Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
referring to fig3 a four - way reversing valve according to the present invention includes a cylindrical valve casing 30 . the valve casing 30 has a supply port p formed at one side of the upper surface thereof , two load ports a and b formed with a slight gap between them and placed at the same height on the outer circumferential surface thereof , and a drain port r formed at the center of the lower surface thereof . coolant connection pipes 31 , 32 , 33 , and 34 , connected to the respective portions of an air conditioning system , for example , the outlet and inlet of the compressor and respective coolant pipes of the heat exchangers , are welded at the respective ports and bent properly . reference numeral 70 denotes a solenoid installed at the upper surface of the valve casing 30 . the solenoid is operated to convert the valve by being excited by an electric signal . the electric signal is applied only when the heating operation of an air conditioning system is selected , but not applied when cooling operation is selected . referring to fig4 the valve casing 30 is formed into a cup shape by processing metal such as brass . a cap 36 having a disc shape is capped on a hooking step 35 formed at the upper portion of the valve casing 30 and the edge of the cap 36 is welded to seal the cap 36 . it is possible to screw together the valve casing 30 and the cap 36 with a separate sealing member so that they can be easily assembled and disassembled . a valve main body 40 fixedly installed in the valve casing 30 is a mold formed by injecting resin , for example . the valve main body 40 includes a cylindrical body portion 41 , a flange portion 42 at the upper portion of the body portion 41 , and a block support portion 43 at the upper portion of the flange portion 42 . the body portion 41 has a diameter slightly less than the inner circumferential surface of the valve casing 30 , so that it can be easily inserted during assembly . the flange portion 42 has such a diameter as to tightly fit to the inner circumferential surface of the valve casing 30 , so that it can be placed on a hooking step 37 formed on the inner circumferential surface of the valve casing 30 and fixed thereon . a cut - away portion 44 is formed at one side of the flange portion 42 and the block support portion 43 and accommodates an end portion 31 a of a coolant connection pipe 31 penetrating the supply port p formed at the cap 36 . the valve main body 40 has a valve chamber 50 a formed in the body portion 41 and a pilot hydraulic chamber 50 b formed by extending the side of the valve chamber 50 a . the valve chamber 50 a is connected to the coolant connection pipe 31 at the support port p through a main port connection hole 51 at the supply &# 39 ; s side penetrating the cut - away portion 44 of the flange portion 42 above the valve chamber 50 a . also , the valve chamber 50 a can be connected to each of the coolant connection pipes 32 and 33 at the side of load ports a and b through main port connection holes 52 and 53 at the load &# 39 ; s side penetrating a wall surface of the body portion 41 . the pilot hydraulic chamber 50 b is formed by cutting the wall surface and bottom surface of the body portion 41 to secure a sufficient space and thus encompassed by the wall surface and bottom surface of the inner circumference of the valve casing 30 exposed thereto and fixed vanes 57 and 58 at both ends of the cut portion . two pilot input ports 54 and 55 respectively formed along the wall surface at the side of the fixed vanes 57 and 58 and above the flange portion 42 penetrate the pilot hydraulic chamber 50 b . a pilot drain port 56 of the pilot hydraulic chamber 50 b penetrates the center of the flange portion 42 to be always connected to a second flow path of the main spool 60 which is described later . the body portion 41 of the valve main body 40 is cut in a diametric direction between the valve chamber 50 a and the pilot hydraulic chamber 50 b and seal blocks 45 and 46 are inserted in the cut portion . the seal blocks 45 and 46 maintain sealing with respect to a boss portion 61 of the main spool 60 which is described later by the inner end portions thereof and the inner circumferential surface of the valve casing 30 by the outer end portions thereof , so that the valve chamber 50 a and the pilot hydraulic chamber 50 b are separated into sealed spaces . seal rings 47 and 48 installed around the main port connection holes 52 and 53 at the load &# 39 ; s side on the outer circumferential surface of the body portion 41 in a half - embedded state closely contact the load ports a and b penetrating the inner circumferential surface of the valve casing 30 to maintain a sealing state . the seal blocks 45 and 46 and the seal rings 47 and 48 are formed of a material exhibiting a high mechanical and sealing feature , for example , teflon based resin . the main spool 60 is formed of a cylindrical boss portion 61 , a spool portion 62 extending from one side of the boss portion 61 and accommodated in the valve chamber 50 a , a vane portion 63 extending from the other side of the boss portion 61 and accommodated in the pilot hydraulic chamber 50 b , and a groove 64 formed from the end of the spool portion 62 to the lower end portion of the boss portion 61 . the groove 64 at the end of the spool portion 62 is connected to the load port a or b through one of the main port connection holes 52 and 53 at the load &# 39 ; s side of the valve main body 40 and always connected to the drain port r of the bottom of the valve casing 30 at the lower end portion of the boss portion 61 , thus forming the second main flow path . also , a drain connection hole 65 for connecting the pilot drain port 56 of the valve main body 40 to the groove 64 is formed by penetrating the upper end portion of the boss portion 61 of the main spool 60 . sealing rings 66 and 67 formed of teflon - based resin are coupled to the upper and lower end portions of the boss portion 61 of the main spool 60 to seal around the drain connection hole 65 penetrating the flange portion 42 of the valve main body 40 and around the drain portion r at the bottom of the valve casing 30 . seal members 68 and 69 formed of teflon - based resin are coupled to the end portion of the spool portion 62 to maintain sealing with the inner circumferential wall surface at the side of the valve chamber 50 a and to the edge of the vane portion 63 to maintain sealing with the ceiling of the pilot hydraulic chamber 50 b and the inner circumferential wall surface and the bottom surface of the valve casing 30 . next , the solenoid 70 , a stem 71 , a plunger 72 , a pilot spool 75 , and a spool seat block 80 are provided as a pilot hydraulic converting means . the solenoid 70 is inserted around the stem 71 and fixed by a screw 77 . an end portion of the stem 71 penetrates the cap 36 so that the stem 71 is fixedly welded on the cap 36 to erect thereon . the plunger 72 is inserted in the stem 71 together with a spring 74 and always protrudes toward a normal position ( refer to fig6 a ) in a spring offset manner . when the solenoid 70 is excited , the plunger 72 is pulled to a converting position ( refer to fig6 b ) by an electrical thrust . the pilot spool 75 has a concave cavity 76 and is inserted into a groove 73 formed in an end portion of the plunger 72 . the pilot spool 75 closely contacts a seat surface 81 of the spool seat block 80 and slides thereon and moves together with the plunger 72 . the spool seat block 80 accommodated on the block support portion 43 of the valve main body 40 is manufactured by processing metal such as brass and has three pilot port connection holes 82 , 83 , and 84 formed in the seat surface 81 which are open with an interval in a vertical direction , that is , in a direction in which the plunger 72 moves . the interval between two neighboring ones of the three pilot port connection holes 82 , 83 , and 84 is less than the diameter of the cavity 76 of the pilot spool 75 and the length between the uppermost pilot port connection hole 82 and the lowermost pilot port connection hole 83 is greater than the diameter of the cavity 76 . that is , when the pilot spool 75 is in a normal position , the lower two neighboring pilot port connection holes 83 and 84 are connected by the cavity 76 of the pilot spool 75 and the uppermost pilot port connection hole 82 is exposed outside the cavity 76 ( referring to fig6 a ). at the converting position , the upper two neighboring pilot port connection holes 82 and 84 are connected by the cavity 77 of the pilot spool 75 and the lowermost pilot port connection hole 83 is exposed . the two uppermost and lowermost pilot port connection holes 82 and 83 of the pilot port connection holes 82 , 83 , and 84 of the spool seat block 80 are connected to the two pilot input ports 54 and 55 formed in the valve main body 40 and the other pilot port connection hole 84 is connected to the pilot drain port 56 . in fig5 reference numerals 38 and 49 denote a concave groove and a protrusion correspondingly formed to guide an assembly position when the valve main body 40 is assembled to the valve casing 30 . in the operation of the four - way reversing valve according to the present invention , referring to fig5 most of fluid ( coolant ) supplied through the coolant connection pipe 31 at the side of supply port p flows into the valve chamber 50 a through the port connection hole 51 at the supply &# 39 ; s side . part of the fluid flows into a space at the upper side of the flange portion 42 of the valve main body 40 along a gap provided at the inner circumferential surface of the valve casing 30 and further enters in the one side of the pilot hydraulic chamber 50 b through one of the two pilot port connection holes 82 and 83 of the spool seat block 80 exposed to the space . when the solenoid 70 is not in an excited state , the plunger 72 protrudes downward by the spring 74 , that is , at the normal position on the seat surface 81 of the spool seat block 80 . when the pilot spool 75 is positioned at the normal position , as shown in fig6 a , the lower two pilot port connection holes 83 and 84 of the three pilot port connection holes 82 , 83 , and 84 formed in the spool seat block 80 are connected by the cavity 76 of the pilot spool 75 and the uppermost pilot port connection hole 82 is exposed . thus , part of the fluid supplied from the supply port p flows in the exposed uppermost pilot port connection hole 82 and moves toward the pilot hydraulic chamber 50 b through the pilot input port 54 at one side connected thereto . the fluid input to the pilot hydraulic chamber 50 b through the pilot input port 54 at one side applies pressure to the vane portion 63 of the main spool 60 from the fixed vane 57 at one side toward the fixed vane 58 at the other side , so that the entire main spool 60 rotates clockwise . when the main spool 60 is rotated clockwise , as shown fig7 a , the load port a at one side of the two load ports a and b is connected to the valve chamber 50 a , forming a first main flow path . also , the load port b at the other side is connected to the drain port r through the groove 64 of the main spool 60 , forming a second main flow path . thus , the air conditioning system is set to perform a cooling operation . in the meantime , during the clockwise rotation of the main spool 60 , the fluid remaining in the clockwise direction of the vane portion 63 in the pilot hydraulic chamber 50 b is exhausted through the pilot input port 55 at the other side formed in the main spool 60 . as shown in fig6 a , the remaining fluid proceeds via the pilot port connection hole 83 connected to the pilot input port 55 , the cavity 76 of the pilot spool 75 , and the pilot port connection hole 84 . then , as shown in fig5 the fluid sequentially passes the pilot drain port 56 of the valve main body 40 and the drain connection hole 65 of the main spool 60 , and is guided toward the groove 64 of the main spool 60 forming the second main flow path . the fluid joins the main stream of the fluid flowing along the second main flow path of the groove 64 and then is drained . next , when the solenoid 70 is excited , the plunger 72 is pulled upward by an electrical thrust according to the excitation of the solenoid 70 . here , as shown in fig6 b , the pilot spool 75 is located at the converting position on the seat surface 81 of the spool seat block 80 . when the pilot spool 75 is positioned at the converting position , the upper two pilot port connection holes 82 and 84 of the three pilot port connection holes 82 , 83 , and 84 formed in the spool seat block 80 are connected by the cavity 76 of the pilot spool 75 and the lowermost pilot port connection hole 83 is exposed . thus , part of the fluid supplied from the supply port p flows in the exposed lowermost pilot port connection hole 83 and moves toward the other side of the pilot hydraulic chamber 50 b through the pilot input port 55 connected thereto . the fluid input to the pilot hydraulic chamber 50 b through the pilot input port 55 at the other side applies pressure to the vane portion 63 of the main spool 60 from the fixed vane 57 at the other side toward the fixed vane 58 at one side , so that the entire main spool 60 rotates counterclockwise . when the main spool 60 is rotated counterclockwise , as shown fig7 b , the load port b at the other side of the two load ports a and b is connected to the valve chamber 50 a , forming a first main flow path . also , the load port a at one side is connected to the drain port r through the groove 64 of the main spool 60 , forming a second main flow path . thus , the air conditioning system is set to perform a heating operation . in the meantime , during the counterclockwise rotation of the main spool 60 , the fluid remaining in the counterclockwise direction of the vane portion 63 in the pilot hydraulic chamber 50 b is exhausted through the pilot input port 54 at one side formed therein . as shown in fig6 a , the remaining fluid proceeds via the pilot port connection hole 82 connected to the pilot input port 54 , the cavity 76 of the pilot spool 75 , and the pilot port connection hole 84 . then , as shown in fig5 the fluid sequentially passes the pilot drain port 56 of the valve main body 40 and the drain connection hole 65 of the main spool 60 , and is guided toward the groove 64 of the main spool 60 forming the second main flow path . the fluid joins the main stream of the fluid flowing along the second main flow path of the groove 64 and then is drained . as described above , the four - way reversing valve according to the present invention includes a vane type main spool as a solenoid - hydraulic - rotation operating type . since a solenoid operated type pilot valve of an inner pilot type to operate the vane type main spool is incorporated into the valve main body in a casing , only the connection pipes corresponding to the main port need to be welded at the valve casing . therefore , the number of welding points can be minimized and manufacturing thereof is made easy . further , during the manufacturing and use thereof , the rate of breakdown due to defective welding can be remarkably reduced . although the present invention is described as being used for a heat pump air conditioning system for a double use of cooling and heating in the above preferred description , it is not limited to the use thereof and the accompanying drawings . that is , the number of ports can be changed according to products to which the present invention is applied . also , the solenoid operated type pilot valve for the operation of the vane type main spool or the structure of the vane can be realized in various ways .	5
referring now to fig1 there is shown a plan view of a thermal ink jet printer 10 . the printer 10 is shown broken away , and in the interior thereof there may be seen a roll or platen 11 for carrying and indexing the print media , which may be paper , overhead transparency film , or the like . a carriage 12 is mounted for movement back and forth adjacent the print zone p of the platen 11 along a guide rail 13 . mounted within the carriage 12 are five disposable print cartrides or pens 14 , 15 , 16 , 17 and 18 . there is no fixed order for the pens 14 - 18 , but for purposes of description , it will be assumed that by way of example , pen 14 prints the color cyan , pen 15 magenta , pen 16 yellow , and pens 17 and 18 print black , although only one black pen 17 may be used , if desired . all five pens 14 - 18 are thermal ink jet pens employing heating of a thin - film resistor to fire a drop of ink . this technology works on the principle of drop on demand . each pen 14 - 18 has a plurality of nozzles 21 ( fig2 ), and each nozzle 21 can supply a drop of ink on demand as the pen carriage 12 scans across the print media carried by the platen 11 . fig2 shows an elevation view of adjacent orifice plates 20 , greatly magnified , which form a part of the pens 14 - 18 . the orifice plates 20 are shown with thirty nozzles 21 for convenience of description , although the actual number of nozzles 21 may be more or less than 30 , if desired . furthermore , the orifice plates 20 may have a different configuration than that shown , for example , long and narrow with the nozzles 21 in two rows instead of three . this multi - pen printer 10 of the present invention has the advantage of providing faster printing speeds and more pages between replacement of disposable print cartrides or pens 14 - 18 . the printer 10 of the present invention which employs a separate pen for each of the primary colors ( pens 14 , 15 , 16 ), plus separate black pens ( pens 17 and 18 ), has a print quality which is equal to or better than prior art printers which provide the three primary colors on a single pen . it has been found that there exists a strong correlation between the alignment of the primary color dots and the quality of the resulting image . in the multi - pen printer of the present invention , the ability to accurately overlay the primary color dots is dependent on manufacturing tolerances in both the pens and the printer . rather than reduce these tolerances by refining the manufacturing processes , the printer of the present invention is provided with the capability to measure tolerance - related dot placement errors . this capability allows application of a correction algorithm to the drop fire timing and image data such that the highest possible quality image is produced . to calibrate the pens 14 - 18 , there is provided a linear encoder 22 , shown in fig3 and 4 . the linear encoder 22 is a high resolution carriage position sensor with quadrature outputs , the resolution being increased by interpolating between quadrature states . the linear encoder 22 is integral to the pen carriage 12 and provides a constant output of position of the carriage 12 as the pens 14 - 18 are scanned back and forth along the guide rail 13 . referring to fig3 the linear encoder 22 which is integral to the carriage 12 employs as a reference a code strip 23 . the code strip 23 is a long strip of dupont brand mylar material , for example , provided with a marking of opaque lines , which may be photographically produced . typically , the code strip 23 may have on the order of 150 lines per inch . the linear encoder 22 may be a linear optical incremental encoder module , such as model heds - 9200 manufactured by the optoelectronics division of hewlett - packard company . a quadrature output of typically 600 to 800 counts per inch is used to operate the motion control system . the reference signal for positioning of ink drops on the print media is generated from a single channel of the encoder 22 . this eliminates any possible problem with phase errors in the encoder 22 . in prior art devices the position of the orifice plate is detected to determine distance between pens in the pen scan direction ( y ). in the present invention the position of a drop of ink in the nominal plane of the print media is detected . in fig4 there is shown a plan view of the arrangement for determining distance between pens in the pen scan direction ( y ). to one side of the print zone ( p ), a drop detector 24 is placed in the nominal plane of the print media . the drop detector 24 comprises a strip of piezoelectric film 25 which is freely suspended or mounted as a diaphragm to the base of the printer 10 . the film 25 is located to be coplanar with the print zone p . the piezoelectric film 25 may be film sold under the trade name kynar , or the like . the piezoelectric film 25 is provided with an opening 26 . behind the opening 26 there is disposed an absorbent ink collector 27 . an electrical connection 28 conducts any electric charge developed by the piezoelectric film 25 to an amplifier and microprocessor electronics ( not shown ). while the carriage 12 is moving at a constant velocity from righ to left , one of the pens 14 - 18 is fired continuously at the rate of 2000 or more drops per second . firing of ink drops begins at a position such that the drops initially pass through the opening 26 and are collected in the absorbent ink collector 27 . when the drop stream hits the edge 30 of the opening 26 , it impacts a portion of the piezoelectric film 25 , causing an electric charge to be developed . at the instant of first drop detect , the encoder 22 integral with the carriage 12 is read . similarly , a reading is obtained for each of the remaining pens 14 - 18 . since the carriage 12 travels at a constant velocity and the pens 14 - 18 are fired , in turn , at a constant frequency , the distance between the pens 14 - 18 in the pen scan direction ( y ) is easily determined . comparison of the carriage positions for all pens 14 - 18 provides the inter - pen spacings . the resolution of the linear encoder 22 is increased by interpolating between pulses . the measurement of the inter - pen distance or spacing ( s ) involves two problems . the carriage 12 is moved at a constant velocity controlled by a servo via the linear encoder 22 and the code strip 23 . the first problem in the measurement of inter - pen spacing ( s ) is that the very slow speed at which the drop detection must be performed ( typically on the order of 0 . 625 to 0 . 833 inches per second ) necessitates a special servo system configuration . the resolution of the linear encoder 22 is such that one encoder count will be traversed in two milliseconds . the high quality velocity feedback needed for stabilizing the servo loop can be obtained despite the quantization of the encoder feedback by timing between encoder counts . the second problem is that the resolution of the measurement that is needed is greater than the 0 . 00125 inch quantization level of the linear encoder 22 . this problem is solved by interpolating between encoder counts by means of time measurements . the time elapsed between encoder counts is available from the timing based servo previously described . an additional timer provides the time elapsed from the last encoder count until drop detection is indicated by the drop detector 24 . the ratio of these times can be used to interpolate the position of the carriage12 at the time of the drop detection . comparison of the positions of the carriage 12 for all pens 14 - 18 provides the inter - pen spacing ( s ). actual test results have shown that position measurements of 0 . 0004 inch or better are obtained . this measurement of the inter - pen spacings s is performed automatically to one side of the print zone p , and the result of the measurement is converted to a correction algorithm to electronically compensate the drop fire timing and image data . this enables the multi - pen thermal ink jet printer 10 of the present invention to accurately overlay the primary color dots , thus resulting in a high quality image being produced . as is well known , the cartridges or pens 14 - 18 are replaceable and are held in place by a latch mechanism and by mechanical registration surfaces . the repeatability of registration of the pens 14 - 18 to the carriage 12 directly affects the print quality . the body of the print cartridges or pens 14 - 18 has some uncertainty in dimension . discrepancies in alignment of the pens 14 - 18 may result in offsets ( o ) or displacements of nozzle arrays relative to each other in the print media index axis ( x ) as shown in fig5 . x - axis measurements are made by successively positioning each one of the pens 14 - 18 adjacent a special pattern 31 of openings provided in the piezoelectric film 25 and firing ink drops through the nozzle array to locate the nozzle pattern . multiple tests per pen may be taken in one carriage pass . this operation is repeated for each of the pens 14 - 18 in the carriage 12 . the special pattern 31 of punched openings is shown in fig6 where it may be seen that the openings are rectangular and of varying lengths and arranged side - by - side in a stair - step pattern . some of the drops impact the piezoelectric film 25 and are detected . others pass through the special pattern 31 of openings and are not detected . this information is mapped into the known position of each nozzle 21 to create a detect / no detect pattern for each of the pens 14 - 18 . the patterns are then compared to determine relative offsets from pen - to - pen . if two of the pens 14 - 18 are determined to be out of alignment by more than one - half a dot row , the image data is shifted up or down in the nozzle arrays to produce the optimum alignment . note that by doing so , nozzles 21 at the ends of the arrays may have to be sacrificed . that is , they will not be usable . the algorithm is a detect / no detect pattern generated from each of the pens 14 - 18 to determine relative pen - to - pen offsets o . this algorithm for the pen alignment in the print media index axis ( x ) is employed as a correction algorithm to electrronically compensate the drop fire timing and image data . this enables the multi - pen thermal ink jet printer 10 of the present invention to accurately overlay the primary color dots , thus resulting in a high quality image being produced . thus , there has been described inter - pen offset determination and compensation in multi - pen thermal ink jet pen printing systems . it will be seen that the printer of the present invention measures drop location data in the nominal plane of the print media rather than at the orifice plate . it will be seen that the printer of the present invention detects drop position both in x and y axes , not in just one axis . also , it will be seen that the printer of the present invention compensates for directionality errors because it measures drop position in the nominal plane of the print media . it is to be understood that the above - described embodiment of the invention is merely illustrative of the many possible specific embodiments which represent applications of the principles of the present invention . numerous and varied other arrangements can be readily devised in accordance with these principles by those skilled in the art without departing from the scope of the invention .	8
in a typical melt - spinning system as depicted in fig1 an extruder 10 extrudes a polymer melt through a spin pack 12 having a plurality of spin pots 14 therein . the spin pots 14 include a plurality of spinneret orifices that , in turn , form a plurality of filament threadlines 16 . it will be understood that , depending on the intended end use , each of the threadlines may include a single filament or may include any number of filaments . preferably , however , each threadline 16 is formed of a plurality of individual filaments . the filament threadlines 16 are cooled in a quench cabinet 18 ( e . g ., by a flow of quench air or other quench fluid ) and are converged at take - up roll 20 to form a yarn . the filaments of the yarn may thereafter be drawn by godet rolls 22 , 24 and taken up by a winder 26 . prior to being taken up by the winder 26 , the filament threadlines may be brought into contact with a finish applicator 28 so that finish oil may be applied thereto . the principal structures employed in an exemplary spin pot 14 according to the present invention is depicted in accompanying fig2 . in this regard , the spin pot 14 includes a generally cylindrical housing 30 which houses an apertured polymer distribution plate 32 , a mott filter unit 34 and a spinneret plate 36 in that order . the housing 30 is sealed at its upper end via an end cap 38 and a membrane gasket 40 interposed between the cap 38 and the distribution plate 32 . at its lower end , the housing 30 is sealed against polymer leakage by a gasket 42 interposed between the spinneret 36 and the housing 30 . important to the present invention , a rigid apertured support plate 50 is provided so as to support a relatively thin , flexible perforated electroformed screen 44 . specifically , the support plate 50 is provided as a mechanical support for the screen 44 and includes a high density of apertures sufficient in size and number so as to maintain the support plate &# 39 ; s rigidity . the screen 44 unitarily includes a peripheral annular nonperforated region 44 - 1 which bounds a central perforated region 44 - 2 . the support plate 50 and screen are sealed between the upstream mott filter unit 34 and the downstream spinneret 36 by means of annular gaskets 46 , 48 , respectively . the perforation pattern of the central region 44 - 2 is shown in a greatly enlarged ( approximately 200x ) manner in accompanying fig3 . as shown therein , the individual perforations 44 - 3 are generally rectangularly shaped and are oriented in a row and column matrix such that perforations 44 - 3 in adjacent rows are offset from one another . the width - wise ( narrower ) dimension of each perforation establishes the smallest nominally sized particle that is prevented from passing therethrough . in this regard , when thermoplastic polymers ( e . g ., nylons such as nylon 6 , nylon 6 , 6 and the like ) are spun , the widthwise dimension of the perforations 44 - 3 should be between about 25μ to about 44μ , and most preferably between about 32μ to about 40μ . particularly favorable results have been obtained when utilized for spinning nylon 6 thermoplastic polymer by perforations 44 - 3 having a widthwise dimension of about 38μ . the lengthwise dimension and the spacings between the perforations 44 - 3 are chosen so as to minimize the pressure drop of the polymer flow through the screen 44 while maintaining its mechanical integrity at the operating pressures involved . thus , as a general rule , the lengthwise dimension of the perforations 44 - 3 should be as long as possible , and the spacing between adjacent perforations should be as small as possible within the design considerations noted previously . again , using nylon 6 polymer as an example , the lengthwise dimension of the perforations can be up to between about 150 to about 155μ or less with the spacings between the perforations ( both end - to - end and laterally ) being within the range of about 110μ to about 150μ , and more typically between about 120μ and about 135μ . the thickness of the screen 44 may range from between about 0 . 001 inch to about 0 . 005 inch . the perforated screen 44 is most preferably formed of an electroformed metal such as nickel , copper , silver or gold . most preferably , however , the screen 44 is formed of electroformed nickel . as shown in fig4 the electroforming process creates a gently sloped shoulder region 44 - 4 which terminates in the well defined rectangular shape of the perforation 44 - 3 . the shoulder region 44 - 4 is thus most preferably positioned in an downstream direction -- i . e ., adjacent the apertured support plate 50 -- with the well defined rectangularly shaped perforation 44 - 3 being positioned in an upstream direction -- i . e ., adjacent the mott filter unit 34 . the electroplated perforated screen may be obtained commercially , for example , from stork veco international of bedford , mass . in this regard , in the electroforming process , a photographic film is used to produce the precise perforation pattern on a metal matrix . the matrix , which is used as the cathode , is submerged in an electroplating bath . with the application of an electrical current , the metal in the electroplating solution ( e . g ., nickel ) is attracted to the pattern on the matrix , for the part . while the invention has been described in connection with what is presently considered to be the most practical and preferred embodiment , it is to be understood that the invention is not to be limited to the disclosed embodiment , but on the contrary , is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims .	3
reference will now be made in detail to the preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings . fig5 is the control sequence of defect area management for an optical disc in accordance with the present invention , and shows the operation of an optical disc r / p device with a host . to improve real time processing of data , maintaining compatibility with the conventional command system would be preferable . accordingly , the present invention further adds a data flag for real - time processing to the conventional command system . as a result , if a defective block is found during a write command for real - time processing , the defective block is skipped rather than replaced . fig6 shows a preferred embodiment of the present invention . generally a conventional write command of 12 bytes for writing data into an optical disc by skipping defective blocks during writing or playback is altered in the present invention . more specifically , a reserved area of the write command ( the 10th byte ) includes a flag indicating the type of data to be written ( wtype ). the reserved area may also include information indicating the speed of the data to be written ( wspeed ). such information would be used by discs which have capability to support the flags . for example , when normal data which does not need real - time writing is input , wtype flag is set to 0 . however , when data requiring real - time processing is input , wtype flag is set to 1 , thereby informing the optical disc r / p device that the data requires real - time processing . accordingly , if the wtype flag within the transferred write command is set to 1 , the optical disc r / p device skips a defective block during writing or playback rather than replacing the defective block . thus , the input data is written into a normal block following the defective block . when the input data does not require real - time processing , the wtype flag is reset to 0 and the optical disc r / p device allows linear replacement whereby data is written into the spare area . also , the wspeed flag may be set according to the required write speed of the input data and transferred within the write command . the optical disc r / p device determines whether to execute linear replacement by utilizing the wspeed . particularly , the speed of data transferred from the host to the optical disc r / p device is recorded into the wspeed area . the optical disc r / p device then compares the recorded speed of the data transfer with the speed by which the data is being written into the optical disc to determine whether to allow linear replalcement . if the transfer speed of data from the host is close to the writing speed of the data into the optical disc , execution of linear replacement slows down the writing of data , thereby reducing the speed of data transfer and increasing the data transfer time . on the other hand , if the transfer speed is significantly slower than the writing speed , slowing down the writing of data would not affect the data transfer time . accordingly , when the transfer speed is lower than the writing speed by a predetermined amount , linear replacement is executed , except when real - time processing is required . the host may determine and control whether to execute linear replacement utilizing the wtype flag , and / or the optical disc r / p device may determine whether to execute linear replacement utilizing both the wtype flag and wspeed . referring to fig5 , if data to be written in real time , such as digital tv stream data or camcorder data , is input ( step 501 ), the host generates a real - time write command and sets the wtype flag to 1 . the host then transfers both the data to be written and the write command to the optical disc r / p device ( step 502 ) through the interface . upon receiving the real - time write command , the optical disc r / p device processes the transferred data together with the write command , and writes the data into a designated position ( step 503 ). the position of the optical disc into which the data is written may be designated using the lba or may be specified in advance using another command . the optical disc r / p device determines whether defective areas exist utilizing the pdl and sdl which indicate the defective areas in the optical disc . if a defective block recorded in the sdl is found during the writing of data ( step 504 ), the optical disc r / p device checks the wtype flag within the write command . since the write command is for real - time processing , the wtype flag would be set to 1 . when the wtype flag is set to 1 , the optical disc r / p device skips the defective block and writes the data into a normal block following the defective block ( step 505 ). upon completion of writing the data ( step 506 ), the optical disc r / p device sends a report back to the host . in the preferred embodiment , if the host requires a current progress during the writing of data , the optical disc r / p device transfers the required information to the host . if there is no request from the host during writing of data , the optical disc r / p device sends a report to the host after data writing is completed . accordingly , if the optical disc r / p device determines that the writing of data is completed , it monitors whether there are any r / p defective blocks . a difference exists between the transfer length used by the host to write the real - time data and the actual size of data to be written due to the number of sdl entries skipped during the writing of the data . thus , if there is at least one skipped defective block , the optical disc r / p device indicates an error and transfers the information of skipped defective blocks to the host ( step 507 ). the host monitors whether the optical disc r / p device has appropriately executed the write command and detects the volume of data which had not been written by the real - time write command of step 502 , based upon the received report . namely , the report includes information such as the number of defective blocks , i . e . the number of sdl entries , skipped during the writing . the host takes into consideration the number of sdl entries in the next write command . particularly , the host varies the volume of data to be written in the next write command , in response to the number of sdl entries skipped during the writing . because the skipped defective blocks cannot be used , the effective size of the disc must be rearranged based upon the skipped defective blocks ( step 508 ). if there is either data which could not be written into the designated position of the optical disc due to the skipped defective blocks ( step 509 ) or continuing data successively connected by the real - time write command ( step 510 ), the host returns to step 502 and repeats transferring the real - time write command . if there is no further data to be written or continuing data in steps 509 and 510 , the writing process ends . however , in the preferred embodiment , if there is no further data to be written or continuing data , the optical disc r / p device moves to the dma area and indicates in the sdl entries where the skipped defective blocks were registered during the recording , that the data corresponding to the defective blocks has been recorded by skipping the defective blocks . thus , during playback of the data , the optical pickup need not move to the spare area , but to the normal block following a defective block when a defective block is found through the sdl . furthermore , if wspeed has been set in the write command when a defective block is found in step 504 , a determination whether to allow and execute a linear replacement for data can be made utilizing wspeed . particularly , the optical disc r / p device compares the speed of wspeed to the actual speed at which the data is being written into the optical disc . if a linear replacement would not affect the writing of data , i . e . writing speed faster than the transfer speed , the linear replacement is executed and data corresponding to defective blocks are written into a replacement block in the spare area . if a linear replacement would detrimentally slow down the real - time writing , i . e . writing speed is slightly higher than the transfer speed , a skip defective area technique is executed and data corresponding to defective blocks are written into normal blocks following the defective blocks . as described above , in the present invention , when data requiring a real - time processing is generated , a real - time write command is sent by which a defective block is skipped and the data corresponding to the defective block is written in a normal block following the defective block . as a result , the optical pickup does not need to move to the spare area whenever a defective block is found , thereby reducing the time it takes the optical pickup to move to and from the spare area . thus , the present invention improves a real - time processing of data in the optical disc r / p device . the foregoing embodiments are merely exemplary and are not to be construed as limiting the present invention . the present teachings can be readily applied to other types of apparatuses . the description of the present invention is intended to be illustrative , and not to limit the scope of the claims . many alternatives , modifications , and variations will be apparent to those skilled in the art .	6
throughout this document , all temperatures are given in degrees celsius and all percentages are weight percentages , unless otherwise stated . the term “ halogen ” or “ halo ” refers to f , cl , i , or br . the term “ alkyl ”, “ alkenyl ”, or “ alkynyl ” refers to a straight chain or branched chain carbon radical containing the designated number of carbon atoms . the term “ alkoxy ” refers to a straight or branched chain alkoxy group . the term “ halo alkyl ” refers to a straight or branched alkyl group substituted with one or more halo atoms . the term “ halo alkoxy ” refers to an alkoxy group substituted with one or more halo atoms . the term “ aryl ” or “ ph ” refers to a phenyl group . the term “ substituted aryl ” refers to a phenyl group substituted with c 12 - c 6 alkyl , c 1 - c 6 alkoxy , halo - c 1 - c 6 alkyl , halo - c 1 - c 6 alkoxy , halo , nitro , carbo - c 1 - c 6 alkoxy , or cyano . the term “ heteroaryl ” refers to pyridyl , pyridinyl , pyrazinyl or pyridazinyl . the term “ me ” refers to a methyl group . the term “ et ” refers to an ethyl group . the term “ pr ” refers to a propyl group . the term “ bu ” refers to a butyl group . the term “ ppm ” refers to parts per million . the term , “ psi ” refers to pounds per square inch . while all the compounds of this invention have fungicidal activity , certain classes of compounds may be preferred for reasons such as , for example , greater efficacy or ease of synthesis . a more preferred class includes those compounds of formula ( 3 ), below a next more preferred class includes those compounds of formula ( 4 ), below a next more preferred class includes those compounds of formula ( 5 ), below a next more preferred class includes those compounds of formula ( 6 ), below wherein x is methyl , halo , or haloalkyl and the additional substituents are as defined in formula ( 1 ), above . currently , it is sometimes preferred when r 1 is hydrogen , c 1 - 4 alkyl , formyl , alkanoyl , alkoxycarbonyl , dialkylaminocarbonyl , or dialkylphosphonyl and r 5 is h , c 1 - 4 alkyl . compounds of the present invention may be prepared by routes commonly known in the art using commercially available or readily synthesized starting materials . such general procedures are described in scheme 1 and scheme 2 , below , wherein the substituents are as described in formula ( 1 ), above , and v is a leaving group , such as , for example , f , cl , or so 2 ch 3 . an compound of formula ( 8 ) is reacted with an appropriately substituted pyridine derivative of formula ( 7 ) in the presence of a base in an aprotic solvent . examples of an appropriate solvent for this reaction would include , but are not restricted to , tetrahydrofuran , dimethyl sulphoxide , acetone , acetonitrile , dimethyl formamide , or n - methylpyrrolidinone . examples of an appropriate base for this reaction would include , but are not restricted to , sodium hydride , potassium hydride , potassium carbonate , potassium t - butoxide , or a tertiary amine derivative such as triethylamine . a ketone derivative of formula ( 9 ) is reacted with an organometallic reagent of the form r 3 — m in a compatible solvent to give an alcohol of the formula ( 10 ). examples of a group r 3 — m would include , but are not restricted to a grignard reagent such as methyl magnesium bromide , an organolithium reagent such as phenyl lithium or a hydride transfer reagent such as sodium borohydride . examples of a suitable solvent would be tetrahydrofuran , diethyl ether , or an appropriate alcohol , selected by compatibility with the reagent and the transformation being carried out . the compound of formula ( 10 ) may be further derivatised by reaction with an appropriate alkylating or acylating reagent r 1 — q , optionally in the presence of an appropriate base . compounds of the formula r 1 — q would include , but are not restricted to acetic anhydride , benzyl bromide , dimethyl carbamoyl chloride , ethyl chloroformate , diethyl phosphoryl chloride , 5 - chloro - 3 - methyl - 2 - methylsulphonylpyridine . examples of a suitable base would include , but are not restricted to a tertiary amine such as triethylamine or pyridine , sodium carbonate , sodium hydride , potassium hydride , or potassium t - butoxide . a compound of formula ( 10 ) may also be reacted with a sulphonyl chloride of the formula rso 2 cl ) in the presence of a suitable base in a compatible solvent to give the corresponding chloride of formula ( 11 ). examples of a suitable sulphonyl chloride would be methanesulphonyl chloride , p - toluenesulphonyl chloride , and examples of a suitable base would be pyridine , triethylamine , or hünig &# 39 ; s base . the compound of formula ( 11 ) may be reacted further with a metal alkoxide salt in a compatible solvent to give a compound of formula ( 1 ). examples of a suitable metal alkoxide would include sodium methoxide , potassium ethoxide , or magnesium methoxide produced in situ by the addition of magnesium metal to methanol . the following examples further illustrate this invention . the examples should not be construed as limiting the invention in any manner . 5 - acetyl - 2 , 3 - dichloropyridine ( 24 . 5 g , 0 . 129 mol ) was slurried in t - butanol ( 200 ml ) and sodium methanethiolate ( 10 g , 0 . 143 mol ) was added . the mixture was heated under reflux conditions for two hours , cooled to room temperature , and diluted with water ( 200 ml ) and ether ( 150 ml ). this was separated and the aqueous phase extracted with ether ( 50 ml ). the combined organic extracts were washed with water ( 100 ml ) and saturated sodium chloride solution ( 100 ml ), dried over anhydrous sodium sulphate , and evaporated to dryness to give the desired product ( 24 . 1 g , 94 %) as a pale , low melting solid . 5 - acetyl - 3 - chloro - 2 - methylthiopyridine ( 24 . 1 g , 0 . 12 mol ) was slurried in absolute ethanol ( 200 ml ) and sodium borohydride ( 4 . 5 g , 0 . 118 mol ) added in portions . the reaction mixture was stirred at room temperature for 48 hours and acidified to ph 2 with 2n hydrochloric acid . this was then diluted with water ( 200 ml ) and the bulk of the ethanol evaporated under reduced pressure , the temperature of the mixture being maintained below 50 ° c . the reaction mixture was diluted with water ( 200 ml ) and extracted twice with dichloromethane ( 15 ml ). the combined organic extracts were washed with water ( 200 ml ) and saturated sodium chloride solution ( 100 ml ), dried over anhydrous sodium sulphate , and evaporated to dryness to give the desired product ( 21 . 9 g , 90 %) as an orange oil . 3 - chloro - 5 -( 1 - hydroxyethyl )- 2 - methylthiopyridine ( 21 . 9 g , 0 . 108 mol ) was dissolved with stirring in anhydrous dmf ( 250 ml ) and 60 % sodium hydride ( 5 g , 0 . 125 mol ) added in portions . the mixture was stirred at room temperature for 30 minutes and benzyl bromide ( 17 . 6 g , 0 . 103 mol ) added dropwise . the mixture was then stirred at room temperature for four hours , diluted with water ( 400 ml ) and extracted three times with ethyl acetate ( 100 ml ). the combined organic extracts were washed twice with water ( 200 ml ) and saturated sodium chloride solution ( 100 ml ), dried over anhydrous sodium sulphate , and evaporated to dryness . purification of the residue by chromatography over silica ( 0 - 5 % ethyl acetate : hexane ) gave the desired product ( 25 . 0 g , 79 %) as a pale yellow oil . 5 -( 1 - benzyloxyethyl )- 3 - chloro - 2 - methylthiopyridine ( 25 g , 0 . 085 mol ) was dissolved with stirring in dichloromethane ( 600 ml ) and 60 % m - chloroperoxybenzoic acid ( 53 . 8 g , 0 . 19 mol ) added in portions . the reaction mixture was stirred at room temperature overnight and 10 % sodium carbonate solution ( 300 ml ) added . the reaction mixture was stirred at room temperature for one hour , separated , and the organic phase washed four times with 2n sodium hydroxide solution ( 150 ml ). it was then washed with saturated sodium chloride solution ( 150 ml ), dried over anhydrous sodium sulphate , and evaporated under reduced pressure to give the product ( 26 . 5 g , 96 %) as a clear viscous oil . 60 % sodium hydride ( 0 . 8 g , 0 . 2 mol ) was washed twice with 50 ml portions of hexane and slurried in anhydrous thf ( 40 ml ). 2 -( hydroxymethyl )- α -( methoxyimino )- n - methyl - benzeneacetamide ( 2 . 0 g , 0 . 009 mol ) was then added in one portion and the mixture stirred at room temperature for 30 minutes . a solution of 5 -( 1 - benzyloxyethyl )- 3 - chloro - 2 - methylsulphonylpyridine ( 3 . 0 g , 0 . 009 mol ) in anhydrous thf ( 5 ml ) was added and the mixture stirred at room temperature overnight . water ( 100 ml ) was added and the mixture extracted three times with ethyl acetate ( 50 ml ). the combined organic extracts were washed twice with water ( 100 ml ) and then with saturated sodium chloride solution ( 50 ml ). the solvent was evaporated under reduced pressure and the residue purified by chromatography over silica ( 30 % ethyl acetate : hexane ) to give the desired product ( 2 . 8 g , 66 %) as a clear viscous gum . sodium borohydride ( 129 mg ; 3 . 4 mmol ) was added in one portion to a solution of 2 -[[[ 5 - benzoyl - 3 - chloro - 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 1 . 0 g ; 2 . 3 mmol ) in ethanol ( 23 ml ) and dichloromethane ( 3 ml ). the reaction was stirred for 10 minutes and quenched with 1n hydrochloric acid ( 2 ml ). the reaction mixture was extracted twice with dichloromethane ( 20 ml ), and the combined organic layers were washed with saturated sodium chloride solution , dried over anhydrous sodium sulphate , filtered and concentrated to give the desired product ( 993 mg ; 99 %) as a white foam . acetic anhydride ( 0 . 17 ml ; 1 . 8 mmol ; 2 eq ) was added dropwise at 0 ° c . to a solution of 2 -[[[ 3 - chloro - 5 - hydroxyphenylmethyl - 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 400 mg ; 0 . 91 mmol ) and 4 - dimethylaminopyridine ( 167 mg ; 1 . 4 mmol ; 1 . 5 eq ) in dichloromethane ( 5 ml ). the reaction mixture was warmed slowly to room temperature , and stirring continued for 10 minutes . the reaction mixture was quenched with water , partitioned , and the aqueous phase was extracted twice with dichloromethane . the combined organic layers were washed with 1n hydrochloric acid followed by saturated sodium chloride solution , then dried over anhydrous sodium sulphate , filtered and concentrated . purification of the crude residue by flash chromatography using 50 % etoac in hexanes provided the acetate as a sticky white foam ( 395 mg ; 0 . 84 mmol ; 93 %). a solution of 2 -[[[ 3 - chloro - 5 - hydroxyphenylmethyl - 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 515 mg ; 1 . 2 mmol ) and pyridine ( 0 . 38 ml ; 4 . 7 mmol ; 4 eq ) in dichloromethane ( 5 ml ) was cooled to 0 ° c . for the dropwise addition of trifluoroacetic anhydride ( 0 . 33 ml ; 2 . 3 mmol ; 2 eq ). the reaction was warmed slowly to room temperature and was quenched with water . upon partitioning , the aqueous layer was extracted twice with dichloromethane ( 5 ml ), and the combined aqueous layers were washed with saturated sodium chloride solution , dried over anhydrous sodium sulphate , filtered and concentrated . the crude product was placed under vacuum to remove the last traces of pyridine . the desired product ( 68 mg ; 0 . 13 mmol ; 11 %) was isolated by chromatography over neutral alumina ( 50 % ethyl acetate : hexane ). 2 -[[[ 3 - chloro - 5 - hydroxyphenylmethyl - 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 500 mg ; 1 . 1 mmol ) and 4 - dimethylaminopyridine ( 836 mg ; 6 . 8 mmol ; 6 eq ) were dissolved in dichloromethane ( 5 ml ), and dimethylcarbamoyl chloride ( 0 . 31 ml ; 3 . 4 mmol ; 3 eq ) was added at room temperature . the reaction mixture was heated to reflux for three hours , cooled back down to room temperature and quenched with water . the aqueous layer was extracted twice with dichloromethane ( 5 ml ), and the combined organic layers were washed with 1n hydrochloric acid and saturated sodium chloride solution . they were then dried over anhydrous sodium sulphate , filtered and concentrated . the crude residue was purified by chromatography using 20 % ch 3 cn and dichloromethane to yield the desired product ( 192 mg 34 %). 2 -[[[ 3 - chloro - 5 - hydroxyphenylmethyl - 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 200 mg ; 0 . 45 mmol ), triethylamine ( 0 . 31 ml ; 2 . 3 mmol ; 5 eq ) and 4 - dimethylaminopyridine ( 44 mg ; 0 . 36 mmol ; 0 . 8 eq ) were dissolved in dichloromethane ( 3 . 6 ml ), and the resulting solution was cooled to − 40 ° c . acetyl formyl anhydride ( 0 . 19 ml ; 1 . 2 mmol ; 2 . 5 eq ) was added dropwise to the reaction mixture , and stirring was continued at low temperature until the reaction was complete after 10 minutes . the cooling bath was removed , and saturated sodium bicarbonate was added to quench any excess reagent still present . the aqueous phase was extracted with dichloromethane ( 2 × 3 ml ), and the combined organic layers were washed with 1n hydrochloric acid followed by saturated sodium chloride solution , dried over anhydrous sodium sulphate , filtered and concentrated . the crude product was purified by chromatography using 50 % etoac in hexanes to give the product ( 541 mg , 100 %) as a white foam . a solution of triethylphosphite ( 94 μl ; 0 . 55 mmol ; 1 . 2 eq ) in dichloromethane ( 0 . 5 ml ) was cooled to 0 ° c . for the addition of iodine ( 126 mg ; 0 . 50 mmol ; 1 . 1 eq ). stirring continued until the purple color dissipated , indicating complete formation of the phosphoryl iodide . this cold solution was transferred dropwise via cannula to a solution of 2 -[[[ 3 - chloro - 5 - hydroxyphenylmethyl - 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 200 mg ; 0 . 45 mmol ) in pyridine ( 0 . 15 ml ; 1 . 8 eq ; 4 eq ) and dichloromethane ( 4 ml ). the alcohol solution turned yellow as the phosphoryl iodide reagent was added , but the color quickly dissipated as stirring continued . upon completion of the addition , the reaction stirred at room temperature for another 30 minutes , turning brown in the process . it was quenched with saturated sodium bicarbonate solution and shaken with a crystal of sodium hydrogen sulphate . the aqueous phase was extracted with dichloromethane ( 2 × 3 ml ), and the combined organic layers were washed with saturated sodium chloride solution , dried over anhydrous sodium sulphate , filtered and concentrated . the crude product was purified by chromatography using 70 - 80 % etoac in hexanes to yield the desired product ( 130 mg , 50 %) as a yellow - tinged foam . dihydropyran ( 0 . 16 ml ; 1 . 7 mmol ; 1 . 5 eq ) and a catalytic amount of pyridinium p - toluenesulphonate ( 28 mg ; 0 . 11 mmol ; 0 . 1 eq ) were added to a solution of 2 [[[ 3 - chloro - 5 - hydroxyphenylmethyl - 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 500 mg ; 1 . 1 mmol ) in dichloromethane ( 8 ml ). the reaction was stirred at room temperature overnight and was quenched with half - saturated sodium chloride solution ( 5 ml ). the aqueous layer was extracted twice with diethyl ether ( 5 ml ), and the combined organic layers were washed with saturated sodium chloride solution , dried over anhydrous sodium sulphate , filtered and concentrated . purification of the crude product by chromatography using 50 % etoac in hexanes gave the desired product ( 521 mg , 87 %) as a white foam . 2 -[[[ 3 - chloro - 5 - hydroxyphenylmethyl - 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 500 mg ; 1 . 1 mmol ) and pyridine ( 0 . 18 ml ; 2 . 3 mmol ; 2 eq ) were dissolved in dichloromethane ( 5 . 7 ml ) at room temperature . the resulting solution was cooled to − 20 ° c . for the dropwise addition of triethylsilyl triflate ( 0 . 39 ml ; 1 . 7 mmol ; 1 . 5 eq ). the bath was removed , and the reaction mixture was warmed slowly to room temperature where it stirred for 30 minutes . it was quenched with water ( 10 ml ) and diluted with diethyl ether ( 10 ml ). the aqueous phase was extracted with diethyl ether ( 5 ml ), and the combined organic layers were washed with 1n hydrochloric acid followed by saturated sodium chloride solution , dried over anhydrous sodium sulphate , filtered and concentrated . the crude product was filtered through a plug of silica gel using diethyl ether to afford the desired product ( 511 mg , 81 %) as a sticky , colorless oil . to a solution of 2 -[[[ 5 - benzoyl - 3 - chloro - 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 1 . 0 g ; 2 . 3 mmol ) in thf ( 30 ml ) was added a 3 . 0 m solution of methylmagnesium bromide in diethyl ether ( 4 . 6 ml ; 13 . 7 mmol ; 6 eq ) at 0 ° c . the solution yellowed , and a precipitate appeared after a few minutes . the solution was warmed to room temperature where it was stirred for two hours . it was then cooled back down to 0 ° c . and quenched with aqueous ammonium chloride ( 20 ml ). the aqueous layer was extracted twice with diethyl ether ( 10 ml ), and the combined organic layers were washed with brine , dried over sodium sulfate and concentrated . the crude residue was passed through a plug of silica gel with the aid of diethyl ether to give the desired product ( 933 mg , 90 %). 2 -[[[ 3 - chloro - 5 -( 1 - hydroxy - 1 - phenylethyl )- 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 933 mg ; 2 . 1 mmol ) was dissolved in ch 2 cl 2 ( 10 ml ), and triethylamine ( 0 . 87 ml ; 6 . 2 mmol ; 3 eq ) was added at room temperature followed by methanesulfonyl chloride ( 0 . 40 ml ; 5 . 2 mmol ; 2 . 5 eq ). the reaction mixture stirred for 30 minutes and was quenched with water . the aqueous layer was extracted twice with diethyl ether ( 20 ml ), and the combined organic layers were washed with 1n hcl followed by brine and then dried over sodium sulfate and concentrated . the crude product was purified by flash column chromatography using 80 % diethyl ether in hexanes to give the desired product ( 778 mg , 87 %). a 60 % solution of n - methylmorpholine n - oxide in water ( 1 . 9 ml ; 11 . 0 mmol ; 1 . 5 eq ) was added to a solution of 2 -[[[ 3 - chloro - 5 -( 1 - phenylethenyl )- 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 3 . 2 g ; 7 . 3 mmol ) in aqueous acetone ( 30 ml acetone ; 6 ml water ) at room temperature . this was followed by the dropwise addition of a 4 % solution of osmium tetroxide in water ( 1 . 43 ml ; 0 . 18 mmol ; 0 . 025 eq ). the resulting reaction mixture stirred overnight , at which point sodium sulfite ( 250 mg ) was added to quench any remaining oxidants . stirring was continued until a black precipitate appeared , and the solution was diluted with water ( 15 ml ) and extracted twice with etoac ( 30 ml ). the combined organic layers were washed with saturated sodium chloride solution , dried over anhydrous sodium sulphate , filtered and concentrated . purification by chromatography using a step gradient of 50 - 80 % etoac in hexanes yielded the desired product as a brownish foam ( 3 . 5 g , 100 %). 2 -[[[ 3 - chloro - 5 -( 1 , 2 - dihydroxy - 1 - phenylethyl )- 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 1 . 22 g ; 2 . 6 mmol ) was dissolved in pyridine ( 6 ml ) and the solution was cooled to 0 ° c . for the addition of p - toluenesulphonyl chloride ( 743 mg ; 3 . 9 mmol ; 1 . 5 eq ). the bath was removed , and the reaction mixture stirred at room temperature overnight . it was then quenched with water ( 6 ml ) and diluted with etoac ( 10 ml ). the aqueous layer was extracted with etoac ( 6 ml ), and the combined organic layers were washed with 1n hydrochloric acid followed by saturated sodium chloride solution , dried over anhydrous sodium sulphate , filtered and concentrated . the crude tosylate was purified by chromatography using 50 % etoac in hexanes to afford 1 . 3 g ( 2 . 0 mmol ; 80 %) of the pure product as a white solid ( m . p . 55 - 60 ° c .). 2 -[[[ 3 - chloro - 5 -( 2 - hydroxy - 1 -[[( 4 - methylphenyl ) sulfonyl ] oxy ]- 2 - phenylethyl )- 2 - pyridinyl ] oxy ] methyl ]- α -( methoxyimino )- n - methyl - benzeneacetamide ( 570 mg ; 0 . 91 mmol ) was dissolved in methanol ( 9 ml ), and potassium carbonate ( 250 mg ; 1 . 8 mmol 2 eq ) was added in one portion . stirring continued at room temperature for about an hour , at which point the reaction mixture was diluted with water and the extracted with diethyl ether ( 10 ml ). the combined organic layers were washed with saturated sodium chloride solution , dried over anhydrous sodium sulphate , filtered and concentrated to give the desired product ( 336 mg , 82 %) as a white solid ( m . p . 48 - 53 ° c .). the following table identifies several compounds of formula ( 1 ) of the formula below prepared analogous to the various procedures illustrated in the preceding examples : the compounds of formula ( 1 ) thus produced are usually obtained as a mixture of the e and z forms , which can then be separated , via standard means known in the art , into each of those forms , if desired . the compounds of formula ( 1 ) show strong fungicidal activity against a wide variety of fungi . the following tests illustrate the fungicidal efficacy of the compounds of this invention . the compounds of the present invention have been found to control fungi , particularly plant pathogens . when employed in the treatment of plant fungal diseases , the compounds are applied to the plants in a disease inhibiting and phytologically acceptable amount . application may be performed before and / or after the infection with fungi on plants . application may also be made through treatment of seeds of plants , soil where plants grow , paddy fields for seedlings , or water for perfusion . the compounds may also be employed effectively for the control of fungi on wood , leather , carpet backings , or in paint . as used herein , the term “ disease inhibiting and phytologically acceptable amount ” refers to an amount of a compound of the present invention which kills or inhibits the plant disease for which control is desired but is not significantly toxic to the plant . this amount will generally be from about 1 to 1000 ppm , with 10 to 500 ppm being preferred . the exact concentration of compound required varies with the fungal disease to be controlled , the type of formulation employed , the method of application , the particular plant species , climate conditions , and the like . a suitable application rate is typically in the range from about 0 . 10 to about 4 lb / a . the compounds of the invention may also be used to protect stored grain and other non - plant loci from fungal infestation . the following experiments were performed in the laboratory to determine the fungicidal efficacy of the compounds of the invention . compound formulation : compound formulation was accomplished by dissolving technical materials in acetone , with serial dilutions then made in acetone to obtain desired rates . final treatment volumes were obtained by adding nine volumes 0 . 05 % aqueous tween - 20 or triton x - 100 , depending upon the pathogen . late blight of tomatoes ( phytophthora infestans — phytin ): tomatoes ( cultivar rutgers ) were grown from seed in a soilless peat - based potting mixture ( metromix ) until the seedlings were 1 - 2 leaf ( bbch 12 ). these plants were then sprayed to run off with the test compound at a rate of 100 ppm . after 24 hours the test plants were inoculated with an aqueous spore suspension of phytophthora infestans . the plants were then transferred to the greenhouse until disease developed on the untreated control plants . powdery mildew of wheat ( erysiphe araminis — erysgt ): wheat ( cultivar monon ) was grown in a soilless peat - based potting mixture ( metromix ) until the seedlings were 1 - 2 leaf ( bbch 12 ). these plants were then sprayed to run off with the test compound at a rate of 100 ppm . after 24 hours the test plants were inoculated with erysiphe graminis by dusting spores from stock plants onto the test plants . the plants were then transferred to the greenhouse until disease developed on the untreated control plants . glume blotch of wheat ( leptosphaeria nodorum — leptno ): wheat ( cultivar monon ) was grown from seed in a soilless peat - based potting mixture ( metromix ) until the seedlings were 1 - 2 leaf ( bbch 12 ). these plants were then sprayed to run off with the test compound at a rate of 100 ppm . after 24 hours the test plants were inoculated with an aqueous spore suspension of leptosphaeria nodorum . the plants were then transferred to the greenhouse until disease developed on the untreated control plants . brown rust ( puccinia recondita — puccrt ): wheat ( cultivar monon ) was grown from seed in a soilless peat - based potting mixture ( metromix ) until the seedlings were 1 - 2 leaf ( bbch 12 ). these plants were then sprayed to run off with the test compound at a rate of 100 ppm . after 24 hours the test plants were inoculated with an aqueous spore suspension of puccinia recondita . the plants were then transferred to the greenhouse until disease developed on the untreated control plants . septoria leaf spot ( septoria tritici — septtr ): wheat ( cultivar monon ) was grown from seed in a soilless peat - based potting mixture ( metromix ) until the seedlings were 1 - 2 leaf ( bbch 12 ). these plants were then sprayed to run off with the test compound at a rate of 100 ppm . after 24 hours the test plants were inoculated with an aqueous spore suspension of septoria tritici . the plants were then transferred to the greenhouse until disease developed on the untreated control plants . the following table presents the activity of typical compounds of the present invention when evaluated in these experiments . the effectiveness of the test compounds in controlling disease was rated using the following scale : the compounds of this invention are preferably applied in the form of a composition comprising one or more of the compounds of formula ( 1 ) with a phytologically - acceptable carrier . the compositions are either concentrated formulations which are dispersed in water or another liquid for application , or are dust or granular formulations which are applied without further treatment . the compositions are prepared according to procedures which are conventional in the agricultural chemical art , but which are novel and important because of the presence therein of the compounds of this invention . some description of the formulation of the compositions is given to assure that agricultural chemists can readily prepare desired compositions . the dispersions in which the compounds are applied are most often aqueous suspensions or emulsions prepared from concentrated formulations of the compounds . such water - soluble , water suspendable , or emulsifiable formulations are either solids , usually known as wettable powders , or liquids , usually known as emulsifiable concentrates or aqueous suspensions . the present invention contemplates all vehicles by which the compounds of this invention can be formulated for delivery for use as a fungicide . as will be readily tappreciated , any material to which these compounds can be added may be used , provided they yield the desired utility without significant interference with activity of the compounds of this invention as antifungal agents . wettable powders , which may be compacted to form water dispersible granules , comprise an intimate mixture of the active compound , an inert carrier and surfactants . the concentration of the active compound is usually from about 10 % to about 90 % w / w , more preferably about 25 % to about 75 % w / w . in the preparation of wettable powder compositions , the toxicant products can be compounded with any of the finely divided solids , such as prophyllite , talc , chalk , gypsum , fuller &# 39 ; s earth , bentonite , attapulgite , starch , casein , gluten , montmorillonite clays , diatomaceous earths , purified silicates or the like . in such operations , the finely divided carrier is ground or mixed with the toxicant in a volatile organic solvent . effective surfactants , comprising from about 0 . 5 % to about 10 % of the wettable powder , include sulfonated lignins , naphthalenesulfonates , alkylbenzenesulfonates , alkyl sulfates , and non - ionic surfactants , such as ethylene oxide adducts of alkyl phenols . emulsifiable concentrates of the compounds of this invention comprise a convenient concentration , such as from about 10 % to about 50 % w / w , in a suitable liquid . the compounds are dissolved in an inert carrier , which is either a water miscible solvent or a mixture of water - immiscible organic solvents , and emulsifiers . the concentrates may be diluted with water and oil to form spray mixtures in the form of oil - in - water emulsions . useful organic solvents include aromatics , especially the high - boiling naphthalenic and olefinic portions of petroleum such as heavy aromatic naphtha . other organic solvents may also be used , such as , for example , terpenic solvents , including rosin derivatives , aliphatic ketones , such as cyclohexanone , and complex alcohols , such as 2 - ethoxyethanol . emulsifiers which can be advantageously employed herein can be readily determined by those skilled in the art and include various nonionic , anionic , cationic and amphoteric emulsifiers , or a blend of two or more emulsifiers . examples of nonionic emulsifiers useful in preparing the emulsifiable concentrates include the polyalkylene glycol ethers and condensation products of alkyl and aryl phenols , aliphatic alcohols , aliphatic amines or fatty acids with ethylene oxide , propylene oxides such as the ethoxylated alkyl phenols and carboxylic esters solubilised with the polyol or polyoxyalkylene . cationic emulsifiers include quaternary ammonium compounds and fatty amine salts . anionic emulsifiers include the oil - soluble salts ( e . g ., calcium ) of alkylaryl sulphonic acids , oil soluble salts or sulphated polyglycol ethers and appropriate salts of phosphated polyglycol ether . representative organic liquids which can be employed in preparing the emulsifiable concentrates of the present invention are the aromatic liquids such as xylene , propyl benzene fractions ; or mixed naphthalene fractions , mineral oils , substituted aromatic organic liquids such as dioctyl phthalate ; kerosene ; dialkyl amides of various fatty acids , particularly the dimethyl amides of fatty glycols and glycol derivatives such as the n - butyl ether , ethyl ether or methyl ether of diethylene glycol , and the methyl ether of triethylene glycol . mixtures of two or more organic liquids are also often suitably employed in the preparation of the emulsifiable concentrate . the preferred organic liquids are xylene , and propyl benzene fractions , with xylene being most preferred . the surface active dispersing agents are usually employed in liquid compositions and in the amount of from 0 . 1 to 20 percent by weight of the combined weight of the dispersing agent and active compound . the active compositions can also contain other compatible additives , for example , plant growth regulators and other biologically active compounds used in agriculture . aqueous suspensions comprise suspensions of water - insoluble compounds of this invention , dispersed in an aqueous vehicle at a concentration in the range from about 5 % to about 50 % w / w . suspensions are prepared by finely grinding the compound , and vigorously mixing it into a vehicle comprised of water and surfactants chosen from the same types above discussed . inert ingredients , such as inorganic salts and synthetic or natural gums , may also be added to increase the density and viscosity of the aqueous vehicle . it is often most effective to grind and mix the compound at the same time by preparing the aqueous mixture and homogenizing it in an implement such as a sand mill , ball mill , or piston - type homogenizer . the compounds may also be applied as granular compositions , which are particularly useful for applications to the soil . granular compositions usually contain from about 0 . 5 % to about 10 % w / w of the compound , dispersed in an inert carrier which consists entirely or in large part of coarsely divided attapulgite , bentonite , diatomite , clay or a similar inexpensive substance . such compositions are usually prepared by dissolving the compound in a suitable solvent and applying it to a granular carrier which has been preformed to the appropriate particle size , in the range of from about 0 . 5 to about 3 mm . such compositions may also be formulated by making a dough or paste of the carrier and compound , and crushing and drying to obtain the desired granular particle . dusts containing the compounds are prepared simply by intimately mixing the compound in powdered form with a suitable dusty agricultural carrier , such as , for example , kaolin clay , ground volcanic rock , and the like . dusts can suitably contain from about 1 % to about 10 % w / w of the compound . the active compositions may contain adjuvant surfactants to enhance deposition , wetting and penetration of the compositions onto the target crop and organism . these adjuvant surfactants may optionally be employed as a component of the formulation or as a tank mix . the amount of adjuvant surfactant will vary from 0 . 01 percent to 1 . 0 percent v / v based on a spray - volume of water , preferably 0 . 05 to 0 . 5 percent . suitable adjuvant surfactants include ethoxylated nonyl phenols , ethoxyated synthetic or natural alcohols , salts of the esters or sulphosuccinic acids , ethoxylated organosilicones , ethoxylated fatty amines and blends of surfactants with mineral or vegetable oils . the composition may optionally include fungicidal combinations which comprise at least 1 % of one or more of the compounds of this invention with another pesticidal compound . such additional pesticidal compounds may be fungicides , insecticides , nematocides , miticides , arthropodicides , bactericides or combinations thereof that are compatible with the compounds of the present invention in the medium selected for application , and not antagonistic to the activity of the present compounds . accordingly , in such embodiments the other pesticidal compound is employed as a supplemental toxicant for the same or for a different pesticidal use . the compounds in combination can generally be present in a ratio of from 1 : 100 to 100 : 1 . the present invention includes within its scope methods for the control or prevention of fungal attack . these methods comprise applying to the locus of the fungus , or to a locus in which the infestation is to be prevented ( for example applying to cereal or grape plants ), a fungicidal amount of one or more of the compounds of this invention or compositions . the compounds are suitable for treatment of various plants at fungicidal levels , while exhibiting low phytotoxicity . the compounds are useful in a protectant or eradicant fashion . the compounds of this invention are applied by any of a variety of known techniques , either as the compounds or as compositions including the compounds . for example , the compounds may be applied to the roots , seeds or foliage of plants for the control of various fungi , without damaging the commercial value of the plants . the materials are applied in the form of any of the generally used formulation types , for example , as solutions , dusts , wettable powders , flowable concentrates , or emulsifiable concentrates . these materials are conveniently applied in various known fashions . the compounds of this invention have been found to have significant fungicidal effect particularly for agricultural use . many of the compounds are particularly effective for use with agricultural crops and horticultural plants , or with wood , paint , leather or carpet backing . in particular , the compounds effectively control a variety of undesirable fungi which infect useful plant crops . activity has been demonstrated for a variety of fungi . it will be understood by those in the art that the efficacy of the compounds of this invention for the foregoing fungi establishes the general utility of the compounds as fungicides . the compounds of this invention have broad ranges of efficacy as fungicides . the exact amount of the active material to be applied is dependent not only on the specific active material being applied , but also on the particular action desired , the fungal species to be controlled , and the stage of growth thereof , as well as the part of the plant or other product to be contacted with the toxic active ingredient . thus , all the active ingredients of the compounds of this invention , and compositions containing the same , may not be equally effective at similar concentrations or against the same fungal species . the compounds of this invention and compositions are effective in use with plants in a disease inhibiting and phytologically acceptable amount . the term “ disease inhibiting and phytologically acceptable amount ” refers to an amount of a compound which kills or inhibits the plant disease for which control is desired , but is not significantly toxic to the plant . this amount will generally be from about 1 to about 1000 ppm , with 10 to 500 ppm being preferred . the exact concentration of compound required varies with the fungal disease to be controlled , the type of formulation employed , the method of application , the particular plant species , climate conditions , and the like . a suitable application rate is typically in the range from about 0 . 10 to about 4 pounds / acre .	0
synthesis of an amine terminated cholesterol group was based on literature . to a stirred solution of 1 . 0 molar equivalent i ( n - boc - 2 , 2 ′-[ ethylenedioxy ] diethylamine , sigma - aldrich ) and 1 . 1 molar equivalents ii ( cholesteryl chloroformate , sigma - aldrich ) in anhydrous toluene , 1 . 5 molar equivalents of dipea ( diisopropylethylamine , sigma - aldrich ) and a catalytic amount of dmap ( 4 - dimethylaminopyridine , sigma - aldrich ) were added . the reaction mixture was refluxed under argon atmosphere for 17 hours . subsequently , the solvent was removed under reduced pressure to obtain an oily residue . flash column chromatography was performed using 40 % ethyl acetate + 60 % hexane as eluent ( rf = 0 . 22 ). the solvent was removed under reduced pressure and the product iii was found to be an off white sticky residue . esi - tof : [ m ] + calcd 661 , [ m ] + found 661 . 1 h nmr ( 300 mhz , cdcl 3 ): 5 . 37 ( t , 1h , olefinic h ), 5 . 25 ( t , 1h , nh ), 5 . 1 ( t , 1h nh ), 4 . 5 ( m , 1h , o — ch cholesterol ), 3 . 61 ( s , 4h , o — ch 2 — ch 2 — o ), 3 . 55 ( m , 4h , 2 × o — ch 2 ), 3 . 37 ( m , 4h , 2 × ch 2 in ch 2 nh ), 2 . 5 - 0 . 87 ( 34h , cholesterol ), 1 . 5 ( s , 9h tert boc ), 0 . 86 ( d , 6h 2 × ch 3 cholesterol ), 0 . 68 ( s , 3h , 1 × ch 3 cholesterol ). product iii was dissolved in dichloromethane and was added in a drop - wise manner to a stirred solution of 4 molar equivalents of tfa ( trifluoroacetic acid ) in dichloromethane . deprotection was obtained after 23 hours at room temperature under continuous stirring . using tlc the deprotection was monitored . solvent was removed under reduced pressure and the residue was dissolved in dichloromethane and neutralized with tea ( triethylamine ). flash column chromatography was performed using 1 % nh 3 ( aq ) solution ( 25 % nh 3 in water ), 9 % meoh and 90 % chloroform ( rf frac13 - 16 = 0 . 38 , rf frac17 - 35 = 0 . 24 ). after solvent removal a yellowish sticky residue was obtained ( 76 . 3 % yield ). the purified product was stored at − 20 ° c . until further use . 1 h nmr ( 300 mhz , cdcl 3 ): 5 . 37 ( t , 1h , olefinic h ), 5 . 25 ( t , 1h nh ), 4 . 5 ( m , 1h , o — ch cholesterol ), 3 . 61 ( s , 4h , o — ch 2 — ch 2 — o ), 3 . 56 ( m , 4h , 2 × och 2 ), 3 . 52 ( t , 2h , nh 2 ), 3 . 37 ( m , 2h , ch 2 in ch 2 nh ), 2 . 89 ( t , 2h , ch 2 nh 2 ), 2 . 5 - 0 . 87 ( 34h , cholesterol ), 0 . 86 ( d , 6h , 2 × ch 3 cholesterol ), 0 . 68 ( d , 3h , 1 × ch 3 cholesterol ) polycaprolactone ( pcl ) was treated for ten seconds ( 10 s ) with oxygen plasma treatment ( opt ) using a plasma prep ii ( spi supplies ). this is a rf plasma treatment . the pcl used was a pcl sheet solvent casted from chloroform , mn 45 , 000 da ( sigma ). prior to sample treatment the chamber was cleaned during a 20 minutes cleaning run . the plasma treatment was performed using electromagnetic radiation having an energy of 400 j , at 200 mtorr of vacuum pressure . this was sufficient to generate aldehyde groups as shown by the purple discoloration of aldehyde - specific purpald dye in thin layer chromatography ( tlc ). the generation of aldehyde groups was further confirmed with x - ray photoelectron spectroscopy ( xps ) and ir - spectroscopy . quantera sxm ( scanning xps microprobe from physical electronics ) showed an increase in oxygen bearing groups , in particular o — c ≡ o and — c ═ o . moreover , bulk polymer modification was excluded by comparing fourier transform infrared spectroscopy with attenuated total reflectance ( ftir - atr ; diamond ) with polarization modulation infrared reflection absorption spectroscopy ( pm - irras ). only in pm - irras on spin - coated gold samples a shoulder appeared in the carbonyl region that was not observed in the atr spectra . due to the differences in sampling depth , atr diamond 5 μm and pm - irras nm regime , surface confinement of the oxygen plasma treatment was concluded . the plasma treatment was repeated with electromagnetic radiation having a different energy . the results of these experiments are given in fig1 . fig1 clearly shows that there is an optimum in the energy of the electromagnetic radiation at 400 j for the treatment of pcl , under the present experimental conditions . the opt modified polycaprolactone sheet according to example ii was contacted with 1 mm of amine terminated cholesterol group in ethanol . contacting lasted for 1 hour at room temperature while shaking the solution . the modified caprolactone sheet was reduced directly in a freshly made nabh 4 solution ( sigma ) i . e . 100 mg in 10 ml ethanol and 40 ml 1 × phosphate buffered saline ( pbs , sigma ). in this example and in example iva the pbs was prepared by the solution of a pbs tablet ( sigma ) in 200 ml of deionized water to yield a 0 . 01 m phosphate buffered saline , with 0 . 0027 m potassium chloride and 0 . 137 m sodium chloride ; ph 7 . 4 at 25 ° c . subsequently the samples were rinsed with milliq to remove salt and briefly sonicated in ethanol to remove adsorbed linker and dried under a stream of nitrogen . to evaluate whether the aldehyde groups , formed after oxygen plasma treatment , are reactive towards the cholesterol group time of flight secondary ion mass spectroscopy ( tof - sims ) ( waters - micromass lct ) and contact angle measurements were used . the surface modification of three different biopolymers treated with oxygen plasma treatment ( opt ) using electromagnetic radiation having an energy of 400 j was compared . the biopolymers tested were polycaprolactone ( pcl , mn = 45 kda ), a segmented block copolymer of poly ( ethylene oxide terephthalate ) and polybutylene terephthalate ( pa , polyactive ® 1000 / 70 / 30 ) and a block copolymer of polylactic acid and polycaprolactone ( pg , pla65 / pcl35 ). after the treatment with opt the samples were incubated with the amine terminated cholesterol group for 1 hour as described above . after both the opt treatment and the incubation with the amine terminated cholesterol group the sensile contact angle was determined . the sensile water contact angle was measured using a krüss contact angle measuring system g10 . the sample for contact angle measurement was placed horizontally with the side to be measured facing up . using the automated syringe a water droplet ( 30 μl droplet distilled or ultrapure milliq water ) was placed on the surface . the droplet was imaged within a period of 5 seconds . by the use of software fitting the sensile water contact angle with the sample surface was deduced . the samples were measured on multiple locations , & gt ; n = 3 , to ensure that a reliable value for the water contact angle was found . fig2 shows the contact angle for the native polymers ( pcl , pa and pg ), the contact angle after treatment with opt and the contact angle after incubation with the amine terminated cholesterol group . the contact angle becomes lower after the treatment with opt which means that the surface becomes more hydrophilic . after incubation with the amine terminated cholesterol group the surface of the polymers becomes more hydrophobic again . further the contact angle after treatment with opt was determined for the pg polymer . the contact angle was determined after various amounts of time as shown in table 1 . also the mobility properties of the bslb were determined . the incubation with the amine terminated cholesterol group was performed as described above . the method for the formation of the lipid bilayer was performed as described in example iv , a below . the amount of mobility of the lipid bilayer was determined by frap analysis as described in example iv , b below . the results of these experiments were used to determine for which amount of time the reactive groups a , were present on the surface of the pg polymer . table 1 shows that for a time of about 92 hour after storage in water ( at room temperature ) the opt treatment the contact angle remained low . after storage under air ( room temperature ) the contact angle remained low for about 2 hours . thus within this time frame sterol groups could be attached to the reactive groups a to form an air - stable lipid bilayer ( rbslb ). a similar stability experiment with pa ( polyactive ® 1000 / 70 / 30 ) showed a much lower stability of the reactive groups a ( aldehyde groups ) and reaction of the aldehyde groups with sterol groups preferably takes place within 5 minutes after the activation of the surface of the pa - object ( see table 1 ). large unilamellar vesicles ( luvs ) were prepared by extrusion ( 11 times ) of a solution of multi laminar vesicles ( mlv ) through 100nm polycarbonate membranes on an avanti polar lipids extruder . the mlv solution was a solution of 1 , 2 - dioleoyl - sn - glycero - 3 - phosphocholine ( dopc ) obtained from avanti polar lipids . mlvs of dopc were generated by vortexing a rehydrated lipid cake in fresh milliq ( 18mω ) at 1 mg / ml . the lipid cake was prepared by drying 99 . 8 mol % dopc and 0 . 2 mol % oregon green or texas red - 1 , 2 - dihexadecanoyl - sn - glycero - 3 - phosphoethanolamine ( dhpe , invitrogen ) from organic solvent . the cake was dried under a stream of nitrogen and left to dry under vacuum for 1 hour . opt modified polycaprolactone sheet according to example ii and opt modified and cholesterol modified polycaprolactone sheets according to example iii were treated with a diluted luv solution of 0 . 5 mg / ml in pbs . the sheets were incubated with the luv solution for 45 minutes above t m of the lipids used (− 20 ° for dopc ) to allow for vesicle adsorption and rupture to occur . optional , to further ensure high yield of ruptured vesicles a freezing step at − 80 ° c . was employed after the initial incubation . after extensive washing in 1 × phosphate buffered saline ( pbs , sigma ), the fluorescently labelled bilayer on pcl was achieved as shown by a fluorescence image of the pcl sheet . the thickness of the dopc layer formed on the object was 4 . 1 nm +/− 0 . 7 nm as determined by force spectroscopy . the dopc lipid bilayer formed according to example iva proved fluidic on the pcl support . the mobility was deduced by observing the diffusion occurring after a population of fluorescent lipids has been bleached , so - called recovery . in fig3 the bilayer consisted of dopc doped with 0 . 2 mol % of oregon green dhpe and was prepared using 100 nm luvs . a , fitted cslm frap recovery curve using a one - component fit , r 2 0 . 999207 . a diffusion coefficient of 1 . 016 μm 2 / s ± 0 . 012 with a mobile fraction of & gt ; 95 % was found . the roi , tot and bg regions had a ω of 24 μm during bleaching and acquisition . the inset shows the complete recovery profile during a single frap measurement using 600 iterations at 900 ms interval . epi - fluorescence images of b , pre bleach c , post bleach and d , after 15 minutes show recovery of fluorescence , scale bar 200 μm . here , the field diaphragm was closed to bleach a 130 μm spot on a single fiber to qualitatively assess later diffusion of the fluorescent layer . according to the method described above lipid bilayers were formed on pcl sheets that were treated with opt and thereafter incubated with an amine terminated cholesterol group for 1 hour , 2 hours or 3 hours respectively . it is shown by the results in table 2 below that by the opt treatment in combination with the incubation with the amine terminated cholesterol group an air - stable lipid bilayer ( rbslb ) can be formed with a mobile fraction of & gt ; 90 % as determined by frap analysis . when the incubation with the amine terminated cholesterol group lasts 3 hours it is shown that the mobile fraction of the air - stable lipid bilayer was reduced to about 50 %. on the untreated pcl sheet and on the pcl sheet that was only treated with opt an air - stable lipid bilayer was not formed . pcl films of 0 . 5 × 0 . 5 cm 2 ( sigma ) were modified on one side , while the other side remained unaltered , with a dopc lipid bilayer formed according to the process described in examples ii , ill and iva . these films were incubated with bovine serum albumin ( bsa , sigma ) modified with dylight 488 ( thermo scientific ) for 20 min . at room temperature in the dark . after the set incubation and protein desorption in sds solution for 1 hour the bsa - dylight488 content was quantified for determination of the non - fouling nature of the modified pcl films . the total protein adsorption decreased by about 50 % after application of the bilayer . it is expected that the reduction is due to the non - fouling nature of the zwitterionic lipid bilayer . since only half of the total surface area was treated , a high degree of protein resistance ( of about 100 %) can be deduced even after dehydration and rehydration of the sample i . e . 1 ×, 2 × or 3 times sequentially . one dehydration cycle was performed by removal of all the liquids above the object and let it dry for 30 min . afterwards pbs was added to rehydrate the lipid bilayer , all conducted at room temperature . bsa conjugated with dylight 488 was incubated with the substrates in pbs . the adsorbed protein was quantified with a plate reader after being desorbed in sds solution . the inset shows adsorption data of bsa in dmem , lacking fbs . relative protein adsorption is presented as mean ± sd ( n = 3 ) and compared using 1 - way anova with post - hoc tukey test , * p =& lt ; 0 . 05 . the bsa adsorption figures show that the attachment of the lipid bilayer to the pcl object is stable . even after rehydration and dehydration of the sample 3 times no amendment of the bsa adsorption occurred . further no fouling with the proteins out of the bsa occurs on the lipid bilayer . this means that the lipid bilayers will also protect the object against other forms of bio - fouling . to gain insight in the non - fouling behaviour of the bslbs , a protein adsorption assay was performed . here , fluorescently labelled bsa was prepared and used to quantify the amount of protein adsorbed to the samples surface . briefly , n - hydrocysuccinimide ( nhs ) activated dylight - 488 was incubated with bsa and purified using spin columns following the protocol provided by the manufacturer ( thermo scientific ). bslb modified pcl films of 0 . 5 × 0 . 5 cm 2 ( sigma ) were incubated with 50 μg / ml bsa conjugates in pbs for 20 min . subsequent washings using pbs ensured loosely bound protein to be removed . adsorbed protein was desorbed in sds solution for 1 h at room temperature and quantified using a plate reader ( victor , perkin - elmer ) and a standard curve . in the case of the dehydrated bslb the buffer was removed and the surface was exposed to air . subsequently , pbs buffer was added to rehydrate the bslb samples . data are presented in table 4 and show that upon formation of the bslb the amount of adsorbed protein is significantly reduced . kgg - peptides were synthesized using a microwave solid - phase peptide synthesizer ( oem ). the fluorenylmethyloxycarbonylchloride ( fmoc )- protected amino acids and the coupling reagents hydroxybenzotriazole ( hobt ) and o - benzotriazole - n , n , n ′, n ′- tetramethyl - uronium - hexafluoro - phosphate ( hbtu ) were obtained from multisyntech . rink - amide resin and hobt / hbtu coupling were used . standard manufacturers amino acid coupling methods were adopted . with exception that the first amino acid was coupled using an initial double coupling procedure . 3 . microwave step ; 35 watt , max t ˜ 40 ° c ., ˜ 40 sec 6 . microwave step , 35 watt , max t ˜ 79 ° c ., ˜ 3 min 11 . microwave step ; ser , asp , gly : 25 watt , max t ˜ 79 ° c ., ˜ 5 min 3 . microwave step ; , 35 watt , max t ˜ 40 ° c ., ˜ 40 sec . 6 . microwave step ; 35 watt , max t ˜ 79 ° c ., ˜ 3 min arg ; 0 watt , max t ˜ 79 ° c ., ˜ 30 min lys ; 25 watt , max t ˜ 79 ° c ., ˜ 5 min arg ; 25 watt , max t ˜ 79 ° c ., ˜ 5 min lys : 25 watt , max t ˜ 79 ° c ., ˜ 5 min the n - terminal kgg - r n was used to couple n - hydroxysuccinimide ( nhs ) activated palmitic acid . nhs - palmitate was prepared according to a literature procedure . 1 : 1 : 1 molar equivalents of palmitic acid ( sigma ), nhs ( sigma ) and n , n ′- dicyclohexylcarbondiimide ( dcc , sigma ) were stirred at 0 ° c . for 1 hr and left overnight at room temperature in thf . the reaction solution was filtered and the product was purified by means of recrystallization in hot methanol . the ir analysis showed for palmitic acid the c - h stretching at 2 , 912 & amp ; 2 , 848 cm − 1 of the alkane , the o — h and — c ═ o stretching at 2 , 500 - 3 , 300 cm − 1 and 1 , 700 cm − 1 of the acid . the nhs - palmitate showed peaks at : alkane , — c — h : 2 , 912 & amp ; 2 , 848 cm − 1 ; ester , — c ═ o : 1 , 821 cm − 1 and — c — o — n : 1 , 071 cm − 1 ; succinimide , sym . c ═ o : 1 , 784 cm − 1 , asym . c ═ o : 1 , 731 cm − 1 and asym . c — n — c : 1 , 212 cm — 1 . after completion of the peptide synthesis a final deprotection step was performed to yield a ‘ free ’ n - terminal amine , leaving the lysine side - group protected . on resin the peptide was reacted with 10 molar equivalents nhs - palmitate in dmf and a small amount of n , n - diisopropylethylamine ( dipea ). the nhs - palmitate was allowed to react for 5 hours . the resin was washed multiple times with dmf and dcm after that microwave cleavage using the microwave solid - phase peptide synthesizer ( cem ) in a tfa / tis / water 95 / 2 . 5 / 2 . 5 was performed according to manufactures instruction as described under example va . after diethyl ether precipitation the peptide conjugate was purified with hplc and lyophilized . hplc purification was performed using water and acetonitrile gradient supplemented with 0 . 1 % tfa . using es + the [ m + h ] + and [ m + h ] 2 + peaks could be found for the fibronectin derivatives using the lyophilized , purified ‘ monopal ’ peptides the coupling of a second nhs - palmitate to the ‘ free ’ amine of the lysine residue was performed . the reaction was conducted in dsmo / dipea in a 10 times molar excess of nhs - palmitate . the reaction was monitored using es + and stopped upon disappearance of the monopal peak , after 4 hours . the crude was washed several times with diethyl ether to remove unreacted nhs - palmitate . the dmso fraction was diluted with milliq and lyophilized . pcl membranes functionalized with two different lipid bilayers were used . the functionalized pcl membranes were obtained according to the process as described in example iva . to test the performance of the lipid bilayers palmitoylated rgd peptides were chosen as a model system for cell adhesion . here , the bilayer was contacted with a high concentration of peptide ( 10 mol %) and the effect of lipids lateral mobility on cell behavior was compared . in the figure the resulting cell size as well as cell area was deduced after two hours of incubation . the cell count decreased upon application of a bare dopc or dspc bilayer . however , upon doping with rgd peptides the cell count increased . when rge control peptides were chosen , cell adhesion was suppressed . moreover , for the gel state lipids ( dspc ) the cell area was significantly higher . immortalized mesenchymal stem cells ( imscs ) were seeded in basal media for two hours at a density of 5 , 000 cells per cm 2 and washed after 30 minutes to remove loosely adherent cells . to study the effect of lateral mobility more in detail imscs were cultured for a period of 1 week in adipogenic media ( to promote the formation of fat cells ) and in osteogenic media ( to promote the formation of bone cells , both fully supplemented . it has been described that fat cell differentiation is promoted on soft surfaces while bone differentiation on stiff supports . it is postulated that mobile ligands ( liquid bslb ) would approximate soft materials while immobile ligands ( gel bslb ) stiff ones . to assess osteogenesis alp was measured and corrected for dna content . moreover , prior to that a proliferation assay allowed us to get insight into the cell densities of the oil o red samples that were used to determine adipogenisis . it can be noted that the liquid state bslb promoted adipogenisis while the gel state bslb promoted osteogenesis .	0
the present invention now is described more fully hereinafter with reference to the accompanying drawings , in which embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . referring now to the drawings , fig1 - 4 illustrate exemplary embodiments of a vehicle energy harvester . the exemplary embodiments can make productive use of the energy that is normally wasted ( in the form of heat ) in reducing the speed of motor vehicles on exit ramps , toll plazas etc ., etc . the vehicle energy harvester can absorb mechanical energy from passing ( or breaking ) vehicles and convert the mechanical energy to electrical energy using , for example , shaft driven generators . other means for converting the mechanical energy to electrical energy also are contemplated . in an exemplary embodiment , the electric power from the generators can be converted , metered , and fed into the commercial power grid . in another exemplary embodiment , each site can be equipped with wireless communications to monitor the status and / or output of the system . the disclosed embodiments can include individual assemblies with integral generators . other generator configurations also are possible , such as separate generators . as shown in fig1 , the vehicle energy harvester unit 10 can be a low - profile surface mounted assembly . the vehicle energy harvester unit 10 can include an entry ramp 12 and an exit ramp 14 . the vehicle energy harvester unit 10 can include a plurality of subunits 16 having a top surface or driving surface 17 . each subunit can include one or more vehicle activated treadles 18 . in an embodiment , each subunit 16 can include a generator unit 20 . in other embodiments , the vehicle energy harvester unit 10 can be set into the road surface . the surface mounted assembly may require minimal installation effort . additionally , the unit count can be scaled to road / breaking needs . in an embodiment , each generator unit 20 can feed a common power summing / conversion unit 22 . a simple cable interconnect conversion 24 can be provided to connect each generator unit 20 to the common power summing / unit 22 . a fail safe configuration can protect the system against individual unit failures . in a disclosed embodiment , the individual absorber units 16 can be connected via cable assemblies 24 . the input power can be summed and applied to a low - loss inverter unit . the power can be converted immediately to a form that is transmittable to the power grid . the output can be metered and applied to the power grid for transmission . with reference to fig2 , an exemplary embodiment of a subunit 16 of a vehicle energy harvester unit 10 can include spring - loaded treadles 18 having a treadles gear 30 engaging a drive gear 32 . the drive gear 32 is coupled to a shaft 34 . in operation , one or more vehicle tires force the spring - loaded treadles 18 down as they roll over the treadles 18 . the treadle gears 30 drive the plurality of drive gears 32 , which rotate the shaft 34 . the shaft 34 winds a torsion spring 36 , thereby absorbing the treadle drive transient . a pawl can lock the shaft 34 as rotation ends . the torsion spring 36 rotates a flywheel 38 , thereby spreading the impulse of the treadle drive over time to extend output to a generator 40 . the flywheel 38 can turn a generator 40 , such as a hydro pump . the generator 40 , in turn , can generate electric power for sale / use / storage . in order to reduce the wear and tear on the treadle assembly , an exemplary embodiment includes a transient absorption means in the form of a torsion spring 36 , as illustrated in fig2 and 4 . in conventional systems , the treadle drive mechanism commonly is attached directly to an electrical generation means . as a result , high speed vehicle impacts with the treadle assembly 18 will cause undue stress on the mechanical components due to the inertia of the electrical generation means ( e . g ., 40 ) connected to it . the exemplary embodiments of the present invention , for example as shown in fig2 and 4 , reduce the mechanical stress ( impulse ) on the mechanical components substantially by storing the treadle drive output in a torsion spring 36 which will release its stored energy to the alternator / generator ( e . g ., 40 ) after the vehicle passes over the treadle 18 . more particularly , the torsion spring 36 can provide advantages of absorbing the impulse imparted by fast - moving vehicles striking the treadles 18 . the torsion spring 36 also can isolate the treadle assembly from mass / inertia of the connected flywheel 38 and alternator / generator ( e . g ., 40 ). the torsion spring 36 further can release stored energy to the electrical charging means ( e . g ., 40 ) with very little loss . as illustrated in fig3 , in another embodiment , a flexible link 42 can provide a low - cost alternative . in this embodiment , the vehicle striking the treadle 18 forces the treadle 18 to rotate about its hinged end point . the inertia of the charging system ( e . g ., 40 ) resists turning of the drive gear 32 . the flexible link 42 can bow ( e . g ., bend or flex ) to absorb impulse then release the energy to the charging system ( e . g ., 40 ). the exemplary embodiments of the invention recognize that a delicate balance must be maintained between the amount of energy absorbed from a vehicle and the resultant disruption to the vehicle and its occupants . thus , the practicality and safety of the system configuration can be improved by absorbing the vehicle &# 39 ; s kinetic energy gradually . in an exemplary embodiment , the system can include a vehicle energy harvester unit 10 with a plurality of treadle subunits 16 having small ( i . e ., less intrusive or disruptive ) portions or components ( e . g ., treadles 18 ) that absorb the vehicles kinetic energy as gently and quietly as possible . as a result of the less disruptive nature of the exemplary system , the actual amount of energy derived from each treadle 18 may be relatively small or reduced compared with more disruptive designs . therefore , the exemplary embodiments of the invention provide further advantages of improving the efficiency with which the system converts the vehicles kinetic energy . exemplary embodiments that can improve the conversion efficiency of the system are discussed below . with reference to fig4 , exemplary embodiments for improving the conversion efficiency of the system will now be described . as exemplarily illustrated in fig4 , an exemplary embodiment of the vehicle energy harvester unit 10 can be equipped with a means for moving or returning the treadle 18 back to the active position , such as a reciprocal spring arrangement 44 or assembly . the embodiments recognize that at least a portion of the energy stored in the means ( e . g ., 44 ) for moving the treadle 18 back to the active position can be used to continue the generate power , thereby improving the conversion efficiency of the system . one of ordinary skill in the art will recognize that the reciprocating spring assembly 44 or arrangement is not limited to the embodiment illustrated in fig4 , and that other arrangements can be provided for performing the desired function of moving the treadle 18 back to the active position can be provided . for example , the reciprocating spring 44 can include one or more springs , such as a compression spring , an extension spring , or a torsion spring , among others , as well as other devices that are capable of storing a portion of the energy imparted by the movement of the treadle or moving the treadle 18 back to the active position , such as a lever arm , a cantilever , a pulley system , etc . in operation of the exemplary embodiment of fig4 , the weight of an oncoming vehicle ( s ) forces the treadle 18 downward . in response to the downward movement of the treadles 18 , one or more drive gears 32 rotate the shaft 34 in a first direction , as indicted by the arrows in fig4 . the ratchet gear 42 a can rotate freely during the downward motion of the treadle 18 . as shown in fig4 , one or more springs ( e . g ., reciprocating springs 44 a ) can be mounted in opposition to the movement of the treadle 18 . when the treadle 18 is actuated by the weight of a passing vehicle , one or more of the springs 44 a are compressed . after the vehicle passes over the treadle 18 , the treadle 18 is released from under the weight of the vehicle and the compressed reciprocal springs 44 a operate to push the treadle 18 back to the ready position . as explained above , the compression of one or more of the springs 44 a results in a portion of the energy absorbed from the vehicle being stored in the springs 44 a . thus , the conversion efficiency of the system can be improved by using at least a portion of this stored energy in the reciprocating springs 44 a to continue to apply rotational force to the shaft 34 . various systems can be implemented to convert a portion of the energy stored in the reciprocating springs 44 a into continued or additional rotational movement of the shaft 34 . for example , as illustrated in fig4 , during the movement of the treadle 18 back to the ready or active position , one or more ratchet gears 42 a can engage in the upward direction and continue to apply rotational force to the shaft 34 . by using the attached ratcheting gear 42 a assembly , some of the energy stored in the springs 44 a can be used to continue the motion of the permanent magnet alternator ( pma ) 40 and thereby provide a backstroke to improve the overall conversion efficiency . thus , the conversion efficiency of the system can be improved by using at least a portion of the stored energy in one or more of the reciprocating springs 44 a to continue to apply rotational force to the shaft 34 . the present invention has been described herein in terms of several preferred embodiments . however , modifications and additions to these embodiments will become apparent to those of ordinary skill in the art upon a reading of the foregoing description . it is intended that all such modifications and additions comprise a part of the present invention to the extent that they fall within the scope of the several claims appended hereto . like numbers refer to like elements throughout . in the figures , the thickness of certain lines , layers , components , elements or features may be exaggerated for clarity . the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention . unless otherwise defined , all terms ( including technical and scientific terms ) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . it will be further understood that terms , such as those defined in commonly used dictionaries , should be interpreted as having a meaning that is consistent with their meaning in the context of the specification and relevant art and should not be interpreted in an idealized or overly formal sense unless expressly so defined herein . well - known functions or constructions may not be described in detail for brevity and / or clarity . as used herein , the singular forms “ a ”, “ an ” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . it will be further understood that the terms “ comprises ” and / or “ comprising ,” when used in this specification , specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one or more other features , integers , steps , operations , elements , components , and / or groups thereof . as used herein , the term “ and / or ” includes any and all combinations of one or more of the associated listed items . as used herein , phrases such as “ between x and y ” and “ between about x and y ” should be interpreted to include x and y . as used herein , phrases such as “ between about x and y ” mean “ between about x and about y .” as used herein , phrases such as “ from about x to y ” mean “ from about x to about y .” it will be understood that when an element is referred to as being “ on ”, “ attached ” to , “ connected ” to , “ coupled ” with , “ contacting ”, etc ., another element , it can be directly on , attached to , connected to , coupled with or contacting the other element or intervening elements may also be present . in contrast , when an element is referred to as being , for example , “ directly on ”, “ directly attached ” to , “ directly connected ” to , “ directly coupled ” with or “ directly contacting ” another element , there are no intervening elements present . it will also be appreciated by those of skill in the art that references to a structure or feature that is disposed “ adjacent ” another feature may have portions that overlap or underlie the adjacent feature . spatially relative terms , such as “ under ”, “ below ”, “ lower ”, “ over ”, “ upper ”, “ lateral ”, “ left ”, “ right ” and the like , may be used herein for ease of description to describe one element or feature &# 39 ; s relationship to another element ( s ) or feature ( s ) as illustrated in the figures . it will be understood that the spatially relative terms are intended to encompass different orientations of the device in use or operation in addition to the orientation depicted in the figures . for example , if the device in the figures is inverted , elements described as “ under ” or “ beneath ” other elements or features would then be oriented “ over ” the other elements or features . the device may be otherwise oriented ( rotated 90 degrees or at other orientations ) and the descriptors of relative spatial relationships used herein interpreted accordingly .	7
