text
stringlengths
0
3.78M
subset
stringclasses
22 values
PATSY R. BRUMFIELD: Sandy’s victims can benefit from li’l ole us Late last week, as I talked to my lawyer son in Jackson, I joked that he should walk down the hall to a specific partner in his firm and speak these words to him: Wind or water? Of course, for anyone who was affected or even tangentially involved with insurance companies or living since Hurricane Katrina, this phrase is key to whether or how much storm victims can regain for their property damage. I jokingly suggested the law firm make plans fast to set up a Big Apple office to be staffed by all Mississippi’s attorneys with Katrina experience. My little “joke” came just days after the New England, New York and New Jersey coasts – and well inland were pummeled by Hurricane Sandy or her remnants. From the looks of the news photos and video footage, the storm’s devastation is tremendous, Katrina-like. Added to the vast shoreline destruction is the massive inland water damage. After Katrina, Mississippi’s inland damage was considerable, especially from the wind, but heavy rains did their share. While I might have been only slightly joking about the law firm and the “wind or water” question, I wasn’t kidding that Sandy’s victims and the affected communities and states are about to learn something we all learned seven years ago: Nobody was prepared to be adequately insured against its ravages. Rebuilding the Gulf Coast region lagged while local and state officials sought to figure out how best to do it. A chief issue was the realization that we could not rebuild as we were before Katrina. We had to be stronger and more able to weather the weather. What sense did it make just to rush back in, rebuild like before and then be swept away with the next tidal surge and 120-mph winds? But the price for smarter rebuilding still smarts for the Gulf Coast region. Building higher and stronger, if you’re allowed to rebuild at all, is very expensive. Securing new insurance sometimes is prohibitive. The good people of New England, New York and New Jersey are facing these same issues. They will want to rush back in and rebuild their lives as soon as possible. You can’t blame them for seeking normalcy as quickly as possible. But it shouldn’t be that simple. We learned that out of great difficulties.Our changing climate demands that we re-evaluate how we build almost anything from now on. How can it be stronger and how can we plan ahead to mitigate the new Mother Nature? No doubt, insurance companies and emergency management planners will demand it. Political officials will face the same difficult decisions up East as our Gulf Coast leaders did. The responses are not always politically popular. It’s good to see that emergency management teams from Mississippi are lending a hand there now. But what about the future? For once, we Southerners have something our brethren should solicit – sound advice borne out of the crucible of tragedy. We have stared into the face of the wind and water, and we have valuable experience to share. Let’s hope the leaders of Sandy’s millions of victims will ask for a hand, from us, for a change. Patsy R. Brumfield writes a Thursday column. Contact her at (662) 678-1596 or patsy.brumfield@journalinc.com. Follow her on Twitter @realnewsqueen.
Pile-CC
/** * ValueIterator.cpp * * Implementation of the value iterator * * @author Emiel Bruijntjes <emiel.bruijntjes@copernica.com> * @copyright 2014 Copernica BV */ #include "includes.h" /** * Set up namespace */ namespace Php { /** * Constructor * @param impl Implementation iterator */ ValueIterator::ValueIterator(ValueIteratorImpl *impl) : _impl(impl) {} /** * Copy constructor * @param that */ ValueIterator::ValueIterator(const ValueIterator &that) : _impl(that._impl->clone()) {} /** * Destructor */ ValueIterator::~ValueIterator() = default; /** * Increment position * @return ValueIterator */ ValueIterator &ValueIterator::operator++() { // increment implementation _impl->increment(); // done return *this; } /** * Decrement position * @return ValueIterator */ ValueIterator &ValueIterator::operator--() { // decrement implementation _impl->decrement(); // done return *this; } /** * Compare with other iterator * @param that * @return bool */ bool ValueIterator::operator==(const ValueIterator &that) const { return _impl->equals(that._impl.get()); } /** * Compare with other iterator * @param that * @return bool */ bool ValueIterator::operator!=(const ValueIterator &that) const { return !_impl->equals(that._impl.get()); } /** * Derefecence, this returns a std::pair with the current key and value * @return std::pair */ const std::pair<Value,Value> &ValueIterator::operator*() const { return _impl->current(); } /** * Dereference, this returns a std::pair with the current key and value * @return std::pair */ const std::pair<Value,Value> *ValueIterator::operator->() const { return &_impl->current(); } /** * End namespace */ }
Github
/* * reserved comment block * DO NOT REMOVE OR ALTER! */ /* * Licensed to the Apache Software Foundation (ASF) under one or more * contributor license agreements. See the NOTICE file distributed with * this work for additional information regarding copyright ownership. * The ASF licenses this file to You under the Apache License, Version 2.0 * (the "License"); you may not use this file except in compliance with * the License. You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package com.sun.org.apache.bcel.internal.classfile; import java.io.DataInput; import java.io.DataOutputStream; import java.io.IOException; import com.sun.org.apache.bcel.internal.Const; /** * This class is derived from the abstract {@link Constant} * and represents a reference to a String object. * * @version $Id$ * @see Constant */ public final class ConstantString extends Constant implements ConstantObject { private int string_index; // Identical to ConstantClass except for this name /** * Initialize from another object. */ public ConstantString(final ConstantString c) { this(c.getStringIndex()); } /** * Initialize instance from file data. * * @param file Input stream * @throws IOException */ ConstantString(final DataInput file) throws IOException { this(file.readUnsignedShort()); } /** * @param string_index Index of Constant_Utf8 in constant pool */ public ConstantString(final int string_index) { super(Const.CONSTANT_String); this.string_index = string_index; } /** * Called by objects that are traversing the nodes of the tree implicitely * defined by the contents of a Java class. I.e., the hierarchy of methods, * fields, attributes, etc. spawns a tree of objects. * * @param v Visitor object */ @Override public void accept( final Visitor v ) { v.visitConstantString(this); } /** * Dump constant field reference to file stream in binary format. * * @param file Output file stream * @throws IOException */ @Override public final void dump( final DataOutputStream file ) throws IOException { file.writeByte(super.getTag()); file.writeShort(string_index); } /** * @return Index in constant pool of the string (ConstantUtf8). */ public final int getStringIndex() { return string_index; } /** * @param string_index the index into the constant of the string value */ public final void setStringIndex( final int string_index ) { this.string_index = string_index; } /** * @return String representation. */ @Override public final String toString() { return super.toString() + "(string_index = " + string_index + ")"; } /** @return String object */ @Override public Object getConstantValue( final ConstantPool cp ) { final Constant c = cp.getConstant(string_index, Const.CONSTANT_Utf8); return ((ConstantUtf8) c).getBytes(); } /** @return dereferenced string */ public String getBytes( final ConstantPool cp ) { return (String) getConstantValue(cp); } }
Github
I've tried to change in the X-KeePass-1 1.21 rev [10] the language from English to German. To this end I started X-KeePass and went to View -> Change Language ... German and selected the language German. Then it worked flawlessly. But when I finished the program X-KeePass and I started it again, the English language was set. How can I solve this language problem? Hi dropper,I suppose that you are using the \English_users\X-KeePass-1.ini file, copied into the root folder, and also that you already downloaded the german.lng file fromm KeePass site and copying into \Bin\KeePass-1 folder (sorry for being so pedantic, is not for you, but to give a general method to all other users).The .ini file is localized in English and uses the KeeLanguage=Standard option. For let it work in German language, you have substantially two ways, both editing X-KeePass-1.ini file: The option (1) is preferred (by me ) because is more general and allows also other languages users to let X-KeePass-1 to be localized in their native language.Of course, changing the language from within KeePass, it asks to restart. DON'T RESTART, but close and rerun X-KeePass-1.exe.Please let me know if this fixes your problem.Best RegardsZioZione The solution, which you have described, is applied to the case, that I downloaded X-KeePass 1_1.21_rev10.zip and then extracted it into a self-selected folder (eg the folder named "X-KeePass"). In my case I use X-KeePass about the winPenPackNet_Full menu. Also I have downloaded from the website -Link- the current version of the file "German.lng". Then I have pasted this file "German.lng" in the folder D:\wpp_full_4.0-beta2\winPenPack\Bin\KeePass-1 (overwriting the existing file "German.lng"). Therefore, I would recommend that in the official version of X-KeePass-1 1.21 rev[10] already this current file "German.lng" is included. Then I went into the folder D:\wpp_full_4.0-beta2\winPenPack\XDrive\en and copied the file "X-KeePass-1.ini" and pasted it into the folder D:\wpp_full_4.0-beta2\winPenPack\XDrive (overwriting the existing file "X-KeePass-1.ini"). Then I edited the file "X-KeePass 1.ini" according to your proposed variant 1.
Pile-CC
Supra, Inc. ''Supra Corporation were best known as manufacturers of modems for personal computers, but also produced a range of hardware for the Amiga and Atari ST, including hard drives, SCSI controllers, memory boards, and processor accelerators. They were purchased by Diamond Multimedia in 1995. Early history The company was founded by John Wiley and Alan Ackerman as Microbits Peripheral Products (MPP), a provider of interface products for the Atari 8-bit family. The two of them were friends in high school when they developed various computer hardware for the school computers, and were best known for a 300 baud modem and a printer interface. The company was successful for some time, but a number of factors led to its bankruptcy around 1986, and its reformation as Supra, initially selling hard drives for the Atari ST. Originally from Albany, Oregon, they later moved to Vancouver, Washington. SupraFAXModem 14400 In 1991 the company arranged a deal with Rockwell International to use their new V.32bix 14,400 bit/s modem chips with an exclusivity arrangement. Their SupraFAXModem 14400 was sold at prices points about half that of the slower 9600 V.32 models of the same era, and its introduction led to a rapid downward spiral in modem pricing. Notable Dates 1986 - Supra introduces a 10 MB hard drive for the Atari ST. 1991 - Supra introduces the SupraFAXModem 14400 at $399 and the SupraFAXModem V.32 at $299. 1994 - Supra purchases PSI Integration 1994 - Supra ships First 28.8 Modem 1994 - Supra ships First Voice Modem 1995 - Supra purchased by Diamond Multimedia 1999 - S3 Graphics purchases Diamond Multimedia Products Supra Modems Supra Voice Modems Software FAXCilitate Supra VoiceMail References External links List of Supra products for the Amiga Category:Defunct computer hardware companies Category:Companies based in Albany, Oregon
Wikipedia (en)
Traffic on National Road in the AM and PM peak periods caused queuing adjacent to the signalized intersections. LJB's design included a 400' long northbound right turn lane on Grange Hall Road to Colonel Glenn Highway, extending the second northbound thru lane on National Road north of Colonel Glenn Highway, moving the signal pole at the southwest corner of the Colonel Glenn Highway intersection to install the right turn lane, extending the sidewalk on the east side of National Road, and milling and resurfacing of the entire length of the project, as well as installing curb, gutter and storm sewer. A maintenance of traffic scheme that included closure and detour of one direction of traffic was implemented to limit costly temporary pavement and permanent right-of-way needs. The typical section for this improvement was studied to minimize any reconstruction with a future phase of improvements to Grange Hall and National Roads. Because of the corridor's close proximity to WPAFB, LJB's design was careful to avoid their perimeter fence while also navigating the process by which an easement from the base could be secured for the roadway widening required.
Pile-CC
Evaluation of a single injection of 99mTc-labeled diethylenetriaminepentaacetic acid for measuring glomerular filtration rate in horses. Glomerular filtration rate (GFR) was measured in 12 clinically normal horses, using the standard inulin clearance method, and values were compared with values for 2 methods, using a single rapid IV injection of 99mTc-labeled diethylenetriaminepentaacetic acid (99mTc-DTPA). The first 99mTc-DTPA method used a 2-compartment model to calculate GFR blood clearance of the tracer. The second method used sequential digital gamma camera images of the kidneys to determine fractional accumulation of the total dose of the tracer in the kidneys (percentage of injected dose, gamma camera) from 0 to 10 minutes after radionuclide administration. Linear correlation among the 3 methods was determined. Mean (+/- SD) GFR, using the inulin clearance method, was 154.67 +/- 42.28 ml/min/100 kg of body weight. Mean GFR, using the 2-compartment blood clearance curve, was 146.92 +/- 27.49 ml/min/100 kg. Mean GFR, using percentage of injected dose (gamma camera method) was 154.7 +/- 22.00 ml/min/100 kg. The percentage of injected dose (gamma camera method) did not correlate significantly to the inulin clearance results. However, a significant (r = 0.666, P less than 0.018) correlation was observed between the inulin method and the 99mTc-DTPA blood clearance method. Significant (P less than 0.0001) difference also was observed in the split function of the equine kidneys, with GFR of the right kidney contributing 60.1 +/- 9.12% of the total function, as determined by 99mTc-DTPA gamma camera imaging. Because the 99mTc-DTPA blood clearance method does not require urine collection, it may be a more practical procedure to measure GFR in the horse.
PubMed Abstracts
This invention relates to a method for the prevention and treatment of eye inflammation due to exposure to an irritant. It has long been known that eye irritation and inflammation can occur from exposure to a wide variety of chemical irritants, e.g., smog, building fires, tobacco smoke and industrial chemicals. More recently, contact lenses have become a major source of such eye irritation and inflammation. There are several non-prescription products marketed today to treat such eye ailments. However, some patients are sensitive to the chemicals in them, some do not respond thereto and none are reliably effective in preventing the irritation which often is associated with wearing contact lenses. The prescription drugs, such as antibiotics and steroidal anti-inflammatory agents, while generally more effective have their own disadvantages. There therefore is a long standing need for safe and effective opthalmic anti-inflammatory agent for treating eye irritation, especially that associated with contact lens use. There is also a need for a non-toxic, non-allergenic bacteriostat and fungistat which is also effective in promoting the normal healing of the surface of the eye by suppressing infection and/or the natural inflammatory process. The present invention meets those needs. The compositions employed in this invention comprise biphenamine (.beta.-diethylaminoethyl 3-phenyl-2-hydroxybenzoate), either as the free base or a pharmaceutically acceptable acid addition salt thereof. Salts of this compound are known to have a variety of activities, including local anesthetic (U.S. Pat. No. 1,976,922); treatment of seborrhea capitis in a shampoo (U.S. Pat. No. 3,123,531); as well as antihistaminic and bactericidal activity and fungicidal properties (U.S. Pat. No. 2,593,350; Report Annual Meeting So. Med. Assoc., Nov. 6, 1961). Biphenamine hydrochloride has been sold as a 1% ointment, under the trademark "Melsaphine," as a topical anesthetic agent possessing bactericidal, fungicidal and antihistamine properties and as a 1% aqueous shampoo under the trademark "Alvinine," Federal Register, Vol. 34, No. 189, page 153, Oct. 2, 1969. See also U.S. Pat. No. 3,123,531. Although its use in a shampoo for treating seborrhea and related conditions is claimed in U.S. Pat. No. 3,123,531, nothing was known concerning its ability to prevent or ameliorate inflammation in eyes which are exposed to an irritant. The topical compositions employed in the method of this invention preferably also comprise a small amount of a skin penetrant, e.g., DMSO (dimethyl sulfoxide) or polypropylene glycol, which has no anti-inflammatory effects in the eye at the concentration employed. U.S. Pat. No. 3,551,554 and 3,711,602 disclose that DMSO is effective as an agent for enhancing tissue penetration of physiologically active agents. U.S. Pat. No. 3,549,770 discloses (Example 36) the topical application of a mixture of acetylsalicylic acid and DMSO is more effective than DMSO alone to relieve the pain and muscle spasm of rheumatoid spondylitis. See also U.S. Pat. Nos. 3,711,602; 3,711,606; and 3,743,727 and references cited therein. These patents disclose that the tissue penetration of physiologically active compounds, inter alia, steroidal agents and certain antimicrobial agents, can be enhanced by DMSO. U.S. Pat. No. 3,740,420 discloses DMSO compositions for topical administration containing thickening agents. The foregoing patents disclose that concentrations of DMSO of 10% by weight and above can effect penetration of such agents through various mucous membrane barriers and that concentrations of 50% by weight and above are effective to achieve penetration thereof through the skin. DMSO is also known to enhance the antiperspirant activity astringent of aluminum, zinc and zirconium salts (U.S. Pat. No. 3,499,961). DMSO has been disclosed as useful for treating a variety of pathological conditions. U.S. Pat. No. 3,549,770 discloses topical application as a particularly advantageous route. This patent claims methods of relieving the signs and symptoms of tissue inflammation; of vascular insufficiency in the blood and lymph circulatory system; of respiratory distress; of arthritis and a method of promoting tissue repair, by administering an effective amount of DMSO, preferably topically. Dosages as low as 0.01 g/kg and up to 1.0 g/kg per day and sometimes higher dosages are contemplated with 0.1-0.2 g/kg individual doses being average. Higher concentrations of DMSO, such as at least 25% and more often at least about 50% are preferred for topical application. In one example (Example 27) the pain associated with skin abrasion was relieved with 15% DMSO in isotonic saline. 10% to 90% water solutions of DMSO, preferably 20% to 40%, in water, alcohol or glycerine are useful for topical application to the mucous membranes of the body although " . . . lower concentrations of DMSO say down to 3% by weight may be useful in some instances." The use of DMSO as an ataratic agent is disclosed in U.S. Pat. No. 3,790,682. Pharmaceutical compositions containing DMSO and thickening agents are disclosed in U.S. Pat. No. 3,740,420, along with their use to treat and repair damaged tissue, as an anti-inflammatory agent, as an analgesic agent, as a muscle relaxant, as an agent for treating vascular insufficiency, and relieve the signs and symptoms of certain specific syndromes, viz., respiratory distress, arthritis and burns. None of the foregoing references disclose or suggest that the prevention and amelioration of eye inflammations can be achieved with low concentration of DMSO at concentrations below 10%, although U.S. Pat. No. 3,549,770 discloses (Col. 10, lines 42-49) that for pharyngitis or hiccups, the subject may gargle with a more dilute aqueous solution, e.g., containing 1% or preferably 10% by weight of DMSO, and (Col. 28, lines 44-56) that concentrations of DMSO down to 3% by weight may be useful in some instances, with 10% to 90% water solutions being particularly suitable. The use of DMSO in ophthalmic solutions at concentrations below 10% by weight is not suggested in the prior art. Moreover, low concentrations of DMSO or propylene glycol alone have little if any beneficial effect in treating eye inflammations.
USPTO Backgrounds
(CNN) Five CIA employees who improperly accessed data belonging to the Senate Select Committee on Intelligence will not face disciplinary measures as they "acted reasonable under the complex and unprecedented circumstances in investigating a potential security breach in the highly classified shared computer network," according to an agency accountability board. Chaired by former Sen. Evan Bayh, D-Indiana, alongside former Obama White House attorney Bob Bauer and three senior CIA officers, the board was convened in August 2014 by CIA Director John Brennan and tasked with investigating the misconduct and putting forward recommendations to ensure that "future instances of the miscommunication and confusion that led to this controversy" do not arise again. The unusually public dispute between the Senate and the CIA over access to classified information began last year when the Senate Intelligence Committee began preparing a report that exposed the CIA's controversial detention and interrogation programs. The CIA, in turn, accused Senate committee staffers of getting access to internal agency documents and improperly handling classified material, a charge the Justice Department determined was lacking evidence to warrant a further investigation. Read More
OpenWebText2
Q: Allow timers to fire when applicationDidEnterBackground I have read Apple's documentation and as many posts as I could here on the topic of how an app can run once it has been backgrounded. It seems that there are ways to get an application to complete some remaining tasks but not continue to run indefinitely in the background. My app has timers set to go off so audio clips can be played to the user. What happens is once the app is backgrounded the clips are not played. I know this can be done somehow as I have run a couple apps like what I am trying to do that are handling it. One example being: Nike+ GPS Are these apps just never calling endBackgroundTask? A: There are some scenarios where your App can run in the Background. Check: http://developer.apple.com/library/ios/#documentation/iphone/conceptual/iphoneosprogrammingguide/BackgroundExecution/BackgroundExecution.html audio. The application plays audible content to the user while in the background. (This includes streaming audio or video content using AirPlay.) location. The application keeps users informed of their location, even while running in the background. voip. The application provides the ability for the user to make phone calls using an Internet connection.
StackExchange
[Automatic sutures in bronchopulmonary surgery]. Efficacy of automatic staplers in broncho-pulmonary surgery was evaluated in a series of 316 consecutive patients. The results confirm that utilization of staplers has drastically reduced the incidence of post-resection bronchial fistulae; moreover on parenchymal tissue such instruments guarantee excellent haemostasis and air tightness. On the contrary, indications for their use on pulmonary vessels seem to be very limited.
PubMed Abstracts
Seattle's bid for the Kings reportedly is favored by Owner the Maloof family NBA Kings Owner the Maloof family is weighing "competing offers" for the team and on Thursday said that they "want to press ahead with the deal they've made with investors from Seattle," according to Lillis, Kasler & Bizjak of the SACRAMENTO BEE. A source said that the statement is the "strongest indication yet that the Maloofs favor the Seattle deal over a backup offer from investors trying to keep the team in Sacramento." The NBA BOG finishes its meeting Friday, but is not expected to vote on the Kings' fate "for at least two more weeks." Meanwhile, it remained "unclear whether the Maloofs would sell to Sacramento's bidders if the Seattle deal is vetoed." Disagreements have "developed between the Maloofs and the Sacramento group," led by Warriors Vice Chair Vivek Ranadivé, "over some of the terms of Ranadive's backup offer." A source said that Sacramento's counteroffer to Seattle hedge fund manager Chris Hansen's recent offer "calls on the Maloofs to scrap the Hansen deal before it comes to a vote." The source said that another possible "sticking point is that Sacramento's bid isn't a binding offer." Meanwhile, Warriors co-Owner Joe Lacob on Thursday said that he "encouraged Ranadive to pursue the Kings." Lacob: "I wish him the best." Asked if it would help the Warriors financially to have the Kings leave Northern California, Lacob said, "I don't think we look at it that way. I don't think that's an issue" (SACRAMENTO BEE, 4/19). INSIDE THE MEETING: In Seattle, Bob Condotta writes "much work still remains" to be done. Pelicans Owner Tom Benson on Thursday said that the BOG is just now "getting into the meat and coconuts" of the Kings issue. The BOG is "scheduled to meet again Friday morning and afternoon, after which NBA commissioner David Stern is expected to meet formally with the media." The BOG on Thursday "met for about six hours and concluded" around 9:00pm ET. There was "undeniably little talking publicly about what may have been said, however, as owners and other officials emerged from the meetings here at the St. Regis Hotel in midtown Manhattan decidedly tight-lipped." Trail Blazers BOD member Peter McLoughlin, who was filling at the meeting for Owner Paul Allen, said, "It's very confidential at this point." Kings co-Owner George Maloof "tried to sneak out a hotel side door," but ended up speaking to reporters. Maloof "revealed little other than that the family hoped 'to get it over with at some point' and that he expects the decision to come in May." Several owners on Thursday reiterated that expansion is "not being discussed" (SEATTLE TIMES, 4/19). GOING GLOBAL: In Sacramento, Joe Davidson writes much like former NBAer Yao Ming "helped increase the NBA's popularity in his native China last decade, imagine what the league could do in India should Ranadive and his group gain NBA ownership approval." At halftime of Wednesday's season finale, Sacramento Mayor Kevin Johnson "beamed during a private moment and talked about the untapped frontier that is India." The NBA already "has an office in Mumbai with six employees marketing the league" (SACRAMENTO BEE, 4/19).
Pile-CC
Optoelectrofluidic sandwich immunoassays for detection of human tumor marker using surface-enhanced Raman scattering. A sandwich immunoassay is a powerful tool for identifying a specific substance in a biological sample. However, its heterogeneous strategy always requires repetitive liquid handlings and long processing time. Here an optoelectrofluidic immunoassay platform for simple, fast, and automated detection of human tumor marker based on surface-enhanced Raman scattering (SERS) has been developed. By using a conventional optoelectrofluidic device and a liquid crystal display module, simple and quantitative detection of human tumor marker, alpha-fetoprotein, in a ∼500 nL sample droplet has been automatically conducted with lower detection limit of about 0.1 ng/mL within 5 min. This study depicts the first practical application, for protein detection, of the optoelectrofluidic manipulation technology. This image-driven immunoassay platform opens a new way for simple, fast, automated, and highly sensitive detection of antigens.
PubMed Abstracts
Story highlights Children who experiment with gender conventions and cross-dress make adults nervous A child who does not conform to gender norms does not mean he/she is transgender 1 out of 10 kids may show gender nonconforming behavior When a boy struts in a tutu or a girl dons boxer shorts, it makes grown-ups nervous. It's one of the first lessons kids who are gender nonconforming learn. Mich is biologically female, but didn't identify as a girl. As a child, Mich insisted on having boy-cut short hair, shunned all things pink and refused to play with dolls or wear dresses. At age 3, "I told my mom I wanted to be a boy," said Mich, who requested to be identified by first name only. "And, throughout the years, I learned that saying that was not right ... and so, you hide this part of yourself. But you still know something's up. The problem with kids is that they don't have the language to say it, but they know." The pressure to be more girly came from Mich's parents and other adults, rather than school bullies, said Mich, who now is 25 and lives in the Bay Area. "The messages from adults, especially my parents, were this was not how it was supposed to be," Mich said. "I don't think it was subtle. I would cut my hair really short and my mom would say, 'Why do you look like a boy? You can't be a boy.' An adult would say, 'Why aren't you in a dress?' They're pushing this message on you." When teenagers and children reject conforming to their biological gender roles, they are often teased, misunderstood or scorned by both peers and adults. A study published in Pediatrics this month showed that children who do not conform to gender roles are more likely to be abused, increasing the likelihood they will have post-traumatic stress disorder by the time they're in their 20s. Gender nonconformity means that an individual tends to associate with roles, behaviors and activities of the opposite gender, rather than those of his or her biological sex. This could be a boy who grows his hair long or paints his nails, or a girl who only wears male clothing. These issues are often confused with transgender identity , but they are not the same thing. Gender nonconforming behavior occurs in one out of 10 children, according to the study. A vast majority of these kids do not need medical interventions, because the behavior tends to fade as they grow older. JUST WATCHED Boy wants to be a Girl Scout Replay More Videos ... MUST WATCH Boy wants to be a Girl Scout 02:04 JUST WATCHED Transgendered woman tells her story Replay More Videos ... MUST WATCH Transgendered woman tells her story 02:58 JUST WATCHED Tammy and Mario: Gender journeys Replay More Videos ... MUST WATCH Tammy and Mario: Gender journeys 05:35 JUST WATCHED Proud to be 'Born This Way' Replay More Videos ... MUST WATCH Proud to be 'Born This Way' 00:59 In the study published Monday, nearly 9,000 respondents were asked to recall their childhood experiences before age 11, including favorite toys, games, roles they took while playing, media characters they imitated or admired, and feelings of femininity and masculinity. When they reached adulthood, the participants were surveyed again -- this time about whether they experienced physical, sexual, or emotional abuse and were screened for PTSD. The results showed "very clear patterns," said S. Bryn Austin, one of the study's authors. "The young people who as children were most nonconforming were much more likely to report mistreatment or abuse, within the family, by people outside the family. They were targeted for abuse." There should be extra precautions taken to protect them, she said. "We are concerned about the health and risk of abuse and harassment targeting children who behave in a way, or express their gender in a way that's not typical," said Austin, an associate professor of pediatrics at the Children's Hospital Boston and Harvard School of Public Health. "We know there's a lot of bias about how girls and boys are supposed to behave." Gender nonconformity tends to diminish as kids get older. And in many cases, kids with these tendencies grow up to be gay or lesbian, experts say. "A lot of children seem to be experimenting with cross-gender behavior, but very few are following through to request gender change as they mature," wrote Dr. Walter Meyer III, a pediatric psychiatrist at the University of Texas Medical Branch in Galveston, Texas, in a separate commentary published in Pediatrics. Mich, who wanted to be a boy during childhood, does not want to become a man, having reached adulthood. Mich now identifies as gender neutral -- meaning neither female nor male. When children cross-dress, they toe the gender divide and challenge conventions, making their parents and adults very anxious. It's an issue that Diane Ehrensaft, director of mental health and founding member of the Child and Adolescent Gender Center and a clinical psychologist in the Bay Area, has dealt with for years. Ehrensaft raised a gender nonconforming son and wrote a book, "Gender Born, Gender Made," in which the cover shows a young boy with curly hair in a tutu. Her son, now an adult, identifies as gay. "I started seeing more and more children and families who just came to me around their child's gender nonconforming behaviors," Ehrensaft said in an interview with CNN.com at a health conference last year. "In the last five years, there has been an explosion in the number of children who are saying you guys have got it wrong. I'm not the gender you think I am." There are "princess boys" and girls who only wear boy clothes, and many others who express their gender identity in unconventional ways. Whether the behavior is a result of nature or nurture remains contested. Some in the field believe children can be brought out of their nonconforming behavior by immersing them in conventional gender roles. Gender nonconformity by itself does not indicate a mental health disorder, so doctors often take a wait-and-see approach when the behaviors appear in young or school-aged children. In rare cases, gender nonconformity in children can lead to gender identity disorder in adolescence, also known as gender dysphoria, a diagnosis that involves a disconnect between a patient's sex, which describes anatomy, and their gender, which involves identity. People with this condition feel distressed because their bodies don't match their gender identity in their minds. The adolescent form of the disorder is typically diagnosed in early puberty, said Dr. Scott Leibowitz, a child and adolescent psychiatrist at the Gender Management Services at the Children's Hospital Boston, the first gender identity clinic in North America. "The dilemma is the inability for anybody to accurately predict whether reported gender dysphoria in childhood persists in adolescence or not. In a majority of cases it does not," he said. In another study published in Pediatrics, authors found that 44% of teenagers with gender identity disorder had significant psychiatric history including self-mutilation and suicide attempts. In either case, signs of gender nonconformity in kids can cause confusion and isolation for families. Often parents are blamed for the kids' behavior. Two years after giving birth, Nicole Seguin realized that her daughter never behaved like a typical girl. Her daughter, Anneke, at age 2, seemed miserable in a dress and would rip or mess up the feminine clothes. "The first time I kind of remember taking off my dress and just chilling with the diaper," said Anneke, now 15. "I did not wear any clothes unless they were my Spiderman jammies. No dresses, nothing pink, nothing like that." Growing up, Anneke always had masculine interests -- soccer and hockey over tea parties and Barbies. One of the first words Anneke as a toddler uttered was "Hup Holland," a phrase used by Dutch soccer fans. When Seguin bought her daughter a dollhouse, Anneke shot toy cars off it. Anneke always wanted to play sports. For years, Anneke identified as "gender fluid" -- meaning not completely male or female. In December, Anneke became Cory, changing names and now preferring the male pronoun. Although identifying more as a male, Cory still considers himself "gender fluid." He likes chick flicks, watches "Glee" but also loves playing hockey. He plays on a nearly all-male hockey squad as goalie. Cory's case highlights the complexity involved in gender identity. Life outside the gender norms doesn't come easy. "I went through various stages of depression," he said. "The only reason why I'm here right now is because of all the support my family gave me."
OpenWebText2
Carly Telford Carly Mitchell Telford (born 7 July 1987) is an English footballer who plays as a goalkeeper for Chelsea and the England national team. Club career Telford joined Leeds United Ladies in 2007 from relegated club Sunderland. In May of that year she had turned out for Charlton Athletic in a tournament in Spain, but Charlton disbanded their women's team shortly afterwards. At Leeds, Telford was named player of the match in the 2008 FA Women's Cup final, after an impressive performance in Leeds' 4–1 defeat to Arsenal. In summer 2010, Telford was called into the England squad as an unattached player, having left Leeds Carnegie. Matt Beard signed her for Chelsea Ladies ahead of the inaugural 2011 FA WSL season. In October 2012 it was announced that Telford would join Australian club Perth Glory for the 2012–13 winter season. Telford left Chelsea after three years in December 2013, signing for Notts County ahead of the 2014 FA WSL season. There she was reunited with her former Leeds coach Rick Passmoor and she would have the opportunity to train with goalkeeper coach Kevin Pilkington. Chelsea coach Emma Hayes' decision to hand Telford a free transfer left her shocked and raging. Telford was carrying a shoulder injury ahead of the 2015 FA Women's Cup Final and Notts County were angry when The Football Association refused their request for dispensation to sign another goalkeeper. Telford recovered to play in the team's 1–0 defeat by Chelsea at Wembley Stadium. She signed a two-year extension to her contract in November 2015. In June 2016, Telford suffered torn ankle ligaments in a win over Doncaster Belles and was ruled out for three months. Notts County moved quickly to sign Lizzie Durack as a replacement. Notts County Ladies folded in April 2017. International career Telford made her senior international debut on 11 March 2007 as a substitute against Scotland, having previously played at U17, U19, U21 and U23 levels. In May 2009, Telford was one of the first 17 female players to be given central contracts by The Football Association. In May 2015, Mark Sampson named Telford in his final squad for the 2015 FIFA Women's World Cup, hosted in Canada. England eventually finished in third place, but Telford was disappointed to be the only member of the squad not to play any minutes at the tournament. In 2019, Telford was part of the England team that won the SheBelieves Cup in the United States, playing two of the three games against Brazil and Japan. Later that year, Telford was called up by Phil Neville to the 2019 World Cup squad. As part of England's social-media facing squad announcement, her name was announced by Sports Presenter Nicole Holliday. Having been included in England squads for the 2007 FIFA Women's World Cup, 2015 FIFA Women's World Cup and UEFA Women's Euro 2017 without getting to play, Telford finally got her first minutes at a major tournament on 14 June 2019, starting in England's second group game at the 2019 FIFA Women's World Cup against Argentina. Personal life Telford attended Tanfield School, then Gateshead College on the Talented Athlete Scholarship Scheme. Honours England FIFA Women's World Cup third place: 2015 SheBelieves Cup: 2019 References External links Carly Telford at the FA website Carly Telford Interview at the Keeper Portal Website Category:1987 births Category:Living people Category:English women's footballers Category:Leeds United L.F.C. players Category:Chelsea F.C. Women players Category:Sunderland A.F.C. Ladies players Category:England women's international footballers Category:FA Women's National League players Category:FA Women's Super League players Category:Notts County L.F.C. players Category:2007 FIFA Women's World Cup players Category:2015 FIFA Women's World Cup players Category:People from Tyne and Wear Category:Women's association football goalkeepers Category:England women's under-23 international footballers Category:2019 FIFA Women's World Cup players
Wikipedia (en)
Transrectal ultrasonotomography of the prostate. New equipment for transrectal ultrasonomography has been developed. Wth this equipment an excellent cross-section picture of various intrapelvic organs is easily obtained. Diagnostic application of the technique is particularly significant for abnormalities of the prostate because the shape of the prostate cannot be revealed by x-ray. Diagnostic criteria for prostatic disease are described, with the demonstration of typical cases. In a test by well trained physicians the diagnostic accuracy of the new technique was more than 80 per cent. Ultrasonotomography provided for precise measurement of prostatic size. Transrectal ultrasonotomography is a promising new diagnostic technique that yeilds abundant information not available with former methods of examination. The procedure is likely to become one of th most important diagnostic tools in the field of urology.
PubMed Abstracts
Cloudify Enterprise Cloudify Enterprise is designed to serve in mission-critical production environments. It is a fully supported product, with guaranteed support SLAs and a known product lifecycle. Read more about our product versions. Discover Life at Cloudify Why 70% of NFV and Digital Transformations Fail While many organizations are trying to undertake digital transformation initiatives, as many as 70% of these initiatives fail. Taking an agile integration approach versus a fork lifting approach, lowers the barrier to entry for organizations looking to truly transform their business. ONAP Network functions virtualization (AKA NFV) has been around for couple of years now, and I’ve recently seen a growing number of posts and articles that try to declare victory or failure of NFV, as well as point out some of the challenges behind NFV adoption. I would start by saying that there seems to be ONAP vs OSM – Who will win? A major topic of discussion in IT circles these days is about the best way to operate an efficient, scalable, and automated network infrastructure. One of the major challenges is being able to offer high availability services while remaining agile enough to swiftly deploy new services; ongoing operations Introduction Microsoft has grown its Azure offering by leaps and bounds, especially in the past year. In our previous blog post about our Azure and Azure Stack plugins, we pointed out that Microsoft’s cloud service is seen as a definite number two in public cloud, behind Amazon’s AWS, but is quickly gaining among large enterprises. Introduction The industry is pushing to make the access world simple with “Access as a service.” Today, each access vendor has its own implementation and many silos exist on dedicated hardware. The motivation is to introduce an access architecture which is open, that potentially runs on commodity servers and whitebox switches, and is based on 5G is already here. It was first deployed at really large scale at the Olympic Winter Games in Pyeongchang and it has proven to be a game changer. In the US, AT&T announced at the beginning of the year that their 5G rollouts will take place by the end of 2018, as have some others. One of the big talking points in the cloud networking world, and at the recent Mobile World Congress which has just concluded, is ONAP. This project is showing immense promise in bringing open, comprehensive network orchestration and automation to virtual network functions and physical devices. In fact, our partner ASOCS just announced their demonstration of VNF Onboarding is known to be one of the biggest challenges in the transformation to NFV transformation as noted in one of the recent SDxCentral report: VNF Migration challenges. Arguably the biggest challenge organizations will face when it comes time to operationalize VNFs is a lack of processes. Many IT organizations are in the throes We recently completed our webinar overviewing and introducing the ONAP project. As many of you might already know, ONAP is the Open Network Automation Platform, being built to manage the NFV networks of the future. With the recent addition of Verizon, ONAP now covers over 60% of total global mobile subscribers, and the future is This article originally appeared in SDxCentral on December 29, 2017. Once upon a time, standards were our friends. They provided industry accepted blueprints for building homogeneous infrastructures that were reliably interoperable. Company A could confidently build an application and—because of standards—know that it would perform as expected on infrastructure run by Company B. Standards have, In the beginning of 2016, the ARIA TOSCA project was announced. Since then, the project has made its way into the Apache Software Foundation and is currently in the incubation process. This follows the path of intent for ARIA, which was to create a completely open source and open governance TOSCA orchestration engine that was Archives Archives Cloudify was designed from the ground up on principles of openness to power the IT transformation revolution - enabling organizations to design, build and deliver core business applications and network services more economically, without compromising on security or IT simplicity
Pile-CC
Amperometric sensors based on Ni/Al and Co/Al layered double hydroxides modified electrode and their application for hydrogen peroxide detection. Two different hydrogen peroxide sensors were constructed with Ni/Al and Co/Al layered double hydroxides (LDHs) modified glassy carbon electrodes (GCE). Ni (Co)/Al-LDHs were synthesized by electrochemical method and were characterized by scanning electron microscopy (SEM) and energy dispersive spectrometry (EDS). The advantages and shortcoming of the two hydrogen peroxide sensors were described in detail. Compared to Co/Al-LDHs modified electrode, sensors fabricated by Ni/Al-LDHs showed quicker heterogeneous electron transfer rate constants (k(s)), lower detection and better reproducibility. But Co/Al-LDHs modified electrode held the advantages of wider linear range and higher sensitivity. Further more, the different catalytic redox mechanisms of hydrogen peroxide on the Ni/Al/GCE and Co/Al/GCE were firstly comparatively explored.
PubMed Abstracts
Gogi Bibimbap is a restaurant located in Richmond, Virginia at 9101 Midlothian Turnpike. They are open every day of the week. A party food, a dish loved by royals and commoners alike and shared by all - has been a traditional Korean dish of celebration for generations. Bibimbap holds a special place on the dinner table of families celebrating the last day of the year; in the warm, helping hands... Foo Dog is a restaurant located in Richmond, Virginia at 1537 West Main Street. They are open every day except Monday. Tuesday Nights are Tiger Tuesday! Buckets of Tiger Beer at a GREAT price! Thursday Night: Ladies Night 7pm till 9pm and then Trivia @ 9:30pm. Free Entry. Winners get Foo Dog Gift Cards! Sunday Funday means Happy Hour goes until 9 p.m. Asian Street food is about more than just... My Noodle & Bar is a restaurant located in Richmond, Virginia at 1600 Monument Avenue. They are open every day of the week. Up until 2013, I learned and worked beside my mom, one of the greatest teachers I'll ever know. I owe a lot of credit to her! She has supported my desire to be a part of... Kokonut Grill is a restaurant located in Richmond, Virginia at 1201 West Main Street. They are open every day of the week. Kokonut Grill Fast Casual Restaurant offering Take out Eat in Flavorful and affordable Fresh Cooked to Order Asian Fusion, Hawaiian, Malaysian, Island Pacific food and Halal.... Umi Sushi Bistro is a restaurant located in Richmond, Virginia at 11645 West Broad Street. They are open every day except Sunday. Umi Sushi Bistro, best sushi in Richmond Virginia. (Maryland crab, spicy tuna, caviar, avocado, crunchy).Umi Sushi Bistro, best sushi in Richmond Virginia. LEVEL Restaurant & Bar is a restaurant located in Richmond, Virginia at 2007 West Broad Street. They are open every day except Monday. Learn more about Level Restaurant & Bar located in Richmond, VA. You can also view the menu and order online. Level Restaurant & Bar offers delicious dining and takeout to Richmond, VA. Level Restaurant & Bar is a cornerstone in the Richmond community and has... Hayashi Sushi & Grill is a restaurant located in Richmond, Virginia at 2160 John Rolfe Parkway. They are open every day of the week. We started Hayashi Sushi about 15 years ago, with the idea of a quality Hibachi and Sushi Restaurant. We are proud of our staff and chefs for all they put in to making each visit enjoyable and all our dishes tastefully prepared. When we opened our Newport News... Sticky Rice is a restaurant located in Richmond, Virginia at 2232 West Main Street. This restaurant serves tokyo burger, mongolian beef, miso soup, honey banana, osaka tuna, spinach or house salad, and teriyaki salad. They also serve shrimp coconut, tofu bites, sticky fruity, dirty vegan, edamame, chicken sesame, and wakame salad. They are open every day of the week. You’ll find that our... Little Asia is a restaurant located in Richmond, Virginia at 3991 Glenside Drive. They are open every day of the week. Mobile Users: Can’t see the menu very well? Try turning your phone to horizontally.Little Asia is a family-owned, fine-dining restaurant. Our unique culinary combination includes Chinese, Thai and Vietnamese, with a touch of Japanese influence. We offer excellent food for a...
Pile-CC
client dev tun proto tcp remote sg.mullvad.net 80 cipher AES-256-CBC resolv-retry infinite nobind persist-key persist-tun verb 3 remote-cert-tls server ping 10 ping-restart 60 sndbuf 524288 rcvbuf 524288 auth-user-pass /config/openvpn-credentials.txt ca /etc/openvpn/mullvad/ca.crt tun-ipv6 script-security 2 tls-cipher TLS-DHE-RSA-WITH-AES-256-GCM-SHA384:TLS-DHE-RSA-WITH-AES-256-CBC-SHA
Github
Q: C - Incompatible Pointer Type Why does the following code give warnings? int main(void) { struct {int x; int y;} test = {42, 1337}; struct {int x; int y;} *test_ptr = &test; } Results: warning: initialization from incompatible pointer type [-Wincompatible-pointer-types] struct {int x; int y;} *test_ptr = &test; ^ A: They're two anonymous structure types (they neither have a tag). All such structure types (in a single translation unit) are distinct — they're never the same type. Add a tag! The relevant sentence in the standard is in §6.7.2.1 Structure and union specifiers: ¶8 The presence of a struct-declaration-list in a struct-or-union-specifier declares a new type, within a translation unit. The struct-declaration-list refers to the material between { and } in the type. That means that in your code, there are two separate types, one for each struct { … }. The two types are separate; you cannot officially assign a value of one type to the other, nor create pointers, etc. In fact, you can't reference those types again after the semicolon. That means you could have: int main(void) { struct {int x; int y;} test = {42, 1337}, *tp = &test; struct {int x; int y;} result, *result_ptr; result_ptr = &result; … } Now test and tp refer to the same type (one a structure, one a pointer to the structure), and similarly result and result_ptr refer to the same type, and the initializations and assignments are fine, but the two types are different. It's not clear that you create a compound literal of either type — you'd have to write (struct {int x; int y;}){.y = 9, .x = 8}, but the presence of the struct-declaration-list means that is another new type. As noted in the comments, there is also section §6.2.7 Compatible type and composite type, which says: ¶1 … Moreover, two structure, union, or enumerated types declared in separate translation units are compatible if their tags and members satisfy the following requirements: If one is declared with a tag, the other shall be declared with the same tag. If both are completed anywhere within their respective translation units, then the following additional requirements apply: there shall be a one-to-one correspondence between their members such that each pair of corresponding members are declared with compatible types; if one member of the pair is declared with an alignment specifier, the other is declared with an equivalent alignment specifier; and if one member of the pair is declared with a name, the other is declared with the same name. For two structures, corresponding members shall be declared in the same order. For two structures or unions, corresponding bit-fields shall have the same widths. Roughly speaking, that says that if the definitions of the types in the two translation units (think 'source files' plus included headers) are the same, then they refer to the same type. Thank goodness for that! Otherwise, you couldn't have the standard I/O library working, amongst other minor details. A: Variables &test and test_ptr, which are anonymous structs, have different types. Anonymous structs defined in the same translation unit are never compatible types1 as the Standard doesn't define compatibility for two structure type definitions in the same translation unit. To have your code compile, you could do: struct {int x; int y;} test = {42, 1337} , *test_ptr; test_ptr = &test; 1 (Quoted from: ISO:IEC 9899:201X 6.2.7 Compatible type and composite type 1) Two types have compatible type if their types are the same. Additional rules for determining whether two types are compatible are described in 6.7.2 for type specifiers, in 6.7.3 for type qualifiers, and in 6.7.6 for declarators. Moreover, two structure, union, or enumerated types declared in separate translation units are compatible if their tags and members satisfy the following requirements: If one is declared with a tag, the other shall be declared with the same tag. If both are completed anywhere within their respective translation units, then the following additional requirements apply: there shall be a one-to-one correspondence between their members such that each pair of corresponding members are declared with compatible types; if one member of the pair is declared with an alignment specifier, the other is declared with an equivalent alignment specifier; and if one member of the pair is declared with a name, the other is declared with the same name. For two structures, corresponding members shall be declared in the same order. For two structures or unions, corresponding bit-fields shall have the same widths. For two enumerations, corresponding members shall have the same values.
StackExchange
// Copyright 2016 Google Inc. // // Licensed under the Apache License, Version 2.0 (the "License"); // you may not use this file except in compliance with the License. // You may obtain a copy of the License at // // http://www.apache.org/licenses/LICENSE-2.0 // // Unless required by applicable law or agreed to in writing, software // distributed under the License is distributed on an "AS IS" BASIS, // WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. // See the License for the specific language governing permissions and // limitations under the License. // //////////////////////////////////////////////////////////////////////////////// #include <stdint.h> #include "lcms2.h" // The main sink int LLVMFuzzerTestOneInput(const uint8_t *data, size_t size) { if (size == 0) return 0; cmsHANDLE handle = cmsIT8LoadFromMem(0, (void *)data, size); if (handle) cmsIT8Free(handle); return 0; }
Github
Wednesday, March 18, 2009 A member of the studio audience, Eneasz, made a specific comment on a recent post that I found generally interesting. Anon - if the truth is partisan, it is only because certain people identifying with a certain political party completely abandoned the truth. The facts are easily available for anyone to verify. Here is a basic axiom . . . truth is non-partisan. One way to look at it – natural disasters do not pay any attention to religious or political affiliation. A hurricane does not care about your party membership, nor does cancer care about the religious beliefs of the person it afflicts. We can try to ignore reality if it does not conform to our particular political or religious prejudices. However, reality always has the final say. I had a niece who thought that it was okay to smoke as long as she did not get caught. Her greatest concern was with avoiding punishment that would come if she was caught smoking. I sought to impress upon her that nobody needs to catch her smoking for her to be punished. "A parent can ground you and take away your phone privileges. However, you're going to be punished whether your parents find out or not. No parent worthy of the title will tell her child, 'I'll kill you if I catch you smoking,' but being killed is exactly the punishment you risk suffering if you continue." This fact points to the reason why truth and honesty are important . . . because reality will not yield to our personal delusions. It is a mark of insanity to hold that whether global warming science is valid or invalid depends on political affiliation. The world is going to suffer huge costs as a result of former President Bush’s disconnect from reality. However, the worst costs are yet to come. Future generations will not remember Bush as the President who brought about the financial crisis of the early 20th century, or the person who invaded Iraq without cause. They’re going to remember him as the President how ignored reality and, in doing so, set in motion a chain of events that explains why Miami is a set of underwater ruins that divers like to visit 40 miles off of the Florida coast. Pope Benedict is currently touring Africa, declaring that the way to fight AIDS and other forms of disease that are killing people by the millions in that nation – and wrecking its economies – is to promote abstinence. He is, at the same time, claiming that those who promote the use of condoms are making the problems worse. However, reality is going to ignore is religious prejudices. As a result of his actions, millions of people will get sick and die, and economies will continue to be wrecked, because reality is not going to yield to his ignorance. As a matter of fact, evolution has provided us with a strong inclination for sex. I know very little about the hundreds of thousands of generations that are my direct ancestors going back hundreds of millions of generations. But this much I do know. None of them (or, perhaps, by some freak accident maybe one or two of them) died a virgin. The economic ruin of Africa, and the death of millions of its inhabitants, will be the fruit of following the Pope’s advice on these matters. Reality will not yield to his religious delusions. It is not at all difficult to trace the bulk of human suffering today – the bulk of human suffering in the future – and even the potential destruction of the human race – to the simple fact that there is not a sufficient amount of appreciation for truth and facts. Too many people think that they can ignore reality without consequences, and too few people are willing to stand up and defend a culture of reason, truth, and honesty. And that could well be our undoing. What we do not know (or what we claim to know that simply is not true) cannot only hurt us - it kills and maims people every day. What we do not know (or what we claim to know that simply is not true) can wipe out the whole human race without the slightest twinge of conscience or concern. Reality is going to win in the end. You can choose to be on the same side, or you can choose to lose. You wrote:"It is a mark of insanity to hold that whether global warming science is valid or invalid depends on political affiliation. The world is going to suffer huge costs as a result of former President Bush’s disconnect from reality. However, the worst costs are yet to come. Future generations will not remember Bush as the President who brought about the financial crisis of the early 20th century, or the person who invaded Iraq without cause. They’re going to remember him as the President how ignored reality and, in doing so, set in motion a chain of events that explains why Miami is a set of underwater ruins that divers like to visit 40 miles off of the Florida coast." Truth, according to reference sources, is the coformity with fact or reality. Also a verifiable and irrefutable fact. Reality is something that exists (factually) independent of opinion about it. While I agree that choosing a position on global warming science based on political ideology is "insane", it is simply an opinion and does not rise to the standard of truth nor reality. The very same thing applies to your judgment of President Bush since future generations do not exist and therefore cannot be remembering anything at this time, the entire narrative is neither truth nor reality. I believe that you mean to intimate that "if all things remain equal", much as economists qualify their prognostications, that yours will become fact or reality. However, at this time they are neither and no better (or worse) than any other opinion on the matter. In fact, my opinion is that your opinion is like the rectum - everybody has one. About Me When I was in high school, I decided that I wanted to leave the world better off than it would have been if I had not existed. This started a quest, through 12 years of college and on to today, to try to discover what a "better" world consists of. I have written a book describing that journey that you can find on my website. In this blog, I will keep track of the issues I have confronted since then.
Pile-CC
Here is the complimentary Rep thread for those of us who have been stressed as fook for the last month or so, because of our season so far... Shout out some excitement, and we will share some rep. Blatant whoring, need not apply! :p Demonpenz 10-05-2004, 12:20 AM and the home of the......................CHIEFS arrowheadrocks 10-05-2004, 12:20 AM ahhh rep whoring.... J Diddy 10-05-2004, 12:21 AM are you an amway rep....rep David. 10-05-2004, 12:21 AM countdown until ArrowheadWolf posts.. :) ROFL Demonpenz 10-05-2004, 12:22 AM start printing playoff tickets David. 10-05-2004, 12:23 AM hmm Ali didn't say POS rep. :hmmm: |Zach| 10-05-2004, 12:23 AM I am not really into making a thread dedicated to rep. BUT I AM DOWN WITH THE CHIEFS WINNING HELLYA papasmurf 10-05-2004, 12:23 AM this game was in the bag. Hammock Parties 10-05-2004, 12:23 AM The Chiefs came ridin inta' Baltimore one dark and stormy day They stomped a mudhole in Jamal and bitchslapped old Ray-Ray We pwned the Ravens in their house and made Billick our bitch And Johnnie Morton made a catch....five yards on a quick hiiiiitch. greg63 10-05-2004, 12:25 AM I'm just glad they finally put one in the win column. My only real critizism is of the Special Teams play, and why we can't get a decent kicker. arrowheadrocks 10-05-2004, 12:25 AM Love the new pic in the sig line, JBret! tommykat 10-05-2004, 12:25 AM Defense rocked............Green really gave his heart running and being hit to try to make the 1st down. and Ray was whining "There's always 2 of them on me coach! Someones not doing their job!" HolmeZz 10-05-2004, 12:27 AM Very relieved. I got more out of this win than I thought we would. We only won by 3, but we dominated the best defense in the game and held one of the best backs in the league to under 75 yards. Oh yeah, and we beat a playoff-contender in their house on Monday Night. Huge, and very proud to be a Chief fan tonight. A bit disappointed that the D won't get the praise it should though. People will see 24 points in the column for Baltimore and think our defense played like it always does. Not true at all. arrowheadrocks 10-05-2004, 12:28 AM and Ray was whining "There's always 2 of them on me coach! Someones not doing their job!" Did you catch the highlights on ESPN showing all the one man match up he was gettin owned on?? Classic! ArrowheadHawk 10-05-2004, 12:29 AM thank god we are not 0-4 and for at least one game it looked like we could play some d Ari Chi3fs 10-05-2004, 12:30 AM Very relieved. I got more out of this win than I thought we would. We only won by 3, but we dominated the best defense in the game and held one of the best backs in the league to under 75 yards. Oh yeah, and we beat a playoff-contender in their house on Monday Night. Huge, and very proud to be a Chief fan tonight. A bit disappointed that the D won't get the praise it should though. People will see 24 points in the column for Baltimore and think our defense played like it always does. Not true at all. D gave up 17... ST gave up 7...that Flea Flicker crap...does that even count? arrowheadrocks 10-05-2004, 12:30 AM Thanks to Trent and Priest my FFL team was redeemed this week. Life is good arrowheadrocks 10-05-2004, 12:32 AM D gave up 17... ST gave up 7...that Flea Flicker crap...does that even count? Or the 7pts the refs handed them on a silver platter on that 3rd down PI?? Frankie 10-05-2004, 12:33 AM WE ARE BACK ON THE MAP!!! :thumb: PBJ PBJ PBJ PBJ :thumb: HolmeZz 10-05-2004, 12:34 AM D gave up 17... ST gave up 7...that Flea Flicker crap...does that even count? I know. But you still see 24 points for the Ravens. We only gave up 13, IMO. The PI call on Dexter is ridiculous. Baltimore would've kicked the FG there. And what you don't see in the box score is field position. We buried our defense with bad field position all night. Our special teams has been the reasons teams have put up the numbers they have. Can't expect to keep forcing punts when teams get the ball at midfield every drive. Frankie 10-05-2004, 01:44 AM To the rest of AFC West: Objects in your rear view mirror are closer than they appear. |Zach| 10-05-2004, 01:48 AM To the rest of AFC West: Objects in your rear view mirror are closer than they appear. Niiiiice And I really loved it when one of BAL's O-lineman knocked Boller down. That was a classic. Ultra Peanut 10-05-2004, 02:14 AM damn, i just repped Gochiefs... I feel dirty.I thought you said "raped." Ari Chi3fs 10-05-2004, 02:15 AM I thought you said "raped." shhhhhh... Ultra Peanut 10-05-2004, 02:18 AM Hey. Loosen up, Sport. Cigarettes, booze, and strippers are where it's at. Let's tear off a piece while we can. That's what I'm talking about. Ari Chi3fs 10-05-2004, 02:23 AM Im coming to Memphis to party. alanm 10-05-2004, 02:24 AM I know. But you still see 24 points for the Ravens. We only gave up 13, IMO. The PI call on Dexter is ridiculous. Baltimore would've kicked the FG there. And what you don't see in the box score is field position. We buried our defense with bad field position all night. Our special teams has been the reasons teams have put up the numbers they have. Can't expect to keep forcing punts when teams get the ball at midfield every drive.Your more correct than you know concerning the special teams. They have been absolutely putrid so far this year. I know they miss Bo terribly but damn.... Some guys just have to be able to tackle. And Baker... Well, I don't even want to go there. When is Cheeks due back? Special teams have contributed more to the 3 losses then the media has let on.:banghead: tk13 10-05-2004, 02:28 AM Bo is a big loss on ST... but don't forget Bartee... he always seems to be around the ball in coverage. ChiefFripp 10-05-2004, 02:46 AM Rep the pain away! Fairplay 10-05-2004, 03:40 AM Damn that win felt good! Mark M 10-05-2004, 06:58 AM Bo is a big loss on ST... but don't forget Bartee... he always seems to be around the ball in coverage. Exactly. The coverage units are missing some much needed speed right now -- Bo is hurt, Bartee has been banged up, and Biesel doesn't play on the coverage unit anymore. Those three guys have been huge on STs the last few years, and are no longer in there. I did, however, see LJ out there during the 4th qtr. Not sure if he was playing the whole game or not. IMHO, that would be the best way to show his teammates that he's not a crybaby putz -- play some STs and make some plays. MM ~~:arrow: KingPriest2 10-05-2004, 07:14 AM That was a great game we just need to keep it going. Dave Lane 10-05-2004, 07:17 AM Count me in on rep fest 1-3. I'll take all I can get or 9 more Chiefs victories. Dave the Talking Can 10-05-2004, 07:22 AM THE SUPERBOWL BUS IS BEING BUILT RIGHT NOW IN A FACTORY IN KOREA, WE'RE ON OUR WAY BABY!! ALL THE KOREANS IN THE HOUSE SAY "HELL YEAH!!" Ari Chi3fs 10-05-2004, 07:23 AM heh. Im repped out for a few hours apparently... so all of the other rep recipients need to share the love...
