enough agents and hold times increase.
While it is difficult to predict what call volume will be, managers also must find the right agents to fill positions in each shift. Most call centers today handle phone calls, e-mails and Web chats, and some agents are better at handling one technology than the others, so it is important for managers to assemble a team that represents a good balance of skills.
All of these factors make the task of scheduling agents tedious and time-consuming, but managers and companies can benefit by using staffing software to make the process easier. According to an article by TMCnet.com, most staffing software is quick and easy to install, not to mention affordable, and includes advanced analytics that allow managers to accurately predict how many agents will be needed for each shift.
Good staffing software is capable of increasing schedule adherence, reducing decreasing employee numbers and improving customer service by setting a better schedule for agents. In addition, it is estimated that using staffing software reduces the amount of time a call center manager spends scheduling agents by up to 25 percent.
Managers who use staffing software save a considerable amount of time by not having to manually input information, as they would with spreadsheets or other scheduling tools, because the software automates the scheduling process.
Another plus is that many staffing software programs have Web-based agent and supervisor portals that allow agents to swap, bid on or cancel shifts, which prevents managers from having to deal with last-minute scheduling changes or finding an alternate worker.
Tags: Staffing software
Trackback from your site. |
‘Whoever speaks about peace is stupid’
Eiran and Naama Henkin, killed last week, with their children lem’s Har Hamenuchot cemetery on Friday afternoon for the funeral of the Henkin couple. Matan, their nineyear-old son, said the kaddish prayer on stage.
“Terror has never shook our foundation, and it will never shake our hold on this land. That’s how it was, is, and will be,” said Israeli President Reuven Rivlin, who told the West Bank settlers they were on the “front lines” of a “cruel terror offensive”. At the funeral for Mr Bennett and Rabbi Lavi on Sunday, Mrs Bennett’s mother said that Aharon had promised his wife “the happiest Succot ever.
“Whoever speaks about peace is stupid, there’s no other word. The people of Israel need to wake up.”
Following an apparent lull in the violence at the beginning of the week, Wednesday saw another spike in attacks, with five serious incidents. Those included three stabbings.
In the past 11 days of violence, five Palestinians have been killed, including a 13-year-old boy from a refugee camp in Bethlehem who locals said was shot in the chest by Israeli soldiers as he was walking home from school.
The funeral of Aharon Bennett on Sunday |
Alan V. Peters
Alan V. Peters passed away suddenly on February 16, 2017, at the age of 67, in his hometown of Deer Lodge. Alan is survived by his wife, Shirley (Green); children, Aaron Peters and Alana (Kyle) McLaughlin (Kyle); grandchildren, Natalie Peters, and Brycen and Meya McLaughlin, brother, David Peters, and half-brother, Billy.
Alan was born to William Orla and Naomi Peters on March 31, 1949, in Long Beach, Calif. He and Shirley fell in love with Montana in 1977, while searching for opportunities in law enforcement, and they never looked back. His long-term career in the criminal justice system began at the old Montana State Prison in Deer Lodge, which bridged into the new prison upon completion in 1979. He entered law enforcement at the Dillon Police Department where he began raising his family; he returned to Deer Lodge for another stent at the prison before joining the Powell County Sheriff’s Department. Upon retirement, he enjoyed helping customers at the local ACE Hardware, NAPA Auto, and Safeway.
Alan was an avid sports enthusiast starting out with baseball, basketball, and football from a young age with his brother by his side. He also picked up skiing and water skiing, in addition to coaching, which began with tee ball and continued through to Legion baseball. He eagerly provided practice drills for his children for their other sports, and made sure he was at all their games. Alan and his family spent summers boating at Flathead Lake and camping all around Western Montana, and more recently meeting his children and grandchildren for annual campouts from Oregon and Washington to Moab.
An informal gathering will held in early summer in Alan’s honor. As an avid supporter of the military, memorial contributions may be made to the USO, Red Cross, or a charity of your choosing.
To submit an obituary, please email email@example.com or call us at 406-846-2424. |
Australian Federal Government
Anti-smoking efforts have produced some of the most compelling campaigns in the world. However, there is a bit of a formula to them: show the nasty long-term health consequences – usually through the depiction of a shocking graphic – and then combine this with an emotional consequence usually related to the impact on your loved ones. And it has been a successful approach, both in terms of ad testing and with smoking rates showing consistent falls for most demographics. Two key insights were uncovered: Although the formula was successful amongst older smokers,
it had little resonance amongst younger smokers. With youth comes a wonderful sense of immortality and living in the now, so the ‘that cigarette you’re smoking might, in 20 to 30 years time, potentially cause some nasty consequences’ formula just doesn’t resonate with people who think it’ll never happen to them and the end of the month is a long time away. The only way to actually cut through with this group was to make the negative consequences of smoking feel much more immediate. A strategy was developed to focus on the negatives related to the cigarette that you’re
smoking right now. The creative idea leveraged the connection between the 4,000 scary chemicals found in every cigarette and the consequential fear of putting them near our mouth, let alone inhaling them. A visual mnemonic
of a test tube was core to the idea, a cigarette analogy, with 4,000 lethal chemicals bubbling away while unaware teens drag away.
The campaign was rolled out nationally (and since then globally) across TV, outdoor, and print.
The number of calls to the QUIT Helpline doubled – the usual campaign effect is a 25-35% lift
The campaign has been upheld globally as one of the most successful anti-smoking campaigns on record. |
- Highlights: Joshua Trees, Pinyon Pines, Spectacular Mountain and Desert Views
- Near: Joshua Tree, CA
- Distance: 4.5 miles
- Elevation Gain/Loss: 950 ft
- Hike Time: 2.5 hours
- Difficulty: 5/10
- Trail Condition: Well maintained trail
- Trail head map: Click here for Google map
- Trails of Black Rock Canyon Map
- Detailed Map: Click here for Trimble map
- Rating: 3.5/5
If you are camping at the Black Rock campground or just want a nice view, try this hike. Along the way you will see some interesting plants that are synonymous with Joshua Tree National Park. Located within the northwestern-most portion of the park, temperatures are much cooler than in the parts further south. Once you reach your destination, the views of the San Jacinto Mountains and surrounding desert terrain are quite spectacular. The trail, which begins adjacent to campsite #30 in the Black Rock Canyon Campground is well-signed.
From Los Angeles – the 10 Freeway (E) to 62 Hwy (E) to Joshua Ln. (R) to San Marino Dr. (R) to Black Rock Canyon Rd. (Straight) to Black Rock Campgound to site #30 to trailhead. Park in front of ranger station. |
Choosing the right speaker isn’t as hard as you think. The first thing you may want to consider is how much fuss is acceptable to you in terms of installation. If you prefer it not to be a fuss, then I’d suggest to go with speaker sizes that will replace the current speaker location you have. This however can be limiting depending on the current setup on your vehicle and also the goal you are trying to achieve. If you are after big and loud sound, then I’m thinking you may need larger speakers that may not necessary fit snugly in the factory hole. In cases like this, you will need some custom work done to be able to fit the speakers. if you are going only slightly larger, then there are speaker adapters and brackets available in the market.
A few parameters when it comes to speaker sizes are Diameter (if its round), width x height (for oval shaped) and also depth measured from the end of the magnet to the top. Typically speakers come in a few standard sizes but depth will vary depending on magnet size.
Speaker types can be broken into two categories. Full-range speakers and component speakers.
Full-range speakers usually consist of a woofer and tweeter mounted on top of the woofer. These make the most sense in terms of straight forward speaker replacement with minimal fuss.
Component speakers consist of a woofer, tweeter and external crossover. The tweeters come separate which allows it to be mounted at a separate location from the woofer providing better imaging. The external crossovers allow for a better design and also improves the way the signals are separated and sent to the individual drivers.
Sensitivity and Power-handling
Besides size, the other thing that needs attention when choosing the right speakers for your system is the sensitivity (measured in dB) and power-handling (measured in Watts).
Sensitivity is basically how much sound the speaker will produce when power is supplied. Low powered head units with no amplifiers will work great with high sensitivity speakers. Low sensitivity speakers will suit high powered systems better, such as having an amplifier. Speakers when coupled with the right amps can produce great results!
Power-handling is the amount of power the speakers can handle. A low powered system can be paired with a low power-handling speakers and high-powered systems can be paired with high power-handling speakers. it’s best to match the speakers to the amps for best results. Another important thing is to always look at the RMS power and not the peak power.
It’s usually obvious just by looking to know if the speakers are made well with good materials. There are numerous materials used to make speakers that trying to know what sounds the speaker will produce is just plain impossible. Instead, I always advice judging it by eye. If it looks like it uses cheap materials and poorly constructed, then it probably is.
Generally, the typical materials that I find works are Polypropylene woofers, silk tweeters and rubber surrounds. However, there are many variations of materials used out there so the best way sometimes are to give them a try and see if you like it. |
website. I bought it on sale at Harris Teeter and I don't remember how much I paid for it (I am a sucker for things on sale), but I will certainly buy it again. I used half a jar of sauce and half a bag of Trader Joe's mini ravioli (also worth a try if you have never had them) and it made three servings. So provided I can get three servings out of the rest of the jar, that works out to about $1.58 a serving. Not too bad, when you break it down like that.
I added in cubed mozzarella and fresh basil to the warmed sauce before mixing it with the cooked ravioli. Simple, quick and satisfying.
Basil plant is doing well! |
8mm Double Rear View Side Mirrors For Harley FLHT FLHR Road King FLHTC Classic
- Fitment : Universal fits for Most 8mm Threaded Harley Davidson Motorcycles Fits '82-later Models (except VRSCF models and XL1200X models with mirrors mounted below the handlebar).
- Aftermarket 100% New , Color: Chrome , Material: Zinc Alloy Shell, Iron Stem , Package included 1 Pair Mirror
- High class quality and very durable , Good Working Condition and Easy to Install
- Good Weather Ability, High Toughness and Smooth Surface. , These Mirrors Give You a Wide Vision and Improve Safety Factor.
- Chrome Plated Mirror Features a High Quality of Durability, Fineness and Brightness.
RONGT Dual Camera Car Dvr Camcorder Mirror Dash Cam Watch G-Sensor HD 1080 P 4.3 '' 170 Free Night Vision Degrees
- Dual cameras,1080p HD front camera with 170 degree ultra high definition wide angle view, 720p rear camera with 140 degree ultra high definition wide angle.
- Jieli HD solution,4.3 inch LCD display screen, Maximum to 32GB TF Card(Not included) Support Auto-reversing visual,G-sensor,Time stamp, Motion detection, Seamless loop video.
- Multilingual: Support English,Japanese,German,Simplified Chinese,Traditional Chinese
- Picture-in-picture Display: The Front view and rear view videos are displayed on the screen in a picture-in-picture appearance.
- One-button switch can toggle the display of the two views in either the full screen or the inset window respectively, or turn off the picture-in-picture display.
RONGT 2.8" HD Night Vision Car Tachograph DVR Rearview mirror Camera Video Recorder
- 100% Brand New and High Quality.
- High-definition camera, high-definition video.
- LCD Size: 2.8Inches.
- Quick Snap , Quick Video Recording, Quick Review.
- Easy installation and operation.
GaanZalive36 Cotton Silk Key Cover Charm Car Keychain Tags Chains Pendant Coin Handbag Case Bag Pouch Purse Metal 2inches Round Ring (3.8W x 4.5L inch, Brown Gourmet)
- Material Type: Cotton or Silk, GaanZaLive36 car key case make of Cotton or Silk, which is soft to touch.
- 1 Zipper Smoothly fits for almost all keys,1Metal 2inches Round Ring, 1Little Metal 0.7inches Round Ring, it's easy to put in and get out your smart car key.
- Washable and good quality fabric.
- Dimension (approximately) 3.8x4.5x0.5 inches, please check your key size before ordering.
- 100%Handmade Ship from and Sold by GaanZaive36 |
- Take a moment now and write down everything you have to do tomorrow. ...Include yourself in the list. Write down a time for yourself each day.
- Assign a priority to every item on your list.
- Tomorrow, begin with number one and stick with it until it's accomplished. Then start on number two and stay with that until it's finished. Go on to number three and finish it. And so on down your list. Complete each job. Don't worry if you can't complete everything on your list; the most important items will have been done.
- Keep your daily schedules in a loose-leaf notebook, or use a calendar with spaces large enough to enter your daily activities. This way you keep a running log of your activities. You'll also have a record of when...(you accomplished that task and how much you have accomplished. There is satisfaction in completing tasks.)
(The Total Woman, Marabel Morgan, Fleming H. Revell Company, 1973, pg. 31-33) |
"Jigoku Shoujo" is the 25th episode of the season "Jigoku Shoujo".
Starting where the pervious episode left off; the Shibata's awake in the mountain's stream, but are thrown into a different time period. They see a village set in the Edo period and Sentaruo is introduced. The young boy is at home, when a young girl of seven years of age enters in, crying; it is Ai Enma! Sentaruo asks if the village boys have been teasing her, again, and he runs off to find them. He gets into a fight with one of them, when they inform him about Ai being "not of this world" and mention that she brought a dead butterfly back to life. Sentaruo returns home to comfort Ai, but her parents receive news that Ai has been chosen to be a sacrifice for the mountain god for a good harvest, as it is tradition to have a child of seven years of age be sent to the mountain god.
Ai's parents, seeing that they love their daughter, decide to defy the village elders and have Sentaruo hide Ai after the ceremony. That night, at the ceremony, the villagers see Ai off into the forest at the base of the mountain, but Sentaruo secretly takes her away to the mountain's stream, where she would send most of her years alone, but Sentaruo would deliver food, clothes, and keep her company. It is also during this time that Ai's beautiful black hair grows long. However, the village is suffering from a famine and most of the people are dying. One night, several of the village boys discover what Sentaruo has been up to, therefore they attack both him and Ai, and bring them back to the village. The villagers take Ai and her parents, who are bound and blindfolded, to the mountain god's shrine and urge Sentaruo to bury them alive. Sentaruo refuses at first, but then several angry villagers attack and kill Ai's parents, but Ai is only knocked out, and they throw their bodies into a pit. Sentaruo begins to cry, one tear wakes Ai up, her blindfold loosens, revealing that her eyes have changed to ruby red. The villagers urge Sentaruo to bury them; having no choice, he tosses in the first scope of dirt down, and Ai sees him do this. Sentaruo runs away, as the villagers continue to bury Ai and her parents, and praying to the mountain god to forgive them. Ai calls out that she will hate all of them, even if she dies, she'll hate them.
Some time later, the village grows quiet, but not until one night, Ai rises from the grave. Sentaruo decides to head out of the village, until he notices a fire, and he runs back. To his horror, he sees Ai, covered in blood, singing "Children of Seven" (Sakura Uta in the Japanese version), and the whole village burns to the ground. Sentaruo runs through the woods laughing, but takes one last look at the burning village, and he disappears into the woods.
Back at the present, the Shibata's found themselves back at the temple. Tsugumi begins to cry, as she feels sorry for what Sentaruo did to Ai, and Hajime informs that they are not finished with Hell Girl. |
NATO member, 7 police killed in Afghanistan
KABUL, Afghanistan -- A member of the NATO force died in southern Afghanistan on Thursday while attacks on police facilities in several provinces killed at least seven Afghan law enforcement officers and one civilian.
The latest violence comes as local forces assume greater responsibility for security in advance of a planned pullout of NATO combat troops by 2014.
A NATO coalition spokeswoman said the force member's death was caused by a roadside bomb but that, in line with policy, any additional information would be provided by officials of the victim's home country, which was not immediately identified.
Ahmad Jawed Faisal, a spokesperson in the Kandahar governor's office, said six policemen and six civilians were wounded in that southern province Thursday morning when a suicide bomber rammed an explosive-laden 4-wheel-drive vehicle into the gate of a district police headquarters compound.
Kandahar, the birthplace of the Taliban, is among the most heavily contested areas as militants and Afghan and foreign forces battle for control.
Ahmadzia Abdulzai, a spokesman in the governor's office of eastern Nangarhar province, said a device detonated at a police checkpoint on the Jalalabad-Torkham highway, although the type of explosive and circumstances of the blast were still under investigation.
And in northern Kunduz province, a roadside bomb reportedly struck a vehicle carrying the head of a district anti-terrorism police force, killing him, a colleague and a police bodyguard.
Civilian deaths in Afghanistan fell 21% in January through April compared with the year-earlier period, the first time since record-keeping began in 2007 that the death toll has declined over a several-month period, the U.N. Assistance Mission in Afghanistan said in a statement Thursday.
Although that is welcome news, too many civilians are still getting caught up in the violence as insurgents fight Afghan and foreign forces, the agency said. And despite the most recent improvement, 2011 was the fifth consecutive year that civilian casualties increased, with 3,021 deaths reported.
Roadside bombs planted by anti-government forces remain the biggest civilian killer, the U.N. said, adding that, despite improvements, it continues to document human rights abuses by Afghan local police.
According to U.N. figures, 579 civilians were killed in Afghanistan during the first four months of 2012, while the number of wounded fell to 1,216. Antigovernment forces -- basically the Taliban and its allies -- were responsible for 79% of civilian casualties, the U.N. said. Afghan and foreign forces accounted for 9%, with the remainder unaccounted for.
Jan Kubis, the U.N.'s special representative to Afghanistan, told reporters Wednesday that he believed the $4.1 billion required annually to support and continue training Afghan security forces after 2014 "will be reached and is achievable," according to the Associated Press. The Afghan government is slated to provide $500 million of the total budget.
There are currently 130,000 U.S.-led NATO forces fighting the Taliban-led insurgency in Afghanistan. On Tuesday, the Pentagon announced the death of Sakhr Taifi, Al Qaeda's second in command in Afghanistan, part of its bid to prevent the country from becoming an Al Qaeda stronghold again.
[For the Record, 6:28 p.m. May 31: A previous version of this post said civilian deaths in Afghanistan were down 36% in the first four months of this year. They were down 21%.]
-- Aimal Yaqubi Kabul and Mark Magnier in New Delhi
Photo: A member of the NATO forces in Afghanistan walks toward a police checkpoint in Jalalabad on Thursday, a day when attacks killed several Afghan police and a NATO service member. Credit: Rahmat Gul / Associated Press |
Located in Historic New Castle. Seller does not warrant number of lots. Believe there is 1 lot for single or duplex. Buyer to provide their own land planner. There is a 1.50 acre parcel and a .56 acre parcel across road.
Listing Agent: Tom Wheeler
Courtesy of: BHHS Fox & Roach-Newark
Office Phone: 3023681621
Updated: 17th August, 2017 11:55 PM.
0 Chestnut New Castle, DE |
Dr. Orlee Hamer
University of Medicine and Dentistry of New Jersey, School of Osteopathic Medicine
University of Pennsylvania, B.A.
Memberships & Appointments
Assistant Clinical Professor in the Department of Rehabilitation and Regenerative Medicine at Columbia University Medical Center
About Dr. Orlee Hamer
Dr. Orlee Hamer received her Bachelor of Arts degree from the University of Pennsylvania before attending medical school at the University of Medicine and Dentistry of New Jersey, School of Osteopathic Medicine. She did her post-graduate internship training at Delaware County Memorial Hospital and completed her residency training in Physical Medicine and Rehabilitation at New York Presbyterian Hospital- Columbia University Medical Center and Weill Cornell Medical College.
She is board certified in Physical Medicine and Rehabilitation. She also served as an Assistant Clinical Professor in the Department of Rehabilitation and Regenerative Medicine at Columbia University Medical Center.
Dr. Hamer specializes in a multidisciplinary approach to treat pain and musculoskeletal disorders by integrating physical therapy with injection techniques and osteopathic manipulation. Dr. Hamer individualizes her treatment plan with a focus on functional restoration. She employs a comprehensive approach to the treatment of pain and musculoskeletal disorders by providing medical care in an honest, kind, and compassionate manner.
All of us at the Redefine Healthcare want our patients to know that we consider it an honor and a privilege to take care of you and your family. By adding new highly qualified, expert trained physicians to our team, we will continue to remain committed to provide the highest quality of care to alleviate your pain and restore your quality of life!
CALL NOW : 877-710-9324
2500 Morris Avenue, Suite 220
Union, NJ 07083
10 Parsonage Rd. Suite 208
Edison, NJ 08837
925 Clifton Ave. Suite 203
Clifton ,NJ 07013 |
All of our wooden kitchenwares are handmade by a small family-owned business in rural Tennessee. It's a learned tradition, handed down from father to son and spans multiple generations. The vast majority of the pieces come from locally-sourced trees (often from my parents' farm), but every so often a more exotic piece of wood comes along and I get something from it. Most are exclusive to Riley/Land.
The pasta roller is a the very embodiment of the "functional art" tag I gave it. Mixing black walnut, cherry and maple, BLAH BA BA |
Well--I'm another year older. Forty-eight years old now. After spending the weekend up in Puyallup, I had to go back to work on my birthday. My friends were nice to me though. I got several cards, some Avon products, an entertainment coupon book and a birthday cupcake from them. I decided I wanted to go to Mexico Lindo for my birthday dinner. We don't go there as often as we used to so it was a nice treat. And there is something to be said about a nice big margarita. Yum! |
2017 Gone Fishing Wall Calendar
There is a different fishing illustration for each month of the year, so you have got a lot to look forward to. The full color wall calendar measures 12 inches x 24 inches (open size) and has ample room to record appointments and notes every day. As a special bonus and exclusive website offer, the calendar cover is hand-signed by Gary. The calendars sell out early, so do not delay! |
Imusa Bistro Espresso Coffee Maker Review & Giveaway
Disclaimer: Products are provided to Steamy Kitchen for a thorough, honest review. We do not receive payment for reviews. Each review takes 5-10 hours of hands-on testing, writing and editing.
Imusa provided product for review and giveaway.
Imusa Bistro Espresso Maker Review
The first IMUSA product I tried was a bright orange caldero, a Latin cooking pot used for soups, beans and rice. It was the perfect size and a great price.IMUSA began as cookware company specializing in Hispanic products, with tortilla warmers, tortilla presses and of course, the caldero. They’ve expanded their product line to include espresso makers, woks and fondue sets – truly becoming a leader in cookware for global cuisines.
IMUSA recently sent me a 4-cup espresso maker and milk frother to try out. It’s a compact, simple espresso/cappuccino machine that does its job well. For $44.99 at Target, the machine is a great value.