fig1 a and 1b depict exemplary systems 100 for deriving and analyzing periodic information in a vibration signal . in the embodiment of fig1 a , a sensor 104 , such as an accelerometer , is attached to a machine 102 to monitor its vibration . although an accelerometer is depicted in the exemplary embodiment of fig1 a , it should be appreciated that other types of sensors could be used , such as a velocity sensor , a displacement probe , an ultrasonic sensor , or a pressure sensor . the sensor 104 generates a vibration signal ( or other type of signal for a sensor other than an accelerometer ) that contains periodic information . for repeatable and best results , it is preferable to place each sensor 104 such that there is a solid path of transition from the signal source ( e . g . a bearing ) to the mounting location of the sensor . the mounting of the sensor 104 should also be performed to ensure that the signal is sensed with as minimal distortion as possible . preferred embodiments include one or more tachometers 116 for measuring the rotational speed of one or more rotating components of the machine 102 . the vibration and tachometer signals are provided to a data collector 106 preferably comprising an analog - to - digital converter ( adc ) 108 for sampling the vibration and tachometer signals , an optional low - pass anti - aliasing filter 110 ( or other combination of low - pass and high - pass filters ), and buffer memory 112 . for example , the data collector 106 may be a digital data recorder , a handheld vibration data collector , or a permanently or temporarily mounted monitoring device . the vibration signal data is communicated to a periodic information processor 114 that performs the information processing tasks described herein . in the embodiment of fig1 a , the periodic information processor 114 is a component of the data collector 106 . in this embodiment , the periodic information processor 114 communicates processed data via a machine data network 122 , which may be a hart ™ or wirelesshart ™ network , an ethernet network , or the internet . an analyst computer 120 receives the processed data via the network 122 for display on a display device 118 . in an alternative embodiment depicted in fig1 b , the periodic information processor 114 is a component of the analyst computer 120 . this embodiment may be preferable for situations in which data transmission and storage are not a major concern , so that the entire data set can be transferred via the network 122 to the analyst computer 120 or other remote processing device for post - processing using the same algorithms and techniques . with regard to sensor placement for bearing and gear diagnosis , the sensor 104 is typically mounted orthogonal to the shaft . it is preferably mounted on a rigid and massive piece of metal that is near the source of the signal ( i . e . bearing or gear ). the large mass of metal on which the sensor is mounted helps prevent resonances entering the signal due to the surface of the machine as opposed to what is happening internal to the machine . the sensor 104 should be mounted so as to minimize loss of signal integrity during transmission . this requires a rigid connection — typically by stud mounting the sensor 104 . in some circumstances , such as where the mounting surface of the machine is rough or covered with many layers of paint , the surface will need to be sanded . fig2 depicts a flowchart of a method for calculating a periodic signal parameter ( psp ) according to a preferred embodiment of the invention . a time - domain vibration waveform is measured , such as using the accelerometer 104 or other sensor attached to the machine 102 being monitored ( step 12 ). an autocorrelation function is performed on the vibration waveform to determine how much of the energy in the waveform is periodic ( step 14 ). in a preferred embodiment , the autocorrelation function cross - correlates the vibration signal with itself to find repeating patterns within the waveform . the autocorrelation function outputs an autocorrelation waveform 16 , examples of which are depicted in fig3 - 7 . several statistical characteristics of the autocorrelation waveform are calculated , including the standard deviation ( σ ), the maximum absolute peak amplitude in the waveform ( maxpeak ), the maximum absolute peak after the first 3 % of the waveform ( maxpeak ( after first 3 %)), and the crest factor ( cf 1 ) ( step 18 ). the positive waveform peaks are sorted out ( step 32 ), any of those peaks that are statistically too large are discarded ( step 34 ), and the mean amplitude ( sorted μ ) and the crest factor ( cf 2 ) of the remaining peaks are calculated ( step 35 ). methods for sorting and discarding peaks that are statistically too large are described hereinafter . if maxpeak is greater than or equal to 0 . 3 ( step 20 ) and if maxpeak is greater than or equal to 0 . 3 ( step 20 ) and if maxpeak is less than 0 . 3 ( step 20 ) and cf 1 less than 4 and σ is less than or equal to 0 . 1 ( step 26 ), then z = 0 . 025 ( step 28 ). if maxpeak is less than 0 . 3 ( step 20 ) and cf 1 is not less than 4 or σ is greater than 0 . 1 ( step 26 ), then z = 0 ( step 30 ). if cf 2 is greater than or equal to 4 and the number of discarded peaks is greater than 2 ( step 36 ), then w = 0 . 025 ( step 38 ). if cf 2 is less than 4 or the number of discarded peaks is not greater than 2 ( step 36 ), then w = 0 ( step 40 ). ( step 42 ) and σ is between 0 . 1 and 0 . 9 ( step 44 ), then x = 0 . 1 ( step 46 ). if ( step 42 ) or σ is not between 0 . 1 and 0 . 9 ( step 44 ), then x = σ ( step 48 ). the psp is the sum of the values of x , w , y and z ( step 50 ). in general , smaller psp values are indicative of more non - periodic signals and less distinctive frequencies , while larger psp values are symptomatic of more periodic signals relating to large single frequencies . as shown in fig3 , psp values of less than a first threshold , such as 0 . 1 , indicate that the vibration waveform is mostly non - periodic . as shown in fig4 , the algorithm for the psp assigns a value of 0 . 1 to signals having low amplitude , higher frequency data . this data may also prove to be bad data . as shown in fig5 , psp values between first and second thresholds , such as between about 0 . 10 and 0 . 14 , indicate that distinct frequencies are present but there is still a significant amount of non - periodic content . as shown in fig6 , psp values greater than the second threshold , such as greater than about 0 . 14 , indicate very distinctive frequencies that are important to analysis , such as vane pass or ball pass frequencies , along with small amplitude signals indicative of lower frequencies , such as rpm or cage along with their harmonics . as shown in fig7 , psp values greater than a third threshold , such as greater than 0 . 5 and above , indicate large dominant single frequencies in the spectrum taken from the vibration waveform . the closer the psp value is to 1 . 0 , the waveform has more periodic signal components and less non - periodic content . the psp provides a single number indicative of the periodic content in a waveform . statistical values are calculated from the autocorrelated waveform and one or more of these values are combined to produce the psp . indication of bad data or non - periodic signals is provided . information about periodicity can be extracted from a large data set and broadcast via a small bandwidth protocol such as hart ®, wirelesshart ®, and other similar protocols . the psp value may be applied specifically to peakvue ™ data in order to distinguish between periodic and non - periodic faults , such as lubrication , cavitation , bearing , gear and rotor faults . the psp value can be used in conjunction with other information to generate an indication of machine condition ( i . e . nature of mechanical fault , severity of the fault ). the other information may include : the original waveform ; processed versions of the waveform ; information obtained from the original vibration waveform ( i . e . peak value , crest factor , kurtosis , skewness ); information obtained from a processed version of the original waveform ( i . e . peakvue ™ processed , rectified , or demodulated waveform ); and / or one or more rule sets . an example is illustrated in table 2 below , where derived values representing psp output and stress wave analysis output ( for example , maximum peak in the peakvue ™ waveform or another derivative of peakvue ™ type analysis or another form of stress wave analysis ) are used to distinguish between different types of faults . in the majority of cases , the severity of the defect increases as the level of peakvue ™ impacting increases . although the example below refers to a stress wave value , other embodiments may use other vibration waveform information indicative of an impacting or other fault condition . a further embodiment of the present invention employs a programmable central processing unit , such as the processor 114 , programmed with program logic to assist a user with an interpretation of waveform information . the program logic compares the periodic signal parameter and stress wave analysis information with expected or historical or empirically - derived experiential values to discern a relative ranking from low to high . then discrete or graduated outputs , such as those portrayed in table 2 above , are employed to select logically arrayed observations , findings , and recommendations . in addition to evaluating psp and stress wave analysis information , program logic sometimes prompts a user to supply additional information or obtains additional information from another source such as from a knowledge base , to enable the logic to distinguish between two or more possible logical results . for example , program logic that returns a high psp and a high stress wave analysis finding may select a rolling element defect finding rather than other possible findings within that category because a similarity is calculated when program logic compares a periodic frequency finding and a bearing fault frequency for a machine component identified in a knowledge base . another technique to differentiate between lubrication and pump cavitation is to look at the trend of the impacting as indicated by stress wave analysis . if it increases slowly , then insufficient lubrication should be suspected . if it increases suddenly on a pump , then it is likely pump cavitation . if combined with logic or inputs on a control system , then the logic could look for process configuration changes that occurred at the same time as the increase in impacting — along with a low psp — to confirm pump cavitation . in some embodiments , the system suggests to the operator what action caused the cavitation , so that the operator can remove the cause and stop the machine from wearing excessively and failing prematurely . a preferred embodiment of the invention creates a new type of vibration spectrum , referred to herein as a periodic information plot ( pip ). the pip provides the user an easily viewed summary of the predominate periodic peaks from the originating spectrum , which would be a peakvue spectrum in a preferred embodiment . in a first embodiment , a signal is collected from plant equipment ( e . g . rotating or reciprocating equipment ) and is processed using two different sets of analysis techniques as depicted in fig8 . first , a waveform is acquired ( step 60 of fig8 ), such as a vibration waveform acquired using the system depicted in fig1 a . if employing a high - pass filter and peak - hold decimation to an oversampled waveform to capture impacting information ( such as using the peakvue ™ process ), this may be a calculated waveform . an fft of the waveform is taken ( step 62 ), resulting in a vibration spectrum ( vs ) 64 with frequency on the x - axis and amplitude on the y - axis , an example of which is shown in fig9 . the waveform from step 60 is also autocorrelated ( step 66 ) to generate a waveform referred to herein as the autocorrelation waveform 68 , having time on the x - axis and the correlation factor on the y - axis . the autocorrelation process accentuates periodic components of the original waveform , while diminishing the presence of random events in the original signal . as a result of the autocorrelation calculations , the autocorrelation waveform 68 has half the x - axis ( time ) values as that of the original vibration waveform 60 . therefore , the timespan of the autocorrelation waveform 68 will be half of that of the original vibration waveform 60 . an optional step ( 70 ) takes the square root of the autocorrelation waveform ( y - axis values ) to provide better differentiation between lower amplitude values . an fft of the autocorrelation waveform 68 is taken ( step 72 ), resulting in an autocorrelation spectrum ( as ) 74 . since random events have largely been removed from the autocorrelation waveform 68 , the remaining signal in the autocorrelation spectrum 74 is strongly related to periodic events . as shown in fig1 , the autocorrelation spectrum 74 has frequency on the x - axis and amplitude related to the correlation factor on the y - axis . because the autocorrelation waveform &# 39 ; s duration is half that of the vibration waveform 60 , the associated autocorrelation spectrum 74 has half the lines of resolution compared to the vibration spectrum 64 . in the first embodiment , the vibration spectrum 64 and the autocorrelation spectrum 74 are processed to derive a graph referred to herein as the periodic information plot ( pip ) ( step 76 ). several methods for processing the vibration spectrum 64 and the autocorrelation spectrum 74 may be used according to the first embodiment , three of which are described below . because the vibration spectrum is twice the resolution of the autocorrelation spectrum , a point - to - point comparison for values on the x - axis ( frequency ) between the two spectra is not possible . however , a point - to - point comparison can be made by mathematically combining the amplitude values of two x - axis values in the vibration spectrum ( step 65 ) for each associated x - axis value in the autocorrelation spectrum . each x as ( n ) value of the autocorrelation spectrum ( where n = 1 . . . n , and n is the number of lines of resolution for the autocorrelation spectrum ) is mapped to the x vs ( 2n ) value on the vibration spectrum . the mathematically combined x - axis value is defined such that x mcvs ( n )= x vs ( 2n ). the mathematically combined amplitude values y vs ( 2n ) and y vs ( 2n − 1 ) ( herein termed y mcvs ( n )) associated with the x mcvs ( n ) value from the vibration spectrum are calculated from the amplitudes of both the x vs ( 2n ) and x vs ( 2n − 1 ) frequencies from the x - axis . the calculation for deriving the mathematically combined amplitude value associated with the x mcvs ( n ) value from the vibration spectrum is : y mcvs ( n )=√{ square root over (( y vs ( 2n − 1 )) 2 +( y vs ( 2n )) 2 )}, 0 where n = 1 . . . n and n is the number of lines of resolution found in the autocorrelation spectrum . in a first method ( step 76 a ), for each x - value in the pip ( x pip1 ), the y - value in the pip ( y pip1 ) is determined by multiplying the mathematically combined y - value in the vibration spectrum ( y mcvs ) by the corresponding y - value in the autocorrelation spectrum ( y as ), according to : for n = 1 to n , where n is the number of x - values ( frequency values ) in the autocorrelation spectrum . since amplitudes of periodic signals in the autocorrelation spectrum are higher than the amplitudes of random signals , the multiplication process will accentuate the periodic peaks while decreasing non - periodic peaks . an example of a pip formed by the first method is depicted in fig1 . in all of the examples depicted herein , n = 1600 . in a second method ( step 76 b ), for each x - value in the pip ( x pip2 ), the y - value in the pip ( y pip2 ) is determined by comparing the corresponding y - value in the autocorrelation spectrum ( y as ) to a predetermined threshold value ( y thr ). for each autocorrelation spectrum amplitude greater than this threshold value , the associated amplitude for pip ( y pip2 ( n )) will be set to the corresponding mathematically combined value from the vibration spectrum ( y mcvs ( n )). y as values above the predetermined threshold indicate data that is largely periodic . thus , the y pip2 values are determined according to : if y as ( n )& gt ; y thr , y pip2 ( n )= y mcvs ( n ) 2 a if y as ( n )≦ y thr , y pip2 ( n )= 0 ( or some other default level ) 2 b in one preferred embodiment of the second method , y thr is set to only include a percentage of the largest peaks from the autocorrelation spectrum . the percentage may be calculated based on the percent periodic signal in the autocorrelation waveform . the percent periodic signal is calculated based on the autocorrelation coefficient , which is the square root of the y - value of the largest peak in the autocorrelation waveform . for this method , only the percent periodic signal of the total number of autocorrelation spectrum peaks will be evaluated . an example of a pip formed by this method , with y thr set to 59 %, is depicted in fig1 . in another preferred embodiment of the second method , y thr is set to include only peaks with values that are within the “ percent periodic signal ” of the largest peak value in the autocorrelation spectrum . these peaks , along with their harmonics that appear in the autocorrelation spectrum , will be utilized as the group of peaks to be intersected with those in the vibration spectrum to form the pip . an example of a pip formed by this method , with y thr set to 59 %, is depicted in fig1 . in a third method ( step 76 c ), the pip is determined according to the first method described above , and then the threshold of the second method is applied to the pip according to : if y pip1 ( n )& gt ; y thr , y pip3 ( n )= y pip1 ( n ) 3 a if y pip1 ( n )≦ y thr , y pip3 ( n )= 0 ( or some other default level ) 3 b for n = 1 to n . an example of a pip formed by this method is depicted in fig1 . some embodiments also derive a non - periodic information plot ( npip ) that consists of only the y - values of the autocorrelation spectrum that are less than a predetermined threshold ( step 78 ). thus , the npip includes only non - periodic components . an example of an npip formed by this method is depicted in fig1 . some embodiments also derive a periodicity map from the vibration spectrum and the autocorrelation spectrum ( step 82 ). the periodicity map is created by pairing the mathematically combined y - values from the vibration spectrum and the autocorrelation spectrum corresponding to any given x - value of the autocorrelation spectrum . these pairs are plotted with the mathematically combined y - value from the vibration spectrum y mcvs ( n ) as the x - value of the point on the map x pm ( n ), and the y - value from the autocorrelation spectrum y vs ( n ) as the corresponding y - value on the map y pm ( n ), according to : for n = 1 to n . as shown in fig1 , the resulting graph resembles a probability mapping . a specific software implementation would allow the user to run a cursor over each point to view the values creating that point . some embodiments also derive a circular information plot from any of the periodic information plots described above ( step 80 ). once a linear pip is calculated , an inverse fft can be applied to generate an “ information waveform .” a circular information plot can then be generated from this information waveform . an example of a circular information plot formed by this method is depicted in fig1 . although preferred embodiments of the invention operate on vibration signals , the invention is not limited to only vibration signals . periodic signal parameters and periodic information plots may be derived from any signal containing periodic components . in a second embodiment , a signal is collected from plant equipment ( i . e . rotating or reciprocating equipment ) and is processed using the method 300 depicted in fig2 . first , a waveform is generated ( step 302 of fig2 ), such as a vibration waveform acquired using the system depicted in fig1 a . if employing a high - pass filter and peak - hold decimation to an oversampled waveform to capture impacting information ( such as using the peakvue ™ process ), this may be a calculated waveform . an fft of the vibration waveform is taken ( step 304 ), resulting in a vibration spectrum 306 with frequency on the x - axis and amplitude on the y - axis , an example of which is shown in fig9 . the vibration spectrum 306 is also referred to herein as the original spectrum to differentiate from the autocorrelation spectrum discussed hereinafter . the waveform from step 302 is autocorrelated ( step 314 ) to generate an autocorrelation waveform 316 , having time on the x - axis and the correlation factor on the y - axis . an fft of the autocorrelation waveform 316 is calculated using the same fmax as was used in the calculation of the fff of the original waveform ( step 318 ), resulting in an autocorrelation spectrum 320 . using the same fmax forces the lines of resolution ( lor ) of the autocorrelation spectrum 320 to be half of the lor used in calculating the original spectrum 306 . since random events have largely been removed from the autocorrelation waveform 316 , the remaining signal in the autocorrelation spectrum 320 is strongly related to periodic events . as shown in fig1 , the autocorrelation spectrum has frequency on the x - axis and amplitude related to the correlation factor on the y - axis . because the autocorrelation waveform &# 39 ; s duration is half that of the original waveform , the associated autocorrelation spectrum has half the lines of resolution compared to the original spectrum . percent periodic energy (% periodic energy ) is the percentage of energy in the original spectrum 306 that is related to periodic signals . it is calculated at step 322 based on the autocorrelation waveform 316 according to : % periodic energy =√{ square root over ( maxpeak ( after 3 % of autocorrelation waveform ))} in a preferred embodiment , the total energy of the original spectrum 306 is calculated as the square root of the sum of the squares of each bin value in the original spectrum 306 ranging from zero to fmax . for purposes of finding bearing and / or gear teeth faults , the original spectrum 306 is the peakvue spectrum . the percent energy of the original spectrum 306 is calculated at step 308 according to : a list of peaks from the original spectrum 306 is generated , wherein each listed peak is a located peak having a located frequency and an associated located amplitude ( step 310 ). a list of peaks from the autocorrelation spectrum 320 is also generated , wherein each listed peak is a located peak having a located frequency and an associated located amplitude ( step 324 ). in both lists , the peaks are arranged in order of descending amplitude , such that the peak having the largest amplitude is first in the list and the peak having the smallest amplitude is last ( steps 312 and 326 ). for the frequency value of each peak in the peak list generated for the autocorrelation spectrum , an associated matching peak is found in the peak list generated for the original spectrum ( step 328 ). for a peak to “ match ,” the frequency value of the peak from the original spectrum 306 must be within n × δfrequency of the frequency value of the peak from the autocorrelation spectrum 320 , where in a preferred embodiment n = 4 and δfrequency is expressed as : for each matching peak from the original spectrum 306 found in step 328 , the values of the located frequency and located amplitude is added to a pip peak list ( step 330 ). as each matching peak is added to the pip peak list , a running total peak energy value of all peaks in the pip peak list is calculated ( step 332 ). because a hanning window is used in the fft calculation for this embodiment , the energy of a located peak is the result of energy from three bin values used in the creation of the located peak . for each total peak energy ≦% energy of original , discard the associated peak in step 330 from the autocorrelation spectrum peak list before returning to step 328 ( step 335 ). this process of matching peaks and adding matched peaks to the pip peak list continues until the periodic information plot ( pip ) is created by plotting the three points associated with each peak in the pip peak list ( step 336 ). in the preferred embodiment , the three points correspond to three bins associated with each located peak , assuming a hanning window is used for fft calculations . examples of pip &# 39 ; s created using the method 300 of fig2 are depicted in fig2 and 23 - 26 . periodic peaks in a spectrum are classified as either synchronous or non - synchronous peaks . synchronous peaks are peaks that occur at the running speed of a shaft and its harmonic frequencies . for a gearbox having multiple shafts , there are also multiple families of synchronous peaks , wherein each family is associated with the speed of a particular shaft in the gearbox . in addition to running speed peaks , synchronous peaks associated with a gearbox also occur at all hunting tooth fundamental frequencies and their harmonics . non - synchronous peaks are periodic families of harmonic peaks that are not members of a synchronous family . a family of non - synchronous , periodic peaks is most likely related to a bearing defect . because there may be many families of peaks related to either synchronous or non - synchronous peaks , a preferred embodiment provides a display color scheme to separate the different families of peaks . by color coding the different families in a spectrum , it is easy to distinguish between frequencies related to bearings ( non - synchronous ) and those related to running speed . in a gearbox , analysis of these running speed harmonic families ( synchronous ) can lead to the discovery of gear teeth problems . using colors to designate the different families of peaks in a spectrum display or in the periodic information plot simplifies the analysis for both the novice and experienced analyst . fig2 depicts an exemplary display indicating the presence of a broken tooth on a two - stage gearbox . the presence of synchronous and non - synchronous periodic peaks is notable in the periodic information plot ( pip ) 130 . as indicated in the key provided in fig2 , synchronous families of peaks include the running speed fundamental and / or harmonics of “ shaft 1 ” highlighted in white ( represented by large solid lines ), “ shaft 2 ” highlighted in red ( represented by long dash lines ), and “ shaft 3 ” highlighted in green ( represented by dotted lines ). other synchronous families of peaks include hunting tooth fundamental frequencies and their harmonics “ htf 1 ” highlighted in blue ( represented by dash - dot - dash - dot lines ) and “ htf 2 ” highlighted in yellow ( represented by dash - dot - dot lines ). non - synchronous families of peaks are highlighted in purple ( represented by thin solid lines —). it should be noted that the peaks shown in red ( long dash lines ) make up the overwhelming number of synchronous family of peaks , all related to the second shaft in the gearbox . in this example , the bull gear on the second shaft has a missing tooth . methods for sorting and discarding statistically outlying peaks in the autocorrelation waveform ( step 34 in fig2 ) the following routine takes an array of data values , such as values of positive peaks in the autocorrelation waveform , and discards values outside the statistically calculated boundaries . in a preferred embodiment , there are four methods or criteria for setting the boundaries . consider an array of p values ( or elements ) where p 0 represents the number of values in the present array under evaluation . now let p − 1 represent the number of values in the array evaluated a single step before p 0 , let p − 2 represent the number of values in the array evaluated a single step before p − 1 , and let p − 3 represent the number of values in the array evaluated a single step before p − 2 . while evaluating the array of values for either the first time or p 0 ≠ p − 1 , calculate the mean ( μ ) and standard deviation ( σ ) for p 0 if   n   σ μ ≥ x , where   x = 0 , 1   and   n = 1 , 2   or   3   in   the   preferred   embodiment , then calculate the mean ( μ ) and standard deviation ( σ ) for p 0 if   n   σ 2  μ ≥ x , where   x = 0 , 1   and   n = 1 , 2   or   3   in   the   preferred   embodiment , then if p 0 = p − 1 = p − 2 , and p − 2 ≠ p − 3 , then calculate the mean ( μ ) and standard deviation ( σ ) for p include array values such that if p 0 = p − 1 = p − 2 , and p − 2 ≠ p − 3 , then calculate the mean ( μ ) and standard deviation ( σ ) for p 0 method 2 : non - conservative , using maximum statistical boundary only ( no minimum boundary ) use the same procedure as in method 1 except only values exceeding the upper statistical boundaries are discarded . the minimum boundary is set to zero . method 4 : conservative , using maximum statistical boundary only ( no minimum boundary ) discard values based on method 1 , step 1 only and based on values exceeding the upper statistical boundaries . the minimum boundary is set to zero . as an example of the sorting method 1 , consider an original set of values , p 0 , containing the twenty - one values listed below in table 3 below , with n = 1 . next , define the set p − 1 = p 0 and define a new set p 0 , the values of which are all the values of p − 1 that are between the values μ + σ = 0 . 689343 and μ − σ = 0 . 409735 . the set p 0 now contains the values listed below in table 4 , wherein three outlier values have been eliminated . now define the set p − 2 = p − 1 , and p − 1 = p 0 and define a new set p 0 , the values of which are all the values of p − 1 that are between the values μ + σ = 0 . 571797 and μ − σ = 0 . 432887 . the set p 0 now contains the values listed below in table 5 , wherein four more outlier values have been eliminated . if at any point in the calculations p 0 = p − 1 and p − 1 ≠ p − 2 , then step 2 would be executed instead of step 1 . in the example above , since p 0 ≠ p − 1 for every iteration , only step 1 was necessary for the calculations . fig2 depicts steps in a preferred embodiment of a method 400 for generating bearing fault condition information . a time - domain oversampled vibration waveform is measured ( step 402 ), such as using the accelerometer 104 or other sensor attached to the machine 102 being monitored . a peakvue ™ waveform is then generated ( step 404 ), such as by high - pass filtering and peak - hold decimating the oversampled waveform . the maximum peak amplitude ( maxpeak ) of the peakvue ™ waveform is determined ( step 406 ), and its associated autocorrelation waveform is calculated ( step 408 ). based on the autocorrelation waveform , the periodic signal parameter ( psp ) is calculated according to the method depicted in fig2 ( step 410 ). in a preferred embodiment , alert amplitude limit levels ( in g &# 39 ; s ) are determined based on the nominal turning speed according to the relationship depicted in fig2 ( step 412 ). fault amplitude limit levels are preferably two times the alert levels . fig2 provides a graphical representation of one method for determining alert limits for a peakvue signal based on the rpm of the machine shaft . the alert level would be compared to the peak value occurring in the peakvue waveform and applies for a developing inner race fault . it will be appreciated that the alert limit levels depicted in fig2 are suggestions only , and the analyst may decide to use values that have been determined to be optimal for their machine . in some situations , the analyst may start out using the values from fig2 , and then adjust them based on experience . before calculations of severity values can be made , percent periodic energy must be calculated . percent periodic energy ( step 414 ) is calculated from the autocorrelation waveform according to : wherein the maximum peak in the autocorrelation waveform does not include the first 3 % of the waveform . generally , the percent periodic energy calculation is not as accurate for values less than 50 %. accordingly , as indicated in fig1 , the slope of the function for values less than 50 % is greater than 1 . 0 . therefore , the percent periodicity is not determined for values less than 50 %. a general severity value is necessary for all severity estimates , which is calculated according to : in a preferred embodiment , the severity value is normalized by multiplying the result of step 416 by a desired maximum gauge value x according to : for the gauges shown in fig1 , where x = 10 , if the psp is greater than 0 . 1 ( step 419 ), a bearing fault is possibly present . bearing fault severity ( bfs ) may be calculated according to : if the resulting answer is greater than x ( 10 in this example ), then the answer is truncated to be x . in some embodiments , knowledge of the turning speed improves confidence that the periodicity is related to bearing faults and not turning speed incidences . when the turning speed is known , periodic peaks from the periodic information plot ( pip ) can be classified as synchronous and non - synchronous . if only synchronous peaks are present , no bearing fault is indicated . if significant non - synchronous peaks are present , a possible bearing issue is confirmed , as indicated by : if psp ≦ 0 . 1 and maxpeak is & lt ; alert level , no fault is indicated by the measurement , meaning the asset is in good condition . if psp is less than or equal to 0 . 1 and maxpeak is greater than the alert amplitude limit level ( step 420 ), a deficiency in bearing lubrication is indicated . in addition , there may be lubrication issues when a bearing fault is present . ( this is shown in fig2 with an arrow going from between steps 419 and 430 to step 422 .) the severity of the lubrication problem is generally dependent upon the maxpeak value of the originating waveform ( step 406 ) and the percent non - periodic energy (% npe ) indicated from the associated autocorrelation waveform ( step 408 ). as shown in fig1 , percent non - periodic energy (% npe ) is a function of percent periodic energy and can be determined using the plot of fig1 ( step 422 ). percent periodic energy (% periodic energy ) is defined as the percentage of energy in the peakvue ( original ) spectrum that is related to periodic signals . % npe is defined as the percentage of energy in the peakvue ( original ) spectrum that is related to random vibration signals . where x is the normalization value ( step 426 ). for the lubrication severity gauge shown in fig1 , x = 10 . if the resulting value is greater than x ( 10 in this example ), then the value is truncated to be x . in an alternative embodiment , instead of determining whether psp is greater than 0 . 1 in step 114 , it is determined whether % periodic energy is greater than y , where in most cases y is 50 %. while the preferred embodiment of the algorithm described above and depicted in fig2 uses a peakvue waveform , the algorithm could be applied to any waveform generated from any type of signal , such as vibration , current , ultrasonic , etc . following are four examples that demonstrate use of the algorithm of fig2 to determine the status of a bearing under different conditions . fig2 depicts the results for a new , fully - lubricated bearing with no faults . as shown , the gauges for bearing fault severity and lubrication severity both indicate a value of zero because the bearing is new and in good condition . fig2 depicts the results for a bearing with no faults other than it is running “ dry ” because there is insufficient lubrication present in the bearing . as shown , the bearing fault severity is still zero but the lubrication severity is about 6 . 5 . in this example , the % periodic energy is 44 . 3 %. the resulting % npe based on fig1 is 77 . 85 %. it should be noted that the psp is 0 . 0618 . fig2 depicts the results for a bearing with a small inner race fault and no lubrication problems . as shown , the bearing fault severity is slightly elevated to about 1 . 4 , but the lubrication severity is close to zero . in this example , the % periodic energy is 88 . 8 %. based on fig1 , the resulting % npe is 11 . 2 %. it should be noted that the psp is 0 . 213 for this example . fig2 depicts the results for a bearing with a small inner race fault as well as a lubrication problem due to the fact that the bearing is running “ dry .” even though psp is 0 . 074 , % periodic energy is 51 %. therefore , the signal has some periodicity . as shown , the bearing fault severity is almost 3 , while the lubrication severity is around 3 . 25 . those skilled in the art will appreciate that this diagnostic result is an advancement in technology , and could not be determined by other available algorithms . the ability to isolate the lower amplitude non - synchronous signals caused by the mechanical damage to the bearing from the non - periodic energy generated by lack of lubrication , which is significantly higher in amplitude , has not previously been available . fig2 depicts steps in a preferred embodiment of a method 200 for generating gearbox fault condition information . a time - domain oversampled vibration waveform is measured , such as using the accelerometer 104 or other sensor attached to the machine 102 being monitored ( step 202 ). a peakvue ™ waveform is then generated , such as by high - pass filtering and peak - hold decimating the oversampled waveform ( step 204 ). the maximum peak amplitude ( maxpeak ) of the peakvue ™ waveform is determined ( step 206 ), and its associated autocorrelation waveform is calculated ( step 208 ). based on the autocorrelation waveform , the periodic signal parameter ( psp ) is calculated according to the method depicted in fig2 ( step 210 ). the rotational speed of at least one of the shafts in the gearbox is measured , such as using a tachometer ( step 212 ), and the speed of each of the other shafts in the gearbox is calculated based on the speed measured in step 212 and knowledge of the gear ratios for the other shafts ( step 214 ). in addition , based on shaft running speeds , hunting tooth frequencies are calculated based on techniques known to those of ordinary skill in the art . in a preferred embodiment , alert amplitude limit levels ( in g &# 39 ; s ) are determined based on the nominal turning speed according to the relationship depicted in fig2 , or based on the analyst &# 39 ; s experience , or both , as discussed above ( step 216 ). fault amplitude limit levels are preferably two times the alert levels . before calculations of specific severity values can be made , percent periodic energy must be calculated . in a preferred embodiment , percent periodic energy is calculated from the autocorrelation waveform according to : wherein the maxpeak of the autocorrelation waveform does not include the first 3 % of the waveform ( step 218 ). generally , the percent periodic energy calculation is not as accurate for values less than 50 %. accordingly , as indicated in fig1 , the slope of the function for values less than 50 % is greater than 1 . 0 . in order to calculate severity values for different faults , a general severity value is determined . general severity may be calculated according to : the severity value is normalized by multiplying the result of step 220 by a desired maximum gauge value x according to : for the gauge shown in fig1 , where x = 10 , the pip is generated using the procedure described herein with reference to fig2 ( step 224 ). if the psp is greater than 0 . 1 ( step 225 ), periodic frequencies related to the gearbox and / or bearings are present . based on knowledge of the turning speed , periodic peaks from the periodic information plot ( pip ) can be classified as synchronous and non - synchronous . if non - synchronous peaks are present in the pip ( step 226 ), a bearing fault severity ( bfs ) value may be calculated ( step 228 ) and displayed ( step 234 ) according to : if synchronous peaks are present ( step 230 ) and fault limits are exceeded , gear teeth degradation is indicated . a gearbox fault severity ( gfs ) value may be calculated ( step 232 ) and displayed ( step 234 ) according to : if the resulting answer is greater than x ( 10 in this example ), then the answer is truncated to be x . if psp ≦ 0 . 1 and max peak is & lt ; alert level , no fault is indicated by the measurement , meaning the asset is in good condition . if psp is less than or equal to 0 . 1 and maxpeak is greater than the alert amplitude limit level ( step 234 ), a deficiency in bearing and / or gearbox lubrication is indicated . in addition , there may be lubrication issues along with mechanical faults present . ( this is shown in fig2 by an arrow going from between steps 225 and 226 to step 236 ). the severity of the lubrication problem is generally dependent upon the maxpeak value of the originating waveform ( step 206 ) and the percent non - periodic energy (% npe ) indicated from the associated autocorrelation waveform ( step 208 ). as discussed above , percent non - periodic energy (% npe ) is a function of percent periodic energy and can be determined using the plot of fig1 ( step 236 ). percent periodic energy (% periodic energy ) is defined as the percentage of energy in the peakvue ( original ) spectrum that is related to periodic signals . percent non - periodic energy is defined as the percentage of energy in the peakvue ( original ) spectrum that is related to random vibration signals . the bearing or gearbox lubrication severity value is determined and displayed according to : where x is the normalization value ( steps 240 and 242 ). for the lubrication severity gauge shown in fig1 , x = 10 . if the resulting value is greater than x ( 10 in this example ), then the value is truncated to be x . in an alternative embodiment , instead of determining whether psp is greater than 0 . 1 in step 218 , it is determined whether % periodic energy is greater than y , where in most cases y is 50 %. the foregoing description of preferred embodiments for this invention has been presented for purposes of illustration and description . they are not intended to be exhaustive or to limit the invention to the precise form disclosed . obvious modifications or variations are possible in light of the above teachings . the embodiments are chosen and described in an effort to provide the best illustrations of the principles of the invention and its practical application , and to thereby enable one of ordinary skill in the art to utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated . all such modifications and variations are within the scope of the invention as determined by the appended claims when interpreted in accordance with the breadth to which they are fairly , legally , and equitably entitled .	6
in the following examples , nss - tag is proved to be feasible to be applied to monitor recombinant protein expressed by zucchini yellow mosaic virus vector . nss - tag is useful for western blotting or enzyme - linked absorption assay ( elisa ) to detect recombinant protein . when nss - tagged zymv hc - pro and wsmov np are transiently expressed by agroinfiltration in tobacco , they are readily detectable and the tag &# 39 ; s possible efficacy for gene silencing suppression is not noticed . co - immunoprecipitation of nss - tagged and non - tagged proteins expressed confirms the interaction of potyviral hc - pro and coat protein . thus , the present invention provides a novel nss - tag system for tagging recombinant protein in both bacterial and plant expression systems . determination and applicability of the minimal sequence of nsscon in prokaryotic protein expression system in the present example , the nsscon sequence was used for tagging gfp expressed by pet28b vector . the feasibility of nsscon sequence as an epitope tag was tested , and the minimal length of the nsscon sequence recognizable by the nsscon monoclonal antibody ( mab ) ( chen et al ., 2006 , phytopathology 96 , 1296 - 1304 ) was determined in the bacterial expression system . all the primers used in this example were listed in table 1 . the green fluorescent protein ( gfp ) open reading frame ( orf ) containing the nsscon sequence ( gfpnsscon ), bamhi , kpni and xhoi sites at its c - extreme was constructed by three successive pcr ( 35 cycles : 30 s denaturation at 94 ° c . ; 30 s annealing at 55 ° c . ; 2 min synthesis at 72 ° c . ; followed by a 10 min final extension at 72 ° c .) using the forward primer p - cacc - gfp coupled with three reverse primers , m - nsscong1 - bk , m - nsscong2 and mnsscon . the gfpnsscon was introduced into pet28b ( novagen , darmstadt , germany ) via ncoi and xhoi restriction sites to generate pet28 - gfpnsscon - his . table 1 primer for construction of pet28 - gfpnsscon - his restriction primer name sequence / seq id no . enzyme * p - cacc - gfp 5 ′- ca ccatgg tgagcaagggcgaggagct - 3 ′ ncoi ( seq id no . 2 ) m - nsscong1bk 5 ′- gttcttcacacctggtttcctta c ggtac bamhi and cggatcc cttgtacagctcgtccatgccg - 3 ′ kpni ( seq id no . 3 ) m - nsscong2 5 ′- ttgattgtgcattgtgaacttgcagcct gtgttcttcacacctggtttc - 3 ′ ( seq id no . 4 ) m - nsscon 5 ′- ggtg ctcgag atttggattaaagatttg xhoi attgtgcattgtgaa - 3 ′ ( seq id no . 5 ) * restriction site is underlined . the stop codon is in bold . the progressively deleted nsscon , either from its n - or c terminus , were constructed by pcr from pet28 - gfpnsscon - his . the primers with added kpn1 , nco1 or xhoi sites for cloning purpose were listed in table 2 . individual constructs of gfp fused with different n - terminal deletions ( 2 - 12 a . a removed ) of nsscon were separately cloned into pet28 - gfpnsscon - his via kpni and xmai sites ( fig1 a and fig1 b ); similarly , those with different c - terminal deletions of nsscon ( 2 - 6 a . a removed ) were separately cloned into pet28 - gfpnsscon - his via ncoi i and xhoi sites ( fig1 a and fig1 b ). the gfp fused with the deletion form nsscon 11 a . a deleted from its n - terminal and 3 a . a from c - terminal ends ( dn11c3 ) was constructed by pcr from the pet28 - gfp - dn11 using primers p - cacc - gfp and m - nsscon - d3 , and then introduced into pet28 - gfpnsscon - his by ncoi and xhoi digestion ( fig1 a and fig1 b ). all the resulted recombinant plasmids were verified by sequencing . the nsscon sequence ( 23 a . a ; residues 98 - 120 of nss protein ) ( seq id no . 56 ) was used for tagging gfp expressed by the pet28b vector in bacteria ( fig1 a and fig1 b ). the gfp - nsscon containing both the nsscon sequence and his - tag ® was readily detected by western blotting using nsscon mab or gfp antiserum ( fig1 b ). gfp tagged with different n - terminal deletions of nsscon ( fig1 b ) were expressed and monitored by western blotting using nsscon mab . the nsscon mab readily recognized the deletion forms of nsscon with up to 11 a . a removed from the n - terminal end , but failed to recognize the 12 a . a - deleted nsscon ( fig1 b ). our results established that the amino acid residues upstream of k109 of nsscon are dispensable for recognition by the mab , whereas residue k109 is indispensable . the mab also recognized the nsscon sequences having 2 , 3 and 4 residues deleted from the c - terminal end , but failed to recognize the peptide when 5 or 6 residues were removed ( fig1 b ). these results indicated that residue f117 at the c - terminal region of nsscon is important for mab recognition , as the reactivity was greatly diminished upon its deletion . thus , the nine amino acid stretch “ 109kftmhnqif117 ” ( seq id no : 1 ) of the nsscon ( fig1 b ) is the minimal length for its recognition by the nsscon mab ; this minimal peptide was designated as “ nss ” asia tospoviral common epitope . serial constructs were generated on a modified petsa vector to express nsscon -, nss - or his - tagged gfp to compare the detectability of different tags ( fig1 c ). the recombinant gfps carrying the different tags , either at the n or c - terminus , were monitored by western blotting using nsscon mab , his - tag ® mab ( invitrogen , carlsbad , usa ) or gfp antiserum . expression of the recombinant gfps was verified by gfp antiserum and quantified relatively to the untagged gfp . the expression level of gfp tagged with either the whole nsscon or the minimal nss at the n - extreme was higher than that for untagged gfp ( fig1 c ). however , expression levels were lower when either of these tags was individually fused at the c - terminus of gfp ; this was especially noticed for the gfp - nsscon fusion ( fig1 c ). importantly , the expression levels of nsscon - or nss - tagged gfp were comparable to those of his - tagged gfp , indicating that both nsscon and nss can efficiently tag gfp for its expression in the bacterial system . also , the reaction strength appeared to be similar for nsscon and nss , regardless of their fusion at the n - or c - terminus of gfp . application of the nss - tag in the bacterial and plant viral expression system in the present example , construct for recombinant protein with nss - tag was constructed and introduced into a bacterial and plant expression system . a . construction of recombinant proteins tagged with nsscon , nss or poly - histidine for expression in prokaryotic or eukaryotic expression system constructs for recombinant proteins tagged with nsscon , nss or poly - histidine for expression in prokaryotic or eukaryotic expression system were prepared by the step as described as follows . for using sphi and apai restriction sites of primers as cloning sites , pet28b was converted into pet28dsa by abolishing the sphi and apai sites of the former by site - directed mutagenesis using the quikchange ™ xl site - directed mutagenesis kit ( stratagene , ca , usa ). as shown in fig1 c , the petsa - gfp - his carrying gfp orf with stop codon and petsa - gfp carrying gfp orf without stop codon were constructed by pcr amplification of gfp sequence from pet28 - gfpnsscon - his using the primer pairs , p - gfp - nsa / m - gfp - bkx and p - gfp - nsa / m - gfp - tga , respectively , and cloned into the mutated pet28dsa . primers were listed in table 3 . in order to compare the efficiencies of different tags , gfp was individually tagged with nsscon , nss - tag and his - tag ® and the sequences were cloned in bacterial expression vector pet28dsa . the gfp orf fused with nsscon sequence and stop codon at c terminal end was amplified by pcr using the primers p - gfp - nsa and m - nsscontga , and cloned into petsa - gfp - his via ncoi and xhoi sites to form petsa - gfp - nsscon ( fig1 c ). the vector petsa - nsscon - gfp ( fig1 c ) carrying gfp orf with nsscon sequence at its n - extreme was constructed from pet28 - gfpnsscon - his by three successive pcrs using three forward primers , p - nsscon1 , p - nsscon2 and p - nsscon , coupled with the reverse primer m - gfptga - x . the amplified fragment was cloned into petsa - gfp via ncoi and xhoi sites . petsa - gfp - nss ( fig1 c ) carrying gfp orf with nss sequence and a stop codon at its c - extreme was constructed petsa - gfp by a modified site - directed mutagenesis pcr ( stratagene , ca , usa ) using the primers p - cnss and m - cnss . the petsa - nss - gfp or petsa - his - gfp carrying gfp with the nss sequence or his - tag ® at the n - extreme was constructed following the design for petsa - gfp - nss , using primer pairs p - nnss / m - nnss and p - nhis / m - nhis , respectively . for tagging other proteins with nss - tag , the orfs of the nia protease of papaya ringspot virus w type ( wnpro ) ( chen et al ., 2008 , molecular plant - microbe interactions 21 , 1046 - 1057 ), the helper component - protease ( hc - pro ) of zucchini yellow mosaic virus ( zhc ) ( lin et al ., 2007 , phytopathology 97 , 287 - 296 ), a chimeric house dust mite allergen , which combined partial dp2 ( 384 b . p ) and dp5 ( 342 b . p ) orfs ( dp25 ) ( seq id no . 57 ), and the nucleocapsid protein of watermelon silver mottle virus ( wnp ) ( chen et al ., 2005 , journal of virologuical methods 129 , 113 - 124 ) were amplified from respective constructs using specific primer pairs ( table 4 ). these amplified fragments were individually introduced into the petsa vector via suitable restriction sites ( fig1 c ). since the above manipulation , which introduced an inadvertent stretch of nucleotide encoding the hc - pro cleavable amino acid stretch yrvg / g , led to unintended post - translational removal of the tags from hc - pro , petsa - zhc - nss or petsa - zhc - his were modified by site - directed mutagenesis pcr using the primer pair p - nss - d6 / m - zhcd6 or p - his - d6 / m - zhcd6 to generate petsa - zhcd6 - nss or pet - zhcd6 - his . from the zymv vector p35zgfphis , which expresses c terminally his - tagged gfp in cucurbit plants ( hsu et al ., 2004 ), p35zgfpnss was generated by site - directed mutagenesis pcr using the primer pair p - zgn / m - zgn . to express n - terminally his - tagged gfp , p35znssgfp was generated from p35zgfphis by two successive site - directed mutagenesis with the primer pairs p - zng / m - zng that added the nss sequence at the n - extreme of gfp and pzdhis / m - zdhis that deleted the his - tag from p35zgfphis . primers were listed in table 5 ). the gfp orfs in p35znssgfp and pzgfpnss were replaced by the orfs of wsmov np ( chen et al ., 2005 ) via sphi / kpni sites or the chimeric dp25 orf via apai / bamhi sites to generate p35znsswnp , p35zwnpnss , p35znssdp25 and p35zdp25nss , respectively . in order to monitor the transient expression of nss - tagged recombinant proteins by agroinfiltration , the sequences of zymv hc - pro , wsmov np and gfp with the nss - tag ( either at n - or c - extreme ) or without tag were released from petsa vector and cloned into the binary pba vector ( niu et al ., 2006 , nature biotechnology 24 , 1420 - 1428 ) via ncoi / xhoi sites to generate the pba - nss - zhc , pba - zhc - nss , pba - zhc , pbanss - wnp , pba - wnp - nss , pba - wnp or pba - gfp . b . protein expression and detection by western blotting or indirect elisa in the present example , protein expression and detection were conducted by western blotting or indirect elisa by the steps as described as follows . the plasmids for protein expression were transferred into e . coli bl21 cells ( novagen , darmstadt , germany ); protein expression was performed as described in the manual of pet system ( novagen , darmstadt , germany ). the plasmids of zymv vector were introduced into the systemic host zucchini squash ( cucurbita pepo l . var . zucchi ) by particle bombardment ( hsu et al ., 2004 ). bacterial protein and zymv - infected tissue samples prepared following standard method were separated on a 12 % polyacrylamide gel containing sodium dodecyl sulfate . the resolved protein profiles were electro - blotted onto a nitrocellulose membrane using a bio - rad ® trans - blot ® apparatus ( trans - blot transfer medium , bio - rad , hercules , calif .) and the expressed proteins were separately detected using the nsscon monoclonal antibody ( mab ) ( 10 , 000 × dilution ) ( chen et al ., 2006 ), gfp antiserum ( 5000 × dilution ) ( hsu et al ., 2004 ), prsv nia - pro antiserum ( prepared against bacteria - expressed nia - pro in our laboratory , unpublished ) ( 5000 × dilution ), zymv hc - pro antiserum ( wu et al ., 2010 , molecular plant - microbe interactions 23 , 17 - 28 ) ( 5000 × dilution ), dp5 antiserum ( hsu et al ., 2004 ) ( 5000 × dilution ) or wsmov np mab ( lin et al ., 2005 , phytopathology 95 , 1482 - 1488 ) ( 10 , 000 × dilution ), following standard procedure . the zymv - expressed recombinant proteins were also monitored similarly using the same antisera . the signals were quantified relatively to the untagged proteins by kodak ® 1d image analysis software ( eastman kodak , rochester , n . y .). the feasibility of nss - tagged proteins for detection by indirect enzyme - linked immunosorbent assay ( elisa ) was examined . the elisa analysis of nss - tagged gfp and wsmov np expressed in bacterial and zymv viral vector systems were done with the nsscon mab ( chen et al ., 2006 ), gfp antiserum ( hsu et al ., 2004 ) wsmov np mab ( lin et al ., 2005 , phytopathology 95 , 1482 - 1488 ), as described earlier by yeh and gonsalves ( yeh and gonsalves , 1984 , phytopathology 74 , 1273 - 1278 ). in the present example , the results demonstrated that the four test proteins fused were detected by the nsscon mab , except for the hc - pro - nss fusion ( fig2 a ). this isolated failure was understood to be because of an hc - pro cleavage site ( yrvg / g ) inadvertently introduced during the construction , which allowed an autocatalytic cleavage by hc - pro ( carrington et al ., 1989 ) that removed the tag following translation . restoration of detection of nss - tag was accomplished by deletion of the cleavage site from the c - terminal region of hc - pro ( fig2 a , zhcd6nss ); however , the his - tag ® was still not detected ( fig3 b , zhcd6his ). expression levels of all recombinant proteins were similar , as shown by western blot assays using the individual antibodies against each protein ( fig2 a ). wnpro and wnp with his - tag ® at their n - termini and zhc - pro with his - tag ® at its c - terminus were not detected , while his - tagged dp25 at its n - terminus was barely detected . when an equal amount of 5 μg purified igg was used for comparison , the nss - tagged gpfs were detected at 256 × antigen dilution by nsscon mab , comparable to the detection sensitivity of the protein by gfp antiserum but superior to the detectablility of the his - tag ® mab which only detected his - tagged gfp up to 32 × dilution ( data not shown ). these results indicated that the nss - tag has greater detection sensitivity for recombinant proteins than the his - tag ®. the above results demonstrate that all the recombinant viruses were infectious and the nss - tagged recombinant proteins were detected by nsscon mab by western blotting from squash plants ( fig2 b and 3b ). the nss - tagged gfp and wnp expressed by bacterial or zymv vector system were also readily detected by elisa using nsscon mab . overall , the results indicate that the recombinant proteins tagged with the nss sequence can be readily detected by the nsscon mab , regardless of the nss - tagged terminus and that the nss sequence is suitable to be used as an epitope tag in both bacterial and plant viral vector expression systems . since the nss sequence is derived from the common epitope of the tospoviral ptgs suppressor , nss protein ( takeda et al ., 2002 , febs letters 532 , 75 - 79 ), in the present example examined was the possibility for nss - tag &# 39 ; s functional interference with the tagged zymv hc - pro , a gene silencing suppressor , and wsmov np , a non - gene silencing suppressor . the nss - tagged and non - tagged zymv hc - pro and wsmov np were separately constructed in a binary vector and expressed in leaves of n . benthamiana by agroinfiltration . in order to monitor the transient expression of nss - tagged recombinant proteins in plants by agroinfiltration , the sequences of zymv hc - pro , wsmov np and gfp fused with the nss sequence ( either at n - or c - extreme ) or without tag were released from petsa vector and cloned into the binary pba vector ( niu et al ., 2006 , nature biotechnology 24 , 1420 - 1428 ) via ncoi / xhoi sites to generate the pba - nss - zhc , pba - zhc - nss , pbazhc , pba - nss - wnp , pba - wnp - nss , pba - wnp or pba - gfp . these binary vectors were introduced into agrobacterium tumefaciens abi strain by eletroporation and cultured in luria - bertani medium ( lb ) with kanamycin and spectinomycin at 28 . 0 overnight . the cells were pelleted down and resuspended to an od600 of 1 . 0 in 10 mm mgcl 2 containing 0 . 015 mm acentonsyrigone and kept in room temperature for 3 hours . suspensions of a . tumefaciens abi carrying pbagfp ( a gfp expressor , driven constitutively by a 35 s promoter ), pbagfi ( a ⅔ gfp orf construct with inverted repeat and used as a silencing inducer , provided by dr shih - shun lin , national taiwan university , taiwan ) were mixed with individual constructed vectors ( ratio 1 : 1 : 1 ) and then injected into the lower side of leaves nicotiana benthamiana domin plants of 10 cm height stage by a syringe without needle and the plants were kept at 25 ° c . the empty vector pba ( niu et al ., 2006 ) was used as a negative control . the transiently expressed recombinant proteins at 3 dpi were monitored by chemiluminescent western blotting ( amersham , bucks , u . k .) using zymv hc - pro antiserum ( wu et al ., 2010 , molecular plant - microbe interactions 23 , 17 - 28 ), wsmov np mab ( lin et al ., 2005 , phytopathology 95 , 1482 - 1488 ) or nsscon mab ( chen et al ., 2006 ) as the primary antibody and horseradish peroxidase - conjugated goat anti - rabbit immunoglobulin ( amersham , bucks , u . k .) or horseradish peroxidase - conjugated goat anti - mouse immunoglobulin ( amersham , bucks , u . k .) as the secondary antibody . the gfp fluorescence was monitored at 3 dpi by a hand - held uv light b - 100ap ( uvp , ca , usa ) and photographed with a digital camera ( d7000 ™, nikon , japan ) with a cokin ™ p series filter ( cokin , 84 mm , 524 nm , french ). the above results demonstrated that at 3 dpi , recombinant zymv hc - pro tagged with the nss sequence , either at the n - or c - terminus , was readily detected by hc - pro antiserum and nsscon mab ( fig4 a ). the nss - tagged forms of wsmov np were expressed to similar levels , based on their detection by the np mab and nsscon mab ( fig4 a ). at 3 dpi , gfp expression was completely silenced when coinfiltrated with the gfi silencing inducer ( fig4 b ). in contrast , fluorescent signals of gfp were similar if coinfiltrated with the gfi construct with either the nss - tagged or non - tagged hc - pro ( fig4 b ). however , gfp expression was not restored if coinfiltrated with the gfi construct with the nss - tagged or non - tagged np ( fig4 b ). the results indicated that nss - tag renders the tagged transiently expressed recombinant proteins immunodetectable and the tag neither interferes with the suppressor activity of zymv hc - pro , nor confers the function of gene silencing suppression on wsmov np . the interaction of potyviral coat protein ( cp ) and hc - pro is essential for the aphid transmission of potyviruses ( atreya and pirone , 1993 proceedings of the national academy of sciences of the united states of america 90 , 11919 - 11923 ; granier et al ., 1993 , journal of general virology 74 , 2737 - 2742 ). in order to test if the nss sequence can be used for co - immunoprecipition analysis of interacting proteins , in the present example , either the bacteria - expressed nss - tagged zymv cp or nss - tagged hc - pro was treated with the other non - tagged interacting protein and the complex was immunoprecipitated using nsscon mab . zymv cp with or without nss - tag was first cloned into the petsa vector ( fig1 c ) by pcr with primers p - zcp and m - zcp ( table 4 ). e . coli bl21 cells were transformed with the individual plasmids carrying zymv cp ( petsa - nss - zcp , petsa - zcp - nss or petsa - zcp ). zymv hc - pro sequences with or without the nss - tag ( petsa - nss - zhc , petsa - zhcd6 - nss or petsa - zhc ) were also used for this example . following induced expression of recombinant proteins , e . coli cells were pelleted and resuspended in 1 ml extraction buffer ( 50 mm tris - hcl , 150 mm nacl , 0 . 5 % triton x - 100 , 5 % glycerol , 1 mm edta and 0 . 02 % nan 3 ) containing protease inhibitor cocktail ( roche diagnostics , in , usa ), lysed with a sonicator 250 - 450 sonifier analog cell disruptor ( branson , conn ., usa ) and then centrifuged at 13 , 000 rpm for 5 minutes . the presence of recombinant proteins in soluble fractions was confirmed with the antiserum against zymv cp ( hsu et al ., 2004 , journal of allergy and clinical immunololgy 113 , 1079 - 1085 ) or hc - pro ( wu et al ., 2010 , molecular plant - microbe interactions 23 , 17 - 28 ). aliquots of each 300 μl sample containing nss - tagged hc - pro or nss - tagged cp were mixed with each 100 μl sample containing non - tagged cp or non tagged hc - pro ( i . e ., nsszhc + zcp ; zhcnss + zcp or nsszcp + zhc ; zcpnss + zhc ) and incubated at 4 ° c . for 1 hour . purified igg of nsscon mab ( 100 μg , described above ) was added to each reaction mixture and incubated at 4 ° c . for 1 hour . then 25 μl mag protein a sepharose ™ ( ge healthcare life sciences , uppsala , sweden ) was added and the mixture was incubated further for 1 hour . the tubes were kept on a magnetic platform ( magrack6 ) to capture the mag protein a sepharose ™ beads . after washing with 600 μl extraction buffer two times , the beads were resuspended in 100 μl sample buffer and the immunoprecipitated proteins were analyzed by western blotting using the antiserum against zymv hc - pro or cp to detect the non - tagged protein pulled down by nsscon mab through co - immunoprecipitation with the nss - tagged proteins . according to the above results , the non - tagged hcpro was co - immunoprecipitated with the nss - tagged cps ( either nsszcp or zcpnss ) by nsscon mab and was able to be detected by hc - pro antiserum ( fig5 a ). similarly , the non - tagged cp was co - immunoprecipitated with nss - tagged hc - pros ( fig5 b ). taken together , the results demonstrated the co - immunoprecipitation of non - tagged hc - pro / cp with nss - tagged cp / hc - pro , implying that the nss - tag is applicable for co - immunoprecipitation analyses for protein - protein interactions . even though numerous characteristics and advantages of the present invention have been set forth in the foregoing description , together with details of the structure and features of the invention , the disclosure is illustrative only . changes may be made in the details , especially in matters of shape , size , and arrangement of parts within the principles of the invention to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed .	2
referring now to the drawings , wherein like reference characters represent like elements , there is shown a preferred embodiment of a topical hyperbaric apparatus 2 in accordance with the present invention . as is conventional , hyperbaric apparatus 2 is to be applied to the patient &# 39 ; s body for the treatment of various wounds and lesions . the hyperbaric apparatus 2 according to the present invention administers therapeutic gases to wound sites by creating a sealed internal chamber 4 which encapsulates such wound sites . when thus encapsulated , therapeutic gases are introduced , and the healing of such wounds is aided . fig1 illustrates a cross - sectional perspective view of the instant invention . hyperbaric chamber apparatus 2 is here cut along line 1 -- 1 of fig2 . internal chamber 4 may be seen as residing in the middle of a shell 10 having an opening 5 disposed on one end . gas introduction means 6 is seen passing through shell 10 and terminating at port 7 . pressure relief means 8 also passes through shell 10 and terminates at port 9 . ports 7 and 9 are sealably affixed to gas impermeable liner 12 . adhesive sealing means 30 is disposed about opening 5 . belting means 20 may be provided as well , as best viewed in fig4 . therein , hook affixing means 24 and loop fastening means 26 are also seen . fastening means 26 is superimposed over the entire length of belt 20 . affixing means 24 is disposed only at one end . the internal chamber 4 is sealed on top end 11 by gas impermeable liner 12 . gas impermeable liner 12 lines the inside of chamber 4 and , as stated , seals top end 11 of said chamber . this is best seen in fig1 where gas impermeable liner 12 and shell 10 are cut along line 1 -- 1 . referring now to fig2 shell 10 as configured , is of a doughnut shape , with non - permeable liner 12 creating a cuplike structure or sealed chamber 14 within shell 10 . the only passageways to such sealed chamber 14 are therapeutic gas introduction means 6 , pressure relief means 8 , and opening 5 . shell 10 is comprised of a base 18 and a short protuberance 19 at the bottom end 16 . circumscribing and disposed on the edge of short protuberance 19 is adhesive sealing means 30 . adhesive sealing means 30 , in conjunction with sealed chamber 14 , when applied to the patient &# 39 ; s body 1 , creates an encapsulated area except for the passageways represented by ports 7 and 9 , which are adapted to receive therapeutic gas introduction means 6 , and pressure relief means 8 , respectively . in use , therapeutic gas introduction means 6 is sealed by attachment to therapeutic gas source 40 and pressure relief means 8 is sealed by attachment to pressure release apparatus 50 . in a preferred embodiment of the present invention , shell 10 , in conjunction with gas impermeable liner 12 and adhesive sealing material 30 , is affixed to the patient &# 39 ; s body so as to encapsulate within sealed chamber 14 a treatable lesion . therapeutic gas source 40 is connected to this sealed chamber by therapeutic gas introduction means 6 and port 7 . therapeutic gases are then introduced within sealed chamber 14 by port 7 . such therapeutic gases pressurize sealed chamber 14 and ultimately pass by way of port 9 through pressure relief means 8 to pressure relief apparatus 50 . belt 20 is correspondingly wrapped around the patient &# 39 ; s body 1 so as to reinforce and secure the sealed chamber 14 to the patient &# 39 ; s body . as thus configured , the patient 1 need only ensure that therapeutic gas source 40 is introducing the therapeutic gases within the proper parameters by viewing control means 42 . at that point , pressure relief apparatus 50 will ensure that the optimal conditions are maintained within the chamber itself . in this embodiment , pressure relief apparatus 50 is a static pressure relief valve . the atmosphere within sealed chamber 14 may also be moisturized by humidification means 44 . fig5 and 6 illustrate the preferred method of application of the present invention . hyperbaric chamber apparatus 2 is here affixed to the lower back in the region of the upper buttock , specifically in the region of the division between buttocks . in this figure , the hyperbaric chamber apparatus 2 is secured to the patient 1 by means of belt 20 . belt 20 is depicted as translucent , therefore , internal chamber 4 may be viewed within shell 10 . therapeutic gas introduction means 6 is attached to therapeutic gas source 40 , humidification means 44 , and control means 42 . pressure relief means 8 is here connected to pressure relief apparatus 50 . in fig6 protuberance 19 is seen as conforming with an irregularly shaped portion of the patient &# 39 ; s body 1 . in this embodiment , shell 10 is preferably comprised of a polyurethane foam 32 and is conformable to the shape of the surface to which it is applied . polyurethane foam 32 is characterized by a 1 . 4 - pound density , a 34 - pound indent load defamation , and is also fire retardant . gas impermeable liner 12 may be any flexible and gas impermeable material , such material being well known , such as the occlusive poly film material manufactured by the 3m corporation under the trademark blend derm . adhesive sealing means 30 is most preferably a hydrofluid material capable of repeated use and rejuvenation . such adhesive means 30 , for proper use , must also be hypoallergenic . such characteristics are present in the adhesive material karaya , a naturally occurring polymer resin . as thus embodied , the present invention introduces an improved method of sealing which produces a hermetic seal . this improved method of sealing also produces numerous beneficial end results , such as portability , hermetic sealing in a portable device , the ability to treat previously untreatable wound sights , lower cost , and disposability . the present invention , by creating a less complicated sealing means and hyperbaric apparatus , is extremely portable . the instant invention weighs in a preferred embodiment , less than 2 pounds , is small in size , and is easily transported . also , because of its low pressure and volume requirements , the present invention allows for the use of the smaller and more portable e size oxygen cylinders . the prior hyperbaric chamber devices , such as lo piano , and lasley , required the much larger h and k size cylinders . this is a significant advance . in addition , the present invention obviates the need for trained personnel for its application . this portability will also facilitate uses heretofore unavailable , such as uses in less accessible locations by people who would not usually have such apparatus available and will allow for patients receiving such treatment to have more normal lives and broader range of travel . not only will the present invention provide a portable hyperbaric chamber , as a result of adhesive sealing means 30 and the flexibility of shell 10 , it also provides a portable hyperbaric chamber with the desired hermetic seal . this hermetic seal has many advantages . it allows for absolute control of the chamber &# 39 ; s environment . leaks which previously made control of the various parameters nearly impossible , will be greatly reduced . this hermetic seal will allow for the optimum conditions to be maintained within the chamber . the flow of the oxygen , the pressure of the oxygen , and the various other stimuli that are introduced within the chamber will be easily regulatable . also as a result of adhesive sealing material 30 and shell 10 , the present invention also facilitates the treatment of wound sights previously untreatable in the absence of relatively sophisticated and cumbersome devices . for instance , lesions in the area of the buttock or bony protrusions of the hip are now treatable . this is particularly significant , because quite often treatable lesions occur in such areas . this device , with respect to such awkwardly placed lesions , will rival the effectiveness of more cumbersome and sophisticated machines . another dramatic result of the present invention is its lower manufacturing cost . the introduction of polyurethane foam 32 and adhesive sealing material 30 to the hyperbaric chamber environment facilitates the manufacture of a particularly useful device for a relatively low price . this will decrease end user cost and conversely increase end user use . as previously stated , this will enable many patients , who in the past were unable to afford such treatment , to now receive the proper therapy . the lower manufacturing costs of the present device will produce wide ranging changes in the use of hyperbaric chambers . hyperbaric chambers will become more widely available . for instance , a local drugstore which could not possibly afford to carry the previous embodiments of hyperbaric chambers , will be able to carry the present invention . further , remote locations which may only store items which ( 1 ) are absolutely necessary , or ( 2 ) are affordable enough to keep one on hand just in case , will be able to stock the present invention . the instant invention will also lead to wider use of hyperbaric chambers for the treatment of appropriate wounds . the &# 34 ; reluctant patient &# 34 ; will be much more likely to utilize a device which is low in cost and simple to use . the instant device , because of its low cost and ease of application as a result of adhesive sealing material 30 , is particularly conducive to home treatment . the instant device &# 39 ; s ease of application further reduces cost by not requiring application by a trained technician . such ease of use will also facilitate wider use by allowing those physically incapable of applying the previous embodiments of portable hyperbaric chambers to apply the present invention by themselves . the present invention will also allow for hyperbaric chamber treatments to be applied in area where it was previously inefficient and cost ineffective to do so . for instance , the treatment of minor wounds , such as burns , which would clearly heal over time and not require sophisticated treatment such as hyperbaric chamber treatment , will now be able to be healed faster by exposure to the hyperbaric atmosphere using the instant invention . previously , such a course of treatment would have been cost ineffective and only available to those able to afford the finest of treatment . the present invention will allow many more people to receive hyperbaric healing treatments . another benefit which flows from such lower cost , is the ability to create a disposable hyperbaric chamber . this ability and result is significant and dramatic . there has been a significant need for such a disposable hyperbaric chamber in multi - patient health care facilities . in such facilities , there exists a considerable handicap in the use of hyperbaric chambers , namely , between each use , the device necessarily required sterilization . further , there is always the risk of spreading the contagion of an infectious disease . these factors limited the availability of hyperbaric chamber atmosphere treatment . with the relatively large investment required for institutions to purchase such devices , it was prohibitive to purchase enough devices to treat all patients as would optimally be required . this produces a situation in which patients are placed on waiting lists and required to take treatments as the devices become available . the present invention will allow the device to be purchased on a per - patient basis and , at the end of the patient &# 39 ; s use , be disposed of or be taken home . this will allow more patients to obtain this treatment more frequently . for example , according to one study , thirty - eight percent of the patients in nursing homes have bedsores . as these types of devices are used today , those patients are required to wait until such equipment becomes available for their use . because of the prohibitive costs , such patients may only be treated on a daily basis or less , rather than the twice daily optimum treatment schedule . the present device will allow for each patient to purchase their own hyperbaric chamber , which may be disposed of after use or be taken home when the patient is to be discharged . the present invention , as previously mentioned , also simplifies the application and operation of such devices . because the present invention is sealed by non - permeable liner 12 , adhesive sealing material 30 and is secondarily reinforced by a belt 20 , the patient is much more capable than previously possible to apply the instant device him or herself . such ease of use will produce similar benefits to those created by lower cost and , in fact , make such benefits only more likely . although the invention herein has been described with reference to a specific embodiment , it is to be understood that this embodiment is merely illustrative of the principles and applications of the present invention . more specifically , it is to be understood that the embodiment , as represented in the detailed description of the present invention , is that embodiment which the inventor presently believes to be preferred . it is to be understood that numerous modifications may be made to the illustrative embodiment and that other arrangements may be devised from the spirit and scope of the present invention as defined by the appended claims .	0
the following detailed description is of the best presently contemplated modes of carrying out the invention . this description is not to be taken in a limiting sense , but is made merely for the purpose of illustrating general principles of embodiments of the invention . the scope of the invention is best defined by the appended claims . in certain instances , detailed descriptions of well - known devices and mechanisms are omitted so as to not obscure the description of the present invention with unnecessary detail . fig1 - 9 illustrate one embodiment of a trash can assembly 20 according to the present invention . the assembly 20 has an outer shell 22 and an inner liner 24 that is adapted to be retained inside the outer shell 22 . the outer shell 22 is a four - sided shell that has four side walls , including a front wall 42 . it is also possible to provide the outer shell 22 in a generally cylindrical , oval or egg shape . the inner liner 24 can have the same , or different , shape as the outer shell 22 . the lid is made up of two separate lid portions 26 and 28 that are split at about the center of the outer shell 22 , each of which is hingedly connected to an upper support frame 130 ( see fig7 ) along a top side edge of the outer shell 22 in a manner such that the lid portions 26 , 28 pivot away from each other ( see arrows m in fig4 ) when they are opened . the outer shell 22 and its lid portions 26 and 28 can be made of a solid and stable material , such as a metal . the upper support frame 130 can be secured to the opened top of the outer shell 22 , and can be provided in a separate material ( e . g ., plastic ) from the outer shell 22 . each lid portion 26 , 28 has a side edge 30 that has a sleeve 32 extending along the side edge 30 . a shaft ( not shown ) is retained inside the sleeve 32 and has opposing ends that are secured to one side edge of the upper support frame 130 , so that the lid portion 26 , 28 can pivot about an axis defined by the shaft and its corresponding sleeve 32 . an l - shaped bracket 34 is secured at the rear end of each lid portion 26 , 28 . one leg of the bracket 34 is secured to the underside of the lid portion 26 , 28 , and the other leg of the bracket 34 has an opening 40 that is adapted to receive an upper hooked end 36 of a corresponding lifting rod 38 . in addition , a toe - kick recess 44 can be provided on the outer shell 22 adjacent the base 46 of the outer shell 22 , and is adapted to receive a foot pedal 48 that is pivotably secured to a pedal bar 60 in the base 46 . the toe - kick recess 44 can be formed as part of the base 46 , and the outer shell 22 would define a curved cut - out to receive the recess 44 . the curved cut - out in the shell 22 can be made by first cutting out a properly sized and configured hole in the body of the outer shell 22 , and then inserting a plastic curved panel that defines the actual recess 44 . the recess 44 extends into the interior confines of the outer shell 22 ( as defined by the periphery of the outer shell 22 ). the recess 44 also extends upwardly for a short distance from the base 6 . the pedal bar 60 is made of a material ( e . g ., metal ) that carries some weight , and extends from the foot pedal 48 along the base 46 and is then pivotably coupled to the lifting rods 38 that extend upwardly along the rear of the outer shell 22 to connect the lid portions 26 , 28 . the pedal bar 60 and the lifting rods 38 operate to translate an updown pivot motion of the pedal 48 to an up - down pivot motion for the lid portions 26 , 28 . each of these components will be described in greater detail hereinbelow . referring now to fig3 - 6 , the base 46 of the outer shell 22 has a raised or domed base panel 52 and a skirt or flange portion 50 that extends from the base panel 52 . in one embodiment of the present invention , the base panel 52 , the skirt 50 and the recess 44 can be formed in one plastic piece . the pedal bar 60 is retained under the base panel 52 and inside the skirt 50 . the pedal bar 60 has two short side walls 64 . the front of the pedal bar 60 is attached to the pedal 48 , and the rear of the pedal bar has two opposite holes 62 . one of the holes 62 is provided on each of the two opposing side walls 64 , and each hole 62 receives a lower hooked end 66 of a corresponding lifting rod 38 . a fulcrum rod 68 extends through the two side walls 64 of the pedal bar 60 at a location that is closer to the front of the pedal bar 60 than the rear of the pedal bar 60 . thus , the pedal bar 60 can be pivoted about a pivot axis defined by he fulcrum rod 68 . in particular , the pedal bar 60 can be pivoted between two positions , a first rest position as shown in fig2 where the pedal 48 is at a vertically higher position than the rear of the pedal bar 60 , and a second open position ( where the lid portions 26 , 28 are opened ) as shown in fig5 where the pedal 48 is pressed to a vertically lower position than the rear of the pedal bar 60 . thus , the fulcrum rod 68 is positioned at a location that is closer to the front of the pedal bar 60 than the rear of the pedal bar 60 so that the portion of the pedal bar 60 that is rearward of the fulcrum rod 68 would be greater ( and therefore heavier ) than the portion of the pedal bar 60 that is forward of the pedal bar 60 , thereby causing the rear of the pedal bar 60 to be at a vertically lower position than the pedal 48 when in the rest position of fig2 . as shown in fig5 the base panel 52 defines a recessed region 70 with a soft material 72 ( e . g ., a foam sponge ) secured below the recessed region 70 . the recessed region 70 acts as a stop member in that it prevents the rear of the pedal bar 60 from being raised to a vertical level that exceeds the vertical position of the recessed region 70 , as shown in fig5 . the soft material 72 therefore functions as a noise and contact absorber so that there will be minimal noise and wear on the pedal bar 60 when it contacts the recessed region 70 . in many applications , given the dimensions of the base 46 , it will be difficult to first position the pedal bar 60 inside the base 46 and then attempt to fit a lengthy fulcrum rod inside the base 46 and insert the fulcrum rod through the pedal bar 60 . therefore , the present invention provides a novel method for securing the fulcrum rod 68 in its desired position with respect to the base 46 and the pedal bar 60 . first , referring to fig6 the base panel 52 is provided with a column 74 that extends vertically downwardly from the base panel 52 , and the column 74 has a horizontal bore ( not shown ) that opens towards the center of the base 46 . next , the fulcrum rod 68 is extended through opposing and aligned openings in the two side walls 64 so that the two opposing ends 76 , 78 of the fulcrum rod 68 extend beyond the side walls 64 . in the next step , the pedal bar 60 and the fulcrum rod 68 are positioned inside the base panel 52 , with one end 76 of the fulcrum rod 68 positioned inside the bore of the column 74 . the other end 78 of the fulcrum rod 68 has a flat configuration with a hole ( not shown ), so that a screw 80 can be threaded through the hole in the end 78 to secure the fulcrum rod 68 to the base panel 52 . a pair of springs 84 and 86 are provided to normally bias the lid portions 26 , 28 to the closed position shown in fig2 . referring to fig2 - 4 , each spring 84 , 86 has a first end 90 that is secured to the base panel 52 , and a second end 92 that is secured to a bent portion 94 of one of the lifting rods 38 . thus , when the assembly 20 is not experiencing any external forces ( i . e ., it is in the closed position ), the springs 84 , 86 will normally bias the lifting rods 38 in the downward vertical direction , thereby causing the lid portions 26 , 28 to be closed . the springs 84 , 86 also prevent the lower hooked ends 66 from becoming disengaged from the rear of the pedal bar 60 , and takes out any slack in the linkage involving the lifting rods 38 . the assembly 20 provides a motion damper 96 that functions to dampen the closing motion of the lid portions 26 , 28 so that the lid portions 26 , 28 can close slowly and not experience a hard slamming motion . the motion damper 96 is illustrated in greater detail in fig9 and can be embodied in the form of the “ rotary motion damper ” sold by itw delpro of frankfort , ill ., although other known and conventional motion dampers can be utilized without departing from the scope of the present invention . the motion damper 96 has a toothed bar 98 with a row of teeth 100 positioned along a side thereof . one end of the toothed bar 98 has a pair of aligned openings 102 . a platform 104 has a pair of guides 106 that receive the toothed bar 98 . a toothed damping wheel 108 is carried on the platform 104 and is adapted to engage the teeth 100 on the toothed bar 98 as the platform 104 experiences relative movement in both directions ( see arrows a and b ) along the toothed bar 98 . assuming that the damping wheel 108 remains stationary , when the toothed bar 98 moves in the direction b , the damping wheel 108 does not offer any resistance so the toothed bar 98 can move smoothly and quickly in the direction b . however , when the toothed bar 98 moves in the direction a , the damping wheel 108 does offer resistance so the toothed bar 98 can only move very slowly in the direction a . the motion damper 96 is positioned in the interior of the outer shell 22 , and is secured to both the base panel 52 and the pedal bar 60 . in particular , the platform 104 has a connecting element 110 that is secured to a bracket ( not shown ) in the base panel 52 . the bracket can be secured to the base panel 52 by a screw 116 as shown in fig2 . in addition , the end of the toothed bar 98 with the aligned openings 102 extends through an opening in the base panel 52 , and a damping rod 112 secured to the pedal bar 60 extends through the openings 102 ( see fig5 and 6 ) to couple the toothed bar 98 to the pedal bar 60 . thus , the platform 104 of the motion damper 96 is essentially fixed at a stationary position with respect to the base panel 52 , and the toothed bar 98 can be moved up or down ( i . e ., in the directions b or a ) as the rear end of the pedal bar 60 is pivoted up or down by the pedal 48 . the operation of the trash can assembly 20 will now be described . when the assembly 20 is not in use , the lid portions 26 , 28 are normally closed as shown in fig2 . at this position , the springs 84 and 86 are relaxed and do not exert any bias . to open the lid portions 26 , 28 , the user steps on the pedal 48 , which pivots the pedal bar 60 about the fulcrum rod 68 with the pedal 48 moving vertically downward , and the rear end of the pedal bar 60 being pivoted vertically upwardly . the soft material 72 provides a buffer or absorber to minimize any noise that may be caused by the pedal bar 60 contacting the recessed region 70 . as shown in fig3 - 5 and 7 - 8 , the rear end of the pedal bar 60 pushes the lifting rods 38 upwardly , so that the lifting rods 38 will push the lid portions 26 , 28 open about the pivoting of the shafts in the sleeves 32 . the lid portions 26 , 28 will pivot away from each other to expose the top of the of the outer shell 22 . simultaneously , the damping rod 112 will push the toothed bar 98 upwardly ( i . e ., in the direction b in fig9 ). as described above , the damping wheel 108 will not offer any resistance to the movement of the toothed bar 98 , so the entire lifting motion of the rear of the pedal bar 60 and the lifting rods 38 will be smooth and relatively quick . at this opened position , the springs 84 and 86 are stretched and therefore biased . as long as the user maintains his or her step on the pedal 48 , the bias of the springs 84 , 86 is overcome , the rear of the pedal bar 60 will remain in the position shown in fig5 and the lid portions 26 , 28 will remain opened . when the user releases the pedal 48 , the combined weight of the pedal bar 60 ( i . e ., a pulling force ) and the lid portions 26 , 28 ( i . e ., pushing forces ), as well as gravity and the natural bias of the springs 84 , 86 , will cause the lid portions 26 , 28 will pivot downwardly to their closed positions . in other words , the lifting rods 38 , the toothed bar 98 and the pedal bar 60 will all experience a downward motion . in this regard , the fact that the fulcrum rod 68 is positioned closer to the pedal 48 ( i . e ., the front of the pedal bar 60 ) means that the rear of the pedal bar 60 is actually heavier , and will exert a force to aid in pulling the lifting rods 38 down in a vertical direction . however , the damping wheel 108 will resist the downward vertical movement ( i . e ., in the direction of arrow a in fig9 ) of the toothed bar 98 , so the entire downward motion of the rear of the pedal bar 60 and the lifting rods 38 will be slowed . by slowing this downward motion of the pedal bar 60 and the lifting rods 38 , the lid portions 26 , 28 will close slowly , and the pedal bar 60 will be lowered slowly , all to avoid any annoying loud slamming actions or noises . referring now to fig2 and 7 , the upper support frame 130 has a border shoulder 132 that extends along its inner periphery which is adapted to receive the upper lip 140 of the inner liner 24 so that the inner liner 24 can be suspended on the shoulder 132 inside the outer shell 22 during use . the support frame 130 has opposing ends 134 and 136 , with a scalloped groove 138 formed in each end 134 , 136 . the scalloped grooves 138 allow the user to insert his or her fingers into the grooves 138 under the upper lip of the inner liner 24 to lift the inner liner 24 from the interior of the outer shell 24 when the lid portions 26 , 28 are opened . this provides a convenient way for the user to remove the inner liner 24 from the outer shell 22 , without requiring the user to grab or grip unnecessarily large portions of the inner liner 24 . the hinged connection of the lid portions 26 , 28 to the upper support frame 130 shown in fig7 can be modified as shown in fig1 - 14 . in fig7 each lid portion 26 , 28 has a metal shaft that is retained in a sleeve 32 and has opposing ends that are secured to the upper support frame 130 in a manner such that the corresponding lid portion 26 or 28 can pivot about an axis defined by the shaft and the sleeve 32 . the sleeve 32 can be formed by curling part of the edge of the metal lid portion 26 , 28 in a manner that leaves a longitudinal opening along the length of the sleeve 32 between the outermost edge of the sleeve 32 and the lid portion 26 , 28 . this curling is best illustrated in fig1 in connection with the sleeve 32 a . the metal shaft can be retained inside this sleeve 32 . unfortunately , the metal - on - metal contact between the shaft and the sleeve 32 causes wear and tear , and result in the generation of squeaky noises when the shaft pivots inside the sleeve 32 . in addition , after extended use , food , dust and other waste matter may enter the interior of the sleeve 32 via the longitudinal opening , which may impede the pivoting motion of the shaft inside the sleeve 32 . the present invention provides a modified connection in fig1 - 14 that overcomes these drawbacks . the same numeral designations will be used to designate the same elements in fig7 and 10 - 14 , except that an “ a ” will be added to the designations in fig1 - 14 . in the embodiment shown in fig1 - 14 , the metal shaft 200 is retained inside a non - metal ( e . g ., plastic ) tube 202 , which is in turn retained inside the sleeve 32 a , as best shown in fig1 . the tube 202 has a generally cylindrical configuration with a protruding edge 204 extending along the length of the tube 202 . the protruding edge 204 is configured as a somewhat rectangular block that is adapted to fit snugly into the longitudinal opening of the sleeve 32 a , thereby blocking the longitudinal opening and preventing dust and particles from entering the interior of the sleeve 32 a . as best shown in fig1 , the tube 202 does not completely fill up the interior space of the sleeve 32 a . the tube 202 has an interior bore 206 through which two separate shaft pieces 208 can be inserted . both shaft pieces 208 can be identical in construction , with one provided at each of the opposing ends of the tube 202 . the shaft pieces 208 can be made from metal . as best shown in fig1 , each shaft piece 208 has a smaller - diameter inner section 210 and a larger - diameter outer section 212 . the inner section 210 is inserted into the bore 206 at one end of the tube 202 , and the outer section 212 has a larger diameter to ensure that part of the shaft piece 208 remains outside the bore 206 . to assemble the lid portion 26 , 28 , the user or manufacturer first inserts the tube 202 into the sleeve 32 a in a manner such that the protruding edge 204 is snugly fitted into the longitudinal opening of the sleeve 32 a . the sleeve 32 a and its tube 202 are then placed into the appropriate location on the side edge of the upper support frame 130 as shown in fig1 . then , as shown in fig1 , the inner section 210 of each shaft piece 208 is inserted through bores 218 in the upper support frame 130 that are aligned with the bore 206 of the tube 202 when the sleeve 32 a and its tube 202 are positioned in the upper support frame 130 . the inner section 210 will extend through the bore 218 in the upper support frame 130 and then into the bore 206 of the tube 202 . a portion of the outer sections 212 of the shaft pieces 212 will be exposed to the outside of the bore 218 , but most of the outer sections 212 will be positioned inside the bore 218 . with one shaft piece 208 provided at each opposing end of the tube 202 and sleeve 32 a , the lid portions 26 , 28 can pivot about the axis defined by these shaft pieces 208 . a small opening 220 is provided on the protruding edge 204 adjacent each end of the tube 202 . the free end of the inner section 210 of each shaft piece 208 is positioned adjacent this opening 220 . as a result , a user can remove the lid portions 26 , 28 by inserting a sharp - tip object ( e . g ., screw - driver ) through the openings 220 ( see fig1 ) and pushing the inner section 210 of each shaft piece 208 out of the bores 206 and 218 . thus , the provision of the non - metal tube 202 provides two immediate benefits . first , the protruding edge 204 prevents dust and particles from entering the interior of the sleeve 32 a . second , the non - metal material of the tube 202 eliminates the metalon - metal contact or grinding of a pivoting metal shaft within a metal sleeve . [ 0054 ] fig1 and 15 also illustrate another modification , where a non - metal ( e . g ., plastic ) washer 230 can be provided to prevent the undesirable metal - to - metal grinding between the bracket 34 and the upper hooked end 36 of the lifting rod 38 . specifically , a plastic washer 230 can be positioned in the opening 40 in the bracket 34 . the washer 230 can have a sleeved configuration with a flange 232 so that the upper hooked end 36 can extend through the washer 230 . as a result , the washer 230 acts as a separating layer between the metal upper hooked end 36 and the metal bracket 34 . fig1 - 9 illustrate the use of one inner liner 24 , but it is also possible to provide two or more inner liners . for example , fig1 and 17 illustrate two inner liners 24 a and 24 b that can be configured to fit snugly , and in side - by - side fashion , inside the outer shell 22 . the provision of two inner liners 24 allows the user to sort the trash , for example , to separate recycleable waste matter from other waste matter . the above detailed description is for the best presently contemplated modes of carrying out the invention . this description is not to be taken in a limiting sense , but is made merely for the purpose of illustrating general principles of embodiments of the invention . the scope of the invention is best defined by the appended claims . in certain instances , detailed descriptions of well - known devices , components , mechanisms and methods are omitted so as to not obscure the description of the present invention with unnecessary detail .	1