Pile-CC
205 F.Supp.2d 1358 (2000) MANDY S., by and through her mother and next friend SANDY F., Plaintiff, v. FULTON COUNTY SCHOOL DISTRICT, Defendant. No. CIV.A.1:99-CV-676GET. United States District Court, N.D. Georgia, Atlanta Division. August 30, 2000. *1359 Torin Dana Togut, Office of Torin D. Togut, Roswell, GA, for plaintiffs. *1360 Thomas Alan Cox, Alexa Roberta Ross, Allegra J. Lawrence, Sutherland, Asbill & Brennan, Atlanta, GA, for defendant. ORDER G. ERNEST TIDWELL, District Judge. The above-styled matter is presently before the court on: (1) Plaintiff's motion for summary judgment [docket no. 21]; (2) Defendant's motion for final judgment [docket nos.22, 23]. Procedural History On May 19, 1998, Mandy S. ("Mandy") requested a due process hearing against Fulton County School District ("School District") that alleged, inter alia, that the School District violated Mandy's substantive and procedural rights to receive a free appropriate public education ("FAPE") for the 1991-92 through 1997-98 school years and that she was entitled to compensatory education and reimbursement of private educational expenses for those school years. Mandy was a twenty-one year old adult at the time. An administrative due process hearing was held on August 17, 18, September 23, 24, 25, and November 4, 1998. On February 12, 1999, the Special Assistant Administrative Law Judge ("ALJ") issued a final decision against Mandy which denied her all relief. On March 12, 1999, Mandy filed this action in district court pursuant to the Individuals With Disabilities Education Act ("IDEA"), 20 U.S.C. §§ 1400, et seq., and its implementing regulations, 34 C.F.R. §§ 300.1, et seq. (1997) seeking a de novo review of the administrative proceedings and reversal of the findings of fact and resulting decision, as well as attorneys' fees and costs. On October 5, 1999, this court denied defendant's motion to dismiss. On February 18, 2000, the parties filed an amended joint motion to waive the pre-trial order requirements, stipulating that neither party would initiate a trial or move to introduce additional evidence in this case. The parties also stipulated that they would file cross-motions for final judgment on April 10, 2000, which would be dispositive of all claims, issues, and defenses in this case. The parties' motion was granted on February 24, 2000. On April 10, 2000, plaintiff filed a motion for summary judgment and defendant filed a motion for judgment. There is some question as to the proper procedural mechanism to be implemented in the district court in bringing an IDEA case before the court for final decision. The Eleventh Circuit has not yet addressed this issue. See Walker County School District v. Bennett, 203 F.3d 1293, 1297 n. 11 (11th Cir.2000). Both the Sixth and the Ninth Circuits have noted that a motion for summary judgment under Federal Rule of Civil Procedure 56 may not be an appropriate procedural device for triggering a district court decision because the district court in reviewing the administrative record, whether additional evidence is taken or not, must weigh and decide disputed issues of fact, an improper exercise under Rule 56. Compare Capistrano Unified School District v. Wartenberg, 59 F.3d 884, 891-92 (9th Cir.1995) and Doe v. Metropolitan Nashville Public Schools, 133 F.3d 384, 387 n. 2 (6th Cir.1998). Having considered the relevant legal authorities, the procedure of filing motions for final judgment appears to this court to be the better practice. Therefore, based on the foregoing and in light of the parties' stipulation, the court will treat plaintiff's motion for summary judgment as a motion for final judgment. *1361 Standard of Review Under the IDEA, any party aggrieved by the result of the administrative proceedings in the state system has the right to bring a civil action in the district court. In that lawsuit "the court shall receive the records of the administrative proceedings, shall hear additional evidence at the request of a party, and, basing its decision on the preponderance of the evidence, shall grant such relief as the court determines is appropriate." § 20 U.S.C. 1415(e)(2). The Supreme Court has delineated the following guideline for review: [A] court's inquiry in suits brought under 20 U.S.C. § 1415(e)(2) is two-fold. First, has the State complied with the procedures set forth in the Act? And second, is the individualized educational program developed through the Act's procedures reasonably calculated to enable the child to receive educational benefits? If these two requirements are met, the State has complied with the obligations imposed by Congress and the courts can require no more. Doe v. Alabama State Dep't of Educ., 915 F.2d 651, 655 (11th Cir.1990)(quoting Hendrick Hudson Cent. Sch. Dist. Bd. of Educ. v. Rowley, 458 U.S. 176, 206-07, 102 S.Ct. 3034, 3051, 73 L.Ed.2d 690 (1982)). Reviewing courts must give "due weight" to the record of the administrative proceeding. Rowley, 458 U.S. at 206, 102 S.Ct. at 3051. In Rowley, the Supreme Court made it clear that § 1415(e)(2) is not an invitation to the district court to substitute its own judgment on sound educational policy for those made at the state administrative level. Rowley, 458 U.S. at 206, 102 S.Ct. at 3050. The Eleventh Circuit has recognized that the role of the district court is simply to "review the administrative determinations contemplated by the Act." Manecke v. School Bd., 762 F.2d 912, 919 (11th Cir.1985), cert. denied, 474 U.S. 1062, 106 S.Ct. 809, 88 L.Ed.2d 784 (1986). The extent of deference to be given the administrative findings of fact is an issue left to the discretion of the district court. Jefferson County Board of Educ. v. Breen, 853 F.2d 853, 857 (11th Cir.1988). The court must consider the administrative findings of fact, but is free to accept or reject them. Id. (citing Town of Burlington v. Department of Educ., Com. of Mass., 736 F.2d 773, 792 (1st Cir.1984), aff'd, 471 U.S. 359, 105 S.Ct. 1996, 85 L.Ed.2d 385 (1985)). Facts Having reviewed the administrative record in light of the foregoing standard, the court credits the factual findings of the ALJ and finds that they are supported by the preponderance of the evidence in the record. Furthermore, the court independently finds the following facts, many of which the plaintiff admitted in either her statement of material facts or her response to defendant's statement of material facts. On June 28, 1987, Mandy, an eleven year old child, suffered an accident involving a four-wheel all-terrain vehicle. As a result of this accident, Mandy incurred a severe traumatic brain injury ("TBI"). Mandy's brain injury severely affected her abilities to engage in daily activities, perform self-help skills, and to appropriately engage in social interactions with others. Mandy's brain injury also significantly impaired her motor coordination, memory, speech and language. In the Spring of 1991, Mandy and her family moved to Atlanta, Georgia. Before Mandy enrolled in the School District, the School District provided her with a comprehensive computer evaluation through the Georgia Institute of Technology ("Georgia Tech"). While the Georgia Tech evaluation was being performed, the *1362 School District provided plaintiff with homebound instruction. Mandy enrolled as a special education student in the School District at age sixteen. Mandy attended Holcomb Bridge Middle School. For the 1992-93 school year, Mandy qualified to receive special education and related services from the School District under the IDEA category of "other health impaired" with the description "traumatic brain injury, left side weakness, walks with quad cane, and balance problems." At the time, the State Department of Education did not recognize a specific classification for TBI. Plaintiff was enrolled in the special education program at Roswell High School for the 1993-94 through 1996-97 school years. The School District developed an IEP and transition plan for Mandy for the 1992-93 through 1997-98 school years. The School District provided special education services and transition services for Mandy for the 1992-93 through the 1996-97 IEPs until she dropped out of Roswell High School ("RHS") on or about February 10, 1997. In 1994, the TBI classification became available in Georgia. The State Department of Education advised the School District that TBI students were to be reclassified upon reevaluation. Plaintiff was classified as TBI at her next evaluation in 1995. Mandy was served as TBI in the "Learning Disabilities" program. Plaintiff's IEPs were developed by a team composed of School District personnel, outside consultants hired by the School District, an attorney for the School District, plaintiff, plaintiff's attorney, and plaintiff's mother. Plaintiff's mother and attorney actively participated in developing the IEPs for the 1991-92 through 1997-98 school years. Their recommendations were, in part, incorporated into the IEPs. Each year, they were informed of the School District's placement and classification of plaintiff. After conferring with counsel, plaintiff's mother signed each resulting IEP indicating their agreement, with the exception of the IEPs for May 24, 1996 and August 19, 1997. Plaintiff received comprehensive services, including cognitive therapy and other therapies, technological services and equipment for the 1991-92 through 1996-97 school years. Some of these services were provided by School District staff specialists. The School District also hired outside providers to deliver educational services to plaintiff. The School District provided Mandy with a computer and special software which could compensate for some of Mandy's difficulties. The School District paid for a seating and positioning clinic at the Shepherd Spinal Center for Mandy and, as a result of Shepherd's recommendations, the School District purchased a customized office chair with an arm trough and a customized desk to accommodate Mandy's special needs. The School District provided plaintiff with textbooks on tape because plaintiff could more easily grasp material if she heard it rather than read it. The School District also provided Mandy with an assistant to help her throughout the day. According to Harold Smith, former Director of Programs for Exceptional Children, the School District expended more resources on plaintiff than on any other non-residential student in his twenty years of service to the School District. The School District provided cognitive therapy through Julie Krupa, a speech language therapist, from January 1995 through the end of that school year. Ms. Krupa gave plaintiff one-to-one cognitive evaluation, assistance and instruction. Ms. Krupa also gave Mandy computer-related training and speech/language-related therapies. She worked directly with School District personnel in a team approach to plaintiff's education. *1363 Prior to the 1996-97 school year, Mandy was on a college preparation diploma course of study at the request of Mandy and her mother. In addition to the academic course work, Mandy received integrated speech, physical, and occupational therapies. Daily living skills also were addressed. On May 24, 1996, Mandy, her mother, and the School District met to develop an IEP for plaintiff for the 1996-97 school year. At this meeting, Mandy, her mother, and the School District staff agreed that Mandy would not be able to secure a regular high school diploma by the time of her expected graduation in May 1998 and that other options should be considered. The committee proposed that plaintiff receive instruction in study skills, English, personal management, work study and keyboarding. Mandy would receive the keyboard training in a classroom with nondisabled peers. The IEP also had as a goal that Mandy would increase her social awareness and development of social skills. The committee recommended that plaintiff receive occupational therapy, physical therapy, speech therapy and career services. The School District did not invite anyone from the Division of Vocational Rehabilitation to attend the May 24, 1996 IEP meeting. The School District did, however, refer Mandy to Vocational Rehabilitation to determine her eligibility for its services as part of her 1996-97 transition plan. Mandy was eligible for vocational rehabilitation services. Dr. Anthony Stringer, Ph.D., completed a neuropsychological evaluation of Mandy at the request of Vocational Rehabilitation on December 13, 1996. Donald Blosser, a counselor for the Division of Vocational Rehabilitation contacted Dr. Stringer about developing a vocational plan for Mandy. Prior to the 1996-97 school year, Mandy and her mother had rejected services from Vocational Rehabilitation. The proposed 1996-97 IEP included goals for Mandy to achieve and set out a certain amount of time each week to be spent on most tasks. For example, the speech language therapist recommended no more than 90 minutes of speech therapy instruction per week to increase her speech skills, as well as more speech practice and repetition in other "real life" contexts. An individual transition plan ("ITP"), necessary for students aged sixteen and older, also was developed for plaintiff on May 24, 1996. According to the School District, plaintiff and her parent had declined information about independent living for Mandy prior to the 1996-97 IEP. At the 1996-97 IEP meeting, plaintiff's counsel asked about career preparation for Mandy. The Instructional Support Teacher for the Career Services Program, Donna Faulkner, emphasized that the School District was without sufficient information to identify possible post-secondary options for plaintiff and urged plaintiff to complete a vocational assessment. The 1996-97 ITP proposed the following transition objective areas: (1) Post-secondary—vocational training; (2) Employment—supported employment; (3) Personal Management—social/interpersonal & living arrangements; (4) Community Participation—Leisure & Community resources. The transition plan specified that plaintiff would explore available leisure groups in the community. The transition plan included a personal management class to help plaintiff increase her ability to act independently in various settings through role-playing, and covered topics including social interactions, job skills, interview etiquette, restaurant etiquette, and time management. All of the instruction occurred at Roswell High *1364 School. The primary goal of the personal management class was personal independence. The transition plan also included a worksite experience in the media center at Roswell High School. This work experience was based on Mandy's expressed interest in a career in computers. Ms. Faulkner and Julie Butler also set up a duplication of a job at a collection agency after plaintiff indicated that she would like to work at a collection agency. To set up the collection agency project for plaintiff, Ms. Faulkner visited different collection agencies and task-analyzed the situations so that she could set up a situation in the school to address plaintiff's interests. Dr. Fjordbak, the neuropsychologist retained to assist in developing educational services for plaintiff, recommended that the treatment team working with Mandy avoid challenging her goals and objectives, even if they seemed unattainable, because plaintiff was so emotionally involved in them. The School District considered Dr. Fjordbak's advice when it created the simulated work situations. At the 1996-97 IEP meeting, plaintiff stated that she did not want to return to RHS. According to plaintiff, the school environment was overwhelming for her, the students were immature "babies" and she did not have any friends at school. Plaintiff wanted to enter a community based instruction program and continue her education in a private placement. Mandy's mother requested that the School District pay for plaintiff to be trained at the Asher Business School ("Asher"). Ms. Faulkner visited Asher and, based on her observations and interviews with the faculty and staff, determined that the school was unable to provide an appropriate education for Mandy. For example, Ms. Faulkner learned that Asher had never dealt with a TBI student and the school's previous experience with providing accommodations consisted of a clothespin attached to the student's hand to assist the student with typing. Mandy and her mother did not sign the May 24, 1996 IEP, however, Mandy did receive services under the IEP until she dropped out of school in February 1997. Until plaintiff withdrew on February 10, 1997, Marilyn Swinehart, in her capacity as case manager, ensured that the objectives and goals of the IEP were implemented. To monitor plaintiff's progress, Ms. Swinehart held meetings for all of plaintiff's providers and collected data from those who worked with plaintiff. Ms. Swinehart met with Mandy's providers to ensure that the necessary modifications or accommodations had been implemented. Due to plaintiff's withdrawal from school, the plans memorialized in the IEP could not be completed, however, Ms. Swinehart testified that Mandy's communication with other students improved during the school year. On August 19, 1997, the IEP placement committee convened to develop an IEP for Mandy for the 1997-98 school year. Prior to developing the 1997-98 IEP, the School District staff evaluated Mandy to determine her current levels so that goals and objectives could be developed for 1997-98. During the assessments, Mandy's mother interrupted and raised concerns about the evaluations. Mandy's mother also stated that the School District should be sued for its failure to provide Mandy with an education. The committee reviewed Mandy's mastery of the 1996-97 IEP goals to determine a starting point for the 1997-98 IEP. Mandy had mastered several of her physical therapy and speech therapy objectives and was in the process of mastering several more. Mandy's speech and language skills regressed over the months since she left school. Mandy was in the process of *1365 mastering some of her life skills objectives such as planning her time and completing class assignments. She also mastered her objective of participating in group settings and activities at school at least once a day. She was in the process of mastering her objective of socializing through group interaction in speech therapy. The IEP placement committee proposed that plaintiff be served as TBI through the "Learning Disability" program in 1997-98. The School District offered a community based instruction program. The committee also proposed that plaintiff receive speech, physical, and occupational therapies, as well as career services each week. The IEP resulting from the August 1997 meeting incorporated goals and objectives including the improvement of social and vocational behaviors, the improvement of keyboarding skills and the exploration of recreation and leisure skills. The School District was disadvantaged in preparing the 1997-98 IEP because it was not in possession of several evaluations which outside providers had conducted on Mandy since she left RHS. The evaluation by neuropsychologist Dr. Jay Uomoto, however, was provided to the School District by Mandy and the meeting recessed temporarily so that all present could read his report. The School District incorporated some of Dr. Uomoto's suggestions into the IEP. For example, Mandy's schedule was changed to give her an additional period to practice the computer in a room by herself with her assistant. A transition plan also was developed for Mandy following the 1997-98 IEP meeting. The transition plan proposed objectives in the areas of: (1) Post-secondary—vocational training and career awareness; (2) Employment—supportive employment; (3) Personal Management—social/interpersonal skills, financial planning, and living arrangements; (4) Community Participation—leisure and community resources. The transition plan includes a personal management course focusing on independent living skills and a work-site experience. The community-based instructional program and some of the independent living skills classes were explained to Mandy and her mother at the IEP meeting. At the time of the IEP meeting, Mandy and her mother had not provided sufficient information regarding Mandy's preferences and interests to specifically formulate objectives incorporating these interests. The transition plan asked plaintiff to identify post-secondary vocations in which she had an interest, offered information about supported employment programs and Vocational Rehabilitation services, specified that plaintiff would increase management of her personal skills and practice them in community and classroom settings, and provided that plaintiff would explore community resources and leisure activities. The transition plan identifies the Career Services staff, Special Education, other outside agencies, Mandy and Mandy's mother as persons potentially responsible for delivering these services. No outside agencies were invited to the 1997-98 IEP meeting. Based on the School district's knowledge and experience regarding the services provided by MARTA, the School District itself evaluated which services would be available from MARTA to assist Mandy with her transportation goals. Mandy and her mother rejected the proposed IEP. Mandy and her mother instead developed and implemented a private rehabilitation program to educate plaintiff after she withdrew from the School District. On October 1, 1997, Mandy moved out of her mother's house and moved into the Grandview Apartments. These apartments are located outside the School District. When Mandy turned 21 years old, she was living in the Grandview Apartments. *1366 In fact, Mandy resided outside the boundaries of the School District for all but a few weeks of the 1997-98 school year. According to Mandy, she chose to move out of her mother's home in order to develop an educational program and placement so that she could become more independent and self-sufficient. Discussion The stated purpose of the IDEA is to ensure that all children with disabilities have available to them a free appropriate public education that emphasizes special education and related services designed to meet their unique needs. 20 U.S.C. § 1400(d)(1)(A). To effectuate that purpose, federal funds are made available to state and local educational entities which are required through an evaluation process to identify children with disabilities and to develop for each disabled child an annual individualized education program or IEP. See 20 U.S.C. §§ 1411, 1414-1415. If the parents of a disabled child are dissatisfied with their child's IEP, the statute requires the educational agency to afford them an impartial due process hearing. 20 U.S.C. § 1415(f). In order to satisfy its duty to provide a free appropriate public education to a disabled child, the state must provide personalized instruction with sufficient support services to permit the child to benefit educationally from that instruction. Drew P. v. Clarke County School Dist., 877 F.2d 927, 930 (11th Cir.1989) (citing Jefferson County Bd. of Educ. v. Breen, 853 F.2d 853 (11th Cir.1988)), cert. denied, 494 U.S. 1046, 110 S.Ct. 1510, 108 L.Ed.2d 646 (1990). The state is not required, however, to maximize the handicapped child's potential; rather, the state must provide the child a "basic floor of opportunity," consisting of access to specialized instruction and related services. Bd. of Educ. v. Rowley, 458 U.S. 176, 200-01, 102 S.Ct. 3034, 3048, 73 L.Ed.2d 690 (1982). Statute of Limitation for 1994-95 and 1995-96 School years Plaintiff requests that she be permitted to pursue relief under the IDEA for the 1994-95 and 1995-96 school years. In considering defendant's motion to dismiss, this court has already determined that the statute of limitation applicable to plaintiff's IDEA claims is the two-year statute of limitation applicable to personal injury actions. At that time, however, the court was unable to determine from plaintiff's Complaint when plaintiff's claims had accrued. IDEA claims accrue when the parents know or have reason to know of the injury or event that is the basis for their claim. Hall v. Knott County Bd. of Educ., 941 F.2d 402, 408 (6th Cir.1991). The cause of action accrues when the plaintiff learns (or should have learned) of the injury, whether or not they know that the injury is actionable. Id. at 408. Having reviewed the record, the court finds that plaintiff's claims for the 1994-95 and 1995-96 school years are barred by the statute of limitation. To be timely, plaintiff's claims must have accrued within two years prior to her filing her due process request on May 19, 1996. Plaintiff argues that she was not aware of any "harm" related to the 1994-95 or 1995-96 IEP's until May 24, 1996 when she first learned that she would not have enough credits to obtain a regular high school diploma by graduation. Plaintiff is advocating a "guaranteed outcome" standard that is inapplicable to the IDEA. See Rowley, 458 U.S. at 192, 208, 102 S.Ct. at 3034, 3052 (IDEA enacted more to open the door for disabled students to public education than to reach a particular level of education). *1367 Plaintiff and her mother, with the assistance of counsel, were active and assertive participants in the creation of the 1994-95 and 1995-96 IEPs. Plaintiff and her mother requested the pursuit of the regular college preparatory diploma. While, in hindsight, this may have been an optimistic endeavor on plaintiff's part, it seems evident to this court that Mandy and her mother were well informed about the extent of Mandy's disabilities at the time the IEPs at issue were adopted. Furthermore, there is no evidence that the School District concealed information regarding Mandy's continued eligibility for special education or her potential for completion of a college preparatory diploma. Likewise, there is no argument or evidence of any procedural defect related to the creation of these IEPs. Therefore, the court finds that plaintiff's claims accrued when Mandy and her mother signed and accepted the 1994-95 and 1995-96 IEPs. Accord Leake by Shreve v. Berkeley County Bd. of Educ., 965 F.Supp. 838, 846 (N.D.W.Va.1997)(parent who signed Education Plan form and knew daughter was not receiving special education services barred from bringing compensatory education claim when daughter subsequently qualified for special education). Accordingly, plaintiff's May 19, 1998 claim with regard to the 1994-95 and 1995-96 IEPs is time-barred. 1996-97 IEP and Transition Services/Compensatory Education "An IEP is a snapshot, not a retrospective. In striving for `appropriateness' an IEP must take into account what was, and was not, objectively reasonable when the snapshot was taken, that is, the time that the IEP was promulgated." Frank S. v. School Comm. of the Dennis-Yarmouth Reg'l Sch. Dist., 26 F.Supp.2d 219, 226 n. 15 (quoting Roland M. v. Concord Sch. Comm., 910 F.2d 983, 992 (1st Cir.1990)). Having reviewed the record, the court finds that the 1996-97 IEP was appropriate. The 1996-97 IEP was developed with the participation of plaintiff, her mother and their counsel, and the School District. It included observations regarding Plaintiff's current abilities and interests and set forth specific goals and objectives in all necessary areas. Functional learning opportunities were included, as well as computer skills training and the creation of two work sites utilizing computer skills. The IEP provided opportunity for plaintiff to work on daily living skills and social awareness such as time management and restaurant etiquette. Although plaintiff contends that the 1996-97 IEP was deficient because it did not propose a community-based program, at the time of the 1996-97 IEP meeting, plaintiff did not request a community based program. Rather, plaintiff wanted to attend the Asher Business School to prepare for a career in computers. In any event, the court notes that the School District was unable to introduce independent living skills in preparation for a community-based program prior to 1996-97 due to plaintiff's insistence upon a college preparation education. The 1996-97 transition plan provided for services in all areas contemplated by the IDEA and, thus, the School District was not required to indicate reasons why certain services were not provided. See eq. Yankton School District v. Schramm, 900 F.Supp. 1182, 1193 (D.S.D.1995), aff'd, 93 F.3d 1369 (8th Cir.1996)(identifying three areas specified in 34 C.F.R. § 300.18(b)(2)). Mandy was given an open referral to Vocational Rehabilitation where she was referred for and received a neuropsychological evaluation in preparation for the development of a vocational plan. Plaintiff did, in fact, gain educational benefit from the 1996-97 IEP before her *1368 withdrawal from RHS. She had mastered or was in the process of mastering many of her speech and physical therapy goals. Plaintiff had increased her rate of typing and was in the process of increasing her independent use and application of the computer. Therefore, the court finds that the 1996-97 IEP was appropriate for plaintiff's individual needs and reasonably calculated to confer an educational benefit. 1997-98 IEP and Transition Services/ Reimbursement Plaintiff seeks reimbursement of expenses related to her private education instruction and services for the 1997-98 school year. The Eleventh Circuit has recognized that reimbursement is an available remedy when the public school IEP is found to be statutorily insufficient and the private schooling chosen by the parents of a disabled child is found to be appropriate. See e.g., Walker County School Dist. v. Bennett, 203 F.3d 1293, 1296 n. 8 (11th Cir.2000)(citing Breen, 853 F.2d at 857). When the court ultimately determines that "the IEP proposed by the school officials was appropriate, the parents [are] barred from obtaining reimbursement." School Comm. of the Town of Burlington v. Department of Educ., 471 U.S. 359, 374, 105 S.Ct. 1996, 2004, 85 L.Ed.2d 385 (1985). After reviewing the record, the court agrees with the ALJ that the 1997-98 IEP and transition plan were appropriate and capable of conferring an educational benefit. The IEP was based on the available information regarding plaintiff's current abilities, interests and preferences. Computer instruction and assistance, as well as speech/language services were included in the IEP. The IEP identified specific goals and objectives for plaintiff to address in these areas. Likewise, the IEP adequately provided for transition services. The 1997-98 ITP proposed that plaintiff be taught in a community-based instruction program. Furthermore, the ITP identified specific objectives in the required major categories specified in 34 C.F.R. § 300.18(b)(2)(I)(b)(2)(iii) and therefore, no additional statements were required. Although no outside agencies were invited to the IEP, such procedural noncompliance with the IDEA is not violative unless it actually results in "substantial deprivation" to the student. See Urban v. Jefferson County School Dist., 89 F.3d 720, 726 (10th Cir.1996). In the instant case, the School District was capable of discussing the programs offered by outside agencies such as Vocational Rehabilitation and MARTA. Furthermore, Vocational Rehabilitation was not likely to provide transition services to Mandy because she rejected those services. Furthermore, with regard to expenses incurred after Mandy moved to the Grandview apartments in October 1997, the court finds that Mandy was not a resident of Fulton County and does not have standing to assert a reimbursement claim against the School District for that period. As an adult at the time of the move, it is plaintiff's residence and not that of her mother which determines the school district responsible for providing FAPE. See 20 U.S.C. § 1415(m)(1). It is undisputed that the Grandview Apartments are located outside of the Fulton County School District. A school district must provide services only to students residing within its jurisdiction. See 20 U.S.C. § 1413(a); O.C.G.A. § 20-2-133(a) (free instruction provided to eligible children who enroll in programs within local school system in which they reside); Susan R.M. v. Northeast Indep. Sch. Dist., 818 F.2d 455, 458-59 (5th Cir.1987)(school district not required to disregard established rules of residency). Although plaintiff attempts to argue that the move to the *1369 Grandview was necessary for plaintiff to receive an education and therefore should be treated more like a private school placement, there is no evidence to support this claim. Even assuming plaintiff could not receive a beneficial education while living in the same home as her mother, there is no evidence that a move outside the district to the Grandview was necessary for plaintiff to develop independent living skills. In light of the foregoing, the court finds that the School District substantially complied with the procedural requirements of the IDEA and that the IEPs and transition plans developed for Mandy for the 1996-97 and 1997-98 school years were appropriate and reasonably calculated to enable Mandy to receive educational benefits. Because the court finds that the 1997-98 proposed IEP was appropriate, it is unnecessary for the court to consider whether plaintiff's private education plan was appropriate. Therefore, defendant's motion for final judgment [docket nos. 22, 23] is GRANTED and plaintiff's motion for final judgment ("a/k/a/ motion for summary judgment") [docket no. 21] is DENIED as to all of plaintiff's claims. Summary (1) Plaintiff's motion for summary judgment (a/k/a motion for final judgment) [docket no. 21] is DENIED; (2) Defendant's motion for final judgment [docket nos.22, 23] is GRANTED.
FreeLaw
Intervention thresholds and cesarean section rates: A time-trends analysis. To improve understanding of rising cesarean section (CS) rates in the UK, this study assessed the relation between clinician thresholds for performing CS for delayed labor progress or suspected fetal distress and corresponding CS rates in Aberdeen, UK. Time-trends analysis of term births from 1988 to 2012 in a population of nulliparous women (N = 53 745) in Aberdeen, UK, using Chi-square test for trend, and binary logistic regression. Data were obtained from the Aberdeen Maternity and Neonatal Databank. Unplanned CS rates per quintile increased from 11.0% (1391/12 686) to 21.1% (2383/11 273) between 1988 and 2012, while planned CS rates increased from 2.7% (338/12 686) to 5.2% (591/11 273). The median duration of labor before CS for delayed progress per quintile decreased from 17.2 (IQR 12.5-22.3) to 13.1 hours (9.6-16.9) before first stage CS and from 17.1 (12.6-22.3) to 15.3 (11.5-19.1) hours before second stage CS (P < .001). The proportion of CS for suspected fetal distress performed with evidence of fetal acidosis declined from 23.4% (98/418) to 17.4% (106/608) per quintile (P < .01). Neonatal unit admission (adjusted OR 1.99, 95% CI 1.85-2.14) was more likely following unplanned CS than vaginal births. Birth trauma was less likely following both unplanned (adjusted OR 0.48, 95% CI 0.39-0.60) and planned (adjusted OR 0.33, 95% CI 0.18-0.63) CS. Increased CS rates can be partly attributed to lowered clinical thresholds for intrapartum CS. Higher CS rates are associated with less birth trauma for the offspring.
PubMed Abstracts
Q: I estimate 10% of the links posted here are dead. How do we deal with them? TL;DR: Approximately 10% of 1.5M randomly selected unique links in the March 2015 data dump are unavailable. To be more precise, that is approximately 150K dead links. Motivation I've been running into more and more links that are dead on Stack Overflow and it's bothering me. In some cases, I've spent the time hunting down a replacement, in others I've notified the owner of the post that a link is dead, and (more shamefully), in others I've simply ignored it and left just a down vote. Obviously that's not good. Before making sweeping generalizations that there are dead links everywhere, though, I wanted to make sure I wasn't just finding bad posts because I was wandering through the review queues. Utilizing the March 2015 data dump, I randomly selected about 25% of the posts (both questions and answers) and then parsed out the links. This works out to 5.6M posts out of 21.7M total. Of these 5.6M posts, 2.3M contained links and 1.5M of these were unique links. I sent each unique URL a HEAD request, with a user agent mimicking Firefox1. I then retested everything that didn't return a successful response a week later. Finally, anything that failed from that batch, I resent a final test a week later. If a site was down in all three tests, I considered it down for this test. Results2 By status code Good news/Bad News: A majority of the links returned a valid response, but there are still roughly 10% that failed. (This image is showing the top status codes returned) The three largest slices of the pie are the status 200s (site working!), status 404 (page not found, but server responded saying the page isn't found) and Connection Errors. Connection errors are sites that had no proper server response. The request to access the page timed out. I was generous in the time out and allowed a request to live for 20 seconds before failing a link with this status. The 4xx and 5xx errors are status codes that fall in the 400 and 500 range of HTTP responses. These are client and server error ranges, thus counted as a failure. 2xx errors (of which was are in the low triple) are pages that responded with a success message in the 200 range, but it wasn't a 200 code. Finally, there were just over a hundred sites that hit a redirect loop that didn't seem to end. These are the 3xx errors. I failed a site with this range if it redirected more than 30 times. There are a negligible number of sites that returned status codes in the 600 and 700 range4 By most common There are, as expected, many URLs that failed that appeared frequently in the sample set. Below is a list of the top 503 URLs that are in posts most often, but failed three times over the course of three weeks. http://docs.jquery.com/Plugins/validation http://www.eclipse.org/eclipselink/moxy.php http://jackson.codehaus.org/ http://xstream.codehaus.org/ http://opencv.willowgarage.com/wiki/ http://developer.android.com/resources/articles/painless-threading.html http://valums.com/ajax-upload/ http://sqlite.phxsoftware.com/ http://qt.nokia.com/ http://www.oracle.com/technetwork/java/codeconv-138413.html http://download.java.net/jdk8/docs/api/java/time/package-summary.html http://docs.oracle.com/javase/1.4.2/docs/api/java/text/SimpleDateFormat.html http://watin.sourceforge.net/ http://leandrovieira.com/projects/jquery/lightbox/ https://graph.facebook.com/ https://ccrma.stanford.edu/courses/422/projects/WaveFormat/ http://www.postsharp.org/ http://www.erichynds.com/jquery/jquery-ui-multiselect-widget/ http://ha.ckers.org/xss.html http://jetty.codehaus.org/jetty/ http://cpp-next.com/archive/2009/08/want-speed-pass-by-value/ http://codespeak.net/lxml/ http://www.hpl.hp.com/personal/Hans_Boehm/gc/ http://jquery.com/demo/thickbox/ http://book.git-scm.com/5_submodules.html http://monotouch.net/ http://developer.android.com/resources/articles/timed-ui-updates.html http://jquery.bassistance.de/validate/demo/ http://codeigniter.com/user_guide/database/active_record.html http://www.phantomjs.org/ http://watin.org/ http://www.db4o.com/ http://qt.nokia.com/products/ http://referencesource.microsoft.com/netframework.aspx https://github.com/facebook/php-sdk/ http://java.decompiler.free.fr/ http://pivotal.github.com/jasmine/ http://api.jquery.com/category/plugins/templates/ http://code.google.com/closure/library http://www.w3schools.com/tags/ref_entities.asp http://xstream.codehaus.org/tutorial.html https://github.com/facebook/php-sdk http://download.java.net/maven/1/jstl/jars/jstl-1.2.jar https://developers.facebook.com/docs/offline-access-deprecation/ http://www.parashift.com/c++-faq-lite/pointers-to-members.html https://developers.facebook.com/docs/mobile/ios/build/ http://downloads.php.net/pierre/ http://fluentnhibernate.org/ http://net.tutsplus.com/tutorials/javascript-ajax/5-ways-to-make-ajax-calls-with-jquery/ http://dev.iceburg.net/jquery/jqModal/ By post score Count of posts by score (top 10) (Covers 94% of all broken links): | Score | Percentage of Total Broken | |-------|----------------------------| | 0 | 36.4087% | | 1 | 25.1674% | | 2 | 13.4089% | | 3 | 7.2806% | | 4 | 4.2971% | | 5 | 2.7065% | | 6 | 1.8068% | | 7 | 1.2854% | | -1 | 1.1935% | | 8 | 0.9415% | By number of views Note, this is number of views at the time the data dump was created, not as of today Count of posts by number of views (top 10): | Views | Total Views | |--------------|-------------| | (0, 200] | 24.4709% | | (200, 400] | 14.2186% | | (400, 600] | 9.5045% | | (600, 800] | 6.9793% | | (800, 1000] | 5.2574% | | (1000, 1200] | 4.1864% | | (1200, 1400] | 3.3699% | | (1400, 1600] | 2.7766% | | (1600, 1800] | 2.3477% | | (1800, 2000] | 1.9550% | By days since post created Note: This is number of days since creation at the time the data dump was created, not from today Count of posts by days since creation (top 10) (Covers 64% of broken links): | Days since Creation | Percentage of Total Broken | |---------------------|----------------------------| | (1110, 1140] | 7.2938% | | (1140, 1170] | 6.7648% | | (1470, 1500] | 6.6579% | | (1080, 1110] | 6.6535% | | (750, 780] | 6.5535% | | (720, 750] | 6.5516% | | (1500, 1530] | 6.3978% | | (390, 420] | 5.8508% | | (360, 390] | 5.8258% | | (780, 810] | 5.5175% | By Ratio of Views:Days Ratio Views:Days (top 20) (Covers 90% of broken links): | Views:Days Ratio | Percentage of Total Broken | |------------------|-------------| | (0, 0.25] | 27.2369% | | (0.25, 0.5] | 18.8496% | | (0.5, 0.75] | 11.4321% | | (0.75, 1] | 7.2481% | | (1, 1.25] | 5.1668% | | (1.25, 1.5] | 3.7907% | | (1.5, 1.75] | 2.9310% | | (1.75, 2] | 2.4033% | | (2, 2.25] | 1.9788% | | (2.25, 2.5] | 1.6850% | | (2.5, 2.75] | 1.4080% | | (2.75, 3] | 1.1879% | | (3, 3.25] | 1.0654% | | (3.25, 3.5] | 0.9391% | | (3.5, 3.75] | 0.8334% | | (3.75, 4] | 0.7165% | | (4, 4.25] | 0.6634% | | (4.25, 4.5] | 0.5789% | | (4.5, 4.75] | 0.5508% | | (4.75, 5] | 0.4833% | Discussion What can we do with all of this? How do we, as a community, solve the issue of 10% of our outbound links pointing to places on the internet that no longer exist? Assuming that my sample was indicative of the entire data dump, there are close to 600K (150K broken unique links x 4, because I took 1/4 of the data dump as a sample) broken links posted in questions and answers on Stack Overflow. I assume a large number of links posted in comments would be broken as well, but that's an activity for another month. We encourage posters to provide snippets from their links just in case a link dies. That definitely helps, but the resources behind the links and the (presumably) expanded explanation behind the links are still gone. How can we properly deal with this? It looks like there have been a few previous discussions: Utilize the Wayback API to automatically fix broken links. Development appeared to stall on this due to the large number of edits the Community user would be making. This would also hide posts that depended on said link from being surfaced for the community to fix it. Link review queue. It was in alpha, but disappeared in early 2014. Badge proposal for fixing broken links Footnotes This is how it ultimately played out. Originally I sent HEAD requests, in an effort to save bandwidth. This turned out to waste a whole bunch of time because there are a whole bunch of sites around the internet that return a 405 Method Not Allowed when sending a HEAD request. The next step was to sent GET requests, but utilize the default Python requests user-agent. A lot of sites were returning 401 or 404 responses to this user agent. Links to Stack Exchange sites were not counted in the above results. The failures seen are almost 100% due to a question/answer/comment being deleted. The process ran as an anonymous user, thus didn't have any reputation and was served a 404. A user with appropriate permissions can still visit the link. I verified a number of 404'd links to Stack Overflow posts and this was the case. The 4th most common failure was to localhost. The 16th and 17th most common were localhost on ports other than 80. I removed these from the result table with the knowledge that these shouldn't be accessible from the internet. There where 7 total URLs that returned status codes in the 600 and 700 range. One such site was code.org with a status code of 752. Sadly, this is not even defined the joke RFC. A: I really think that, at least at this point, there isn't a problem. To the extent it is a problem, it is difficult to fix. Stack Overflow is meant to be a Q&A site, not a repository of links. Encountering a dead link is an annoyance, but it doesn't instantly invalidate the answer, and often barely has any impact at all. This site has a policy of encouraging answers consisting of more than links exactly for this reason: so even if the link dies, the answer still survives and remains meaningful. If an answer consists of just a link, then this is the problem, not the dead links. I'd go as far as to say the question hasn't really been answered. Many of the links are dead simply because the resource they pointed to has been moved to a slightly different location that any user could discover with a tiny bit of effort (for example, typing the name into Google). Take the link http://www.eclipse.org/eclipselink/moxy.php for example. Even though I don't trust casual users to actually fix the link, I do trust them not to be total idiots and just google eclipse moxy and follow one of the top three results to the new location. In other cases, it's simply impossible to fix a link at all, except by a person who is familiar with the subject. This is a more significant problem, but unfortunately not one that is fixable automatically. For example, take the link http://www.db4o.com, to the object database db4o. db4o hasn't existed for a while now and is no longer supported by the developer. You might be able to find the source code or the binaries, but I would not fix the link to point to them, because I would not recommend it to anyone (since it's dead). The problem is not really that the link is dead, but rather that the product has ceased to exist, and the answer that recommends it is no longer valid. It can only be fixed by posting a new answer, voting, and comments. These things might already exist on the questions you looked at. Also, a major problem with any automatic scheme to fix dead links is the potential for error. A link that points to something else, or to something that is no longer a valid answer, is a lot worse than a dead link, in the same way that misinformation is a lot worse than a lack of information. It really might confuse users, or have them using outdated software. If the bulk of the dead links continues to grow, and if popular answers get hit as well, I really would like to do something about it, largely because it makes the site looks dated and unprofessional. As it stands, an attempt at fixing it would be nice, but not something I think is important. Personally, I have encountered very few dead links as a casual user. A: The world wide web's sole purpose was to link relevant documents together. With no (working) links, there's no web. So I think every effort that can be undertaken to fix broken links, is a good effort. We shouldn't rely on users fixing their own post. We have way more inactive than active users. Perhaps there could be something like a "broken link queue", where users can report a broken link (A) and suggest a replacement (B). Then when agreed upon by reviewers and/or moderators, the system (Community user) could replace all instances in all posts of link A with link B. Of course this is very spam-sensitive, so the actual implementation details needs to be worked out pretty tight. A: I propose another hybrid of the previous broken link queue (as was mentioned above in comments and other answers) and an automated process to fix broken links with an archived version (which has also been suggested). The broken link queue should focus on editing and fixing the links in a post (as opposed to closing it). It'd be similar to the suggested edits queue, but with the focus intended to correct links not spelling and grammar. This could be done by only allowing a user to edit the links. One possibility, I envision is presenting the user with the links in the post and a status on whether or not the link is available. If it's not available, give the user a way to change that specific link. Utilizing this post, I have a quick mock up of what I propose such a review task looks like: All the links that appear in the post are on the right hand side of the screen. The links that are accessible have a green check mark. The ones that are broken (and the reason for being in this queue) have a red X. When a user elects to fix a post, they are presented with a modal showing only the broken URLs. With this queue, though, I think an automated process would be helpful as well. The idea is that this would operate similarly to the Low Quality queue, where the system can automatically add a post to the queue if certain criteria are met or a user can flag a post as having broken links. I've based my idea on what Tim Post outlined in the comments to a previous post. Automated process performs a "Today in History" type check. This keeps the fixes limited to a small subset of posts per day. It also focuses on older posts, which were more likely to have a broken link than something posted recently. Example: On July 31, 2015, the only posts being checked for bad links would be anything posted on July 31 in any year 2008 through current year - 1. Utilizing the Wayback Machine API, or similar service, the system attempts to change broken links into an archived version of the URL. This archived version should probably be from "close" to the time the post was originally made. If the automated process isn't able to find an archived version of the link, the post should be tossed into the Broken Link queue When the Community edits a post to fix a link, a new Post History event is utilized to show that a link was changed. This would allow anyone looking at revision history to easily see that a specific change was only to fix links. Actions performed in the previous bullets are exposed to 10K users in the moderator tools. Much like recent close/delete posts show up, these do as well. This allows higher rep users to spot check (if they so desire). I think this portion is important when the automated process fixes a link. For community edits in the queue, the history tab in /review seems sufficient. If a post consists of a large percentage of a link (or links) and these links were changed by Community, the post should have further action taken on it in some queue. Example: A post where X+% of the text is hyperlinks is very dependant on the links being active. If one or more of the links are broken, the post may no longer be relevant (or may be a link only post). One example I found while doing this was this answer. I don't think that this type of edit from the Community user should bump a post to the front page. Edits done in the broken link queue, though, should bump the post just like a suggested edit does today. By preventing the automated Community posts from being bumped, we prevent the the front page from being flooded, daily, with old posts and these edits. I think that the exposure in the 10K tools and the broken link queue will provide the visibility needed to check the process is working correctly. Queue Flow: Automated process flow: The automated link checking will likely run into several of the problems I did. Mainly: Sites modify the HEAD request to send a 404 instead of a 405. My solution to this was to issue GET requests for everything. Sites don't like certain user agents. My solution to this was to mimic the Firefox user agent. To be a good internet citizen, Stack Exchange probably shouldn't go that far, but providing a unique user agent that is easily identifiable as "StackExchangeBot" (think "GoogleBot"), should be helpful in identifying where traffic is coming from. Sites that are down one week and up another. I solved this by spreading my tests over a period of 3 weeks. With the queue and automatic linking to an archived version of the site, this may not be necessary. However, immediately converting a link to an archived copy should be discussed by the community. Do we convert the broken link immediately? Or do we try again in X days. If it's still down then convert it? It was suggested in another answer that we first offer the poster the chance to make changes before an automatic process takes place. The need to throttle requests so that you don't flood a site with requests. I solved this by only querying unique URLs. This still issues a lot of requests to certain, popular, domains. This could be solved by staggering the checks over a period of minutes/hours versus spewing 100s - 1000s of GET requests at midnight daily. With the broken link queue, I feel the first two would be acceptable. Much like posts in the Low Quality queue appear because of a heuristic, despite not being low quality, links will be the same way. The system will flag them as broken and the queue will determine if that is true (if an archived version of the site can't be found by the automated process). The bullet about throttling requests is an implementation detail that I'm sure the developers would be able to figure out.
StackExchange
Solid-phase assisted refolding of carbonic anhydrase using beta-cyclodextrin-polyurethane polymer. Artificial chaperone-assisted refolding has been shown to be an effective approach for improving the refolding yield of denatured proteins. Independent refolding of several structurally diverse proteins by this approach has provided promising results regarding significant suppression of aggregation along with enhanced refolding yields. However, from the industrial point of view, some modifications seem to be essential for making the technique more efficient. In that regard and with a cost-cutting goal we designed, for the first time, a beta-cyclodextrin-polyurethane polymer to replace the soluble beta-cyclodextrin as the stripping agent for refolding of carbonic anhydrase. Our results indicated that under the optimally developed refolding environment, the denatured carbonic anhydrase was refolded with a yield of 75% using 15 mg/mL of the beta-cyclodextrin-polyurethane polymer, a yield near to stripping by soluble beta-CD. This new stripping approach seems to constitute an ideal approach for refolding of proteins at much lower industrial costs compared to stripping with soluble beta-cyclodextrin. However, further-improvements in solid-phase artificial chaperone assisted technique are demanded either through synthesizing better stripping agents or by optimizing and defining better refolding environments.
PubMed Abstracts
hello, ehh i have watching info about the move sketch, that move cant generate momento, struggle, etc. but... does it could generate shadow moves (from XD, colosseum)?. if someone can test it pliz comment. steps: 1- trade a smeargle (from saphire, rubi, and to get it use cheat codes or trade it to emerald) to XD, colosseum.2- fight with a shadow pokemon (try to attack last, for to copy the shadow move)3- if the shadow move is copied, trade the smeargle to rubi/saphire There's no real point trying to sketch a shadow move, because none of them are unique, you can just sketch them off other Pokemon that learn it. Say, Salamence learns Refresh as a shadow move, but you can just Sketch refresh off a Chansey or something similar. Moves like Memento and Final Gambit can't be sketched, because the Pokemon using those moves faints instantly, and you can't sketch them afterwards. You can sketch Explosion and Selfdestruct, by having a double battle, with your partner having Damp. example: ill fight with a hariyama and a medichan, i select smeargle and a claidol. if in first turn claidol use ancient power and next smeargle use sketch. the sketched move will be ancient power (if claidol attack first and next smeargle use sketch next), right? Who is online Users browsing this forum: No registered users and 2 guests You cannot post new topics in this forumYou cannot reply to topics in this forumYou cannot edit your posts in this forumYou cannot delete your posts in this forumYou cannot post attachments in this forum
Pile-CC
Jan de Vos (historian) Jan de Vos van Gerven (1936 – 24 July 2011) was a Belgian historian, who lived in Mexico from 1973 until his death in 2011. In 1995 he became guest advisor to the Zapatista Army of National Liberation (EZLN) during the peace talks between the EZLN and the Mexican Government. Career Jan de Vos was born in Antwerp, Belgium, in 1936. He grew up bilingual in Dutch and French. He achieved his PhD in the humanities at the University of Leuven, Belgium. In 1973 he came to Chiapas, Mexico, as a missionary priest. Over time, and in relationships with the indigenous Maya of the Lacandon region, he adopted an outlook influenced by liberation theology. "I came to Chiapas to bring the Mayan people the Word of God, but they converted me instead" During his life in Chiapas he did research and wrote many books on the history of the Lacandon region and processes that led to the Chiapas conflict. In 1986, he received an academic prize (the Premio Chiapas) and in 1992 he received the national Juchimán de Plata prize. Having made a reputation by writing on the Lacandon Jungle, he was invited as a permanent guest advisor by the EZLN during the negotiations between the government and the EZLN in San Andrés Larráinzar in 1995. (see also the San Andrés Accords) As a distinguished person in the region he entered the Consejo Consultivo (Consultative Council) of the EU/Chiapas development project Prodesis around 2004. In her answer to a question in the European Parliament, Commissioner Ferrero-Waldner referred to Jan de Vos to underline the transparent and democratic character of the project:"From an institutional point of view, major emphasis has been put on inclusive participation and control by civil society within PRODESIS’ Consultative Council, whose “civil society college” currently includes 30 members of regional and national civil society organisations. The renowned Chiapas expert and EZLN’s external consultant during the negotiation of the San Andres Agreement, Professor Jan de Vos, is also a member of that Consultative Council." During an interview in 2007, however, de Vos was very critical of Prodesis's way of operating, and sceptical about the possible results. In his opinion, the people in the Lacandon region have been betrayed too often (which is a strong sentiment in the region) and Prodesis is making the same mistakes as predecessor-projects like PIDDS and the Cañadas programme. In the last years of his life, de Vos worked at CIESAS (Centro de Investigaciones y Estudios Superiores en Antropología Social) and resided mainly in Mexico City, but he often returned to San Cristobal de las Casas. Selected works Among several indispensable works on the history of Chiapas, he wrote Fray Pedro Lorenzo de la Nada and The Battle of The Sumidero. He became most known however for his trilogy on the Lacandon Jungle: La Paz de Dios y del Rey: la Conquista de la Selva Lacandona, 1525-1821 (The Peace of God and the King: the Conquest of the Lacandon Jungle) Oro verde: la Conquista de la Selva Lacandona por los Madereros Tabasqueños, 1822-1949 (Green Gold: the Conquest of the Lacandon Jungle by the Tabasco's Timber Dealers) Una Tierra Para Sembrar Sueños: Historia Reciente de la Selva Lacandona, 1950-2000 (A Land for Sowing Dreams: Recent History of the Lacandon Jungle) An excerpt from the introduction to The Peace of God and the King; The Conquest of the Lacandon Jungle, 1525-1821:"For Western Civilization, violent and oppressive by nature, the Indigenous cultures continue to be a nuisance which has to be eliminated. Today, several South American countries keep exterminating in cold blood the last free indigenous tribes of the Amazon Rain Forest. Other nations limit themselves to destroying the autochthonous cultures and forcing the indigenous people to enter national society, only to turn them into uprooted second-class citizens. In other countries they are enclosed, for dubious philantropic reasons, in reservations (sometimes territorial, sometimes subtly cultural), in which the indigenous people are condemned to live like museum pieces, without being able to participate freely in the life of the nation they belong to. And there is not a single country in the American continent where Indians are not economically exploited and socially oppressed by their white and mestizo brothers." (La Paz de Dios y del Rey; La conquista de la Selva Lacandona. 1525-1821; Mexico, Fondo de Cultura Económica, 1993) References Interview by Monique Lemaitre on 8 February 1996 at the cultural center "El Carmen" in San Cristóbal de las Casas, Chiapas, during the National Forum on Indigenous Rights. CIESAS (Centro de Investigaciones y Estudios Superiores en Antropología Social) Profile at CIESAS (in Spanish); Perfil del Investigador de Ciesas D. van der Meulen & M. Duran de Huerta: "Oude & nieuwe Maya's, een reisverslag"; Uitgeverij Boom, 2005 Category:Belgian historians Category:1936 births Category:2011 deaths Category:Mexican historians Category:Belgian emigrants to Mexico
Wikipedia (en)
J-S86011-16 NON-PRECEDENTIAL DECISION - SEE SUPERIOR COURT I.O.P. 65.37 COMMONWEALTH OF PENNSYLVANIA : IN THE SUPERIOR COURT OF : PENNSYLVANIA : v. : : : JAQUAN WATSON : : Appellant : No. 9 WDA 2016 Appeal from the Judgment of Sentence November 3, 2015 In the Court of Common Pleas of Cambria County Criminal Division at No(s): CP-11-CR-0002009-2014 BEFORE: GANTMAN, P.J., MOULTON, J., STEVENS*, P.J.E. MEMORANDUM BY STEVENS, P.J.E.: FILED FEBRUARY 17, 2017 Appellant Jaquan Watson appeals from the judgment of sentence entered in the Court of Common Pleas of Cambria County on November 3, 2015, following his guilty plea to one count each of third-degree murder, and Persons not to possess, use, manufacture, control, sell or transfer firearms.1 We affirm. The trial court briefly set forth the facts of this case as follows: The testimony at the preliminary hearing established that at approximately 1:30 a.m. on July 13, 2014, [Tyrone] Williams arrived at Building 28 at the Oakhurst Homes looking for a ____________________________________________ 1 18 Pa.C.S.A. §§ 2502(c), 6105(a)(1), respectively. *Former Justice specially assigned to the Superior Court. J-S86011-16 female friend. He approached a group that included [Richard A.] Cook, [Fidel L.] Cosby and [Appellant] that was gathered outside the building. Williams was informed by someone in the group where to locate his friend and he left for that location. Williams returned shortly thereafter and for reasons that are unclear had an altercation with one person in the group and was struck by that person or someone else in the group. Williams then walked away toward Grandinetti Avenue. While Williams was standing near Grandinetti Avenue, Cook, Cosby, and [Appellant] drew handguns and began firing at him. Williams fled toward Daniel Street while the three continued firing. Williams’ body was eventually found a short distance up a hill near Daniel Street. An autopsy revealed that Williams was struck multiple times with rounds from different caliber handguns with the fatal shot being a back to front through and through that passed his heart and lung. This round was never recovered. Eyewitnesses stated that [Appellant] was firing a semi-automatic handgun with silver on top, Cook was firing a revolver, and Cosby was firing a larger semi-automatic handgun with a laser sight. Detectives from the Johnstown Police Department (JPD) were eventually able to locate and arrest all three suspects. During interviews Cook admitted to being present at the scene, to possessing a .22 caliber revolver that night, to seeing [Appellant] pull a handgun, to seeing [Appellant] firing at Williams, and to drawing his own revolver. Cook stated that he did not recall firing his weapon that night. Trial Court Opinion, filed 3/1/16, at 3-4. Appellant initially was charged in a Criminal Complaint on July 15, 2014, as a “principle [sic] or accomplice” of criminal homicide in the death of Mr. Williams. In the Criminal Information filed on November 21, 2014, Appellant was charged as “the Actor” in the homicide. Thereafter, on September 17, 2015, the Commonwealth filed an Amended Information wherein Appellant was charged as “a principal or accomplice.” Appellant challenged the amendment, and following a hearing on September 21, 2015, on this issue and other pretrial motions, the trial court permitted the -2- J-S86011-16 Criminal Information to be amended. In doing so, the trial court reasoned Appellant had not been surprised or prejudiced since the matter had been viewed from the outset as one wherein the codefendants acted in concert. N.T., 9/21/15, at 26-27. The Commonwealth filed a Motion for Consolidation on July 7, 2015, and Appellant filed a Motion to Sever under Pa.R.Crim.P. 583.2 Following the Consolidation Hearing held on September 11, 2015, at which Appellant opposed the Commonwealth’s Motion to Consolidate, the trial court granted the Commonwealth’s motion and denied Appellant’s motion to sever.3 On September 22, 2015, the day upon which jury selection was scheduled to begin, Appellant and his codefendants entered guilty pleas and agreed to waive their right to withdraw those pleas.4 Sentencing was ____________________________________________ 2 This Rule states that: The court may order separate trials of offenses or defendants, or provide other appropriate relief, if it appears that any party may be prejudiced by offenses or defendants being tried together. Pa.R.Crim.P 583. 3 While the Docket Entries indicate an Order was entered denying Appellant’s Motion to Sever on September 11, 2015, no corresponding written motion appears in the certified record. 4 While Appellant initially hesitated to enter into a plea due to the fact he had not been promised a definitive period of incarceration, following a detailed discussion with his counsel and the trial court, Appellant eventually decided to plead guilty. N.T. Guilty Plea, 9/22/15, at 4-10. -3- J-S86011-16 scheduled for November 3, 2015; however, on November 2, 2015, Appellant filed his “Motion for Withdrawal of Guilty Plea” wherein he alleged, inter alia, that: “there is a fair and just reason that he should be permitted to withdraw his guilty pleas as he avers he that he is not guilty of the alleged offenses, and further avers that he was under great pressure and not thinking clearly when he entered his guilty pleas. . . . ” See Motion to Vacate Guilty Plea, filed 11/2/15, at ¶ 3. On November 3, 2015, the trial court denied Appellant’s motion and sentenced him to a period of incarceration of two hundred four (204) months to four hundred eighty (480) months in prison on the third-degree murder charge and to a consecutive term of forty-eight (48) months’ to one hundred twenty (120) months’ incarceration on the firearms charge. N.T. Sentencing, 11/3/15, at 52-53. Appellant filed a post-sentence motion to modify his sentence, and following a hearing, the trial court denied the same on December 22, 2015. On December 29, 2015, Appellant filed a timely notice of appeal. 5 On January 6, 2016, the trial court ordered Appellant to file a concise statement of matters complained of on appeal pursuant to Pa.R.A.P. 1925(b), and Appellant filed the same on January 29, 2016, wherein he raised five claims. ____________________________________________ 5 Codefendant Richard A. Cook’s appeal from his judgment of sentence is pending in this Court. See Commonwealth v. Cook, 5 WDA 2016. -4- J-S86011-16 The trial court filed its opinion pursuant to Pa.R.A.P. 1925(a) on March 1, 2016. Appellant now presents the following Statement of Questions Involved: 1. Did the [t]rial [c]ourt commit reversible error when it granted the Commonwealth’s request to consolidate the trials of Fidel Cosby, Richard Cook and [ ] [A]ppellant [] over objection from Appellant[?] 2. Did the [t]rial [j]udge commit reversible error by allowing the Commonwealth [to] file an amended Criminal Information over objection from [Appellant] on 09/17/15 when jury selection was scheduled to begin on 09/22/15[?] 3. Did the [t]rial [j]udge commit reversible error by not continuing the trial to give the [Appellant] additional time to prepare for trial based on the material change in the Information set forth in paragraph 2 above[?] 4. Did the [t]rial [c]ourt err in denying [Appellant’s] pre- sentence motion to withdraw his guilty plea where he asserted a plausible claim of innocence? 5. Did the [c]ourt err in sentencing [Appellant] to an aggregate twenty-one (21) to fifty year period of incarceration? Brief for Appellant at 5. Appellant first maintains the trial court erred in granting the Commonwealth’s motion to consolidate the trials of Appellant and his codefendants. Appellant relies upon Pa.R.CrimP. 582(B)(1) and (2) to support his claim that the Commonwealth’s failure to file a written Notice of Joinder prior to formal arraignment on November 25, 2014, and its failure to file a motion for consolidation as part of an omnibus pretrial motion within thirty days of formal arraignment rendered its motion untimely and, -5- J-S86011-16 therefore, the trial court should have denied it on procedural grounds. Brief for Appellant at 11-12. Appellant further notes Pa.R.Crim.P. 583 provides that where it appears a party may be prejudiced if offenses or defendants are tried together, the trial court may order separate trials. Appellant maintains “[a] problem of constitutional proportions arises in joint trials when the prosecutor seeks to offer into evidence a confession of one defendant which implicates another,” and that herein, while he did not make a confession, Appellant’s codefendant Cook clearly implicated Appellant as the shooter such that Appellant had been denied his rights under the “confrontation clause.” Id. at 13. Appellant reasons that were a trial held, based upon the evidence the Commonwealth would have presented and the complex nature of the case, the jury could not have separated such evidence and likely would have convicted all three defendants as it “would have been unable to determine who fired the fatal shot, and all three would have or could have been unjustly convicted of 1st Degree Murder.” Id. at 13-14. Finally, Appellant claims that while his codefendants made statements which could be introduced against them, such statements would constitute inadmissible hearsay against Appellant, who did not make a statement, and that evidence would be unfairly prejudicial to him at a joint trial. Id. Initially, we note it is well-settled that the decision to join or sever offenses for trial is within the trial court’s discretion and will not be reversed on appeal absent a manifest abuse thereof or a showing of prejudice or clear -6- J-S86011-16 injustice to the defendant. Commonwealth v. Wholaver, 605 Pa. 325, 351, 989 A.2d 883, 898 (2010). Herein, the trial court reasoned that numerous factors, including the fact that the charges against Appellant and his codefendants arose from the same course of events and the same witnesses would be called in the trial of each, militated in favor of joinder. Trial Court Opinion, filed 3/1/16, at 7. In addition, the trial court determined Appellant could not meet the standard to prove prejudice, because the charges were not so numerous or disparate that a properly-instructed jury would have been rendered unable to separate the evidence against each defendant. Id. at 7-8. In addition, the trial court pointed out that whether the statements of Appellant’s codefendants would have been admitted into evidence never had been determined, and Appellant could have sought at trial to limit what portions thereof the Commonwealth might introduce. Id. at 8. Further, the trial court found Appellant had not been prejudiced by the Commonwealth’s motion, since all pretrial proceedings involved all three defendants, and nothing in the Pennsylvania Rules of Procedure places a deadline on the Commonwealth for filing a motion to consolidate. Id. at 9. As the trial court stated, Rule 582(B)(2) provides that a motion to consolidate “must ordinarily be included in the omnibus pretrial motion.” Pa.R.Crim.P. 582(B)(2) (emphasis added). The use of the word “ordinarily” plainly indicates that while motions to consolidate should normally be included in an omnibus pretrial motion, the rule is not absolute, and there -7- J-S86011-16 are certain circumstances where a motion to consolidate will be considered outside of an omnibus motion. This Court will not make a rule absolute when the plain language does not purport to do so; thus, under the facts presented herein, where Commonwealth filed its motion several weeks before trial and each pretrial proceeding involved all three defendants, we find the trial court did not err by considering the Commonwealth’s motion. The timeliness of the Commonwealth’s motion aside, we find Appellant’s challenge to be moot as Appellant and his codefendants entered guilty pleas prior to trial; thus, there was no joint trial at which Appellant was subjected to prejudice. Indeed, Appellant speaks in terms of the prejudice that might have or would have befallen him had trial occurred and if statements of codefendants Cook and Cosby were introduced into evidence. Brief for Appellant at 13-14. “A defendant requesting a separate trial must show real potential for prejudice rather than mere speculation.” Commonwealth v. Serrano, 61 A.3d 279, 285 (Pa.Super. 2013) (citation omitted). As such, the trial court correctly determined Appellant simply cannot show that he was prejudiced by its decision to consolidate the matters for trial. This claim, therefore, does not warrant relief. In his second and third issues, Appellant argues the trial court committed reversible error by permitting the Commonwealth to amend the Criminal Information several days prior to the date upon which trial was scheduled to commence without providing Appellant with additional time to -8- J-S86011-16 prepare a defense for trial based upon the alleged material change. Specifically, Appellant explains that while the original Criminal Complaint filed on July 15, 2014, named him as an actor or accomplice in the death of Tyrone Williams, the Criminal Information filed on November 21, 2014, charged him only as the principal actor; thus, Appellant and his counsel prepared for trial based upon the Criminal Information. Brief for Appellant at 14. Appellant maintains that the Commonwealth’s Amended Information filed on September 17, 2015, alleging he acted either as a principal or as an accomplice was impermissible as it clearly expanded and changed the nature of the offense. Id. at 15-16. While he admits he never sought to have his trial continued, Appellant reasons the trial court may have sua sponte granted a continuance pursuant to Pa.R.Crim.P. 106.6 Appellant posits that in light of the gravity of the charged offenses, the trial court should have continued the trial in the interests of justice to allow such a young man more time to make an informed decision to enter a guilty plea or proceed to trial. Id. at 17-18.7 Pa.R.Crim.P. 564 states: ____________________________________________ 6 This rule provides in relevant part that: “[t]he court or issuing authority may, in the interests of justice, grant a continuance, on its own motion, or on the motion of either party.” Pa.R.Crim.P. 106 (A). 7 Prior to pleading guilty, Appellant indicated he was twenty years old. N.T. Guilty Plea, 9/22/15, at 20. -9- J-S86011-16 The court may allow an information to be amended when there is a defect in form, the description of the offense(s), the description of any person or any property, or the date charged, provided the information as amended does not charge an additional or different offense. Upon amendment, the court may grant such postponement of trial or other relief as is necessary in the interests of justice. Pa.R.Crim.P. 564. Additionally, [i]n reviewing a grant to amend an information, the Court will look to whether the appellant was fully apprised of the factual scenario which supports the charges against him. Where the crimes specified in the original information involved the same basis elements and arose out of the same factual situation as the crime added by the amendment, the appellant is deemed to have been placed on notice regarding his alleged criminal conduct and no prejudice to defendant results. Commonwealth v. Mentzer, 18 A.3d 1200, 1202–03 (Pa.Super. 2011) (citation omitted). Herein, as has been stated above, the Criminal Complaint filed on July 15, 2014, charged Appellant as both the principal and accomplice to the offenses of homicide and aggravated assault. The Commonwealth explained that although the charge was “typed over defectively by the [District Attorney’s] office,” N.T., 9/21/15 at 25, its theory of the case never changed. The Commonwealth stressed that from the time of the preliminary hearing held on October 1, 2014, Appellant was aware he was charged with acting as an accomplice to his and his codefendants. Brief for Appellee at 9 - 10 - J-S86011-16 citing N.T. Preliminary Hearing, 10/1/14, at 118-19.8 Indeed, Appellant adduced no evidence at the September 21, 2015, hearing that he was prejudiced by the amendment. Even if he had, it is clear that Appellant and his counsel were well aware of the charges, as they negotiated a plea bargain with the Commonwealth, and the plea colloquy included a recitation of the facts alleged as well as stated the criminal charges. Appellant also was reminded that no promises regarding his sentence had been made. We read such conduct by Appellant as a knowing acquiesce in the technical error and conclude that the Commonwealth provided Appellant with a sufficiently specific accusation of the crimes charged, as upon pleading guilty a defendant admits to all of the facts averred in the indictment. See Commonwealth, Department of Transportation v. Mitchell, 517 Pa. 203, 212, 535 A.2d 581, 585 (1987) (plurality). See also Commonwealth v. Montgomery, 485 Pa. 110, 114, 401 A.2d 318, 319 (1979) (stating that a guilty plea constitutes a waiver of all nonjurisdictional defects and defenses and stressing that a defendant who pleads guilty waives the right ____________________________________________ 8 Appellant has not provided the notes of testimony of the preliminary hearing for our review. “It is the obligation of the appellant to make sure that the record forwarded to an appellate court contains those documents necessary to allow a complete and judicious assessment of the issues raised on appeal.” Hrinkevich v. Hrinkevich, 676 A.2d 237, 240 (Pa.Super. 1996) (citation omitted). - 11 - J-S86011-16 to challenge anything but the legality of his sentence and the validity of his plea). Thus, despite the technical flaw, the trial court did not err in its decision to permit the Commonwealth to amend the information. With regard to Appellant’s claim the trial court erred by failing to sua sponte continue his scheduled trial in light of its decision to allow the Commonwealth to amend the Criminal Information, we note that it was not required to do so under Pa.R.Crim.P. 564. Also, Appellant admits he never sought a continuance either orally or in writing, and our review of the record confirms he neither requested additional time nor objected on the record after the trial court found the Amended Information did not result in prejudice or unfair surprise to Appellant and his codefendants. See Brief for Appellant at 17; N.T., 9/21/15, at 27. To the contrary, Appellant asked only that the accomplice liability language be stricken from the Amended Information so that he may “proceed with trial tomorrow on the original charge that he was charged with some nine months ago.” N.T., 9/21/15, at 17. On Appeal, Appellant has proffered only a bald assertion he was prejudiced by the amendment and failed to assert how he would have prepared differently for trial had a continuance been granted sua sponte. Accordingly, Appellant has waived this claim. See Commonwealth v. Houck, 102 A.3d 443, 451 (Pa.Super. 