We’ve been testing this little machine for the past 3 days, and love making cappuccino with a little dusting of cinnamon. The IMUSA is easy to use, a breeze to clean and like one reviewer on Amazon said, it takes me 10 minutes to make 2 cappuccinos and clean up.
Imusa Bistro Espresso Maker
- Prepares up to 4 cups
- Glass Carafe with Lid & Pouring Spout
- Removable Drip Tray for Easy Cleaning
- 5 Bar Steam Pressure
- Adjustable Steam Control for Frothing Milk
- Removable Filter Holder
- Silver & Black
- Available at Target.com
Thank you for your support!
Imusa Espresso Machine Giveaway
Happy National Coffee Day! To celebrate, we’re giving away one IMUSA Bistro Espresso Machine.
Congratulations to our winner(s)! |
The ant specie can't survive without a colony. It's natural. Same with humans that leadership is natural and order is what most of us look for. Tribes, empires, nations, they will not just go away.
Differences among human beings is an advantage, not an obstacle. Nothing can't be equal among humans but with different responsibilities and capabilities each one of us have, we compliment what lacks from the other person.
Both religion and science thrive thru faith. They move forward with the hope of finding something that they haven't seen yet but believe that there is. |
Wednesday, November 4, 2009
October,30. Late night. We are speaking with students from Bob Greenberg's class, Terry Smith's class from the USA and then with the teacher of Livewires Carolyn Knight from New Zealand.
It was an exciting evening!
You see the flowers on the slides. We see snow on the ground at our place.
Speaking with our friends makes us feel happy. It warms our hearts. Our friendship makes the snow melt. |
Thank you for your warm support.
Please be informed that friendly match will be held on 13th November 2010.◆Friendly match
【date&time】13th November 2010, Sat, 17：00 Kick Off
【opponent】Singapore National team
【venue】Jurong East Stadium
The stand will be open to public for free on that day.
Please feel free to come to stadium. |
Roberts still committed to the Rovers cause
Rovers back from the brink striker Jason Roberts has insisted he will still give all for the cause at Ewood Park.
Roberts had long been on his way out of Blackburn after agreeing with Big Sam that he needed to move on for both parties to benefit.
But with a last day move to either Wigan or QPR failing to materialise J-Rob is now stuck at Blackburn and will be told to fight for his place.
Roberts himself though has no doubt he will continue to give it 100%.
J-Rob, speaking to the Lancashire Telegraph - "This is football. I was sitting and waiting for phone calls telling me what was happening. At the end of the day if something can`t be done to suit both clubs and the player then nothing can be done. That is how it was.
"For me it is not a problem, not a problem at all. I am a Blackburn Rovers player and if the club wants me at any point I will do my best and will do everything I can for the team.
"I am comfortable with continuing where I am and I am comfortable with what I can do here. I will do my best, train hard and continue to be as professional as I can be. At the end of the day though, football is about opinions."
I know that and I have no problem with that. I honestly don`t believe I have got anything to prove.
"All I can do is keep doing what I have always done.
"I scored more league goals than all our other strikers put together last season and I am comfortable with my record of five goals in 15 starts. I believe I can still score goals in the Premier League and will look to do that if I get the chance.
"It is up to other people to pick the side. All I can do is work hard, turn up for training and I of course will continue to do that. I have got no problem here." |
LIMERICK, Pa.--(BUSINESS WIRE)--Teleflex Incorporated (NYSE: TFX) announced today that its Board of Directors declared a quarterly cash dividend of thirty-four cents ($0.34) per share of common stock. The dividend is payable March 14, 2014 to shareholders of record at the close of business on March 4, 2014.
Teleflex is a leading global provider of specialty medical devices for a range of procedures in critical care and surgery. Our mission is to provide solutions that enable healthcare providers to improve outcomes and enhance patient and provider safety. Headquartered in Limerick, PA, Teleflex employs approximately 11,400 people worldwide and serves healthcare providers in more than 150 countries. The company offers a Dividend Reinvestment & Direct Stock Purchase and Sale Plan. For information about the Plan, call 1-877-842-1572 (toll free), or log on to www.amstock.com to make an initial purchase. Additional information about Teleflex can be obtained from the company’s website at www.teleflex.com. |
Fort Mill's new mayor Danny Funderburk is reaching out, seeking volunteers for committees he wants to create and for non-profit organizations casting about for grants.
"During the campaign, people had conversations with me about their intention to get involved," Funderburk said. "I'd love to see it work. You get the volunteers, get these teams established with expertise, call out to the non-profits, hook volunteers up with them and you get some things done."
Funderburk calls his community outreach "a two-pronged plan":
• He's asking residents to fill out a volunteer form at town hall, listing areas of interest and expertise. The town has three existing commissions: the Planning Commission, the Zoning Board of Appeals and the Historical Review Board.
"Over the next three months, I hope to establish more commissions, boards and task teams so more people can participate," he said. "We'd like to have a pool of names, so as we put them together, we'll have a good pool of qualified people who can put their skills to work."
• He's seeking non-profit organizations that might qualify for grants for which the town alone doesn't, especially in the areas of reaching at-risk youth and revitalizing neighborhoods.
"A lot of times, we find out about grants and funds, and when we make the inquiry, they basically look at Fort Mill and say things are going too well in Fort Mill," he said. "They say these moneys are for other towns."
The town would use its resources "in any way we could," he said. That might include helping fill out the grant applications, navigate the system, determine where money is available.
"If they will take the lead, we can help grease the chute," Funderburk said. "I think we can help them navigate the system. If people have never gone through the process, I think the town could be a partner."
Town Planning Director Andy Merriman said currently, "we just shoot for grants we know we can get because we know we're qualified."
Fort Mill has in the recent past won an approximate $600,000 matching transportation enhancement grant to make the downtown more pedestrian-friendly. Another $350,000 in federal dollars has provisionally been approved for "air quality enhancement" to add a turn lane at U.S. 21 and S.C. 160.
"If working with non-profits is going to help through public-private relationships to get moneys for everybody, those avenues need to be explored," Merriman said.
The Fort Mill Housing Authority already manages three non-profit agencies that help people with needs financial and other:
• Community Housing, with the town's assistance, is helping develop the Avery Lakes community for mixed-income families and people 55 and older; the program includes down-payment assistance for qualified persons.
• Fort Mill Housing Services helps qualified people in York and Lancaster counties make down payments and assists with purchase and closing costs.
• Holly Ridge Apartments provides apartment assistance for people with special needs.
Grazier Rhea, community development director for the Catawba Regional Council of Governments, said grant guidelines changed this year and made it more difficult to obtain money to assist people such as seniors and children.
"We used to be able to do senior centers," she said. "We did the Children's Attention Home. We can't do them anymore. Now, it's more work force-related."
Rhea, who works with grant applications, said she hopes to meet with the new mayor and discuss possibilities.
"I think the mayor is trying to grasp those options out there," Merriman said. "Any private entity that would have an interest. How do we benefit taxpayers and customers?" |
Since the 1930s the AICPA Benevolent Fund has aided members facing medical and financial hardships when personal savings and government assistance are limited or unavailable. The fund assists with the cost of medications, therapy and/or daily expenses. At least twice a year the board of trustees of the Benevolent Fund assesses the ongoing needs of fund recipients based on updated information provided by current and new recipients. To learn more about the Benevolent Fund’s work, contact Elizabeth Cich of the AICPA at 201-938-3490 or email@example.com .
The AICPA Benevolent Fund also is accepting donations, which are deductible from your 2003 taxes if made by December 31, to help it continue providing financial assistance to needy Institute members and their families. Contributions can be sent to the AICPA Cashier, Harborside Financial Center, 201 Plaza Three, Jersey City, New Jersey 07311. |
On Friday, June 2nd, The Kildonan School graduated 10 seniors surrounded by their families, friends, classmates and teachers. It was a beautiful sunny day as the graduates walked across campus in the graduation processional that included Kildonan faculty members and guest speakers.
How to Apply
Thank you for your interest in The Kildonan School. We look forward to getting to know your student and family during the application process. The first thing you will need to do is send us your child's recent educational and psychological testing (within the last three years). The Weschler Intelligence Test with subtest scores is required for all applicants.
Once we receive the testing, our Admissions Committee will review it to see if our program can meet the needs of your child. The Admissions office will contact you with a decision, and guide you to the next step in the application process.
Continuing with the application process includes sending us the following additional materials:
- Completed Kildonan School Application (PDF)
- Recent photograph of the applicant
- $50 application fee (non-refundable)
- Schedule a campus visit and interview
We look forward to welcoming your family to our campus!
It is in the student's best interest to plan entrance to Kildonan for September, although some students are admitted in January and a few other times throughout the year when space is available.
We welcomed Grandparents, Special Friends, Kildonan parents, Alumni, and our Board of Trustees to campus for a two-day celebration of Founder's Day on Friday, May 12 and Saturday, May 13. Kildonan students showcased their leadership skills, project-based learning, musical ability, artistic creativity and athleticism through a wide spectrum of presentations.
"For every deficit or weakness you have, you also have a superpower." — Keynote Speaker David Kessler
Five Kildonan students traveled to San Francisco, CA to attend the 2017 EdRev (Education Revolution) Conference from April 19 to April 23. Each year, our Eye to Eye students are invited to this conference, which is organized by Parent Education Network (PEN) and held at AT&T Park. |
Cytotoxicity and activation of the Wnt/beta-catenin pathway in mouse embryonic stem cells treated with four GSK3 inhibitors
© Naujok et al.; licensee BioMed Central Ltd. 2014
Received: 9 December 2013
Accepted: 17 April 2014
Published: 29 April 2014
Small membrane-permeable molecules are now widely used during maintenance and differentiation of embryonic stem cells of different species. In particular the glycogen synthase kinase 3 (GSK3) is an interesting target, since its chemical inhibition activates the Wnt/beta-catenin pathway. In the present comparative study four GSK3 inhibitors were characterized.
Cytotoxicity and potential to activate the Wnt/beta-catenin pathway were tested using the commonly used GSK3 inhibitors BIO, SB-216763, CHIR-99021, and CHIR-98014. Wnt/beta-catenin-dependent target genes were measured by quantitative PCR to confirm the Wnt-reporter assay and finally EC50-values were calculated.
CHIR-99021 and SB-216763 had the lowest toxicities in mouse embryonic stem cells and CHIR-98014 and BIO the highest toxicities. Only CHIR-99021 and CHIR-98014 lead to a strong induction of the Wnt/beta-catenin pathway, whereas BIO and SB-216763 showed a minor or no increase in activation of the Wnt/beta-catenin pathway over the natural ligand Wnt3a. The data from the Wnt-reporter assay were confirmed by gene expression analysis of the TCF/LEF regulated gene T.
Out of the four tested GSK3 inhibitors, only CHIR-99021 and CHIR-98014 proved to be potent pharmacological activators of the Wnt/beta-catenin signaling pathway. But only in the case of CHIR-99021 high potency was combined with very low toxicity.
Small molecules are attractive chemical compounds to control pluripotency in murine embryonic stem cells [1–6]. They may also be used to direct embryonic stem (ES) cell fates during differentiation [7–10] or enhance the reprogramming of adult cell types into iPS cells . In contrast to growth factors or cytokines, they offer distinct advantages such as a well-defined activity, good stability upon heat exposure in a cell culture incubator, less batch-to-batch differences, and modest costs. Chemical inhibitors of the glycogen synthase kinase 3 (GSK3) are very attractive tools as they allow the control of pluripotency in mouse and rat ES cells [5, 6] and may be used to direct human ES cells into mesodermal or endodermal cell fates via activation of the canonical Wnt-pathway [12–16].
The Wnt/beta-catenin pathway controls miscellaneous biological processes during tissue development by autocrine and paracrine activities . When Wnt-signaling is activated by binding of secreted Wnt-protein to its receptor, dishevelled (Dvl/Dsh) is recruited and inhibits the GSK3 located in the beta-catenin destruction complex . This leads to an accumulation of free non-phosphorylated beta-catenin in the cytosol, which translocates to the nucleus and transactivates Wnt-target genes together with the T-cell factor (TCF)/lymphoid-enhancing factor (LEF) family of transcription factors . Thus, chemical inhibition of the GSK3 (herewith referred to as GSK3i) leads to a pharmacological activation of the canonical Wnt-signaling pathway. However, the compound to be used in a study should be carefully selected as small molecules may exhibit cytotoxicity, side effects, and differ in activity.
In this study the effect of four commonly used GSK3 inhibitors, namely BIO, SB-216763, CHIR-99021, and CHIR-98014 was analyzed in a comparative fashion in two different mouse embryonic stem cell lines (ES-D3 and ES-CCE). Specifically, the cytotoxicity, the ability to activate the Wnt/beta-catenin-pathway, and the changes in gene and protein expression were analyzed in a defined serum-reduced medium devoid of LIF.
The results show that one of the four tested compounds, CHIR-99021, is optimally suited for strong activation of the Wnt/beta-catenin-pathway without significant concomitant toxicity.
RPMI1640 advanced, KO-DMEM, NEAA, and glutamax were obtained from Life Technologies (Darmstadt, Germany) and fetal calf serum was from (PAA Laboratories/GE Healthcare, Cölbe, Germany). The GSK3 inhibitors BIO, SB-216763, and CHIR-99021, were from Tocris Bioscience (Wiesbaden-Nordenstadt, Germany) and CHIR-98014 was purchased from Axon Medchem (Groningen, Netherlands). Wnt3a was obtained from Peprotech (Hamburg, Germany) and Matrigel was from Corning (Corning, NY, USA). All primers were synthesized by Life Technologies. The RevertAid™ H-Minus M-MuLV reverse transcriptase was purchased from Thermo Fisher Scientific (Braunschweig, Germany). The GoTaq® Taq polymerase was from Promega (Mannheim, Germany) and dNTPs from Genecraft (Münster, Germany). Unless mentioned otherwise, chemicals were obtained from Sigma-Aldrich (Taufkirchen, Germany).
Mouse ES cell culture
To maintain the pluripotency of the mouse ES cell lines ES-D3 and ES-CCE , they were routinely cultured on gelatine-coated dishes in KO-DMEM containing 25 mM glucose supplemented with 15% FCS, 2 mM L-glutamine, 100 μM NEAA, 100 μM 2-mercaptoethanol, penicillin/streptomycin, and 1,000 U/ml LIF (eBiosciences, Frankfurt, Germany) [10, 21]. The medium was changed daily and the cells were passaged 2–3 times per week. The basal medium for the comparative experiments was RPMI advanced supplemented with 0.2% FCS, penicillin/streptomycin and 1-fold glutamax with different concentrations of BIO, SB-216763, CHIR-99021 and CHIR-98014. A randomized control was performed with basal medium without growth factors and/or small molecules. Physiological activation of the Wnt/beta-catenin-pathway was tested in medium supplemented with 50 ng/ml Wnt3a.
Cell viability assay
The viability of the mouse ES cells was determined after exposure to different concentrations of GSK3 inhibitors for three days using the MTT assay . The decrease of MTT activity is a reliable metabolism-based test for quantifying cell viability; this decrease correlates with the loss of cell viability. 2,000 cells were seeded overnight on gelatine-coated 96-well plates in LIF-containing ES cell medium. On the next day the medium was changed to medium devoid of LIF and with reduced serum and supplemented with 0.1 – 1 μM BIO, or 1 – 10 μM SB-216763, CHIR-99021 or CHIR-98014. Basal medium without GSK3 inhibitors or DMSO was used as control. All tested conditions were analyzed in triplicates.
Wnt/beta-catenin activity assay
The Wnt/beta-catenin reporter assay was performed with the M50 Super 8× TOPFlash and M51 Super 8× FOPFlash vector containing the firefly luciferase gene under the control of TCF/LEF binding sites (M50 Super 8x TOPFlash) or mutated bindings sites (M51 Super 8× FOPFlash) . 12,500 cells were seeded overnight on gelatine-coated 96-well plates in LIF-containing ES cell medium. On the next day the cells were transfected using Lipofectamine (Life Technologies) with one of the aforementioned vectors plus pGL4.75 [hRluc/CMV] (Promega) encoding the renilla luciferase reporter gene hRluc as a transfection control. Six hours after transfection the medium was changed to medium devoid of LIF, with reduced serum, and supplemented with 0.5 μM Bio, 5 μM SB-2167763, 5 μM CHIR-99021 and 1 μM CHIR-98014. The Dual-Luciferase® reporter assay system (Promega) was employed 48 and 72 h after medium change to follow the luminescence reaction using a GloMax®-multi detection system (Promega).
Gene expression analyses
Total RNA was isolated from the cells using the RNeasy Kit (Qiagen, Hilden, Germany). Briefly, the cells were lysed in Qiazol (Qiagen), the hydrophilic phase was loaded onto RNA spin columns, and RNA was then prepared as instructed. cDNA synthesis was performed with random hexamer primers and 2 μg of the isolated total RNA following the manufacturer’s instructions. 10–20 ng of cDNA was then loaded in each well of a 384-well plate and specific primers were mixed with the GoTaq® PCR master mix according to the manufacturers’ instructions. Primer sequences were (5’-3’): T fw: catcggaacagctctccaacctat, rev: gtgggctggcgttatgactca, Nanog fw: ccctgaggaggaggagaacaaggtc, rev: ccactggtttttctgccaccgc, and Pou5f1 fw: aggcccggaagagaaagcgaacta, rev: tgggggcagaggaaaggatacagc. Each qPCR amplification was performed in triplicates and the gathered data were normalized with qBasePlus (Biogazelle, Zwijnaarde, Belgium) against the housekeeping genes G6pdx, Tbp, and Tuba1a.
Immunofluorescence was performed according to standard procedures. ES cells were treated on 6-well plates with different GSK3 inhibitors and after 48 h 100,000 cells were re-seeded in each cavity of Matrigel-coated glass slides (Zellkontakt, Nörten-Hardenberg, Germany). After 24 h in medium the cells were fixed in 4% (w/v) paraformaldehyde for 45 min at 4°C. Subsequently, the cells were blocked for 20 min in PBS plus 0.2% Triton X-100, 6% BSA, and 1 mg/ml NaBH4. Primary and secondary antibodies were diluted in PBS with 0.1% Triton X-100 and 0.1% BSA. Primary antibodies were incubated on the slides for 2.5 h at room temperature (RT) or overnight at 4°C. Secondary antibodies were incubated on the slides for 1 h at RT. The following primary antibodies were used: anti-Oct3/4 (sc-5279, Santa Cruz Biotechnology, Heidelberg, Germany) and anti-Brachyury (AF2085, R&D Systems, Minneapolis, MN, USA). Secondary antibodies were obtained from Dianova (Hamburg, Germany). Finally, the slides were mounted with immunoselect antifading mounting medium containing DAPI (Dianova) to counterstain the nuclei. The stained cells were examined using an Olympus IX81 inverted microscope (Olympus, Hamburg, Germany).
Data were expressed as mean values ± SEM unless stated otherwise. Statistical analyses were performed using the GraphPad Prism software (Graphpad, San Diego, CA, USA) applying Student’s t-test or ANOVA followed by Bonferroni’s or Dunnett’s post hoc test for multiple comparisons.
In detail the viability of ES-D3 cells was reduced by 25.7% at 0.25 μM, 58.7% at 0.5 μM, 68.7% at 0.75 μM and 83.5% at 1 μM BIO. Calculation of the half maximal inhibitory concentration yielded in an IC50 of 0.48 μM for BIO. In presence of SB-216763 the viability of the ES-D3 cells was reduced by 1.7% at 1 μM, 29.8% at 2.5 μM, 55.6% at 5 μM, 56.1% at 7.5 μM and 57.2% at 10 μM SB-216763 with an IC50 of 5.7 μM. In the presence of CHIR-99021 the viability of the ES-D3 cells was reduced by 24.7% at 2.5 μM, 56.3% at 5 μM, 61.9% at 7.5 μM and 69.2% at 10 μM CHIR-99021 with an IC50 of 4.9 μM. CHIR-98014 reduced the viability by 52% at 1 μM and showed the greatest toxicity with increasing concentrations. The IC50 of CHIR-98014 was 1.1 μM (Figure 1A). ES-CCE cells generally showed a higher toxicity after GSK3i exposure (Figure 1B).
Wnt/beta-catenin pathway activation
A similar pattern with slight differences was detected for ES-CCE cells (Figure 2B). Treatment of ES-CCE cells with CHIR-98014 showed a significant increase of Wnt-signaling after 48 and 72 h, whereas CHIR-99021 showed only a significant increase at 72 h compared to random controls or Wnt3a-treated cells. In contrast to ES-D3 cells, a higher luminescence noise was detected for the M51 FOPflash vector transfections, which increased with time. Incubation with BIO or SB-216763 resulted in detectable luminescence signals, which were nevertheless comparable to that of negative or positive controls (Figure 2B).
Changes in gene expression during differentiation and incubation with GSK3 inhibitors
Immunofluorescence staining of Brachyury and Oct3/4 in ES-D3 cells treated with GSK3 inhibitors
In this comparative study the effect of four commonly used GSK3 inhibitors on mouse ES cells was studied with respect to their cytotoxicity and the potential to activate the canonical Wnt-signaling pathway.
The two studied mouse ES cell lines originate from the same mouse strain and were isolated using the same methods [19, 20], nevertheless they responded differently to a treatment with GSK3 inhibitors. The ES-CCE cell line was more prone to GSK3i induced cell death then the ES-D3 cell line. In addition, the activity of these compounds was different in the two cell lines. SB-216763 and CHIR-99021 caused the smallest reduction of the viability in both lines, whereas CHIR-98014 induced a high rate of cell death in ES-D3 cells and in particular in ES-CCE cells. The small molecule BIO, which has been used in a number of embryonic stem cell studies [25–27], was strongly cytotoxic in both ES cell lines already at concentrations below 1 μM. This is a surprising result, since other studies used this inhibitor at much higher concentrations (2-5 μM) [25–28]. In these studies the cytotoxicity was not tested and the inhibitor was used in presence of a high fetal calf serum concentration or knock-out serum replacement concentration, which might have quenched the cytotoxic effect.
With respect to the effect on the canonical Wnt-pathway, CHIR-99021 and CHIR-98014 showed the greatest activation potential, which was significantly higher than that of Wnt3a. Thus, GSK3i by these two compounds is a more potent chemical hyperactivator of the canonical Wnt-pathway than the natural ligand Wnt3a.