references in this specification to “ an embodiment ”, “ one embodiment ”, or the like , mean that the particular feature , structure or characteristic being described is included in at least one embodiment of the present invention . occurrences of such phrases in this specification do not necessarily all refer to the same embodiment . the following detailed description is described with reference to a storage system environment ; however , it is appreciated that the systems , methods , and data structures described herein are equally applicable to any data processing system utilizing a key - value map in conjunction with a data buffer . fig1 shows an example of a network storage system 100 , which includes a plurality of client systems 104 a - n ( collectively referred to herein as “ clients 104 ,” or any one client system individually , as “ client 104 ”), a storage server 108 , and a network 106 connecting the client systems 104 and the storage server 108 . as shown in fig1 , the storage server 108 is coupled with a number of mass storage devices ( or storage containers ) 112 a - n ( collectively referred to herein as “ storage containers 112 ,” or any one storage container individually , as “ storage container 112 ”), such as disks , in a mass storage subsystem 105 . alternatively , some or all of the mass storage devices 112 can be other types of storage , such as flash memory , solid - state drives ( ssds ), tape storage , etc . however , for ease of description , the storage devices 112 are assumed to be disks herein . the storage server 108 can be , for example , one of the fas - series of storage server products available from netapp ®, inc . the client systems 104 are connected to the storage server 108 via the network 106 , which can be a packet - switched network , for example , a local area network ( lan ) or wide area network ( wan ). further , the storage server 108 can be connected to the disks 112 via a switching fabric ( not shown ), which can be a fiber distributed data interface ( fddi ) network , for example . it is noted that , within the network data storage environment , any other suitable number of storage servers and / or mass storage devices , and / or any other suitable network technologies , may be employed . the storage server 108 can make some or all of the storage space on the disk ( s ) 112 available to the client systems 104 in a conventional manner . for example , each of the disks 112 can be implemented as an individual disk , multiple disks ( e . g ., a raid group ) or any other suitable mass storage device ( s ). storage of information in the mass storage subsystem 105 can be implemented as one or more storage volumes that comprise a collection of physical storage disks 112 cooperating to define an overall logical arrangement of volume block number ( vbn ) space on the volume ( s ). each logical volume is generally , although not necessarily , associated with its own file system . the disks within a logical volume / file system are typically organized as one or more groups , wherein each group may be operated as a redundant array of independent ( or inexpensive ) disks ( raid ). most raid implementations , such as a raid - 4 level implementation , enhance the reliability / integrity of data storage through the redundant writing of data “ stripes ” across a given number of physical disks in the raid group , and the appropriate storing of parity information with respect to the striped data . an illustrative example of a raid implementation is a raid - 4 level implementation , although it should be understood that other types and levels of raid implementations may be used according to the techniques described herein . one or more raid groups together form an aggregate . an aggregate can contain one or more volumes . the storage server 108 can receive and respond to various read and write requests from the client systems 104 , directed to data stored in or to be stored in the storage subsystem 105 . the storage server 108 also includes an internal buffer cache 110 , which can be implemented as dram , for example , or as non - volatile solid - state memory , such as flash memory . in one embodiment , the buffer cache 110 comprises a host - side flash cache that accelerates i / o . although not shown , in one embodiment , the buffer cache 110 can alternatively or additionally be included within one or more of the client systems 104 . although the storage server 108 is illustrated as a single unit in fig1 , it can have a distributed architecture . for example , the storage server 108 can be designed as a physically separate network module ( e . g ., “ n - blade ”) and disk module ( e . g ., “ d - blade ) ( not shown ), which communicate with each other over a physical interconnect . such an architecture allows convenient scaling , such as by deploying two or more n - blades and d - blades , all capable of communicating with each other through the interconnect . further , a storage server 108 can be configured to implement one or more virtual storage servers . virtual storage servers allow the sharing of the underlying physical storage controller resources , ( e . g ., processors and memory , between virtual storage servers while allowing each virtual storage server to run its own operating system ) thereby providing functional isolation . with this configuration , multiple server operating systems that previously ran on individual machines , ( e . g ., to avoid interference ) are able to run on the same physical machine because of the functional isolation provided by a virtual storage server implementation . this can be a more cost effective way of providing storage server solutions to multiple customers than providing separate physical server resources for each customer . fig2 is a diagram illustrating an example of the hardware architecture of a storage controller 200 that can implement one or more network storage servers , for example , storage server 108 of fig1 . the storage server is a processing system that provides storage services relating to the organization of information on storage devices , such as disks 112 of the mass storage subsystem 105 . in an illustrative embodiment , the storage server 108 includes a processor subsystem 210 that includes one or more processors . the storage server 108 further includes a memory 220 , a network adapter 240 , and a storage adapter 250 , all interconnected by an interconnect 260 . the storage server 108 can be embodied as a single - or multi - processor storage server executing a storage operating system 222 that preferably implements a high - level module , called a storage manager , to logically organize data as a hierarchical structure of named directories , files , and / or data “ blocks ” on the disks 112 . the memory 220 illustratively comprises storage locations that are addressable by the processor ( s ) 210 and adapters 240 and 250 for storing software program code and data associated with the techniques introduced here . for example , some of the storage locations of memory 220 can be used as a data buffer 224 , a key - value map 226 , and a key management engine 228 . the data buffer 224 temporarily stores data that is transferred between the clients 104 and the disks 112 . each non - empty entry in buffer 224 includes a key that is associated with a value of a key - value pair . the key - value map 226 stores the key - value pairs . in particular , each slot of the key - value map 226 is identifiable by a plurality of keys and includes a slot header ( or meta data ) and a slot value ( data ). the slot header indicates the status ( or state ) of each of the plurality of keys associated with the slot . at any given time , at most , a single key can be used as the current key ( i . e ., allocated key or next key to be allocated if all keys are unallocated ) for any given slot of the key - value map 226 . in some embodiments , each key is associated with a value or identifier ( id ) that uniquely identifies a data module . this may be useful if , for example , the size of the identifier is larger than the size of the key . the key management engine 228 includes software code configured to create and maintain the key - value map 226 and the keyspace ( i . e ., the plurality of keys associated with each slot ) using the slot headers . the processor 210 and adapters may , in turn , comprise processing elements and / or logic circuitry configured to execute the software code and manipulate the data structures . although not shown , in one embodiment , the data buffer 224 , the key - value map 226 , and / or the key management engine 228 can be included within one or more clients ( e . g ., client 104 of fig1 ). the storage operating system 222 , portions of which are typically resident in memory and executed by the processing elements , functionally organizes the storage server 108 by ( among other functions ) invoking storage operations in support of the storage service provided by the storage server 108 . it will be apparent to those skilled in the art that other processing and memory implementations , including various computer readable storage media , may be used for storing and executing program instructions pertaining to the techniques introduced here . similar to the storage server 108 , the storage operating system 222 can be distributed , with modules of the storage system running on separate physical resources . the network adapter 240 includes a plurality of ports to couple the storage server 108 with one or more clients 104 , or other storage servers , over point - to - point links , wide area networks , virtual private networks implemented over a public network ( internet ) or a shared local area network . the network adapter 240 thus can include the mechanical components as well as the electrical and signaling circuitry needed to connect the storage server 108 to the network 106 . illustratively , the network 106 can be embodied as an ethernet network or a fibre channel network . each client 104 can communicate with the storage server 108 over the network 106 by exchanging packets or frames of data according to pre - defined protocols , such as transmission control protocol / internet protocol ( tcp / ip ). the storage adapter 250 cooperates with the storage operating system 222 to access information requested by the clients 104 . the information may be stored on any type of attached array of writable storage media , such as magnetic disk or tape , optical disk ( e . g ., cd - rom or dvd ), flash memory , solid - state drive ( ssd ), electronic random access memory ( ram ), micro - electro mechanical and / or any other similar media adapted to store information , including data and parity information . however , as illustratively described herein , the information is stored on disks 112 . the storage adapter 250 includes a plurality of ports having input / output ( i / o ) interface circuitry that couples with the disks over an i / o interconnect arrangement , such as a conventional high - performance , fibre channel link topology . the storage operating system 222 facilitates clients &# 39 ; access to data stored on the disks 112 . in certain embodiments , the storage operating system 222 implements a write - anywhere file system that cooperates with one or more virtualization modules to “ virtualize ” the storage space provided by disks 112 . in certain embodiments , a storage manager 310 ( fig3 ) element of the storage operation system 222 logically organizes the information as a hierarchical structure of named directories and files on the disks 112 . each “ on - disk ” file may be implemented as a set of disk blocks configured to store information . as used herein , the term “ file ” means any logical container of data . the virtualization module ( s ) may allow the storage manager 310 to further logically organize information as a hierarchical structure of blocks on the disks that are exported as named logical units . fig3 schematically illustrates an example of the architecture 300 of a storage operating system 222 for use in a storage server 108 . in one embodiment , the storage operating system 222 can be the netapp ® data ontap ™ operating system available from netapp , inc ., sunnyvale , calif . that implements a write anywhere file layout ( wafl ™) file system . however , another storage operating system may alternatively be designed or enhanced for use in accordance with the techniques described herein . the storage operating system 222 can be implemented as programmable circuitry programmed with software and / or firmware , or as specially designed non - programmable circuitry ( i . e ., hardware ), or in a combination thereof . in the illustrated embodiment , the storage operating system 222 includes several modules , or layers . these layers include a storage manager 310 , which is the core functional element of the storage operating system 222 . the storage manager 310 imposes a structure ( e . g ., one or more file systems ) on the data managed by the storage server 108 and services read and write requests from clients 104 . to allow the storage server to communicate over the network 106 ( e . g ., with clients 104 ), the storage operating system 222 also includes a multi - protocol layer 320 and a network access layer 330 , logically under the storage manager 310 . the multi - protocol layer 320 implements various higher - level network protocols , such as network file system ( nfs ), common internet file system ( cifs ), hypertext transfer protocol ( http ), and / or internet small computer system interface ( iscsi ), to make data stored on the disks 112 available to users and / or application programs . the network access layer 330 includes one or more network drivers that implement one or more lower - level protocols to communicate over the network , such as ethernet , internet protocol ( ip ), tcp / ip , fibre channel protocol and / or user datagram protocol / internet protocol ( udp / ip ). also , to allow the device to communicate with a storage subsystem ( e . g ., storage subsystem 105 ), the storage operating system 222 includes a storage access layer 340 and an associated storage driver layer 350 logically under the storage manager 310 . the storage access layer 340 implements a higher - level storage redundancy algorithm , such as raid - 4 , raid - 5 or raid dp ®. the storage driver layer 350 implements a lower - level storage device access protocol , such as fibre channel protocol or small computer system interface ( scsi ). also shown in fig3 is the path 315 of data flow through the storage operating system 222 , associated with a read or write operation , from the client interface to the storage interface . thus , the storage manager 310 accesses the storage subsystem 105 through the storage access layer 340 and the storage driver layer 350 . clients 104 can interact with the storage server 108 in accordance with a client / server model of information delivery . that is , the client 104 requests the services of the storage server 108 , and the storage server may return the results of the services requested by the client , by exchanging packets over the network 106 . the clients may issue packets including file - based access protocols , such as cifs or nfs , over tcp / ip when accessing information in the form of files and directories . alternatively , the clients may issue packets including block - based access protocols , such as iscsi and scsi , when accessing information in the form of blocks . additionally , in the example of fig3 , a data buffer 312 is inserted in the path 315 of data flow through the storage operating system 222 . in one embodiment , the data buffer 312 comprises a circular buffer or cache system that acts as a first - in first out ( fifo ) queue . the circular buffer is configured to accelerate i / o operations on the main storage 105 . the data buffer 312 includes a plurality of entries ( see , for example , data buffer 450 of fig4 ). each non - empty entry in the data buffer 312 includes a key that corresponds to a specific source ( e . g ., storage container or disk ) in the main storage . a key - value map 314 is used to associate the keys with the identities of the specific sources . that is , to use the circular buffer , an identifier for each source is added to the key - value map so that a key is bound to that identifier . thus , in such an embodiment the number of sources that can use the circular buffer is limited to the number of slots in the key - value map . in some embodiments , the value bound to the current key in the slot of the key value map is a source identifier ( id ) associated with the source . it is appreciated that a key - value map can be used in different manners in other ( e . g ., non - storage ) environments . the storage operating system 222 includes a management layer 360 that provides a path for a network administrator to request network management operations ( e . g ., storage system configuration changes , etc . ), on the storage system . in one embodiment , the management layer includes a key management engine 370 that creates and maintains the key - value map 314 . for example , the key - value map 314 comprises slots that store opaque data blobs or values . accordingly , these values are only accessible via one or more commands issued from the key - management engine 370 . the commands can be a result of one or more system administer initiated operations such as , for example , add , get , and delete operations . additionally , the key management engine 370 must be able to recognize and track the status of invalid keys . for example , the data buffer , key management engine , or other management engine may issue a get operation to obtain the value bound to an invalidated key . the key - management engine 370 must be able to recognize and communicate the invalidity of the key to the caller ( e . g ., the data buffer 312 or other management engine ) so that the data in the buffer associated with the invalid key is not transferred ( e . g ., to / from clients or to / from main storage ). fig4 shows an example of the contents of a memory system 400 that includes at least one data buffer and at least one key - value map stored thereon , for example , memory 220 of fig2 . more specifically , fig4 illustrates how associating a plurality of keys with each slot of a key - value map , as described herein , can result in the ability to reuse slot entries when a key - value pair is deleted . memory system 400 includes a key - value map 410 , a keyspace 420 , a free slot list 430 , and a data buffer 450 . the memory system 400 can comprise one or more persistent memories such as disks , flash memory , solid - state drives ( ssds ), tape storage , etc ., and / or one or more non - persistent memories such as dram . however , it is appreciated that in order to achieve durability , the key - value map 410 must be stored or replicated on one or more persistent memories . although not shown for the sake of simplicity , in some embodiments the key - value map 410 includes both in - memory and persistent data structures . the in - memory data structures can be realized using a memory array . additionally , a persistent copy of the key - value map &# 39 ; s in - memory contents can also be stored on a non - volatile storage device . for example , the key - value map 410 can be implemented using flash storage on solid state drives ( ssds ). however , it is appreciated that any non - volatile storage medium can be used , including magnetic disk and phase - change memory . the persistent copy can be referred to as the map region . the map region is an array of map entries or slots . a slot &# 39 ; s index in the array is its “ key .” the key value map 410 is an array indexed from 0 to n − 1 where n is equal to the total number of map entries or slots in the key - value map . in the example of fig4 , n is equal to 4 . note that n can be any number ( i . e ., greater than , equal to , or less than 4 ); the value of n equal to 4 is chosen in this example for ease of description . continuing with the example of fig4 , the key value map 410 includes slots 411 - 414 . the slots 411 - 414 include slot headers 416 and slot values 418 . the slot headers 416 can include a variety of information including information for managing the plurality of keys associated with each slot . that is , at any given time each key of the plurality of keys associated with a slot is in one of three possible states . the states for the keys are tracked by the slot headers 416 . the slot headers 416 are discussed in greater detail with reference to fig5 . the slot values 418 are the values or identifiers that are stored with the current key . for example , values can be added to the key - value map 410 or bound to a key when an add operation is received . the add operation adds or associates the current key as defined in the slot header with a value . for example , in embodiments discussed herein related to the storage system environment , a value that is associated with a key can comprise , for example , a disk or storage container identifier . once the disk or storage container identifier is added to the key - value map 410 , then the disk or storage container can be cached or buffered . the disks or storage containers that can be cached or buffered can be a subset of the total number of disks or storage containers in use in some embodiments . the keyspace 420 includes all of the possible keys that can be used or associated with the slots of key - value map 410 . in this example , keyspace 420 includes 16 keys illustratively numbered 0 - 15 . it is appreciated that any number of keys can be used with the key - value map 410 as long as each slot is associated with at least a plurality of keys . the key management engine associates the keys in keyspace 420 with the slots . in one embodiment , the key management engine associates the keys in the keyspace 420 with the slots of the key - value map based on the total number of slots n , where a key k is defined to map or associate to a slot s by the function s = k % n . thus , given a keyspace with m possible values ( e . g ., a 32 - bit key value can have 2 32 possible values ), there are at most ceiling ( m / n ) possible keys that map to a particular slot . accordingly , in the example of fig4 , keys 0 , 4 , 8 , and 12 are associated with slot 0 ( slot 411 ); keys 1 , 5 , 9 , and 13 are associated with slot 1 ( slot 412 ); keys 2 , 6 , 10 , and 14 are associated with slot 2 ( slot 413 ); and keys 3 , 7 , 11 , and 15 are associated with slot 3 ( slot 414 ). the range or number of keys that can be associated with or map to a particular slot can thus be expressed as r = ceiling ( m / n ), where each of the slot &# 39 ; s r keys is in one of three states : unallocated , current , or wait . an individual keys state is determined based on information in the associated slot header 416 . in the unallocated state , the key is available to be assigned to a new value ( e . g ., the key is “ free ”). in the current state , the slot is currently storing the value for the key . in the wait state , the key has been deleted from the map and is waiting for indication from the buffer that any references to the key have been removed — at which point the key transitions the unallocated state . the state map that tracks the state of each key is discussed in greater detail with reference to fig6 . the key management engine 370 uses the free slot list 430 to track the free slots of the key - value map 410 . as shown in fig4 , free slot list 430 includes an entry for each slot 432 that indicates a “ free ” status . free slots are those slots that are currently in an unallocated state . that is , free slots are those slots that are neither associated with a value in the key - value map nor in the wait state subsequent to having the value previously associated with that key deleted . in some embodiments , the key management engine 370 can keep a separate free slot list 430 for each key - value map . alternatively or additionally , the key management engine 370 may read the slot headers 416 to determine whether a slot is free . in the example of fig4 , a value of “ 0 ” indicates that a slot is not available and a value of “ 1 ” indicates that a slot is available . accordingly , in the example of fig4 , slot 2 is the only available slot . because slot 2 ( slot 413 ) of key - value map 410 is available , none of the keys associated with the slot ( i . e ., keys 2 , 6 , 10 , or 14 ) are bound to the value ( i . e ., id — 2 ). each entry in the buffer 450 includes a reference key 452 and a buffer value 454 . in the example of fig4 , the buffer values 454 are illustrated as buffer_value — 1 through buffer_value — 11 , where each buffer value 454 is data cached from a system , disk , or storage container identifiable by the reference key ( i . e ., by using the key - value map 410 to obtain the value bound to the key ). although not shown , when the key previously associated or bound to the value “ id — 2 ” is deleted ( e . g ., keys 2 , 6 , 10 , or 14 ), the key management engine 370 either determines the current read location in the buffer 450 and tracks the buffer to identify when there are no more references to the key , or transfers a message to the buffer 450 or a buffer management engine ( not shown ) to request a notification of when no more references to the key are made in the buffer 450 ( i . e ., no more references are made to the deleted key in the reference key 452 ). fig5 shows an example of a persistent key - value slot header 500 that includes various fields . slot header 500 can be a detailed example of one of the slot headers 416 and slot values 418 discussed with reference to fig4 ; although other configurations are also possible . slot header 500 includes a sector field 510 , a map checksum field 512 , a current key position field 514 , a wait window start position field 516 , a flag field 518 , and a reserved field 520 . the map value field 522 is also shown which can be , for example , the key value field 418 of fig4 . it is appreciated that more or fewer field are possible . in one embodiment , the sector field 510 represents the sector containing the key - value map slot . the sector field 510 can be used to identify or detect misdirected i / o operations . the map checksum field 512 contains the computed checksum of the map entry . in some cases the checksum may be computed with all zeros for the checksum field 512 . the checksum may be used to detect corruption of the map entry . in one embodiment , the sector field 510 and the map checksum field 512 are optional . the map current key position field 514 , the wait window start position field 516 , and the flag field 518 are used in concert to determine the current state of the keys associated with a slot . the map current key position field 514 indicates the position of the current key . the current key can be indicated numerically ( shown in greater detail with reference to fig7 a - 7d ). the wait window start position field indicates the position of the first key in a wait state . that is , the keys typically enter the wait state on a first - in first - out ( fifo ) basis . the wait window indicates the first key of the plurality of keys associated with the slot that entered the wait state . the flag field numerically indicates the state of the slot . for example , the current key position field and the wait window start position field can both be set to the same value when initialized or when all keys are in a wait state . accordingly , the flag field can indicate when the slot is empty and none of the keys are assigned , when the slot is empty and all of the keys are in wait state , when the current key contains a bonded value , and when the current key does not contain a bonded value . each key state is discussed in greater detail with reference to fig6 . fig6 shows an example of a state diagram having the various states and state transitions associated with each key of the keyspace , for example , keyspace 420 of fig4 . more specifically , fig6 illustrates management of the keys of the keyspace by the management engine on a per slot basis . each key of the plurality of keys associated with a slot is always in one of three states : the unallocated state 610 , the allocated state 620 , or the wait state 630 . when initialized by the key management engine , a plurality of keys of the keyspace are associated with each slot . as discussed , each slot has a slot header including various fields . using fig4 as an example , keys 1 , 5 , 9 , and 13 of keyspace 420 , when initialized , are associated with slot 1 of key - value map 410 . association of the keys to the slots can be performed by the key management engine in a number of manners . in this example , the keys are associated based on the function s = k % n . in one embodiment , the header fields associated with slot 1 will be set at initialization . the current key position field is set to 0 ; the wait window start position field is set to 0 ; and the flag field is set to ‘ all empty .’ when the flag field is set to ‘ all empty ,’ the current key position and the wait window start position fields are ignored . thus , after initialization , the current key is the key corresponding to position 0 . more importantly , after initialization , all of the keys associated with a slot are in unallocated state 610 . at any given time , of the plurality of keys associated with the slot , more than one of the plurality of keys , or all of the keys , can be in the unallocated state 610 simultaneously . in the unallocated state 610 , there are no references to the key in the data buffer . moreover , when in the unallocated state 610 , a key is free to be assigned , associated or bound to a new value . when the keyspace management engine receives an add operation indicating a request from a user or system administrator to add or bind a key , one of the keys of the plurality of keys in the unallocated state 610 is bound to the new value and that key is put into the allocated state 620 . at any given time , at most , one of the keys of the plurality of keys associated with the slot can be in the allocated state 620 . in the current state , the slot is currently storing the value for the key . further , during the current state , the bound key may be referenced one or more times in the data buffer . these references are valid references or non - dirty references because , in the current state , the key has not yet been deleted . the key management engine receives a remove operation when , for example , a system administrator wants to remove one of the key - value pairs in the key - value map . the remove operation deletes the key - value pair or unbinds the key value pair . the key can be unbound from the value in the key - value map immediately ; however , the key may still be referenced in the data buffer . thus , after a key is deleted , the key is put into a wait state 630 . the wait state 630 is the period after a key has been deleted and before the key has been recycled ( i . e ., where recycling a key is defined as entering the unallocated state ). the key - value map structure can support a wait state of an arbitrary duration . multiple keys ( or all of the keys ) associated with a slot of the key - value map can be in wait state 630 simultaneously . however , keys must exit the wait state in the order in which they entered . during the wait state 630 , the key may be referenced one or more times in the data buffer . however , the references to the key are no longer valid because the key has been deleted . accordingly , these references in the data buffer are referred to as invalid or “ dirty ” keys . in one embodiment , the wait state can only be exited once all of the invalid keys are guaranteed to be removed from the data buffer . that is , the wait state 630 can only be exited once the invalid references no longer exit . in the case where a circular buffer ( or cache ) is used , the key management engine can guarantee that the invalid references no longer exists in the circular data buffer once the circular buffer has completed a full rotation . for example , when a delete operation is received at the key management engine , the key management engine puts the key to be deleted in a wait state and concurrently identifies the current read pointer or read location in the circular buffer . as the circular buffer increments , if an invalid key reference is determined to exist in the circular buffer , then the reference is deleted . thus , when the circular buffer completes a full rotation ( i . e ., after returning to the original read location ), the key management engine can then guarantee that any invalid references to the deleted key have been properly removed . at this point , the state of the key can transition back to the unallocated state . it is appreciated that the data buffer may use other ways to determine when the key is no longer referenced . fig7 a - 7d show examples illustrating a scheme of persistently tracking keys using one or more of the various fields of the persistent key - value slot headers , for example , slot header fields 416 of fig4 . more specifically , fig7 a - 7d illustrate an example of using the slot header fields to track the state ( unallocated , current , or wait ) of each of a plurality of key &# 39 ; s that are associated with a single slot while the slot is in use . the key tracking is illustrated using a key wheel 700 . referring first to fig7 a , which illustrates the key - wheel 700 for a single slot after initialization or when all the keys are empty ( not assigned or bound to a value ). in this example , the key - wheel 700 illustrates slot 1 of key - value map 410 . the key - wheel 700 includes key locations 0 , 1 , 2 , and 3 corresponding to keys 1 , 5 , 9 , and 13 , respectively . as shown in fig7 a , the current key position and the wait key position are both set to 0 corresponding to key 1 . further , the flag field in fig7 a is set to ‘ all empty .’ thus , in the example of fig7 a , each of the keys 1 , 5 , 9 , and 13 are in the unallocated state 610 . fig7 b illustrates key - wheel 700 after a key is bound to a new value . more specifically , key location 0 of slot 1 corresponding to key 1 of keyspace 420 is bound to a new value in the key - value map 410 . in this example , the current key position does not change because the current key position ( as determined by the current key position field ) is already set to 0 . however , the flag field is set to ‘ current full ’ indicating that the value in the value field is currently bound to the key indicated by the current key position field . the wait key position remains unchanged . in this case , key 1 of the keyspace 420 is in the allocated state and the remaining keys associated with slot 1 ( i . e ., keys 5 , 9 , and 13 ) remain in the unallocated state . fig7 c illustrates key - wheel 700 after the key - value pair assigned in fig7 b is deleted , a new key - value pair is assigned and deleted , and another new key value pair is assigned and deleted . more specifically , the value associated or bound to key 1 in fig7 b is first deleted . although not shown , at this point the current key position is incremented from key location 0 corresponding to key 1 to key location 1 corresponding to key 5 and the flag field is set to ‘ current empty ’ indicating that the current key position field is not currently filled . moreover , because key 1 was deleted , the state of the key is changed from the allocated state 620 to a wait state 630 . as previously discussed , when a key is deleted or in the wait state 630 , the key management engine either tracks the data buffer or requests a notification from a data buffer manager ( not shown ) for an indication of when there are no longer references to the deleted key in the data buffer . in this example , the key management engine requests a notification of when data buffer 450 no longer includes references to key 1 . a new value is then bound to or assigned to key 5 ( corresponding to key location 1 in the key - wheel 700 ) of the key - value map and subsequently deleted . although not shown , at this point the current key position in the key - wheel 700 is incremented from key location 1 corresponding to key 5 to key location 2 corresponding to key 9 . the flag is set to ‘ current empty ’ and because key 5 is deleted , it is placed in the wait state 630 . another new key value pair is then bound to or assigned to key 9 ( corresponding to key location 2 in the key - wheel 700 ) of the key - value map and subsequently deleted . the flag is set to ‘ current empty ’ ( after being set to ‘ current full ’ when the value is bound to key 9 ) and because key 9 is deleted , it is placed in the wait state 630 . also shown in this example , subsequent to the value assigned to or bound to key 1 corresponding to key location 0 being deleted , the key management engine receives the indication that key 1 is no longer referenced in the data buffer . accordingly , the key management engine transitions key 1 from the wait state 630 back to the unallocated state 610 . it is appreciated that this indication may arrive anytime after key 1 is placed in the wait state 630 and has no relation to the other keys being bound and / or deleted . thus , as shown in fig7 c , keys 1 and 13 are in the unallocated state 610 , and keys 5 and 9 are in the wait state 630 . fig7 d illustrates key - wheel 700 after a third key - value pair is added and deleted and a fourth key - value pair is added and deleted . as previously discussed , after each key is deleted it is transitioned to the wait state 630 . thus , as shown , in fig7 d all of the keys associated with slot 1 ( i . e ., keys 1 , 5 , 9 , and 13 ) are in the wait state . the keys will be removed from the wait state as indicators are received that the keys are no longer referenced in the data buffer . in this case , the keys will be transitioned from the wait state 630 to the unallocated state 610 in the order in which the keys entered the wait state ( i . e ., in the following order : key 5 , key 9 , key 13 , and , key 1 ). fig8 is a flow diagram illustrating an example process 800 for creating and initializing a key - value map , for example , the key - value map 410 of fig4 . the key management engine , among other functions , creates and maintains the key - value map . in one embodiment , the key management engine creates and initializes the key - value map including associating a plurality of keys with each slot of the key - value map . in the creation stage , at step 810 , the key management engine creates the key - value map by allocating a plurality of slots in a memory . in the association stage , at step 812 , the key management engine associates a plurality of keys of the keyspace with each slot of the key - value map . it is appreciated that the key management engine may associate the plurality of keys of the keyspace with each slot of the key - value map in any number of ways including , in one embodiment , associating the plurality of keys of the keyspace to each slot based on the function s = k % n . in the initialization stage , at step 814 , the key management engine initializes the plurality of keys for each slot by setting the slot header values to default values . in one embodiment , the initialization stage is optional or combined with the association stage . fig9 is a flow diagram illustrating an example of a process 900 for adding a key - value pair to a key - value map , for example , the key - value map 410 of fig4 . the key management engine , among other functions , receives requests to add or bind values to keys of a key - value map and performs the process 900 . in one embodiment , the key management engine receives a value , associates or binds the value with a key of the key - value map ( if a slot is available ) and returns the bound key . in the receiving stage , at step 910 , the key management engine receives a bind or add request including a value to be bound . the request can be received from a system user or administrator . in one embodiment , a system administrator provides the name or identification of a storage container or system that the system administrator would like to cache ( i . e ., use the circular data buffer ). the key management engine , at step 912 , determines whether a free slot is available . in one embodiment , the key management engine uses a free slot list to determine whether a free slot is available . if a free slot is not available , at step 914 , the key management engine either waits for a free key to become available or returns a failure message to the system administrator . a free slot may not be available if a number of keys from one or more slots are in the wait state and / or if all of the slots currently have keys in the allocated state ( i . e ., the slots already have a value bound to one of the plurality of keys associated with the slot ). if a free slot is available , in the identification stage , at step 916 , the key management engine identifies the current key of the slot using the slot header information . in the binding stage , at step 918 , the key management engine binds the identified current key with the value . in one embodiment , the key management engine binds the identified current key by updating the header information for the slot and writing the header information and the value to the slot . lastly , at the return stage , step 920 , the key management engine returns the key to which the provided value is now bound in the key - value map . in one embodiment , the returned key can then be used to identify i / o operations from the identified storage container . the process then returns . fig1 is a flow diagram illustrating an example process 1000 of deleting a key - value pair from a key - value map , for example , the key - value map 410 of fig4 . the key management engine , among other functions , receives requests to delete or remove a bound key - value pair from a key - value map and performs the process 1000 . in one embodiment , the key management engine receives a key , identifies the associated slot , and deletes the key - value pair binding if the key is valid . the key management engine also recycles the deleted key and can reuse the deleted slot immediately . in some examples , the value may be removed from the key - value pair . in other cases , the slot header information may simply be updated to reflect that the given key is no longer valid ( i . e ., put into the wait state ). in the receiving stage , at step 1010 , the key management engine receives a delete or unbind request including the key associated with the key - value pair to be unbound . in one embodiment , a system administrator provides an instruction to remove a storage container from caching and the key management engine first determines the key associated with the storage container . once the key management engine receives and / or identifies the key to be deleted , at step 1012 , the key management engine determines whether the key is valid . if the key is not valid then , at step 1014 , the key management engine returns a failure message ( e . g ., to the system administrator and / or the calling module ). if the key is valid then , in the wait state determination stage , at step 1020 , the current key is placed in a wait state . in the slot determination stage , at step 1022 , the key management engine determines the next key to use with the slot ( e . g ., the next key that will be bound for that slot ). in one embodiment , the keys are used in a specific order . for example , the keys may be used in the order in which the keys become available ( i . e ., the order in which they are recycled or enter the unallocated state ). in one embodiment , the key with the lowest number available is used . in some examples , the next available key will not be currently available . it is appreciated that there many possibilities for determining the next key to use with the slot . in the write stage , at step 1024 , the slot header information is updated by writing the updated slot header information including the updated slot header information . at step 1026 the key management engine determines whether additional keys are available for use for the slot ( e . g ., whether the flag field for the slot is not set to ‘ all wait ’). if keys are remaining , at step 1038 , the key management engine adds the slot to the free slot list . otherwise , the process returns . from the wait stage , at step 1032 , the key management engine transfers a request for notification . the request for notification indicates when the deleted key is no longer referenced in the data buffer . in one alternative embodiment , the key management engine monitors the buffer itself to determine when the deleted key is no longer referenced . at step 1034 , the key management engine determines if the notification has been received . if the notification has been received , at step 1036 , the deleted key can be recycled ( i . e ., transitioned from the wait state to the unallocated state ). at step 1038 , the key management engine adds the slot to the free slot list if all of the keys were in the wait state before this notification was received ( i . e ., flag field set to ‘ all wait ’). the process then returns . fig1 is a flow diagram illustrating an example process 1100 of getting or looking up a value associated with a key of key - value pair from a key - value map , for example , key - value map 410 of fig4 . the key management engine , among other functions , receives requests to get or lookup a value of a bound key - value pair from a key - value map . in one embodiment , the key management engine receives a key , identifies the associated slot , and reads and returns the value bound to the key if the key is valid . in the receiving stage , at step 1110 , the key management engine receives a get or lookup request including a key . the get or lookup operation can be received from the data buffer , for example , data buffer 450 of fig4 , or from a data buffer management engine ( not shown ). the request can also be received from a system administrator . once the key management engine receives or identifies the request , at step 1112 , the key management engine determines whether the key is valid . if the key is not valid then , at step 1114 , the key management engine returns a failure message ( e . g ., to the system administrator and / or the calling module ). if the key is valid then , in the determination stage , at step 1116 , the key management engine determines the value bound to the key and , at step 1118 , the key management engine returns the value . the processes described herein are organized as sequences of operations in the flowcharts . however , it should be understood that at least some of the operations associated with these processes potentially can be reordered , supplemented , or substituted for , while still performing the same overall technique . the techniques introduced above can be implemented by programmable circuitry programmed or configured by software and / or firmware , or they can be implemented entirely by special - purpose “ hardwired ” circuitry , or in a combination of such forms . such special - purpose circuitry ( if any ) can be in the form of , for example , one or more application - specific integrated circuits ( asics ), programmable logic devices ( plds ), field - programmable gate arrays ( fpgas ), etc . software or firmware for implementing the techniques introduced here may be stored on a machine - readable storage medium and may be executed by one or more general - purpose or special - purpose programmable microprocessors . a “ machine - readable medium ”, as the term is used herein , includes any mechanism that can store information in a form accessible by a machine ( a machine may be , for example , a computer , network device , cellular phone , personal digital assistant ( pda ), manufacturing tool , any device with one or more processors , etc .). for example , a machine - accessible medium includes recordable / non - recordable media ( e . g ., read - only memory ( rom ); random access memory ( ram ); magnetic disk storage media ; optical storage media ; flash memory devices ; etc . ), etc . the term “ logic ”, as used herein , can include , for example , special - purpose hardwired circuitry , software and / or firmware in conjunction with programmable circuitry , or a combination thereof . although the present invention has been described with reference to specific exemplary embodiments , it will be recognized that the invention is not limited to the embodiments described , but can be practiced with modification and alteration within the spirit and scope of the appended claims . accordingly , the specification and drawings are to be regarded in an illustrative sense rather than a restrictive sense .	6
it is now contemplated to solvent - deasphalt an asphalt - containing mineral oil with a liquid solvent consisting of at least two components selected from the group consisting of hydrogen sulfide , carbon dioxide , and light hydrocarbon , said light hydrocarbon being selected from the group consisting of propane , butanes , pentanes and blends thereof . thus , both binary and ternary liquid solvents are contemplated . briefly , the process comprises contacting the asphalt - containing mineral oil with the liquid solvent , in the absence of added hydrogen , in a volume ratio of 1 : 1 to about 1 : 20 , i . e . one to about 20 volumes of solvent are used for each volume of mineral oil to be treated . the contacting is conducted for a time and at a temperature and pressure more fully described hereinbelow , whereby are formed a liquid phase containing solvent and deasphalted oil and a separate liquid phase rich in tar . the immiscible phases are separated , followed by recovery of deasphalted oil and asphalt from the respective phases . the advantage provided by the binary or ternary liquid solvent of this invention is an increase in selectivity over that achieved with a single solvent consisting of hydrogen sulfide , carbon dioxide or light hydrocarbon used alone . the binary or ternary solvent of this invention also is characterized by being easily separated from the deasphalted oil and the tar - rich phases , thereby minimizing cost and reducing solvent loss . the process of this invention is particularly well suited for the deasphalting of atmospheric tower or vacuum tower bottoms from the distillation of petroleum oils , commonly known as residual oils or residua . however , petroleum crude oils , and topped crude oils , as well as other petroleum hydrocarbon oils that contain an asphaltic component , may be treated by the method of this invention . additionally , heavy oils derived from tar sands , shale , or other sources , may likewise be treated . any conventional method of contacting the asphaltene - containing mineral oil with the binary or ternary liquid solvent of this invention may be used . for example , batch contacting is effective . countercurrent contacting and separation of the phases , as is commonly practiced in propane deasphalting , may be used . in this latter method of contacting , the asphalt - containing mineral oil , which in some cases may advantageously be mixed with a small amount of the solvent to promote fluidity , is fed continuously at an intermediate point in a packed tower . concurrently , the binary or ternary solvent of this invention is fed at a point below the intermediate point , and flows upwardly through the tower wherein it contacts the fed and forms two liquid phases , one rich in oil and the other rich in tar . the oil phase flows upwardly and is removed from the top of the tower , while the tar phase flows downwardly and is removed from the bottom of the tower . the liquid solvent of this invention consists of two components or three components , as hereinabove described , each of the components being present in an amount equal to at least 10 percent of the total volume of the solvent . the components of the liquid solvent are selected from the group consisting of hydrogen sulfide , carbon dioxide , and light hydrocarbon , said light hydrocarbon consisting essentially of propane , butane , pentane , or blends of these hydrocarbons . for the purpose of this invention , it is particularly preferred that the light hydrocarbon consist essentially of propane . thus , in its preferred form , it is contemplated that this invention utilizes a binary solvent consisting of hydrogen sulfide and carbon dioxide ; or hydrogen sulfide and propane ; or carbon dioxide and propane . the preferred ternary composition consists of hydrogen sulfide , carbon dioxide , and propane . for each of the binary solvents , the composition contains 10 to 90 percent by volume of one component , with the remainder , 90 to 10 % by volume , being the second component . the ternary liquid solvent contains at least 10 volume percent each of hydrogen sulfide , carbon dioxide , and propane . as will be recognized by those skilled in the art , the critical temperatures and pressures of hydrogen sulfide , carbon dioxide , and lighthydrocarbon are different from one another . since the present invention contemplates contacting asphalt - containing mineral oil with liquid solvent , the contacting must be done at a temperature lower than the critical temperature , and at a pressure sufficiently high to maintain the binary or ternary solvent in the liquid phase during the contacting step , and until the phases are separated . after separation of the phases , the liquid solvent is removed from each of the phases by conventional means , whereby recovery of deasphalted oil , and tar comprising asphaltenes , aromatic hydrocarbons , heterocyclic nitrogen and sulfur compounds and metal - containing compounds , are effected . alternatively , the tar phase may be subjected to additional treatment prior to removal of the liquid solvent in order to modify or separate the constituents thereof . when using mixtures of hydrogen sulfide and light hydrocarbon as the binary solvent in the process of this invention , it is preferred to conduct the contacting step and separation of the phases at a temperature of less than about 60 ° c ., and at a pressure of at least about 400 p . s . i . g ., said pressure being effective to maintain the solvent in the liquid phase . in some instances temperatures of 60 ° c . to 80 ° c . may be used , however . the precise temperature to be used will depend on the mineral oil to be deasphalted , the volume ratio of solvent to mineral oil , the equipment chosen , and the extent of deasphalting and / or demetallization desired . the selection of operating conditions based on a few routine experiments is a procedure well known to those of skill in the art . the critical conditions for mixtures of hydrogen sulfide and propane have been reported in the literature by w . b . kay and g . m . rambosek , ind . eng . chem . 45 , 221 - 226 ( 1953 ), the entire contents of which are incorporated herein by reference . table i is derived from that publication and is reproduced here for convenience . table i______________________________________critical conditions for h . sub . 2 s - propane mixtures critical criticalmol . % propane pressure , temperatures , in mixture lb ./ sq . in . ° c . ______________________________________0 1297 . 1 99 . 910 . 16 1159 . 5 92 . 721 . 83 1040 . 2 87 . 532 . 45 956 . 2 84 . 943 . 59 887 . 6 84 . 656 . 58 821 . 7 85 . 770 . 14 759 . 2 88 . 583 . 67 695 . 0 92 . 0100 . 0 616 . 3 96 . 7______________________________________ when using binary or ternary mixtures other than hydrogen sulfide and light hydrocarbon , it is necessary to conduct the contacting at a temperature of less than about 100 ° c ., and preferably at a temperature less than about 35 ° c ., with a pressure of at least about 1000 p . s . i . g . the critical conditions for mixtures of hydrogen sulfide and carbon dioxide have been reported in the literature by j . a . bierlein and w . b . kay , ind . eng . chem . 45 , 618 - 623 ( 1953 ), the entire contents of which are incorporated herein be reference . table ii is derived from that reference and is reproduced here for convenience . table ii______________________________________critical conditions for h . sub . 2 s - co . sub . 2 mixtures critical criticalmol . fraction pressure , temperaturesco . sub . 2 lb ./ in .. sup . 2 ° c . ______________________________________0 1306 100 . 38 . 0630 1305 93 . 50 . 1614 1302 84 . 16 . 2608 1284 74 . 48 . 3759 1245 64 . 74 . 4728 1207 56 . 98 . 6659 1129 43 . 72 . 8292 1085 35 . 96 . 9009 1076 33 . 531 . 1072 31 . 10______________________________________ this invention will now be illustrated by examples , which examples are not to be construed as limiting the invention described by the present specification including the claims . all parts and ratios given in the examples are by weight unless explicitly stated to be otherwise . in general , the contacting of the asphaltene - containing mineral oil with the liquid solvent according to this invention is conducted for a time sufficient to insure intimate contact of the oil and solvent , and in general this occurs within a period of less than about 10 minutes in a single stage batch apparatus . in a column operation which effects multistage contacting , each stage generally will require less than about 10 minutes for effective contacting . thus , the contacting step does not require extensive time except when the mineral oil is extremely viscous , in which case it is preferred to premix the oil with an amount of solvent effective to reduce the viscosity of the mineral oil , said amount being insufficient to induce phase separation . the reducing solvent preferably is chosen from the group consisting of liquid hydrogen sulfide , liquid carbon dioxide , liquid light hydrocarbon , and mixtures thereof . for purposes of the present invention , the deasphalting solvent is preferably substantially anhydrous , and precautions should be taken to avoid entry of moisture into the process during the contacting and separation steps . a residual oil obtained by vacuum distillation of an arabian crude was deasphalted in a continuous unit using propane as a solvent . ______________________________________gravity , ° api 9 . 6specific gravity at 60 / 60 ° f . 1 . 0028carbon residue , % wt ( conradson ) 12 . 5nickel , ppm 16vanadium , ppm 72______________________________________ the deasphalting was conducted with a solvent dosage of 600 volume percent , and at an average deasphalting temperature of 50 ° c . the properties of the recovered deasphalted oil and tar were as follows : ______________________________________deasphalted oil______________________________________yield , % vol . 66 . 8gravity , ° api 16 . 6specific gravity at 60 / 60 ° f . 0 . 9554carbon residue , % wt ( conradson ) 7 . 6nickel , ppm 1 . 5vanadium , ppm 8 . 4______________________________________ ______________________________________tar______________________________________yield ( by difference ) 33 . 2carbon residue , % wt ( conradson ) 20nickel , ppm 30vanadium , ppm 155______________________________________ the same feed is used as in example 1 , under the same process conditions but , instead of propane , the solvent is a mixture of h 2 s / propane in the ratio of 1 / 9 vol . the yields and properties of the recovered deasphalted oil and tar are : ______________________________________deasphalted oil______________________________________yield , % vol . 72gravity , ° api 16 . 6specific gravity at 60 / 60 ° f . 0 . 9554carbon residue , % wt ( conradson ) 7 . 6nickel , ppm 1 . 5vanadium , ppm 8 . 4______________________________________ ______________________________________tar______________________________________yield , % vol . ( by difference ) 28carbon residue , % wt ( conradson ) 24nickel , ppm 50vanadium , ppm 190______________________________________ the same feed is used as in example 1 , under the same process conditions but , instead of propane , the solvet is a mixture of co 2 / propane in the ratio 2 / 8 vol . the yields and properties of the recovered deasphalted oil and tar are : ______________________________________deasphalted oil______________________________________yield , % vol . 69gravity , ° api 16 . 6specific gravity 60 / 60 ° f . 0 . 9554carbon residue , % wt ( conradson ) 7 . 6nickel , ppm 1 . 5vanadium , ppm 8 . 4______________________________________ ______________________________________tar______________________________________yield , % vol . ( by difference ) 31carbon residue , % wt ( conradson ) 22nickel , ppm 40vanadium , ppm 170______________________________________ the same feed is used as in example 1 , under the same process conditions but , instead of propane , the solvent is a mixture of h 2 s / co 2 / propane in the ratio of 2 / 2 / 6 vol . the yields and properties of the recovered deasphalted oil and tar are : ______________________________________deasphalted oil______________________________________yield , % vol . 78gravity , ° api 16 . 6specific gravity , 60 / 60 ° f . 0 . 9554carbon residue , % wt ( conradson ) 7 . 6nickel , ppm 1 . 5vanadium , ppm 8 . 4______________________________________ ______________________________________tar______________________________________yield , % vol . ( by difference ) 22carbon residue , % wt ( conradson ) 27nickel , ppm 60vanadium , ppm 200______________________________________	1
the above and other technical details , features and effects of the present invention will be will be better understood with regard to the detailed description of the embodiments below , with reference to the drawings . the drawings as referred to throughout the description of the present invention are for illustration only , but not drawn according to actual scale . please refer to fig3 a - 3b and 4 - 5 . fig3 a shows an image 30 which is non - uniformly illuminated . fig3 b shows an embodiment as to how the non - uniformly illuminated image 30 of fig3 a is segmented into four non - overlapping regions r 31 - r 34 , in which different regions r 31 - r 34 are exposed by different exposure parameters ( in this embodiment , different exposure durations ed 31 - ed 34 as shown in fig4 ). fig5 shows a flowchart of a region based shutter adaptation method according to an embodiment of the present invention . after obtaining an image 30 ( the step st 1 in fig5 ), the image 30 is segmented into different regions r 31 - r 34 ( the step st 2 in fig5 ). typically , an image includes multiple pixels , so each of the regions r 31 - r 34 include one or more pixels . as shown in fig3 b , in one embodiment , the number of the regions is , for example but not limited to , four . in other embodiments , the number of the regions may be varied as a matter of design choice . besides , in the embodiment of fig3 a - 3b , all the regions r 31 - r 34 are rectangular and all four regions r 31 - r 34 have the same area size . this is only one non - limiting embodiment of the present invention . in other embodiments , the image can be segmented by any other ways wherein the regions can have the same or different shapes , the same or different area sizes , and located by any layout . several non - limiting examples are given in fig6 a - 6d . next , in the step st 3 in fig5 , this embodiment identifies the brightness value of each of the regions r 41 - r 44 . because the image 30 is non - uniformly illuminated , at least some of the regions r 31 - r 34 have different brightness values . the brightness value of a region can be calculated by any suitable ways , and the present invention is not limited to anyone of them . for example , the brightness value of a region can be represented by a brightness value of the brightest pixel in the region ; the brightness value of a region can be represented by an average brightness value of all the pixels in the region ; the brightness value of a region can be represented by a number of the pixels which have a brightness value higher than a brightness threshold ; etc . ( each pixel has a corresponding brightness value .) in the step st 4 in fig5 , this embodiment applies exposure parameters to the regions r 31 - r 34 according to brightness values of the regions r 31 - r 34 . referring to fig3 b and 4 , the region r 32 having the highest brightness value is exposed by a shortest exposure duration ed 32 , while the region r 33 having the lowest brightness value is exposed by a longest exposure duration ed 33 . the regions r 31 and r 34 having middle brightness values are exposed by exposure durations with a time length between the shortest exposure duration ed 32 and longest exposure duration ed 33 . in this embodiment , the regions r 31 and r 34 have similar brightness values , so the exposure durations ed 31 and ed 34 have the same time length . in another embodiment , the exposure durations ed 31 and ed 34 may have different time lengths . the exact time lengths of the exposure durations ed 31 - ed 34 can be determined in correspondence with the brightness values of the regions r 31 and r 34 . in this embodiment , for example , the exposure duration ed 32 is 100 ms , the exposure durations ed 31 and ed 34 are 150 ms each , and the exposure duration ed 33 is 300 ms . certainly , the numbers can change according to practical requirements of exposure . note that , although the embodiment shown by fig3 a - 3b and 4 - 5 discloses three different exposure parameters applied to four regions , the present invention is not limited to this arrangement . the present invention only requires at least two different exposure parameters applied to at least two different regions . the minimum requirement is that the exposure parameter applied to one of the regions is different from the exposure parameter applied to at least another one of the regions . a region other than these two regions can use an exposure parameter which is the same as or different from the exposure parameter of one of the two regions . as compared to the prior art shown in fig2 a - 2b where only one exposure region is assigned to the whole non - uniformly illuminated image 20 , the present invention can obtain better information of the non - uniformly illuminated image 30 because the exposure duration for each respective region can be different . in fig2 a - 2b , because only one exposure duration is applied to everywhere in the image 20 , either the region r 2 is underexposed or the region r 1 is overexposed . however , in the present invention , the information or features in the regions r 31 - r 34 can be respectively obtained by different exposure parameters most suitable to respective regions . note that a “ region ” in an image does not necessarily have to consist of a group of pixels which are directly or indirectly neighboring to one another . for clarity , the term “ directly neighboring ” is defined as two pixels directly in contact with each other ; the term “ indirectly neighboring ” is defined as two pixels which are not directly in contact with each other but can be connected through one or more pixels in the same region . a “ region ” can be a group of pixels by any definition , which can include pixels which are neighboring ( directly or indirectly ) to one another or pixels which are not neighboring to one another . fig7 shows an embodiment wherein a “ region ” includes a group of pixels which are separated from one another . as an illustrative example to explain why the regions are thus defined , it is assumed that the image 50 is a color image wherein each pixel unit includes four pixels 1 - 4 . for example , the number 1 may indicate green pixels ; the number 2 may indicate red pixels ; the number 3 may indicate blue pixels ; and the number 4 may indicate red pixels or a fourth color . please refer to fig7 in conjunction with fig5 . after obtaining an image 50 ( the step st 1 in fig5 ), the image 50 is segmented into four different regions r 51 - r 54 ( the step st 2 in fig5 ), wherein the region 51 includes all the pixels denoted by the number 1 ; the region 52 includes all the pixels denoted by the number 2 ; the region 53 includes all the pixels denoted by the number 3 ; and the region 54 includes all the pixels denoted by the number 4 . ( the shapes circle , square , triangle and rounded - square that encompass the numbers 1 - 4 are used to illustrate the grouping , not about the sizes of the pixels ). in one embodiment , at least one of the regions 51 - 54 consists of pixels of only one color . even if the ambient light is uniform and the image 50 is uniformly illuminated , the brightness of each color may be different in response to such ambient light . for example , there may be stronger light intensity in the green component than the other color components . according to the present invention , for better extracting information or features in the image 50 , the regions r 51 - r 54 can be exposed by different exposure parameters such as by different exposure durations . fig8 a - 8b show two embodiments of the exposure durations of the regions r 51 - r 54 of fig7 . please refer to fig8 a and the steps st 3 - st 4 in fig5 , this embodiment identifies the brightness values of the regions r 51 - r 54 and exposes the regions r 51 - r 54 by corresponding exposure durations ed 51 - 54 ( as shown in fig8 a ). more specifically , for example , the ambient light has strong green component ( strong green light intensity ), weak red component ( weak red light intensity ), and the light intensity of the blue component is in between . therefore , as shown in fig8 a , the exposure duration ed 51 for the region r 51 which includes all the green pixels is the shortest ; the exposure duration ed 53 for the region r 53 which includes all the blue pixels is longer than the exposure duration ed 51 ; and the exposure durations ed 52 and ed 54 for the regions r 52 and r 54 which include the red pixels are the same and the longest . in another embodiment , although the regions r 52 and r 54 are both groups of red pixels , these regions do not have to be exposed by the same exposure duration . as shown in fig8 b , assuming that the regions r 52 and r 54 are both groups of red pixels , these regions r 52 and r 54 are exposed by different exposure durations according to their respective brightness values . that is , pixels of the same color can be divided into different regions and exposed by different exposure parameters such as different exposure durations . in other words , an image can be segmented into different regions by any characteristics of the pixels , such as but not limited to : by locations of the pixels , by colors of the pixels , or by locations and colors of the pixels . the present invention has been described in considerable detail with reference to certain preferred embodiments thereof . it should be understood that the description is for illustrative purpose , not for limiting the scope of the present invention ; for example , the colors of the pixels are not limited to green , red and blue . an embodiment or a claim of the present invention does not need to achieve all the objectives or advantages of the present invention . the title and abstract are provided for assisting searches but not for limiting the scope of the present invention . those skilled in this art can readily conceive variations and modifications within the spirit of the present invention . in view of the foregoing , the spirit of the present invention should cover all such and other modifications and variations , which should be interpreted to fall within the scope of the following claims and their equivalents .	7
the present invention now will be described more fully hereinafter with reference to the accompanying drawings , in which preferred embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . like numbers refer to like elements throughout . the novel flight subsystem of embodiments of the invention performs the function of an “ electronic hood ” and is worn like glasses or goggles . the pilot eyewear of embodiments of the invention integrates variable opacity optical elements into comfortable glasses , goggles , or any suitable eyewear . this has been accomplished through the use of custom lens structures employing a transmissive - type twisted nematic liquid crystal polymer layer as an electro - active layer . in at least one embodiment , the lens darkening system uses battery powered near infrared light emitting diode ( led ) sources mounted in the cockpit of an aircraft to provide a solid angle cone of invisible light which functions to determine pilot head position . the infrared source and detection system responds to the pilot - in - training head up / down position , allowing the pilot to always see the cockpit - mounted tactical and strategic displays but restricting that pilot &# 39 ; s vision out of the windscreen and / or ( optionally ) side windows . the instructor pilot does not wear the vision restrictive glasses to ensure flight safety . in one embodiment , a controller , linked to the aircraft flight computer or altimeter , commands the lenses to become clear when the test pilot looks through the windscreen when the aircraft is below 200 feet altitude on final approach , enabling the pilot to safely maneuver the aircraft to touchdown . in an alternate embodiment , the infrared source receives the altitude information directly from the altimeter or flight computer and the infrared source stops emitting ( thereby causing the lenses to become clear ) when the aircraft is below 200 feet altitude on final approach . a goal of the invention is to provide a system and method to enable pilots in instrument training to become proficient with instrument metrological conditions or flying solely by cockpit instruments . another goal is to provide a wearable variable vision restriction system which can simulate variable visibility conditions corresponding to various metrological conditions such as clouds , rain , fog , smoke , haze , night time darkness levels , or clear skies . this second goal may be accomplished by selective variation of the lens darkening schemes ( such as by varying duty cycle , excitation frequency , and amplitude of the lens control signal ) combined with selective light scattering mechanisms as additive lens elements , fig1 is block diagram of a system for selectively obscuring a user &# 39 ; s vision , in accordance with one embodiment of the invention . such a system may be used to restrict or obscure a student pilot &# 39 ; s vision during instrument - only flight sessions . the system 10 comprises a head position detection element 12 for detecting a position of the user &# 39 ; s head , eyewear 16 having variably transmittive lenses , and a controller 14 . the controller is configured to receive user head position information from the head position detection element and to control the transmittivity of the lenses based on the user head position information by varying an electrical signal applied to the lenses . the head position detection element 12 may comprise one or more near - infrared light emitting diodes and an associated detector 24 mounted on the user &# 39 ; s head ( e . g ., on a helmet worn by the user ). in one specific embodiment , the head position detection element comprises three near - infrared light emitting diodes , such that one light emitting diode 18 is mounted in front of the user to detect an up and down position of the user &# 39 ; s head and one light emitting diode is mounted on each side of the user to detect a right ( 20 ) and left ( 22 ) position of the user &# 39 ; s head . a collimator 23 is positioned adjacent the detector 24 such that the infrared light from the leds passes through the collimator before being received by the detector ( i . e ., the detector is “ looking through ” the collimator at the leds ). as the leds emit an uncollimated “ cone ” of light , the collimator enables the detector to have a limited field of view that provides angularity in the detection to enable the head position to be determined . for purposes of this application , the combination of the collimator and the detector will be termed a “ collimated detector .” the controller 14 typically controls the transmittivity of the lenses by varying the amplitude or duty cycle of the electrical signal applied to the lenses , such as via signal generator 26 . in one embodiment , the infrared ( ir ) sources ( leds 18 , 20 , 22 ) receive altitude information , such as from altimeter 28 . this altitude information enables the ir sources to cease emitting , thereby lightening the lenses and not obscuring the user &# 39 ; s vision when the aircraft altitude information indicates that the aircraft is below a predetermined altitude ( e . g ., 200 feet ). in an alternate embodiment , the controller 14 may receive the aircraft altitude information , such as from altimeter 28 , and cease applying the signal to the lenses . fig2 - 4 illustrate the operation of the system of fig1 in for pilot training in an aircraft . the user head position information from the head position detection element typically comprises at least information regarding the up / down position of the user &# 39 ; s head relative to a predetermined point in space in front of the user . as such , the controller may be configured to reduce the transmittivity to darken the lenses and thereby obscure the user &# 39 ; s vision when the user &# 39 ; s up and down head position is above the predetermined point in space , and to increase the transmittivity to lighten the lenses and thereby not obscure the user &# 39 ; s vision when the user &# 39 ; s up and down head position is below the predetermined point in space . in one embodiment , the invention allows the pilot to always see the cockpit - mounted tactical and strategic displays ( which may be termed the “ instrument panel ”) but restricting that pilot &# 39 ; s vision out of the windscreen and / or ( optionally ) side windows . in such an embodiment , the predetermined point in space is at the border between the windscreen and the instrument panel ( i . e ., at the “ dashboard ”). this is illustrated in fig2 , 3 a and 3 b . fig2 illustrates a pilot &# 39 ; s view of a windscreen 30 , a dashboard 32 , and an instrument panel 34 of an aircraft . as illustrated in fig2 , when the pilot &# 39 ; s head position indicates that the pilot is attempting to look out the windscreen 30 , the lenses of the variably transmittive eyewear become opaque . conversely , when the pilot &# 39 ; s head position indicates that the pilot is attempting to look at the instrument panel 34 , the lenses of the variably transmittive eyewear become clear . fig3 a and 3b illustrate a side view of a pilot 36 wearing the variably transmittive eyewear 16 . as seen in fig3 a , when the pilot &# 39 ; s head position indicates that the pilot is attempting to look out the windscreen 30 , the lenses of the variably transmittive eyewear become opaque . conversely , as seen in fig3 b , when the pilot &# 39 ; s head position indicates that the pilot is attempting to look at the instrument panel 34 , the lenses of the variably transmittive eyewear become clear . in addition to the up / down position of the pilot &# 39 ; s head , the user head position information may comprise information regarding the left / right position of the user &# 39 ; s head relative to a predetermined point in space in front of the user . as such , the controller may be configured to reduce the transmittivity to darken the lenses and thereby obscure the user &# 39 ; s vision when the user &# 39 ; s left and right head position is more than a predetermined distance from the predetermined point in space . this is illustrated in fig4 . fig4 illustrates a top view of a pilot within an aircraft cockpit . as illustrated in fig4 , when the pilot &# 39 ; s head position indicates that the pilot 36 is attempting to look out either of the side windows 38 , the lenses of the variably transmittive eyewear become opaque . when the pilot &# 39 ; s head position indicates that the pilot is looking forward , the up / down position information determines whether the eyewear is opaque or clear . although not illustrated in the figures , the system may comprise a gaze direction detection element for detecting a direction of the user &# 39 ; s gaze . in such an embodiment , the controller is further configured to receive user gaze direction information from the gaze direction detection element and to control the transmittivity of the lenses based on the user head position information and the gaze direction information . fig5 a and 5b illustrate the location of led receivers in an aircraft 40 , in accordance with one embodiment of the invention . fig5 a is a top view and fig5 b is a side view . as can be seen in fig5 a , three near - infrared light emitting diodes may be used , such that one light emitting diode 18 is mounted in front of the user to detect an up and down position of the user &# 39 ; s head 36 and one light emitting diode is mounted on each side of the user to detect a right ( 20 ) and left ( 22 ) position of the user &# 39 ; s head . as seen in fig5 a , the leds provide a solid angle cone of invisible light which functions to determine pilot head position . as can be seen in fig5 b , the front led 18 is typically mounted on the aircraft dashboard and the side leds are typically mounted above each side window ( the left side led is illustrated in fig5 b ). fig5 b also again illustrates that , when the pilot &# 39 ; s head position indicates that the pilot is attempting to look out the windscreen 30 , the lenses of the variably transmittive eyewear become opaque . conversely , when the pilot &# 39 ; s head position indicates that the pilot is attempting to look at the instrument panel 34 , the lenses of the variably transmittive eyewear become clear . fig6 is a not - to - scale cross section of a lens of variably transmittive eyewear , illustrating the structure of the lens , in accordance with one embodiment of the invention . each variably transmittive lens 50 typically comprises two stacked variable attenuation optical cells 52 sandwiching a half - wave plate 64 . each optical cell 52 may comprise a transparent substrate 60 , an optically transparent electrically conductive layer 58 on the substrate , a transmissive type twisted nematic liquid crystal polymer layer 56 on the electrically conductive layer , a first linear polarization layer 62 on the substrate opposite the electrically conductive layer , and a second linear polarization layer 54 on the liquid crystal polymer layer . the second polarization layer 54 has a transmission axis oriented 90 degrees apart from a transmission axis of the first polarization layer 62 . in at least one embodiment a 4 - 6 micron thickness nematic layer 56 is deposited upon a transparent substrate 60 that is coated with optically transparent indium tin oxide ( ito ). the ito electrically conductive layer 58 acts to provide a uniform electric field in the region between substrates such that the electric field is perpendicular to the substrates and is also coated with a thin variable rotation optical element layer . lens elements ideally comprise optical grade polycarbonate ( but glass also works ) as substrate material . the above described layered lenses serve to accomplish variable light transmission operating as an electro - optical kerr cell over the visible band ( 270 nanometer ( nm ) bandwidth centered on 560 nm ) when a sufficiently large electric field is applied to the ito layers . inside the helically oriented birefringent nematic crystal layer , propagating light is described by two elliptically polarized eigen modes ( which follows the mauguin limit where d times delta n is much greater than phi times lambda divided by pi ( where phi = the twist angle of the liquid crystal layer , d = layer thickness , delta n = birefringence of the liquid crystal , and lambda = center wavelength ( about 560 nm ))). light rays become linearly polarized photons which follow the nematic helix structure resulting in wave - guiding . thus by application of an electric field to the ito layer , the degree of rotation of the nematic crystal can be controlled , which in turn controls the transmission of light through the combined layers . the layers act as electro - optical attenuation cells by effectively rotating the polarization axis of light exiting the first linear polarization layer such that it will also pass through the second linear polarization layer . thus the transmission characteristics may be controlled by an applied electric field of sufficient amplitude to rotate the nematic crystal . the ratio of light transmission through one cell can achieve as much as 500 : 1 extinction ratio with proper excitation . stacking two such variable attenuation cells in sequential optical path with a half - wave plate ( with matching optical transmission characteristics , e . g ., 270 nm bandwidth centered on 560 nm ) positioned in plane parallel fashion results in transmission characteristics dependent upon the orientation of the fast axis of the half - wave plate relative to the transmission axis of the linear polarizers on either side of the half - wave plate . two such layered structures serve as left and right “ unbreakable ” lens elements ( i . e ., considerably more break - resistant than glass of same ( approx . 0 . 7 millimeter ) thickness ) when integrated into a wearable frame with earpieces to be worn like sunglasses . the laminated polarizing films also serve to protect the wearer &# 39 ; s eye ( s ) in the event of accidental lens breakage due to impact . a driver circuit output ( such as from signal generator 26 ) is normally a square wave of 6 to 12 volts amplitude applied directly to the ito layers , but additional rectification and driving the two lens elements in parallel by use of a selective switching matrix greatly increases the extinction ratio . the electrical connection between the driver circuit outputs and the ito lens elements ( both can be located within the glasses frames ) is typically accomplished using interconnecting wires positioned with conductive elastomeric strips in contact with the ito surfaces . overall light transmission / attenuation through each combined lens element is controlled by variation of the amplitude of excitation voltage as well as the duty cycle applied to the ito layers . the overall transmission of light through two “ stacked ” lens cells without excitation is determined by setting the exact angle of the half - wave plates to allow an equivalent amount of light to equal the desired neutral density filter . the equivalent neutral density filter transmission characteristics can be calibrated by comparison with a fixed neutral density filter . the left lens elements dynamic and static light transmission characteristics are typically matched to the right lens elements characteristics to prevent disorientation of the wearer . substrate material : optical grade polycarbonate optical blank dimensions : 4 centimeter ( height )× 6 centimeter ( width ) metallization layer : indium tin oxide transparent , conductive layer deposited over polycarbonate . retarder material ; nematic liquid ( bi - refringent polymer ) crystal polarizing material : dichroic polymer wavelength : wideband 450 to 700 nanometers transmission polychromatic with bandpass centered on 560 nm “ gray ” or “ green ” lens appearance beam divergence : 2 arc minutes distortion : ¼ wavelength transmittance : clear mode = 75 % with unpolarized input lower transmission values obtained by rotation of lens element layers to approximate dark neutral filter ( nd = 4 ) has been determined optimal for full sunlight in cockpit contrast on / off attenuation : currently around 500 : 1 per layer voltage level for transition : 8 to 15 volts 15 volts applied to two lens elements ( positioned serially in optical path ) results in 1000 : 1 attenuation ratio led power supply : coin cell lithium batteries circuitry : flexible detector / driver card in glasses frames standard pc board for infrared led drivers switching ( transparent to dark ) time : 1 millisecond temperature range : 10 to 50 degrees centigrade with minor modifications , such as using an instantly acting ( 10 millisecond to extinction ) optical attenuation cell integrated into eyewear , embodiments of the invention may be capable of protecting a pilot &# 39 ; s eyes by detection and attenuation of hostile laser impingement . many modifications and other embodiments of the invention will come to mind to one skilled in the art to which this invention pertains having the benefit of the teachings presented in the foregoing descriptions and the associated drawings . therefore , it is to be understood that the invention is not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims . although specific terms are employed herein , they are used in a generic and descriptive sense only and not for purposes of limitation .	6
the following description is of the best embodiments presently contemplated for carrying out this invention . this description is made for the purpose of illustrating the general principles of this invention and is not meant to limit the inventive concepts claimed herein . referring now to fig1 , there is shown a disk drive 100 which could embody this invention . as shown in fig1 , at least one rotatable magnetic disk 112 is supported on a spindle 114 and rotated by a disk drive motor 118 . the magnetic recording on each disk is in the form of annular patterns of concentric data tracks ( not shown ) on the magnetic disk 112 . at least one slider 113 is positioned near the magnetic disk 112 , each slider 113 supporting one or more magnetic head assemblies 121 . as the magnetic disk rotates , slider 113 moves radially in and out over the disk surface 122 so that the magnetic head assembly 121 may access different tracks of the magnetic disk where desired data are written . each slider 113 is attached to an actuator arm 119 by way of a suspension 115 . the suspension 115 provides a slight spring force which biases slider 113 against the disk surface 122 . each actuator arm 119 is attached to an actuator means 127 . the actuator means 127 as shown in fig1 may be a voice coil motor ( vcm ). the vcm comprises a coil movable within a fixed magnetic field , the direction and speed of the coil movements being controlled by the motor current signals supplied by controller 129 . during operation of the disk storage system , the rotation of the magnetic disk 112 generates an air bearing between the slider 113 and the disk surface 122 which exerts an upward force or lift on the slider . the air bearing thus counter - balances the slight spring force of suspension 115 and supports slider 113 off and slightly above the disk surface by a small , substantially constant spacing during normal operation . the various components of the disk storage system are controlled in operation by control signals generated by control unit 129 , such as access control signals and internal clock signals . typically , the control unit 129 comprises logic control circuits , storage means and a microprocessor . the control unit 129 generates control signals to control various system operations such as drive motor control signals on line 123 and head position and seek control signals on line 128 . the control signals on line 128 provide the desired current profiles to optimally move and position slider 113 to the desired data track on disk 112 . write and read signals are communicated to and from write and read heads 121 by way of recording channel 125 . with reference to fig2 , the orientation of the magnetic head 121 in a slider 113 can be seen in more detail . fig2 is an abs view of the slider 113 , and as can be seen the magnetic head including an inductive write head and a read sensor , is located at a trailing edge of the slider . the above description of a typical magnetic disk storage system , and the accompanying illustration of fig1 are for representation purposes only . it should be apparent that disk storage systems may contain a large number of disks and actuators , and each actuator may support a number of sliders . with reference now to fig3 , 4 and 5 , an example of a lorentz magnetoresistor , ( in this case shown in the form of an extraordinary magnetoresistive sensor ( emr )) 300 for use in a magnetic head 121 ( fig2 ) is shown and described . other lorentz magnetoresistors may be substituted . a lorentz magnetoresistive sensor ( of which an emr sensor is but one example ) is a device that uses the lorentz effect to detect the presence of a magnetic field and register this presence of a magnetic field as a change in electrical properties of the device . the lorentz sensor 300 may be formed in a mesa structure 301 formed on a substrate 304 such as si , gaas , inas , insb or inp . the mesa structure 301 can include a hetero - structure 302 . the heterostructure 302 can include a first layer 306 of semi - conducting material having a first band - gap , a second layer 308 of semi - conducting material formed on the first layer 306 and having a second bandgap that is smaller than that of the first layer 306 , and a third semi - conducting layer 310 of semi - conducting material formed on top of the second layer 308 and having a third band gap that is greater than the second band gap . the materials in the first and third layers 306 , 310 may be similar or identical . an energetic potential well ( quantum well ) is created by the first , second and third semi - conducting material layers due to the different band - gaps of the different materials . thus , carriers can be confined inside layer 308 , which is considered the emr active film , or magnetically active film , in the sensor 300 . this is also referred to as the quantum well or the two - dimensional electron gas ( 2deg ) layer . the first layer 306 is typically formed on top of a buffer layer 312 that may be one or more layers . the buffer layer 312 can comprise several periods of a super - lattice structure that functions to prevent impurities present in the substrate from migrating into the functional layers 306 , 308 , 310 . in addition , the buffer layer 312 is chosen to accommodate the typically different lattice constants of the substrate 304 and the functional layers of the heterostructure 302 to thus act as a strain relief layer between the substrate and the functional layers . one or more doped layers are incorporated into the semiconductor material in the first layer 306 , the third layer 310 , or both layers 306 and 310 , and are spaced apart from the boundary of the second and third semiconductor materials . the doped layers provide electrons ( if n - doped ) or holes ( if p - doped ) to the quantum well . the electrons or holes are concentrated in the quantum well in the form of a two dimensional electron - gas or hole - gas , respectively . n - doping layers are not necessary in the case of alsb / inas / alsb wherein the electrons originate from deep donors in the alsb layers as well as from states in the interface between the alsb and the inas quantum well . higher electron densities can be obtained by the use of te dopant atoms in the alsb liner layers or their vicinity . the layers 306 , 308 , 310 may be for example a al 0 . 09 in 0 . 91 sb / insb / al 0 . 09 in 0 . 91 sb heterostructure grown onto a semi - conducting si substrate 304 with a buffer layer 312 in between . the layers 306 , 308 , 310 may also be alsb / inas / alsb . quantum wells are preferably made of narrow gap materials such as insb , gaas and inas . narrow band - gap semiconductors typically have a high electron mobility , since the effective electron mass is greatly reduced . for example , the room temperature electron mobility of insb and inas are 70 , 000 cm 2 / vs and 35 , 000 cm 2 / vs , respectively . the bottom al 0 . 09 in 0 . 91 sb layer 306 formed on the buffer layer 312 has a thickness in the range of approximately 1 - 3 microns and the top al 0 . 09 in 0 . 91 sb layer 310 can have a thickness in the range of approximately 10 to 1000 nm , typically 50 nm . the doping layers incorporated into layers 306 , 310 have a thickness from one monolayer ( delta - doped layer ) up to 10 nm . the doping layer is spaced from the insb / al 0 . 09 in 0 . 91 sb boundaries of first and second or second and third semi - conducting materials by a distance of 10 - 300 angstrom . an n type doping is preferred , since electrons typically have higher mobility than holes . the typical n - dopant is silicon with a concentration in the range of 1 to 10 19 / cm 3 . in the case of alsb / inas / alsb quantum wells , delta doping is also possible to increment the electron density in the inas quantum well . this is typically done by intercalating a few monolayers of te within the alsb layers . the deposition process for the heterostructure 302 is preferably molecular - beam - epitaxy , but other epitaxial growth methods can be used . a capping layer 314 is formed over the heterostructure 302 to protect the device from corrosion . the capping layer 314 is formed of an insulating material such as oxides or nitrides of aluminum or silicon ( e . g ., si 3 n 4 , al 2 o 3 ) or a non - corrosive semi - insulating semiconductor . the layers 312 , 306 , 308 , 310 , 314 together form the mesa structure 301 . two current leads 316 , 318 and two voltage leads 320 , 322 are patterned over one side of the emr structure 302 so that they make electrical contact with the quantum well 308 . a metallic shunt 324 is patterned on the side opposite the current and voltage leads 318 - 322 of the emr structure 302 so that it also makes electrical contact with the quantum well 308 . an applied magnetic field h ( fig4 ), i . e ., the magnetic field to be sensed , is generally oriented normal to the plane of the layers in the emr structure 302 . the leads 316 , 318 , 320 , 322 typically comprise metallic contacts , for example au , auge , or ge diffused into the device . for the case of an emr device based on si , the leads and shunt material are preferably a metallic alloy of si , such as tisi 2 . fig4 is a top schematic view of the emr sensor 300 through a section of the active film 308 and will illustrate the basic operation of the sensor . in the absence of an applied magnetic field h , sense current through the leads 316 , 322 passes into the semiconductor active film 308 and is shunted through die shunt 324 , as shown by line 402 . when an applied magnetic field h , having a component perpendicular to the plane of the layers in the emr structure 302 , is present , as shown by the arrow tail into the paper in fig2 , current is deflected from the shunt 324 and passes primarily through the semiconductor active film 308 , as shown by line 404 . the change in electrical resistance due to the applied magnetic field is detected across the voltage leads 320 , 318 . although , the emr sensor 300 has been described in terms of a mesa structure 301 having a semiconductor heterostrucure 302 that forms a quantum well , this is by way of example only . various other structures are possible for forming an emr sensor . for example , the mesa structure could be formed as a block of semiconducting material si , without the multi - layer structure 302 . other suitable semiconductor materials are thin films of the iii - v group such as gaas and inas . although such thin films have no quantum well structures , in the case of si , it has been found to provide effective emr sensing capabilities . therefore , the emr sensor described above is for purposes of illustration only , and the integrated amplification of the present invention ( to be described below ) can be used with any form of lorentz magnetoresistive sensor . in addition , although the integrated signal amplification is being described herein in terms of use with an emr sensor , the integrated signal amplification could be used in another type of sensor , such as a giant magnetoresistive sensor ( gmr ) or tunnel junction sensor ( tmr ). fig8 , shows a schematic illustration of an integrated amplification structure that can efficiently amplify a signal from the emr sensor 300 . the proximity of the amplifier to the signal source drastically reduces the added noise concomitant with remote signal amplification . although prior art emr sensors have used the substrate 304 merely as a support structure onto which to build and hold the mesa 301 , the present invention takes advantage of the fact that the substrate is constructed of a semiconductor material and incorporates a signal amplifying transistor within the substrate structure 304 . with particular reference to fig8 , one of the voltage leads 320 is connected with the gate of an integrated amplifier formed in the substrate of 304 . the amplifier circuit 802 can be constructed , for example , as a mosfet transistor amplifier , or some other type of semiconductor based amplifier structure employing other transistor types such as cmos , bi - polar , etc . an insulation layer 804 such as an oxide layer may be formed between the substrate 304 and the emr sensor 300 . although , the integrated amplification can be accomplished with only a single amplifier 802 such as that described above , a second amplifier 810 can be provided , with the gate of the second amplifier 810 being connected with the other voltage lead 322 of the emr or other lorentz magnetorsistor sensor . as can be seen with reference to fig8 , each of the amplifier circuits 802 , 810 can have a source lead 806 , 812 and a drain lead 808 , 814 . these leads can be connected ( such as through a via formed in the oxide layer 804 ) with ancillary electronics ( not shown ) and then to other amplification and processing circuitry such as the data recording channel circuitry 125 discussed above with reference to fig1 . of course , the emr sensor 300 and integrated amplifier 802 and / or 810 could be used in applications other than data recording , in which case the source and drain circuitry 806 , 808 would be connected with other circuitry appropriate to that application . for example , the current leads from the emr device 300 could be connected directly to the built - in amplifier if the emr devices is operated in constant voltage mode , thereby providing an alternative sensing mode to the conventional voltage detection mode . with reference now to fig6 and 7 , a possible structure for constructing an emr sensor 300 with integrated amplification 802 is described . fig6 shows a cross sectional view of the substrate , with the oxide layer 804 formed thereover . fig7 shows a top down view of the structure shown in fig6 . the current leads 316 , 318 and voltage leads 320 , 322 can be formed over the oxide layer 804 . as shown in fig7 , the leads 316 - 322 are connected with the mesa structure of the emr sensor 300 as described with reference to fig3 - 5 or other structure that undergoes a magnetoresistive change in the presence of an external magnetic field . with reference to fig6 , the substrate 304 is constructed of a semiconductor material , such as si , gaas , inas or insb . one or more transistors , such as a mosfet , cmos or some other type of transistor amplifier can be formed in the substrate and appropriately connected with a voltage or a current lead of the emr device 300 . for example , to construct an integrated mosfet transistor amplifier , the substrate can be a p - type material such as si , and portions of the substrate can be implanted with phosphorous through a mask to produce n - doped regions 604 , 606 . in the case shown in fig6 , the voltage lead v 2 322 ( or voltage lead v 1 320 ) provide a gate voltage . the n doped region 604 , can be connected with an electrical lead 602 for example to provide a source current at the n doped region 604 . a lead 608 can be connected with the other n doped region 606 to provide a drain from which a signal can be read . of course , the above description of a specific transistor circuit incorporated into a substrate onto which an emr device is constructed of is for purposes of illustration only . many other types and constructions of transistors can be incorporated into a substrate , and would all fall within the intended scope of the invention . this built - in signal amplification is needed to extend the usefulness of emr devices to detect bit dimensions in the nano - scale regime as it will be required for tb / in 2 recording . the basic upper structure of the emr sensor can be any type of emr sensor device . this invention uses the fact that the substrate material can be used as an active electronic material to provide built - in amplification , rather than merely as a physical support structure providing no electronic functionality as has been the case in the prior art . in such prior art devices , because the signal from the emr device itself is small , the signals have needed to be remotely amplified leading to noise problems and rise - time limitations . the integrated amplification of the present invention avoids these problems by providing signal amplification right at the location of the emr device . in the present invention , amplifiers such as cmos transistors are used to amplify the voltage signal , using the voltage region of the emr device as a gate voltage . this could be used with just one voltage sense , or with compared voltage sense for greater sensitivity . this also gives a low - impedance output , leading to faster device operation . it should also be pointed out that , while the integrated signal amplification has been described above as being useful with an emr sensor , such integrated signal amplification could be used with many other types of magnetic sensor devices . for example , the emr sensor could be replaced with another type of magnetoresistive sensor , such as but not limited to : a current in plane or current perpendicular to plane giant magnetoresistive sensor ( cpp or cip - gmr ); tunnel magnetoresistive sensor ( tmr ) also known as a magnetic tunnel junction sensor ( mtj ); coulomb blockade anisotropic magnetoresistive device ; hall effect sensor ; spin accumulation device ; or spin hall effect sensor . the integrated signal amplification could also be used to amplify a signal of some other sensor devices other than a magnetoresistive sensor . while various embodiments have been described above , it should be understood that they have been presented by way of example only , and not limitation . other embodiments falling within the scope of the invention may also become apparent to those skilled in the art . thus , the breadth and scope of the invention should not be limited by any of the above - described exemplary embodiments , but should be defined only in accordance with the following claims and their equivalents .	6
in the following description , numerous details are set forth to provide an understanding of the present invention . however , it will be understood by those skilled in the art that the present invention may be practiced without these details and numerous variations or modifications from the described embodiments may be possible . as used herein , the terms “ up ” and “ down ”, “ upper ” and “ lower ”, “ upwardly ” and “ downwardly ” and other like terms indicating relative positions above or below a given point or element are used in this description to more clearly describe some embodiments of the invention . however , when applied to equipment and methods for use in wells that are deviated or horizontal , such terms may refer to a left to right or right to left relationship as appropriate . generally , preferred embodiments of the invention provide a variable flow area valve assembly that includes an axially sliding valve sleeve adapted to regulate the flow of fluid through one or more orifices in the valve housing . the sleeve is axially translated from one flow area position to the next by the pressure of a measured volume of hydraulic fluid bearing on a cross - sectional area of the sleeve . a valve actuator operably attached to the valve housing transmits , from a surface source , the measured volume of hydraulic fluid necessary to shift the valve sleeve position from one flow increment to the next in a sequence of several locations between a fully open position to a fully closed position . the change in fluid flow area as the sleeve is actuated through the incremental positions varies so that predetermined changes in flow condition can be provided . as used herein , flow condition may refer to pressure drop across the valve and / or flow rate through an orifice in the valve . at each position increment of the sleeve translation range between fully open and fully closed , the sleeve is secured from uncontrolled displacement by a resilient snap ring set in a sleeve ring seat . at each designated flow area position , is a detent channel in the valve housing . the snap ring on the sleeve expands into a respective detent channel . each detent channel is defined between parallel channel walls . at least one wall of each channel is formed at an acute angle to the housing axis with each angle being progressively steep . consequently , a relationship may be established between the channel wall angle respective to a particular flow area setting and the hydraulic pressure from the valve actuator necessary to displace the sleeve from the particular flow area to another . with respect to fig1 a , the “ upper ” end of the invention assembly includes an index housing 10 shown in cross - section to be a tubular element having a number of circumferential channels 40 a through 40 g turned about the internal bore perimeter 11 . the side walls of these channels are set at distinctive acute angles . the side walls of the channel 40 a may be cut at 25 °, for example . representatively , the side wall cut for channel 40 b may be cut at 30 °, the sidewall angle of channel 40 c may be 35 °, the sidewall angle for channel 40 d may be 45 °, the sidewall angle for channel 40 c may be 50 ° and the sidewall angle of channel 40 f may be 60 °. as shown by fig1 b , the lower end of the index housing 10 threadably assembles with a tubular actuator housing 12 . the assembly joint between the index housing 10 and the actuator housing 12 compresses a chevron seal 30 that wipes the outer cylindrical surface of an axially shifted flow regulator sleeve 20 . the lower end of the actuator housing 12 threadably assembles with a tubular sub 14 as shown by fig1 d . the bottom end of the sub 14 threadably assembles with a tubular bottom housing 16 . the thread joint between the sub 14 and the bottom housing 16 compresses a chevron seal 34 against the outer cylindrical surface of the axially shifted sleeve 20 . the tubular wall of the actuator housing 12 is perforated by a number of elongated orifices 28 as seen from fig1 c . in open alignment with the actuator housing orifices 28 are the corresponding orifices 26 through a seal compression sleeve 24 . the compression sleeve 24 engages the intermediate chevron seal 36 and is secured by an outer clamp 18 . the chevron seal 36 wipes the regulator sleeve 20 surface . within the housing bore , a tubular sleeve 20 is disposed for a sliding seal fit with the chevron seals 30 , 34 and 36 . through the lower end of the sleeve 20 tube wall , a number of elongated orifices 22 may be provided to cooperate with the housing orifices 26 and 28 . the upper end of the regulator sleeve 20 carries a resilient snap ring 42 in a caging channel 44 shown by fig1 a . the outer corners of the snap ring 42 are chamfered to facilitate radial constriction of the snap ring perimeter by an axial thrust on the sleeve 20 . the sleeve is designed for an operative stroke between the detent channels 40 a and 40 g , inclusive . the snap ring 42 seats into each detent channel 40 for a respective fluid flow relationship through the orifices 22 , 26 and 28 . when the snap ring 42 is seated in detent channel 40 a , the valve is fully closed . when the snap ring 42 is seated in detent channel 40 g , the valve is fully open . at each of the detent channel positions between 40 a and 40 g , a progressively increasing flow area is provided by increased alignment between the sleeve orifices 22 and the housing orifices 26 , 28 . along the outer surface of the sleeve 20 and aligned between the upper housing seal 30 and the intermediate seal 36 is a chevron seal 32 shown by fig1 c . the seal 32 is secured to the sleeve 20 and moves with it as a load piston . the seal 32 wipes the internal bore wall of a housing cylinder 13 and divides it into two variable volume pressure chambers 46 and 48 . the upper pressure chamber 46 is served by a closing hydraulic conduit 50 from a surface source of hydraulic pressure supply as illustrated by fig1 b . the lower pressure chamber 48 is served by a hydraulic conduit 52 from the control actuator 60 as shown by fig1 c . the control actuator 60 is supplied with hydraulic fluid from the well surface through conduit 54 as shown by fig1 b for opening the valve . one embodiment of the control actuator 60 is illustrated in detail by fig2 . an actuation cylinder 61 contains a stepping piston 62 for control of hydraulic fluid flow through the cylinder 61 along a direction of orientation from the supply conduit 54 to the sleeve control conduit 52 . the stepping piston 62 has a sliding seal 65 with the wall of cylinder 61 . a return spring 66 exerts a resilient bias on the stepping piston toward the fluid in - flow end of the cylinder 61 . an orifice closure plug 63 projects axially from the out - flow end of the stepping piston to align with the entrance orifice of the sleeve control conduit 52 . distinctively , the volume 64 of cylinder 61 that is displaced by translation of the stepping piston 62 from the in - flow end of the cylinder 61 as illustrated by fig2 to closure of the conduit 52 by the plug 63 substantially corresponds to the displaced volume of the lower sleeve chamber 48 for advancement of a single opening increment e . g . to move the sleeve snap ring 42 from the detent channel 40 b to the detent channel 40 c . a plurality of stepping piston 62 strokes may be required to move the sleeve 20 from an initial opening of the valve as illustrated by fig1 a and the axial distance between detent channels 40 a and 40 b . the stepping piston 62 further comprises a fluid flow check valve 76 that is oriented to permit a reverse flow of fluid at a limited flow rate from the sleeve control conduit 52 toward the supply conduit 54 by lifting the valve closure off the valve conduit seat against the bias of closure spring 77 . also within the body of the stepping piston 62 is a stepping valve 70 that comprises an orifice closure pintle 74 acting against the valve seat 73 around the flow orifice 71 . a spring 75 exerts resilient bias on the pintle 74 to open the flow orifice 71 . however , a salient end 78 of the pintle 74 projects above the in - flow end - plane of the pintle 74 to close the orifice 71 when the stepping piston 62 is pressed against the in - flow end of the cylinder 61 by the bias of return spring 66 . as illustrated by fig1 d , the regulator sleeve 20 is in the closed valve position . opening of the valve to a minimum flow rate increment requires the sleeve 20 to be advanced upwardly to move the snap ring 42 from the detent position 40 a illustrated to the adjacent detent position 40 b . such linear displacement of the sleeve position relative to the housing requires a finite volumetric increase in the lower pressure chamber 48 . this finite volume of hydraulic fluid is displaced from the displacement chamber portion 64 of the actuation cylinder 61 by the stepping piston 62 as the piston is translated along the cylinder length . opening hydraulic pressure is directed from the surface along the opening hydraulic line 54 into the upper chamber 68 of the cylinder 61 . the initial pressure differential across the opposite faces of the piston 62 closes both piston valves 70 and 76 and overcomes the spring bias 66 to drive the piston 62 toward the control conduit 52 thereby displacing the fluid volume 64 from the cylinder 61 . at the end of the piston 62 stroke , the plug 63 closes the entrance orifice of conduit 52 to terminate the fluid displacement from the actuation cylinder 61 . closure of the conduit 52 is signaled to the surface by an abrupt increase in the pressure of opening line conduit 54 . the fluid displaced from actuation cylinder 61 is channeled into the lower sleeve chamber 48 to drive the sleeve snap ring 42 from detent channel 40 a to 40 b . the resilient bias of the snap ring 42 into the channel 40 b secures the sleeve position at that location . upon receipt of the abrupt pressure increase , pressure in the opening conduit 54 is released at the surface and the return spring 66 is allowed to drive the stepping piston 62 toward the in - flow end of the cylinder 61 . without the high pressure differential across the stepping valve 70 , the spring 75 displaces the pintle 74 from the valve seat 73 to permit a bypass flow of fluid from the conduit 54 through the orifice 71 into the displacement chamber 64 of cylinder 61 until the pintle salient 78 abuts the end wall of the cylinder . the foregoing procedure is repeated for each increment of sleeve opening except that the pressure supplied to the opening conduit 54 that is required to overcome the progressively increased angle of each detent channel wall 40 c through 40 g increases correspondingly . hence , by the pressure value required to advance the sleeve an increment , the identity of the opening increment may be known . from any position of relative opening , the valve may be closed by a surface directed pressure charge along closing conduit 50 into the upper sleeve chamber 46 . see fig1 b and 1c . correspondingly displaced fluid in the lower sleeve chamber 48 follows a reverse flow path along the actuator control conduit 52 into the cylinder 61 and past the stepping piston 62 through the check valve 76 . an alternative embodiment of the invention control actuator 60 is illustrated by fig3 . in this embodiment , the check valve 76 is omitted as separate apparatus . the bias force of stepping valve opening spring 75 is modified to keep the orifice 71 open against the closing bias of return spring 66 to permit a controlled bypass flow of fluid from the lower sleeve chamber when the valve is closed . use of sleeve retainer detent channels 40 having progressive side wall angles is one method of informational feedback for indicating the sleeve position . it should be understood by those of skill in the art that other devices may be used to accomplish the same end such as linear transducers . other applications for the actuator valve 60 described herein may include stepping control for under - reaming tools . it may also be used in a drill - stem testing tool to set an inflatable packer for pressure reversals without unsetting the tool . in another application , the actuator may be used to step set an inflatable packer to different inflation pressures . similar to the present embodiments , the actuator may be used to step set a gas lift valve into different flow rate positions . although the invention has been described in terms of particular embodiments which are set forth in detail , it should be understood that this is by illustration only and that the invention is not necessarily limited thereto . alternative embodiments and operating techniques will become apparent to those of ordinary skill in the art in view of the present disclosure . accordingly , modifications of the invention are contemplated which may be made without departing from the spirit of the claimed invention .	4