2014) (stating, “the failure to make a timely and specific objection before the trial court at the appropriate stage - 12 - J-S86011-16 of the proceedings will result in waiver of the issue.” (citation omitted)); Pa.R.A.P. 302(a) (stating an issue not raised in the trial court is considered waived for purposes of appellate review). In his fourth claim, Appellant avers the trial court erred in denying his pre-sentence motion to withdraw his guilty plea filed on November 2, 2015, in light of his assertion of a plausible claim of innocence. In support of this claim, Appellant argues that through his counsel he asserted at the sentencing hearing he was “not guilty of this offense” and was under a “great deal of pressure” when he entered his plea and “said things that were not accurate.” Brief for Appellant at 20. He claims that his confusion arose, in part, from his inability to discuss with counsel the ramifications of the Commonwealth’s amendment to the Criminal Information to include a theory of accomplice liability. Id. citing N.T. Sentencing, 11/03/15, at 5-6. Relying upon Commonwealth v. Carrasquillo, 631 Pa. 692, 115 A.3d 1284 (2015), Appellant reasons that “given the unique situation that [he] was placed in the day of jury selection, i.e. the delayed Amended Information, [he] stated fair and just reasons for his desire to withdraw his guilty plea, and said request should have been granted by the trial judge.” Brief for Appellant at 20. Acknowledging the fact that he had agreed to waive his opportunity to withdraw his guilty plea, Appellant posits he should not be prevented from exercising his right to do so notwithstanding. Appellant stresses he had entered an open plea and that the Commonwealth would - 13 - J-S86011-16 have had difficulty proving him guilty of first-degree murder beyond a reasonable doubt. Id. at 21-22. Under Pa.R.Crim.P. 591, a trial court may, in its discretion, allow a defendant to withdraw a guilty plea at any time before his sentence is imposed. Pa.R.Crim.P. 591(A) (“At any time before the imposition of sentence, the court may, in its discretion, permit, upon motion of the defendant, or direct, sua sponte, the withdrawal of a plea of guilty or nolo contendere and the substitution of a plea of not guilty.”). The standard of review that we employ in challenges to a trial court's decision regarding a pre-sentence motion to withdraw a guilty plea is well-settled: A trial court's decision regarding whether to permit a guilty plea to be withdrawn should not be upset absent an abuse of discretion. An abuse of discretion exists when a defendant shows any fair and just reasons for withdrawing his plea absent substantial prejudice to the Commonwealth. In its discretion, a trial court may grant a motion for the withdrawal of a guilty plea at any time before the imposition of sentence. Although there is no absolute right to withdraw a guilty plea, properly received by the trial court, it is clear that a request made before sentencing should be liberally allowed. The policy underlying this liberal exercise of discretion is well-established: The trial courts in exercising their discretion must recognize that before judgment, the courts should show solicitude for a defendant who wishes to undo a waiver of all constitutional rights that surround the right to trial—perhaps the most devastating waiver possible under our constitution. In [Commonwealth v.]Forbes, [299 A.2d 268 (Pa. 1973)] our Supreme Court instructed that, in determining whether to grant a pre[-]sentence motion for withdrawal of a guilty plea, the test to be applied by the trial courts is fairness and justice. - 14 - J-S86011-16 Commonwealth v. Elia, 83 A.3d 254, 261–262 (Pa.Super. 2013) (internal quotations and citations omitted). In addition, our Supreme Court in Carrasquillo recently reaffirmed the Forbes ruling, stating: there is no absolute right to withdraw a guilty plea; trial courts have discretion in determining whether a withdrawal request will be granted; such discretion is to be administered liberally in favor of the accused; and any demonstration by a defendant of a fair-and-just reason will suffice to support a grant, unless withdrawal would work substantial prejudice to the Commonwealth. Carrasquillo, 631 Pa. at 704, 115 A.3d at 1291–1292 (footnote omitted). In Carrasquillo the Supreme Court also declared a defendant's innocence claim must be at least plausible to demonstrate, in and of itself, a fair and just reason for pre-sentence withdrawal of a plea. Carrasquillo, 631 Pa. at 704, 115 A.3d at 1292.9 The Court concluded that a per se approach to allowing a pre-sentence withdrawal of a guilty plea on one’s mere assertion of his innocence is unsatisfactory. Id. It further noted that in evaluating a pre-sentence request to withdraw a guilty plea, courts could consider the timing of the innocence claim. Carrasquillo., 631 Pa. at 705, 115 A.3d at 1292 citing Commonwealth v. Forbes, 450 Pa. 185, 192, 299 A.2d 268, 272 (1973) (“Obviously, the appellant, by his assertion of innocence—so early in the proceedings, i.e., one month after the initial ____________________________________________ 9 The Supreme Court arrived at the same conclusion in a companion case, Commonwealth v. Hvizda, ___ Pa. ____, 116 A.3d 1103 (2015), decided the same day. - 15 - J-S86011-16 tender of a plea,—offered a ‘fair and just’ reason for withdrawal of the plea.”) (brackets omitted). In considering this issue, the trial court stressed that Appellant had indicated when entering his guilty plea he was aware jurors and all parties were ready for trial and understood he was, therefore, giving up his right to withdraw his plea. The trial court explained it had informed Appellant that it would not grant such a motion were Appellant to file one “between now and at the time of [his] sentencing.” Trial Court Opinion, filed 3/1/16, at 12 citing N.T. Guilty Plea, 9/22/15, at 15. Accordingly, the trial court reasoned that since Appellant had waived his right to withdraw his guilty plea, it did not err in denying his subsequent motion. Id. at 14. In the alternative, the trial court asserted that even if Appellant had not waived his right to withdraw his plea, he could not have been entitled to do so for his failure to present a plausible claim of innocence or colorable demonstration that permitting withdrawal of the plea would promote fairness and justice in this matter as is required under Carrasquillo and Hvizda. The trial court reasoned that: the evidence presented at the preliminary hearing clearly place[s] him at the scene of the murder with a weapon in his hand firing at Williams. Further, eyewitness testimony was that [Appellant], along with Cook and Cosby continued to fire at Williams as he fled. Viewing [Appellant’s] claim against the totality of the evidence available reveals that his claim of innocence is implausible under the factual circumstances of this case. Trial Court Opinion, filed 3/1/16, at 15. - 16 - J-S86011-16 Initially, we note that this Court has held a trial court abused its discretion when it found a defendant waived his right to withdraw a guilty plea prior to sentencing where the defendant had entered an open plea and later asserted his innocence, and where there was no alleged prejudice to the Commonwealth if the plea were to be withdrawn. Commonwealth v. Pardo, 35 A.3d 1222, 1224 (Pa.Super. 2011). We further have held that in keeping with the dictates of Pa.R.Crim.P. 590 and 591 and our Supreme Court's liberal standard of granting pre-sentence requests to withdraw guilty pleas, a trial court may not “curtail a defendant's ability to withdraw his guilty plea via a boilerplate statement of waiver in a written guilty plea colloquy.” Id. In light of the foregoing, while we acknowledge the Commonwealth’s position that the waiver in this case was not a boilerplate waiver but, rather, was attendant to jury selection, Brief for Appellee at 16, we decline under the facts of this case to find Appellant waived his right to withdraw his guilty plea. However, relying on the most recent pronouncements of our Supreme Court in Carrasquillo and Hvizda, we find no abuse of discretion on the part of the trial court in concluding, in the alternative, that Appellant failed to assert a plausible claim of innocence or to show that permitting withdrawal of the plea would promote fairness and justice herein. Appellant entered his guilty plea on September 22, 2015, yet he did not file his motion to withdraw his plea until November 2, 2015, the day before his scheduled sentencing. Therein, he simply averred “he is not - 17 - J-S86011-16 guilty of the alleged offenses,” and that “he was under great pressure and not thinking clearly when he entered his guilty pleas on the above referenced date.” See Motion for Withdrawal of Guilty Plea, filed November 2, 2015, at ¶ 3. Such assertions in a last minute motion to withdraw a guilty plea do not amount to a colorable claim of innocence or suggest Appellant should have been permitted to withdraw his plea in the interest of justice. To the contrary, prior to filing his motion, Appellant prepared a written colloquy, and the trial court conducted an extensive discussion with Appellant in response to the latter’s inquiry as to what his sentence might be. N.T. Guilty Plea, 9/22/15, at 5-6. During this time, the trial court explained to Appellant the potential for a life imprisonment sentence should a jury convict him of first-degree murder and the ramifications of the proffered plea agreement. N.T. Guilty Plea, 9/22/15, at 5-8. Therefore, we find the trial court did not abuse its discretion when it refused Appellant’s attempted withdrawal of his plea.10 ____________________________________________ 10 Because Appellant did not demonstrate this prerequisite, we need not consider whether the withdrawal of his plea would substantially prejudice the Commonwealth. See Carrasquillo, supra, 115 A.3d at 1293 n. 9. Notwithstanding, in reliance on the tendered pleas, witnesses and jurors who were present to participate in Appellant’s trial on September 22, 2015, were dismissed. Our Supreme Court has found substantial prejudice and affirmed the denial of a defendant’s pre-sentence motion to withdraw his guilty plea where the Commonwealth dismissed numerous key witnesses in reliance upon the plea. Commonwealth v. Ross, 498 Pa. 512, 447 A.2d 943 (1982). - 18 - J-S86011-16 Finally, in an argument which consists of just one statement, Appellant avers his sentence was excessive and that the trial court failed to consider his age, his expression of remorse and the psychological report he submitted in his post-sentence motion prior to sentencing. Upon noting it never had viewed Appellant’s brief and, therefore, could not discern whether the averments he made therein met the standard set forth in Pa.R.A.P. 2119(f), the trial court assumed, arguendo, the brief was not defective and that Appellant had raised a substantial question permitting appellate review. Notwithstanding, the trial court proceeded to determine this issue lacked merit and explained it properly had considered the Sentencing Guidelines, Appellant’s Pre-sentence Investigation (PSI) report, mitigating factors, and the circumstances surrounding the crimes when fashioning Appellant’s sentence which fell within the standard range of the Sentencing Guidelines. Upon our review, we find Appellant has waived this issue. A claim the trial court failed to consider mitigating factors implicates the discretionary aspects of one’s sentence.11 See Commonwealth v. Raven, 97 A.3d 1244, 1252 (Pa.Super. 2014) (a claim that the sentencing court failed to consider mitigating factors when imposing sentence is a ____________________________________________ 11 Open plea agreements do not preclude a defendant from appealing the discretionary aspects of his sentence. See Commonwealth v. Tirado, 870 A.2d 362, 365 n. 5 (Pa.Super. 2005). - 19 - J-S86011-16 challenge to the discretionary aspects of one's sentence). It is well-settled that a challenge to the discretionary aspects of one’s sentence must be treated as a petition for permission to appeal, as the right to pursue such a claim is not absolute. Id. When considering an appellant’s challenge to the discretionary aspects of his sentence, we conduct a four-part analysis to determine: (1) whether appellant has filed a timely notice of appeal, see Pa.R.A.P. 902 and 903; (2) whether the issue was properly preserved at sentencing or in a motion to reconsider and modify sentence, see Pa.R.Crim.P. [720]; (3) whether appellant's brief has a fatal defect, Pa.R.A.P. 2119(f); and (4) whether there is a substantial question that the sentence appealed from is not appropriate under the Sentencing Code, 42. Pa.C.S.A. § 9781(b). Commonwealth v. Moury, 992 A.2d 162, 170 (Pa.Super. 2010) (quotation marks and some citations omitted). Herein, Appellant disputed his sentence in a post-sentence motion and filed a timely appeal. However, Appellant’s brief fails to include the requisite Rule 2119(f) statement, and the Commonwealth has objected to this deficiency. “Because the Appellant failed to comply with Pa.R.A.P. 2119(f) and the Commonwealth objected to the omission, this Court may not review the merits of the claim[.]” Commonwealth v. Kiesel, 854 A.2d 530, 533 (Pa.Super. 2004).12 ____________________________________________ 12 Even had Appellant included the requisite Rule 2119(f) statement in his appellate brief, we would have found this claim waived for lack of (Footnote Continued Next Page) - 20 - J-S86011-16 Judgment of sentence affirmed.13 PJ Gantman and Judge Moulton concur in the result. Judgment Entered. Joseph D. Seletyn, Esq. Prothonotary Date: 2/17/2017 _______________________ (Footnote Continued) development. See Commonwealth v. Spotz, 610 Pa. 17, 157, 18 A.3d 244, 327 (2011). 13 “It is well-settled that an appellate court may affirm the decision of the trial court if there is any basis on the record to support the trial court's action. This is so even if we rely upon a different basis in our decision to affirm.” Commonwealth v. Harper, 611 A.2d 1211, 1213 n. 1 (Pa.Super. 1992) (citations omitted). - 21 -
FreeLaw
""" Components for "My playlists" page. """ import urwid from clay.gp import gp from clay.songlist import SongListBox from clay.notifications import notification_area from clay.pages.page import AbstractPage from clay.hotkeys import hotkey_manager class MyPlaylistListItem(urwid.Columns): """ One playlist in the list of playlists. """ signals = ['activate'] def __init__(self, playlist): self.playlist = playlist self.text = urwid.SelectableIcon(u' \u2630 {} ({})'.format( self.playlist.name, len(self.playlist.tracks) ), cursor_position=3) self.text.set_layout('left', 'clip', None) self.content = urwid.AttrWrap( self.text, 'default', 'selected' ) super(MyPlaylistListItem, self).__init__([self.content]) def keypress(self, size, key): """ Handle keypress. """ return hotkey_manager.keypress("playlist_page", self, super(MyPlaylistListItem, self), size, key) def start_playlist(self): """ Start playing the selected playlist """ urwid.emit_signal(self, 'activate', self) def get_tracks(self): """ Returns a list of :class:`clay.gp.Track` instances. """ return self.playlist.tracks class MyPlaylistListBox(urwid.ListBox): """ List of playlists. """ signals = ['activate'] def __init__(self, app): self.app = app self.walker = urwid.SimpleListWalker([ urwid.Text('Not ready') ]) self.notification = None gp.auth_state_changed += self.auth_state_changed super(MyPlaylistListBox, self).__init__(self.walker) def auth_state_changed(self, is_auth): """ Called when auth state changes (e. g. user is logged in). Requests fetching of playlists. """ if is_auth: self.walker[:] = [ urwid.Text(u'\n \uf01e Loading playlists...', align='center') ] gp.get_all_user_playlist_contents_async(callback=self.on_get_playlists) def on_get_playlists(self, playlists, error): """ Called when a list of playlists fetch completes. Populates list of playlists. """ if error: notification_area.notify('Failed to get playlists: {}'.format(str(error))) items = [] for playlist in playlists: myplaylistlistitem = MyPlaylistListItem(playlist) urwid.connect_signal( myplaylistlistitem, 'activate', self.item_activated ) items.append(myplaylistlistitem) self.walker[:] = items self.app.redraw() def item_activated(self, myplaylistlistitem): """ Called when a specific playlist is selected. Re-emits this event. """ urwid.emit_signal(self, 'activate', myplaylistlistitem) class MyPlaylistsPage(urwid.Columns, AbstractPage): """ Playlists page. Contains two parts: - List of playlists (:class:`.MyPlaylistListBox`) - List of songs in selected playlist (:class:`clay:songlist:SongListBox`) """ @property def name(self): return 'Playlists' @property def key(self): return 2 @property def slug(self): """ Return page ID (str). """ return "playlists" def __init__(self, app): self.app = app self.myplaylistlist = MyPlaylistListBox(app) self.songlist = SongListBox(app) self.songlist.set_placeholder('\n Select a playlist.') urwid.connect_signal( self.myplaylistlist, 'activate', self.myplaylistlistitem_activated ) super(MyPlaylistsPage, self).__init__([ self.myplaylistlist, self.songlist ]) def myplaylistlistitem_activated(self, myplaylistlistitem): """ Called when specific playlist is selected. Populates songlist with tracks from the selected playlist. """ self.songlist.populate( myplaylistlistitem.get_tracks() ) def activate(self): pass
Github
Sequence data are available from GenBank, Fishbol, and BOLD as indicated in the article text. Sequences longer than 200 bp were uploaded in GenBank (accession numbers: Germany KJ531289 to KJ531379; France KJ535741 to KJ535783; Spain KJ623816 to KJ623830; Portugal MF067430 to MF067499) and BOLD database in the case of COI sequences (UK and ROI KJ510424 KJ531384 and KJ563141-KJ645864). Introduction {#sec001} ============ Seafood fraud is more common than most consumers think and many studies have highlighted the fact that species substitution is especially frequent in certain seafood products, such as those labelled as Atlantic Bluefin tuna, European hake or Atlantic cod \[[@pone.0196641.ref001]--[@pone.0196641.ref003]\]. The consequences of this malpractice not only involve the economic deception of consumers \[[@pone.0196641.ref004]\], but may also have a negative impact on the sustainability of marine resources \[[@pone.0196641.ref005]\]. However, the diversity and number of fish commonly traded globally as seafood is so vast, that much remains to be done to understand the true ecological costs of mislabelling \[[@pone.0196641.ref006]\]. One of the essential elements in the fight against seafood fraud is legislation. European Union (EU) labelling regulations are aimed at providing information to consumers such as commercial and scientific names, thus assuring their traceability and identification throughout the value chain (EU 1379/2013), however in this regulation the type of fishery or aquaculture product determine the mandatory information required in the labels and, therefore, may decrease the expected effects \[[@pone.0196641.ref007]\]. Recent studies suggest that seafood mislabelling has generally decreased in European countries due to the existence and enforcement of these labelling regulations and the use of appropriate species identification methodologies \[[@pone.0196641.ref001],[@pone.0196641.ref008]\]. This can also be linked to the EU involvement in funding projects dealing with this problem from the very beginning of the EU framework programme \[[@pone.0196641.ref009]\], putting Europe at the forefront of the authenticity tests development, especially regarding seafood \[[@pone.0196641.ref010]\]. Tunas are among the most desirable marine fish worldwide, with a global tuna and tuna-like species catch that peaked at 7.7 million tonnes in 2014 \[[@pone.0196641.ref011]\]. Skipjack (*Katsuwonus pelamis*) and Yellowfin (*Thunnus albacares*) were the tuna species most captured with about 3 and 1.5 million tonnes, respectively \[[@pone.0196641.ref010]\]. In contrast, the captures of Bluefin tuna (three species: *T*. *thynnus*, *T*. *orientalis* and *T*. *maccoyii*) during the same period did not exceed 40,000 tonnes. The conservation status of the different tuna species and stocks is also variable but worrying: several stocks are overfished (31%) and near to that threshold (17%), whereas 52% remain at a healthy level of abundance \[[@pone.0196641.ref012]\]. However, market demand has not decreased and the tuna fishing fleet maintains their capacity \[[@pone.0196641.ref010]\]. Atlantic Bluefin tuna (*T*. *thynnus*) deserves special attention since the strong market demand on this species during the last decades nearly provoked a collapse in the populations, such as East Atlantic and Mediterranean, which forced the reduction of the total allowable catch (TAC) for the Mediterranean fishery since 2007. This measure allowed the recovery of the stock \[[@pone.0196641.ref013]\]. Since the most desirable species are not always available for the market, strong economic forces may result in some degree of substitution, fraud or mislabelling \[[@pone.0196641.ref014]\]. It is not easy to find a global mislabelling rate for tuna; different studies have shown different levels. In general, factors such as country, type of retailer, sampling target or year may explain these differences. Pardo et al. \[[@pone.0196641.ref015]\] suggest an average 18% misdescription for tuna, Gordoa et al. \[[@pone.0196641.ref016]\] found 37% of fresh and frozen tuna in Spain at points of sale and 48% in restaurants. In some other cases, these values were extremely high such as 95% found by Oceana in Brussels restaurants for Bluefin tuna \[[@pone.0196641.ref017]\]; however, studies have typically varied in their sampling strategies, and therefore remain poorly comparable. Transnational evaluation of seafood fraud could reveal trends among countries or geographic areas, which ultimately could help to design coordinated measures to reduce the global incidence of mislabelling. However, transnational studies are scarce; some examples were reported in North America, with samples taken from USA and Canada \[[@pone.0196641.ref018]\]. As part of the Labelfish project, 1563 seafood samples of different categories and processing degrees were collected across 19 cities and six European countries, revealing an average mislabelling rate of 4.93% for the European retail sector \[[@pone.0196641.ref007]\]. Later, in 2015 the EU Commission organised a coordinated plan to analyse 3906 samples of fish, mostly white fish, in 27 Member States and 2 EFTA (European Free Trade Association) Member States. These samplings and analyses resulted in identifying an overall mislabelling of white fish in Europe of 6% \[[@pone.0196641.ref019]\]. This study benefits from the previous Mariani et al. \[[@pone.0196641.ref007]\] sampling, focusing only in the tuna products. The objective was to gain deeper understanding of the patterns and drivers of tuna mislabelling across Europe by examining the factors affecting mislabelling rates of these products in six European countries. In particular, the analysed factors included the influence of processing and species labelling in mislabelling rates, and the type of substitution which characterizes the fraud in tuna products. Materials and methods {#sec002} ===================== Sampling {#sec003} -------- Commercial samples of tuna products were purchased in markets of 18 different cities in Europe belonging to 6 countries (France, Germany, Ireland, Portugal, Spain, and United Kingdom) between 2013 and 2014. Locations were chosen in order to have a good coverage and geographical replication for each country ([S1 Table](#pone.0196641.s001){ref-type="supplementary-material"}). In each city, the sampling was aimed to cover a wide metropolitan area and a wide range of types of retailers, including supermarkets, traditional markets and specialized fishmongers. When several products were purchased in a single store these were chosen with different brands or types of processing. The most abundant types of tuna products (fresh, frozen and canned tuna) have been sampled in all countries, while in some Southern regions in Europe (in Spain, Portugal and France), other types of convenience food containing tuna were also sampled and analysed, such as salads and precooked products. 545 samples were successfully analysed: 225 were fresh and frozen (unprocessed), 268 canned (processed) and 52 miscellaneous (processed). The number of samples analysed per country were: 87 in Spain, 71 in Portugal, 93 in France, 53 in ROI, 154 in UK, and 87 in Germany ([S1 Table](#pone.0196641.s001){ref-type="supplementary-material"}). Samples were obtained in their original packaging and were transported to the laboratory on the day of purchase, where they were stored at -20°C, or a small piece of tissue was removed and preserved in absolute ethanol. Packaging was retained or photographed and all label information was registered. Assessment of compliance with European seafood labelling legislation {#sec004} -------------------------------------------------------------------- Determination of tuna commercial products mislabelling was carried out taking into consideration the adequate European regulation: - (EC) No 852/2004 where it is established the definition of processed and unprocessed food (i.e. fresh and frozen tuna fall into the category of unprocessed fishery and aquaculture products, while canned tuna into the processed ones). - EEC 1536/92 where it is stated that preserved tuna and bonito must be prepared exclusively from certain fish species (i.e. tuna cans should contain only any *Thunnus* species or *Katsuwonus pelamis*), mixing of species is not allowed in each tin (unless muscular structure has disappeared), only commercial names are required - EU1379/2013 indicating the required information to be presented to consumers, among others commercial and scientific names (the latter except for canned and other prepared products such as salads). - Also, all member states have translated these European regulations into national legislation, the main aspect to be considered is the specific denomination that each country establishes to designate different tuna products, including fresh, frozen and canned tuna. A summary of these denominations is presented in [S2 Table](#pone.0196641.s002){ref-type="supplementary-material"}. DNA extraction, amplification and analysis {#sec005} ------------------------------------------ Sample screening involved five European laboratories with extensive experience in seafood authenticity. Each lab also carried out blind-sample ring trials to ascertain consistency of the methods used to identify fish species (full details of these experiments are presented in [S1 File](#pone.0196641.s008){ref-type="supplementary-material"}). A summary of the methods employed in this study is presented in [S3 Table](#pone.0196641.s003){ref-type="supplementary-material"}, where the specific DNA extraction commercial kits, primers used, molecular regions and size of the amplicons, DNA sequencing procedure and sequence analysis are indicated. Different mitochondrial DNA target regions were used in the laboratories involved in the study: cytochrome b, cytochrome oxidase I and control region. Tuna species in fresh and frozen products were identified using larger fragments, 464 bp for cytochrome b marker, 650 bp for cytochrome oxidase I and 450 bp for the control region marker \[[@pone.0196641.ref020],[@pone.0196641.ref021]\]. In the case of canned tuna most laboratories used cytochrome b markers of shorter size, 187 and 176 bp \[[@pone.0196641.ref009],[@pone.0196641.ref022]\], except for France, which used a short control region fragment of 150 bp \[[@pone.0196641.ref008]\]. Primers and PCR protocols are specified in [S4 Table](#pone.0196641.s004){ref-type="supplementary-material"}. Once checked by agarose electrophoresis in 1--2% agarose gels, PCR products were sequenced. Subsequent DNA sequence analysis was performed as indicated in [S3 Table](#pone.0196641.s003){ref-type="supplementary-material"}. Briefly, sequences were edited using Chromas (Technelysium), Bioedit \[[@pone.0196641.ref023]\] and GeneDoc \[[@pone.0196641.ref024]\] and matched against NCBI database using the nucleotide BLAST (Basic Alignment Search Tool) and the BOLD (Barcode of Life) database for the COI sequences \[[@pone.0196641.ref025]\]. Species were identified using a 99% minimum match criterion, with the exception of *Thunnus albacares* and *T*. *obesus*, where the threshold was 100% \[[@pone.0196641.ref026]\]. For an unequivocal identification, laboratories from Spain, France and Germany also constructed Neighbor-Joining trees using MEGA software \[[@pone.0196641.ref027]\] with their own reference sequences using Tamura-Nei distances. Sequences longer than 200 bp were uploaded in GenBank (accession numbers: Germany KJ531289 to KJ531379; France KJ535741 to KJ535783; Spain KJ623816 to KJ623830; Portugal MF067430 to MF067499) and BOLD database in the case of COI sequences (UK and ROI KJ510424 KJ531384 and KJ563141-KJ645864) Samples containing a different species than the one declared in the label were considered mislabelled. When only the commercial name was present, mislabelling records were obtained by following each country's list of approved commercial designation for tunas ([S2 Table](#pone.0196641.s002){ref-type="supplementary-material"}). When the scientific name was present, it was the one taken as a reference to compare with the analytical result. Statistical analysis {#sec006} -------------------- Software GraphPad Prism was used to perform pairwise comparisons between data sets using Chi-square with Yate's correction and correlation analysis for the dependence between number of samples and mislabelling rate. Results and discussion {#sec007} ---------------------- 545 tuna samples--of which 225 fresh & frozen, 268 canned and 52 miscellaneous (e.g. dried, roes, salads etc.)--were successfully sequenced and identified (for more detailed information about the results of previous tuna species identification ring trials see [S1 File](#pone.0196641.s008){ref-type="supplementary-material"}); 37 of them were mislabelled, making an overall mislabelling rate of 6.79% ([Fig 1](#pone.0196641.g001){ref-type="fig"}). This study is not only the largest sampling effort reported for tuna products but also one that involves six different European countries. Previously reported mislabelling rates for tuna were very variable, on average 18% \[[@pone.0196641.ref015]\], mainly because these rates may change over time and also because the type of retailer or provenance of samples influence dramatically the results obtained. The much lower value found here may be an indication of the impact of labelling legislation and control, the mass media coverage of food fraud with the consequence of consumer being more aware of food labels \[[@pone.0196641.ref008]\]. ![Collected samples and mislabelling rate for tuna seafood products across six European countries.\ Fig 1A: Number of collected samples and mislabelling rates (red bars) for all analysed tuna products in six European countries. Statistical differences are shown by letters, different letters indicate P\<0.05. Fig 1B: Number of collected samples and mislabelling rates (red bars) for fresh and frozen tuna products in six European countries. Statistical differences are shown by letters, different letters indicate P\<0.05. Fig 1C: Number of collected samples and mislabelling rates (red bars) for canned tuna products in six European countries.](pone.0196641.g001){#pone.0196641.g001} The mislabelling rate was not significantly different (Chi-square = 0.1045; df = 1; P = 0.3733) between fresh & frozen and canned tuna, 6.70% and 7.84%, respectively, while the miscellaneous products showed 1.92% mislabelling (not significative differences among them). Previous works have reported higher mislabelling rates, recently Gordoa et al. \[[@pone.0196641.ref016]\] have shown that fresh and frozen tuna in Spain was mislabelled up to 37% at points of sale, while in restaurants the mislabelling rate was even higher, 48%. In a previous report from Oceana \[[@pone.0196641.ref028]\], tuna samples obtained at different points of the value chain in different states of the USA showed that 58% of tuna products were mislabelled. However, this overall data may not be comparable directly, because the specific type of tuna products (i.e. species) have a relevant influence on the final mislabelling rate. [Fig 1A](#pone.0196641.g001){ref-type="fig"} shows that small differences between mislabelling rates were observed among Portugal, France, Ireland, UK and Germany (not significant), with France showing the lowest mislabelling rate of the study. On the other hand, Spain showed the highest mislabelling rates, with significant differences with those of France and UK (Chi-square = 3.0760; df = 1; P = 0.0397 and Chi-square = 3.2840; df = 1; P = 0.0350, respectively). However, these overall mislabelling rates did not reflect the mislabelling situation of different tuna products: i.e. while some products exhibited 1.92% mislabelling rate (for example the category "miscellaneous"), fresh and frozen tuna products were mislabelled at 6.70% ([Fig 1B](#pone.0196641.g001){ref-type="fig"}). In fact, we have observed significant differences for fresh and frozen tuna for Spain (25%) compared with Ireland (0%, Chi-square = 3.2250; df = 1; P = 0.0363), UK (3.7%, Chi-square = 7.3940; df = 1; P = 0.0033) and Germany (4.7%, Chi-square = 5.1300; df = 1; P = 0.0118). Canned samples presented an overall mislabelling rate of 7.84%, in this case differences in canned tuna among countries, ranging from 3.45% (France) to 13.04% (Germany) were not significant ([Fig 1C](#pone.0196641.g001){ref-type="fig"}). Additionally, no significant correlation was found between the number of samples taken in each country for each category or the seafood consumption ratio per habitant and the mislabelling rate (data not shown), therefore other factors should be considered when interpreting the results obtained. The analysis of the influence of the type of labelling in the final mislabelling rate can be observed in [Fig 2](#pone.0196641.g002){ref-type="fig"} and [S5 Table](#pone.0196641.s005){ref-type="supplementary-material"}. Although a significant correlation couldn't be established among the number of samples labelled as tuna and the mislabelling rate in a particular country (data not shown), the influence of sampling tuna product with Atlantic Bluefin tuna label can be clearly seen in the changes in mislabelling rates: when these products are excluded in the mislabelling rate calculation, the differences among countries were not significant. In fact, while overall mislabelling rate drops down to 1% in the case of labelling just tuna, it goes up (88%) in the case of Atlantic Bluefin tuna labelled products. These results agree with the results found by Vandamme et al. \[[@pone.0196641.ref029]\] that reported a low mislabelling rate for tuna in sushi of about 10%, but which rises up to 18% when tuna species is considered in the labelling. Likewise, Gordoa et al. \[[@pone.0196641.ref016]\] reported a 73% of mislabelling for Atlantic Bluefin tuna and points towards economic gain as the main reason for mislabelling tuna. Atlantic Bluefin mislabelling has been highlighted as an example of inverse relationship between low volume catches and high proportion of substitution; offer and demand do not match and the result is a very high mislabelling rate \[[@pone.0196641.ref030]\]. ![Mislabelling rate for fresh and frozen tuna seafood products across six European countries.\ Overall mislabelling rates (OVERALL MR) for fresh and frozen tuna products and mislabelling rate of products excluding those labelled as Atlantic Bluefin tuna (MR EXCLUDING ABFT) in six European countries. Statistical differences are shown by letters, different letter indicate P\<0.05.](pone.0196641.g002){#pone.0196641.g002} In the case of canned tuna, including species in the label provoked an increase in the mislabelling ([Fig 3](#pone.0196641.g003){ref-type="fig"} and [S6 Table](#pone.0196641.s006){ref-type="supplementary-material"}), and significant differences could be observed in overall values, from 1% mislabelling rate for Tuna labelling up to 10% mislabelling rates when species are indicated in the label (Chi-square = 4.381, p = 0.0182). General names such as tuna, which include any species of the genus *Thunnus* and *K*. *pelamis*, were associated with very low mislabelling rates (0%), while indicating the species in the can resulted in a higher mislabelling rate (17--60%) ([S6 Table](#pone.0196641.s006){ref-type="supplementary-material"}). In general, these mislabelling rates were lower than those found for fresh or frozen tuna products. ![Mislabelling rate for canned tuna seafood products across six European countries.\ Overall mislabelling rates (OVERALL MR) for canned tuna products and mislabelling rate of products with labels indicating species (MR INCLUDING SPECIES) in six European countries.](pone.0196641.g003){#pone.0196641.g003} Current labelling legislation in EU establishes the obligation to indicate commercial name and species in the case of fresh, frozen, smoked and dried seafood products (EU1379/2013). However, we have found many fresh and frozen tuna products, from 29% in Portugal up to 100% in Ireland, which were still labelled with the generic name tuna ([S5 Table](#pone.0196641.s005){ref-type="supplementary-material"}). Although we did not consider them mislabelled in this study, these results indicate a poor implementation of labelling rules across Europe. In the case of canned products, legislation allows the use of generic names, such as tuna, and as it can be seen here, samples with the generic name tuna have shown very low mislabelling rates. These differences in labelling requirements between fresh/frozen and canned tuna are difficult to understand from a consumer point of view as the same need for information should be required. In fact, the campaign "one fish, one name" advocates for the establishment of more specific names for every type of seafood product \[[@pone.0196641.ref031]\] and the main objective is to empower consumers to make more accurate purchasing decisions. The implementation of this approach will help to better protect resources and to fight illegal fishing practices. [Fig 4](#pone.0196641.g004){ref-type="fig"} and [S7 Table](#pone.0196641.s007){ref-type="supplementary-material"} show the type of substitution observed in the analysed samples. Frozen and fresh samples exhibited two main types of substitutions, affecting the products labelled as *T*. *albacares* and *T*. *thynnus*. In the case of *T*. *thynnus* (7 samples mislabelled), commercially labelled as Atlantic Bluefin tuna, thon Rouge or atún Rojo, the levels of substitution by *T*. *albacares* or *T*. *obesus* were similar (43%). More mislabelled samples were found for *T*. *albacares* (Yellowfin, thon Albacore, atun de aleta amarilla), in this case only one species, *T*. *obesus*, was found to substitute this species. In this latter case, unintentional substitution may take place due to occurrence of mixed schools of both species, which are very similar as juveniles \[[@pone.0196641.ref032]\], and can be captured at the same time. ![Tuna species identified in mislabelled samples.\ Fresh and frozen: tuna species identified in mislabelled fresh and frozen tuna samples. Canned: tuna species identified in mislabelled canned tuna samples. N: number of mislabelled samples, number in brackets indicates the number of samples where a particular tuna species was identified.](pone.0196641.g004){#pone.0196641.g004} In terms of species, substitution results in canned tuna were different from those of fresh and frozen tuna. Canned tuna labelled as Yellowfin, Light tuna, thon albacore and atún Claro were replaced by *T*. *alalunga* (50% of samples, all of them from Spain), *T*. *obesus* (20%, none of them were samples from Spain, national legislation allows in this country to label *T*. *obesus* as atún Claro) and *K*. *pelamis* (20% of the samples) and *E*. *alleteratus* (10%). This is an example of lack of coherence in the European legislation: in one country, it is permitted to label *T*. *albacares* or *T*. *obesus* as Light tuna (Spain), while in the other European countries is not allowed. One might expect that this may have an impact on the mislabelling rates found for Light tuna in Spain, however, mislabelling rates for this product were similar to other countries where only *T*. *albacares* can be used in Light tuna can production. The results shown in [S6 Table](#pone.0196641.s006){ref-type="supplementary-material"} indicate that percent of samples labelled generically as tuna has an impact in the mislabelling rate of the country for canned tuna, since this type of products present mislabelling rates close to 0%. Samples of *K*. *pelamis* were only relevant in UK, Germany, France and Ireland, while in countries like Spain and Portugal is very difficult to find canned tuna labelled as *K*. *pelamis*. In the case of *K*. *pelamis* labelled cans bought in the UK, all mislabelled samples were substituted by *T*. *albacares/T*. *obesus*. This type of substitution has been referred by some authors as reverse substitution, a cheaper species is substituted by an expensive one, and that may be an indication of hiding a product from a IUU fishery practice \[[@pone.0196641.ref016]\]. Another substitution was found in Germany where *T*. *alalunga* was substituted by *K*. *pelamis*. These results may indicate that different value chains, fresh/frozen tuna and canned tuna rely in different providers of raw material, besides the cultural aspects of each particular market (i.e. Spanish consumers value light appearance meat in canned tuna while this feature may be not as relevant in other European markets). It has been reported that identification of the *Thunnus* species with mtDNA markers may present some problems due to low interspecific variability and introgression issues. One of the problems is the low genetic distance found between *T*. *alalunga* and *T*. *orientalis*. There is also a low percentage of specimens of Atlantic Bluefin Tuna (ABFT) which exhibit almost the same sequence as Pacific Bluefin Tuna (PBFT) using some mtDNA markers and vice versa \[[@pone.0196641.ref026]\]. However, in our samples there were not any of these cases (i.e. a sample labelled as ABFT but being identified as PBFT) and although the current legislation would consider this example mislabelled (fresh and frozen tuna) this problem does not affect our mislabelling results. There is also introgression between ABFT and *T*. *alalunga*, 2--3% of ABFT specimens showing mitochondrial sequences of *T*. *alalunga*, but again we did not find any samples with this situation. Therefore, we conclude that in the present study these issues are not affecting our mislabelling results. After looking into tuna product labelling across a significant portion of the largest global player in seafood trade (i.e. the European Union), it is apparent that this high-demand and widely marketed food category epitomises all the key challenges of global seafood sustainability and traceability. First, most of the products rely on catches from distant and/or tropical waters and a range of processing avenues, all of which poses the logistic challenges of a long and complex supply chain. Secondly, "tuna" is one of the general "umbrella" terms under which many species with diverse biological traits continue to be traded, especially in geographic areas exporting high volumes of seafood to Europe \[[@pone.0196641.ref033]\]. Collectively, the opportunities for species substitution, be it for deliberately maximising financial gain or through sheer logistic errors/mismanagement, remain high; so does the exposure of consumers to a lack of transparency that prevents environmentally conscious purchasing decision and/or may result in inadvertent consumption of unhealthy products (e.g. high heavy metal content, \[[@pone.0196641.ref034]\]). Progress in this area can be achieved through a robust international policy of accurate species-level labelling and coordinated governance efforts. Supporting information {#sec008} ====================== ###### Tuna samples collected in six European countries between 2012 and 2014. (DOCX) ###### Click here for additional data file. ###### Commercial denominations of tuna in EU and six member states (ES, PT, UK, ROI, FR, GER). (DOCX) ###### Click here for additional data file. ###### DNA analysis methods used in this study by the participant laboratories. (DOCX) ###### Click here for additional data file. ###### Primers sequences and PCR protocols used in the study. (DOCX) ###### Click here for additional data file. ###### Number of samples of fresh and frozen tuna analysed and mislabelling results split by type of label. (DOCX) ###### Click here for additional data file. ###### Number of samples of canned tuna analysed and mislabelling results split by type of label. (DOCX) ###### Click here for additional data file. ###### Species which appear as substitute in the mislabelled samples. (DOCX) ###### Click here for additional data file. ###### Tuna species identification ring trials. (DOCX) ###### Click here for additional data file. We acknowledge Anxela Aldrey, Roswitha Koch and Rainer Kündiger for their technical assistance. The work was funded by LABELFISH project, supported by the EU Atlantic Area Programme Project Number 2011-1/163 and the UK Department for Environment, Food & Rural Affairs grant FA0116. [^1]: **Competing Interests:**The authors have declared that no competing interests exist.
PubMed Central
Precious and Few "Precious and Few" is a song recorded by American group Climax which became a major North American hit in early 1972. Written by the band's guitarist, Walter D. Nims, it spent three weeks at number three on the U.S. Billboard Hot 100 and hit number one on the Cash Box Top 100. It also reached number six on Canada's RPM 100. Lead vocals were provided by Sonny Geraci, who also sang lead on "Time Won't Let Me" by his previous band, The Outsiders. Nims had also been a member of The Outsiders. "Precious and Few" had originally been released on Carousel Records in 1971. The song featured The Ron Hicklin Singers as backing vocalists, a piano, drums, strings and a horn section. Cover versions Filipino music group The Company covered the song, released in 1999. Chart performance Weekly charts Year-end charts References External links Lyrics of this song Category:1971 songs Category:1971 debut singles Category:Climax (band) songs
Wikipedia (en)
[The expression of Cyclin D1 modulated by somatotropin on human pancreas cancer cell lines Bxpc-3]. To observe the growth effect of somatostapin on human pancreas cancer lines Bxpc-3. The Bxpc-3 pancreas cancer cells were treated with Somatotropin. The cells hyperplasia were detected by MTT and were observed apoptosis cells determinated quantitatively by TUNEL, quantify immune fluoresence double marked the proliferation cells and apoptosis cells, the expression of Cyclin D1 detected by immunohistochemical. The growth effect of pancrea cancer cells were limited by 10(-7) M, 10(-8) M, 10(-9) M Somatotropin on 2 day. The limited effect was decreased from 3 day. The cells proliferation were increased by somotostapin on 4day to 5day. The relationship between the expression of Cyclin D1 and apoptosis was negative correlation and the cells hyperplasia was positive correlation in Bxpc-3 cell line. From the cell study we knew the expression of Cyclin D1 reflected the prolefiration of pancreas cancer cells.
PubMed Abstracts
47 Md. App. 202 (1980) 422 A.2d 389 MARCIA S. DECKER v. GERALD H. FINK. No. 246, September Term, 1980. Court of Special Appeals of Maryland. Decided November 12, 1980. The cause was argued before THOMPSON, MOORE and LISS, JJ. Donald P. McLaughlin, with whom were Powers & McLaughlin on the brief, for appellant. William A. Ehrmantraut, with whom were Kenneth *203 Armstrong and Donahue, Ehrmantraut & Montedonico, Courtland K. Townsend, Jr., and Mannes, Meyers, Nadonley, Townsend & O'Brien on the brief, for appellee. LISS, J., delivered the opinion of the Court. In April, 1965, Marcia J. Decker, appellant, then age twenty-nine, consulted Dr. Gerald H. Fink, appellee, a practicing psychiatrist, for assistance for certain mental and emotional problems she was then experiencing. The appellant commenced a course of psychotherapy treatments which required weekly fifty minute visits to the doctor's office located in his residence. Appellant subsequently went into psychoanalysis, a more intense form of treatment, which required four visits a week. Treatment consisted of the appellant lying on a couch and relating to the appellee her innermost thoughts, emotions, dreams, desires and conflicts, the objective being to resolve these conflicts through the process of analysis. On March 7, 1977, appellant filed, in the Circuit Court for Montgomery County, a one count declaration against the appellee, claiming medical malpractice and alleging that during the course of psychoanalysis at the doctor's office he improperly manipulated the analysis for the purpose of engaging in sexual relations with the appellant, and that as a result of the appellee's actions, the appellant's mental and emotional condition worsened. The appellee filed a general issue plea and a special plea of limitations. The appellee denied a sexual relationship ever existed between the appellant and himself at any time and contended further that his professional treatment of the appellant terminated in December, 1971. On January 7, 1980, a jury trial of the case began, and at the close of appellant's case, appellee moved for a directed verdict on the grounds that the patient-physician relationship terminated in December of 1971, or alternatively, that the appellant knew or reasonably should have known of the appellee's alleged malpractice before March, 1974. The trial judge granted appellee's motion for a *204 directed verdict on March 17, 1980 finding as a matter of law that the appellant knew or in the exercise of reasonable diligence should have known of the alleged malpractice of the appellee in May of 1973, and that the appellant's declaration filed in March of 1977 was barred by limitations. It is from this judgment that appellant has filed the instant appeal. Appellant raises two questions for determination by this appeal: 1. Whether the impairment of appellant's judgment which she contends resulted from the transference phenomenon during the course of the psychoanalysis by the appellee was sufficient to toll the running of the statute of limitations? 2. Whether the trial court erred in ruling as a matter of law that the appellant knew or in the exercise of reasonable diligence should have known of the alleged malpractice of the appellee in May of 1973, and that the claim of appellant filed in March of 1977 was barred by limitations? 1. Appellant offered testimony of experts that an essential element of successful psychoanalysis is the creation of a special relationship recognized in the field of psychiatry as the transference phenomenon. That phenomenon, she contends, gives rise to an emotional reaction by the patient to the analyst which produces an ancient and subconscious parent-childlike relationship, as a result of which the patient is freed of the necessity to interact with the analyst on the level of an adult face-to-face relationship, and the patient is thus permitted to focus on her innermost thoughts and feelings which may then become subject to free association and lead to the resolution of the patient's emotional conflicts. Inherent in the transference neurosis is the development of a strong dependence by the patient upon the analyst and an extraordinary faith and trust in him which may frequently develop into a love relationship and *205 which can deprive the patient of her independent judgment and ability to distinguish the reality of her interaction with the analyst and vice versa. Further, such a phenomenon renders the patient vulnerable and susceptible to the influence and suggestion of the analyst. Appellant testified that after receiving psychotherapy and psychoanalysis from the appellee from April, 1965 to February, 1971, appellee commenced a sexual relationship with her during each and every visit to his office thereafter until the end of the summer of 1975. Early in 1971, appellee suggested that treatment be concluded at the end of that year. Regular treatment was, in fact, terminated at that time. Appellant testified that due to her strong feelings for the appellee and her emotional and psychological dependence on him because of the transference phenomenon, she was in a state of confusion and anxiety which caused her to consult another psychiatrist whom she saw from April to September of 1973. She told the new psychiatrist of the treatment and relationship between the appellee and herself. She was advised not to continue in psychoanalysis with the appellee, and that treatment of that nature could not be beneficial so long as she continued a sexual relationship with the appellee. She was referred to still another psychoanalyst whom she saw three or four times during the summer of 1973 and to whom she also related her experiences with the appellee. She was advised to continue analysis but with a female physician. She continued analysis with the female doctor from September, 1973 until August, 1976. In the meantime, appellant testified, she continued to see the appellee's at his office through the summer of 1975 and psychoanalysis and sexual activity continued at the appellee's office until that time. Appellant stopped treatment with the female physician in August of 1976 and filed suit against the appellee on March 7, 1977. Maryland Code, Courts and Judicial Proceedings Article, Section 5-101 (1980) provides "a civil action at law shall be filed within three years from the date it accrues...." The statute of limitations as adopted by the Legislature of the State of Maryland reflects what is deemed an adequate *206 period of time in which a "person of ordinary diligence" should bring his action. Walko Corp. v. Burger Chef Systems, Inc., 281 Md. 207, 378 A.2d 1100 (1977). The legislative policy underlying statutes of limitation include the encouragement of promptness in instituting actions, the suppression of stale or fraudulent claims, and most of all, the providing of the elements of fairness to defendants. Judge Levine, quoting from Chase Securities Corp. v. Donaldson, 325 U.S. 304, 314, 65 S.Ct. 1137 (1945), in Walko, supra, said: Statutes of limitation find their justification in necessity and convenience rather than logic. They represent expedience, rather than principles. They are practical and pragmatic devices to spare the courts from litigation of stale claims, and the citizen from being put to his defense after memories have faded, witnesses have died or disappeared, and evidence has been lost.... They represent a public policy about the privilege to litigate. [281 Md. at 210.] Statutes of limitation are to be strictly construed, the courts refusing to give such statutes a strained construction to evade their effect. See McMahan v. Dorchester Fertilizer Co., 184 Md. 155, 40 A.2d 313 (1944). There are exceptions to the general statutory three year limitation period which are contained in Section 5-101 of the Courts and Judicial Proceedings Article. Two exceptions are statutory and are found in Sections 5-201 and 5-203. Section 5-201 states, in pertinent part, as follows: Persons under a disability. (a) Extension of time. — When a cause of action subject to a limitation under Subtitle 1 accrues in favor of a minor or mental incompetent, that person shall file his action within the lesser of three years or the applicable period of limitations after the date the disability is removed. *207 The statutory disabilities which toll the statute are infancy or lunacy. Rettaliata v. Sullivan, 208 Md. 617, 119 A.2d 420 (1956). It is generally recognized that a person may be under the legal disability of insanity, or unsoundness of mind, within the meaning of the exception to the statute of limitations, when the disability is of such a nature as to show him unable to manage his business affairs or estate, or to comprehend his legal rights or liabilities. Roberts v. Stith, 383 P.2d 14 (Okla. 1963); Hurd v. County of Alleghany, 39 App. Div.2d 499, 336 N.Y.S.2d 952 (1972). The term "disability" as used in the applicable Maryland statutes has been held to mean "... the general disability of lunacy or infancy as to the care of property and the safeguarding of rights." Funk v. Wingert, 134 Md. 523, 527, 107 A. 345 (1919). In McDonald v. Boslow, 363 F. Supp. 493 (D. Md. 1973), the plaintiff, while confined at the Maryland Patuxent Institution, brought a Civil Rights Act suit against the director of Patuxent and others alleging violation of his constitutional rights, particularly infliction of cruel and unusual punishment in the nature of beatings and denial of medical attention. The court, applying Maryland law in granting the defendant's motion to dismiss, held that commitment of the plaintiff to Patuxent Institution did not constitute an adjudication of non compos sufficient to toll the statute of limitations. The court in analyzing the disability exception to the statute of limitations stated: In short, the purpose ... behind Art. 57, Section 2 [Section 5-201 of the Courts Article] is, the protection of those who suffer from a debilitating incapacity to such an extent as to render them incapable of caring for themselves or their property, and as to render their assent to a contract nugatory. It is to that class of individuals to which the benefit of a tolling of the statute of limitations was addressed, i.e., that group of individuals whose cognitive functioning was so severely impaired as to render them incapable of husbanding a presently existing, known right. [363 F. Supp. at 496.] *208 Appellant seeks to have this Court add the category of "impaired judgment" to the list of disabilities which will toll the running of the statute of limitations. She offers no authority for that proposition, nor have we been able to find such authority. Even if there were such authority, the factual testimony of the three psychiatrists who treated the appellant during 1973 does not support her contention that she was the victim of impaired judgment which prevented her from realizing that she had a malpractice action against the appellee. Dr. Gross testified that when he saw the appellant she was not psychotic, not hallucinating, but could make decisions. In his professional analysis of the appellant's mental condition, he said: Q. Now, when she came to you, as I understand it, there was no disassociation, no lack of touch with reality and she was able to make decisions on her own, is that correct? A. Yes, basically. Q. I don't want to be just qualified by your term basically. Isn't this what you testified to in your deposition on page 5: "what about decision-making? Was she able to in your opinion, able to make decisions regarding her own welfare, her interests, and things of that nature?" and your answer was "yes." Wasn't that your testimony at that time? A. I presume it was. * * * * Q. You had mentioned on direct examination that you performed a mental status exam, is that correct? A. Yes. Q. And let me correct — you can correct me if I'm wrong, but your mental status exam, as I understand your testimony, indicated she had no delusions, no hallucinations, that she could *209 relate with people well or good I think was your expression, that she was in touch with reality, could make decisions. Is there anything else you want to add to that? A. No. The record extract discloses that essentially similar testimony as to the appellant's medical and mental condition was given by the other two psychiatrists who saw and treated the appellant in 1973. Appellant's impaired judgment, if it existed, is not sufficient legal justification for failing to file her medical malpractice claim against the appellee within the time allowed by the statute of limitations. 2. Section 5-203 of the Courts Article provides for an exception to the general statutory period in those instances where a party is kept in ignorance of a cause of action by the fraud of an adverse party. That exception is not applicable in this case, and we shall therefore not discuss the legal principles governing those circumstances. The Court of Appeals enunciated an exception to the strict construction of the limitation statute in the medical malpractice case of Hahn v. Claybrook, 130 Md. 149, 100 A. 83 (1917). In that case, the Court adopted the "discovery test" which provides that the statute begins to run from the time of the discovery of the alleged injury or when it should have been discovered by the exercise of due diligence. The discovery exception has been frequently applied in medical malpractice cases in this State since that time. The rule is that when there is a continuing course of treatment the statute does not begin to run until the treatment is terminated. A corollary to this rule is that, if during the course of treatment, the patient learns or should reasonably have learned of the injury sustained by the patient then the statute runs from the time of knowledge actual or constructive. Waldman v. Rohrbaugh, 241 Md. 137, 215 A.2d *210 825 (1966); Jones v. Sugar, 18 Md. App. 99, 305 A.2d 219 (1973).[1] As we stated in Jones, There is no doubt but that in medical malpractice cases in this jurisdiction, the limitation period starts to run when the patient discovers, or by reasonable diligence should have discovered, the negligent act which caused his injury, or in other words that he may have the basis for an actionable claim, whether or not there is a continuing course of treatment. [18 Md. App. at 105.] There is no statutory definition of when a medical malpractice cause of action accrues, and in the absence of such a definition the resolution of that question is left to judicial determination. Goldstein v. Potomac Electric Power Co., 285 Md. 673, 404 A.2d 1064 (1979); Harig v. Johns Manville Products Corp., 284 Md. 70, 394 A.2d 299 (1978); James v. Weisheit, 279 Md. 41, 367 A.2d 482 (1977). In Jones, supra, we cited the philosophy which required the establishment of the discovery rule and the role of the trial judge in applying the rule. Quoting from Lopez v. Sawyer, 62 N.J. 267, 271, 300 A.2d 563 (1973), we said: The discovery rule is essentially a rule of equity. It has been said that in equity lies its genesis. [Citation omitted.] Like so many other equitable doctrines it has appeared and is developing as a means of mitigating the often harsh and unjust results which flow from a rigid and automatic adherence to a strict rule of law. On the face of it, it seems inequitable that an injured person, unaware that he has a cause of action, should be denied his day in court solely because of his ignorance, if he is otherwise blameless.... It may also be unjust, however, to compel a person to defend a lawsuit long after the alleged injury has occurred, when memories have faded, witnesses have died, and evidence has been lost. After all, *211 statutes of limitation are statutes of repose and the principal consideration underlying their enactment is one of fairness to the defendant. [Citation omitted.] So in each case the equitable claims of opposing parties must be identified, evaluated and weighed. Where, as is often the case, they cannot be wholly reconciled, a just accommodation must be reached. We think this can better be done by a judge than a jury. [18 Md. App. at 105-06, n. 4.] Appellant contends the law governing the granting of a motion for directed verdict to be from Campbell v. Jenifer, 222 Md. 106, 159 A.2d 353 (1960): [The] Court must ... resolve all conflicts in the evidence in favor of the plaintiff and assume the truth of all evidence and such inferences as may naturally and legitimately be deduced therefrom which tend to support the right of the plaintiff to recover. Or, as it is often stated the evidence must be considered in the light most favorable to the plaintiff. [222 Md. at 110.] Generally that would suffice; however, in Moy v. Bell, 46 Md. App. 364, 368-69, 416 A.2d 289 (1980), we pointed to an added dimension when such motion is predicated upon a purely legal question (such as limitations) which would end the case if, from the plaintiff's own case, that issue is found factually to apply. In such instance the judge becomes the factfinder for purposes of determining the applicability of the statute of limitations and we may not set aside his factual findings unless he was clearly in error. Id. at 369; Md. Rule 1086. Applying that standard, there was evidence before the trial court to establish that in May, 1973 the appellant knew or should have known that the appellee's alleged treatment of her and his alleged sexual involvement with her was grossly unprofessional, improper, and harmful to her mental and emotional well being. Appellant admitted that she was so advised at the time she discussed her situation with each of the three psychiatrists with whom she met. The psychiatrist who treated her from April until *212 September of 1973 testified that he informed her in May of 1973 that a sexual relationship with the appellee was inappropriate conduct, that she should not continue seeing the appellee, and that she should terminate the relationship. He stated that in his opinion such conduct on the part of the appellee, if it occurred, was a violation of medical standards. When asked if the appellant was able to understand the ramifications of continuing the relationship and his advice to terminate it, he testified that appellant understood and appreciated what he was saying. The trial judge had evidence before him that the appellant knew or should have known in May of 1973 that the alleged sexual relationship between appellee and appellant was inappropriate medical conduct and was detrimental to her mental health and well being. Once this was established, there was no legal excuse for her failure to enter her medical malpractice action against the appellee until ten months beyond the expiration of the three year limitation period. Judgment affirmed, costs to be paid by appellant. NOTES [1] United States v. Kubrick, 444 U.S. 111, 100 S.Ct. 352 (1980).
FreeLaw
Yeah, so, Reddit has mostly gone dark. Not in the sense that anti-Internet freedom government entities have nefariously blocked all or most of the site — nothing like that. No, Reddit’s current predicament is user-generated. As BuzzFeed‘s Ryan Broderick reports, major subreddits were suddenly rendered private by their moderators on Thursday night. That’s because Reddit fired Victoria Taylor, who’s popularly known on the site as u/chooter. Taylor, who worked as Reddit’s director of communications, helped the r/IAMA subreddit — which has conducted incredibly popular Q&A’s with presidents and criminals alike. As moderator “karmanaut” explains, “we learned that Victoria was unexpectedly let go from her position with Reddt. We all had the rug ripped out from under us and feel betrayed.” No particular reason was given for Taylor’s termination, and while such information is relevant only to Reddit’s in-house staff, that it happened so abruptly and without any communicated warning to the r/IAMA mods is what pissed off karmanaut. So they made r/IAMA private, rendering it unreadable to all but a few users. To make matters worse, several other popular subreddits followed suit. Unsurprisingly, Redditors assumed Taylor’s firing was another unpopular part of interim CEO Ellen Pao‘s plan, so they filed a Change.org petition calling for her resignation. As of this writing, it has 15,750 signatures of the required 25,000. Meanwhile, Reddit co-founder Alexis Ohanian — another target of angry Redditors — hasn’t done much to alleviate the situation. If anything, he’s made it worse: Reddit founder Alexis Ohanian last night in response to the drama surrounding r/IAmA: “Popcorn tastes good.” pic.twitter.com/lBsbV0kNS0 — Ryan Broderick (@broderick) July 3, 2015 He tried to make up for his comments later, but to no avail: “I made two dumb joke comments in SRD, which I admit were dumb,” Ohanian wrote this morning about his popcorn post pic.twitter.com/PCORArlvKr — Ryan Broderick (@broderick) July 3, 2015 Meanwhile, behind the scenes, Ohanian and the Reddit administration are trying to lay down the law with the r/IAMA mods: Ohanian in apparently private post on r/modtalk: “Get the blacked out subreddits back online” https://t.co/BSLPjVutOm pic.twitter.com/HK3lO8muJh — Ryan Broderick (@broderick) July 3, 2015 So yeah. Reddit has, for the most part, gone dark. Internet content writers like myself, as well as those of you who read it while wasting time at work, are supposedly struggling to find things to write about. (Honestly, we’re doing just fine.) But if you really want a alternative time-suck to Reddit, you’re not alone. “Reddit alternative” is trending on Google in a big way. [h/t BuzzFeed] [Image via Reddit] — — >> Follow Andrew Husband (@AndrewHusband) on Twitter Have a tip we should know? [email protected]
OpenWebText2
Ingersoll Lockwood Ingersoll Lockwood (2 August 1841 – 30 September 1918) was an American lawyer and writer. As a writer, he is particularly known today for his Baron Trump children's novels. However, he wrote other children's novels, as well as the dystopian novel, 1900: or; The Last President, a play, and several non-fiction works. He wrote some of his non-fiction under the pseudonym Irwin Longman. Life and legal career Lockwood was born in Ossining, New York, the son of Munson Ingersoll and Sarah Lewis (née Smith) Lockwood. Munson Lockwood, like his two older brothers, Ralph and Albert, was a lawyer and intimate friend of Henry Clay. However, Munson primarily achieved prominence as a military man and civic activist. He was a general in the New York State Militia and commandant of its 7th Brigade. A great admirer of the Hungarian statesman and freedom fighter Lajos Kossuth, Munson actively raised funds for him in New York. He was also one of the founders of Ossining's first bank and Dale Cemetery and served as the Warden of Sing Sing prison from 1850 to 1855. Like his father and uncles, Ingersoll Lockwood also trained as a lawyer, although his first position was as a diplomat. In 1862 he was appointed Consul to the Kingdom of Hanover by Abraham Lincoln. At the time he was the youngest member of the US consular force and served in that post for four years. On his return he established a legal practice in New York City with his older brother Henry. By the 1880s Lockwood had established a parallel career as a lecturer and writer. In 1884, he married Winifred Wallace Tinker, a graduate of Vassar College and aspiring author. They were divorced in 1892. That same year she married Edward R. Johnes, a lawyer by profession and a literateur by avocation. He was described in Current Literature as Winifred's "kind and most sympathetic literary advisor." Lockwood spent his retirement years in Saratoga Springs, New York where he published his last book, a collection of poetry entitled In Varying Mood, or, Jetsam, Flotsam and Ligan in 1912. It opens with juxtaposed photographs of Lockwood at age 35 and at age 70. In the preface, he wrote: The end has almost come. I'm only waiting for the signal to push off and begin my voyage to the Isles of the Blest in the far Western Seas. I was troubled in my mind at first, for my little bark, staunch though it may be, sat too deep in the water. It was overladen with conceits that wouldn't be current and merchandise that wouldn't be saleable in the Isles of the Blest. Overboard with it! Now that I have lightened ship I feel better. Lockwood died in Saratoga Springs five years later at the age of 77. Notes References External links Category:1841 births Category:1918 deaths Category:People from Ossining, New York Category:People from Saratoga Springs, New York Category:19th-century American novelists Category:19th-century American male writers Category:New York (state) lawyers Category:Writers from New York (state) Category:19th-century American lawyers
Wikipedia (en)
Tag: recycling Computer system encompasses three major elements particularly, hardware, software and humanware. Each of these parts closely will depend on the other two so as to enable meaningful usability. If installed individually, they could be helpful elsewhere, probably, however redundant in reaching significant processing tasks. The greatest manner is to get a can of compressed air from your local hardware shop or computer store and spray short bursts of compressed air into dirty or dusty space’s particularly into the large CPU fan which might build dust in a short time. If you do not have an air compressor or compressed air can you possibly can simply clean your computer case out with a brush making sure to be mild on the pc components. The motherboard is the physique or mainframe of the pc, via which all other components interface It is the central circuit board making up a complex digital system. …
Pile-CC
Q: Xcode: "The working copy ____ has uncommitted changes" vs. git status: "nothing to commit, working directory clean" In Xcode 5.0.2, I try to pull from a remote and am given the following message: "The working copy 'project-name' has uncommitted changes. Commit or discard the changes and try again." Fair enough. I pull up the commit dialog, and am then given the message, "This file does not exist at the requested revision." Clicking 'OK' brings me on into the commit dialog. (There is no revision displayed in the right pane, presumably for the same reason I was given the most recent message.) Selecting the flat view, I see that there is only one modified file: project.pbxproj. I enter a commit message and click 'Commit 1 File'. When I then go to pull, I find that I am in exactly the same position as before--the same messages appear and I am unable to pull (or push) no matter how many times I make a commit. Curious, I run git diff to see just what has changed. Nothing. git status provides me with equally helpful output: nothing to commit, working directory clean. git push or git pull? Yep, those work just fine from the command line. So what gives? Why does Xcode insist that I have changes in my working directory? Why won't it tell me what they are? Have tried restarting Xcode and system. While I'm happy that I still have some way to push and pull, it would be really nice if the Xcode git integration was behaving nicely. Any ideas? I've found these similar questions, but none address this particular issue (or provide an acceptable solution): Cannot push, pull or merge git. "Working copy has uncommited changes" Commit or discard the changes and try again Git pull fails: You have unstaged changes. Git status: nothing to commit (working directory clean) Xcode Version Controll GIT - has uncommitted changes, just after commit Xcode says "Uncommitted Changes" Whenever I try to git pull or push A: Okay, so I fixed my issue. With Xcode open: Open terminal - cd / to your project directory. Type in: "git reset --hard" Type in git status Restart Xcode and make a commit (Just a comment or something ) Repeat the above steps. This sorted out my issue for me. A: You must fix it with command line git. Go to your working folder in Terminal, type: git status That will show you what files have uncommitted changes. Crashlytics, for instance, will update itself as soon as you run it, and even using Xcode/Source Control/Discard Changes won't get rid of it. Once you see the files that have uncommitted changes (ignore added files), use: git checkout -- Folder/filename.ext That's the same as a "discard" in Xcode. After you've done that, go back to Xcode and you should be able to switch branches.
StackExchange
Q: Are space and time hierarchies even comparable? I am wondering if there are any results to what extent the space and time hierarchies "disagree" on which problem is harder. For example, is it known whether there are languages $L_1$ and $L_2$ such that $L_1 \in \DeclareMathOperator{TIME}{TIME} \TIME(f(n))\setminus SPACE(g(n)),L_2\in \DeclareMathOperator{SPACE}{SPACE} \SPACE(g(n)) \setminus \TIME(f(n))$? How often does this occur? P.S.- The question Function with space-depending computation time seems to ask something similar but was worded confusingly and none of the answers seem to be what I'm looking for. A: You can get the situation you describe by choosing weird functions $f(n)$ and $g(n)$. For example, let $g(n) = n^3$ and $$f(n) = \begin{cases} n & \text{if $n$ is odd}, \\\ 2^{n^5} & \text{if $n$ is even}. \end{cases} $$ Then choose $L_1$ and $L_2$ as follows: $L_1$ is a language containing only strings of even length which can be decided in time $O(2^{n^5})$ but not in time $O(2^{n^4})$. The existence of such a language is pretty easy to prove from the time hierarchy theorem. $L_2$ is a language containing only strings of odd length which can be decided in space $O(n^3)$ but not in space $O(n^2)$. The existence of such a language is pretty easy to prove from the space hierarchy theorem. Then we have the following facts: $L_1 \in TIME(f(n))$: To decide whether a string is in $L_1$, simply check whether the length $n$ is even. If it is, then continue to use the $O(2^{n^5})$ time decider for $L_1$ whose existence is guaranteed by the definition of $L_1$. If $n$ is odd, immediately reject since $L_1$ does not include any odd length strings anyway. This procedure decides $L_1$, runs in time $O(n)$ when $n$ is odd, and runs in time $O(2^{n^5})$ when $n$ is even. In other words, this procedure decides $L_1$ in time $O(f(n))$. As desired, $L_1 \in TIME(f(n))$. $L_2 \in SPACE(g(n))$: By the definition of $L_2$, $L_2$ can be decided in space $O(n^3)$. Thus, $L_2 \in SPACE(n^3) = SPACE(g(n))$, as desired. $L_1 \not\in SPACE(g(n))$: Suppose for the sake of contradiction that $L_1 \in SPACE(g(n)) = SPACE(n^3)$. We know that $SPACE(n^3) \subseteq TIME(2^{O(n^3)}) \subsetneq TIME(2^{n^4})$. Thus, there exists a decider for $L_1$ which runs in time $O(2^{n^4})$. This directly contradicts the definition of $L_1$. Then by contradiction, we see that $L_1 \not\in SPACE(g(n))$. $L_2 \not\in TIME(f(n))$: Suppose for the sake of contradiction that $L_2 \in TIME(f(n))$. This means that there exists a constant $c$ and an algorithm $A$ deciding $L_2$ such that on any input of size $n$, algorithm $A$ terminates in time $c\times f(n)$. We construct a new algorithm $A'$ as follows: given some input, walk through the entire input, keeping track of whether the input length is even or odd; if at the end of the input the length is determined to be odd, return to the start of the input and run $A$; otherwise, reject. For any input of odd length, $A'$ returns the same answer as $A$. For any input of even length, $A'$ rejects, which matches the expected behavior since $L_2$ contains no even length strings. Thus, $A'$ also decides $L_2$. On even length inputs, $A'$ runs for exactly $n$ steps. On odd length inputs, $A'$ runs for exactly $2n$ steps more than $A$ requires. But $A$ requires at most $c\times f(n)$ steps, which for odd $n$ is $cn$. Thus, in all cases, $A'$ runs in at most $(c+2)n$ steps. In other words, algorithm $A'$ decides $L_2$ in time $O(n)$. But since $TIME(n) \subseteq SPACE(n)$, we can conclude that $L_2 \in SPACE(n) \subsetneq SPACE(n^2)$. This contradicts the definition of $L_2$. Thus, by contradiction we see that $L_2 \not\in TIME(f(n))$.
StackExchange
Q: Get output outside the ajax call I'm using the libraby request for my ajax call, this library give me a response and after I'm using JSON. I've got a constant id inside and where I'm block is to use this constant outside the request() I know that I need a promises but I don't understand how to use it ... const options = { *** }, }; request(options, function(error, response, issue) { const json = JSON.parse(issue); for (let i = 0; i < json.versions.length; i++) { const test = json.versions[i].name; if (test === version) { const id = json.versions[i].id; //here id } } }); console.log(id); // I need to retrieve the const id here but id it's undefined, so how can I specified id A: Try using: const options = { *** }, }; let id; function getMyBody(options, callback) { request(options, function(error, response, issue) { const json = JSON.parse(issue); for (let i = 0; i < json.versions.length; i++) { const test = json.versions[i].name; if (test === version) { const id = json.versions[i].id; //here id callback(id); } } }); }); } getMyBody(options,(id)=>{this.id = id; console.log(id);})
StackExchange
This invention relates to novel herbicidal compositions, particularly aqueous solutions, containing the herbicide N-phosphonomethylyglycine (also known as glyphosate) and an alkyl phenol polyoxyalkylene carboxylic acid-containing surfactant. N-phosphonomethylglycine, as well as analogous compounds including salts, and the herbicidal properties and formulations containing them, are described in numerous patents, such as U.S. Pat. No. 3,799,758. This patent describes a number of compositions containing N-phosphonomethylglycine and analogous compounds and discloses that the incorporation of a surface-active agent into such compositions "greatly enhances their efficiency". A number of surface-active agents are disclosed in that patent. The patent also mentions that because N-phosphonomethylglycine itself is relatively insoluble in water, it is generally preferred to utilize the more readily soluble derivatives of N-phosphonomethylglycine, including metal salts and salts of N-phosphonomethylglycine and strong acids, namely those having a pK of 2.5 or less, such as hydrochloric, sulfuric, phosphoric, trifluoracetic, trichloracetic, and the like. A number of subsequent patents and patent applications describe in more detail particular surfactants which may be used with N-phosphonomethylglycine or its salts. For instance, U.S. Pat. No. 5,180,414 describes compositions of N-phosphonomethylglycine containing certain alkyl polyoxyethylene phosphoric acid ester surfactants. European Patent Application 290,416 describes compositions containing N-phosphonomethylglycine or its salts and an alkoxylated amine having at the most 12 alkoxy groups per molecule. European Patent Application 472,310 describes new surfactant compositions for use with pesticides, including glyphosate, which comprise a polyoxyalkylene alkyl amine containing at least about 7 moles of an oxyalkylene group combined with a second compound which has the property of reducing eye irritantcy. Such eye irritant-reducing compounds include sulfated polyoxyalkylene alkyl phenols, polyoxyalkylene alcohol sulfates, mono- and di-(polyoxyalkylene alcohol)phosphates, mono- and di-(polyoxyalkylene alkyl phenol)phosphates, polyoxyalkylene alkyl phenol carboxylates and polyoxyalkylene carboxylates. It is an object of the present invention to provide new phosphonomethylglycine-containing compositions, particularly aqueous solutions of N-phosphonomethylglycine which may be readily used for herbicidal application and control of undesirable plants.