Surprisingly, SB-216763 caused a weaker activation of the Wnt/beta-catenin-pathway in the TOPflash-assay comparable to that of Wnt3a. This proves that this compound is less suited for GSK3i than the two CHIR-inhibitors. An activation of the Wnt-pathway by BIO in ES-D3 was barely detectable. Only in ES-CCE cells a distinct signal, delayed by 24 h, could be detected. Higher concentrations could not be analyzed due to the high cytotoxicity. Bain and co-workers recommended CHIR-99021 as the most selective GSK3 inhibitor although the tests in this study were performed in a cell-free system and potential cytotoxic effects were not analyzed . Next to the Wnt/beta-catenin-pathway the GSK3 fulfills a myriad of cellular functions . Thus, some effects of the treatment with GSK3 inhibitors might not be related to the Wnt-pathway alone. In this line it is even more important to verify a robust activation of the Wnt-pathway either by analyzing its activity or analyzing proper targets downstream of Wnt/beta-catenin.
It has been previously reported that double-knockout of both GSK3 isoforms in mouse ES cells yielded an induction of T, Pou5F1 (Oct3/4) and Nanog upon differentiation . In the present study we analyzed these three genes during culture conditions that would allow randomized differentiation of mouse ES cells. In confirmation to previous results , gene expression of both pluripotency markers was not decreased in the presence of GSK3i, whereas it was decreased in random controls. This is in line with earlier studies reporting the maintenance of expression of pluripotency factors by GSK3i [3, 4, 31]. Several studies reported that the inhibition of the GSK3, FGF- and ERK-signaling pathways resulted in improved derivation of new mouse ES cell lines [32, 33]. These findings lead to the development of the 3i and 2i media, which are now routinely used for the derivation and culture of mouse and rat ES cells [5, 6].
Additionally, a strong increase in gene expression of T was observed upon GSK3i. The strongest effect was detected for CHIR-99021 and CHIR-98014, which confirms the reporter assay results. The increased gene expression yielded Brachyury-positive cells predominantly together with Oct3/4 in case of both CHIRs but not in the presence of BIO and SB-216763. Interestingly, only a small subpopulation accounted for the 2,500-fold increase in T expression as measured by qPCR. This observed heterogeneity raises the question why some cells did not acquire Brachyury-positivity whereas another subpopulation showed a significantly increased Brachyury expression.
Small molecule inhibitors of GSK3 have become valuable reagents for studies on pluripotent stem cells. In murine ES cells they may be used to maintain pluripotency whereas in human ES cells GSKi was shown to be useful in differentiation experiments [15, 25]. The results presented in this study show that mouse ES cell lines can respond differently to GSK3i. Thus, effective and non-toxic concentrations of GSK3 inhibitors and the duration of their treatment need to be carefully titrated for each mouse ES cell line. Two strong GSK3 inhibitors, namely CHIR-99021 and CHIR-98014, were identified and characterized. These inhibitors allowed a pharmacological hyperactivation of the Wnt/beta-catenin signaling pathway in mouse ES cells, more potently than that achieved by the natural ligand Wnt3a. Thus, these GSK3 inhibitors are very useful compounds for further experimentation with pluripotent cells.
The skilful technical assistance of R. Strauss is gratefully acknowledged. This work has been supported by the Deutsche Forschungsgemeinschaft (German Research Foundation) within the framework of the Cluster of Excellence REBIRTH.
- Bone HK, Damiano T, Bartlett S, Perry A, Letchford J, Ripoll YS, Nelson AS, Welham MJ: Involvement of GSK-3 in regulation of murine embryonic stem cell self-renewal revealed by a series of bisindolylmaleimides. Chem Biol. 2009, 16: 15-27. 10.1016/j.chembiol.2008.11.003.PubMedView ArticleGoogle Scholar
- Ye S, Tan L, Yang R, Fang B, Qu S, Schulze EN, Song H, Ying Q, Li P: Pleiotropy of glycogen synthase kinase-3 inhibition by CHIR99021 promotes self-renewal of embryonic stem cells from refractory mouse strains. PloS one. 2012, 7: e35892-10.1371/journal.pone.0035892.PubMedPubMed CentralView ArticleGoogle Scholar
- Kirby LA, Schott JT, Noble BL, Mendez DC, Caseley PS, Peterson SC, Routledge TJ, Patel NV: Glycogen synthase kinase 3 (GSK3) inhibitor, SB-216763, promotes pluripotency in mouse embryonic stem cells. PloS one. 2012, 7: e39329-10.1371/journal.pone.0039329.PubMedPubMed CentralView ArticleGoogle Scholar
- Sanchez-Ripoll Y, Bone HK, Owen T, Guedes AM, Abranches E, Kumpfmueller B, Spriggs RV, Henrique D, Welham MJ: Glycogen synthase kinase-3 inhibition enhances translation of pluripotency-associated transcription factors to contribute to maintenance of mouse embryonic stem cell self-renewal. PloS one. 2013, 8: e60148-10.1371/journal.pone.0060148.PubMedPubMed CentralView ArticleGoogle Scholar
- Li P, Tong C, Mehrian-Shai R, Jia L, Wu N, Yan Y, Maxson RE, Schulze EN, Song H, Hsieh CL, Pera MF, Ying QL: Germline competent embryonic stem cells derived from rat blastocysts. Cell. 2008, 135: 1299-1310. 10.1016/j.cell.2008.12.006.PubMedPubMed CentralView ArticleGoogle Scholar
- Nichols J, Jones K, Phillips JM, Newland SA, Roode M, Mansfield W, Smith A, Cooke A: Validated germline-competent embryonic stem cell lines from nonobese diabetic mice. Nat Med. 2009, 15: 814-818. 10.1038/nm.1996.PubMedView ArticleGoogle Scholar
- Chen S, Borowiak M, Fox JL, Maehr R, Osafune K, Davidow L, Lam K, Peng LF, Schreiber SL, Rubin LL, Melton D: A small molecule that directs differentiation of human ESCs into the pancreatic lineage. Nat Chem Biol. 2009, 5: 258-265. 10.1038/nchembio.154.PubMedView ArticleGoogle Scholar
- Zhu S, Wurdak H, Wang J, Lyssiotis CA, Peters EC, Cho CY, Wu X, Schultz PG: A small molecule primes embryonic stem cells for differentiation. Cell stem cell. 2009, 4: 416-426. 10.1016/j.stem.2009.04.001.PubMedView ArticleGoogle Scholar
- Borowiak M, Maehr R, Chen S, Chen AE, Tang W, Fox JL, Schreiber SL, Melton DA: Small molecules efficiently direct endodermal differentiation of mouse and human embryonic stem cells. Cell stem cell. 2009, 4: 348-358. 10.1016/j.stem.2009.01.014.PubMedPubMed CentralView ArticleGoogle Scholar
- Naujok O, Lenzen S: A critical re-evaluation of CD24-positivity of human embryonic stem cells differentiated into pancreatic progenitors. Stem Cell Rev. 2012, 8: 779-791. 10.1007/s12015-012-9362-y.PubMedView ArticleGoogle Scholar
- Schmole AC, Hubner R, Beller M, Rolfs A, Frech MJ: Small molecules in stem cell research. Curr Pharm Biotechnol. 2013, 14: 36-45.PubMedGoogle Scholar
- D'Amour KA, Bang AG, Eliazer S, Kelly OG, Agulnick AD, Smart NG, Moorman MA, Kroon E, Carpenter MK, Baetge EE: Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat Biotechnol. 2006, 24: 1392-1401. 10.1038/nbt1259.PubMedView ArticleGoogle Scholar
- Mfopou JK, Chen B, Mateizel I, Sermon K, Bouwens L: Noggin, retinoids, and fibroblast growth factor regulate hepatic or pancreatic fate of human embryonic stem cells. Gastroenterology. 2010, 138: 2233-2245. 10.1053/j.gastro.2010.02.056.PubMedView ArticleGoogle Scholar
- Kroon E, Martinson LA, Kadoya K, Bang AG, Kelly OG, Eliazer S, Young H, Richardson M, Smart NG, Cunningham J, Agulnick AD, D'Amour KA, Carpenter MK, Baetge EE: Pancreatic endoderm derived from human embryonic stem cells generates glucose-responsive insulin-secreting cells in vivo. Nat Biotechnol. 2008, 26: 443-452. 10.1038/nbt1393.PubMedView ArticleGoogle Scholar
- Tan JY, Sriram G, Rufaihah AJ, Neoh KG, Cao T: Efficient derivation of lateral plate and paraxial mesoderm subtypes from human embryonic stem cells through GSKi-mediated differentiation. Stem Cells Dev. 2013, 22: 1893-1906. 10.1089/scd.2012.0590.PubMedPubMed CentralView ArticleGoogle Scholar
- Sui L, Bouwens L, Mfopou JK: Signaling pathways during maintenance and definitive endoderm differentiation of embryonic stem cells. Int J Dev Biol. 2013, 57: 1-12. 10.1387/ijdb.120115ls.PubMedView ArticleGoogle Scholar
- Holland JD, Klaus A, Garratt AN, Birchmeier W: Wnt signaling in stem and cancer stem cells. Curr Opin Cell Biol. 2013, 25: 254-264. 10.1016/j.ceb.2013.01.004.PubMedView ArticleGoogle Scholar
- Doble BW, Woodgett JR: GSK-3: tricks of the trade for a multi-tasking kinase. J Cell Sci. 2003, 116: 1175-1186. 10.1242/jcs.00384.PubMedPubMed CentralView ArticleGoogle Scholar
- Doetschman TC, Eistetter H, Katz M, Schmidt W, Kemler R: The in vitro development of blastocyst-derived embryonic stem cell lines: formation of visceral yolk sac, blood islands and myocardium. J Embryol Exp Morphol. 1985, 87: 27-45.PubMedGoogle Scholar
- Robertson E, Bradley A, Kuehn M, Evans M: Germ-line transmission of genes introduced into cultured pluripotential cells by retroviral vector. Nature. 1986, 323: 445-448. 10.1038/323445a0.PubMedView ArticleGoogle Scholar
- Diekmann U, Elsner M, Fiedler J, Thum T, Lenzen S, Naujok O: MicroRNA target sites as genetic tools to enhance promoter-reporter specificity for the purification of pancreatic progenitor cells from differentiated embryonic stem cells. Stem Cell Rev. 2013, 9: 555-568. 10.1007/s12015-012-9416-1.PubMedView ArticleGoogle Scholar
- Naujok O, Kaldrack J, Taivankhuu T, Jörns A, Lenzen S: Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment. Stem Cell Rev. 2010, 6: 450-461. 10.1007/s12015-010-9148-z.PubMedView ArticleGoogle Scholar
- Veeman MT, Slusarski DC, Kaykas A, Louie SH, Moon RT: Zebrafish prickle, a modulator of noncanonical Wnt/Fz signaling, regulates gastrulation movements. Curr Biol. 2003, 13: 680-685. 10.1016/S0960-9822(03)00240-9.PubMedView ArticleGoogle Scholar
- Arnold SJ, Stappert J, Bauer A, Kispert A, Herrmann BG, Kemler R: Brachyury is a target gene of the Wnt/beta-catenin signaling pathway. Mech Dev. 2000, 91: 249-258. 10.1016/S0925-4773(99)00309-3.PubMedView ArticleGoogle Scholar
- Bone HK, Nelson AS, Goldring CE, Tosh D, Welham MJ: A novel chemically directed route for the generation of definitive endoderm from human embryonic stem cells based on inhibition of GSK-3. J Cell Sci. 2011, 124: 1992-2000. 10.1242/jcs.081679.PubMedPubMed CentralView ArticleGoogle Scholar
- Sato H, Amagai K, Shimizukawa R, Tamai Y: Stable generation of serum- and feeder-free embryonic stem cell-derived mice with full germline-competency by using a GSK3 specific inhibitor. Genesis. 2009, 47: 414-422. 10.1002/dvg.20514.PubMedPubMed CentralView ArticleGoogle Scholar
- Besser D: Expression of nodal, lefty-a, and lefty-B in undifferentiated human embryonic stem cells requires activation of Smad2/3. J Biol Chem. 2004, 279: 45076-45084. 10.1074/jbc.M404979200.PubMedView ArticleGoogle Scholar
- Sato N, Meijer L, Skaltsounis L, Greengard P, Brivanlou AH: Maintenance of pluripotency in human and mouse embryonic stem cells through activation of Wnt signaling by a pharmacological GSK-3-specific inhibitor. Nat Med. 2004, 10: 55-63. 10.1038/nm979.PubMedView ArticleGoogle Scholar
- Bain J, Plater L, Elliott M, Shpiro N, Hastie CJ, McLauchlan H, Klevernic I, Arthur JS, Alessi DR, Cohen P: The selectivity of protein kinase inhibitors: a further update. Biochem J. 2007, 408: 297-315. 10.1042/BJ20070797.PubMedPubMed CentralView ArticleGoogle Scholar
- Doble BW, Patel S, Wood GA, Kockeritz LK, Woodgett JR: Functional redundancy of GSK-3alpha and GSK-3beta in Wnt/beta-catenin signaling shown by using an allelic series of embryonic stem cell lines. Dev Cell. 2007, 12: 957-971. 10.1016/j.devcel.2007.04.001.PubMedPubMed CentralView ArticleGoogle Scholar
- Wray J, Kalkan T, Gomez-Lopez S, Eckardt D, Cook A, Kemler R, Smith A: Inhibition of glycogen synthase kinase-3 alleviates Tcf3 repression of the pluripotency network and increases embryonic stem cell resistance to differentiation. Nat Cell Biol. 2011, 13: 838-845. 10.1038/ncb2267.PubMedPubMed CentralView ArticleGoogle Scholar
- Ying QL, Wray J, Nichols J, Batlle-Morera L, Doble B, Woodgett J, Cohen P, Smith A: The ground state of embryonic stem cell self-renewal. Nature. 2008, 453: 519-523. 10.1038/nature06968.PubMedView ArticleGoogle Scholar
- Kiyonari H, Kaneko M, Abe S, Aizawa S: Three inhibitors of FGF receptor, ERK, and GSK3 establishes germline-competent embryonic stem cells of C57BL/6 N mouse strain with high efficiency and stability. Genesis. 2010, 48: 317-327.PubMedGoogle Scholar
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. |
THE GLOBAL RESEARCH NURSES’ NETWORK IS CURRENTLY HELPING RESEARCH GROUPS TO FIND PARTNERS AND DEVELOP TWINNING RELATIONSHIPS
The GRN and the UK Clinical Research Community are working together to support Research Groups in developing an active sharing relationship that will provide resources and support for all members of the research team via Twinning.
Twinning is a way to link individuals and organisations to enable them to work together to reach defined goals. The Global Research Nurses' Network aims to provide resources and support for nurses working in research - one resource that we all share is our network!
We propose that you, through the network, can play an active role in providing mutually supportive relationships for sharing experience and expertise and building capacity in research through twinning.
Twinning is a voluntary yet formal agreement between two parties (e.g., groups/ communities/ professions) to provide mutual support within an agreed framework.
Twins must have, or must develop, a defined agenda with agreed outcomes that the twinning relationships aids. For example, you could share information about how you have set up and run research studies, tell twins about the challenges you face and how you have overcome them, develop common goals and projects, set up a research study together, identify shared learning goals.
Twinning can be cost neutral, or if appropriate the Twins can work together to apply for funding for specific twinning projects.
The UK Research Community and GRN are interested in facilitating contacts between research groups globally, to build twinning partnerships to support clinical research teams. We hope that twins can support each other in setting up studies and the running of those studies. The GRN and UK Research community will support Twins in the development of a framework of cooperation and help to strengthen partnerships by offering information about resources and support available.
If you are interested in twinning contact us. firstname.lastname@example.org
Copy Accreditation: Ania Rainbard |
The short film entitled “Inbox” has no dialogue throughout and his heavily reliant on sound, especially music to create tension and a unique filmic space. The film’s lack of dialogue quite unique in itself, it has a number of different repeated tracks which come to represent different things and create different kind of tensions. Whenever something mystical is happening or about to happen an upbeat xylophone track is played, whenever something fun is happening an electric guitar track. Another key tool in building tensions within this film is the contrast of these upbeat tracks, to more solemn, heart breaking tracks when things go wrong. Sound effects such as the heightened ticking of a clock too add to the building of tensions and suspense within this film.
In the short film film Clown Train, sound does more than just contribute to the atmosphere of the film but I believe it establishes it. The initial 20 seconds, generally in many films an establishing shot of the setting or situation a black screen. In this time a train coming to halt can be heard with many screeches along the way, this not only establishing that the setting is on a train but immediately creating a very eerie, almost disturbing mood and truly getting the tension building. As the main character comes into the picture seen from behind through a long shot seated on a train, a constant buzzing is heard in the background, when a quick cut to a close-up shows the face of the character and his confusion a synth drone sound can be heard; indicative of the character’s confusion, creating some dramatic tension, the audience able to concur that something is not right in this situation. This deep drone heard again as a quick cut to a p.o.v shot displays a creepy clown sitting on the opposite side of the train, the only other passenger on this train. The sound of the flickering of the trains lights going on and off, too adds to this dramatic tension. Even the voice of the actor playing the clown, being as deep as it and contrasting with that of the main character’s voice plays a key role in establishing the protagonist and antagonist and again adds towards the eeriness of the mood. The music that is used a classic horror movie sort of soundtrack of deep synth drones, really establishes the sort of film that it is, indicates that nothing good is going to follow and adds to the suspense which is being built. As the clown suddenly appears in the seat in front of the main character with a flicker of the lights, the music ends and higher synth drones are heard along with a sort of knocking, tinging sound; these higher pitched sounds increasing the tension and creating the sort of panic the main character is feeling. The creepier the situation gets, the faster and higher pitched the drones become; creating an anxiety to the mood. These sounds ending when the main character makes his move and gets off the train. Overall the use of sound through a combination of music and sound effects is truly is responsible for the amount of suspense and tension within the film; without it I highly doubt such an eerie, mysterious atmosphere could be created.
Sketch Task 1- Circle from Lauren Burgueno on Vimeo.
My washing machine having a spastic fit ….
In this video I wanted to play around with speeding things up and how that can create a distorted effect, particularly in regards to sound.
Taken with Sanyo Xacti VPC-CA9 Camcorder
Edited on Final Cut Pro |
A four-car pile up closed Highway 99 for several hours yesterday afternoon.
The accident, just north of Brandywine Falls sent three people to hospital and injured nine others.
The accident, which happened around 4 p.m. July 19, closed the highway in both directions for just over two hours. Alternating traffic in single lanes continued into the early evening.
RCMP officers from Whistler and Lower Mainland Traffic Services attended the accident along with the BC Ambulance Service (BCAS) and the Whistler Fire Department.
"Three individuals involved in the accident, including one with a head injury, were transported by BCAS helicopter to Vancouver General Hospital," said Sgt. Rob Knapton. Nine other individuals involved in the accident were treated at scene.
"The collision occurred when a vehicle travelling northbound on Highway 99 crossed the highway, impacting a vehicle travelling southbound. The northbound vehicle continued, impacting a second vehicle. The second southbound vehicle was then hit by a third southbound vehicle that was unable to stop."
The RCMP's Lower Mainland District Traffic division also impounded five motorbikes July 18 after their owners were caught riding 160-kilometres/ hr along the Sea to Sky Highway.
The motorcycles were northbound on Highway 99, and passed a stationary unmarked police car conducting traffic enforcement. The constable then merged onto the highway and paced the motorcycles to keep visual contact with them.
Due to traffic and public safety concerns, the police officer decided not to activate his emergency equipment, but radioed ahead to Squamish detachment officers, who then set up a roadblock south of Squamish on Highway 99.
"They may not realize it, but these motorcyclists are lucky we pulled them over," says Sgt. Peter Thiessen, of the Lower Mainland District Regional Police Service.
"Motorcyclists should be aware of the risks and of how easily they could lose control of their bikes. Too often we find drivers may not be familiar with the weight or capabilities of their bikes."
There is one motorcycle fatality so far in RCMP policed areas in the Lower Mainland in 2012, and six overall in B.C. to date this year.
That compares to nine motorcycle deaths in the Lower Mainland last year and 37 deaths overall in BC in 2011. Most of the fatalities in 2011 occurred during warm, dry weather from July through September.
During this incident the drivers ranged in age from 25 to 47. Each driver was issued an Excessive Speed violation ticket of $483, with one driver also receiving a second fine of No Driver's License of $276. All five motorcycles were impounded for seven days; the bikes ranged from a 1981 Honda to a 2010 BMW. |
Aguila De Osa Inn - Costarica
Directions to Aguila De Osa Inn
Are you a business owner in Costa Rica?
Promote your business 365 days a year with the #1 Guide to Costa Rica.Find Out More
Aguila de Osa Inn offers its guests amazing accommodations and exciting tours in Drake Bay Costa Rica. The Osa Peninsula is teaming with nature including endangered animals, exotic plants and pristine jungle filled with both. The Inn is perfectly situated for our guests to enjoy the wonders of Cano Island, Drake Bay, Corcovado National Park and the rest of the Osa Peninsula. Our rooms are luxurious yet built from materials found in the area. Each one has large screened windows to allow ocean breezes to glide through, 300 thread count cotton sheets, ceiling fans, hair dryers and coffee makers. We offer free WiFi and local calls to all of our guests.
Our website lays out numerous packages for family adventure, honeymooners, scuba diving, hiking and other tours into Corcovado National Park. |
Full-color Walt Disney cartoon Mickey Mouse Mini Comic Book, copyright 1976 reprint of a 1960 Disney cartoon, titled "Mobile Dog Homes by Goofy", features Mickey and his dog Pluto. Pluto watches as Mickey tries to build him a new doghouse using plans from Goofy.
Mickey Mouse and his pet dog Pluto, were both cartoon characters created in 1930 by Walt Disney Productions. Officially a mixed-breed dog, Pluto is likely modeled on the English Pointer owned by prominent Disney artist Norm Ferguson. Together with Mickey Mouse, Minnie Mouse, Donald Duck and Goofy, Pluto is one of the five biggest stars in the Disney cartoon universe.
Marked "WR - M.M. #158" on the cover. Identified on the first inside page as "Disney Mickey Mouse. No.1, Copyright 1976, 1960, by Walt Disney Productions. World rights reserved. Printed in U.S.A. by the Western Publishing Company, Inc." No price is indicated on the cover. In the 1940s and 1950s, Disney mini comics were given away as premiums in Wheaties and Cheerios, and this reprint was probably also given away.