fig1 shows a fastener device 100 of the prior art . the prior art fastener 100 has a rounded upper surface 110 , a central hole 120 , an embedded fastener 130 , slots 140 , and a hole 150 . the prior art fastener 100 is made of a molded plastic , and is placed below a slat opening in a slat floor . a common bolt type fastener is inserted into the central hole 120 from above and screwed into the embedded fastener 130 . in this manner , the prior art fastener 100 may be used to fasten equipment to an upper surface of a slat floor . the slots 140 may be used to position or restrain an item being fastened to the slat floor . the hole 150 may be used in conjunction with a tool to hold the prior art fastener 100 in position below a slat opening . fig2 shows one embodiment of a fastener 200 of the present invention . the fastener 200 has a flat upper surface 210 , two sloping upper surfaces 220 , two substantially vertical end surfaces 230 , a bevel 240 , and a central hole 250 . the two sloping upper surfaces 220 are preferrably at an angle from the horizontal of approximately twenty - nine degrees , but may range from , for example , ten to sixty degrees in angle . the width w of the fastener 200 in the preferred embodiment is approximately seven eighths of an inch , which allows the fastener 200 to fit through a standard one inch slat opening . alternatively , the width w of the fastener 200 may vary from , for example , about one - quarter of an inch to about six inches , depending on the size of the slat opening . in the preferred embodiment , the fastener 200 has a length l of approximately one and eleven sixteenths inches , but the length l may vary from about one - quarter of an inch to about twelve inches . in the preferred embodiment , the fastener 200 has a height h of fifteen sixteenths of an inch , but the height h may vary from about one - quarter of an inch to about twelve inches . in the preferred embodiment , the fastener 200 is made of a thermoplastic resin , and more particularly of a thirty percent glass - filled thermoplastic resin . it will be obvious to one skilled in the art that other materials may be used to make the fastener 200 , such as wood , metal , or other plastics having satisfactory qualities . in use , the central hole 250 is capable of receiving an upper fastener component , such as a bolt or a screw ( not shown ). the two sloping upper surfaces 220 function to bring the fastener 200 into a centered position with respect to a slat opening in a slat floor , so that the upper surface 210 and the central hole 250 are centered in the slat opening . the upper fastener component , whether it be a screw or a bolt , may be started into the fastener 200 prior to the fastener 200 being inserted downward through an opening in the slat floor . alternatively , the fastener 200 may be placed underneath an item already in place on the slat floor by means of a tool and then the upper fastener component may be inserted downward into the fastener 200 . when the threads of the upper fastener component meet the thread locking capability of the fastener 200 ( discussed below ) the fastener 200 will turn with the upper fastener component unless a restraining force is applied to the fastener 200 . due to this thread locking capability , the fastener 200 will turn with the upper fastener component unless it is brought upward into contact with the lower surface of the slat floor . the angled surface of the bevel 240 translates a portion of an upward force into rotational force when the fastener 200 is forced upward into contact with the lower surface of a slat floor . in this manner , the fastener 200 is brought into cross - alignment with the slat opening in the slat floor , and held in alignment by the sloping upper surfaces 220 . the fastener 200 can therefore be inserted downward through a slat opening from the upper side of the slat floor , can center itself in the slat opening , and can seek and maintain a position of cross - alignment while being tightened , so that the fastener 200 may function to fasten an item firmly to the slat floor . in one embodiment , an upper fastener component such as a screw ( not shown ) is used in conjunction with the fastener 200 . the screw can be used to fasten an item to the fastener 200 by screwing the screw into the central hole 250 of the fastener 200 . in this embodiment , the central hole 250 must be of a diameter that is less than the diameter of the screw , so that the threads of the screw will be forced into the material of the fastener 200 . the central hole 250 may be of a depth sufficient to accommodate the screw , or alternatively may be deeper , including a central hole 250 that passes all the way through the fastener 250 . in addition , the material of the fastener 200 may be displaced by the screw threads of the screw , creating a friction sufficient to create a thread locking capability between the screw and the fastener 200 . fig3 is a side view of the preferred embodiment of the fastener 200 . the preferred embodiment of the fastener 200 includes an upper central hole 250 , a lower central hole 260 , and a lower fastener component 270 . the lower fastener component 270 is a threaded nut , although alternatively the lower fastener component 270 could be a spring clip or other retainer that attaches to a corresponding upper fastener component inserted into the central hole 250 . the lower fastener component 270 is embedded in substantially the center of the fastener 200 . additionally , the lower fastener component 270 is coaxial with both the upper central hole 250 and the lower central hole 260 , which are also coaxial with each other . due to the embedded nature of the lower fastener component 270 , it is firmly held in place and cannot turn with respect to the fastener 200 when an upper fastener component is inserted and tightened . the upper central hole 250 is sized to accommodate an inserted upper fastener component , and in the preferred embodiment can accommodate a bolt of three - eights of an inch in diameter . the lower central hole 260 is slightly smaller than the upper central hole 250 . the smaller diameter of the lower central hole 260 provides a locking effect to the bolt fastener , as any threaded portion of the bolt that extends beyond the lower fastener component 270 will bite into the sidewall of the lower central hole 260 , with the friction generated between the bolt and the fastener 200 being sufficient to prevent removal of the bolt unless sufficient torque is exerted on the bolt . in the preferred embodiment , the lower central hole 260 is approximately eleven thirty - seconds of an inch to one quarter of an inch in diameter when a three - eighths inch bolt is being used . fig4 is a side view of an alternative embodiment of the fastener 200 , showing the placement of a lower fastener component 270 embedded in the lower surface of the fastener 200 and coaxial with the central hole 250 . the lower fastener component 270 is a threaded lock nut , although alternatively the lower fastener component 270 could be a spring clip or other retainer that attaches to a corresponding fastener component inserted into the central hole 250 . the embedded lower fastener component 270 is held in the fastener 200 by friction , although alternatively it could be loose or held in place by an adhesive or other means . it will be obvious that although the lower fastener component 270 is shown as being recessed into the fastener 200 , it could alternatively rest on the lower surface of the fastener 200 . fig5 illustrates the use of the fastener 200 . the slat floor 500 is generally constructed of concrete of four to five inches in thickness . the slat opening 510 in the slat floor is generally one inch in width . the upper fastener component 520 passes through an item 530 which is to be fastened to the slat floor 540 , and then into the fastener 200 . in use , the fastener 200 is inserted length - wise through the slat opening 510 and then rotated into cross - alignment with the slat opening 510 , as shown . the upper fastener component 520 is screwed into the fastener 200 in order to bring the fastener 200 into firm contact with the slat floor 500 . in this manner , the item 530 can be firmly fastened to the slat floor 500 with the advantage that the fastener 200 can be inserted , cross - aligned , and tightened from the top side of an existing slat floor . although the opening is shown having beveled surfaces corresponding to the sloping upper surfaces 220 , it should be understood that the fastener 200 may be used with any configuration of hole or slot opening , including openings having bevels or sloped sides . while the invention has been described in detail above , the invention is not intended to be limited to the specific embodiments as described . it is evident that those skilled in the art may now make numerous uses and modifications of and departures from the specific embodiments described herein without departing from the inventive concepts .	5
the following description is merely exemplary in nature and is not intended to limit the present disclosure , application , or uses . it should be understood that throughout the drawings , corresponding reference numerals indicate like or corresponding parts and features . as used herein , the terms module , control module , and controller may refer to one or more of the following : an application specific integrated circuit ( asic ), an electronic circuit , a processor ( shared , dedicated , or group ) and memory that execute one or more software or firmware programs , a combinational logic circuit , or other suitable components that provide the described functionality . as used herein , computer readable medium may refer to any medium capable of storing data for a computer or module , including a processor . computer - readable medium includes , but is not limited to , memory , ram , rom , prom , eprom , eeprom , flash memory , cd - rom , floppy disk , magnetic tape , other magnetic medium , optical medium , or any other device or medium capable of storing data for a computer . with reference to fig1 , an exemplary refrigeration system 5 includes a compressor 10 that compresses refrigerant vapor . while a specific refrigeration system is shown in fig1 , the present teachings are applicable to any refrigeration system , including heat pump , hvac , and chiller systems . refrigerant vapor from compressor 10 is delivered to a condenser 12 where the refrigerant vapor is liquefied at high pressure , thereby rejecting heat to the outside air . the liquid refrigerant exiting condenser 12 is delivered to an evaporator 16 through an expansion valve 14 . expansion valve 14 may be a mechanical or electronic valve for controlling super heat of the refrigerant . the refrigerant passes through expansion valve 14 where a pressure drop causes the high pressure liquid refrigerant to achieve a lower pressure combination of liquid and vapor . as hot air moves across evaporator 16 , the low pressure liquid turns into gas , thereby removing heat from evaporator 16 . the low pressure gas is again delivered to compressor 10 where it is compressed to a high pressure gas , and delivered to condenser 12 to start the refrigeration cycle again . with reference to fig1 and 3 , compressor 10 may be driven by an inverter drive 22 , also referred to as a variable frequency drive ( vfd ), housed in an enclosure 20 . enclosure 20 may be near compressor 10 . inverter drive 22 receives electrical power from a power supply 18 and delivers electrical power to compressor 10 . inverter drive 22 includes a control module 25 with a processor and software operable to modulate and control the frequency of electrical power delivered to an electric motor of compressor 10 . control module 25 includes a computer readable medium for storing data including the software executed by the processor to modulate and control the frequency of electrical power delivered to the electric motor of compressor and the software necessary for control module 25 to execute and perform the protection and control algorithms of the present teachings . by modulating the frequency of electrical power delivered to the electric motor of compressor 10 , control module 25 may thereby modulate and control the speed , and consequently the capacity , of compressor 10 . inverter drive 22 includes solid state electronics to modulate the frequency of electrical power . generally , inverter drive 22 converts the inputted electrical power from ac to dc , and then converts the electrical power from dc back to ac at a desired frequency . for example , inverter drive 22 may directly rectify electrical power with a full - wave rectifier bridge . inverter driver 22 may then chop the electrical power using insulated gate bipolar transistors ( igbt &# 39 ; s ) or thyristors to achieve the desired frequency . other suitable electronic components may be used to modulate the frequency of electrical power from power supply 18 . electric motor speed of compressor 10 is controlled by the frequency of electrical power received from inverter driver 22 . for example , when compressor 10 is driven at sixty hertz electric power , compressor 10 may operate at full capacity operation . when compressor 10 is driven at thirty hertz electric power , compressor 10 may operate at half capacity operation . piping from evaporator 16 to compressor 10 may be routed through enclosure 20 to cool the electronic components of inverter drive 22 within enclosure 20 . enclosure 20 may include a cold plate 15 . suction gas refrigerant may cool the cold plate prior to entering compressor 10 and thereby cool the electrical components of inverter drive 22 . in this way , cold plate 15 may function as a heat exchanger between suction gas and inverter drive 22 such that heat from inverter drive 22 is transferred to suction gas prior to the suction gas entering compressor 10 . as shown in fig2 and 3 , electric power from inverter drive 22 housed within enclosure 20 may be delivered to compressor 10 via a terminal box 24 attached to compressor 10 . a compressor floodback or overheat condition is undesirable and may cause damage to compressor 10 or other refrigeration system components . suction super heat ( ssh ) and / or discharge super heat ( dsh ) may be correlated to a flood back or overheating condition of compressor 10 and may be monitored to detect and / or predict a flood back or overheating condition of compressor 10 . dsh is the difference between the temperature of refrigerant vapor leaving the compressor , referred to as discharge line temperature ( dlt ) and the saturated condenser temperature ( tcond ). suction super heat ( ssh ) is the difference between the temperature of refrigerant vapor entering the compressor , referred to as suction line temperature ( slt ) and saturated evaporator temperature ( tevap ). ssh and dsh may be correlated as shown in fig5 . the correlation between dsh and ssh may be particularly accurate for scroll type compressors , with outside ambient temperature being only a secondary effect . as shown in fig5 , correlations between dsh and ssh are shown for outdoor temperatures ( odt ) of one - hundred fifteen degrees fahrenheit , ninety - five degrees fahrenheit , seventy - five degrees fahrenheit , and fifty - five degrees fahrenheit . the correlation shown in fig5 is an example only and specific correlations for specific compressors may vary by compressor type , model , capacity , etc . a flood back condition may occur when ssh is approaching zero degrees or when dsh is approaching twenty to forty degrees fahrenheit . for this reason , dsh may be used to detect the onset of a flood back condition and its severity . when ssh is at zero degrees , ssh may not indicate the severity of the flood back condition . as the floodback condition becomes more severe , ssh remains at around zero degrees . when ssh is at zero degrees , however , dsh may be between twenty and forty degrees fahrenheit and may more accurately indicate the severity of a flood back condition . when dsh is in the range of thirty degrees fahrenheit to eighty degrees fahrenheit , compressor 10 may operate within a normal range . when dsh is below thirty degrees fahrenheit , the onset of a flood back condition may occur . when dsh is below ten degrees fahrenheit , a severe flood back condition may occur . with respect to overheating , when dsh is greater than eighty degrees fahrenheit , the onset of an overheating condition may occur . when dsh is greater than one - hundred degrees fahrenheit , a severe overheating condition may be present . in fig5 , typical ssh temperatures for exemplar refrigerant charge levels are shown . for example , as the percentage of refrigerant charge in refrigeration system 5 decreases , ssh typically increases . to determine dsh , dlt may be subtracted from tcond . dlt may be sensed by a dlt sensor 28 that senses a temperature of refrigerant exiting compressor 10 . as shown in fig1 , dlt sensor 28 may be external to compressor 10 and may be mounted proximate a discharge outlet of compressor 10 . alternatively , an internal dlt sensor 30 may be used as shown in fig4 . in fig4 , a cross - section of compressor 10 is shown . internal dlt sensor 30 may be embedded in an upper fixed scroll of a scroll compressor and may sense a temperature of discharge refrigerant exiting the intermeshing scrolls . in the alternative , a combination temperature / pressure sensor may be used . in such case , tcond may be measured based on the pressure of refrigerant exiting compressor 10 as measured by the combination sensor . moreover , in such case , dsh may be calculated based on dlt , as measured by the temperature portion of the sensor , and on tcond , as measured by the pressure portion of the combination sensor . tcond may be derived from other system parameters . specifically , tcond may be derived from compressor current and voltage ( i . e ., compressor power ), compressor speed , and compressor map data associated with compressor 10 . a method for deriving tcond based on current , voltage and compressor map data for a fixed speed compressor is described in the commonly assigned application for compressor diagnostic and protection system , u . s . application ser . no . 11 / 059 , 646 , publication no . u . s . 2005 / 0235660 . compressor map data for a fixed speed compressor correlating compressor current and voltage to tcond may be compressor specific and based on test data for a specific compressor type , model and capacity . in the case of a variable speed compressor , tcond may also be a function of compressor speed , in addition to compressor power . a graphical correlation between compressor power in watts and compressor speed is shown in fig6 . as shown , tcond is a function of compressor power and compressor speed . in this way , a three - dimensional compressor map with data correlating compressor power , compressor speed , and tcond may be derived for a specific compressor based on test data . compressor current may be used instead of compressor power . compressor power , however , may be preferred over compressor current to reduce the impact of any line voltage variation . the compressor map may be stored in a computer readable medium accessible to control module 25 . in this way , control module 25 may calculate tcond based on compressor power data and compressor speed data . control module 25 may calculate , monitor , or detect compressor power data during the calculations performed to convert electrical power from power supply 18 to electrical power at a desired frequency . in this way , compressor power and current data may be readily available to control module 25 . in addition , control module 25 may calculate , monitor , or detect compressor speed based on the frequency of electrical power delivered to the electric motor of compressor 10 . in this way , compressor speed data may also be readily available to control module 25 . based on compressor power and compressor speed , control module 25 may derive tcond . after measuring or calculating tcond , control module 25 may calculate dsh as the difference between tcond and dlt , with dlt data being receiving from external dlt sensor 28 or internal dlt sensor 30 . control module 25 may monitor dsh to detect a flood back or overheat condition , based on the correlation between dsh and flood back and overheat conditions described above . upon detection of a flood back or overheat condition , control module 25 may adjust compressor speed or adjust expansion valve 14 accordingly . control module 25 may communicate with or control expansion valve 14 . alternatively , control module 25 may communicate with a system controller for refrigeration system 5 and may notify system controller of the flood back or overheat condition . system controller may then adjust expansion valve or compressor speed accordingly . dsh may be monitored to detect or predict a sudden flood back or overheat condition . a sudden reduction in dlt or dsh without significant accompanying change in tcond may be indicative of a sudden flood back or overheat condition . for example , if dlt or dsh decreases by a predetermined temperature amount ( e . g ., fifty degrees fahrenheit ) within a predetermined time period ( e . g ., fifty seconds ), a sudden flood back condition may exist . such a condition may be caused by expansion valve 14 being stuck open . likewise , a sudden increase in dlt or dsh with similar magnitude and without significant accompanying change in tcond may be indicative of a sudden overheat condition due to expansion valve 14 being stuck closed . for example , if dlt or dsh increases by a predetermined temperature amount ( e . g ., fifty degrees fahrenheit ) within a predetermined time period ( e . g ., fifty seconds ), a sudden overheat condition may exist . control module 25 may monitor dsh and dlt to determine whether compressor 10 is operating within a predetermined operating envelope . as shown in fig7 , a compressor operating envelope may provide maximum flood back and maximum and / or minimum dsh / dlt limits . in addition , a maximum scroll temperature limit ( tscroll ) may be provided , in the case of a scroll compressor . in addition , a maximum motor temperature ( tmotor ) may be provided . as shown in fig7 , compressor speed and expansion valve 14 may be adjusted based on dsh and / or dlt to insure compressor operation within the compressor operating envelope . in this way , dsh and / or dlt may move back into an acceptable range as indicated by fig7 . compressor speed adjustment may take priority over expansion valve adjustment . in some cases , such as a defrost state , it may be difficult for expansion valve 14 to respond quickly and compressor speed adjustment may be more appropriate . in the event of a flood back condition , control module 25 may limit a compressor speed range . for example , when dsh is below thirty degrees fahrenheit , compressor operation may be limited to the compressor &# 39 ; s cooling capacity rating speed . for example , the cooling capacity rating speed may be 4500 rpm . when dsh is between thirty degrees fahrenheit and sixty degrees fahrenheit , compressor operating speed range may be expanded linearly to the full operating speed range . for example , compressor operating speed range may be between 1800 and 7000 rpm . the function correlating tcond with compressor speed and power , may assume a predetermined or constant saturated tevap . as shown in fig8 , the correlation between compressor power and tcond may be insensitive to variations of tevap . for additional accuracy , tevap may be derived as a function of tcond and dlt , as described in commonly assigned u . s . application ser . no . 11 / 059 , 646 , u . s . publication no . 2005 / 0235660 . for variable speed compressors , the correlation may also reflect compressor speed . in this way , tevap may be derived as a function of tcond , dlt and compressor speed . as shown in fig9 , tevap is shown correlated with dlt , for various tcond levels . for this reason , compressor map data for different speeds may be used . tcond and tevap may be calculated based on a single derivation . in addition , iterative calculations may be made based on the following equations : multiple iterations of these equations may be performed to achieve convergence . for example , three iterations may provide optimal convergence . as discussed above , more or less iteration , or no iterations , may be used . tevap and tcond may also be determined by using compressor map data , for different speeds , based on dlt and compressor power , based on the following equations : once tevap and tcond are known , additional compressor performance parameters may be derived . for example , compressor capacity and compressor efficiency may be derived based on additional compressor performance map data for a specific compressor model and capacity . such additional compressor map data may be derived from test data . for example , compressor mass flow or capacity , may be derived according to the following equation : where m0 - m19 are compressor model and size specific , as published by compressor manufacturers . compressor map data may be stored within a computer readable medium within control module 25 or accessible to control module 25 . as shown in fig1 , a flow chart for derived parameters is shown . in step 100 , tcond may be derived from compressor power and compressor speed . in step 101 , tevap may be derived from dlt and tcond . in step 102 , capacity / mass flow and a compressor energy efficiency ratio may be derived from tevap and tcond . in addition , by monitoring run time in step 103 , additional parameters may be derived . specifically , in step 104 , load and kwh / day may be derived from run time , capacity / mass flow , eer , and compressor power . by monitoring the above operating parameters , control module 25 may insure that compressor 10 is operating within acceptable operating envelope limits that are preset by a particular compressor designer or manufacturer and may detect and predict certain undesirable operating conditions , such as compressor floodback and overheat conditions . further , control module 25 may derive other useful data related to compressor efficiency , power consumption , etc . where compressor 10 is driven by a suction cooled inverter drive 22 , tevap may be alternatively calculated . because tevap may be calculated from mass flow , tcond , and compressor speed as discussed above , control module 25 may derive mass flow from a difference in temperature between suction gas entering cold plate 15 ( ts ) and a temperature of a heat sink ( ti ) located on or near inverter drive 22 . control module 25 may calculate delta t according to the following equation : ts and ti may be measured by two temperature sensors 33 and 34 shown in fig1 . temperature sensor 33 measures the temperature of the heat sink ( ti ) and may be incorporated as part of inverter drive 22 . alternatively , temperature sensor 33 may measure a temperature of suction gas exiting cold plate 15 and may be located on or near the piping between cold plate 15 and compressor 10 . temperature sensor 34 measures the temperature of suction gas entering cold plate 15 . control module 25 may determine mass flow based on delta t and by determining the applied heat of inverter drive 22 . as shown in fig1 , mass flow may be derived based on lost heat of inverter drive 22 and delta t . as shown in fig1 , the relationship between mass flow , delta t and applied inverter heat may be mapped based on test data . inverter heat may be derived based on inverter speed ( i . e ., compressor speed ) and inverter efficiency as shown in fig1 . with reference again to fig1 , inputs include compressor speed ( rpm ) 120 , compressor current 122 , compressor voltage 124 , compressor power factor 126 , ti 128 and ts 130 . from compressor current 122 , compressor voltage 124 , and power factor 126 , compressor power 132 is derived . from temperatures ti 128 and ts 130 , delta t 134 is derived . from rpm 120 and power , tcond 136 is derived . also from rpm 120 and power 132 , inverter heat loss 138 is derived . from inverter heat loss , and delta t 134 , mass flow 140 is derived . from rpm 120 , tcond 136 , and mass flow 140 , tevap 142 is derived . from tevap 142 and ts 130 , ssh 144 is derived . from ssh 144 and ambient temperature as sensed by ambient temperature sensor 29 , dsh 146 is derived . once dsh 146 is derived , all of the benefits of the algorithms described above may be gained , including protection of compressor 10 from flood back and overheat conditions . as shown by dotted line 141 , tcond and tevap may be iteratively calculated to more accurately derive tcond and tevap . for example , optimal convergence may be achieved with three iterations . more or less iterations may also be used . as shown in fig1 , control module 25 takes as measured inputs compressor speed rpm , inverter drive current , voltage , and power , and heat sink temperatures ti and ts . control module also takes as input ambient temperature as indicated by ambient temperature sensor 29 . as discussed above , control module 25 derives from these measured inputs the outputs of tcond , tevap , mass flow , ssh , dsh , and dlt . as shown in fig1 , control module 25 may monitor slt with slt sensor 35 , which may include a combination pressure and temperature sensor may be used . in such case , tevap may be measured based on the suction pressure as measured by the pressure portion of the combination sensor . further , ssh may be calculated based on slt , as measured by the temperature portion of the combination sensor , and tevap . slt sensor 34 , 35 may be located at an inlet to compressor 10 and may sense a temperature or pressure of refrigerant entering compressor 10 subsequent to inverter 22 , enclosure 20 , or cold plate 15 . alternatively slt sensor may be located at an inlet to enclosure 20 , inverter 22 , or cold plate 15 and may sense a temperature or pressure of refrigerant entering the enclosure 20 , inverter 22 , or cold plate 15 . in addition , similar to the calculation of dsh based on dlt described above , control module 25 may also calculate ssh . for example , compressor power , compressor speed , and compressor map data may be used to derive tcond and tevap may be derived from tcond . once tevap is derived , ssh may be derived from slt and tevap and used as described above for monitoring various compressor operating parameters and protecting against flood back and overheat conditions .	5
the present invention is directed to an improved method for administering a safe and effective dosage of tranilast for the treatment or prevention of restenosis associated with coronary intervention . m . nobuyoshi conducted pathological observations on coronary vessels of 7 patients who died within 3 months after coronary intervention ( ptca ), and reported that excessive proliferation of vascular smooth muscle cells ( hereinafter referred to as vsmcs ) could be observed but excessive production of collagen could not be observed ( ptca , pages 15 - 21 , published by igakushoin , 1988 ). this report suggests that proliferation of vsmcs plays a key role in restenosis associated with coronary interventions . for purposes of the present invention , it was concluded that a drug concentration in human plasma which prevents proliferation of vsmcs is a desirable method for the treatment or prevention of restenosis associated with coronary intervention . this was confirmed by clinical tests . it was found that tranilast significantly prevents proliferation of human vsmcs at 100 micromolar concentration ( 100 μm ) in human plasma ( fukuyama et al , canadian journal of physiology and pharmacology , vol . 74 , no . 1 , pp . 80 - 84 , 1996 ). it was demonstrated that proliferation of vsmcs in humans can be prevented by administering tranilast at a plasma concentration of about 100 μm . data was obtained from clinical studies in which tranilast was administered to three healthy adult humans in a dose of 2 . 5 mg / kg three times per day for a period of five days . it was confirmed that when tranilast was administered in a dose of 2 . 5 mg / kg three times per day , the plasma concentration of tranilast reached a steady state of about 18 . 7 - 27 . 4 μg / ml ( about 57 - 84 μm ) on the 2nd day after the first administration . thus , it was demonstrated that restenosis associated with coronary interventions can be treated or prevented by administering tranilast so as to maintain a plasma concentration of about 100 μm which is effective for preventing the proliferation of human vsmcs . for example , in the case of patients weighing 60 kg , tranilast was administered in a dose of about 500 - 790 mg per day in order to obtain a plasma concentration of about 100 μm which prevents or treats restenosis associated with coronary intervention . since absorption of tranilast varies depending on the weight and sex and age of the patients , the severity of the condition to be treated , and the like , it is preferable to determine a daily dose of tranilast so as to maintain a plasma concentration of about 100 μm in view of the status of patients . a plasma concentration which prevents proliferation of vsmcs varies depending on the nature of patients . therefore , a plasma concentration which prevents proliferation of vsmcs , i . e ., 100 μm , has to be a guide for the treatment or prevention of restenosis associated with coronary intervention . data also was obtained from clinical studies of patients who were administered a dose of 600 mg of tranilast per body per day for a period of 8 weeks to 3 months after coronary interventions ( ptca ), and it was confirmed that the incidence of restenosis after coronary intervention ( ptca ) was less than 20 % with drug treatment . when a placebo was administered to patients , the incidence of restenosis was about 50 %. ueda et al conducted pathologic studies by angiography on cardiovascular vessels after coronary intervention , and reported that a large proliferation of vsmcs occurs at about 12 days after coronary intervention [ kokyu to junkan ( respiration and circulation ), vol . 43 , no . 3 , pp . 257 - 262 , 1995 ]. tamai et al proposed that tranilast has to be administered in a daily dose of 300 - 1000 mg for a period of about 3 - 6 consecutive months after coronary intervention . taking into consideration that proliferation of vsmcs is a critical factor in restenosis associated with coronary intervention , and that proliferation of vsmcs occurs at an early stage after coronary intervention , the method proposed by tamai et al is not the only protocol for the treatment or prevention of restenosis associated with coronary intervention . the data from clinical studies stated above demonstrate that tranilast has to be administered after coronary intervention in a manner which prevents excessive proliferation of vsmcs . it is not necessary to administer tranilast for a period of more than 3 months , since in accordance with the present invention a shorter treatment period is effective for the prevention or treatment of restenosis . tranilast and pharmaceutically acceptable salts thereof of the present invention are known compounds and can be prepared according to standard processes , such as the method described in u . s . pat . no . 4 , 623 , 724 . when tranilast or a pharmaceutically acceptable salt thereof is employed therapeutically , it can be administered in appropriate dosage forms , such as powder , granules , tablets , capsules , dry - syrups , plasters , suppositories , injectable solutions , and the like . a tranilast pharmaceutical composition can be formulated by admixing suitable carriers such as excipients , disintegrators , binders , brighteners , and the like , and prepared in accordance with conventional molding methods and dosage forms . the present invention is further illustrated in more detail by way of the following examples . this example demonstrates the effect of tranilast on proliferation and migration in culture of human vascular smooth muscle cells ( vsmcs ). newborn human aortic smooth muscle cells at the fourth passage culture were provided by kurabo ( osaka , japan ). confluent vsmcs were subcultured at a 1 : 5 split ratio in dmem supplemented with 10 % fbs . vsmcs were used within passages 5 - 10 and were characterized as smooth muscle by morphologic criteria and by expression of smooth muscle α - actin . the cells were negative in mycoplasma assays . the cell proliferation assay was performed by counting the number of cells . first , vsmcs was seeded at a density of 3 × 10 3 cells / cm 2 in dmem supplemented with 10 % fbs in 25 cm 2 tissue culture flasks . the next day , the medium was discarded , and fresh dmem ( 10 % fbs ) containing various concentrations of tranilast was added to the cells . four days after the addition of tranilast , the number of cells was determined with a hematocytometer . cells were grown to confluence in 96 - well tissue culture dishes , and the growth was arrested for 48 hours in a serum - free medium consisting of dmem supplemented with 5 μg / ml insulin , 5 μg / ml transferrin , and 5 ng / ml selenium ( its ). the dmem - its medium was employed to maintain the vsmcs in a quiescent but not catabolic state , a condition that resembles that of healthy cells in the normal arterial wall in vivo ( libby and o &# 39 ; brien 1983 ). the dmem - its medium was then removed , and fresh dmem containing a growth factor was added to the quiescent cells . the cells were subsequently incubated for 20 hours in the absence or presence of tranilast . the cells were then incubated with [ 3 h ] thymidine ( 46 kbq / ml ) for 2 hours in the absence or presence of tranilast . next , ice - cold 10 % trichloroacetic acid was added to each well , and the plates were kept at 4 ° c . for 10 minutes . trichloroacetic acid insoluble materials were then harvested onto unifilter plates ( gf / b 96 , packard instrument , meriden , conn .) with a cell harvester . the extent of [ 3 h ] thymidine incorporation was determined by scintillation counting . the migration of cells was assayed by a modified boyden &# 39 ; s chamber method using a 96 - well boyden chamber apparatus ( neuroprobe inc ., cabin john , md .) ( grotendorst et al 1982 ). chemoattractant ( pdgf - bb ) was first diluted in dmem with or without tranilast and then loaded into the lower wells of the boyden chamber . the wells were subsequently covered with a standard 8 μm pore filter ( nucleopore corp ., pleasanton , calif .) coated with type i collagen . the cell suspensions ( 1 × 10 4 cells ) in dmem containing 0 . 1 % bovine serum albumin ( bsa ) with or without tranilast were then loaded into the upper wells of the chamber , after which the chamber was incubated for 4 hours at 37 ° c . in an atmosphere of 95 % air and 5 % co 2 . nonmigrated cells on the upper surface were scraped off . the filters were then fixed in methanol and strained with diff - quick staining solution ( international reagent corp ., kobe , japan ). the number of vsmcs per 400 × high power field ( hpf ) that had migrated to the lower surface of the filters was then determined microscopically . four hpfs were counted per well , and the values were averaged . tranilast significantly inhibited the proliferation of human vsmcs in a 100μ molar concentration . ( 2 ) effect of tranilast on pdgf - bb - induced dna synthesis in quiescent human vsmcs tranilast significantly inhibited dna synthesis in quiescent human vsmcs that were stimulated with 50 ng / ml pdgf - bb in a 100μ molar concentration . tranilast significantly inhibited the vsmcs migration elicited by 50 ng / ml pdgf - bb in a 100μ molar concentration . this example demonstrates a sufficient dosage period of tranilast for treatment or prevention of restenosis associated with ptca surgery . two hundred eighty eight patients had angina pectoris or myocardial infarction and who underwent successful elective ptca ( including repeat ptca ) in their significant stenotic lesion ( s ) participated in this study . these patients were divided into two groups , and all groups did not differ significantly in sex , age and body weight ; first group received placebo ( hereinafter identified p group ), second group received tranilast in a daily dose of 600 mg ( hereinafter identified t group ). and coronary angiography was performed immediately before and immediately after ptca , and 3 months ( or at the time of withdrawal ) after the completion of drug administration . two hundred fifty - six lesions of two hundred thirty - two patients whose ptca was successful and had not withdrawn participated in efficacy evaluation , and each lesion was evaluated based on the change in stenosis using the following grades . no restenosis : the loss in the stenotic region dilated by ptca was less than 50 % of the gain ( loss / gain & lt ; 50 %). restenosis : the loss in the stenotic region dilated by ptca was not less than 50 % of the gain loss / gain ≧ 50 %). ______________________________________a . patient background ( 188 cases used for analysis ofefficacy ) p group t groupitem classification ( 114 ps ) ( 118 ps ) test______________________________________sex male 86 94 ns female 28 24 p = 0 . 529age & lt ; 65 yrs old 58 68 ns 65 yrs old ≦ 13 17 p = 0 . 302 mean ± s . d . 63 . 8 ± 62 . 5 ± ns 0 . 8 0 . 9 p = 0 . 346body mean ± s . d 60 . 8 ± 60 . 8 ± nsweight 0 . 8 0 . 8 p = 0 . 936______________________________________b . baseline characteristics of lesions ( subjected toefficacy evaluation ) p group t groupitem classification ( 126 ls ) ( 130 ls ) test______________________________________ptca initial ptca 85 100 + repeat ptca 41 30 p = 0 . 096branch rca 40 40 ns lad 55 61 p = 0 . 838 lcx 31 29type type a 16 11 ns type b 107 117 p = 0 . 407 type c 3 2 length of 6 . 1 ± 6 . 3 ± + lesion ( mm ) 0 . 4 0 . 3 p = 0 . 097 mean ± s . d ( n = 67 ) ( n = 64 ) ( n = 63 ) ______________________________________c . resultssubst . admin . term p group t group test______________________________________ ( 1 ) restenosis rate by lesion & lt ; 8 weeks ( 3 ls ) ( 14 ls ) rate 33 . 3 % 42 . 9 % ns p = 1 . 00008 weeks ≦ ( 127 ls ) ( 112 ls ) rate 44 . 1 % 18 . 8 % * p = 0 . 0000 ( 2 ) restenosis rate by patient & lt ; 8 weeks ( 2 ps ) ( 14 ps ) rate 50 . 0 % 42 . 9 % ns p = 1 . 00008 weeks ≦ ( 112 ps ) ( 104 ps ) rate 47 . 3 % 20 . 2 % * p = 0 . 0000______________________________________	0
with reference to fig2 , an “ active cardstack ” 22 is shown as having five images 24 , 26 , 28 , 30 and 32 . the images extend diagonally and provide a perception of rearward images being partially covered by forward images , so that only the foremost image 24 is shown in its entirety . each of the images represents display information of a memory - stored item , such as image files in non - volatile memory or opened desktop windows from volatile memory ( random access memory ). the invention will be described primarily in the embodiment in which the memory - stored items are image files , such as digital photographs . however , other applications of the invention will be described below . since the active cardstack 22 is arranged such that each image 24 - 32 is at least partially exposed , a display icon , such as a cursor , may be moved into perceived contact with any one of the images . the images may be described as first - level images . however , when the cursor is brought into contact with one of the images , a second - level image is formed . thus , the cardstack is a dynamic stack that is manipulated merely by movement of the cursor onto the stack . it is not necessary to “ click ” the device that manipulates the cursor ( e . g ., a mouse ) or to register a keyboard keystroke . in the center portion of fig2 , a cursor 34 is shown as being positioned over the second image 26 . this causes a second - level image to be generated in a position offset from the original position . in the embodiment that will be described with reference to fig3 and 4 , the first - level image is preserved and the second - level image is shown in its entirety . regardless of whether the approach of fig2 or the approach of fig3 and 4 is utilized , the mere repositioning of the cursor causes the stack to be modified to an “ activated cardstack ” 36 . if the cursor 34 is scanned across the images 24 - 32 along a path in which the cursor is sequentially aligned with the images , a corresponding sequence of second - level images will be presented to a viewer . in this manner , each of the images 24 - 32 can be reviewed for content without requiring a repetitive point - and - click process . the number of images within the original cardstack 22 may be fixed or may be selected by the user . if the number of images 24 - 32 is less than the total number of images that can be browsed , the preferred embodiment allows continued browsing without requiring a user input beyond the positioning of the cursor 34 . for example , if the cursor 34 is located immediately to the right of the cardstack 36 , as viewed in fig2 , the next subset of images 38 , 40 , 42 , 44 and 46 is introduced as a second active cardstack 48 . for the purpose of reducing the likelihood that a new cardstack will be introduced unintentionally , there should be a threshold time for the positioning of the cursor before the cardstack is changed . moreover , stack - to - stack incrementing and decrementing icons may be formed to the right and left of the cardstack , respectively , as will be described with reference to fig3 . by positioning the cursor 34 over the decrementing icon , the cardstack 48 may be resubstituted with the original cardstack 22 . referring now to fig3 , a stack 50 of first - level images 52 , 54 , 56 , 58 and 60 is shown in greater detail . a cursor 62 is in perceived contact with the center image 56 , causing a second - level image 64 to be generated . unlike fig2 , the second - level image 64 is shown in its entirety . this is the preferred embodiment , but is not critical . as can be seen , a sufficient portion of each first - level image 52 - 60 is exposed to allow a user to utilize the exposed portions as mnemonic devices . as the number of images in the stack is increased , the ratio of the exposed portion to the overlapped portion will decrease , but the value of the mnemonic aid may be increased , since there will be more images to consider . the window 66 in which the stack 50 resides includes a stack - to - stack incrementing icon 68 and a stack - to - stack decrementing icon 70 . by positioning the cursor 62 in alignment with the incrementing icon 68 for a set period of time , a second stack will be presented to the user . for example , if there are 75 digital images within a library , the entire library will be displayed in stacks of five images if the cursor is left in position along the incrementing icon 68 . in the preferred embodiment , each image in a stack is displayed as a second - level image before the stack is changed . thus , the process will scan through all 75 images in the library . the decrementing icon 70 operates in the reverse manner . optionally , the controlling computer program is configured to allow instant incrementing or decrementing by clicking the computer mouse when the cursor 62 resides on the appropriate icon 68 or 70 . in addition to the display of the second - level image 64 , positioning the cursor 62 in perceived contact with the exposed region of the first - level image 56 triggers the display of file information 72 regarding the image . the file information shown in fig3 identifies the storage location and the size of the image . other information may be included . for applications in which the images 52 - 60 represent web pages , the file information may be the urls of the images . referring now to fig4 , the window 66 of fig3 is shown as being a component of a graphical user interface 74 that includes three other windows 76 , 78 and 80 . the window 76 displays a third - level image 82 that corresponds to the images 56 and 64 . while the second - level image 64 is transitory , since it is removed by moving the cursor 62 , the third - level image 82 will remain after the selection of a displayed stack has been incremented forward or decremented rearward . thus , the display within the window 76 is not based upon the current display of images within the window 66 . the “ loading ” of an image into the window 76 can be triggered by a combination of user designations , such as cursor positioning and mouse clicking . the window 78 presents a menu that is used to select the images for forming the displayed stack 50 within the window 66 . in the illustrated example , the images are stored in a folder 84 and the first - listed image ( i . e ., house 1 ) has been designated as the first image in the displayed stack 50 . the designated image and the following four images in the folder 84 are used to form the stack . the next five images can be used to form a “ next ” stack by positioning the cursor 62 in window 66 over the icon 68 for the set period of time . as an alternative , the first stack may be designated by selecting a folder in which the files are stored . thus , by designating the folder 84 , the first image files in the folder will be used to form the stack 50 . as a user option , the selection of the image files from an image library may be arbitrary . that is , rather than a stack that directly reflects the order of files within the folder 84 , there may be a degree of randomness in the selection of files for forming the stack . the window 80 may be used to transfer or organize the stored images . for example , the third - level image 82 within the window 76 may be transferred to the folder 86 in the window 80 . drag - and - drop techniques may be used to transfer the image 82 from the window 76 or to transfer the corresponding file designation from the window 78 . however , in the preferred embodiment , the manipulation of images can occur without moving the cursor 62 from the window 66 . a combination of computer mouse operations and / or a keystroke may be used to enter one of the images 52 - 60 of the stack 50 into the folder 86 . in this application of the invention , the stack 50 is used for selecting files that are of interest to the user . the image files within a folder having a large library of images can be sorted into a number of more manageable folders by segregating the images on the basis of content ( e . g ., family pictures , work - related pictures , etc ). instead of sorting , the selected images may be duplicated as a result of selections triggered within window 66 . for example , the window 80 in which folder 86 resides may be a window for an auxiliary or a removable storage device . thus , the invention may be used for its browsing - selection capability in addition to its browsing - viewing capability . in one alternative application of the invention , the images 52 - 60 are thumbnail images of video clips . the thumbnail images can be browsed in the same manner as described with reference to the scrolling of digital photographs from a digital camera . however , when a particular thumbnail image is designated for loading into the window 76 , the video clip is automatically run in the window . in another alternative embodiment , the images 52 - 60 in the stack 50 are representative of text documents . the images represent display information for the different text documents . this browsing approach is particularly useful if the text documents include banners or other features that distinguish one document from another . the operations of the invention will be described with reference to fig4 , 5 and 6 . fig5 is an example of a process flow of steps , while fig6 is a simplification of the components for implementing the steps . at step 88 , the system detects an input from a user regarding forming a stack . in fig4 , the image labeled “ house 1 ” is selected from the window 78 for forming the displayed stack 50 , as indicated at step 90 . the selected image is positioned as the first image in the displayed stack . as previously noted , the user input may be a selection of a folder rather than an image and / or may include a degree of randomness in the selection of available images for forming the stack . in fig6 , the images are stored in the image source 92 . the source may be a hard drive of a computer or may be a storage at a remote site , with the images being accessible via a network , such as the internet . for applications in which only the windows 66 and 78 are available , the process steps may be implemented entirely within the digital camera that is used to form the images . in this embodiment , the image source 92 is the memory of the camera . at least one central processing unit ( cpu ) 94 is used to execute the necessary instructions . the cpu is connected to a program 96 , which is stored in non - volatile memory . the user input device 98 may be any one of or a combination of known devices for manipulating a cursor , such as a computer mouse , a trackball or a keyboard . the graphical user interface of fig4 is presented on a display device 100 , such as a monitor . the movement of a cursor across the display device 100 is tracked by the cpu 94 , as indicated at step 102 in fig5 . as a result , the system will be able to detect when the cursor 62 of fig4 is positioned over one of the images 52 - 60 in the stack 50 . when the cursor is positioned over one of the images , the transitory second - level image 64 is presented . this display step 104 allows the user to efficiently browse through the images . the use of the window 76 is not critical to the invention . if the third - level image 82 is desired , the process includes a decision step 106 of determining whether an image has been selected . one acceptable mechanism for selecting the image may be “ clicking ” the computer mouse that controls the cursor 62 . the selection of an image generates the third - level image 82 , as indicated at step 108 . the selection may also be used to duplicate or move the image file to another folder , to print the image , or to otherwise manipulate the selected image or image file . the method also includes the step 110 of detecting when the user has generated a command to change the stack . the command may be a result of selecting another image from the window 78 or may be the result of using the incrementing icon 68 or the decrementing icon 70 . as previously described , merely by positioning the icon 62 over the incrementing icon 68 , a transitory image is formed for each of the first - level images 52 - 60 in the stack 50 before the stack is substituted at step 112 to present a different subset of images that will be scrolled with respect to generating the transitory images . in such a sequence , the step 104 of displaying the transitory images on the basis of cursor location results in all of the transitory images being generated as a result of the location of the cursor on the incrementing icon 68 . as will be well understood by persons skilled in the art , the sequence of steps shown in fig5 may be varied without diverging from the invention . moreover , the diagonal arrangement of images 52 - 60 in the stack 50 of fig4 is not critical . any other overlapping arrangement that conserves display real estate may be substituted . however , an advantage of the diagonal arrangement is that the cursor 62 may be moved in a straight line to sequentially generate a transitory image for each one of the first - level images . while the invention has been described primarily with respect to browsing image files within a computer or digital camera , applications within other equipment have been contemplated . for example , the graphical user interface may be a liquid crystal display ( lcd ) of a digital printer having a number of documents that are stored in memory . the images that represent the documents may be the first - level images that are browsed in the manner described with reference to fig1 - 6 . as the first - level images are browsed , second - level transitory images are presented . selecting a particular image causes the corresponding document to be identified as the document to be printed . in another contemplated embodiment , the invention is used to browse through computer windows . the conventional approach is illustrated in fig7 . a display 114 shows four opened windows 116 , 118 , 120 and 122 . in a lower portion of the display 114 are five icons 124 , 126 , 128 , 130 and 132 . each icon 124 - 132 corresponds to an open window . five icons are present , but only four open windows are shown , since one window is entirely covered by the apparent windows . in the display of fig7 , the “ forward ” window is window 116 . however , by clicking on any one of the five icons , the corresponding window is moved to the “ forward ” position . this procedure works well if the information on the icons easily distinguishes one window from the other windows and when the number of open windows is sufficiently low that the information on the icons is apparent . as the number of open windows increases , the available spacing for the icons decreases . referring now to fig8 , in accordance with this embodiment of the invention , a window - browsing region 134 of a display 136 includes display information for the various open windows . thus , the window 138 that was not apparent in fig7 is represented in the window - browsing region 134 of fig8 . in fact , it is this window that is indicated by the hovering of the cursor 140 , so that a transitory second - level image 142 is formed for the window 138 . by selecting the first - level image in the stack 144 , the window 138 is moved to the “ forward ” position within the display 136 . this provides an easily manipulated process for identifying the open windows and selecting one of the windows . as an alternative embodiment of fig8 , the movement of the cursor 140 over one of the icons in the stack 144 may automatically move the corresponding window 116 - 122 to the “ forward ” position within the display 136 . that is , the transitory window 142 is not critical . in another application , the stack 144 of icons within the window - browsing region 134 represents display information for documents or applications which have not been opened . thus , the icons within the stack 144 may be display information for various applications within a “ start ” list or may be documents that are available using a particular program , such as a word processing program .	6
the present invention is based , in part , on the observation that transmitters of radio frequency signals are calibrated for particular load conditions . in a typical situation , a transmitter is calibrated with test equipment as the load and then used with an antenna as the load . the load conditions created by the test equipment are not necessarily exactly the same as the load conditions created by the antenna , and , moreover , different antennas have slightly different characteristics and may create different load conditions at the output of the transmitter . in some situations , the manufacturer may calibrate the transmitter with one kind of test equipment and a compliance verification laboratory may test the transmitter with another kind of test equipment ( e . g ., for fcc rules compliance ). transmitter load conditions may vary also with environmental changes such as temperatures and humidity variations . for this reason the present invention looked at ways to substantially overcome variations in load conditions and thereby improve power measurement and control in transmission systems . we will examine such ways with the examples that follow . in general , because it recognizes that load conditions are imperfect and often result in standing waves produced from reflected signals interfering with forward signal , the present invention proposes to substantially cancel the effects of the reflected waves . specifically , the present invention proposes to converge reflected waves which are out of phase at substantially 180 ° and thus cancel each other . one approach for implementing this involves quadrature sampling in a directional waveguide . fig3 illustrates a directional waveguide for power detection by quadrature sampling . as shown , the power detection system 100 includes a directional waveguide defined by top , down , input and output planes , 102 a - d , respectively . the bottom plane 102 b has two slots 104 a and 104 b spaced apart a quarter wave distance ( 90 °), based on the frequency band . two probes 106 a and 106 b ( labeled p 1 and p 2 , respectively ) protrude through the slots into the waveguide . the probes are therefore also spaced apart a quarter wave distance , or 90 °. the physical dimensions of the waveguide and , in particular , the distance between the slots 104 a and 104 b depend on the frequency range of transmission . thus , for instance , if the transmission frequency is 50 ghz and the bandwidth is 10 % of the transmission frequency , i . e ., +/− 2 . 5 ghz , a quarter wavelength would be 1 . 5 mm . in this configuration , the probes , p 1 and p 2 , are passive devices such as conductors ( traces ) on a printed circuit board ( pcb ) 120 . the pcb is shaped to allow passage of the two probes through the slots 104 a and 104 b . then , in addition to the probes , the pcb 120 holds detector circuit components such as a 90 ° delay line 108 , a power combiner 110 and a detector diode 112 . the power detector circuit on the pcb is formed with the probe p 1 connected to one side of the power combiner via the 90 ° delay line and with the probe p 2 connected to the other side of the power combiner . the detector diode 112 is connected across the power combiner 110 to receive a signal which represents the measured power . the power combiner in this circuit is a passive circuit such as a resistive connection that produces a voltage drop proportionate to the current induced from the power measured by the probes p 1 and p 2 . the buffer amplifier 114 and downstream stages ( not shown ) are located off the pcb 120 . the buffer amplifier protects the detector diode from the effects of downstream stages in order to maintain the diode &# 39 ; s signal integrity and reliably correlate the output of the diode with the measured power . in operation , the forward signals are any type of transmitted signals at a particular frequency range , having a particular power level and being modulated if they carry any information . un - modulated signals with a particular frequency do not contain any information and they are typically known as the carrier waves . modulated signals carry information and they are created by various modulation techniques examples of which include am ( amplitude modulation ), fm ( frequency modulation ), qam ( quadrature amplitude modulation ), and pwm ( pulse width modulation ). the forward signals travel from the input plane 102 c toward the output plane 102 d and because of imperfect load conditions reflected signals travel in the opposite direction . both forward and reflected signals are intercepted by the probes p 1 and p 2 , which are located 90 ° apart , and converge at the power combiner . as they travel through the waveguide , forward waves intercepted by probe p 1 pass through the 90 ° delay line and thus incur a 90 ° delay . at the same time , forward signals intercepted by probe p 2 pass directly to the power combiner , but they incur a 90 ° delay in reaching probe p 2 because of the 90 ° distance between probe p 1 and p 2 . in other words , because they are equally delayed by 90 °, the forward signals intercepted by probes p 1 and p 2 converge at the power combiner in phase relative to each other . this means that the forward signals &# 39 ; convergence is constructive and the resulting signal is the sum of both . by comparison , the reflected signals converge at the power combiner at opposite phases ( 180 °) relative to each and their convergence is destructive . more specifically , reflected waves intercepted by probe p 2 pass directly to the power combiner while reflected waves intercepted by probe p 1 travel 180 ° before they reach the power combiner ( 90 ° distance to p 1 and 90 ° delay at the delay line ). signals converging at 180 ° phase difference cancel each other . therefore , the destructive convergence of the reflected signals results in them canceling each other and not affecting the power measurement . in other words , the measured power as presented by the voltage across the power combiner is substantially free from load condition variations . the measured power is then reliably detected by the detector diode 112 and the value is passed along via the buffer amplifier 114 to downstream stages ( of the power control loop ). it is noted that the frequency range is scalable to other , higher frequencies simply with changes to the pcb layout design and changes to the waveguide dimensions and distance between the slots . in essence , there would be one set of dimensions for each frequency , but the fundamental design is similar for the various frequencies . the ease with which a pcb can be designed and made is one advantage of the present invention . it is further noted that the depth of insertion of the probes into the waveguide controls the sensitivity of the detector circuit ( i . e ., the power level detection voltage at the power combiner ). hence , the ease with which the pcb can be adjusted to achieve the proper depth of protrusion into the waveguide is yet another advantage of the present invention . furthermore , the pcb can be made sufficiently small that it fits easily inside the waveguide body . fig4 is an isometric view of a waveguide , taken apart , and a pcb with the power detection circuit . in this illustration , the waveguide is produced when the two semi - circular members 101 a and 110 b are joined . the material these members are made out of is suitable for microwave applications and is therefore suitable for producing the waveguide . when joined , the two members form a cylinder with a duct which , in this case , has a rectangular cross section and is substantially aligned with the axis of the cylinder . the length of the cylinder determines the length of the duct and , in turn , the length of the waveguide ( as necessary for the particular frequency band ). the shape and dimensions of the duct define the walls of the waveguide and particularly the top , bottom , input and load planes 102 a - d . the bottom plane 102 b has two notches that define the slots 104 a and 104 b through which the probes 106 a and 106 b can protrude into the waveguide . being smaller than the length of the waveguide , the distance between the slots , and in turn the probes , is set to a quarter wavelength ( 90 °) which varies with the transmission frequency band . one or both members accommodate the pcb and the slots . specifically , one or both members 101 and 101 b have a detector notch extending below the bottom plane ( not shown ) for fitting the pcb with the power detection circuitry between them when the members are joined such that the probes are allowed to protrude through the slots sufficiently to produce the desired sensitivity . moreover , the notches that define the slots 104 a and 104 b in the bottom plane 102 b are carved out of one or both members , depending on whether the detector notch is provided in one or both members . as mentioned before , the detector circuitry is mounted on the pcb and because the circuit components are small the pcb dimensions can be small as well . what changes with frequency is the waveguide dimensions and the distance between the probes and the slots . the frequency change requires very simple redesign of the pcb layout and mechanical dimensions of the members that produce the waveguide . therefore , this configuration is easy to manufacture in commercial applications and the results are easily repeatable . in sum , the present invention provides ways in which reliable power detection and control can be achieved despite variations in load conditions ; and the mechanical - electrical configuration of the power detection system is relatively simple and less costly to produce . thus , although the present invention has been described in considerable detail with reference to certain preferred versions thereof , other versions are possible . in other words , the spirit and scope of the appended claims should not be limited to the description of the preferred versions contained herein .	6
fig1 is a general plan view of a portion of a document processing machine , like a document sorting machine , designated generally as machine 10 . the document handling apparatus of this invention is included in the machine 10 and is designated generally as apparatus 12 . the apparatus 12 includes a receptacle means 14 for receiving or pocketing documents to be stacked therein ; an entry drive roller means 16 for receiving a document 18 from a document track 20 ; a cupping means 22 for cupping the document 20 to be stacked ; and a wave guide means 24 which facilitates moving the trailing edges of the documents already in the receptacle means 14 out of the way of the leading edge of a document to be pocketed in the receptacle means 14 . the receptacle means 14 , the entry drive roller means 16 , the cupping means 22 , and the wave guide means 24 are all mounted on a planar member or support 26 . the machine 10 may include a plurality of the &# 34 ; pockets &# 34 ;, like apparatus 12 shown in fig1 . as the document 18 moves along the document track 20 ( from left to right as viewed in fig1 ), a conventional pocket selector 28 is used to divert the document 18 from the document track 20 to the apparatus 12 . the selector 28 is controlled by a controller 30 shown in fig2 . in one position , the selector 28 is used to divert all those documents which should be pocketed in the apparatus 12 into the apparatus 12 , and in a second position , it is used to permit the documents to be pocketed in other pockets to be moved downstream to such additional pockets ( not shown ). a selector , like 32 ( fig2 ), may be used for such additional pockets or apparatuses . the entry drive roller means 16 ( fig1 ) includes a drive roller 16 - 1 and an associated pinch roller 16 - 2 to move a document 18 along the document track 20 . a conventional transport drive 34 , under the control of the controller 30 , is used to rotate the drive roller 16 - 1 . when a document 18 is to be pocketed in the apparatus 12 , the controller 30 actuates the selector 28 to divert the document 18 towards the apparatus 12 . the document 18 is partially bent as it travels around the periphery of the drive roller 16 - 1 in moving towards the cupping means 22 . the cupping means 22 includes an initial cupping rib 22 - 0 which is located on a guide member 24 - 1 associated with the wave guide means 24 . the guide member 24 - 1 is shown in more detail in fig3 along with the location and shape of the cupping rib 22 - 0 located thereon . one of the features of the apparatus 12 relates to a sloped wall 24 - 2 on the guide member 24 - 1 . when a very thin or flimsy document 18 passes around the drive roller 16 - 1 , centrifugal force tends to force the top edge of the document 18 away from the drive roller 16 - 1 . with the sloped wall 24 - 2 , a thin document 18 is supported as it rides up the sloped wall 24 - 2 in moving in the direction of arrow c in fig3 . the cupping rib 22 - 0 facilitates the start of the cupping process , and the cupping is completed by a cupping drive roller assembly which includes first , second , and third drive rollers 22 - 1 , 22 - 2 , and 22 - 3 , respectively , ( shown in fig5 ). the initial cupping rib 22 - 0 minimizes the noise generated by the document encountering the drive rollers 22 - 1 , 22 - 2 , and 22 - 3 . this is an important feature , especially when the apparatus 12 is to be used in an environment where excessive noise is undesirable , as in a banking environment . the first , second , and third drive rollers 22 - 1 , 22 - 2 , and 22 - 3 are mounted on a shaft 22 - 4 with suitable spacers 22 - 5 and 22 - 6 and o - ring drive portions 22 - 7 and 22 - 8 as shown in fig5 . the first and third rollers 22 - 1 and 22 - 3 are made of a &# 34 ; hard drive &# 34 ; material while the second drive roller 22 - 2 is made of a &# 34 ; soft drive &# 34 ; material , with the first and third rollers mentioned being equidistantly spaced from the second drive roller 22 - 2 . as used herein , a soft drive material has a higher coefficient of friction than does a hard drive material , and in the embodiment described , the second drive roller 22 - 2 is made of a resilient material like nitrile rubber , for example . for a hard drive material , polycarbonate plastic may be used . in effect , there are two drive forces being applied by two different materials ( those just named ) at three locations , namely , by drive rollers 22 - 1 and 22 - 3 and by the second drive force associated with the second drive roller 22 - 2 and its associated pinch roller 22 - 9 . the pinch roller 22 - 9 ( fig6 ) is resiliently biased into engagement with the second drive roller 22 - 2 and , in effect , is a steel roller bearing . by the construction described , the second drive roller 22 - 2 tends to supplement the pull of the document 18 from the entry drive roller means 16 . this action reduces a ripple effect caused when a document reacts to the usual &# 34 ; cornering motion &# 34 ; in prior art devices when passing around a drive roller prior to encountering a cupping device . reducing the ripple effect reduces the noise associated with the apparatus 12 . this is a feature of the apparatus 12 , with fig6 showing the document 18 ( in dashed outline ) being cupped by the cupping means 22 . another feature of the cupping means 22 is that it can be assembled one way or 180 degrees relative to this one way with no loss in function . this is because the first and third drive rollers 22 - 1 and 22 - 3 are equidistantly spaced from the second drive roller 22 - 2 , with the same being true for the o - ring drive portions 22 - 7 and 22 - 8 relative to second drive roller 22 - 2 . the rod 22 - 4 is supported in a support 36 secured to the planar support 26 . o - ring belts , like belt 34 - 1 shown in fig1 engage the drive portions 22 - 7 and 22 - 8 to rotate the first , second , and third drive rollers 22 - 1 , 22 - 2 , and 22 - 3 . the o - ring belts 34 - 1 are coupled to the drive rollers 16 - 1 . the dimensions and geometry of the drive rollers 16 - 1 and the drive rollers 22 - 1 , 22 - 2 , and 22 - 3 are such as to enable the second drive roller 22 - 2 to pull the document 18 from the drive rollers 16 - 1 as previously discussed . the wave guide means 24 , alluded to earlier herein with reference to fig1 includes a wave guide member or document spring 24 - 3 shown in fig1 . u . s . pat . no . 4 , 640 , 505 , which is assigned to the same assignee as is the present application , explains the general functioning of a document spring generally similar to the document spring 24 - 3 . fig1 shows the position of the document spring 24 - 3 when no documents are in the receptacle means 14 . ( the pressure plate 14 - 5 is displaced in fig1 from its normal position which is biased to the right as shown in fig7 .) one end of the document spring 24 - 3 passes through an opening 24 - 4 in the guide member 24 - 1 ( fig3 ), and the remaining end thereof passes through an opening 24 - 5 in the guide member 24 - 1 . each of the ends of the document spring 24 - 3 has a rectangular opening therein which passes over a circular post , like 40 and 42 shown in fig1 and fits on to a mating rectangular boss 56 ( fig1 ) as will be discussed hereinafter . the alignment of the post 42 is such that its longitudinal axis is substantially parallel to the direction that the document 18 assumes when being moved from the entry drive roller means 16 towards the guide member 24 - 1 . the post 40 is substantially perpendicular to the guide member 24 - 1 . a button 44 fits over the post 40 to retain the end of the document spring 24 - 3 on its associated rectangular boss and similarly , a button 46 fits over the post 42 to retain the remaining end of the document spring 24 - 3 on its associated rectangular boss 56 . the construction associated with the buttons 44 and 46 provides an easy way for an operator of the machine 10 to replace the document spring 24 - 3 when necessary . fig7 is a view , similar to fig1 showing how the trailing edges 18 - 1 of documents 18 already in the receptacle 14 means tend the block the entry of the next document to be pocketed therein . fig8 is a schematic showing of how a &# 34 ; wave &# 34 ; 24 - 6 , developed by the document 18 pushing the document spring 24 - 3 , tends to move the trailing edges 18 - 1 of those documents already in the receptacle means 14 out of the way of the next incoming document 18 . as the leading edge of the document 18 enters the receptacle means 14 , the wave 24 - 6 which was developed , tends to move out of the opening 24 - 4 ( fig3 ) in the guide member 24 - 1 . the wave guide means 24 also includes a rib 24 - 7 ( fig3 ) located on the guide member 24 - 1 which helps to maintain the cupping of the document 18 as it is moved towards the receptacle means 14 . there are also three ribs 24 - 8 ( fig3 ) located on the guide member 24 - 1 ; these three ribs assist the document spring 24 - 3 from exerting increasing pressure on the document 18 , and they provide a smooth transition to the drive rollers 14 - 2 and 14 - 3 ( fig1 ). ribs 24 - 9 located on opposed sides of the rib 24 - 7 also facilitate the cupping function . as the leading edge of the document 18 enters the receptacle means 14 , it encounters the lower and upper stacking drive rollers 14 - 2 and 14 - 3 ( fig1 ) which drive the leading edge of the document 18 towards a stop 14 - 4 . these stacking drive rollers 14 - 2 and 14 - 3 are conventionally driven in a counter - clockwise direction ( as viewed in fig8 ) by the transport drive 34 shown in fig1 . the receptacle means 14 also has a conventional pressure plate 14 - 5 which is conventionally biased to move towards the stacking guide 14 - 1 as shown in fig7 and 8 . the pressure plate 14 - 5 has clearances or openings 14 - 6 therein to prevent the lower and upper stacking drive rollers 14 - 2 and 14 - 3 from abrading thereagainst when the receptacle means 14 has no documents therein . the receptacle means 14 also includes ribs 14 - 7 and 14 - 8 which prevent a chatter caused by the first or first few documents 18 entering the receptacle means 14 . the rib 14 - 7 , shown in fig9 is located on the pressure plate 14 - 5 below the opening 14 - 6 , and the rib 14 - 8 is located on the stacking guide 14 - 1 above the stacking drive roller 14 - 2 . rib 14 - 9 is located on the stacking guide 14 - 1 and is centered between the drive rollers 14 - 2 and 14 - 3 . as documents 18 are stacked within the receptacle means 14 , the pressure plate 14 - 5 moves away from the stacking guide 14 - 1 until the pressure plate 14 - 5 cooperates with a &# 34 ; full &# 34 ; sensor 48 ( fig1 and 2 ) to indicate to the controller 30 and the operator of the machine 10 that then receptacle means 14 is full . the operator can the remove the stack of documents 18 from the receptacle means 14 to repeat the process . an additional full sensor 50 is shown for an adjacent apparatus ( not shown ) similar to apparatus 12 . an off / on switch 52 is shown for the controller 30 . fig1 shows the structure for securing the document spring 24 - 3 to the wave guide means 24 . in this regard , the post 42 receives the rectangular opening 54 in the end of the document spring 24 - 3 after being inserted through the opening 24 - 5 . the post 42 extends from a quadrilaterally or rectangularly - shaped boss 56 which is part of the wave guide means 24 . the rectangular opening 54 in the document spring 24 - 3 fits onto the rectangular boss 56 to maintain the document spring 24 - 3 in the proper position as shown in fig1 . the button 46 is made of a resilient material and has a round hole 58 therein to fit on the post 42 and a round hole 60 ( fig1 ) to fit on the rectangular boss 56 . the round hole 60 is forced over the square boss 56 without any need for orientation . this is a feature which enables an operator of the machine 10 to replace the document spring 24 - 3 when necessary . the post 40 and the button 44 have a construction which is similar to that just described relative to post 42 and button 46 . a feature of this invention is that the receptacle means 14 , the entry drive roller means 16 , the document track 20 , the cupping means 22 , and the wave guide means 24 are all mounted on the same level on the planar support 26 . in some of the prior art apparatuses , the receptacle means was lower than the document track ; this meant that as a document was fed from the document track to the receptacle means , the lower leading edge of the document would &# 34 ; crash &# 34 ; into the support plate , causing some crimping of the lower edge . this caused some jamming of documents at the receptacle means . another feature is that the cupping rib 22 - 0 initiates the cupping of the document 18 ; however , more importantly , it reduces the impact of the leading edge of the document 18 as it approaches the cupping means 22 , and this reduces the noise of such an impact . the clearance openings 24 - 5 and 24 - 4 ( fig3 ) in the guide member 24 - 1 enable the document spring 24 - 3 to provide an improved performance compared to prior art devices . in the embodiment described , the document spring 24 - 3 has a width of 0 . 334 inch , a thickness of 0 . 003 inch , and is made of kapton plastic material . the first opening 24 - 5 reduces the impact that the leading edge of the document 18 encounters when first contacting the document spring 24 - 3 ; however , it still permits the leading edge to create the wave 24 - 6 shown in fig8 . when the wave 24 - 6 ( formed by the document 18 ) reaches the second opening 24 - 4 , the document 18 forces the wave through the opening 24 - 4 . this construction consistently locates the entry point at which the document 18 enters the receptacle means 14 . because the stacking drive rollers 14 - 2 and 14 - 3 are located relative to the opening 24 - 4 , it means that the leading edge of each of the documents entering the receptacle means 14 does so at about the same point relative to these rollers 14 - 2 and 14 - 3 . with the construction described , the document spring 24 - 3 of the present apparatus 12 has been used to pocket over 7 , 000 , 000 documents while showing no signs of wear , whereas a document spring used in the apparatus disclosed in the patent mentioned earlier herein had a useful life of pocketing about 1 , 000 , 000 documents . the stacking drive rollers 14 - 2 and 14 - 3 are made of nitrile rubber and are spaced apart and parallel to each other so as to drive the document 18 towards the stop 14 - 4 without any tilting or skewing .	1
fig1 through 5 , discussed below , and the various embodiments used to describe the principles of the present invention in this patent document are by way of illustration only and should not be construed in any way to limit the scope of the invention . those skilled in the art will understand that the principles of the present invention may be implemented in any suitably arranged device . fig1 depicts a simplified cross section of a conventional high performance silicon germanium : carbon ( sige : c ) based heterojunction bipolar transistor ( hbt ) base structure 100 . two layers of sige : c 101 sandwich a dopant layer 102 . the base regions of most conventional sige : c hbts use phosphorus ( p ) as the dopant to form dopant layer 102 . fig2 depicts an example of a secondary ion mass spectrometry ( sims ) profile 200 of the dopant concentration , in atoms per cubic centimeter ( atom / cm 3 ), as a function of depth , in micrometers ( μm ), when conventional doping methods are used . in this case , the dopant , phosphorus ( p ), exhibits high levels of segregation as carbon ( c ) and germanium ( ge ) concentrations are varied . the concentration of c is shown by plot 201 and depicted by a thick solid line , while the concentration of ge is shown by plot 203 and depicted by a thin solid line . the concentration of p , on the other hand , is shown by plot 202 and depicted by a dotted line . the overall dopant profile resulting from conventional doping methods is not very sharp , but in fact relatively broad . the steepness or sharpness of the resulting curve due to phosphorus segregation is approximately 20 nanometers per decade ( 20 nm / dec ). high p segregation adversely affects important transistor characteristics such as the gain , early voltage , voltage between the base and collector , and cutoff frequency . accordingly , sige : c transistors made in accordance with conventional doping methods exhibit relatively poor rf and dc performance . fig3 depicts an exemplary process diagram 300 for atomic layer doping ( ald ) in accordance with an embodiment of the present disclosure . process 300 begins at step 301 with a silicon surface layer 401 a ( see fig4 ) in an ambient temperature of approximately 400 degrees celsius ( 400 ° c .). silicon surface layer 401 a is baked at about 900 ° c .) in step 302 to remove any residual contaminant from the surface . then , in step 303 , silicon surface layer 401 a is cooled to appropriately 600 - 650 ° c . at an ambient temperature of approximately 600 ° c ., a silicon buffer layer 401 b is grown on top of the silicon surface layer 401 a in step 304 . the thickness of silicon buffer layer 401 b is grown to about 2 - 10 nm . preferably , si buffer layer 410 b is grown to about 5 nm . the concentration of ge and c are preferably controlled to remain substantially matched during steps 305 through 310 . process 300 continues in steps 305 and 306 , where the ambient temperature is kept at approximately 600 ° c . and two epitaxial layers of germanium ( ge ) are purged into the silicon cap layer grown in step 304 . steps 305 and 306 control ge grading from essentially zero to about 20 %. preferably , ge grading is sustained at about 15 % ge . after purging the silicon cap layer grown in step 304 with ge , a sige : c layer 402 ( see fig4 ) is formed in step 307 . the thickness of sige : c layer 402 is generally kept between 30 - 100 nm . preferably , sige : c layer 402 is about 50 nm thick . sige : c layer 402 is then exposed to an nitrogen ( n 2 ) ambient and cooled to approximately 500 ° c . in step 308 . conventional ald doping processes typically expose a sige : c layer to an h 2 ambient during the purging cycle . process 300 continues by maintaining the deposition temperature at about 500 ° c . in steps 309 and 310 . this is a reduction in temperature over conventional ald doping processes . at 500 ° c ., doping segregation effects are minimized while maintaining a high epitaxial growth rate and complying with any other manufacturing requirements . in step 309 , the epitaxial growth process is temporarily interrupted and the surface of the sige : c layer 402 is exposed to dopant , preferably p , for about one minute . the result is phosphorous ald layer 403 ( see fig4 ). the concentration of dopant , p , is about 1 × 10 13 atoms / cm 2 and 1 × 10 14 atoms / cm 2 . preferably the concentration of dopant , p , is about 3 . 5 × 10 13 atoms / cm 2 . although phosphorus is a preferred dopant , it should be understood that other dopants , such as arsenic and antimony , may also be used in accordance with the present disclosure . after exposure to phosphorus in step 309 , sige : c spacer 404 ( see fig4 ) is allowed to grow in an n 2 ambient for a predetermined amount of time in step 310 . sige : c spacer 404 is grown to a thickness between about 2 - 20 nm . preferably , sige : c spacer 404 is grown to about 10 nm . in step 310 , the top surface of the sige : c spacer 404 , is exposed to an n , ambient to aid eventually reducing vapor pressure ( vp ) auto - doping due to any hydrogen carry - over or memory effect later in process 300 . in step 311 , the sige : c spacer 404 is exposed to a hydrogen ambient ( h 2 ). at this stage of process 300 preferably exposes the sige : c spacer to an h 2 ambient rather than an n 2 ambient . at higher temperatures , an n 2 ambient would adversely react with silicon , while an h 2 ambient facilitates building a silicon cap faster than the same in an n 2 ambient . process 300 continues in step 312 by increasing the ambient temperature to about 650 ° c . and growing a final silicon cap layer 405 ( see fig4 ). silicon cap layer 405 is grown to a thickness between about 20 nm and 60 nm . preferably , silicon cap layer 405 is about 40 nm thick . after cooling the temperature to about 600 ° c . in step 313 , the resulting base structure 400 ( see fig4 ) may be removed . in summary , process 300 results in the exemplary base structure 400 illustrated in fig4 . silicon surface layer 401 a is topped with silicon buffer layer 401 b . sige : c layer 402 is grown on top of silicon buffer layer 410 b . a phosphorous ald layer 403 is grown on top of the sige : c layer 402 . the sige : c layer 402 is topped with a sige : c spacer 404 . the resulting base structure 400 is finished off with a silicon cap layer 405 . fig5 depicts an example of a sims profile 500 illustrating dopant concentration ( atom / cm 3 ) as a function of depth ( μm ) when exemplary doping methods in accordance an embodiment of the present disclosure are used . the concentration of dopant , p , is shown by plot 501 in fig5 . on the other hand , the concentration of ge is shown by plot 502 , concentration of silicon is shown by plot 504 and c show in plot 503 . the concentrations of ge ( plot 502 ) and c ( plot 503 ) are substantially matched prior and post phosphorous ald . the steepness of the profile is optimized to about 6 nm / dec and full width at half maximum in less than 10 nm at 500 ° c . n 2 . preferably , the steepness of the profile should be minimized . thus , unlike conventional methods , preferred embodiments of the present disclosure match the percentage concentration of ge and c during the ald process , while controlling exposure to an ambient nitrogen at about 500 ° c . a sige : c spacer post ald deposition in n 2 is absent from conventional methods . the steepness of the base profile is optimized to at least 6 nm / dec at 500 ° c . n 2 versus a 20 nm / dec at 600 ° c . h 2 exhibited by conventional methods . accordingly , a robust process with sharp base profiles conducive for use in , for example , complimentary high speed bicmos where ald techniques are is disclosed . such techniques yield less sensitivity to process temperatures and make it possible to reduce exposure times while minimizing outdiffusion . it is important to note that while the present invention has been described in the context of a fully functional process , those skilled in the art will appreciate that at least portions of the process are capable of adapting to a variations within the process without deviating from the preferred embodiments described above . although the present invention has been described in detail , those skilled in the art will understand that various changes , substitutions , variations , enhancements , nuances , gradations , lesser forms , alterations , revisions , improvements and knock - offs of the invention disclosed herein may be made without departing from the spirit and scope of the invention in its broadest form .	7
the following detailed description and appended drawings describe and illustrate various exemplary embodiments of the invention . the description and drawings serve to enable one skilled in the art to make and use the invention , and are not intended to limit the scope of the invention in any manner . in respect of the methods disclosed and illustrated , the steps presented are exemplary in nature , and thus , the order of the steps is not necessary or critical . fig1 and 2 show a stator assembly 10 in accordance with an embodiment of the invention . the stator assembly 10 is adapted to be used in a motor ( not shown ). the stator assembly 10 includes a cylindrical hollow main body portion 12 having a longitudinal axis x . in the embodiment shown , the main body portion 12 is formed from an iron alloy . it is understood that other materials can be used to form the main body portion 12 without departing from the scope and spirit of the invention . the main body portion 12 is disposed around a rotor assembly 14 which is coupled to a driven member ( not shown ) such as a traction drive , a pump impeller , or a compressor impeller , for example , by a shaft 16 . the stator assembly 10 also includes a cooling jacket 18 disposed around and in thermal communication with the main body portion 12 . in the illustrated embodiment , the cooling jacket 18 is formed from aluminum . however , other materials can be used to form the cooling jacket 18 as desired . the cooling jacket 18 includes a plurality of fluid conduits 20 formed therein . in the embodiment shown , the fluid conduits 20 are formed substantially parallel to the longitudinal axis x of the main body portion 12 . it is understood that the fluid conduits 20 can be formed between the cooling jacket 18 and the main body portion 12 or otherwise , and can be formed in different directions and orientations as desired . the fluid conduits 20 are adapted to receive a coolant ( not shown ) from a source of coolant ( not shown ) therein . a first end plate 22 is disposed on a first end 24 of the stator assembly 10 . the first end plate 22 forms a substantially fluid tight seal with the first end 24 of the stator assembly 10 . a pair of apertures ( not show ) is formed in the first end plate 22 for receiving one of an inlet fitting 23 and an outlet fitting 25 therein . the fittings 23 , 25 are in fluid communication with the fluid conduits 20 formed in the cooling jacket 18 and the source of coolant . the first end plate 22 also includes a central groove 26 formed in a first surface 28 thereof . the central groove 26 receives a first bearing 30 that rotatingly supports the shaft 16 . it is understood that the first bearing 30 can be any type of bearing as desired such as an air bearing and a ball bearing , for example . optionally , one or more coolant channels ( not shown ) can be formed in the first end plate 22 . the coolant channels formed in the first end plate 22 can be in fluid communication with the inlet fitting 23 , the outlet fitting 25 , and / or the fluid conduits 20 formed in the cooling jacket 18 as desired . a second end plate 32 is disposed on a second end 34 of the stator assembly 10 . the second end plate 32 forms a substantially fluid tight seal with the second end 34 of the stator assembly 10 . the second end plate 32 includes a central groove 36 formed in a first surface 38 thereof adapted to receive a second bearing 40 that rotatingly supports the shaft 16 . it is understood that the second bearing 40 can be any type of bearing as desired such as an air bearing and a ball bearing , for example . a central aperture ( not shown ) is formed in the second end plate 32 . the shaft 16 extends through the central aperture to the driven member . optionally , one or more coolant channels ( not shown ) can be formed in the second end plate 32 . in this case , the fluid conduits 20 formed in the cooling jacket 18 would extend to the second end 34 of the stator assembly 10 and be in fluid communication with the coolant channels formed in the second end plate 32 . to produce the stator assembly 10 , a mold ( not shown ) for the cooling jacket 18 is disposed around the main body portion 12 and the cooling jacket 18 is cast directly over the main body portion 12 . as the cooling jacket 18 is being molded , the fluid conduits 20 are injection molded into the cooling jacket 18 . it is understood that the cooling jacket 18 can be formed prior to disposal over the main body portion 12 as desired . it is also understood that the fluid conduits 20 can be formed in the cooling jacket 18 subsequent to the molding of the cooling jacket 18 as desired . it is further understood that the mold for the cooling jacket 18 may include structure for forming the fluid conduits 20 as desired . the main body portion 12 and the cooling jacket 18 are disposed around the rotor assembly 14 and the shaft 16 . the first end plate 22 including the first bearing 30 is sealed to the first end 24 of the stator assembly 10 and the shaft 16 is rotatably secured in the first bearing 30 . it is understood that the first end plate 22 can be sealed to the first end 24 of the stator assembly 10 by any means , such as with tie rod screws ( not shown ), for example . the inlet fitting 23 and the outlet fitting 25 are disposed in the apertures formed in the first end plate 22 to communicate with the fluid conduits 20 formed in the cooling jacket 18 . the shaft 16 is inserted through the central aperture formed in the second end plate 32 . the second end plate 32 , including the second bearing 40 , is sealed to the second end 34 of the stator assembly 10 , and the shaft 16 is rotatably secured in the second bearing 40 . it is understood that the second end plate 32 can be sealed to the second end 34 of the stator assembly 10 by any means , such as with tie rod screws ( not shown ), for example . in use , the shaft 16 is coupled to the driven member . a magnetic field is generated by the stator assembly 10 , which causes the rotor assembly 14 and the shaft 16 to rotate about the longitudinal axis x of the main body portion 12 . the rotation of the rotor assembly 14 and shaft 16 is transferred to the driven member . heat is produced during operation of the stator assembly 10 . coolant from the coolant source is caused to flow into the inlet fitting 23 and through the first end plate 22 into the fluid conduits 20 formed in the cooling jacket 18 . the coolant absorbs heat energy from the main body portion 12 to cool the main body portion 12 . if coolant channels are formed in the endplates 22 , 32 , coolant flowing therethrough can be used to cool the first end 24 and the second end 34 of the stator assembly 10 . the coolant then flows out of the stator assembly 10 through the outlet fitting 25 . the coolant can be recirculated between the coolant source and the fluid conduits 20 formed in the cooling jacket 18 to maintain the temperature of the stator assembly 10 within a desired range . fig3 shows a stator assembly 110 in accordance with another embodiment of the invention . similar structure discussed above for fig1 and 2 includes the same reference numeral followed by a prime “′” symbol . a conduit 111 is disposed in a mold ( not shown ) for forming a cooling jacket 118 . in the embodiment shown , the conduit 111 is formed from a stainless steel alloy . it is understood that other materials may be used to form the conduit 111 , such as an aluminum alloy or brass , for example . the conduit 111 includes a fluid inlet 123 and a fluid outlet 125 in fluid communication with a source of coolant . although the conduit 111 is shown , as a helically wound coil , other conduit shapes and flow patterns can be used as desired . to form the cooling jacket 118 , the conduit 111 is disposed around a main portion 12 ′ of the stator assembly 110 . the cooling jacket 118 is molded around the conduit 111 . the fluid inlet 123 and the fluid outlet 125 are then connected to the source of coolant to provide fluid communication between the source of coolant and the conduit 111 . the remaining assembly process for the stator assembly 110 is substantially the same as described above for fig1 and 2 . in use , the stator assembly 110 is coupled to a driven member ( not shown ) as described above for fig1 and 2 . a magnetic field is generated by the stator assembly 110 which results in the generation of heat . coolant from the coolant source is caused to flow through the conduit 111 . the coolant absorbs heat energy from the main body portion 12 ′. the coolant can be recirculated between the coolant source and the piping 111 disposed in the cooling jacket 118 to maintain the temperature of the stator assembly 110 within a desired range . from the foregoing description , one ordinarily skilled in the art can easily ascertain the essential characteristics of this invention and , without departing from the spirit and scope thereof , can make various changes and modifications to the invention to adapt it to various usages and conditions .	8
preferred embodiments of the present invention will be described in detail herein below with reference to the annexed drawings . in the drawings , the same or similar elements are denoted by the same reference numerals even though they are depicted in different drawings . in the following description , a detailed description of known functions and configurations incorporated herein will be omitted when it may make the subject matter of the present invention rather unclear . fig1 is a block diagram illustrating an apparatus for controlling a sar of a mobile terminal in accordance with a preferred embodiment of the present invention . referring to fig1 , the apparatus for controlling the sar of the mobile terminal includes a controller 1 , a voice processor 5 , a user interface unit ( not shown ) having a display 3 and a key entry unit 7 , a memory 9 , and a tpc ( transmit power control ) unit 10 . the controller 1 controls an overall operation of a mobile terminal . in a clpc ( closed loop power control ) mode , the controller 1 controls a transmission power of the mobile terminal upon receiving tpc information from a bts ( base transceiver station ). in the case of an olpc ( open loop power control ) mode , the controller 1 controls a transmission power of the mobile terminal upon receiving an intensity of a reception signal from a bts . particularly , the controller 1 generates a signal for controlling an amplification gain of the tpc unit 10 according to a user - selected sar control mode of a mobile terminal . the present invention is based on the assumption that the sar control mode is classified into a normal mode and a sar safe mode . however , it should be noted that the sar safe mode can be subdivided into a plurality of sub - modes according to the degree of sar attenuation . in addition , although the present invention will hereinafter be described on the assumption that a gain of a drive amplifier 103 is controlled according to a sar control mode , it should be noted that the present invention can also be applicable to a power amplifier 107 other than the drive amplifier 103 . the display 3 displays a variety of messages under the control of the controller 1 . the voice processor 5 converts audio data received from the tpc unit 10 into audible sound through a speaker upon receiving a control signal from the controller 1 , converts an audio or voice signal received through a microphone into predetermined data , and transmits the predetermined data to the tpc unit 10 . the key entry unit 7 includes a plurality of number keys and a plurality of function keys , and outputs key entry data entered by user to the controller 1 . the memory 9 stores program data needed to control the mobile terminal , and also stores any data created while executing program and user data created by a user . particularly , the memory 9 stores various sar control mode information predetermined by a user along with code tables showing the drive amplifier &# 39 ; s gains in response to individual sar control modes . representative examples are shown in tables 1 and 2 . the code shown in the tables 1 and 2 denote a plurality of relative values versus code values at a maximal transmission power of 24 dbm on the assumption that the transmission power for 1150 reverse channels is in the dynamic range from − 40 dbm to 24 dbm . however , it should be noted that code values can be indicated as absolute values . table 1 is a code table referenced by the controller 1 when the sar control mode is set to a normal mode , and table 2 is a code table referenced by the controller when the sar control mode is set to a safe mode . individual gains of the code table shown in table 2 are lower than those of the code table shown n table 1 by a predetermined value at a maximal transmission power of 24 dbm . in more detail , the safe mode restricts a transmission power of a weak electric field requiring a high transmission power on the basis of the code table of table 2 , resulting in sar attenuation . on the other hand , in an intermediate electric field or a strong electric field requiring a low transmission power , the safe mode and the normal mode have the same code values . in this case , the transmission power is determined in light of power control information received from a bts in a closed loop power control mode , and is also determined in light of signal intensity received from the bts in an open loop power control mode . although it is assumed that a weak electric field gain of a sar safe mode is set to 96 % as compared to that of a sar normal mode in the present invention , the gain can be variable . in order to effectively reduce a sar in the weak electric field , for which rf signals must be transmitted with a high transmission power , without excessively reducing the number of successful phone calls , weak electric field gains in the sar safe mode should be determined in light of the relationship between a ratio of the successful phone calls and a sar . further , although the present invention discloses an example for reducing only a gain at a maximal transmission power , it will be understood by those skilled in the art that the present invention is applicable to other modifications such as an example for reducing individual gains attained at 20 dbm or 16 dbm at which a relatively high transmission power is required . in addition , although the safe mode and the normal mode each have code tables in the present invention , the present invention is applicable to other modifications for subtracting a prescribed value from any code value of the normal mode &# 39 ; s code table in the safe mode while having only a code table for the normal mode . when a gain of the power amplifier 103 is controlled according to a sar control mode as described above , the memory 9 stores gain code tables of the power amplifier 103 . the tpc unit 10 modulates or demodulates rf signals containing audio or control data received through an antenna upon receiving a control signal of the controller 1 . the tpc unit 10 includes a mixer 101 , a drive amplifier 103 , a bpf ( band pass filter ) 105 , a power amplifier 107 , and a duplexer 109 . the mixer 101 functions as an up - converter for converting an if ( intermediate frequency ) signal into an rf signal having a prescribed bandwidth , and mixes the if signal with a local oscillator frequency . the drive amplifier 103 enables an output signal of the mixer 101 to be an optimal signal , and thereby enables the power amplifier 107 to sufficiently amplify the output signal of the mixer 101 . provided that the power amplifier 107 is not driven by an optimal signal , its own efficiency may be seriously deteriorated . in accordance with the present invention , an amplification factor of the drive amplifier 103 is variable with a gain control signal generated from the controller 1 . the bpf 105 selects only a transmission ( tx ) frequency , performs a band - pass - filtering on the selected transmission frequency with a low insertion loss , and removes the remaining unnecessary frequencies , i . e ., frequencies other than the selected transmission frequency . the power amplifier 107 amplifies rf signals generated from the bpf 105 such that a signal with the sufficient power is transmitted from the mobile terminal to a bts through the antenna . fig2 is a flow chart illustrating a method for controlling a sar of a mobile terminal in accordance with the preferred embodiment of the present invention . referring to fig2 , the mobile terminal controller 1 checks a sar control mode selected by a user in step 21 . the controller 1 provides a user with a user interface for setting up the sar control mode . typically , the user interface adds a sar control mode setup function to a selection menu of a mobile terminal , and enables a user to select either a safe mode or a normal mode on the key entry unit 7 . information of the sar control mode selected by a user is stored in the memory 9 . such sar control mode information may be indicated as a flag . where the sar control mode is set to a normal mode in step 21 , the controller 1 calls a gain code table of a drive amplifier in association with the normal mode stored in the memory 9 in step 23 . although the present invention will control a gain of the drive amplifier 103 according to a sar control mode , the present invention may also control that of the power amplifier . on the other hand , when the sar control mode is set to a safe mode in step 21 , the controller 1 calls a gain code table of a drive amplifier in association with a safe mode stored in the memory 9 in step 24 , and then proceeds to step 25 . the controller 1 outputs a code value in response to a transmission power selected by either one of code tables in step 25 . in a closed loop power control mode , the controller 1 selects a code value in response to tpc information received from a bts . in an open loop power control mode , the controller 1 selects a code value in response to signal intensity received from the bts . the controller 1 controls a gain of the drive amplifier 103 according to the selected code value in step 27 . rf signals pre - amplified at the drive amplifier 103 are re - amplified at the power amplifier 107 over the bpf 105 , and then transmitted over a duplexer 109 in step 29 . as is apparent from the description above , an apparatus and method for controlling a sar of a mobile terminal according to the present invention enables a user to freely select a desired sar , resulting in more reliability of a mobile terminal for the user . that is , the present invention attenuates a sar according to a user &# 39 ; s selection , resulting in less danger for the user to be exposed to emi , and providing greater convenience to the user . although preferred embodiments of the present invention have been disclosed for illustrative purposes , those skilled in the art will appreciate that various modifications , additions and substitutions are possible , without departing from the scope and spirit of the invention as disclosed in the accompanying claims .	7