USPTO Backgrounds
Things a text editor must do - davweb http://www.theregister.co.uk/2013/03/11/verity_stob_text_editor/ ====== bcoates Before you all get too angry about the scandalous lies about your favorite editor note that this is a Verity Stob column. If you're reading it for a sober, fair-minded review of the various tradeoffs involved in the very serious business of text editing, you're doing it wrong. ~~~ michael_h I'm not sure how someone can read past ...press Ctrl + Shift + L (if you are following along on your Mac, just press squiggle squoggle shift Home) and not pick up that this is _satire_ , or perhaps just plain humo(u)r. ~~~ yen223 It's so obviously satire - I mean, which Mac has a Home button amirite? ~~~ Samuel_Michon My Apple keyboard has a 'Home' key... [http://km.support.apple.com/library/APPLE/APPLECARE_ALLGEOS/...](http://km.support.apple.com/library/APPLE/APPLECARE_ALLGEOS/HT1216/Pasted%20Graphic.png) (And of course, all iOS devices have a 'Home' button.) ------ kaoD The article could've been titled "I hate emacs for no particular reason". It's probable more accurate. ------ jussij > It turns out that my brain was only fitted with 72 bytes of "finger memory"; > furthermore it turns out to be EPROM, not Flash. I need to wipe out all the > WordStar keystrokes from 1986 (Ctrl+Y to delete a line, anyone?) before I > can add any more, and I have lost the ultra-violet wiping-out gadget (ask > your dad) needed to achieve this. If he'd taken a look at the Zeus editor he would have found all the features mention (except the multi-cursor thing) and by selecting the WordStar key mapping, he wouldn't even have to erase the EPROM in his fingers. Jussi Jumppanen Author: Zeus ~~~ lotsofcows Verity Stob is a laaaadddddy. <http://en.wikipedia.org/wiki/Verity_Stob> ~~~ jussij My apologies to Verity for the gender error. ------ jtheory I must say this isn't nearly as funny as much of the Verity Stob posts, but no problem. Mostly I was amazed to see that the _same_ horrible bug in Notepad++ that seriously bit me once (the text replacement buffer silently truncated... aargh!) is the one mentioned here. ~~~ JonnieCache It's hard to beat her history of computing, "8086 and all that" [http://www.theregister.co.uk/2012/12/22/verity_stob_8086_and...](http://www.theregister.co.uk/2012/12/22/verity_stob_8086_and_all_that_revisited/) ------ Jgrubb I'm often taken a bit back by how bad text looks in screenshots of Windows whatever. I really wouldn't want to look at that all day. Just my preference... ~~~ swah It's ok - we feel the same about OSX font rendering. ------ NateDad I like Sublime, but I think it's criminal that it can't show line endings. That's right up there with syntax highlighting in my list of must-have features. How often do line endings screw you? Since I tend to work on a lot of cross platform stuff, for me, it's all the time. I pretty much keep Notepad++ around just so I can pop things into it to look at their line endings. ~~~ thezoid I'm pretty sure you can turn that on. Though I think it shows all whitespace characters unless he's changed some more recently. ------ Samuel_Michon _"Another giveaway [of Sublime's Mac influences]: Sublime comes with a set of colour schemes with names like Dawn, Expresso Libre, Monokai, Slush & Poppies and the Smell of Napalm in the Morning (I may have made one of those up). Contrast this with an equivalent list from a Windows product (in fact Delphi VCL skins): Carbon, Charcoal Dark Slate, Emerald Light Slate, Golden Graphite, Slate Classico and Dark Beige Slate Classico Carbon (I may have made one of those up)."_ To me, the second list comes off as more Mac themed. _Carbon_ is a set of Mac APIs, _Charcoal_ was the system font for Mac OS 8, and _Graphite_ was the nickname of the Power Mac G4. As for the first list, OS X has a desktop picture of poppies and Expresso[sic] could be Java inspired (like Cocoa, Gianduia, Espresso, Chocolat, Cappuccino, etc.) I doubt Apple would call anything 'Libre' in their English branding or documentation. ------ Ensorceled Well. At least he was pretty clear this was all his opinion. But that's a couple of minutes of my life I'd like to get back. I'm soOOooo glad I learned ed as my first editor which lead to a 30 year love affair with vi. Both of those editors sound painful to use. ~~~ swah OTOH Vimscript is painful to use compared to Python... ~~~ MatthewPhillips That's a feature, instead of customizing your text editor you spend your time coding the thing you originally wanted to code. ~~~ swah Heh, that's true. But most Vim users also want customization, as shown by bundles like <http://vim.spf13.com/>. ------ malux85 "No support for Object Pascal ... minus 1 million points" "How can I possibly use this as an IDE for theregister.co.uk backend systems when it doesn't support _object pascal_ " Get off my lawn! What smells like Mustard? The president is a demi-crat! ------ binarymax I will say TexPad is an amazing editor (as long as you don't need to do any unicode). Like verity I've been using it for many many years, and I have yet to find a replacement that I enjoy as much. When I switched to Linux, I tried to learn all kinds of emacs and vi, and never enjoyed them as much. LightTable seems like it will finally answer my prayers, however. ------ mattfieldy For an article that prefaces it's dialogue with a desire to "leave the right- thinking reader with an impression of calm, reasoned rationality", it reads like opinionated tosh. How the author arrived at these six criteria as a reasonable litmus test for the applicability and usefulness of a text editor absolutely boggles the mind. ~~~ alanctgardner2 Verity is usually satirical; at best he's overblown and ridiculous. I don't think the Reg's editorial staff expects you to take this as gospel, it's mostly for entertainment value. ------ jhawk28 Sublime Text 3 fixes most of the problems mentioned in the article. It starts up fast, handles large files better. Still no option to show newline characters. ------ oneeyedpigeon Sublime is generally great, but it desperately needs one fix before I'll ever really love it: make page up/down commutative. ------ martinced What an opinionated piece of crap TFA is. This kind of stuff is precisely why I stopped reading The Reg a long time ago. Seriously: _"4. The editor should contain no implementation of Lisp."_ Why do they do that? Because of course Emacs totally rocks in their last example, where you need to apply the same modification to various lines (in Emacs you'd probably use a macro repeating some search and replace using a quick Lisp substitution). How do you even want to talk with people who argue for their own limitation? Appeal to authority: I urge people to read _"Beating the average"_ from pg. ~~~ lotsofcows It's a joke! How is it possible, given the URL, that it's the Reg, the author's name, the layout and the content to miss that it's a joke? This particular line is a reference to <http://en.wikipedia.org/wiki/Greenspuns_tenth_rule>
HackerNews
&tldr; Please provide semantically versioned releases of your packages and libraries. Update: There is a proposal to bring semantic versioning to the Go community. When it comes to package management the Go community is different from the rest. There are some places that’s not a good thing and release versions happen to be one of them. In general Go packages, many of which are used in production, have no identifiable version other than a commit id and that’s a problem. Why Bother Versioning? There are theoretical and then there are practical reasons to version. I want to share a little of both by example. Kubernetes has quite a few dependencies. And its dependencies have dependencies. Sometimes they share a dependency but list different versions of it. If you took the version specified by Kubernetes and the versions specified by their dependencies you’ll find 42 conflicts (as or writing this post). A conflict is there two different versions are being specified (often in a Godep file). Since they are all specified as commit ids there’s not way to distinguish a difference. When I looked deeper (by hand) I found cases were versions could be years apart in time. This is not ideal. What if I asked you to use version f9885acc8cd1403afcd09570c89a009e8bd1dc19 of OpenSSL? Or, what if that’s the version bundled in something you downloaded? Would you feel safe using that. Based on the commit id there’s no real way to tell when it came from. Is it safe? It’s not safe. This version is susceptible to Heartbleed. No one does this with OpenSSL. They use versions so a simple version comparison can tell if it’s safe. Thankfully OpenSSL doesn’t version by commit id. Stability can be an issue. I was recently working on a project that pulled in some 3rd party libraries. The problem was one of stability. The latest commit wasn’t stable. It didn’t work. So, work had to be done to walk through the commits to find one that worked. This is tedious and annoying. If there are stable releases you can use that. It’s not like most people run the latest commit of Go, Firefox, or well just about anything else. Note, if you believe Go packages only need to be tied to the commit ids then I challenge you to run everything that way. The Go toolchain, your browser, and all of it. Other Language Communities I’ve been looking at how other language communities handle packages. I decided to look at release versions in these communities and I was going to attempt to calculate a percent of packages in those communities that have release versions. But, I found that all the popular packages have releases and some communities require them. It was hard to find a package with any kind of adoption that didn’t have releases. I didn’t calculate a percentage because it’s a tiny fraction of a percent. The State of Go Versioning So, how does Go compare? I used tools such as Godoc and Go Search to find the top packages. The packages fell into 5 categories: 9 of the top 20 most imported according to Go Search had no release versions at all. When I look at other lists on Godoc or Go Search these ratio of only about half having versions holds up. To go further I looked at GitHub Trends for Go packages (excluding applications written in Go) and found 75% for the past month didn’t have release versions. Of those that have release versions many are out of date. It’s not unusual to have the latest release be over a year old. Sometimes closer to two years. There can be many, sometimes hundreds of, commits since then. While these versioned releases exist they are essentially useless. Those who are using gopkg.in . These really fall into two categories. Those who are doing incremental releases and those who just have a major branch you need to follow. The latter is similar to not versioning except you have the major version API break handled. The former is great and I like to see it. Some have tags that have meaning only to that project. Are these releases? What do they mean? I don’t know because it’s not obvious. They appear to be one offs. Some use release versions, keep making releases, and I’m overjoyed to see them. It makes me smile when I see packages like beego and logrus releasing versions. There’s more to the state of Go besides the state of the releases on packages. You need tools that can leverage them. Here are a few: gopkg.in has been around for some time to allow projects on GitHub to handle versions through imports. Glide is a package manager for Go and the GO15VENDOREXPERIMENT . You can specify versions and ranges (e.g., ^1.2.3 ). . You can specify versions and ranges (e.g., ). gb-vendor will let you specify tags that can be versions (no SemVer range filtering yet but I’ve read the Dave wants to add it). We are starting to see the rise of tools that can use the versions intelligently. Please Use Semantic Versioning It’s not only time to start versioning but to use semantic versioning (SemVer). SemVer is a specification and you can derive meaning from the version numbers allowing for useful comparisons. SemVer or something very similar is what every other programming language community uses. The newer language communities are using it explicitly. Since SemVer is a spec we don’t need to argue about what should be in it and there are already packages allowing you to work with them. It’s time for the Go community to have semantically versioned releases of all packages. It’s what all the mature language communities do. We should join them.
OpenWebText2
// Copyright 2015 The Go Authors. All rights reserved. // Use of this source code is governed by a BSD-style // license that can be found in the LICENSE file. package tea import ( "bytes" "testing" ) // A sample test key for when we just want to initialize a cipher var testKey = []byte{0x00, 0x11, 0x22, 0x33, 0x44, 0x55, 0x66, 0x77, 0x88, 0x99, 0xAA, 0xBB, 0xCC, 0xDD, 0xEE, 0xFF} // Test that the block size for tea is correct func TestBlocksize(t *testing.T) { c, err := NewCipher(testKey) if err != nil { t.Fatalf("NewCipher returned error: %s", err) } if result := c.BlockSize(); result != BlockSize { t.Errorf("cipher.BlockSize returned %d, but expected %d", result, BlockSize) } } // Test that invalid key sizes return an error func TestInvalidKeySize(t *testing.T) { var key [KeySize + 1]byte if _, err := NewCipher(key[:]); err == nil { t.Errorf("invalid key size %d didn't result in an error.", len(key)) } if _, err := NewCipher(key[:KeySize-1]); err == nil { t.Errorf("invalid key size %d didn't result in an error.", KeySize-1) } } // Test Vectors type teaTest struct { rounds int key []byte plaintext []byte ciphertext []byte } var teaTests = []teaTest{ // These were sourced from https://github.com/froydnj/ironclad/blob/master/testing/test-vectors/tea.testvec { numRounds, []byte{0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00}, []byte{0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00}, []byte{0x41, 0xea, 0x3a, 0x0a, 0x94, 0xba, 0xa9, 0x40}, }, { numRounds, []byte{0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff}, []byte{0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff}, []byte{0x31, 0x9b, 0xbe, 0xfb, 0x01, 0x6a, 0xbd, 0xb2}, }, { 16, []byte{0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00}, []byte{0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00}, []byte{0xed, 0x28, 0x5d, 0xa1, 0x45, 0x5b, 0x33, 0xc1}, }, } // Test encryption func TestCipherEncrypt(t *testing.T) { // Test encryption with standard 64 rounds for i, test := range teaTests { c, err := NewCipherWithRounds(test.key, test.rounds) if err != nil { t.Fatalf("#%d: NewCipher returned error: %s", i, err) } var ciphertext [BlockSize]byte c.Encrypt(ciphertext[:], test.plaintext) if !bytes.Equal(ciphertext[:], test.ciphertext) { t.Errorf("#%d: incorrect ciphertext. Got %x, wanted %x", i, ciphertext, test.ciphertext) } var plaintext2 [BlockSize]byte c.Decrypt(plaintext2[:], ciphertext[:]) if !bytes.Equal(plaintext2[:], test.plaintext) { t.Errorf("#%d: incorrect plaintext. Got %x, wanted %x", i, plaintext2, test.plaintext) } } }
Github
438 F.Supp. 613 (1977) UNITED STATES of America v. Alfred Henry MANUSZAK a/k/a Sassy Doc. Crim. No. 73-647. United States District Court, E. D. Pennsylvania. May 25, 1977. Addendum To Opinion July 13, 1977. *614 Joel M. Friedman, Philadelphia Strike Force, Philadelphia, Pa., for plaintiff. Donald J. Goldberg, Philadelphia, Pa., for respondent. OPINION DITTER, District Judge. The question presented in this case is whether probation may be revoked upon the basis of court-authorized wiretap evidence without first giving the probationer an opportunity to litigate the validity of the wiretap. Reluctantly, I conclude that it may not. *615 On January 30, 1974, respondent, Alfred Henry Manuszak, also known as "Sassy Doc," plead guilty to operating an illegal gambling business in violation of 18 U.S.C. § 1955. I imposed a fine of $4,000., suspended sentence of imprisonment, and placed Manuszak on probation for a period of three years upon the condition, inter alia, that he "refrain from any unlawful conduct." Subsequently, on January 27th of this year, the government petitioned to have Manuszak's probation revoked on the grounds that he has continued to engage in illegal gambling activities. The evidence upon which the government intends to rely at the revocation hearing consists of a telephone conversation between Manuszak and another individual which was intercepted pursuant to a wiretap order initially entered by Judge Broderick and extended by Judge Newcomer. After the petition was filed Manuszak requested that the government supply him with copies of the original and extension wiretap applications, orders, and supporting affidavits so that he might file a motion to suppress the intercepted conversations. Since Local Rule of Criminal Procedure 16(b) requires that motions to suppress evidence derived from electronic surveillance be heard by the judge who originally authorized it, in effect respondent requests this court to stay his probation revocation hearing until after Judge Broderick has ruled on his motion to suppress. The government resists disclosure[1] of the requested items and opposes staying the revocation hearing on the grounds that these measures are unnecessary since, in its view, respondent is not entitled to test the validity of wire interceptions as a prerequisite to the use of evidence derived therefrom in a probation revocation proceeding. Two arguments are advanced by the government in support of its position. First, it contends that the legality of the interceptions is simply immaterial because the exclusionary rule does not apply to probation revocation proceedings. Alternatively, the government contends that even if the exclusionary rule does apply to probation revocation proceedings, this court's review of the legality of the interceptions should be limited to an in camera inspection of the court orders to see if they are facially valid.[2] The respondent takes issue with both of the government's arguments. At the outset it is important to note that respondent does not and could not rely on the exclusionary rule developed by the courts as a remedy designed to safeguard fourth amendment rights through its supposed deterrent effect. See Mapp v. Ohio, 367 U.S. 643, 81 S.Ct. 1684, 6 L.Ed.2d 1081 (1961); Weeks v. United States, 232 U.S. 383, 34 S.Ct. 341, 58 L.Ed. 652 (1914). Numerous cases have held that this judicially created doctrine has no application in the probation revocation context. See, e. g., United States v. Vandemark, 522 F.2d 1019 (9th Cir. 1975); United States v. Winsett, 518 F.2d 51 (9th Cir. 1975); United States v. Farmer, 512 F.2d 160, 162-63 (6th Cir. 1975); United States v. Brown, 488 F.2d 94, 95 (5th Cir. 1973); United States ex rel. Sperling v. Fitzpatrick, 426 F.2d 1161 (2d Cir. 1970) (parole revocation). Rather, respondent relies on the statutory exclusionary rule contained in Title III of the Omnibus Crime Control and Safe Streets Act of 1968, Section 802, as amended, 18 U.S.C. § 2515[3] which, he contends, provides a significantly *616 broader exclusionary remedy where illegal electronic surveillance is involved than does the judicially created exclusionary rule. The government disputes that this statute has a broader sweep than its judicially created counterpart, yet in support of its position it relies primarily on cases which have refused to apply the judicially created rule to non-wiretap evidence in a variety of contexts. These cases are not controlling in the matter at hand.[4] The only authority supporting the government's position that the statutory exclusionary rules does not apply to probation revocation proceedings is United States v. Caron, 474 F.2d 506, 509-10 (5th Cir. 1973), in which the court held that Section 2515 did not proscribe the use of evidence obtained by unlawful wiretapping for impeachment purposes.[5] In reaching its decision on the statutory point the court relied on a certain passage in the legislative history of Title III as evidencing Congress' intent that Section 2515 was not to expand the exclusionary rule beyond the confines of the judicially-created doctrine. The passage in question, contained in the Senate Report on the bill that included Title III, states: Section 2515 of the new chapter imposes an evidentiary sanction to compel compliance with the other prohibitions of the chapter. It provides that intercepted wire or oral communications or evidence derived therefrom may not be received in evidence in any proceeding before any court, grand jury, department, officer, agency, regulatory body, legislative committee, or other authority of the United States, a State, or a political subdivision of a State, where the disclosure of that information would be in violation of this chapter. The provision must, of course, be read in light of section 2518(10)(a) discussed below, which defines the class entitled to make a motion to suppress. It largely reflects existing law. It applies to suppress evidence directly (Nardone v. United States, 58 S.Ct. 275, 302 U.S. 379 [82 L.Ed. 314] (1937)) or indirectly obtained in violation of the chapter. (Nardone v. United States, 60 S.Ct. 266, 308 U.S. 338 [84 L.Ed. 307] (1939).) There is, however, no intention to change the attenuation rule. See Nardone v. United States, 127 F.2d 521 (2d), certiorari denied, 62 S.Ct. 1296, 316 U.S. 698 [86 L.Ed. 1767] (1942); Wong Sun v. United States, 83 S.Ct. 407, 371 U.S. 471 [9 L.Ed.2d 441] (1963). Nor generally to press the scope of the suppression role beyond present search and seizure law. See Walder v. United States, 74 S.Ct. 354, 347 U.S. 62 [98 L.Ed. 503] (1954). S.Rep.No.1097, 90th Cong., 2d Sess., 1968 U.S.Code Cong. & Adm.News, pp. 2184-85 (emphasis added), quoted in Caron, supra, at 509-10. The problem with the quoted statement is that it is in fundamental conflict with the language of the statute itself, which plainly does extend the scope of the suppression remedy beyond conventional search and seizure law by providing that unlawfully intercepted communications may not be received in evidence "in any trial, hearing or other proceeding in or before any court, grand jury, department, . . . [etc.]" *617 (Emphasis added.) The most obvious example of the expanded scope of the statutory exclusionary rule is found in the grand jury context. It traditionally has been the rule that the grand jury may consider incompetent or illegally obtained evidence and that an indictment based upon such evidence is not subject to challenge. See United States v. Calandra, 414 U.S. 338, 94 S.Ct. 613, 38 L.Ed.2d 561 (1974); United States v. Blue, 384 U.S. 251, 86 S.Ct. 1416, 16 L.Ed.2d 510 (1966); Lawn v. United States, 355 U.S. 339, 78 S.Ct. 311, 2 L.Ed.2d 321 (1958); Costello v. United States, 350 U.S. 359, 76 S.Ct. 406, 100 L.Ed. 397 (1956). Yet Section 2515 specifically excludes from use by the grand jury evidence derived from unlawful electronic surveillance. See Gelbard v. United States, 408 U.S. 41, 92 S.Ct. 2357, 33 L.Ed.2d 179 (1972). While disagreeing with the majority over the right of a grand jury witness to raise Section 2515 as a defense to a contempt charge brought for failure to answer questions based on information obtained through allegedly unlawful wiretapping, even the dissenters in Gelbard agreed that the statute "prohibits the use of illegally overheard . . . communications before grand juries as well as other governmental bodies." Id. at 72-73, 92 S.Ct. at 2373-74 (Rehnquist, J., dissenting). In Calandra, Mr. Justice Powell, who was one of the dissenters in Gelbard, offered the following explanation for the differing results reached in the two cases: The dissent's reliance on Gelbard v. United States, 408 U.S. 41, 92 S.Ct. 2357, 33 L.Ed.2d 179 (1972), is misplaced. . . The Court's holding [in Gelbard] rested exclusively on the interpretation of Tit. III, which represented a congressional effort to afford special safeguards against the unique problems posed by misuse of wiretapping and electronic surveillance. There was no indication, in either Gelbard or the legislative history, that Tit. III was regarded as a restatement of existing law with respect to grand jury proceedings. As Mr. Justice White noted in his concurring opinion in Gelbard, Tit. III "unquestionably works a change in the law with respect to the rights of grand jury witnesses . . ." 408 U.S. at 70, 92 S.Ct. at 2372. Calandra, supra at 355 n. 11, 94 S.Ct. at 623 (emphasis added). Taken together, the combined force of Gelbard, Calandra, and the plain language of Section 2515 are sufficiently compelling to override the single passage in the legislative history relied on in Caron[6] and to convince me that the statute does indeed create a broader exclusionary rule than the judicially-created one. And since it cannot be disputed that a probation revocation proceeding is a "proceeding" within the meaning of Section 2515, I conclude that the statutory exclusionary rule is applicable here. The government's fallback position is that even if the exclusionary rule does apply to probation revocation proceedings, the respondent is not entitled to a fullblown suppression hearing on the legality of the interceptions. Rather, relying on In re Persico, 491 F.2d 1156 (2d Cir.), cert. denied, 419 U.S. 924, 95 S.Ct. 199, 42 L.Ed.2d 158, reh. denied, 419 U.S. 1060, 95 S.Ct. 645, 42 L.Ed.2d 657 (1974),[7] the government contends *618 that the court should conduct only a limited in camera inspection of the interception order and supporting papers to determine their facial validity. In Persico the court adopted the position espoused in Justice White's concurring opinion in Gelbard and held that a grand jury witness was not entitled to a full suppression hearing prior to answering questions based on electronic surveillance where the government produced a court order authorizing such surveillance. The court concluded that only where the illegality of the surveillance may be established without resort to a suppression hearing, that is where the government either has admitted its illegality or failed to produce a court order or where the illegality has been determined in a prior judicial proceeding, could a grand jury witness rely on Section 2515 as a defense to a contempt charge. Id. at 1161. The government's reliance on Persico here is misplaced. The Persico court based its decision on legislative history revealing Congress' understanding that the statutory exclusionary rule contained in Section 2515 would be limited by Section 2518(10)(a), which governs the class of persons entitled to make a motion to suppress and that the latter section did not extend to grand jury witnesses. Id. But while the legislative history of Section 2518(10)(a) clearly does show an intent to exclude grand jury witnesses from the class entitled to make a motion to suppress,[8] it evinces no similar intent with respect to a person facing probation revocation. More importantly, the legislative history of Section 2518(9) affirmatively shows that a probationer subject to revocation proceedings may invoke the suppression motion provided for in Section 2518(10)(a). Paragraph 9 provides that the contents of any intercepted wire or oral communication or evidence derived therefrom shall not be received in evidence or otherwise disclosed in any Federal or State trial, hearing, or other proceeding unless each party not less than 10 days before the trial has been furnished with a copy of the court order under which the interception was authorized or approved. "Proceeding" is intended to include all adversary type hearings. It would include a trial itself, a probation revocation proceeding, or a hearing on a motion for reduction of sentence. It would not include a grand jury hearing. Compare [United States v.] Blue, 384 U.S. 251, 86 S.Ct. 1416, [16 L.Ed.2d 510] (1966). The 10-day period is designed to give the party an opportunity to make a pretrial motion to suppress under paragraph (10)(a), discussed below. Compare Segurola v. United States, [275 U.S. 106,] 48 S.Ct. 77, [72 L.Ed. 186] (1927). Where it is not possible to furnish the party the information 10 days before trial, and he would not be prejudiced, the judge may waive the requirement. Such a situation might arise, for example, when an intercepted communication became relevant only as a *619 result of the character of a defense presented by the defendant. Ordinarily, prejudice would be shown only where it was established that the trial could not be reasonably recessed in order that the motion to suppress could be fully heard or that the granting of a mistrial rather than excluding the evidence would be grossly unfair. S.Rep.No.1097, supra, 1968 U.S.Code Cong. & Adm.News at pp. 2194-95 (emphasis added). For the reasons stated above I conclude that the respondent is entitled to litigate the validity of the wiretaps in question prior to their use as evidence at his probation revocation hearing. I recognize and fully agree[9] with the government that the reasons for not applying the judicially-created exclusionary rule in the probation revocation context are equally applicable here and that the delay inherent in the statutory suppression remedy is likely to be every bit as inimical to the rehabilitation objectives of probation policy as it would be to the proper functioning of the grand jury. Nonetheless Congress has spoken and I am not free to disregard its clear mandate. Relief from perceived undesirable effects of the statutory exclusionary rule must be sought through legislative, not judicial action.[10] The government's petition to revoke Manuszak's probation will be stayed pending resolution of the motion to suppress which respondent forthwith shall file before Judge Broderick. ADDENDUM TO OPINION The government has asked that I reconsider my opinion of May 25, 1977, in the above matter. In that opinion I held that before probation may be revoked on the basis of evidence obtained through court-authorized electronic surveillance, the probationer must be given the opportunity to litigate the validity of the wiretap.[1] I have engaged in the requested reconsideration and will abide by my earlier decision. My reasons follow. The specific portion of my prior opinion with which the government takes issue is footnote 10, which reads as follows: (10) The government also resists disclosure of the court orders and supporting papers on the grounds that it will impair an on-going grand jury investigation by revealing the identity of actual or prospective grand jury witnesses who might then be subjected to pressure to refrain from testifying or to testify falsely. While I am sympathetic to the government's plight, the fact remains that it has sought to revoke respondent's probation and therefore under Section 2518(9) he has the right to be furnished with a copy of the court order and accompanying application. Unlike Section 2518(8)(d), dealt with by Judge Fogel in Application of United *620 States, [413 F.Supp. 1321 (E.D.Pa. 1976)] which gives the court discretion to deny access to the order and application, Section 2518(9) mandates that these items be made available to a party facing . . . "any proceeding," although Section 2518(10)(a) does give the court some discretion to deny access to the intercepted communications themselves. The government objects to the intimation in the above footnote that courts have no discretion to deny Section 2518(10)(a) suppression movants access to the wiretap application and order. It is the government's view that such discretion does exist and it therefore requests that I "strike footnote 10 from [my] Opinion and hold that Section 2518(9) does not divest the hearing judge of his discretion in determining what disclosure is appropriate on a motion to suppress."[2] In support of its position that Section 2518(9) does not require disclosure of the wiretap application and order, the government first argues that this section is a notice and not a disclosure provision. The plain language of the statute is to the contrary, however. The statute does not say that a party facing a trial, hearing or other proceeding must be given notice of the wiretap; it says that he must be "furnished with a copy of the court order, and accompanying application." 18 U.S.C. § 2518(9) (emphasis added).[3] See United States v. Ripka, 349 F.Supp. 539, 541-42 (E.D.Pa. 1972), aff'd mem. Appeal of Manuszak, 480 F.2d 919 (3d Cir.), cert. denied sub nom., United States v. Manuszak, 414 U.S. 979, 94 S.Ct. 285, 38 L.Ed.2d 223 (1973). The government cites a number of cases which have held that failure to comply with various disclosure or inventory provisions of Title III do not necessarily require suppression of evidence derived from electronic surveillance. These cases[4] do not support the government's position. In relying on them it has failed to distinguish between the requirements of the Act and the remedy for failure to comply with those requirements. For example, in United States v. Kohne, supra, the court held that the failure to serve the order and application on the defendants ten days prior to trial did not require suppression of the wiretap evidence. But the court most certainly did not hold that the defendants had no right to obtain these documents from the government prior to moving for suppression. In fact the whole basis for the court's decision was that the defendants had suffered no prejudice since they had been provided with the application and order prior to the suppression hearing and had utilized them in cross-examining the government's witnesses at this hearing. 358 F.Supp. at 1057 and n. 4. Noting that Section 2518(10)(a) enumerates in general terms the issues which may be raised in a motion to suppress but does not specify the nature of the proceeding which must be held to resolve these issues, the government next argues that this section does not require that an evidentiary hearing be held in every case. See United States v. Losing, 539 F.2d 1174 (8th Cir. 1976). I agree with this much of the government's argument and to the extent *621 my prior opinion may have suggested that an evidentiary hearing is mandatory in every case, I now expressly declare that it was not my intention to do so.[5] However, I do not agree that the court's discretion as to whether or not to hear evidence means that the court also has discretion to deny disclosure of the wiretap applications and order mandated by Section 2518(9) or that the court may determine the validity of the electronic surveillance ex parte by an in camera submission of these documents. Again, the case relied on by the government to support its position does not do so. Losing, supra, holds only that the court has discretion to deny a hearing on the suppression motion. It makes no suggestion that a similar discretion exists with respect to disclosure of the application and order and in fact, as in Kohne, supra, the defendants in Losing had been provided with the application and order prior to moving to suppress. See 539 F.2d at 1176-77. Section 2518(10)(a) provides that a motion to suppress may be made on the grounds that: (i) the communication was unlawfully intercepted; (ii) the order of authorization or approval under which [the communication] was intercepted is insufficient on its face; or (iii) the interception was not made in conformity with the order of interception or approval. And the purpose of Section 2518(9) is not, as the government contends, merely to provide a person facing a "proceeding" with notice of the wiretap so that he can move to suppress; it is "designed to give the party an opportunity to make a pre-trial motion to suppress." S.Rep.No.1097, supra, 1968 U.S.Code Cong. & Admin.News, pp. 2194-95 (emphasis added). But how can a party realistically have an opportunity to move to suppress on one or more of the statutory grounds if all he is told is that a wiretap has occurred and that evidence derived therefrom will be used against him in the forthcoming proceeding? Unless the legislative history is to be interpreted as contemplating that a party may be given only the opportunity to file a conclusory motion in language tracking that used in Section 2518(10)(a), Section 2518(9) must be construed as making disclosure of the application and order mandatory. Losing also supports this interpretation of Section 2518(9). The Losing court adopted the criterion set forth in United States v. Ledesma, 499 F.2d 36 (9th Cir.), cert. denied, 419 U.S. 1024, 95 S.Ct. 501, 42 L.Ed.2d 298 (1974), for determining when a hearing on a suppression motion is required: Evidentiary hearings need not be set as a matter of course, but if the moving papers are sufficiently definite, specific, detailed and nonconjectural to enable the court to conclude that contested issues of fact going to the validity of the search are in question, an evidentiary hearing is required. Id. at 39, quoted in Losing, supra at 1177. It is difficult to believe that a party would ever be able to file "definite, specific, detailed and nonconjectural" moving papers so as to obtain a hearing if he is not provided with a copy of the wiretap application and order. This is true regardless of the grounds upon which the motion is based. Without access to the wiretap application the party against whom the government is proceeding would not know the information presented to the judge who approved the interceptions and could not challenge its accuracy nor could his counsel make an intelligent assessment of whether *622 the application established probable cause.[6] The party therefore would be in no position to assert (except in a conclusory fashion) that the communications were unlawfully intercepted. Denial of access to the application and order also would effectively preclude motions to suppress based on the second and third statutory grounds. Obviously, a party cannot argue that the wiretap authorization is facially insufficient unless he has an opportunity to review the face of the authorization. And to determine whether it would be fruitful to argue that the interception was not made in conformity with the order the party must be able to compare the terms of the order with the reality of the manner in which the interception was carried out. This, again, necessitates that the party have access to the order.[7] I recognize that In re Lochiatto, 497 F.2d 803 (1st Cir. 1974), provides a modicum of support for the government's position that the validity of the wiretap may be determined by the court in camera,[8] but that case involved a grand jury witness and I agree with In re Persico, 491 F.2d 1156, 1161-62 (2d Cir.), cert. denied, 419 U.S. 924, 95 S.Ct. 199, 42 L.Ed.2d 158, reh. denied, 419 U.S. 1060, 95 S.Ct. 645, 42 L.Ed.2d 657 (1974), that such a person is not entitled to make the Section 2518(10)(a) suppression motion. I therefore find Lochiatto distinguishable from the case sub judice.[9] The government's third argument is that construing Section 2518(9) as a mandatory disclosure provision is inconsistent with Section 2518(8)(b) which provides for sealing of the wiretap application and order and disclosure only upon a showing of good cause.[10] The attempted analogy between *623 Sections 2518(8) and 2518(9) must fail, however, because the two sections do not operate in the same context. Section 2518(8) establishes a procedural framework for providing notice to those who have been the target of an actual or attempted[11] wiretap or whose conversations have been overheard regardless of whether or not they have become the subject of a specific charge of wrongdoing.[12] See Petition of Leppo, 497 F.2d 954, 956 (5th Cir. 1974); United States v. Best, 363 F.Supp. 11, 19-21 (S.D.Ga.1973); United States v. Lanza, 341 F.Supp. 405, 420-21 (M.D.Fla.1972); Application of United States, supra. However, Section 2518(9) applies only to those who are facing a trial or other adversary proceedings, that is those against whom the government has sought the infliction of some form of punishment. This distinction was recognized by the Ninth Circuit in United States v. Chun, 503 F.2d 533 (1974). Section 2518(8)(d) was clearly meant to provide this post-use notice. The Senate Report on that subparagraph states: "Yet the intent of the provision is that the principle of post-use notice will be retained." 1968 U.S.Code Cong. and Adm.News at 2194. Such post-use notice functions to provide individuals with the opportunity to exercise their constitutional right to challenge the validity of a wiretap, and, thereby, the admissibility of evidence obtained or derived therefrom. See Alderman v. United States, 394 U.S. 165, 183, 89 S.Ct. 961, 22 L.Ed.2d 176 (1969); Nardone v. United States, 308 U.S. 338, 341, 60 S.Ct. 266, 84 L.Ed. 307 (1939). Section 2518(9) performs a dual function. First, it operates to provide the requisite post-use notice to aggrieved persons in those instances where it is not supplied by subparagraphs 2518(8)(d). United States v. Ripka, 349 F.Supp. 539, 541-542 (E.D.Pa.1972). At the same time it also operates to provide additional information to an individual who has received § 2518(8)(d) notice, and who is subsequently indicted, so that he may be in a better position to attack the validity of the initial order. Id. at 537 n. 6. (emphasis added). In view of the consequences facing persons covered by Section 2518(9), i. e. the potential loss of liberty, it is not at all surprising that Congress would provide them with significantly greater procedural protections than those who have suffered only the invasion of privacy entailed in the wiretap itself or the affront to dignity which may result from learning one is under government suspicion of wrongdoing.[13] Finally the government argues that it is incongruous to require disclosure of the *624 application and order and at the same time leave disclosure of intercepted communications or evidence derived therefrom to the discretion of the court. Even if this contention were entirely accurate, I would be forced to reject it because the plain language of Sections 2518(9) and 2518(10)(a) draw just such a distinction with respect to disclosure of these items.[14] In any event, the distinction appears not to be as irrational as the government suggests. First, Congress may well have believed that in the usual case information actually gathered through electronic surveillance would be more likely to be of a sensitive or highly personal character than information contained in the application and order for the interception and therefore concluded that the trial judge should have some leeway with respect to the former items but not the latter. Secondly, the information contained in the application and order usually will be of much greater importance to a party contemplating the filing of a suppression motion than the intercepted communications themselves. As noted previously access to intercepted communications would seem to be important only when the suppression motion is based on the third statutory ground, i. e., that the interception was not made in conformity with the application or order, and even then only when the nature of the communications would be relevant to determining the motion.[15] The application and order, however, establish the very foundation upon which any surveillance was conducted in the first place and upon which its legality must stand or fall. Thus, a party must have access to these documents in order to make any kind of effective assessment of the surveillance's validity no matter what grounds may ultimately be relied upon to support a suppression motion.[16] In summary then, I conclude that Section 2518(9) makes disclosure of the wiretap application and order mandatory to those, such as respondent Manuszak, within the class entitled to make a Section 2518(10)(a) suppression motion. I further conclude that the validity of the wiretap may not be determined in an ex parte proceeding by the court's reviewing these documents (i. e. the application and order) in camera, although the court may review intercepted communications which are not part of the application in camera if it becomes necessary to do so. After the application and order have been disclosed to the party facing a "proceeding" as explained in the legislative history of Section 2518(9) he is then entitled to move for suppression on any of the grounds enumerated in Section *625 2518(10)(a). While the decision to hold an evidentiary hearing on the suppression motion rests with the discretion of the judge hearing it depending upon the issues raised therein, the motion must be decided in an adversary context; that is the movant must at least be given an opportunity to present written or oral arguments in support of his position. I recognize that where the wiretap application and order contain sensitive information the disclosure of which could prejudice an ongoing investigation, the government may be put to the hard choice of either foregoing its proceeding against the defendant or risking the frustration of its investigation. But this is a choice which Congress has in plain language decreed the government must make when it seeks to deprive a person of his liberty on the basis of wiretap evidence. In truth it is not much different than a number of other difficult decisions which the government must make in pursuing a criminal prosecution, such as when it must decide whether to proceed with a case that will require revelation of the identity of an informant. Cf. Roviaro v. United States, 353 U.S. 53, 77 S.Ct. 623, 1 L.Ed.2d 639 (1957). ORDER AND NOW, this 13th day of July, 1977, having reconsidered this court's opinion of May 25, 1977, in the above matter, it is hereby ordered that the government's motion to strike footnote 10 from the opinion is denied. NOTES [1] The government has allowed counsel for the respondent to listen to the tape recording of the conversation upon which it will rely in seeking revocation of Manuszak's probation and also has provided counsel with a transcript of this conversation. [2] The government has supplied the court with copies of the court orders and supporting papers for in camera review. Presumably it is the government's position that since only the facial validity of the court orders is at issue, I may conduct such review without violating the spirit of Local Rule 16(b). In view of my disposition of this case, I have no occasion to decide the correctness of the government's position. Cf. In re Proceedings to Enforce Grand Jury Subpoena, 430 F.Supp. 1071, at 1076 (E.D.Pa., filed April 14, 1977) (Lord, C. J.). [3] 18 U.S.C. § 2515 provides: Whenever any wire or oral communication has been intercepted, no part of the contents of such communication and no evidence derived therefrom may be received in evidence in any trial, hearing, or other proceeding in or before any court, grand jury, department, officer, agency, regulatory body, legislative committee, or other authority of the United States, a State, or a political subdivision thereof if the disclosure of that information would be in violation of this chapter. [4] The only cases cited by the government that involved electronic surveillance are Alderman v. United States, 394 U.S. 165, 89 S.Ct. 961, 22 L.Ed.2d 176 (1969) and United States v. Schipani, 435 F.2d 26 (2d Cir. 1970), cert. denied, 401 U.S. 983, 91 S.Ct. 1198, 28 L.Ed.2d 334 (1971). However, both of those cases involved electronic surveillance that was conducted prior to the effective date of Title III and were not decided with reference to Section 2515. [5] The precise question presented to the Fifth Circuit in Caron was the propriety of the district court's action in allowing the government to utilize the wiretap evidence for impeachment purposes without a prior evidentiary hearing on its validity. However, the appeals court decided the case on the grounds that even if the tap "had been found . . . unlawful, use of the tape recordings solely for impeachment purposes would not be proscribed." 474 F.2d at 508. [6] Arguably the result reached in Caron may be supported on the ground that the citation of Walder v. United States, 347 U.S. 62, 74 S.Ct. 354, 98 L.Ed. 503 (1954), in the legislative history is a particularly persuasive indicia that Congress did not intend to preclude impeachment use of evidence obtained through unlawful electronic surveillance. Another basis upon which Caron arguably is supportable is that the commission of perjury is so offensive to judicial integrity that the court's own interest in neutralizing its effects is strong enough to overcome all but a specific legislative command that otherwise reliable evidence not be used for impeachment purposes. Cf. Harris v. New York, 401 U.S. 222, 91 S.Ct. 643, 28 L.Ed.2d 1 (1971). Obviously, neither of these rationales apply to the government's use of unlawfully obtained wiretap evidence to support its case in chief in a probation revocation hearing. [7] See also In re Grand Jury Proceedings (Worobyzt), 522 F.2d 196 (5th Cir. 1975), cert. denied, 425 U.S. 911, 96 S.Ct. 1507, 47 L.Ed.2d 761 (1976); Droback v. United States, 509 F.2d 625 (9th Cir. 1974), cert. denied, 421 U.S. 964, 95 S.Ct. 1952, 44 L.Ed.2d 450 (1975); In re Vigorito, 499 F.2d 1351 (2d Cir. 1974), cert. denied, 419 U.S. 1056, 95 S.Ct. 640, 42 L.Ed.2d 654 (1975). But see In re Lochiatto, 497 F.2d 803 (1st Cir. 1974). Cf. Application of United States Authorizing Interception, 413 F.Supp. 1321 (E.D.Pa.1976). [8] (10)(a) provides that any aggrieved persons, as defined in section 2510(11), discussed above, in any trial hearing or other proceeding in or before any court department, officer, agency, regulating body or other authority of the United States, a State, or a political subdivision of a State may make a motion to suppress the contents of any intercepted wire or oral communication or evidence derived therefrom. This provision must be read in connection with sections 2515 and 2517, discussed above, which it limits. It provides the remedy for the right created by section 2515. Because no person is a party as such to a grand jury proceeding, the provision does not envision the making of a motion to suppress in the context of such a proceeding itself. Normally, there is no limitation on the character of evidence that may be presented to a grand jury, which is enforcible by an individual. ([United States v.] Blue, [384 U.S. 251,] 86 S.Ct. 1416, [16 L.Ed.2d 510] (1965).) There is no intent to change this general rule. It is the intent of the provision only that when a motion to suppress is granted in another context, its scope may include use in a future grand jury proceeding. S.Rep.No.1097, supra, 1968 U.S.Code Cong. & Adm.News at p. 2195. [9] Cf. United States v. Iannece, 405 F.Supp. 599, 606 (E.D.Pa.1975), aff'd sub nom., United States v. Manuszak, 532 F.2d 311 (3d Cir. 1976). [10] government also resists disclosure of the court orders and supporting papers on the grounds that it will impair an on-going grand jury investigation by revealing the identity of actual or prospective grand jury witnesses who might then be subjected to pressure to refrain from testifying or to testify falsely. While I am sympathetic to the government's plight, the fact remains that it has sought to revoke respondent's probation and therefore under Section 2518(9) he has the right to be furnished with a copy of the court order and accompanying application. Unlike Section 2518(8)(d), dealt with by Judge Fogel in Application of United States, supra, which gives the court discretion to deny access to the order and application, Section 2518(9) mandates that these items be made available to a party facing . . . "any proceeding," although Section 2518(10)(a) does give the court some discretion to deny access to the intercepted communications themselves. [1] The specific issues I decided in the earlier opinion were (1) that the statutory exclusionary rule contained in 18 U.S.C. § 2515 applies to probation revocation proceedings and (2) that a probationer facing revocation is among the class of persons entitled to make the statutory motion to suppress provided for by 18 U.S.C. § 2518(10)(a). [2] Memorandum in Support of Government's Motion for Reconsideration at 2. [3] Section 2518(9) gives the trial judge discretion to waive the ten-day advance disclosure period but not to dispense with disclosure entirely. In fact the legislative history of the section reveals that even failure to comply with this ten-day provision will require exclusion of the wiretap evidence unless the motion to suppress can be "fully heard" anyway. S.Rep.No. 1097, 90th Cong. 2d Sess., 1968 U.S.Code Cong. & Admin.News, p. 2195. [4] See United States v. Donovan, 429 U.S. 413, 97 S.Ct. 658, 673-74, 50 L.Ed.2d 652; United States v. Johnson, 539 F.2d 181, 194 and n. 53 (D.C. Cir. 1976), cert. denied, 429 U.S. 1061, 97 S.Ct. 784, 50 L.Ed.2d 776 (1977); United States v. Vento, 533 F.2d 838, 864 (3d Cir. 1976); United States v. Iannelli, 477 F.2d 999, 1003 (3d Cir. 1973), aff'd, 420 U.S. 770, 95 S.Ct. 1284, 43 L.Ed.2d 616 (1975); United States v. Kohne, 358 F.Supp. 1053, 1057 (W.D.Pa.1973), aff'd mem. Appeal of Jabella, 485 F.2d 682 (3d Cir.), cert. denied, 417 U.S. 918, 94 S.Ct. 2624, 41 L.Ed.2d 224 (1974). [5] As noted earlier, see note 1 supra, in my previous opinion I held only that a probationer facing revocation is entitled to make the statutory motion to suppress. See slip op. at 618. However, on page 617 of that opinion I stated, "The government's fallback position is that even if the exclusionary rule does apply to probation revocation proceedings, the respondent is not entitled to a fullblown suppression hearing on the legality of the interceptions." As the context makes clear, this statement was intended merely to reflect the government's position on the necessity of a hearing and not to suggest that I felt a hearing was mandatory. [6] Contrary to the government's argument, supplying petitioner with a transcript of the conversation it intends to rely on at the revocation hearing is no substitute for furnishing the application and order because the transcript of what was actually overheard would be of no assistance in determining if there was probable cause for the interception in the first place. [7] Where the suppression motion is based upon the manner in which the interception was carried out, i. e. that it was not in conformity with the order of authorization, it is possible that the movant will desire access to some or all of the intercepted communications in addition to the application and order. As footnote 10 of my original opinion points out, disclosure of the communications themselves is committed to the court's discretion. [8] Unlike the Second, Fifth and Ninth Circuits, see In re Persico, supra; In re Grand Jury Proceedings (Worobyzt), 522 F.2d 196 (5th Cir. 1975), cert. denied, 425 U.S. 911, 96 S.Ct. 1507, 47 L.Ed.2d 761 (1976); Droback v. United States, 509 F.2d 625 (9th Cir. 1974), cert. denied, 421 U.S. 964, 95 S.Ct. 1952, 44 L.Ed.2d 450 (1975) the First Circuit in Lochiatto held that Section 2518(10)(a) does extend to a grand jury witness facing contempt proceedings. 497 F.2d at 806-07 & n. 7. Since the court also held that the validity of the wiretap could be determined in camera if the district judge, in his discretion, determined that disclosure would prejudice the government, the decision arguably would support using the same procedure here by analogy. However, as noted in the text, I agree with the courts that have held Section 2518(10)(a) inapplicable to grand jury witnesses and therefore find the analogy unpersuasive. [9] The government also relies on Justice Stewart's concurring opinion in Giordano v. U. S., 394 U.S. 310, 313, 89 S.Ct. 1163, 1165, 22 L.Ed.2d 297 (1969). In that case the Justice noted that the Court's decision in Alderman v. United States, 394 U.S. 165, 89 S.Ct. 961, 22 L.Ed.2d 176 (1969), dealt only with the question of what procedures should be utilized to determine if the defendant's convictions had been tainted by admittedly illegal electronic surveillance and did not hold that determination of the validity of the surveillance required an adversary proceeding. See also Taglianetti v. United States, 394 U.S. 316, 317, 89 S.Ct. 1099, 22 L.Ed.2d 302 (1969) (per curiam). These and several other cases cited by the government involved pre-Title III wiretaps and were decided on fourth amendment rather than statutory grounds. Here the basis of my decision is Section 2518(9), the plain language of which makes disclosure of the application and order mandatory for those, such as petitioner, entitled to make the statutory suppression motion. [10] Not only the contents of the application and order, but also their very existence may be protected from disclosure at least temporarily under the provision of Section 2518(8)(d) allowing for the postponement of service of the post-intercept inventory on an ex parte showing of good cause. But this section may not be invoked to delay disclosure of the application and order beyond the point when it is required to be made under Section 2518(9) to a party facing a "proceeding." See United States v. Eastman, 465 F.2d 1057, 1063 n. 13 (3d Cir. 1972). [11] Notice must be given to the targets of a wiretap application that has not been approved by the court. See Section 2518(8)(d). [12] Grand jury witnesses fall into this category, which also explains why they are excluded from the class entitled to make the Section 2518(10)(a) suppression motion. The purpose of calling a witness before the grand jury is not to inflict punishment upon him but to secure the information he possesses with regard to a matter under investigation. In cases such as Persico and Lochiatto prosecution for contempt was not sought as an end in itself but only as a means of forcing the witness to provide the requested information. [13] The legislative history of Section 2518(8)(b) does contain the following statement, "Applications and orders may not be disclosed except incidental to the disclosure or use of the records themselves after a showing of good cause, for example, under [Section 2518](10)(a) discussed below." S.Rep.No.1097, supra, 1968 U.S.Code Cong. & Adm.News, at p. 2194. In view of the clearly directory character of the language used in Section 2518(9), the section which specifically deals with disclosure to a party facing a "proceeding," I believe the above statement must be taken to mean not that a showing of good cause is required for disclosure of the application and order incident to a Section 2518(10)(a) motion, but that the opportunity to file such a motion is in itself an example of "good cause" for the disclosure. [14] Of course, the very fact that Sections 2518(8) and (10)(a) plainly do give the courts discretion with respect to certain matters shows that Congress was at no loss to find appropriate language when it wished to do so. Its failure to use such language with respect to Section 2518(9) is thus persuasive evidence that disclosure of the application and order under that section was intended to be mandatory. [15] For example if the motion were based on, say, failure to minimize interceptions of attorney-client conversations, review of such interceptions would be relevant to deciding the motion. Cf. Losing, supra, at 1179-80. In giving this example, I emphasize that the mere fact the intercepted communication is relevant to the motion to suppress does not mean that it must be disclosed. As noted in the text under Section 2518(10)(a) the judge has discretion with respect to such disclosure. [16] The government points out that applications and orders covered by Section 2518(9) need not be mutually exclusive of intercepted communications covered by Section 2518(10)(a). This situation would arise where evidence derived from one wiretap was utilized as part of the probable cause for obtaining a second wiretap. I agree with the government's observation as a factual matter, but am unable to agree that this justifies a conclusion that disclosure of the application and order is discretionary. While a communication may be more sensitive than other information contained in an application, once it is incorporated into another application it becomes part of the foundation upon which the legality of the other interception depends and for the reasons stated in the text its disclosure then becomes of paramount importance to a party facing a "proceeding" based on that interception.
FreeLaw
Christmas (Johnny Reid album) Christmas is the first Christmas album by the Canadian country music artist Johnny Reid. It was released on November 10, 2009, by MapleMusic Recordings. The album contains nine Christmas classics along with the original songs "Waiting for Christmas to Come" and "Christmas Time Again". Christmas was certified Gold by the Canadian Recording Industry Association within one day of release. Track listing Personnel Eddie Bayers- drums Richard Bennett- bouzouki, acoustic guitar, electric guitar Eric Darken- percussion Bailey Eleazer- children's choir Sophie Eleazer- children's choir Vicki Hampton- background vocals Tania Hancheroff- background vocals Jim Hoke- harmonica, mandolin, baritone saxophone, tenor saxophone John Barlow Jarvis- organ, piano, Wurlitzer Caylor Lanius- children's choir Sam Levine- penny whistle Brent Maher- background vocals Joy Owings- children's choir Johnny Reid- lead vocals, background vocals Mark Selby- acoustic guitar, electric guitar Glenn Worf- bass guitar Chart performance Certifications References Category:Johnny Reid albums Category:2009 Christmas albums Category:Christmas albums by Canadian artists Category:Country Christmas albums
Wikipedia (en)
Choice commercial location in the heart of Milford's historic district. The structure is appoximately 1,400 square feet divided equally over two floors. The owner is a real estate broker. Broker will hold a contract for deed with a $50,000.00 down payment with a three to five year balloon. Terms are flexible.
Pile-CC
Marie-Thérèse Bruguière Marie-Thérèse Bruguière (born 26 October 1942) in Mauguio, Hérault, is a French politician, and retired hospital administrator. She was elected to represent the Department of Hérault in the Senate of France (le Sénat) on 21 September 2008. She is a member of the Union for a Popular Movement (UMP), which is a part of the European People's Party (PPE). Current positions Mayor of Saint-Aunès since 1989 Regional Councillor since 2004 Senator from l'Hérault since 2008 Vice president of the Communauté de communes du Pays de l'Or President of the SIVOM de l'étang de l'Or External links Her page on the Senate web site Category:1946 births Category:Living people Category:French Senators of the Fifth Republic Category:Union for a Popular Movement politicians Category:Women members of the Senate (France) Category:21st-century French women politicians Category:Senators of Hérault
Wikipedia (en)
// Copyright (C) 2013 Davis E. King (davis@dlib.net) // License: Boost Software License See LICENSE.txt for the full license. #undef DLIB_PARALLEL_FoR_ABSTRACT_Hh_ #ifdef DLIB_PARALLEL_FoR_ABSTRACT_Hh_ #include "thread_pool_extension_abstract.h" #include "async_abstract.h" namespace dlib { // ---------------------------------------------------------------------------------------- template <typename T> void parallel_for_blocked ( thread_pool& tp, long begin, long end, T& obj, void (T::*funct)(long, long), long chunks_per_thread = 8 ); /*! requires - begin <= end - chunks_per_thread > 0 ensures - This is a convenience function for submitting a block of jobs to a thread_pool. In particular, given the half open range [begin, end), this function will split the range into approximately tp.num_threads_in_pool()*chunks_per_thread blocks, which it will then submit to the thread_pool. The given thread_pool will then call (obj.*funct)() on each of the subranges. - To be precise, suppose we have broken the range [begin, end) into the following subranges: - [begin[0], end[0]) - [begin[1], end[1]) - [begin[2], end[2]) ... - [begin[n], end[n]) Then parallel_for_blocked() submits each of these subranges to tp for processing such that (obj.*funct)(begin[i], end[i]) is invoked for all valid values of i. Moreover, the subranges are non-overlapping and completely cover the total range of [begin, end). - This function will not perform any memory allocations or create any system resources such as mutex objects. !*/ // ---------------------------------------------------------------------------------------- template <typename T> void parallel_for_blocked ( unsigned long num_threads, long begin, long end, T& obj, void (T::*funct)(long, long), long chunks_per_thread = 8 ); /*! requires - begin <= end - chunks_per_thread > 0 ensures - This function is equivalent to the following block of code: thread_pool tp(num_threads); parallel_for_blocked(tp, begin, end, obj, funct, chunks_per_thread); !*/ // ---------------------------------------------------------------------------------------- template <typename T> void parallel_for_blocked ( thread_pool& tp, long begin, long end, const T& funct, long chunks_per_thread = 8 ); /*! requires - chunks_per_thread > 0 - begin <= end ensures - This is a convenience function for submitting a block of jobs to a thread_pool. In particular, given the range [begin, end), this function will split the range into approximately tp.num_threads_in_pool()*chunks_per_thread blocks, which it will then submit to the thread_pool. The given thread_pool will then call funct() on each of the subranges. - To be precise, suppose we have broken the range [begin, end) into the following subranges: - [begin[0], end[0]) - [begin[1], end[1]) - [begin[2], end[2]) ... - [begin[n], end[n]) Then parallel_for_blocked() submits each of these subranges to tp for processing such that funct(begin[i], end[i]) is invoked for all valid values of i. - This function will not perform any memory allocations or create any system resources such as mutex objects. !*/ // ---------------------------------------------------------------------------------------- template <typename T> void parallel_for_blocked ( unsigned long num_threads, long begin, long end, const T& funct, long chunks_per_thread = 8 ); /*! requires - begin <= end - chunks_per_thread > 0 ensures - This function is equivalent to the following block of code: thread_pool tp(num_threads); parallel_for_blocked(tp, begin, end, funct, chunks_per_thread); !*/ // ---------------------------------------------------------------------------------------- template <typename T> void parallel_for_blocked ( long begin, long end, const T& funct, long chunks_per_thread = 8 ); /*! requires - begin <= end - chunks_per_thread > 0 ensures - This function is equivalent to the following block of code: parallel_for_blocked(default_thread_pool(), begin, end, funct, chunks_per_thread); !*/ // ---------------------------------------------------------------------------------------- // ---------------------------------------------------------------------------------------- template <typename T> void parallel_for ( thread_pool& tp, long begin, long end, T& obj, void (T::*funct)(long), long chunks_per_thread = 8 ); /*! requires - begin <= end - chunks_per_thread > 0 ensures - This function is equivalent to the following function call: parallel_for_blocked(tp, begin, end, [&](long begin_sub, long end_sub) { for (long i = begin_sub; i < end_sub; ++i) (obj.*funct)(i); }, chunks_per_thread); - Therefore, this routine invokes (obj.*funct)(i) for all i in the range [begin, end). However, it does so using tp.num_threads_in_pool() parallel threads. - This function will not perform any memory allocations or create any system resources such as mutex objects. !*/ // ---------------------------------------------------------------------------------------- template <typename T> void parallel_for ( unsigned long num_threads, long begin, long end, T& obj, void (T::*funct)(long), long chunks_per_thread = 8 ); /*! requires - begin <= end - chunks_per_thread > 0 ensures - This function is equivalent to the following block of code: thread_pool tp(num_threads); parallel_for(tp, begin, end, obj, funct, chunks_per_thread); !*/ // ---------------------------------------------------------------------------------------- template <typename T> void parallel_for ( thread_pool& tp, long begin, long end, const T& funct, long chunks_per_thread = 8 ); /*! requires - begin <= end - chunks_per_thread > 0 ensures - This function is equivalent to the following function call: parallel_for_blocked(tp, begin, end, [&](long begin_sub, long end_sub) { for (long i = begin_sub; i < end_sub; ++i) funct(i); }, chunks_per_thread); - Therefore, this routine invokes funct(i) for all i in the range [begin, end). However, it does so using tp.num_threads_in_pool() parallel threads. - This function will not perform any memory allocations or create any system resources such as mutex objects. !*/ // ---------------------------------------------------------------------------------------- template <typename T> void parallel_for ( unsigned long num_threads, long begin, long end, const T& funct, long chunks_per_thread = 8 ); /*! requires - begin <= end - chunks_per_thread > 0 ensures - This function is equivalent to the following block of code: thread_pool tp(num_threads); parallel_for(tp, begin, end, funct, chunks_per_thread); !*/ // ---------------------------------------------------------------------------------------- template <typename T> void parallel_for ( long begin, long end, const T& funct, long chunks_per_thread = 8 ); /*! requires - begin <= end - chunks_per_thread > 0 ensures - This function is equivalent to the following block of code: parallel_for(default_thread_pool(), begin, end, funct, chunks_per_thread); !*/ // ---------------------------------------------------------------------------------------- // ---------------------------------------------------------------------------------------- template <typename T> void parallel_for_verbose ( thread_pool& tp, long begin, long end, T& obj, void (T::*funct)(long), long chunks_per_thread = 8 ); /*! requires - begin <= end - chunks_per_thread > 0 ensures - This function is identical to the parallel_for() routine defined above except that it will print messages to cout showing the progress in executing the parallel for loop. !*/ // ---------------------------------------------------------------------------------------- template <typename T> void parallel_for_verbose ( unsigned long num_threads, long begin, long end, T& obj, void (T::*funct)(long), long chunks_per_thread = 8 ); /*! requires - begin <= end - chunks_per_thread > 0 ensures - This function is identical to the parallel_for() routine defined above except that it will print messages to cout showing the progress in executing the parallel for loop. !*/ // ---------------------------------------------------------------------------------------- template <typename T> void parallel_for_verbose ( thread_pool& tp, long begin, long end, const T& funct, long chunks_per_thread = 8 ); /*! requires - begin <= end - chunks_per_thread > 0 ensures - This function is identical to the parallel_for() routine defined above except that it will print messages to cout showing the progress in executing the parallel for loop. !*/ // ---------------------------------------------------------------------------------------- template <typename T> void parallel_for_verbose ( unsigned long num_threads, long begin, long end, const T& funct, long chunks_per_thread = 8 ); /*! requires - begin <= end - chunks_per_thread > 0 ensures - This function is identical to the parallel_for() routine defined above except that it will print messages to cout showing the progress in executing the parallel for loop. !*/ // ---------------------------------------------------------------------------------------- template <typename T> void parallel_for_verbose ( long begin, long end, const T& funct, long chunks_per_thread = 8 ); /*! requires - begin <= end - chunks_per_thread > 0 ensures - This function is identical to the parallel_for() routine defined above except that it will print messages to cout showing the progress in executing the parallel for loop. - It will also use the default_thread_pool(). !*/ // ---------------------------------------------------------------------------------------- // ---------------------------------------------------------------------------------------- template <typename T> void parallel_for_blocked_verbose ( thread_pool& tp, long begin, long end, T& obj, void (T::*funct)(long,long), long chunks_per_thread = 8 ); /*! requires - begin <= end - chunks_per_thread > 0 ensures - This function is identical to the parallel_for_blocked() routine defined above except that it will print messages to cout showing the progress in executing the parallel for loop. !*/ // ---------------------------------------------------------------------------------------- template <typename T> void parallel_for_blocked_verbose ( unsigned long num_threads, long begin, long end, T& obj, void (T::*funct)(long,long), long chunks_per_thread = 8 ); /*! requires - begin <= end - chunks_per_thread > 0 ensures - This function is identical to the parallel_for_blocked() routine defined above except that it will print messages to cout showing the progress in executing the parallel for loop. !*/ // ---------------------------------------------------------------------------------------- template <typename T> void parallel_for_blocked_verbose ( thread_pool& tp, long begin, long end, const T& funct, long chunks_per_thread = 8 ); /*! requires - begin <= end - chunks_per_thread > 0 ensures - This function is identical to the parallel_for_blocked() routine defined above except that it will print messages to cout showing the progress in executing the parallel for loop. !*/ // ---------------------------------------------------------------------------------------- template <typename T> void parallel_for_blocked_verbose ( unsigned long num_threads, long begin, long end, const T& funct, long chunks_per_thread = 8 ); /*! requires - begin <= end - chunks_per_thread > 0 ensures - This function is identical to the parallel_for_blocked() routine defined above except that it will print messages to cout showing the progress in executing the parallel for loop. !*/ // ---------------------------------------------------------------------------------------- template <typename T> void parallel_for_blocked_verbose ( long begin, long end, const T& funct, long chunks_per_thread = 8 ); /*! requires - begin <= end - chunks_per_thread > 0 ensures - This function is identical to the parallel_for_blocked() routine defined above except that it will print messages to cout showing the progress in executing the parallel for loop. - It will also use the default_thread_pool() !*/ // ---------------------------------------------------------------------------------------- } #endif // DLIB_PARALLEL_FoR_ABSTRACT_Hh_
Github
Virginia residents have just a little more time to provide feedback to the Department of Education as it redesigns public school performance report cards, which provide accountability ratings. The final product is not only supposed to allow users to sift through information more fluidly, but will also provide a more customized layout of demographics. Less than a third of each dollar spent on higher education today goes to those who do the teaching. The rest is spent on administration, campus maintenance and other services students expect for the often high tuitions they pay, but that situation may be changing as low-paid faculty members join unions and find new ways to get better compensation. Fifty years ago, more than 75% of college faculty members were full-time and had tenure or were on track to get it. Today, only a third are part of that elite group. Many of those doing the teaching at American universities are poorly paid, have no job security and limited benefits. Some have PhD’s but still qualify for government assistance to buy food. The general public might think of universities as places for learning - and that would make teaching a valued resource, but a growing number of people at the head of college classrooms are making less than the minimum wage, have no job security and no benefits. In the first part of our series, we look at how a majority of college instructors are not tenured or even on track to full-time, tenured positions. Rose Forp spent many years training adults in the workplace. Over time, it dawned on her that she loved to teach.
Pile-CC
Craven Cave-In In a transparent effort to appease upstate Republicans angry about the city's management of a camp for the homeless located in suburban Orange County, the Giuliani administration has quietly reversed its position on a five-year-old lawsuit, agreeing to expensive security protocols it does not impose in any of its 38 other shelters. The turnabout occurred after Rudy Giuliani's appearance at an Orange County Republican dinner on April 6 was boycotted by two local Republicans—County Executive Joseph Rampe and Town of Blooming Grove supervisor Katherine Bonelli—both of whom have been suing the city about conditions at the camp since Giuliani took office in 1994. Homeless advocates are concerned that the concessions—which range from fencing in the entire 360-acre camp to NYPD supervision of a dramatically increased security force—may turn the city's largest shelter "into a prison." Bonelli told the Voice that, because of the long-standing litigation, Giuliani "can't say he didn't know" about the problems camp residents have been causing in the surrounding communities, adding that "the first time he came to our county, he came for political reasons, not to address the issues of the camp." Nonetheless, local Republicans expect action now, precisely because of the mayor's new statewide senate ambitions. Dominick Fiorille/ Times Herald Record Giuliani in Orange County: "I'm sorry if NYC hasn't been as responsive to this as it should have been." At the mayor's direction, Corporation Counsel Michael Hess led a seven-member delegation of top city officials on a highly unusual trip upstate on May 5, holding separate meetings with attorneys for the county and town, as well as lunching at the GOP headquarters there with party leaders and others concerned about the camp. Surrounded by miniature elephant statues and I Love Newt signs, Hess and his entourage, including Homeless Services Commissioner Marty Oesterreich and Deputy Police Commissioner Richard Sheirer, announced a series of concessions at the party session. In an hour-long meeting chaired by the same county leader who invited the mayor to the April dinner, John Hicks, and including 10 local Republican leaders or their representatives, the city officials said they were taking steps, such as rigorous warrant checks before placing homeless at the camp, that Hess's office had previously rejected in court papers as illegal. The gist of the county complaint, first asserted in a 1994 filing, is that the city has used the facility—which is called Camp LaGuardia and houses up to a thousand homeless men—as a "dumping ground" for residents who are "criminal and dangerous." These men are "allowed to leave" the camp "to harass and annoy" people in Blooming Grove, Chester, and other towns, according to the lawsuit. The Giuliani administration employed every imaginable legal tactic against the suits until recently—seeking a change of venue from Orange County, fighting the depositions of city employees, appealing a lower court loss, and filing a 1998 motion for summary judgment seeking dismissal. It has also significantly increased the number of men bused to the camp, raising the average daily population from 770 men during the Dinkins administration to 925 last fiscal year. But County Attorney Richard Golden says "there's been a remarkable reversal" in the city's position since the mayor's campaign appearance. "It's very atypical for corporation counsel to be involved this personally on any litigation and he has done so at the request of the mayor. They have been very cooperative and eager to find a way in which they can address the concerns of Orange County. The best word to describe the city's initial response to this lawsuit is complete indifference. That has changed 180 degrees." Golden's assessment is in stark contrast to his contention in a November brief that the city was treating Orange County as if it were "a Scrooge-like NIMBY attempting to interfere for its own selfish reasons with the munificent charitable work conducted by the city at Camp LaGuardia." Indeed, city attorneys argued it was "abundantly clear" that the county was trying "to affect adversely the interests of the homeless" by "violating their civil rights." Observing that the county sought "to limit the ability of Camp LaGuardia residents to leave and reenter Camp LaGuardia," a city attorney countered that "homeless individuals have various rights, which must be recognized," citing prior court decisions. A December 11, 1997, city brief flatly contended that, "contrary" to the county's "assertions," a "warrant check cannot be done as a condition of granting shelter to a homeless person." Yet Sheirer, who is chief of staff to Police Commissioner Howard Safir, announced at the Hess meeting that the department had instituted a system of wide-ranging warrant checks "in the last three weeks." He said the checks were not just of felonies, but of misdemeanors. "We're going to have an NYPD person, either on loan to DHS or assigned to us with an online computer" at the Bellevue facility in Manhattan, where homeless are assigned to the camp, promised Sheirer, and he is "going to be able to check each person" sent to LaGuardia. As recently as November 6, 1998, a city attorney claimed in a letter to the county that "many of the warrants" for LaGuardia residents were so minor that they "involved failure to perform community service or to pay a fine or surcharge." The city also deposed Orange County sheriff Frank Bigger to elicit testimony that "police officers under his command" made virtually no arrests of LaGuardia residents, a contention buttressed by a recent New York Times story by Nina Bernstein, which said that town police "could recall no serious crime against a local resident by a LaGuardia man."