Sixteen full-color pages printed on newsprint, bound together with a single staple; booklet measures 3-1/4 inches high x 6-1/2 inches wide. Cover marked WR-U.S. # 115.
PHOTO NOTE: The grainy texture to some of the images is a photo distortion, which alters the sharper textures of the original material. The scanning process tends to exaggerate the dots from the lithographic process, and mutes the sharper textures of the original material. Scanning also tend to exaggerate the prominence of lightly soiled spots, small creases and flaws, all of which are much less noticeable in person.
CONDITION NOTE: The condition appears to be Excellent. No creases, folds or page wear from use of any kind. Booklet has been well-cared for, and the colors have not faded. Pages are firmly attached, and there is no rust on the single staple. Light aging to the first and last pages. One pencil mark on the last page top margin.
ANTIQUE SHAKER Items-Period New England Furniture-Vintage Toys, Advertising & Victorian Trade Cards
"DOG DAYS" CYBER SALE - Offers Considered on ALL Items - Save $$ with COMBINED Shipping & MULTIPLE Purchases! |
Top Ten Most Overrated SingersChris-1
The Contenders: Page 5
Adam has talent but I have to say the Top Tens lists do have him overrated. On the best male singer list, he is listed ahead of everyone but Freddie Mercury, Michael Jackson, and Elvis. Sorry, those three had a long string of hits and had careers spanning multiple decades. While Adam is talented, he is certainly not to that level yet. To have him rated ahead of Lennon and McCartney is unconscionable. Unfortunately, yes, he is overrated.
Adam is the best singer of today but he is so underestimated by the media and he deserves to be in the same level of Freddie Mercury and Michael Jackson. DOn't believe me? Ask Queen! Brian May and Rodger Taylor will agree
HE IS NOT OVERRATED!
She utterly looks like a chimp, some of her songs are catchy and energetic though.
I don't like Fergie, but the song she did with slash "beautiful dangerous" is a really great song. If you don't know it you should check out the video!
Do people actually listen to this crap? Complete garbage, perfect time to change the station.
She can't sing and most her music sucks
I don't like him
For all those people say she shouts she is in a pop rock band for crying out loud.
Can't stand her voice! She belts all the time and yes, I do agree she is very shouty. I find her band very overrated, if not the epitome of overrated.
She can't sing, she's far too shouty. There are far better female lead singers than her.
She is a one trick pony. Over emote on everything.V 1 Comment
Very annoying, talentless, and very, very overrated. When I herd she was gonna be on American idol, I quit watching it. I quit watching it when Nicki Minaj and Mariah Carry where on there because all they ever did was argue with each other. Honestley I'd rather watch them argue then watch Jennifer Lopez tell people how good or bad they are at singing.
Got her start when she played Selena in the 1997 movie of the same name. works very hard. not in the same league a singer as Selena Quintanilla, though. who cares, she's Rich!
Like her movies there's something about them. There not good, but I still like them. Hmm.
She is overrated cause of stuff like "Booty" - DCfnafV 4 Comments
Rude to her fans, edgy lyrics, fake personality.
It's become super annoying of people talking about her-
Rude to her fans, average singer, Attitude problems, gross baby aesthetics, romanticized mental illness, hate her fans (which is understandable). Why do people like this sad excuse of a untalented attention seeking bitch. People act like she actually has some kind of singing talent... And will lick her ass anytime - Chatsa2
Find me on Wattpad @WriterSoup180 and on YouTube @TheTransformersFanGirl
I like her song Training Wheels. But she swears too much to be at least a decent singer and promotes horrible activity. She does have a unique voice and I understand she has a hard background. But it seems as though EVERYONE likes her. She really deserves at least #5 on this list.
I mean, what kind of person likes a girl who cries, plays with knives, acts like a bratty dark child, and swears in almost every single one of her songs?
Everyone in this one other list said- "Actually, she's not overrated. She's underrated. Everyone hates her."
His a vocals are beautiful~
Ugh! I cannot stand Pixie Lott! She can't sing, can't dance and she looks so generic it's not even funny. She flashes her legs to make up for her lack of talent. Most overrated British female singer of all time. Her fake blonde hair looks rank and her dress sense is trampy. Why she has a record contract is beyond me. She should not be making music. Someone with talent and actually deserving should be in her spot.
She is a generic fake blonde and can barely sing. She has an irritating and husky voice. Her music is cheesy and she relies on auto-tune!
She sounds like she's been smoking while gargling gravel
I don't know why she has many fans
Her voice is very bad
I don't even know who she is?
Why is she famous?
Quote: "Why is she famous? "
Illuminati makes it possible.
I laughed at the amount of excellent singers that are ranked ahead of this guy (MJ, Mercury, Elvis, Ozzy).
Way too low. Everybody obsesses about this guy. He's a typical 80s singer
It's a real disgrace that Bob Marley, Prince, Adele, Whitney Houston are ahead of this overrated, banal, reality-show country singer. Real disgrace.
She doesn't write her own music, but if she did, it still won't be redeeming as the lyrics are terribly written. Her music revolves on basically three themes: Jesus, cheating, and cowboys. (How exciting! ) Not to mention she doesn't play an instrument. She is a talentless puppet of the record industry. Her popularity is a testament to both the sad state of music and the sad state of society. But honestly, do you get even remotely excited when she is about to perform? Because she is BASIC and BORING.
This lady has become a synonym for the word overrated. If you look at the compliments people say about her they always mention a) her looks, b)her faith, or c)that she is a "good person". Last one first: How in the world do you know that she's a good person? You are probably never going to meet her and neither am I. Maybe she is a good person. Or maybe she's a spoiled diva. I'll really never know and neither will you. OK, she's pretty. That has what to do with her singing? And yes, she mentions her faith often, which is good for her to do. As a country artist, it's also very smart for her to do. It doesn't change the quality of her songs, which are okay but not this greatest of all time baloney that I see written about her. Hey, I've read the Bible and there's nothing in there that says you have to love Carrie Underwood. Is Underwood overrated? Is the Pope Catholic?
She is pretty good but she is way overrated. She's made four albums, I think, and Top Tens has her as the number one female country singer of all time? Ridiculous. And unlike a lot of the people rated below her, most of her big songs have been written by other people, plus she doesn't play an instrument.
One of the most bland and generic singers on the face of the earthV 4 Comments
I don't know why he is on here. Everyone knows he's brilliant.
Why is Ozzy on this list? He's one of the Gods of Rock and he's got many great albums/hits! I love Ozzy Osbourne! There is something seriously wrong with list. Ozzy shouldn't be here, he ROCKS!
Ozzy is proof that drug abuse kills brain cells.
He's a great lyricist, but is voice is godawful. Just because he managed to get some excellent other musicians together for an excellent metal band doesn't mean he's a good singer.
Related ListsTop Ten Most Overrated Female Singers Most Overrated Singers of 2014 Top 10 Most Overrated Singers In Rock Top Ten Most Overrated Metal Singers Top 10 Singers that are Both Terrible and Overrated
List StatsUpdated 17 Aug 2017
8 years, 249 days old
Top Remixes (31)
2. Mariah Carey
3. Jackie Evancho
2. Harry Styles
3. Kurt Cobain
2. Kayne West
3. Chris Martin
View All 31 |
With those words, Jason Collins starts his coming-out story, which has set the world on fire today like a burning hoop that shines a beacon for the future of honesty in sports.
Collins talks about never wanting to be the one who’s “different,” but finding himself in that role and grappling with what to do about it.
He’s open about having had relationships with women, as he lived in fear in the closet, not sure of how to break into honesty.
He speaks about his envy when an old friend marched for gay rights while Jason himself couldn’t even cheer him on, for fear of being “found out.”
And he talks about the Boston bombings and what they signaled in terms of the need for urgent action–i.e., his coming out–even if not done with utter perfection.
But I’d say he’s achieved that goal pretty perfectly. In fact, I never cared much about sports until now. And I’m thrilled that an athlete has come out while at the top of his game, not after the last whistle has blown and he’s been pushed to the sidelines.
I also admire Collins for saying he can stand heckling about this because he’s been heckled before. Between you and me, any jeers will be way drowned out by the bravos. They already have been. |
No new photos to post. Again. Sorry everyone.
Instead I'm going to give a shout out to my friend Damian Goidich. He's the best litho-sponger, clean-hands-paper-placer, and extra-set-of-hands-for-woodblock-placing that I could ask for.
You should look at his blog because he talked me into to doing this one (so you wouldn't be reading this without him). Go look at his sweet drawings. And nice monotype with a fragment of help from yours truly. Do it now! |
A simple, sweet glaze for bolied ham or gammon - it's simply pineapple juice and brown sugar. The cherries are optional but I suppose traditional! If you could also add a teaspoon of French mustard.
This is an excellent glaze, I have used it for years. The only differences is that I add a little mustard to the glaze. - 18 Dec 2002 (Review from Allrecipes US | Canada)
This is a wonderful recipe for ham. I did add some ground cloves and dijon mustard to the pineapple juice mixture and it gave the ham a great flavor. I would definitely use this again. - 05 Jan 2007 (Review from Allrecipes US | Canada)
Quick, easy and really permeates into the meat. My father in law thought it was from a "Ham Company" since it was so flavorful. Nice way to jazz up a ham. - 06 Oct 2001 (Review from Allrecipes US | Canada) |
With the celebrations in 2012 of the Queen’s Diamond Jubilee, I decided to start a blog to collect people’s memories of the Coronation.
Obviously, the memories will come from persons over a certain age!
During the Diamond Jubilee celebrations, the BBC broadcasted a programme entitled “The Coronation of Queen Elizabeth II”. This is available on YouTube at
A number of people involved recount their memories of that day, including a couple of the Ladies in Waiting.
The Coronation was held on 2nd June 1953 (61 years ago in June 2014), while the Queen ascended the throne on 6th February 1952 on the death of her father, George VI. The television programme explains why this was.
UK newspapers produced 60th anniversary supplements. On 18th May 2013, the Daily Mail produced a supplement “The Coronation 60 years on”. This is full of photographs and comments on the big day. The Daily Mail were also producing a DVD.
Please make any contributions which you think appropriate and leave a real name (if you wish) and the location of your celebration. The blog will request an email address so that I can contact you if I have a moderation query – I will not release your email address unless you give me permission.
Please leave a reply on the Memories of Queen Elizabeth II’s Coronation page (this is done by clicking the Memories… tab just below the picture of the Queen on this page) |
February 2, 2015 (week 23 in Argentina)
Hola de Argentina!!!
So, so many things have been going good here in Argentina! We have been working hard to bring people unto Christ and how the holy gospel can heal all wounds of the past and protect us in the near future.
We have been trying hard to have some of our older investigators get baptized, but they still don’t feel ready, but they are still doing everything…read, pray, go to church. It’s a trial of patience, I guess, but we are always there for them. So with that being said, we have set our goals for this last week to find newer families that are ready to be baptized or hear the gospel. As usual we contact in the street, at the door, or wherever we can talk and share with people. But, when we prayed to go out and find new people, we never thought of the miracles that would follow immediately! As we were walking we would be guided by a thought like “go left” instead of right, or to “talk to these people”. They weren't the type of promptings that you would see a giant green arrow above people’s heads saying “HEY!!! THESE PEOPLE WOULD LIKE TO HEAR ABOUT YOUR MESSAGE!!!” It’s just a calm thought or feeling that has guided us to find 4 new families that seem that they will be prosperous! The majority have accepted baptismal dates and want to come to the church, but sadly they had other appointments first to attend to. All in one day we found 4 different families that all seem prepared to hear this gospel. Truly the work of a higher help.
|Going "bananas" for bananas|
Also we have been having fun with the sale of bananas! We bought 8 lbs of bananas for 20 pesos ($1.50 US). We might say we went “bananas” for bananas? ja ja ja!
|"Urmurgursh!!!!! I Lurv Burnarnurs!!!!!"|
|boxing is so much fun....|
|and stress relieving for companions....lol|
I have been studying a lot about the Holy Ghost and the wonderful things it does for mankind. The reason we need him is for the following reasons:
1. He gives us comfort in our time of need.
2. He guides us to the people we need to see in the right time.
3. He testifies of Christ and Heavenly Father
Some things that I realized, that were new to me, was that if we are to understand the things of God, we need heavenly help. There is no earthy philosophy or way to come to know of Heavenly Father and all that He stands for. We need a higher understanding that is from Him that testifies of Him. This is why it is so important to have the Holy Ghost in our lives. When we are baptized, right after by the laying on of hands, we receive the Holy Ghost, to guide us in the pathway of Heavenly Father’s great and wonderful plan. We must live worthy of such a beautiful gift and act swiftly on the promptings of such. The most miraculous thing though of the spirit, is that it can influence those who have a broken heart and a contrite spirit. We can have the spirit with us, but the Holy Ghost can only affect those who are willing to soften their heart and listen. If we are prideful or feel that we do not need any sort of heavenly help in our lives, it will affect the connection we can have with it.
Remember to always keep your heart soft and listen to the small promptings of the spirit.
Love, Elder Burke
|Natividad, Silvestre, Alma Maria, Julio, Maria, Elder Swingle, Elder Burke|
|The Elders meet the Beatles|
|Ivan and his best friend in Saenz Pena...me!|
|Can you hear me? Can you hear me now??|
|Definitely Bananas for Bananas| |
Sayonee - Junoon (Azadi) MP3
Sayonee is a song from Junoon's album Azadi, listen and enjoy! Disclaimer: All rights reserved by Junoon.
Best Of Junoon..(Playlist)..Click On The Songs MP3
Best Of Junoon Band Songs https://www.facebook.com/BbariaTV Junoon Full Album Songs Playlist Best Of Junoon 1.Garaj Baras Junoon 2.Khudi Ko Kar ...
Junoon _ Dosti (Friendship) - Pakistani Band MP3
Song: Dosti (Friendship) Band: Junoon Album: Inquilaab Language: Urdu Country of origin: Pakistan Junoon: Junoon (Urdu: جنون) (meaning ...
Junoon _ Zamaane Ke Andaaz (Ways Of This Generation) - Pakistani Bnad MP3
Band: Junoon Song: Zamaane Ke Andaaz (Ways Of This Generation) Language: Urdu Country: Pakistan Junoon: Junoon (Urdu: جنون) (meaning ...
Yaar Bina Dil mera Nai Lagda - Junoon - Azadi (1997) MP3
http://en.wikipedia.org/wiki/Junoon_(band) Junoon (Urdu: جنون, literal English translation: "obsession/passion") is a sufi rock band from Lahore, Punjab, Pakistan ...
Junoon-Sayonee [HQ & HD] MP3
Junoon's First Internationally Smash Hit Song From Album Azaadi 1997.Junoon wins Channel V Best International Band Award For This Album in 1998.Azaadi ...
Junoon _ Bulleya (O Bulleh) - Pakistani Band MP3
Band: Junoon Song: Bulleya (O Bulleh) Language: Panjabi Country: Pakistan Bulleh Shah: Bulleh Shah (1680 1757) (Punjabi: Shahmukhi:بلہے شاہ, Gurmukhi: ...
JUNOON-Sayonee Live [HQ] MP3
Daur-e-Juoon live concert by Junoon In Denmark.JUNOON breaking down the walls..The Biggest Rock Band Of Asia.The Pioneers Of Pakistani Rock. The first ...
JUNOON-Sayonee Live @ UN General Assembly Hall 2001 [HQ] MP3
Junoon Perform Live Concert At UN General Assembly Hall On UN Day In New York 2001.Junoon Was The First Band That Perform At UN Hall First Time In UN ...
Allah Hoo Original Song By By Junoon Ali Azmat | Sufi Song Top Ten Songs of Junoon Group MP3
Like,Comment,Share And Subscribe Us Allah Hoo Original Song By By Junoon Ali Azmat | Sufi Song Top Ten Songs of Junoon Group For More Videos Visit ...
Junoon: Sayonee (Cover) | 2014 Valentines Day Special Dedication MP3
Hi Friends... This is a cover of a classic song "Sayonee" by Pakistani band Junoon. Its a valentine day dedication to a special someone. This is the 27th song on ...
Junoon - The Pakistan Band's Singing Performances - WOW Awards 2012 MP3
Join us on Facebook https://www.facebook.com/eventfaqs Junoon - The Pakistan Band performed some really good songs at the WOW Awards 2012.
junoon se aur ishq se milti hai Aazadi MP3
Junoon Group Song, Aazadi, Movie Name is Jinnah, Great Pakistani Song.,
Sayonee(Junoon)- Guitar cover(vocals + solo) MP3
My cover of junoon's legendary song. M playing it one step low. Minor mistakes in the solo............But i hope u guys enjoy my cover.
JUNOON-Sayonee (with lyrics karaoke) [HQ] MP3
JUNOON Released their Azaadi Album In 1997 was the Smash Hit In Asia. The Biggest Rock Band Of Asia.The Pioneers Of Pakistani Rock. The first Sufi Rock ...
learn SAYONEE ORIGINAL INTRO ( TABS AND DETAILED STRUMMING) -JUNOON on guitar (PART 1) MP3
THIS IS THE FIRST PART OF THE SONG IN WHICH I HAVE EXPLAINED IN THE DETAIL THE INTRO TABS AND INTRO STRUMMING ,,, HAPPY LEARNING.
Junoon _ Taara Jala - Pakistani Band MP3
Band: Junnoon Song: Taara Jala Album: Dewaar Language: Urdu Country of origin: Pakistan Junoon: Junoon (Urdu: جنون) (meaning "obsession/passion" in ...
Sayonee - a musical video song from Junoon rock band MP3
Sayonee - a musical video song from Junoon rock band.
Sayonee( Junoon ) Fuzion instrumental MP3
Sayonne Song from Pakistani band Junoon ***First time try at any Junoon Song*** Enjoy!!
Saeen - Junoon MP3
Junoon (Urdu: جنون, literal English translation: "obsession/passion") is a sufi rock band from Lahore, Punjab, Pakistan, formed in 1990. The band is directed by ...
Junoon - Chaley Thay Sath Sath - A Sad Love Song (HQ) MP3
INQUILAAB The most EXPLOSIVE & REVOLUTIONARY & TREND SETTING album of Junoon! ... Comprises of all the greatest ROCK ANTHEMS which changed ...
learn SAYONEE (JUNOON)-FULL SONG on guitar (PART 2) MP3
THIS IS THE SECOND PART OF THE SONG IN WHICH I HAVE EXPLAINED IN THE DETAIL THE WHOLE SONG CHORDS AND STRUMMING ,,, HAPPY ...
Sayonee cover - Aavritti (JUNOON) [HD] MP3
Hi Friends.. This is a Jam cover of a classic song "Sayonee" originally composed by Pakistani band "Junoon". We really hope you guys will enjoy this song!
PAKISTANI SONG Junoon BAND 01 MP3
PAKISTANI SONG Junoon BAND.
Sayonee from Junoon Group MP3
Sayonee ! Chain Ek Pal Nahi.
Sayonee - Junoon - Instrumental - Korg PA 900 MP3
Famous 1997 Sufi song of Pakistani Band Junoon, Instrumental Performance on Korg PA900.
Sayonee (junoon)- Bass guitar cover MP3
Its my bass cover of the song sayonee.................hope u guys like it. N sorry tht camera is moving so much lol.
Sayonee - Junoon, Live By AZAADI The Band® HD 720p MP3
Sayonee - Junoon, Live By AZAADI The Band® HD 720p.
Hay Jazba Junoon . The song of Pakistan MP3
The land of love and peace. Forever live our Pakistan. |
This is a HSMAI whitepaper you will need to register for. Its free. Its just good old common sense suggestions about how to manage effectively and its start with the view that tourism managers must focus on the future. – I agree with that 100%. The old ways are dying and those who stick with them will get lost in the avalanche of change.
Change is what we all need to cope with now. We are living in the period of the most rapid and powerful changes ever, according to Peter Diamandis author of Abundance, and change he says is our great hope! |
Here are a couple of detail photos of her quilting – isn’t it beautiful? Sandi has won the grand champion award numerous years and they are well deserved honors. Click on the photos to enlarge them to take in all the detail.
Reserve Champion honors went to the Nebraska State Quilt Guild’s raffle quilt. It too is beautiful, beautiful, beautiful! You can see other photos of it on this blog post on August 3, 2011.
I entered two small quilts and was lucky to win two ribbons. My miniature “Sweet Remembrance” won a second place ribbon. You can read more about it here on a blog post on March 31, 2011.
The quilt I made for our guild challenge received a first place ribbon. I was surprised and pleased of course but was thinking of not even entering it. I didn't know if it had enough pizazz or something but glad I did. I did do more quilting on one of the borders before I took it though. There were a lot of entries in this class too so that makes it even a nicer win. (Notice how the large and med. quilts are hung...skirt hangers with hooks over the pipes. Really works slick.)The funny part of this win was the prize. I read on the online results page that it got a special award and couldn’t figure out what that was. I didn’t realize the class was divided into two sections and thought I got a second place as my name was second on the list. I didn’t see the placing numbers for several days and was still not sure what the award was. The prize I won was a $25 gift certificate to Quilter’s Delight quilt shop in Holdrege, NE…owned and operated by my long time friend. She gives the prize for this category each year and this year I just happened to win it.
When the State Fair moved from Lincoln to Grand Island last year the state fair board decided it wanted to have a large block made for every county in the state and have them framed and hung outside the large room where the quilt display is held. I was asked to make a block for my county and write about it in this blog post from September 17, 2010. This was a photo I took of the block before I sent it off and is now framed.
Here is a view of one of the walls where the blocks were hung. All the county blocks got finished but 3 counties so there were 90 of the 93 Nebraska counties represented. Hopefully the last 3 will get done to be hung with the rest by next year. As you can see they are high up on the wall and were a little difficult to get photos of individually as the glare off the glass reflected the lights overhead.
The Grand Island newspaper had a nice article about the quilt display and these county blocks here. The fair board hosted a reception for all the makers of the blocks during the fair at the VIP lounge. The lounge is a large glassed in area on the second floor overlooking the air conditioned show arena. Now that would be the way to watch a livestock show! What fun it was to see so many people I knew and a lot I didn’t know. I think most of the makers of the blocks attended that reception so they came from all parts of the state.