fig1 is a schematic diagram showing the essential portions of a first embodiment of the present invention as it is applied to a three - plate type ccd color camera ( image pickup apparatus ). in fig1 the reference numeral 101 designates a variable apex angle prism as optical image deflecting means . the variable apex angle prism 101 is removably mounted forward of a photo - taking optical system 102 in such a manner that it is difficult for the other aberrations ( distortion , etc .) than chromatic aberration to occur . the reference numeral 103 denotes a color dividing prism for dividing the light beam from the photo - taking optical system 102 into three color lights , i . e ., red ( r ), green ( g ) and blue ( b ). in the present embodiment , images based on the respective color lights are formed on the photosensitive surfaces of image pickup elements 104 - 106 each comprising a ccd by the photo - taking optical system 102 through the color dividing prism 103 . the reference numerals 107 - 109 designate image shift circuits as electronic image shift means corresponding to r light , g light and b light , respectively . each of the image shift circuits 107 - 109 has an a / d converter , an image memory , a d / a converter , etc . images formed on the surfaces of the image pickup elements by the image pickup optical system 102 are converted into image information of each color light by the image pickup elements 104 - 106 and input to the image shift circuits 107 - 109 . at this time , image memory read - out addresses are controlled by a calculation circuit 116 , whereby the positions of the images are two - dimensionally shifted . the reference numeral 113 denotes an angle sensor as a camera angle detector . the angle sensor 113 comprises a gyroscope or the like and detects angles of inclination . o slashed . x and . o slashed . y resulting from the vibration of the image pickup apparatus . the reference numeral 100 designates driving means having , for example , a gimbals structure . the driving means 100 mechanically or magnetically drives the prism apex angles of the variable apex angle prism 101 in two x and y directions on the basis of output signals . o slashed . x and . o slashed . y from the camera angle detector 113 . the reference numeral 111 denotes a deflection angle detector which detects the apex angles of the variable apex angle prism 101 in the x direction and the y direction and outputs detection signals ε x and ε y . the reference numeral 112 designates a focal length detector which detects the focal length of the image pickup optical system 102 in a predetermined zoom position . the image pickup optical system 102 may be comprised of a lens system of a single focal length , and in this case , the focal length is constant . the reference numeral 116 denotes a calculation circuit which calculates the amount of image shift by a method to be described by the use of output signals from the deflection angle detector 111 and the focal length detector 112 and a signal from an rom 117 storing therein the refractive indices n r , n g and n b of the material of the variable apex angle prism 101 for the respective color lights r , g and b . the reference numeral 110 designates an encoder which converts signals from the image shift circuits 107 - 109 , for example , into standardized image signals of the ntsc type or the pal type . the encoder 110 includes means for γ correction , outline correction , white balance , etc . a description will now be given of a method of correcting the movement of the image on the surfaces of the image pickup elements caused when the image pickup apparatus vibrates in the present embodiment . first , in the present embodiment , the angles of inclination . o slashed . x and . o slashed . y caused by the vibration or the like of the image pickup apparatus are detected by the camera angle detector 113 , and on the basis of the result of the detection , the apex angle of the variable apex angle prism 101 as the optical image deflecting means is varied by the driving means 100 to thereby correct the movement of the images . that is , the optical image deflecting means two - dimensionally deflects the images formed on the respective image pickup elements 104 - 106 by the image pickup optical system 102 , thereby optically correcting the movement of the images . at this time , the deviation of the images based on chromatic aberration created when the apex angle of the variable apex angle prism 101 is varied is shifted by electronic image shift means and is corrected thereby . that is , in the present embodiment , the image shift circuits 107 - 109 constituting the electronic image shift means effect image shift ( trimming ) two - dimensionally for each channel in accordance with the direction and angle of deflection of the optical image deflecting means and the focal length of the image pickup optical system 102 . in the present embodiemnt , the image signals of the ccd &# 39 ; s 104 , 105 and 106 are processed by the use of the shift circuits 107 , 108 and 109 ( image signal processing means ), respectively , but in principle , the shift circuit 108 can be eliminated if the design is made such that the image of a certain channel , for example , the g channel , as the reference channel coincides with the images formed by the other two channels . let it be assumed that the amounts of image shift of the respective color lights in the x and y directions relative to the image pickup elements 104 - 106 are δx r , δy r , δx g , δy g , δx b and δy b . these values are found by the calculation circuit 116 on the basis of the value of the apex angle of the variable apex angle prism 101 detected by the deflection detecting circuit 111 , the value of the focal length of the image pickup optical system 102 detected by the focal length detector 112 , and the values of the refractive indices n r , n g and n b of the material of the variable apex angle prism 101 for the respective color lights stored in the rom 117 . fig3 is an illustration showing an example of the positional relation among the then - existing amounts of image shift δx r , δy r , δx g , δy g , δx b and δy b . when as previously described , the focal length of the image pickup optical system is f and the emergence angle of inclination from the variable apex angle prism is τ n , the chromatic aberration δy n created by a variation in the apex angle of the variable apex angle prism 101 can be found by the aforementioned equation ( 1 ), i . e ., accordingly , when the apex angles of the variable apex angle prism in the x direction and the y direction are ε x and ε y , respectively , and the refractive index of the material of the variable apex angle prism is n , the chromatic difference of magnification can be found from the equation ( 1 ). so , the amounts of image shift δx r , δy r , δx g , δy g , δx b and δy b are found by the calculation circuit 116 on the basis of the following equations : the image shift circuits 107 - 109 effect the shift of the images in conformity with the amounts of image shift found by the calculation circuit 116 , and transmit the calculated image signals to the encoder 110 . the encoder 110 converts the signals from the image shift circuits 107 - 109 into standardized image signals of the ntsc type or the pal type . in the present embodiment , the chromatic difference of magnification created by the angle of deflection of the variable apex angle prism 101 is corrected in the manner described above , and as a whole , the movement of the images by the vibration of the image pickup apparatus is corrected well . in the present embodiment , instead of the angle sensor , an angular velocity sensor may be used as the camera angle detector 113 to detect the angular velocity , and use may be made of the output signal thereof which has been integrated , or the angular acceleration which has been double - integrated . further , as proposed in japanese laid - open patent application no . 61 - 269572 , the design may be made such that the shake of the camera is detected from the image signal obtained by the image pickup apparatus , by an image processing circuit corresponding to the camera angle detector 113 and is corrected thereby . fig4 is a schematic diagram showing the essential portions of a second embodiment of the present invention . in this embodiment , a signal system is added to the embodiment of fig1 to improve the image stabilizing characteristics of the image stabilizing image pickup apparatus . since the driving means 100 and the variable apex angle prism 101 are mechanically connected together , the frequencies which can respond to the detected vibration are low , e . g . up to the order of 10 hz . accordingly , it is difficult to effect correction for vibrations having a frequency component higher than this frequency . so , in the present embodiment , the correction of the movement of images when the image pickup apparatus vibrates minutely at a high frequency , e . g . of 10 hz or higher is effected by image - shifting all channels by the same amount in the same direction by the image shift circuits 107 - 109 . generally , the vibration of the image pickup apparatus is great in amplitude for low frequency components ( with 0 - 10 hz ) and small in amplitude for high frequency components ( 10 hz or higher ). in the present embodiment , the movement of images of low frequency components and great amplitude is corrected chiefly by optical deflecting means and the movement of images of high frequency components and small amplitude is corrected by electronic image shift means and as a whole , the movement of images based on a wide range of oscillation frequency and amplitude is corrected . in the present embodiment , the differences (. o slashed . x - ε x ) and (. o slashed . y - ε y ) between the output values . o slashed . x and . o slashed . y as the angles of inclination from the camera angle detector 113 and the angles of deflection ε x and ε y when the apex angle of the variable apex angle prism 101 is varied are information corresponding to the amount of the angle of deflection which the driving means 100 and the variable apex angle prism 101 could not completely follow . so , in the present embodiment , the amount of deflection which the driving means 100 and the variable apex angle prism 101 could not completely follow , i . e ., the under - corrected amount , is input to the calculation circuit 116 and the images are electronically shifted and corrected in the direction opposite to the minute vibration by the image shift circuits 107 - 109 , whereby there are obtained images whose vibration has been precisely corrected even for high frequencies . in the present embodiemnt , the amounts of image shift δx r , δy r , δx g , δy g , δx b and δy b when the correction accompanying minute vibrations of high frequencies is effected simultaneously with the chromatic aberration correction of the first embodiment for the electronic image shift means are : here , if the amounts of image shift reach too high values ( several percent or more of the size of the picture plane ), it will cause the breakage of the picture plane by an image shift , or the distortion or shading created by the image pickup optical system 102 will be observed as vibration on the output picture plane , thus causing the quality of image to be deteriorated . therefore , in the present embodiment , it is preferable to provide limiter means for limiting the amounts of image shift so as to be of the order of several percent of the size of the picture plane . fig5 is a schematic diagram of the essential portions neighboring the electronic image shift means of a third embodiment of the present invention . in this embodiment , there is shown image shift means for directly controlling the read - out positions of image pickup elements . the reference numerals 204 - 206 designate image pickup elements such as ccd &# 39 ; s or saticons , and the reference numerals 207 - 209 denote read - out area control circuits for controlling the read - out positions of images . in the image pickup elements 204 - 206 , the timing ( the phase for each of three color lights ) and scanning speed of the scanning signal of an electron beam are changed , whereby apparently the images can be minutely shifted . in the present embodiment , the scanning signal is controlled on the basis of the amounts of image shift δx r , δy r , δx g , δy g , δx b and δy b from the calculation circuit 116 , not shown , to thereby obtain an effect similar to that of the second embodiment . also , in the solid state image pickup elements such as ccd &# 39 ; s , the clocks of ccd transfer registers in the horizontal direction ( h direction ) and the vertical direction ( v direction ) are controlled , whereby apparently the images can be shifted by a technique similar to that proposed , for example , in u . s . pat . no . 4 , 593 , 311 . such image shift means can also be realized in a color camera of the one plate type . that is , the image is read out by a conventional method , whereafter the image is divided into color lights r , g and b , which are input to the image shift circuits 107 - 109 of fig1 and image shift is effected therein , whereby a similar effect can be obtained . according to the present invention , there can be achieved an image stabilizing image pickup apparatus suitable for a video camera , a broadcasting hand - held camera or the like in which the movement of an image caused by the vibration or the like of the image pickup apparatus is corrected by the use of optical image deflecting means and electronic image shift means to thereby prevent a reduction in the resolving power of the image and which is made compact as a whole and yet can quickly and highly accurately correct the movement of the image , for example , of a wide range of oscillation frequencies . also , according to the present invention , there can be achieved an image stabilizing image pickup apparatus characterized in that the influence of the color dispersion of the material of a variable apex angle prism can be corrected well and therefore the use of vap material of high refractive index becomes possible and that the vap driving angle ε can be made small and driving means can readily be made compact .	7
among the compounds of formula ( 1 ), those having the ( s )- configuration at position 20 of the e - ring are preferred for pharmaceutical use . r 1 and r 2 are preferably and independently ( the same or different ) h , a hydroxyl group , a halo group , an amino group , a nitro group , a cyano group , a c 1 - 3 alkyl group , a c 1 - 3 perhaloalkyl group , a c 1 - 3 alkenyl group , a c 1 - 3 alkynyl group , a c 1 - 3 alkoxyl group , a c 1 - 3 aminoalkyl group , a c 1 - 3 alkylamino group , a c 1 - 3 dialkylamino group , or r 1 and r 2 together form a group of the formula — o ( ch 2 ) n o — wherein n represents the integer 1 or 2 . more preferably , r 1 and r 2 are independently ( the same or different ) h , a methyl group , an amino group , a nitro group , a cyano group , a hydroxyl group , a hydroxymethyl group , a methylamino group , a dimethylamino group , an ethylamino group , a diethylamino group , an aminomethyl group , a methylaminomethyl group , a dimethylaminomethyl group , and the like . r 3 is preferably f , an amino group , or a hydroxyl group . r 4 is preferably h or f . r 5 is preferably an ethyl group . r 6 , r 7 and r 8 are preferably independently ( the same or different ) a c 1 - 6 alkyl group , a phenyl group or a —( ch 2 ) n r 10 group , wherein n is an integer within the range of 1 through 6 and r 10 is a halogen or a cyano group . the compounds of the present invention can be prepared according to the general synthetic scheme shown in fig1 . in the synthetic scheme of fig1 , an iodopyridone 2 is first n - alkylated with a propargyl derivative 3 to produce radical precursor 4 . radical precursor 4 then undergoes a radical cascade with arylisonitrile 5 to generate product 1 . the n - alkylation proceeds smoothly following optimized conditions . see curran , d . p . et al ., tetrahedron lett ., 36 , 8917 ( 1995 ), the disclosure of which is incorporated herein by reference . the synthesis of iodopyridone 2 and the conditions of the radical cascade have been previously reported . the propargylating agent 3 is readily prepared by the standard silylation of the dianion of propargyl alcohol with a suitable sylating agent r 6 r 7 r 8 six followed by conversion of the propargyl alcohol to a leaving group such as a bromide , iodide or sulfonate . see curran , d . p . et al ., angew . chem . int . ed . engl ., 34 , 2683 ( 1995 ), the disclosure of which is incorporated herein by reference , and u . s . patent application ser . no . 08 / 436 , 799 , filed may 8 , 1995 , the disclosures of which are incorporated herein by reference . generally , various reagents can be used in the radical cascade including , but not limited to , hexamethyltin , hexamethyldisilane , or tetrakis ( trimethylsilyl ) silane . the source of energy for this reaction can be a sun lamp or an ultraviolet lamp . the temperature is preferably set between approximately 25 and 150 ° c . more preferably , the temperature is set at approximately 70 ° c . there are generally no limitations upon the choice of solvent used other than inertness to the radical cascade . preferred solvents include benzene , toluene , acetonitrile , thf and tert - butanol . also , there is very broad latitude in the choice of substituents on the alkyne and the isonitrile because of the mildness of the reaction conditions . fig2 illustrates an embodiment of a general synthetic scheme for the synthesis of ( 20s )- 11 - fluoro - 7 - trimethylsilylcamptothecin 12 . a problem in this synthetic scheme is to control the regioselectivity of the radical cascade when both ortho positions in the arylisonitrile are available for cyclization ( that is , r 4 is h in the final compound of formula 1 ). one solution to this problem relies upon the introduction of a trimethylsilyl group on the aryl isonitrile , ( e . g . 3 - fluoro - 2 - trimethylsilylphenyl isonitrile 9 ). the trimethylsilyl substituent blocks one of the ortho sites of the isonitrile toward cyclization and can be removed after the cascade reaction by hydrodesilylation . in this example , the selectivity proceeds further in the sense that only one of the trimethylsilyl groups is removed in the last step . other embodiments of the general synthetic scheme for the preparation of several novel camptothecin derivatives are illustrated in fig3 to 6 , and in the examples . the present invention provides a short and efficient synthetic scheme well suited to known structure - activity relationships in the camptothecin family . indeed , the biological activity of the camptothecin skeleton is generally intolerant or has very little tolerance to substituents other than at the 7 and / or 9 - 11 positions . following synthesis , these substituents are introduced via the alkynylderivative 3 and arylisonitrile 5 , respectively . the antitumor activities of several compounds of formula 1 are shown in table 1 and compared to those of several well known camptothecin analogs . the syntheses of the various exemplary compounds of the present invention set forth in table 1 are discussed in further detail in an example section following this section . the camptothecin derivatives were evaluated for their cytotoxic effects on the growth of hl - 60 ( human promyelocytic leukemic ), 833k ( human teratocarcinoma ) and dc - 3f ( hamster lung ) cells in vitro . the cells were cultured in an initial density of 5 × 10 − 4 cell / ml . they were maintained in a 5 % co 2 humidified atmosphere at 37 ° c . in rpmi - 1640 media ( gibco - brl grand island , n . y .) containing penicillin 100u / ml )/ streptomycin ( 100 μg / ml ) ( gibco - brl ) and 10 % heat inactivated fetal bovine serum . the assay was performed in duplicate in 96 - well microplates . the cytotoxicity of the compounds toward hl - 60 cells following 72 hr incubation was determined by xtt - microculture tetrazolium assay . scudiero , d . a ., et al ., cancer res ., 48 , 4827 ( 1988 ), the disclosure of which is incorporated herein by reference . 2 ′, 3 ′- bis (- methoxy - 4 - nitro - 5 - sulfheny )- 5 -[( phenylamino ) carbonyl ]- 2h - tetrazolium hydroxide ( xtt ) was prepared at 1 mg / ml in prewarmed ( 37 ° c .) medium without serum . phenazine methosulfate ( pms ) and fresh xtt were mixed together to obtain 0 . 075 mm pms - xtt solution ( 25 μl of the stock 5 mm pms was added per 5 ml of 1 mg / ml xtt ). fifty μl of this mixture was added to each well of the cell culture at the end of 72 hr incubation . after incubation at 37 ° c . for 4 hr ., absorbance at 450 nm and 630 nm was measured with a microplate reader ( el340 , bio - tek instruments , inc ., winooski , vt .). the cytotoxicity of the camptothecin compounds toward 833k teratocarcinoma solid tumor cells and dc - 3f hamster lung cells was determined in 96 - well microplates by a method described by skehan et al . for measuring cellular protein content . skehan et al ., “ new colorometric cytotoxicity assay for anticancer drug screening ,” j . nat &# 39 ; l cancer inst ., 82 , 1107 ( 1990 ), the disclosure of which is incorporated herein by reference . cultures were fixed with trichloroacetic acid and then stained for 30 minutes with 0 . 4 % sulforhodamine b dissolved in 1 % acetic acid . unbound dye was removed by acetic acid washes , and the protein - bound dye was extracted with an unbuffered tris base [ tris ( hydroxy - methyl ) aminomethan ] for determination of absorbance at 570 nm in a 96 - well microplate reader . the experiments were carried out in duplicate using five to six concentrations of the drugs tested . data were analyzed via computer software . see , chou , j , and chou , t . c ., dose - effect analysis with microcomputers : quantitation of ed 50 , ld 50 , synergism , antagonism , low - dose risk , receptor - ligand binding and enzyme kinetics , 2 nd ed ., biosoft , cambridge ( 1987 ); and chou , t . c ., “ the median - effect principle and the combination index for quantitation of synergism and antagonism ,” synergism and antagonism in chemotherapy , academic press , san diego , 61 - 102 ( 1991 ), the disclosures of which are incorporated herein by reference . for dna cleavage assay the reaction mixture comprised tris - hcl buffer 10 mm , ph7 . 5 ; pbr 322 supercoiled double stranded circular dna ( 4363 base pairs , from bochringer mannheim biochemicals ) 0 . 125 μg / ml , drug ( camptothecin or its derivatives ) concentration at 1 , 10 and 100 μm , in the presence of purified dna topoisomerase i with final volume of 20 μl as described previously . hsiang , y . h ., et al ., “ camptothecin induces protein - linked dna breaks via mammalian dna topoisomerase i ,” j . biol . chem ., 260 , 14873 ( 1985 ), the disclosure of which is incorporated herein by reference . incubation was carried out at 37 ° c . for 60 min . the reaction was stopped by adding the loading buffer dye ( 2 % sodium dodesyl sulfate , 0 . 05 % bromophenol blue and 6 % glycerol ). electrophoresis was carried cut on 1 % agarose gel plus ethidium bromide ( 1 μg / ml ) in tbe buffer ( tris - base - boric acid - edta ) and ran at 25 v for 18 hrs . photographs were taken under uv light using polaroid film type 55 / n and developed as indicated by the manufacturer . to study the inhibiting effect on dna topoisomerase i mediated relaxation of dna , the method described by liu and miller was used . liu , h . f . et al ., “ cleavage of dna by mammalian dna topoisomerase ii ,” j . biol . chem ., 258 , 15365 ( 1980 ), the disclosure of which is incorporated herein by reference . for this assay , 0 . 18 μg of pbr 322 dna , 0 . 5 u of topo i ( gibco - brl ), various concentrations ( 1 - 100 μm of camptothecin or an analog , in a reaction mixture ( 20 μl ) containing 50 mm tris - hcl , ph 7 . 5 , 120 mm kcl , 10 mm mgcl 2 , 0 . 5 mm dtt , 0 . 5 mm edta , 30 μg / ml bsa , 20 μg / ml pbr 322 dna and various amounts of the enzyme was incubated at 37 ° c . for 30 min ., and stopped with 5 % sbs and 150 μg / ml proteinase k . the samples were loaded onto 1 % agarose in tae running buffer , electrophoresed overnight at 39 v , stained with etbr , and photographed under uv light . antitumor activities of camptothecin derivatives were tested in b 6 d 2 f 1 mice bearing sarcoma - 180 or lewis lung murine solid tumor . for s - 180 , 3 × 10 6 cells were innoculated subcutaneously on day 3 . antitumor treatment started on day 1 intraperitoneously twice daily for five days . tumor volumes on day 7 and day 14 were measured . average tumor volumes were described as the ratio of treated versus untreated control ( t / c ). the control ( treated with dmso vehicle only ) tumor volumes for day 7 and day 14 were 0 . 11 cm 3 and 0 . 61 cm 3 , respectively . the t / c camptothecin is designated with “+++.” an increment or decrement of 10 % as compared to the camptothecin t / c on day 14 at 2 mg / kg dosage is designated with increase or decrease of one “+” unit , respectively . for lewis lung carcinoma , tumor cells ( 1 × 10 6 ) were inoculated subcutaneously on day 0 and treatment started on day 1 , intraperitoneously twice daily for five days . the grading of effects was as described above . as shown table 1 , many of the camptothecin derivatives tested for the antitumor cytotoxicity in vitro exhibited higher potency than camptothecin in one to three cell lines . most of those compounds exhibiting higher antitumor cytotoxicity also exhibited higher potency in enhancing the dna - topoisomerase i - mediated cleavage of pbr 322 dna , or in inhibiting the dna - topoisomerase i - mediated relaxation of pbr 322 dna . these results suggest excellent correlation between the antitumor cytoxicity of the camptothecin compounds with their ability to inhibit the functions of dna - topoisomerase i . for in vivo chemotherapeutic effects in tumor - bearing mice , for example , 7 - trimethylsilyl camptothecin showed better activity than camptothecin against sarcoma 180 in b 6 d 2 f 1 mice at several equivalent doses in a dose dependent manner in terms of tumor volume reduction . similarly , for lewis lung carcinoma , 7 - trimethylsilyl - 11 - fluoro camptothecin exhibited a similar antitumor effect to camptothecin in terms of tumor volume reduction at 4 - fold lower doses than camptothecin . thus , 7 - trimethylsilyl - 11 - fluoro camptothecin is more efficacious than camptothecin in its antitumor effects in vivo . the present inventors have thus discovered that introduction of a silyl group ( for example , a trimethylsilyl group ) at position 7 of the camptothecin structure typically results in a compound with better anti - tumor activity than camptothecin ( see , for example , the compound of example 1 as compared to ( 20s )- cpt ). the silyl group is also beneficial in the irinotecan series ( see , for example , the compound of example 6 as compared to irinotecan ). the anti - tumor activity remains essentially unchanged when a hydroxy group is introduced at position 10 of the compound of example 1 to produce the compound of example 5 . the compound of example 6 is a relative of sn - 38 , the active metabolite of irinotecan . some of the highest activities were observed in the present studies when a trimethylsilyl group was introduced in conjunction with a fluoro atom at position 11 ( see , for example , the compound of example 7 ), or a primary amine group at positions 10 or 11 ( see , respectively , examples 8 and 9 ). introduction of a fluoro atom in position 12 also results in an analog only approximately 2 times less potent than camptothecin ( see , example 11 as compared to ( 20s )- cpt ). this result is surprising considering the poor activity of the 12 - substituted camptothecins reported previously in the literature . a mammal ( human or animal ) may thus be treated by a method which comprises the administration to the mammal of a pharmaceutically effective amount of a compound of formula ( 1 ) or a pharmaceutically acceptable salt thereof . the condition of the mammal can thereby be improved . the compounds of the present invention can be administered in a variety of dosage forms including , for example : parenterally ( for example , intravenously , intradermally , intramuscularly or subcutaneously ); orally ( for example , in the form of tablets , lozengers , capsules , suspensions or liquid solutions ); rectally or vaginally , in the form of a suppository ; or topically ( for example , as a paste , cream , gel or lotion ). optimal dosages to be administered may be determined by those skilled in the art and will vary with the particular compound of formula ( 1 ) to be used , the strength of the preparation , the mode of administration , the time and frequency of administration , and the advancement of the patient &# 39 ; s condition . additional factors depending on the particular patient will result in the need to adjust dosages . such factors include patient age , weight , gender and diet . dosages may be administered at once or divided into a number of smaller doses administered at varying intervals of time . the following examples are provided for illustration of the invention and are not intended to be limiting thereof . to a solution of ( s )- 4 - ethyl - 4 - hydroxy - 6 - iodo - 3 - oxo - 1h - pyrano [ 3 , 4 - c ]- 8 - pyridone [ iodopyridone ( 2 ), 250 mg , 0 . 746 mmol ] in dme ( 2 . 5 ml ) and dmf ( 0 . 60 ml ) at 0 ° c . under argon was added 60 % nah in mineral oil ( 31 . 3 mg , 0 . 783 mmol ). libr ( 150 mg , 1 . 75 mmol ) was added 10 min latter . after 15 min at room temperature , 3 - trimethylsilyl - 2 - propynyl bromide ( 430 mg , 2 . 24 mmol ) was injected and the reaction mixture was heated in the dark at 65 ° c . for 20 h . the final solution was poured into brine ( 20 ml ), extracted with acoet ( 6 × 15 ml ) and dried ( na 2 so 4 ). the residue obtained after removal of the solvents was subjected to flash - chromatography ( chcl 3 / acoet 95 : 5 ) to give 283 mg ( 85 %) of a foam : [ α ] 20 d + 36 . 7 ( c 1 , chcl 3 ); ir ( neat , cm − 1 ) 3384 , 2940 , 2166 , 1730 , 1634 , 1518 , 1406 , 1130 , 841 , 752 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 14 ( s , 9 h ), 0 . 95 ( t , j = 7 . 4 hz , 3 h ), 1 . 77 ( m , 2 h ), 3 . 66 ( s , 1 h ), 5 . 00 ( d , j = 17 . 2 hz , 1 h ), 5 . 10 ( d , j = 16 . 4 hz , 1 h ), 5 . 15 ( d , j = 17 . 2 hz , 1 h ), 5 . 49 ( d , j = 16 . 4 hz , 1 h ), 7 . 16 ( s , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ − 0 . 40 , 7 . 7 , 31 . 5 , 44 . 5 , 66 . 3 , 71 . 8 , 90 . 9 , 97 . 9 , 116 . 5 , 118 . 1 , 148 . 6 , 157 . 9 , 173 . 3 ; hrms ( ei ) m / z calcd for c 16 h 20 ino 4 si ( m + ) 445 . 0206 , found 445 . 0203 ; lrms ( ei ) m / z 445 ( m + ), 430 , 416 , 386 . a solution of the compound prepared in ( 1 ) ( 36 . 6 mg , 0 . 082 mmol ), phenyl isonitrile ( 0 . 25 mmol ) and hexamethylditin ( 42 mg , 0 . 123 mmol ) in benzene ( 1 . 3 ml ) under argon was irradiated at 70 ° c . with a 275w ge sunlamp for 10 h . the final reaction mixture was concentrated and subjected to flash - chromatography ( chcl 3 / meoh 96 : 4 ) to provide 18 . 8 mg ( 54 %) of a slightly yellow solid : [ α ] 20 d + 39 . 0 ( c 0 . 2 , chcl 3 / meoh 4 : 1 ); 1 h nmr ( 300 mhz , cdcl 3 / cd 3 od 3 : 1 ) δ 0 . 50 ( s , 9 h ), 0 . 83 ( t , j = 7 . 4 hz , 3 h ), 1 . 74 ( m , 2 h ), 3 . 72 ( br s , 1 h ), 5 . 12 ( d , j = 16 . 4 hz , 1 h ), 5 . 16 ( br s , 2 h ), 5 . 47 ( d , j = 16 . 4 hz , 1 h ), 7 . 49 ( t , j = 8 . 1 hz , 1 h ), 7 . 54 ( s , 1 h ), 7 . 62 ( t , j = 8 . 1 hz , 1 h ), 8 . 02 ( d , j = 8 . 1 hz , 1 h ), 8 . 07 ( d , j = 8 . 1 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 / cd 3 od 3 : 1 ) δ 0 . 9 , 7 . 2 , 29 . 3 , 31 . 0 , 51 . 7 , 65 . 5 , 98 . 3 , 118 . 4 , 127 . 3 , 128 . 0 , 129 . 7 , 130 . 0 , 131 . 8 , 134 . 3 , 144 . 7 , 145 . 6 , 147 . 3 , 151 . 1 , 173 . 5 ; hrms ( ei ) m / z calcd for c 23 h 24 n 2 o 4 si ( m + ) 420 . 1505 , found 420 . 1501 ; lrms ( ei ) m / z 420 ( m + ), 391 , 376 , 361 , 347 , 320 , 291 . following the procedure described in example 1 -( 1 ), iodopyridone ( 2 ) ( 200 mg , 0 . 60 mmol ) and 3 - tert - butyldimethylsilyl - 2 - propynyl bromide ( 280 mg , 1 . 20 mmol ) provided , after flash - chromatography ( ch 2 cl 2 / acoet 9 : 1 ), 173 mg ( 59 %) of a white foam : [ α ] 20 d + 58 ( c 0 . 2 , chcl 3 ); ir ( chcl 3 , cm − 1 ) 3548 , 2950 , 2927 , 2859 , 1745 , 1648 , 1526 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 08 ( s , 6 h ), 0 . 92 ( m , 12 h ), 1 . 79 ( m , 2 h ), 3 . 77 ( br s , 1 h ), 5 . 00 - 5 . 25 ( m , 3 h ), 5 . 50 ( d , j = 16 . 4 hz , 1 h ) 7 . 19 ( s , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ − 4 . 9 , 7 . 63 , 16 . 6 , 26 . 0 , 31 . 6 , 44 . 5 , 66 . 3 , 71 . 8 , 89 . 4 , 98 . 6 , 100 . 0 , 116 . 5 , 118 . 1 , 148 . 6 , 158 . 0 , 173 . 2 ; hrms ( ei ) m / z calcd for c 19 h 26 ino 4 si ( m + ) 487 . 0679 , found 487 . 0676 ; lrms ( ei ) m / z 487 ( m + ), 430 , 386 , 96 , 81 , 57 . following the procedure described in example 1 -( 2 ), the compound prepared in ( 1 ) ( 48 . 7 mg , 0 . 10 mmol ) afforded , after flash - chromatographies ( ch 2 cl 2 / meoh 96 : 4 ; ch 2 cl 2 / acetone 9 : 1 ), 24 . 8 mg ( 54 %) of an off yellow solid : [ α ] 20 d + 35 . 5 ( c 0 . 2 , chcl 3 ); ir ( chcl 3 , cm − 1 ) 3028 , 2980 , 2960 , 2932 , 2859 , 1741 , 1658 , 1600 , 1555 , 1257 , 1198 , 1158 , 1045 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 69 ( s , 6 h ), 0 . 98 ( s , 9 h ), 1 . 03 ( t , j = 7 . 3 hz , 3 h ), 1 . 86 ( m , 2 h ), 3 . 86 ( s , 1 h ), 5 . 29 ( d , j = 16 . 3 hz , 1 h ), 5 . 31 ( s , 2 h ), 5 . 73 ( d , j = 16 . 3 hz , 1 h ), 7 . 60 ( t , j = 6 . 3 hz , 1 h ), 7 . 60 ( t , j = 7 . 0 hz , 1 h ), 7 . 66 ( s , 1 h ), 7 . 74 ( t , j = 7 . 3 hz , 1 h ) 8 . 20 ( t , j = 8 . 1 hz , 2 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ − 0 . 56 , 7 . 80 , 19 . 2 , 27 . 1 , 31 . 6 , 52 . 4 , 66 . 3 , 72 . 8 , 97 . 7 , 118 . 2 , 127 . 0 , 129 . 5 , 129 . 6 , 130 . 8 , 132 . 7 , 136 . 0 , 143 . 0 , 146 . 4 , 148 . 0 , 150 . 1 , 150 . 6 , 157 . 4 , 173 . 9 ; hrms ( ei ) m / z calcd for c 26 h 30 n 2 o 4 si ( m + ) 462 . 1974 , found 462 . 1975 ; lrms ( ei ) m / z 462 ( m + ), 450 , 361 , 331 , 304 , 245 , 223 , 57 . following the procedure described in example 1 -( 1 ), iodopyridone ( 2 ) ( 200 mg , 0 . 60 mmol ) and 3 - tert - butyldiphenylsilyl - 2 - propynyl bromide ( 428 mg , 1 . 20 mmol ) provided , after flash - chromatography ( ch 2 cl 2 / acoet 9 : 1 ), 258 mg ( 70 %) of a white foam : [ α ] 20 d + 45 . 1 ( c 0 . 2 , chcl 3 ); ir ( chcl 3 , cm − 1 ) 3546 , 2928 , 2855 , 1741 , 1658 , 1526 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 97 ( t , j = 7 . 3 hz , 3 h ), 1 . 08 ( s , 9 h ), 1 . 80 ( m , j = 7 . 1 hz , 2 h ), 3 . 76 ( br s , 1 h ), 5 . 13 ( d , j = 16 . 4 hz , 1 h ), 5 . 29 ( d , j = 2 . 5 hz , 2 h ), 5 . 52 ( d , j = 16 . 4 hz , 1 h ), 7 . 22 ( s , 1 h ), 7 . 32 - 7 . 40 ( m , 6 h ), 7 . 76 - 7 . 78 ( m , 4 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 7 . 6 , 18 . 6 , 27 . 0 , 31 . 6 , 44 . 6 , 60 . 4 , 66 . 3 , 71 . 8 , 86 . 5 , 99 . 9 , 102 . 2 , 116 . 6 , 127 . 7 , 129 . 6 , 132 . 6 , 135 . 6 , 148 . 7 , 157 . 8 , 173 . 2 ; hrms ( ei ) m / z calcd for c 25 h 21 ino 4 si ( m - c 4 h 9 + ) 554 . 0279 , found 554 . 0285 ; lrms ( ei ) m / z 554 ( m - c 4 h 9 + ), 587 , 510 , 220 , 143 , 105 . following the procedure described in example 1 -( 2 ), the compound prepared in ( 1 ) ( 61 . 1 mg , 0 . 10 mmol ) yielded , after flash - chromatographies ( ch 2 cl 2 / meoh 96 : 4 ; ch 2 cl 2 / acetone 9 : 1 ), 26 . 5 mg ( 45 %) of a light yellow solid : [ α ] 20 d + 35 . 2 ( c 0 . 2 , chcl 3 ); ir ( chcl 3 , cm − 1 ) 3003 , 2984 , 2969 , 2958 , 2935 , 1741 , 1658 , 1599 , 1555 , 1428 , 1226 , 1216 , 1158 , 1102 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 1 . 00 ( t , j = 7 . 3 hz , 3 h ), 1 . 44 ( s , 9 h ), 1 . 84 ( m , 2 h ), 3 . 75 ( s , 1 h ), 4 . 21 ( d , j = 5 . 7 hz , 2 h ), 5 . 19 ( d , j = 16 . 3 hz , 1 h ), 5 . 64 ( d , j = 16 . 3 hz , 1 h ), 7 . 43 ( m , 5 h ), 7 . 51 ( t , j = 7 . 3 hz , 2 h ), 7 . 62 ( s , 1 h ), 7 . 69 ( m , 5 h ), 8 . 10 ( d , j = 8 . 5 hz , 1 h ), 8 . 22 ( d , j = 8 . 2 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 7 . 9 , 20 . 4 , 30 . 2 , 31 . 6 , 52 . 2 , 66 . 4 , 72 . 8 , 97 . 5 , 118 . 2 , 126 . 3 , 128 . 6 , 129 . 8 , 130 . 3 , 130 . 7 , 131 . 9 , 132 . 2 , 134 . 6 , 134 . 64 , 136 . 4 , 136 . 5 , 138 . 1 , 140 . 9 , 146 . 2 , 148 . 4 , 149 . 9 , 151 . 3 , 157 . 1 , 174 . 1 ; hrms ( ei ) m / z calcd for c 36 h 34 n 2 o 4 si ( m + ) 586 . 2281 , found 586 . 2288 ; lrms ( ei ) m / z 586 ( m + ), 542 , 529 , 485 , 428 , 407 , 321 , 181 , 131 , 69 . to a solution of 4 - acetoxyformanilide ( 13 ) ( 358 mg , 1 . 0 mmol ) in ch 2 cl 2 ( 10 ml ) at 0 ° c . were successively added tetrabromomethane ( 0 . 70 g , 2 . 1 mmol ), triphenylphosphine ( 525 mg , 2 . 1 mmol ), and triethylamine ( 320 ml , 2 . 1 mmol ), and the resulting mixture was refluxed in the dark for 3 h . after evaporation of the solvents , the crude was triturated in ice - cooled et 2 o ( 20 ml ) and filtered . the solvent was evaporated and the residue was purified by flash - chromatography ( hexanes / acoet 8 : 2 ) to afford 243 mg ( 76 %) of a slightly brown solid : ir ( neat , cm − 1 ) 2127 , 1768 , 1501 , 1370 , 1201 , 1180 , 909 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 2 . 29 ( s , 3 h ), 7 . 11 ( d , j = 8 . 8 hz , 2 h ), 7 . 38 ( d , j = 8 . 8 hz , 2h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 21 . 0 , 122 . 8 , 127 . 6 , 150 . 8 , 164 . 3 , 168 . 8 ; hrms ( ei ) m / z calcd for c 9 h 7 no 2 ( m + ) 161 . 0477 , found 161 . 0474 ; lrms ( ei ) m / z 161 ( m + ), 133 , 119 , 91 . following the procedure described in example 1 -( 2 ), the compound prepared in example 1 -( 1 ) ( 44 . 5 mg , 0 . 10 mmol ) and the compound prepared in ( 1 ) ( 48 . 3 mg , 0 . 30 mmol ) provided , after flash - chromatography ( chcl 3 / acetone 10 : 1 ), 29 . 9 mg ( 63 %) of a slightly yellow oil : [ α ] 20 d + 29 . 9 ( c 0 . 5 , chcl 3 ); 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 61 ( s , 9h ), 0 . 98 ( t , j = 7 . 4 hz , 3 h ), 1 . 86 ( m , 2 h ), 2 . 38 ( s , 3 h ), 4 . 13 ( br s , 1 h ), 5 . 24 ( d , j = 16 . 4 hz , 1 h ), 5 . 27 ( s , 2 h ), 5 . 68 ( d , j = 16 . 4 hz , 1 h ), 7 . 46 ( dd , j = 9 . 2 , 2 . 5 hz , 1 h ), 7 . 60 ( s , 1 h ), 7 . 96 ( d , j = 2 . 5 hz , 1 h ), 8 . 13 ( d , j = 9 . 2 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 1 . 4 , 7 . 8 , 21 . 4 , 31 . 5 , 51 . 7 , 66 . 2 , 97 . 6 , 118 . 3 , 118 . 9 , 124 . 6 , 132 . 1 , 135 . 0 , 145 . 7 , 146 . 1 , 148 . 9 , 150 . 1 , 150 . 7 , 157 . 3 , 169 . 1 , 173 . 7 ; hrms ( ei ) m / z calcd for c 25 h 26 n 2 o 6 si ( m + ) 478 . 1560 , found 478 . 1582 ; lrms ( ei ) m / z 478 ( m + ), 436 , 392 , 377 , 336 , 277 . a solution of the compound ( 15 ) prepared in example 5 -( 2 ) ( 16 . 8 mg , 0 . 035 mmol ) and k 2 co 3 ( 9 . 6 mg , 0 . 070 mmol ) in meoh ( 100 ml ) and h 2 o ( 100 ml ) was stirred 1 h 30 at room temperature . the reaction mixture was acidified with acoh ( 2 drops ), diluted with brine ( 10 ml ) and extracted with acoet ( 10 × 10 ml ). the combined organic layers were dried ( na 2 so 4 ) and evaporated , and the residue was purified by flash - chromatographies ( chcl 3 / meoh / acoh 90 : 10 : 2 ; chcl 3 / acetone 2 : 1 ) to give 15 . 1 mg ( 99 %) of a white solid : [ α ] 20 d + 18 . 9 ( c 0 . 2 , chcl 3 / meoh 4 : 1 ); 1 h nmr ( 300 mhz , cdcl 3 / cd 3 od 4 : 1 ) 60 . 45 ( s , 9 h ), 0 . 84 ( t , j = 7 . 3 hz , 3 h ), 1 . 75 ( m , 2 h ), 5 . 12 ( br s , 2 h ), 5 . 12 ( d , j = 16 . 3 hz , 1 h ), 5 . 48 ( d , j = 16 . 3 hz , 1 h ), 7 . 24 ( dd , j = 9 . 1 , 2 . 5 hz , 1 h ), 7 . 39 ( d , j = 2 . 5 hz , 1 h ), 7 . 87 ( d , j = 9 . 1 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 / cd 3 od 4 : 1 ) δ 0 . 8 , 7 . 4 , 31 . 1 , 51 . 8 , 65 . 7 , 97 . 5 , 109 . 8 , 117 . 5 , 122 . 3 , 131 . 3 , 133 . 7 , 134 . 6 , 141 . 7 , 142 . 6 , 146 . 3 , 147 . 5 , 151 . 1 , 156 . 3 , 157 . 6 ; hrms ( ei ) m / z calcd for c 23 h 24 n 2 o 5 si ( m + ) 436 . 1454 , found 436 . 1450 ; lrms ( ei ) m / z 436 ( m + ), 392 , 377 , 336 , 323 . reaction of this compound with nh 2 ch 2 ch 2 nme 2 followed by etcocl provided the open e - ring analog for biological testing . to a solution of 4 - nitrophenyl chloroformate ( 31 ) ( 5 . 15 g , 25 . 6 mmol ) in 150 ml of dry thf at − 78 ° c . was added triethylamine ( 10 . 7 ml , 76 . 2 mmol ), followed by a solution of 4 - piperidinopiperidine ( 30 ) ( 4 . 51 g , 25 . 6 mmol ) in 40 ml of thf . this solution was stirred for two hours , after which the solvent was removed , and the residue was taken up in acoet , filtered and evaporated . the crude yellow solid was passed through a pad of neutral alumina using acoet as an eluent to yield , after evaporation , 6 . 73 g ( 79 %) of a white solid : ir ( chcl 3 , cm − 1 ) 3046 , 2937 , 2859 , 1704 , 1620 , 1513 , 1466 , 1242 , 1197 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 1 . 20 - 1 . 80 ( m , 8 h ), 1 . 90 ( d , j = 12 . 7 hz , 2 h ), 2 . 20 - 2 . 70 ( m , 5 h ), 2 . 87 ( t , j = 12 hz , 1 h ), 3 . 01 ( t , j = 12 hz , 1 h ), 4 . 30 ( br s , 2 h ), 7 . 29 ( d , j = 9 hz , 2 h ), 8 . 26 ( d , j = 9 hz , 2 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 24 . 6 , 26 . 3 , 27 . 5 , 28 . 2 , 40 . 1 , 44 . 4 , 50 . 1 , 62 . 0 , 122 . 2 , 124 . 9 , 144 . 8 , 151 . 9 , 156 . 3 ; hrms ( ei ) m / z calcd for c 17 h 23 n 3 o 4 ( m + ) 333 . 1676 , found 333 . 1688 ; lrms ( ei ) m / z 333 ( m + ), 195 , 167 , 124 , 110 , 96 , 55 . to a solution of the compound prepared in ( 1 ) ( 1 . 012 g , 3 . 03 mmol ) in acoet ( 125 ml ) was added 10 % pd / c ( 0 . 15 g ). the system was purged several times with argon , and a 1 l balloon of h 2 was added . after stirring the resulting mixture at room temperature for 12 hours , the catalyst was removed by filtration through celite and the solvent was evaporated to give 835 mg ( 91 %) of a white solid : ir ( chcl 3 , cm − 1 ) 3453 , 3400 , 3028 , 2936 , 2859 , 1703 , 1513 , 1429 , 1242 , 1226 , 1210 , 1197 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 1 . 30 - 1 . 70 ( m , 8 h ), 1 . 86 ( d , j = 12 . 6 hz , 2 h ), 2 . 33 - 2 . 62 ( m , 5 h ), 2 . 68 - 3 . 04 ( m , 2 h ), 3 . 58 ( br s , 2h ), 4 . 30 ( br s , 2 h ), 6 . 64 ( d , j = 6 . 0 hz , 2 h ), 6 . 87 ( d , j = 6 . 0 hz , 2 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 24 . 6 , 26 . 3 , 27 . 5 , 28 . 1 , 43 . 8 , 43 . 9 , 50 . 1 , 62 . 3 , 115 . 4 , 122 . 3 , 143 . 4 , 143 . 7 , 154 . 1 ; hrms ( ei ) m / z calcd for c 17 h 25 n 3 o 2 ( m + ) 303 . 1944 , found 303 . 1947 ; lrms ( ei ) m / z 303 ( m + ), 195 , 167 , 124 , 108 , 96 , 80 , 65 , 55 . to a stirred solution of dicyclohexylcarbodiimide ( 272 mg , 1 . 32 mmol ) in ch 2 cl 2 ( 5 ml ) at 0 ° c . was added 98 % formic acid ( 60 . 7 mg , 1 . 32 mmol ) dropwise . after 10 minutes , the resulting mixture was added via syringe to a solution of the compound prepared in example ( 2 ) ( 200 mg , 0 . 66 mmol ) in pyridine ( 5 ml ) at 0 ° c . the reaction mixture was then allowed to warm to room temperature and stirred 3 h . the pyridine solvent was evaporated and the residue was taken up in ch 2 cl 2 , filtered , evaporated and subjected directly to a basic alumina column ( ch 2 cl 2 / meoh 95 : 5 ) to give 118 mg ( 83 %) of a white solid , which consists , at room temperature , of a mixture of the cis and trans rotamers originating from hindered rotation around the formamide carbon - nitrogen bond : ir ( chcl 3 , cm − 1 ) 3025 , 3013 , 2937 , 2888 , 2861 , 1703 , 1517 , 1466 , 1275 , 1226 , 1210 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 1 . 38 - 1 . 80 ( m , 8 h ), 1 . 90 ( d , j = 12 hz , 2 h ), 2 . 40 - 2 . 70 ( m , 5 h ), 2 . 83 ( t , j = 12 hz , 1 h ), 2 . 97 ( t , j = 12 hz , 1 h ), 4 . 32 ( m , 2 h ), 7 . 03 - 7 . 11 ( m , 3 h ), 7 . 37 ( br s , 0 . 5 h ) ( cis ), 7 . 46 ( d , j = 10 hz , 1 h ), 7 . 53 ( d , j = 11 hz , 0 . 5 h ) ( trans ), 8 . 32 ( d , j = 2 hz , 0 . 5 h ) ( cis ), 8 . 59 ( d , j = 11 hz , 0 . 5 h ) ( trans ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 24 . 6 , 26 . 3 , 27 . 6 , 28 . 1 , 44 . 2 , 44 . 0 , 50 . 1 , 82 . 2 , 120 . 0 , 121 . 0 , 122 . 1 , 123 . 0 , 133 . 9 , 134 . 3 , 147 . 5 , 148 . 9 , 153 . 9 , 153 . 4 , 159 . 1 , 162 . 5 ; hrms ( ei ) m / z calcd for c 18 h 25 n 3 o 3 ( m + ) 331 . 1884 , found 331 . 1896 ; lrms ( ei ) m / z 331 ( m + ), 244 , 202 , 167 , 124 , 80 , 55 . to a solution of the compound prepared in example ( 3 ) ( 90 . 1 mg , 0 . 272 mmol ) in ch 2 cl 2 ( 10 ml ) were successively added triethylamine ( 69 . 5 mg , 0 . 688 mmol ) them dropwise , at 0 ° c ., a solution of triphosgene ( 68 mg , 0 . 229 mmol ) in dry ch 2 cl 2 ( 10 ml ). the mixture was stirred 2 hours at room temperature , washed with 7 % nahco 3 ( 5 ml ) and dried ( mgso 4 ). the crude brown residue obtained after evaporation of the solvent was subjected to flash - chromatography ( et 2 o / et 2 nh 95 : 5 ) to yield 67 . 2 mg ( 79 %) of a white solid : ir ( chcl 3 , cm − 1 ) 3034 , 2937 , 2131 , 1718 , 1504 , 1429 , 1233 , 1224 , 1213 , 1198 , 1184 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 1 . 32 - 1 . 75 ( m , 8 h ), 1 . 90 ( br d , j = 12 . 4 hz , 2 h ), 2 . 32 - 2 . 65 ( m , 5 h ), 2 . 84 ( t , j = 12 . 3 hz , 1 h ), 2 . 98 ( t , j = 12 . 1 hz , 1 h ), 4 . 20 - 4 . 40 ( m , 2 h ), 7 . 14 ( d , j = 8 . 8 hz , 2 h ), 7 . 37 ( d , j = 8 . 8 hz , 2 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 25 . 0 , 26 . 5 , 27 . 8 , 28 . 5 , 44 . 4 , 50 . 6 , 62 . 7 , 123 . 3 , 127 . 8 , 152 . 1 , 153 . 1 , 164 . 4 ; hrms ( ei ) m / z calcd for c 18 h 23 n 3 o 2 ( m + ) 313 . 1779 , found 313 . 1790 ; lrms ( ei ) m / z 313 ( m + ), 195 , 167 , 124 , 110 , 84 , 55 . following the procedure described in example 1 -( 2 ), the compound prepared in example 1 -( 1 ) ( 44 . 5 mg , 0 . 10 mmol ), the compound prepared in ( 4 ) ( 93 . 9 mg , 0 . 3 mmol ), and hexamethylditin ( 50 mg , 0 . 15 mmol ) in dry benzene ( 1 . 5 ml ) were irradiated for 9 hours at 70 ° with a 275w ge sunlamp . the reaction was evaporated , dissolved in meoh with a few drops of dmso to aid solubility and injected into a waters reverse phase hplc . the conditions used to effect separation were as follows . a waters 600e system controller with a waters 490e programmable multiwavelength detector , a sargent welch plotter and waters c - 18 25 × 10 cartridge columns were employed . a gradient elution , [ 5 : 95 mecn / h 2 o ( 0 . 1 % tfa ) to 30 : 70 mecn / h 2 o ( 0 . 1 % tfa )], over 40 minutes time at 20 ml / min gave a semipurified grey solid after lyophilization . the grey solid was further purified ( ch 2 cl 2 / etoh 70 : 30 ) on a chromatotron using a 1 mm plate to give 12 mg ( 19 %) of a yellow solid : [ α ] 20 d + 14 . 8 ( c 0 . 2 , chcl 3 ); ir ( chcl 3 , cm − 1 ) 3023 , 2957 , 2933 , 1720 , 1659 , 1601 , 1216 , 1191 , 1175 , 1158 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 64 ( s , 9 h ), 1 . 03 ( t , j = 7 . 3 hz , 3 h ), 1 . 50 - 1 . 51 ( br m , 2 h ), 1 . 51 - 1 . 52 ( br m , 6 h ), 1 . 84 ( m , j = 7 . 3 hz , 2 h ), 2 . 01 - 2 . 10 ( br m , 2 h ), 2 . 60 - 2 . 75 ( br s , 5 h ), 2 . 75 - 3 . 12 ( br m , 2 h ), 4 . 30 - 4 . 50 ( br m , 2 h ), 5 . 30 ( d , j = 16 . 3 hz , 1 h ), 5 . 31 ( s , 2 h ), 5 . 74 ( d , j = 16 . 3 hz , 1 h ), 7 . 55 ( dd , j = 9 . 0 , 2 . 4 hz , 1 h ), 7 . 63 ( s , 1 h ), 8 . 01 ( d , j = 2 . 3 hz , 1 h ), 8 . 19 ( d , j = 9 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 1 . 5 , 7 . 8 , 25 . 4 , 29 . 7 , 31 . 5 , 43 . 8 , 50 . 1 , 51 . 8 , 62 . 5 , 66 . 3 , 72 . 8 , 97 . 5 , 118 . 1 , 119 . 0 , 125 . 1 , 132 . 0 , 132 . 3 , 134 . 9 , 143 . 4 , 145 . 6 , 146 . 4 , 150 . 1 , 150 . 5 , 152 . 8 , 157 . 4 , 174 . 0 ; hrms ( ei ) m / z calcd for c 34 h 42 n 4 o 6 si ( m + ) 630 . 2898 , found 630 . 2874 ; lrms ( ei ) m / z 630 ( m + ), 586 , 501 , 457 , 195 , 167 , 153 , 124 , 111 , 96 , 84 . the preparation of 3 - fluoro - 2 - trimethylsilylbenzaldehyde proceeds through a selective ortho - metallation . see comins , d . l . et al ., j . org . chem ., 49 , 1078 ( 1984 ). see also snieckus , v ., chem . rev ., 90 , 879 ( 1990 ). to a solution of n , n , n ′- trimethylethylenediamine ( 2 . 70 ml , 20 mmol ) in thf ( 50 ml ) was slowly added 1 . 6 n n - buli in hexanes ( 13 ml , 21 mmol ) at − 20 ° c ., followed by 3 - fluorobenzaldehyde ( 2 . 10 ml , 20 mmol ) 15 min latter . after 15 minute at this temperature , 1 . 6 n n - buli in hexanes ( 38 ml , 60 mmol ) was injected and the solution was stirred 1 h 30 at − 35 ° c . chlorotrimethylsilane ( 15 ml , 120 mmol ) was added and the reaction mixture was stirred overnight at room temperature . the final solution was poured into ice - cooled 1 n hcl ( 150 ml ), quickly extracted with et 2 o ( 3 × 100 ), washed with brine and dried ( na 2 so 4 ). after evaporation of the solvents , the residue was purified by flash - chromatography ( hexanes / acoet 95 : 5 ) to provide 3 . 25 g ( 83 %) of an oil : ir ( neat , cm − 1 ) 1701 , 1440 , 1252 , 1233 , 1109 , 848 , 764 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 40 ( d , j = 2 . 6 hz , 9 h ), 7 . 18 ( br t , j = 9 . 0 hz , 1 h ), 7 . 47 ( ddd , j 1 = j 2 = 8 . 1 hz , j 3 = 5 . 4 hz , 1 h ), 7 . 70 ( br d , j = 7 . 5 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 1 . 8 , 120 . 8 ( d , j cf = 29 hz ), 126 . 8 , 128 . 2 , 131 . 2 , 143 . 3 , 167 . 6 ( d , j cf = 244 hz ), 192 . 4 ; hrms ( ei ) m / z calcd for c 9 h 10 fosi ( m - ch 3 + ) 181 . 0485 , found 181 . 0482 ; lrms ( ei ) m / z 181 ( m - ch 3 + ), 151 , 125 , 103 , 91 . a classical oxidation to the free acid was then performed . see hill , l . r . et al ., j . org . chem ., 50 , 470 ( 1985 ). to a solution of the compound prepared in ( 1 ) ( 3 . 41 g , 17 . 3 mmol ) in tert - butanol ( 20 ml ) were successively added a 2 n solution of 2 - methyl - 2 - butene in thf ( 55 ml , 110 mmol ) then slowly , over a period of 10 minutes , a solution of 80 % naclo 2 ( 2 . 55 g , 22 . 5 mmol ) and nah 2 po 4 . h 2 o ( 3 . 10 g , 22 . 5 mmol ) in water ( 18 ml ). the resulting mixture was stirred 16 h at room temperature , the tert - butanol was evaporated , and the residue was taken up in 1 n naoh ( 50 ml ) and washed with hexanes ( 3 × 20 ml ). the aqueous layer was acidified with 1 n hcl to ph 2 , saturated with nacl , and extracted with et 2 o ( 3 × 50 ml ). the combined organic layers were dried ( na 2 so 4 ) and evaporated to provide 3 . 13 g ( 85 %) of a white solid : ir ( nacl , cm − 1 ) 2982 , 1700 , 1434 , 1294 , 1271 , 1253 , 1230 , 849 , 763 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 39 ( d , j = 2 . 6 hz , 9 h ), 7 . 16 ( br t , j = 9 . 1 hz , 1 h ), 7 . 41 ( ddd , j 1 = j 2 = 7 . 9 hz , j 3 = 5 . 6 hz , 1 h ), 7 . 73 ( br d , j = 7 . 7 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 1 . 3 , 119 . 5 ( d , j cf = 27 hz ), 126 . 0 , 127 . 3 , 130 . 9 , 138 . 0 , 167 . 5 ( d , j cf = 243 hz ), 174 . 5 ; hrms ( ei ) m / z calcd for c 9 h 10 fo 2 si ( m - ch 3 + ) 197 . 0434 , found 197 . 0433 ; lrms ( ei ) m / z 197 ( m - ch 3 + ), 179 , 133 , 115 , 105 . preparation of the intermediate isocyanate was carried out via a curtius rearrangement . see capson , t . l . et al ., tetrahedron lett ., 25 , 3515 ( 1984 ) and references herein . to a solution of the compound prepared in ( 2 ) ( 3 . 03 g , 14 . 3 mmol ) in ch 2 cl 2 ( 20 ml ) was added oxalylchloride ( 1 . 30 ml , 15 . 0 mmol ) and the resulting mixture was stirred 3 h at room temperature . the residue obtained after evaporation of the solvent was diluted with thf ( 10 ml ) and injected with vigorous stirring to a ice - cooled solution of nan 3 ( 3 . 70 g , 57 mmol ) in h 2 o ( 20 ml ) and acetone ( 50 ml ). after 15 min at 0 ° c . and 1 min at room temperature , the solution was extracted with et 2 o ( 4 × 50 ml ) and dried ( na 2 so 4 ). the residue obtained after evaporation of solvents was refluxed in toluene for 1 h 30 to provide , upon solvent removal , 2 . 85 g ( 79 %) of a slightly yellow oil : ir ( neat , cm − 1 ) 2269 , 1598 , 1433 , 1252 , 1228 , 846 , 788 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 38 ( d , j = 1 . 9 hz , 9 h ), 6 . 82 ( br t , j = 8 . 3 hz , 1 h ), 6 . 90 ( br d , j = 8 . 2 hz , 1 h ), 7 . 25 ( ddd , j 1 = j 2 = 8 . 1 hz , j 3 = 6 . 6 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 0 . 4 , 112 . 6 ( d , j cf = 26 hz ), 120 . 5 , 122 . 5 , 131 . 5 , 139 . 2 , 167 . 4 ( d , j cf = 241 hz ). a deoxygenation then afforded the expected isonitrile . see baldwin , j . e . et al ., tetrahedron , 39 , 2989 ( 1983 ). triethylamine ( 4 . 10 ml , 29 . 3 mmol ) was added slowly at 0 ° c . to a 2 n solution of trichlorosilane in ch 2 cl 2 ( 8 . 40 ml , 16 . 8 mmol ) followed , 5 min latter , by the compound prepared in example ( 3 ) ( 2 . 35 g . 11 . 2 mmol ). after 1 h 30 at 0 ° c . and 30 min at room temperature , the solution was saturated with nh 3 , filtered over celite , washed with 5 % nah 2 po 4 and dried ( na 2 so 4 ). the crude obtained after evaporation of the solvent was then subjected to flash - chromatography ( hexanes / acoet 95 : 5 ) to afford 1 . 42 g ( 66 %) of a slighly purple liquid : ir ( neat , cm − 1 ) 2114 , 1598 , 1440 , 1254 , 1237 , 1110 , 943 , 848 , 793 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 45 ( d , j = 1 . 8 hz , 9 h ), 7 . 01 ( br t , j = 8 . 3 hz , 1 h ), 7 . 17 ( br d , j = 7 . 7 hz , 1 h ), 7 . 32 ( ddd , j 1 = j 2 = 8 . 0 hz , j 3 = 6 . 1 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 0 . 1 , 116 . 5 ( d , j cf = 26 hz ), 124 . 3 , 131 . 6 , 166 . 8 ( d , j cf = 243 hz ), 166 . 9 ; hrms ( ei ) m / z calcd for c 10 h 12 fnsi ( m + ) 193 . 0723 , found 193 . 0715 ; lrms ( ei ) m / z 193 ( m + ), 178 , 150 , 116 , 105 . following the procedure described in example 1 -( 2 ), the compound prepared in example 1 -( 1 ) ( 43 . 5 mg , 0 . 098 mmol ) and the compound prepared in example ( 4 ) ( 76 mg , 0 . 39 mmol ) provided , after flash - chromatography ( chcl 3 / acetone 20 : 1 ), 33 . 4 mg ( 67 %) of a slighly yellow oil : [ α ] 20 d + 23 . 6 ( c 0 . 2 , chcl 3 ); 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 53 ( d , j = 1 . 7 hz , 9 h ), 0 . 60 ( s , 9 h ), 1 . 02 ( t , j = 7 . 4 hz , 3 h ), 1 . 88 ( m , 2 h ), 3 . 82 ( br s , 1 h ), 5 . 28 ( d , j = 16 . 3 hz , 1 h ), 5 . 29 ( br s , 2 h ), 5 . 72 ( d , j = 16 . 3 hz , 1 h ), 7 . 31 ( t , j = 8 . 7 hz , 1 h ), 7 . 46 ( s , 1 h ), 8 . 18 ( dd , j = 9 . 2 , 5 . 9 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 1 . 6 , 1 . 7 , 7 . 7 , 31 . 4 , 51 . 8 , 66 . 3 , 72 . 7 , 97 . 2 , 117 . 8 ( d , j cf = 33 hz ), 124 . 3 ( d , j cf = 28 hz ), 128 . 9 , 131 . 1 , 133 . 1 , 144 . 4 , 146 . 7 , 150 . 1 , 153 . 4 , 157 . 4 , 167 . 6 ( d , j cf = 245 hz ), 173 . 9 ; hrms ( ei ) m / z calcd for c 26 h 31 fn 2 o 4 si 2 ( m + ) 510 . 1806 , found 510 . 1806 ; lrms ( ei ) m / z 510 ( m + ), 495 , 466 , 451 , 395 , 319 . a solution of the compound prepared in example ( 5 ) ( 19 . 5 mg , 0 . 038 mmol ) in 48 % hbr ( 1 ml ) was heated at 50 ° c . for 20 h . the reaction mixture was slowly poured with vigorous stirring into saturated nahco 3 ( 10 ml ), extracted with acoet ( 6 × 20 ml ) and dried ( na 2 so 4 ). after evaporation of the solvent , the residue was purified by flash - chromatography ( chcl 3 / acetone 8 : 1 ) to give 12 . 5 mg ( 83 %) of a slighly yellow solid : [ α ] 20 d + 39 . 6 ( c 0 . 2 , chcl 3 ); 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 62 ( s , 9 h ), 1 . 01 ( t , j = 7 . 4 hz , 3 h ), 1 . 87 ( m , 2 h ), 3 . 81 ( br s , 1 h ), 5 . 28 ( d , j = 16 . 4 hz , 1 h ), 5 . 28 ( br s , 2 h ), 5 . 72 ( d , j = 16 . 4 hz , 1 h ), 7 . 31 ( ddd , j = 9 . 6 , 7 . 8 , 2 . 8 hz , 1 h ), 7 . 61 ( s , 1 h ), 7 . 78 ( dd , j = 9 . 7 , 2 . 7 hz , 1 h ), 8 . 19 ( dd , j = 9 . 4 , 5 . 8 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 1 . 6 , 7 . 8 , 31 . 5 , 51 . 7 , 66 . 3 , 72 . 7 , 97 . 8 , 114 . 3 ( d , j cf = 20 hz ), 117 . 7 ( d , j cf = 26 hz ), 118 . 5 , 128 . 9 , 130 . 0 , 133 . 9 , 144 . 4 , 146 . 1 , 149 . 3 , 150 . 1 , 151 . 7 , 157 . 4 , 162 . 6 ( d , j cf = 250 hz ), 173 . 9 ; hrms ( ei ) m / z calcd for c 23 h 23 fn 2 o 4 si ( m + ) 438 . 1411 , found 438 . 1412 ; lrms ( ei ) m / z 438 ( m + ), 409 , 394 , 379 , 365 , 338 , 309 . the isonitrile was prepared in 2 steps via classical boc - protection followed by dehydration . see einhorn , j . et al ., synlett , 37 ( 1991 ). a mixture of 4 - aminoformanilide ( 1 . 71 g , 12 . 6 mmol ), di - tert - butyl dicarbonate ( 2 . 87 g , 13 . 2 mmol ) and nahco 3 ( 1 . 11 g , 13 . 2 mmol ) in absolute etoh ( 50 ml ) was sonicated in a cleaning bath for 4 h . the final solution was filtered through a pad of celite and concentrated to dryness . the residue was taken up in half brine ( 50 ml ), extracted with acoet ( 6 × 30 ml ) and dried ( na 2 so 4 ). after evaporation of the solvent , the residual oil was subjected to flash - chromatography ( chcl 3 / meoh 95 : 5 ) to give 2 . 85 g ( 96 %) of 4 - tert - butyloxycarbonylaminoformanilide , as a white solid . this intermediate ( 945 mg , 4 . 0 mmol ) was subjected to the conditions described in example 5 -( 1 ) to provide , after flash - chromatography ( hexanes / acoet 9 : 1 ), 502 mg ( 58 %) of a slighly brown solid : ir ( nacl , cm − 1 ) 3370 , 2121 , 1691 , 1524 , 1412 , 1364 , 1239 , 1158 , 832 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 1 . 48 ( s , 9 h ), 6 . 75 ( br s , 1 h ), 7 . 26 ( d , j = 8 . 8 hz , 2 h ), 7 . 37 ( d , j = 8 . 8 hz , 2 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 28 . 2 , 81 . 3 , 118 . 5 , 127 . 1 , 139 . 4 , 152 . 3 , 162 . 7 ; hrms ( ei ) m / z calcd for c 12 h 14 n 2 o 2 ( m + ) 218 . 1055 , found 218 . 1044 ; lrms ( ei ) m / z 218 ( m + ), 162 , 144 . following the procedure described in example 1 -( 2 ), the compound prepared in example 1 -( 1 ) ( 44 . 5 mg , 0 . 10 mmol ) and the compound prepared in example ( 1 ) ( 65 mg , 0 . 30 mmol ) provided , after flash - chromatography ( chcl 3 / acetone 6 : 1 ), 32 . 5 mg ( 60 %) of a slighly yellow solid : [ α ] 20 d + 28 . 0 ( c 0 . 2 , chcl 3 ); 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 63 ( s , 9 h ), 0 . 99 ( t , j = 7 . 4 hz , 3 h ), 1 . 53 ( s , 9 h ), 1 . 86 ( m , 2 h ), 4 . 03 ( br s , 1 h ), 5 . 24 ( d , j = 16 . 2 hz , 1 h ), 5 . 26 ( s , 2 h ), 5 . 70 ( d , j = 16 . 2 hz , 1 h ), 7 . 00 ( br s , 1 h ), 7 . 47 ( dd , j = 9 . 2 , 2 . 3 hz , 1 h ), 7 . 55 ( s , 1 h ), 8 . 02 ( d , j = 9 . 2 hz , 1 h ), 8 . 56 ( br s , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 1 . 3 , 7 . 8 , 28 . 2 , 31 . 5 , 51 . 8 , 66 . 3 , 72 . 8 , 97 . 1 , 114 . 4 , 117 . 8 , 122 . 6 , 131 . 3 , 132 . 8 , 135 . 0 , 137 . 2 , 142 . 9 , 144 . 3 , 146 . 6 , 149 . 2 , 150 . 1 , 157 . 4 , 173 . 9 ; hrms ( ei ) m / z calcd for c 23 h 25 n 3 o 4 si ( m - boc + ) 435 . 1614 , found 435 . 1612 ; lrms ( ei ) m / z 535 ( m + ), 479 , 435 , 391 , 362 , 335 . a solution of the compound prepared in example ( 2 ) ( 75 . 5 mg , 0 . 141 mmol ) and tfa ( 500 ml ) in ch 2 cl 2 ( 2 ml ) was stirred 3 h at room temperature . the reaction mixture was then poured into saturated nahco 3 ( 50 ml ), extracted with acoet ( 10 × 15 ml ) and dried ( na 2 so 4 ). the residue obtained after evaporation of the solvents was purified by flash - chromatography ( chcl 3 / meoh 95 : 5 ) to afford 55 . 4 mg ( 90 %) of a yellow solid : [ α ] 20 d + 18 . 7 ( c 0 . 15 , chcl 3 / meoh 4 : 1 ); 1 h nmr ( 300 mhz , cdcl 3 / cd 3 od 4 : 1 ) δ 0 . 40 ( s , 9 h ), 0 . 80 ( t , j = 7 . 4 hz , 3 h ), 1 . 70 ( m , 2 h ), 5 . 05 ( s , 2 h ), 5 . 08 ( d , j = 16 . 3 hz , 1 h ), 5 . 43 ( d , j = 16 . 3 hz , 1 h ), 7 . 05 ( br s , 1 h ), 7 . 07 ( d , j = 8 . 0 hz , 1 h ), 7 . 38 ( s , 1 h ), 7 . 74 ( d , j = 8 . 0 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 / cd 3 od 4 : 1 ) δ 0 . 6 , 7 . 2 , 30 . 8 , 51 . 8 , 65 . 5 , 72 . 7 , 97 . 0 , 107 . 2 , 116 . 8 , 122 . 0 , 130 . 7 , 134 . 0 , 134 . 7 , 139 . 9 , 141 . 7 , 145 . 8 , 146 . 9 , 151 . 2 , 157 . 5 , 173 . 7 ; hrms ( ei ) m / z calcd for c 23 h 25 n 3 o 4 si ( m + ) 435 . 1614 , found 435 . 1613 ; lrms ( ei ) m / z 435 ( m + ), 391 , 376 , 335 , 290 . the isonitrile was prepared in 2 steps following the same procedures as described in example 9 -( 1 ). in the first step , the boc - protection of 3 - aminoformanilide ( 1 . 80 g , 13 . 2 mmol ) provided , after flash - chromatography ( chcl 3 / meoh 95 : 5 ), 2 . 65 g ( 85 %) of 3 - tert - butyloxycarbonylaminoformanilide , as a white solid . this intermediate ( 412 mg , 1 . 74 mmol ) was then subjected to the conditions described in example 5 -( 1 ) to provide , after flash - chromatography ( hexanes / acoet 9 : 1 ), 190 mg ( 50 %) of a brown solid : ir ( nacl , cm − 1 ) 3318 , 2126 , 1715 , 1603 , 1547 , 1433 , 1236 , 1162 , 782 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 1 . 49 ( s , 9 h ), 6 . 67 ( br s , 1 h ), 7 . 00 ( m , 1 h ), 7 . 20 - 7 . 30 ( m , 2 h ), 7 . 60 ( br s , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 28 . 2 , 81 . 3 , 116 . 0 , 118 . 9 , 120 . 6 , 129 . 8 , 139 . 5 , 152 . 3 , 163 . 6 ; hrms ( ei ) m / z calcd for c 12 h 14 n 2 o 2 ( m + ) 218 . 1055 , found 218 . 1047 ; lrms ( ei ) m / z 218 ( m + ), 196 , 162 , 152 , 118 . following the procedure described in example 1 -( 2 ), the compound prepared in example 1 -( 1 ) ( 44 . 5 mg , 0 . 10 mmol ) and the compound prepared in example ( 1 ) ( 65 . 5 mg , 0 . 3 mmol ) afforded , after flash - chromatographies ( chcl 3 / meoh 95 : 5 ; chcl 3 / acetone 5 : 1 ), 23 . 1 mg ( 43 %) of a slighly yellow oil . this intermediate ( 14 . 7 mg , 0 . 027 mmol ) was then deprotected following the conditions described in example 9 -( 3 ) to provide , after flash - chromatography ( chcl 3 / meoh 9 : 1 ), 11 . 8 mg ( 99 %) of ( 20s )- 11 - amino - 7 - trimethylsilylcamptothecin , as a yellow solid and with the exclusion of other isomers : [ α ] 20 d + 15 . 0 ( c 0 . 1 , chcl 3 / meoh 4 : 1 ); 1 h nmr ( 300 mhz , cdcl 3 / cd 3 od 4 : 1 ) δ 0 . 44 ( s , 9 h ), 0 . 86 ( t , j = 7 . 4 hz , 3 h ), 1 . 76 ( m , 2 h ), 5 . 08 ( s , 2 h ), 5 . 14 ( d , j = 16 . 4 hz , 1 h ), 5 . 50 ( d , j = 16 . 3 hz , 1 h ), 6 . 97 ( dd , j = 9 . 2 , 2 . 5 hz , 1 h ), 7 . 07 ( d , j = 2 . 5 hz , 1 h ), 7 . 50 ( s , 1 h ), 7 . 84 ( d , j = 9 . 2 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 / cd 3 od 4 : 1 ) δ 1 . 1 , 7 . 4 , 31 . 0 , 51 . 7 , 65 . 6 , 97 . 9 , 107 . 9 , 117 . 8 , 119 . 7 , 125 . 9 , 127 . 1 , 129 . 0 , 130 . 4 , 135 . 4 , 144 . 3 , 149 . 5 , 149 . 9 , 151 . 1 , 157 . 6 , 175 . 3 ; hrms ( ei ) m / z calcd for c 23 h 25 n 3 o 4 si ( m + ) 435 . 1614 , found 435 . 1626 ; lrms ( ei ) m / z 435 ( m + ), 406 , 391 , 376 , 335 . to a solution of 2 - fluoro - 4 - nitroaniline ( 21 ) [ prepared according to katritsky , a . r . et al ., j . org . chem ., 51 , 5039 ( 1986 )] ( 2 . 16 g , 13 . 9 mmol ) in ch 2 cl 2 ( 25 ml ) were successively added di - tert - butyl dicarbonate ( 3 . 19 g , 14 . 6 mmol ), triethylamine ( 2 . 95 ml , 20 . 8 mmol ) and 4 - dimethylaminopyridine ( 210 mg , 1 . 67 mmol ) and the reaction mixture was stirred 16 h at room temperature . the final solution was diluted with ch 2 cl 2 ( 75 ml ), washed with ice - cooled 5 % citric acid ( 4 × 50 ml ) and dried ( na 2 so 4 ). after evaporation of the solvent , the residue was subjected to flash - chromatography ( hexanes / acoet 9 : 5 ) to provide , in order of elution , first 1 . 95 g ( 55 %) of the mono - protected derivative , 4 - tert - butyloxycarbonylamino - 3 - fluoro - 1 - nitrobenzene , secondly 1 . 13 g ( 23 %) of the bis - protected derivative , 4 - di - tert - butyloxycarbonylamino - 3 - fluoro - 1 - nitrobenzene . the characteristics of the mono - protected derivative are as follows : 1 h nmr ( 300 mhz , cdcl 3 ) δ 1 . 52 ( s , 9 h ), 6 . 99 ( br s , 1 h ), 7 . 95 ( m , 1 h ), 8 . 03 ( br d , j = 9 . 2 hz , 1 h ), 8 . 34 ( br t , j = 8 . 5 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 28 . 1 , 82 . 5 , 110 . 9 ( d , j cf = 23 hz ), 118 . 3 , 120 . 8 , 133 . 5 , 141 . 7 , 150 . 1 ( d , j cf = 243 hz ), 151 . 4 ; hrms ( ei ) m / z calcd for c 11 h 13 fn 2 o 4 ( m + ) 256 . 0859 , found 258 . 0854 ; lrms ( ei ) m / z 256 ( m + ), 200 , 182 , 57 . reduction of the nitro group to the amine function was carried out following a classical procedure . see ram , s . et al ., tetrahedron lett ., 25 , 3415 ( 1984 ). to a solution of the compound prepared in example ( 1 ) ( 1 . 62 g , 6 . 32 mmol ) and ammonium formate ( 1 . 70 g , 27 mmol ) in anhydrous meoh ( 12 ml ) was added 10 % pd — c ( 400 mg ) in one portion . after 2 h at room temperature , the final solution was filtered over celite , concentrated and the residue was directly subjected to flash - chromatography ( chcl 3 / meoh 9 : 1 ) to provide 1 . 40 g ( 98 %) of a slighly yellow oil : 1 h nmr ( 300 mhz , cd 3 socd 3 ) δ 1 . 40 ( s , 9 h ), 5 . 22 ( s , 2 h ), 6 . 25 - 6 . 35 ( m , 2 h ), 6 . 93 ( br t , j = 8 . 0 hz , 1 h ), 8 . 29 ( br s , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 28 . 5 , 80 . 4 , 102 . 1 ( d , j cf = 24 hz ), 110 . 7 , 117 . 2 , 122 . 8 , 143 . 4 , 153 . 1 , 154 . 1 ( d , j cf = 244 hz ); hrms ( ei ) m / z calcd for c 11 h 15 fn 2 o 2 ( m + ) 226 . 1118 , found 226 . 1116 ; lrms ( ei ) m / z 226 ( m + ), 170 , 126 , 83 , 57 . to a stirred solution of dicyclohexylcarbodiimide ( 1 . 51 g , 7 . 31 mmol ) in ch 2 cl 2 ( 15 ml ) at 0 ° c . was added formic acid ( 275 ml , 7 . 31 mmol ) dropwise . after 10 minutes , the resulting mixture was added over a period of 5 minutes to a solution of the compound prepared in example ( 2 ) ( 1 . 28 g , 5 . 66 mmol ) in ch 2 cl 2 ( 10 ml ) and pyridine ( 0 . 61 ml , 7 . 50 mmol ) at 0 ° c . the reaction mixture was then allowed to warm to room temperature and stirred 16 h . after filtration over celite , the final solution was concentrated and subjected to flash - chromatography ( chcl 3 / acoet 85 : 15 ) to give 1 . 44 g ( 100 %) of 4 - tert - butyloxycarbonylamino - 3 - fluoroformamide , as a white solid . this intermediate ( 1 . 38 g , 5 . 43 mmol ) was dissolved in ch 2 cl 2 ( 20 ml ) and , at 0 ° c ., were successively added tetrabromomethane ( 1 . 93 g , 5 . 80 mmol ), triphenylphosphine ( 1 . 52 g , 5 . 80 mmol ), and 1 , 4 - diazabicyclo [ 2 . 2 . 2 ] octane ( dabco , 650 mg , 5 . 80 mmol ). the reaction mixture was allowed to warm to room temperature and stirred 2 h . after evaporation of the solvent , the crude was triturated in ice - cooled et 2 o ( 20 ml ) and filtered over celite . the residue obtained after evaporation of the solvent was purified by flash - chromatography ( hexanes / acoet 95 : 5 to 9 : 1 ) to provide 660 mg ( 51 %) of a slighly brown solid : 1 h nmr ( 300 mhz , cdcl 3 ) δ 1 . 51 ( s , 9 h ), 6 . 76 ( br s , 1 h ), 7 . 05 - 7 . 20 ( m , 2 h ), 8 . 17 ( br t , j = 8 . 6 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 28 . 1 , 81 . 8 , 113 . 3 ( d , j cf = 25 hz ), 119 . 7 , 123 . 0 , 128 . 6 , 150 . 6 ( d , j cf = 242 hz ), 151 . 8 , 164 . 2 ; hrms ( ei ) m / z calcd for c 12 h 13 fn 2 o 2 ( m + ) 236 . 0961 , found 236 . 0952 ; lrms ( ei ) m / z 236 ( m + ), 180 , 163 , 136 , 08 , 57 . following the procedure described in example 1 -( 2 ), the compound prepared in example 1 -( 1 ) ( 66 . 8 mg , 0 . 15 mmol ) and the compound described in example ( 3 ) ( 110 mg , 0 . 50 mmol ) provided , after flash - chromatographies ( chcl 3 / meoh 96 : 4 ; chcl 3 / acetone 10 : 1 ), 47 . 6 mg ( 57 %) of a slighly yellow oil containing the above regioisomers : 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 54 ( d , j = 4 . 9 hz , 9h minor ), 0 . 65 ( s , 9h major ), 0 . 99 ( t , j = 7 . 3 hz , 3h ), 1 . 86 ( m , 2h ), 3 . 93 ( br s , 1h ), 5 . 24 ( d , j = 16 . 3 hz , 1h minor ), 5 . 25 ( br s , 2h major ), 5 . 25 ( d , j = 16 . 3 hz , 1h major ), 5 . 30 ( br s , 2h minor ), 5 . 68 ( d , j = 16 . 3 hz , 1h minor ), 5 . 69 ( d , j = 16 . 3 hz , 1h major ), 6 . 98 ( d , j = 3 . 6 hz , 1h minor ), 7 . 02 ( d , j = 3 . 6 hz , 1h major ), 7 . 52 ( s , 1h minor ), 7 . 53 ( s , 1h major ), 7 . 74 ( d , j = 12 . 1 hz , 1h major ), 7 . 92 ( br d , j = 9 . 3 hz , 1h minor ), 8 . 60 ( br t , j = 8 . 4 hz , 1h minor ), 9 . 08 ( d , j = 8 . 7 hz , 1h major ); hrms ( ei ) m / z calcd for c 28 h 32 fn 3 o 6 si 553 . 2044 , found 553 . 2022 ; lrms ( ei ) m / z 553 ( m + ), 493 , 479 , 453 , 435 , 424 , 409 , 394 , 380 , 353 . the compound prepared in example ( 4 ) ( 41 . 3 mg , 0 . 0746 mmol ) was deprotected following the conditions described in example 9 -( 3 ). after workup , the crude was subjected to a flash - chromatography ( chcl 3 / acetone / meoh 70 : 10 : 1 . 5 ) to provide , in order of elution , first 14 . 1 mg ( 42 %) of the pure ( 20s )- 10 - amino - 11 - fluoro - 7 - trimethylsilyl - camptothecin , then a 15 . 2 mg of a c . a . 1 : 1 mixture of ( 20s )- 10 - amino - 11 - fluoro - 7 - trimethylsilylcamptothecin and ( 20s )- 10 - amino - 9 - fluoro - 7 - trimethylsilylcamptothecin . the characteristics of ( 20s )- 10 - amino - 11 - fluoro - 7 - trimethylsilylcamptothecin are as follows : [ α ] 20 d + 20 . 0 ( c 0 . 2 , chcl 3 / meoh 4 : 1 ); 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 59 ( s , 9h ), 1 . 00 ( t , j = 7 . 4 hz , 3 h ), 1 . 86 ( m , 2 h ), 3 . 86 ( br s , 1 h ), 4 . 31 ( br s , 2 h ), 5 . 21 ( br s , 2 h ), 5 . 26 ( d , j = 16 . 4 hz , 1 h ), 5 . 69 ( d , j = 16 . 4 hz , 1 h ), 7 . 30 ( d , j = 9 . 3 hz , 1 h ), 7 . 50 ( s , 1 h ), 7 . 69 ( d , j = 11 . 8 hz , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 / cd 3 od 10 : 1 ) δ 1 . 4 , 7 . 7 , 31 . 4 , 51 . 9 , 66 . 1 , 72 . 7 , 97 . 1 , 109 . 4 , 113 . 6 ( d , j cf = 20 hz ), 117 . 3 , 130 . 8 , 134 . 4 , 136 . 4 , 140 . 2 , 142 ., 146 . 5 , 147 . 6 , 150 . 6 , 153 . 9 , 154 . 0 ( d , j cf = 251 hz ), 157 . 6 , 173 . 9 ; hrms ( ei ) m / z calcd for c 23 h 24 fn 3 o 4 si ( m + ) 453 . 1520 , found 453 . 1500 ; lrms ( ei ) m / z 453 ( m + ), 424 , 409 , 394 , 352 , 181 , 131 , 119 . following the procedure described in example 1 -( 2 ), the compound prepared in example 1 -( 1 ) ( 44 . 5 mg , 0 . 10 mmol ) and 2 , 3 - difluorophenyl isonitrile [ prepared in 20 % yield following the procedure of weber , w . p . et al ., tetrahedron lett ., 13 , 1637 ( 1972 ) with stirring 2 days at room temperature before workup ] ( 42 mg , 0 . 30 mmol ) afforded , after flash - chromatographies ( chcl 3 / meoh 95 : 5 ; chcl 3 / acetone 10 : 1 to 4 : 1 ), 22 . 6 mg ( 50 %) of a slighly yellow oil containing the above regioisomers : 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 56 ( d , j = 4 . 8 hz , 1h minor ), 0 . 65 ( s , 9h major ), 1 . 00 ( t , j = 7 . 4 hz , 3 h ), 1 . 86 ( m , 2 h ), 3 . 87 ( br s , 1h minor ), 3 . 97 ( br s , 1h major ), 5 . 0 - 5 . 47 ( m , 3 h ), 5 . 68 ( d , j = 16 . 5 hz , 1 h ), 5 . 70 ( d , j = 16 . 4 hz , 1h minor ), 7 . 31 ( m , 1h minor ), 7 . 44 ( dt , j = 9 . 4 , 7 . 4 hz , 1h major ), 7 . 59 ( s , 1h minor ), 7 . 60 ( s , 1h major ), 7 . 68 ( m , 1h minor ), 7 . 93 ( m , 1h major ); hrms ( ei ) m / z calcd for c 23 h 22 f 2 n 2 o 4 si ( m + ) 456 . 1317 , found 456 . 1321 ; lrms ( ei ) m / z 456 ( m + ), 438 , 428 , 412 , 383 , 356 , 327 . following the procedure outlined in example 1 -( 1 ), iodopyridone 2 , ( 200 mg , 0 . 598 mmol ) was combined with triisopropylsilyl - 2 - propynyl bromide ( 329 mg , 1 . 196 mmol ). chromatography ( ch 2 cl 2 / acoet 9 : 1 ) gave 41 . 1 mg ( 13 %) of a white foam : 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 91 ( t , j = 7 hz , 6 h ), 0 . 99 ( s , 18 h ), 1 . 71 ( m , j = 7 hz , 2 h ), 3 . 65 ( s , 1 h ), 5 . 0 - 5 . 2 ( m , 3 h ), 5 . 45 ( d , j = 16 hz , 1 h ), 7 . 13 ( s , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 7 . 7 , 11 . 2 , 18 . 7 , 31 . 7 , 44 . 6 , 66 . 5 , 71 . 9 , 87 . 7 , 100 . 1 , 116 . 6 , 118 . 2 , 148 . 6 , 158 . 0 , 173 . 4 ; hrms ( ei ) m / z calcd for c 22 h 32 ino 4 si ( m + ) 529 . 1162 , found 529 . 1145 ; lrms ( ei ) m / z 529 ( m + ), 486 , 442 , 82 , 59 . following the procedure outlined in example 1 -( 2 ), the pyridone described above ( 41 mg , 0 . 077 mmol ) yielded 23 . 3 mg ( 60 %) of a light yellow solid : [ α ] 20 d + 31 . 7 ( c 0 . 2 , ch 2 cl 2 ); ir ( chcl 3 , cm − 1 ) 3026 , 3008 , 2996 , 2962 , 2950 , 2932 , 2892 , 2869 , 1742 , 1658 , 1598 , 1555 , 1466 , 1230 , 1220 , 1158 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 1 . 02 ( t , j = 7 hz , 3 h ), 1 . 18 ( d , j = 7 hz , 18 h ), 1 . 60 - 2 . 0 ( m , 5 h ), 2 . 17 ( s , 1 h ), 5 . 31 ( d , j = 16 hz , 1 h ), 5 . 41 ( s , 2 h ), 5 . 76 ( d , j = 16 , 1 h ), 7 . 61 ( t , j = 7 hz , 1h ), 7 . 69 ( s , 1 h ), 7 . 78 ( t , j = 7 hz 1 h ), 8 . 20 ( t , j = 7 hz , 2 h ); 13 c nmr ( 125 mhz , cdcl 3 ) δ 7 . 9 , 13 . 5 , 19 . 2 , 31 . 7 , 52 . 6 , 66 . 5 , 72 . 9 , 98 . 4 , 118 . 6 , 127 . 1 , 129 . 7 , 130 . 2 , 130 . 4 , 133 . 6 , 136 . 3 , 145 . 0 , 146 . 0 , 150 . 3 , 150 . 6 , 157 . 4 , 174 . 1 ; hrms ( ei ) m / z calcd for c 29 h 36 n 2 o 4 si ( m + ) 504 . 2444 , found 504 . 2436 ; lrms ( ei ) m / z 504 ( m + ), 461 , 433 , 419 , 405 , 391 , 375 , 361 , 347 , 311 , 275 , 174 , 93 , 69 , 59 . following the procedure outlined in example 1 -( 1 ), iodopyridone 2 , ( 150 mg , 0 . 450 mmol ) was combined with triethylsilyl - 2 - propynyl bromide ( 210 mg , 0 . 90 mmol ). chromatography ( ch 2 cl 2 / acoet 9 : 1 ) gave 97 . 0 mg ( 45 %) of a white foam : 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 54 ( q , j = 8 hz , 6 h ), 0 . 92 ( t , j = 8 hz , 12 h ), 1 . 74 ( m , j = 7 hz , 2 h ), 3 . 57 ( s , 1 h ), 4 . 9 - 5 . 1 ( m , 3 h ), 5 . 46 ( d , j = 16 hz , 1 h ), 7 . 13 ( s , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 4 . 1 , 7 . 4 , 7 . 6 , 31 . 5 , 44 . 5 , 66 . 3 , 71 . 8 , 88 . 7 , 99 . 2 , 100 . 0 , 116 . 5 , 118 . 1 , 148 . 5 , 158 . 0 , 173 . 2 ; hrms ( ei ) m / z calcd for c 19 h 26 ino 4 si ( m + ) 487 . 0676 , found 487 . 0688 ; lrms ( ei ) m / z 487 ( m + ), 458 , 430 , 420 , 402 , 360 , 332 , 153 , 141 , 125 , 96 , 83 , 68 , 57 . following the procedure outlined in example 1 -( 2 ), the pyridone described above ( 48 . 7 mg , 0 . 1 mmol ) yielded 29 . 8 mg ( 65 %) of a light yellow solid : [ α ] 20 d + 35 . 9 ( c 0 . 2 , ch 2 cl 2 ); ir ( chcl 3 , cm − 1 ) 3015 , 3002 , 2960 , 2935 , 1741 , 1658 , 1599 , 1219 , 1199 , 1158 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 80 - 1 . 00 ( m , 12 h ), 1 . 0 - 1 . 18 ( m , 6 h ), 1 . 70 - 1 . 90 ( m , 2 h ), 5 . 22 - 5 . 27 ( m , 3 h ), 5 . 69 ( d , j = 16 hz , 1 h ), 7 . 58 ( t , j = 7 hz , 1 h ), 7 . 63 ( s , 1 h ), 7 . 72 ( t , j = 7 hz 1 h ), 8 . 18 ( m , 2 h ); 13 c nmr ( 125 mhz , cdcl 3 ) δ 5 . 0 , 7 . 6 , 7 . 9 , 31 . 7 , 52 . 1 , 66 . 5 , 72 . 9 , 97 . 7 , 118 . 3 , 127 . 4 , 127 . 9 , 129 . 7 , 131 . 2 , 132 . 6 , 136 . 1 , 142 . 6 , 146 . 6 , 147 . 9 , 150 . 2 , 150 . 9 , 157 . 6 , 174 . 1 ; hrms ( ei ) m / z calcd for c 26 h 30 n 2 o 4 si ( m + ) 462 . 1975 , found 462 . 1982 ; lrms ( ei ) m / z 462 ( m + ), 433 , 418 , 405 , 389 , 361 , 256 , 220 , 205 , 189 , 178 , 149 , 137 , 123 , 109 , 95 , 81 , 69 , 57 . following the procedure outlined in example 1 -( 1 ), iodopyridone 2 ( 150 mg , 0 . 450 mmol ) was combined with dimethyl -( 1s , 2s , 5s ) 7 , 7 dimethylnorpinylsilyl - 2 - propynyl bromide ( 281 mg , 0 . 90 mmol ). chromatography ( ch 2 cl 2 / acoet 9 : 1 ) gave 100 . 8 mg ( 39 %) of a white foam : 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 10 ( d , j = 2 hz , 6 h ), 0 . 48 - 0 . 70 ( m , 2 h ), 0 . 72 ( s , 3 h ), 0 . 93 ( t , j = 7 hz , 3 h ), 1 . 10 ( s , 3 h ), 1 . 15 - 1 . 40 ( m , 3 h ), 1 . 60 - 1 . 85 ( m , 6 h ), 1 . 88 - 2 . 00 ( m , 1 h ), 2 . 05 - 2 . 20 ( m , 1 h ), 3 . 58 ( s , 1 h ), 4 . 95 ( m , 3 h ), 5 . 46 ( d , j = 16 hz , 1 h ), 7 . 13 ( s , 1 h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 0 . 78 , 7 . 8 , 20 . 2 , 23 . 1 , 24 . 0 , 24 . 8 , 25 . 3 , 27 . 0 , 31 . 3 , 31 . 7 , 39 . 7 , 40 . 7 , 44 . 7 , 49 . 1 , 66 . 5 , 71 . 9 , 91 . 0 , 98 . 5 , 100 . 3 , 116 . 6 , 118 . 3 , 148 . 7 , 158 . 0 , 173 . 4 . following the procedure outlined in example 1 -( 2 ), the pyridone described above ( 57 . 0 mg , 0 . 1 mmol ) yielded 29 . 4 mg ( 54 %) of a light yellow solid : [ α ] 20 d + 29 . 2 ( c 0 . 2 , ch 2 cl 2 ); ir ( chcl 3 , cm − 1 ) 3020 , 3000 , 2980 , 2972 , 2939 , 2914 , 2824 , 2867 , 1741 , 1658 , 1599 , 1556 , 1264 , 1231 , 1201 , 1157 , 843 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 50 - 0 . 70 ( m , 8 h ), 0 . 90 - 1 . 10 ( m , 9 h ), 1 . 10 - 1 . 35 ( m , 4 h ), 1 . 40 - 1 . 60 ( m , 3 h ), 1 . 72 ( m , 1 h ), 1 . 80 - 1 . 95 ( m , 2 h ), 2 . 05 - 2 . 11 ( m , 2 h ), 5 . 25 ( d , j = 16 hz 1 h ), 5 . 27 ( s , 2 h ), 5 . 69 ( d , j = 16 hz , 1 h ), 7 . 58 ( t , j = 8 hz , 1 h ), 7 . 62 ( s , 1 h ), 7 . 72 ( t , j = 8 hz , 1 h ), 8 . 10 - 8 . 2 ( m , 2 h ); 13 c nmr ( 125 mhz , cdcl 3 ) δ 1 . 4 , 7 . 9 , 19 . 9 , 23 . 0 , 24 . 6 , 25 . 3 , 26 . 8 , 31 . 6 , 31 . 7 , 39 . 6 , 40 . 5 , 49 . 3 , 52 . 0 , 66 . 5 , 72 . 9 , 97 . 7 , 118 . 3 , 127 . 3 , 128 . 3 , 129 . 7 , 131 . 2 , 132 . 1 , 134 . 6 , 144 . 6 , 146 . 6 , 148 . 0 , 150 . 2 , 150 . 9 , 157 . 6 , 174 . 0 ; hrms ( ei ) m / z calcd for c 32 h 38 n 2 o 4 si ( m + ) 542 . 2601 , found 542 . 2588 ; lrms ( ei ) m / z 542 ( m + ), 498 , 487 , 460 , 443 , 431 , 406 , 387 , 377 , 362 , 333 , 318 , 304 , 289 , 275 , 219 , 178 , 166 , 141 , 115 , 95 , 67 . following the procedure cited by rico and co - workers ( j . org . chem . 1994 , 59 , 415 ), iodopyridone 2 , ( 150 mg , 0 . 450 mmol ) was combined with 3 - cyanopropyldimethylsilyl - 2 - propynyl bromide ( 165 mg , 0 . 678 mmol ), k 2 co 3 ( 124 mg , 0 . 90 mmol ), bu 4 n + br − ( 14 . 5 mg , 0 . 045 mmol ), h 2 o ( 0 . 02 ml ) and toluene ( 3 . 6 ml ). this mixture was refluxed for 1 h . after filtration and chromatography ( ch 2 cl 2 / acoet 9 : 1 ) 34 . 0 mg ( 15 %) of a white oil was obtained : 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 17 ( s , 6h ), 0 . 70 - 0 . 80 ( m , 2 h ), 0 . 98 ( t , j = 7 hz , 3 h ), 1 . 70 - 1 . 90 ( m , 4 h ), 2 . 39 ( t , j = 7 , 2 h ), 3 . 66 ( s , 1 h ), 4 . 9 - 5 . 22 ( m , 3 h ), 5 . 51 ( d , j = 16 hz , 1 h ), 7 . 19 ( s , 1 h ); 13 c nmr ( 125 mhz , cdcl 3 ) δ − 2 . 1 , 7 . 8 , 15 . 4 , 20 . 5 , 20 . 6 , 31 . 6 , 44 . 6 , 66 . 4 , 71 . 9 , 89 . 1 , 99 . 6 , 100 . 0 , 116 . 7 , 118 . 3 , 119 . 7 , 148 . 8 , 158 . 0 , 173 . 3 ; hrms ( ei ) m / z calcd for c 19 h 23 in 2 o 4 si ( m + ) 498 . 0472 , found 498 . 0480 ; lrms ( ei ) m / z 498 ( m + ), 483 , 470 , 445 , 430 , 416 , 402 , 392 , 371 , 348 , 335 , 306 , 290 , 266 , 223 , 202 , 185 , 163 , 136 , 126 , 109 , 98 , 81 , 69 , 57 . following the procedure outlined in example 1 -( 2 ), the pyridone described above ( 25 . 0 mg , 0 . 05 mmol ) yielded 9 . 8 mg ( 41 %) of a light yellow solid : [ α ] 20 d + 34 . 3 ( c 0 . 2 , ch 2 cl 2 ); ir ( chcl 3 , cm − 1 ) 3025 , 3016 , 1741 , 1659 , 1600 , 1264 , 1222 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 71 ( s , 6 h ), 1 . 05 ( t , j = 7 hz , 3 h ), 1 . 26 ( m , 2 h ), 1 . 66 ( m , 2 h ), 1 . 90 ( m , 2 h ), 2 . 35 ( t , j = 7 hz , 2 h ), 3 . 76 ( s , 1 h ), 5 . 31 ( d , j = 16 hz , 1 h ), 5 . 31 ( s , 2 h ), 5 . 75 ( d , j = 16 hz , 1 h ), 7 . 67 ( m , 2 h ), 7 . 82 ( t , j = 8 hz , 1 h ), 8 . 17 ( d , j = 8 hz 1 h ), 8 . 24 ( d , j = 8 hz , 1 h ); 13 c nmr ( 125 mhz , cdcl 3 ) δ 0 . 2 , 7 . 9 , 16 . 8 , 20 . 7 , 20 . 73 , 31 . 7 , 50 . 9 , 66 . 5 , 72 . 8 , 97 . 9 , 118 . 5 , 119 . 2 , 127 . 7 , 127 . 8 , 130 . 0 , 131 . 4 , 131 . 9 , 135 . 2 , 141 . 9 , 146 . 3 , 148 . 1 , 150 . 3 , 151 . 1 , 157 . 5 , 174 . 0 ; hrms ( ei ) m / z calcd for c 26 h 27 n 3 o 4 si ( m + ) 473 . 1771 , found 473 . 1755 ; lrms ( ei ) m / z 473 ( m + ), 444 , 429 , 414 , 400 , 389 , 373 362 , 344 , 331 , 303 , 289 , 2 . 75 , 245 , 219 , 166 , 152 , 130 , 98 , 71 . following the procedure outlined in example 1 -( 1 ), [ iodopyridone 2 ( 150 mg , 0 . 450 mmol ) was combined with 3 - chloropropyldimethylsilyl - 2 - propynyl bromide ( 228 mg , 0 . 90 mmol ). chromatography ( ch 2 cl 2 / acoet 9 : 1 ) gave 75 . 4 mg ( 33 %) of a clear oil . analysis of the nmr showed the presence of the alkyl bromide in addition to the desired chloro derivative in a 1 . 6 : 1 ratio in favor of the former : 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 09 ( s , 6 h ), 0 . 60 - 0 . 70 ( m , 2 h ), 0 . 85 - 0 . 89 ( t , j = 7 hz , 3 h ), 1 . 60 - 1 . 95 ( m , 4 h ), 3 . 33 ( t , j = 7 hz , 2 h , assigned to iodo ), 3 . 44 ( t , j = 7 hz , 2 h , assigned to bromo ), 3 . 75 ( s , 1 h ), 4 . 91 - 5 . 18 ( m , 3 h ), 5 . 42 ( d , j = 16 hz , 1 h ), 7 . 12 ( s , 1 h ). following the procedure outlined in example 1 -( 2 ), the pyridone described above ( 51 mg , 0 . 1 mmol ) yielded 23 mg ( 49 %) of a light yellow solid . analysis of the spectral data identified this solid as a 3 component mixture corresponding to the chloro , bromo and the iodo derivatives in a 1 . 6 : 1 : 1 . 3 ratio : [ α ] 20 d + 30 . 8 ( c 0 . 2 , ch 2 cl 2 ); ir ( chcl 3 , cm − 1 ) 3029 , 3012 , 2980 , 2963 , 2933 , 1742 , 1658 , 1600 , 1556 , 1258 , 1233 , 1218 , 1200 , 1158 , 1045 , 843 , 822 , 794 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 69 ( s , 6 h ), 1 . 04 ( t , j = 7 hz , 3 h ), 1 . 18 - 1 . 30 ( m , 2 h ), 1 . 60 - 2 . 0 ( m , 4 h ), 3 . 15 ( t , j = 7 hz , 2 h , assigned to iodo ), 3 . 36 ( t , j = 7 hz , 2 h , assigned to bromo ), 3 . 48 ( t , j = 7 hz , 2 h , assigned to chloro ), 3 . 88 ( s , 1 h ), 5 . 30 ( d , j = 16 hz , 1 h ), 5 . 31 ( s , 2 h ), 5 . 74 ( d , j = 16 hz , 1 h ), 7 . 62 - 7 . 66 ( m , 2 h ), 7 . 87 ( t , j = 8 hz , 1 h ), 8 . 18 ( d , j = 8 hz , 1 h ), 8 . 22 ( d , j = 8 hz , 1 h ); 13 c nmr ( 125 mhz , cdcl 3 ) δ 0 . 2 , 7 . 9 , 14 . 7 , 27 . 5 , 31 . 7 , 47 . 4 , 51 . 9 , 66 . 4 , 72 . 8 , 98 . 2 , 118 . 6 , 127 . 7 , 127 . 9 , 130 . 0 , 131 . 0 , 132 . 0 , 135 . 2 , 146 . 1 , 147 . 6 , 150 . 2 , 157 . 5 , 174 . 0 ; hrms ( ei ) m / z calcd for c 25 h 27 cln 2 o 4 si ( m + ) 482 . 1429 , found 482 . 1413 ; lrms ( ei ) m / z 482 ( m + ), 453 , 438 , 361 , 305 , 275 . following the procedure outlined in example 1 -( 2 ), the pyridone described above ( 34 . 5 mg , 0 . 071 mmol ) and p - acetoxyisonitrile yielded 21 . 3 mg ( 58 %) of a light yellow solid : [ α ] 20 d + 36 . 2 ( c 0 . 2 , ch 2 cl 2 ); ir ( chcl 3 , cm − 1 ) 3029 , 3000 , 2958 , 2931 , 2902 , 2885 , 2859 , 1742 , 1659 , 1600 , 1557 , 1504 , 1464 , 1371 , 1256 , 1232 , 1195 , 1166 , 1045 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 69 ( s , 6 h ), 0 . 90 ( s , 9 h ), 1 . 04 ( t , j = 7 hz , 3 h ), 1 . 80 - 2 . 00 ( m , j = 7 hz , 2 h ), 2 . 40 ( s , 3 h ), 3 . 81 ( s , 1 h ), 5 . 30 ( d , j = 16 hz 1 h ), 5 . 31 . ( s , 2 h ), 5 . 75 ( d , j = 16 hz , 1 h ), 7 . 53 ( dd , j 1 = 9 hz , j 2 = 2 hz , 1 h ), 7 . 65 ( s , 1 h ), 8 . 08 ( d , j = 2 hz , 1 h ), 8 . 21 ( d , j = 9 hz , 1 h ); 13 c nmr ( 125 mhz , cdcl 3 ) δ 0 . 6 , 7 . 9 , 19 . 3 , 21 . 5 , 27 . 2 , 31 . 7 , 52 . 5 , 66 . 5 , 72 . 9 , 97 . 7 , 118 . 4 , 120 . 4 , 124 . 8 , 132 . 1 , 133 . 2 , 136 . 7 , 142 . 8 , 146 . 2 , 146 . 4 , 149 . 0 , 150 . 2 , 150 . 8 , 157 . 5 , 169 . 1 , 174 . 1 ; lrms ( ei ) m / z 520 ( m + ), 478 , 463 , 421 , 377 , 347 , 320 , 291 , 57 . following the procedure outlined in example 2 -( 2 ), the pyridone described above ( 34 . 5 mg , 0 . 071 mmol ) yielded , using the same chromatographic conditions , 21 . 3 mg ( 58 %) of a light yellow solid : [ α ] 20 d + 36 . 2 ( c 0 . 2 , ch 2 cl 2 ); ir ( chcl 3 , cm − 1 ) 3029 , 3000 , 2958 , 2931 , 2902 , 2885 , 2859 , 1742 , 1659 , 1600 , 1557 , 1504 , 1464 , 1371 , 1256 , 1232 , 1195 , 1166 , 1045 ; 1 h nmr ( 300 mhz , cdcl 3 ) δ 0 . 69 ( s , 6 h ), 0 . 90 ( s , 9 h ), 1 . 04 ( t , j = 7 hz , 3 h ), 1 . 80 - 2 . 00 ( m , j = 7 hz , 2 h ), 2 . 40 ( s , 3 h ), 3 . 81 ( s , 1 h ), 5 . 30 ( d , j = 16 hz 1h ), 5 . 31 . ( s , 2h ), 5 . 75 ( d , j = 16 hz , 1 h ), 7 . 53 ( dd , j 1 = 9 hz , j 2 = 2 hz , 1 h ), 7 . 65 ( s , 1 h ), 8 . 08 ( d , j = 2 hz , 1h ), 8 . 21 ( d , j = 9 hz , 1 h ); 13 c nmr ( 125 mhz , cdcl 3 ) δ 0 . 6 , 7 . 9 , 19 . 3 , 21 . 5 , 27 . 2 , 31 . 7 , 52 . 5 , 66 . 5 , 72 . 9 , 97 . 7 , 118 . 4 , 120 . 4 , 124 . 8 , 132 . 1 , 133 . 2 , 136 . 7 , 142 . 8 , 146 . 2 , 146 . 4 , 149 . 0 , 150 . 2 , 150 . 8 , 157 . 5 , 169 . 1 , 174 . 1 ; hrms ( ei ) m / z calcd for c 28 h 32 n 2 o 6 si ( m + ) 520 . 2030 , found 520 . 2014 lrms ( ei ) m / z 520 ( m + ), 478 , 463 , 421 , 377 , 347 , 320 , 291 , 57 . following the procedure outlined in example 5 , ( 13 . 4 mg , 0 . 026 mmol ) of the compound described in example 18 was converted to the hydroxy derivative . purification ( 2 : 1 ch 2 cl 2 : acetone ) on a preparative tlc plate gave 10 . 6 mg ( 85 %) of a yellow solid : [ α ] 20 d + 17 . 4 ( c 0 . 2 , 3 : 1 ch 2 cl 2 / meoh ); 1 h nmr ( 300 mhz , 3 : 1 cdcl 3 / cd 3 od ) δ 0 . 66 ( s , 6h ), 0 . 88 - 1 . 05 ( m , 12h ), 1 . 80 - 2 . 00 ( m , 2h ), 5 . 25 - 5 . 30 ( m , 3 h ), 5 . 70 ( d , j = 16 hz , 1 h ), 7 . 37 ( dd , j 1 = 9 hz , j 2 = 2 hz , 1 h ), 7 . 54 ( d , j = 2 hz , 1 h ), 7 . 60 ( s , 1 h ), 8 . 05 ( d , j = 9 hz , 1 h ); 13 c nmr ( 125 mhz , ( 3 : 1 ) cdcl 3 : cd 3 od ) δ 8 . 1 , 20 . 6 , 27 . 6 , 30 . 4 , 31 . 9 , 53 . 6 , 66 . 5 , 73 . 9 , 98 . 6 , 112 . 1 , 118 . 8 , 123 . 3 , 132 . 1 , 135 . 6 , 137 . 4 , 141 . 6 , 143 . 8 , 147 . 3 , 148 . 4 , 152 . 6 , 157 . 5 , 158 . 7 , 174 . 7 ; hrms ( ei ) m / z calcd for c 26 h 30 n 2 o 5 si ( m + ) 478 . 1924 , found 478 . 1947 lrms ( ei ) m / z 478 ( m + ), 434 , 421 , 377 , 304 , 284 , 227 , 178 , 149 , 137 , 109 , 97 , 83 , 69 , 57 . although the present invention has been described in detail in connection with the above examples , it is to be understood that such detail is solely for that purpose and that variations can be made by those skilled in the art without departing from the spirit of the invention except as it may be limited by the following claims .	2
fig1 shows a manufacturing method for the present invention . at first the quartz blank 100 ( fig1 ( a )) is cut to 50 μm from artificial quartz , then a part of one side ( upper surface ) is solved by etching with hydrogen fluoride , and a concave groove 101 is made ( fig1 ( b )). the oscillation part is generated by the thin layer between this pit 101 and the lower surface of quartz blank 100 , the remaining part becomes the frame 102 , which is attached by electrodes . these are same as the conventional manufacturing methods . as the next step , the whole lower surface is processed by a dry etching as ion etching ( hereafter ion etching process ) with hydrogen fluoride , and the quartz blank 100 becomes thinner fig1 ( c ). this ion etching process is to sputter silicone atoms in silicone dioxide at the surface of quartz blank 100 , when the electric voltage is impressed to fluorine atoms and accelerate ions after the molecular bondages are cut in the plasma state . as mentioned previously , it is not possible for the sole chemical wet etching to decrease the thickness thinner than 20 μm . afterwards the ion etching process will decrease the thickness down to approximately 10 . 3 μm . the target thickness is 10 μm . however , the ion etching process alone will not achieve the target thickness . the ion etching can decrease the thickness , however this has the disadvantage of forming an ion - damaged layer , which is unknown defect with non - crystalline component at the mono - crystalline surface , since the ion etching process uses atomic collisions . the thickness of the layer is approximately 0 . 2 - 0 . 3 μm . therefore we employed the mechanical polishing . the dual face polishing machine does the job to polish the final processing ( fig1 ( d )), and it machines the blank down to 10 . 3 μm with the surface layer 0 . 3 μm . the dual face polishing machine structure is similar to a planet gear . at first the quartz plate 100 is set to the steel carrier 106 , which corresponds to the planet gear and rotates with axis - rotation at the same time , and the blank 100 is sandwiched between the lower fixed table 104 and the upper table 103 . both fixed tables are patched by foamed poly - urethane polishing pad 105 . thereafter , cerium oxide whetstone powder is streaming with water , the quartz blank 100 held by carrier 106 rotates around its own axis between the lower and upper tables 103 , 104 , also the upper table 103 rotates , and then the quartz 100 can be polished . as shown in fig1 ( e ), the lower surface of quartz blank 100 becomes curved in convex lens shape . this lens shape is known to be efficient in generating more steady oscillation , since spurious oscillation ( secondary vibration ) as the erroneous reaction for electronics does not appear . fig2 will show how the convex lens shape of the blank is formed . the polished quantity is proportional to the polishing pressure . the frame 102 of concave quartz blank 100 after the ion etching is strongly pressurized to be polished between the upper table 103 and lower table 104 , and the grooved part for oscillation is slightly impressed only by the lower table 104 . furthermore the polishing force at the central region of the concaved structure part 101 is weaker ( fig2 ( a )). therefore the polished mass is at minimum at the center of the concave part 101 , it becomes maximum at the frame part 102 , and the polished quantity among these parts changes with a curvature like a part of a sphere . as a consequence , the quartz oscillator was finished in the convex lens shape ( fig2 ( b )). the thickest central part of the lens is as thin as 10 μm . as understood from the above , the dual polishing machine cuts only 0 . 3 μm . this small amount of polishing enables the damaged layer to be removed and shaped in a convex lens shape . in other words , the chemical etching and dry etching process corresponds to the coarse machining , and the dual face polishing processing corresponds to the fine machining . the combination of these polishing processes in this invention makes the piezoelectric device thinner than the conventional one , and also the oscillation part in a convex lens shape makes it steady in electric vibration without the spurious one . this invention presents the manufacturing method of a high frequency quartz oscillator with an efficient combination of chemical wet etching ( abbreviated as chemical etching ), reactive ion etching ( rie ), inductive coupled plasma etching ( dry etching ) and mechanical polishing . as a result , we could manufacture the high frequency quartz oscillator in a piano - convex type with a general dual face polishing machine , when the quartz blank was in one step single - sided inverted mesa type . fig3 ( a ) illustrates a reactance - frequency characteristic example of quartz oscillator , which is made by rie and ion milling ( or plasma etching ). there exists the spurious peak near the primary peak at the resonance frequency . this is thought to be due to the ion damage of the dry etching process . after the dry etched surface was manually polished , the spurious peaks were removed as shown in fig3 ( b ), the electric property was improved . therefore the ion - damaged layer of the dry etching process was found to be extremely thin as 0 . 3 μm , and this could be removed by the mechanical polishing process . in order to mass - produce quartz blanks in one step single sided inverse mesa type by chemical etching , quartz wafers were masked and chemically etched . the shape is shown in fig4 ( a ). the oscillating part of a 73 . 4 μm thick quartz wafer was chemically etched down to 32 . 68 μm , and the depth of the etched pit was sufficiently deep with acceptable surface roughness . a reactance - frequency property of this quartz blank is seen in fig4 ( b ). this is similar to that of the dry etching process as shown in fig3 ( a ). in order to achieve higher frequency , the dry etching process of the mechanical polishing process with the dual face polishing machine was employed to decrease the thickness . here before the ion - damaged layer must be removed , the surface side of dry etching was selected to be the planar surface of quartz blank in single - sided inverse mesa type . this rie processing condition was the standard one . it is possible for the ion damage to be decreased by small rf power and high pressure . however this means a slower ion etching rate , and the first dry etching was performed in the high efficient mode , and the third one was performed in the low damage condition . by the way , the removed mass was controlled by the processing time of the first dry etching process . fig5 shows the reactance - frequency of the machined blank after the series of above processing . after performing these processes , four machined blanks were produced by one chemical etching and three dry etchings . fig6 shows the polishing condition and the mechanical polishing result . the quartz blank in a single - sided inverse mesa type with one step after the previous process was polished by the dual - face polishing machine . in this case , it was polished by the conventional processing condition . however two upper polishing plates were made from iron and aluminum to study the damage to the thin oscillation part and the effect of the shape . when the upper polishing plate is made from iron , the pressure to quartz is 1 . 8 times stronger than aluminum . when the mechanical polishing was executed with the dual face polishing machine , the blank could be machined without any fear of the first problem of breaking the thin oscillation part . the second target of forming the shape was successfully accomplished as shown in fig6 . this fig6 illustrates the measured result of the shape when the inference microscope was used to observe the flat surface of the quartz oscillation part in the single - sided inverse mesa type with one step . then the oscillation part was found to be protruding in a convex lens shape . this shape is apparently spherical , and the opposite side is basically planar . therefore , although the dual face polishing machine is designed to form a planar surface , this machine can make the single - sided convex quartz oscillator , when the polished material is a quartz blank of the single - sided inverse mesa type . the principle of this shaping mechanism is seen as follows . when the quartz blank in one step single - sided inverse mesa type with thin oscillation part is impressed with the polishing pressure , the thin part is distorted toward the cavity direction and this part cannot be substantially polished . after the polishing process is finished and the polishing pressure is relieved , the thin part ( which is distorted toward the pit ) rebounds to the opposite side , and this shape becomes the protruded lens shape . fig7 illustrates a characteristic diagram of acoustic reactance - frequency for four blanks and two machining pressures . the electric property ( a ) after the polishing process is remarkably improved compared to that ( b ) before the polishing process , and this can oscillate in a high frequency . the spurious resonance before the polishing process ( b ) is eliminated by the polishing process , and the sharp resonance curve is observed . however , if this thickness becomes too thin or the polishing pressure becomes too strong , the spurious resonance appears , although the primary peak remains . there exists an optimum pressure and an aperture / thickness ratio . fig8 illustrates the form and surface roughness as a function of the resonator thickness , i . e . the changing graph to show the level difference ( p - v ) between the peak and valley at the central oscillation part ( 1 . 44 × 1 . 31 mm ) versus the quartz resonator thickness . fig9 shows the inverse of finished curvature radius in convex lens shape as a function of the thickness . since fig8 is identical to fig9 in cases of the aluminum fixed table , but are different from the iron table , the shape is thought to be pure spherical for al and distorted one for fe . on the other hand , the concave curvature of the quartz oscillator increased when the thickness increased in one step single - sided inverse mesa type . this means the machining distortion rate when the convex lens shape was formed at the planar surface . the electric property will be improved when the optimum condition is chosen for the polishing and heat processing rates . fig1 shows the roughness at the concave central part versus the thickness . the free whetstone powder changes the roughness even where the polishing pad does not make contact . for the chemical etching process , the roughness was ra 2 . 6 nm , it deteriorated to ra 7 nm where the typical concave and convex stripes appeared due to the chemical polishing . this roughness will be relieved , when the ion damaged layer is cut by the mechanical polishing in 0 . 3 - 0 . 4 μm thickness , after the concave part ( one step single - sided inverse mesa type or one step double - sided inverse mesa type ) is formed by dry etching process . also fig1 shows that the property of a one step double - sided inverse mesa type was demonstrated to be improved by the dual - face polishing machine , same as the one step single - sided inverse mesa type , after the blank was processed by the dry etching . based on these results , the electrically high performance quartz oscillator was proved to be made above 334 mhz high frequency , when the aperture thickness ratio ( d / t ) was from 50 to 150 ( optimum 80 ). the following theme concerns the acousto - electric transducer as an application of the piezoelectric device of this invention . while a conventional detection and prediction of earthquake was executed by ocean observation , underground structure probe , earth magnetic observation , ground movement measurements between two points with gps and laser , and so forth , acoustic wave observation due to the earthquake and tsunami will be one of these detection and prediction . a focused microphone can transform the acoustic wave to an electric signal , which is convenient to record and analyze , but it is difficult to detect the acoustic wave at the specific frequency due to the picking up of noises . fig1 from ( a ) to ( e ) illustrate variously executed examples of acousto - electric transducer of piezoelectric device in this invention . in fig1 , cylinders 21 and 54 are made from piezoelectric material of mono - crystalline such as quartz and lithium niobium oxide or other ceramics as such barium titan oxide . in fig1 a pressure receiver 22 is located at the center of cylinders 21 and 54 , two electrodes 23 and 24 are vaporized by metal on the pressure receiver , gold lead wires 26 are pasted to electrodes 23 and 24 by electrically conductive adhesive , and the amplifier is connected between electrodes 23 and 24 to measure the inductive voltage . ( electrodes 23 , 24 and amplifier 25 are illustrated only in fig1 ( a ).) fig1 ( a ) is bi - convex type , ( b ) is bi - concave type , ( c ) is planar , ( d ) is convex - concave type , and ( e ) is plano - convex type . as seen fig1 ( a ), rooms a and b are formed by two plugs 55 , which seal the inside of cylinder 21 , and seal the inside of cylinder 54 , respectively . both rooms a and b are de - pressurized ( if possible vacuum or inert gas filling ), and both cylinders 21 and 54 catch acoustic waves along parallel and vertical axes . this structure allows the pressure receiver 22 to catch signal intensively compared to the case without cylinders 21 and 54 . then we made the precise pressuresensor , since the pressure receiver 22 can easily hear the external vibration with slender cylinders 21 and 54 . when the cylinders are not evacuated , the cylinders must be filled with inert gas . fig1 shows the upper surface diagram of the acousto - electric transducer in fig1 ( a ) and ( b ), the hole or space part 47 is formed at the pressure plate 22 . then the vibration at the left cylinder 21 and right cylinder 54 moves freely from part a to b and vice versa , and the vibration at a resonates with b at the central part . consequently the pressure receiver 22 at the central part vibrates more strongly , when there is a hole or space 47 . by the way there exists a specific good case without the hole or space 47 . in this paragraph , the method , which was proposed in the previous invention by the present applicant , is described to explain the mechanical formation of the pressure receiver 22 . in the fundamental method , the circular rod 30 , which is made from a piezoelectric material such as quartz , barium titan oxide , lithium niobium or other ceramics and so on as shown in fig1 , is held by a chuck 31 of a polishing machine such as a lathe . the tool holder 34 , which has a freely rotating whetstone with diamond powder on the surface , is fixed by the tool holder 34 . the whetstone 32 is spherical to be cut at the opposite side as seen in fig1 , and this is freely rotatably held by the axis holder 36 at the tip of the holding arm 35 . at the outer part of the whetstone 32 , there are v shape grooves 32 a as shown in fig1 ( a ) and the enlarged diagram of fig1 ( b ) taken along section line a - a , one inner wall of groove 32 a is directional to the surface at the central part . the whetstone 32 is rotated at high speed by an air jet stream , which is generated by an air nozzle 40 , that is disposed in a tangential direction ( preferably 8 ˜ 50 rpm ), and the polished blank is slowly cut ( for example 1 μm / min ). during the polishing time , a jet nozzle 41 ejects water , cools the whetstone 32 , and wipes out the polished waste . when the whetstone 32 is rotated , the circular rod 30 is rotated around the axis as shown in fig1 , and it becomes circular or a circular hole is formed by the whetstone 32 . also when the polishing surface of pressured surface 22 is convex as shown in fig1 , a dram type whetstone 32 ′ is used as seen in fig1 (( a ) is the front view and ( b ) is the plan view ). when the polishing surface of pressured surface 22 is flat , a flat type whetstone 32 ″ is used as seen in fig1 ( c ). otherwise , the whetstone 32 , which is much smaller than the hole diameter as shown in fig1 , rotates along the curved surface of pressured surface 22 with the same machining tool 33 in fig1 of nc machine . at the same time , a chuck 31 rotates and polishes the pressured surface with a circular rod 30 . also the tool to make the hole or space part 47 is a whetstone 32 ″ in fig1 ( d ), which does not cut the holding part 47 and machines the hole or space part 47 . of course the tool to make the hole or space part 47 can be a conventional drill , which is electrically gilt by diamonds . also the circular hole of the machining tool can be the usual rotating one around the axis , for example , a spherical whetstone as shown in fig1 or a disk type one as shown in fig2 . after the whetstone 32 has completed the coarse machining , the polishing whetstone 32 ″ ( instead of the whetstone 32 ), which is made from felt or buff and so forth , can do the fine lapping process . this whetstone 32 ″″ of felt or buff with grooves 32 a can be rotated an by air jet stream , which is generated by air nozzle 40 as with the whetstone 32 , and it can easily perform the polishing step . fig2 and 22 illustrate manufacturing charts of the cutting and polishing machines which structure is shown in fig1 . the diameter of whetstone 32 is 20 mm , and the depth of grooves 32 ( a ) are 1 mm . the following measured figures are the rotation number of whetstone 32 and air pressure , when the air nozzle 40 of a cutting and polishing machine with 16 grooves ejects air directed tangentially at the periphery of whetstone 40 . { circumflex over ( 1 )} air pressure is 0 . 5 atmosphere , and rotation of whetstone 32 is about 12 , 200 rpm . { circumflex over ( 2 )} air pressure is 1 . 0 atmosphere , and rotation of whetstone 32 is about 22 , 000 rpm . { circumflex over ( 3 )} air pressure is 2 . 0 atmosphere , and rotation of whetstone 32 is about 37 , 500 rpm . { circumflex over ( 4 )} air pressure is 3 . 0 atmosphere , and rotation of whetstone 32 is about 47 , 800 rpm . { circumflex over ( 5 )} air pressure is 4 . 