Pile-CC
Q: Approximating π via Monte Carlo simulation Inspired by a tweet linked to me by a friend and a Haskell implementation by her for the same problem, I decided to try my hand at approximating the value of π using everything in the Haskell standard library I could find for the job. Here’s what I came up with: module Pi where import Data.List (genericLength) import Control.Arrow (Arrow, (<<<), (***), arr) import System.Random (newStdGen, randoms) type Point a = (a, a) chunk2 :: [a] -> [(a, a)] chunk2 [] = [] chunk2 [_] = error "list of uneven length" chunk2 (x:y:r) = (x, y) : chunk2 r both :: Arrow arr => arr a b -> arr (a, a) (b, b) both f = f *** f unsplit :: Arrow arr => (a -> b -> c) -> arr (a, b) c unsplit = arr . uncurry randomFloats :: IO [Float] randomFloats = randoms <$> newStdGen randomPoints :: IO [Point Float] randomPoints = chunk2 <$> randomFloats isInUnitCircle :: (Floating a, Ord a) => Point a -> Bool isInUnitCircle (x, y) = x' + y' < 0.25 where x' = (x - 0.5) ** 2 y' = (y - 0.5) ** 2 lengthRatio :: (Fractional c) => [b] -> [b] -> c lengthRatio = curry (unsplit (/) <<< both genericLength) approximatePi :: [Point Float] -> Float approximatePi points = circleRatio * 4.0 where circlePoints = filter isInUnitCircle points circleRatio = circlePoints `lengthRatio` points main :: IO () main = do putStrLn "How many points do you want to generate to approximate π?" numPoints <- read <$> getLine points <- take numPoints <$> randomPoints print $ approximatePi points I’m interested in a general review, but I’m especially curious about my use of arrows: is there a better way to write lengthRatio? Are anything like both and unsplit provided anywhere in the standard library? If not, do any packages help? A: About those arrows I’m interested in a general review, but I’m especially curious about my use of arrows: is there a better way to write lengthRatio? Compare the following two lines. Both do the same, but which one would you rather see if you need to change your code drunk in three months, with only 5% battery left? lengthRatio = curry (unsplit (/) <<< both genericLength) lengthRatio xs ys = genericLength xs / genericLength ys Also, which one has which type, and which one is more general? Arrows are great if you want to abstract functions. But throughout your small script, you're still just working with (->), not any other instance of Arrow. For a small script like this, Arrow is too much. For example the pointwise definition above is actually a character shorter than the pointfree one. Sure, the pointfree one is clever, but it's also very beginner-unfriendly. About randomness randomPoints introduces a dependency between your point coordinates \$x\$ and \$y\$, since both draw from the same sequence. This usually leads to points on hyperplanes (see disadvantages of LCG and spectral test). Your friends variant doesn't have this immediate problem: randomTuples :: Int -> IO [(Float, Float)] randomTuples n = do seed1 <- newStdGen seed2 <- newStdGen let xs = randoms seed1 :: [Float] -- two different ys = randoms seed2 :: [Float] -- generators being used return $ take n $ zipWith (,) xs ys However, since newStdGen is merely a split, it's more or less hiding the dependency at another place. Still, it's something to keep in mind, if you don't want to end up with something like this. But how would you check this? Well, you would run tests, over and over. Here's the second design critique on randomPoints, it doesn't take a RandomGen. Truth be told, if I say that Arrow is too much for a small script, then randomPoints :: RandomGen g => g -> [Point Float] is too much either. Also, if you know you're going to generate Points, a newtype Point a together with instance Random a => Random (Point a) where is feasible and doesn't introduce a potential error via chunk2. Keep possible problems with Random in mind, though. About names The function isInUnitCircle lies. It's not testing whether the point \$(x,y)\$ lies in the circle with radius \$r = 1\$ with center in the origin, e.g. $$ \sqrt{x^2 + y^2} \le 1^2 \Leftrightarrow x^2 + y^2 \le 1 $$ but in the circle with diameter \$d = 2r = 1\$ with center in \$(0.5, 0.5)\$. In the following picture, the green region is where you generate your random values. In the left one, you see the regular unit circle, in the right one, you see the circle size you're actually testing (after shifting your values from the green square into the red one): Therefore, you're not calculating the "usual" fourth of a circle, but instead a circle with a fourth of the original size (\$\pi(\frac{1}{2})^2 = \frac{\pi}{4}\$)). Luckily, it doesn't matter for the convergence. A real test that checks whether a point is in the unit circle is tremendously easier: isInUnitCircle :: (Num a, Ord a) => Point a -> Bool isInUnitCircle (x, y) = x ^ 2 + y ^ 2 <= 1 About optimization Last, but not least, there's an issue with approximatePi, or rather the use of lengthRatio on the same list twice. Actually, taking the length of the list again is a litle bit strange, since you know how large the sample is: numPoints <- read <$> getLine -- sample size points <- take numPoints <$> randomPoints print $ approximatePi points -- sample size still known (?) But let's say that you don't actually know how many points you have. Let's assume that someone wants to check a many points. Suddenly, the memory usage of your program explodes: $ echo 10000000 | ./CalcPi +RTS -s How many points do you want to generate to approximate π? 3.141744 33,724,505,920 bytes allocated in the heap 5,288,250,096 bytes copied during GC 1,319,621,976 bytes maximum residency (17 sample(s)) 5,554,344 bytes maximum slop 2587 MB total memory in use (0 MB lost due to fragmentation) Tot time (elapsed) Avg pause Max pause Gen 0 63626 colls, 0 par 1.606s 3.155s 0.0000s 0.0006s Gen 1 17 colls, 0 par 2.732s 3.373s 0.1984s 1.2720s INIT time 0.000s ( 0.000s elapsed) MUT time 17.158s ( 15.542s elapsed) GC time 4.337s ( 6.528s elapsed) EXIT time 0.019s ( 0.166s elapsed) Total time 21.514s ( 22.236s elapsed) %GC time 20.2% (29.4% elapsed) Alloc rate 1,965,530,983 bytes per MUT second Productivity 79.8% of total user, 77.2% of total elapsed Even though randoms generates a lazy list, approximatePi needs to hold onto it completely due to lengthRatio. A classic space leak. The altnerative version of lengthRatio won't save you from that. Instead, provide a function to check the ratio of filtered elements: -- Rational from Data.Ratio filterRatio :: (a -> Bool) -> [a] -> Rational filterRatio p xs = -- exercise That way, you can define a version of approximatePi that works for large lists: approximatePi :: [Points Float] -> Double approximatePi points = circleRatio * 4 where circleRatio = fromRational $ filterRatio isInUnitCircle points $ echo 10000000 | ./GenPIRatio +RTS -s How many points do you want to generate to approximate π? 3.1421592 24,445,866,792 bytes allocated in the heap 15,555,552 bytes copied during GC 77,896 bytes maximum residency (2 sample(s)) 21,224 bytes maximum slop 1 MB total memory in use (0 MB lost due to fragmentation) Tot time (elapsed) Avg pause Max pause Gen 0 46874 colls, 0 par 0.012s 0.113s 0.0000s 0.0001s Gen 1 2 colls, 0 par 0.000s 0.000s 0.0001s 0.0001s INIT time 0.000s ( 0.000s elapsed) MUT time 10.809s ( 10.746s elapsed) GC time 0.012s ( 0.113s elapsed) EXIT time 0.000s ( 0.000s elapsed) Total time 10.821s ( 10.859s elapsed) %GC time 0.1% (1.0% elapsed) Alloc rate 2,261,657,279 bytes per MUT second Productivity 99.9% of total user, 99.5% of total elapsed Summary Food for thought: Use the right level of abstraction for your problem. Arrow is an overkill for such a small script, but alright for learning. Try to decrease the amount of IO wherever possible, but again, that might be too abstract for a small script. Bad: Don't lie, give things the right name. Don't overcomplicate, keep pointfree to a sane minimum. Major space leak in approximatePi. Read the linked section of RWH and try to define filterRatio or a similar function. Good: Type signatures! Yay! Explicit imports! Type synonym instead of (a, a) everywhere! So beside the slight arrow-overkill, well done.
StackExchange
Q: Find the sum of the series $S = \sum_{k=1}^{n} \frac{k}{k^{4} + k^{2} + 1} $ $$ S = \sum_{k=1}^{n} \frac{k}{k^{4} + k^{2} + 1} $$ I started by factorizing the denominator as $k^2+k+1$ and $k^2-k+1$ The numerator leaves a quadratic with $k$ and $k-1$ or a constant with $k+1$ and $k-1.$ I tried writing the individual terms, ofcourse, it was useless. How do I do this? A: So your term is equal to $$\frac{1}{2}\left(\frac{1}{k^2-k+1}-\frac{1}{k^2+k+1}\right)$$ Now note $(k+1)^2-(k+1)+1=k^2+k+1$, so your term is: $$\frac{1}{2}\left(\frac{1}{k^2-k+1}-\frac{1}{(k+1)^2-(k+1)+1}\right)$$ and you can apply a telescoping series technique to establish the sum to $n$ is just half of $\frac{1}{1^2 -1 +1}-\frac{1}{(n+1)^2-(n+1)+1}$. And if you are also looking for the limit, half of $\frac{1}{1^2 -1 +1}$.
StackExchange
Nucleation of microbiologic calcification by proteolipid. The component of crude phospholipid responsible for B. matruchotii calcification was isolated. Crude phospholipid, extracted from the microorganism, was separated into five fractions by column chromatography. A single, protein-containing fraction catalyzed apatite formation in a metastable calcium phosphate solution. The nucleating fraction was identified as a proteolipid.
PubMed Abstracts
Q: Obtaining EntityManager in Spring + Hibernate configuration I have a Spring MVC 4.0 application, and I am learning JPA. I use Hibernate as the JPA implementation. I can configure Hibernate as described in this tutorial. It works fine, but I have to use Hibernate's Session object: @Autowired SessionFactory sessionFactory; ... Session session = sessionFactory.openSession(); Now, I want to use JPA's EntityManager instead. I have followed this tutorial on the same web site (the configuration is very similar). And I tried to obtain an EntityManager object this way: @PersistenceContext EntityManager entityManager; I got a runtime message: java.lang.IllegalStateException: No transactional EntityManager available Then, I followed the suggestion in this answer, and tried to use the following code: @PersistenceContext EntityManager entityManager; ... entityManager=entityManager.getEntityManagerFactory().createEntityManager(); It works a few times (about 9 repetitive method invocations), and then the application freezes. What is the right way to get EntityManager in Spring + Hibernate configuration? I do not need any Spring transaction functionality for now. I just want to get an access to EntityManager and play with JPA. Spring/Hibernate configuration file (hibernate.xml) <?xml version="1.0" encoding="UTF-8"?> <beans xmlns="http://www.springframework.org/schema/beans" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:context="http://www.springframework.org/schema/context" xmlns:tx="http://www.springframework.org/schema/tx" xsi:schemaLocation="http://www.springframework.org/schema/beans http://www.springframework.org/schema/beans/spring-beans-4.0.xsd http://www.springframework.org/schema/context http://www.springframework.org/schema/context/spring-context-4.0.xsd http://www.springframework.org/schema/tx http://www.springframework.org/schema/tx/spring-tx-4.0.xsd"> <bean id="dataSource" class="org.apache.tomcat.dbcp.dbcp.BasicDataSource"> <property name="driverClassName" value="com.mysql.jdbc.Driver" /> <property name="url" value="jdbc:mysql://localhost:3306/test_db" /> <property name="username" value="test" /> <property name="password" value="test" /> </bean> <bean id="entityManagerFactory" class="org.springframework.orm.jpa.LocalContainerEntityManagerFactoryBean"> <property name="dataSource" ref="dataSource" /> <property name="packagesToScan" value="net.myproject" /> <property name="jpaVendorAdapter"> <bean class="org.springframework.orm.jpa.vendor.HibernateJpaVendorAdapter" /> </property> <property name="jpaProperties"> <props> <prop key="hibernate.hbm2ddl.auto">update</prop> <prop key="hibernate.dialect">org.hibernate.dialect.MySQL5Dialect</prop> <prop key="hibernate.show_sql">true</prop> </props> </property> </bean> <bean id="transactionManager" class="org.springframework.orm.jpa.JpaTransactionManager"> <property name="entityManagerFactory" ref="entityManagerFactory" /> </bean> <bean id="persistenceExceptionTranslationPostProcessor" class="org.springframework.dao.annotation.PersistenceExceptionTranslationPostProcessor" /> <tx:annotation-driven /> </beans> The class where I attempt to use EntityManager @Repository public class ProductsService { @PersistenceContext EntityManager entityManager; @Transactional public GridResponse<Product> getProducts(GridRequest dRequest) { // The following line causes the exception: "java.lang.IllegalStateException: No transactional EntityManager available" Session session = entityManager.unwrap(Session.class); //... } ... A: For the @PersistenceContext EntityManager entityManager; approach, add tx:annotation-driven to your .xml configuration and mark your methods where you use entityManager as @Transactional. A: It can be use with @Autowired as shown in https://stackoverflow.com/a/33742769/2028440 @Autowired private EntityManager entityManager;
StackExchange
Q: Die if anything is written to STDERR? How can I force Perl script to die if anything is written to STDERR ? Such action should be done instantly, when such output happen, or even before, to prevent that output... A: This doesn't seem like an especially smart idea, but a tied filehandle should work. According to the perltie manpage: When STDERR is tied, its PRINT method will be called to issue warnings and error messages. This feature is temporarily disabled during the call, which means you can use warn() inside PRINT without starting a recursive loop. So something like this (adapted from the manpage example) ought to work: package FatalHandle; use strict; use warnings; sub TIEHANDLE { my $i; bless \$i, shift } sub PRINT { my $r = shift; die "message to STDERR: ", @_; } package main; tie *STDERR, "FatalHandle"; warn "this should be fatal."; print "Should never get here."; And that outputs (with exit code 255): message to STDERR: this should be fatal. at fh.pl line 17. A: Here's a method that works no matter how STDERR (fd 2) is written to, even if it's a C extension that doesn't use Perl's STDERR variable to do so. It will even kill child processes that write to STDERR! { pipe(my $r, my $w) or die("Can't create pipe: $!\n"); open(STDERR, '>&', $w) or die("Can't dup pipe: $!\n"); close($r); } print "abc\n"; print "def\n"; print STDERR "xxx\n"; print "ghi\n"; print "jkl\n"; $ perl a.pl abc def $ echo $? 141 Doesn't work on Windows. Doesn't work if you add a SIGPIPE handler.
StackExchange
Robert Khuzami, Director, SEC Division of Enforcement, testified today before the House Oversight and Government Reform Committee and Domestic Policy Subcommittee, on Events Surrounding Bank of America’s Acquisition of Merrill Lynch. His prepared testimony defends the proposed settlement rejected by Judge Rakoff and discusses the Bank's assertion of attorney-client privilege. An amendment to the House financial regulation legislation that would have subjected investment advisers associated with broker-dealers to FINRA regulation was defeated by voice vote. This is a battle of the titans among influential lobbyists, as the broker-dealer groups go against the investment advisory groups. The broker-dealers might have expected more support since FINRA's former CEO, Mary Schapiro, is now SEC Chair, but that isn't how it played out. InvNews,House scraps plan to place B-D advisers under Finra (UPDATED). (hat tip: Jill Gross) The SEC today announced insider trading charges against Brien P. Santarlas — a former attorney at Ropes & Gray LLP — for his alleged role in the insider trading ring that made over $20 million trading ahead of corporate acquisition announcements using inside information tipped by Santarlas and his colleague at Ropes & Gray, Arthur J. Cutillo, in exchange for cash kickbacks. The SEC alleges that Santarlas misappropriated from his law firm material, nonpublic information concerning at least two corporate acquisitions involving Ropes & Gray clients — 3Com Corp. and Axcan Pharma Inc. The U.S. Attorney's Office for the Southern District of New York also announced today criminal charges against Santarlas in connection with the above insider trading scheme. The complaint alleges that Santarlas gained access to material, nonpublic information by, among other means, accessing Ropes & Gray's computer network and viewing confidential deal documents. The SEC alleges that, using attorney Jason Goldfarb as a conduit, Santarlas and Cutillo tipped inside information concerning these corporate acquisitions to Zvi Goffer ("Zvi"), a proprietary trader at Schottenfeld Group, LLC ("Schottenfeld"). The complaint further alleges that Zvi traded on this information for Schottenfeld, and had numerous downstream tippees who also traded on the information, including other professional traders and portfolio managers at hedge fund advisers. The SEC previously charged Cutillo, Goldfarb, Zvi, and six others in connection with this insider trading scheme on November 5, 2009. See SEC v. Cutillo, et al., 09-CV-9208 (S.D.N.Y.) (LAK)/Lit. Rel. 21283. The SEC today filed a settled civil injunctive action against Investools Inc., Michael J. Drew and Eben D. Miller. According to the SEC's complaint, from 2004 to approximately June 2007, at Investools how-to-trade-securities workshops former Investools employees Drew and Miller misleadingly portrayed themselves as expert investors who made their living trading securities. They did so to mislead investors into believing that they too would make extraordinary profits trading securities if they purchased expensive Investools instructional courses and other products and followed Investools' securities trading strategies. The complaint further alleges that in reality, neither Drew nor Miller made the trading profits they claimed. The complaint also alleges that Investools is liable for the fraudulent conduct of its sales personnel as a "controlling person" under the federal securities laws. Investools agreed to a civil injunction and to pay a $3 million civil penalty. Drew and Miller agreed, respectively, to pay civil penalties of $380,000 and $130,000, and to be enjoined from violating the antifraud provisions of the federal securities laws. Drew and Miller additionally agreed to be enjoined, for five years, from receiving compensation for their participation in, among other related activities, the sale of classes, workshops, or seminars given to actual or prospective securities investors concerning securities trading. In settling the matter, Investools, Drew and Miller neither admitted nor denied the allegations in the Commission's complaint. Robert Khuzami, SEC Director, Division of Enforcement, testified yesterday on Mortgage Fraud, Securities Fraud, and the Financial Meltdown: Prosecuting Those Responsible before the United States Senate Committee on the Judiciary. The SEC announced an Open Meeting - Wednesday, December 16, 2009 - 10:00 a.m. The subject matter of the Open Meeting will be: Item 1: The Commission will consider whether to adopt amendments to rules and forms under the Securities Act of 1933, the Securities Exchange Act of 1934 and the Investment Company Act of 1940 to enhance the disclosures that registrants are required to make about compensation and other corporate governance matters. Item 2: The Commission will consider whether to adopt amendments to the investment adviser custody rule (rule 206(4)-2) under the Investment Advisers Act of 1940) and related forms and rules. The amendments would enhance the protections provided advisory clients when they entrust their funds and securities to an investment adviser. In a court filing, the SEC stated that it would delay the effective date of Rule 151A, which makes indexed annuities securities, for two years. The D.C. Circuit had previously upheld the SEC's legal analysis but remanded the Rule for consideration of the economic impact, which the court found deficient. InvNews, Indexed annuities as securities? Not until 2013, says the SEC. The House Capital Markets Subcommittee, chaired by Rep.Kanjorski, held another hearing today on the Madoff fraud, specifically dealing with SIPC. In honor of the occasion, the New York Times today ran an article featuring the head of SIPC, Stephen P. Harbeck, whom critics have charged with being too conservative in his interpretation of the statute. Critics object to the failure of SIPC to recognize claims from investors whose withdrawals at least equaled their deposits and from investors through feeder funds. NYTimes, Protection Chief Struggles With Madoff Claims. At the hearing Michael Conley, an SEC official, proposed that the claims of early investors be adjusted to reflect inflation, a recommendation it will make to the bankrupty court. Here are excerpts from his testimony on this point: The Madoff case raises difficult issues. Based on an analysis of SIPA, its legislative history, and cases that have applied it, the Commission is recommending to the bankruptcy court that customer claims should be determined through the cash-in/cash-out method advocated by the Trustee and SIPC — with an additional adjustment to ensure that the investors' claims in this long-running scheme are valued most accurately and fairly. The Commission is basing its recommendation on the conclusion that the claims of the Madoff investors cannot be valued based on the balance shown on their final account statements. Although this approach would allow most Madoff account holders to receive payments on their claims, those payments would be based on account balances reflecting amounts that Madoff himself concocted that bear no relation to reality. ... Neither SIPA nor any of the cases interpreting that statute can be read to support an approach that would value claims based on the fictitious investment returns of such a scheme. .... Therefore, the Commission has concluded that the most reasonable way to measure the value of the Madoff customers' net equity is to look to the money those customers invested with Madoff as a proxy for the unspecified investments in securities (the split-strike conversion strategy) Madoff told them he would make for their accounts. The Commission's recommendation resembles what would likely be the outcome in a private suit by a customer challenging the distribution of assets on the same facts. Although the customer could establish that the broker had committed fraud, and could recover her initial investment (less withdrawals), she would not be able to recover as damages the amounts shown on the final account statements because they were based on fraudulent backdating of trades through hindsight. The fraud did not cause the customer to lose actual proceeds that were (or could have been) the product of legitimate trading. The same principles are relevant in calculating the Madoff customers' net equity under SIPA. In this case, the only reliably determinable transactions are the cash deposits and withdrawals those customers made to and from their brokerage accounts.... In addition, it is important to note that basing customers' net equity on the fictitious balances on their final account statements would do nothing to increase the fund of customer property — it would simply reallocate it. It is clear that there will not be enough money in the fund of customer property to pay out the $65 billion that Madoff falsely reported was in customer accounts when the firm failed. The Trustee has estimated that he may be able to recover as much as $8 billion to distribute to claimants. Using the final account statement approach would have the effect of favoring early investors-many of whom withdrew all or more than the principal they invested with Madoff — over later investors — some of whom withdrew little or none of what they invested and will not receive a distribution equal even to their principal. While the final account statement approach favors earlier customers at the expense of later customers, the SEC is also sensitive to the corresponding fairness concerns under the cash-in/cash-out method. That method of calculating net equity favors later customers at the expense of earlier customers by treating a dollar invested in 1987 as having the same value as a dollar invested in 2007. ... In the SEC's view, to achieve a fair and economically accurate allocation among Madoff customers who invested and withdrew funds in different historical periods, it is appropriate to convert the dollars invested into "time-equivalent" or constant dollars. This constant-dollar approach is rooted in the classic economic concept of the time value of money and will result in greater fairness across different generations of Madoff investors — in effect, treating early investors and later investors alike in terms of the real economic value of their investments. The issue of calculating net equity in constant dollars has not arisen before in SIPA cases, probably because many Ponzi-type schemes are of relatively short duration, and the inequity among those who invested at different points in time is less striking. But the Madoff fraud — which lasted for 20-plus years — puts this issue into stark relief. ... Under the facts of this case, the Commission believes that the use of constant dollars can be distinguished from the payment of interest discussed in that Sixth Circuit case and that the best reading of SIPA and the cases interpreting it is that net equity here should be calculated in constant dollars. It also is the Commission's view that the constant-dollar method will have limited application to the calculation of net equity in other liquidations under SIPA. ... Here is the prepared testimony of Mr. Harbeck that does not address this damages calculation issue. The U.S. Department of the Treasury today announced that it has commenced a secondary public offering of approximately 88,401,697 warrants to purchase the common stock of JPMorgan Chase & Co. (the "Company"). The offering is expected to price through a modified Dutch auction. Deutsche Bank Securities Inc. is the sole book-running manager and Ramirez & Co., Inc., The Williams Capital Group, L.P. and Utendahl Capital Group, LLC are the co-managers for the offering. Deutsche Bank Securities Inc., in its capacity as auction agent, has specified that the auction will commence at 8 a.m., Eastern Time, on December 10, 2009, and will close at 6:30 p.m., Eastern Time, on that same day (the "submission deadline"). During the auction period, potential bidders will be able to place bids at any price (in increments of $0.25) at or above the minimum bid price of $8.00 per warrant. The auction procedures, and the strike price, expiration, and other terms of the warrants are described in the preliminary prospectus supplement. The SEC today halted a Ponzi scheme involving a New York firm that solicited investments involving personal injury lawsuit settlements but instead shipped the money overseas. The SEC obtained a court order freezing the assets of the firm, Rockford Funding Group LLC, its president, and several companies holding money from the scam that began several months ago. The SEC alleges that Rockford used cold calling and a Web site to raise at least $11 million from more than 200 investors in 41 different states and Canada since March 2009. Rockford Group falsely touted itself as a leading private equity firm with an $800 million pipeline of investments and many Fortune 500 companies as clients, and told investors their money would be safely invested in structured settlements in private lawsuits. According to the SEC's complaint, filed in U.S. District Court for the Southern District of New York, Rockford Group does not appear to engage in any investment activity that would generate any returns for investors, let alone its claimed returns of at least 15 percent annually. Instead, dividend payments made to investors have been funded by other investors' contributions, and Rockford Group transferred most of the money collected from investors to banks in Latvia and Hong Kong. "The SEC alleges that Rockford Group lured investors by promising high returns and falsely assuring investors that it is a member of the Securities Investor Protection Corporation (SIPC) with up to $4 million in insurance to meet customer claims. According to the SEC's complaint, however, Rockford Group is not a member of SIPC. The SEC today charged Brookstreet Securities Corp. and its President and CEO Stanley C. Brooks with fraud for systematically selling risky mortgage-backed securities to customers with conservative investment goals. The fraud cost many Brookstreet investors their savings, homes, or retirement cushions, and eventually caused the firm to collapse. The SEC alleges that Brookstreet and Brooks developed an internal program through which the firm’s registered representatives sold particularly risky and illiquid types of Collateralized Mortgage Obligations (“CMOs”) to more than 1,000 seniors, retirees, and others for whom they were unsuitable. The SEC further alleges that Brookstreet continued to promote and sell risky CMOs to retail investors even after Brooks received numerous indications and personal warnings that these were “dangerous” investments that could become worthless overnight. Finally, in a last-ditch effort to save Brookstreet from failing during the financial crisis, Brooks directed the unauthorized sale of CMOs from Brookstreet customers’ cash-only accounts, causing substantial investor losses. According to the SEC’s complaint, filed in federal district court in Santa Ana, Calif., Brookstreet customers invested approximately $300 million through the firm’s CMO program between 2004 and 2007. The SEC previously charged 10 Brookstreet registered representatives with making misrepresentations to investors related to the sale of risky CMOs. FINRA announced today that it expelled Meeting Street Brokerage, LLC of Palm City, FL from the securities industry for market manipulation of Relay Capital Corporation stock — as well as for violations of Regulation T, Anti-Money Laundering (AML) rules, instant message retention requirements, registration requirements and net capital requirements. In addition, FINRA barred Meeting Street broker Lisa A. Esposito for participating in the manipulation and for violating Regulation T. FINRA sanctioned her husband, Vincent A. Esposito, the firm's owner, principal and AML Compliance Officer, for those same violations and for violations of his AML obligations. Vincent Esposito was suspended from associating with a securities firm in any capacity for 90 days, suspended from associating with a securities firm in a principal capacity for two years and fined $15,000. FINRA found that in 2005, Meeting Street and the Espositos participated in a manipulative scheme designed to increase and/or maintain artificially the price and volume of a Pink Sheet-traded stock issued by Relay Capital. Relay Capital was first incorporated in Canada in 2002 as First Canadian American Credit Services, later relocating to Nevada and changing its name to Galloway Oil and Gas, Inc. Relay Capital currently reports that it is in the business of marketing pre-paid financial services. In its investigation, FINRA found that Meeting Street and the Espositos participated in the manipulation of Relay Capital stock by: placing approximately 100 matched orders for the firm's customers — i.e., prearranged orders for the purchase and/or sale of the stock for the purpose of creating the false appearance of high trading volume and inflating or maintaining the stock's price; transferring free shares of the stock to customers who had purchased or agreed to purchase additional shares of the stock; continually allowing customers to purchase the stock without sufficient funds to do so and without a good faith belief that they would pay for their purchases before selling the stock; and effecting nearly 100 purchases for customers in which the cost to buy the stock was met by the sale of the same stock. FINRA also found that Meeting Street and the Espositos effected certain agency cross trades between customers at prices in excess of the price at which Relay Capital stock traded on the date of the transactions. FINRA further found that a consulting company owned and controlled by Lisa Esposito received over 1.2 million shares of Relay Capital stock as payment for consulting services and that Meeting Street generated $289,000 in commissions in 2005 for placing Relay Capital stock trades. FINRA also found that Meeting Street and the Espositos committed numerous violations of Regulation T, many of which were in furtherance of the manipulation, and that Meeting Street and Vincent Esposito, the firm's AML Compliance Officer, violated their AML obligations by failing, in several instances between 2005 and 2007, to investigate and report suspicious activity. In concluding this settlement, Meeting Street and the Espositos neither admitted nor denied the charges, but consented to the entry of FINRA's findings. The SEI Advisor Network and The Committee for the Fiduciary Standard recently conducted a survey of financial advisers and brokers to determine the level of support and understanding of the fiduciary standard. The survey was completed by 890 RIAs, IARs and registered broker-dealers, who self-identified their compensation structures as follows: commission (132), commission-fee (510) and fee-based and fee-only (242). The findings include: A majority of brokers (53%) believe that "all financial professionals who give investment and financial advice should be required to meet the fiduciary standard;" twenty-seven percent disagree with the statement. Among those who identified themselves as fee-based and fee-only advisers, 86% agreed with the statement. Eighty percent of brokers stated that they understood the fiduciary standard either "fairly well" or "very well." Nearly all (98%) of advisers stated they understand the standard "fairly well" or "very well." Respondents were asked if they believed that they should be allowed to meet a fiduciary standard in providing advice and then revert to a suitability standard when recommending products. Ninety-three percent of fee-based and fee-only advisers disagreed with that statement, as did fifty-five percent of commission-fee brokers. In contrast, thirty-seven percent of commission-only brokers disagreed with that statement. As to compensation, fifteen percent of advisers said that they believe investors do not care how they are compensated, in contrast to fifty-six percent of commission-fee brokers and sixty-three percent of commission-only brokers. Emory University School of Law’s Center for Transactional Law and Practice will hold its second biennial conference on the teaching of transactional law and skills, Transactional Education: What’s Next? The conference will be held at Emory Law on Friday, June 4, and Saturday, June 5, 2010. The Steering Committee is soliciting proposals immediately, but in no event later than 5:00 p.m., February 1, 2010. It welcomes proposals on any subject of interest to current or potential teachers of transactional law and skills. The SEC noticed a proposed rule change (SR-FINRA-2009-070) submitted by FINRA pursuant to Rule 19b-4 under the Securities Exchange Act of 1934 related to communications with the public about variable life insurance and variable annuities. Publication is expected in the Federal Register during the week of December 7. (Rel. 34-61107) On Dec. 4, 2009, the SEC approved an extension and modification of temporary exemptions that allow ICE Trust U.S. LLC (f/k/a ICE US Trust LLC) to operate as a central counterparty for clearing credit default swaps. On March 6, 2009, the SEC previously granted ICE Trust a similar exemption that was scheduled to expire on Dec. 7, 2009. The SEC's December 4th action extends the exemptions that were set to expire and expands them to address additional credit default swap clearing arrangements. The SEC is soliciting public comment on all aspects of these exemptions to assist in its consideration of any further action that may be needed in this area. (Rel. 34-61119) The SEC posted on its website its Select SEC and Market Data for Fiscal 2009, which includes information on enforcement actions. The SEC reports that it obtained disgorgement orders of approximately $2.09 billion and penalty orders of about $345 million. It also sought orders barring 90 individuals from serving as officers or directors of public companies. The SEC today charged three former top officers of New Century Financial Corporation with securities fraud for misleading investors as New Century’s subprime mortgage business was collapsing in 2006. At the time of the fraud, New Century was one of the largest subprime lenders in the nation. The SEC’s complaint names as defendants: former CEO and co-founder Brad A. Morrice, former CFO Patti M. Dodge, and former Controller David N. Kenneally. In its complaint, the SEC alleges that New Century disclosures generally sought to assure investors that its business was not at risk and was performing better than its peers. Defendants, however, failed to disclose important negative information, including dramatic increases in early loan defaults, loan repurchases, and pending loan repurchase requests. Defendants knew this negative information from numerous internal reports they regularly received, including weekly reports that Morrice ominously entitled “Storm Watch.” The complaint also alleges that Dodge and Kenneally fraudulently accounted for expenses related to bad loans that it had to repurchase. In the face of dramatically increasing loan repurchases and a huge, undisclosed backlog of repurchase demands, Kenneally, with Dodge’s knowledge, made changes to New Century’s accounting for loan repurchases in both the second and third quarters of 2006. These undisclosed accounting changes violated generally accepted accounting principles and resulted in New Century’s improperly avoiding substantial repurchase expenses and materially overstating its financial results. The complaint, filed in federal court in the Central District of California, seeks permanent injunctions against future violations, disgorgement with prejudgment interest, officer and director bars, and civil penalties. This paper, published in a symposium on the work of Adolf Berle, approaches the Berle-Dodd debate from the perspective that corporate managers have responsibilities beyond pursuing the interests of shareholders. Stock based executive compensation, designed to align managers’ interests with those of shareholders, has, in the investment banking industry in particular, failed to avert, and may have caused, managers to take excessive risks that in the 2008 financial crisis inflicted great damage on creditors and on society as a whole. We describe here the broad outlines of a proposal that we will discuss in future publications in more detail to impose some measure of personal liability for a bank’s debts on the most highly paid bankers. The proposal would revive two mechanisms that imposed such personal liability in an earlier era: general partnership, which was common for investment banks prior to the 1980s, and assessable stock, which was relatively common in corporations including some commercial banks through the 1930s. One proposal is that bankers earning over $3 million per year be required to enter into a partnership/joint venture agreement with the employing bank that would make them personally liable for some of the bank’s debts. The other proposal is that compensation in excess of $1 million per year be paid to bankers only in stock that is assessable in the event of the bank’s insolvency in an amount equal to the book value of the stock on the date of issue. In either case, the bankers’ liability would not be unlimited: they would be allowed to shield $1 million from creditors. Imposing genuine downside risk through these or other vehicles for personal liability may be the best way to make bankers approach risk in a manner that reflects the potential for externalities of the sort the crisis has so dramatically demonstrated.
Pile-CC
List of ships named Toko Maru Many Japanese ships have been named Toko Maru or Tōkō Maru, some adding a numeral (eg "No.2"). Toko Maru (1908), a cargo ship torpedoed and sunk in the South China Sea by on 12 October 1944 Japanese auxiliary stores ship Tōkō Maru No. 2 Go, an auxiliary transport ship of the Imperial Japanese 5th Fleet in 1942 Toko Maru (tanker), a tanker torpedoed and sunk in the Pacific Ocean by on 27 March 1943 Toko Maru (1940), a transport ship torpedoed and sunk in the Pacific Ocean east of Palau by on 30 January 1944 Toko Maru (1944), a cargo ship torpedoed and sunk in the Pacific Ocean south of Honshu by on 16 April 1945 Toko Maru, a research/fishing vessel launched in 1970, and later converted to yacht Titanic See also Tokomaru (canoe), a Maori oceangoing canoe used in migrations that settled New Zealand , a British steam cargo ship built in 1893 as Westmeath Category:Ship names
Wikipedia (en)
Letters and Symbols: How I designed the Keen IO logo - micahwolfe https://keen.io/blog/43496487388/letters-and-symbols-how-i-designed-the-keen-io-logo ====== alexdevkar The more I hear from designers, the more I realize how much more thought I should be putting into design choices. ~~~ mwetzler no kidding. The branding process was much longer than any of us expected (fellow Keen IO employee here). So much to think about, from Tshirts to favicon.
HackerNews
Henry Hatton (disambiguation) Henry Hatton was a Nova Scotia politician. Henry Hatton may also refer to: Henry Finch-Hatton, 13th Earl of Winchilsea (1852 – 1927), English peer Henry Hatton (Irish politician), represented Fethard (County Wexford) (Parliament of Ireland constituency) Henry Hatton (MP for Wexford), represented Wexford Borough (Parliament of Ireland constituency)
Wikipedia (en)
IT came as a surprise; it usually does. One minute he stood there, in the prime of beard, with a mustache, too. The next minute, not even an upper-lip hair was left standing. ''Men in this country are judged less on their appearance than women are,'' said Ann Weber, a social psychologist and an associate professor of psychology at the University of North Carolina at Asheville. ''That is why men are thought to owe no one an explanation for changing their appearance, while women are thought to owe everyone an explanation.'' Men are particularly silent on the subject of beards. ''For men, shaving off a beard is one of the few self-centered acts possible in terms of looks,'' said Bonnie Jacobson, the director of the New York Institute for Psychological Change in Manhattan. Dr. Weber explained: ''Since a man's appearance has little to do with his social value, whether to wear a beard or not is a matter of how he feels about the face staring back at him in the mirror.''
OpenWebText2
All relevant data are within the manuscript and its Supporting Information files. Introduction {#sec001} ============ The faithful transmission of genetic material during each cell division is vital for the survival of all living organisms. The kinetochore, a multi-subunit protein complex that assembles onto a specialized region of the chromatin called the centromere, is essential for proper chromosome segregation \[[@pgen.1008477.ref001]\]. In *Saccharomyces cerevisiae*, kinetochores are assembled around a central histone H3 variant known as Cse4^CENP-A^, which marks the centromere. Kinetochore assembly is initiated by Mif2^CENP-C^, an evolutionarily conserved protein, which directs a hierarchical assembly of proteins to form the Constitutive Centromere-Associated Network (CCAN), whose structure has recently been determined \[[@pgen.1008477.ref002]--[@pgen.1008477.ref004]\]. Like most other kinetochore subunits, CCAN associates with the centromere throughout the cell cycle, and contains: Mif2, the Ctf19-Okp1-Mcm21-Ame1 (COMA) complex \[[@pgen.1008477.ref005]\], Chl4-Iml3 \[[@pgen.1008477.ref006]\], Ctf3-Mcm16-Mcm22 (CMM) \[[@pgen.1008477.ref007]\] and Cnn1-Wip1-Mhf1/2 \[[@pgen.1008477.ref008]\]; of these, Mif2 and Ame1-Okp1 play an early and essential role \[[@pgen.1008477.ref009], [@pgen.1008477.ref010]\]. Ctf19-Mcm21 directly binds to Ame1-Okp1 to form the COMA complex, followed by the sequential assembly of Chl4-Iml3, Ctf3-Mcm16-Mcm22 and Cnn1-Wip1. Moreover, mutants of the non-essential subunits of CCAN in *Saccharomyces cerevisiae* have been shown to impair faithful chromosome segregation \[[@pgen.1008477.ref011]--[@pgen.1008477.ref014]\]. Once fully assembled, CCAN provides a platform that recruits the outer kinetochore proteins, such as the KMN network (Knl1/Mis12 complex/Ndc80 complex), which connects the microtubules to facilitate chromosome movement \[[@pgen.1008477.ref015], [@pgen.1008477.ref016]\]. While much has been learned about the composition and assembly of the kinetochore, much less is known about how various post-translational modification pathways may regulate its activity \[[@pgen.1008477.ref017]\]. An earlier genetic screen in the yeast *Saccharomyces cerevisiae* identified *SMT3* as a high-copy suppressor of a temperature-sensitive mutant of *mif2-3*, an essential protein required for proper chromosome segregation \[[@pgen.1008477.ref018]\]. *SMT3* encodes the yeast **S**mall **U**biquitin-like **MO**difier (**SUMO**), which similarly suppresses the temperature-sensitivity of the CENP-C^Mif2^ mutant in chicken cells \[[@pgen.1008477.ref019]\]. SUMO is a member of the ubiquitin-like protein family, and is highly conserved throughout all eukaryotes \[[@pgen.1008477.ref020]\]. Sumoylation, like ubiquitination, utilizes a three-step enzymatic cascade to modify target proteins, which begins with an E1 activating enzyme (Aos1-Uba2 in *S*. *cerevisiae*), followed by an E2 conjugating enzyme (Ubc9) and ends with several E3 ligases (Siz1, Siz2 and Mms21 in *S*. *cerevisiae*), which catalyze the covalent attachment of SUMO to its target proteins \[[@pgen.1008477.ref021]\]. Sumoylation, being a highly dynamic and reversible post-translational modification, is removed from its target proteins by a group of enzymes known as the Ulp/SENP (ubiquitin-like protease/sentrin-specific protease) family of proteases, which cleave the isopeptide bond between SUMO and its substrate. The founding members of the Ulp/SENP family of enzymes are *S*. *cerevisiae* Ulp1 and Ulp2 \[[@pgen.1008477.ref022], [@pgen.1008477.ref023]\], whereas six SENPs, SENP1--3 and SENP5--7, have been found in humans \[[@pgen.1008477.ref024]\]. Interestingly, *SMT4*, another suppressor of *mif2-3* \[[@pgen.1008477.ref018]\], was found to encode the Ulp2 protease \[[@pgen.1008477.ref023], [@pgen.1008477.ref025]\]. This suggests that homeostasis of intracellular sumoylation, possibly at the kinetochore, may be needed to suppress the conditional lethality of the *mif2-3* mutant. Moreover, the *ulp2Δ* mutant exhibits defects in mitotic progression and chromosome segregation \[[@pgen.1008477.ref023], [@pgen.1008477.ref025], [@pgen.1008477.ref026]\], and was recently reported to specifically accumulate aneuploidy of chromosome I \[[@pgen.1008477.ref027]\]; this further suggests an important role for Ulp2 in maintaining proper chromosome segregation. The mechanism by which Ulp2 promotes proper chromosome segregation appears to be conserved; mutation of Ulp-4, an ortholog of Ulp2 in *C*. *elegans*, results in a chromosome segregation defect \[[@pgen.1008477.ref028]\], while the knockdown of SENP6, the human ortholog of Ulp2, also affects chromosome segregation and causes mis-localization of the inner kinetochore complex CENP-H/I/K \[[@pgen.1008477.ref029]\]. Altogether, these findings suggest an important role for Ulp2^SENP6^, and ultimately a role for SUMO homeostasis, in maintaining proper chromosome segregation, possibly via Mif2^CENP-C^ mediated kinetochore assembly. We previously identified the substrates of Ulp2 via a proteome-wide approach, showing that Ulp2 specifically targets protein complexes at three distinct chromosomal regions, which include the nucleolar RENT complex, the MCM complex and the inner kinetochore CCAN complex \[[@pgen.1008477.ref030]\]. Remarkably, the loss of Ulp2 was found to increase CCAN sumoylation by nearly 20-fold, including Mcm21, Mcm16, Mcm22, Ame1 and Okp1, indicating that Ulp2 specifically targets CCAN \[[@pgen.1008477.ref030]\]. This was followed by two studies, which together demonstrated that Ulp2 targets its nucleolar substrates via a dual-substrate recognition mechanism \[[@pgen.1008477.ref031], [@pgen.1008477.ref032]\]; Ulp2 localizes to the nucleolus through its binding to the Csm1 nucleolar protein, where it then specifically targets poly-sumoylated substrates through its C-terminal SUMO-interacting motif (SIM). Interestingly, a mutation in Ulp2's SIM resulted in a synergistic growth defect when it was combined with a mutation in a C-terminal Conserved Region (CCR) of Ulp2 (a.a. 931--934), whose function had not been defined \[[@pgen.1008477.ref031]\]. Here we characterize this CCR of Ulp2 as a kinetochore-targeting motif that recruits Ulp2 to the kinetochore by directly binding to the Ctf3^CENP-I^-Mcm16^CENP-H^-Mcm22^CENP-K^ (CMM) complex. Ulp2 then utilizes its SIM to target hyper-sumoylated CCAN subunits, preserving the SUMO homeostasis of the kinetochore machinery. Thus, Ulp2 promotes accurate chromosome segregation through the tight regulation of CCAN sumoylation to maintain SUMO homeostasis of the kinetochore. Results {#sec002} ======= Ulp2's CCR and SIM are both required for maintaining CCAN sumoylation in *HF-SMT3* cells {#sec003} ---------------------------------------------------------------------------------------- In our prior study, we showed that the *ulp2-781Δ* mutant, but not the *csm1Δ* mutant, elevates the sumoylation of both the inner kinetochore and nucleolar proteins \[[@pgen.1008477.ref032]\]. This suggests that in addition to Csm1-binding, Ulp2^781-1034^ contains additional sequence elements that direct Ulp2 to desumoylate CCAN. Sequence alignments of Ulp2's fungal orthologs revealed three conserved hydrophobic residues in the CCR of Ulp2 (a.a. 931--934) ([Fig 1A](#pgen.1008477.g001){ref-type="fig"}, upper panel), which, when mutated to alanine and combined with the *ulp2-SIM*^*3A*^ mutation, resulted in a synergistic growth defect \[[@pgen.1008477.ref031]\]. To determine the effect of these *ulp2* mutations on kinetochore sumoylation, we used the *HF-SMT3* (*6×His-3×Flag-SMT3*) strain and the quantitative SUMO proteomic method developed in our previous studies \[[@pgen.1008477.ref030], [@pgen.1008477.ref033]\] ([Fig 1A](#pgen.1008477.g001){ref-type="fig"}, lower panel). We found that the *ulp2-CCR*^*3A*^ mutation results in an almost five-fold increase in the amount of sumoylated Mcm21 and Okp1 ([Fig 1B](#pgen.1008477.g001){ref-type="fig"}), while the sumoylation of Ulp2's substrates in the nucleolus and at origins of DNA replication are not appreciably affected ([S1 Table](#pgen.1008477.s003){ref-type="supplementary-material"}). Because sumoylated CCAN exists at a low level in wild-type cells that is often below the MS detection limit, we next compared CCAN sumoylation levels in the *ulp2- SIM*^*3A*^*CCR*^*3A*^ double mutant to its levels in the *ulp2-SIM*^*3A*^ mutant, where sumoylated Ulp2 substrates accumulate to higher levels \[[@pgen.1008477.ref031]\]. We found that the *ulp2-CCR*^*3A*^ mutant causes CCAN sumoylation to increase by over four-fold in the *ulp2-SIM*^*3A*^ strain background ([Fig 1B](#pgen.1008477.g001){ref-type="fig"} and [S2 Table](#pgen.1008477.s004){ref-type="supplementary-material"}), similar to its effect in the wild-type background. ![The C-terminal Conserved Region (CCR) and SUMO-interacting motif (SIM) of Ulp2 are both needed to desumoylate the CCAN complex.\ A) Illustration depicting Ulp2's domain structure and the quantitative MS approach used to determine the effect of various *ulp2* mutations on sumoylated CCAN in the *HF-SMT3* (6×His-3×FLAG-Smt3) strain background (see experimental methods for details). Conserved hydrophobic residues in Ulp2's SIM and CCR are indicated. Triple alanine mutations of these residues generate the *ulp2-SIM*^*3A*^ and *ulp2-CCR*^*3A*^ mutants. B-D) Effects of various *ulp2* mutations on sumoylated CCAN subunits are shown, while the rest of the MS results can be found in [S1](#pgen.1008477.s003){ref-type="supplementary-material"}--[S6](#pgen.1008477.s008){ref-type="supplementary-material"} Tables. In each case, the fold-changes in the sumoylated CCAN subunit are shown for each of the indicated strains. CCAN subunits not identified in the MS experiments are indicated by \#. Asterisks (\*) indicate where an insufficient number of peptides are available for statistical analysis.](pgen.1008477.g001){#pgen.1008477.g001} We next examined the effect of the *ulp2-SIM*^*3A*^ mutation and found that it caused a moderate increase in the amount of sumoylated Ame1, Mcm21, Okp1 and Mcm16, indicating a role for Ulp2's SIM in facilitating CCAN desumoylation by Ulp2 ([Fig 1C](#pgen.1008477.g001){ref-type="fig"}, [S3 Table](#pgen.1008477.s005){ref-type="supplementary-material"}). Similarly, this effect is also observed in the *ulp2-CCR*^*3A*^ background, as sumoylated CCAN subunits, including Ame1, Mcm21, Okp1, Mcm16 and Mcm22, accumulated to higher levels in the *ulp2-SIM*^*3A*^*CCR*^*3A*^ double mutant compared to the *ulp2-CCR*^*3A*^ single mutant ([Fig 1C](#pgen.1008477.g001){ref-type="fig"}, [S4 Table](#pgen.1008477.s006){ref-type="supplementary-material"}). In fact, the *ulp2-SIM*^*3A*^*CCR*^*3A*^ double mutant drastically increases the sumoylation of multiple CCAN subunits compared to the wild-type strain ([Fig 1D](#pgen.1008477.g001){ref-type="fig"}, [S5 Table](#pgen.1008477.s007){ref-type="supplementary-material"}). Moreover, sumoylation of CCAN reaches a level that phenocopies that of the *ulp2Δ* mutant, indicating that Ulp2's CCR and SIM play a partially redundant role in directing Ulp2 to desumoylate CCAN ([Fig 1D](#pgen.1008477.g001){ref-type="fig"}, [S6 Table](#pgen.1008477.s008){ref-type="supplementary-material"}). CCAN abundance is not appreciably affected in the *ulp2-CCR*^*3A*^ and *ulp2-SIM*^*3A*^ mutants {#sec004} ----------------------------------------------------------------------------------------------- The strains used in the above proteomic approach made use of HF-Smt3, which allows for the enrichment of total sumoylated proteins, but the HF tag on Smt3 compromises poly-sumoylation to an unknown extent \[[@pgen.1008477.ref030], [@pgen.1008477.ref033]\]. A previous study showed that poly-sumoylated protein could be targeted for degradation, which was perturbed by the HF tag on Smt3 \[[@pgen.1008477.ref032]\]. Additionally, our proteomic approach specifically measures the relative change in the amount of proteins that are conjugated to SUMO; thus the poly-sumoylation status or the protein levels of CCAN subunits could not be determined. To address these concerns, we took advantage of Ulp1-C580S, a catalytically inactive form of Ulp1, which exhibits a strong affinity to SUMO itself \[[@pgen.1008477.ref034], [@pgen.1008477.ref035]\]. We first immobilized recombinant Ulp1^403-621^-C580S onto CNBr-activated resin, and then tested its ability to purify endogenous sumoylated proteins from yeast cell extracts, which resulted in the recovery of approximately 50% of SUMO conjugates ([Fig 2A](#pgen.1008477.g002){ref-type="fig"}). To facilitate the detection of CCAN in the *ulp2-CCR*^*3A*^, *ulp2-SIM*^*3A*^ and *ulp2-SIM*^*3A*^*CCR*^*3A*^ mutants, an endogenous Protein A tag was fused to the C-terminus of each CCAN subunit (Ame1, Mcm21, Okp1, Mcm16 and Mcm22). As shown in [Fig 2B](#pgen.1008477.g002){ref-type="fig"}, the expression level of Mcm21 was unaffected by any of the *ulp2* mutations. Furthermore, a higher molecular weight species of Mcm21 is enriched in the elution, and is referred to as sumoylated Mcm21. Both the *ulp2-SIM*^*3A*^ and *ulp2-CCR*^*3A*^ single mutants caused a modest but appreciable increase in the abundance of sumoylated Mcm21, while the *ulp2-SIM*^*3A*^*CCR*^*3A*^ double mutant caused a drastic accumulation in the levels and species of sumoylated Mcm21 ([Fig 2B](#pgen.1008477.g002){ref-type="fig"}), demonstrating partially redundant roles for Ulp2's SIM and CCR in suppressing excessive Mcm21 sumoylation. ![Desumoylation of CCAN is partially redundantly controlled by Ulp2's SIM and CCR.\ A) Anti-Smt3 Western blot to observe total sumoylated proteins via the Ulp1-C580S pull-down approach. Relative loading amounts are indicated at the top of each sample lane. 2B-2F) Protein A tagged Mcm21, Ame1, Okp1, Mcm16 and Mcm22 were detected using an anti-Protein A antibody and Western blot analysis. Approximately 150-fold more loading was used for the eluted samples compared to the input samples. Sumoylated species of these CCAN subunits were only detected in the purified sample, which appear as higher molecular weight bands compared to the corresponding un-sumoylated CCAN subunit.](pgen.1008477.g002){#pgen.1008477.g002} Similar to Mcm21, several species of sumoylated Ame1 and Okp1 were detected in wild type cells, which are modestly elevated in the *ulp2-SIM*^*3A*^ and *ulp2-CCR*^*3A*^ mutants, but more drastically accumulate in the *ulp2-SIM*^*3A*^*CCR*^*3A*^ mutant ([Fig 2C and 2D](#pgen.1008477.g002){ref-type="fig"}). A slower migrating species of Ame1 was detected in cell lysate, but was determined to be unrelated to SUMO, as it is insensitive to Ulp1 cleavage ([S1 Fig](#pgen.1008477.s001){ref-type="supplementary-material"}). However, the higher molecular weight species of Ame1 is referred to as sumoylated Ame1, as it is enriched via the Ulp1-C580S resin and can be cleaved by Ulp1 ([S1 Fig](#pgen.1008477.s001){ref-type="supplementary-material"}). Unlike the COMA subunits (Ame1, Okp1 and Mcm21), the levels of sumoylated Mcm16 and Mcm22 increase modestly in the *ulp2-CCR*^*3A*^ mutant, but in the *ulp2-SIM*^*3A*^ mutant they accumulate to a higher level comparable to the level in the *ulp2-SIM*^*3A*^*CCR*^*3A*^ double mutant ([Fig 2E and 2F](#pgen.1008477.g002){ref-type="fig"}). This behavior differs from the MS findings above for these proteins, which could be attributed to the fact that the untagged WT Smt3 strain was used here. For example, hyper-sumoylated Mcm16 and Mcm22 could have already reached a maximum level in the *ulp2-SIM*^*3A*^ mutant, which prevents the detection of any additional effect from *ulp2-CCR*^*3A*^. We also did not investigate the other CCAN subunits Ctf3 and Ctf19, whose sumoylation was not detected by MS possibly due to their lower levels. In all cases, the protein levels of unmodified CCAN subunits are not grossly altered in any of the *ulp2* mutants, suggesting that these effects are not due to a change in CCAN expression. Overall, the findings here are in general agreement with the MS results performed using HF-Smt3 cells ([Fig 1](#pgen.1008477.g001){ref-type="fig"}), despite accurate quantification of sumoylated CCAN by MS was limited by their low abundance, especially in wild type cells. The CMM complex mediates the association of Ulp2 to the kinetochore {#sec005} ------------------------------------------------------------------- Prior studies have demonstrated that CCAN assembles at centromeres in a hierarchical order ([Fig 3A](#pgen.1008477.g003){ref-type="fig"}) \[[@pgen.1008477.ref009], [@pgen.1008477.ref010], [@pgen.1008477.ref036]\], and considering that Ulp2's CCR seems to play a specific role in desumoylating CCAN, we tested whether Ulp2 binds to the kinetochore through its CCR. Using an immobilized Ulp2^873-1034^ (Ulp2-CCR) affinity column ([S1 Fig](#pgen.1008477.s001){ref-type="supplementary-material"}), we found that the wild-type Ulp2-CCR resin binds to Mcm21 in yeast cell extracts, and that this binding is abolished by the *ulp2-CCR*^*3A*^ mutation ([Fig 3B](#pgen.1008477.g003){ref-type="fig"}). Interestingly, deletion of Ctf19 or Mcm16 also abolished the binding between Ulp2 and Mcm21 without affecting the abundance of Mcm21 ([Fig 3C](#pgen.1008477.g003){ref-type="fig"}), indicating that Mcm21 does not directly bind to Ulp2. Because Mcm16 is required for the Ulp2-Mcm21 interaction, we next investigated whether deleting Chl4 and Cnn1 had any effect. Deletion of Cnn1, which acts downstream of Mcm16 in CCAN assembly, did not disrupt the binding between Ulp2 and Mcm21, whereas the deletion of Chl4, which helps to recruit Mcm16 to Mcm21, abolished the binding ([Fig 3D](#pgen.1008477.g003){ref-type="fig"}). In contrast, deletion of Chl4 or Cnn1 did not disrupt binding between Ulp2's CCR and Mcm16 ([Fig 3E](#pgen.1008477.g003){ref-type="fig"}), further implying that Mcm16 may directly interact with Ulp2. Moreover, the deletion of any individual subunit of CMM (Ctf3-Mcm16-Mcm21) eliminated Ulp2's interaction with the other two CMM subunits ([Fig 3F--3H](#pgen.1008477.g003){ref-type="fig"}), indicating that an intact CMM complex is needed to interact with Ulp2. In all cases, the *ulp2-CCR*^*3A*^ mutation reduced or abolished its binding to CMM, confirming the specificity of this interaction. Taken together, these findings suggest that Ulp2 interacts with the CMM complex, which in turn mediates Ulp2's interaction with the other CCAN sub-complexes. How Ulp2 may interact with the fully assembled kinetochore remains to be determined. ![Binding between Ulp2's CCR and the kinetochore requires the Ctf3-Mcm16-Mcm22 complex.\ A) Illustration of the hierarchical order of CCAN assembly. Various sub-complexes of CCAN are distinguished in colored boxes, in which essential subunits are shown in ***bold***. B) Pull-down assay to observe the binding between Mcm21 and Ulp2's CCR. C) Effect of *mcm16Δ* and *ctf19Δ* on the binding between Mcm21 and Ulp2's CCR. D) Effect of *chl4Δ* and *cnn1Δ* on the binding between Mcm21 and Ulp2's CCR. E) Effect of *chl4Δ* and *cnn1Δ* on the binding between Mcm16 Ulp2's CCR. F) Effect of *mcm16Δ*, *mcm22Δ* and *mcm21Δ* on the binding between Ctf3 and Ulp2's CCR. G) Effect of *mcm16Δ* and *ctf3Δ* on the binding between Mcm22 and Ulp2's CCR. H) Effect of *mcm22Δ* and *ctf3Δ* on the binding between Mcm16 and Ulp2's CCR. TAF tag refers to 6xHIS-3xFLAG-ProteinA (see footnote in [S12 Table](#pgen.1008477.s014){ref-type="supplementary-material"}).](pgen.1008477.g003){#pgen.1008477.g003} Ulp2's CCR is sufficient for its interaction with the CMM complex {#sec006} ----------------------------------------------------------------- Considering the role of the conserved motif (a.a. 931--934) in Ulp2's CCR in mediating the interaction between Ulp2 and CMM ([Fig 3](#pgen.1008477.g003){ref-type="fig"}), we next sought to determine the minimal region in Ulp2 that is sufficient for binding to CMM. A synthetic peptide containing the conserved motif (Ulp2^896-937^) was found to bind to Ctf3 in yeast cell lysates, while a synthetic peptide (Ulp2^896-937^) containing the *CCR*^*3A*^ mutation does not bind ([Fig 4A](#pgen.1008477.g004){ref-type="fig"}), confirming the specificity of this interaction. To further determine whether the binding between Ulp2 and CMM is direct, we expressed the CMM complex in SF9 insect cells, eliminating any interference from other yeast proteins, and used Tandem Mass Tag (TMT) based quantitative mass spectrometry (MS) to analyze specific proteins that bound to resins immobilized with either Ulp2-CCR or Ulp2-CCR^3A^ peptides ([Fig 4B](#pgen.1008477.g004){ref-type="fig"}). As shown in [Fig 4C](#pgen.1008477.g004){ref-type="fig"} and [S7 Table](#pgen.1008477.s009){ref-type="supplementary-material"}, Ctf3, Mcm16 and Mcm22 of the CMM complex were the only proteins that specifically bind to the Ulp2-CCR peptide resin. In fact, Ctf3, Mcm16 and Mcm22 were found to be more than three-fold enriched by the wild-type Ulp2-CCR peptide resin compared to the Ulp2-CCR^3A^ peptide resin ([Fig 4D](#pgen.1008477.g004){ref-type="fig"}), even though more Ulp2-CCR^3A^ peptide resin was used for the pull-down. Taken together, these results demonstrate that Ulp2's CCR directly binds to the CMM complex. ![Ulp2's CCR directly binds to the CMM complex.\ A) Experimental schematic and Western blot analysis for detecting the binding of a synthetic Ulp2-CCR peptide with Ctf3 in yeast cell extract. B) Experimental design to use TMT-based quantitative MS to compare the binding proteins of Ulp2's CCR, purified using SF9 cells expressing the CMM complex. C) Log~2~ ratios of proteins associating with Ulp2-CCR versus Ulp2-CCR^3A^, identified by MS, are plotted on the Y-axis, while the number of peptides identified for each protein is plotted on the X-axis. D) Quantification of the relative abundance of Mcm16, Ctf3, Mcm22 and Ulp2-CCR is shown in Figure 4C. Error bars were calculated based on the standard error of the mean of TMT reporter ions found in multiple peptides of each protein. E) ChIP-qPCR analysis to measure the association of Ulp2 to the Centromere-III revealed a partial role for Ulp2's CCR and Mcm16. The *p*-values indicate statistically significant differences of Ulp2-TAF with Ulp2-CCR^3A^-TAF and *mcm16Δ* using a two-tailed Student's t-test. F) Effect of *mcm16Δ* and *ctf19Δ* on sumoylated Mcm21, which was purified using the Ulp1-C580S affinity resin (see [Fig 2](#pgen.1008477.g002){ref-type="fig"}).](pgen.1008477.g004){#pgen.1008477.g004} To address whether the interaction between Ulp2 and CMM plays a role in recruiting Ulp2 to the kinetochore assembled at the centromere, chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) were performed to measure the amount of DNA bound to endogenously tagged Ulp2. This reveals that Ulp2 specifically binds to the centromere-III region but not the *CUP1* region ([Fig 4E](#pgen.1008477.g004){ref-type="fig"}). This centromere-specific binding of Ulp2 is partially reduced by *ulp2-CCR*^*3A*^, similar to that caused by *mcm16Δ* ([Fig 4E](#pgen.1008477.g004){ref-type="fig"}). This partial effect is in agreement with the partial role of Ulp2's CCR in facilitating CCAN desumoylation (Figs [1](#pgen.1008477.g001){ref-type="fig"} and [2](#pgen.1008477.g002){ref-type="fig"}), and it further suggests that Ulp2's SIM and protease domain could be responsible for the remaining centromere binding activity. Consistent with the role of Mcm16 in recruiting Ulp2 to the centromere, deletion of Mcm16 led to an elevated level of sumoylated Mcm21 ([Fig 4F](#pgen.1008477.g004){ref-type="fig"}), while deletion of Ctf19, which disrupts the formation of the Ctf19-Mcm21 sub-complex \[[@pgen.1008477.ref005]\], caused a complete loss of sumoylated Mcm21. Thus, localization of Ulp2 to the centromere via Mcm16 plays a role in keeping the sumoylation of Mcm21 low. The CMM complex plays two roles in maintaining SUMO homeostasis of the inner kinetochore {#sec007} ---------------------------------------------------------------------------------------- Considering the biochemical defects of the *ulp2* mutants in CCAN binding and desumoylation, we next evaluated its potential defect in chromosome segregation by performing a quantitative mating assay to measure the rate of chromosome-III loss in the *ulp2* mutants \[[@pgen.1008477.ref037]\]. As seen in [Fig 5A](#pgen.1008477.g005){ref-type="fig"} and [S8 Table](#pgen.1008477.s010){ref-type="supplementary-material"}, compared to wild-type cells, the *ulp2-SIM*^*3A*^ and *ulp2-CCR*^*3A*^ mutations result in an 8-fold and 4-fold respective increase in the rate of chromosome-III loss, while the *ulp2-SIM*^*3A*^*CCR*^*3A*^ double mutant causes a synergistic 64-fold increase in the rate of chromosome loss. These results indicate that Ulp2's CCR and SIM play a partially redundant role in preventing chromosome loss. ![Mcm16 plays a dual role in regulating CCAN sumoylation.