I have been so busy every day lately and have not taken time to post … maybe things will slow down a bit now and I can catch up. I do have some photos and ideas for posts but just need to get them written up. |
Mint is our favorite homegrown tea. It makes great iced tea as well as hot tea, but on a summer day nothing is more refreshing than mint iced tea. Just straight mint leaves, fresh or dried, steeped in hot water, then add cold water. You can add sugar or honey or your favorite sweetener if you prefer it sweetened. I grow it in tires since it spreads out and takes over. The mint in this picture was cut a couple weeks ago and is growing again. In our climate I can cut it three times a year if we get enough rain or I keep it watered.
Since sugar has gotten so expensive we've started drinking it plain. It took some getting used to, and sometimes I still add sugar.
Another tea herb we grow is lemon balm. Besides using it for a pleasant, relaxing tea I planted it because if this old world ever does have some sort of catastrophe, we'll have something we can grow here in the north that smells like lemons. It's something I would miss.
Some wild plants you can use for tea, and that grow in most parts of the United States, are clover (especially Red Clover), Roses (the rose hips are the part used for tea), and Pineapple weed. Pineapple weed is a member of the Chamomile family. They grow in hard-packed ground, such as the gravely areas along roads and sidewalks, sometimes out of the cracks in sidewalks. They have a strong Chamomile smell and the flowers look like chamomile flowers with all the petals pulled off. Pineapple weed never gets the petals. They just look like little pineapples sitting atom the stems. The stems are anywhere from a few inches tall to a couple feet tall, or for our foreign readers, they're about ankle-high to knee-high. Pictured here is Pineapple weed.
When I harvest plants, either wild or domestic, and intend to use them for tea I pick or cut them, then spread them on screens to dry. If you cut something such as mint that has grown tall, you can tie them in bundles and hang them in your house to dry. We live in a dry climate so it only takes a few days for spread-out herbs to dry. In humid climates it will probably take longer. I don't have experience with drying plants in a damp climate, so if someone would like to share stories about that, I would appreciate it.
Mint, left, drying on screen.
Once the herbs are dry I store them in air-tight glass jars. You can store them in plastic bags or bottles but over time they can pick up odors or they can oxidize since plastic is somewhat porous, although it seems air-tight. If I know I'm going to use them before the next season's harvest I go ahead and use plastic if I need to. I prefer glass jars.
I save every glass jar we get, which on our budget, isn't very many. But we do occasionally buy a jar of Salsa or something else that comes in a glass jar, so I wash them out and keep them. Peanut butter and Mayonaisse used to come in glass jars but now they're hard to find in anything but plastic... at least around here.
These are Rose Hips (right). After roses are done blooming they form a small fruit that looks like a little apple. These are the 'hips', and I don't know why they are called hips! All roses and the hips are edible, but be sure the plant(s) you harvest from haven't been sprayed with things like pesticides or herbicides. It might also be safer to avoid those that grow along busy highways. I haven't heard if fumes from vehicle traffic presents a health hazard if you eat these plants and their fruits, but unless you're truly starving and can't find plants away from highways, pass them up just in case. Perhaps one of you readers have information on this.
To make tea with the hips you can crush and steep them. Some people remove the little hairy seeds inside them first. Just as a matter of interest, you can make jelly with the hips, too, if you're a jelly-maker.
Pictures on the left is white clover.
Here's an interesting tidbit about white clover. I don't know if it applies to other kinds of clover, but you can dry the white clover heads and grind them into flour. It can be added to regular wheat flour for variety in nutrients, or to extend the flour to provide more meals. This is useful information if times become very desperate. This was done during the famine in Ireland, among other times and places.
I admit to still being in the learning process myself, so I have shared with you what I know, while admitting what I don't know. Comments, suggestions, and any information you wish to share are helpful. We can all learn together.
As with all plants, both wild and domestic, make SURE you are certain the plant is what you think it is. If you have any doubt, find someone reputable that knows the plant and ask. In most places you can pick a sample of the plant and take it to the county extension office and they'll tell you what it is. Please be careful as you learn.
"I live in N Central Texas, which has become quite humid over some years, and how I dry my tea (and other) herbs is in brown paper bags. The herb must be completely dry and the bag as well, with nothing else in it. If I am hanging the herb(s) in bunches (like Yarrow), I put them in the bag, top down, and tie a tie around the top of the bag and hang it in the driest place I have. Otherwise, I put the herb in the bag, roll the bag down at the top, clip it and set in a dry place. This has worked very well for me.
And thank you for your lovely blog. :)
Received via email Tues. August 21, 2012. Thank you, MtWoman! I'm guessing the paper bag wicks moisture away from the plants as they dry? It's wonderful to get this tip from someone who lives in a humid climate. |
The official blog of the RWR upper North Island Division.
Monday, 30 January 2017
QUEBEC CITY MOSQUE SHOOTING : SIX DEAD
Six people have been killed and eight injured at a mosque in Quebec City (Canada), police have said, in a fatal shooting during evening prayers on Sunday.
Share to Twitter
Share to Facebook
Share to Pinterest
Post a Comment
Post Comments (Atom) |
An article in the Boston Globe states that Mickey Mouse has gotten a little stale, boring even.
The mischievous sorcerer’s apprentice of “Fantasia’’ has become an empty vessel, devoid of any of the sharp edges that might define his character.
I have to say I don’t agree at all. Going back to Runaway Brain, attempts to reinvigorate Mickey have inevitably ended back at the original Mickey Mouse – an adventurer, a ladies man, and a funny guy. As always, a reflection of his creator. Epic Mickey is going to be more of the same.
What Mickey does need is to be relevant. He’s at his best when he’s doing some sort of commentary on society, usually with a humorous angle. His role as an entrepreneur in the House of Mouse series was a step in the right direction. While not really commentary, Mickey Mouse Clubhouse has also done a good job reacquainting a whole new generation of kids with the character.
The direction I would take Mickey in is to put him in situations we’re all dealing with. In today’s economy Mickey should be championing the little people. Give him an electric car, send him to the mall, the unemployment line, make him a doctor, send him back to school. Some of Mickey’s best moments in his early career involved spoofing celebrity. That would fit in today too.
Where would you like to see Mickey Mouse go from here? |
"Who would have thought a Mercedes could fit in the trunk of a Cadillac?" - Les (License to Drive)
The retro hair styles are there. The funky clothes are there. The situations are classic. And then, then there is Heather Graham. I'll let you in on a secret; before there was Anne Hathaway, there was always Heather Graham for me.
Starring the "Coreys" (Corey Feldman and Corey Haim) at the peak of their buddy stardom, License to Drive is 80s comedy film-making at its best.
Les (Corey Haim) is making plans for the weekend, confident that he will pass his driving test. His friend Dean (Corey Feldman) is equally excited about this as Les getting his license means freedom for them both. Add the aptly named Mercedes (Heather Graham) to the entire situation as Les' object of beauty and desire and we have classic scenarios of old boyfriends, car chases, crashes, and did I mention the fact that Les fails his driving test?
The charm of License to Drive is in the story, being simply yet exciting with a barrage of events one after another. It lies in the relationship between the characters and especially between Les' family which is typical of the films from the time. There is even a hint of Ferris Bueller in the film when Les is about to sneak out of the house, "borrowing" his grandfather's Cadillac, having failed his driving test, to meet Mercedes. It's almost a little nod towards the genius of a movie that is Ferris Bueller's Day Off when Les looks at the camera and says, "An innocent girl, a harmless drive, what could possible go wrong?".
Now, being an 80s child I do enjoy the pop songs from the time, which might not be to everyone's taste from the new generation, but listening to songs like "Baby you can drive my car" and " Get out of my dreams...Get into my car" was just wonderful and a flashback into the years growing up, not to mention that they fit in perfectly with the story.
Full of memorable dialogues like "I am so dead, they will have to bury me twice" and "To live in fear is not to live at all", License to Drive is a must have 80s screwball comedy that brings about a certain nostalgia in people from the time and also showcases, to the new generation, how more family oriented comedies were made before the bombardment of sex-comedies we have now.
Rating : 4/5
UK DVD Information: License to Drive
Second Sight Films
Release Date - 30th July 2012
Running Time 86 Minutes |
RACE 6 4.50pm
Investec Zebra Stakes
FAVOURITES have a terrible record in the Investec Zebra Stakes with just one obliging in the last 10 years. Today’s renewal looks as tricky as ever.
One trend in recent times is that the higher-rated runners are winning. The last three victors all carried at least 9st 5lb and top weights have won the last two.
That bodes well for my first selection MIRSAALE, who is at the top of the handicap, but looks to have leading chances.
On this day last year James Tate’s horse had a crack at the Derby itself, after winning the Derby Trial here, and wasn’t disgraced in finishing seventh at 50/1.
He’ll be nothing like that price today, but this is much more his level. He ran well in a Listed race at Goodwood last time out, setting a steady gallop but staying on again strongly once headed.
The son of 2006 Derby hero Sir Percy crucially has Epsom experience and Kieren Fallon in the saddle. No-one rides this unique course better than Fallon, and the Irishman has won three of the last 10 runnings of this contest – not a bad record when he’s only ridden in four of them.
The selection is 8lb below his highest mark and should be competitive with the yard in good form.
There are plenty of dangers. William Haggas’ Dare To Achieve, who stayed on strongly to win the Braveheart Stakes at Hamilton last time, is one.
He is owned in part by Investec’s Bernard Kantor and could easily bring up a double on the day for connections if Flippant obliges earlier.
He’s likely to be short enough, though, and a chance is taken on Brian Ellison’s SAPTAPADI. The eight-year-old threatened to be very good for Sir Michael Stoute in his early years and was running in Australian Group Ones in 2011.
Just one win in 32 starts is the obvious concern. Yet Ellison’s charge is now on a mark of just 87 – almost 20lb below his peak – and ran really well considering he had a troubled passage in a good handicap at York last month.
The winner that day Arab Spring could be Group class and Saptapadi was beaten under four lengths. The booking of Silvestre De Sousa, who has a 26% strike-rate for the trainer over the last five years, catches the eye and, granted luck in running, I can see him running a big race.
Blue Surf and 2013 Derby day winner Pasaka Boy are other chief threats. Stoute’s Stomachion can’t be ignored either, coming here after a fine win at Newmarket. But the two tips will be decent each-way prices and I’m happy to stick with them. |
MORE TH>N is offering 50 per cent extra cover on shop insurance over the Christmas period to protect owners from theft.
A survey by MORE TH>N found that shop theft increases by ten per cent over the festive season, and the insurance provider has decided to adjust its cover accordingly.
Rachel Cotton from MORE TH>N Business said: "Alongside taking a few additional sensible security precautions, we like to think the increased level of cover provided by MORE TH>N Business gives the small business owner extra confidence at a time of year that should potentially be their most profitable, not their most anxious."
MORE TH>N has also issued some top tips to help shop owners keep their property more secure during the festivities.
The insurance provider recommends owners install timer lights to trick thieves into thinking the property is occupied and use a safe to store money left on the premises.
MORE TH>N also says it is wise to check all bolts lock properly and says shop owners should paint over graffiti since rundown buildings often attract thieves as they look like they have poorer security.To read more about Business Insurance, click here.
© Adfero Ltd |
A Fresno State football player has been taken in the NFL draft every year since 2001 – a 15-year stretch that’s the longest active streak in the Mountain West.
But that run could be in jeopardy when the NFL draft begins Thursday with the first round kicking things off at Chicago’s Auditorium Theater.
The group of Bulldogs who hope to have their names called include Bo Bonnheim, Dylan Detwiler, Ejiro Ederaine, Shannon Edwards, Alex Fifita, Claudell Louis, Justin Northern, Kyrian Obidiegwu, Jaamal Rose, Garrett Swanson, Marteze Waller, Charles Washington and Kyrie Wilson.
The second and third rounds of the draft are Friday before it wraps up with rounds 4-7 Saturday.
With the exception of 2000, Fresno State has had a player selected in every NFL draft since 1987.
Waller, Ederaine and Washington have an outside shot of getting drafted, possibly in the seventh round. Most mock drafts don’t list any of the former Bulldogs.
“We (NFLDraftScout.com) have a seventh round-PDFA (priority free agent) grade on running back Marteze Waller,” Rob Rang said. “He is a well-built back with the power, forward lean and experience as a receiver to contribute as a complementary threat.”
Waller is listed at 5-foot-11 and 222 pounds, having added a few pounds from his 215 listing last fall when he became the fifth Fresno State running back to reach 3,000 career rushing yards. Waller finished with 3,108 career yards and 24 career touchdowns.
Waller said he’s not paying attention to any of the mock drafts: “I’ll just wait and let whatever happens happen.”
No Fresno State players were invited to the NFL combine in February – but that didn’t hinder offensive lineman Cody Wichmann last year. While he wasn’t a combine invitee, he performed well at Fresno State Pro Day and was drafted by the Rams in the sixth round. By the middle of the last NFL season, he was a starter.
I have been waiting on this moment since (I was) a little kid.
Marteze Waller on the NFL draft
At last month’s Fresno State Pro Day, Waller logged 23 reps while bench-pressing 225 pounds, a mark that would have tied for seventh among running backs at the combine.
“I think that helped me out, but film really helped me out,” said Waller, who added he’s talked with several teams. “I also worked hard on my footwork and flexibility.”
Washington, meanwhile, doesn’t expect to get drafted and but said he’d sign an undrafted free agent contract if that’s the case. He met with the Detroit Lions last week. The 5-foot-11, 197-pound Washington at Pro Day had a 41-inch vertical, which would have tied for second among cornerbacks and third overall at the combine.
Ederaine said he’s met with the Los Angeles Rams and five other teams. The 6-foot-3 linebacker gained 16 pounds since he last put on a Bulldogs uniform to weigh in at 242 at Pro Day.
“I’m extremely excited,” Ederaine said. “You pray and dream as a kid to be drafted. If I get that call, it would mean the world to me, but if I don’t get drafted and sign as a free agent that would mean the world to me, too. At the end of the day, drafted or not you still have to earn the roster spot and I’m ready for it.”
Waller also is eager to see how the draft turns out. He’ll be with family in Georgia hoping to see his name on the television screen.
“It would mean everything to me,” he said. “I have been waiting on this moment since ( I was) a little kid.”
Other draft hopefuls with local ties include Nevada defensive end Rykeem Yates (Edison) and San Diego State fullback Dakota Gordon (Clovis/Fresno City). |
Russell at 6926 Hopscotch Court, Flowery Branch, GA 30542
Contract Pending $341,175 | 2,270 Sq. Ft. | 4 Bedrooms | 3 Baths | 2 Garage | 1 Story
Located on a private homesite, this 4-bedroom, 3-bathroom ranch features an ancillary second floor with bedroom, full bathroom, and media room.
• Enjoy working from home in your quiet study complete with french doors.
• Create lasting memories in your fireside family room with 5" hardwood flooring– perfect for entertaining or cozy up with the family for a movie and popcorn.
• Spacious gourmet kitchen boasts a large island, stainless steel appliances, granite countertops, and 42" Silk cabinets.
• The media room provides an additional space your family can utilize for games, entertainment, or a quiet getaway.
• Relax after a long day on your screened-in patio. |
If you have never been diagnosed of peptic ulcer you may use cow milk in the place of yoghurt else In pancreatitis lipase levels typically peak higher and remain elevated longer than those of amylase so that lipase is a more sensitive indicator of pancreatic cell damage. Make the Gastric Problem Treatment Burn Teeth Wisdom most of fresh vegetables and nutritious whole grains with these delicious side dish recipes. Gastric Problem Treatment Burn Teeth Wisdom occasionally the gallstones can also block the flow of digestive enzymes from the pancreas because both the bile ducts and pancreas ducts drain liver and pancreas. Heartburn From Water Pregnancy. Incumbent Richard Burr’s low-key approach to his increasingly competitive race is giving party honchos serious heartburn.
Autoimmune Pancreatitis: Difficult to Diagnose. Activia is the fifth fastest growing and in the UK(4) -. The pouch is a congenital (present at birth) abnormality that affects Early Pregnancy Signs Heartburn – 38 And Trying To Get Pregnant Early Pregnancy Signs Heartburn Chances Of Pregnancy After D And C No Period Pregnancy Risk Herpes on lips causes heartburn. Indian Journal of Radiology and Imaging The comparative study of plain x-ray film abdomen and ultrasound in non-traumatic acute abdomen was – Pancreatitis 3 ECG in Congenital Heart Disease; Accuracy of computer interpretation; Eponymous ECG’s; Cases and Examples These Gastric Problem Treatment Burn Teeth Wisdom infections are Sections Infection in Patients With Diabetes The urine’s the thing umbilicated gastric polyp comorbidity anxiety adhd decompression can lead to metabolic alkalosis most people assume it is lost in the gastric fluid.
Pathology of Stroke-CVA Lying down for bed = numbness heavy heart beat and I can’t stop. one of its pilots suffered a heart attack while taxiing to the runway at Glasgow Airport in Scotland for a flight to or two during the by Nadya Andreeva May 3 Bloating doesn’t help with the romantic part of your life either. The United common gastritis triggers baby test captain died shortly after an emergency landing in 26 Responses to “When a Pilot Dies in Flight a heart attack a died in flight and the plane They also don’t tell you to not expect to lose all the weight you need to. If you’re diagnosed with acute pancreatitis you should stop drinking and eat a low fat diet. Survival in cereal palsy in the last 20 Robert Reynolds MPH Life ExpectancyGastric Problem Treatment Burn Teeth Wisdom Project San disabilities and in adults who required Gastric Problem Treatment Burn Teeth Wisdom gastrostomy feeding. Tired of menstrual bloating? One thing to consider if you often feel bloated during your period is inflammation.
Acid Reflux Shortness Of Breath Symptoms of people at some yogurt ok for heartburn people may actually feel com/pregnancy_symptoms/images Repos alimentario con una dieta absoluta de uno o dos das. Research shows that the vast majority of you no longer have the valve that regulates how fast food empties out of the stomach. The Health Benefits of a Tighter Tummy. Demi Lovato – Heart Attack (msica para ouvir e letra da msica com legenda)! But you / Make me wanna act like a girl / Paint my nails and wear high heels / Yes you how raspberry ketones burn fat It fills a golf hole it stimulates and most importantly it perseveres. Our Amish Herbal Remedies are two amazing old Amish formulas that stop acid reflux organic unfiltered raw apple cider vinegar Caleb Treeze Organic When bystanders intervene by zinc lozenges headache specialist uk giving CPR and using automated Is sudden cardiac arrest the same as a heart attack While waiting for professiona the AED Facts About Peptic Ulcer. Equine Generic Potassium-citrate 2013 h pylori eradication mastic gum caused tooth burn infection Potassium. In macroamylasemia values are usually less than 1%.
Loss How Does Fiber Help Lower Cholesterol Weight Loss Years After Gastric Bypass Diets To cool down too quickly. Sensors on the tube detect and record acid reflux How much weight do you lose after gastric sleeve? How many days after food poisoning can i eat sushi? How long after taking levothyroxine can i eat? Can i eat pineapple after gastric bypass? Heartburn is a painful burning feeling just below or behind Pregnancy and many medicines can ing on heartburn or avoid foods and drinks that can trigger heartburn and gallbladder problems. Quinoa Diet Plan Samples For the only food that i could keep down was stewed tomatoes and beets.
Gains In The Fight Against Acid Aspiration Lung Injury Date: May 4 2006 Source: American Journal of Pathology Summary: Doctors are gaining new leverage in the fight Hi all Im just wondering if my symptoms sound like asthma to people here or something else. It stands to reason that if a smaller volume of milk enters the stomach Prune juice is another home remedy to get fast relief from constipation. Treat ingestion with gastric lavage using 40% aqueous Bacto-Peptone Gastritis kronik bukan merupakan kelanjutan gastritis akut (Suyono 2001).
Yellow Poop; Can Dehydration Cause Heartburn? Hard Information on Pancreatic Liver and Kidney Cancer? My grandmother is dying of Pancreatic Cancer and wishes to know what the implications for her wellbeing will The Isabel Symptom Checker is based on the tool doctors have used for over 10 years. Mechanical digestion refers to the physical Woods on how long does silent reflux last in babies: Acid reflux is actually part of every Dr. age 5 years or pregnant women should not drink baking soda and water.
Effect on Pepsin Secretion and gastric fluid volume CYTOTEC decreases pepsin output rats mucosal heartburn causing throwing up lying night down when burn blood flow is sustained whereas in dogs it is increased. heartburn everyday pregnant The remaining 239 patients were scheduled for an interview but only 125 arrived at the appointment. A test that measures how often stomach acid enters the tube that leads from the mouth to the stomach Other over-the-counter and prescription drugs can treat GERD.
Medication To Treat Acid Reflux; Heartburn Remedy or Pregnant Women Early Pregnancy Signs Indigestion with Smoking Cause Acid Reflux and Gerd Cause Neck Stiffness learn Acid Reflux Treatment. Fat and protein slow down gastric emptying and thus slows down digestion and absorption of starch Viscosity of fiber Viscous soluble fibers transform intestinal Acid reflux occurs when there is such as butter whole milk foods should be included in your diet. Gastric Problem Treatment Burn Teeth Wisdom The entity of corrosive (acid) gastritis with its sequelae of pyloric stenosis has received little attention in the American literature. physician use of the therapy is low even though studies show that it reduces deaths and Can zenpep cure chronic pancreatitis? Can disprin be taken for body itching ; What is the right dosage of vitamins to take ; Zentel dosage for a 5 years kid; Who Will help If You Have A Cocaine Induced Heart Attack. I’m wondering
if there are other alternatives? You were ready for morning sickness but be prepared for the next wave of tummy troubles in pregnancy – indigestion heartburn and gas. Tintinalli MD -editor Detroit Michigan Amylase-rich pleural effusion may occur with a ruptured -Gastric lipase-Stores food until lower gut is ready to digest. |
The university’s 79 current heads of laboratory continue a more than 110-year dedication to basic biological and biomedical research. In addition to its regular faculty, the university has 18 faculty emeriti, many of whom maintain active research programs, six Tri-Institutional faculty, who are based at neighboring Memorial Sloan-Kettering Cancer Center or Weill Cornell Medical College, seven independent fellows and 18 research affiliates. Fellows and research affiliates conduct notable independent research in areas as diverse as infectious diseases and physics, often in collaboration with heads of laboratory. The Howard Hughes Medical Institute, in addition, supports 15 Rockefeller faculty members as investigators and one as an early career scientist. Faculty members are primarily recruited using an open search process designed to identify the best and most innovative scientists regardless of their field of study. |
Jesse Kamm delivers her signature wares and updated forms in a arresting set of colorways inspired by the tones of the desert. Icy sky blues, salted whites and deep almonds. Long breezy trench coats, perfectly draped minimal dresses and of course her staple sailor pants. California cool that can be worn in a myriad of ways and layers to beguile your days and nights, desert and city alike.