0 atmosphere , and rotation of whetstone 32 is about 50 , 000 rpm , which is the bearing limitation . also , instead of the cutting whetstone 32 the cutting and polishing machine in fig2 and 22 , we can use the polishing whetstone shown in fig1 ( e ), which is made from iron , aluminum , metal as cupper , buff , felt , glass , plastics , ceramics or others . the machining method shown in fig1 , which uses polishing whetstone 32 ″″ and a polishing agent such as diamond paste , cerium oxide , alumina , gc or others , can cut and polish piezoelectric material such as quartz in various shapes as shown in fig1 at the same time . it is the reason for the polishing machine to cut and polish at the same time , since the whetstone 32 ″″ in fig1 ( e ) can easily rotate up to 50 , 000 rpm at the bearing limit . as this can be efficiently done only with the polishing process , this method , which uses this polishing whetstone 32 ″″ of felt , buff , iron , or others , can cut and polish piezoelectric material such as extremely thin quartz at the same time . the above paragraph explains the manufacturing method , which was previously invented by us , and the following introduces newly invented acousto - electric transducer . initially , we will explain the method of forming the convex lens type pressure receiver 22 ( oscillation surface ) in fig2 at the center of piezoelectric material in a hollow cylindrical shape in as shown fig1 ( a ). ( a ) the first product , the target of which is to form the convex lens shape 20 a , is made from both ends of cylindrical piezoelectric material 20 by means of mechanical polishing , etching process , or the like . ( b ) only a cylindrical part of the first product in the convex lens shape is processed by the dry etching process ( rie or cip process ), other parts are not etched . this process can be executed by setting the ring mask , which is made from glass , quartz , tungsten , nickel , pure iron , plastic or other materials , on the end of the cylindrical piezoelectric material 20 . ( c ) this process continues to the central part of the piezoelectric material 20 as shown in fig2 ( c ). ( d ) after the dry etching process reaches the predetermined length at the central part , the same dry etching process is undertook from the opposite surface . in practice , this is done by inverting the piezoelectric material 20 , not by moving the dry etching machine . ( e ) as shown in fig2 ( e ), after the convex lens shape is formed at the central part of piezoelectric material 20 , the ion - damaged layer , which is generated by the dry etching process in 0 . 2 μm - 0 . 3 μm depth , is removed by the mechanical polishing method . then we have the oscillator ( resonator ) with electrically excellent performance , since the lens shape of ring support type is formed at the cylindrical central part as shown in fig2 ( f ). fig2 illustrates the machining stage to process the pressure receiver ( oscillating surface ), of which one side is in a convex lens shape and the other side is flat . fig2 illustrates the machining stage to process the pressure receiver ( oscillating surface ), of which one side is in a convex lens shape and the other side is concave . fig2 illustrates the machining stage to process the pressure receiver ( oscillating surface ), of which both sides are flat fig2 illustrates another machining process for forming a hollow cylindrical oscillator . the successive engineering stages is described as follows . ( a ) the first product , the target of which is to form the convex lens shape 20 a , is made from both ends of cylindrical piezoelectric material 20 by means of mechanical polishing , etching process , or the like . ( b ) only a cylindrical part of the first product in the convex lens shape is processed by the dry etching ( rie or cip process ), other parts are not etched . this process can be executed by setting a hollow cylinder 52 , which is smaller than the material 20 and made from glass , quartz , tungsten , nickel , pure iron , plastic , or other material , on the end of the cylindrical piezoelectric material 20 . then the dry etching process is simultaneously performed at the inner and outer surfaces of piezoelectric hollow cylinder 52 . at the same time , the end surface of the cylinder 52 is shaven . ( c ) this process continues to the central part of the piezoelectric material 20 as shown in fig2 ( c ). ( d ) after the dry etching process reaches the predetermined length of the central part , the same dry etching process is undertook from the opposite surface . in practice , this is done by inverting the piezoelectric material 20 , not by moving the dry etching machine . ( e ) as shown in fig2 ( e ), after the convex lens shape is formed at the central part of piezoelectric material 20 , the ion - damaged layer , which is generated by the dry etching process in 0 . 2 μm ˜ 0 . 3 μm depth , is removed by the mechanical polishing method . then we have the oscillator ( resonator ) with electrically excellent performance , since the lens shape of ring support type is formed at the cylindrical central part , and a lens shape shown in fig2 ( f ) is formed at the central part of hollow cylinder , we get the oscillator ( resonator ), which contains the holding part in a ring - support shape and is electrically excellent . although fig2 shows the example of producing the bi - convex lens shape , other shapes of the oscillator in those arbitrary shapes can be made also by processing to maintain the initial shape . the following paragraph introduces a processing method to make the convex lens shape oscillator ( resonator ), which is connected to an extremely thin connector . fig2 and 29 show the processing method , and this is explained as follows . ( 1 ) the first product , the target of which is to form the convex lens shape 20 a , is made from both ends of a thick piezoelectric plate 20 by means of mechanical polishing , etching process , or the like . ( 2 ) only a cylindrical part of the first product in the convex lens shape is processed by the dry etching process , as other parts are not etched . this process can be executed by setting a hollow cylindrical auxiliary tool 50 ( on the top of the first product ), which is smaller than the hollow cylinder 20 and made from glass , quartz , tungsten , nickel , pure iron , plastic or other material , and the surface of the tool 50 and the both ends are shaven by the dry etching process at the same time or successively ( step one end in this sample ). then , after the convex lens shape is formed at the central part of piezoelectric material 20 , the ion - damaged layer , which is generated by the dry etching process in 0 . 2 μm ˜ 0 . 3 μm depth , is removed by the mechanical polishing method . then we have the oscillator with electrically excellent performance , since the lens shape of ring support type is formed at the cylindrical central part , and a lens shape in fig2 ( f ) is formed at the central part of hollow cylinder , we get the oscillator ( resonator ), which outer surface is in a ring - support shape with the holding part . although fig2 and 29 show the example of producing the convex lens shape , other shapes of the oscillator ( resonator ) in piano - convex , bi - convex , concavo - convex , or other arbitrary shapes , can be made also by processing to maintain the initial shape , when both surfaces of the piezoelectric material 20 are machined in flat , concave or other shapes . fig2 illustrates another process to make the convex lens shape oscillation part ( resonation part ) with a very thin connector in the ring shape holder . this is described step by step as follows . ( 1 ) at both ends of the piezoelectric disk , a convex lens type auxiliary blank 51 is pressingly set by using the mechanical polishing process , press formation ( to make lens ), etching process , or other means . otherwise , the auxiliary blank 51 is pasted on the piezoelectric material 20 by using resist ( for instance ospr resist made in tokyo ohka kogyo ltd .) or other adhesives . here the material of the auxiliary blank 51 is glass , optical glass , lens , quartz , tungsten , nickel , pure iron , plastics , or other material . ( 2 ) only the convex lens shape part of auxiliary blank 51 is dry etched , a hollow cylindrical auxiliary tool 50 , which is made from glass , optical glass , lens , quartz , tungsten , nickel , pure iron , plastics or other material , is set on the top of the auxiliary blank 51 , in order not to etch other part of the convex lens shape . and the surface of auxiliary tool 50 is homogeneously shaven by dry etching process at the same time . then the surface of blank 51 is etched at first , next the surface of piezoelectric material 20 is shaven , and an ultra thin convex lens shape is formed at the central part in hollow cylindrical shape . after the mechanical lapping process removes the 0 . 2 μm ˜ 0 . 3 μm ion - damaged layer , which is followed by the dry etching , and finally formed is the electrically excellent oscillator , which has the lens shape in the hollow cylindrical central part and the ring - support type holder at the outer part . fig3 shows the auxiliary blank 51 , which is made by a pressing process or others in the lens shape at the hollow cylindrical central part and the ring - support type holder , and this is different from fig2 and 29 . quartz oscillators , which have the lens shape in the hollow cylindrical central part and also have the ring - support type holder at the outer part as shown in fig3 ( f ), can be conveniently made without using the auxiliary tool 50 , which is made from glass , optical glass , lens , quartz , tungsten , nickel , pure iron , plastics , or other materials . the material of the auxiliary blank 51 can be made from glass , optical glass , lens , quartz , tungsten , nickel , pure iron , plastics or others , however the best material is quartz glass similar to quartz crystal to press the auxiliary blank 51 , but other material is to be useful . in fig3 the convex lens auxiliary blank 51 is set by pressing on both sides of piezoelectric material 20 or pasted by resist adhesives and dry etched , however other arbitrary shapes such as plano - convex , bi - flat , concavo - convex , bi - convex are to be made by processing the auxiliary blank 51 in convex lens , concave lens or other shapes and by decreasing the thickness of the initial shape by the dry etching process . electrodes 23 and 24 in fig3 are made by vapor depositing al , ag , au and so forth on both sides of the oscillator ( resonator ), which is made by the above process . also , the ultra slender gold wire 26 ( for example 18 μm ) is pasted to the electrode with a bonding machine or electrically conductive adhesive . usually the electrode and lead wire are made by vaporization only , however the electrode only is vaporized and afterwards the gold wire is pasted to the electrode , since the electrode and lead wire cannot be made solely by the vaporization when the diameter of the hollow cylinder is very small and slender . other examples are illustrated in fig3 , 33 , 34 and 35 . in order to mass produce quartz blanks in two steps double - sided grooved type by the chemical wet etching and dry etching process , the quartz wafer is masked and etched by the wet or dry process in these cases . these shapes are shown in fig3 ( a ), 33 , 34 ( a ) and 35 ( a ). in these examples , an 80 μm thick quartz wafer is masked as the first step , then the oscillation part is processed in every 25 μm from both sides of the quartz wafer by chemical etching or dry etching as shown in fig3 ( b ), 33 ( b ), 34 ( b ) and 35 ( b ), and the thickness of oscillation part becomes 30 μm after these etching processes . then , the quartz wafer an masked as the second step , the 30 μm oscillation part is processed in every 13 μm from both sides by chemical etching or dry etching as shown in fig3 ( c ), 33 ( c ), 34 ( c ) and 35 ( c ), and the thickness of the oscillation part becomes 4 μm after these etching processes . like the circle shapes shown in fig3 ( a ) and 33 ( a ), hexagonal shape shown in fig3 ( a ), square shape shown in fig3 ( a ), or other quartz wafer shapes can be masked as the first step so as to be 30 μm thick of the oscillation part by the chemical etching or dry etching . as the second masking process shown in fig3 ( c ), 33 ( c ), 34 ( c ), and 35 ( c ), the thickness of the oscillation part is processed in order to be 4 μm . { circumflex over ( 1 )} although the outer shape is square or rectangular , the shape of the oscillation part becomes pure circular or circle , which is electrically excellent . { circumflex over ( 2 )} as shown in fig3 and 33 , when the outer shape of quartz blank is square or rectangular , and the shape of the oscillation part is purely circular or in circle , it becomes difficult for the crystal orientation to be seen , since the crystal orientation has no mark . then the crystal orientation is marked by etching in a specific shape as shown in fig3 ( a ) and fig3 ( a ), when the shape of the oscillation part is processed to be circular . { circumflex over ( 3 )} as shown in fig3 , 33 , 34 and 35 , when the outer shape of quartz blank is square , mass production becomes easy compared to the circular case , because the cutting is conveniently done . { circumflex over ( 4 )} the outer shape of the quartz blank can be square , however the electric property of quartz oscillator becomes more excellent , when the shape of oscillation part is purely circular or in circle . { circumflex over ( 5 )} as shown in fig3 ( c ), 33 ( c ), 34 ( c ), and 35 ( c ), the ratio of diameter over the thickness ( d / t ) is to be approximately 80 and the optimum diameter of the oscillation part is 4 μm × 80 = 0 . 32 mm in order to get the best electric performance , when the oscillation part is 4 μm thick . when the initial quartz blank is 80 μm thick and the oscillation diameter is 0 . 32 mm , it is impossible for the circular oscillation part to be processed down to 4 μm thick by only one masking after the chemical etching of 76 μm . when the diameter of oscillation part becomes as small as 0 . 32 mm , the chemical etching cannot be homogeneously processed due to the surface tension of solution as hydrogen fluoride and the crystalline anisotropy . when the chemical etching is successively processed more than two times , it become possible for the blank of the small diameter less than 0 . 32 mm to be shaved . { circumflex over ( 6 )} in the case of the dry etching process , there exists no problem for the diameter of the oscillation part to be as small as 0 . 32 mm . { circumflex over ( 7 )} when this is in two steps wise shape and the thickness is decreased step by step , the mechanical polishing process can easily remove the damaged layer , which is generated during the chemical or dry etching . fig3 , 37 , 38 , and 39 illustrate quartz blank samples of a two stepped single - sided concave shape , which are different from those in fig3 , 33 , 34 and 35 . in these examples , the quartz wafer is masked and processed by chemical and dry etching to produce massively . these shapes are illustrated in fig3 ( a ), 37 ( a ), 38 ( a ), and 39 ( a ). initially , an 80 μm thick quartz wafer is masked in the first stage , and one side of the wafer is shaved by 60 μm by chemical etching and dry etching as shown in fig3 ( b ), 37 ( b ), 38 ( b ), and 39 ( b ), and the thickness becomes 20 μm . then the 20 μm wafer is masked in the second stage , and it is shaved in 16 μm by chemical etching and dry etching as shown in fig3 ( c ), 37 ( c ), 38 ( c ), and 39 ( c ), and the thickness finally becomes 4 μm . these processes serve to reduce the oscillation part to 4 μm , and have the following merits in addition to those shown in fig3 , 33 , 34 and 35 . { circumflex over ( 1 )} after this is masked twice or more than two times to make the aperture ratio larger , processed by chemical etching and dry chemical etching , and then mechanically polished as shown in fig2 ( a ), the aperture ratio ( d / t ) becomes approximately 80 and the electrical property is at an optimum . fig3 ( c ) illustrates the cross section , and this structure is concave in order to widen the pressure distribution . this concave structure is not plano - convex with a larger curvature , it really becomes like a convex lens similar to concavo - convex or bi - convex shape , which electric property is ideal , and we complete the ultra thin quartz oscillator less than 0 . 5 μm . for example of bt - cut , the primary frequency of fundamental wave becomes approximately 5 . 0 ghz . also , it is possible to use other materials such as at - cut , sc - cut , fc - cut , it - cut , and other cuts . { circumflex over ( 2 )} when the outer region of oscillation part is structured so as to be another concave shape or stepwise , this electrode can be easily made , even if the target diameter of the oscillation part is extremely small . { circumflex over ( 3 )} after the chemical etching and dry etching processes are completed , the polishing process to remove the ion damaged layer ( changed layer due to the process ) is conveniently executed , since the thickness of quartz blank is , step by step , decreasing toward the center . fig4 , 41 , 42 , and 43 illustrate the manufacturing method of a quartz oscillator in a two - stepped single sided concave shape . as shown in fig4 ( b ), 41 ( b ), 42 ( b ), and 43 ( b ), one surface of 80 μm thick quartz wafer is masked as the first stage , and one side of the wafer , which diameter is 0 . 32 mm and pure circular ( otherwise circular , square , hexagonal or other shape ), is shaved 16 μm by chemical etching and dry etching . then the quartz wafer is masked in the second stage , one side of wafer is shaved 60 μm by chemical etching and dry etching as shown in fig4 ( c ), 41 ( c ), 42 ( c ), and 43 ( c ), where the diameter is 1 . 6 mm and the shape is circular , square , hexagonal or others , and the thickness becomes 4 μm and the diameter of the oscillation part is 0 . 32 mm . also , the mechanically polished shape as shown in fig4 ( c ), 41 ( c ), 42 ( c ), and 43 ( c ) can remarkably improve the electrical performance , after the chemical etching and dry etching processes are done and the polishing process to remove the ion damaged layer due to the etching is properly executed . fig4 , 45 , 46 , and 47 illustrate manufacturing processes of quartz oscillators in two steps double - sided grooved types . as shown in fig4 ( b ), 45 ( b ), 46 ( b ) and 47 ( b ), one surface of 80 μm thick quartz wafer is masked in the first stage , and one side of the wafer , which diameter is 0 . 32 mm and pure circular ( otherwise nearly circular ), is shaved 12 μm by chemical etching and dry etching . then the quartz wafer is masked in the second stage , and both sides of the wafer are shaved 26 μm by chemical etching and dry etching as shown in fig4 ( c ), 45 ( c ), 46 ( c ), and 47 ( c ), where the diameter is 1 . 6 mm and the shape is circular , square , hexagonal , or others . the thickness becomes 4 u m and the diameter of the oscillation part is 0 . 32 mm . fig4 illustrates an optimum dimension diagram , in which the oscillation part becomes 0 . 8 μm . in the case of at - cut , the 0 . 8 μm thickness of the oscillation part means to complete a quartz oscillator of 2 . 1 ghz approximately . then the next hand phone will becomes extremely small . the oscillation part becomes the shape as shown in fig4 ( c ), 45 ( c ), 46 ( c ), 47 ( c ), and 48 ( c ), after the chemical etching , dry etching and mechanical polishing process by a dual - face polishing machine ( polishing table ) and other polishing means to remove the damaged layer due to the etching . in this case , since the oscillation part of the quartz blank becomes stepwise and the oscillating diameter is large as illustrated in fig4 ( c ), 45 ( c ), 46 ( c ), 47 and 48 ( c ), the polishing agent such as cerium oxide can smoothly penetrate from both sides during the polishing process by the polishing table , barrel polishing machine , or ultrasonic polishing method . therefore , the mechanical polishing process becomes efficient , and the electric performance of the quartz oscillator becomes ideal . { circumflex over ( 1 )} from the result of the examination , when a single - sided grooved type oscillator with two steps is processed to be piano - convex shape , the optimum aperture ratio ( d / t ) is approximately 80 . { circumflex over ( 2 )} the dimension of the blank is bigger than 1 inch × 1 inch , and the thickness becomes larger than 80 μm . { circumflex over ( 3 )} the quartz crystal is anisotropy , and the anisotropy appears when the chemical etching shaves more deeply than 1 / 20 of the oscillation diameter . in order to clear these three problems , two chemical etching processes in fig4 , 50 , 51 , 52 , and 53 are employed by the relative etching process . at first , the central oscillation part with a small diameter is etched , and secondly , the second oscillation part ( the second groove ) with larger diameter is etched . fig4 , 50 , 51 , 52 , and 53 illustrate shapes and dimensions that satisfy the above conditions . when the quartz oscillator in a two - stepped single - sided concave shape is made by a pressurized polishing process from both sides with the dual - face polishing machine or a one - face polishing process , the planar surface which is at the opposite side of the chemical etching becomes a convex lens shape nearly as piano - convex , concavo - convex , or bi - convex , which is ideal for the electric performance . fig5 and 56 illustrate the first shape example of two steps single - sided concave quartz oscillator , which were measured by an interference microscope , after the oscillator was made on the basis of the manufacturing diagram in fig5 . when the peak to valley of the surface profile is shown in fig5 and 56 , the surface is manufactured to be as accurate as approximately 0 . 002 μm roughness . also , the shape accuracy is made to be almost purely circular . furthermore , measured data in fig5 shows that the parallel accuracy is around 0 . 02 μm thick at the center of the first oscillation part , however this does not affect the electrical performance of the quartz oscillator . fig5 shows the first photo sample ( normanski microgram ) of two steps single - sided grooved type quartz oscillator in fig5 and 56 . based on the photograph in fig5 , the quartz anisotropy is said not to be observed . fig5 shows the changing state to the convex lens shape of the first oscillation part in fig5 ( c ), wherein the quartz oscillator in fig5 ( c ) is made by pressurizing from both sides . fig6 and 61 illustrate the second upper surface shape example of two steps single - sided grooved type quartz oscillator , which were measured by an interference microscope , after the oscillator was made on the basis of the manufacturing diagram in fig5 . when the peak to valley of the surface profile is shown in fig6 and 61 , the surface is manufactured to be as accurate as approximately 0 . 003 μm roughness similar to fig5 and 56 . also the shape accuracy is made to be almost purely circular . furthermore , the measured data in fig6 shows that the parallel accuracy is around 0 . 02 μm thick at the oscillation part , which is the same as in fig5 , however this inversely affects the better electrical performance of a quartz oscillator due to the bi - convex shape . fig6 shows the second photo sample ( normanski microgram ) of the two - stepped single - sided grooved type quartz oscillator in fig6 and 61 . based on this photograph in fig6 , the quartz anisotropy is not observed , which is the same as the first photo sample in fig5 . fig6 shows the changing state to the convex lens shape of the first oscillation part in fig6 ( c ), when the quartz oscillator in fig5 ( c ) is made by pressurizing from both sides . fig6 and 66 illustrate the second upper surface shape example of two steps double - sided grooved type quartz oscillator , which were measured by an interference microscope , after the oscillator was made on the basis of the manufacturing diagram in fig6 . when the peak to valley of the surface profile is shown in fig6 and 66 , the surface is manufactured in order to be as accurate as approximately 0 . 003 μm roughness similar to fig5 and 56 . also the shape accuracy is made to be almost purely circular . furthermore , the measured data in fig6 shows that the parallel accuracy is around 0 . 02 μm thick at the oscillation part , which is the same as in fig5 , however this inversely affects the better electrical performance of quartz oscillator due to the bi - convex shape . fig6 and 68 illustrate the third shape example of two steps double - sided grooved type quartz oscillator , whose rear surfaces were measured by an interference microscope . when the peak to valley of surface profile is seen in fig6 and 68 , the rear surface is manufactured to be as accurate as approximately 0 . 004 μm roughness similar to fig5 and 56 . also the shape accuracy is made to be almost purely circular . furthermore , the measured data in fig6 shows that the parallel accuracy is around 0 . 02 μm thick at the oscillation part , which is the same as in fig6 . fig6 shows the third photo sample ( normanski microgram ) of two steps double - sided grooved type quartz oscillator in fig6 and 66 . based on the photograph in fig6 , the quartz anisotropy is not observed as in fig5 . fig7 illustrates the fourth example of two steps double - sided grooved type quartz oscillator surface , which was made by the manufacturing diagram in fig7 and the front surface was measured by an interference microscope . when the peak to valley of the surface profile is seen in fig7 , the front surface is manufactured so as not to be as accurate as approximately 1 . 0 μm roughness , which is quite different from fig5 and 56 . also the shape accuracy is made to be distorted and not to be circular fig7 illustrates the fourth example of two steps double - sided grooved type quartz oscillator surface , which was made by the manufacturing diagram in fig7 and the rear surface was measured by an interference microscope . when the peak to valley of surface profile is seen in fig7 , the front surface is manufactured to be worse than approximately 2 . 0 μm roughness , which is quite different from fig5 and 56 . also the shape accuracy is made to be distorted and nearly elliptic similar to fig7 . fig7 and 74 show the fourth photo samples ( normanski microgram of front and rear surfaces ) of two steps single - sided grooved type quartz oscillator in fig7 and 72 . based on the photographs in fig7 and 74 , the front and rear surfaces are made to be distorted and nearly elliptic due to the anisotropy , and these are quite different from that in fig5 . fig7 illustrates the fifth surface example of two steps double - sided grooved type quartz oscillator , which was made by the manufacturing diagram in fig7 and the rear surface was measured by an interference microscope . when the peak to valley of surface profile is seen in fig7 , the surface is manufactured to be worse as unobservable , which is quite different from fig5 and 56 . also the shape accuracy is made to be much more distorted and worse elliptic than the fourth case in fig7 and 72 . fig7 shows the fifth photo sample ( normanski microgram ) of two steps single - sided grooved type quartz oscillator in fig7 . based on the photograph in fig7 , the surface is made to be distorted and nearly elliptic due to the anisotropy , and this is quite different from that in fig5 . fig7 and 79 show the sixth shape diagram of the conventional quartz oscillator front surface in one step double - sided inverse mesa type , which is approximately 5 μm thick and made by hoffman inc . in the usa . the peak to valley of the shape diagram in fig7 and 79 is approximately 0 . 008 μm , however the surface accuracy is worse than that of the two - stepped grooved type in fig5 , 61 , 66 , and 68 . also the large wave is observed on the surface of the oscillation part . fig8 and 81 show the sixth rear surface shape diagram of one step double - sided inverse mesa type conventional quartz oscillator , which is approximately 5 μm thick as seen in fig7 and 79 . the peak to valley of the rear shape diagram is approximately 0 . 025 μm and worse than the front surface in fig7 and 79 . furthermore the surface accuracy is ten times worse than that of two steps concave type in fig5 , 61 , 66 , and 68 . also the large wave is observed on the surface of the oscillation part . therefore , the surface accuracy and parallel accuracy of the two steps grooved type are found to be better than those of one step inverse mesa type . fig8 shows a surface photo ( normanski microgram ) of the sixth manufactured sample in double - sided inverse mesa type seen in fig7 and 79 . { circumflex over ( 1 )} as demonstrated in the above examples , there exists no anisotropy of quartz oscillators in every case of the first manufactured sample of two steps single - sided grooved type in fig5 and 56 , the second sample of two steps single - sided grooved type in fig6 and 61 , and the third sample of two steps double - sided grooved type in fig6 and 66 . { circumflex over ( 2 )} the surface accuracy and shape accuracy of the fourth quartz oscillator sample in steps double - sided grooved type in fig7 and of the fifth quartz oscillator sample in steps single - sided grooved type in fig7 are measured to be worse than those of the first , second , and third samples . this is found to be due to the quartz anisotropy . { circumflex over ( 3 )} it is found to be the reason for the quartz anisotropy of first , second , and third samples not to observed ( not for the fourth and fifth samples ), why the larger diameter oscillation part ( the second oscillation part ) of the first , second , and third samples in fig5 , 59 , and 64 are chemically etched at first , and the smaller first oscillation part is done secondly , and why the smaller diameter oscillation part ( the first oscillation part ) of the fourth and fifth samples in fig7 and 75 are chemically etched at first , and the larger second oscillation part is done secondly ( these are etched relatively at the same time ). { circumflex over ( 4 )} the first , second , and third samples are proved to be machined in ultra fine accuracy , the fourth and fifth samples are not , however the latter devices can be used as the lower grade quartz oscillator . on the contrary , the first , second , and third oscillators show more than one hundred times better accuracy compared to the fourth and fifth cases . therefore the former three manufacturing methods should be utilized for the ultra accurate quartz oscillator as shown in fig5 , 59 , and 64 . the following paragraph shows the frequency , wave shape and resonance characteristics of quartz oscillator in two steps shape . { circumflex over ( 1 )} fig8 , 84 , 85 and 86 show measured resonance characteristics of the second quartz oscillator in two steps single - sided grooved type in fig5 , 64 , and 70 , and of the third and fourth ones in two steps double - sided grooved type . { circumflex over ( 2 )} resonance characteristics in fig8 , 84 , 85 , and 86 are measured at the first oscillation part in fig5 ( c ), 64 ( c ) and 70 ( c ), not at the larger second grooved region ( second oscillation part ) in fig5 ( b ), 64 ( b ) and 70 ( b ). { circumflex over ( 3 )} fig8 and 84 are measured resonance characteristics of the second quartz oscillator example , which are made based on the diagrams in fig5 for two steps single - sided grooved type . when a material blank is at - cut , it is thought to be the most excellent electrical performance in the world at present for the resonant point at 184 . 872 mhz in fig8 and 181 . 232 mhz in fig8 to see the resonance characteristics in fig8 and 84 . { circumflex over ( 4 )} fig8 shows measured resonance characteristics of the fourth quartz oscillator example , which is made based on the diagram in fig7 for two steps double - sided grooved type . when the material blank is at - cut , it is thought to be the most excellent electrical performance in the world at present for the resonant point at 257 . 369 mhz to see the resonance characteristics in fig8 . { circumflex over ( 5 )} fig8 shows measured resonance characteristics of the third quartz oscillator example , which is made based on the diagram in fig6 for two steps double - sided grooved type . it is thought to be the most excellent electrical performance in the world at present for the resonant point at 283 . 178 mhz to see the resonance characteristics in fig8 . { circumflex over ( 6 )} fig8 is measured resonance characteristics of the sixth quartz oscillator example , which is made by hoffman inc . in usa for one step double - sided inverse mesa type and oscillation part is approximately 5 u m . { circumflex over ( 7 )} when the resonance property of one step double - sided inverse mesa type in fig8 is compared both to those of two steps single - sided grooved type in fig8 and 84 and to two steps double - sided grooved type in fig8 and 86 , the electrical resonance characteristics in fig8 , 84 , 85 , and 86 is much better than that in fig8 , although these frequencies are slightly different . { circumflex over ( 8 )} it is thought to be due to the present two steps grooved shape for electrical resonance characteristics of two steps single - sided grooved type in fig8 and 84 and of two steps double - sided grooved type in fig8 and 86 , to be much better than that of hoffman &# 39 ; s resonator in one step inverse mesa type in fig8 . { circumflex over ( 9 )} the large area of the second grooved part ( second oscillation part ) in two steps grooved stereo type in fig5 ( b ), 64 ( b ), and 70 ( c ) is not vibrated , the first oscillation part in very small diameter is only vibrated , and the first oscillation part is demonstrated to contribute solely for the electrical resonance . { circumflex over ( 10 )} the above discovery implies that the ultra high frequency resonance over 160 ghz primary wave ( approximately 0 . 015 μm thick ), with bt - cut , for example , can be oscillated in near future , and that it can be possible for electrically ideal quartz oscillator to be made in concavo - convex lens shape rather than in two steps single - grooved plano - convex type . fig8 and 89 show dimensional manufacturing drawings of quartz oscillators in three steps single - sided grooved type . when these quartz oscillators in three steps single - sided grooved type are compared to those in two steps single - sided grooved type , electric characteristics of the former are found to be better than those of the latter . the reason is due to the three step stereo structure and the efficient energy utilization . the quartz oscillator in fig8 is nearly an eight - sided polygonal shape at the first oscillation part and circular at the second and third oscillation part , on the other hand , the quartz oscillator in fig8 is nearly an eight - sided polygonal shape at the second oscillation part similar to the first part . fig9 and 91 show dimensional manufacturing drawings of quartz oscillators in three steps double - sided grooved type . when these quartz oscillators in three steps double - sided grooved type are compared to those in two steps double - sided grooved type , electric characteristics of the former are found to be much better than those of the latter . the reason is due to the three step stereo structure and the efficient energy utilization . the quartz oscillator in fig9 is nearly an eight - sided polygonal shape at the first oscillation part and circular at the second and third oscillation part . on the other hand , the quartz oscillator in fig9 is nearly an eight - sided polygonal shape at the second oscillation part similar to the first part . fig9 illustrates the mechanical polishing example , where quartz oscillator in the three - stepped single - sided grooved type in fig8 ( f ) is machined by pressurizing from the upper and lower tables of a dual - face polishing machine ( polishing table ). this polishing process can make three steps single - sided quartz oscillator , whose shape is approximately equal to concavo - convex in fig9 ( f ) rather than single - sided convex . the reason to become nearly concavo - convex lens shape in fig9 ( f ) is that the quartz oscillator in the parallel plate type has poor electrical resonance with spurious oscillations , since the high frequency quartz resonator becomes extremely thin and the parallel accuracy allowance is very severe . on the other hand , the quartz resonator in convex lens shape shows excellent electrical performance , since the parallel accuracy allowance is not so sever as that of the parallel plate . fig9 and 95 show measured surface shapes of the second quartz oscillator example in two steps single - sided grooved type , which is made by the manufacture diagram in fig5 after pressurizing between upper and lower tables of a dual - face polishing machine ( polishing table ) as seen in fig6 , 61 , and 62 . the single - sided grooved type is seen as the second manufactured examples in fig5 and 60 , the seventh one in fig9 and the eighth in fig9 . however the interference stripes ( newton rings ) were observed both in the seventh example in fig9 and the eighth one in fig9 , which are machined by the polishing table . the difference between the seventh case and eighth case is that the seventh example in fig9 is polished during 30 minutes , and the eighth one in fig9 is polished during 60 minutes . the seventh example becomes concavo - convex in fig6 ( c ), and the shape of the originally planar surface is slightly 1 . 25 μm convex toward the lower direction . the eighth example also becomes concavo - convex in fig6 ( c ), and the shape of the originally planar surface is measured to be 3 . 5 μm convex toward the lower direction by the interference microscope . therefore , the protruding grade is found to be proportional to the polishing time . the electrical property of the eighth quartz oscillator example in fig9 is much better than the seventh example in fig9 . based on these results for the seventh and eighth manufacturing cases , the quartz oscillators in the two - stepped single - sided grooved type are found to become convex lens shape , which is introduced in fig1 , and 6 as the one step inverse mesa type . the dotted line a - b in fig9 and 95 is the boundary layer , which divides the first oscillation part and second grooved part ( second oscillation part ). when the dotted line a - b is the boundary , which divides the first oscillation part and second grooved part ( second oscillation part ), the second part becomes slightly convex lens shape , the quartz oscillator is measured to become more clearly concavo - convex shape ( one side is concave and another side is convex ) with larger curvature than that of one step single - sided inverse mesa type in fig1 , and 6 . also two steps single - sided grooved type in fig9 and 95 becomes larger curvature type ( the lower line is widened ), and concavo - convex ( rather than plano - convex ) in more protruding convex lens shape than those of one step inverse mesa type in fig6 . therefore , three steps or more than three steps single - sided grooved type becomes larger curvature shape ( the lower line is widen ), and concavo - convex shape in more protruding convex lens type than those of two steps single - sided grooved type . fig9 illustrated another shape of the above example . fig9 ( a ) and ( b ) show one case of a double - sided grooved device in which one side has one step and another side has two steps , fig9 ( c ) and ( d ) show the case which one side has one step and another side is three steps , and fig9 ( e ) and ( f ) show another case which one side is two steps and another side is three steps . when the shape in fig9 ( a ), ( c ), and ( e ) are polished by pressurizing between upper and lower tables of a dual - face polishing table ( polishing table ), the central oscillation part becomes a convex lens shape as shown in fig9 ( b ), ( d ), and ( f ). fig9 is a stating diagram of the parallel accuracy for a parallel plate . fig9 ( a ), ( b ), and ( c ) illustrate objects of 100 mm , 50 mm , and 25 mm with the same incline angle . the cross section height of a 100 mm object is 2 mm and 4 mm high . the cross section height of a 50 mm object is 2 mm and approximately 3 mm high . the cross section height of a 25 mm object is 2 mm and approximately 2 . 3 mm high . thus , it is found even for the same inclination objects that the error between these heights is smaller as the length is shorter . this phenomena can explain the following . it must be parallel or in convex lens shape for the quartz oscillator to perform ideal electrical characteristics . the best parallel error is ideally 0 , however it is practically impossible to make the plate with zero error of parallelism . besides , the size of wafer becomes larger in these years , and the thickness becomes thicker as the size becomes bigger . the typical wafer size is 60 mm high , 30 mm wide , and 80 μm thick at the present . as the size of wafer becomes larger , the parallel error is inversely bigger . when a quartz blank is chemically etched , the quartz anisotropy generates . as the method for avoiding this anisotropy , this must not be chemically etched more than 1 / 20 of the aperture ( diameter ). for example , if the thickness of the oscillation part is 5 μm of an 80 μm thick wafer , and the remaining 75 μm is chemically etched , the aperture ( diameter ) should be 1500 μm = 1 . 5 mm , which is 20 times of 75 μm . when the oscillation part of a quartz oscillator is 5 μm thick , the diameter of the oscillation part is enough to be 80 times of the thickness both for parallel plate and convex lens shape since the aperture ( diameter ) is sufficient to be 0 . 4 mm for the 5 μm thick oscillation part . when the same parallel plate is used , the parallel error of 1 . 5 mm diameter is quite different from that of 0 . 4 mm diameter . in conclusion , the smaller the aperture is , the smaller the parallel error of the oscillation part is relatively , when parallel error of the wafer is same . in order to make a small aperture quartz oscillator , it is necessary to avoid the original quartz anisotropy , and it is found to be the most optimum for two or three steps single - sided grooved or double - sided grooved shape , since the minimum thickness of wafer is 80 μm . the resonance characteristics is best in fig8 , 84 , 85 , and 86 , since the oscillation part aperture is designed to be small , and the parallel error of the parallel plate relatively becomes small first of all . the second reason is thought to be that the impressed energy is efficiently utilized in two steps grooved type . the third reason is that the surface accuracy is between 0 . 002 μm and 0 . 004 μm due to the chemical etching process , when the oscillation aperture is small and the shape is two steps grooved type as shown in fig5 , 61 , 66 , and 68 . when quartz oscillator in fig5 is measured by a photograph in fig5 , the oscillation aperture ( diameter ) is 0 . 12 mm , and the surface accuracy is 0 . 002 μm . in the case of the quartz oscillator in fig6 , the oscillation aperture is measured to be 0 . 59 mm by the photograph in fig6 , and the surface accuracy is 0 . 003 μm . in cases of quartz oscillator in fig6 and 66 , the oscillation aperture is measured to be 0 . 95 mm by the photograph in fig6 , and the surface accuracy is 0 . 004 μm . the above events demonstrate that the smaller the oscillation aperture is , the higher the surface machining accuracy is . ( 1 ) when both ends of a cylindrical blank are made at first to be the final target as lens , single - sided convex , single - sided groove , or planar shape , the oscillation part with a predetermined thickness can be shaped in the hollow cylindrical piezoelectric element , by shaving homogeneously to be circular from the cylinder end with a dry etching process . ( 2 ) the following effect will arise , when the planar piezoelectric blank is attached by an auxiliary mold in convex lens or convex lens shape , or when the auxiliary mold shape is pressed to the end of piezoelectric material by dry etching process after the auxiliary mold is pasted to the piezoelectric material with dry etching process . when the press forming makes the optical lens of flat and convex ( or concave ) shape with the outer ring - support ( in frame shape ) holder , and the auxiliary mold as the optical lens is attached to the planar piezoelectric material and shaved by the dry etching process , the planar piezoelectric surface is processed to be in the same lens shape with the high surface accuracy as the conventional lens , which is machined by press forming or other mechanical polishing processes . then we can conveniently manufacture the ultra accurate quartz oscillator ( quartz resonator ), which is in lens shape at the central part and accompanied by the outer holder in the ring - support shape ( frame shape or hollow bamboo cylinder shape ). ( 3 ) furthermore , since the crystal axis of quartz can be easily identical to the machining axis of optical lens , the quartz oscillator becomes electrically excellent . ( 4 ) the final surface accuracy becomes equal to the original surface accuracy at both ends of the cylinder shape . however , the intrinsic electrical characteristics of the piezoelectric element will not restore , if the ion - damaged layer due to the dry etching process is removed . ( 5 ) if the cylinder is machined to be in the hollow cylinder shape by the mechanical process , it is difficult for the deep groove to be machined . ( 6 ) when the piezoelectric material is formed to be in hollow cylinder shape by the dry etching process , the lens shaped oscillator is made at the central part of hollow cylinder , which hole diameter is approximately 10 mm , hole length is from 1 . 0 cm to 15 cm , and thickness is around 1 mm . ( 7 ) it is actually extremely difficult for the hollow cylinder thickness to be machined only by the mechanical process , however the present invention to use the dry etching can manufacture oscillators in ultra high performance , since this invention enables the processing to be in lens shape at the central part with the holder of extremely thin bamboo hollow cylinder and ring - support shape ( bamboo type hollow cylinder shape ) at the outer part . ( 8 ) the thickness of the bamboo type hollow cylinder can be polished to be extremely thin , since the dry etching process is performed at the same time both for outer and inner surfaces of the bamboo type ring - support shape . ( 9 ) if the ion - damaged layer is not considered during the dry etching process ( rie or cip ), the ultra thin lens shape can be manufactured after both ends are shaved in the same accuracy as the original one at the end of the cylinder . ( 10 ) since we can manufacture oscillators , whose walls are quite thin , hole diameter is small , hole length of bamboo hollow cylinder is long , central pressure sensor part is in the convex or concave lens shape , and it makes high performance to catch an acoustic wave . ( 11 ) when the outer diameter of small oscillator in bamboo type hollow cylinder shape is less than ½ inch , for example , the pressure or the temperature of oil , methane gas , and so on is always measured at the same time , after this is inserted into the pipe under say 5000 m of ground to pump oil , methane etc . ( 12 ) the diameter of a conventional pressure sensor ( called quartz sensor ) is as large as about ¾ inch , and this cannot always be inserted into the drilling pipe to get oil and methane . ( 13 ) this high performance of the pressure sensor can detect oil and methane gas in extremely deep underground . if it is two steps single - sided grooved type or double - sided grooved type ( abbreviation for grooved type or grooved resonators ), after the second oscillation part ( second grooved part ) in circular , triangular , rectangular , hexagonal , or other shapes to mark the crystal orientation of piezoelectric material is machined inside or at the central part in square or rectangular shape , the inside or the central region of the second oscillation part is again formed so as to be pure circular , quasi - circular , triangular , square , hexagonal , or other shapes . the following effects are observed . { circumflex over ( 1 )} since the shape of the rectangular quartz blank is machined to be pure circular , quasi - circular or other shapes , the piezoelectric device achieves more excellent electric performance . { circumflex over ( 2 )} since the outer shape of the quartz blank can be in the form of a rectangular shape even if the oscillation part is purely circular or quasi - circular , the quartz wafer can be automatically cut , and then mass production becomes easy . { circumflex over ( 3 )} even when the oscillation part is in accurately circular or quasi - circular shape , the crystal axis direction can be conveniently recognized . { circumflex over ( 4 )} when the extremely small oscillation part is manufactured by the chemical etching process , the shape is formed to avoid to be affected by the surface tension and crystal anisotropy due to the chemical etching step by step . { circumflex over ( 5 )} since the most ideal frequency of oscillation energy at the first circular vibrating part is dissipated from the outer second oscillation part ( second grooved part ) toward the outer periphery step by step , the quartz oscillator becomes to show the excellent ideal electrical performance . { circumflex over ( 6 )} as the oscillation part is made to be very small and the aperture ratio ( d / t ) is set to around 80 by forming the oscillation part to be stepwise thin , the electrically excellent quartz oscillator can be manufactured , when the primary frequency is more than 400 mhz ( less than 4 μm thick for at - cut ) for the at - cut case . { circumflex over ( 7 )} after the quartz oscillator is cut to be rectangular , the pure circular or quasi - circular first oscillation part is made , and another circular second oscillation part ( second grooved part ) is also made inside or at the central region of the first oscillation part to mark the crystal orientation . by this manufacturing method , after the direction marking slit is cut to find the crystal orientation as shown in fig3 ( a ), 36 ( a ), 40 ( a ), and 44 ( a ). by forming a crescent shape type in fig3 ( a ), 37 ( a ), 41 ( a ), and 45 ( b ), both the first oscillation part and the second one ( second grooved part ) can be formed to be pure - circular or quasi - circular , and the quartz blank is conveniently cut and massively produced from the quartz wafer to be in the rectangular outer shape . { circumflex over ( 8 )} if the oscillation part is not made to be in thin at least two steps shape by chemically etching the first oscillation part and the second one ( second grooved part ), the wafer is thick as 80 μm . when the frequency of oscillation part is high as 2 . 1 ghz at at - cut , the oscillation part is approximately 0 . 8 μm , the aperture ratio is found to be around 80 to resonate the best wave . then the diameter of the oscillation part is extremely small as 0 . 8 μm × 80 = 64 μm , the homogeneous chemical etching becomes impossible due to the surface tension of liquid solution as hydrogen fluoride etc for the chemical etching or crystal anisotropy , if the oscillation parts are not chemically etched to be thin step by step . { circumflex over ( 9 )} furthermore , when the aperture diameter is 64 μm , the chemically etched depth by hydrogen fluoride is at most 3 . 2 μm ( for instance approximately 1 / 20 of the diameter ). if the chemical etching is deeper than this , the quartz crystal anisotropy appears , and the flat surface accuracy becomes poor . therefore , the ultra high frequency quartz oscillator must be manufactured by forming at least two steps shape with the chemical etching , since the aperture ratio is found to be about 80 to make electrically high - level quartz oscillator . { circumflex over ( 10 )} when the diameter of the first oscillation part becomes extremely small as 64 μm or 0 . 32 mm , the shape of the second oscillation part becomes triangular , rectangular , or hexagonal except pure - circular or quasi - circular . since the shape is too small , this can be better to be pure circular or quasi circular , however this can be triangular , rectangular , hexagonal , or other shapes . { circumflex over ( 11 )} since the electrode to oscillate only the second oscillation part is attached by photo resist chemical etching process to the front and rear surfaces of the first oscillation part , whose diameter is very small as approximately 0 . 32 mm and shape is pure - circular or quasi - circular , the second part does not oscillate , and the electrically ideal oscillator ( resonator ) is made to resonate at more high frequency without the spurious signal . { circumflex over ( 12 )} when the quartz is relatively and chemically etched by using two or three steps or the plural steps shape , the chemical etching can shave the deep groove , which must be deeper than 1 / 20 of the oscillation part diameter to avoid the quartz crystal anisotropy . { circumflex over ( 13 )} after the first chemical etching makes at first the pure circular or quasi circular shape , whose first oscillation part diameter is 0 . 32 mm and depth is 16 μm for example , the first and second oscillation parts are chemically and relatively etched step by step in order to make form the rectangular , hexagonal , or other shapes with 1 . 6 mm diameter at the outer part of circular shape , and the anisotropy problem can be solved . { circumflex over ( 14 )} as discussed above , since the quartz anisotropy problem is relatively solved by chemical etching process with two steps more deeply than 1 / 20 of the aperture diameter , it becomes possible for mass production of high frequency quartz oscillator by using over 80 μm thick and more than 1 inch × 1 inch wafer plate . after the blank is selected to be the quartz crystal unit in the chemically etched single - sided grooved type of more than two steps shape , this is etched by the reactive ion etching ( rie ) and polished by dual - face polishing machine , the at - cut quartz oscillator is successfully developed over 467 mhz fundamental frequency . this quartz oscillator processed by this method is nearly in the concavo - convex or bi - convex shape rather than plano - convex shape as the ideal convex lens type , and this shows the excellent reactance - frequency characteristics . this machining method demonstrates that the optimum aperture ratio d / t ( diameter / thickness ) is 80 . as the consequence , when the quartz oscillator with very high frequency is required to be manufactured , the aperture diameter d becomes small , since the diameter d is proportional to the thickness t , which is extremely thin . when the diameter becomes small , the quartz oscillator shows the anisotropy problem , the parallel accuracy cannot be maintained due to the chemical etching process , since the quartz wafer is shaved to be deeper than 1 / 20 of the diameter d . this problem was solved in the following methods . at first , the first chemical etching is done , after the depth of the first oscillation part is selected to be less than 1 / 20 of the aperture diameter d which is 80 times of the thickness t corresponding to the frequency , and next we chemically etched the second oscillation part ( second grooved part ), whose diameter is much larger than the first oscillation part ( outer region of the first oscillation part ) and is not affected by d / t ( 80 : 1 or 100 : 1 ) problem . since the first and second oscillation part ( grooved part ) is chemically and respectively etched with two steps , the quartz anisotropy property is solved . also , even if the quartz wafer blank is thick , the aperture d of oscillation part can be very small . therefore we can mass - produce the ultra high frequency quartz oscillator whose electric characteristic is ideal and extremely thin in the plano - convex shape . this problem was solved in the following way . at first , the first chemical etching is done , after the depth of the first oscillation part is selected to be less than 1 / 20 of the aperture diameter d which is 80 or 100 times of the thickness t corresponding to the frequency , and secondly we chemically etched the second oscillation part ( second grooved part ), whose diameter is much larger than the first oscillation part ( outer region of the first oscillation part ) and is not affected by d / t problem . since the first and second oscillation part ( grooved part ) is chemically and respectively etched step by step , the quartz anisotropy property is finally solved . when another method from fig3 to fig3 is used instead of the above process , the second grooved part ( second oscillation part ) is chemically etched or processed by the dry etching at first , and the central first oscillation part is formed to be purely circular or quasi circular , and then this method is found to be the best way , since the quartz anisotropy problem is not observed as previously explained . by the way , even if the quartz wafer blank is thick , the aperture d of oscillation part can be very small . therefore we can mass - produce the electrically ideal ultra high frequency quartz oscillator , which is extremely thin in the plano - convex shape . as shown on u . s . pat . no . 3 , 694 , 677 on sep . 26 , 1972 , dr . gunter k . guttwein , dr . arthur d . ballato , dr . theodre j . lukaszek invented quartz oscillators of one step inverted mesa type ( single - sided inverted mesa type and double - sided inverted mesa type ) at us army . this time we manufactured novel quartz oscillators of single - sided grooved type in two steps shape by using the chemical etching process or dry etching , which were found to have the following advantages over the former quartz oscillators in one step shape . { circumflex over ( 1 )} when the aperture ratio ( d / t ) is chosen to be optimum , the oscillation area is made to be small as possible . then the waved shape is prevented and becomes small on the oscillation surface , when the oscillation part is made to be thin as 5 μm . also the surface accuracy becomes at least ten times better . { circumflex over ( 2 )} since the quartz anisotropy is avoided by selecting the aperture ratio to be 80 : 1 ( d / t ), the surface accuracy is improved for any quartz blank thickness . { circumflex over ( 3 )} the latter new two steps oscillator has the structure of the optimum aperture ratio as 80 : 1 ( d / t ) regardless of quartz plate thickness t . { circumflex over ( 4 )} tough resonators against the mechanical shock and acceleration can be made , since the thick plate improves the structural and dynamic strength . furthermore the step type quartz oscillators of two or more than two steps shape enables us to resist more strong shock . { circumflex over ( 5 )} since the former one step quartz oscillator in single - sided inverse mesa type and double - sided inverted mesa type are apt to make pin holes , the one step resonator etched down to 5 μm cannot be mass - produced . the latter two steps one can be mass - produced down to 5 μm . { circumflex over ( 6 )} while one step inverted mesa type device needs only one chemical etching process , the two steps double - sided grooved type requires two etching processes . however the electrical property becomes improved , and the quartz oscillator device over 70 mhz will become two steps double - sided grooved type in the near future . { circumflex over ( 7 )} when the single - sided inverted mesa type or doubled sided inverted mesa type in one step shape becomes thinner than 5 μm , the aperture ratio ( d / t ) must be larger due to the quartz anisotropy , and then there appears the wave shape ( like up and down hills ) on the oscillation part . also the surface accuracy on the oscillation part becomes worse than 0 . 02 μm . { circumflex over ( 8 )} in case of grooved type in two steps shape , there are few waves , and the surface accuracy is approximately 0 . 003 μm . and these are ten times better than those of inverted mesa type in one step shape . { circumflex over ( 9 )} in case of grooved type in two or more steps , since there are the second grooved part ( second oscillation part ) and third grooved part ( third oscillation part ), the oscillation energy impressed on the small first central oscillation part ( oscillating surface with electric voltage ) is efficiently and smoothly used at the second and third outer oscillation part step by step , and the resonator shows the excellent electrical performance . { circumflex over ( 10 )} in case of the single - sided grooved type in two steps shape , the device can be mass - produced to be thinner than 5 μm . after the oscillation surface of the blank is made to be thinner than 5 μm , the blank is polished by the polishing machine to impress mechanical pressure on the quartz plate both from upper and lower sides in order to confine the energy . as a consequence , ideal quartz oscillators in the concavo - convex or bi - convex lens shape , rather than the conventional piano - convex , are thought to be made to show better electric property approximately as 5 . 0 ghz fundamental frequency for bt - cut below 0 . 5 μm . furthermore , in the near future , it will be possible for the quartz oscillator to be developed as thin as approximately 0 . 015 μm ( primary frequency as 160 ghz for bt - cut ). the accurate name of the single - sided inverted mesa type or double - sided inverted mesa type with two steps in this invention should be called as the single - sided grooved type or double - sided grooved type ( abbreviated as grooved type or grooved resonators type ). the reasons of these names are as follows . { circumflex over ( 1 )} even when the outer shape is pure circular , the central oscillation part can be in purely circular shape , which contributes to better electrical performance . { circumflex over ( 2 )} the oscillation energy impressed on the small first central oscillation part is efficiently and smoothly used at the second grooved part ( second oscillation part ) and third outer grooved part ( third oscillation part ) step by step . { circumflex over ( 3 )} the electrode can be made smoothly in step shape . { circumflex over ( 4 )} the quartz blank can be made to be thick , while the oscillation part is processed to be very thin . { circumflex over ( 5 )} based on the above items , the one step inverted mesa type invented by the us army is quite different from the grooved type in this invention . therefore , this is named as the grooved type or grooved resonators type . the following papers were introduced to show that the aperture ratio ( d / t ) should be approximately 80 in order to achieve the best electrical performance . { circumflex over ( 1 )} 1999 ieee international frequency control symposium , pp . 425 - 428 . { circumflex over ( 4 )} 21st ( 1999 ) piezoelectric devices conference and exhibition , pp . 4 / 1 - 4 / 6 . { circumflex over ( 3 )} 2000 ieee / eia international frequency control symposium & amp ; exhibition , pp 255 - 259 . this invention is related to the manufacturing process of a grooved type device in two or more than two steps stereo shape by using the chemical etching , and then this can apply to a wide variety of semi - conducting electronic materials such as silicone , gallium arsenate , and so forth in addition to the piezoelectric material as quartz , lithium niobium , etc . this invention can be used for a wide variety of fields such as communication equipment , instrumentation , general computer , office automation information technology , home appliance microcomputer , and so forth .	8
some embodiments of the invention are explained below with reference to the drawings . the embodiments , however , should not be construed to limit the invention . fig1 is a cross - sectional view of a device according to the first embodiment . all of the cross - sectional view is schematic and do not show true relative film thicknesses of actual devices . the soi semiconductor substrate comprises a semiconductor bulk 10 a 10 b , a first thin buried insulating layer 20 formed on a first semiconductor layer , and a second thick buried insulating layer 30 formed on the first semiconductor layer . for example , the thickness of the first buried insulating layer 20 is 10 nm , and the second buried insulating layer 30 is 100 nm thicker than the first insulating layer . the semiconductor bulk 10 a , 10 b are made of single - crystal silicon , poly - silicon , silicon germanium or silicon carbide . the first buried insulating layer region , for example , can be used for a fbc circuit , and the second buried insulating layer region can be used for a logic circuit . the thicknesses of the first and second buried insulating layers can be adjusted for each circuit type . for example , the thickness of the second buried insulating layer can be varied from 50 nm to 200 nm according to a particular logic circuit generation . if the buried oxide thickness is less than 50 nm , the substrate capacitance can not be neglected and if the thickness is larger than 200 nm , the device performance is degraded by heating of the substrate due to the low thermal conductivity of silicon dioxide . on the other hand , the buried insulating layer has to be thicker than 10 nm for fbc devices . although thinner buried insulating layers increase signal intensity , the requirement of a thickness of at least 10 nm is set by the need to have sufficient insulation between the top and bottom semiconductor layers . the depth of the first and second buried insulating layers from the substrate surface is flexible . the depth can be controlled by thinning the surface silicon layer . the depth is optimized for each device type . for example , a 40 nm to 100 nm depth is used for the 45 nm generation logic devices . the surface of the substrate must be flat and should have no steps due to the different thicknesses of the buried insulating layers in different parts of the substrate . no step means that there are no steps , sharp edges or bumps which may reduce process margins for photo - lithography and etching . the requirement of flatness for the soi substrate surface becomes progressively more severe for smaller design generations . the difference of the highest and lowest points of a step on the soi surface must be less than 100 nm for the 130 nm design rule generation and less than 20 nm for 45 nm design rule generation . fig2 through 4 are cross - sectional diagrams showing the flow of the manufacturing process of a semiconductor device according to the first embodiment of the invention . as shown in fig2 a , a soi substrate with a 10 nm buried oxide layer is used . one of the methods of producing such soi substrates is explained below . a porous silicon layer is formed on a seed substrate by a nodic oxidation . a single - crystal silicon layer is epitaxially grown on top of the porous silicon layer . next , an oxide layer is grown on the surface of the single - crystal silicon layer and the surface is attached to a dummy substrate . the two substrates are then separated from each other by cutting at the porous silicon layer and the remaining porous silicon is removed . finally , the substrate is annealed in hydrogen containing gas to obtain a flat surface . on an soi substrate , a first mask 40 and a second mask 50 are deposited sequentially . in this example , the first mask 40 is a 150 nm - thick si 3 n 4 film and the second mask 50 is a 1 μm - thick sio 2 layer . the first mask should be thick enough to prevent the oxidation of the silicon substrate under the first mask in an annealing process in an oxygen atmosphere . the first and the second mask together should be thick enough to shield the substrate from implanted ions in the ion implantation process at a later stage . next , a resist layer is formed on top of the second mask 60 and patterned with normal photo - lithography techniques . the first mask 40 and the second mask 50 are then partially etched by rie using the resist mask to create region 70 . although in fig2 b , the depth of region 70 reaches the substrate , it is not necessary to continue etching until the substrate is reached . in the next step , oxygen ions are implanted into the substrate through region 70 formed in the first mask 40 and the second mask 50 . the ion implantation conditions are , for example , 150 kev to 200 kev o + ions with a total dose of 4 × 10 17 cm − 2 to 6 × 10 17 cm − 2 . as shown in fig3 a , after this process , oxygen ions are implanted into the substrate only in region 70 but not in those parts of the substrate that remain covered by the first mask 40 and the second mask 50 . the second mask 50 is then removed by a selective wet etching process with nh 3 f or by dry etching with hf vapor . the substrate is then annealed in an oxygen — containing atmosphere . the first annealing is done , for example , in an atmosphere of ar gas , mixed with 1 % of oxygen , at 1300 to 1400 ° c . for 4 hours , followed by a second anneal in an atmosphere of 100 % oxygen gas at 1300 to 1400 ° c . for 4 hours . during the first anneal , implanted oxygen reacts with the silicon in the substrate , forming a silicon dioxide layer in the substrate . there should preferably be no oxidation under the first mask region . the conditions for the first anneal are chosen so as to prevent the thin buried oxide layer 20 under the first mask from growing thicker . the first mask 40 must be an oxygen - resistant material or an oxide itself to prevent oxidation under the mask . the surface area which is not covered by the fist mask will grow an 800 nm - thick first thermal oxide layer 80 . because silicon dioxide has 2 . 2 times larger volume than crystalline silicon , the thick oxide region 30 will expand and push up the substrate surface . this will create a step 100 between the thin and thick buried oxide regions . the step 100 heights may reach 200 nm . next , the first mask 40 is removed by wet or dry etching . after this step , the substrate has region 110 , with almost no oxide on the surface and region 80 that is covered with an 800 nm - thick oxide layer , as shown in fig4 a . the substrate then proceeds to the second annealing step . the conditions for the second anneal are , for example , 100 % oxygen atmosphere at 900 ° c . for 1 hour . during the second annealing process , the surface oxidation rate in region 80 , which is already covered with a thick oxide layer , is much slower than in region 110 , which is not covered with an oxide . as a result , region 110 is oxidized , forming a second thermal oxide layer 120 . after the annealing procedures , the depth of the oxide - silicon interface is the same in both the first thermal oxide and the second thermal oxide regions . the final surface flatness can be controlled by adjusting the process conditions for the second anneal , as shown in fig4 b . as a last step , the first thermal oxide layer 80 and the second thermal oxide layer 120 are removed by wet or dry etching . an soi substrate obtained by this process has a flat surface at the boundary between regions of thin and thick buried oxide . according to embodiment 1 , the height difference between the thick and thin buried oxide layers is less than 20 nm and very good control of the thin buried oxide thickness can be achieved even after a thermal oxidation process . additional advantages and modifications will readily occur to those skilled in the art . for example , the second mask can be made of si 3 n 4 or other materials . in the first embodiment , the soi substrate was manufactured by first forming the thinner buried oxide region , followed by the growth of the thicker buried oxide region using a single oxygen implant process . the second embodiment comprises two oxygen implantation processes that are used to produce the thicker and thinner buried soi substrate regions . a cross - sectional view of the device according to the second embodiment is the same as for the first embodiment , shown in fig1 . fig5 through 7 are cross - sectional diagrams showing the flow of the manufacturing process of a semiconductor device according to the second embodiment of the invention . one possible process of producing such a soi substrate is explained below . on a bulk substrate 10 , a first mask 40 and a second mask 50 are deposited sequentially so that mask 50 covers mask 40 . in this example , the first mask 40 is a 150 nm - thick si 3 n 4 film and the second mask 50 is a 1 μm - thick sio 2 layer . the first mask should be thick enough to prevent oxidation of the silicon substrate under the first mask in an annealing process in an oxygen atmosphere . the first and the second mask together should be thick enough to shield the substrate from implanted ions in the ion implantation process at a later stage . next , a resist layer 60 is formed on top of the second mask 50 and patterned with normal photo - lithography techniques . the first mask 40 and the second mask 50 are then partially etched by rie using the resist mask to create region 70 . although in fig5 a , the depth of region 70 reaches the substrate , it is not necessary to continue etching until the substrate is reached . in the next step , oxygen ions are implanted into the substrate through regions 70 formed in the first mask 40 and the second mask 50 to form the thicker buried oxide layer . the ion implantation conditions are , for example , 180 kev o + ions with a total dose of 4 × 10 17 cm − 2 to 6 × 10 17 cm − 2 . as shown in fig5 b , after this process , oxygen ions are implanted into the substrate only in region 70 but not in those parts of the substrate that remain covered by the first mask 40 and the second mask 50 . the second mask 50 is then removed by a selective wet etching process with nh 3 f or by dry etching with hf vapor . the substrate is then annealed in an oxygen - containing atmosphere . the first annealing is done , for example , in an atmosphere of ar gas , mixed with 1 % of oxygen , at 1300 to 1400 ° c . for 4 hours , followed by a second anneal in an atmosphere of 100 % oxygen gas at 1300 to 1400 ° c . for 4 hours . during the first anneal , implanted oxygen reacts with the silicon in the substrate , forming a silicon dioxide layer 30 in the substrate . there should preferably be no oxidation under the first mask region 40 . the first mask must be an oxygen - resistant material or an oxide itself to prevent oxidation under the mask . the surface area which is not covered by the fist mask will grow an 800 nm - thick first thermal oxide layer 80 . because silicon dioxide has 2 . 2 times larger volume than crystalline silicon , the thick oxide region 30 will expand and push up the substrate surface . this will create a step at the edges of the thick buried oxide regions . the step heights may reach 200 nm . in the next step , oxygen ions are implanted into the substrate through the thin mask 40 and the surface oxide layer 80 . the ion implantation conditions are , for example , 180 kev to 200 kev o + ions with a total dose of 1 × 10 17 cm − 2 to 3 × 10 17 cm − 2 . as shown in fig6 b , after this second implantation process , oxygen ions are implanted into the substrate under the first mask region 40 to create a thin buried oxide layer 20 . the implantation conditions can be modified to control the thickness and depth of the thin buried oxide layer 20 . the first mask 40 is then removed by wet or dry etching . after this step , the substrate has a region with almost no oxide on the surface and region 80 that is covered with an 800 nm - thick oxide layer , as shown in fig7 a . the substrate then proceeds to the second annealing step . the conditions for the second anneal can be , for example the same as the first annealing conditions . during the second anneal , implanted oxygen reacts with the silicon in the substrate , forming a thin buried silicon dioxide layer 20 in the substrate and also a second oxide layer 110 at the surface which is not covered with an oxide layer . the substrate then proceeds to the third annealing step . the conditions for the third anneal are , for example , 100 % oxygen atmosphere at 900 ° c . for 1 hour . during the third annealing process , the surface oxidation rate in region 80 is slower than in the second oxide region 110 due to the larger starting thickness of the oxide layer in region 80 . as a result , the second oxide in region 110 grows faster than first oxide in the region 80 , creating a third oxide layer 120 . after the third annealing procedures , the depth of the oxide - silicon interface is the same in both region 120 and the first oxide region 80 , as shown in fig7 b . the final surface flatness can be controlled by adjusting the process conditions for the third anneal . as the last step , the first thermal oxide layer in region 80 and the third oxide layer in region 120 are removed by wet or dry etching . an soi substrate obtained by this process has a flat surface at the boundary between regions of thin and thick buried oxide . according to embodiment 2 , the height difference between the thick and thin buried oxide layers is less than 20 nm and very good control of the thin buried oxide thickness can be achieved even after the second and third thermal oxidation processes . additional advantages and modifications will readily occur to those skilled in the art . for example , there can be a non - oxide region between the thin buried oxide 20 and thick buried oxide 30 , as shown in fig8 a or the thin and thick buried oxide regions can overlap , as shown in fig8 b . the thin and thick buried oxide layer do not need to be at the same depth from the surface , either can be deeper , as shown in fig8 a and 8b . therefore , the invention in its broader aspects is not limited to the specific details and representative embodiments shown and described herein . accordingly , various modifications may be made without departing from the spirit or scope of the general inventive concept as defined by the appended claims and their equivalents .	7
a novel methodology was developed for making pvdc - based carbon that has the structure provided by the skeleton made from vitreous carbon foam . a low - density support structure was coated with a pvdc precursor and carbonized to form a porous sorbent - coated monolith . the objective was to produce predominantly microporous monolithic carbon ( from pvdc ) that had good mechanical properties and an open - cell structure ( from vitreous carbon foam ). these structures were expected to show good ammonia adsorption and desorption performance as well as low pressure drop . the support structure that we employed was a duocel ® foam manufactured by erg aerospace corporation . this foam is described as an open - cell , porous structure consisting of an interconnected network of solid “ struts .” it is available in a variety of pore sizes , defined as pores per inch ( ppi ), in the range of 5 - 100 ppi . materials include aluminum , copper , reticulated vitreous carbon ( rvc ) and silicon carbide ( sic ), and blocks of these materials can be obtained with volumes as high as 37 liters ( carbon and silicon carbide ). for the space - suit application , vitreous carbon was chosen as the sorbent support structure . unlike the metal foam materials , vitreous carbon is chemically resistant to the hydrogen - chloride vapors that are evolved during carbonization of pvdc . compared to silicon carbide , the carbon foam is more readily available , has a lower cost , and is lighter for a given porosity . the 30 - 80 ppi foam that was used is available as 4 × 4 inch ( 10 × 10 cm ) panels in nominal thicknesses up to 0 . 5 inch ( 1 . 3 cm ). it was found that it could be easily and reproducibly cut into cylinders using a precision arch punch . two fabrication routes for producing the pvdc carbon - coated foam structures were explored . a wet - deposition technique , in which the rvc foam substrates were dip - coated in a pvdc solution precursor and then carbonized , was initially investigated . in the second approach , the foam substrates were filled with the dry pvdc powder and then carbonized . three pvdc precursor powders were evaluated : a pvdc homopolymer from honeywell , a dow chemical copolymer ( saran 506 ), and a solvay advanced polymers copolymer ( ixan sga - 1 ). the main processing parameters affecting ammonia adsorption performance are the starting material ( type of polymer ), the carbonization temperature , and activation conditions , if activation is employed . the effect of a carbon surface conditioning step , using thermal oxidation in air , turned out unexpectedly to be of paramount importance for good ammonia - sorption capacity and sorbent regeneration in vacuum . experimental details for each fabrication method , surface conditioning , ammonia adsorption testing , and regeneration testing are provided below . for dip - coating experiments , rvc foam samples with pore sizes ranging from 30 - 80 ppi were cut into 22 mm diameter × 12 mm thick substrates . the mass of the bare substrates ranged from 0 . 20 - 0 . 25 g , depending on the pore size . the process of coating the substrates using a pvdc liquid precursor involved three basic steps , as illustrated in fig1 . in step 1 , foam sample 14 was first dipped in a solution of pvdc / solvent 16 , being contained in vessel 18 , and then briefly drained ( fig1 a ). in step 2 ( fig1 b ), sample 14 ′, obtained from the previous step , was submerged in a bath of hot water 20 , the hot water being contained in vessel 22 and having a temperature of 40 - 50 ° c ., for a period of about 30 seconds , and then cured for 12 - 36 hours . in step 3 ( fig1 c ), sample 24 , obtained from the previous step , was heat - treated in tube furnace 26 at about 300 ° c . under flowing high purity nitrogen ( 1 l / min ) to boil off any trapped solvent and water , and to partially carbonize the pvdc . to increase the mass of pvdc carbon in the foam , the process cycle was repeated until the desired pvdc carbon / foam mass ratio was achieved . at this point , the sample was subjected to a final high temperature heat treatment ( in nitrogen ) to fully carbonize the pvdc . a heating rate of about 10 ° c ./ min was used up to 750 ° c . and about 15 ° c ./ min from 750 ° c . to the final heat - treatment ( carbonization ) temperature , up to 1050 ° c . after the final high - temperature carbonization step , the mass of pvdc carbon deposited on the foam samples was found to be about 0 . 15 - 0 . 30 g / coat cycle , depending on the foam pore size and the pvdc solution concentration . the pvdc precursor solutions ( step 1 ) were prepared by dissolving the pvdc powder in a suitable organic solvent , using vigorous stirring and modest heating to 50 ° c . of the three polymer formulations studied , the solvay blend was the most soluble . it readily dissolved in acetone , methyl ethyl ketone and n - methylpyrrolidone ( nmp ). the solvay solutions were also observed to be the most stable , having shelf lives of more than one week for nmp - based solutions prepared up to 35 % in concentration ( by weight ). the dow pvdc blend was only soluble in nmp at concentrations up to 30 %, and its shelf life was limited to one day . the honeywell homopolymer was much more difficult to dissolve , requiring heating to 100 ° c . and higher . however , upon cooling to below 50 ° c ., the solutions gelled and were unusable for dip - coating . consequently , dip - coating of the rvc foams was performed using only the solvay and dow solutions . the water - submersion step ( step 2 ) partially crystallizes or “ sets ” the pvdc , forming a continuous external skin of polymer on the foam substrate , as shown in fig2 a . ( it cannot be ruled out that some type of reaction with the water is occurring , but it is more likely that the water simply displaces the solvent , causing the pvdc to locally re - crystallize .) the outer skin seems to encapsulate the pvdc solution inside the foam matrix ( fig2 b ), minimizing further drainage of the pvdc solution . after an additional curing period (& gt ; 12 hours ) in air , a substantial amount of the pvdc inside the foam matrix is crystallized , as shown in fig2 c . note , however , that although in fig2 c the foam / polymer structure appears completely solidified , there is still a significant amount of liquid that remains , including the solvent and possibly trapped water . an important goal of the solution - coating method is that the coated sorbent has good adhesion to the carbon support structure . fig3 compares scanning electron microscopy ( sem ) images obtained for an uncoated carbon foam disc and two different regions of a carbon foam disc after 5 - coat cycles . for the uncoated sample ( fig3 a ), the lattice nature of the foam is clearly evident in the image as several levels of the carbon framework can be seen . fig3 b displays an image obtained from the external surface ( base ) of the coated disk . after five coating cycles , the carbon struts appear thicker and obviously coated , yet the underlying lattice is still evident . to further probe this sample , it was sliced in half ( perpendicular to the cylinder axis ) for sem analysis of the inner coated region . as shown in fig3 c , the carbon lattice is still evident but appears heavily coated , similar to the external surface of the sample . the second pvdc carbon coating method that was studied used dry pvdc powder precursors . for these experiments , the substrates were cut from 80 ppi rvc foam into 22 mm diameter × 12 mm thick substrates . they were then placed into a sealed plastic container , partially filled with pvdc powder ( honeywell or dow ), and then gently shaken for a few minutes . the powder - filled foam samples were then carbonized ( in nitrogen ), again in two separate heat treatments . here , however , a ramp rate of 1 ° c ./ min was employed for the low temperature carbonization step to 300 ° c . to avoid “ foaming .” for the final heat - treatment step , a heating rate of about 1 ° c ./ min was used up to 550 ° c . and about 5 ° c ./ min from 550 ° c . to the final cure temperature ( 800 - 1450 ° c .). in these experiments , only the honeywell and dow pvdc powders were studied and only one carbon deposition cycle was performed for each sample . the yield of carbon for each sample was 0 . 5 - 0 . 6 g per run , which was much higher than the carbon yield per cycle for the dip - coated samples . high - temperature activation of both dip - coated and dry - coated foam samples was performed in pure carbon dioxide , using a high - temperature tube furnace . the samples were heated to 900 ° c . at a ramp rate of about 22 ° c ./ min and held for 4 hours , yielding a burn - off ( weight loss ) of about 25 %. we also observed similar burn - off in the rvc foam substrate and , therefore , always included a bare foam sample during each activation run , to correct for any foam losses in the pvdc carbon coated samples . as described below , surface conditioning of the pvdc carbon after carbonization , via thermal oxidation at relatively modest temperatures , had a dramatic effect on ammonia adsorption . for these experiments , the pvdc carbon - coated foam samples were oxidized in ambient air at temperatures ranging from 250 ° c . to 325 ° c . for periods of up to 72 hours . at 250 ° c ., none of the samples that were studied showed any weight loss after oxidation . at 325 ° c ., however , a sample carbonized to 900 ° c . showed about 20 % burn - off , while a sample carbonized to 1450 ° c . showed no measurable weight loss . three types of commercially available granular activated carbons were obtained from the leading activated - carbon manufacturers : calgon and norit . ammonasorb ii ( impregnated with phosphoric acid ), and bpl ( no acid impregnation or acid washing ) were provided by calgon . norit provided darco , which is produced from lignite coal by steam activation , followed by acid wash . all the above activated carbons were ground to − 30 + 40 mesh size prior to ammonia - sorption testing . a fully automated gas - sorption system quantachrome asiqwin was used for collecting and processing nitrogen - isotherm data . several carbon samples were tested , and all of them were outgassed under vacuum at 300 ° c . for at least 3 hours prior to measurements . nitrogen adsorption isotherms were then determined at 77 k , and these data were used to perform the following analyses : ( a ) bet surface area ; ( b ) pore volume ; ( c ) dubinin - radushkevich ( d - r ) micropore surface area and micropore volume ; and ( d ) pore - size distribution of micropores using the density functional theory ( dft ). the bet surface area of carbon / foam monoliths was found to be in the range 265 - 603 m 2 / g , which was lower than expected . pvdc carbon is known to be extremely microporous , with a bet surface area close to 1000 m 2 / g upon carbonization ( walker , p . l ., jr ., austin , l . g ., and nandi , s . p ., “ activated diffusion of gases in molecular - sieve materials ,” in chemistry and physics of carbon , p . l . walker , jr . ( ed . ), vol 2 , marcel dekker , new york , 1966 ). it was later found that the vitreous carbon foam used as a support for pvdc carbon did produce some weight loss upon sorbent carbonization and activation , which indicates that this material also contributed to the overall pore volume of the monolith . this is consistent with the nitrogen adsorption isotherm data , which showed that the percentage of micropore volume in monoliths was in the range 15 - 84 %, again lower than expected . it is still believed that the ammonia - sorption behavior determined in this study was largely dominated by the pvdc carbon in the monolith . the total pore volume was between 0 . 27 cm 3 / g and 1 . 06 cm 3 / g , and the micropore volume was found to be in the range 0 . 10 - 0 . 23 cm 3 / g . it is expected that increasing the degree of microporosity in future monoliths , e . g ., by avoiding supports that contribute mesoporosity , will lead to improved performance . a test stand for ammonia adsorption measurements under dry and humid conditions was assembled , as shown schematically in fig4 . the test stand was used to evaluate the pvdc carbon monoliths as well as three granular commercial activated carbon sorbents , including calgon &# 39 ; s ammonasorb ii phosphoric acid - impregnated formulation . the apparatus , shown in fig4 , incorporates a fourier transform infrared ( ftir ) multi - gas analyzer , which was used for both ammonia and water quantification . using mass flow controllers , a 120 ppm ammonia / nitrogen gas mixture is mixed with a 35 % oxygen / nitrogen blend to achieve the desired concentration of ammonia in a balance of oxygen and nitrogen . for humidifying the gas stream , a portion of the oxygen / nitrogen mixture is re - routed through a water bubbler , using fine needle valves for adjustment . during testing , the final mixture is first routed through a sample bypass line , to establish the baseline ammonia and humidity conditions . the gas is then re - directed through the sample “ cell ” for the sorbent adsorption testing . the sample cell consists of a glass tube 23 that contains the sorbent sample 24 ′. it is mounted in a vertical orientation with the gas inlet at the top of the cell so that gas flow is in a downward direction . the 22 mm diameter pvdc carbon - coated foam samples , and also multi - channel carbon monoliths , were wrapped in teflon tape and then inserted into a 22 mm diameter quartz tube . the carbon sample height was typically 1 . 2 cm . the teflon tape assures a snug and reasonably gas - tight fit between the foam sample and the quartz tubing . for the granular sorbents , about 0 . 25 g of sieved sample (+ 40 - 30 mesh ) was loaded into 5 mm i . d . glass tubes and held in place using ceramic wool on both ends , resulting in a carbon bed length of about 15 mm . for the monolith samples , the inlet ammonia concentration and gas flow rate were 20 ppm and 1 l / min , respectively . for the granular samples , the inlet concentration and flow rate were 23 ppm and 0 . 45 l / min . the oxygen concentration used in all experiments was 29 . 3 vol %, with the balance being nitrogen . gas - concentration data were collected using the ftir analyzer at one minute intervals . the procedure was to monitor the ammonia breakthrough curves ( ammonia concentration versus time ) and to terminate the adsorption measurement when the ammonia concentration had reached 90 % of the inlet concentration ( after breakthrough ). two methods of sorbent regeneration were explored : nitrogen gas desorption and vacuum desorption , with and without mild heating (˜ 60 ° c .). the procedure for nitrogen desorption was to switch the sample gas flow to pure nitrogen , after the ammonia adsorption measurement was completed , and to monitor the ammonia desorption using the ftir analyzer . for vacuum regeneration experiments , the sample cell was removed from the test stand and installed in a high vacuum chamber pumped by a turbomolecular pump ( base vacuum of about 10 − 6 torr ). after the vacuum regeneration , the sample cell was re - installed on the test stand and the ammonia adsorption was measured again to determine the regenerated capacity . a number of samples were fabricated and tested for ammonia adsorption and desorption . table 1 summarizes the experimental details involved in the sample fabrication for a variety of representative samples , including the method of coating ( solution vs . dry powder ), the pvdc type , the maximum carbonization temperature and soak period , and the oxidation temperature and soak period ( if employed ). table 1 also provides the ammonia adsorption capacity measured for each sample . in some cases , adsorption data are included where additional sample conditioning ( activation and / or oxidation ) was employed . in addition to the foam samples , table 1 also includes the results for three commercial granular carbons , including ammonasorb ii it should be noted that , unless stated otherwise , data in table 1 , and also in the figures , are for initial sorption ( i . e . fresh carbon surface ), for nominally dry - gas conditions , and for unoxidized samples . several foam - supported carbon samples , as well as the granular ammonasorb ii , were subjected to multiple adsorption - desorption cycles , and ammonia - sorption testing was performed after each regeneration ( desorption ) experiment . in selected cases , both dry and humid gas conditions were used . these results are discussed in sections “ sorbent regeneration ” and “ the effect of gas humidity ” below . in general , ammonia - sorption data can be presented in terms of either breakthrough curves or sorption - capacity curves , and these two different ways of presenting sorption data are illustrated in fig5 . although the information included in each of these curves is equivalent , most ammonia - sorption data have been reported in terms of sorption - capacity curves ( e . g ., see luna et al . 2008 and luna et al . 2010 , supra ). in general , this convention is followed in the data presentation , although in some cases breakthrough curves are also shown to better illustrate whether or not ammonia concentration dropped to zero and for how long it stayed at the zero level . vacuum regeneration of ammonia sorbent is a critically important feature of the sorbents of this invention . ammonia sorption on high - purity carbons that have not been impregnated with any acids is governed mostly by physical adsorption ( physisorption ) rather than irreversible , or almost irreversible , chemisorption , which dominates ammonia sorption on acid - treated or mineral - matter containing carbons . for this reason , little or no loss of sorption capacity is expected in the instant sorbents following initial cycles of ammonia adsorption - desorption . in contrast , acid - treated carbons , such as ammonasorb ii , normally show little or no recovery of their original sorption capacity after the first chemisorption event . this is observed in a series of experiments involving pvdc / foam monolith 07 - 26 - 11 - de , which was subjected to repeated ammonia adsorption - desorption cycles ( fig6 ). it can be seen that the loss of sorption capacity is essentially limited to the first cycle , and that this loss is modest ( about one third ). this initial loss of sorbent activity may be due to the limited irreversible sorption that takes place on few strongly acidic sites that may exist even in high - purity pvdc carbons . in contrast , the loss of ammonia - sorption capacity in the case of acid - impregnated carbon ammonasorb ii is a factor of eight , which is shown in fig7 . it should be noted that data in fig6 represent the sorbent that has been most extensively studied with respect to multiple regeneration , and not necessarily the sorbent of the invention that is most effective for all purposes . performance data in fig6 can be compared to the corresponding data for ammonasorb ii ( fig7 ), and the superior regenerative capability of the non - acid - treated sorbent is evident . it should be noted that ammonasorb breakthrough curves do not reach the zero level after the first adsorption experiment has been performed . this provides a clear contrast between the instant vacuum - regenerable sorbent and an acid - treated one ( ammonasorb ii ). the comparison of ammonasorb ii performance with a different sorbent of this invention is shown in fig8 . superior sorbent regeneration is evident for the instant vacuum - regenerable sorbent , and its ammonia - sorption capacity after regeneration is almost three times higher than that for ammonasorb ii . data shown in fig8 were collected at low relative humidity ( rh ) conditions ( 10 %). another important result concerns the time needed for sufficient sorbent regeneration . under the conditions used , and for sorbent 07 - 26 - 11 - de , it was found that a room - temperature 15 - minute exposure to vacuum resulted in a temporary and partial loss of ammonia - sorption capacity , i . e . incomplete desorption ( compare lines 7 and 8 in fig6 ). this could easily be reversed upon a longer exposure of the spent sorbent to vacuum ( see line 9 in fig6 ). it was also found that a one - hour exposure to vacuum at room temperature was sufficient to provide effective ammonia desorption ( compare lines 7 , 8 , and 9 in fig6 ). data in fig6 also show that this desorption time scale was shorter than the adsorption time scale ( usually 70 - 90 minutes before breakthrough took place ), which makes vacuum regeneration practical in a swing fashion . this is an important result proving the feasibility of vacuum regeneration of carbons that have pores with dimensions close to molecular scales (& lt ; 20 å ). the strong effect of carbon oxidation on ammonia - sorption capacity is shown in fig9 . it is evident that carbon exposure to ambient air results in a tremendous increase in ammonia - sorption capacity ( up to a factor of 20 , depending on oxidation exposure time and temperature ). moreover , it was found that sorption enhancement due to carbon oxidation is retained upon multiple vacuum regenerations of the sorbent ( see fig6 ). the above results can be explained by the formation of weakly acidic carbon - oxygen complexes resulting from oxygen chemisorption on carbon during oxygen pre - treatment . it is believed that the surface acidity is sufficient to increase ammonia - sorption capacity , but not strong enough to significantly impair ammonia desorption in the vacuum - regeneration step . the initial drop in ammonia - sorption capacity represented by the difference between line 1 and all the other lines in fig6 is believed to be attributable to the presence of a small proportion ( about one third ) of strongly acidic sites , which tend to adsorb ammonia irreversibly . in the case of ammonasorb ii , which is a carbon impregnated with phosphoric acid , the carbon surface is composed of predominantly strong acidic sites , which , it is believed , is why only about 12 % of adsorbed ammonia can be vacuum - regenerated ( see fig7 ). like most of the data published in the literature , initial experiments performed pursuant to the present invention involved ammonia sorption from a flow of dry gas . it was believed that the effect of gas humidity was only modest for activated carbons (˜ 0 %- 136 % improvement for 40 % relative humidity ), as reported by luna et al ., 2010 , supra . when experiments with humid gas were performed , it was unexpectedly found that the performance of the present sorbents was improved by a factor of about 2 . 5 when inlet gas contained water vapor in addition to ammonia , oxygen , and nitrogen . these results are summarized in fig1 . since carbon - activation causes profound changes in the carbon pore structure ( pore - size distribution , specific surface area , pore volume , etc . ), it is not surprising that these changes should be reflected in ammonia - sorption performance data . an example of sorption - capacity curves for a carbon monolith derived from pvdc is shown in fig1 . a strong effect of carbon activation is evident in this case , but the magnitude of sorption enhancement ( or reduction ) depends on the nature of the carbon , its precursor , carbonization conditions , activation agent ( carbon dioxide , steam , oxygen ), and activation conditions ( temperature and hold time ). three types of pvdc were used in producing sorbents embodying the present invention , obtained from different suppliers , i . e . dow , solvay , and honeywell . the first two are commercial products that include some co - polymers and additives , whereas the honeywell pvdc was a high - purity research grade homopolymer . carbons prepared from the above precursors showed different performance characteristics , and monoliths from some of them were easier to fabricate than from others . in general , the honeywell pvdc carbon showed better sorption capacity than dow carbon , which in turn was better than solvay . side - by - side comparisons were conducted with three commercial carbons : calgon ammonasorb ii ( impregnated with phosphoric acid ), calgon bpl ( no acid impregnation or acid washing ), and norit darco ( acid - washed ). the comparison of monolithic carbon of the present invention with the state - of - the - art ammonasorb ii is shown in fig6 and fig7 , and the monolithic carbon is clearly seen to excel because of its regenerability and good sorption capacity . it should be noted that the ammonasorb ii sorption capacity shown in table 1 ( 19 . 6 mg / g ) is in good agreement with the results published by luna et al . 2010 , supra , for the same sorbent and similar sorption conditions ( 17 . 8 mg / g and 19 . 4 mg / g obtained in two separate experiments ). the ammonia - sorption capacity of oxidized monolithic carbons that were prepared using the dry technique , and whose carbonization temperature was not higher than 900 ° c ., was found to be a factor of 4 - 45 higher than the sorption capacity of calgon bpl ( see table 1 ). the corresponding factor for the above carbons with respect to norit darco was 0 . 72 - 7 . 5 . the comparison of sorption capacity of pvdc carbons with zeolite - based sorbents looks less favorable at first sight . under dry - gas conditions , zeolites were found to adsorb between 3 . 2 mg / g and 47 . 9 mg / g , and ammonia adsorption from a stream of humid air was somewhat lower : 0 . 5 - 38 . 8 mg / g ( luna et al ., 2010 ). another study showed , however , that regeneration of zeolites involves heating to elevated temperatures that are well in excess of 100 ° c ., and that the effectiveness of vacuum regeneration is limited ( liu , c . y . and aika , k ., “ ammonia adsorption on ion exchanged y - zeolites as ammonia storage material ,” j . of the japan petroleum inst . 46 ( 5 ), 301 - 307 , 2003 ). thus , it can be concluded that vacuum - regenerable carbon remains attractive for plss applications . pressure - drop measurements were performed for some of the foam - based monoliths of the invention , and fig1 shows the comparison of the data obtained with the calculated pressure drop for a corresponding packed bed of granular sorbent . the advantage of the monolith over a packed bed seems to be at least a factor of two , and a difference of about two orders of magnitude was found for monoliths with parallel channels ( wójtowicz , m . a ., florczak , e ., kroo , e ., rubenstein , e . p ., serio , m . a ., and filburn , t ., “ monolithic sorbents for carbon dioxide removal ,” proc . 36 th int . conf on environmental systems ( ices ), norfolk , va ., jul . 17 - 20 , 2006 , sae technical paper no . 2006 - 01 - 2193 , sae international , 2006 ). it has been shown experimentally that resistive heating to about 80 ° c . is rapid and effective in the case of carbon - sorbent monoliths . this was done by connecting electrodes to opposite ends of a duocel vitreous carbon foam , and applying ac voltage . the temperature of the carbon foam was monitored using a hand - held pyrometer . it was demonstrated that the temperature could easily reach about 80 ° c . within less than 30 seconds . it is reasonable to expect that more effective regeneration will occur when the sorbent is heated in addition to being exposed to vacuum .	1