\ A) Chromosome loss rates of WT, *ulp2-SIM*^*3A*^, *ulp2-CCR*^*3A*^, *ulp2-SIM*^*3A*^*CCR*^*3A*^, *mcm16Δ*, *mcm16Δ ulp2-SIM*^*3A*^, *mcm16Δ ulp2-CCR*^*3A*^ and *mcm16Δ ulp2-SIM*^*3A*^*CCR*^*3A*^ mutants, measured by quantitative mating (also see [S8 Table](#pgen.1008477.s010){ref-type="supplementary-material"}). B) Growth of various *ulp2* and *mcm16Δ* mutants, following the acute removal of the complementing *ULP2* plasmid by 5-fluoroorotic acid (5-FOA). C) Quantitative MS to measure the effect of *mcm16Δ* on intracellular sumoylation in the *ulp2Δ* mutant (also see [S9 Table](#pgen.1008477.s011){ref-type="supplementary-material"}). D-E) Western blot analysis to observe the effect of *mcm16Δ* on Mcm21 and Ame1 sumoylation in the *ulp2Δ* mutant, following the enrichment of sumoylated proteins via the Ulp1-C580S affinity resin. F) Western blot analysis to observe the effect of *mcm16Δ* on the sumoylation of Mcm21 in various *ulp2* mutants following the enrichment of sumoylated proteins via Ulp1-C580S affinity resin.](pgen.1008477.g005){#pgen.1008477.g005} Given that CMM directly binds to Ulp2 ([Fig 4](#pgen.1008477.g004){ref-type="fig"}), we next asked whether a mutation in this complex would result in a chromosome loss defect similar to that of the *ulp2-CCR*^*3A*^, and further cause a synergistic increase in chromosome loss when it is combined with the *ulp2-SIM*^*3A*^. To address this, a quantitative mating assay was performed, revealing that the *mcm16Δ* mutant caused a 4-fold increase in the rate of chromosome loss ([Fig 5A](#pgen.1008477.g005){ref-type="fig"} and [S8 Table](#pgen.1008477.s010){ref-type="supplementary-material"}). Surprisingly, the *mcm16Δ* mutant did not further increase the rate of chromosome loss when combined with *ulp2-SIM*^*3A*^; instead, loss of Mcm16 in the *ulp2-SIM*^*3A*^*CCR*^*3A*^ mutant drastically reduced the rate of chromosome loss from 64-fold to 6-fold. To explore this further, we examined the effect of *mcm16Δ* on the growth of various *ulp2* mutants. As in our previous work \[[@pgen.1008477.ref031]\], mutations to Ulp2's SIM and CCR result in a growth defect when the complementing wild-type Ulp2 is acutely removed by plasmid shuffling ([Fig 5B](#pgen.1008477.g005){ref-type="fig"}, rows 2--5). Interestingly, *mcm16Δ* strongly suppressed both the growth defect of the *ulp2Δ* mutant ([Fig 5](#pgen.1008477.g005){ref-type="fig"}, rows 1 and 6) and that of the *ulp2-SIM*^*3A*^*CCR*^*3A*^ mutant ([Fig 5](#pgen.1008477.g005){ref-type="fig"}, rows 5 and 10). These findings raise the possibility that Mcm16 plays another role that is distinct from recruiting Ulp2 (Figs [3](#pgen.1008477.g003){ref-type="fig"} and [4](#pgen.1008477.g004){ref-type="fig"}). To explore other functions of Mcm16, we performed quantitative MS in the *ulp2Δ* background to determine whether the loss of Mcm16 has any effect on sumoylated CCAN. As seen in [Fig 5C](#pgen.1008477.g005){ref-type="fig"} and [S9 Table](#pgen.1008477.s011){ref-type="supplementary-material"}, we observed approximately 2--4 folds more sumoylated Ame1, Mcm21 and Okp1 in the *ulp2Δ* single mutant than the *ulp2Δ mcm16Δ* double mutant, besides the expected absence of sumoylated Mcm16 in the *ulp2Δ mcm16Δ* double mutant. To confirm this, we purified total sumoylated proteins using the Ulp1-C580S pull-down method ([Fig 2A](#pgen.1008477.g002){ref-type="fig"}). As shown in [Fig 5D and 5E](#pgen.1008477.g005){ref-type="fig"}, *mcm16Δ* reduced the hyper-sumoylated species of Mcm21 and Ame1 in the *ulp2Δ* mutant background, whereas the amount of sumoylated Mcm21 and Ame1 was increased in the wild-type *ULP2* background. Moreover, *mcm16Δ* caused a modest reduction of hyper-sumoylated Mcm21 in the *ulp2-SIM*^*3A*^*CCR*^*3A*^ double mutant ([Fig 5F](#pgen.1008477.g005){ref-type="fig"}, lanes 5 and 8), although little effect was observed in the *ulp2* single mutants. Overall, these findings indicate that Mcm16 plays two opposing roles in regulating kinetochore sumoylation: 1) recruiting Ulp2 to desumoylate Mcm21 and Ame1, and 2) facilitating the sumoylation of Mcm21 and Ame1, which is more clearly observed in cells lacking Ulp2. It should be noted that these opposing roles of Mcm16 are not contradictory to each other; instead, they suggest that separation-of-function mutations in the CMM complex would be needed to understand these roles further. The homeostasis of CCAN sumoylation is critical for accurate chromosome segregation {#sec008} ----------------------------------------------------------------------------------- Our results suggest that an accumulation of hyper-sumoylated CCAN leads to growth defects and elevated chromosome loss in the *ulp2* mutants ([Fig 5](#pgen.1008477.g005){ref-type="fig"}). If so, the *smt3-allR* mutant, in which formation of poly-SUMO chains is blocked \[[@pgen.1008477.ref038]\], should suppress the chromosome loss defect of the *ulp2-SIM*^*3A*^*CCR*^*3A*^ mutant. Interestingly, the mutation of *smt3-allR* alone resulted in a drastic 57-fold increase in the rate of chromosome-III loss, which is comparable to that of the *ulp2-SIM*^*3A*^*CCR*^*3A*^ mutant. This suggests that poly-sumoylation is needed to prevent chromosome loss in wild-type cells. Remarkably, combining the *smt3-allR* and *ulp2-SIM*^*3A*^*CCR*^*3A*^ mutations led to a marked reduction in the rate of chromosome loss by \~10-fold (from \~60-fold to 6-fold) ([Fig 6A](#pgen.1008477.g006){ref-type="fig"} and [S8 Table](#pgen.1008477.s010){ref-type="supplementary-material"}), raising the hypothesis that CCAN sumoylation must be maintained at a precise level to ensure accurate chromosome segregation. To explore this further, we next used the Ulp1-C580S pull-down approach to investigate the effect of *smt3-allR* on the levels of CCAN sumoylation. As shown in [Fig 6B](#pgen.1008477.g006){ref-type="fig"}, *smt3-allR* has little detectable effect on the amount of sumoylated Mcm21 in the wild-type background, indicating that poly-sumoylated Mcm21 in wild-type cells, if present, exists at a level below the detection limit of this assay. However, *smt3-allR* appears to reduce the amount of the slowest migrating species of Mcm21 in the *ulp2-SIM*^*3A*^*CCR*^*3A*^ mutant ([Fig 6B](#pgen.1008477.g006){ref-type="fig"}), suggesting that these are the poly-sumoylated species of Mcm21. However, multiple higher molecular weight species of Mcm21 still persist in the *smt3-allR ulp2-SIM*^*3A*^*CCR*^*3A*^ triple mutant ([Fig 6B](#pgen.1008477.g006){ref-type="fig"}). Because *smt3-allR* is expected to eliminate all branched poly-SUMO chains, these higher molecular weight species of Mcm21 are likely attributed to mono-sumoylation of multiple lysines on Mcm21, although we cannot exclude the possibility that Smt3-allR can still form linear chains whose existence have yet to be confirmed. Similarly, *smt3-allR* does not have an appreciable effect on the abundance of sumoylated Ame1, Okp1, Mcm16 and Mcm22 in the wild-type background ([Fig 6C--6F](#pgen.1008477.g006){ref-type="fig"}), indicating that poly-sumoylated species of these proteins are below the detection limit of this assay. As observed above and here (Figs [2](#pgen.1008477.g002){ref-type="fig"} and [6C--6F](#pgen.1008477.g006){ref-type="fig"}), multiple slower migrating sumoylated species of these CCAN subunits are readily detected in the *ulp2-SIM*^*3A*^*CCR*^*3A*^ mutant, which remain in the *smt3-allR ulp2-SIM*^*3A*^*CCR*^*3A*^ triple mutant, suggesting that each of these CCAN subunits is likely mono-sumoylated on several lysine residues. Interestingly, multiple mono-sumoylated species of Mcm16, Mcm22, Okp1 and Mcm21 appear to accumulate to a higher level in the *smt3-allR ulp2-SIM*^*3A*^*CCR*^*3A*^ triple mutant than in the *ulp2-SIM*^*3A*^*CCR*^*3A*^ mutant. One possible explanation is that *smt3-allR* could channel the unstable poly-sumoylated proteins into the more stable mono-sumoylated proteins, although alternative explanation could also exist; for example, the gel electrophoretic mobility pattern for poly-sumoylated proteins may differ from that of multiply mono-sumoylated species. Regardless of whether poly-SUMO chains could form, a relatively large number of SUMO moieties remain attached to CCAN in the *ulp2-SIM*^*3A*^*CCR*^*3A*^ mutant, which creates a situation where a high local concentration of SUMO at the inner kinetochore could act as a negative feedback signal to recruit Ulp2. Using this feedback mechanism, Ulp2 prevents excessive sumoylation at the inner kinetochore. ![CCAN sumoylation and chromosome segregation are affected by changes in poly-sumoylation.\ A) Chromosome loss rates, measured by quantitative mating, of WT, *smt3-allR*, *ulp2-SIM*^*3A*^*CCR*^*3A*^, and *smt3-allR ulp2-SIM*^*3A*^*CCR*^*3A*^ triple mutants (also see [S8 Table](#pgen.1008477.s010){ref-type="supplementary-material"}). B-F) The effects of *smt3-allR* on the sumoylation patterns of CCAN subunits in wild-type *ULP2* and the *ulp2-SIM*^*3A*^*CCR*^*3A*^ mutant backgrounds.](pgen.1008477.g006){#pgen.1008477.g006} Regulation of CCAN sumoylation during the cell cycle and in response to DNA replication stress {#sec009} ---------------------------------------------------------------------------------------------- To further explore the functions of Ulp2, we performed tetrad dissections of diploid yeast containing *ULP2/ulp2-707Δ* and *ULP2/ulp2-SIM*^*3A*^*CCR*^*3A*^ heterozygous mutants. As seen in [Fig 7A](#pgen.1008477.g007){ref-type="fig"}, neither of these *ulp2* mutants has an appreciable effect on spore viability or cell growth, unlike the *ulp2Δ* mutant \[[@pgen.1008477.ref023]\]. To determine whether the *ulp2-SIM*^*3A*^*CCR*^*3A*^ double mutant has aneuploidy similar to that of the *ulp2Δ* mutant \[[@pgen.1008477.ref027], [@pgen.1008477.ref039]\], we applied TMT-based quantitative MS to measure the abundance of proteins expressed from each chromosome. As summarized in [S2 Fig](#pgen.1008477.s002){ref-type="supplementary-material"} and [S10](#pgen.1008477.s012){ref-type="supplementary-material"} and [S11](#pgen.1008477.s013){ref-type="supplementary-material"} Tables, chromosomal protein expression levels were not significantly altered between the wild-type and *ulp2-SIM*^*3A*^*CCR*^*3A*^ haploid spores, while elevated levels of protein expression are seen from chromosome I, III and XI in the *ulp2Δ* cells. However, the expected two-fold increase was not observed from any of these chromosomes, likely due to a heterogeneous distribution of aneuploidy in the *ulp2Δ* mutant, which rapidly develops survivors and was found to be genetically unstable, undergoing adaptive evolution and losing its state of aneuploidy \[[@pgen.1008477.ref039]\]. ![Regulation of Mcm21 desumoylation during the cell cycle and in response to DNA replication stress.\ A) Tetrad dissection of *ulp2-707* and *ulp2-SIM*^*3A*^*CCR*^*3A*^. B) Plating assay to evaluate the growth of various *ulp2* mutants in response to high temperature, HU and benomyl. As controls, the *rad53Δ* mutant shows an expected hypersensitivity to HU, while the *mad1Δ* mutant shows an expected hypersensitivity to benomyl. C-D) Sumoylation of Mcm21 in wild-type and the *ulp2-SIM*^*3A*^*CCR*^*3A*^ mutant strains during different stages of the cell cycle, which are confirmed by FACS analysis. E-F) Effect of HU treatment on sumoylated Mcm21 in wild-type and the *ulp2-SIM*^*3A*^*CCR*^*3A*^ mutant. G) Effect of *ndc10-1* on sumoylated Mcm21 in the wild-type strain background. Both wild type and *ndc10-1* mutant cells were grown at room temperature, shifted to 37 °C for 6 hours, and then the cells were collected for FACS and Ulp1-C580S pull-down experiments.](pgen.1008477.g007){#pgen.1008477.g007} The observation that the *ulp2-SIM*^*3A*^*CCR*^*3A*^ mutant has relatively normal growth comparable to the wild-type strain prompted us to investigate its growth under stresses. Interestingly, these *ulp2* mutants are hypersensitive to hydroxyurea (HU) but not to benomyl ([Fig 7B](#pgen.1008477.g007){ref-type="fig"}), suggesting that the accumulation of hyper-sumoylated CCAN in the *ulp2* mutant does not impair kinetochore function during chromosome segregation; instead, it may interfere with the kinetochore in response to DNA replication stress, possibly when the centromeres are replicated. Next, we examined the level of sumoylated Mcm21 during different cell cycle stages. Sumoylated Mcm21 appears to be modestly higher in G1, lower in the S and G2-M phases in both WT and the *ulp2-SIM*^*3A*^*CCR*^*3A*^ mutant ([Fig 7C and 7D](#pgen.1008477.g007){ref-type="fig"}). Interestingly, HU treatment caused a reduction in sumoylated Mcm21 in WT cells, but a marked accumulation of hyper-sumoylated Mcm21 in the *ulp2-SIM*^*3A*^*CCR*^*3A*^ mutant ([Fig 7E and 7F](#pgen.1008477.g007){ref-type="fig"}). The reason for these distinct responses to HU treatment is presently unknown; although they indicate that sumoylation of Mcm21 is particularly sensitive to DNA replication stress. A remaining question is the role of kinetochore assembly on CCAN sumoylation. To address this, we used the *ndc10-1* mutant, which was shown to disrupt kinetochore assembly at non-permissive temperature \[[@pgen.1008477.ref040]\]. Sumoylated Mcm21 is drastically reduced in the *ndc10-1* mutant following a temperature shift to 37 °C for 6 hours ([Fig 7E](#pgen.1008477.g007){ref-type="fig"}); and FACS analysis shows that the *ndc10-1* mutant accumulates over 2C DNA content, likely as a result of chromosome mis-segregation. This finding, together with the observation that Mcm16 also contributes to sumoylation of Mcm21 ([Fig 5C](#pgen.1008477.g005){ref-type="fig"}), suggests that sumoylation of Mcm21 likely occurs on the fully assembled kinetochore at the centromere where Ulp2 is recruited (see [Fig 4E](#pgen.1008477.g004){ref-type="fig"}). Discussion {#sec010} ========== Prior studies have implicated that protein sumoylation plays an evolutionarily conserved, yet poorly understood role in regulating kinetochore function. Among the enzymes that catalyze reversible sumoylation, the Ulp2^SENP6^ family of enzymes appears to play a specific role in regulating chromosome segregation \[[@pgen.1008477.ref023], [@pgen.1008477.ref025], [@pgen.1008477.ref028], [@pgen.1008477.ref029], [@pgen.1008477.ref041], [@pgen.1008477.ref042]\]; however, the mechanism has been elusive. Our results here show that Ulp2 targets the inner kinetochore CCAN complex through two distinct and partially redundant mechanisms ([Fig 8](#pgen.1008477.g008){ref-type="fig"}): one that utilizes a newly identified kinetochore-targeting motif (previously referred to as CCR) of Ulp2, which recruits it to the kinetochore via the CMM complex, and the second that applies a negative feedback mechanism to selectively target hyper-sumoylated CCAN subunits via the SIM motif of Ulp2. Importantly, a failure in either mechanism results in an elevated chromosome loss rate, while a loss of both leads to a synergistic increase in chromosome loss. Interestingly, the *smt3-allR* mutant, which reduces the level of poly-sumoylation, results in an elevated rate of chromosome loss in cells containing wild-type Ulp2 ([Fig 6](#pgen.1008477.g006){ref-type="fig"}); however, the same mutation suppresses the chromosome loss defect of the *ulp2* mutant where CCAN becomes aberrantly poly-sumoylated. Moreover, hyper-sumoylated Mcm21 accumulates in this *ulp2* mutant in response to DNA replication stress, resulting in impaired growth ([Fig 7](#pgen.1008477.g007){ref-type="fig"}). Thus SUMO homeostasis at the kinetochore is critical to ensure accurate chromosome segregation likely via centromere replication. ![A model of how the Ulp2 protease is recruited to the kinetochore, via binding to the CMM complex and SUMO, to desumoylate the CCAN complex.](pgen.1008477.g008){#pgen.1008477.g008} Our previous study showed that Ulp1 is responsible for the bulk of intracellular desumoylation, while in contrast Ulp2 is highly specific \[[@pgen.1008477.ref030]\]. This finding was followed by two recent studies, which showed that Ulp2 targets its substrates using a dual substrate recognition mechanism \[[@pgen.1008477.ref031], [@pgen.1008477.ref032]\]. The findings here further extend this, revealing a new negative feedback mechanism by which Ulp2 targets the kinetochore, where it selectively targets hyper-sumoylated CCAN subunits to maintain SUMO homeostasis. Notably, the *smt3-allR* mutation, which eliminates the formation of branched poly-SUMO chains \[[@pgen.1008477.ref043]\], does not appreciably alter the level of sumoylated CCAN subunits in cells containing wild-type Ulp2, unlike the effect of the *ulp2-SIM*^*3A*^ mutation, which eliminates this negative feedback mechanism altogether. Thus, the binding between the SIM and branched poly-SUMO chains alone is insufficient to account for the negative feedback mechanism of Ulp2. Instead, the fact that several CCAN subunits are modified by multiple SUMO moieties in the *ulp2 smt3-allR* mutant ([Fig 7](#pgen.1008477.g007){ref-type="fig"}) suggests that mono-sumoylation of multiple lysines in the CCAN complex could create a high local concentration of SUMO at the kinetochore, collectively triggering Ulp2's negative feedback mechanism. Consistent with this idea, sumoylation of CCAN requires a functional Ndc10, suggesting that the assembled kinetochore is being targeted. Considering that SUMO has been found to modify multiple subunits of many protein complexes \[[@pgen.1008477.ref033], [@pgen.1008477.ref044]--[@pgen.1008477.ref046]\], it is conceivable that Ulp2 might employ a similar negative feedback mechanism to target other substrates, particularly when their sumoylation is allowed to accumulate. The findings here suggest that homeostasis of kinetochore sumoylation, specifically by Ulp2, is critical for accurate chromosome segregation. However, the specific function of sumoylation at the kinetochore or the specific role that sumoylated CCAN plays remain key questions for future investigation. The observation that several CCAN subunits can be sumoylated at multiple lysine residues or via poly-SUMO chains raises the possibility that these sumoylation events may act collectively to regulate the kinetochore, aside from acting as Ulp2's negative feedback signal. Concerning the nature of this function, a previous study showed that the knockdown of SENP6 in human cells led to the mis-localization of the CENP-H/I/K complex \[[@pgen.1008477.ref029]\], the human ortholog of *S*. *cerevisiae* CMM. However, deletion of Mcm16, a core subunit of the CMM complex, does not fully recapitulate the chromosome segregation defect of the *ulp2* mutant ([Fig 5A](#pgen.1008477.g005){ref-type="fig"}), suggesting that the role that Ulp2 plays in regulating the kinetochore is not limited to maintaining the function of CMM in yeast. Instead, the fact that *mcm16Δ* strongly suppresses the chromosome loss defect of the *ulp2* mutant appears to be consistent with the requirement for Mcm16 in generating an aberrantly hyper-sumoylated kinetochore in the *ulp2* mutant. On the other hand, the reduction of poly-sumoylation in the *smt3-allR* mutant results in a substantial increase in chromosome loss rate ([Fig 6](#pgen.1008477.g006){ref-type="fig"}), indicating that poly-sumoylation plays an important role in maintaining accurate chromosome segregation in wild-type cells. Although the *smt3-allR* mutation does not appreciably affect the amount of sumoylated CCAN subunits in unperturbed wild-type cells ([Fig 6](#pgen.1008477.g006){ref-type="fig"}), we cannot exclude the possibility that poly-sumoylated CCAN may accumulate transiently and is thus too low to be detected in unperturbed cells. Strikingly, the combination of the *smt3-allR* and *ulp2-SIM*^*3A*^*CCR*^*3A*^ mutations led to a mutual suppression of the chromosome loss defect seen in the individual mutants ([Fig 6A](#pgen.1008477.g006){ref-type="fig"}), further supporting the idea that the level of sumoylation at the CCAN complex must be tightly regulated to ensure accurate chromosome segregation. What might the function of sumoylated CCAN be? Given the relatively low stoichiometry of sumoylated CCAN subunits, it seems appropriate to consider them an unstable intermediate, which trigger a biological response only when needed, with Ulp2 preventing their accumulation under normal circumstances. Interestingly, the *ulp2* mutants are hypersensitive to DNA replication stress, but not to benomyl that specifically perturbs chromosome segregation ([Fig 7B](#pgen.1008477.g007){ref-type="fig"}). Moreover, DNA replication stress strongly perturbs the amount of sumoylated CCAN ([Fig 7E and 7F](#pgen.1008477.g007){ref-type="fig"}). Although still speculative, these findings suggest that sumoylated CCAN may act during centromere replication when the kinetochore is expected to undergo a dynamic remodeling. If so, how the kinetochore-centromere interface is perturbed in the *ulp2* mutant remains an important subject for future investigations. Materials and methods {#sec011} ===================== *S*. *cerevisiae* strain and plasmid construction {#sec012} ------------------------------------------------- Standard *S*. *cerevisiae* genetic methods were used to generate strains and plasmids in this study ([S12 Table](#pgen.1008477.s014){ref-type="supplementary-material"}). All integrated mutations in yeast strains and plasmids were confirmed by PCR and DNA sequencing. Yeast growth assay {#sec013} ------------------ Yeast growth was measured using a 5-Fluoroorotic acid (5-FOA) sensitivity assay as previously described \[[@pgen.1008477.ref031]\]: Briefly, cells were grown in 4 mL of synthetic complete medium lacking leucine (SC-Leu, US Biological) until OD~600~ \~1, followed by normalization to an OD~600~ of 0.5. Cells were then diluted five-fold serial dilutions in a sterile 96-well plate with sterile dH~2~O. 5 μL of each dilution was then spotted on either SC-Leu plates or 5-FOA plates (SC supplemented with 0.1% 5-FOA). Both plates were incubated at 30°C for two days, and images were acquired using a Bio-Rad ChemiDoc MP imaging system. Similarly, wild-type and various mutant cells were grown in YPD, 10-fold serial diluted and then spotted on plates containing either hydroxyurea or benomyl (see [Fig 7](#pgen.1008477.g007){ref-type="fig"}). Chromosome loss assay {#sec014} --------------------- Chromosome loss rates were measured using a quantitative mating assay as previously described \[[@pgen.1008477.ref037]\]. Briefly, *ulp2* mutants, expressed in haploid *MATα ARG2 LEU2 ura3* strains, were mated to a tester strain (HZY601: *MATα arg2 URA3*) by mixing \~1×10^7^ log-phase cells of each strain on a filter membrane (0.8 μm MCE Membrane Filter, MF-Millipore), followed by incubation at 30°C for 5 h on a YPD plate (1% Yeast extract, 2% Peptone and 2% Dextrose). Cells were washed and resuspended in 1 mL of sterile dH~2~O. The total number of viable cells was determined by taking 1% of the cell population and plating them onto SC-Arg plates. Diploid cells were selected by plating 10--100% of the remaining cells onto SC-Arg-Ura plates, such that the final numbers of cells growing on SC-Arg-Ura plates were between 100 and 200. Chromosome loss rates were determined by taking the number of Arg^+^ Ura^+^ Leu^−^colonies divided by the total number of viable colonies. For each experimental strain, 95% confidence intervals, of the median chromosome loss rates, were calculated using 16 isolates from each strain. Protein purification and preparation of CNBr-activated resin {#sec015} ------------------------------------------------------------ Ulp1^403-621^-C580S affinity resin was generated by cloning Ulp1^403-621^-C580S into a LIC 2C-T plasmid containing an N-terminal, TEV-cleavable, 6×His-MBP fusion tag. This construct was transformed into *Escherichia coli* Rosetta-2(DE3) pLysS (Novagen) cells, and grown in 2 liters of LB (Luria Broth) media containing 100 μg/mL of ampicillin and 34 μg/mL of chloramphenicol. Proteins were expressed using IPTG induction (0.2 mM IPTG) for 16h at 18°C, with cells being induced at a starting OD~600~ of \~0.6. Cells were lysed in PBSN buffer (1.06 mM KH~2~PO~4~, 5.6 mM K~2~HPO~4~, 154 mM NaCl, 10% Glycerol, 0.2% NP-40, pH 7.4) with protease inhibitors (2 mM phenylmethylsulfonyl fluoride, 200 μM benzamidine, 0.5 μg/mL leupeptin, 1 μg/mL pepstatin A). Ulp1^403-621^-C580S was purified via Ni-NTA resin (Qiagen), followed by dialysis and anion exchange chromatography (monoQ 5/50 GL) on an ÄKTA pure FPLC system. Elution fractions were pooled and concentrated to a final protein concentration of 15 mg/mL; proteins were then conjugated to CNBr-activated resin (GE Healthcare) according to manufacturer protocols. Ulp2-CCR resin was prepared in the same manner as Ulp1^403-621^-C580S resin with the following modification: Ulp2^873-1034^ WT or mutant variants were cloned into a LIC 2G-T plasmid containing an N-terminal, TEV-cleavable, 6×His -GST fusion tag. Analysis of CCAN sumoylation and protein-protein interactions {#sec016} ------------------------------------------------------------- To analyze sumoylated CCAN proteins, whole cell extracts were generated by glass bead beating, followed by the enrichment of sumoylated proteins via Ulp1-C580S affinity resin. Specifically, yeast cells were grown in 100 mL of YPD or SC-Leu medium to an OD~600~ of 1.0. Cells were harvested and washed with 10 mL of PBS buffer (PBS, 10% Glycerol, pH 7.4), supplemented with protease inhibitors (2 mM phenylmethylsulfonyl fluoride, 200 μM benzamidine, 0.5 μg/mL leupeptin, 1 μg/mL pepstatin A), 20 mM N-Ethylmaleimide and 20 mM Iodoacetamide. Cell pellets were resuspended in 1 mL of PBSN buffer, containing 2 mM MgCl~2~, protease inhibitors and 100 μg DNaseI (Grade II, Roche). Whole cell extracts were generated at 4°C via glass bead-beating (500 μL of glass beads, 10 cycles of 30s break with 2 min rest period) and followed by centrifugation at 15,000 ×*g*. Sumoylated proteins were purified by incubating soluble whole cell extracts with 20 μL Ulp1^403-621^-C580S resin for 2h at 4°C. Resin was washed six times with PBSN buffer, and bound proteins were eluted by boiling in 25 μL of 2×LDS sample buffer (NuPAGE LDS Sample Buffer, Invitrogen). Samples were then reduced using 50 mM DTT and run on SDS-PAGE and analyzed by western blotting using an α-Protein A 1° antibody (Sigma P3775), α-Smt3 1° antibody (rabbit polyclonal antibody made via Covance, Inc.), and an α-rabbit HRP 2° antibody (Sigma). To test if the slower migrating species of Ame1 are sumoylated ([S1 Fig](#pgen.1008477.s001){ref-type="supplementary-material"}), cells expressing Protein A tagged Ame1 were harvested and lysed as above with the following modifications: Omission of N-ethylmaleimide and Iodoacetamide from the cell washing buffer, and the addition of 2 mM DTT and 2.5 μg of recombinant Ulp1 to ensure that SUMO conjugates have been cleaved off of target proteins \[[@pgen.1008477.ref035]\]. To analyze the interactions between CCAN subunits and Ulp2-CCR, pull-down assays were performed using either wild type or mutant variants of Ulp2-CCR resin. Pulldown assays were performed in the same manner as described above for the enrichment of sumoylated proteins using Ulp1^403-621^-C580S. To detect binding between Ctf3 and CCR peptides, biotinylated peptides of UIp2^896-937^-CCR and UIp2^896-937^-CCR^3A^ (0.2 mM from EZbio) in 1 mL PBS were preincubated with 100 μL of NeutrAvidin-agarose resin and washed with 1 mL of PBSN. Whole cell extracts containing Ctf3-Protein A were incubated with 10 μL of peptide resin and washed with 5×1 mL of PBSN buffer. Bound proteins were eluted using 25 μL of 2×LDS sample buffer and then run on SDS-PAGE followed by Protein a western blot as described above. ChIP analysis of Ulp2 {#sec017} --------------------- To analyze the localization of Ulp2 to centromere, ChIP was carried out as described previously \[[@pgen.1008477.ref047]\]. Briefly, yeast cultures (50 mL for each immunoprecipitation) were grown to an OD~600~ of 0.8 and cross-linked for 15 min with 1% formaldehyde at room temperature followed by the addition of 125 mM glycine to quench the reaction. Whole cell lysates were prepared via glass bead-beating as described above and sonicated to shear the genomic DNA to an average size of 500 bp. Immunoprecipitation was performed using Dynabeads Protein G and anti-Flag antibody M2 (5 μL for each IP, Sigma) and then the Input and IP material were purified using QIAquick PCR Purification kit (QIAGEN). The Input was diluted 1:100 and IP samples were diluted 1:10 in water followed by qPCR using SYBR Green 2x master mix (KAPA Biosystems) on a Roche LightCycler 480. Genomic DNA prepared from wild-type cells was serially diluted to make a standard curve of each primer pair for calculation. Fold enrichment values were calculated as percentage of total Input DNA. Primer pairs used here: CEN3-Forward ATCAGCGCCAAACAATATGGAAAA, CEN3-Reverse GAGCAAAACTTCCACCAGTAAACG, CUP1-Forward AACTTCCAAAATGAAGGTCA and CUP1-Reverse GCATGACTTCTTGGTTTCTT. Cell cycle arrest and FACS analysis {#sec018} ----------------------------------- To analyze sumoylation of Mcm21 during cell cycle ([Fig 7](#pgen.1008477.g007){ref-type="fig"}), wild-type and *ulp2-SIM*^*3A*^*CCR*^*3A*^ mutant (containing *bar1Δ*) were arrested in the G1 phase by 15 nM alpha-factor for 3.5 hours. Cells were then washed twice with pre-warmed fresh YPD media and then suspended in two volumes of pre-warmed fresh YPD media to allow re-entry into the S phase. At each time point, aliquots of cells were harvested for Ulp1^403-621^-C580S pull-down analysis as described above. In parallel, 300 μL cell culture of each time point was fixed by 700 μL ethanol, treated by Protease K and RNAse A, and then stained by Sytox Green dye for FACS analysis using a BD LSRFortessa cell analyzer. 200 mM HU or 7.5 μg/mL nocodazole was added to various yeast cultures for 3 hours to arrest cells in the early S or G2-M phase, respectively. These arrested cells were then similarly processed for WB and FACS analyses. Preparation of sumoylated proteins from yeast whole cell extracts and TMT labeling of peptides for LC-MS/MS analysis {#sec019} -------------------------------------------------------------------------------------------------------------------- Total sumoylated proteins from yeast strains containing HF-Smt3 were purified as previously described \[[@pgen.1008477.ref031]\]. To generate yeast whole cell extracts for Tandem Mass Tag (TMT) labeling, yeast cells were grown up in YPD medium at 30°C to an OD~600~ of 1.0. Cells were pelleted by centrifugation at 4000 ×*g* at 4°C, followed by glass bead beating for 10 min in lysis buffer (200 mM NaOH, 100 mM Phosphate Buffer pH 8.0, 2% SDS). Samples were neutralized using 200 mM HCl and boiled at 65°C for 10 min. Protein concentrations were then measured by Bradford reagent and equal amounts of protein (\~200 μg) from each extract were digested using 2 μg of trypsin protease at 37°C. Protein digests were acidified using Trifluoroacetic acid (TFA) to a final concentration of 0.5%. Digested peptides were desalted using C18 Sep-Pak cartridges (Waters) and dried down by speed-vac at 30°C. Thermo Scientific TMT10plex labels were used to label tryptic peptides generated from yeast whole cell extracts. Specifically, TMT10-126, TMT10-127N, TMT10-128C, TMT10-129N, TMT10-130C were used to differentially label samples. Briefly, 20 μg of peptides from yeast whole cell extract were labeled with an individual TMT10 tag for 2h at room temperature. Samples were then combined and dried down by speed-vac at 30°C. Peptides were then re-suspended in 80% acetonitrile 20% dH2O and subjected to offline fractionation as previously described \[[@pgen.1008477.ref033]\]. [Fig 5C](#pgen.1008477.g005){ref-type="fig"} used TMT10-127N, TMT10-128C, TMT10-129N and TMT10-130C. [Fig 5D](#pgen.1008477.g005){ref-type="fig"} used TMT10-126, TMT10-127N, TMT10-128C, TMT10-129N and TMT10-130C. Sf9 insect cell expression of Ctf3-Mcm16-Mcm22 and pulldown assay with Ulp2-CCR resin {#sec020} ------------------------------------------------------------------------------------- SF9 insect cell co-expression of Ctf3, Mcm16 and Mcm22 was performed as described in the Baculovirus Expression System (Thermo Fisher Scientific). The co-expression construct was derived from yeast genomic DNA and sequentially cloned and inserted into the pFastbac plasmid using standard restriction enzyme and DNA ligation. Whole cell extracts were generated from 200 mL of SF9 insect cells at \~ 2.0 x 10^6^ cells/mL. Cells were harvested by centrifugation at 400 *×g* at 4°C, followed by washing with 10 mL of wash buffer (PBS, 10% glycerol, 2 mM phenylmethylsulfonyl fluoride, 200 μM benzamidine, 0.5 μg/mL leupeptin, 1 μg/mL pepstatin A and 100 μg/mL of DNaseI). Cell pelleted were dounced 20 times with a 15 mL dounce homogenizer and spun down at 30,000 *×g* at 4°C. 1 mL of clarified cell extracts were then bound to 25 μL Ulp2-CCR or Ulp2-CCR^3A^ resin for 2 hours at 4°C. Resin was washed with 8 volumes of PBS + 0.2% NP-40 and eluted using 150uL of elution buffer (6M Urea + 50mM phosphate for 1 hour at 4°C. Elutions were reduced, alkylated and digested with Trypsin (1 μg per elution) as described above. Samples were then acidified and labeled using TMT labels as described above. Data analysis for LC-MS/MS data {#sec021} ------------------------------- Data analysis for SILAC labeled samples were performed as previously described \[[@pgen.1008477.ref031]\] with the following exception: A minimum cut-off for 3 unique peptides was not applied. Instead proteins with less than 3 unique peptides were validated by manual inspection. TMT labeled samples were searched via the COMET peptide search engine as part of the Trans Proteomic Pipeline (TPP). The search results were then processed using TPP, where quantification of the TMT reporter ion was analyzed by the Libra software tool. An FDR of less than 1% was applied for peptide identification, and a minimum intensity of the TMT reporter ion was set at 1000. Expression of chromosome specific proteins were quantified by averaging the contributing signal of each TMT reporter ion that originates from proteins belonging to each of the 16 yeast chromosomes. The MS data analysis of SF9 expressed CMM extracts was performed in the same manner as above, with the following modifications: a composite protein database, containing the SF9 insect cell proteome along with the yeast protein sequence of Ulp2, Ctf3, Mcm16 and Mcm22 was used to search the MS data; additionally, a 3 peptide minimum cut-off was applied. Supporting information {#sec022} ====================== ###### A\) Western blot of Protein A tagged Ame1 from whole cell extracts and enriched sumoylated proteins. The upper band of Ame1 in whole cell extract (WCE), as indicated by an asterisk, was insensitive to Ulp1 treatment. In contrast, the eluted sample contains an upper band, which is sensitive to Ulp1 treatment and is thus the sumoylated species of Ame1. B) Conjugation of purified Ulp2-CCR (WT and 3A mutant) proteins to CNBr resin. These resins were then used to examine the binding between the Ulp2-CCR and CCAN subunits (see [Fig 3](#pgen.1008477.g003){ref-type="fig"}). (DOCX) ###### Click here for additional data file. ###### Quantitative MS to compare chromosome-specific protein expression between wild type and various *ulp2* mutants. Expression of chromosome specific proteins were quantified by averaging the contributing signal of each TMT reporter ion that originates from proteins encoded by genes on each of the 16 yeast chromosomes. A) Comparison of chromosome-specific expression of proteins between WT and *ulp2-SIM*^*3A*^*CCR*^*3A*^ mutant. B) Comparison of chromosome-specific expression of proteins between WT and four independent *ulp2Δ* strains. (DOCX) ###### Click here for additional data file. ###### Quantitative MS to compare sumoylated proteins in WT and the *ulp2-CCR*^*3A*^ mutant. Median ratios and the number of positive spectral matches (PSMs) are listed for each protein. (DOCX) ###### Click here for additional data file. ###### Quantitative MS to compare sumoylated proteins in the *ulp2-SIM*^*3A*^ and the *ulp2-SIM*^*3A*^*CCR*^*3A*^ mutants. Median ratios and the number of positive spectral matches (PSMs) are listed for each protein. (DOCX) ###### Click here for additional data file. ###### Quantitative MS to compare sumoylated proteins in WT and the *ulp2-SIM*^*3A*^ mutant. Median ratios and the number of positive spectral matches (PSMs) are listed for each protein. (DOCX) ###### Click here for additional data file. ###### Quantitative MS to compare sumoylated proteins in the *ulp2-CCR*^*3A*^ and the *ulp2-SIM*^*3A*^*CCR*^*3A*^ mutants. Median ratios and the number of positive spectral matches (PSMs) are listed for each protein. (DOCX) ###### Click here for additional data file. ###### Quantitative MS to compare sumoylated proteins in WT and the *ulp2-SIM*^*3A*^*CCR*^*3A*^ mutant. Median ratios and the number of positive spectral matches (PSMs) are listed for each protein. (DOCX) ###### Click here for additional data file. ###### Quantitative MS to compare sumoylated proteins in the *ulp2Δ* and the *ulp2-CCR*^*3A*^*SIM*^*3A*^ mutants. Median ratios and the number of positive spectral matches (PSMs) are listed for each protein. (DOCX) ###### Click here for additional data file. ###### Quantitative MS to compare the binding proteins of the wild-type Ulp2-CCR and the Ulp2-CCR^3A^ resins, using SF9-insect cell extracts expressing the yeast CMM complex. \% abundance, standard-error of the mean (SEM), average abundance ratios and the number of positive spectral matches (PSMs) for proteins associating with CCR and CCR^3A^ resin are listed. (DOCX) ###### Click here for additional data file. ###### Quantitative mating results for assaying the rate of chromosome III loss, which are used to generate Figs [5B](#pgen.1008477.g005){ref-type="fig"}, [6A](#pgen.1008477.g006){ref-type="fig"} and [7A](#pgen.1008477.g007){ref-type="fig"}. Median chromosome III loss rates, the 95% confidence interval (CI) and the Fold-change relative to WT are shown. (DOCX) ###### Click here for additional data file. ###### Quantitative MS to compare sumoylated proteins in the *ulp2Δ* and *ulp2Δmcm16Δ mutants*. Median ratios and the number of positive spectral matches (PSMs) are listed for each protein. (DOCX) ###### Click here for additional data file. ###### Quantitative MS to compare the % abundance of proteins expressed on each chromosome in wild-type and the *ulp2-SIM*^*3A*^*CCR*^*3A*^ mutants. (DOCX) ###### Click here for additional data file. ###### Quantitative MS to compare the % abundance of proteins expressed on each chromosome in wild-type and several independently prepared *ulp2Δ* mutants. (DOCX) ###### Click here for additional data file. ###### Yeast strains and plasmids used in this study. (DOCX) ###### Click here for additional data file. We would like to thank Yong-qi Gao and other members of the Zhou lab for technical assistance, Dr. Kevin Corbett's lab in advising the expression of the yeast Ctf3-Mcm16-Mcm22 complex in insect cells, and Dr. Sue Biggins for the *ndc10-1* strain. We would also like to thank Drs. Kevin Corbett and Arshad Desai for their critical readings of this work and helpful suggestions. Finally, we thank the anonymous reviewers for their constructive criticisms and helpful suggestions. [^1]: The authors have declared that no competing interests exist.
PubMed Central
india Updated: May 12, 2016 08:39 IST Republican frontrunner Donald Trump may be facing a lot of hostility back in US but a section in India is praying for his win in the race to the White House. The Hindu Sena, a right wing group, performed a hawan (religious ceremony) at Delhi’s Jantar Mantar on Wednesday to pray for his victory in the US presidential elections. Trump, who has emerged as the frontrunner to be the Republican Party’s nominee for the presidential polls, has had a controversial run during the primaries due to his views on women and minorities in the US. Read | Why a Trump presidency may be good for India Hindu Sena organised a hawan in support of Donald Trump at Jantar Mantar in New Delhi on Wednesday. (Arvind Yadav/HT Photo) Activists of the Hindu Sena smeared a photo of Trump with vermillion amid religious chants at the hawan at the Jantar Mantar. The ceremony started at 12.30 pm — a mahurat decided by priests over two weeks ago -- where posters of Trump were put up to evoke the gods to help in his victory. Along with pictures of Hindu gods Shiva and Hanuman, were pictures of Trump smiling with captions, ‘We support Trump’. “The whole world is screaming against Islamic terrorism, and even India is not safe from it,” said Vishnu Gupta, founder of the Hindu Sena nationalist group. “Only Donald Trump can save humanity.” Read | Indian MPs root for Clinton over Trump in US presidential race Hindu Sena holding We Support Trump posters at the hawan near Jantar Mantar in New Delhi on Wednesday. (Arvind Yadav/HT Photo) “We want Donald Trump to win the presidential polls. He has promised to uproot Islamic terror and we support this ideology,” said Gupta. Gupta believes that it is only Trump, who has the “guts to stand by his promises of eradicating Islamic terrorism”. “I have been a follower of his speeches and the world needs a strong leader like him to be able to counter Islamic terror groups. Especially for a country like ours, which has bitter relations with our neighbours, we need a strong anti-terror policy to keep the terrorists at bay,” he said. Gupta is also planning to organise a march outside the American Embassy, later this month, so that all US-based Indians support Trump in the race for president. “The world has become a single unit now, and I want our Prime Minister, Narendra Modi, to support and campaign for Trump,” said Gupta. Sunil Kumar, a member of the group, said that the aim of the one-hour hawan was to ward off terror groups such as ISIS, and al-Qaida. Also read | India is doing great and no one is talking about it: Donald Trump Donald Trump for President, in America or in India
OpenWebText2
Clearance of Pseudomonas aeruginosa from normal rat lungs after immunization with somatic antigens or toxin A. In a recent study we observed that in most Danish CF patients a period of approximately one year of intermittent colonization precedes the onset of chronic P. aeruginosa lung infection. An experimental model of acute P. aeruginosa pneumonia in normal rats was utilized to investigate the possibility of improving bacterial clearance by vaccination. Rats were immunized with either P. aeruginosa whole bacterial sonicate, O-polysaccharide toxin A conjugate, alginate toxin A conjugate or purified alginate. Saliva and serum samples were obtained to investigate the potential of different vaccines to induce local IgA and systemic IgM, IgG and IgA antibodies. In all immunized rats a significant (p < 0.05) rise in antibody titers against the vaccine components could be demonstrated in both saliva and serum. The macroscopic pathological changes observed at 6, 24 and 48 h after bacterial challenge included a pronounced inflammatory reaction in all groups of rats, whether vaccinated or not (p > 0.05). Approximately 99.5% of the initial inoculum was cleared within the first 6 h after challenge in all groups of rats (p > 0.77). Four weeks after challenge no bacteria could be cultured and no sign of previous inflammation could be demonstrated in any of the groups. The results of this study show that the inflammatory reaction and the natural capacity to clear bacteria in the lungs of normal rats are very efficient against P. aeruginosa and could not be improved by immunization.
PubMed Abstracts
Daniel Plumleed 744 Key Route Blvd Albany, CA 94706 dplum@socrates.berkeley.edu To Mr. Ken Lay, I'm writing to urge you to donate the millions of dollars you made from selling Enron stock before the company declared bankruptcy to funds, such as Enron Employee Transition Fund and REACH, that benefit the company's employees, who lost their retirement savings, and provide relief to low-income consumers in California, who can't afford to pay their energy bills. Enron and you made millions out of the pocketbooks of California consumers and from the efforts of your employees. Indeed, while you netted well over a $100 million, many of Enron's employees were financially devastated when the company declared bankruptcy and their retirement plans were wiped out. And Enron made an astronomical profit during the California energy crisis last year. As a result, there are thousands of consumers who are unable to pay their basic energy bills and the largest utility in the state is bankrupt. The New York Times reported that you sold $101 million worth of Enron stock while aggressively urging the company's employees to keep buying it. Please donate this money to the funds set up to help repair the lives of those Americans hurt by Enron's underhanded dealings. Think about this equation: Power (money) = Responsibility. If you put yourself in a position to reap the benefits of others for your own gain you owe the others responible actions in their behalf. If you fail to do this, you should pay a retribution of at least equal value than what you declared your personal value to be. Sincerely, Daniel Plumleed
Enron Emails
The Plastic Age (film) The Plastic Age is a 1925 black-and-white silent film, starring Clara Bow, Donald Keith, and Gilbert Roland. The film survives today not only on 16 mm film, but also on video and DVD. The film was based on a best-selling novel from 1924 of the same name, written by Percy Marks, a Brown University English instructor who chronicled the life of the fast-set of that university and used the fictitious Sanford College as a backdrop. The Plastic Age is known to most silent film fans as the very first hit of Clara Bow's career, and helped jumpstart her fast rise to stardom. Frederica Sagor Maas and Eve Unsell adapted the book for the screen. Plot Hugh Carver (Donald Keith) is an athletic star and a freshman at Prescott College. During a hazing initiation by his fraternity brothers, he meets Cynthia Day (Clara Bow), a popular girl who loves to party and have a good time. She introduces him to the pleasures of illicit drinking, dancing at illegal roadhouses, and getting nasty in the back seats of cars. A love-triangle develops between Day, Carver, and Carver's roommate, Carl Peters (Gilbert Roland), who also likes Day. Eventually, Peters gives up his crush on Day and reconciles his friendship with Carver. Carver's grades, athletic performance and moral character begin to suffer as a result of his late nights and wild partying, and on a visit home, his strict father tosses him out of the house and tells him not to come back until he's 'made good'. After almost being arrested at a roadhouse raid, Day and Carver escape in her automobile, and Day realizes that her lifestyle is bad for Carver, so the two stop seeing each other. Carver's school performance then improves greatly, and he leads his teammates to victory at the big football game at the end of the year. Peters tells Carver that Day still loves him, and that she has changed, becoming less wild and more mature. Day and Carver are reunited at the end. Background The Plastic Age was based on the 1924 novel of the same name, which was written by Brown University professor Percy Marks, a popular novelist at the time. Marks' novels were based on his students, the 'flaming youth in rebellion' of the twenties, who danced to wild jazz, drank from silver flasks, and had petting parties. Benjamin Percival Schulberg, the CEO of Preferred Pictures (a film studio & film distributor, as well as an actors agency), outbid all the major and minor studios for the rights to The Plastic Age; Schulberg paid $35,000 for the copyrights to the novel. The Plastic Age was filmed in the summer of 1925, at both Pomona College, located in Claremont, California, and in Hollywood, at the FBO Studios, the production company owned and operated by Joseph P. Kennedy, the wealthy Boston, Massachusetts banker/stockbroker patriarch of the Kennedy family. The film became a major hit in late 1925, and was Bow's first hit film. She became a star as a result of its success, which led her to being signed by a major studio and becoming a major star with the 1927 release of It. After seeing The Plastic Age soon after its release, Adolph Zukor, the founder and CEO of Paramount Pictures, contacted Schulberg, who had started his career as a publicist with Paramount before leaving the studio in 1918 to form Preferred Pictures. According to Clara Bow biographer David Stenn, Zukor proposed to Schulberg that he wanted to merge Preferred Pictures with Paramount, so that he could get Bow and make a star out of her, due to what Zukor saw as the great potential that she had as an actress. Schulberg agreed, but wanted Zukor to allow him to produce and control the product that Paramount assigned to him for Bow, which included script, casting, production crew, and wardrobe control. He also wanted to be made an associate producer at Paramount. The deal was made in early November 1925. Controversy Even though the film was a wide spread success, the Woman's Christian Temperance Union (WCTU) showed concerns for the films portrayal of Alcohol consumption as acceptable, regardless of the restrictions that prohibition brought in. They also voiced their opinion on the Swingers Dance style and Jazz music as "behaviour which is desperately in need of purification by the cleansing powers of Holy water" Cast Clara Bow as Cynthia Day Donald Keith as Hugh Carver Mary Alden as Mrs. Carver Henry B. Walthall as Henry Carver Gilbert Roland as Carl Peters David Butler as Coach Henley Gwen Lee as Carl's girl Appearing in minor uncredited roles are future film stars Janet Gaynor, Clark Gable, and Carole Lombard. DVD release The Plastic Age is currently available on DVD, through Image Entertainment, in a double-feature format, which includes the Louise Brooks film, The Show Off (1926). David Shepard preserved the film through his company, Film Preservation Associates. Composer Eric Beheim scored the music for The Plastic Age. Kino On Video released the film in August 1999, as part of a 4 video set featuring Clara's work, which includes It (1927); the set is still available in the VHS format as of March 2012. References External links Category:1925 films Category:1920s romantic comedy films Category:American films Category:American black-and-white films Category:American romantic comedy films Category:American silent feature films Category:Films directed by Wesley Ruggles Category:Films based on American novels Category:Films produced by B. P. Schulberg Category:Films set in universities and colleges
Wikipedia (en)
Altcoins Venezuela Decides One Coin’s Not Enough, Readies New ‘Petro Gold’ Token Things are only getting weirder in Venezuela, as President Nicolas Maduro decides that one state-issued cryptocurrency farce isn’t enough. Now, the socialist country with a crumbling economy is ready to launch second Petro token — called Petro Gold. Maduro’s Vision Earlier this week, collapsing socialist country Venezuela purportedly launched Petro — the world’s first state-issued cryptocurrency — purportedly backed by the country’s oil reserves. The problem is, the oil allegedly backing each token has yet to be drilled, and the country is currently in the throes of an extreme economic crisis. Of course, Maduro had already deemed Petro a massive success from the moment it launched — if not before. By his own estimations, the President’s prized cryptocurrency has raised $735 million in the first day of a pre-sale. Riding high on his self-deemed success, Maduro has decided to issue another state-backed cryptocurrency, called “Petro Gold.” In a televised speech, the socialist leader stated: Next week I‘m going to launch the Petro Gold, backed by Gold, which is even more powerful, that will strengthen the Petro. As the name implies, Petro Gold will purportedly be backed by the country’s gold supply. Whether or not the precious metal has actually been excavated from the ground, however, remains to be seen. Reasonable Doubt Most experts interpret Maduro’s new found love for state-issued cryptocurrencies as little more than an attempt to circumvent U.S. financial sanctions as Venezuela buckles under hyperinflation and a collapsing socialist economy currently unable to provide enough food for its citizens. In fact, U.S. investors may even be getting themselves into legal trouble should they invest in Petro or Petro Gold, as the U.S. Treasury Department has already claimed that Venezuela’s cryptocurrency potentially violates international sanctions. Venezuelan opposition leaders are unsurprisingly calling Maduro’s oil-and-gold-backed cryptocurrencies illegal debt issues, while informed investors are left with far more questions than answers. One such investor, Sean Walsh — founder of crypto-asset investment firm Redwood City Ventures — thinks Petro Gold is speculative at best, telling Reuters: Rather than buying a cryptocurrency backed by gold, I’d just go buy the gold. Gold is a physical thing that you want to be able to hold in your hands, because that’s the point. The South American country has a long history of uncompensated expropriations, and its fiat currency has depreciated upwards of 99 percent. Those facts shouldn’t exactly inspire investor confidence. Others claim that supporting Venezuela’s cryptocurrency projects in any way is akin to financially supporting both the regime’s crackdown on human rights and inability to govern. The Venezuelan government has also repeatedly proved itself to be against the very foundations of blockchain technology and cryptocurrency, by remaining incredibly opaque and safeguarding what many countries would consider public information. What do you think of Petro and Petro Gold? Would you even consider investing in either cryptocurrency? Let us know in the comments below! Images courtesy of Shutterstock, Bitcoinist archives
OpenWebText2
The production of polymers or copolymers of lower .alpha.-olefins, particularly ethylene and propylene, has gained substantial commercial significance. The polymeric products are inexpensive and exhibit a number of commercially useful properties. In the case of the polymerization of ethylene, the process is relatively uncomplicated in that the product type is not influenced by the manner in which the ethylene molecules add to the growing polymeric chain and the product does not exist in stereoisomeric forms. In the case of the polymerization of propylene, however, the presence of pendant methyl groups on the polymeric chain provides the possiblity of several types of product depending on the steric regularity with which the propylene units add to the growing chain. Much if not most of the commercial polypropylene results from the stereoregular addition of propylene units in a regular head-to-tail manner. The propylene in which the addition of units is random is termed atactic. This amorphous form is less desirable and, if present in significant quantities, must be removed as by extraction in order to obtain a more desirable crystalline product. Also significant from a commercial standpoint is the activity of the polymerization catalyst. A number of the early polymerization catalysts, e.g., trivalent titanium, chromium or vanadium catalysts, were of relatively low activity and the product contained significant proportions of catalyst residues. The removal of such residues as by a deashing step was required in order to obtain commercially acceptable properties. The more recent olefin polymerization catalysts are more stereo-regulating and of sufficient catalytic activity so that extraction and/or deashing steps are not required. In the terms now conventionally employed for the components, the high activity olefin polymerization catalysts are formed from a procatalyst which typically contains magnesium, titanium and halide moieties as well as an electron donor, a cocatalyst which is usually an organoaluminum compound and a selectivity control agent which may be provided as a partial or total complex with the cocatalyst. Although each of these catalyst components has a considerable influence on the polymerization catalyst and process and the product thereby produced, the nature of the catalyst as well as the polyolefin product seem to be most influenced by the procatalyst. Much of the research toward improvement of the olefin polymerization catalyst has been directed toward improvemen of the procatalyst component. Kioka et al, U.S. Pat. No. 4,330,649, describe a solid catalyst component (procatalyst) obtained by heating a soluble magnesium compound such as magnesium chloride with a higher alcohol in the presence of an ester to produce a solution which is added to titanium tetrachloride and an electron donor to form the procatalyst. Band, U.S. Pat. No. 4,472,521, reacts a magnesium alkoxide with a titanium alkoxide of 4 or more carbon atoms in each alkoxide in the presence of aromatic hydrocarbon. Titanium tetrachloride and an electron donor are added to the resulting solution to produce a solid procatalyst which is post-treated with transition metal halide. Arzoumanides, U.S. Pat. No. 4,540,679, produces a catalyst component by contacting a suspension of magnesium ethoxide in ethanol with carbon dioxide. The addition of an organoaluminum compound in a hydrocarbon to the resulting solution produces granular particles which are employed as a support for titanium upon treatment with titanium tetrachloride. Nestlerode et al, U.S. Pat. No. 4,728,705, solubilize magnesium ethoxide in ethanol with carbon dioxide and spray dry the resulting solution or alternatively use the solution to impregnate catalyst support particles. The particles resulting from either modification are useful in the production of a procatalyst of desirable morphology. A somewhat different type of catalyst component precursor is described by Job, U.S. Pat. No. 4,710,428, wherein a magnesium compound of the general formula EQU Mg.sub.4 (OR).sub.6 (ROH).sub.10 A (I) is formed wherein R independently is lower alkyl of up to 4 carbon atoms inclusive and A is one or more anions having a total oxidation state of -2. This complex magnesium compound is contacted with a tetravalent titanium halide, a halohydrocarbon and an electron donor to form the procatalyst. The use of such magnesium compounds has certain advantages in that they are crystalline materials of desirable morphology whereas magnesium ethoxide is not. The conversion of the crystals of such magnesium compounds to olefin polymerization procatalysts is by conventional technology. The catalysts produced from such procatalysts are good high activity olefin polymerization catalysts, particularly for the polymerization or copolymerization of propylene. It would be of advantage, however, to provide improved olefin polymerization catalysts.
USPTO Backgrounds
Lance Armstrong & Matthew McConaughey Lance Armstrong and Matthew McConaughey celebrate University of Texas' win in the BCS National Championship football game. 1 /29: Lance Armstrong and Matthew McConaughey running Pin 1/29 :Lance Armstrong and Matthew McConaughey running Share Tweet Pin Lance Armstrong and Matthew McConaughey run, bare-chested, while listening to their iPods. 2 /29: Lance Armstrong and Matthew McConaughey stay in shape Pin 2/29 :Lance Armstrong and Matthew McConaughey stay in shape Share Tweet Pin Lance Armstrong and Matthew McConaughey run to stay in shape, while listening to their favorite tunes on their iPods. 3 /29: Lance Armstrong and Matthew McConaughey exercise Pin 3/29 :Lance Armstrong and Matthew McConaughey exercise Share Tweet Pin Lance Armstrong and Matthew McConaughey hang out together. The duo runs and exercises outdoors to stay in shape. 4 /29: Lance Armstrong and Matthew McConaughey in Miami Pin 4/29 :Lance Armstrong and Matthew McConaughey in Miami Share Tweet Pin Lance Armstrong and Matthew McConaughey run on the boardwalk in Miami as onlookers stare as they pass by. The two were on vacation in Miami. 5 /29: Lance Armstrong and Matthew McConaughey shirtless Pin 5/29 :Lance Armstrong and Matthew McConaughey shirtless Share Tweet Pin Lance Armstrong and Matthew McConaughey get ready for a run. The two guys were vacationing in Miami and staying in shape by runninig near the beach. 6 /29: Lance Armstrong and Matthew McConaughey at Miami beach Pin 6/29 :Lance Armstrong and Matthew McConaughey at Miami beach Share Tweet Pin Lance Armstrong and Matthew McConaughey hang out on the beach in Miami, where the two were on vacation. Armstrong and McConaughey both enjoy biking as well as running. 7 /29: Matthew McConaughey and Lance Armstrong on the beach Pin 7/29 :Matthew McConaughey and Lance Armstrong on the beach Share Tweet Pin Matthew McConaughey and Lance Armstrong hang out in Miami on the beach and enjoy the scenery. 8 /29: Lance Armstrong and Matthew McConaughey run in the rain Pin 8/29 :Lance Armstrong and Matthew McConaughey run in the rain Share Tweet Pin Despite the unpredictable weather in Miami, Lance Armstrong and Matthew McConaughey continue their run near the beach. 9 /29: Lance Armstrong and Matthew McConaughey caught in the rain Pin 9/29 :Lance Armstrong and Matthew McConaughey caught in the rain Share Tweet Pin Lance Armstrong and Matthew McConaughey were caught in a downpour while vacationing in Miami. The two guys, who both love to exercise, were running at the beach. 10 /29: Matthew McConaughey and Lance Armstrong swimming Pin 10/29 :Matthew McConaughey and Lance Armstrong swimming Share Tweet Pin Matthew McConaughey and Lance Armstrong take a dip in the ocean. The two guys are often seen biking, running and partying near the beach. 11 /29: Matthew McConaughey and Lance Armstrong at the beach Pin 11/29 :Matthew McConaughey and Lance Armstrong at the beach Share Tweet Pin Matthew McConaughey and Lance Armstrong hang out at the beach. The two are together so often, the tabloids and gossip sites are often speculating about the nature of their relationship. 12 /29: Lance Armstrong and Matthew McConaughey near the water Pin 12/29 :Lance Armstrong and Matthew McConaughey near the water Share Tweet Pin Lance Armstrong and Matthew McConaughey often hang out on the beach in Malibu, as well as vacation together in Miami and other locations. 13 /29: Matthew McConaughey and Lance Armstrong get ready to ride Pin 13/29 :Matthew McConaughey and Lance Armstrong get ready to ride Share Tweet Pin Matthew McConaughey and Lance Armstrong get ready for a bike ride in Malibu, California. 14 /29: Matthew McConaughey and Lance Armstrong take a ride Pin 14/29 :Matthew McConaughey and Lance Armstrong take a ride Share Tweet Pin Matthew McConaughey and Lance Armstrong take a bike ride in Malibu. The two are often seen running, biking and exercising together. 15 /29: Matthew McConaughey and Lance Armstrong meet up Pin 15/29 :Matthew McConaughey and Lance Armstrong meet up Share Tweet Pin Matthew McConaughey and Lance Armstrong meet up to take a bike ride. Both men are very health conscious and can often be found biking and running in Malibu. 16 /29: Matthew McConaughey and Lance Armstrong in Malibu Pin 16/29 :Matthew McConaughey and Lance Armstrong in Malibu Share Tweet Pin Matthew McConaughey and Lance Armstrong walk in Malibu after spending the day bike riding. The guy pals can often be found together at sporting events, the beach and nightclubs. 17 /29: Matthew McConaughey and Lance Armstrong in a wine shop Pin 17/29 :Matthew McConaughey and Lance Armstrong in a wine shop Share Tweet Pin Matthew McConaughey and Lance Armstrong drop into a wine shop (presumbly to buy a bottle) after the two finished a day of biking in Malibu. 18 /29: Matthew McConaughey and Lance Armstrong look out the window Pin 18/29 :Matthew McConaughey and Lance Armstrong look out the window Share Tweet Pin Matthew McConaughey and Lance Armstrong take a look out the window of a liquore store. The best buddies spent the day biking near Matthew's home in Malibu, California. 19 /29: Matthew McConaughey and Lance Armstrong have drinks Pin 19/29 :Matthew McConaughey and Lance Armstrong have drinks Share Tweet Pin Matthew McConaughey and Lance Armstrong definitely enjoy the nightlife. Here they have a few drinks after spending the day near the beach biking. 20 /29: Lance Armstrong and Matthew McConaughey go out Pin 20/29 :Lance Armstrong and Matthew McConaughey go out Share Tweet Pin Lance Armstrong and Matthew McConaughey go out and have some drinks. The two look nice, dressed up in their suits. They are often seen at nightspots and events together, partying and having a good time. 21 /29: Matthew McConaughey and Lance Armstrong laugh Pin 21/29 :Matthew McConaughey and Lance Armstrong laugh Share Tweet Pin Matthew McConaughey and Lance Armstrong laugh and enjoy themselves before heading out for a bike ride on Pacific Coast Highway in Malibu, California. 22 /29: Lance Armstrong and Matthew McConaughey take a walk Pin 22/29 :Lance Armstrong and Matthew McConaughey take a walk Share Tweet Pin Lance Armstrong and Matthew McConaughey walk together after hanging out near the beach exercising. Both men stay fit by walking, running and of course, biking. 23 /29: Lance Armstrong and Matthew McConaughey enjoy a couple drinks Pin 23/29 :Lance Armstrong and Matthew McConaughey enjoy a couple drinks Share Tweet Pin Pals Lance Armstrong and Matthew McConaughey enjoy a few drinks. McConaughey has a baby with Camila Alves, while Armstrong has been romantically linked to many women. 24 /29: Cyclist Lance Armstrong and actor Matthew McConaughey Pin 24/29 :Cyclist Lance Armstrong and actor Matthew McConaughey Share Tweet Pin Cyclist Lance Armstrong and actor Matthew McConaughey get ready to take a bike ride along PCH in Malibu. Armstrong has gotten McConaughey into the sport over the last several years. 25 /29: Matthew McConaughey and Lance Armstrong bike in Malibu Pin 25/29 :Matthew McConaughey and Lance Armstrong bike in Malibu Share Tweet Pin Matthew McConaughey and Lance Armstrong, along with others, bike along Pacific Coast Highway in Malibu. The area is a popular spot for biking, hiking, running and other outdoor activities. With the beautifully scenery and the beach, it's a great location for outdoor fun. 26 /29: Matthew McConaughey and Lance Armstrong come in from the water Pin 26/29 :Matthew McConaughey and Lance Armstrong come in from the water Share Tweet Pin After some fun in the sun, Matthew McConaughey and Lance Armstrong come in from the water. The actor and cyclist spend a great deal of time at the beach. McConaughey has a home in Malibu. 27 /29: Lance Armstrong and Matthew McConaughey talk to a woman Pin 27/29 :Lance Armstrong and Matthew McConaughey talk to a woman Share Tweet Pin Lance Armstrong and Matthew McConaughey are stopped by a woman on the beach. After a day of surf, sun and sand, Armstrong and McConaughey hung out and had a few drinks. 28 /29: Matthew McConaughey and Lance Armstrong laugh at the beach Pin 28/29 :Matthew McConaughey and Lance Armstrong laugh at the beach Share Tweet Pin Matthew McConaughey and Lance Armstrong seem to be enjoying themselves at the beach. They often run or bike near the beach. But here, they are relaxing and enjoying the view, while taking an occasional dip in the water. 29 /29: Lance Armstrong and Matthew McConaughey run on the beach Pin 29/29 :Lance Armstrong and Matthew McConaughey run on the beach Share Tweet Pin Lance Armstrong and Matthew McConaughey run on the beach. Running on the sand is great exercise. The two guy pals listen to music on their iPods while going for a run.
Pile-CC
Screenshot : WBOY ( YouTube Phillip Hudok claims the state of West Virginia is violating his religious beliefs by requiring him to get a biometric drivers license. The Christian West Virginia man garnered local attention on Monday afternoon when he arrived at the Elkins Department of Motor Vehicles wearing Native American attire, reports local NBC/ABC affiliate WBOY. In 2008, West Virginia DMV Commissioner Joseph Cicchirillo allowed Hudok and a group of 50 or 60 Christians to get a new drivers license and not have their photo stored on a database, according to the Associated Press. For the next several years, Hudok was able to use a license with a face photo that was not stored on a database. But Governor Earl Ray Tomblin blocked the exemption and Hudok had to get a license with a photo that was stored on May 2017, according to WBOY. Hudok reportedly proceeded to show up to the DMV wearing a Native American costume. And he wore such an outfit again when he showed up this week to renew his license. In an interview with WBOY, Hudok suggested that other religious groups were protected more than Christians—an apparent explanation for his racist costume. It seems Hudok isn’t referencing any religion specifically, but dressing as a Native American caricature for shock value. Hudo k did not respond to a Gizmodo request to explain how the driver license violates his religious beliefs, but he seems to be referring to the Real ID Act, which requires states to “use a face biometric standard that allows for facial recognition and authentication.” In February 2012, Hudok reportedly spoke to the Senate Transportation and Infrastructure Committee in support of a bill that would allow exemption from Real ID for religious reasons. According to The Register-Herald, Hudo k equated Real ID to the Biblical “mark of the beast” from the Book of Revelation. “If we as Christians comply with the Real ID act, we would be enrolled into a global system of identification that directly links our body through biometrics to our ability to buy or sell,” Hudok reportedly told the committee. “If end-time prophecy is not important to Christians, I’d like to know what is.” Hudok said at the time. “I don’t have any alternatives but to live according to my convictions.” Apparently in the ensuing years, he has found that one alternative is to follow the law but wear an offensive costume while doing so. Update March 27 9 am EST: Hudok responded to Gizmodo’s request for comment on Wednesday morning. “Biometrics is numbering man,” he said, suggesting that the Biblical prophesy that a “Mark will someday be required by all,” was about biometrics. He referred to this article as a “hit piece” and said, “Race wasn’t in the equation.” He said “cross dressers and women wearing burkas” get special treatment at the DMV and compared his protest to the Boston Tea Party. “World is and has always been a spiritual battleground, not a playground,” Hudok added. [WBOY]
OpenWebText2
الحدث - خاص English Below بيان إدانة اليمن، 1 أبريل 2018: بناء على ما نشر على مواقع التواصل الاجتماعي وبناء على ما قام به التضامن النسوي من متابعات للخبر والتواصل هاتفيا مع مصدر موثوق من أهالي المنطقة، يدين التضامن النسوي بشدة جريمة اغتصاب والاعتداء بالضرب امرأة في مديرية الخوخة، محافظة الحديدة، من قبل عسكري سوداني، ونؤكد بأن هذه الجريمة الصارخة ترقى الى جريمة حرب بحسب نظام روما الأساسي ويعاقب عليها القانون الوطني. وعليه نطالب: • سرعة توجه اللجنة الوطنية للتحقيق في ادعاءات انتهاكات حقوق الانسان ومجموعة الخبراء الدوليين المعنيين بالتحقيق في ادعاءات حقوق الانسان للتحقيق في هذه الادعاءات وتوثيق الجريمة. • ونطالب الحكومة وقوات التحالف بأخذ الاجراءات اللازمة والصارمة تجاه الجاني ومحاسبته قضائيا والتأكد من عدم إفلاته من العقاب واتخاذ إجراءات صارمة لردع مثل هذه الجرائم والتحقيق في خلفيات وانتماءات العناصر المسلحة التي استقدمها التحالف والتي يشتبه بانتمائهم لعناصر جانجاويد المتهمين بارتكاب جرائم حرب في دارفور السودان، وتعويض الناجية وتقديم الدعم النفسي لها ولأسرتها. • كما نتوجه الى النائب العام وندعوه الى تكليف النيابة العامة في الحديدة بإجراءات التحقيقات والتحفظ على الأدلة وحماية الضحية وأسرتها. • ونحذر من التستر على هذه الجريمة النكراء التي تمس كل اليمنيين. Condemnation Statement Yemen, 1st April 2018: As per the allegations on social media and our own follow up and call to a verified source from the residents in the area, we, the Women Solidarity Network, strongly condemn the rape crime and physical abuse committed against a women from Alkhoukha District, in Hodaida, by a Sudanese armed person. The Women Solidarity Network consider this a grave crime, which can be amount to a war crime as per the Rome Statute and is punishable by the national law. Consequently, we urgently demand the following: - We call on the National Committee for investigating Alleged Human Rights Violations, and the International Eminent Expert Group tasked with investigating alleged human rights violations and abuses, to investigate this crime and document it. - We also demand that the government and the coalition forces take the needed strict actions towards the perpetrator and hold him legally accountable and ensure that he does not escape punishment, and take a range of deterrent measures towards such crimes. We call on them to also investigate the backgrounds of armed personnel that the coalition has brought to Yemen, including possibly members affiliated to Janjaweed militias accused of committing human rights crimes in Sudan’s Darfour region. - We also urge them to compensate the survivor and provide psychosocial support for her and for her family. We also call on the Attorney-General to assign the General Prosecutor of Hodieda to investigate the matter, preserve the evidence, and protect the victim and her family. - We warn against concealing evidence and obstruction of justice on this crime that affect all Yemenis.