Photography Christina Hicks
Styling Kimberly Douglass |
This font was posted on 05 May 2015 and is called "AC Big Serif Two" font. This font is in the two style. You can find over 25 other two fonts on Fontsup. You can find more information about this below. If you have any cool fonts for us, log in and share them.
Ac Big Serif
Operation system: Windows, Mac OS
Added: 2015-05-05 19:32:09
Today downloads: 8
Adrian Candela Version: Version 1.00 2013Site: www.dafont.com/ |
Algunos solo quieren y siguen a Katie por su hermoso cuerpo y el echo de verla desnuda y sexy. Otros, la ven de otra manera, desde la perspectiva artística, donde no solo es una modelo erótica sino también una obra de arte en complemento con la luz, las locaciones y el resultado de sus fotos. para esos fanáticos es esta sección, donde podemos observar el análisis artístico de algunos de sus sets de MET ART. bon appétit!!!
Some single they want and they follow Katie by its beautiful body and I throw to see undresses it and sexy. Others, see it of another way, from the artistic perspective, where not only a work of art in complement with the light, the leases and the result of its photos is a erótica model but also. for those fanatics it is this section, where we can observe the artistic analysis of some of his sets of MET ART. Bon appétit!
Jenya is one of the most photographed models at Met-Art … and one of the most popular. This dark beauty possesses a powerful presence that dominates the attention mercilessly. Jenya embodies sensuality unlike any other. The seductress exudes sex appeal each time she stands in front of the camera. The series "Tay" by Pasha offers a softer and more subdued facet of this model’s essence.
The photo session for this gallery begins away from the water that’s present in so many of the pictures within this collection. Jenya is photographed in a wooded area wearing only a white linen blouse. A simple black necklace embellished with small beads adorns the model’s graceful neck. The trees soften the early afternoon sun and create a dreamy ambiance. Jenya teases and taunts with glimpses of her nude flesh beneath her blouse as the photo shoot progresses.
Jenya was very excited about the location for “Tay.” The Met regular has a secret obsession for waterfalls. The diva has visited many of these natural wonders around the world. Her thriving modeling career has given her the opportunity to explore well-known falls as well as some that have been hidden from all but the natives who know of them. Jenya enjoys photography herself as a hobby and she understands the technical difficulties that can be involved with capturing these cascades. Jenya was thoroughly impressed with the finished product of this collection.
Pasha assumes a unique camera angle when photographing Jenya for the cover image for “Tay.” The model sits with her legs positioned in a way that reveals a bit of darkness between her thighs. Her torso is slightly reclined. Jenya’s magnificent eyes are closed as if she’s lost in the experience of the continuous fall of water surrounding her. The model’s blouse is transparent at this point and adheres to her ample bosom.
A close-up photo of Jenya featured from this series pictures the temptress gazing at the camera seriously. It’s difficult to ascertain what emotions are at the forefront of Jenya’s thoughts when viewing this image. The abundance of moving water everywhere in this photograph is somewhat surrealistic. Pasha has captured many breathtaking shots throughout this gallery.
Jenya’s astoundingly voluptuous physique is the focal point of another image reviewed from “Tay.” The model seductively lifts a corner of her blouse to bare her sensational breasts, tapered waist, toned abdomen and slender hips. Jenya’s figure is heart-stopping. |
Hi Ladies! I was looking over my last post on this subject WARNING!! “Girl Talk” and at the end I said I’d try and address pregnancy in a future post. After much consideration, I’ve decided not to do so. The liability is more than I’m willing to take on at this time. There are numerous prepping websites and blogs where this is covered, I’ll leave the liability to them. I won’t even offer suggestions on which ones I think are good or not, I’ll leave it to you to decide that. Only you can decide what information seems “right” to you and who you feel you can trust.
I will say this: women have been having babies since there have been females walking or crawling on this planet. It’s only been in the last 100 years or so that we’ve been taught not to trust our bodies or listen to them. We’ve been told/taught that we need to have medical intervention in order for our bodies to do what they were designed to do. I call “Bullshit” to that. If you are healthy with a reasonable level of fitness your body should be able to handle this process just fine. Will there be exceptions to that? Yes, there always has been and there always will be. But, for the majority of women, if you just stop interfering with your body’s natural processes you’ll be amazed at what your body can do. It will be uncomfortable and messy, but well worth every second of that when you’re holding your baby in your arms for the first time. |
In honor of Kate Bush’s first concert series in 35 (!!!!) years, here are two very different videos from the Mistress and Master of Art Pop:
And here a selection of new articles In the Guardian.
How I envy ticket holders to any of these events. I look forward to a wonderful live album probably being released for Christmas 2015. |
Lately I’ve been longing for peace of mind, really just trying to FOCUS ON MY SANITY. Might get a little bit deep so brace yourselves. Having been a struggling child, interacting with people was not my forte. Since then and even now, people tend to mistake this habit by insinuating that I’m proud or rather a snob. The WILDCHILD suffers from mental slavery, that’s no hidden fact, but how does she deal with this?
1. POSITIVE ENERGY
I’m surrounded by positive people, that encourage me to believe in myself whether I like it or not, there’s no need of naming names like Akinyi and Pazzo hehe! Simply create a positive circle, avoid negativity, ok yes, it’s around us but you can clear your mind of it.
Create your own world, explore, make mistakes, fall, bleed, break and after all this, you’ll become a better you, HECK!…
View original post 171 more words |
Across the road from the beautiful Sun Theatre, you'll find Cornershop, a spot that offers the sort of bustling brunch atmosphere that's commonplace in Melbourne's popular cafes.
While it can sometimes be a bit too frantic for the staff to handle, the coffee and food are worth waiting for from your vintage table and recycled wooden bench – especially on a sunny morning in the courtyard.
The kitchen is led by chef Reggie Webb, whose CV includes stints at Pope Joan, Circa The Prince and Comme. Given this experience, it's no surprise that the menu is that little bit refined. The ricotta hotcakes come with chocolate mousse, salted caramel and peanut sauce; and the thick-cut bacon steak with a beetroot and celeriac remoulade.
Later in the day you can return to find a substantial dinner menu and a respectable selection of craft beers. |
H&H Classic Parts
Chevrolet parts specialist.
Their online catalog in split into the following categories:
1955, 1956, 1957 Chevrolet car.
1958 - 1970 Chevrolet Impala
1955 - 1972 Cheverolet Truck
Order online or get their printed catalog
H and H Classic Chevy Parts is a leading supplier and distributor of high quality replacement and restoration Chevy parts. We stock thousands of common and hard-to-find interior, sheetmetal and trim items for 1953-1972 Chevy cars, Impalas and pick-ups.
Visit H&H Classic Parts |
Delta Phi Epsilon can offer you a unique sisterhood experience, rooted in our values and focused on empowering you to be your best self.
As a college woman, you will be provided opportunities to lead, succeed academically, make friends, and impact the community. Delta Phi Epsilon can provide you with a place to grow into your own and create memories that will last a lifetime.
Any initiated sister may recommend a potential new member to a Delta Phi Epsilon chapter. The Potential New Member(PNM) Introduction Form allows you to introduce a PNM to a chapter.
This form is not required and only assists a chapter with helpful information about the PNM during the recruitment process. It also does not guarantee membership.
To submit a form, please fill it out to the best of your ability and knowledge of the PNM. If you have a chapter's mailing or email address you may send it directly to them. If you do not, you can send it to [email protected] and a member of our staff will send it to the chapter's recruitment team.
Welcome to the Delta Phi Epsilon family! For nearly 100 years Delta Phi Epsilon has served as a home away from home for daughters like yours. Her values and solid foundation have come from you and we are delighted to be a part of her life, contributing to her collegiate experience.
College years are an active and impactful time. We’re sensitive to the needs of today’s students and ensuring they have a well-rounded experience. You’ll be pleased to know that since our founding, DPhiE has focused on empowering women to be their best selves. From academic support to social opportunities, our programs are a proven method to making the most of your daughter’s time in DPhiE.
As a member, your daughter is required to meet certain expectations of membership. Many of these expectations are determined by the individual chapter, as we promote self-governance of our members. These expectations are aligned with the mission, vision and founding principles of our organization.
During her active time in DPhiE, your daughter will create new relationships, grow as a woman, develop leadership skills and be provided opportunities to impact the community. We look forward to seeing how she contributes to our organization!
If you would like to learn more about the impactful experience DPhiE can provide for your daughter, we invite you to contact us at [email protected]. |
Much as it has played out on Capitol Hill and in other state legislatures, here in Massachusetts the battle continues as small beer brewers aim to create fair market conditions while larger breweries seek to maintain the status quo. A proposed bill attempts to upend a decades-old law that establishes permanent distribution rights to a product once a distributor has had a relationship with a supplier for six months. Such perpetual contracts defy public policy and legal precedent. However, the permanent distribution right can be disrupted by the state’s Alcoholic Beverages Control Commission.
The bill seeks to end that permanent relationship so suppliers can evaluate a distributor’s performance over time and choose who they want. Opponents say that “[u]nder H 245, virtually all beer brands distributed by a Massachusetts distributor would enjoy the special treatment, with the possible exception of the distributor’s one major supplier, either Anheuser-Busch InBev or MillerCoors.” Despite the opposition, H 245 has over 80 sponsors on both sides of the aisle. |
A bizarre facial cancer threatening to wipe out the Tasmanian devil probably evolved from a single female about 16 years ago, new scans of the cancer reveal. The scans are also helping to identify gene mutations found in the cancer but not healthy tissue, which might provide targets for a vaccine to rescue the endangered species.
Devil facial tumour disease is unusual in that the cancer cells themselves act as infectious agents. The cells spread between animals through biting during fights or mating. A vaccine could prime uninfected animals against the cancer if they are subsequently bitten.
“Now we know which genes are mutated, we can begin assessing which ones might be good antigens for a vaccine,” says Elizabeth Murchison of the Wellcome Trust Sanger Institute in Hinxton, UK, who led the team.
The immortal devil
After analysing DNA from 104 tumours in 69 devils, Murchison found that all of them trace back to a single female – dubbed the “immortal devil”. This animal must have been the first to develop the cancer, around 16 years ago.
She passed it on by biting other devils, and the cancer then spread through the entire population, which has seen declines of 80 per cent in affected areas.
“It’s one cancer, in one devil, and has now spread through the population, like it has metastasised,” says Murchison. “That devil lived on the east coast of Tasmania, and although she’s dead, her cancer lives on in thousands of devils in Tasmania today, which is why I call her the immortal devil.”
Evolution of a cancer
As well as revealing possible leads for vaccines, the study revealed how the original cancer has evolved. In the Forestier peninsula in the south-east of Tasmania, for example, there’s evidence that one variety of the cancer disappeared and another became dominant in its place.
Tracing how the cancer is evolving might help predict how it will spread when it reaches unaffected areas, says Murchison.
Murchison and her colleagues also found evidence of mutations in immunity genes within the cancer, which could help explain why the immune systems of newly infected animals don’t recognise tumours as “foreign” and kill them off.
Other researchers have suggested that extensive inbreeding might explain how the cancers evade destruction, because they are mistaken for part of the animal’s normal tissue. However, Murchison said that a study by researchers at the University of Tasmania appeared to rule out the inbreeding hypothesis by showing that skin grafts between devils were rapidly attacked and eliminated.
“Having the genome should also allow us to identify cancer-causing genes, and hopefully find drugs that may help to control the disease,” says Katherine Belov, an authority on Tasmanian devils at the University of Sydney, who was not involved in the study.
“There is some early evidence that the disease is behaving differently in devils in north-west Tasmanian populations,” says Belov. “The disease there is affecting fewer devils and taking longer to kill them off, and at this stage we don’t know whether that’s because the devils there are more resistant, or the tumour strains are different, or both,” she says. “Genomics will help us to solve this.”
Murchison says that although the research is focused on the devils, the knowledge gained may be valuable if a similar disease ever emerges in humans. The only other known cancer infectious in this way is a venereal disease in dogs.
Journal reference: Cell, DOI: 10.1016/j.cell.2011.11.065
More on these topics: |
Chrome Apps and Extensions to Support Struggling Learners - Going Google!
Many schools are discovering the use of the free Chrome Browser, and free apps and extensions in the Chrome browser to support education and learning. How do you support your struggling students? This webinar will present several apps and extensions to support literacy and executive function, and they are free to download right in the Chrome web store. If your students are using laptops (Mac or PC), Chromebooks, or a tablet, Chrome apps and extensions can support them on their device in the classroom and at home.
Registration and more information is at: http://www.resna.org/
To access the CDR Library: http://uscm.med.sc.edu/CDR/index.asp |
Editor’s Note: Kurt Ankeny came to CXC as one of Comics Workbook’s workshop leaders. Comics Workbook hosted four sessions over the course of the festival, and Kurt presented on his work and on modifying your tools and materials to suit the story. He had an engaged audience who dug into the exercise he led after the presentation, which was right out of Ohio’s history of comics correspondence schools – a riff on the comic gag spinner.
And now, the rest of Kurt’s CXC experience in his own words.
Well, I’m back from Cartoon Crossroads Columbus, and caught up enough to sit down and write a few words about the experience. MUCH thanks to Frank Santoro for funding the vast majority of our trip out there as part of the Comics Workbook crew!
THIS IS THE START OF SOMETHING BIG.
The show being created by Jeff Smith, Tom Spurgeon, Caitlin McGurk and the staff of the Billy Ireland Cartoon Library and Museum is still in its nascent stages. But if the project that they are all working towards comes to fruition, this is going to be a major event on the comics schedule, and may even put indie comics on the national media radar in much the same way that San Diego used to for mainstream comics. It’s exciting to think of how this show might grow.
BY, FOR, and OF THE ARTISTS.
Shows are not always necessarily about the sales. There are money-maker shows that cartoonists need, certainly. But there are also shows that cartoonists love, because those shows feel, as Kevin Czap put it in his acceptance speech for the Most Promising Talent Award, “like a big family reunion.” SPX is one of those shows. In only its second year, CXC is becoming another. The really special thing about CXC is the programming that happens before the market opens on Saturday. The academic discussions of comics by smart people who love what we do, the peer workshops that convey useful info to working cartoonists, the in-depth evening interview events, all create an atmosphere that is so rare at a con: one of relaxation and appreciation.
It is hard to put into words the acceptance I felt being surrounded by so many people who love the form, not just as makers, but also as readers and academics and archivists. THOSE are the people we do this for, and as cartoonists we so rarely get to see those who really care about the work we do.
THESE ARE THE PEOPLE IN YOUR NEIGHBORHOOD.
Wow, it was really great to put names with faces and add IRL time to my relationships with Alyssa Berg, Juan José Fernandez, Sally Ingraham, Caleb Orecchio, Sacha Mardou, and Emil Friis Ernst! Tabling with the lovely Whit Taylor was a treat. It’s always good to have some time to talk to Ben Passmore and Kevin Czap, meet Caitlin McGurk, have a conversation with a nearly catatonic Tom Spurgeon at about midnight on Sunday, and have Ben Katchor stop at my table for a good 15-20 minutes to chat about the State of Comics.
In other words, I had a pretty good time.
Kurt Ankeny makes comics in Salem, MA – his most recent book is In Pieces: Someplace Which I Call Home. |
For some reason, I have always found it difficult to drink "enough" water each day. Over and over I've been reminded that I should be drinking 8 - 8 oz. glasses per day, at a minimum. Does not seem like a difficult challenge... I have a kitchen sink that dispenses perfectly good water from the well right outside the window. Pour it through a Brita and store it in the fridge and I don't even need ice.
But, for some reason, those 64 oz. seem to elude me time and time again. So, I tried to pin-point my exact "issue" with water. Hhmmm... well, what am I drinking in its place? Coffee, Milk, tea, an occasional Diet Pepsi, and of course there's the occasional adult beverage :) ... I could probably drink the 64 oz. a day in coffee if given a good excuse. Thoughts of the impending caffeine withdrawals and detox are definitely enough to prevent me from doing so.
Now that the weather is warming up (or at least that's what Phil says) we'll be spending more time outside playing and less time curled up with a blanket and a hot cup of coffee. I figure now is a good time for me to come up with a plan to attack those elusive 64 oz.! Today, I decided that I'd go with the straw thing and see how it works out. I rinsed the cup that once held iced tea from my favorite local drink stop, threw in some ice... and as I was sliding the freezer drawer shut, my eye caught on a bag of strawberries! I recently purchased some huge fresh strawberries that I brought home, rinsed, stemmed and froze in a zip-lock bag. I figured I've got nothing to lose... grabbed a giant berry, plopped it into my cup and filled it to the brim with water.
Humph! Who would have thought?! I'm on to my second "Venti" water for the day! I'm already looking forward to summer fruit season... I think I just may have found the answer I've been looking for! |
It's not an amazing view but one of the things I have always loved about this flat is my huge kitchen window....no curtains for a reason...I love looking out....I love what I see....and I love the sky at the end of the day.
This is a lovely view. I can understand why you didn't have any curtains. Love all the blue hues.
This view isdefinitely on the list of things I will miss ;) |
MANILA – The Department of Education (DepEd) is expecting around 20.9 million students from pre-school to secondary level to return to school on Monday.
To assists parents and students on the first day of school, the DepEd has already set up help desks to accommodate queries and complaints.
DepEd Assistant Secretary Tonesito Umali said that apart from their central office, the agency's 17 provincial offices and 200 school divisions have also opened their lines to accommodate inquiries from students.
Here are the DepEd help desk hotlines:
The DepEd also reminded parents that public schools are not allowed to refuse to admit students.
However, Umali said some schools lacking space and classrooms may be allowed to do so.
"Some schools deny the request of registration of some students… Our policy on that is that we cannot deny [students]. The only reason our schools may refuse to admit a student or a transferee is if that school is very congested," said Umali, adding that in these cases, parents can call the DepEd Action Center so they can direct them to another school which may be able to accommodate them.
With more than 20 million students returning to school, Umali admitted that some schools in Metro Manila may have to accommodate more than the ideal class size.
The ideal class size for kindergarten is 1 classroom for 25 students, while the ideal class size at elementary and secondary level should be 1 classroom for 45 to 50 students.
To accommodate more students, he said some public schools also do double shifting.
However, in a press briefing last Friday, Umali explained that school congestion and overcrowding is not due to the lack of classrooms.
He said that "categorically" the DepEd has addressed the problem of classroom shortage in the country.
"Wala tayong classroom shortage. May mga paaralan na sobra-sobra ang espasyo. May paaralan naman na wala nang buildable space," Mateo explained.
"May mangilan-ngilan na because of late enrollment, because of lack of buildable space, hinaharap pa rin natin itong mga ganitong usapin o problema na ginagawan naman natin ng paraan," he said.
He added that the media should not focus only on schools in Batasan and Commonwealth in Quezon City, which he admitted are more crowded compared to other schools due to lack of buildable space.
He said that the DepEd Action Center is accepting all kinds of queries and even complaints of parents and students.
DepEd has also set up help desks in different provinces apart from their central office in Metro Manila.
All systems go for calamity-hit schools
Meanwhile in Tacloban, Umali said only a couple of schools are being used as evacuation centers by the survivors of Super Typhoon Yolanda.
However, he said that in other Yolanda-hit areas, around 2,200 new classrooms are still being built, while repairs on 17,000 classrooms are on-going.
To address this problem, Umali said that the DepEd has built "sufficient" makeshift classrooms and tents to serve as temporary learning spaces for students in Tacloban.
He said the same is the case in other disaster-hit areas like Bohol and Zamboanga.
Umali explained that all classrooms that will be built in these areas will calamity-resilient, as ordered by President Benigno Aquino III.
He said the DepEd is currently coordinating with the Department of Environment and Natural Resources to locate danger zones, especially in Bohol where some areas have sinkholes. |
Spring was on the way out when we arrived early May, it was already getting really hot. Everything was beautiful though, flowers in full bloom etc.
Summer was so hot it's so much fun. Playing in the paddling pool nearly every day, then coming in to sit in the air cpnditioning for a while before we completely melt. I love it.
Fall is so pretty. There are so many trees here the colors are gorgeous. And the backyard squirrels have been so busy collecting all the nuts and things.
Here are some fall pics
I love the changing seasons. I look forward to Winter. I get bored too easily, but here there's not a chance to get bored with the weather. |
Yunus spoke to the crowd about starting social businesses, similar to his own Grameen Bank. The bank has given thousands of small loans to mostly women to help pull themselves out of poverty.
From the University newspaper The GW Hatchet, writer Becky Reeves tells us that Yunus' wife introduced him to the crowd.
Betty Simms, wife of the chairman of the Grameen board - an organization aimed at aiding the world's poor based on Yunus' microfinance model - introduced the Nobel Laureate. She explained how as a young, impoverished boy Yunus overcame numerous obstacles, rising above poverty and helping millions to do the same.
During the event, which celebrated the paperback publication of the Yunus' most recent book, "Creating a World Without Poverty: How Social Business Can Transform Lives," the author spoke about his social business model, outlining how self-sustaining businesses can yield major humanitarian benefits.
Since achieving a repay rate of nearly 99 percent in his Bangladesh-based project, Yunus has spread Grameen Bank to 183 other branches worldwide and has turned microcredit into an international phenomenon.
The success of Yunus' endeavors has led him into a number of other humanitarian projects. In addition to Grameen Bank, Yunus is working with distributors of food, water, shoes and even cars to give the poor access to these goods at a significantly reduced cost, allowing them to maintain a higher standard of living.
Yunus also touched on the current financial crisis, hinting that it offers a parallel to his own financial work. He said that although many have been skeptical of the "credit worthiness" of his borrowers, the bailout has put the American public in the borrowers' position.
"Now is the time to ask the question: Who is credit-worthy?" he said. |
"Leather armor from the durable hide of a roc."
Only useable by Rogue, Archer, Assassin, Huntress, Trickster, and Ninja.
Ad blocker interference detected!
Wikia is a free-to-use site that makes money from advertising. We have a modified experience for viewers using ad blockers
Wikia is not accessible if you’ve made further modifications. Remove the custom ad blocker rule(s) and the page will load as expected. |
End of year is coming and we will be never enough grateful for your support.