now referring to the figures , fig1 shows an oblique view of an exemplary embodiment of the footrest with integral heater of the present invention . the footrest includes a base 1 having a cold air intake 3 , a base housing 2 and the components contained therein ( shown in more detail in the following figures ) for receiving a mass of cold air through the cold air intake 3 and heating and expelling a mass of warm air . vectors 8 indicate the mass of cold air being drawn into the cold air intake 3 , shown in the foreground of fig1 . once the mass of cold air is drawn into the base 1 of the footrest and heated to a desired temperature , it is expelled as a mass of warm air from a warm air exhaust on the rear of the base 1 ( not visible in fig1 ). vectors 9 indicate the origin and direction of travel the mass of warm air . a footplate 10 is provided attached to the base 1 of the footrest using one or more mounting devices 5 , as shown in fig1 . the footplate 10 is provided to support one or both feet of a user , and may be provided with multiple friction elements 11 allowing the footplate 10 to better grip the user &# 39 ; s feet . the footplate 10 may be provided with the general shape of an outline of a pair of human feet . the footplate 10 may also be provided with an adjusting mechanism allowing it to pivot around an axis formed by the mounting devices 5 shown in fig1 . in one embodiment , the adjusting mechanism comprises a flexible washer around each mounting device 5 . the footplate 10 may be only loosely connected to the base 1 using the mounting devices 10 . when the angle of the footplate 10 is depressed slightly , for example by the weight of a user &# 39 ; s foot , the elastic properties exhibited by the flexible washers in compression exert a reaction force on the footplate 10 balancing the downward force of the user &# 39 ; s foot . this is but one embodiment ; other provisions for an adjusting mechanism for the footplate 10 will be known to those skilled in the art . one or more mounting brackets 6 are provided attached to the base 1 of the footrest . the mounting brackets 6 are used to attach a warm air shield 15 to the base 1 . the warm air shield is provided to allow for the redirection of the mass of warm air onto the feet of a user of the footrest . the vectors 9 show the mass of warm air being redirected along the interior concave surface of the warm air shield 15 , from an initially vertical direction when the vectors 9 exit the base 1 of the footrest to a partially downward direction towards the footplate 10 . in this manner , a user who places her feet on the footplate 10 may have them warmed by the redirected mass of warm air represented by the vectors 9 . it should be understood that the design of the warm air shield 15 shown in fig1 is exemplary only and that a variety of interior surfaces may be provided for the warm air shield 15 in order to produce varying orientations of the vectors 9 indicating a mass of warm air directed over the feet of a user of the footrest . the warm air shield 15 may additionally incorporate a series of recesses 16 as shown in fig1 for aesthetic and / or functional purposes . in the embodiment shown , the recesses 16 are placed so as to allow a greater clearance between the warm air shield 15 and the footplate 10 , allowing a user of the footrest to more easily place her foot on the footplate 10 without the instep of the foot coming into contact with the warm air shied 15 . fig2 depicts an interior view of the base 1 of the previous figure . the base 1 includes a base plate 29 , having mounting brackets 26 for facilitating the attachment of the base housing 2 shown in the previous figure to the base plate 29 of the base 1 . mounted on the base plate 29 is a radial fan 21 adjacent to a heating element 23 , which is itself adjacent to a heating channel 22 . ambient air is drawn into the base 1 from the environment through the cold air intake 3 by the radial fan 21 . the airflow generated by the radial fan 21 is forced through the heating channel 22 , in which resides the heating element 23 , shown to the left of the radial fan 21 in fig2 . vectors 8 indicate a mass of cold air being drawn into the radial fan 21 and expelled across the heating element 23 in the heating channel 22 . as the mass of cold air traverses the heating element 23 , it warms and continues to travel down the heating channel 22 . the heating channel 22 terminates at a warm air exhaust 28 . the warm air exhaust 28 is matched to a gap in the base housing 2 covering the base 1 . vectors 9 indicating the path of a mass of warm air as it travels through the warm air exhaust 28 to pass through the gap in the base housing 2 , to be redirected onto the feet of a user of the footrest by the warm air shield 15 of fig1 . exhaust fins 27 are provided in the warm air exhaust 28 to more evenly distribute the passage of the mass of warm air along the warm air exhaust 28 from the heating channel 22 . the exemplary embodiment of fig2 shows the channel 22 fabricated from sheet metal bent , stamped and / or cut to form the desired channel shape . fig2 also shows a series of screw holes 25 formed in the structure of the channel 22 . these screw holes allow a cover ( not shown in fig2 ) to be placed over the channel 22 , confining the passage of the mass of warm air between the heating element 23 and the warm air exhaust 28 to the channel 22 . as shown in more detail in the following figure , the cover may be placed over the channel 22 and secured with sheet metal screws . alternative methods of attachment may be available , as is know to those skilled in the art . in an exemplary embodiment of the present footrest , the heating element 23 comprises a two - stage heater , similar to the type of heater found in home hair drying equipment . the heating element 23 may be more specifically comprised of bare , coiled nichrome wire wrapped around insulating mica boards . as is known to those skilled in the art , nichrome wire is an alloy of two metals , nickel and chromium . nichrome wire is a desirable choice for a filament of the heating element 23 because of its conductive properties , and because unlike ferrous or other metals , it fails to oxidize when heated . as an alternative embodiment , heating element 23 may comprise a solid resistive heating element outfitted with a heat sink . when the mass of cold air is initially propelled into the heating channel 22 by the radial fan 21 , it is much cooler than the nichrome wire of the heating element 23 . due to this fact , heat flows from the nichrome wire to the mass of cold air . how hot the mass of cold air passing over the heating element 23 becomes is dependent in large part on the power supplied to the heating element 23 . the higher the wattage , the more heat is generated in the heating element &# 39 ; s coils and transferred to the mass of cold air . the mass of cold air becomes heated immediately after passing over the heating element 23 and a mass of warm air is produced preferably moderately heated so that , while the mass of warm air is comfortable and soothing when directed at the feet of a user , it is not so hot as to be uncomfortable or dangerous . when mass of cold air is drawn into the base 1 of the footrest by the radial fan 21 , foreign particles may be pulled towards the cold air intake 3 . to prevent particles above a certain size from entering the base 1 , a wire screen is provided as part of the cold air intake 3 . without this screen , lint or other contaminants may build up inside the base 1 and be scorched by the heating element 23 , or they may clog the radial fan 21 itself . an excess of these contaminants inside the base 1 can also partially block the airflow into the heating channel 22 , potentially causing the heating element 23 to overheat due to the lessened airflow available to carry away the heat generated by the coils of nichrome wire . in the footrest depicted in fig1 and 2 , the base housing 2 may serve not only as a structural component of the footrest and to protect the component parts contained therein , but also to insulate the heating element 23 from transferring its heat directly to the base housing 2 and through it to the footplate 10 . an arch in the base housing 2 further distances the footplate 10 and with it the user &# 39 ; s feet from the heating element 23 . in this manner the user &# 39 ; s feet will be heated by the mass of warm air expelled from the warm air exhaust 28 ( represented by vectors 9 ), rather than by a conductance of heat directly to the footrest 10 itself . fig2 shows a wiring harness 24 comprising a power cord and other necessary components for providing current to the radial fan 21 and the electric heater 23 . proper composition and arrangement of these components are known to those skilled in the art . a high / low heat switch 20 may be supplied as part of the wiring harness 24 . this switch allows a user of the footrest to determine whether a greater or lesser amount of electrical power will be dissipated as heat by the heating element 23 . in an alternative embodiment , the high / low heat switch 20 may be provided mounted ( in a manner not shown ) on the footplate 10 shown in fig1 . the high / low heat switch 20 may additionally be mounted in a fashion allowing a user to select a desired heat setting using her foot . in a further embodiment , the footrest may be provided with certain safety features to protect a user from burns or electrical shock . one feature comprises a safety cut - off switch included in the wiring harness 24 . this safety cut - off switch ( not shown ) ensures that the mass of warm air expelled by the warm air exhaust 28 never exceeds a temperature above which it could possibly burn the skin of a user of the footrest . the safety cut - off switch may comprises a temperature sensitive device such as a bimetallic strip which would interrupt the flow of current to the heating element 23 when the temperature inside the heating channel 22 exceeded a certain limit . the wiring harness 24 shown in fig2 may also include a ground fault interrupt device ( also not shown ). as is known in the art , the ground fault interrupt device will trip and stop a flow of current through a pair of lines if it senses an imbalance between the current flowing in the hot and neutral lines . in this manner , were the wiring harness 24 to become improperly grounded and cause a potentially dangerous situation , the ground fault interrupt device would trip before significant harm could be caused . fig3 shows an overhead view of the base 1 of the footrest from fig2 , with the addition of a cover plate 30 over the previously exposed heating channel 22 . a series of screws 31 are provided corresponding to the screw holes 25 of the previous figure . with the cover plate 30 attached to the heating channel 22 using the screws 31 , an enclosed and relatively airtight passage is created between the radial fan 21 and the warm air exhaust 28 . in this manner the radial fan can create a zone of high pressure at the beginning of the heating channel 22 forcing air across the heating element 23 and out the warm air exhaust 28 . fig4 depicts multiple overhead views of the exposed interior of the base 1 from fig2 . these views better depict the details of various components of the present footrest , including the cold air intake 3 , high / low heat switch 20 , radial fan 21 , heating channel 22 , heating element 23 , wiring harness 24 , mounting bracket 26 , warm air exhaust 28 and the base plate 29 . heretofore the invention has been discussed having a radial fan 21 for moving a mass of air through the footrest . a radial fan preferred given its quiet operation . however , alternatives exist to the radial - type are known in the art . in a series of alternative embodiments , a medium or high speed radial , axial , or drum type fan , a duct propeller fan , or a blower type fan driven by an electric fan motor may be provided in the present footrest . the radial fan 21 preferably includes either an ac or a dc motor , which is directly coupled to the impeller of the radial fan 21 . the motor may be electrically coupled to a conventional switch , included as part of the wiring harness 24 , for turning the radial fan 21 on and off . this switch ( not shown ) may include multiple settings for various speeds which produce various air velocities for the mass of cold air propelled into the heating channel 22 . in an embodiment of the present footrest , the heating element 23 is electrically coupled to the radial fan 21 by the wiring harness 24 so that a common switch ( not shown ) activates each of the radial fan 21 and the heater element 23 . in another exemplary embodiment , the radial fan 21 and the heater element 23 may be separately controlled to disable the heating element 23 when the radial fan 21 is being operated so as to circulate a mass of cold air over the feet of a user of the footrest . in further alternative embodiments of the present footrest , the user &# 39 ; s foot may be heated by means other than heated air , such as by directing streams of steam to the user &# 39 ; s foot or heating the footplate 10 itself . these heating means may be used in addition to or instead of the heating arrangements described above in reference to fig1 – 4 . in another alternative embodiment of the present footrest , a pair of footplates are provided 10 , one to receive each foot of a user of the footrest . it will be understood that various modifications can be made to the disclosed embodiments of the present invention without departing from the spirit and scope thereof . therefore , the above description should not be construed as limiting the invention , but merely as an exemplification of preferred embodiments of the invention . those skilled in the art will envision other modifications within the scope and spirit of the present invention .	0
a first embodiment of the merchandise display system of the present invention is indicated generally at 100 and is shown in fig1 – 9 . display system 100 includes a lockable rod assembly 102 , a hanging assembly 104 which hangs from rod assembly 102 and a lockable merchandise display case 106 which is connected to and hangs from hanging assembly 104 . hanging assembly 104 is configured to allow display case 106 and merchandise 122 within to pivot and swivel in a manner such that the consumer can easily handle case 106 and view merchandise 122 within case 106 . lockable rod assembly 102 includes an inner end 108 which is lockable to a peg board 110 or the like . inner end 108 may also be securely fixed to a wall or other type of display unit . rod assembly 102 includes lockable base assembly 109 adjacent inner end 108 . rod assembly 102 further includes an upper rod 112 and a lower rod 114 which are substantially parallel and extend outwardly and horizontally from inner end 108 to an outer end 116 . inner rod assembly 102 further includes a locking mechanism 118 adjacent outer end 116 , the locking mechanism locking onto rod 114 to prevent removal of merchandise from lower rod 114 . one embodiment of a rod assembly that may be used is more fully described in u . s . pat . no . 6 , 474 , 478 granted to huehner et al . on nov . 5 , 2002 , and said patent is incorporated herein by reference . display case 106 includes an interior chamber 120 in which is inserted an item of merchandise 122 . display case 106 includes a front side 119 , a back side 121 , and a pair of lateral sides 123 . display case 106 further includes an upper end 124 and a lower end 126 . a lockable door 128 is hingedly connected to case 106 by hinge 130 adjacent lower end 126 . case 106 also includes an upper wall 132 adjacent upper end 124 in opposed relation to door 128 . upper wall 132 defines a pair of slots 134 for receiving a portion of hanging assembly 104 as described below . any of a variety of known lockable cases may be used as display case 106 . in accordance with the present invention , hanging assembly 104 includes a hanging member 136 , a swivel member 138 , a u - shaped lower member 140 and a cap 142 . hanging member 136 has an upper portion 144 which defines a hole 146 for receiving lower rod 114 . hanging member 136 further includes a lower portion 148 which includes a pair of downwardly extending spaced prongs 150 each of which includes a neck 152 , a shoulder 154 extending outwardly from neck 152 and a surface 156 which tapers downwardly and inwardly from shoulder 154 . swivel member 138 defines a vertical hole 158 for receiving prongs 150 of hanging member 136 . swivel member 158 further includes shoulders 160 ( fig4 ) which separate a cylindrical upper chamber 162 and a cylindrical lower chamber 164 of hole 158 , the upper chamber having a smaller diameter than the lower chamber . hole 158 is configured to receive prongs 150 of hanging member 136 such that shoulders 160 and shoulders 154 engage one another in a snap fit engagement which prevents removal of hanging member 136 from swivel member 138 . tapered surfaces 156 facilitate in section of prongs 150 into hole 158 . cap 142 covers lower chamber 164 of hole 158 and may do so by snap fit engagement or be secured in another manner known in the art . swivel member 138 has ends 166 , from each of which extend downwardly an inner tab 168 and an outer tab 170 opposed to one another in spaced relation to define a slot 172 . outer tab 170 defines a horizontal hole 173 . u - shaped lower member 140 includes a substantially flat and rectangular base member 174 from which extend upwardly a pair of spaced tabs 176 in opposed relation to one another . each tab 176 has an outer surface 178 from which extends a dome - shaped knob 180 . base member 174 of lower member 140 is configured to be positioned in interior chamber 120 of display case 106 adjacent upper wall 132 to provide the connection of member 174 to case 106 . tabs 176 of member 140 extend through slots 134 in upper wall 132 of display case 106 and into slots 172 of swivel member 138 . knobs 180 slide into respective holes 173 in outer tabs 170 to form a snap fit engagement . an axis 182 extends vertically through hole 158 of swivel member 138 and also between prongs 150 of hanging member 136 . an axis 184 passes through knobs 180 , as shown in fig8 . in operation , hanging assembly 104 allows display case 106 to be maneuvered easily in a great variety of positions so that a consumer can easily view all sides of merchandise 122 encased therein . fig5 – 9 indicate the various positions of the case and show its maneuverability and overall use . as seen in fig5 , hanging assembly 104 is in a display position as it ordinarily would be for display purposes as it hangs from lower rod 114 of rod assembly 102 . in this position , swivel member 138 and display case 106 are situated substantially normal to lower rod 114 as viewed from above . fig6 shows hanging assembly 104 along with display case 106 in a position rotated approximately 90 ° from the position shown in fig5 about axis 182 . in this position , swivel member 138 and display case 106 are situated substantially parallel to lower rod 114 as viewed from above . swivel member 138 swivels about axis 182 as supported by shoulders 160 resting on shoulders 154 of prongs 150 . the diameter of upper chamber 162 of hole 158 is large enough to allow chamber 162 to rotate about neck 154 of prongs 150 while the diameter of lower chamber 164 likewise allows rotation about tapered surfaces 156 of prong 150 . cap 142 functions to prevent tampering with prongs 150 by a shoplifter attempting to break prongs 150 or disengage them from within hole 158 . the display position of fig5 shows upper wall 132 , front side 119 and lateral sides 123 . fig6 , like fig5 , continues to show upper wall 132 and the same lateral side 123 , but in the 90 ° swivelled position also shows back side 121 of case 106 . fig7 shows hanging assembly 104 and display case 106 rotated approximately 180 ° from the display position shown in fig5 . thus , fig7 shows back side 121 and upper wall 132 along with the other lateral side 123 of display case 106 . the rotational movement of swivel member 138 allows swivel member 138 and display case 106 to rotate 360 ° about axis 182 , thereby allowing all sides of display case 106 and merchandise 122 encased therein to be seen by consumers . because a plurality of items of merchandise 122 are displayed within respective cases 106 hanging from lower rod 114 , ordinarily the simple rotational movement allowed by swivel member 138 may not be sufficient to allow a consumer to view all the sides easily due to interference of such movement by the other cases 106 . this difficulty is resolved by the additional ability of hanging assembly 104 to pivot upwardly as shown in fig8 . more particularly , lower member 140 is configured to rotate about axis 184 which passes through knobs 180 . tabs 176 of lower member 140 move freely within slots 172 defined by swivel member 138 and knobs 180 move freely within respective holes 173 . however , the snap fit engagement of knobs 180 into holes 173 is sufficiently secure to prevent removal by a shoplifter or make such removal rather difficult . the rotational motion about axis 184 allows display case 106 to travel an arc of at least 180 ° in the direction between inner end 108 and outer end 116 of rod assembly 102 , limited only by interference with lower rod 114 , locking mechanism 118 , base assembly 109 , peg board 110 , or any other display cases 106 hanging from rod 114 . referring back to the position shown in fig6 , the rotational motion indicated in fig8 from the position shown in fig6 would allow case 106 to be moved in a far broader arc approaching that of a full circle , limited only by the interference with upper rod 112 and other such members . the overall movement allowed by the rotation about axes 182 and 184 allows display case 106 to be maneuvered in nearly any position so that item of merchandise 122 can be easily viewed and relevant information read from all sides of said item . the overall movement of display case 106 is also facilitated and enhanced by the fact that hanging assembly 104 is able to rotate about lower rod 114 . fig9 shows display case 106 rotated upwardly towards outer end 116 of rod assembly 102 . further , lockable door 128 is shown in an open position after rotating about hinge 130 . finally , item of merchandise 122 is shown being removed from case 106 . thus , merchandise display system 100 provides a secure system by which items of merchandise 122 are encased in display cases 106 which have lockable doors 128 to prevent merchandise 122 from being removed without authorization . further , system 100 prevents unauthorized removal from lower rod 114 of hanging assembly 104 and display case 106 hanging therefrom . system 100 also allows the consumer to maneuver display case 106 with item of merchandise 122 therein to easily view merchandise 122 without the need for removal from rod 114 . thus , system 100 provides security for the seller as well as convenient review of merchandise 122 for the consumer . a second embodiment of the merchandise display system of the present invention is indicated generally at 200 and is shown in fig1 – 15 . display system 200 includes a lockable rod assembly 202 , a hanging assembly 204 which hangs from rod assembly 202 and a lockable merchandise display case 206 which is connected to and hangs from hanging assembly 204 . hanging assembly 204 is configured to allow display case 206 and merchandise 222 within to pivot and swivel in a manner such that the consumer can easily handle case 206 and view merchandise 222 within case 206 . lockable rod assembly 202 includes an inner end 208 which is lockable to a peg board 210 or the like . rod assembly 202 includes lockable base assembly 209 adjacent inner end 208 . rod assembly 202 further includes an upper rod 212 and a lower rod 214 which are substantially parallel and extend outwardly and horizontally from inner end 208 to an outer end 216 . inner rod assembly 202 further includes a locking mechanism 218 adjacent outer end 216 , the locking mechanism locking onto rod 214 to prevent removal of merchandise from lower rod 214 . rod assembly 202 is more fully described in u . s . pat . no . 6 , 474 , 478 , as noted above . display case 206 includes an interior chamber 220 in which is inserted an item of merchandise 222 . display case 206 includes a front side 219 , a back side 221 , and a pair of lateral sides 223 . display case 206 further includes an upper end 224 and a lower end 226 . unlike display case 106 , display case 206 does not have a lockable door adjacent the lower end . instead , display case 206 includes an inner shell 228 and an outer shell 229 which rotate about a pair of common hinge pins 230 ( fig1 ) between a closed position ( fig1 ) and an open position ( fig1 ), the inner shell and outer shell being lockable in the closed position . in accordance with the present invention , hanging assembly 204 includes a hanging member 236 , a swivel member 238 , hinge pins 230 and a cap 242 . hanging member 236 has an upper portion 244 which defines a hole 246 for receiving lower rod 214 . hanging member 236 further includes a lower portion 248 which includes a pair of downwardly extending prongs 250 each of which includes a neck 252 , a shoulder 254 extending outwardly from neck 252 and a surface 256 which tapers downwardly and inwardly from shoulder 254 . swivel member 238 defines a vertical hole 258 for receiving prongs 250 of hanging member 236 . swivel member 258 further includes shoulders 260 ( fig1 ) which separate a cylindrical upper chamber 262 and a cylindrical lower chamber 264 of hole 258 , the upper chamber having a smaller diameter than the lower chamber . hole 258 is configured to receive prongs 250 of hanging member 236 such that shoulders 260 and shoulders 254 engage one another in a snap fit engagement which prevents removal of hanging member 236 from swivel member 238 . tapered surface 256 facilitates in section of prongs 150 into hole 258 . cap 242 covers lower chamber 264 of hole 258 and may do so by snap fit engagement or be secured in another manner known in the art . swivel member 238 has ends 266 and a pair of arms 268 extending downwardly adjacent respective ends 166 . arms 268 define a pair of respective horizontal holes 273 which are substantially in alignment with one another and also configured to align with hinge holes 231 formed in inner shell 228 and hinge holes 233 formed in outer shell 229 of display case 206 . hinge pins 230 are inserted in hinge holes 231 and 233 and into hole 273 in arms 268 , thereby allowing for rotational movement about axis 235 ( fig1 ), which extends through hinge pins 230 . this rotational movement may be accomplished , for example , by the diameters of hinge holes 233 of outer shell 229 forming a snug fit with hinge pins 230 while hinge holes 231 of inner shell 228 and holes 273 of arms 268 are large enough to permit a rotational movement of hinge pins 230 . in operation , hanging assembly 204 allows display case 206 to be maneuvered easily in a great variety of positions so that a consumer can easily view all sides of merchandise 222 encased therein . fig5 – 7 showing the first embodiment of the present invention are generally applicable as to the movement of the second embodiment as well , and in combination with fig1 – 15 , indicate the various positions of the case and show its maneuverability and overall use . hanging assembly 204 functions in the same manner as hanging assembly 104 in regard to the rotational or swiveling properties as viewed from above , as described in regard to assembly 104 above . like assembly 104 , hanging assembly 204 pivots upwardly as shown in fig1 . while the same motion is allowed , assembly 204 utilizes a different configuration to achieve that effect . more particularly , with hinge pins 230 inserted into hinge holes 231 and 233 of display case 206 and holes 273 of arms 268 , display case 206 is able to rotate about axis 235 with respect to swivel member 238 . the maneuverability of display case 206 about axis 235 is essentially the same as display case 106 about axis 184 . further , the overall maneuverability of display case 206 is substantially the same as that of case 106 , as described above . fig1 shows display case 206 rotated upwardly towards outer end 216 of rod assembly 202 . fig1 also shows display case 206 in an open position . display case 206 differs from case 106 in that display case 206 includes an inner shell 228 and an outer shell 229 that pivot with respect to one another about axis 235 with the use of hinge pins 230 . fig1 further shows item of merchandise 222 being removed from case 206 . inner shell 228 and outer shell 229 may be locked to one another in a closed position ( fig1 ) to prevent unauthorized removal of merchandise 222 . thus , merchandise display system 200 provides a secure system by which items of merchandise 222 are encased in display cases 206 which have lockable inner and outer shells 228 and 229 to prevent merchandise 222 from being removed without authorization . further , system 200 prevents unauthorized removal from lower rod 214 of hanging assembly 204 and display case 206 hanging therefrom . system 200 also allows the consumer to maneuver display case 206 with item of merchandise 222 therein to easily view merchandise 222 without the need for removal from rod 214 . thus , system 200 provides security for the seller as well as convenient review of merchandise 222 for the consumer . a third embodiment of the merchandise display system of the present invention is indicated generally at 300 and is shown in fig1 – 23 . display system 300 includes a lockable rod assembly 302 , a hanging assembly 304 which hangs from rod assembly 302 and a lockable merchandise display case 306 which is connected to and hangs from hanging assembly 304 . hanging assembly 304 is configured to allow display case 306 and merchandise 322 within to pivot and swivel in a manner such that the consumer can easily handle case 306 and view merchandise 322 within case 306 . lockable rod assembly 302 includes an inner end 308 which is lockable to a peg board 310 or the like . rod assembly 302 includes lockable base assembly 309 adjacent inner end 308 . rod assembly 302 further includes an upper rod 312 and a lower rod 314 which are substantially parallel and extend outwardly and horizontally from inner end 308 to an outer end 316 . inner rod assembly 302 further includes a locking mechanism 318 adjacent outer end 316 , the locking mechanism locking onto rod 314 to prevent removal of merchandise 322 from lower rod 314 . rod assembly 302 is the same as assemblies 102 and 202 . display case 306 includes an interior chamber 320 in which is inserted an item of merchandise 322 . display case 306 includes a front side 319 , a back side 321 , and a pair of lateral sides 323 . display case 306 further includes an upper end 324 and a lower end 326 . a lockable door 328 is hingedly connected to case 306 by hinge 330 . case 306 also includes an upper wall 332 adjacent upper end 324 in opposed relation to door 328 . upper wall 332 defines a pair of slots 334 for receiving a portion of hanging assembly 304 as described below . in accordance with the present invention , hanging assembly 304 includes a hanging member 336 , a swivel member 338 , a u - shaped lower member 340 and a cap 342 . hanging assembly 304 allows case 306 to be removed from rod assembly 302 when a lock is unlocked . the key that unlocks this lock may be the same key that unlocks rod assembly 302 . hanging member 336 includes an upper member 341 and a lower member 343 . upper member 341 of hanging member 336 has an upper portion 344 which defines a hole 346 for receiving lower rod 314 . a cylinder 345 defining an interior chamber 347 ( fig2 ) extends downwardly from upper portion 344 of upper member 341 . cylinder 345 has a lower end 337 and defines an annular recessed area 339 adjacent lower end 337 . recessed area 339 is part of interior chamber 347 . lower member 343 includes a lower portion 348 and a generally cylindrical rod 349 extending upwardly therefrom . rod 349 defines a notch 351 extending lengthwise on one side of rod 349 . an annular flange 357 complementary to recessed area 339 extends radially outward from rod 349 below notch 351 . a plate spring 353 is disposed within interior chamber 347 of cylinder 345 to one side of chamber 347 . in an assembled form , rod 349 of lower member 343 is disposed within interior chamber 347 of cylinder 345 with annular flange 357 disposed within recessed area 339 in a snap - fit engagement . in a locked position ( fig1 ), plate spring 353 is partially disposed within notch 351 and engages an upper portion of rod 349 . fig2 shows hanging assembly 304 in an unlocked position wherein a magnetic key 355 attracts the portion of plate spring 353 which was disposed within notch 351 in the locked position so that plate spring 353 lies flat outside the bounds of notch 351 . swivel member 338 , cap 342 and u - shaped lower member 340 are identical to their counterparts in the first embodiment as described above . however , in accordance with the present invention , fig2 and 21 show an alternate embodiment of a lockable rod assembly 303 . rod assembly 303 includes a pair of ends 305 which may be fixed to a display or which can be locked in a lockable base assembly 307 connected to a peg board 309 or the like . at least one base assembly 307 is configured to allow upper portions 344 to be placed on the rod when assembly 307 is unlocked . in operation , hanging assembly 304 functions in the same manner as hanging assembly 104 of the first embodiment , except for the removably connected upper and lower members 341 and 343 of hanging member 336 and the locking mechanism created by upper member 341 , lower member 343 and plate spring 353 . in addition , the maneuverability of display system 300 is altered somewhat by the use of the alternate u - shaped lockable rod assembly 303 , as described below . when rod 349 is disposed in interior chamber 347 with flange 357 forming a snap - fit engagement with recessed area 339 , flange 357 supports the lower portions of hanging assembly 304 along with display case 306 and merchandise 322 . however , this snap - fit engagement still allows reasonably easy removal of rod 349 from interior chamber 347 when hanging assembly 304 is in the unlocked position . the locking mechanism of hanging member 336 functions as follows . rod 349 is inserted into interior chamber 347 of cylinder 345 so that the inwardly extending portion of plate spring 353 is depressed outwardly until notch 351 aligns with said portion of plate spring 353 , thereby allowing said portion of plate spring 353 to move inwardly into notch 351 and engage an upper portion of rod 349 , to prevent removal of rod 349 from interior chamber 347 of cylinder 345 . to unlock the locking mechanism , magnetic key 355 is placed against cylinder 345 adjacent plate spring 353 to attract the inwardly disposed portion of plate spring 353 , thus removing said portion of plate spring 353 from within notch 351 , as shown in fig2 . rod 349 may be removed from interior chamber 347 , as shown in fig2 . this allows the lower portion of hanging assembly 304 to be removed along with display case 306 and item of merchandise 322 as desired . this gives an alternative method of removing display case 306 from rod 314 or rod assembly 303 without having to unlock the rod assembly itself . as viewed from above , u - shaped lockable rod assembly 303 allows for similar movement as with rod assembly 302 , which as noted above , is the same as assemblies 102 and 202 . however , the maneuverability of display case 306 hanging from rod assembly 303 is not limited by an upper rod or a locking mechanism at the end of an upper and lower rod as is the case with rod assembly 302 . similar to rod assembly 302 , assembly 303 would be limited by any additional display cases 306 hanging from rod assembly 303 . however , maneuverability would also be limited by a peg board 309 or the like . nonetheless , display case 306 is able to rotate in a 360 ° arc as viewed from above and also may rotate about axis 384 such that it may travel an arc of at least 180 ° in a direction between a pair of ends 305 of rod assembly 303 . thus , merchandise display system 300 provides a secure system by which items of merchandise 322 are encased in display cases 306 which have lockable doors 328 to prevent merchandise 322 from being removed without authorization . further , system 300 prevents unauthorized removal from lower rod 314 of hanging assembly 304 and display case 306 hanging therefrom . assembly 300 also allows the consumer to maneuver display case 306 with item of merchandise 322 therein to easily view merchandise 322 without the need for removal from rod 314 . thus , system 300 provides security for the seller as well as convenient review of merchandise 322 for the consumer . a fourth embodiment of the merchandise display system of the present invention is indicated generally at 400 and is shown in fig2 – 30 . display system 400 includes a lockable rod assembly 402 , a hanging assembly 404 which hangs from rod assembly 402 and a lockable merchandise display case 406 which is connected to and hangs from hanging assembly 404 . hanging assembly 404 is configured to allow display case 406 and merchandise 422 within to pivot and swivel in a manner such that the consumer can easily handle case 406 and view merchandise 422 within case 406 . lockable rod assembly 402 is the same as rod assembly 102 and functions in the same manner . in addition , display case 406 is similar to display case 106 except that upper wall 432 , instead of defining a pair of slots , defines a pair of holes 434 . as viewed from above , holes 434 are substantially shaped like a cross - section of a light bulb wherein there is a circular portion 433 with a u - shaped portion 435 extending outwardly therefrom . in accordance with the present invention , hanging assembly 404 includes a hanging member 436 and a swivel member 438 . hanging member 436 has an upper portion 444 which defines a hole 446 for receiving lower rod 414 . upper portion 444 also includes a pair of ears 445 extending outwardly therefrom . hanging member 436 further includes a lower portion 448 which includes a downwardly extending neck 452 from which extends downwardly a spherical member 450 . swivel member 438 defines a vertical cylindrical hole 458 for receiving spherical member 450 of hanging member 446 . hole 458 is bounded by cylinder 447 having an upper end 449 and a lower end 451 . hole 458 is narrowed adjacent upper end 449 of cylinder 447 by inwardly extending annular flange 453 . a pair of wings 455 extend horizontally outwardly from cylinder 447 adjacent lower end 451 . a pair of ribs 457 extend outwardly in a vertical plane from cylinder 447 and upwardly from respective wings 455 . a pair of spaced locking tabs 459 extend downwardly from respective wings 455 . as shown in fig2 – 28 , each locking tab includes a neck 461 extending downwardly from respective wing 455 and a substantially circular foot 463 connected to neck 461 there below . in relation to neck 461 , foot 463 extends toward front side 419 of display case 406 when swivel member 438 is connected thereto , and foot 463 also extends laterally toward lateral sides 423 of case 406 . each locking tab 459 also includes a finger which extends downwardly from respective wing 455 and outwardly from respective neck 461 away from the forward extension of foot 463 such that finger 465 extends toward back side 421 of display case 406 when swivel member 438 is installed thereon . in assembling hanging assembly 404 , upper portion 444 of hanging member 436 is inserted upwardly through hole 458 of swivel member 438 so that upper portion 444 is disposed above cylinder 447 and spherical member 450 rests against annular flange 453 . the distance defined by the outermost portions of ears 445 is larger than the diameter defined by the innermost portion of annular flange 453 . ears 455 nonetheless slide past flange 453 so that during assembly ears 445 prevent hanging member 436 from slipping back through hole 458 before hanging member 436 is hung on lower rod 414 of rod assembly 402 . the diameter of spherical member 450 is wide enough to prevent spherical member 450 from being pushed upwardly beyond annular flange 453 , but is small enough to allow easy movement within hole 458 of cylinder 447 . locking tabs 459 form a locking engagement with display case 406 when inserted properly into holes 434 . fig2 – 28 indicate how locking tabs 459 are inserted into holes 434 . first , each foot 463 is aligned with and inserted into a respective circular portion 433 of hole 434 . each foot 463 is then slid toward front side 419 of case 406 so that each neck 461 fits into a respective u - shaped portion 435 . simultaneously , each finger 465 slides along upper wall 432 until it snaps downwardly into a respective circular portion 433 of hole 434 . once in this configuration , as shown in fig2 , locking tabs 459 form a locking engagement with case 406 . in operation , hanging assembly 404 allows display case 406 to be maneuvered easily in a great variety of positions so that a consumer can easily view all sides of merchandise 422 encased therein . hanging assembly 104 functions somewhat similarly to the previous embodiments in that it allows for substantially the same type of movement . particularly , assembly 404 and case 406 may be rotated 360 ° about vertical axis 482 . in addition , the ball and socket configuration of assembly 404 allows swivel member 438 and display case 406 to pivot upwardly in any direction from axis 482 . while this upward movement is multi - directional , it is more limited than in the previous embodiments . the limiting factor is an interference between annular flange 453 or upper end 449 of cylinder 447 and neck 452 of hanging member 436 as swivel member 438 and display case 406 are moved in an upward direction . nonetheless , with the additional mobility provided by rotational movement of hanging member 436 about lower rod 414 , display case 406 may be maneuvered sufficiently to view any side of display case 406 without difficulty . thus , merchandise display system 400 provides a secure system by which items of merchandise 422 are encased in display cases 406 which have lockable doors 428 to prevent merchandise 422 from being removed without authorization . further , system 400 prevents unauthorized removal from lower rod 414 of hanging assembly 404 and display case 406 hanging therefrom . system 400 also allows the consumer to maneuver display case 406 with item of merchandise 422 therein to easily view merchandise 422 without the need for removal from rod 414 . thus , system 400 provides security for the seller as well as convenient review of merchandise 422 for the consumer . in the foregoing description , certain terms have been used for brevity , clearness , and understanding . no unnecessary limitations are to be implied therefrom beyond the requirement of the prior art because such terms are used for descriptive purposes and are intended to be broadly construed . moreover , the description and illustration of the invention is an example and the invention is not limited to the exact details shown or described .	0
as shown in the system of fig1 a laser beam 40 is emitted through a lens 30 , and is applied to a metal plate x which lays on a top portion of another plate y . the laser beam 40 should have sufficient energy to cut a plate x , and weld the molten metal from this cutting to a plate y . in fig1 a weld 10 can be been formed between the plate x and the plate y . the laser beam 40 may be surrounded with a gaseous shield in a nozzle 20 of the system . a compressed gas can be introduced to the nozzle via an opening 50 of the nozzle 20 . the gas exiting the nozzle 20 may remove some of the molten metal and improve cutting and welding parameters . different gases , mixtures of them , or compressed air could be used depending on the metals being cut and welded , their thickness and the cutting parameters . in some circumstances , gas or compressed air assistance may not be necessary . as shown in fig2 a clamp may include a plate 80 and a plurality of compression springs 60 which press the plate 80 to the metal plates x , y . the clamp is generally in the same position relative to the laser beam , and provides a pressure on the plate x around the beam . the clamp insures a tight contact of the plates x , y to one another in the area where the laser beam cutting and welding occurs . the plate 80 ( which slides along and on a surface of the plate x ) has an opening 70 through which the laser beam 40 passes to reach the plates x , y , while providing pressure on the plate x . the opening 70 should have a concentric shape and a sufficient size in order not to disturb the cutting and welding process ( e . g ., not to block the irradiation by the laser beam 40 ). an edge of the opening 70 can have a sharp - cut configuration such that when the plate 80 slides on the plate x , this edge can remove at least some if not all of the metal appearing on the plate x during the cutting and welding process . the excess metal can be blown and / or sucked out using a vacuum arrangement . in one exemplary embodiment of the present invention , the welding and simultaneously cutting procedures of the plates x , y could be implemented at the comers on the side of “ home ” or “ reference ” position of a cnc table ( not shown ), i . e ., without the need to perform such procedures at other sections of the plates x , y . this is performed especially when extremely detailed cutting is needed . the cutting and welding path can be controlled by either traversing the laser beam 40 or moving the plates x , y through a stationary beam . any conventional mechanical moving arrangement , such as the cnc table , can be used along with suitable electronic controls for performing the laser operation . as shown in fig2 a vacuum chuck clamp 90 can be used to secure the plate y into a proper position , and to assure its parallel position to the cnc table . by evacuating a vacuum chamber 100 , a force is preferably exerted onto the plate y which holds and maintains the plate y on the vacuum chuck clamp 90 . in another possible exemplary embodiment of a method for securing the plate x into a proper position on the plate y can be performed by tack - welding the corners of the plate x to the plate y , while being under the pressure of the clamp . the plate x can also be secured on the plate y by simultaneously cutting and welding ( while under the pressure of the clamp ) on the four corners of the plate using small welded circles having the size of spot welding . it is possible that other types of clamps and plate securing methods different than the above described method can be used to maintain the plates x , y in the proper position and / or alignment . although the examples shown in the drawings include a disk and a ring , it should be appreciated that almost any design can be fabricated using the method described herewith . various designs generally consist of an outside line , and possibly an inside lines . to illustrate the application of the disclosed method , fig3 a , 3b , and 3 c show the example of cutting a disk from one plate x and affixing it by welding to a second plate y . fig3 a shows the top view of the plates x , y from the top view , where a circle 110 is cut , in which a disk is formed and welded onto the plate y by the laser beam 40 . in this exemplary embodiment of the method according to the present invention , the plates x , y are tightly pressed together , and the laser beam 40 is utilized to produce a specific design configuration ( e . g ., a circle ). gas or compressed air may be used depending on the parameters of the application . if a part of the plate x that is external of the circle 110 is removed through a peeling process , the disk formed from such part of the plate x inside the circle 110 would remain welded to the plate y ( as shown in fig3 b ). the circular cut and welding of the disk to the plate y occur simultaneously according to the present invention . to conserve the quantities of the used precious metal , a further circle 120 can be cut in the metal plate y prior to the placement of the plate x on the plate y . the disk contained in the circle 120 can then be removed and recycled , as shown in fig3 c . another exemplary embodiment of the method according to the present invention is provided for cutting and welding a metal ring , which is formed by cutting two concentric circles in the plate x , and simultaneously welding the circles to the separate metal plate y is shown in fig4 a and 4b . fig4 a shows the plate x provided on the plate y with two circles 210 , 220 simultaneously cut to form the metal ring which is welded unto the plate y . in order for the metal ring between the circles 210 , 220 of the plate x to remain on the plate y , it is may be advantageous to initially remove the metal surrounding the circle 210 using a peeling process , and then remove the metal disk inside the circle 220 . if the plate y has an opening 230 as shown in fig4 b , then the metal disk inside of circle 220 on the plate x may be removed by applying the pressure to the metal disk through the opening 230 in the plate y . if the plate y does not have the opening 230 , then the removal of the metal disk inside of the circle 220 can be done by various methods , such as the exemplary methods described below : in fig5 a , a u - shaped hook 240 can be cut into the plate x . the u - shaped hook 240 is then used as a handle for removing the metal disk inside the circle 220 , as shown in fig5 b . other shapes besides the u - shape hook 240 can also be suitable for a use in this exemplary embodiment of the method according to the present invention . cutting the u - shape hook 240 should preferably be done prior to the placement of the plate x on the plate y in order not to leave any marks on the surface of the plate y . the ( upper ) plate x can be a thin metal plate or a foil ( e . g ., 0 . 003 inches thick ). to flatten the metal plate x for the laser cutting , the metal plate x should be pressed with a clamp to a flat surface of the cnc table . glass or a similar material that would not stick ( e . g ., weld ) to the plate x when it is cut should be placed between the plate x and the cnc table to allow an easy removal of the plate x after the cutting procedure . a small excess of molten metal , may appear on both sides of the plate x in the area where the cutting action occurred . this excess of the molten metal on the bottom of the plate x may disturb the tight contact needed between the plates x , y which may be necessary later in the procedure . this excess of the metal may have to be removed with an abrasive material , such as sandpaper , and / or by using a sanding machine , etc . the metal disk inside of the circle 220 of the plate x can also be removed as shown in fig6 a . a metal strip 250 is placed and joined to a top portion of the plate x . then , this metal strip 250 can later be used as a handle to remove the metal disk inside of the circle 220 as shown in fig6 b . the joining of the strip 5 could be done by laser welding , or by using a spot weld 260 as shown in fig6 a . this procedure should be done carefully so as not to damage the plate y . it will be apparent that other processes of attaching the metal strip 250 to the plate x may also be utilized . a more secure joining procedure of the plates x , y may be performed using various methods . one such exemplary procedure utilizes a welding beam along the perimeter line . the above - described methods join the plates x , y on the perimeter of the configuration . to secure a bonding of the contacting surfaces of the plates x , y , a variety of bonding metal surface methods are usable according to the present invention . for example , such exemplary procedures may include fusion or diffusion weld bonding , brazing , soldering , and / or micro - welding . it should be understood that appropriate preparations for the selected method should be performed prior to laser cutting . in the case of an exemplary brazing procedure , a thin layer of a brazing material may be applied to the bottom part of the plate x before its placement ( e . g ., fig3 c shows an exception because , in this case , the brazing material could be applied through the opening in the plate y ). depending on the application , the bonding process described above can be performed with or without special atmosphere , vacuum , vacuum inert gas assisted atmosphere etc . for example , to join the plates x , y to one another , a thin layer of a bonding material can be applied as follows : method c . as a separate layer ( layer x 1 , as shown in fig8 ). when methods b or c are utilized , the bonding material ( what is exposed up after removing excess portions of the plate x ) may be stripped away . the stripping arrangement or compound preferably dissolves the bonding material , and does not effect the material and / or the composition of the plate y . for example , if the plate y is composed of copper , brass or karat gold alloy , and the bonding material is made of a high phosphorus electro - less nickel , the stripping arrangement / compound can be compound named 3136 - b manufactured by omg fidelity , inc . the plate x can be protected from stripping using , e . g ., any known mask . to achieve such bonding , a variety of bonding materials ( with a wide range of parameters ) can be used . provided below are examples of the bonding materials that are self - fluxing . in particular the first two examples of bonding materials are provided for brazing , and the last two are provided for soldering that covering temperature range approximately 1200 ° f . 1 . elnic 101 — manufacturer — macdermid inc . high phosphorus electro - less nickel plating solution . manufacturer suggests 0 . 0005 inch of deposit , melting point temperature 1630 ° f . exemplary experimentation : for bonding 0 . 003 inch thick plate x having a top area of 1 . 25 square inches ( and which is composed of a platinum material ) to 0 . 020 inch plate y ( composed of 18 karat gold material ), 0 . 0001 inch of deposit was utilized . the thinner such deposit , the easier it is to keep the gold standard of the object . this bonding can be applied using method a or method b . [ 0046 ] 2 . sil - fos — manufacturer — handy and harman this bonding arrangement / compound can have a form of a foil , a thickness as 0 . 0015 inch , and a melting point temperature of 1190 ° f . [ 0047 ] 3 . gold - tin , au - 80 %, sn - 20 %— manufacturer — williams advanced materials , having a melting point temperature of 536 ° f . [ 0048 ] 4 . gold - tin , au - 10 %, sn - 90 %.— manufacturer — williams advanced materials , having a melting point temperature of 423 ° f . for both examples 2 , 3 and 4 , the bonding can be applied using one of methods a , b , c , or a combination thereof . when stripping the bonding materials which are gold alloys that are used for joining the plates x , y , it is possible to utilize a process described in u . s . pat . no . 5 , 009 , 755 ( the “&# 39 ; 755 patent ”), the entire disclosure of which is incorporated herein by reference . for example , pure silver dissolves very slowly using the method disclosed in the &# 39 ; 755 patent , and its thin deposit on the top surface of the plate y would likely protect the plate y from the stripping process . this silver deposit could be stripped thereafter using a silver stripping arrangement / compound , e . g ., if the plate y is made from a karat gold alloy , it can be used as a stripping arrangement / compound , such as technic envirostrip ag manufactured by technic inc . to achieve an acceptable bonding result , the plate x and y preferably require a good contact of the superposed surfaces . this can be accomplished buy using graphite plates as a clamping device , because of its high coefficient of a thermal expansion . a variety of graphite materials with a wide range of their parameters can be used for this application . to accomplish bonding as mentioned in the example 1 , two plates of graphite r4340 which were a half an inch thick can be used . it is also possible to bond the plates x , y ( e . g ., by soldering , brazing , etc .). thereafter , a laser or another cutting arrangement can be used to cut , the plates x , y , and a procedure can be implemented that changes the characteristics of the bonding material so that is softened ( e . g ., by heating the bonding material ). then , the excess material of the plate x can be peeled off . it is possible for the bonding material still resident on the plate y after the procedure to be stripped away . using the exemplary methods described above , a single metal plate x is attached to the plate y . however the plate x can be replaced with two or more metal plates superposed on one another . these plates are cut and welded one to another , either simultaneously or in succession . when attaching two or more plates to the plate y in succession , a first plate x 1 , as shown in fig7 is first cut and welded to the plate y . the top of the plate x 1 may be prepared by removing any excess of the molten metal with an abrasive material such as sandpaper , and / or using a sanding machine , etc . then , a second plate x 2 may be placed on top of the first plate x 1 , and the cutting and welding process are repeated to yield a multi - layered metal object . this exemplary process may be continued for additional layers . the parameters of the process ( e . g ., energy of the laser beam , width of the cut , pressure of assistant gas or compressed air shield pressure , type of laser , etc .) may be adjusted according to each particular application . multiple metal plates can also be affixed simultaneously as shown in fig8 in which the arrangement of the first and second metal plates x 1 , x 2 is provided on top of the plate y . in this exemplary embodiment , a single laser beam can cut both of the plates x 1 , x 2 , and may weld the first and second plates x 1 , x 2 together and to the plate y . depending on the particular design , the pieces of one or both of the metal plates ( i . e ., the plate x 1 or the plate x 2 ) may be removed via a peeling procedure from either side of the cut . in the above - described techniques , the plate ( s ) used on top of the plate y should be of a sufficient thickness , such that when the excess metal is removed , the tear should appear only in the place of the cut or between two cuts ( if the excess metal is removed there between ), and possibly nowhere else . in one exemplary implementation , in a case when the plate x is a 0 . 003 inch thickness stainless steel 304 hard foil that is applied on the 0 . 020 brass plate y , the distance between two cuts can be as little as approximately 0 . 012 inches . also , when a 0 . 003 inch thickness heat treatable platinum foil is used for a material of the plate x applied on the 0 . 02 18 karat gold plate y , the distance between two cuts can be as small as approximately 0 . 016 inches . it should be understood that if this foil is thinner , the above - referenced distance between the two cuts may be greater . as indicated above , the energy of the laser beam should be enough to cut the plate x , and weld the molten metal produced from this cutting procedure to the plate y . if the metals of the plates x , y are made from dissimilar metals , and the plate x ( e . g ., the top plate ) may have a significantly higher melting temperature and / or a higher laser reflection factor , various techniques can be available for welding the two metals . of the plates x , y such techniques are described in various publication . for example , u . s . pat . no . 5 , 844 , 198 ( the entire disclosure of which is incorporated herein by reference ) discloses a method for using nd - yag “ pulse shaping ” laser for welding dissimilar metals with different melting points . u . s . pat . no . 4 , 023 , 005 ( the entire disclosure of which is incorporated herein by reference ) discloses a method for laser welding of the dissimilar metals with different reflectivity by covering a thin layer of metal with low reflectivity on a metal with high reflectivity . it is preferable for the surface tension parameter of the molten metal of the plate x to be taken into consideration . for example , if this parameter is relatively high ( e . g ., as for platinum ), it is difficult to split the molten metal by a stream of an assisted gas or air . when electro - less nickel is used as a bonding material , the cut can be made sufficiently smoother due to the fact that the molten alloy of a platinum nickel has a lower surface tension then platinum metal . the same effect may occur by placing a thin layer of a proper metal on the top of the plate x . in a case when it is desired for the thickness of the plate x needs to be thinner ( e . g ., 0 . 0001 inches instead of 0 . 0003 inches ), it is possible to clad the top surface of the plate x with a low reflectivity strong metal ( e . g ., nickel ), which could be stripped away after the processing is completed . in another embodiment of the present invention , it is possible to make the cuts described above with a configuration consisting of a group of lines . referring to fig2 the plate 80 of the clamp can slides on the surface of the plate x ( thus providing pressure to the plate x ) the plate 80 can also act as a heat sink to absorb heat from the plate x . as previously described , a small excess of the molten metal may appear on the top of the plate x during the procedure according to the present invention . this would affect the heat transfer from the plate x to the plate 80 , since the contact between these two plates may be partly interrupted . the irradiated area of the plates x , y is generally subjected to a thermal expansion , with a particular area of the plate x expanding more that a corresponding area of the plate y due to the plate x &# 39 ; s accumulation of more laser energy than the plate y ( and possibly due to the fact that the plate x may be significantly thinner than the plate y ). for this exemplary purpose , the cutting would preferably start from the lines in the center of the configuration , and extend outward to the perimeter thereof . cutting the lines in an opposite order ( i . e ., start from the lines at the perimeter lines and extending toward the center lines of the configuration may cause the center of the object to possible have a “ bubble ” at the end of this exemplary procedure . such bubble may cause the plate x lose contact with the plate y , and thus possibly only the plate x would be cut , without welding it to the plate y . this process according to the present invention can be used in different metal working techniques . these exemplary techniques can be as follows : a ) plate x - configuration can be used as a temporary mask for different processes on the surface of plate y ( e . g ., plating , etching , reticulation , etc .). when this exemplary process is completed , the mask ( e . g ., the plate x ) can be removed by using the procedure described above , and / or by dissolving it with a proper stripping arrangement . b ) the area of plate y that is exposed after removing one or more parts of the plate x can be used for a variety of processes such as inlay , granulation , applying metal powder , enamel etc . to achieve an inlay process in the exposed area of the plate y , it is possible to insert and bond an object from another material which can have a mirror image configuration of this area . this object can be produced by a laser - cutting procedure . in this exemplary procedure of an inlay process , it is possible to use other techniques to expose the area of plate y by peeling off the excess material for the plate x . in other exemplary techniques ( e . g ., see u . s . pat . no . 5 , 660 , 668 , the entire disclosure of which is incorporated herein by reference ), a laser beam evaporation method can be used . in another exemplary embodiment of the present invention , the top portions of the plates x , y plate can be slightly textured ( for example , via a sandblasting procedure , etc .). the top surface of the plate x ( when the plate x is a top plate ) can be heavily textured because it is free of contact with any other plate . however , the top surface of the plate y should not be heavily textured because the plate x should be bonded to it . the last cutting operation can be a step of cutting out the plate y to its own configuration . the laser cut edge of the plates x , y can be shaped by , e . g ., cnc tools , hand tools , etc . at the end , the entire item or resulting product can be bent and shaped into any preferable object ( e . g ., a three - dimensional object ). if a sophisticated motion and laser controllers are used , the plate surfaces do not have to be flat , and can utilize other configurations ( for example , a cylindrical machining process , etc .). to ensure a particular level of the preciseness of the product produced by the cnc process , it is possible to use a cnc head ( after the use of the laser head ) that would utilize the same table as used by the laser head so as to cnc - machine the product ( e . g ., machining the edge of the plate x ). this cnc - machining procedure can use the same working file for its operation as the file used for the laser cutting procedure . in one exemplary embodiment of the system and method according to the present invention , nd : yag laser and the following parameters may be utilized : it should be appreciated that other lasers may also be utilized in a system for performing the method according to the present invention . such system may utilize a processing arrangement ( e . g ., a personal computer executing instructions for controlling the laser beams , and plate locations ). while the invention has been described in connection with preferred embodiments , it will be understood by those of ordinary skill in the art that other variations and modifications of the preferred embodiments described above may be made without departing from the scope of the invention . other embodiments will be apparent to those of ordinary skill in the art from a consideration of the specification or practice of the invention disclosed herein . it is intended that the specification and the described examples are considered as exemplary only , with the true scope and spirit of the invention indicated by the following claims .	1
the invention is to be described hereinafter using specific working examples ( b ), and compared with the less highly performing systems of the prior art ( vb ). the working examples specified below serve to support the invention and to demonstrate the differences relative to the prior art , but they are not intended to limit the general subject matter of the invention , as it is defined in the claims . the components specified in tables 2a , 2b and 3 are compounded in a twin - screw extruder from werner and pfleiderer having a screw diameter of 25 mm , with specified processing parameters ( see table 1 ); the polyamide pellets along with the adjuvants are metered into the intake zone , while the glass fibers optionally used are metered into the polymer melt via a side feeder 3 barrel units ahead of the die . the compounded formulations were taken off in the form of an extruded strand , from a die having a diameter of 3 mm , and were pelletized after water cooling . after pelletizing and drying at 110 ° c . for 24 hours , the properties of the pellets were measured and the test specimens were produced . the compounded formulations were injected on an arburg allrounder 320 - 210 - 750 injection - molding machine to give specimens at defined barrel temperatures for zones 1 to 4 and at a defined mold temperature ( see table 1 ). the molding produced by injection molding in the form of a plate for comparative example vb3 and example b11 had a thickness of 2 mm ; the thickness of the iso test specimens was 4 mm . in example b11 , the foil b7 ( thickness 100 μm ) for the individual test specimens was cut to an exact fit and placed against the inner wall of the mold cavity , bearing against it over its full area . the foil was then in - mold - coated under the conditions specified in table 1 with the molding composition specified in table 3 . the foils were produced on a single - screw extruder for examples b1 to b11 and vb1 or on a dr . collin gmbh e 30 flat - film coextrusion unit ( e . g . vb2 ) having one ( two ) 30 mm 3 - zone screw ( s ). the foils were produced using a slot die / multilayer die . the dimensions of the foil were 200 mm width or 250 mm and 100 μm thickness . the foils were wound up using a chill roll and cut to the required length . the further production parameters can be seen in table 1 . in comparative example vb2 a 3 - layer foil with the layer sequence aba , layer a being a 5 to 10 μm layer of vb1 and the middle layer b being an 80 to 90 μm layer of pet ( with no additions ), was subjected to the laser structuring and subsequent electroless metallization , without the foil having been drawn and heat - set beforehand . the foil , which was smooth after extrusion , underwent warping during laser irradiation and became highly corrugated . the measurements were carried out according to the following standards on the following test specimens . the modulus of elasticity in tension was determined in accordance with iso 527 at a tensioning speed of 1 mm / min , the yield stress , breaking strength and elongation at break in accordance with iso 527 with a tensioning speed of 50 mm / min ( unreinforced versions ) or with a tensioning speed of 5 mm / min ( reinforced versions ) at a temperature of 23 ° c ., the specimen used being an iso tensile rod , standard : iso / cd 3167 , type a1 , 170 × 20 / 10 × 4 mm . impact strength and charpy notched impact strength were measured according to iso 179 on the iso test rod , standard : iso / cd 3167 , type b1 , 80 × 10 × 4 mm at 23 ° c . temperature . the thermal characteristics ( melting temperature ( tm ), enthalpy of fusion ( δhm ), glass transition temperature ( tg )) were determined on the pellets in accordance with iso standard 11357 - 11 - 2 . differential scanning calorimetry ( dsc ) was carried out with 20 ° c ./ min heating rate . for the glass transition temperature ( tg ), the temperature for the middle stage or for the point of inflection is reported . the relative viscosity ( ηrel ) was measured in accordance with din en iso 307 on 0 . 5 wt % strength solutions in m - cresol at 20 ° c . pellets are the sample used . to assess the metallization performance , injection moldings in vb3 and b11 ( plate 60 × 60 × 2 mm or , for example b11 , the in - mold - coated foil b7 in the same dimensions 60 × 60 × 2 mm ) and also foil sections with dimensions of 60 × 60 × 0 . 1 mm for examples b1 to b10 were structured using an nd : yag laser and afterward subjected to electroless metallization in a copperizing bath . for the laser structuring , 32 adjacent regions measuring 4 × 4 mm were irradiated on the surface of the molding . laser structuring took place using a trumpf trumark station 5000 laser at a wavelength of 1064 nm . the rate was varied in the range from 300 to 7200 mm / s , the pulse frequency in the range of 10 - 80 khz , and the hatch ( pulse overlap ) in the range from 0 . 03 to 0 . 09 mm ( fig1 ). following the laser structuring , the moldings are subjected to a cleaning operation in order to remove the residues from the laser process . in this procedure , the moldings passed through successively ultrasound baths containing surfactant and deionized water . after cleaning , the moldings are metalized in succession in reductive copperizing baths ( mid copper 100 xb strike and mid copper 100 xb build , macdermid ) at 55 to 65 ° c . the residence time here is 20 min in the strike bath and 1 - 3 h in the build bath . the rate of copper deposition ( thickness of the copper layer ) in the mid copper 100 xb build bath on the laser - irradiated areas averages 3 to 5 μm / h . the metallizability was calculated as the ratio of metalized fields to the total number of fields , and reported as a percentage fraction . in total 32 fields having different parameters per sample plate , as shown in fig1 , are structured with the laser and then metalized as described above . metalized fields are only the fields metalized uniformly and completely in the procedure described above . in all mid technologies , chemically reductive copper deposition is the key initial metallizing operation , and determines the quality of the layer as a whole . it is therefore completely sufficient for the quality of the primary metal layer to be assessed . in order to arrive at the completed mid part , building on the first copper layer ( primary layer ), generally nickel and then a final layer of immersion gold are deposited . of course other metal layers as well , such as further layers of copper , palladium , tin or silver , may also be applied to the primary layer . the foils are assessed for their planarity by inspection , using foil sections with dimensions of 60 × 60 × 0 . 1 mm or 150 × 150 × 0 . 1 mm , as used for the laser structuring , with assessment taking place in each case after foil production , after laser structuring , and after metallization . foil planarity is characterized as follows : +: foil lies flat on a smooth surface and at no point in the foil plane has visible elevations or depressions ; in other words , the foil is flat . o : foil does not lie flat on a smooth surface and in the foil plane clearly has a number of elevations or depressions which occupy a multiple of the foil thickness ; overall or in the region treated with the laser , the foil is corrugated . the compositions listed for b1 to b10 ( tables 2a and b ) can be readily processed by extrusion to give smooth , speck - free foils having a thickness of 100 micrometers . the mechanical properties determined on iso specimens show that for these molding compositions , elongation at break and impact strength are high and breaking strength is good . the foils can all be structured and metalized to good or very good effect , without the thin foils becoming damaged . it was also found that the metal layer applied electrolessly to the foils possesses very good adhesion to the foil material . accordingly , the metalized foils can be rolled up multiply to give a roll having a diameter ( d ) of less than or equal to 10 mm without any observation of detachment or visible damage to the metal layer . the foils in experiments b5 , b7 and b8 - b10 retain their planarity , moreover , after laser structuring and metallization , whereas other foils , especially those of vb1 and vb2 , undergo warping as early as during laser structuring , or at the latest during metallization , becoming corrugated and so completely losing their flat form . table 3 contains the comparison between an injection molding containing the lds additive throughout ( vb3 ) and a molding of the same size produced by in - mold - coating of the foil b7 ( example b11 ), which contains the lds additive in a thin surface micrometers thick . the layer formed from the in - mold - coated plastic is free from lds additives . the in - mold - coated foil adheres very well and over the full area to the in - mold - coated plastic , making the foil layer impossible to detach without destruction . the molding produced by in - mold - coating has significantly better mechanical properties . thus for inventive example b11 , with a higher modulus of elasticity , the breaking strength is 35 %, the elongation at break is 40 %, the impact strength is 90 %, and the notched impact strength is more than 100 % higher than for vb3 , and with equally good metallizability on the part of the molding . a further advantage of b11 is the much lower level of lds additive required for the production of laser - structurable moldings of this kind . overall , based on the molding , much less lds additive is necessary for b11 , specifically just 1 / 20 of the lds additive amount for vb3 in order to achieve equally good metallizability on the part of the molding .	2
as can be seen in fig1 , a device 10 for injecting pharmaceutical liquid may be in the form of a single - use syringe 10 . this device 10 is configured to be prefilled , so as to be able to store the pharmaceutical liquid over a relatively long period before injecting it . the device 10 comprises a liquid storage reservoir 12 , which has two opposite ends , namely a proximal end 14 and a distal end 16 . each of the ends 14 , 16 is provided with an orifice 14 a , 16 a . more specifically , the storage reservoir 12 has a tubular shape with circular cross section and has at its proximal end 14 , a flange 18 , and at its distal end 16 , a part intended to receive an added injection needle , introduced into the orifice 16 a . the device 10 is arranged to receive a plunger , similar to the plunger 20 represented in fig2 , slidably mounted in the reservoir 12 so as to be able to exert a pressure on the liquid stored in the reservoir 12 in order to make it pass into the injection needle , by sliding of the liquid in the direction indicated by the arrow 22 . generally the plunger 20 is a generally cylindrical axisymmetric part made of rubber or made from another elastically deformable material , mounted in a leaktight manner in the reservoir 12 so that liquid in the reservoir 12 cannot come out through the proximal end 14 . the reservoir 12 has inner walls arranged in order to allow sliding cooperation with the plunger , in particular that do not generate excessive friction . in this example , the plunger 20 which is in the reservoir 12 is actuated by a plunger rod which passes through the proximal end 14 a , by being pushed by the user &# 39 ; s fingers . the reservoir 12 is defined by a tubular wall 24 , comprising a first plastic layer 26 and a second plastic layer 28 that are superposed . the layers 26 and 28 have a different permeability to gases , very particularly to oxygen and to carbon dioxide . the first layer 26 here forms a barrier against water . its water permeability is less than 0 . 2 g /( m 2 * day * bar ) at 23 ° c . and at a relative humidity ratio of 85 %, preferably less than 0 . 05 g /( m 2 * day * bar ). this first layer 26 comprises a cycloolefin polymer , more specifically a cyclic olefin polymer ( for example cop ) or an ethylene / cyclic olefin copolymer ( for example coc ). this first layer 26 is in direct contact with the pharmaceutical liquid stored in the reservoir 12 , it prevents the liquid from leaving the reservoir 12 and also prevents water found outside of the injection device 10 from being introduced into the reservoir . the second layer 28 forms a barrier against gases , its oxygen permeability is less than 5 cm 3 /( m 2 * day * bar ) at 20 ° c . and at a relative humidity ratio of 65 %, preferably less than 1 cm 3 /( m 2 * day * bar ) at 20 ° c . and at a relative humidity ratio of 65 %. this second layer 28 comprises a material selected from an ethylene / vinyl alcohol copolymer ( evoh ), a polyester or a co - polyester , a polyamide or a co - polyamide , or silicon oxide ( siox ). this second layer 28 is on the outer side with respect to the first layer 26 . it is more impermeable to gases than the first layer 26 . the second layer 28 comprises , in this example , two plastic sublayers superposed on one another and firmly attached to one another . the first sublayer , in contact with the first layer 26 , is referred to as the cohesion layer , it comprises a material that provides cohesion with the first layer 26 , preferably by fusion of material at the surface between this sublayer and the first layer 26 . for example , the first layer 26 comprises a cyclic olefin polymer ( cop ), the cohesion sublayer also comprises a cycloolefin polymer ( cop ), and the other sublayer comprises a material selected from an ethylene / ethylene vinyl alcohol copolymer ( evoh ), a polyester or a co - polyester , a polyamide or a co - polyamide , or silicon oxide ( siox ). optionally , between the two sublayers forming the second layer 28 , an additional sublayer of adhesive may be provided , which is intended to bond the first cohesion sublayer and the other sublayer . according to one particularly advantageous example , provided on top of the second layer 28 is an outer layer , or at the very least a layer that covers other inner layers , the mechanical characteristics of which , such as the tensile modulus , permit an autoclave cycle at 121 ° c ., which thus makes it possible to ensure the resistance of the injection device 10 during a sterilization . according to another example , or in combination with this layer , the mechanical characteristics of which permit an autoclave cycle at 121 ° c ., the second layer 28 is covered with an outer layer that forms a marking support , making it possible to identify the syringe and the liquid stored within . the process for manufacturing the injection device from fig1 will now be described . according to a first way of proceeding , a film , optionally a multilayer film , intended to form the second layer 28 that forms a barrier against gases is firstly inserted into a mold , then a material is injected into the same mold in order to form the first layer 26 . according to another way of proceeding , a material is injected into a mold in order to form the first layer 26 , and once this first layer 26 is molded , a film intended to form the second layer 28 is added around it . fig2 illustrates an injection device 10 having a reservoir with a composition similar to that from fig1 . however , in this example , the device 10 is a medical cartridge , its distal end comprises an added assembly 30 , comprising in this example means 32 for attaching the cartridge to another device , such as an autoinjector , and also a central surface area 34 intended to be pierced by a needle during the autoinjection process . fig3 and 4 illustrate an injection device 10 similar to that from fig1 and different from a syringe , it is in the form of a medical cartridge having , at its distal end , a septum 36 crimped over the rest of the cartridge . alternatively , the element 36 could be a removable cap . it will be noted that the invention is not limited to the embodiments presented above , other embodiments will appear clear to a person skilled in the art . in particular , it is possible to modify the composition of the layers 26 and 28 .	0
referring now to fig3 , a stacked package arrangement and assembly method in accordance with the present invention will be described that is suitable for packaging integrated circuits . the illustrated arrangement is a form often referred to as a package on package ( pop ) type semiconductor package . the top package 300 is a grid array package that may take most any desired grid array form . by way of example , in the illustrated embodiment , top package 300 takes substantially the same form as the top package 100 illustrated in fig1 and 2 although this is not a requirement . in the illustrated embodiment , one or more dice ( not shown ) are mounted on and electrically connected to a substrate 305 . the substrate 305 may take the form of a conventional bga substrate or any other suitable form and has solder bumps 301 on its bottom surface 302 . as will be appreciated by those familiar with the art , the substrate 305 typically has a number of i / o pads ( not shown ) on its lower surface and routing traces and vias that facilitate electrical connection of the encapsulated die ( or dice ) to the i / o pads . solder bumps 301 are formed on i / o pads . in some specific applications , the top package 300 may be a commodity type memory package and therefore its specific design may vary widely . the bottom package 310 is a grid array type package having a substrate 311 that supports a flip chip mounted die 312 . the substrate 311 has contact pads 313 on its top surface 315 that are complementary to the solder bumps on top package 300 . each contact pad 313 has an associated solder bump 317 thereon such that the solder bumps 317 may be positioned to face the solder bumps 301 on top package 300 . the substrate 311 also has a set of contact pads 340 on its lower surface 342 . the lower contact pads 340 are each bumped with corresponding solder balls 344 and are arranged to facilitate electrically coupling the bottom package 310 to an external device . thus , the bottom package 310 is quite similar to the bottom package 110 illustrated in fig1 , except that solder bumps 317 are formed on the contact pads 313 on the top surface of substrate 311 . therefore , the bottom package also has an appearance that it somewhat similar to bottom package 210 illustrated in fig2 with a significant exception that no encapsulant / molding material is deposited on the top surface of the substrate 111 and thus , there is no encapsulant that surrounds the solder bumps 317 . like substrate 305 , substrate 311 may take the form of a bga substrate and typically includes routing traces and vias ( not shown ) that electrically connect the flip chip mounted die 312 to the upper and lower contact pads . the substrate may be formed from any suitable material — by way of example , bt ( bismaleimide - triazine ) fr4 and other such materials are commonly used to form the substrate . during assembly of a stacked package on package ( pop ) device 320 , the top package 300 is placed on the bottom package 310 and the facing solder bumps 301 and 317 on the top and bottom packages respectively are reflowed to form solder joints 324 between the i / o pads on the top package substrate 305 and the contact pads 313 on the bottom package substrate as illustrated in fig3 ( b ). the volume of solder in the facing solder bumps 301 , 317 and the solder reflow conditions are arranged so that the resulting solder joints 324 have a standoff height that is greater than the height of the flip chip mounted die 312 . with this arrangement , an air gap 327 will be formed between the die 312 and the bottom surface 302 of top package 300 ( which is typically the bottom surface of substrate 305 ). by designing in a gap between the die 312 and bottom surface 302 , space is provided to accommodate warping of one or both of the packages 300 , 310 . that is , even if one ( or both ) of the packages are warped somewhat , there is a much higher probability that each of the facing solder ball pairs 301 , 317 will come into contact with one another to thereby form robust solder joints 324 . thus , the air gap 327 provides sufficient tolerances so that the die 312 on the lower package 310 doesn &# 39 ; t contact the bottom surface 302 of the top package 300 in a manner that prevents any of the facing solder ball pairs from reflowing together . it has been determined that this approach provides a significantly lower open contact defect rate than the conventional approach described above with respect to fig1 . the only extra step required in the formation of the bottom package 310 when compared to the approach of fig1 is the bumping of the contact pads 313 on the top surface of the lower package — which is a relatively inexpensive process . the described approach is more cost effective than the approach described above with respect to fig2 because the steps of encapsulating the top surface of the lower package substrate 311 and then laser ablating the regions around the solder balls can be eliminated . the described approach also substantially eliminates the risk that ablation dust contaminates a potential solder joint in a manner that causes an open or defective contact . the appropriate air gap between the top of die 312 and the adjacent bottom surface 302 of top package 300 will vary based on a number of factors including ( a ) the amount of warpage that might be expected in the component packages 300 , 310 ; ( b ) package height constraints ; ( c ) the positions of the solder bumps 301 , 317 ; ( d ) the footprint size of the stacked packages ; etc . it is noted that the term air gap distance is used because the actual standoff distance will vary somewhat based on the warpage of the specific components used , which will typically vary from component to component . the air gap would be expected if the actual components used had a reference warpage ( which may be zero ). in one particular application , the top package 300 takes the form of a memory package ( e . g . ram , flash memory , etc .) and the bottom package 310 takes the form of a processor arranged to utilize the memory in the memory package . as will be appreciated by those familiar with the art , memory tends to be a commodity and therefore the quality and susceptibility to warpage may vary significantly by supplier and / or product line . the described pop packaging approach can help facilitate the successful use of memory products from a variety of different suppliers and / or having significantly different cost points and warpage susceptibilities without requiring pop package redesign and without incurring an undue number defects . fig4 ( a ) and 4 ( b ) illustrate a processor package 410 suitable for use as the bottom package 310 in the embodiment of fig3 . as seen in fig4 ( a ), two rows of contact pads 313 / solder balls 317 are provided around and peripherally outside of the die 312 . the actual number of rows of contact pads / solder balls will vary in accordance with the design requirements of the processor — although 1 - 3 rows of contacts are most common in the illustrated embodiment the rows of contacts are continuous and symmetrical , but again , that is not a requirement . fig4 ( b ) illustrates the bottom surface of processor package 410 . although only a few embodiments of the invention have been described in detail , it should be appreciated that the invention may be implemented in many other forms without departing from the spirit or scope of the invention . for example , although a particular top package design has been illustrated , it should be appreciated that the form factor of the top package may be widely varied . in the illustrated embodiment a two device pop design is shown . however , it should be appreciated that the same approach can readily be used in pop designs that stack 3 or more devices on top of one another . therefore , the present embodiments should be considered illustrative and not restrictive and the invention is not to be limited to the details given herein , but may be modified within the scope and equivalents of the appended claims .	7
according to the present invention , acne vulgaris is treated by the use of an oral tetracycline antibiotic , preferably minocycline . this antibiotic is administered in an antibiotically effective amount of approximately 1 . 0 milligram per kilogram of body weight per day ( 1 . 0 mg / kg / day ). while this may be accomplished by the use of divided doses , it is preferred that the tetracycline antibiotic be delivered in a single daily dose . this treatment regime is initiated without a loading dose , and is continued until resolution or substantial resolution of the patient &# 39 ; s acne . the course of treatment typically lasts 12 to up to 60 weeks , but will be adjusted according to the disease status and other medical conditions of each patient in the exercise of ordinary good clinical judgment by the patient &# 39 ; s health care provider . controlled , double - blinded studies were undertaken to determine the effectiveness of this invention . treatment of 473 patients with acne was undertaken according to the present invention . placebos were provided to 239 patients . the effectiveness of the invention in treating acne vulgaris is shown in table 1 . while effective as a treatment for acne , this resulted in almost no side effects above those observed with a placebo , as shown in table 2 . the effectiveness of this invention can be seen by comparing the above efficacy data with published data on the effectiveness of conventional tetracycline treatments for acne in the reduction of total acne lesions and in the reduction of inflammatory lesions . see , e . g . hersel & amp ; gisslen , “ minocycline in acne vulgaris : a double blind study ,” current therapeutic research , 1976 . because of the variations in body weight encountered in clinical practice , in the actual practice of this invention it is not practical to provide every patient with exactly 1 mg / kg / day of oral tetracycline antibiotic . however , it is acceptable to approximate this dose by providing the patient with from 0 . 5 to 1 . 5 mg / kg / day although from 0 . 7 to 1 . 3 mg / kg / day is preferred , and 1 . 0 mg / kg / day is ideal . while it can be effective to provide the oral tetracycline antibiotic in divided doses taken over the course of a day ( e . g . twice or three times a day ), it is preferable to provide the oral tetracycline antibiotic in a dosage form that releases the antibiotic slowly during the course of a day so that once - a - day dosing is possible . while delayed release dosage forms are known in the art , the formulation of them is far from predictable and the selection of a specific delayed release formulation is accomplished more by trial and error than by mathematical prediction based on known properties of delay release agents . no delayed release product useful in the present invention has been known heretofore . it has been discovered that the ratio of fast dissolving carriers to slow dissolving carriers in the core caplet is important in obtaining a dissolution profile that enables once - a - day dosing in accordance with the present invention . by keeping the ratio of these components within a certain range , one may obtain this result . the fast dissolving carrier is any binder , vehicle , or excipient that quickly dissolves in an aqueous physiological medium , such as gastric fluid , thereby tending to quickly release the active ingredient . lactose , its salts and hydrates are good examples of such components . it has been observed that sometimes a portion of the fast dissolving components are formulated in a manner that results in the complete or partial encapsulation or inclusion or coating of these fast - dissolving materials in granules of slow - dissolving materials . these encapsulated materials are excluded from the calculation of the above mentioned ratio of fast - dissolving to slow dissolving components . a slow dissolving carrier is any binder , vehicle , or excipient that dissolves slowly over the course of hours and perhaps a day , thereby slowing the release of the active ingredient . examples of such components are polyvinyl pyrrolidone , polyvinyl acetate , microcrystalline cellulose , methyl cellulose , ethyl cellulose , hydroxypropyl cellulose , hydroxypropylmethyl cellulose , or waxy or lipid - based tableting agents such as magnesium stearate or calcium stearate . outer “ enteric ” coatings are excluded from this amount when calculating the above - mentioned ratio . insoluble carriers are binders , vehicles , or excipients that are practically insoluble in physiological fluids , such as gastric fluid , and includes compounds , such as silicon dioxide and talc . while the exact formulation of these dosage forms can vary , it has been observed that it is advantageous to formulate them so that the ratio of fast dissolving carriers to slow dissolving carriers is from 0 . 30 to 0 . 50 , and preferably from 0 . 35 to 0 . 45 . a ratio of about 0 . 36 to 0 . 40 is particularly preferable . dosage forms , such as capsules , tablets , and caplets that release 25 to 52 % of the antibiotics within 1 hour , 53 to 89 % in 2 hours , and at least 90 % within 4 hours are suited to the once - a - day dosage regimen contemplated by the current inventories . more preferably , 30 to 52 % of the antibiotic is released within 1 hour , 53 to 84 % within 2 hours , and at least 85 % within 4 hours . alternatively , the oral tetracycline antibiotic may be delivered in a dosage form that releases the antibiotic in such a way that the maximum blood concentration of the antibiotic ( c max ) is reached at about 3 . 5 hours after administration ( t max ). in actual practice of the invention , the c max should be reached between 2 . 75 and 4 . 0 after administration , more preferably between 3 . 0 and 3 . 75 after administration . as examples of such a once - a - day formulation , one may use the following : quantity component ( mg ) 135 mg caplet minocycline ( as 145 . 8 hydrochloride ) ( dry weight ) lactose 107 . 4 monohydrate ( intragranular ) lactose 43 . 8 monohydrate ( extragranular ) total lactose 151 . 2 monohydrate hpmc 94 silicon dioxide 3 mg . stearate 6 45 mg caplet minocycline ( as 48 . 6 hydrochloride ) ( dry weight ) lactose 192 . 2 monohydrate ( intragranular ) lactose 42 . 2 monohydrate ( extragranular ) total lactose 234 . 40 monohydrate hpmc 108 silicon dioxide 3 mg . stearate 6 each of these components is combined in a conventional fashion , compressed in a tabletting apparatus , and then provided in a conventional manner with a suitable coating , such as , without limitation opadry ii and optional coloring .	0
although special parallel hardware implemented in silicon [ e . g ., holler , m . a . &# 34 ; multi - layer neural network employing multiplexed output neurons &# 34 ;, u . s . pat . no . 5 , 087 , 826 1992 ] or superconductors [ ornstein , l . &# 34 ; dam processing &# 34 ;, u . s . pat . no . 3 , 633 , 171 1972 ] would produce extremely fast executions , it is more convenient to examine performance of neural nets by simulating them in software for use on commercial serial digital computers . for back propagation networks , shell programs which simulate the nets are quite attractive [ e . g ., see bigus , j . p . &# 34 ; neural network shell for application programs &# 34 ;, u . s . pat . no . 5 , 124 , 665 1992 ] and such a shell , which is designed to operate within the environment of a standard commercial spreadsheet program , like microsoft ® excel ™ is extremely convenient [ e . g ., see &# 34 ; neuralyst ™ version 1 . 3 user &# 39 ; s guide &# 34 ;, neural network technology for microsoft ® excel ™, epics systems , sierra madre , calif . ( 1993 )]. all methods of the present invention are easily implemented with a program such as neuralys ™, version 1 . 3 . fig6 illustrates , by way of example , a conventional computer system 60 , comprising processing unit 66 coupled to memory 64 ( e . g ., ram ), an input device 68 ( e . g ., a keyboard ), and output devices such as display 70 and printer 72 , wherein computer system 60 is adapted for implementing the present invention by stored - program execution . that is , as mentioned above , particularly for purposes of simulation , it is often convenient to implement a neural network within the physical framework of a programmed digital computer , wherein , for example , weight , bias , input , and output signals are stored in memory 64 ( e . g ., ram ) and processing unit 66 ( cpu ) processes these signals in accordance with a neural network architecture ( e . g ., a feed forward net ) and with processing methods for training the network according to the present invention that are implemented according to programs stored in memory 64 . in an embodiment , the processing unit 66 can be implemented to perform parallel processing of the programs and data stored in memory 64 . such simulation is employed to separately determine the weight signals for a physical neural network device , which may then be programmed according to the results of such a simulation . as a basis for understanding the present invention , it is helpful to review some further details of the operation of the prior art back propagation method for supervised learning . fig1 schematically depicts a simple layered network having an input layer 10 , a hidden layer 11 , and an output layer 12 . every input sample is represented by a set of measurements of i properties , in a list of l numbers , which comprise the coordinates of the sample - vector ( these are usually pre - normalized so that the magnitudes of each number range in the interval from 0 to 1 ). the neural net input layer 10 is constructed with 1 input neurons or nodes , and each property ( or dimension ) is assigned to one neuron . each input node is connected by one link to each node in the next hidden layer 11 which contains m nodes , and in a typical 3 - layer network , such as the one shown in fig1 each of the m nodes in the hidden layer is connected by one link to each of n nodes in an output layer . it may be understood that neural network structures such as depicted in fig1 may be implemented as digital and / or analog circuitry or simulated with a digital and / or analog computer . as stated above , the number of input layer 10 nodes , l , is set by the number of measured properties of each sample . the heuristic methods for choosing the number of nodes in the hidden layer , m , constitute a special subject of back propagation which will not be discussed here , since it has little impact on the differences between supervised and unsupervised learning . the number , n , of output nodes is set by the number of classes one wishes to train the network to recognized , and can be decided in essentially two different ways . for example , assuming that one wishes to teach the network to recognize the differences between two kinds of samples which belong to well - known sub - classes , a and b , a network could be constructed where the number of nodes in the output layer 12 , n , equals 1 . a target table is used for tabulating the desired outputs for each input vector from a training set of input vectors , according to the membership of the input vector . for instance , the desired output is set to either 1 or 0 , depending on whether the input training set vector belongs to sub - class a or b , respectively . this assignment of values of 1 or 0 in the target table to each training sample , by the trainer , constitutes the supervisory step whereby prior classification knowledge is introduced into a back propagation network . in this simple example where there is only one output node , the target table has a row for each input sample vector and only one column for recording the value of each desired output ( i . e ., 1 or 0 ) of each input sample vector . an alternate way to represent a population of samples having two sub - classes is to set the number of output nodes n = 2 , rather than 1 , and to assign two target columns in the target table for each sample . column 1 identifies membership in sub - class a , and column 2 , membership in sub - class b . entries into the target table for input samples from the training set classified as belonging to sub - class a would be 1 in column 1 , and 0 in column 2 . conversely , entries in the target table would be 0 in column 1 , and 1 in column 2 for input samples from the training set belonging to sub - class b . for cases where the relationships , if any , among the classes is uncertain or unknown , n must generally be set equal to the number of known sub - classes , with one target column for each sub - class . a 1 will be entered in each of the appropriate sub - class columns , and 0 &# 39 ; s in all the other sub - class columns . if a sample belongs to more than one sub - class , its target row will contain 1 &# 39 ; s in each appropriate column , and 0 &# 39 ; s in all the rest of its columns . in a back propagation network , there is also an equivalent of an &# 34 ; output table &# 34 ;, with rows and columns mapped , one to one , to the target table . when the learning procedure is activated , input values for the first sample are propagated &# 34 ; forward &# 34 ; through the hidden layer 11 ( or hidden layers ) to the output layer . the strength of the signal , at each connection , is modified by a connection - specific weight ( typically , each connection weight is initially assigned an arbitrary random value between - 1 and + 1 ), and the summed input to each node is also biased and transformed with the logistic sigmoidal function before it is distributed to the next layer of connections . the final output signals , emanating from the output layer 12 , in response to the first sample applied to the input layer 10 are placed in the first row of the output table . the values in the output table are compared to the corresponding values in the target table and , using the generalized delta rule , the process readjusts weights ( which , as noted above , are usually initially random and arbitrary ) associated with each connection between nodes , propagating &# 34 ; backwards &# 34 ; from output to input , so as to reduce differences (&# 34 ; delta &# 39 ; s &# 34 ;) between target and output . this process is repeated for each of the training samples consecutively , cycling through the entire set of training samples as many times as is necessary to reduce differences between targets and outputs to less than some previously assigned maximum acceptable residual training error , or alternatively , until some specified stop - point ( e . g ., the completion of a particular number of cycles ) has been reached . when that point is reached , the process terminates , and the network is said to be &# 34 ; trained &# 34 ;. referring to fig2 which depicts a histogram of the output values of an output column , each threshold boundary , representing a &# 34 ; maximum acceptable training error &# 34 ; ( 0 . 05 in this case ), can be viewed as a line - surrogate for a sub - class - separating hypersurface . there will be cases where some &# 34 ; transitional &# 34 ; samples in a training set form a more or less continuous distribution between two sub - classes : in the case where training is continued until the outputs match the targets within the acceptable error , a clean split usually will have been forced on that transitional set of samples , assigning them to one or the other of the extreme sub - classes , as a result of the sigmoid transform , and a sensitivity to any statistical unevenness in the distribution of the transitional samples . however , in a case where the training is terminated after a prescribed number of cycles of iteration ( but where that number of cycles is fewer than in the residual - error - terminating case above ), some of the outputs for the transitional samples will usually be found to be distributed around 0 . 5 . if the training is repeated by restarting the back propagation with a new random set of weights , the robustness of the performance of the back propagation method can be tested . if the transitional samples are repeatedly classified with outputs near 0 . 5 , the result almost certainly reflects their intermediate status , rather than a hangup at a local , instead of a global , minimum of the back propagation process . in general , the more adequately the training set of samples represents the population ( class ) from which it is drawn , and the larger the training set , consecutive training runs on either the same or different training sets will be more repeatable , and new samples will be classified more correctly by the network . while the foregoing overview of back propagation does not describe the mathematical principles and details of recalculating the weights , ( which , for example , are thoroughly discussed in rumelhart , hilton , and williams 1986 , and in neuralys ™ 1 . 