OpenWebText2
A blog about technology-enhanced learning, teaching and assessment, with side order of open educational practices. Written by Leo Havemann, Learning Technologist at Birkbeck, University of London (a member institution of the Bloomsbury Learning Environment, hence 'BLE'), and co-ordinator of M25 Learning Technology Group and ELESIG London. Tuesday, 8 July 2014 Breaking down barriers: Open Educational Practices as an emerging academic literacy A conference presentation with Jo Stroud and Javiera Atenas at Connected Learning in an Open World: Academic Practice and Technology conference, University of Greenwich; 8 July 2014. Links for our accompanying Prezi plus our speaking notes are below. Abstract: This paper considers barriers to the uptake of Open Educational Practices (OEP) and how these barriers might potentially be overcome. ‘Open education’ has become an increasingly important topic in TEL and wider educational debates, partly driven by the rapid emergence of MOOCs. Various activities, such as sharing of teaching resources, open access publishing, and delivery of free, online courses, are being promoted under the umbrella of ‘openness’, yet the majority of scholars do not appear to be embracing the concept wholeheartedly. Amidst dramatic changes to the current learning, teaching, and research landscape, academics are increasingly called upon to become ‘connected’, ‘digital’, and ‘open’ scholars, requiring engagement with a kaleidoscope of interconnected open social and digital practices. Potentially the most powerful and compelling argument for any version of ‘open education’ is the claim that academics should adopt Open Educational Practices (OEP). For example, Andrade et al. (2011) assert that “OER and OEP are changing learning scenarios” and that “the use of OER and the implementation of OEP lead to innovations in pedagogical terms”. OEP consist not only of creating and reusing OER, but also of other forms of transparency around academic practice, such as blogging, tweeting, presenting, and debating scholarly and pedagogic activities, in ways that promote reusability, revision, and collaboration (Ehlers, 2011; Jacobi & Woert, 2012). OEP are therefore tactics for increasing access to knowledge, developing and strengthening communities of practice, disseminating positive ways of working, leveraging high-quality existing resources, and promoting innovative pedagogies (Andrade et al., 2011). In spite of this, there appears to be a lack of engagement with OEP. It’s possible that these theoretical and practical benefits have not been widely understood by the academic community, but it also seems to be the case that real or perceived regulatory, technical, cultural, and skills barriers exist. In our presentation we will consider the nature of these barriers in greater detail and suggest potential strategies for their mitigation. References: Andrade, A., Ehlers, U.-D., Caine, A., Carneiro, R., & Conole, G. (2011). Beyond OER: Shifting Focus from Resources to Practices (pp. 1–191). Duisburg-Essen. Retrieved from http://www.oerasia.org/OERResources/8.pdf Ehlers, U., & Conole, G. (2010). Open Educational Practices : Unleashing the power of OER (pp. 1–9). Retrieved from http://efquel.org/wp-content/uploads/2012/03/OEP_Unleashing-the-power-of-OER.pdf Ehlers, U-D. (2011). From Open Educational Resources to open educational practices. eLearning Papers, (23), 1–8. Retrieved from http://www.elearningeuropa.info/nl/node/71328 Jacobi, R., & Woert, N. van der. (2012). Trend Report on Open Educational Resources 2012. SURF, Utrecht.
Pile-CC
Q: Using ionicons in a rails app I have a rails app I'd like to use these in. Following the instructions, I ensured the font path in .css was assets/fonts/ionicons... but it doesn't seem to be working. Anyone ever use these before? A: If anyone else has trouble to use ionicons in your rails projects, I suggest to use the gem font-ionicons-rails that I built. It's very simple to use, as below: Installation: Add this to your Gemfile: gem "font-ionicons-rails" Usage: In your application.css, include the css file: /* *= require ionicons */ Sass Support If you prefer SCSS, add this to your application.css.scss file: @import "ionicons"; If you use the Sass indented syntax, add this to your application.css.sass file: @import ionicons Then restart your webserver if it was previously running. That's all. Now you are ready to use ionicons in your project using the tag i or using the gem helper to improve use. Helpers ion_icon "camera" # => <i class="ion-camera"></i> ion_icon "camera", text: "Take a photo" # => <i class="ion-camera"></i> Take a photo ion_icon "chevron-right", text: "Get started", right: true # => Get started <i class="ion-chevron-right"></i> content_tag(:li, ion_icon("checkmark-round", text: "Bulleted list item")) # => <li><i class="ion-checkmark-round"></i> Bulleted list item</li> It's pretty ease now, yay. A: These are the steps I usually take: Add the following to config/application.rb config.assets.paths << Rails.root.join('app', 'assets', 'fonts') Make the directory app/assets/fonts and copy the font files to that directory. Copy ionicons.css to app/assets/stylesheets Edit ionicons.css file and update the url() calls to work with the asset pipeline: src: font-url("ionicons.eot?v=1.3.0"); src: font-url("ionicons.eot?v=1.3.0#iefix") format("embedded-opentype"), font-url("ionicons.ttf?v=1.3.0") format("truetype"), font-url("ionicons.woff?v=1.3.0") format("woff"), font-url("ionicons.svg?v=1.3.0#Ionicons") format("svg"); Restart webrick/thin/whatever and you should be good. :)
StackExchange
F1 2013 After the starting lights went off, it seemed that French Lotus driver Romain Grosjean or Australian Red Bull driver Mark Webber might end victorious from a tactical and strategy guided race in Japan on Sunday, but in the end it was Webber’s team mate namely German Red Bull driver Sebastian Vettel who took his ninth success of the season - and fifth in a row - after a clever timed two-stop strategy. It must be mentioned here, that the chances of Australian Red Bull driver Mark Webber to score a maiden victory were damped at the start when both he and his German team mate Sebastian Vettel were relatively slow of the line, while the Lotus of Frenchman Romain Grosjean propelled from fourth on the grid to snatch the lead going into the first corner. For a while however, the Australian’s three-stop strategy looked quite promising as he swapped to Pirelli’s medium tires for his final stint with 11 laps to go. Unfortunately it took him until the 52nd lap to remove Romain Grosjean from second place, by which time 3 times Formula 1 World Champion Sebastian Vettel was too far away to be overtaken. This result was however not enough for the German Red Bull driver to clinch the drivers’ Formula 1 World championship for a fourth time in a row as Fernando Alonso’s fourth place for the Scuderia Ferrari leaves him 90 points behind the German, with 100 points still up for grabs in the final four races. Spanish Scuderi Ferrari driver Fern ando Alonso played second fiddle for a long time to Brazilian Ferrari team mate Felipe Massa, but then moved ahead of the Brazilian and in the closing stages fought and won a fierce battle with Sauber’s top-form driver Nico Hulkenberg. The latter was also overtaken close to the finish by experienced Kimi Raikkonen, who brought his Lotus home fifth, after taking the German down in an exciting overtaking maneuver. As Esteban Gutierrez drove the best race of his till date short F1 career to score his first points with a hard-earned seventh place, it was an excellent birthday present for Peter Sauber who was back home in Switzerland celebrating his 70th birthday. Esteban Gutierrez earned his result by holding off the Mercedes of German driver Nico Rosberg to the flag, as Vodafone McLaren Mercedes driver Jenson Button passed Brazilian Scuderia Felipe Massa on the penultimate lap to score two points precious for the Woking based team. On the other hand, the Brazilian Scuderia Ferrari driver had lost time with a drive-through penalty for speeding in the pit lane. It was a tough day for Mercedes, who lost British driver Lewis Hamilton as a contender in the first corner. As French Lotus driver Romain Grosjean came down the inside British Mercedes driver Lewis Hamilton was sandwiched between the two Red Bulls as they struggled for momentum. As German Red Bull driver Sebastian Vettel had to move left to avoid the Lotus, he slit the Mercedes’ right-rear tire open with his left front-wing endplate. The devastated British Mercedes driver Lewis Hamilton limped back to his pits with a puncture, tried to resume the race, but soon retired as the resulting aerodynamic damage was delaying him more than a second a lap. Paul di Resta drove an energetic race for Force India but just lost out on points to British Vodafone McLaren Mercedes driver Jenson Button and Brazilian Scuderia Ferrari driver Felipe Massa in the closing stages and thus finished 11th, while Jean-Eric Vergne fought for 12th for Toro Rosso, just ahead of his team mate Daniel Ricciardo. The Australian started on the hard tires and did the longest first stint, but his chances of points were completely ruined when he got a drive-through penalty for completing a pass on Force India’s Adrian Sutil by going totally off track exiting 130R on the 28th lap and being considered by the stewards to have gained an unfair advantage. Adrian Sutil made a brilliant start from last spot on the starting grid and was always in the lower midfield fight, but had to settle for 14th, a long way behind Ricciardo and a mere tenth of a second ahead of Sergio Perez, who like Vodafone McLaren Mercedes team mate Jenson Button did a three-stop race. Pastor Maldonado and Valtteri Bottas were 16th and 17th for Williams, the Finn dropping from 13th in the final laps after a driving mistake in the peak of the battle. Caterham and Marussia lost Giedo van der Garde and Jules Bianchi at the very first corner when the Dutchman and the Frenchman collided at the start, without causing an early safety car period. After serving a drive-through penalty in the first five laps for driving through a red light during qualifying, Charles Pic fought through to lead Marussia’s Max Chilton home. German Red Bull driver Sebastian Vettel's fourth win in Japan brings him to 297 points in the standings to Fernando Alonso’s 207, which means he can clinch the title at the next round in India by finishing fifth or higher, regardless of what the Spanish Scuderia Ferrari driver will achieve. Kimi Raikkonen expanded his gap from Lewis Hamilton in third place with 177 to 161, while Mark Webber is moving back into contention with them on 148 points. The result gave Red Bull another 43 points, bringing their total points to 445 in the 2013 Formula 1 constructors' standings. The result of the Scuderia Ferrari pulled them further ahead of Mercedes, the gap being a mere 10 points with 297 to 287, while Lotus are back in the fight for second place with 264. The former title contenders Vodafone McLaren Mercedes have only 83 to Force India’s 62 points.
Pile-CC
Quick Filters I enjoy having great time together. avaible hours a week in tokyo city I'm new arrive and I love hord hot man!!Full service widauth rush!. You are looking for young and sexy girl to do your dreams to come true you are in the write place st Century Dating experience online, it is my Dream to Revolutionize the way we date and spend our valuable time by stipulating my personal preferences in mate selection, I thought this would create a better experience for the paying gentlemen booking my Time Companionship, leaving you with a memory to last of our dating experience and a smile on your face, to avoid disappointment please start with a Platonic Date, Dinner Date, Fuddle or The Ultimate Girlfriend Experience (GFE) to ensure we feel chemistry before experimenting with longer dates ( wk months) I am more a courtesan than a profesional escort girl,I like to meet a friend,a lover and to feel relaxed,comfortable and to have fun on my dates,I am not a clock watcher My name is Alisa Make your fantasies to reality!!!non-rushvery open minded Fun, Bubbly Personality I am sweet, innocent and very feminine i am an elegant and charming lady from slovakia with an appetite for the new and unknown. I can meet you anywhere and offer a true gfe. If you are in Romania or about to come and you feel like you need a classy and sexy escort lady to join youthen I am the perfect choice for you; you will understand why the romanian girls are so loved all over the world You will be happy with me and you'll remember me for a long time. I prefer to cater to a few number of gentleman friends and only through recommendations but if you got on my page you probably know that its will never be dull moment with me!i will shower you with kisses and my attention and make our encounter one to be remembered . www.polish-silk.eu - 2018 DISCLAIMER: All models on www.polish-silk.eu adult site are 18 years or older. www.polish-silk.eu has a zero-tolerance policy against ILLEGAL pornography. All galleries and links are provided by 3rd parties. We have no control over the content of these pages. We take no responsibility for the content on any website which we link to, please use your own discretion while surfing the porn links. Contact us | Privacy Policy | 18 USC 2257 | DMCA
Pile-CC
Q: ASP.NET DetailsView Update exception handling - truncated data I'm using a DetailsView for updating a record. If the edit input of some fields is too long, the system produces a "data will be truncated" exception. I can see where I can detect the error in DetailsViewItemUpdating or DetailsViewItemUpdated, and provide a user message. However, I believe the visual feedback should be sufficient for this release, i.e. "hey, it didn't take my 30 characters, even though the header label said it would only allow 20". Is there a way to force the DetailsView to do the truncation and accept the update? Or some other approach to this data handling exception, which must be pretty common. A: ANSWER: from Ammar Gaffar at EE: Convert to template field In EditItemTemplate Set DataBindings > MaxLength property to desired max length of field Works fine.
StackExchange
L. Birge Harrison Lovell Birge Harrison (October 28, 1854, Philadelphia, Pennsylvania – 1929) was an American genre and landscape painter, teacher, and writer. He was a prominent practitioner and advocate of Tonalism. Life Born in Philadelphia, Birge Harrison was the brother of artist T. Alexander Harrison. He studied first at the Pennsylvania Academy of the Fine Arts in 1874, and later credited Thomas Eakins as a positive influence on his own teaching style. He then went to Paris on the advice of John Singer Sargent to study with Carolus-Duran and at the École des Beaux-Arts under Cabanel. In 1881 Harrison exhibited at the Paris Salon, and in 1882 his Salon entry, Novembre, became one of the first paintings by an American artist to be purchased by the French government. Discussing the painting years later Harrison attributed its handling to "A Scandinavian painter (who) had shown me the secret of atmospheric painting....and....the importance of vibration and refraction in landscape painting." The paintings of this period included peasant subjects that showed the influence of Jules Bastien-Lepage. The limited palette and wistful mood of the early works would continue to be distinguishing features of Harrison's later landscape paintings. Harrison met the Australian painter Eleanor Ritchie in the course of his summer landscape travels; they married and returned to America, where he began to exhibit annually at the National Academy of Design, and after 1889 at the Pennsylvania Academy of the Fine Arts. Temporarily forced to stop painting on account of ill health, he spent considerable time between 1889 and 1893 traveling in Australia, the South Seas, and New Mexico, and wrote and illustrated articles for publication. In 1891 Harrison and his wife moved to California, but after her death in 1895 while expecting their first child, Harrison remarried and moved to Plymouth, Massachusetts, where he became a leader of the Tonalist school. He then relocated again, this time to Woodstock, New York at the turn of the century where he founded a school based on his experiments in Tonalism. In 1906 Harrison helped found the Art Students League Summer School in Woodstock, where his pupils would include his niece, the architect and painter Margaret Fulton Spencer. He became known especially for his paintings of landscapes in the snow. Harrison received numerous prizes and medals, including the gold medal at the Pennsylvania Academy of the Fine Arts in 1910. He became a member of the National Academy of Design in 1910, National Institute of Arts and Letters, New York Water Color Club, Society of American Artists, and was director of the landscape school of the Art Students League. In 1909 Harrison's lectures were published in a book entitled Landscape Painting; the book was cited as "a standard work for students, and was referred to as "a fine commentary on the technique of the craft." According to art historian William H. Gerdts, Harrison was then "the leading writer in America on contemporary landscape painting." Harrison's writing reveals an interest in the retinal perception of color, and in tonal harmony; he believed that the term Impressionism was descriptive not merely of the recent movement in French painting, but referred to any work done "honestly and sincerely" before nature. Harrison's painting exemplified the lessons he taught, emphasizing the practice of open-air observation rather than technical facility. Harrison's pupils included Mary Gine Riley and Florence Thaw. Paintings Winter twilight (1910, 30 x 40 cm) Meadow in the Connecticut November (1881, musée des beaux-arts de Rennes, France) Le moulin rouge (1909) Fifth Avenue in Winter. Notes Sources Harrison Genealogy Repository Paintings and Sculpture in the Collection of the National Academy of Design, p. 249 Gerdts, William H. American Impressionism. Abbeville, 1984. Gerdts, William H., et al. Lasting Impressions: American Painters in France 1865–1915. Terra Foundation of the Arts, 1992. Biography, The Johnson Collection The New York Times, November 14, 1909 Category:Artists from Philadelphia Category:19th-century American painters Category:American male painters Category:20th-century American painters Category:1854 births Category:1929 deaths Category:Pennsylvania Academy of the Fine Arts alumni Category:American alumni of the École des Beaux-Arts Category:National Academy of Design members Category:Art Students League of New York faculty Category:Painters from Pennsylvania Category:American genre painters Category:American landscape painters Category:20th-century American non-fiction writers Category:American art writers Category:People from New Hope, Pennsylvania Category:Pennsylvania Impressionism Category:20th-century American male writers Category:American male non-fiction writers Category:Students of Thomas Eakins
Wikipedia (en)
G'DAY, BOWERY The Aussie BBQ is a popular annual showcase at SXSW that features—you're psychic!—the best in Down Under talent. This year, it migrates evermore north to the Bowery Ballroom for a densely packed, on-off evening. The roster, already nine deep and counting, includes pensive rockers the Jezabels, country troubs Wagons, tropicalia poppers the Holidays, hip-hop ensemble Bliss N Eso, and more. Don't miss Hungry Kids of Hungary, who have a truly unfathomable name but solid, Big Day Out Festival–approved rock chops. Take note: This event is strictly BYOD (Bring Your Own Dingo). Sun., March 13, 2 p.m., 2011
Pile-CC
Breast cancer among Filipina American women represents a major but largely neglected cancer disparity; -first, though not as highly visible as other Asian subgroups, the Filipino population in the US is large, second among Asians only to the Chinese. Second, Filipinas have higher rates of breast cancer incidence than most other Asian subgroups. Third, resources for and data regarding Filipina women with breast cancer are almost non-existent. In 2004, West Bay Filipino Multi-Service Center (West Bay) joined forces with the UCSF: comprehensive Cancer Center (UCSF-CCC) and the San Francisco General (SFGH) Breast Care Program to start the first Filipina breast cancer support group (Sinag Tala) in San Francisco. However, group attendance is uneven and the little research available on Filipino Americans suggests that a "one size fits all" approach to outreach would not be effective in this highly relational (collectivist-oriented) culture. The proposed study will elucidate the meanings of survivorship and breast cancer support in this community, and inform how to design more culturally appropriate outreach building upon existing community resources social networks) for the women who need them most. We will utilize multiple qualitative methods because each taps different types of data (participant observation, individual ethnographic interviews, and small group interviews) to achieve our specific aims to: 1) identify beliefs and values associated with breast cancer, survivorship, and support; and 2) create and pre-test culturally resonant outreach themes and channels based on core cultural values and existing community resources. The conceptual framework is drawn from theories of quality of life, social capital, and relational culture. The product of this study will be new, culturally appropriate outreach themes and outreach communication channels designed to encourage Filipina breast cancer patients and survivors to take part in support groups. Just as access to and participation in adequate and meaningful social support has been shown to improve the quality of life of White breast cancer patients, developing meaningful outreach themes and channels to link Filipina breast cancer survivors to support services is likely to improve the quality of life of Filipina breast cancer survivors and to address survivorship disparities in this community. Formative research into culturally relevant outreach for support services has implications across the stages of survivorship. [unreadable] [unreadable] [unreadable] [unreadable]
NIH ExPorter
Gas-chromatographic screening of capsular polysaccharides of Neisseria meningitidis. Thirteen systemic strains, i e strains isolated from systemic infections, and 77 carrier isolates of Neisseria meningitidis were serogrouped by agglutination and analyzed by gas chromatography (GC) of phenol extracts. For systemic strains the sugar patterns were in accordance with their group-specific capsular polysaccharides (CPS). Some carrier isolates revealed unexpected GC profiles. Upon immunological retesting with new sera, GC results were generally confirmed. Occasional isolates initially serogrouped as B or Y completely lacked neuraminic acid. Some non-groupable isolates were shown by ultracentrifugation and GC to have significant amounts of this sugar likely to originate from CPS of known composition or from unknown polysaccharides. One such originally non-groupable isolate showed a weak agglutination reaction specifically with group B antiserum when reexamined. Generally, carrier isolates had lower amounts of CPS than systemic strains of the same group. Five successive isolates from one carrier were first serogrouped as X, Z or non-groupable, but they had high amounts of galactosamine and 2-keto-3-deoxy octonate, sugars characterizing CPS of serogroup 29E. These isolates were confirmed by agglutination with recently available group 29E antiserum to be of this serogroup, which has not been reported before in Norway. Ultracentrifugation revealed the presence of unknown polysaccharides containing glucose, galactose or glucosamine, but further purification of these polymers is required to determine their composition and immunological importance.
PubMed Abstracts
Disclaimer: I supposed I should put this: I don't own Fairy Tail. How depressing. Author's Note: This was written for Father's Day and my sister's birthday even though she hates the fact that I write fanfiction! WHO CARES? It's my birthday, I can do what I want! XD So happy early 18th, sis, and I appreciate you not commenting on my writing on my birthday today! By the way, constructive criticism and reviews will be much appreciated. There's only a small part of NatsuxLucy, but it's still there. XD The Pain We Share - by HawkofNavarre Dedicated to my sis, who will sadly never read this. XD Tomorrow was going to be a terrible day, Lucy knew. It was going to horrible and gross and painful, but there was nothing she could do about it. Even if she could stop herself from thinking about it, the thought would still linger in her mind. Nobody knew, and nobody understood. It would be Sunday tomorrow, and the most vile day of the year in her mind. She didn't want it to come, however; it wasn't as if she could stop time. Lucy didn't want it to come… I hate that day, she thought to herself, clenching her fists on the counter of Fairy Tail's bar. "Lucy? Is there something wrong?" Mirajane asked her, all smiles as usual. The waitress dried a glass as she glanced at her friend. Lucy blinked when her idol spoke before uncurling her hand and placing them on her lap. She gave Mirajane a reassuring smile. "Oh, there's nothing wrong at all, Mira-san. Thanks for asking though." She turned away before the transforming magician could see the deceit in her eyes. Lucy hated lying with a passion, but she didn't want to tell anyone. They would only try to comfort her and she simply wanted to be left alone. The stellar spirit mage didn't need their sympathy, even if they were her nakama. It would be better if she just didn't come tomorrow because she knew that she'd feel even more depressed than at present time, and then only more eyes would be on her. "Natsu, cheer up!" The moody girl laid her arms on the table and rested her head on them as she twisted to view the conversation going on between Happy and Natsu. The normally cheerful Salamander had an unusual scowl shown on his face. He was slumped over a table that he was isolated at. Lucy didn't know why he was so grumpy. Natsu was always so annoying and loud. Why the huge difference today? In fact, he was so odd today that the blonde was even getting a little nervous. He was more out of it than what she'd originally thought. What were the chances of the dragon slayer glaring at his fire-meal? Lucy was beginning to think that he'd gone crazy. "There's no use being sad about it!" Happy advised his closest friend worriedly. "You should eat! You haven't eaten all day, and it's not likely that you'll eat tomorrow!" "I'm not hungry," Natsu replied gruffly to the flying cat. His eyes narrowed more, if that were possible, to stare harder at the food in front of him. It seemed as if he was trying to make it combust into even hotter flames. "You're magic is going to be all drained!" "Who cares?" Lucy decided not to pay any more attention to the two's little squabble. It looked like it was going nowhere fast anyway. It wasn't interesting at all. So, what could she do to entertain herself for the next couple of hours? It didn't seem likely that she, Natsu, and Happy would go and do a mission any time soon. Heck, the red-haired teenager even informed her that he didn't want to go on a mission for the next couple of days. "You know everyone's got it just as bad as you, Natsu," she overheard Happy say in concern. "Of course I know," he responded curtly, though it was less grumpy than before, "but they've all gotten over it. It's…different for me." "Natsu…" "Happy, I don't wanna talk about it anymore." "…Aye," She didn't know what they were babbling about though it sounded quite upsetting for Natsu. Lucy did want to know now, and that was good. Pondering that subject would be her distraction for the next couple of days. She supposed the fire-user didn't always have to be an idiot outside of battle. Lucy stood up and bid farewell to Mira, settling on rereading some of her favourite books at home. No more thinking about tomorrow. - "Father!" Lucy shouted as her small legs carried her into said person's study. "Look what I drew!" The tiny girl proudly held up a colourful picture that held a rather adorable image of a family of three—a man, a woman, and their petite child. On the piece of paper, they were holding hands and a smile was on all of their faces. In the background there was a properly coloured rainbow with the sun peeking out from under the beam's arc. It was to be a present to her father. "Lucy," the man she called her father stormed loudly. His face was not visible through the shadow washed over it as his head was low. He stood up and shot a piercing look at his innocent daughter. "How many times have I told you not to come into my room while I'm working?" "This…would be the thirty-third time, father," she answered quietly, her eyes wide and filled with terror. "I only wanted you to see my picture, father! I'm really sorry! I didn't mean to disturb you! I meant no ha—" "And why do you have time to draw such foolishness?" he demanded furiously, his voice low and menacing. "I really am sor—" "You should be focusing on your studies, not scribbling nonsense on a piece of paper! I shall increase the length of your lessons if you have so much time!" "No! Please, father! I didn't mean to disturb you! I really didn't!" she shouted desperately. Lucy didn't want her papa to be mad at her! It was horrible when her papa was mad at her! "Give me that abomination," he commanded coldly, referring to the optimistic picture in her hand. The young Heartphilia approached her father's desk without protest although she was shaking profusely. She held out the paper that she'd poured her heart and soul into, biting her lip in fear. The picture was abruptly snatched from her possession and she watched in fright as her parent glared at it in disdain. He suddenly snorted at it and held it high in the air. Lucy's eyes clung onto the portrait she'd worked so hard on, following it in her father's grasp. Crrrrssssshhhh! She was barely able to contain a cry as the paper that appeared worthless was torn in half. She'd did her best on that picture, sketching neatly and colouring within the lines liked she'd always been told, and there it was being torn in half right before her very own eyes. Crrrsssshhh! He ripped it again and again and again until it was just remnants of what is used to be. The cruel man crushed the fragments in his hand before he opened the window and threw it out in disgust. He snarled as he watched it fall into the giant garden outside. Finally, he turned back to Lucy, disgust and spite evident in his greedy eyes. "Go back to your studies now, and never think of something so foolish and trivial again," he ordered, a deep, loathing tone in his voice. "Y-yes, father," she responded in a near whisper, trying as hard as she could not to cry. Were they mocking her? Were her tears mocking her? If she cried, her papa would only scold her again. Did her tears want her to be scolded? However, before the water could emerge from her eyes, she ran from the room, prying the door open and closing it carefully behind her. Lucy's tears began to fall as she desperately hurried down the hall to her room where she flung herself onto the bed, her tiny figure racking with sobs. "I'm sorry, father! I'm sorry, father! I'm sorry, father!" she screamed on her bed until her voice was hoarse. "I only wanted you to be proud of me!" - I only wanted you to be proud of me! Lucy jerked awake, blinking many times, breathing hard, and sweating freely. She looked blankly around the room. It was just a dream, she told herself. This wasn't the same bed she'd been crying on. Hesitantly, she untangled herself from the covers and rolled out of bed, pinching her arm to make sure she was real. "Ouch," she hissed, wincing at the pain she'd inflicted on her limb. It seemed that she was indeed real. Sighing, Lucy glanced out the window to see it was a bright, sunny day. It just had to contrast with her mood so much. She groaned aloud and stalked to the bathroom where she shut the door and stripped free of her clothes. Stepping into the shower, she thought of her dream again. Now that had been real. The blonde remembered that day as clearly as she remembered the names of her stellar spirits. Lucy set the water to the desired temperature and let the liquid wash over her. It had been seven years ago when her mother had been out shopping on the exact same day as today, and that was the reason she hated this day so much. The picture that she worked harder on than anything had been her gift to her father as a Father's Day present, and not only did he not appreciate it one bit, but he'd also insulted it, thought it revolting, and tossed it out the window. When he'd ripped it into shreds, he'd ripped his daughter's heart apart as well. Ever since that day, she'd hated him with a passion. Turning away her cookies had been one thing, but this had pushed her over the edge. That day, she'd realized she would never be good enough for her father. She shook her head in anger as she smashed her palm against the tiles of her shower, the rush of water running down her body. Lucy hated Father's Day. She hated this wretched day. - Rather than spend the day glaring at the wall and living in the past, Lucy decided that she would spend the day basking in her friends' presences. Fairy Tail was her favourite place, and she would change this day into something that didn't have anything to do with her disgustful father. After all, though it was Father's Day, it was still just a regular day. She had nakama now, and she didn't need to mope all day! However, when Lucy set foot in her guild, it wasn't at all as cheery and bright as she hoped it'd be. Gray was somehow harassing Natsu early in the morning, with his shirt off of course. "What is wrong with you today?" Gray asked the dragon slayer with an annoyed expression on his face. "Shut the hell up and leave me alone," Natsu shot back without his usual flare, sitting in the same spot and position as he had done the previous day. Perfect, he was acting like he had yesterday. Lucy was starting to get really freaked out by this. "Why are you so depressed?" the ice mage demanded in frustration, stomping around and holding his head. "Why the hell won't you fight me?" "I told you to go away," the Salamander growled in irritation though he still wasn't moving. Happy hovered over his partner while looking at half-naked teen in concern. Gray didn't listen. "Oi, answer me!" he shouted, putting a hand on the fire mage's should before recoiling quick. "Ow! Damn it! Why are you so hot?" A few of the older, immature guild members heard Gray's comment and began to laugh like idiots. Natsu only snickered. "I don't know what the hell is up with you, so you'd better start acting normal again real soon!" the black-haired guild mate yelled loudly. He was now, for some reason, only wearing his boxers. He stalked off in rage to find something else to do. Lucy blinked a couple of times at the scene that had just played out before her and considered her options. One, talk to Natsu, two, avoid fiery Natsu and talk to Mirajane, or three, avoid flaming Natsu and talk to Levi. She sighed, choosing the first option. Since the red-haired boy was her friend, she figured she'd better find out why he was so…not being Natsu. Besides, she could admit that there was just a hint of curiousness deep within her mind. The female mage prepared herself by taking a deep breath as she walked over to the table and sat beside her companion. "Happy, could you let me talk to Natsu alone for a second?" she asked kindly, offering a smile to the cat. "I promise I'll be nice," Happy was reluctant at first, she could tell, but eventually gave in. "Aye." With that, the flying animal took off elsewhere, leaving Lucy alone with the boy who had originally gotten her to join guild she so loved. "Hey, Natsu. What's up?" Surprisingly, he answered. "I hate this day." It took her a few seconds to register exactly what had just happened and then another few seconds to figure out exactly what he had said. "Really? Me too," she agreed. "Father's Day is a stupid day." "Yeah," Natsu nodded. "Why do you hate it?" "I always tried to make my dad proud of me when I was young. I'd do my very best to make him a great present, but in the end, he'd just spit on it and dispose of it in front of me. All I wanted for him to acknowledge me," she admitted quietly. Lucy had no idea why she was telling Natsu this, but it was certainly making her feel better. If spilling your guts felt this good, who knew how great it would feel to stand on a roof and shout every profanity at her father? Lucy celebrated internally at her success, but only smiled encouragingly at him. "Every Father's Day, Igneel and I would have the biggest fight. It was something we did yearly," he told her, now sitting up straight. "Hold on," Lucy interjected quickly, "didn't you live in a forest? How did you know when Father's Day was?" Natsu gave her an odd look. "Duh, we had a calendar," "C-calendar?" she spluttered in disbelief. I was hard to imagine a boy and dragon living in a forest with a calendar tacked up to a tree's trunk. "Yeah? So? What about it?" he asked in annoyance. "Nothing! Nothing! Go on!" the stellar spirit mage insisted hastily. Nothing about Natsu should surprise her anymore. Being raised by a dragon was already weird enough—not to mention having a battle as a Father's Day present. After shooting her one last strange look, he continued. "Anyway, after the fight, we'd always make a promise to each other that we had to fulfil before the next Father's Day. Today, seven years ago, I made Igneel promise to teach me a new fire move. He did that the week before he disappeared, but I couldn't…" "Natsu…?" "I couldn't keep my promise," he choked out in shame, head lowered and fists clenched. "Igneel made me promise just to be with him the next Father's Day! It was so easy and I couldn't do it!" "It wasn't your fault! It wasn't like you didn't do everything you could!" Lucy argued. She hadn't seen this side of Natsu before. Was he…crying…? "I couldn't keep my promise," he repeated in disgrace. "Igneel always took care of me, and I couldn't repay him by fulfilling my promise." Was he even listening to her? She knew he was feeling horrible and guilty, but she was going to put some sense into his brain! Lucy yanked on his scaly scarf and forced Natsu to listen to her. "Listen up, Natsu. Igneel was a great father, wasn't he?" She received a nod as his fearful eyes met hers. So he wasn't crying, but he still felt bad. "Then he'll understand that you tried your hardest to keep your promise! You don't have to go on hating yourself on Father's Day just because you feel guilty! So instead of feeling bad about something that was impossible for you to control, whey don't you focus on looking for Igneel? He won't care that you couldn't keep a promise if he gets to see you again!" After that, she promptly let go of his scarf. "You're…right!" Natsu decided with newfound determination. "I'll just have to look harder for Igneel!" "That's the spirit!" she cheered him on gladly, happy that he was back to is normal self. Her task had been surprisingly easy. "Thanks, Lucy! Oh, and you know what?" "Hmm?" "You're not alone," he informed her kindly. "Huh? What do you mean?" Lucy asked in confusion. "Gray, Erza, and me too—we've all lost our real parents, so you don't have to be so sad and think about your dad. Everyone else is in pain too! We all hurt together. It's the pain we all share," Natsu said intelligently. "Yeah, it's in the past now. I know that now," she spoke with a small grin. He grinned back at her. "Don't think about your dad!" he told her as if it were effortless to do. "We're your nakama! We're your family! We'll hurt with you!" Suddenly, he leaned in close and kissed her full out on the lips. Lucy was paralysed in shock, but surprising, it wasn't bad. Eventually, she melted into the soft kiss Natsu was giving her and leaned in closer. It was…hot, but was a welcoming warmth. She liked it a lot, and that's all she knew. It could have been a few minutes later that they pulled apart or it could have been a few seconds. She didn't know. That was much too nice to keep track of time. "What was that for?" she asked, still flushed from their heated moment. "Nothing much!" Natsu replied with another grin after licking his swollen lips. "Someone just told me that girls liked kisses for a thank you!" "Eh?" Unfortunately, she would never find out who told Natsu this as he was already dashing away. "Where are you going?" "I'm gunna kick Gray's ass!" he called back in excitement before running out of sight. She sighed contently for the first time that day. Maybe Father's Day wasn't so bad after all. Her own father could just go burn in Hell. She just hoped that she could make that kiss a tradition. The author would like to thank you for your continued support. Your review has been posted.
Pile-CC
Meryl Streep, Sandra Bullock and Michael Douglas were among the stars who turned out to honor Jane Fonda as she received a special award from the American Film Institute on Thursday night. The veteran … Image 2 of 18|2014 AFI Life Achievement Award: A Tribute to Jane Fonda Frazer Harrison / Getty Images for AFI Actress Lily Tomlin (L) and honoree Jane Fonda attend the 2014 AFI Life Achievement Award: A Tribute to Jane Fonda at the Dolby Theatre on June 5, 2014 in Hollywood, California. Tribute show airing Saturday, June 14, 2014 at 9pm ET/PT on TNT. (Photo by Frazer Harrison/Getty Images for AFI) Actress Lily Tomlin (L) and honoree Jane Fonda attend the 2014 AFI Life Achievement Award: A Tribute to Jane Fonda at the Dolby Theatre on June 5, 2014 in Hollywood, California. Tribute show airing Saturday, June 14, 2014 at 9pm ET/PT on TNT. (Photo by Frazer Harrison/Getty Images for AFI) Actress Lily Tomlin (L) and honoree Jane Fonda attend the 2014 AFI...Life Achievement Award: A Tribute to Jane Fonda at the Dolby Theatre...on June 5, 2014 in Hollywood, California. Tribute show airing...Saturday, June 14, 2014 at 9pm ET/PT on TNT. (Photo by Frazer...Harrison/Getty Images for AFI) Image 3 of 18|2014 AFI Life Achievement Award: A Tribute to Jane Fonda Kevin Mazur / WireImage Actors Eva Longoria, Catherine Zeta-Jones and Melanie Griffith attend the 2014 AFI Life Achievement Award: A Tribute to Jane Fonda at the Dolby Theatre on June 5, 2014 in Hollywood, California. Actors Jeff Daniels (L) and Peter Fonda attend the 2014 AFI Life Achievement Award: A Tribute to Jane Fonda After Party at the Dolby Theatre on June 5, 2014 in Hollywood, California. Actors Jeff Daniels (L) and Peter Fonda attend the 2014 AFI Life...Achievement Award: A Tribute to Jane Fonda After Party at the Dolby...Theatre on June 5, 2014 in Hollywood, California. Image 12 of 18|2014 AFI Life Achievement Award: A Tribute to Jane Fonda Frazer Harrison / Getty Images for AFI (L-R) Actresses Wanda Sykes and Diane Lane with Alex Sykes attend the 2014 AFI Life Achievement Award: A Tribute to Jane Fonda After Party at the Dolby Theatre on June 5, 2014 in Hollywood, California. (L-R) Actresses Wanda Sykes and Diane Lane with Alex Sykes attend the 2014 AFI Life Achievement Award: A Tribute to Jane Fonda After Party at the Dolby Theatre on June 5, 2014 in Hollywood, California. (L-R) Actresses Wanda Sykes and Diane Lane with Alex Sykes attend the...2014 AFI Life Achievement Award: A Tribute to Jane Fonda After Party...at the Dolby Theatre on June 5, 2014 in Hollywood, California. Image 13 of 18|2014 AFI Life Achievement Award: A Tribute to Jane Fonda Stefanie Keenan / WireImage (L-R) Writer Eve Ensler, actress Rosario Dawson and honoree Jane Fonda pose for a selfie photo during the 2014 AFI Life Achievement Award: A Tribute to Jane Fonda after party at the Dolby Theatre on June 5, 2014 in Hollywood, California. (L-R) Writer Eve Ensler, actress Rosario Dawson and honoree Jane Fonda pose for a selfie photo during the 2014 AFI Life Achievement Award: A Tribute to Jane Fonda after party at the Dolby Theatre on June 5, 2014 in Hollywood, California. (L-R) Writer Eve Ensler, actress Rosario Dawson and honoree Jane...Fonda pose for a selfie photo during the 2014 AFI Life Achievement...Award: A Tribute to Jane Fonda after party at the Dolby Theatre on...June 5, 2014 in Hollywood, California. Image 14 of 18|2014 AFI Life Achievement Award: A Tribute to Jane Fonda Frazer Harrison / Getty Images for AFI (L-R) Writer Eve Ensler, actors Dylan McDermott and Rosario Dawson attend the 2014 AFI Life Achievement Award: A Tribute to Jane Fonda After Party at the Dolby Theatre on June 5, 2014 in Hollywood, California (L-R) Writer Eve Ensler, actors Dylan McDermott and Rosario Dawson attend the 2014 AFI Life Achievement Award: A Tribute to Jane Fonda After Party at the Dolby Theatre on June 5, 2014 in Hollywood, California (L-R) Writer Eve Ensler, actors Dylan McDermott and Rosario Dawson...attend the 2014 AFI Life Achievement Award: A Tribute to Jane Fonda...After Party at the Dolby Theatre on June 5, 2014 in Hollywood,...California Image 15 of 18|2014 AFI Life Achievement Award: A Tribute to Jane Fonda Frazer Harrison / Getty Images for AFI (L-R) Writer Eve Ensler, actress Rosario Dawson, honoree Jane Fonda, and actress Rosanna Arquette attend the 2014 AFI Life Achievement Award: A Tribute to Jane Fonda After Party at the Dolby Theatre on June 5, 2014 in Hollywood, California. Meryl Streep, Sandra Bullock and Michael Douglas were among the stars who turned out to honor Jane Fonda as she received a special award from the American Film Institute on Thursday night. The veteran actress received the organization’s Life Achievement Award during a glitzy bash at Los Angeles’ Dolby Theatre, and Hollywood royalty turned out to salute her. Streep and Bullock both gave speeches, along with Sally Field and Lily Tomlin, and Douglas, who received the same prize in 2009, was on hand to present Fonda with the trophy. During the presentation, the actor told the audience about his time working with Fonda on the 1979 movie “The China Syndrome,” saying, “I learned that not only is Jane an amazing actress, but she is the world’s greatest multi-tasker. She was simultaneously an actress, she was a mom, she was a fitness expert and a brave, very courageous political activist. So, deep down, who really is Jane Fonda? She is one of a kind… Jane, you are true film royalty, not through birth, but through your talent.” Fonda, who follows in the footsteps of her actor father Henry Fonda in receiving the AFI award, said, “I’m so happy to add another woman’s name to the list (of AFI award winners).” Tributes also came from Fonda’s actor son Troy Garity and her brother Peter Fonda, as well as her “The Newsroom” co-star Jeff Daniels, who performed a song he wrote specially for the occasion. Sally Field brought her close pal and peer Jane Fonda to tears with a passionate speech about her love of acting as she unveiled her star on the Hollywood Walk of Fame. The “Mrs. Doubtfire” actress was honored with the 2,524th star on the iconic walkway, in front of the Hollywood Wax Museum, on Monday. Beau Bridges spoke about working with Field on 1979′s “Norma Rae,” while her lifelong friend Fonda also told the crowd about her relationship with the Oscar winner. The “On Golden Pond” star was overcome with emotion as Field gave an impassioned speech about her determination to become an actor. She said, “Yes, so it’s true – 50 years ago this year, I began this journey. I was 17 years old, didn’t have an agent, wasn’t a member of the Screen Actors’ Guild, and all of a sudden, I was the star of a television series. “To have a long-term career, you have to want what you want, more than you think you’re capable of wanting. You have to constantly step aside of anything having to do with ego, and entitlement, and just head to the work wherever it might be. I’ve ridden the highs, and tried to learn from the lows. … I’ve done a love scene with a pelican, but then I’ve also done a love scene with Paul Newman. … “I’ve been fully clothed, semi clothed and fully naked. I’ve worked my whole life and feel the many miles I have accumulated in this saddle, and I can tell your right here and right now I have never, in this last 50 years, never, not once, considered changing my mind.” Veteran actress Jane Fonda threatened to end her relationship with boyfriend Richard Perry if he didn’t start taking his battle with Parkinson’s disease seriously. The 76-year-old Oscar winner began dating the record producer in 2009 and was made aware of his condition on their first date. Fonda has now opened up about her experience of dating someone with the degenerative illness, and admits she handed Perry an ultimatum to make him prioritize his health. In a candid blog on her official site, Fonda writes, “Richard Perry, the man I live with, has Parkinson’s. He’s had it for over 10 years. He told me about it four and a half years ago on our first date. … Frankly, I didn’t pay it much heed. After all, it was just a date. “But then there comes love and I entered a committed relationship and I said, ‘Richard, if you don’t take your disease seriously and become an expert in it so you know exactly what your options are, I’m not hanging around.’ And he did become an expert. He has a top notch motor-disorder neurologist, he works out every day, does yoga, he takes his meds.” The actress admits she wrote the blog to show her support for other Parkinson’s sufferers, including actor Michael J. Fox, who was diagnosed with the condition in the early 1990s. Fonda adds: “Richard and I are both grateful that more and more people are talking about their Parkinson’s disease, most especially and importantly, Michael J. Fox. So, with this blog, we’re publicly joining the discourse.” Jane Fonda has poked fun at critics of her role as former U.S. First Lady Nancy Reagan in new movie “The Butler” by declaring their opposition and comments merely help to promote the Lee Daniels film. … 85th Annual Academy Awards - Arrivals (Photo by Steve Granitz/WireImage) Jane Fonda has poked fun at critics of her role as former U.S. First Lady Nancy Reagan in new movie “The Butler” by declaring their opposition and comments merely help to promote the Lee Daniels film. The peace-loving movie icon wasn’t a popular choice to play former president Ronald Reagan’s wife in the star-studded film when she was cast last year, but she insists that conservatives who are seeking to discredit and boycott director Daniels’ movie are simply driving more people to the cinema. She says, “It will cause more people to see the movie.” One Facebook page, titled Boycott Hanoi Jane Playing Nancy Reagan, is urging Republicans and fans of the Reagans not to see the film when it is released in October. Targeting Navy veteran Larry Reyes, who launched the site, Fonda says, “Get a life. … I might not have always agreed with Nancy Reagan, but I admire her, and I’d never try to insert my views when playing her. I tried to be who she was: a forceful, loyal, powerful first lady.” The film, about Eugene Allen – the butler to eight U.S. leaders and their families, also features John Cusack as Richard Nixon, Robin Williams as Dwight Eisenhower and Alan Rickman as Reagan. Oprah Winfrey appears as Allen’s wife. Jane Fonda previously “shied away” from talking about her adopted daughter Mary Williams in the media, because she was worried about the public’s reaction to her interracial family. The actress and … 85th Annual Academy Awards - Arrivals Steve Granitz/WireImage Jane Fonda previously “shied away” from talking about her adopted daughter Mary Williams in the media, because she was worried about the public’s reaction to her interracial family. The actress and her second husband Tom Hayden took in Williams when she was 14 after establishing a special connection with the underprivileged girl at her Laurel Springs Children’s Camp in Santa Barbara, Calif. They recently sat down for their very first interview together on “Oprah’s Next Chapter,” which is set to air on Sunday, and during the special Fonda is quizzed about her decision to keep Williams, now 43, out of the public eye. When asked by host Oprah Winfrey if she hid their mother-daughter relationship out of shame, especially around her third husband Ted Turner, the 75 year old says, “Well it’s not that I’ve kept it a secret but… there was a time whenever we would go to a black-tie event I would never want to do the red carpet. I kind of shied away from those moments (when I might be asked about her)… To me, it’s perfectly normal to have a black daughter.” Meanwhile, Williams, who was one of six children born to a single mother in Oakland, Calif., insists she’ll forever be grateful to the Oscar winner for giving her a better life. She says, “It was like… I was in a dark room and the door had cracked open just a little and the light shone in and I just flew. There was no intellectual thought process about it. It was all very instinctual. I didn’t even think about it. And I didn’t really know her. I could have gone into a situation where, you know, she could have been a horrible person when I got there. But that’s how desperate I was. I didn’t care. I wanted – anything had to be better than where I was.” First Look: Meet Jane Fonda’s “Lost” Daughter, Mary Williams At 14, Mary Williams moved from the poverty-stricken streets of East Oakland, California, to Jane Fonda’s hacienda in Santa Monica, California, becoming the adopted daughter many people didn’t know the actress had. Now, Mary is sharing her story in her memoir, The Lost Daughter. Watch as Jane and Mary sit down with Oprah to discuss their relationship. “Barbarella” legend Jane Fonda has never considered herself a sex symbol, insisting she has worked hard to be taken seriously as an actress. Fonda became a global pin-up after landing the role of the … “Barbarella” legend Jane Fonda has never considered herself a sex symbol, insisting she has worked hard to be taken seriously as an actress. Fonda became a global pin-up after landing the role of the futuristic siren in the 1968 cult classic. She went on to win two Academy Awards for her more serious work and the actress admits she has always been baffled and annoyed by her status as a sexy star. She tells Piers Morgan, “I think (‘Barbarella’) it’s a charming, camp movie, not very sexy, but at the time many young boys had their first experiences and I’m glad of that, I think it’s kind of cool that I aroused a lot of young men at that time but it’s pretty tame compared to what you see now… “I’ve never thought of myself as a sex symbol. I don’t really care one way or another, I just like to work and it was fun to do that and I’m glad I went on to make movies like ‘Klute’ and ‘Coming Home’ when I began to produce and ‘On Golden Pond,’ I’m glad I didn’t get stuck on the ‘Barbarella’ mode. “I wasn’t (happy with being a sex symbol) if you really want to know. ‘Barbarella’ did not do well at the box office, it’s become a cult film, but it was not a big deal at the time. After that I came back and did ‘They Shoot Horses, Don’t They?’ so that window of time when one could have slotted me in as a sex symbol didn’t really last, because at heart I’m a serious actress… “I think being stuck with a label like sex symbol can be very limiting. If a man I care about thinks I’m sexy then great, but I don’t want to be labeled anything.” Veteran actress Jane Fonda once bathed in her late dog’s ashes after mistaking them for bath crystals. The “Barbarella” star spotted the urn in her hotel room after a long day at work and presumed the … Jane Fonda Signs Copies Of "Prime Time: Making The Most Of All Of Your Life" Veteran actress Jane Fonda once bathed in her late dog’s ashes after mistaking them for bath crystals. The “Barbarella” star spotted the urn in her hotel room after a long day at work and presumed the contents were bathing products. Fonda proceeded to run a bath and pour in the ashes, but she was left aghast after spotting a bone and realizing she was actually handling the ashes of her dead pooch Roxy. She tells Britain’s Daily Express, “One evening, when I came home from work, I found an urn sitting on my hotel room table with a note, ‘Until We Meet Again’. I thought, ‘What could this be and who’s it from?’ I opened the urn and it appeared to be bath salts. “So I ran a nice hot bath and dumped some of the ‘salts’ into it. But a small fragment of bone fell out as well and I realized, with shock, they were Roxy’s ashes. Jemal Countess/Getty Images Veteran actress Jane Fonda has quashed rumors she’s set to wed for the fourth time, insisting she’ll never walk down the aisle again. The “Barbarella” star, 73, is happily … The “Barbarella” star was “traumatized” after the screen legend made a disparaging remark about her body, and insists the incident contributed to a lifelong obsession with her appearance. She tells Britain’s You magazine, “I was brought up to feel fat, though my father wouldn’t tell me directly – he’d get one of his wives (Fonda married five times) to tell me that I shouldn’t wear a bikini. One day, I overheard him talking about me and I can’t even tell you what he said because it traumatized me and I can’t pretend I’ll ever get over it. “So I was the product of objectifying parents and also a product of the ’50s, when the way a woman looked was so important. It’s why I pay attention to my appearance now. I believed that to be loved you had to be perfect, and even though I’ve got over that now, it took a long time.” Fonda went on to battle bulimia and admits none of her three husbands noticed her eating disorder. She adds, “We develop addictions because we’re missing something and my addiction was food. I moved outside myself, left a big, empty space inside, and tried to fill it with food. I went through phases of binging and purging and it was many years before I could sit at a table without feeling any anxiety. Bulimia is very easy to hide, but you can’t be intimate with people if you’re an addict.” Jane Fonda has shunned airbrushing for her latest magazine photoshoot to show fans she isn’t “perfect.” The veteran actress appears on the cover of the latest issue of Good Housekeeping, and she asked for the pictures not to be digitally enhanced. Fonda, 73, admits she worries younger women are comparing themselves to impossible standards of beauty and hopes she can help in some way. She says, “I feel so sorry for these young actresses coming up. There are always photographers everywhere, if they have a dimple in their buttock, there’s a close-up of it in some gossip magazine. So there’s this cult of perfection. Consequently all the young people who emulate celebrities think they have to look perfect and that’s so destructive.”
Pile-CC
Tag Archives: E-Book A private corn field near Utica Illinois bisected by a country road at sunset A blog and You Tube channel sharing about culture, travel and a simple lifestyle. Traveling through Jamaica we drive fast when the roads cooperate, feeling the wind, and listening to the crickets singing the song of the universe. Ultra smooth and new highway in Ohio early morning. Surreal feeling traveling on it almost like a sled in the sky. Rural Road in Virginia adjacent to a field and wildlife refuge. Many Americans think of yoga as physical exercise, they know much of the practice involves a series of postures or “asanas” and narrowly focus on using yoga to be fit, ignorant of the larger possibilities. The word “yoga” comes from the Sanskrit root “yuj,” which means “to join” or “to yoke.” The term was used to refer to the yoking together of horses and/or oxen but it came to mean the joining together of the body and mind for the purpose of seeking the divine (my personal interpretation and there are many). Yoga involves breathing and meditation techniques as well as the discipline of physical postures and flows. Many schools exist with different orientations aimed at optimizing health and well being as well as guiding the student to consciously progress in the spiritual life. Most of the seekers on the path to enlightenment acknowledge that this life is filled with the illusion of separation from the divine. Many spiritual disciplines aim to pierce the “veil” and bring us back “home” to our creator. We seek the literal “kingdom of heaven on earth” by embracing the great mystery and paradox that we must leave “home” or our own comfort zone to reunite with the essential self and shatter the illusions of the world. They say we forget the reality of our “true” – higher self, that we only remember in glimpses perhaps when we dream. The task of life is to remember, once again our true nature; to “know” it in our day-to-day reality. To “hear” this truth in the silent times that contain the seeds of all wisdom. Travel necessitates leaving “home” and like Odysseus and others who Joseph Campbell said embark on “The Hero’s Journey” we must sometimes leave one world behind to find another. We may seek pleasure, adventure, gain or employment but most must strike out on their own in this life in the process of individuation, survival and/or evolution. My “Hero’s Journey” involves a new career in commercial truck driving. In parallel my heart’s desire and gifts have led me to write an ebook for tourists to Jamaica with my partner, Fureus. Our book, Island Voices, Reggae and New Jamaican Music bridges culture and new music for the contemporary traveller. Either in the air or on the road we who are moving from place to place are warriors and of an independent and odd tribe. I was forced to leave home in search of employment and have become a combination monk and American cowboy as a professional driver/nomad. Seeking to get to Jamaica as often as possible I am facing many challenges and having to live very simply. I experience much austerity and, often the gifts of random kindness while observing a full spectrum of humanity unknown to soccer Moms, cubicle dwellers and suburban commuters. I practice yoga in my day to day life on the truck and maintain simple eating habits. I am grateful for fresh food and water when I get it. I discipline my body and especially my mind to maintain balance or otherwise be thrust into an emotional quicksand of sorts longing as I do for my home and missing the comforts of my lover, friends and animals. Writing this blog and sharing my journey through photos and in the future video on my You Tube channel is one way I make sense of the hardships I encounter daily. My sense of the beautiful has expanded this year and my sensibilities as an artist are changing as I hone into the essential. As Antoine de Saint-Exupéry said in his great book, The Little Prince: “And now here is my secret, a very simple secret: It is only with the heart that one can see rightly; what is essential is invisible to the eye.” It is a mystery and another paradox that we photographers and artists seek always to express what is in our heart through our work. Visit this blog often to share my journey and in doing so the deepest recesses of my heart. Island Voices Reggae & New Jamaican Music -an Ebook/Digital Music Guide for Tourists & Visitors to the Island. The United States is experiencing the dead of winter, snow, ice and below freezing temperatures. For those who can escape, why not go to Jamaica and experience the blue, green island and the beautiful people there. When you go, take our book on your smartphone or digital reading tablet. It links to hundreds of songs, artists and websites that you can explore. Don’t feel like a stranger – feel at home with the people and their culture through a love of the music. Reggae is education through music and each generation evolves the music further. In addition, if you need a guide while you are there, I can hook you up with Fureus, a rap composer, producer and co-author of our book that can show you the secret, best places. Click on the link on the home page of this blog “My Book” to buy the ebook. Call me or Fureus or email us from our book page. Happy Travels! Share this: I moved to California four weeks ago. I travel between here, Jamaica and Florida. I’m lucky to have homes in both Duncans, Jamaica and Hobe Sound, Florida. Here in So Cal, I have an opportunity to spend time with my family and “reinvent myself” while marketing my new e-book/digital music guide, written with Fureus, “Island Voices Reggae and New Jamaican Music.” I’m creating this site and blog to feature my portfolios and enable me to link to Pinterest and other social media in an integrated fashion independent of my consulting and publishing site, Universal Eye Media. I’ll be writing about the adventure of marketing the book and sharing information for authors. As a devotee of digital publishing, I’m building documents for the iPad and tablets that are really individual apps for people – articles or magazines that are personalized and specific. The pundits have talked a long time about “media convergence” but now it is truly happening as we can create apps and documents that combine video, websites, photography and writing into elegant and beautiful documents that are pieces of art. I’ll be helping writers, artists, musicians and business people to forward their individual and personal goals with new media. I’m connecting with lots of eclectic and electric people. Truly, the vibe and geography is different than the east coast. I’m told the energy is conducive to innovation and open communication. So far it feels that way.