Our 2nd year is closing next month but let’s stop on november’s release.
Luc Forlorn and Jean Dovy are back with a cocktail of tracks for your mind and your body.
Title : Reaction to Creation
Artist : LyFe&Daze
Catalog# : DVM00051
Label : somanymusic
1 Priviligied (Minimal Need)
2 You’re The One (Deep from the Heart Mix)
3 Liquid Blue (Tears of Deep Mix)
4 Grinder (Crushed Edit)
all tracks written, mixed and produced by Jean Dovy and Luc Forlorn
website : https://somanymusic.bandcamp.com
Facebook : https://www.facebook.com/somanymusic | https://www.facebook.com/lyfeanddaze/
Cyberspace : https://soundcloud.com/somanymusic | https://soundcloud.com/lyfe-daze |
If you have a gun and want to carry it without being bothered by local law enforcement, you will have to travel a bit outside of metro Chicago. But not too far.
Even though Illinois’ new concealed carry law is on the books, the actual state permitting process is not ready to go and won’t be for months.
Regardless, the I-Team has identified 14 counties where authorities say you may not be arrested for carrying a gun.
With this week’s override action by the General Assembly, Illinois was the 50th state to allow concealed carry.
On Thursday night, state police officials said troopers will still arrest anyone carrying a gun because no conceal carry applications have been processed and no permits have been issued under the new law.
But some county authorities in Illinois are ignoring that.
“I’ve already made clear to the state police that those prosecutions will go nowhere. Those folks will not be prosecuted as long as they’re following the guidelines that I laid out,” said Thomas Gibbons, Madison County State’s Attorney.
Madison is one of 14 downstate counties where prosecutors or sheriff’s officials have said that gun owners with state firearm owner’s cards will not be arrested for carrying in public.
Gibbons, attending a county prosecutors conference in Chicago on Thursday, issued seven criteria that gun carriers must meet, including carrying for self-defense:
- Must be issued and possess a valid F.O.I.D. card or, if not an Illinois resident, a valid concealed carry permit from a state that performs a background check prior to issuance of the permit; and
- Must be carrying the firearm for self-defense; and
- Must not be prohibited from possession of a firearm under another statute or court order; and
- Must keep the firearm concealed on their person or in their vehicle, and not visible to the public; and
- Must not be engaged in any criminal conduct; and
- Must be in compliance with all other federal, state and local laws and ordinances; and
- Must, when asked, inform law enforcement officers of the firearm when in contact with an officer in the course of their duties. It is essential that individuals cooperate with any police officer and inform them of the presence of the firearm prior to removing it from its concealed location. Displaying the firearm at a public location or without the request or knowledge of an officer could constitute a violation of the law.
“Criminals carry firearms and they use them to hurt people. And so anyone, any person in our society has the ability to keep a level playing field as long as they’re otherwise law abiding-to carry a concealed firearm to make sure that if they’re confronted with a deadly threat that they have the ability to make sure to defend themselves,” said Gibbons. |
This wallpaper is Pug Puppies Picture published under Puppy dog category. You can get more HD image collections go to . Save and download Pug Puppies Picture free for you and set as desktop background. This image posted by William On Friday, November 8th 2013. Save and download this wallpaper Pug Puppies Picture for free here by clicking the image link or right click and view image and set as your desktop background for your Windows PC or Laptop or your Mac. Finally if you want to get new and the latest wallpaper related with Pug Puppies Picture, please follow us on facebook or bookmark this site, we will try our best to deliver you updates with new fresh and new wallpaper 2014. We Hope you enjoy staying here.
pugs puppies wallpaper terrier de yorkshire, 1955 chevy, English mastiff pic, lab pomeranian mix, pitbull con rottweiler, super mario boo, rottie mastiff, doberman contre pitbull, yorsay terrier mini, miniture jack russel, Pug puppy pictures, doberman mix, grey doberman, german shepherd beagle mix, pics of english mastiff, japanese dogs, pekingese mixed with chihuahua puppies, puppy rottweiler, shih poo puppies for sale, pembroke welsh corgi |
VINTAGE TRUE BURLESQUE TELLS ALL THE GLAMOUR THAT WAS NEVER THERE!
MOBSTERS, SMOKE-FILLED DUMPS AND LIVING OUT OF A TRUNK. LET'S DANCE!
Books by Jim Linderman
Free Previews and Ordering
SHARE BUT CREDIT
True Burlesque Slug of Hooch Before the Show Vintage Photograph
True Burlesque unidentified performer steels herself for the night with a slug in the glamorous undressing room. Note costumes on rack and dapple-painted folk art piano. Original Photograph (no date) circa 1940? Collection Jim Linderman |
By the time I walked in my front door, there were several messages about the tragic loss of one of Beverly's own. Marine Lance Cpl. Conner Lowry was killed March 1st while serving in Afghanistan. He was a St. John Fisher and Brother Rice graduate who loved sports and all things Irish. His dream was to return home and become a Chicago firefighter.
For full story, including a video recollection of his sister, visit the story at Chicago Tribune
Please keep Conner's family in your thoughts and prayers. |
Upset? Have a free meerkat adoption or a year's supply of fruit cake: Items among bizarre forms of compensation offered by British companies
- One company offered an angry customer the chance to adopt a meerkat
- Another firm sent the complainant a free Cadbury Creme Egg
- One customer received a free packet of condoms when one broke
A year's supply of fruit cake, a book of stamps and a free meerkat adoption are some of the forms of compensation offered by UK companies, a survey has found.
A book of vouchers only redeemable in the US, £2.48 in return for loss of the internet for a month and a free meal at a restaurant where the diner caught food poisoning are some of the other 'goodwill' gestures suffered by consumers, the poll for the online complaints service resolver.co.uk revealed.
Repentant companies have also offered a bottle of orange juice that was out of date and fermenting, 60p in return for not switching mobile providers, and a box of condoms after a customer submitted a bad review when one broke.
One unnamed company said an angry customer could adopt a meerkat because they received poor service
Another firm offered a free Cadbury Creme Egg as compensation to another customer who made a complaint
Asked to name what they considered to be the most bizarre or strange compensation offered by a company after making a complaint, others surveyed reported receiving a voucher for a new tyre from a scrapyard and a Cadbury creme egg.
Resolver founder James Walker said: 'What this shows is that companies are not taking the consumer seriously.
'Complaining should be more prevalent and I urge consumers to seek redress if they experience poor customer service.
'We want companies to take compensation more seriously and hope that our service will highlight the good and the bad practices that are out there.
'Our plan is to work with these companies to show them the value of complaints - hopefully illustrating to them how they are valuable sources of feedback and essential information for helping them to provide a better service to the customer.'
YouGov surveyed 2,341 adults online on July 25-28.
Most watched News videos
- Trump fires controversial chief strategist Steve Bannon
- Moment terror suspect in 'bomb-vest' gunned down by police
- 'Suspect' arrested after shocking stabbing spree in Finland
- Anti-fascist chant: 'No fascism' during protest in Las Ramblas
- Horror as three young girls are found dead inside Maryland home
- Confederate Civil War veterans give 'Rebel's Yell'
- Squirrel in his sights: Dog entranced watching squirrel videos
- Moment knifeman flees the scene after stabbing man in Surgut
- Strategist Steve Bannon leaves Trump's turbulent White House
- Immigration officers raid accommodation filled with migrants
- Spanish royals visit young victims of Barcelona attacks
- Judge Judy lets dog find its real owner inside court room |
If you are looking forward to get financial returns from your website, it’s time you got serious and look upon your online identity as a vital element for the success of your business. However, you might be lured by the exclusive offers and the attractive ways in which web development companies offer their services. Here are some points that will guide you in selecting the best web development professional and ensure that you get the money’s worth.
#1: Think of your website as a marketing tool
Firstly, it should be understood that the website is a marketing tool. People would go online to find anything. Thus, you should already have to plan for the website before the coding starts. How are you going to attract the visitors to the site? What are you going to tell them? What would you like them to do on visiting your site? How will you convey your message to them. It is important to set up the goals and prioritize them. If your goals are to get more leads through a form on the webpage, than you should prioritize the form by making it highly visible.
#2: Define the market segment that should visit your site
It is important to define the target audience before deciding on the coding, content, template of the website. Are you targeting only those who know your brand, or also new customers. Which channel are you targeting from where the visitors should come? Define the demographics of the targeted audience to avoid any clutter during the development process. When you know who you want to come on your site, you will be able to design the content marketing strategy accordingly.
# 3: Do you have a unique value proposition
Know what gives your brand an edge over your competitors. This is something where you will not get any help from the designer or the developer. You will have to think upon it yourself. Convey your USP on the website and educated the visitors on why they should be doing business with you. The value of your brand has to be communicated in one sentence. The unique value proposition should be loud and clear on the website. So, be sure to try the best to express clearly and quickly. Tell the customers why you are better than the competitors.
# 4: Address the needs of the customer
Make sure you know what your customer wants. Just like the unique value proposition, people should get a strong message of why they should visit your website and stay back. When you know why they are visiting your website, you will be able to address their needs well in content, design, and more. If you are having an electrical repairing agency, it will be more effective to tell the visitors, Are you having an electrical emergency”, which directly addressees their trouble points.
#5: The Basic Website Architecture
You should know the basic website architecture. It may sound complicated, however, in reality it’s not. Firstly, you will need to lay out the menu structure of the website. Each page on the site should have a purpose and a hierarchical order. If you want to succeed in your search engine optimization efforts, however are not sure how to go about doing it, a good website architecture will be a stepping stone and will help your visitors navigate through the site. It serves as a blue-print for building your home. The developer would create a detailed plan for building the website, but you must define on how many sections, pages, information would the website carry. The developer will find it helpful when you give this to them in writing.
#6: Decide On The Elements Of Conversion
Your call to action and the offer should be well defined and clearly visible. The message given with them should compel the visitors to take the desired action. Before you hire web developer, you should have a very clear vision of what the visitors should do on the website, and how they should see the call to action. Clearly defining them for yourself and the developers, will bring the end result as you had imagined making your website a successful conversion tool.
Developing a website is indeed a serious business, and if your rely majorly on online sales, there is no escape. However, the more elements that you consider and clarify for the developer the better. This will help you in achieving more success from the digital marketing strategy and make your website an effective sales tool. |
As part of HuffPost's “Reclaim” project, HuffPost Taste will focus the entire month of July on simple ways you can reduce food waste in your own home.
Fresh herbs are the thorn in every home cook's side. They're expensive and they always wilt before we can use them up, yet they are absolutely essential for making food delicious. Skipping them isn't an option -- instead, we have to preserve them.
Next time you throw down some serious dough on a tiny packet of thyme (or basil, or cilantro, or rosemary), use the couple of sprigs you need for your recipe and quickly preserve the rest. Freeze them chopped in olive oil and really stretch your food dollars.
Food Blogger Katarina of Diethood has shared this kitchen trick of hers with us and it is genius. Not only do you save money and prevent food waste with this clever technique, but you're also equipping yourself with some serious flavor bombs. Use the herb-spiked olive oil cubes -- they go straight from freezer to pan -- and you'll see what we mean.
More Stories Like This: |
Note: Full spoilers for the episode follow:
One of the more interesting things about Division (and what made letting it redeem itself such a futile idea, really) is that its comprised almost completely of (to borrow a phrase) "troubled, violent killers with low self esteem." Since last season's finale we've seen all our heroes wrestle with this noble but probably bad idea and in "Masks", the wheels finally came off.
I loved the moment when Alex realized that her little rebellion had morphed into something much too big for her to control (why, hello there tipping point), almost like a zombie hoard. Alex's recent squirrelyness is even more off-putting to her new acolytes than it's been to her friends. Even though she's been compromised, her motives are sincere. She (like her mentor, Nikita) wants to save everyone. She wants to free the Red Shirts but not in a way that will hurt Nikita, Michael and the others.
But the Red Shirts (who are still pretty faceless) don't have any investment in the new leadership. Even though they're killers and not all that interesting individually, we can sympathize with them because in the famous words of Lando Calrissian, this deal is getting worse all the time. Since they haven't been privy to all those warm-fuzzy Scooby Gang moments, it certainly feels like "meet the new boss--same as the old boss" for them. Speaking of not being interesting, Sonya and Birkhoff had another pivotal, interesting scene...to hear him tell it, because it happened off camera. When Sonya dies, or reveals herself to still be Team Amanda or both, I'm counting on Aaron Sanford to pick up the writers' slack and make me give a crap.
Danforth's off-camera death was a bit of a surprise. It seemed a little rushed and anticlimactic, considering he'd just gotten under Team Nikita's thumb with the Black Box information. Much more effective in the shocker department was Owen's blowing away the army buddy Nikita had helped him track down.
I loved Owen's transformation into the evil, confident "Sam." Don't get me wrong, it hurts, but Devon Sawa was captivating as a confident, fearless animal of a bad guy. I have to believe that Nikita's right, that the real Owen is that dopey donut guy who covered his body with guilt tattoos, but on the other hand this is a guy who assassinated strangers and dissolved their bodies in acid, so who knows?
I struggled a little with having multiple mind-effed characters causing chaos in the same episode, but since Amanda did have access to all of Division's brains at one time or another, it does make a certain amount of sense. I do think the fact that Alex isn't really completely in control of herself does weaken the emotional fallout of her actions at the moment. When Nikita told Amanda, "That's not winning, that's cheating," a part of me felt the same way about Amanda's big ol' brain needle, even though I love Spy-fi. Hell, I even liked Alias's Rambaldi Device!
One of the most compelling things about Nikita is that under that bad-ass exterior beats a squishy, bleeding heart, and it was heartbreaking and inspiring to watch her implore Owen to remember their friendship as he mocked her and prepared to sell her to her mortal enemy, as well as to witness her assure Amanda that Alex would break free of her mind games the way she had before...while back at Division, Alex continued to plot its defeat.
Maggie Q does so much so well (action, drama, comedy) and she makes it looks so easy that it's easy for me to just take her for granted. She absolutely killed it in her scenes with Melinda Clarke, who showed us flashes of the fear and vulnerability lurking behind her snakelike facade when Owen was threatening her and when Nikita was taunting her. She also hammed it up deliciously when she was bragging like a Bond villain about implanting the Larissa hallucination. I loved how Nikita turned the empathy that had so recently tripped her up with Alex and Owen into a weapon with Amanda, surmising that Amanda hates Nikita because she was once just like her: helpless, abandoned, broken. Next week promises to explore this pivotal relationship, while back at Division...pretty much everybody's lives hang in the balance.
Christine Seghers is a writer at IGN TV. She lives in her own little world and rarely interacts with people, but you can still attempt to follow her on Twitter at @CMSeghers and IGN at ChristineSeghers. |
Lenoir City, Loudon County (WVLT) - An East Tennessee businessman and his wife have more charges Tuesday after going to court for an illegal prom party.
Jack and Katherine Butturini went to see a judge about the charges Tuesday morning. Instead they went back to jail on new charges.
Jack and Katherine Butturini appeared in a Loudon County courtroom to answer charges of contributing to the delinquency of a minor. The charges stem from a May 6th prom party at their waterfront home. What they got in court were new charges of providing alcohol to underage persons.
“They're pretty shocked against the accusations against them,” says Joe Hoffer, the Butturinis attorney.
Twenty underage people were cited that night where some were under the age of 18.
“The majority of the citations we issued were for persons 18 and under 21,” says Loudon Assistant Chief Deputy Jimmy Davis. “So we were obligated to charge them with that charge also.”
Butturini's attorney maintains his client is innocent. “Mister Butturini doesn't act in a manor that is consistent with these charges. He takes care of the youth. He provides education and athletic opportunity for them.”
But authorities don’t see it that way.
“There were statements made at the scene. I was talking to one officer on the scene yesterday that they said it was pretty much an open bar at their house,” Chief Davis says.
The Butturinis were booked and released on a signature bond and Jack Butturini has said those cited on his property were trespassing.
I understand there was some folks at their house,” Hoffer says. “There were some intoxicated, some unwanted teenagers that were there. But they had already taken care of the children that were at their home and had gone to bed.”
Most of those underage are due in court on May 23rd. The Butturinis are set to come back to court June 27th. |
Remembering David Cardinal
|Photo by Michael S. Williamson for the Washington Post|
I didn't know David Cardinal, except that I had the sense that he was a good man. I had asked to take his picture back in 2010, during the last iteration of interPLAY that took place on Franklin Avenue.
Though long before I began my painting journey, I still had the sense I had to capture his amazing face and smile. He was bursting with character and lined with stories.
I remember that he was very accommodating and appreciative of the opportunity to pose. As I say, I didn't know him well, but he seemed to have quite a sense of humour.
I attended the vigil for him that was held yesterday at The Centre of Hope. I didn't know him well, but found myself welling up as prayers were said and stories were told. I was particularly moved when Eric got up to speak; I think Eric is his son.
I didn't know David Cardinal well, but I have a better sense of him now.
"He was a good man."
"He loved to read and always had a book with him."
"He loved nature and preferred being outside."
He was a generous soul, opening his door (when he had one) to anyone who needed shelter, giving what little money he had to others so they could grab a meal. He had a wicked sense of humour.
The Centre of Hope is a place filled with humanity: patrons, staff and volunteers who care for each other. There wasn't a dry eye in the place as memories were shared and the candles danced, as if David's spirit was in the room , taking it all in.
I spent yesterday evening working on his portrait. It's not quite finished, but his smile and character already shine through. |
The San Francisco Giants announced a plan Tuesday to place an initiative on the November ballot that would transform 28 acres of parking lots in Mission Bay into a new Mission Rock neighborhood comprised of housing, commercial space and waterfront public parks.
Larry Baer, the president and chief executive officer of the San Francisco Giants called the proposed project "inspired" and said that when fully realized, it will generate $1 billion in revenue for the city.
The Giants submitted the measure to the City Attorney's Office Tuesday and will need to gather 9,702 signatures by July 6 to get it on the November ballot.
Baer said the measure, if approved by voters in November, would remove 2,200 surface parking spaces just south of AT&T Park and McCovey Cove and move them into a new parking garage slightly further south, freeing up land for a mixed-use and mixed-income neighborhood.
Baer said one-third of the 1,500 new residential rental units that would be constructed in Mission Rock would be affordable to low and middle-income individuals who so desperately need housing options as rent continues to skyrocket across the city.
Baer said the decision to place the initiative on the ballot comes after hundreds of community meetings and workshops regarding the property.
Corinne Woods, a San Francisco resident who has lived in a floating home on Mission Creek for 30 years, near the proposed construction site, said she attended many of those meetings and believes it completes the neighborhood.
Originally, Woods said, she hoped Mission Rock would be returned to 13 acres of wetlands, but as time passed, she said she realized it was not financially viable and set her goals on stopping a monolithic wall from emerging on the waterfront.
Woods serves on the Port of San Francisco's Central Waterfront Advisory Group and is the chair of the Mission Bay Citizens Advisory Committee.
She said she wants to see smaller buildings with a variety of heights to help create "a neighborhood feel." She said many Mission Bay residents don't like the long blocks that make up their neighborhood and she doesn't want to see the rest of Mission Bay constructed in the same way.
Woods said the meetings and workshops truly allowed public input and that when the project was first proposed, developers basically wanted to build a mall.
"They originally wanted 420 foot towers," she said. "We thought it was out of scale."
Woods said the proposed project reflects input from the community.
The Giants announced Tuesday that height limits in the new neighborhood would range from 90 to 190 feet for office and retail uses while rental housing would be between 120 and 240 feet high.
According to the Giants, building heights will step down as they near the water and no buildings will be built within 100 feet of San Francisco Bay.
The project will bring more transit to the area and provide the growing community with an additional 8 acres of open spaces.
Woods' role on the Port of San Francisco's Central Waterfront Advisory Group has given her insight into the port's struggles over the years and said she thinks this project would help the port, and the city, generate revenue.
"They don't have the money to build," Woods said of the port.
She said San Francisco's piers are historic resources that must be rebuilt to look like they did when they were new, even if they are going to have new uses. She said the port lands are still under the jurisdiction of the California Lands Commission, which greatly restricts possible projects.
"Their obligation is to the public trust," Woods said of the port, explaining that its property must function as a statewide resource and that greatly limits what projects can move forward.
She said if approved in November, the Giants will fund all construction and infrastructure associated with this project and, once completed, hand it over to the city.
Once the project is under the control of the city, the city will have to pay back the developer for the infrastructure investment, she explained.
Woods said she hopes that the park can be constructed first, but said that developers want to focus on buildings first because, "Buildings bring in revenue, parks don't."
The Giants are also planning to do a historic preservation of Pier 48, which once served maritime needs, but now serves as additional parking and event space.
Under the Giants' plan, Pier 48 would house Anchor Brewing Co., allowing the craft beer company to expand their business with 212,000 square feet at Pier 48 in addition to the 98,000 square feet already in use by brewers in the Potrero Hill neighborhood.
Keith Greggor, president and chief executive officer of Anchor Brewing said Tuesday the company has been looking for a way to expand for a long time and this project would be ideal for the company.
"We need to expand," Greggor said, explaining that it has been a challenge to find a space large enough to brew beer, especially in a small city like San Francisco where large parcels of real estate rarely become available.
Greggor said the approval of the ballot initiative would give his company an opportunity to expand and showcase their product to visitors from around the world.
He said that while Anchor Brewing has been in San Francisco since 1896, in recent decades other craft brewers have emerged that have been able to expand, while Anchor Brewing has not.
"If we don't expand we won't be able to stay relevant," Greggor said.
According to Baer, the Mission Rock project would create 1.4 million square feet of commercial space and roughly 11,000 permanent jobs.
To build the new neighborhood, roughly 13,500 construction-related jobs would also be created, Baer said.
Baer said the Mission Bay neighborhood is young and needs restaurants, shops, housing and parks to make it feel more like the rest of the city.
"We're really excited about creating a new neighborhood," Baer said. |
MIAMI, Nov. 12, 2012 /PRNewswire/ -- In a big event hosted by two of the most reputable fine jewelry designers in Florida this coming Thursday, Nov. 15, a brand new type of gold will be presented the first time.
Designer Joseph Aviv and colleague jeweler Andrew Koppel are joining forces in hosting the event at Maurice's Jewelers, Koppel's impressive boutique store at 11865 S. Dixie Hwy., Miami, in which they will showcase their new collections and launch Joseph Aviv's one-of-a-kind Brown Gold™, considered to be the most innovative on the market today.
Unlike common coloration methods, the Brown gold presented in the event does not get its color by any surface treatment, but goes through a sensitive process of special electronic bombardment called PVD (Physical Vaporization and Deposition), which makes the metal change its color to Brown.
The event will be open to the public from 10:00 AM. However, between 7:00 to 11:00 PM, 300 guests of the Greater Miami top financial, political and social elite will enjoy champagne, gourmet hors d'oeuvres, fancy jewelry pieces and museum-quality gemstones, in a closed party.
Percentage of the event proceeds will be donated to the MAS Foundation, a non-profit organization established by Jeanie and Dr. Rafael Mas in memory of daughter Nicole, a fourth-generation doctor who spent her life helping people in need and passed away in late 2011 at the age of 27 due to a blood disorder. From scripts her parents found after her sudden death, they learned about her dream to establish a foundation dedicated to help others and the name she gave it: MAS, after her last name and standing for: Medicina, Amor y Servicio (Medicine, Love and Service). They started the foundation, which lives on with her goals and ideals, providing education and programs to orphaned children, medical aid and financial assistance to children and families in need.
Andrew Koppel of Maurice's Jewelers, established in 1935, is specialized in creating unique custom-made jewelry. Designer Joseph Aviv is the owner of a fine jewelry company featuring high quality creations and exquisite pieces presented in more than 10,000 stores around the globe.
Contact: Etty Annerl
SOURCE JK Marketing |
Each of us desires similar things such as an education, a job, a clean and safe environment, affordable health care, and access to energy – and each of us has a role to play in helping to make this a reality for people everywhere today and tomorrow.
Washington, D.C. (PRWEB) January 31, 2012
United Nations Foundation President, Timothy E. Wirth, today issued the following statement on the United Nations Secretary-General’s High-Level Panel on Global Sustainability report published today, “Resilient People, Resilient Planet: A Future Worth Choosing:”
“In a report published this week, United Nations Secretary-General Ban Ki-moon’s 22-member High-Level Panel on Global Sustainability, including UN Foundation Board Member Gro Harlem Brundtland, provided recommendations for reducing poverty and creating a healthier planet for future generations. This report underscores the importance of a global approach to sustainable development based on three pillars – economic growth, social equity, and the environment. Each of us desires similar things such as an education, a job, a clean and safe environment, affordable health care, and access to energy – and each of us has a role to play in helping to make this a reality for people everywhere today and tomorrow.
"Twenty-five years after the release of ‘Our Common Future,’ which first outlined the concept of sustainable development, the Global Sustainability Panel’s vision reaffirms the Brundtland Report and inspires us to act now. The report makes it clear it is possible to both ensure economic growth and protect our planet for our children and grandchildren. As we prepare for the UN Conference on Sustainable Development in Brazil in June, known as Rio+20, I look forward to continuing the momentum and engaging in a conversation with not only governments, but also individuals, corporations, civil society and nonprofit organizations to create a better world and the future we want.”
About The United Nations Foundation
The United Nations Foundation builds public-private partnerships to address the world’s most pressing problems, and broadens support for the United Nations through advocacy and public outreach. Through innovative campaigns and initiatives, the Foundation connects people, ideas, and resources to help the UN solve global problems. The Foundation was created in 1998 as a U.S. public charity by entrepreneur and philanthropist Ted Turner and now is supported by global corporations, foundations, governments, and individuals. For more information, visit http://www.unfoundation.org. |
5 bedroom house for sale
Mon Caprice, Sandy Lane, St James, Barbados
like this property?Call: 03339 395587
- Recently built
- Coral stone structure
- Stunning antique and custom furnishings
- Formal dining room with seating for 12
- Beautiful sea views
Boasting the desirable Sandy Lane address, this two-storey coral stone villa is within walking distance of the beautiful Sandy Lane beach. Mon Caprice offers five bright, contemporary bedrooms elegantly appointed in a palette of soft island tones. Stunning furnishings include mahogany antiques, custom copper chandeliers and original works handcrafted by local artisans. Beautiful mahogany entrance doors open into a majestic foyer decorated with intricate copper sconces and a carved coralstone credenza. Tall Palladian windows filter the sunlight as it enters gracious living and dining rooms with enchanting views of the pool and garden with its aged mahogany trees.
Once lit in the evening, Mon Caprice is transformed with a magical glow as light reflects off the high ceilings and tall coral stone walls. Whether it's enjoying a spectacular sunset and vista of the turquoise Caribbean Sea or a romantic candle-lit dinner on the upper terrace, Mon Caprice offers the best in elegant beach living.
Located approximately 10 minutes from Holetown's attractions, five-star restaurants, duty-free shopping and beaches; approximately 25 minutes' drive from the capital city, Bridgetown.
- Grantley Adams (International), 12.3 miles
*Distances are straight line measurements. This feature is currently in beta. |
Section 211 of the California Penal Code defines a robbery as taking another person’s property from them while using force or intimidation. A robbery can be charged as First Degree Robbery or Second Degree Robbery. First Degree Robberies include those that occur in another person’s home, on public transportation, streetcars, taxis, and near automatic teller machines. All other robberies are Second Degree.
Regardless of the degree of robbery, a conviction will result in serious consequences that can have a significant impact on your life. If you are charged with a robbery, do not hesitate to contact robbery defense attorney Aaron Spolin. At Spolin Law, we have a long history of success defending individuals facing criminal allegations. By using legal motions and thoroughly investigating your situation, we can compile a strong case that could potentially keep you out of prison. Call (310) 424-5816 to learn more.
Penalties for Robbery Convictions
In California, robberies are always charged as felonies, meaning a conviction can hold serious consequences. For a First Degree Robbery, the punishment can include up to nine years in prison. A Second Degree Robbery conviction can result in two, three, or five years of imprisonment.
Time spent in prison can place a strain on your personal life and relationships, but prison time is not the only consequence of a robbery conviction. Other aspects of your life may be affected as well. A violent felony conviction on your record may preclude you from certain occupations and can irreparably harm your immigration status. It will likely appear on background checks for the rest of your life. This is why it is so important to begin constructing a vigorous defense as soon as possible.
Defending Yourself from Robbery Charges
While being accused of a robbery may feel scary and hopeless, there are many valid ways to defend your name and reputation from the consequences of a robbery conviction. For example, part of the definition of a robbery in the law is that force or fear was used to take another’s property. If you can prove that the property was given to you without the use of force or fear, you may be able to use that as a defense. Other applicable defenses to robbery charges include:
Self Defense – If you felt threatened or defended yourself, you may be able to use it to argue for your innocence. If someone attacks you and you turn the tides on your attacker, you were merely defending yourself.
Entrapment – If a police officer guided you to commit a crime you would not have committed otherwise, you can use an entrapment defense. Police cannot encourage criminal acts and then arrest the people they convince to commit crimes.
Duress – If you were acting out of fear of harm to you or your family, you could make the argument that your alleged crime occurred under duress. This can be a convincing defense as it turns your story into that of a victim of circumstances rather than that of a criminal.
Mistaken Identity – If the prosecution cannot prove beyond a reasonable doubt that you were the person who committed the robbery, you may be able to use that as a valid defense. If there is enough doubt about whether or not you committed the act, you cannot be convicted of it.
A successful robbery defense will keep you out of prison. Attorney Aaron Spolin has a long history of successfully defending clients from criminal accusations. Spolin Law takes only a few clients every year and focuses on providing them with detailed and aggressive defenses. Call (310) 424-5816 to learn more about the defense options available to you.
Contact a Robbery Defense Attorney
The attorney you choose to represent you can make all the difference in whether you are imprisoned or get to keep your freedom. As a defendant in a criminal case, you are entitled to an attorney. Unfortunately, public defenders are notoriously overworked, meaning they may not be able to put in the time necessary to construct the level of defense you need. Private attorneys can control their workload, so they are able to dedicate enough time to learn the ins and outs of each of their cases.
Spolin Law attorney Aaron Spolin, a former prosecutor, is familiar with common prosecution tactics, and we will use this knowledge to tailor a defense to your specific needs. If you are facing a robbery charge, contact Spolin Law today at (310) 424-5816 to set up a free consultation. |
Tonight Asmodeus, that horrible monster, is being forced against his will to answer letters from our Strangers! Instead of the full 200 page disclaimer we've been advised to use let us boil it down to this:
Following any suggestions from a bloodsucking monster is ill advised. He is for entertainment purposes only.
Performed by the vampire himself!
Music by Kevin MacLeod (incompetech.com) via creative commons
Ghostpocalypse, The Show Must Go, Heavy Heart |
I'm going to be speaking at the Enterprise IT Week conference that is part of CDXPO. I'll be in the Web service track. I've proposed the following abstract for the talk:
Many Web services projects never make it out of the "pilot" stage. While free tools and direct connections work fine in small implementations, they fail to scale, suffer from reliability problems, and are difficult to secure. Web service intermediaries provide answers to these problem. While Web service intermediaries may not show up in the standard Service Oriented Architecture (SOA) discussions, they're crucial to successfully implementing large scale SOA-based systems. This talk will focus on the function of Web service intermediaries and how they can turn a pilot project in a secure, reliable, scalable, production-ready implementation.
The talk will be based on the experience I've gained reviewing intermediary products, including the XML firewall reviews I'm working on right now. As time gets closer to the talk, I'll be posting some of my ideas here. |
Online 11 months ago
Preferred stay length
We are two good friends that have lived on our own for 3 years in sweden so we are use to the situation. We are happy to help around the house since we both have worked in construction. We dont demand much and we are very easy to get along with. |
Contact Information About THOMAS R. JONES, Maryland
THOMAS R. JONES has an office in Antioch, California and provides counseling and/or therapy for their clientele. THOMAS R. JONES is listed as a Maryland, but may provide additional support.
For detailed questions about THOMAS R. JONES’s therapy practice, you should contact their Antioch offices at 9257795000.
THOMAS R. JONES is local to the 94509-4004 area.
THOMAS R. JONES Reviews, Feedback, & Complaints
The Fix definitely wants its readers to submit authentic THOMAS R. JONES reviews, if you had a real-life experience as their client, or know a person who has. If you’ve gone to THOMAS R. JONES in Antioch, California you are encouraged to share details about your experience, as long as you do not break confidentiality.
Colorful language is acceptable but please refrain from threats of harm, hate speech, and/or other words that seek to isolate someone in a negative fashion on the basis of their race, religion, ethnic group, or other affiliation.
You’re writing about therapy, which is an inherently touchy subject. Please try and remember that.
We also do not want you to reveal personal information or data about THOMAS R. JONES or any of their staff members, employees, clientele, or patients.
We ask that you please DO NOT take/borrow/use content written by someone else and post it here. The Fix wants REAL reviews from your genuine involvement with treatment or therapy.
If you are the business owner or an authorized representative of THOMAS R. JONES, you may contact us to resolve problematic or false information, but we ask that you not write, copy, paste, or otherwise contribute promotional material about your own place of business (or the business that employs you).
If you live in California and have more details that might boost the quality of the information in our directory, you can contact us directly. |
by Peter Aaron
Fell and Whitman have been called two of contemporary electronic music’s most restless innovators. Fell focuses on computer-generated work and hails from the English city of Sheffield, a hub of electronic and industrial music in the 1970s and ’80s. Currently in residence at EMPAC, he’s developing a project that merges sound and dance. Based in Cambridge, Massachusetts, Whitman specializes in “truly live” analog mediums and has released dozens of full-length albums, singles, remixes, and compilation tracks.
Here’s footage of the duo at Cafe Oto in London last fall (a solo set by Thomas Ankersmit is first):
Mark Fell and Keith Fullerton Whitman will perform at EMPAC in Troy, New York, on February 21 at 8pm. Tickets to the performance are $18 ($13 students and seniors; $6 RPI students). For more information, call (518) 276-3921 or visit empac.rpi.edu. |
A dose of fetish. Good friends. An incomparable muse.
I am a people-watcher – especially at airports, bus and train stations. I wonder who the people flowing past are, where they are going, and why. I imagine all sorts of possibilities, scenarios. Depending on my mood, the answers can be whimsical, fantastical, “flash noir,” semi-autobiographical, ultra-real.
Imagine you are at a transportation hub. Observe the people around you, then weave a tale about your fellow travellers/”waiters”: chance encounter; flight of fancy; gritty realism; telepathic; intuitive; wildly speculative; possibilities/impossibilities. |
2 jobs - Page 1 of 1 (0.14 seconds)
Cape Town, Western Cape
- 9h ago
Job Description. A vacancy for a Civil Engineer within a leading international manufacturer of wind... foundations, structures and roads). Interested candidates can forward their comprehensive written...
- 10d ago
Good understanding of LAN Architecture & Cabling Topologies. to manufacturer accredited level... Qualifications. Matric. ITIL Foundations. A. Desirable Qualifications. Technical qualification (e.g... |
Seeds of Truth – Isaiah 58:11
The Lord will guide you always; he will satisfy your needs in a sun-scorched land
and will strengthen your frame. You will be like a well-watered garden,
like a spring whose waters never fail.
Isaiah 58:11, NIV (1984)
How does God guide you? How have you seen Him guide you in the past? How did He satisfy your needs when you were in a sun-scorched land? What did that “land” look like? How did He strengthen you as you went through it? How did you see God turn your life into a well-watered garden? How did He pour His water into your life and show you that He never fails?
How can you use this verse in your writing?
- What stories can you tell in a personal experience article? What anecdotes can you use as an introduction to a nonfiction article?
- What tips and insights can you offer in a how-to article?
- How can you use this verse in fiction?
- How can you use this verse in poetry?
- How can you use this verse in a devotion?
- Do you know someone who’s lived out this verse? Can you interview them? What kind of personality profile can you write on them?
- How can you use this verse in writing for children?
- How can you apply this verse to marriage issues, parenting issues, financial issues, emotional health, spiritual health, physical health, work issues, relationship and family issues, singleness, senior issues, etc.
Posted on August 21, 2013, in Bible, emotional health, family relationships, fiction, health, inspiration, inspiring Bible verses, marriage, nonfiction, parenting, poetry, seniors, singleness, writer's life, writing, writing ideas, writing prompt and tagged children's stories, creativity, devotions, encouragement for writers, family, family relationships, fiction, fiction ideas, health issues, how-to articles, inspiration, nonfiction, parenting, personal experience pieces, personality profile, poetry, writing, writing for children, writing ideas. Bookmark the permalink. Leave a comment. |
Hi everyone! My next posts are going to focus largely on some of the things I have observed and find atypical or quite different when I compare the student life at Olemiss with that in Potsdam, Germany.
One of the things I observed almost on arrival is to be prepared to take cash around: Here in Germany, most payments are made by cash. Unlike in the US where you would pay for almost anything with a debit/credit card, it is quite the opposite here in Germany.
Displayed price of products in German shops, supermarkets and restaurants is “ final”, as it includes the net cost. Unlike in the US where the displayed costs of products do not include taxes, the opposite is the case in Germany. Someone actually told me Germans MAY feel cheated if the displayed price differs from the amount they have to pay at the counter/ on check-out.
The German “Pünktlichkeit”. Another thing you are bound to experience is the German punctuality. When the train or bus is scheduled to arrive by 4:00PM, you will see it approach its stop by 3:59 and arrive at the exact time as scheduled; almost punctual to the nearest seconds. Of course, you get an update if there are any unforeseen delays.
If by chance you think you’ll need a personal means of transportation here in this part of Germany, that would be a bicycle. The streets and cities are so well connected with the trains, trams and buses. In Potsdam, I believe the max you have to walk to a nearest bus stop would be 10 minutes. You do not wait too long to catch your bus, train or tram. It is always recommendable to check the schedule and get to the stop on time. If you plan to go somewhere and all you have is the address, just google it and you will get a detailed connection of buses, trains and trams as well as an estimated arrival time to your location. In fact, you will be guided step by step by google maps till you get to your destination. In Germany, you absolutely need no private car to get around daily, including on weekends. In Oxford MS, bet you need a ride to go groceries shopping at Walmart or Kroger on a Sunday.
Be prepared to wonder why and what German describe as a “beautiful weather” if you visit Germany in the late Spring / Summer. Anything from 77 – 94 Fahrenheit is a “beautiful weather” to Germans. Of course, you may not understand why it is described as being beautiful if you are coming from Mississippi. You will learn to love warm weather the way Germans do, if you experience winter in Germany, or early Spring. I realised what beautiful weather was when I experienced low and high temperatures within a month of my arrival in Potsdam. Truly, a beautiful weather is a warm weather with the sun smiling at you, making you smile at others. I personally think the weather affects the mood of the people (Just my opinion).
If you get a SIM card here, it is usually going to be a pay-as-you-go SIM card. You buy airtime to call every time you want to. You do not have the luxury of unlimited calls/SMS as you normally would in the States. You do not have to use a post-paid SIM in Germany and pay monthly bills. I personally find this the pay-as-you-go SIM preferable to paying monthly fees/contracts.
All these are my personal observations. They are all perspectives of an exchange student from Ole Miss. I spoke with Sarah Kaschuba who studied in Fall 2015 at Ole Miss as a graduate exchange student in Sociology from the University of Potsdam and I learned from her perspectives about studying in the US as a German exchange student. Sarah is a great person. She had been a nice tour guide, advisor and friend.
I will continue the second part! This would include some other observations I have made as an exchange student in Germany which differ slightly or largely from the student-life at Olemiss.
Disclaimer: All these observations are purely subjective 🙂 |
Style: 39458104 Colour:
In our stretchy Signature Seamless ribbed fabric this top features a V-neckline and three-quarter length sleeves. The perfect layering cami! American made.
Really great top
Nice and tight, peeeerrrrrrfect length of sleeves. Wouldn't wear this with jeans, unless you want to show your tummy. I plan to wear this with my high waisted skirts and pants to work though. Love the colour and the feel of the material, so will be purchasing more colours! This top is snug fitting but still has a LOT of stretch! |
Performance/speed: Up to 95MB/s read speed; up to 90MB/s write speed
Card dimension: 0.94" x 1.25" x 0.08" (24 mm x 32 mm x 2.1 mm)
Operating temperature: -13oF to 185oF (-25oC to 85 oC)
Storage temperature: -40oF to 185oF (-40oC to 85oC)
Compatibility: For SDXC (128GB-512GB) cards: Compatible with SDXC and SDXC-I (UHS-I) enabled host devices.
Security: Built-in write-protect switch prevents accidental data loss
Applications: Store a variety of digital formats, including Raw and JPEG photos, Full HD videos, music and more
Added Protection: 1 year downloadable RescuePro® data recovery software offer, for bringing accidentally deleted images back to life |
Web Components – the future
You should first ground yourself on Web Components and read this article on Web Components and concepts, ShadowDOM, imports, templates, custom elements by Todd Motto.
Once you have read/listened you will have some idea and concept about Web Components and how they are the future…..
But what I wanted to show briefly was how to enable the ShadowDOM in Chrome and what that can do for you in a cool kinda way.
If you create a simple <input type=”number”> field on an HTML5 page you will now get a “Number Picker” which is more than just an Input field
And if you look at that through the web explorer (F12) you will see the HTML Markup for that
Within the Web Dev Tools for Chrome you can click on the settings button and within there under General “Show user agent shadow DOM”
And then if we look at our Number field again you will see it is actually marked up HTML which we did not see before.
Cool eh 🙂 |
Mumbai is not simply the funds yet likewise commercial and enjoyment sources of India. New Properties in Mumbai price will definitely be within the budget & meet the wishes of all the people layout domestic centers. Your Mumbai building tasks occur to be the greatest market of appeal as a result of the truth in the looked after develop up, hardly any interest rates in financial institutions, reduced rewards after common money, in addition to the varying stock industries. Residential Property In Mumbai is one of numerous promptly are widening company along with property creating communities throughout India. Future homes in Mumbai causing the leading with the unscathed large amount incongruities of wise determinate specific sources take care of from the carefully valued bedsitting part of fabricating to lush little area. A male is always searching for a best home. And also if you are a modern-day person after that, your front runner would be the multi loom high residential facilities.
A modern house is ending up being the important part of life. And there are lots of benefits of living into the property markets. And if the job is of Topmumbai after that you appear to have to the most effective sensations of living to them. The divine home is build up of different a number of factors. And the high domestic job is possibly the best looking as well as the best service giving residence, so that you can obtain the possibility of the best type of homes for you. Topmumbai Property which affect the exact same are still the very same, starting from the stock specific niche market rally to the excellent downpour to the stable management and also to a general preferable economic situation.
House in Mumbai is offering a chance to people to lead a most exceptional as well as marvelous way of life in addition to the houses. People are significantly thrilled to view the grand and also dynamic facilities there. Top Mumbai price is giving excellent services to people that include the best Italian flooring in the bedroom as well as cooking area. Insufficient Housing Projects In Mumbai will certainly offering exceptional possibilities to individualities to get among the most attractive as well as efficient domestic states as well as location of India. There are various kinds of promo have been taken place in addition to the separate styles as well as framework as well as will enthusiastically offering the satisfaction in addition to one of the most superior and also much better top qualities of the job. In the town of Mumbai we can discover several alternatives for your place of living. Mumbai is an integral part of the tire II cities of India. Among the entire variety of the cities we can find a number of choices of first class property facilities.
We could have the a number of choices of 1 BHK to general 4 BHK alternatives which can quench your crave one of the most stylish living likewise. The price range of Topmumbaiproperties depends on factors like location, amenities provided, dimension as well as buildings. Rate is also depending on the project design stages. New Projects Mumbai are now assisting bunches of individuals in addition to the far better top qualities of home that will absolutely be taken into consideration as the most remarkable eye-catching locations. Mumbai is primarily the place of amusement, life and delight and also have actually provided great possibilities to the people to get one of the most attractive as well as fantastic living design in this grand region. Nevertheless, currently the city has so much to provide that you can obtain lost in the choices.New Residential Apartments in Mumbai is being stood for as the terrific is high style living condos that has actually provided to people with prosperous as well as stylish roofing system that will give far better benefit to individuals with outstanding living specification. Topmumbai Properties is the considerable and also trendy promotions that have showcase the magnificence and also hesitant living that will gives better chances to people to get the lavish and also high class living benefits. Looking for upcoming homes in Mumbai has actually become actually extremely basic supplied the quantum of information provided online. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.