Pile-CC
import asyncio import random from typing import Optional, Callable import aiojobs import bili_statistics from user.user import User from tasks.base_class import TaskType, UniqueType, How2Call from printer import info as print class Users: __slots__ = ('_users', '_global_task_control', '_global_task_arrangement', '_dict_bili', '_force_sleep') def __init__(self, global_task_control: dict, global_task_arrangement: dict, dict_bili: dict, force_sleep: Callable): self._users = [] self._global_task_control = global_task_control self._global_task_arrangement = global_task_arrangement self._dict_bili = dict_bili self._force_sleep = force_sleep @property def superuser(self) -> User: return self._users[0] def gets_with_restrict(self, index: int, task): task_name = task.TASK_NAME for user in self.gets(index): if user.is_in_jail and task_name in ( 'recv_heart_gift', 'open_silver_box', 'join_storm_raffle', 'join_guard_raffle', 'join_tv_raffle', 'join_pk_raffle' ): continue if task_name != 'null': # null 就忽略过滤,直接参与 if f'probability_{task_name}' in user.task_arrangement: # 平均概率筛选 if not random.random() < user.task_arrangement[f'probability_{task_name}']: continue if not bili_statistics.add2max_time_task_checkers( # 每日次数筛选 user_id=user.id, task=task, max_time=user.task_arrangement.get(task_name, -1)): continue yield user # async 只是为了 User 里面的 aiohttp 的 session;即使切了也没啥吧,append 的时候不切换协程,对 notifier 运行中不会造成什么影响 async def add_user(self, user_info: dict, custom_task_control: dict, custom_task_arrangement: dict): task_control = {**self._global_task_control, **custom_task_control} task_arrangement = {**self._global_task_arrangement, **custom_task_arrangement} user = User( dict_user=user_info, task_ctrl=task_control, task_arrangement=task_arrangement, dict_bili=self._dict_bili, force_sleep=self._force_sleep) self._users.append(user) def gets(self, index: int): if index == -2: for user in self._users: yield user return user = self._users[index] yield user class Notifier: __slots__ = ('_loop', '_users', '_scheduler',) def __init__(self, loop=None): if loop is None: self._loop = asyncio.get_event_loop() else: self._loop = loop self._users: Optional[Users] = None self._scheduler: Optional[aiojobs.Scheduler] = None def init(self, users: Users): self._users = users async def add_user(self, **kwargs): await self._users.add_user(**kwargs) # pause 和 resume 必须在同一个循环里面用,否则可能发生类似线程不安全的东西 async def resume(self): if self._scheduler is None: self._scheduler = await aiojobs.create_scheduler() async def pause(self): if self._scheduler is not None and not self._scheduler.closed: scheduler = self._scheduler self._scheduler = None await scheduler.close() @staticmethod async def _unique_work(user: User, task, func: Callable, *args, **kwargs): if bili_statistics.start_unique_task(user.id, task): try: result = await func(user, *args, **kwargs) bili_statistics.done_unique_task(user.id, task) return result except asyncio.CancelledError: print(f'CONFIRMED CANCEL {user} {func}') bili_statistics.cancel_unique_task(user.id, task) else: print(f'重复推送{func} {user.id}(此为debug信息忽略即可)') return None @staticmethod async def _multi_work(user: User, _, func: Callable, *args, **kwargs): try: return await func(user, *args, **kwargs) except asyncio.CancelledError: print(f'CONFIRMED CANCEL {user} {func}') return None async def run_sched_func(self, func: Callable, *args, **kwargs): scheduler = self._scheduler if scheduler is not None and not scheduler.closed: await scheduler.spawn(func(*args, **kwargs)) # 这里是为了日常任务的check问题 async def run_sched_func_with_return(self, func: Callable, *args, **kwargs): scheduler = self._scheduler if scheduler is not None and not scheduler.closed: return await func(*args, **kwargs) def run_sched_func_bg(self, *args, **kwargs): self._loop.create_task(self.run_sched_func(*args, **kwargs)) @staticmethod async def run_forced_func(func: Callable, *args, **kwargs): return await func(*args, **kwargs) def run_forced_func_bg(self, *args, **kwargs): self._loop.create_task(self.run_forced_func(*args, **kwargs)) async def _dont_wait(self, task, handle_work: Callable, handle_unique: Callable, func_work: Callable, check_results, _): for user_id, delay_range, *args in check_results: for user in self._users.gets_with_restrict(user_id, task): delay = random.uniform(*delay_range) self._loop.call_later( delay, handle_work, handle_unique, user, task, func_work, *args) async def _wait(self, task, handle_work: Callable, handle_unique: Callable, func_work: Callable, check_results, return_results: bool): if not return_results: for user_id, _, *args in check_results: for user in self._users.gets_with_restrict(user_id, task): await handle_work(handle_unique, user, task, func_work, *args) return None results = [] for user_id, _, *args in check_results: for user in self._users.gets_with_restrict(user_id, task): results.append(await handle_work(handle_unique, user, task, func_work, *args)) return results async def _wait_and_pass(self, task, handle_work: Callable, handle_unique: Callable, func_work: Callable, check_results, return_results: bool): if not return_results: for user_id, _, *args in check_results: result = args for user in self._users.gets_with_restrict(user_id, task): result = await handle_work(handle_unique, user, task, func_work, *result) return None results = [] for user_id, _, *args in check_results: result = args for user in self._users.gets_with_restrict(user_id, task): result = await handle_work(handle_unique, user, task, func_work, *(result[-1])) results.append(result[:-1]) return results ''' 设有 task 参数传入。是传一个类,而不是实例对象! class Task: async def check() async def 工作函数() # work / webconsole_work / cmdconsole_work ''' # handle_check notifier 执行 task.check 函数时的包裹函数 # handle_works notifier 执行 task 的"工作函数"时的包裹函数 # handle_work 执行具体每个 user 的"工作函数"时外层包裹函数,WAIT WAIT_AND_PASS 时无效,一定是forced的 # handle_unique 执行具体每个 user 的"工作函数时"时内层包裹函数 _unique_work / _multi_work # func_work "工作函数" eg: task.work async def exec_task(self, task, *args, **kwargs): handle_check = None handle_works = None handle_work = None func_work = None handle_unique = None need_results = None if task.TASK_TYPE == TaskType.SCHED: handle_check = self.run_sched_func_with_return func_work = task.work need_results = False elif task.TASK_TYPE == TaskType.FORCED: handle_check = self.run_forced_func func_work = task.work need_results = False elif task.TASK_TYPE == TaskType.CONSOLE: handle_check = self.run_forced_func ctrl, *args = args # 此时ctrl隐含在args中 if ctrl == 'web': func_work = task.web_console_work need_results = True elif ctrl == 'cmd': func_work = task.cmd_console_work need_results = False if task.HOW2CALL == How2Call.DONT_WAIT: handle_works = self._dont_wait if task.TASK_TYPE == TaskType.SCHED: handle_work = self.run_sched_func_bg else: handle_work = self.run_forced_func_bg elif task.HOW2CALL == How2Call.WAIT: handle_works = self._wait handle_work = self.run_forced_func elif task.HOW2CALL == How2Call.WAIT_AND_PASS: handle_works = self._wait_and_pass handle_work = self.run_forced_func if task.UNIQUE_TYPE == UniqueType.MULTI: handle_unique = self._multi_work elif task.UNIQUE_TYPE == UniqueType.UNIQUE: handle_unique = self._unique_work check_results = await handle_check(task.check, self._users.superuser, *args, **kwargs) print('check_results:', task, check_results) if check_results is not None: return await handle_works(task, handle_work, handle_unique, func_work, check_results, need_results) async def exec_func(self, func: Callable, *args, **kwargs): return await func(self._users.superuser, *args, **kwargs) def exec_task_no_wait(self, task, *args, **kwargs): self._loop.create_task(self.exec_task(task, *args, **kwargs)) def get_users(self, user_id: int): return self._users.gets(user_id) var_notifier = Notifier() def init(**kwargs): var_notifier.init(**kwargs) async def exec_task(task, *args, **kwargs): return await var_notifier.exec_task(task, *args, **kwargs) def exec_task_no_wait(task, *args, **kwargs): var_notifier.exec_task_no_wait(task, *args, **kwargs) async def exec_func(func: Callable, *args, **kwargs): return await var_notifier.exec_func(func, *args, **kwargs) async def pause(): await var_notifier.pause() async def resume(): await var_notifier.resume() async def add_user(**kwargs): await var_notifier.add_user(**kwargs) def get_users(user_id: int): return var_notifier.get_users(user_id)
Github
Q: How to Post to a Discord Webhook with Discord.js (code 400 Bad Request)? I'm trying to access a discord Webhook using Nodejs for simple messages (for now). I have looked at several attempts here and at other places, but didn't quite understand them or was able to replicate them myself. Reading through the docs and searching online I found node-fetch which in my eyes should work fine in principle, while seemingly simpler. const fetch = require('node-fetch'); var webhook = { "id":"my webhook id", "token":"my webhook token" }; var URL = `https://discordapp.com/api/webhooks/${webhook.id}/${webhook.token}`; fetch(URL, { "method":"POST", "payload": JSON.stringify({ "content":"test" }) }) .then(res=> console.log(res)); The only output I ever get is a Response Object with status code 400. The only time I do get something else is when I remove the method, then I get code 200 which doesn't help much... Is my payload somehow completely wrong or did I make a mistake with the URL or fetch syntax? A: Instead of making your own POST request, you can use the WebhookClient built into Discord.js like so... const id = ''; const token = ''; const webhook = new Discord.WebhookClient(id, token); webhook.send('Hello world.') .catch(console.error);
StackExchange
1. Introduction {#sec1-ijms-19-01027} =============== The mammalian oral mucosal tissue is characterized by permanent morphological and biochemical modification during its lifespan. These changes are substantially regulated by the stage of the keratinization process that involves keratinoblasts. Moreover, the maintenance of the "balance" between keratinoblasts, keratinocytes, and fibroblasts is crucial for the morphological modification of oral mucosa \[[@B1-ijms-19-01027]\]. The basic structure can be modified as the response to changes in environment, saliva contents, as well as drug delivery and administration. The proper morphology of oral mucosa influences the biochemical/metabolic status of the tissue. Therefore, the tissue architecture of oral mucosa and its cellular metabolic status are often recognized as the main factors determining the physiological and/or pathological condition of the oral mucosa \[[@B2-ijms-19-01027]\]. We have recently intensively investigated the structure of oral tissue in pig using fluorescence observation and confocal microscopy. Using the primary cultivation systems we established the co-culture of mucosal keratinocytes and fibroblasts isolated from porcine buccal pouch mucosa. It is also well demonstrated that culture of separated keratinocytes may be achieved only using selective medium with enzymatic separation of tissue \[[@B3-ijms-19-01027]\]. However, the culture system is often composed of both of these cells' populations and therefore only co-culture system of oral mucosa may be successfully implemented in experiments. Our recent studies, using microarray analysis, indicated substantial changes in gene expression during porcine buccal pouch mucosal cells culture \[[@B4-ijms-19-01027]\]. We found that the transcriptomic profile was significantly related to the time period of in vitro culture (IVC). Moreover, using real-time cells proliferation system (RTCA) we found an increased proliferation index of mucosal cells cultured for long-term in vitro. These observation suggested that during long-term buccal pouch mucosal cells cultivation, the cells undergo substantial proliferation and differentiation \[[@B3-ijms-19-01027]\]. The identification of new ontological groups that represent genes significantly up-, and/or down-regulated during cells proliferation in vitro suggested that oral mucosal cells represent tissue form recognized as "metabolic bioreactor". Using microarray technique we analyzed both, known genes that are involved in new metabolic/homeostasis pathways, and new genes that may be markers of well recognized processes. As we know, the cells' morphological composition and metabolic/homeostasis status belong to the main features that describe tissue biology \[[@B5-ijms-19-01027],[@B6-ijms-19-01027],[@B7-ijms-19-01027]\]. Although the morphological architecture of oral mucosa is well recognized using several histological methods, the metabolic versus biochemical status of these cells cultured primary in vitro, is not entirely known. Therefore this study was aimed to investigate the transcriptomic profile of genes involved in the metabolism and homeostasis in porcine buccal pouch mucosal cells during long-term primary in vitro culture. 2. Results {#sec2-ijms-19-01027} ========== Using Affymetrix^®^ Porcine Gene 1.1 ST Array we examined expression of 12,258 porcine transcripts. Genes with fold change higher then abs (2) and wit corrected *p* value lower than 0.05 were considered as differentially expressed. This set of genes consists of 131 different transcripts. The amounts of up and downregulated genes were presented as volcano plots ([Figure 1](#ijms-19-01027-f001){ref-type="fig"}). DAVID (Database for Annotation, Visualization and Integrated Discovery) software was used for extraction of the genes belong to "positive regulation of metabolic process" and "regulation of homeostatic process" gene ontology biological process terms (GO BP). Up and down regulated gene sets were subjected to DAVID searching separately and only gene sets where adjusted *p*-value were lower than 0.05 were selected. Selected sets of genes were subjected to a hierarchical clusterization procedure and presented as heatmaps ([Figure 2](#ijms-19-01027-f002){ref-type="fig"}). Set of the differentially expressed genes belonging to "positive regulation of metabolic process" and "regulation of homeostatic process" GO BP terms category were also presented with symbols, fold changes in expression, Entrez gene IDs and corrected *p* values were presented in [Table 1](#ijms-19-01027-t001){ref-type="table"}. STRING-generated interaction network was created with differentially expressed genes belonging to the "positive regulation of metabolic process" and "regulation of homeostatic process" ontology terms. The results show that there are evidences for *TGFB1* interaction with *REL, CCL2*, and *SPP1* genes. Moreover, evidence show that *REL* can interact with *LYN* and *FCER1G* genes and *SPP1* can interact with *ITGB3*. The results were shown in [Figure 3](#ijms-19-01027-f003){ref-type="fig"}. Furthermore the *CPDB* analysis showed that two pairs of genes: *LYN* and *FCER1G* as well as *ITGB3* and *SPP1* can be found together in complexes categorized in Reactome, PID (Pathway Interaction Database) and BioCarta databases. The results were shown in [Table 2](#ijms-19-01027-t002){ref-type="table"}. In Gene Ontology database genes that formed one particular GO group can also belong to other different GO term categories. By this reason we investigated genes shared between "positive regulation of metabolic process" and "regulation of homeostatic process" GO BP terms. The relations between these genes were showed in [Figure 4](#ijms-19-01027-f004){ref-type="fig"}. RT-qPCR (Real Time- quantitative Polymerase Chain Reaction) analysis was performed, in order to quantitatively validate the microarray analysis. The results were shown as a bar chart ([Figure 5](#ijms-19-01027-f005){ref-type="fig"}). As can be seen in the figure above, while most of the directions of changes in gene expression have been validated, the scale of changes often varies between the methods. This is explainable as the RT-qPCR is a far more quantitative method than Microarrays. These variations are sometimes small (e.g., *SPP1*, *LIF*, *LYN*), while sometimes showing major discrepancies between the two analyses (e.g., *FCER1G*, *ITGB3*, *ETS1*). Nevertheless, in some examples the direction of changes also wasn't validated by RT-qPCR. There were situations, in which only singular samples exhibited this kind of variations (e.g., *REL*, *ETS1*, *CCL2*), while in one example, *TGFB1*, all of the changes have shown different directions. This fact could be explained by difference in precision of those two methods, however it brings major limitation of whole transcriptome screening to light, as it is mainly a qualitative, rather than quantitative study. 3. Discussion {#sec3-ijms-19-01027} ============= The intensity of morphological and biochemical changes of oral mucosa throughout its life is a characteristic feature of the analyzed tissue in mammals. The basic structure, with mutual proportions and interactions between keratinoblasts, keratinocytes, and fibroblasts, may be modified by many external factors, like environment changes, stress, mechanical strain, drug delivery, and administration. Along with the anatomical features, the oral mucosa plays a critical physiological role in distributing masticatory forces, as well as protecting the underlying residual ridge from excessive loading \[[@B8-ijms-19-01027]\]. We can use mucosal biomechanical parameters, as fundamentals to define oral soft tissues behavior, which are closely relevant to clinical applications, including stimuli for tissue remodeling, pressure--pain thresholds, tissue displaceability and residual bone resorption. For example, the oral mucosa was found to be highly deformable and elastic under compression. Additionally, apart from the elastic response, there is a viscous component in this fluid-rich material that increases material viscoelasticity \[[@B9-ijms-19-01027]\]. The processes associated with epithelium regeneration is the base for stem cell research and/or oral cancer investigation. These artificially cultured tissue equivalents are used in transplant surgery for the treatment of a variety of tissue dysfunctions in regions such as the eye, esophagus, or urethra \[[@B3-ijms-19-01027],[@B10-ijms-19-01027]\]. Oral mucosa has been highlighted as a viable alternative source of epidermal cells, due to its easy preparation and suitable features, such as higher cell proliferation rates, lower terminal cell differentiation degrees and an increased biological activity as compared to epidermal keratinocytes. This tissue has another advantage. During harvesting it has been proven to produce less disability, and provides better aesthetic outcome \[[@B11-ijms-19-01027],[@B12-ijms-19-01027]\]. As shown by Guzman-Uribe et al., it is possible to develop dermal-epidermal substitutes from the isolation of cells from oral mucosa for diabetic and healthy subjects using the air-liquid technique \[[@B13-ijms-19-01027]\]. Nevertheless, the dynamic behavior of oral mucosa tissues remain not well understood. Therefore, employing primary cell culture and a microarray approach, we aimed to investigate the transcriptomic profile of buccal pouch mucosal cells during long-term, in vitro culture. Our recent studies are an introduction to issues related to characterization of morphological and biochemical mechanisms of the oral mucosa \[[@B4-ijms-19-01027],[@B14-ijms-19-01027]\]. In the present study, we examined the mRNA expression level changes during IVC of two ontology groups: (1) "Positive regulation of metabolic process" and (2) "Regulation of homeostatic process". This approach will allow us to better understand dynamic behavior of oral mucosa tissues. From all analyzed genes, which showed different expression patterns, a total of 17 genes that belong to both gene ontology biological process terms were studied. In the group of described transcript profiles after microarray assay, we found five genes (*ITGB3*, *TGFB1*, *LYN*, *ETS1,* and *PTGS2*) with similar changes in transcripts expression profile during culture in both GO BP terms. Integrin subunit beta 3 (*ITGB3*) and transforming growth factor beta 1 (*TGFB1*) show increased transcript levels after 7 days of culture. During longer maintenance of the cell culture, after 15 days we observed significant decrease in *ITGB3* and *TGFB1* mRNA levels in both GO BP terms. Interestingly, in the final phase of our culture (after 30 days), heat map clearly shows slightly increased transcript expression. Integrins are heterodimeric cell surface glycoproteins consisting of α and β subunits, that connect the extracellular matrix (ECM) to the cytoskeleton \[[@B15-ijms-19-01027]\]. Mechanical forces on matrix-integrin-cytoskeleton linkages are crucial for cell viability, morphology, and organ function. The production of force depends on the molecular connections from extracellular-matrix-integrin complexes to the cytoskeleton. Therefore, we can conclude that integrins are necessary to perform one of the key functions of the oral mucosa-distributing masticatory forces. Moreover, it is well recognized that integrins play an essential role in creating epithelial cell polarity \[[@B16-ijms-19-01027],[@B17-ijms-19-01027],[@B18-ijms-19-01027]\]. Cell polarity is a fundamental organizing principle in metazoan that is necessary for cell division, differentiation, and morphogenesis. Polarization of epithelia is implicit in the development of lumens, which are essential for glandular tissues to carry out their normal functions, nevertheless loss of cell polarity and subsequent tissue disorganization is a hallmark of diseases such as cancer \[[@B19-ijms-19-01027],[@B20-ijms-19-01027]\]. For example, β1 integrin ablation results in a loss of polarity leading to defective arterial lumen formation and asymmetric cell division in skin epithelia \[[@B21-ijms-19-01027]\]. In other studies, authors using three-dimensional (3D) culture models demonstrated a direct role of β1-integrin in the regulation of epithelial cell polarity. Blocking β1-integrin function in this system caused inversion of apical polarity \[[@B22-ijms-19-01027]\]. Other studies have shown integrins' complex role in epithelial cell differentiation \[[@B23-ijms-19-01027]\]. Some studies indicate pivotal role of integrins in the action of *TGFB1* signaling pathway in epithelial cells \[[@B24-ijms-19-01027],[@B25-ijms-19-01027]\]. The cytokine transforming growth factor beta 1 (*TGFB1*) is a known mediator of fibroblast---myofibroblast differentiation, and it mainly elicits its effects through the SMAD (Mothers against decapentaplegic homolog) signal transduction pathway. It also influences a range of other cellular processes, including migration and proliferation, and its release initiates a sequence of events that are crucial in tissue repair, including chemoattraction of inflammatory cells, induction of angiogenesis, and regulation of inflammatory mediators \[[@B26-ijms-19-01027]\]. The effects of *TGFβ* on transcription can be positive or negative depending on the targeted gene and the cellular context \[[@B27-ijms-19-01027]\]. Cirillo et al. \[[@B28-ijms-19-01027]\] suggested that the TGF-β family of cytokines secreted by cancer-associated fibroblast (CAFs) derived from genetically unstable oral squamous cell carcinomas promote the malignant phenotype by weakening intercellular epithelial adhesion. As shown by authors, members of the TGF-β family of cytokines distinguish CAFs from oral cancer and from normal oral fibroblasts \[[@B28-ijms-19-01027]\]. In other studies, the researchers investigated the role of *TGF-β* in the induction of fibrosis in another oral disorder, namely oral submucous fibrosis (OSF) \[[@B29-ijms-19-01027],[@B30-ijms-19-01027]\]. OSF is a potentially malignant condition of the oral cavity, characterized by a generalized submucosal fibrosis \[[@B31-ijms-19-01027]\]. Fibrosis is caused by abnormal increase in the collagen production, nevertheless the exact mechanism is not known. Isoforms of *TGF-β*, *β1* and *β2* have been defined as a pro-fibrotic growth factors which cause deposition of extracellular matrix (ECM) by increasing the synthesis of matrix protein like collagen and decreasing the degradation by stimulating various inhibitor mechanisms. As detailed by Kamath et al., expression of *TGF-β1* and *TGF-β2* was increased in OSF as compared to normal oral mucosa \[[@B29-ijms-19-01027]\]. Additionally, authors have shown the most prominent role of isoform β1 in the fibrotic pathway. Similar patterns of mRNA expression exhibit also type of cytokine genes: C-C motif chemokine ligand 2 (*CCL2*) and polo like kinase 2 (*PLK2*)---protein kinases that have a role in normal cell division \[[@B32-ijms-19-01027]\]. It should be noted that variable expression of *CCL2* and *PLK2* only concerns "positive regulation of metabolic process" GO term. Proto-oncogenes *LYN* and *ETS1* have also shown similar changes in transcript expression profiles in both GO terms described. Heat maps indicates significant reduction of mRNA expression in day 15 compared with day 7. Subsequently, we demonstrated slightly increased transcript levels in 30 compare with D15, however still significantly lower than in D7 (see [Table 1](#ijms-19-01027-t001){ref-type="table"}). Src-family protein-tyrosine kinases (STKs) belong to a family of nonreceptor-type tyrosine kinases and include at least eight members (including *LYN*) with significant amino acid sequence homology. STKs are known to play crucial roles in the regulation of leukocyte functions, including cell migration, adhesion, phagocytosis, and proliferation \[[@B33-ijms-19-01027]\]. *LYN* is mainly expressed in hematopoietic cells with dual roles both as a positive and a negative signaling molecule in B lymphocytes and myeloid cells \[[@B34-ijms-19-01027]\]. Lim et al. \[[@B35-ijms-19-01027]\] also suggested that this proto-oncogene plays a positive regulatory role in retinoic acid-inducible gene I (*RIG-I*)---mediated interferon expression as a downstream component of IFN-β promoter stimulator-1 (*IPS-1*). As shown by Chen laboratory, *LYN* may be a key candidate gene for the formation of precancerous lesions in oral buccal mucosa \[[@B36-ijms-19-01027]\]. The proto-oncogene *ETS1* is a transcription factor known to regulate the expression of a number of genes involved in extracellular matrix remodeling \[[@B37-ijms-19-01027]\]. Similar to the proto-oncogene *LYN* described above, *ETS1* is a critical B cell transcription factor that prevents plasma cells (PCs) differentiation. Furthermore, as reviewed by Garrett-Sinha, *ETS1* is expressed in T cells, NK cells, and NK T cells and is inducible in other, non-lymphoid cell types in response to certain stimuli \[[@B37-ijms-19-01027]\]. Interactions between *ETS1* and its important regulators *LYN*, which maintains *ETS1* expression to limit the differentiation of autoreactive PCs, were described by a Mayeux et al. \[[@B38-ijms-19-01027]\] study. The researchers observed a significant genetic interaction between *Lyn* and *Ets1* in B cells, resulting in a greater and more rapid production of IgM autoAbs in *Lyn*+/−*Ets1*+/− mice than in *Lyn*+/− or *Ets1*+/− mice. Oikawa and Yamada indicate that generally, expression levels of ETS1 correlate well with the grade of invasiveness and metastasis. Upregulation of this ETS family member expression has been documented in many types of human tumors, including oral cancer \[[@B39-ijms-19-01027]\]. Vairaktaris and coworkers compared the levels of *ETS1* expression in diabetic and normal oral mucosa rat models and subsequently they analyzed expression changes in cancerous stages. The authors have shown elevated expression of this proto-oncogene both in diabetic and normal rats, but in cancerous stages (oral squamous cell carcinoma (OSCC)) expression levels was higher in diabetic than in normal rats indicating that diabetes may contribute to enhanced invasion and metastatic potential by increasing *ETS1* levels \[[@B40-ijms-19-01027]\]. In the hamster model with OSCC, the researchers also observed elevated expression levels of *ETS1* compare with controls \[[@B41-ijms-19-01027]\]. Prostaglandin-endoperoxide synthase 2 (*PTGS2*), also known as cyclooxygenase 2 (*COX2*), is the last example of analyzed genes described in both GO BP terms. PTGS2 is the key, rate-limiting enzyme in prostaglandin biosynthesis from arachidonic acid, and acts both as a dioxygenase and as a peroxidase. Cyclooxygenases exist in at least two isoforms, PTGS1 (*COX1*) and PTGS2 (*COX2*). Unlike *PTGS1*, which is expressed constitutively, *PTGS2* expression is induced by cytokines and growth factors and is upregulated during inflammation \[[@B42-ijms-19-01027]\]. *PTGS2* has been shown to be expressed in most solid tumor types \[[@B43-ijms-19-01027],[@B44-ijms-19-01027]\]. Similar to the previously described genes, few studies analyzed *PTGS2* expression in OSCC. For example, Byatnal and coworkers evaluated *COX2* expression using indirect streptavidin biotin method. The researchers did not describe enzyme in normal oral mucosa. Elevated *COX2* expression was observed in 58 out of 75 specimens of OSCC \[[@B45-ijms-19-01027]\]. Other studies have also shown, employing immune histochemical staining, that upregulated *COX2* expression was found in OSCC and dysplasia compared to normal mucosa subjects \[[@B46-ijms-19-01027]\]. Additionally, Mauro et al. have compared both isoforms, *PTGS1* and *PTGS2*, expression levels by immunohistochemistry and RT-PCR in normal human oral mucosa and three different pathologies (hyperplasia, dysplasia, and carcinoma). As in the previously cited studies, *PTGS2* is not expressed in the normal tissue. Authors demonstrated enzyme expression in hyperplasia, reaches the maximum activation in dysplasia and then starts to be downregulated in carcinoma \[[@B47-ijms-19-01027]\]. *COX1* mRNA and protein have been already detected in normal oral mucosa. In conclusion, our data showed how morphological and biochemical changes of oral mucosal tissue throughout long-term cell culture in vitro are manifested in variable gene expression levels. However, it must be considered that this study is an entry level, in vitro analysis of the tissue of interest. Given the fact, that the cell culture is primarily obtained from the tissue sample, the results need to be accounted for all of the types of cells that are present in the "mix", additionally the microarray approach, used to analyze the full transcriptome of the cells is largely qualitative, which can be seen, as validation of the results with quantitative RT-qPCR, often gives variable results. This might be due to the fact that the microarrays account for multiple available exons forming many variants of the expressed gene, which is not usually the case with RT-qPCR, as it probes for a specific gene sequence. It can also be explained with the mutual interaction between different cDNA species, present in the sample used for microarray analysis, which may lead to highly reproducible, false negative/positive results that impact the probe averages used for calculation of the total gene results. Finally, the analysis is focused only on transcriptome, which does not always reveal the full picture, as processes such as: alternative splicing, translation regulation, and post-translational modification can often change the amount in which the protein product is present, as well as the way in which it acts. Despite that and the fact that the study is in vitro based, which does not always translate into in vivo situation, it gives insight on the basic molecular mechanisms driving oral mucosal cells in vitro behavior, and may serve as reference for the future in vivo and clinical research. We observed differential expression profile of genes involved in two gene ontology groups, namely "positive regulation of metabolic process" (GO: 0009893) and "regulation of homeostatic process" (GO: 0032844). Firstly, we identified new genes, which may be the markers of these processes in oral mucosal cells in pigs. Additionally, differential expression profile of these cells during long-term in vitro culture suggests that the intensity of cellular metabolism and homeostasis is regulated by genes involved in "lifespan regulatory mechanisms". Our recent experiments indicate that formation of proper morphological architecture of oral mucosa belongs to genetically inherited processes. Therefore, we suggested that, at least in vitro, both tissue cellular morphology and metabolic/physiological properties may be dependent on cellular lifespan. However, these results need to be confirmed by further analysis on protein level, possibly focused on particular, isolated cell populations found in the oral mucosal tissue. 4. Materials and Methods {#sec4-ijms-19-01027} ======================== 4.1. Animals {#sec4dot1-ijms-19-01027} ------------ For this study, a total of 35 pubertal crossbred Polish Landrace gilts (young female pigs), bred on commercial local farm were used. They had a mean age of 155 days (range 140--170 days) and the mean weight was 100 kg (95--120 kg). All of the animals were housed under identical conditions and fed the same forage (depending on age and reproductive status). All experiments were approved by Local Ethics Committee of the Poznan University of Life Sciences, Poland (permission no. 32/2012, 30.06.2012). 4.2. Cell Isolation and Culture {#sec4dot2-ijms-19-01027} ------------------------------- After slaughter, samples of buccal pouch mucosa were obtained within 40 min and transported to the laboratory. The excised tissue was washed twice in Dulbecco's phosphate buffered saline (D-PBS) (137 mM NaCl, 27 mM KCl, 10 mM Na~2~HPO~4~, 2 mM KH~2~PO~4~, pH 7.4). The surface of the buccal pouch was surgically removed using sterile surgical blades. The tissue fragments were incubated with 0.05% collagenase I (Sigma Aldrich, Madison, WI, USA) for 40 min at 38 °C in a shaking water bath and then were treated witch 0.5% Trypsin/EDTA (Cascade Biologics, Portland, OR, USA) for 10 min. The cell suspension obtained from this digestion was filtered through mesh to remove non-dissociated tissue fragments. Isolated cells were washed three times by centrifugation (10 min at 200× *g*) with Dulbecco's modified Eagle's medium (DMEM; Sigma Aldrich, Madison, WI, USA) supplemented with gentamicin (20 μg/mL) and 0.1% BSA. The final cell pellet was resuspended in DMEM supplemented with 10% fetal calf serum (FCS; Sigma Aldrich, Madison, WI, USA) and 10 U/mL penicillin G, 10 mg/mL streptomycin, and 25 μg/mL amphotericin B. Cell viability was 90 to 95% as determined by trypan blue staining (Sigma Aldrich, Madison, WI, USA). The cells were cultured at 37 °C in a humidified atmosphere of 5% CO~2~. Once the oral mucosal cell cultures attained 70--80% confluency, they were passaged by washing with PBS, digested with 0.025% Trypsin/EDTA (Cascade Biologics, Portland, OR, USA), neutralized by a 0.0125% trypsin inhibitor (Cascade Biologics, Portland, OR, USA), centrifuged, and resuspended at a seeding density of 2 × 10^4^ cells/cm^2^. The culture medium was changed every three days. Before the collection of cells for the analyzed samples, photos of the culture were taken to monitor the possible changes of morphology ([Figure 6](#ijms-19-01027-f006){ref-type="fig"}). The reference sample photos (24 h) are not shown in the figure, due to the difficulties in obtaining clear photograph of a primary culture in such early stages, due to visual contaminants proprietary to such culture. 4.3. Microarray Expression Analysis and Statistics {#sec4dot3-ijms-19-01027} -------------------------------------------------- Total RNA (100 ng) from each sample was subjected to two rounds of sense cDNA amplification (Ambion^®^ WT Expression Kit). The obtained cDNA was biotin labelled and fragmentated by Affymetrix GeneChip^®^ WT Terminal Labelling and Hybridization (Affymetrix, Santa Clara, CA, USA). Biotin-labelled fragments of cDNA (5.5 μg) were hybridized to the Affymetrix^®^ Porcine Gene 1.1 ST Array Strip (48 °C/20 h). Microarrays were then washed and stained according to the technical protocol using the Affymetrix GeneAtlas Fluidics Station. The array strips were scanned employing Imaging Station of the GeneAtlas System. Preliminary analysis of the scanned chips was performed using Affymetrix GeneAtlasTM Operating Software (Affymetrix, Santa Clara, CA, USA). The quality of gene expression data was confirmed according to the quality control criteria provided by the software. The obtained CEL files were imported into downstream data analysis software. The primary microarray analysis was performed by the means of Bioconductor and R programming languages. The background was normalized by the Robust Multiarray Averaging (RMA) algorithm. Subsequently the microarray data was merged with a description file. To determine the statistical significance of the analyzed genes, moderated *t*-statistics from the empirical Bayes method were performed. The obtained p-value was corrected for multiple comparisons using Benjamini and Hochberg's false discovery rate. The selection of significantly altered genes was based on a *p*-value beneath 0.05 and expression higher than two fold. Differentially expressed genes were subjected to selection by examination of genes involved in cell migration regulation. The differentially expressed gene list (separated for up- and down-regulated genes) was uploaded to DAVID software (Database for Annotation, Visualization and Integrated Discovery) \[[@B48-ijms-19-01027]\]. Among extracted enriched Gene Ontology Biological Process (GO BP) terms, we focused on "positive regulation of metabolic process" (GO: 0009893) and "regulation of homeostatic process" (GO: 0032844). Interactions between differentially expressed genes/proteins belonging to the "positive regulation of metabolic process" and "regulation of homeostatic process" GO terms were investigated by STRING10 software (Search Tool for the Retrieval of Interacting Genes) \[[@B49-ijms-19-01027]\]. The list of gene names was used as a query for an interaction prediction. The search criteria were based on co-occurrences of genes/proteins in scientific texts (text mining), co-expression, and experimentally observed interactions. The results of such analysis generated a gene/protein interaction network where the intensity of the edges reflected the strength of the interaction score. Additionally we have investigated if product (proteins) of selected differentially expressed genes belongs to a known protein complexes. Gene names were subjected to Max Plank Institute for Molecular Genetics Consensus Path Data Base (GCDB). This database integrates interaction networks in Homo sapiens including binary and complex protein-protein, genetic, metabolic, signaling, gene regulatory and drug-target interactions, as well as biochemical pathways from 32 public resources \[[@B50-ijms-19-01027]\]. In order to further investigate the changes in studied GO terms, we have calculated the z-score (the number of up- regulated genes minus the number of down- regulated genes divided by the square root of the count) analysis with GOplot package \[[@B51-ijms-19-01027]\]. The results shows allowed us to investigate the enrichment of those two GO BP terms. 4.4. Real Time q-PCR Analysis {#sec4dot4-ijms-19-01027} ----------------------------- The RT-qPCR method was performed to confirm the results obtained in the analysis of expression microarrays. Based on the results obtained during the analysis of expression microarrays, three genes were selected from each heatmap: the ones showing highest, lowest, and intermediate-level of expression. Changes in the level of expression of those genes were then examined ([Table 1](#ijms-19-01027-t001){ref-type="table"}). Four biological samples of each gene were used for the analysis. Each biological test was performed in 3 replicates. Reverse transcription was based on the protocols and reagents of SABiosciences (RT^2^ First Stand Kit---330401), using a Veritimer 96 well Thermal Cycler. 1 microgram of each gene's RNA transcript was used for reverse transcription. Real-time PCR was performed using the 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA), RT^2^ SYBR^®^ Green ROX^TM^ qPCR Master Mix (Qiagen Sciences, Hilden, Germany) and sequence-specific primers ([Table 3](#ijms-19-01027-t003){ref-type="table"}). Glyceraldehyde-3-phosphate dehydrogenase (*GADPH*), β-actin (*ACTB*), and hypoxanthine-guanine phosphoribosyltransferase *1* (*HRPT1*) were used as reference genes. Gene expressions were analyzed using the relative quantification (RQ) method. The q-PCR starters were designed using Primer3Plus software (<http://primer3plus.com/cgi-bin/dev/primer3plus.cgi>). The sequence of the respective genes was taken from the Ensemble database (<http://www.ensembl.org/index.html>), from which only the sequence of exons was exported, as the target sequence of the designed starter was spread across the border of two adjacent exons. This approach was used as a precaution against the possibility of a non-specific DNA template-based product (DNAse contained in the reverse transcription kit that was used as the other precaution). Agarose gel electrophoresis was applied to confirm the specificity of the amplified products. Marta Dyszkiewicz-Konwińska---experimental design, conducting of the experiments, choice of models, and writing of manuscript parts; Mariusz J. Nawrocki---writing of manuscript parts; Yan Huang-experimental design and editorial assistance; Artur Bryja---conducting of the experiments, data analysis, and figure preparation; Piotr Celichowski---data analysis, figure preparation, and writing of manuscript parts; Maurycy Jankowski---conducting of the experiments, data analysis, and language corrections; Katarzyna Błochowiak---revision of medical methodology; Katarzyna Mehr---revision of medical methodology; Małgorzata Bruska---project supervision; Michał Nowicki---project supervision; Maciej Zabel---revision of methodology and writing assistance; Bartosz Kempisty---project supervision, project design, revision of methodology, editorial supervision, and writing of manuscript parts All authors declare they have no conflicts of interest. ![The Volcano plot representation between differently expressed genes between 7, 15, and 30 days of culture. The gene selection criteria were *p*-value beneath 0.05 and expression higher than two fold.](ijms-19-01027-g001){#ijms-19-01027-f001} ![Heat map representation of differentially expressed genes belonging to the "positive regulation of metabolic process" and "regulation of homeostatic process"---GEOTERM BP database. Arbitrary signal intensity acquired from microarray analysis is represented by colors (green, higher; red, lower expression). Log2 signal intensity values for any single gene were resized to Row Z-Score scale (from −2, the lowest expression, to +2, the highest expression for a single gene). Each analysis was run in two samples coming from different in vitro cultures of oral mucosal cells. Changes in transcript levels were analyzed between three time periods-Day 7(D7), Day 15 (D15) and Day 30 (D30), of primary culture. The fold change was calculated in relation to transcript levels at hour 24 of primary culture.](ijms-19-01027-g002){#ijms-19-01027-f002} ![STRING (Search Tool for the Retrieval of Interacting Genes/Proteins)-generated interaction network among differentially expressed genes belonging to the "positive regulation of metabolic process" and "regulation of homeostatic process" GO BP terms. The intensity of the edges reflects the strength of interaction score.](ijms-19-01027-g003){#ijms-19-01027-f003} ![The representation of the relationship between differently expressed genes that belong to the "positive regulation of metabolic process" and "regulation of homeostatic process" GO terms. The ribbons show, which gene belongs to which categories. The genes were sorted by logFC from most to least changed gene. The gene that was downregulated the most, between day 7 and day 30, is presented on the bottom of the chart, the gene exhibiting the lowest amount of change is presented topmost. The intensity of the color indicates the scale of change in expression.](ijms-19-01027-g004){#ijms-19-01027-f004} ![The results of RT-qPCR (Real Time-quantitative Polymerase Chain Reaction) validation of analyzed genes, presented in the form of bar-graph. All the fold changes were described in relation to the transcript levels in 24 h of primary culture. LogFC was used to present the data, in order to improve the clarity and comparability of up and downregulation results.](ijms-19-01027-g005){#ijms-19-01027-f005} ![Photos of cell cultures prior to the material collection taken under an inverted microscope using relief contrast.](ijms-19-01027-g006){#ijms-19-01027-f006} ijms-19-01027-t001_Table 1 ###### The official gene symbols, fold changes, and adjusted *p*. values of the differently expressed genes that belong to the "positive regulation of metabolic process" and "regulation of homeostatic process". Adjusted *p*-values are presented in brackets next to their respective fold changes. Official Gene Symbol Fold Change D7/D1 Fold Change D15/D1 Fold Change D30/D1 Fold Change D7/D15 Fold Change D7/D30 Fold Change D15/D30 ENTREZ GENE ID ---------------------- ------------------- ---------------------- ---------------------- -------------------- -------------------- --------------------- ---------------- *LMO2* 0.62 (0.004) 0.30 (0.0001) 0.33 (0.0002) 0.48 (0.03) 0.54 (0.03) 1.11 (0.74) 4005 *LIF* 0.37 (0.005) 0.09 (4.45 × 10^−5^) 0.13 (5.79 × 10^−5^) 0.25 (0.01) 0.35 (0.02) 1.40 (0.33) 3976 *REL* 0.91 (0.49) 0.30 (0.0004) 0.46 (0.002) 0.33 (0.02) 0.51 (0.06) 1.53 (0.38) 5966 *ETS1* 0.41 (0.002) 0.16 (0.0001) 0.19 (0.0002) 0.40 (0.03) 0.46 (0.05) 1.17 (0.75) 2113 *LYN* 2.04 (0.005) 0.81 (0.20) 0.83 (0.25) 0.40 (0.03) 0.41 (0.04) 1.03 (0.98) 4067 *RFC4* 1.27 (0.11) 0.57 (0.006) 0.54 (0.004) 0.45 (0.03) 0.43 (0.04) 0.95 (0.94) 5984 *CCL8* 3.04 (0.0005) 0.33 (0.0004) 1.30 (0.0003) 0.11 (0.01) 0.10 (0.01) 0.92 (0.86) 6355 *TGFB1* 0.61 (0.002) 0.27 (8.78 × 10^−5^) 0.50 (0.0005) 0.44 (0.01) 0.81 (0.22) 1.84 (0.07) 7040 *PLK2* 4.25 (0.002) 0.71 (0.20) 2.59 (0.01) 0.17 (0.03) 0.61 (0.31) 3.67 (0.19) 10,769 *ITGB3* 0.82 (0.32) 0.28 (0.001) 0.63 (0.04) 0.34 (0.04) 0.77 (0.42) 2.22 (0.23) 3690 *DUSP5* 0.34 (0.01) 0.06 (0.0004) 0.11 (0.0009) 0.17 (0.04) 0.34 (0.12) 1.97 (0.46) 1847 *PTGS2* 0.66 (0.16) 0.12 (0.0007) 0.22 (0.002) 0.18 (0.03) 0.33 (0.09) 1.86 (0.45) 5743 *SCARB1* 3.01 (0.001) 1.14 (0.40) 1.79 (0.01) 0.38 (0.03) 0.59 (0.13) 1.56 (0.36) 949 *FCER1G* 2.09 (0.001) 0.89 (0.32) 0.87 (0.24) 0.42 (0.03) 0.41 (0.02) 0.98 (0.98) 2207 *SPP1* 4.35 (0.002) 0.40 (0.01) 0.30 (0.005) 0.09 (0.02) 0.07 (0.02) 0.76 (0.77) 6696 *CCL2* 0.92 (0.75) 0.23 (0.002) 0.63 (0.09) 0.25 (0.04) 0.69 (0.40) 2.71 (0.23) 6347 ijms-19-01027-t002_Table 2 ###### The list of proteins complexes from Reactome, PID (Pathway Interaction Database) and BioCarta databases, that included protein products of differently expressed genes that belongs to the "positive regulation of metabolic process" and "regulation of homeostatic process". *p*-Value *q*-Value Complex_Name Source Members_Input_Overlap Members_Input_Overlap_Geneids Size Effective_Size --------------- --------------- ----------------------------------------------------------------- ---------- ----------------------- ------------------------------- ------ ---------------- 5.51 × 10^−6^ 2.94 × 10^−5^ αv/β3 Integrin/Osteopontin PID ITGB3; SPP1 3690; 6696 3 3 1.10 × 10^−5^ 2.94 × 10^−5^ GPVI:FceRI γ:FYN:LYN Reactome FCER1G; LYN 2207; 4067 4 4 1.10 × 10^−5^ 2.94 × 10^−5^ αv/β3 Integrin/Osteopontin/Src PID ITGB3; SPP1 3690; 6696 4 4 1.83 × 10^−5^ 2.94 × 10^−5^ Fc epsilon receptor I/LYN/SYK BioCarta FCER1G; LYN 2207; 4067 5 5 1.83 × 10^−5^ 2.94 × 10^−5^ GPVI:phosphorylated Fc Epsilon R1 γ:FYN:LYN:Collagen type I:SYK Reactome FCER1G; LYN 2207; 4067 5 5 2.75 × 10^−5^ 3.67 × 10^−5^ Antigen/IgE/Fc epsilon R1/LYN/SYK PID FCER1G; LYN 2207; 4067 6 6 3.85 × 10^−5^ 4.40 × 10^−5^ Antigen/IgE/Fc epsilon R1/LYN/SYK/WIP PID FCER1G; LYN 2207; 4067 7 7 ijms-19-01027-t003_Table 3 ###### Primer information and primer sequences used for the RT-qPCR analysis. Gene Number Product Length (bp) 3′-5′ 5′-3′ ---------- ---------------- --------------------- ---------------------- ---------------------- *SCARB1* NM_213967.1 242 ccccatcgtctaccagatcc agtcctgaagaagtggggtg *PTGS2* NM_214321 202 aaaggcctcaatcgaccaga atctgggcgaggcttttcta *DUSP5* XM_003359366 250 tgcacgacccacctacacta gcgagatcacactcctcctc *ITGB3* NM_214002.1 231 ctcatcggccttgctactct agagacacccacaatcctgg *PLK2* XM_003133981 205 agcctgcttccagacaaaaa gaaggaggtagagccgaggt *CCL2* NM_214214.1 112 gaagagtcaccagcagcaag tggcttatggagtcctggac *TGFB1* NM_214015.2 208 accatgccaatttctgcctg gaacgcacgatcatgttgga *CCL8* NM_001164515.1 206 caatggaaagatccccttca ctcgcagtccaggtaggaag *RFC4* XM_013988325 169 atgcatctgatgaacgtgga cgtcttaaagctgcctgagc *LYN* XM_021089363.1 248 agaggccatcaacttcggat tctgcaggtagtcgaaggtg *ETS1* NM_001162886.1 166 atcagctggacaggagatgg gtttacccgccgtcttgtg *REL* XM_005662527.3 238 ccagaaactgtggcaggatt aggctgaggtaccattgtgg *LIF* NM_214402.2 209 gtgccaacgccctctttatt attgaggctcctttggtccc *SPP1* NM_214023 82 agaagttccgcagatccgaa tccgtctcctcactttccac FCR1G NM_001001265.1 111 accctcctctactgtcgact ataagtctcctggttccggg
PubMed Central
/* Firefox Quantum userChrome.css tweaks ************************************************/ /* Github: https://github.com/aris-t2/customcssforfx ************************************/ /****************************************************************************************/ @import "./addonlists_compact.css"; #addons-page .addon{ padding: 0 4px !important; }
Github
On Feb. 11, President Peter Salovey announced that he and the Yale Corporation had voted to change the name of Calhoun College, one of the university’s undergraduate residential colleges, to honor alumna Grace Murray Hopper. Grace Brewster Murray Hopper was a computer pioneer and naval officer. Read the story. Here is a look at Hopper’s life and legacy. Grace Brewster Murray Hopper was a computer pioneer and naval officer. She received a master’s degree (1930) and a Ph.D. (1934) in mathematics from Yale. One of the first three modern “programmers,” Hopper is best known for her trailblazing contributions to the development of computer languages. Known as irreverent, sharp-tongued, and brilliant, she enjoyed long and influential careers in both the U.S. Navy and the private sector. The daughter of Walter Fletcher Murray (Yale B.A. 1894, Phi Beta Kappa) and Mary Campbell Van Horne, Grace Brewster Murray was born in 1906 in New York City. Her father owned an insurance company. She was educated in private schools, and the family summered in Wolfeboro, New Hampshire. In 1928 she graduated Phi Beta Kappa from Vassar College with degrees in mathematics and physics. In 1930 Hopper received her master’s degree in mathematics from Yale. In 1931 she began teaching mathematics at Vassar while pursuing her doctorate at Yale under computer pioneer Howard Engstrom. In 1934 she completed her Ph.D. in mathematics and mathematical physics from Yale. During a one-year sabbatical from Vassar, Hopper studied with the famous mathematician Richard Courant at New York University. Hopper came of age at a time of unusual opportunity for women. A relatively high number of women were receiving doctorates in the 1920s and 1930s — numbers that would not be matched again until the 1980s.1 World War II also created opportunities for women to enter the workforce in greater numbers. Nonetheless, Hopper’s success in a male-dominated field and in male-dominated organizations, including the U.S. Navy, was exceptional. After the bombing of Pearl Harbor and the United States’ entry into World War II, Hopper decided to join the war effort. She was initially rejected because of her age and diminutive size, but she persisted. Taking a leave of absence from Vassar, where she was an associate professor, Hopper joined the U.S. Naval Reserve (Women’s Reserve) in December 1943 and was assigned to the Bureau of Ships Computation Project at Harvard University. There she worked for Howard Aiken, another computer pioneer, who had developed the IBM Automatic Sequence Controlled Calculator, better known as the Mark I, one of the earliest electromechanical computers. One of the first three computer “programmers,” Hopper was responsible for programming the Mark I and punching machine instructions onto tape. She also wrote the 561-page user manual for the Mark I. The close relationship between the American military and the early computer industry, nurtured first by World War II and then the Cold War, shaped Hopper’s career path. Hopper and her fellow officers in the Harvard lab worked on top-secret calculations essential to the war effort — computing rocket trajectories, creating range tables for new anti-aircraft guns, and calibrating minesweepers. In addition to their work for the Navy, Hopper and her colleagues also completed calculations for the army and “ran numbers” used by John von Neumann in developing the plutonium bomb dropped on Nagasaki, Japan. After the war Hopper turned down a full professorship at Vassar in order to remain at Harvard, becoming a research fellow in engineering sciences and applied physics. During this time she helped develop the Mark II and Mark III computers as Harvard continued to receive funding contracts from the Navy. One evening in 1945 while working on the Mark II, Hopper and her colleagues encountered a problem. They took the machine apart and found a large moth. Although the term “bug” had been used by engineers since the 19th century to describe a mechanical malfunction, Hopper was the first to refer to a computer problem as a “bug” and to speak of “debugging” a computer. In 1946 Hopper left active service when the Navy turned down her request for a regular commission because of her age. Shortly thereafter Hopper left Harvard when it became clear she would not be promoted or granted tenure. In 1949 she joined the Eckert-Mauchly Computer Corporation in Philadelphia as senior mathematician. The company, which was soon acquired by Remington Rand, had developed the first electronic computer (the ENIAC) under army contracts. In Philadelphia Hopper undertook some of her most influential work. As head programmer for Remington Rand, she worked on the UNIVAC I (Universal Automatic Computer). In 1952 her programming team developed the first computer language “compiler” called A-0. Compilers translated mathematical code into machine-readable binary code, and they would eventually make it possible to write programs for multiple computers rather than a single machine. Next her team developed Flow-Matic, the first programming language to use English-like commands. Unlike earlier computer languages such as FORTRAN, which used mathematical symbols, Flow-Matic used regular English words. Hopper felt that data processors, who were not typically mathematicians or engineers, would be more comfortable using word-based languages. In a 1980 interview she explained, “What I was after in beginning English language [programming] was to bring another whole group of people able to use the computer easily … I kept calling for more user friendly languages. Most of the stuff we get from academicians, computer science people, is in no way adapted to people.”2 As the number of computer languages proliferated, the need for a standardized language for business purposes grew. In 1959 COBOL (short for “common business-oriented language”) was introduced as the first standardized general business computer language. Although many people contributed to the “invention” of COBOL, Hopper promoted the language and its adoption by both military and private-sector users. Throughout the 1960s she led efforts to develop compilers for COBOL. Her biographer Kurt Beyer calls her “the person most responsible for the success of COBOL during the 1960s.” Her influence was significant; by the 1970s COBOL was the “most extensively used computer language” in the world.3 Throughout her career in the private sector, Hopper had remained a Navy reservist. In 1966 age restrictions forced her to retire from the Navy as a commander. She later called it “the saddest day of my life.”4 Seven months later, however, at the age of 60, she was recalled to active service. Increasing operations in Southeast Asia were taxing the Navy’s capacities, and her help was needed to standardize the Navy’s multiple computer languages. Nicknamed “Amazing Grace” by her subordinates, Hopper remained on active duty for 19 years. She retired from UNIVAC, a division of Sperry Rand, in 1972. Hopper became a well-recognized figure toward the end of her life. She was the recipient of more than 40 honorary degrees, and many scholarships, professorships, awards, and conferences are named in her honor. In 1972 she received Yale’s Wilbur Lucius Cross Medal. In 1991 President George Bush awarded Hopper the National Medal of Technology, the nation’s highest technology award; she was the first woman to be so honored as an individual. In 1996 the Navy commissioned the U.S.S. Hopper, a guided missile destroyer. Kurt Beyer, author of “Grace Hopper and the Invention of the Information Age,” suggests that Hopper achieved so much attention and even “celebrity” late in life because a Republican Congressman from Illinois saw an interview with Hopper on “60 Minutes” in 1983. After seeing the interview he successfully introduced a bill to have Hopper promoted to the rank of commodore. At the age of 79, Hopper retired as a rear admiral. She was the oldest serving officer in the U.S. Armed Forces. That same year she went to work as a senior consultant in public relations at the Digital Equipment Corporation, where she worked up until a year before her death in 1992. Hopper was buried with full military honors in Arlington National Cemetery. In 2016 Hopper posthumously received the Presidential Medal of Freedom, the nation’s highest civilian honor, in recognition of her remarkable contributions to the field of computer science. Visionary communicator and educator Hopper was not only a brilliant mathematician and computer scientist; she was also a gifted teacher and communicator. Although she left the comfort of her faculty position at Vassar to join the Navy, teaching remained part of her life. In 1959 Hopper was a visiting and then adjunct lecturer at the Moore School of Electrical Engineering at the University of Pennsylvania. From 1971 to 1978 she served as a professorial lecturer in management sciences at George Washington University. Outside of academia, she organized myriad workshops and conferences to promote understanding of programming and expand the community of computer programmers. Throughout her time at Eckert-Mauchly and its successor companies she also continued to teach a seminar. In accepting the National Medal of Technology, Hopper said, “If you ask me what accomplishment I’m most proud of, the answer would be all the young people I’ve trained over the years; that’s more important than writing the first compiler.”5 Hopper’s talents as a teacher also helped her communicate with a wide variety of audiences — technical experts and engineers, business leaders and data processors, young people, and the general public. She helped persuade business clients of the value of adopting new technologies, and Beyer describes her as a “spokesperson for the evolving computer industry” in the 1950s.6 Hopper played a similar role for the Navy. From 1977 to 1986 she was “the Navy’s foremost propagandist for its computer program as … [its] representative to learned societies, industry associations, and technical symposia.”7 In the last years of her life she did similar work in public relations for the Digital Equipment Corporation. Hopper was also a clear writer. Under orders from Howard Aiken, she wrote the world’s first computer programming manual. Throughout her career she placed great value on documentation and being able to explain complex situations and problems to different audiences. “I’ve come to feel that there is no use doing anything unless you can communicate,” she said in a 1980 interview.8 During the Cold War, military and business investment in computer technology continued to grow. Nevertheless, many people remained skeptical of what computers could do or how they could transform new areas and applications. Hopper fervently believed that advances in computer science would continue to accelerate; she embraced and looked forward to the future. She often said she wanted to live until January 1, 2000, in order to see the unexpected advances computers had made by then — and laugh at the unbelievers. “I think we consistently continually [sic] underestimate what we can do with computers if we really try,” she said in 1980.9 This confidence that computers would become increasingly ubiquitous was a driving force behind her efforts to make them more user-friendly. Bibliography There are extensive archival collections about Hopper’s life. In addition to the Grace Murray Hopper Collection at the Smithsonian and relevant collections at other universities and research institutes, there are also thousands of pages of oral histories that were collected from Hopper and her colleagues over a 50-year period. Despite these rich sources, there are no comprehensive biographies of Hopper. Kurt W. Beyer, “Grace Hopper and the Invention of the Information Age” (Cambridge: MIT Press, 2009),[i] concentrates on the period from 1945 to 1960, ending his substantive discussion of her life with the creation of COBOL. Another helpful source is Kathleen Williams’ “Improbable Warriors: Mathematicians Grace Hopper and Mina Rees in World War II,” in B. Booss-Bavnbek and J. Høyrup, eds., “Mathematics and War,” 108-125 (Basel: Birkhäuser, 2003). Very little has been written about Hopper’s personal life. Hopper divorced her husband, an English teacher, in 1945. She never remarried or had children. Kurt Beyer discusses her struggles with alcoholism, depression, and suicidal thoughts in the 1940s, but his book does not detail how or if she recovered. 1. “Oral History of Captain Grace Hopper,” interview conducted December 1980 by Angeline Pantages, Naval Data Automation Command, Maryland, Computer History Museum, 1980, 11. Hereafter “Hopper Oral History.” 2. Beyer, “Grace Hopper,” 304, 310. 3. Kathleen Williams, “Improbable Warriors: Mathematicians Grace Hopper and Mina Rees in World War II,” in B. Booss-Bavnbek and J. Høyrup, eds., “Mathematics and War” (Basel: Birkhäuser, 2003), 117. 4. Poor health prevented Hopper from receiving the award in person, but she prepared these remarks, which were delivered on her behalf. See Carmen Lois Mitchell, “The Contribution of Grace Murray Hopper to Computer Science and Computer Education” (Ph.D. diss., University of North Texas, 1994), 77. 5. Beyer, “Grace Hopper,” 11. 6. Williams, “Improbable Warriors,” 118. 7. “Hopper Oral History,” 26. 8. “Hopper Oral History,” 48. 9. For factual errors in Beyer’s book, see Judy Green and Jeanne LaDuke, “To the editor,” Isis 102, no. 1 (March 2011): 136-137. For example, Beyer erroneously states that Hopper was the first woman to receive a Ph.D. in mathematics from Yale. Correction: An earlier version of this story incorrectly stated that Hopper had received a Ph.D. in “mathematics and mathematical physics.” Her doctorate was only in the former.
OpenWebText2
Identification and molecular cloning of Tetrahymena 138-kDa protein, a transcription elongation factor homologue that interacts with microtubules in vitro. Macronucleus of Tetrahymena divides amitotically, although in a microtubule-dependent fashion. Besides the localization study and pharmacological study of macronuclear microtubules, mechanism of the macronuclear division is poorly understood. A biochemical search for microtubule-associated protein was attempted from the isolated macronucleus. Improvement on macronucleus isolation method and microtubule coprecipitation assay led to the cloning of p138, a new homologue of transcription elongation factor FACT (facilitates chromatin transcription) 140kDa subunit. DNase treatment test of macronuclear extract and the sequence of p138 suggested that p138 is associated with chromosome in the macronucleus. The release tests of p138 from microtubules indicated that p138 is released from microtubules in the presence of ATP but not in the presence of AMP-PNP. Together, the results suggest a novel function of FACT homologue, that p138 interacts with both microtubules and chromosome.
PubMed Abstracts
Rangers add Uehara to 'pen for Davis, Hunter TORONTO -- The Rangers' quest for bullpen help has led them to acquire right-handed reliever Koji Uehara from the Orioles for pitcher Tommy Hunter and first baseman Chris Davis. The trade was officially announced Saturday night. "Koji is one of the most effective relievers in the game this year and the past couple of years," Rangers general manager Jon Daniels said. "He's battle-tested, he's done it in the American League East, he's a strike-thrower and he has swing-and-miss stuff. We felt he was the right fit for the club. Our scouts were on him and strongly recommended him." The Rangers had interest in Padres closer Heath Bell, but did not want to give up any of their top prospects from the farm system. The Padres had interest in top pitching prospects Martin Perez, Joe Wieland and Robbie Erlin, but the Rangers were clearly reluctant to go there. Instead the Rangers parted with two players who they had a high regard for in the past, but had slid into less meaningful roles as a middle reliever and backup corner infielder. Bell is also going to be a free agent after this season. Uehara has a vesting option in his contract and needs just 12 more appearances to be signed at $4 million for next season. He can become a free agent after 2012. "The attractive part of this deal is three-fold," Daniels said. "First and foremost, we really like Koji. The second part is he'll probably be back next year. It's nice to have a bullpen piece that we're excited about already in place. Third, we like Tommy and Chris, but for this moment in time, they are not filling critical roles. Those are roles that other guys can fill and this allows us to not trade guys who are a little more high-end pieces." Uehara is expected to join the Rangers on Sunday in Toronto. The Rangers will also activate infielder Andres Blanco off the disabled list to replace Davis on the 25-man roster. "There are two contradicting feelings," Uehara said in Baltimore after learning of the trade. "Part of me says that a contending team wants me, and that's gratifying. At the same time, Baltimore -- I've been there for two years. It's really sad." Daniels said the Rangers are still talking with other teams, and it may be possible they continue to talk with the Padres about Bell. But he said he had nothing going at the moment as of Saturday night. "We're open to that but this takes the edge off it," Daniels said. "We haven't stopped all conversations. If something makes sense, we're open to improving the club. Until four o'clock [Sunday] I wouldn't rule it out." Uehara joins Mark Lowe in giving the Rangers two proven right-handed setup relievers in front of closer Neftali Feliz. Uehara has pitched in 43 games for the Orioles and is 1-1 with a 1.72 ERA while holding opponents to a .152 batting average. Left-handers are hitting .136 off him while right-handers are batting .171. In 47 innings, he has allowed 25 hits and eight walks while striking out 62. He has not allowed a run in 11 innings in July. He is 36 years old and this is his third season in the United States. His two primary pitches are a fastball that averages 88.1 mph and a split-finger fastball. He also has a slider that he uses only occasionally. He ranks fifth in the American League among relievers with 11.87 strikeouts per nine innings. His ratios of 7.75 strikeouts per walks as well as 6.32 baserunners per nine innings are the highest among A.L. relievers. "They have a great lineup and great starting pitching," Uehara said. "They give me a chance to pitch, and I'll do my best." The risk is that he has had injury problems the past two seasons. He has been on the disabled list four times, twice with a strained left hamstring and twice with a strained right elbow. But he has not allowed a run in nine games this season in which he was pitching for the second straight day. He also has to adapt himself to the intense Texas heat. "Maybe that's one big concern that I may have," Uehara said. "I'm not sure, yet, but maybe." He was an outstanding starting pitcher for Japan for the Yomiuri Giants from 1998-2008, going 112-62 with a 3.01 ERA. He was a two-time winner of the Eiji Sawamura Award, which is the Japanese equivalent of the Cy Young Award. He was a member of the Japanese team that won the World Baseball Classic in 2006 and has never lost a game in international competition, including two Olympics. The Orioles originally signed him to a two-year, $10 million contract on Jan. 13, 2009. He signed a one-year, $3 million extension last offseason that calls for a $4 million vesting option for next season if he pitches in 55 games. He is 12 games away from that option being automatically exercised. The Rangers will get $2 million in salary relief for 2012 from the Orioles. Hunter was 1-1 with a 2.93 ERA in eight relief appearances for the Rangers. He was a 13-game winner as a starter for the Rangers last year. He was supposed to be in the Rangers' rotation at the start of the season, but strained his right groin muscle at the end of Spring Training. He missed three months and was never able to regain his spot in the rotation. The Rangers have been using him in middle relief since he came off the disabled list. "Baltimore was interested in acquiring a controllable young starter, and Tommy has shown he can get the job done," Daniels said. "Except for a couple of minor injuries, he has shown he can get the job done. He's durable, he throws strikes and has a good makeup. Fortunately for us, we have a rotation that's performing at a high level 1-5, and we've got Scott Feldman and we have a lot of guys [in the Minors] coming behind them that we really like." Davis was the Rangers' Opening Day first baseman in 2009 after hitting .285 with 17 home runs and 55 RBIs over 80 games in the second half of the 2008 season. But he has not been able to return to that level and has been bouncing back and forth from Triple-A over the past three seasons. At Triple-A, he has a .337 batting average and a .609 slugging percentage over the past four years. In 48 games at Round Rock this season, he was hitting .368 with 24 home runs and 66 RBIs as well as an .824 slugging percentage. The Rangers called him up from Triple-A for a third time on July 23 when Adrian Beltre went on the disabled list, and he is hitting .250 with three home runs and six RBIs in 28 games at the big league level. "Chris is in a good spot," Daniels said. "He understands where we are as a club and our winning expectations. Other guys have come along and claimed spots, and it was unlikely that he will get a regular job here barring injury. Where he is in his career, he has a better chance of performing at a high level somewhere else. Baltimore was looking for a corner bat. I wish him all the luck in the world." Daniels said he understood the possibility that Davis could end up being a "late bloomer" like Nelson Cruz and develop into a high-impact offensive player.
Pile-CC
Q: How to print only the largest file in a directory in Linux? I would like to know how can i sort a directory and print out to the terminal only the largest file in that specific directory? This is my directory: file1 2 file2 3 file3 1 file4 5 file5 2 The wanted result is to print "file4" to the terminal A: For just files in the directory you can use this: ls -Shld * | head -n 1 To include directories you can us du: du -a * | sort -n -r | head -n 1
StackExchange
Date Archives2016 November 28, 2016Comments Off on Climate science – It’s a lot older than you think!Climate Change, Science One of the biggest myths about climate science – a myth that has been deliberately fostered, for decades — is that we just don’t know that much, yet. The field is still in its infancy, people argue, and a lot more is needed before coming to consensus. After all, aren’t scientists always changing their minds?… Read More What’s one of the most important things we can do about climate change? Talk about it. Seventy-two percent of people in the US are cautious, concerned, or alarmed about climate change, according to the Yale Program on Climate Change Communication’s Six Americas survey. Yet so few of us talk to our friends and family about… Read More RACHEL MARTIN, HOST: One thing President-elect Donald Trump has been pretty clear about this campaign season is that he wants to dismantle the Environmental Protection Agency. He called the agency a disgrace and has put a leading climate change skeptic in charge of his EPA transition team. To get some perspective, we called up Katharine Hayhoe. She’s an atmospheric scientist and director of the Climate Science Center at Texas Tech University. She’s also a devout Christian and has spent her life outside of her research convincing fellow conservative Christians that climate change is real. When I asked Katharine Hayhoe how Donald Trump’s presidency would affect climate policy, she said she wasn’t terribly worried because if you look at the headway that’s been made in clean energy solutions, much of it, she says, hasn’t come from federal programs. GSB: As a climate change communicator myself—I give the Climate Reality Project slide shows, basically an updated version of Al Gore’s slide show from “An Inconvenient Truth”—to community groups of all types, this “what to do about it” piece is the hardest, especially with skeptical audiences… So how did you handle it? KH:I found that… Read More Dear President elect, I’m a climate scientist. Thanks to decades and even centuries of careful research, we know climate is changing, we’re responsible, and the impacts are serious. I’ve helped write U.S. national climate assessments that document how climate change is affecting the country’s water, its energy, ecosystems, infrastructure, and even people’s health. This thing… Read More “Speaking of shills, if she teaches in Texas she probably gets grants from the oil industry.” This is one of the more polite social media missiles Katharine Hayhoe has had fired at her this week. But it’s hopelessly misguided. Hayhoe is a climate scientist. And she’s on a mission to persuade skeptics that humans are… Read More about me I write about the things I'm interested in: the fascinating nuances of climate science, why a changing climate matters to real people, how we're going to solve it, and what faith has to do with fixing this global challenge.
Pile-CC
Hello guys ! Here's an illustration of a beach shack 🏝. Do not forget to check out attachments ! We are open for work enquiries. Let's create something awesome together. Want to know what we offer in designing? Contact Us Follow us : Behance | Instagram | Dribbble
OpenWebText2
Congenital ichthyosiform erythroderma: particulate staining pattern of TGK. A case of late onset non-bullous congenital ichthyosiform erythroderma (CIE) was studied. This patient was not born as a collodion baby and did not have skin abnormalities until 9-10 years of age. She gradually developed erythroderma and fine scales, callosities of her feet, and a mild ectropion. Since recent work has revealed that in the majority of CIE patients, transglutaminase (TGK) is distributed in the cytoplasm of granular cells and horny cells (11), TGK was studied in our case. It was found that TGK was distributed along the cell periphery of horny cells and also in the cytoplasm of granular cells. In the control skins, TGK was stained along the cell periphery of horny cells and granular cells. The marginal band formation was normal. Involucrine and loricrin, the building materials of the marginal band whose-cross-linking is mediated by TGK, were normally stained in the upper epidermis. Cytoplasmic TGK of granular cells and normal development of the marginal band may serve as a helpful diagnostic marker of CIE, particularly because the often confusing collodion baby of lamellar ichthyosis may lack TGK staining and the marginal band altogether.
PubMed Abstracts
Synthesis of some phthalazine derivatives chemically related to hydralazine. The potent antihypertensive properties of hydralazine and dihydralazine prompted the synthesis of sixteen new phthalazine derivatives with thiosemicarbazide or beta-propionamide residues to investigate their possible antihypertensive activity.
PubMed Abstracts
A method of this kind has been described. Only the actual tracks are refilled in this known method, whereas the roadway strip lying between two neighbouring tracks is not renewed (German Specification No. is DE-A-25 24 762). The invention also relates to a device for carrying out the method. In this connection an apparatus is known which comprises two stripping-laying apparatus graders which are arranged at a distance from one another laterally of the working direction and serve to fill two adjacent tracks. The strip of roadway lying between the graders is not therefore covered by this apparatus as well, as a result of which this intermediate strip remains at the original, low road level as compared with the inner edges of the asphalt strips filling the tracks. According to this prior art, pools of water, which may give rise to accidents, are often formed between the two inner edges of the track-filling material, laid in strips, as a result of rain or melted snow. Road users are also presented with a disturbing optical effect, caused by the two separate asphalt tracks.
USPTO Backgrounds
Carolyn S. Shoemaker Carolyn Jean Spellmann Shoemaker (born June 24, 1929) is an American astronomer and is a co-discoverer of Comet Shoemaker–Levy 9. She once held the record for most comets discovered by an individual. Although Shoemaker earned degrees in history, political science and English literature, she had almost no interest in science until after she met and married geologist Eugene M. ("Gene") Shoemaker in 1950–51. She said later that his explanations of his work thrilled her. Despite her relative inexperience and her lack of a relevant scientific degree, Caltech had no objection to her joining Gene's team at the California Institute of Technology as a research assistant. Shoemaker had already shown herself to be unusually patient, and she had already demonstrated exceptional stereoscopic vision, both qualities were extremely valuable in a career looking for objects in near-earth space. Early and personal life Carolyn Lash Spellmann was born in Gallup, New Mexico, United States, to Leonard and Hazel Arthur Spellmann. Her family moved to Chico, California, where she and her brother Richard grew up. Spellmann earned bachelor's and master's degrees in history, political science, and English literature from Chico State University. Richard went to the California Institute of Technology (Caltech), where he earned a bachelor's degree in chemical engineering. Richard's roommate at Caltech was a young graduate student named Gene Shoemaker. Carolyn did not meet Gene until the summer of 1950, when she attended her brother's wedding. Gene had moved to New Jersey by 1950, to begin work toward a doctoral degree at Princeton University, but flew back to California to serve as Richard's best man. He then returned to his studies at Princeton. However, Carolyn and Gene maintained a "pen pal" relationship. They followed this with a two-week camping trip on the Tennessee Plateau. On August 18, 1951, Carolyn and Gene married. Gene Shoemaker would go on to become a pioneer in the field of astrogeology. The couple had three children: Christy, Linda, and Patrick (Pat) Shoemaker. The family lived in Grand Junction, Colorado; Menlo Park, California; and Pasadena, California; before finally settling down in Flagstaff, Arizona, where she worked in collaboration with her husband at the Lowell Observatory. Careers The first job Shoemaker held after marrying Gene was teaching the seventh grade. Feeling unsatisfied with the teaching profession, she quit to raise a family. Mary Chapman, author of Shoemaker's biography for the USGS Astrogeology Center, wrote "Carolyn is a warm, caring, and extremely patient woman, but her skills were better suited for a non-teaching environment. At the age of 51, after her children had grown up and moved out, Shoemaker started looking for work that would combat her "empty nest syndrome." In her youth, she had never been interested in scientific topics. She had taken one course in geology, but found it extremely boring. Meeting Gene had changed all that. She reportedly told others that,"listening to Gene explaining geology made what she had thought was a boring subject into an exciting and interesting pursuit of knowledge." A student at Lowell Observatory began teaching her astronomy. Then she began work as a field assistant for her husband, working on his search program mapping and analyzing impact craters. Carolyn Shoemaker started her astronomical career in 1980, at age 51, searching for Earth-crossing asteroids and comets at California Institute of Technology, Pasadena, California, and the Palomar Observatory, San Diego, California. That year, Shoemaker was hired at the United States Geological Survey (USGS) as a visiting scientist in the astronomy branch, and then in 1989 began work as an astronomy research professor at Northern Arizona University. She concentrated her work on searching for comets and planet-crossing asteroids. Teamed with astronomer David H. Levy, the Shoemakers identified Shoemaker-Levy 9, a fragmented comet orbiting the planet Jupiter on March 24, 1993. In the 1980s and 1990s, Shoemaker used film taken at the wide-field telescope at the Palomar Observatory, combined with a stereoscope, to find objects which moved against the background of fixed stars. In 1997, Gene and Carolyn were involved in a car crash in Australia. Gene was killed instantly, while Carolyn sustained severe injuries. Carolyn eventually recovered and continued to work at the Lowell Observatory with Levy. She was actively involved in astronomical observation work till at least 2002. , Shoemaker had been credited with discovering or co-discovering 32 comets and over 800 asteroids. Awards and honors Shoemaker received an honorary doctorate from the Northern Arizona University, Flagstaff, Arizona, and the U.S. National Aeronautics and Space Administration Exceptional Scientific Achievement Medal in 1996. She and her husband were awarded the James Craig Watson Medal by the U.S. National Academy of Sciences in 1998. Shoemaker also received the Rittenhouse Medal of the Rittenhouse Astronomical Society in 1988 and the Scientist of the Year Award in 1995. The Hildian asteroid 4446 Carolyn, discovered by colleague Edward Bowell at Lowell Observatory in 1985, was named in her honor. List of discovered minor planets Shoemaker is credited by the Minor Planet Center with the discovery of 377 numbered minor planets made between 1980 and 1994. References External links Universe Today page about Carolyn Shoemaker Category:American women astronomers Category:Women planetary scientists Category:Discoverers of asteroids Category:Discoverers of comets Category:1929 births Category:Living people Category:People from Gallup, New Mexico Category:California State University, Chico alumni Category:Northern Arizona University faculty Category:Palomar Observatory Category:People from Flagstaff, Arizona Category:20th-century astronomers Category:21st-century astronomers Category:20th-century women Category:21st-century women * Category:20th-century American scientists Category:21st-century American scientists Category:20th-century women scientists Category:21st-century women scientists
Wikipedia (en)
Q: Extending form validation rule in codeigniter I have a form with two fields <input type="text" name="total_plots" value="" placeholder="Enter Total plots" /> <input type="text" name="available_plots" value="" placeholder="Enter Available Plots " /> Available plot "available_plots" field value should be less than total plots "total_plots" field value I don't want to write callbacks. I want to extend the form validation rule. How to ? MY_Form_validation <?php if ( ! defined('BASEPATH')) exit('No direct script access allowed'); class MY_Form_validation extends CI_Form_validation { public function __construct() { parent::__construct(); $this->CI =& get_instance(); } public function check_avail($str) { $this->CI->form_validation->set_message('check_avail', 'Available plot should be less than Total plot.'); $total_plots = $this->CI->input->post('total_plots'); //echo '------'.$total_plots; //echo '------'.$str; if($str > $total_plots){ return false; } } } // class I have written rules in config <?php $config['plot_settings'] = array( array( 'field' => 'total_plots', 'label' => 'Total Plots', 'rules' => 'trim|xss_clean' ), array( 'field' => 'available_plots', 'label' => 'Available Plots', 'rules' => 'trim|xss_clean|check_avail' ) ); ?> Controller <?php defined('BASEPATH') OR exit('No direct script access allowed'); class Plot extends CI_Controller { public function __construct() { parent::__construct(); $this->load->library('Admin_layout'); $this->load->model('admin/plot_model'); $this->config->load('plot_rules'); $this->output->enable_profiler(TRUE); $this->new_name=''; } public function add(){ $this->form_validation->set_rules($this->config->item('plot_settings')); $this->form_validation->set_error_delimiters('<p><b>', '</b></p>'); if ($this->form_validation->run('submit') == FALSE ) { $this->admin_layout->set_title('Post Plot'); $this->admin_layout->view('admin/post_plot'); } }//add } A: I think you can do this without writing a callback or extending the validation rule. CI already provides a validation rule to check for less_than value. $total_plots = $this->input->post('total_plots'); $this->form_validation->set_rules('available_plots', 'Available Plots', "less_than[$total_plots]"); It should work.
StackExchange