3 user &# 39 ; s guide ) it should be understood from this overview that back propagation represents a well understood , straightforward and powerful method for implementing the formidable task of optimizing the internal weights that are used to train a feedforward network . the foregoing overview , however , also highlights the limitations of supervised back propagation : the network is coerced to learn an a priori classification of the training set through the implicit dependence of the training process on the target vectors , assigned by the supposed expert supervisor . the present invention overcomes these limitations by featuring the advantages of unsupervised learning while exploiting the attributes of back propagation . learning without supervision ( i . e ., without a trainer or teacher ) implicitly requires that them are no trainer - provided targets ; rather the network itself &# 34 ; discovers &# 34 ; sub - classes within a training set ( i . e ., classifies the training set ). fig3 is an operational flowchart for the method of implementing unsupervised back propagation according to the present invention . in step 30 , the target values are assigned as 1 &# 39 ; s or 0 &# 39 ; s in a manner which does not depend on prior knowledge of sub - class membership of training samples . for instance , the target values could be assigned arbitrarily , which in this context includes randomly . in step 31 the network executes a back propagation run for one , or more cycles through the input training set , using the assigned target values . next , in step 32 , the outputs are compared to the assigned targets . typically , this comparison indicates that outputs are generally very poorly matched to targets . for a population containing natural sub - classes , by chance alone , however , a few of the arbitrarily set target values will probably have been &# 34 ; usefully labelled &# 34 ;, and it is likely , on the average , that the corresponding outputs will have converged somewhat closer to those targets ( in the short training period ) than will the rest of the outputs towards their assigned targets . the outputs associated with &# 34 ; unusefully labelled &# 34 ; targets , will generally , on the average , converge towards their targets by a less - than - average amount . this permits identifying &# 34 ; errors in target assignment &# 34 ; with low , but significant confidence . if , in step 33 , a termination condition is not satisfied , then in step 34 the targets are relabelled ( i . e ., reassigned ) on the basis of some measure of such convergence . in the preferred embodiment , the measure of convergence of outputs towards targets used in step 32 , is based on a column average that is calculated for each output table column . each output value of a given column is compared to the column average for that column . if the output value is greater than the column average , the conjugate target value is replaced with a 1 ( if it is not already a 1 ); and if the output value is less than the average , the corresponding target value is replaced with a 0 ( if it is not already a 0 ). the back propagation run ( step 31 ) is then repeated , using the updated targets . since , on the average , a larger fraction of the targets are now usefully labelled according to sub - classes in the training set , the weights associated with properly labelled members of &# 34 ; real &# 34 ; classes begin to tighten and further favorably influence the convergence of both properly and improperly assigned targets . by repeating these operations over many cycles , the process converges on stable classifications . internal variables , such as those known in the art as &# 34 ; momentum &# 34 ;, &# 34 ; learning rate &# 34 ; and &# 34 ; input noise &# 34 ;, are adjusted according to the same guidelines that are commonly used to optimize standard back propagation . for natural sub - classes , the rates of convergence of outputs , ( though initially severely perturbed by both the random assignments of weight and of target values ), are ultimately determined by the statistics of the sample properties of the training set . further , the design of the process ensures that the weight - noise and target - noise are steadily reduced , as the network learns . after an iteration , if the termination condition is met in step 33 then the training session is completed ( i . e ., step 35 ). typically , the termination condition is based on whether the outputs have converged to the targets within some predetermined residual acceptable training error , or whether a predetermined number of iterations have been performed . it can be understood that if only the latter termination condition is used , it is not necessary to perform step 32 before step 33 , and thus the operational flow chart of fig3 may be modified such that step 31 is followed directly by step 33 , and step 32 is incorporated as the first part of step 34 ( i . e ., compare convergence and relabel target vectors accordingly ). such a method of classification is properly designated as unsupervised since the network is not furnished with fixed known input sample - vector target - vector pairs that were determined in some separate prior classification step . instead , the network itself generates and learns the classification of the input training set . another embodiment of the present invention indicates one of the flexible and useful ways in which this unsupervised back propagation method may be modified . referring again to fig3 according to this embodiment , after step 30 is performed , the iteration of steps 31 , 32 , 33 , and 34 proceeds until some fraction of the desired stop - point ( e . g ., about 1 / 4 of percentage of the way ) is reached . for instance , if the desired stop point were based on the percentage of output vectors within the residual training error , then &# 34 ; 1 / 4 of the way &# 34 ; refers to the point where about 1 / 4 of the output vectors fall within the residual training error . the existence of this condition may be determined in step 32 . when this condition is met , in addition to relabelling the target vectors in step 34 , the weights are reinitialized [ e . g ., a new set of random weights are loaded into the network ]. then , the training iteration , beginning with step 31 , is initiated using the new target vectors and the new set of weights . according to this embodiment , the iteration continues until a second fraction of the desired stop point is reached ( e . g ., 1 / 2 the way ). again , when this condition is met , not only are the target vectors relabelled but also , a new set of weights are assigned to the network . the iteration is restarted and continued until the termination condition , step 33 , is satisfied . it is obvious that variations of this embodiment include varying the number of times that random weights are assigned to the network after the initial step 30 . in the example given , weights were reinitialized twice ; however , any number of times , including only once , is possible . further , the values of the fractional stop points may also be varied . as a result of this alternative embodiment of the present invention , the classification produced is likely to be somewhat more robust because it is less likely that it will converge to , and hang up at some local , rather than global minimum of the sample class . however , such training will be slower . generally , the number , n , of output nodes in a back propagation network must approximate the number of sub - classes to be generated . prior knowledge or experience may provide information suggesting a possible range of sub - classes , and the performance of networks having a different number of output nodes within this range may be compared ; however , this would constitute some degree of supervision . generally , however , implementing unsupervised learning when there is no information indicating how the samples will classify requires a method and means for &# 34 ; extracting &# 34 ; the sub - classes . in the preferred embodiment of the present invention , a hierarchical method is implemented wherein unsupervised back propagation is performed in a manner that is designed to extract at least the number of natural sub - classes in the population . referring to fig4 the hierarchical classification method employed in accordance with the present invention is described . first , in step 40 , a network is defined having n output nodes ( to facilitate the description of this method , n is set to equal one ). then , in step 41 , the unsupervised back propagation method is executed in accordance with the method of the present invention . for the example where n = 1 , this procedure divides the training set into two sub - classes . next , in step 42 , an additional number of samples drawn from the population which was the source of the training set are classified by the network trained in the previous step . the size of this new sample set will usually be made equal to the number of samples in the original training set . this classification is performed with the very fast so - called &# 34 ; testing &# 34 ; mode of the trained back propagation network . with these additional classified samples , there are two sub - groups of samples , each with samples comparable in number to the original training set , belonging to a separate &# 34 ; branch &# 34 ; ( i . e ., sub - class ) of the original class or &# 34 ; tree trunk &# 34 ;. by separately applying the unsupervised back propagation method ( i . e ., step 41 via step 40 ) using the members of each of these sub - classes as input samples , each sub - group is further subdivided into two additional sub - classes ( assuming that a network with one output node is employed again ), resulting in a total of 4 sub - sub - classes at this stage . as depicted in fig4 the operational flow from step 42 proceeds to step 40 . in accordance with the foregoing description , there is no modification of the network topology performed by step 40 upon iteration from step 42 and thus , in step 41 the same network is used for unsupervised back propagation throughout the branching levels . in a more general case , however , upon each iteration from step 42 , the network topology may be modified in step 40 . for example , it may be advantageous to initially sub - divide the training samples into more than two sub - groups ; whereas subsequent iterations may employ fewer output nodes than previous &# 34 ; levels &# 34 ;. by iterating this general procedure , a &# 34 ; classification tree &# 34 ; is grown . with populations composed of natural subclasses , the process ultimately terminates on substantially homogeneous branch - tips . many possibilities exist for establishing a termination condition . preferably , the iteration may be terminated when the unsupervised back propagation step 41 does not substantially generate more than one sub - group in response to an input sample set , or when a predetermined number of iterations have been performed . the unique sets of connection - weights , &# 34 ; tailored &# 34 ; for the particular partitioning at each branching point in the classification tree , ( i . e ., rumelhart &# 39 ; s &# 34 ; internal representations &# 34 ;) are saved and stored for each sub - branch . advantageously , the generation of such a classification tree is determined by the statistical distribution of sample properties , rather than by any preconceived notion of what kinds , and how many &# 34 ; natural &# 34 ; classes are contained within the parent population . many additional variations may be implemented in connection with the hierarchical classification method . for instance , it may sometimes be advantageous to asymmetrically sub - divide sub - groups generated from the same classification step ( i . e ., having the same &# 34 ; trunk &# 34 ;), whereby a different network topology is used for implementing unsupervised back propagation for the respective subgroups . in some cases , it may be advantageous to no longer classify a sub - group ( i . e ., terminate a branch ) while continuing to classify another sub - group having a common trunk . moreover , it may be useful to terminate training before homogeneity has been achieved . in general , for hierarchical classification , if p branch tips are &# 34 ; discovered &# 34 ;, them will be about log . sub . ( m + 1 ) p levels of branching , and it will take log . sub . ( m + 1 ) p very fast consecutive matchings in the testing mode to classify a new sample . for example , if p is as large as 2 20 (≈ 10 6 ), and n = 1 , log . sub . ( m + 1 ) p = 20 , classification of an input vector will take only 20 binary steps . to achieve the same level of classification with a single network in a single training run would require n = one million output nodes and mp more connections than are required for the above network with n = 1 output node . such a larger network is more difficult to implement , and will generally take much longer to train . it can be shown that classification trees are most efficient when ( n + 1 ), the number of branches at each dividing point on the tree , is between 2 and 4 , but that efficiency drops less than 50 %, even when ( n + 1 )= 10 . thus , n is preferably less than about 10 . such classification trees of small networks are much more efficient than massive single networks . the hierarchical procedure described hereinabove , parallels that for generating hierarchical classifications presented by ornstein , ( see supra , ornstein 1965 ), whereby the herein unsupervised back propagation method corresponds to the therein informationally - weighted similarity measures . additional modifications can provide other valuable features to the present invention . for instance , if the procedure for labelling the branches of the classification tree follow the prescription in ornstein ( i . e ., see supra , 1965 ), a significant shannon - fano code will be generated , ( see also , goodman , r . m ., and smyth , p . &# 34 ; decision tree design from a communication theory standpoint &# 34 ;, ieee transactions on information theory 34 , 979 - 994 ( 1988 )). the label for each sub - class therefore would code for the &# 34 ; meaning &# 34 ; of the sub - class in an information - theoretically efficient way . another modification can provide the ability to efficiently handle the necessary fuzziness of some classifications , such as those required for medical diagnoses . to clarify one aspect of fuzziness , it is useful to consider the example of natural languages which seem to evolve in ways that preserve reasonably large phonetic gaps between most words ( i . e ., gaps in &# 34 ; phonetic space &# 34 ;, not in connected speech ). as a result , the vocabulary of american - english ( well under 2 20 words ) occupies a minute fraction of the total phonetic space of a telephone channel ( at about 15 , 000 bits per word , the channel could be used to distinguish 2 15 , 000 possible different &# 34 ; words &# 34 ;). the evolution of organisms , through so - called species isolating mechanisms , also assures fairly large gaps between most species of organisms . most conceivable hybrid or intermediate kinds of organism of the sort dog - elephant , do not exist . likewise most possible &# 34 ; hybrid words &# 34 ;, such dophant or gelph , are not found in english dictionaries . the situation appears to be somewhat different in the kind of multidimensional space occupied by human diseases . patients can exhibit any degree of illness , from normality to full - blown disease . also , patients can , and occasionally do , suffer from both diabetes and anemia ; heart disease and lung cancer ; duodenal ulcer and pneumonia , etc ., and with varying degrees of severity of each of the member pairs of the diseases . &# 34 ; disease space &# 34 ; therefore , does not necessarily contain as many large empty gaps between clusters that make digital subdivision of natural classes relatively easy . it would not be adequate if a machine , designed to provide automated diagnoses , were only able to recognize one out of three or four diseases which may simultaneously afflict a patient . accordingly , a further embodiment of the present invention may be practiced , which is adapted for efficiently classifying fuzzy information . in accordance with this further embodiment , the stop - point for back propagation is set for a degree of convergence towards the targets , such that a histogram of the outputs looks approximately like fig5 a ( rather than fig2 which represents a near - perfect match ). then double thresholds ( i . e ., nested hypersurfaces ) for &# 34 ; fuzzy sets &# 34 ; can be defined , as in fig5 b and fig5 c , so that both sub - classes overlap and include , for example , the same ≈ 10 % marginal members . an embodiment with approximately 10 percent overlap , and n = 1 , produces a finished classification tree with about 4 times as many branch tips as the previously described embodiments of the present invention . the increased number represents &# 34 ; duplicates &# 34 ; generally distributed in very different parts of the tree . however , this only requires two more levels of branching which corresponds to only two additional steps to decode each input . since matching steps , in the trained network , are very fast , such an embodiment provides added diagnostic power with only a small additional throughput delay . although the above description provides many specifycities , these enabling details should not be construed as limiting the scope of the invention , and it will be readily understood by those persons skilled in the art that the present invention is susceptible to many modifications , adaptations , and equivalent implementations without departing from this scope . for example , one skilled in the art could easily fashion many functionally equivalent methods which could serve to adjust a back propagation or back - propagation - like network to perform , without a teacher , following the various principles outlined above . &# 34 ; back - propagation - like &# 34 ; is understood to include all feedforward neural network systems and methods , or their simulations , which compare target values to output values and use some variant of a delta rule to modify connection - weights , feeding backwards through the network layers , from output to input , ( e . g ., see sankar and mammone cited above ; see also , yamada , k . et al ., &# 34 ; handwritten numerical recognition by multilayered neural networks with improved learning algorithm ,&# 34 ; proc . of int . joint conf . on neural networks , washington , d . c ., jun . 18 - 20 , 1989 , pp . 259 - 266 , ieee n . y . 1989 ), and of course includes conventional back propagation . further , it is understood by one skilled in the art that randomly assigning initial values to targets is similar to the way values are typically initially assigned to weights in back propagation , and the subsequent repeated checks and readjustments of the targets , based on the differences between the targets and outputs , is likewise similar to the repeated application of the generalized delta rule to check and readjust the weights in back propagation to try to achieve maximal rates of descent along error surfaces to global minima . it is , therefore , further understood that applications of variants of the generalized delta rule to check and readjust the values of initially &# 34 ; randomized &# 34 ; targets are also encompassed by this invention . in addition , as noted above , when using back propagation , it is typical practice arbitrarily to assign random values to network weights as training is initialized . rumelhart , hilton , and williams ( cited above ) note that &# 34 ; if all weights start out with equal values and if the solution requires that unequal weights be developed , the system can never learn .&# 34 ; they refer to this as a symmetry breaking problem because &# 34 ; all hidden units connected directly to the output inputs will get identical error signals , and since the weights changes depend on the error signals , the weights from those units to the output units must always be the same ... we counteract this problem by starting the system with small random weights &# 34 ;. this practice of initializing with random weights is also unbiased with respect to the nature of the learning task and therefore is universally applicable . however , the nature of back propagation is such that any arbitrary or non - arbitrary set of initial weights ( other than sets of weights of equal values ) will in fact also permit supervised learning with back propagation . in back propagation , and especially in unsupervised back propagation , the larger the number of samples in the training set , the slower the convergence . therefore , methods which can increase the overall rate of convergence of unsupervised back propagation are of special interest . it will be useful to explore a strategy applicable to the construction of sub - nets of an hierarchical tree composed of neural networks which each generate two output classes . for instance , selecting a small random sub - set ( e . g ., 10 samples ) of a much larger training set , constructing a network with two nodes in the hidden layer and one output node , and initializing random weights and executing an unsupervised back propagation ( e . g ., as described above ), will converge relatively quickly and will probably recognize a &# 34 ; major &# 34 ; class and a residue class . if this process is repeated a few times with the same sample sub - set , but with new random weights , even though the sample sub - set is a statistically small sample , the classification produced in most of the repeated runs should be quite similar . because the sample almost certainly contains some representatives of the major class ( by definition ), a set of final weights , from among those repeat runs which are more nearly in agreement with one another , would be a . much better set ( than random weights ) for initializing unsupervised back propagation of the entire large training set . that is , on average , those weights will already &# 34 ; represent &# 34 ; ( in rumelhart et al .&# 39 ; s sense ), at least the major class , better than almost any random set of weights , and therefore should lead quicker and more robust convergence . this is only one example of many , which may utilize preliminary analysis of the training data set to develop non - arbitrary alternatives to random values for the initialization of weights for back propagation . and since non - arbitrary weights , assigned on the basis of some knowledge of the particular problem domain ( e . g ., see yamada et al . cited above ), or from some prior analysis of the training data set , may even lead to more rapid or more robust training than does initializing with a random set of weights , non - arbitrary or other arbitrary , rather than random assignment of initial values to connection weights , in an otherwise back - propagation - like method are also encompassed in this invention . also , as understood in the art , &# 34 ; binary &# 34 ; signifies two - valued and thus , representation of binary states with numeric values other than 0 and 1 ( e . g ., - 1 and + 1 , etc .) are encompassed in this invention . moreover , while the preferred embodiment is described according to assigning one of two values ( i . e ., binary valued ) to each target output value , it can be understood that any one of a plurality of numeric values ( i . e ., multi - valued , or n - ary valued ) may be assigned to a target outputs . then , based on some measure of convergence , the target output value is permuted when the convergence condition is not satisfied . the value to which the target value is permuted may be random , arbitrary , or based on the magnitude of convergence itself . these and other changes can be made without departing from the spirit and the scope of the invention and without diminishing its attendant advantages . it is therefore intended that the present invention is not limited to the disclosed embodiments but should be defined in accordance with the claims which follow .	6
the patch of the present invention , which comprises the carrier layer , can employ any suitable patch technology . for example , the patch can be a matrix type transdermal or transmucosal patch . ( e . g ., chien et al ., u . s . pat . nos . 4 , 906 , 169 and 5 , 023 , 084 ; cleary et al ., u . s . pat . no . 4 , 911 , 916 ; teillaud et al ., u . s . pat . no . 5 . 605 , 702 ; venkateshwaran et al ., u . s . pat . no . 5 , 783 , 208 ; ebert et al ., u . s . pat . no . 5 , 460 , 820 ; ebert et al ., transdermal delivery system with adhesive overlay and peel seal disc , u . s . pat no . 5 , 662 , 925 ; chang et al ., device for administering an active agent to the skin or mucosa , u . s . pat . nos . 4 , 849 , 224 and 4 , 983 , 395 ). the matrix of the patch can comprise a polymeric or co - polymeric basal support layer , such as an acrylic or ethylene / vinyl acetate copolymer or a polyurethane foam or cellulosic material . in accordance with embodiments of the present invention directed particularly to transmucosal applications , a variety of pharmaceutically acceptable transmucosal patch systems are known in the art and are useful . for example , a transmucosal patch system comprising a laminated composite of , for example , an adhesive layer , a backing layer , a permeable membrane defining a reservoir containing the aqueous solution , a peel seal disc underlying the membrane , one or more heat seals , and a removable release liner . ( ebert et al ., transdermal delivery system with adhesive overlay and peel seal disc , u . s . pat no . 5 , 662 , 925 ; chang et al ., device for administering an active agent to the skin or mucosa , u . s . pat . nos . 4 , 849 , 224 and 4 , 983 , 395 ). some useful transmucosal systems employ a non - ionic detergent along with a permeation enhancer . these examples of useful patch technologies applicable to the present invention , are merely illustrative and are not limiting of the present invention . in some embodiments of the inventive patch , the carrier layer also contains peptide stabilizers and / or compounds that can facilitate and / or enhance transport of substrates and products across the semipermeable surface of the carrier layer . examples of permeation enhancers include , but are not limited to , comprising a permeation or penetration enhancer , such as polyethylene glycol monolaurate , dimethyl sulfoxide , n - vinyl - 2 - pyrrolidone , n -( 2 - hydroxyethyl )- pyrrolidone , or 3 - hydroxy - n - methyl - 2 - pyrrolidone a bile salt or fusidate , a hydrophilic polymer , such as hydroxypropyl cellulose , hydroxypropyl methylcellulose , hydroxyethylcellulose , dextran , pectin , polyvinyl pyrrolidone , starch , gelatin , or any of a number of other polymers known to be useful for this purpose . preferably , the inventive patch includes an air - tight and moisture - tight external layer or membrane that keeps the pharmaceutically acceptable aqueous solution from dehydrating during use . the external layer is opposite to the semipermeable surface that is contacted with the externally accessible tissue surface . some embodiments of the inventive patch further comprise an adhesive layer comprising an adhesive , such as , but not limited to , polysiloxane , for adhering the patch to the externally accessible tissue surface , such as the epidermis or mucosa . alternatively , the patch can be contacted with the externally accessible tissue surface and held in place by an overlying bandage ( e . g ., adhesive , gauze or other type of bandage ) or suitable pressure device or means adapted for keeping the semipermeable surface of the carrier layer in contact with the tissue surface for the desired time . other embodiments include features include a backing layer , or peelable seal or liner that preserves operability of the patch during storage before use . bacteriostatic agents can also be included in the pharmaceutically acceptable aqueous solution , or in the polymeric or co - polymeric matrix . in accordance with the inventive patch , the carrier layer comprises a pharmaceutically acceptable aqueous solution , which contains one or more specific probe ( s ) comprising the peptide substrate , or substrates , of the proteolytic enzyme ( s ) of interest . in accordance with the invention , the carrier layer of the patch can contain a first , second , third , or subsequent different probe for targeting a first , second , third , or subsequent different proteolytic enzyme of interest . preferably , but not necessarily , the peptide substrate is an oligopeptide substrate analog of the proteolytic enzyme of interest . the first , second , or subsequent proteolytic enzyme of interest can be , for example , a serine protease , a cathepsin , or a metalloproteinase . in some preferred embodiments , the probes can be dissolved in the pharmaceutically acceptable aqueous solution . in these embodiments the probes can freely diffuse through the semipermeable membrane into the tissue . in other embodiments , the probes are complexed to a polymeric or co - polymeric matrix within the carrier layer , and the semipermeable membrane is permeable to the first ( second , third , or subsequent ) proteolytic enzyme of interest , which if present , can diffuse into the patch to react with the probe ( s ), resulting in the production of detectable cleavage products in accordance with the invention . in some embodiments of the inventive patch and method of detecting a cancer , such as a skin cancer , the cleavage product is detectable by interaction with a specific antibody or aptamer , or by molecular interaction with another reagent , such as a detectable nanoparticle that specifically binds the cleavage product of interest . ( e . g ., nam jm , thaxton cs , mirkin ca , nanoparticle - based bio - bar codes for the ultrasensitive detection of proteins , science 301 ( 5641 ): 1884 - 6 [ 2003 ]; cognet l , tardin c , boyer d , choquet d , tamarat p , lounis b , single metallic nanoparticle imaging for protein detection in cells , proc natl acad sci u s a . 2003 sep 30 ; 100 ( 20 ): 11350 - 11355 [ 2003 ]). an “ aptamer ” is an oligonucleotide , e . g ., a dna or a rna molecule , that binds to a specific molecular target , such as a protein or metabolite . an aptamer can be synthesized by known techniques or can be obtained commercially . ( e . g ., hamaguchi , n . et al ., apatamer beacons for the detection of proteins , analytical biochemistry 294 : 126 - 131 [ 2001 ]). “ antibodies ” include whole antibodies , and antibody fragments , with a specific target - binding capability of interest , i . e ., antigen - specific or hapten - specific targeting ligands . antibody fragments include , for example fab , fab ′, f ( ab ′) 2 , or f ( v ) fragments . antibodies can also be polyclonal or monoclonal antibodies . antibodies also include antigen - specific or hapten - specific targeting ligands complexed with linker moieties to a carrier molecule . in other embodiments of the inventive patch and method , the probe further comprises a detectable label , such that after cleavage of the oligopeptide substrate analog by the proteolytic enzyme of interest , a cleavage product is formed that bears the detectable label . in accordance with these embodiments , the label can be , but is not limited to , a fluorochrome , a radioisotope , or a stable ( i . e ., non - radioactive ) isotope , as long as the substrate is synthesized with the label placed in a metabolically suitable location in the structure of the substrate , i . e ., a location where enzymatic cleavage results in the isotopic label being sequestered in the cleavage product . usefully , fluorochromes can be comprised in intramolecularly - quenched fluorescence probes . methods of making intramolecularly - quenched fluorescence probes and fluorescence detection that are useful in practicing the present invention are known . ( e . g ., weissleder , et al ., intramolecularly - quenched near infrared fluorescent probes , u . s . pat . no . 6 , 083 , 486 ; beekman , b ., et al ., convenient fluorometric assay for matrix metalloproteinase activity and its application in biological media , 1996 . febs lett 390 : 221 [ 1996 ]; beekman , b ., et al ., highly increased levels of active stromelysin in rheumatoid synovial fluid determined by a selective fluorogenic assay , 1997 . febs lett 418 : 305 [ 1997 ]; ntziachristos v , bremer c , weissleder , r , fluorescence imaging with near - infrared light : new technological advances that enable in vivo molecular imaging , eur radiol 13 : 195 - 208 [ 2003 ]; mahmood u , tung ch , bogdanov a jr , weissleder r ., near - infrared optical imaging of protease activity for tumor detection , radiology 213 ( 3 ): 866 - 70 [ 1999 ]; bremer c , bredow s , mahmood u , weissleder r ., tung ch , optical imaging of matrix metalloproteinase - 2 activity in tumors : feasibility study in a mouse model , radiology 221 ( 2 ): 523 - 9 [ 2001 ]; bremer c , tung ch , weissleder r ., in vivo molecular target assessment of matrix metalloproteinase inhibition , nat med . 7 ( 6 ): 743 - 8 , comment on 655 - 6 [ 2001 ];. ntziachristos v , tung ch , bremer c , weissleder r ., fluorescence molecular tomography resolves protease activity in vivo , nat med 8 ( 7 ): 757 - 60 [ 2002 ]; tung ch , mahmood u , bredow s , weissleder r ., in vivo imaging of proteolytic enzyme activity using a novel molecular reporter , cancer res 60 ( 17 ): 4953 - 8 [ 2000 ]; simonetti , lucarini g , brancorsini d , nita p , bernardini ml , biagini g , offidani a ., immunohistochemical expression of vascular endothelial growth factor , matrix metalloproteinase 2 , and matrix metalloproteinase 9 in cutaneous melanocytic lesions , cancer 95 ( 9 ): 1963 - 70 [ 2002 ]). an enzymatic “ fingerprint ” or profile of a particular tumor type can also be obtained in accordance with the inventive method . in some embodiments of the inventive method , detecting the presence or absence of the first cleavage product or the second cleavage product , or both , is performed by applying detection means ( e . g ., fluorescence , radiation , nuclear magnetic resonance , immuno - or other detection means ) directly to the patch . in other embodiments , the cleavage products are extracted from the patch to obtain an extract , and suitable detection means are applied to the extract . suitable methods for detecting the presence ( or absence ) of fluorescence , include but are not limited to , spectrofluorometry , fluorescence resonance energy transfer ( fret ) and capillary electrophoresis with fluorescence detection means . direct detection of the product in the patch itself can be accomplished by illumination of the patch and detection of emitting light by the naked eye or by using an array of optical devices utilizing regular , infrared , near - infrared and / or ultraviolet light , depending on the optical properties of fluorogenic substrates used in the patch . useful radioisotopic labels include , but are not limited to 35 s , 14 c , or 3 h , which are detectable using appropriate radiation detecting means . alternatively , a stable isotope , such as but not limited to 13 c , 2 h , 17o or 18o can be employed as the label . detection of stable isotopes is typically accomplished with techniques such as mass spectroscopy or nuclear magnetic resonance . to obtain an enzymatic fingerprint of a tumor , more than one differently labeled substrate must be used . for example , two or more substrates , each specific for a different proteinase and each labeled with different fluorochromes , can be employed . cleavage products bearing different labels are identified based on their different characteristics , for example , spectral ( e . g ., fluorescence ) or isotopic characteristics . in accordance with the inventive method , the semipermeable surface of the patch is kept in contact with the externally accessible tissue surface for a time sufficient for diffusion of detectable amounts of cleavage product into the patch , in the event a proteolytic enzyme of interest is present . this period is partially dependent upon the detection means employed . for example , employing a radiolabel can typically provide greater sensitivity than employing antibody - based detection of the cleavage product . generally a period of about 15 minutes to about 30 minutes is preferable , but longer periods of about one to about two hours , or longer , can be employed . all references cited herein are incorporated in their entirety by reference . while the invention has been described with reference to its preferred embodiments , it will be appreciated by those skilled in this art that variations can be made departing from the precise examples of the methods and compositions disclosed herein , which , nonetheless , embody the invention . experiments were performed to demonstrate that fluorogenic peptide substrates diffuse from the cellulose patch to the source of mmps , and fluorescent products of the enzymatic reaction diffuse back to the patch and can be detected using ultraviolet ( uv ) light . electrophoresis grade agar ( sigma ) in 20 mm tris buffer , ph 7 . 6 , 2 . 5 mm znso 4 and 5 mm cacl 2 was melted and poured into 60 - mm petri dishes . next , 0 . 5 microliters of active mmp2 and mmp6 ( concentration 0 . 001 micrograms / microliter , oncogene research products ) was injected into the agar ( 0 , 2 and 5 mm below the surface ). buffer without enzymes was used as a control . injection sites were covered with a cellulose membrane patch previously immersed in a solution of high affinity fluorogenic substrates for mmps ( 10 − 5 m of dabcyl - gaba - pro - gln - gly - leu - glu ( edans )- ala - lys - nh 2 [ seq id no : 1 ]; for proteolytic product , excitation maximum is λ = 340 nm and emission maximum is λ = 485 nm ; calbiochem , catalog no . 444256 and / or dabcyl - gaba - arg - pro - lys - pro - val - glu - nva - trp - arg - glu ( edans )- ala - lys - nh [ seq id no : 2 ], nva = norvaline ; for proteolytic product , excitation maximum is λ = 360 nm and emission maximum is λ = 490 nm ; calbiochem , catalog no . 444257 ). membrane patches were removed after 30 , 60 and 120 minutes and fluorescence was semiquantitatively analyzed by viewing with a fluorescence microscope using a “ dapi ” filter with excitation maximum 340 - 360 nm and emission maximum 460 - 490 nm . fluorescence was detected in the patches under experimental conditions , but not in controls . as shown in table 1 , the relative fluorescence indirectly correlated with the distance of the substrate from the patch at the agar surface and the incubation time , which is consistent with diffusion of the cleavage product into the patch . experiments were performed to demonstrate that the patch technique can be used to detect mmps activity in cultures of human melanoma cells . all in vitro experiments were done in triplicate and were repeated a minimum of two times . human melanoma cell lines sk - mel - 28 and wm 266 - 4 and mouse melanoma cell line b16 were obtained from the american tissue culture collection ( atcc ) and were cultured according to recommendations of atcc ( dmem , 10 % fcs , penicillin + streptomycin ). cells were used in experiments after two passages in the laboratory . confluent cultures in 60 - mm petri dishes were used in these experiments . liquid culture media were removed and replaced with low melting temperature agarose ( sigma , cell culture grade ) in dmem . after a gel was formed ( approximately 1 - 2 mm thick ), a cellulose membrane previously immersed in a solution of high affinity fluorogenic substrates for mmps , as described in example 1 , was placed on top of the gel . membranes were removed after 30 , 60 , 120 and 360 minutes and fluorescence was analyzed as described in example 1 . fluorescence was detected in patches that were in contact with agar for 120 and 360 minutes , but not in controls . in vivo detection of mmp activity in a mouse model of melanoma experiments were performed to demonstrate that the inventive method can be used to detect mmp activity in vivo in animal models of melanoma . mouse melanoma cell line b16 was used . the b16 cells were cultured and passaged as described above . a total of 5 × 10 6 cells were injected subcutaneously or intradermally into left and right limbs of three inbred c57bl / 6joiahsd mice . four days after injection , when melanoma lesions became very large ( about 3 - 5 mm in diameter ), animals were sacrificed , and melanomas with adjacent intact skin were removed . a cellulose membrane patch that was previously immersed in a solution of high affinity fluorogenic substrates for mmps , as described in example 1 , was placed on the external surface of the removed specimen , and the membrane was covered with an adhesive bandage to affix the membrane patch to the skin for the time period of interest . the membrane patches were removed after 60 and 120 minutes and fluorescence was analyzed , as described in example 1 . fluorescence was detected in patches that were in contact with melanoma tumor for either 60 minutes or 120 minutes , but not in the controls minus fluorogenic substrate . in other experiments , mouse melanoma cell line b16 was cultured as described above , and approximately 5 × 10 6 cells were injected subcutaneously or intradermally into the left and right limbs of three c57bl / 6joiahsd mice . after 4 days , when melanomas were approximately 2 mm in diameter , the membrane patches , as described in example 1 , were placed directly on top of the skin exhibiting melanoma and affixed with adhesive bandages as described above . patches were removed after 90 minutes , and fluorescence analyzed . in all cases of melanoma , a fluorescent signal was visualized using uv light . in still other experiments human melanoma cell lines sk - mel - 28 ( atcc htb - 72 ) and wm 266 - 4 ( atcc crl - 1676 ) were cultured according to recommendations of atcc ( dmem , 10 % fcs , penicillin / streptomycin ). 5 × 10 6 cells ( 1 : 1 mixture of both cell lines ) were injected subcutaneously or intradermally into the left and right limbs of two hsd : athymic - nu mice . large skin tumors ( diameter 5 mm ) developed after 10 weeks . the tumors were mobile ( i . e ., tumors formed a compact mass of cells and were not infiltrating epidermis and muscle ) and were completely covered with intact epidermis . a cellulose membrane patch , as described in example 1 , was placed on the skin with melanoma tumors . in a control experiment , the patch loaded with fluorogenic mmps substrate was applied to the skin of intact ( living ) mouse . patches were removed after 70 minutes and fluorescent signal visualized using uv light . fluorescent products of proteolysis were detected in patches that covered skin melanomas . in contrast , a test patch applied to healthy skin showed no fluorescence . study included 7 melanoma patients and 6 patients with nonmalignant lesion . patch analysis was used to compare proteolytic activity of mpps using fluorogenic peptides in melanoma and nonmalignant lesions . 1 . dabcyl - gaba - pro - gln - gly - leu - glu ( edans )- ala - lys - nh ( calbiochem ) — before use membrane was soaked in 10 − 5 m solution of peptide in 20 mm tris buffer , ph 7 . 6 , 2 . 5 mm znso 4 and 5 mm cacl 2 . 2 . dabcyl - gaba - arg - pro - lys - pro - val - glu - nva - trp - arg - glu ( edans )- ala - lys - n h ( calbiochem ) — before use membrane was soaked in 10 − 5 m solution of peptide in 20 mm tris buffer , ph 7 . 6 , 2 . 5 mm znso 4 and 5 mm cacl 2 . patch — 1 cm 2 cellulose membrane , added 100 μl of peptide mixture . applied on skin for 2 hours before surgical removal of lesion . all lesions were on the arm . cellulose membrane was fixed with a bandaid adhesive . patch observed immediately after removal under uv light followed by extraction of peptides using 20 mm tris buffer , ph 7 . 6 . fluorescence measured after 1 hour incubation of patch in 1 ml of buffer . analysis of results showed that five out of 7 melanoma patients had detectable fluorescent signal in patch , whereas signal was undetectable in 5 out of six patients with nonmalignant skin lesion .	0
the preferred embodiment herein described is not intended to be exhaustive or to limit the invention to the precise form disclosed . it is chosen and described to explain the principles of the invention and its application and practical use to enable others skilled in the art to utilize the invention . as shown in the drawings debubbling machine 10 includes a peripheral support frame 12 and an outer cover 14 ( shown cut away in the drawings ) which define an inner chamber 16 . frame 12 includes interconnecting vertical frame members 18 and horizontal frame members 19 , 20 . cross members 22 extend between lower horizontal frame members 19 and with plate 24 support a lifting cylinder 26 which may be of the pneumatic or hydraulic variety . cylinder 26 includes a block 28 and extendable rod 32 which is connected at its distal end to lower support 30 . support 30 is connected to an inner frame 34 which includes horizontal frame member 36 and vertical frame members 38 . vertical frame members 38 include outer guide blocks 40 through which extend guide rods 42 as shown to provide for straight up and down movement of inner frame 34 correlative with cylinder rod 32 . guide rods 42 are connected to machine frame 12 through vertical studs 44 . inner frame 34 carries and supports the operational parts of machine 10 . it is understood that , while two support platens , two vacuum platens and two conveyors are depicted , the process of bubble removal from a flat substrate , such as pc board 8 , is the same regardless of the number of platens and conveyors . a lower support platen 46 is connected between vertical frame members 38 and includes opposite extending roller guides 48 . a roller 50 is journalled in each pair of guides 48 and one or both of the rollers are turned by a conventional electric motor 52 which is operatively connected to one or both rollers 50 . an endless conveyor belt 54 formed of conventional fabric or synthetic material is stretched across rollers 50 so that correlative rotation of the rollers 50 and belt 54 is achieved . belt 54 defines upper run 56 and lower run 58 . a vacuum plate 60 is positioned between vertical frame members 38 above conveyor belt 54 . platen 60 includes a downturned continuous peripheral flange 62 . lowering power cylinders 64 ( two shown ) are connected between platen 60 and upper support plate 70 . power cylinders 64 each include block 66 connected to plate 70 and an extendable rod 68 connected to platen 60 as shown in fig6 . upper support platen 70 is connected between vertical frame members 38 and includes roller guides 72 similar to roller guides 48 . rollers 74 are journalled in guides 72 and driven by motor 52 in the same fashion as rollers 50 . it should be noted that motor 52 will be connected to rollers 50 and 74 in a fashion such that each set of rollers may be driven independently of the other . this split type of connection is known to those skilled in the art and does not form a part of this invention . an endless conveyor belt 76 is stretched across rollers 74 to achieve correlative rotation of the belt and rollers . belt 76 defines lower run 80 and upper run 78 and is of a width sufficient to accommodate pc board 8 , but narrow enough to allow connection of cylinder blocks 66 to platen 70 . vacuum plate 82 is positioned between vertical frame members 38 above belt 76 and includes a downturned continuous peripheral flange 84 . lowering power cylinders 86 are connected between upper support plate 88 and vacuum platen 82 . power cylinders 86 include block 90 connected to plate 88 and extendable rod 92 connected to platen 82 . plate 88 is connected to and between vertical frame members 38 . a vacuum pump ( not shown ) is connected operatively between vacuum platens 60 , 82 through tubing 93 , 94 . automatic valves 96 , 97 control air flow towards main vacuum tube 98 . an electronics cabinet 100 houses a programmable control ( not shown ) of conventional construction which correlates the cycling of all of the moving parts of machine 10 . machine 10 operates to remove bubbles from pc board 8 as follows . as board 8 completes the coating cycle ( not shown ), it is transported towards machine 10 by conveyor belts ( not shown ) and enters machine 10 through a slot in cover 14 known in the trade as the material pass line . conveyor upper run 78 is aligned with the pass line so that board 8 slides onto belt 76 as seen in fig4 . the programmable control ( not shown ) then signals motor 52 to turn rollers 74 and belt 76 until the pc board 8 is completely within enclosure 16 beneath vacuum platen 82 . motor 52 then stops and lifting cylinder 26 is activated along with lowering power cylinders 86 . rod 32 lifts inner frame 34 until lower conveyor belt upper run 56 is aligned with the pass line ( fig5 ) and a second pc board 9 slides onto belt 54 which is rotating with its rollers 50 . at this time , power cylinder rods 92 extend to urge flange 84 of vacuum plates 82 into contact with upper belt upper run 78 and platen 70 to form a plenum 102 . vacuum pump ( not shown ) and valve 96 are then activated to draw air from plenum 102 for a predetermined time ( usually a few seconds ) to remove any bubbles from the coated pc board 8 . after the second pc board 9 is placed beneath vacuum platen 60 , belt 54 stops . when bubble removal from board 8 is completed , or when the predetermined time elapses , cylinder rods 92 retracted and lifting cylinder rod 32 retracts into block 28 to lower inner frame 34 . when upper belt upper run 78 is again aligned with the pass line , motor 52 drives rollers 74 and belt 76 to cause board 8 to exit machine 10 where it may be transported to the next processing station ( not shown ). another board 8 may now enter machine 10 onto belt 76 . at this time , cylinder rods 68 extend to urge flange 62 of vacuum platen 60 into contact with lower belt upper run 56 and platen 46 to form a plenum 104 . vacuum pump ( not shown ) and valve 97 are activated to draw air from plenum 104 as described above for plenum 102 . this completes one full cycle of machine 10 which may continuously recycle under the influence of the programmable controller . it is understood that the above description does not limit the invention to the precise details above - given , but may be modified within the scope of the appended claims .	7
referring to the drawings wherein identical reference numerals denote the same elements throughout the various views , fig1 shows an automatic paint tinting machine 10 . it should be noted that the present invention is equally applicable to the precise mixing of any other type of fluid . a paint can 20 contains base paint ready for tinting with pigment , which is delivered by the operation of the tinting machine 10 . the tinting machine 10 may also be used to deliver colorants to an empty container . a frame 12 houses the internal components of the tinting machine 10 . a movable mounting plate 14 is connected to the frame 12 . a microprocessor - based computer 16 controls several aspects of the delivery of pigment which will likewise be discussed in greater detail below . a sight 22 , which is preferably formed as a hole in mounting plate 14 , is positioned above the paint can 20 . the primary function of the sight 22 is to permit the operator of the machine 10 to have a reference point for placement of the paint can 20 so that pigment is reliably delivered thereto . shelf 24 is preferably designed to be of sufficient size and strength to accommodate at least a standard one - gallon paint can and preferably as wide a range of paint containers as are reasonably likely to be used in conjunction with the machine 10 , and in fact may be adjustable to accommodate containers as necessary . in the preferred embodiment , the operator places the paint can 20 on the shelf 24 and ensures that the mouth of the paint can 20 or , in some embodiments , a bunghole in the can lid , is aligned with the sight 22 . fig2 is a schematic view of the internal components of the tinting machine 10 . a plurality of individual colorant sub - systems are provided , one for each colorant in the paint manufacturer &# 39 ; s color system . in the particular example shown , first and second colorant sub - systems 26 a and 26 b are shown for the purposes of illustration however , any number of colorant sub - systems desired may be used , and in practical application the tinting systems in common use by most paint manufacturers include several colorants , for example twelve . it should also be noted that the base paint has its own color characteristics . it therefore can be treated in the same manner as a “ colorant ” and the tinting machine 10 may be provided with a separate colorant sub - system 26 for dispensing the base paint . each of the colorant sub - systems 26 a and 26 b includes a colorant reservoir 28 a , 28 b which are connected to respective colorant pumps 30 a , 30 b by supply lines 32 a , 32 b . motorized stirrers 34 a and 34 b may be provided to keep the colorants adequately mixed . the colorant pumps 30 a , 30 b are in turn connected to corresponding colorant valves 36 a and 36 b by pump discharge lines 38 a , 38 b . each of the colorant valves 36 a , 36 b is a three - way type of valve which directs colorant received from the respective colorant pump 30 a , 30 b either back to the colorant reservoirs 28 a , 28 b through return lines 40 a , 40 b , or out through dispensing lines 42 a , 42 b and into a paint can 20 , depending on how the colorant valves 36 a , 36 b are set . the colorant valves 36 a , 36 b are arranged to be operated remotely , for example by providing individual solenoids of a known type ( not shown ) connected to each of the colorant valves 36 a , 36 b . owing to the method of operation of the present system , which is explained in more detail below , no particular type of pump is required to move the colorants . any pump which will create a steady flow of the colorants through the piping loop from the colorant reservoirs 28 a , 28 b through the respective colorant valve 36 a or 36 b may be used . therefore , both positive - displacement and non - positive - displacement pumps are appropriate . furthermore , the colorant pumps 30 a , 30 b could be eliminated entirely by providing means such as inert gas or compressed air to pressurize the colorant reservoirs 28 a , 28 b . the colorant pumps 30 a , 30 b may be operated in various ways . each colorant pump 30 a , 30 b may be driven by its own electric motor . however , preferably to minimize the number of components used , all of the colorant pumps 30 a , 30 b are driven by a single prime mover through a mechanical drive train using belts , gears , shafts , or a combination thereof . the illustrated example in fig2 shows an electric motor 44 controlled by a variable - speed ac drive of a known type . the motor 44 in turn drives the colorant pumps 30 a , 30 b through a belt and pulley system 46 . the ac drive may include means for outputting a motor speed signal . the colorant valves 36 a , 36 b and the colorant pumps 30 a , 30 b are connected to a control system 48 which in the illustrated example includes a programmable logic controller ( plc ) 50 of a known type and a computer 52 of a known type , such as a pc - compatible computer , operating in concert . the plc 50 operates the electric motor 44 ( through the ac drive ) and colorant valves 36 a , 36 b based on commands received from the computer 52 . the plc 50 may be programmed to execute a series of steps based on relatively simple high - level commands from the computer 52 . fig3 a and 3b depict the steps involved in tinting a container of paint . the manner in which of these steps are executed may vary . for example , each step may be individually triggered by a control software program running on the computer 52 . alternatively , the control software of the computer 52 may simply provide an indication of the required colorant volumes to the plc , in which case the plc 50 would be programmed to execute the detailed steps of the tinting process . the process begins at block 54 . the user inputs into the computer 52 the desired final color and quantity of paint to be tinted . at block 56 , the control software refers to a stored “ formula ” which describes the correct quantity of each colorant required to produce the desired color for a given volume of tint base . typically , colorants are mixed by volume , but mass may also be used as a measure . the control system 48 then determines in block 58 the proper duration of flow or “ dispense times ” tn = t 1 . . . tmax for each colorant required by using a stored calibration which correlates the quantity of colorant for each unit time at a specific flowrate . this calibration may also allow for time delays in the operation of the electromechanical portions of the system . fig4 shows a graphical example of a chart representing a stored calibration . an equivalent numerical look - up table or other data format may also be used for the same purpose , or a curve fit equation could be used to calculate the dispense time for each colorant . not all of the colorants are required for every chosen color . for example , a particular color may require only four colorants out of twelve available colorants . the control system 48 then verifies that the correct size container is in place at block 60 . once all the initial conditions are satisfied , the user provides a “ dispense ” command . the control system 48 then causes the dispensing valves 36 a , 36 b to move to , or to remain in , the recirculation ( or “ closed ”) position at block 62 and the colorant pumps 30 a , 30 b to begin running at a desired speed at block 64 . when the colorant pumps are verified to be operating at the correct rpm by monitoring the speed signal from the ac drive ( see block 66 ), this means that steady - state recirculation of the colorant from the colorant reservoirs 28 a , 28 b through the colorant pumps 30 a , 30 b to the dispensing valves 36 a , 36 b and back to the colorant reservoirs 36 a , 36 b is confirmed . at block 68 , a time value “ t ” is set equal to zero and the required dispensing valves v 1 . . . vmax are opened ( block 70 ). the time value t may be measured by an internal clock of the computer 52 or the plc 50 . alternatively , a separate timing chip may be provided . continuing on fig3 b , at block 72 , the time t is incremented by the desired amount . the smallest time interval of the system is limited only by the accuracy of the clock used , and may be on the order of microseconds . a count value “ n ” corresponding to the colorant number is set equal to 1 at block 74 . at block 76 , t is checked to determine if it equals the value “ tn ” for the first colorant . if not , n is incremented to n + 1 at block 78 . at block 80 , the value n is checked to determine if it is greater than the maximum value nmax . if not , the process returns to block 76 where the test is repeated to determine if time “ tn ” for the subsequent colorant has been reached . if at block 76 , the time tn has been reached , then the corresponding colorant valve “ vn ” is closed ( block 82 ) and the value of n is again incremented ( block 78 ). the cycle through blocks 76 through 82 is subsequently repeated until all of the required colorants n 1 through nmax are checked . once all the colorants have been checked at the initial time increment , the test at block 80 will indicate that n is greater than nmax . if this the case , then the system checks at block 84 to determine if all of the colorant valves have been closed . if this is not the case , then the system proceeds to block 72 where the time t is incremented . the process then proceeds to block 74 where n is reset equal to 1 and the loop of blocks 76 through 82 is repeated . if at block 84 all colorant valves have been closed , then the process proceeds to block 86 where the colorant pumps are stopped . the process is thus finished , as indicated at block 88 . the above - noted steps are merely a representative example of how a colorant flow may be measured using time - based metering , and they may be varied as need to suit an individual application . in particular , the step of recirculating the colorants may be eliminated under certain circumstances . for example , if a liquid dye were to be used , then the recirculation step would be eliminated because there would be no need to keep a pigment in suspension . in that case , the calibration chart would be modified to reflect the unsteady nature of the initial colorant flow after the colorant valves 36 a , 36 b are opened . the foregoing has described a fluid tinting apparatus and method . while specific embodiments of the present invention have been described , it will be apparent to those skilled in the art that various modifications thereto can be made without departing from the spirit and scope of the invention . accordingly , the foregoing description of the preferred embodiment of the invention and the best mode for practicing the invention are provided for the purpose of illustration only and not for the purpose of limitation .	1
the present invention has particularly beneficial utility in the mounting of a showerhead or gas distribution plate ( gdp ) in a cvd ( chemical vapor deposition ) chamber used to deposit material layers on a semiconductor wafer substrate . however , while references may be made to such cvd chamber , the invention may be equally applicable to mounting a showerhead or gdp in any type of process chamber such as a pvd ( physical vapor deposition ) chamber , an etching chamber or a plasma ashing chamber . referring to fig2 and 3 , a typical cvd system 34 in implementation of one embodiment of the present invention includes a process chamber 36 having a chamber wall 38 and a chamber bottom 40 which together define a chamber interior 42 . a gas mix plate 48 is typically provided in the upper end of the process chamber 36 for receiving and mixing a flow of deposition gases 62 . a showerhead 44 is mounted beneath the gas mix plate 48 in a manner to be hereinafter described and receives the gas 62 from the gas mix plate 48 and disperses the gas 62 into the chamber interior 42 , typically through an underlying confine ring 46 , in conventional fashion . in operation of the cvd system 34 , a wafer 50 is placed on a wafer support ( not shown ) provided in the chamber interior 42 for the deposition of material layers on the wafer 50 , as is well - known by those skilled in the art . it is understood that the process chamber 36 heretofore described with respect to fig2 represents one example of a process chamber which is suitable for the present invention and that process chambers of various description which may have features that depart from those heretofore described are equally suitable for implementation of the invention . according to the present invention , the showerhead 44 is mounted in the process chamber 36 using multiple exterior fasteners 56 . each of the exterior fasteners 56 typically includes a fastener head 58 from which extends a threaded shank 60 . as shown in fig2 , the showerhead 44 is mounted in the process chamber 36 by extending the threaded shank 60 of each exterior fastener 56 through a corresponding chamber wall fastener opening 52 which extends laterally through the chamber wall 38 , and threading the threaded shank 60 into a registering showerhead fastener opening 54 which extends into the lateral surface of the showerhead 44 . as shown in fig3 , multiple exterior fasteners 56 are used in the manner heretofore described to mount the showerhead 44 in the process chamber 36 . the exterior fasteners 56 may be equally spaced from each other along the circumference or perimeter of the chamber wall 38 . in a preferred embodiment , eight of the exterior fasteners 56 are used to mount the showerhead 44 , as shown , although a lesser or greater number of exterior fasteners 56 may be used , as desired . in typical operation of the cvd system 34 , deposition gases 62 are introduced into the chamber interior 42 through the gas mix plate 48 , the showerhead 44 and the confinement ring 46 , respectively , where the gases 62 flow into contact with the wafer 50 and materials carried by the gases 62 are deposited onto the wafer 50 . upon completion of the cvd process , the gases 62 are evacuated from the chamber interior 42 by operation of a pump ( not illustrated ) to draw the gases 62 out of the chamber interior 42 , typically in conventional fashion . it will be appreciated from a consideration of fig2 that each showerhead fastener opening 54 in the showerhead 44 is substantially sealed off from the chamber interior 42 by abutment of the showerhead 44 against the chamber wall 38 . consequently , the exterior fasteners 56 extend into the showerhead 44 in such a manner that each of the exterior fasteners 56 , as well as the regions of the showerhead 44 which contact the exterior fasteners 56 , is substantially isolated from the chamber interior 42 in which processing of the wafer 50 is carried out . accordingly , particles generated by friction between the showerhead 44 and the threaded shank 60 , induced by thermal expansion and contraction cycling of the showerhead 44 during processing , are incapable of inadvertently falling into the chamber interior 42 and contaminating a wafer 50 being processed therein . referring next to fig4 - 6 , a typical cvd system 64 in implementation of another embodiment of the present invention includes a process chamber 66 having a chamber wall 68 and a chamber bottom 70 which define a chamber interior 72 . a gas mix plate 78 is typically mounted in the upper end of the process chamber 66 , and a showerhead 74 is mounted in the process chamber 66 in a manner to be hereinafter described . a spacer 86 is typically interposed between the gas mix plate 78 and the showerhead 74 . a confine ring 76 is typically mounted in the chamber interior 72 , beneath the showerhead 74 . in operation of the cvd system 64 , a wafer 80 is placed on a wafer support ( not shown ) provided in the chamber interior 72 for the deposition of material layers on the wafer 80 . it is understood that process chambers of various description which may have features that depart from those heretofore described with respect to fig4 are equally suitable for implementation of the invention . according to the present invention , the showerhead 74 is mounted in the process chamber 66 using multiple embedded fasteners 92 . each of the embedded fasteners 92 typically includes a fastener head 94 from which extends a threaded shank 96 . as shown in fig4 , the showerhead 74 is mounted in the process chamber 66 by extending the threaded shank 96 of each embedded fastener 92 through a corresponding ring fastener opening 77 which extends through the confine ring 76 , a showerhead fastener opening 82 which extends through the showerhead 74 , a spacer fastener opening 88 which extends through the spacer 86 provided between the gas mix plate 78 and the showerhead 74 . the threaded shank 96 of each embedded fastener 92 is then threaded into a registering plate fastener opening 90 which extends into the bottom surface of the gas mix plate 78 . as shown in fig6 , the bottom end of the ring fastener opening 77 is typically characterized by a circumferential expansion which defines a fastener head cavity 84 in the confine ring 76 . accordingly , as shown in fig4 , the fastener head 94 of each embedded fastener 92 is contained in the corresponding fastener head cavity 84 in such a manner that the flat surface of the fastener head 94 is substantially flush with the bottom surface of the confine ring 76 . as shown in fig5 , multiple embedded fasteners 92 are typically used to mount the showerhead 74 in the process chamber 66 . the embedded fasteners 66 may be equally spaced from each other along the circumference or perimeter of the confine ring 76 and the showerhead 74 . in a preferred embodiment , eight of the embedded fasteners 92 are used to mount the showerhead 74 in the process chamber 66 , as shown , although a lesser or greater number of the embedded fasteners 92 may be used , as desired . in typical operation of the cvd system 64 , deposition gases 98 are introduced into the chamber interior 72 through the gas mix plate 78 , the showerhead 74 and the confinement ring 76 , respectively , and flow into contact with the wafer 80 . various materials carried by the deposition gases 98 are deposited onto the wafer 80 . upon completion of the cvd process , the gases 98 are evacuated from the chamber interior 72 , typically in conventional fashion . it will be appreciated from a consideration of fig4 that the fastener head 94 of each of the embedded fasteners 92 is recessed into the confine ring 76 in such a manner that the threaded shank 96 each of the embedded fasteners 92 is substantially isolated from the chamber interior 72 in which processing of the wafer 80 is carried out . accordingly , particles generated by friction between the showerhead 74 and / or the confine ring 76 and the threaded shank 96 , induced by thermal expansion and contraction cycling of the showerhead 74 and confine ring 76 during processing , are incapable of inadvertently falling into the chamber interior 72 and contaminating a wafer 80 being processed therein . while the preferred embodiments of the invention have been described above , it will be recognized and understood that various modifications can be made in the invention and the appended claims are intended to cover all such modifications which may fall within the spirit and scope of the invention .	8
the present application relates to techniques and tools for efficient compression and decompression of digital media data . in various described embodiments , a still image encoder and / or decoder incorporate techniques for compressing and / or decompressing image data . various alternatives to the implementations described herein are possible . for example , techniques described with reference to flowchart diagrams can be altered by changing the ordering of stages shown in the flowcharts , by repeating or omitting certain stages , etc . as another example , although some implementations are described with reference to specific digital media formats , other formats also can be used . the various techniques and tools can be used in combination or independently . different embodiments implement one or more of the described techniques and tools . some techniques and tools described herein can be used in a still image encoder or decoder , or in some other system not specifically limited to still image encoding or decoding . fig1 illustrates a generalized example of a suitable computing environment 100 in which several of the described embodiments may be implemented . the computing environment 100 is not intended to suggest any limitation as to scope of use or functionality , as the techniques and tools may be implemented in diverse general - purpose or special - purpose computing environments . with reference to fig1 , the computing environment 100 includes at least one processing unit 110 and memory 120 . in fig1 , this most basic configuration 130 is included within a dashed line . the processing unit 110 executes computer - executable instructions and may be a real or a virtual processor . in a multi - processing system , multiple processing units execute computer - executable instructions to increase processing power . the memory 120 may be volatile memory ( e . g ., registers , cache , ram ), non - volatile memory ( e . g ., rom , eeprom , flash memory , etc . ), or some combination of the two . the memory 120 stores software 180 implementing a digital media encoder or decoder with one or more of the described techniques and tools . a computing environment may have additional features . for example , the computing environment 100 includes storage 140 , one or more input devices 150 , one or more output devices 160 , and one or more communication connections 170 . an interconnection mechanism ( not shown ) such as a bus , controller , or network interconnects the components of the computing environment 100 . typically , operating system software ( not shown ) provides an operating environment for other software executing in the computing environment 100 , and coordinates activities of the components of the computing environment 100 . the storage 140 may be removable or non - removable , and includes magnetic disks , magnetic tapes or cassettes , cd - roms , dvds ( including high - definition dvds ), or any other medium which can be used to store information and which can be accessed within the computing environment 100 . the storage 140 stores instructions for the software 180 implementing the digital media encoder or decoder . the input device ( s ) 150 may be a touch input device such as a keyboard , mouse , pen , or trackball , a voice input device , a scanning device , still image capture device ( e . g ., digital camera ), or another device that provides input to the computing environment 100 . for audio or video encoding , the input device ( s ) 150 may be a sound card , video card , tv tuner card , or similar device that accepts audio or video input in analog or digital form , or a cd - rom or cd - rw that reads audio or video samples into the computing environment 100 . the output device ( s ) 160 may be a display , printer , speaker , cd - or dvd - writer , or another device that provides output from the computing environment 100 . the communication connection ( s ) 170 enable communication over a communication medium to another computing entity . the communication medium conveys information such as computer - executable instructions , digital media input or output , or other data in a modulated data signal . a modulated data signal is a signal that has one or more of its characteristics set or changed in such a manner as to encode information in the signal . by way of example , and not limitation , communication media include wired or wireless techniques implemented with an electrical , optical , rf , infrared , acoustic , or other carrier . the techniques and tools can be described in the general context of computer - readable media . computer - readable media are any available media that can be accessed within a computing environment . by way of example , and not limitation , with the computing environment 100 , computer - readable media include memory 120 , storage 140 , communication media , and combinations of any of the above . the techniques and tools can be described in the general context of computer - executable instructions , such as those included in program modules , being executed in a computing environment on a target real or virtual processor . generally , program modules include routines , programs , libraries , objects , classes , components , data structures , etc ., that perform particular tasks or implement particular abstract data types . the functionality of the program modules may be combined or split between program modules as desired in various embodiments . computer - executable instructions for program modules may be executed within a local or distributed computing environment . for the sake of presentation , the detailed description uses terms like “ select ” and “ receive ” to describe computer operations in a computing environment . these terms are high - level abstractions for operations performed by a computer , and should not be confused with acts performed by a human being . the actual computer operations corresponding to these terms vary depending on implementation . described embodiments provide advanced still image codec bitstream features , including the ability to perform cardinal rotations and mirror flips on an image without a full decode and re - encode . this feature can be supported by multiple design techniques , including : a . the symmetry of basis functions of the lbt allows a mirror flip of spatial data within the transform block by merely negating the sign of odd - symmetric transform coefficients . this is true for both spatial orientations , x and y . b . the isotropic nature of basis functions of the lbt allows the spatial data within the transform block to be transposed by merely transposing the transform coefficients . cardinal rotations can be implemented as combinations of transpose and mirror flips . a . in order to realize a mirror flip within a macroblock of data , the modified transform blocks are scanned in the laterally inversed sequence ( in x and / or y depending on the requirement ). likewise , within a tile the modified macroblocks are scanned in the laterally inversed order , and within an image the modified tiles are scanned in the laterally inversed order . b . in order to realize a transpose , the modified blocks , macroblocks and tiles are transposed . cardinal rotations can be implemented as combinations of transpose and mirror flips . 3 . signaling of an inscribed area within an extended crop area — this allows for non - macroblock aligned images to be mirror flipped or rotated freely and the non - zero offset of the image from the macroblock grid to be allowed in any direction , not merely the right and bottom . 4 . signaling of position of chroma sample — this allows chroma sub - sampled color formats such as yuv4 : 2 : 0 and yuv4 : 2 : 2 to be rotated by permitting the independent specification of the location of the chroma sample . it also allows the relative alignments of luma / chroma sample positions to be signaled to the decoder , so an upsampling filter with the appropriate phase can be chosen . signaling of positions of chroma samples is covered in detail below . described signaling techniques allow images to be rotated within the compressed domain with no loss of information and no significant change in compressed size . this is a desirable bitstream feature and has complexity benefits . an image consists of multiple planes of data . in the primary space , an image is typically made up of 3 color planes corresponding respectively to the red , green and blue ( r , g and b ) channels . in the internal color space used in most popular codecs , an image is made up of 3 converted color planes often referred to as y , u and v . the y component is called the luminance or luma plane , which roughly corresponds to a grayscale rendering of the image . the u and v components are referred to as chroma , chrominance or color difference planes . the nomenclature y , u , v is used here in a generic sense with the understanding that described techniques and tools are applicable to a variety of “ yuv type ” color formats such as ycbcr , ycocg , etc . a color format called yuv 4 : 4 : 4 has one u and one v sample for each y sample . the human eye is very sensitive to the intensity variation and resolution of the luminance channel . it is relatively less sensitive to chroma . this allows for a simple means of reducing pixel count in the data by sub - sampling or dropping the resolution of the chroma ( u and v ) components . 1 . yuv 4 : 2 : 2 — here , the spatial resolution of u and v in the x direction is reduced by a factor of 2 ( usually with some anti - aliasing filter ). 2 . yuv 4 : 2 : 0 — here , the spatial resolution of u and v in both x and y directions is reduced by a factor of 2 . for the yuv 4 : 2 : 2 case , each chroma sample corresponds to two luma samples . likewise , for the yuv 4 : 2 : 0 case , each chroma sample corresponds to four luma samples . the chroma subsampling is usually performed after filtering the samples with an anti - aliasing filter . the phase of this filter determines the relative position of the chroma and luma samples . when converting back from either of these formats to yuv 4 : 4 : 4 for the purpose of display or printing , the knowledge of the relative sample positions must be available so that the proper upsampling filter can be used . one approach to this problem is to either mandate or signal the exact upsampling filter that should be used . however , this approach imposes additional requirements on the system and may not compatible with the rest of the industry . a simpler and more flexible solution of indicating how to reconstruct full resolution data from a sub - sampled version is by signaling “ position ” information regarding alignment of luma and chroma samples . this approach allows the decoder to use any upsampling filter whose phase is matched to the position information . while this approach does not specify a unique reconstruction rule ( i . e . unique upsampling filter ), it has a sufficiently good performance and has widespread acceptance . the “ position ” of a sub - sampled data point is the location or phase of this value within a full - resolution grid . the position information is used to pick between upsampling filters that are compliant with the phase constraint . the position information is two dimensional in general — a shift is specified in both the horizontal and vertical directions . fig2 and 3 show examples of two common chroma position rules used for yuv 4 : 2 : 0 . in fig2 , phase =( 0 , 0 ), and in fig3 , phase =( 0 . 5 , 0 . 5 ) in luma pixel units . the two examples shown in fig2 and 3 are the most common cases for yuv 4 : 2 : 0 sub - sampling of chroma . these two centering rules are usually sufficient for video data but usually insufficient for image data . a difference between video and images is that video is seldom rotated or mirror flipped , whereas images are very often rotated and / or mirror flipped . to see why the two centering rules are usually insufficient for image data , consider the following cases . case 1 : consider a mirror flip along the horizontal direction for the centering example 1 . now the chroma sample is co - located not with the top left luma sample but with the top right luma sample . the corresponding phase of chroma is ( 1 , 0 ) in luma pixel units , which is not defined by the rules shown in fig2 and 3 . case 2 : likewise , a mirror flip along the vertical direction of an image with chroma position shown in example 1 results in a chroma position with ( 0 , 1 ) phase in luma pixel units which is not defined by the rules shown in fig2 and 3 . the above cases show the usefulness of defining additional chroma centering rules as side information to a bitstream to aid the process of correct reconstruction when the image is subject to the basic operations of cardinal rotations and mirror flips . another complication is introduced by interlaced video . a frame of interlaced video contains two fields — the top field and the bottom field . a field of video may be stored at its full resolution with no chroma downsampling . more commonly , it is carried in a chroma downsampled form such as yuv 4 : 2 : 2 where the chroma is downsampled in the x direction by a factor of 2 , and matches the luma resolution in the y direction . in the recent video codecs , however , a field of interlaced video is defined in the yuv 4 : 2 : 0 space so its chroma is downsampled by a factor of 2 in both x and y directions . this operation often results in a chroma centering with a phase shift of 0 . 25 or 0 . 75 ( in luma pixel units ) in the vertical direction depending on whether it is top or bottom field data , respectively . such a centering can be used to ensure the following : 1 . alternating lines of chroma in the frame are produced by alternating fields . the chroma downsampling of interlace data is shown in fig4 . the x axis downsampling may have any phase and is not relevant to this discussion . therefore , the figure only shows the y axis centering and displacements . with the above in mind , we define two rules for chroma position . the first rule , referred to as the short rule defines 15 chroma centering phases . this rule is signaled using a 4 bit word within an image bitstream . table 1 enumerates the values and corresponding phases of the syntax element chroma_centering_short in one implementation . in the example shown in table 1 , chroma_centering_short can take on values between 0 and 15 , but the value 14 is reserved and not used . chroma_centering_short can be signaled , for example , in an image header or an image plane header . a second and more comprehensive chroma centering rule , referred to as extended rule , is also described . this rule has the advantage of allowing an image to be translated , without loss of data , by any integer number of pixels . this is in addition to rotates and mirror flips . in one implementation , the extended rule is signaled with a seven - bit word ( chroma_centering_long ) within the image bitstream , and the enumeration of phases corresponding to the syntax element chroma_centering_long is as follows . chroma_centering_long = chroma_centering_x + chroma_centering_y * 9 , where chroma_centering_x and chroma_centering_y are syntax elements defining the phase in the x and y directions , as shown below in table 2 . chroma_centering_x and chroma_centering_y take values between 0 and 8 . therefore , chroma_centering_long can take on values between 0 and 80 . values outside this range are reserved . chroma_centering_long , chroma_centering_x and / or chroma_centering_y can be signaled , for example , in an image header or an image plane header . it is possible to use other mappings in place of tables 1 and 2 . it is also possible to use other encodings of the chroma_centering elements such as variable length codes . transform coding is a compression technique used in many digital media ( e . g ., audio , image and video ) compression systems . uncompressed digital image and video is typically represented or captured as samples of picture elements or colors at locations in an image or video frame arranged in a two - dimensional ( 2d ) grid . this is referred to as a spatial - domain representation of the image or video . for example , a typical format for images consists of a stream of 24 - bit color picture element samples arranged as a grid . each sample is a number representing color components at a pixel location in the grid within a color space , such as rgb , or yiq , among others . various image and video systems may use various different color , spatial and time resolutions of sampling . similarly , digital audio is typically represented as time - sampled audio signal stream . for example , a typical audio format consists of a stream of 16 - bit amplitude samples of an audio signal taken at regular time intervals . uncompressed digital audio , image and video signals can consume considerable storage and transmission capacity . transform coding reduces the size of digital audio , images and video by transforming the spatial - domain representation of the signal into a frequency - domain ( or other like transform domain ) representation , and then reducing resolution of certain generally less perceptible frequency components of the transform - domain representation . this generally produces much less perceptible degradation of the digital signal compared to reducing color or spatial resolution of images or video in the spatial domain , or of audio in the time domain . more specifically , a typical block transform - based encoder / decoder system 500 ( also called a “ codec ”) shown in fig5 divides the uncompressed digital image &# 39 ; s pixels into fixed - size two dimensional blocks ( x 1 , . . . x n ), each block possibly overlapping with other blocks . at an encoder 510 , a linear transform 520 - 521 that does spatial - frequency analysis is applied to each block , which converts the spaced samples within the block to a set of frequency ( or transform ) coefficients generally representing the strength of the digital signal in corresponding frequency bands over the block interval . for compression , the transform coefficients may be selectively quantized 530 ( i . e ., reduced in resolution , such as by dropping least significant bits of the coefficient values or otherwise mapping values in a higher resolution number set to a lower resolution ), and also entropy or variable - length coded 530 into a compressed data stream . at decoding , the transform coefficients will inversely transform 570 - 571 to nearly reconstruct the original color / spatial sampled image / video signal ( reconstructed blocks { circumflex over ( x )}{ circumflex over ( x 1 )}, { circumflex over ( x )}{ circumflex over ( x n )}). the block transform 520 - 521 can be defined as a mathematical operation on a vector x of size n . most often , the operation is a linear multiplication , producing the transform domain output y = mx , m being the transform matrix . when the input data is arbitrarily long , it is segmented into n sized vectors and a block transform is applied to each segment . for the purpose of data compression , reversible block transforms are chosen . in other words , the matrix m is invertible . in multiple dimensions ( e . g ., for image and video ), block transforms are typically implemented as separable operations . the matrix multiplication is applied separably along each dimension of the data ( i . e ., both rows and columns ). for compression , the transform coefficients ( components of vector y ) may be selectively quantized ( i . e ., reduced in resolution , such as by dropping least significant bits of the coefficient values or otherwise mapping values in a higher resolution number set to a lower resolution ), and also entropy or variable - length coded into a compressed data stream . at decoding in the decoder 550 , the inverse of these operations ( dequantization / entropy decoding 560 and inverse block transform 570 - 571 ) are applied on the decoder 550 side , as shown in fig5 . while reconstructing the data , the inverse matrix m − 1 ( inverse transform 570 - 571 ) is applied as a multiplier to the transform domain data . when applied to the transform domain data , the inverse transform nearly reconstructs the original time - domain or spatial - domain digital media . in many block transform - based coding applications , the transform is desirably reversible to support both lossy and lossless compression depending on the quantization factor . with no quantization ( generally represented as a quantization factor of 1 ) for example , a codec utilizing a reversible transform can exactly reproduce the input data at decoding . however , the requirement of reversibility in these applications constrains the choice of transforms upon which the codec can be designed . many image and video compression systems , such as mpeg and windows media , among others , utilize transforms based on the discrete cosine transform ( dct ). the dct is known to have favorable energy compaction properties that result in near - optimal data compression . in these compression systems , the inverse dct ( idct ) is employed in the reconstruction loops in both the encoder and the decoder of the compression system for reconstructing individual image blocks . fig6 and 7 are a generalized diagram of the processes employed in a representative 2 - dimensional ( 2d ) data encoder 600 and decoder 700 . the diagrams present a generalized or simplified illustration of a compression / decompression system that can be used to implement described techniques and tools . in alternative compression / decompression systems , additional or fewer processes than those illustrated in this representative encoder and decoder can be used for the 2d data compression . for example , some encoders / decoders may also include color conversion , color formats , scalable coding , lossless coding , macroblock modes , etc . the compression system ( encoder and decoder ) can provide lossless and / or lossy compression of the 2d data , depending on the quantization which may be based on a quantization parameter varying from lossless to lossy . the 2d data encoder 600 produces a compressed bitstream 620 that is a more compact representation ( for typical input ) of 2d data 610 presented as input to the encoder . for example , the 2d data input can be an image , a frame of a video sequence , or other data having two dimensions . the 2d data encoder divides a frame of the input data into blocks ( illustrated generally in fig6 as partitioning 630 ), which in the illustrated implementation are non - overlapping 4 × 4 pixel blocks that form a regular pattern across the plane of the frame . these blocks are grouped in clusters , called macroblocks , which are 16 × 16 pixels in size in this representative encoder . in turn , the macroblocks are grouped into regular structures called tiles . the tiles also form a regular pattern over the image , such that tiles in a horizontal row are of uniform height and aligned , and tiles in a vertical column are of uniform width and aligned . in the representative encoder , the tiles can be any arbitrary size that is a multiple of 16 in the horizontal and / or vertical direction . alternative encoder implementations can divide the image into block , macroblock , tiles , or other units of other size and structure . a “ forward overlap ” operator 640 is applied to each edge between blocks , after which each 4 × 4 block is transformed using a block transform 650 . this block transform 650 can be the reversible , scale - free 2d transform described by srinivasan , u . s . patent application ser . no . 11 / 015 , 707 , entitled , “ reversible transform for lossy and lossless 2 - d data compression ,” filed dec . 17 , 2004 . the overlap operator 640 can be the reversible overlap operator described by tu et al ., u . s . patent application ser . no . 11 / 015 , 148 , entitled , “ reversible overlap operator for efficient lossless data compression ,” filed dec . 17 , 2004 ; and by tu et al ., u . s . patent application ser . no . 11 / 035 , 991 , entitled , “ reversible 2 - dimensional pre -/ post - filtering for lapped biorthogonal transform ,” filed jan . 14 , 2005 . alternatively , the discrete cosine transform or other block transforms and overlap operators can be used . subsequent to the transform , the dc coefficient 660 of each 4 × 4 transform block is subject to a similar processing chain ( tiling , forward overlap , followed by 4 × 4 block transform ). the resulting dc transform coefficients and the ac transform coefficients 662 are quantized 670 , entropy coded 680 and packetized 690 . the decoder performs the reverse process . on the decoder side , the transform coefficient bits are extracted 710 from their respective packets , from which the coefficients are themselves decoded 720 and dequantized 730 . the dc coefficients 740 are regenerated by applying an inverse transform , and the plane of dc coefficients is “ inverse overlapped ” using a suitable smoothing operator applied across the dc block edges . subsequently , the entire data is regenerated by applying the 4 × 4 inverse transform 750 to the dc coefficients , and the ac coefficients 742 decoded from the bitstream . finally , the block edges in the resulting image planes are inverse overlap filtered 760 . this produces a reconstructed 2d data output 790 . in an exemplary implementation , the encoder 600 ( fig6 ) compresses an input image into the compressed bitstream 620 ( e . g ., a file ), and the decoder 700 ( fig7 ) reconstructs the original input or an approximation thereof , based on whether lossless or lossy coding is employed . the process of encoding involves the application of a forward lapped transform ( lt ) discussed below , which is implemented with reversible 2 - dimensional pre -/ post - filtering also described more fully below . the decoding process involves the application of the inverse lapped transform ( ilt ) using the reversible 2 - dimensional pre -/ post - filtering . the illustrated lt and the ilt are inverses of each other , in an exact sense , and therefore can be collectively referred to as a reversible lapped transform . as a reversible transform , the lt / ilt pair can be used for lossless image compression . the input data 610 compressed by the illustrated encoder 600 / decoder 700 can be images of various color formats ( e . g ., rgb / yuv4 : 4 : 4 , yuv4 : 2 : 2 or yuv4 : 2 : 0 color image formats ). typically , the input image always has a luminance ( y ) component . if it is a rgb / yuv4 : 4 : 4 , yuv4 : 2 : 2 or yuv4 : 2 : 0 image , the image also has chrominance components , such as a u component and a v component . the separate color planes or components of the image can have different spatial resolutions . in case of an input image in the yuv 4 : 2 : 0 color format for example , the u and v components have half of the width and height of the y component . as discussed above , the encoder 600 tiles the input image or picture into macroblocks . in an exemplary implementation , the encoder 600 tiles the input image into 16 × 16 pixel areas ( called “ macroblocks ”) in the y channel ( which may be 16 × 16 , 16 × 8 or 8 × 8 areas in the u and v channels depending on the color format ). each macroblock color plane is tiled into 4 × 4 pixel regions or blocks . therefore , a macroblock is composed for the various color formats in the following manner for this exemplary encoder implementation : for a grayscale image , each macroblock contains 16 4 × 4 luminance ( y ) blocks . for a yuv4 : 2 : 0 format color image , each macroblock contains 16 4 × 4 y blocks , and 4 each 4 × 4 chrominance ( u and v ) blocks . for a yuv4 : 2 : 2 format color image , each macroblock contains 16 4 × 4 y blocks , and 8 each 4 × 4 chrominance ( u and v ) blocks . for a rgb or yuv4 : 4 : 4 color image , each macroblock contains 16 blocks each of y , u and v channels . accordingly , after transform , a macroblock in this representative encoder 600 / decoder 700 has three frequency sub bands : a dc sub band ( dc macroblock ), a low pass sub band ( low pass macroblock ), and a high pass sub band ( high pass macroblock ). in the representative system , the low pass and / or high pass sub bands are optional in the bitstream — these sub bands may be entirely dropped . further , the compressed data can be packed into the bitstream in one of two orderings : spatial order and frequency order . for the spatial order , different sub bands of the same macroblock within a tile are ordered together , and the resulting bitstream of each tile is written into one packet . for the frequency order , the same sub band from different macroblocks within a tile are grouped together , and thus the bitstream of a tile is written into three packets : a dc tile packet , a low pass tile packet , and a high pass tile packet . in addition , there may be other data layers . thus , for the representative system , an image is organized in the following “ dimensions ”: spatial dimension : frame → tile → macroblock ; frequency dimension : dc \| low pass \| high pass ; and channel dimension : luminance \| chrominance \| chrominance — 1 . . . ( e . g . as y \| u \| v ). the arrows above denote a hierarchy , whereas the vertical bars denote a partitioning . although the representative system organizes the compressed digital media data in spatial , frequency and channel dimensions , the flexible quantization approach described here can be applied in alternative encoder / decoder systems that organize their data along fewer , additional or other dimensions . for example , the flexible quantization approach can be applied to coding using a larger number of frequency bands , other format of color channels ( e . g ., yiq , rgb , etc . ), additional image channels ( e . g ., for stereo vision or other multiple camera arrays ). having described and illustrated the principles of our invention with reference to various embodiments , it will be recognized that the various embodiments can be modified in arrangement and detail without departing from such principles . it should be understood that the programs , processes , or methods described herein are not related or limited to any particular type of computing environment , unless indicated otherwise . various types of general purpose or specialized computing environments may be used with or perform operations in accordance with the teachings described herein . elements of embodiments shown in software may be implemented in hardware and vice versa . in view of the many possible embodiments to which the principles of the disclosed invention may be applied , it should be recognized that the illustrated embodiments are only preferred examples of the invention and should not be taken as limiting the scope of the invention . rather , the scope of the invention is defined by the following claims . we therefore claim as our invention all that comes within the scope and spirit of these claims .	7
referring first to fig1 and 2 , a coating device generally designated by the reference numeral 1 is provided with a box - shaped casing 2 and a plurality of casters 3 are securely fixed to the bottom of the casing 2 so that the casing 2 is movable . a base plate 4 is extended horizontally at the lower portion of the casing 2 and an upright panel 5 is erected on the base plate 4 intermediates the front and rear sides of the casing 2 . the upper end of the upright panel 5 is positioned in the vicinity of the top of the casing 2 and is supported by a ceiling plate 6 which in turn is attached to the casing 2 and is extended in the horizontal direction . the width of the upright panel 5 is substantially equal to that of the casing 2 and a door 7 is attached to the front opening of the casing 2 forwardly of the upright panel 5 so as to open the casing 2 to the exterior or to close the casing 2 from the exterior . a supply roller 8 is supported like a cantilever substantially at the center of the upright panel 5 and a roll of a continuous base member 9 is rotatably mounted on the supply roller 8 . a coating stand 10 is supported by the upright panel 5 immediately above the supply roller 8 and is extended forwardly . a coating means 11 to be described in detail hereinafter is mounted on the coating stand 10 . an orientation device 12 is supported by the upright panel 5 and extended forwardly from the left side of the coating stand 10 ( see fig1 ). when a magnetic coating liquid is coated on a continuous base member 13 unrolled from the continuous base member roll 9 , by a coating means 11 , the orientation device 12 serves to improve the orientation of magnetic finely divided particles contained in the coating medium . a driving roller 14 is supported like a cantilever by the upright panel 5 at a position below the horizontal center line thereof and is drivingly connected to a rotating shaft 17 of a motor 16 securely mounted on a motor stand 15 which in turn is securely mounted on the base plate 4 behind the upright panel 5 . therefore when the motor 16 is energized , the driving roller 14 is rotated . a pulley 18 to be described in detail hereinafter is mounted on the rotating shaft 17 of the motor 16 . an arm 19 is pivoted with a pin 20 to the upright panel 5 in the vicinity of the driving roller 14 and carries a driven roller 21 which is in contact with the driving roller 14 . the driven roller 21 is normally pressed against the driving roller 14 under the force of a bias spring ( not shown ). a take - up roller 22 for rewinding the coated continuous base member 13 is supported like a cantilever by the upright panel 5 on the right side of the driving roller 14 and is driven by a motor 23 as in the case of the driving roller 14 . a plurality of guide rollers 24a , 24b and so on are supported like a cantilever by the front surface of the upright panel 5 so as to define the passage of the continuous base member 13 which is unrolled from the continuous base member roll 9 , passes through the coating means 11 , the orientation device 12 and the driving roller 14 and then is wound by the take - up roller 22 . these guide rollers 24a and 24b are so arranged that the continuous base member 13 unrolled from the continuous base member roll 9 is transported around the roll 9 twice along a spiral passage in the counterclockwise direction before it reaches the driving roller 14 . the guide rollers 24a are driven positively while the guide rollers 24b are driven when they are made into sliding contact with the continuous base member 13 . a suitable number of positive guide rollers 24a are interposed between the passive guide rollers 24b so that even when the distance between the continuous base member roll 9 and the driving roller 14 which unrolls the continuous base member 13 is relatively long , the elongation of the continuous base member 13 can be prevented . more particularly , the positive guide roller 24a most closer to the driving roller 14 carries a pulley 25 behind the upright panel 5 and an endless belt ( not shown ) is wrapped around the groove 26 of the pulley 25 and the groove 27 of the pulley 18 carried by the rotating shaft 17 of the motor 16 so that the rotation of the motor 16 is transmitted to the positive guide roller 24a . endless belts ( not shown ) are wrapped around the grooves 28 and 29 of the positive guide pulley 25 of the positive guide roller 24a and the pulleys carried by the other positive guide rollers 24a so that the latter are positively driven . a plurality of positive and passive guide rollers 24a and 24b are used so that they are made of a aluminum and consequently the coating device 1 is light in weight . the surfaces of the guide rollers 24a and 24b are subjected to the surface treatment so as to form an alumilite layer or are plated with hard chrominum . referring next to fig3 the coating means 11 has a base frame 30 mounted on the coating stand 10 and a pair of guide walls 31 are extended upwardly from the lengthwise side walls of the base frame 30 and are spaced apart from each other by a suitable distance in the widthwise direction of the continuous base member 13 . a sliding plate 33 having a polished upper surface 34 such as a mirror surface of a sheet of glass is disposed on the upper surface 32 of the base frame 30 between the guide walls 31 and a coating liquid supply means 35 for supplying coating liquid to the sliding plate 33 is mounted on the upper surface 34 of the sliding plate 33 . the coating liquid supply means 35 is of a rectangular cross section and has a vertical through hole 36 to define a pool of coating liquid 36 and the lengthwise ends of the coating liquid supply means 35 abut the guide walls 31 , respectively . the lower side of the rear wall 37 of the coating liquid supply means 35 which is on the downstream side of the continuous base member 13 transported through the coating means 11 , is formed with a slit 38 substantially over the whole length of the hole 36 in the coating medium supply means 35 and the slit 38 and the upper surface 34 of the sliding plate 33 are spaced apart from each other by a predetermined distance . a coating liquid fed into the coating liquid supply means 35 issues through the slit 38 . the upper side of each of the guide walls 31 is formed with a pair of arcuate recesses 39 which are spaced apart from each other by a predetermined distance in the direction in which the continuous base member 13 is transported and a pair of arcuate recesses 39 formed at the upper side of one guide wall 31 are in opposed relationship with a pair of arcuate recesses 39 formed at the upper side of the other guide wall 31 . a pair of cylindrical stoppers 40 are extended between the guide walls 31 and fitted into the arcuate recesses 39 of the guide walls 31 . the distance between the stoppers 40 is substantially equal to the length of the coating liquid supply means 35 in the direction in which the continuous base member 13 is transported so that the coating liquid supply means 35 is sandwiched between the stoppers 40 and is prevented from being displaced in the direction in which the continuous base member 13 is transported . referring back to fig1 and 2 , operation panels 41 are attached to the upper front portion of the casing 2 and a drawer 42 for receiving tools and the like therein is provided at the lower portion of the casing 2 . next the mode of operation of the coating device with the above - described construction will be described . first , the door 7 of the casing 2 is opened so that the continuous base member roll 9 is mounted on the supply roller 8 and an operator manually unwinds the continuous base member 13 from the roll 9 , wraps it around the guide rollers 24a and 24b , passes it through the coating means 11 , the orientation device 12 and the driving roller 14 and winds the leading edge of the continuous base member 13 around the take - up roller 22 . prior to the above - described threading operation , the coating liquid supply means 35 of the coating means 11 is removed and the continuous base member 13 is caused to slide over the upper surface 34 of the sliding plate 33 . thereafter , the coating liquid supply means 35 is mounted on the continuous base member 13 on the slide plate 33 and after a predetermined quantity of a coating liquid is fed into the coating liquid supply means 35 , the door 7 is closed . next the motors 16 and 23 are energized so that the driving roller 14 is rotated and consequently the continuous base member 13 clamped between the driving roller 14 and the driven roller 21 is pulled , whereby it is gradually unrolled from the roll 9 . when the continuous base member 13 passes over the slide plate 33 of the coating means 11 , the coating liquid issues through the slit 38 of the coating liquid supply means 35 over the continuous base member 13 without entraining dust particles in the coated layer . the continuous base member 13 which passed through the coating means 11 is guided by the guide roller 24b so as to enter the orientation device 12 . when the magnetic coating liquid is used in the coating means 11 , the orientation device 12 improves the orientation of finely divided magnetic particles contained in the coated layer . thereafter , the continuous base member 13 is guided by the guide rollers 24a and 24b in such a way that the coated layer on the continuous base member 13 is not made in contact with the guide rollers 24a and 24b and is transported around the roll 9 about one and a half turns so that the coated liquid is dried . when the coated continuous base member 13 reaches the driving roller 14 , the coated layer on the continuous base member 13 is made into contact with the driving roller 14 for the first time since it has left the coating means 11 , but while the continuous base member 13 is transported a long distance between the coating means 11 and the driving roller 14 , the coating liquid applied to the continuous base member 13 is already sufficiently dried . therefore , the degradation of the quality of the coated layer on the continuous base member 13 due to the contact thereof with the driving roller 14 can be avoided . even though the continuous base member 13 is transported a long distance from the coating means 11 to the driving roller 14 , it is positively transported by the positive guide rollers 24a which are rotated by the motor 16 so that there is no possibility that the continuous base member 13 is elongated . the continuous base member 13 which has passed past the driving roller 14 and the driven roller 13 is rewound by the take - up roller 22 which is driven by the motor 23 . when the coating device 1 is used in coating tests , the thickness of the coated layer on the continuous base member 13 can be varied in a simple manner by replacing the coating liquid supply means 35 with another coating liquid supply means having a slit 38 of a different width . in the case of coating tests , it is preferable that the rollers 8 , 14 , 24a and 24b are small in size . when the coating device 1 is used in a cold northern district , it is preferable to provide as an option a heater for heating the interior of the casing 2 , thereby accelerating the drying of the coated layer .	6
detailed descriptions of one or more preferred embodiments are provided herein . it is to be understood , however , that the present invention may be embodied in various forms . therefore , specific details disclosed herein are not to be interpreted as limiting , but rather as a basis for the claims and as a representative basis for teaching one skilled in the art to employ the present invention in any appropriate manner . the present invention encompasses three embodiments of a combined umbilical cord clamp , cutter , disinfectant , and data collecting system to be used in developing nations ( fig1 , fig2 , fig3 , fig4 , fig5 , fig6 , fig7 , fig8 , and fig9 ). in the first embodiment illustrated in fig1 , 2 , 3 , and 4 , two symmetric units composed of a sufficiently hard plastic material to cut umbilical tissue and embedded with an rfid chip fit together and form a thin , oval shape ( 1 ). this guides the umbilical tissue to the center of the device , producing an even cutting motion as the device is being closed . the use of two identical units allows the orientation of the device to be irrelevant during use . each unit has a saw - toothed chamfered cutting blade with the largest blade in the center to allow the largest cut to be made in the center of the umbilical cord ( 2 ). the chamfered edges of the blade provide shearing strength , thereby allowing the blade to be manufactured in the same hard plastic as the rest of the device ( 1 ). once closed , the chamfered edge produces a seal , preventing the umbilical cord from being exposed to the environment . the blades of the symmetric units are flush with one another when the units are together , creating a single cutting site along the umbilical cord . each unit also has a clamp ( 3 ) with small , curved saw - toothed edges . once closed , these edges form a tight seal around the umbilical cord tissue to stop the flow of blood . unlike the cutting blade ( 2 ), the teeth of the clamp are dulled in order to securely clamp the cord without severing it . an ergonomically designed handle - grip ( 4 ) flares out from the curve of the symmetric units ( 1 ). the placement of the handle gives the user extra leverage during the cutting stroke to ensure that the umbilical cord is completely severed . it also provides an obvious gripping point ; the shape of the handle allows the user &# 39 ; s thumb to rest in the curved portion on one side and the user &# 39 ; s index finger to rest in the curved portion on the other side . each unit has a barrel hinge , allowing the device to be manufactured as two symmetric parts ( 5 ). the two hinges of the symmetric units are in parallel to provide a single axis of rotation for a smooth cutting motion . the ratchet - locking system ( 6 ) is incorporated with the barrel hinge ( 5 ). once closure of the device begins , the ratchet - locking system prevents the symmetric units from being reopened after use . with each small movement toward closing the device , successive ratchet locks will take hold and prevent the device from being opened wider than the current position . this is important because reopening would nullify many of the safety and disinfectant features of the device . the press fit extrusions ( 7 ) temporarily hold the two symmetric units together until the umbilical cord has been severed . after cutting , the units are pulled apart to form separate entities , and one unit remains attached to the infant until the stump of the umbilical cord atrophies and falls off . the symmetric units contain a small disinfectant packet located between the two blades ( 8 ). in one motion , the blade travels through the packet , severing the cord and releasing the contents onto the severed end of the umbilical cord . the hook - locking mechanism ensures the device does not reopen once the cutting motion is complete ( 9 ). this feature is a failsafe for the ratchet lock ( 6 ), and together , the two features comprise a tamper - proof locking system . in the second embodiment illustrated in fig5 and 6 , two symmetric units composed of a sufficiently hard plastic material to cut umbilical tissue embedded with an rfid chip fit together to form a thin , s - curved shape ( 21 ). this guides the umbilical tissue to the center of the device , producing an even cutting motion as the device is being closed . the use of two identical units allows the orientation of the device to be irrelevant during use . each unit has a saw - toothed chamfered cutting blade with a semi - circular shape to allow for an even cutting motion ( 22 ). the chamfered edges of the blade provide shearing strength , thereby allowing the blade to be manufactured in the same hard plastic as the rest of the device ( 21 ). once closed , the chamfered edge produces a seal , preventing the umbilical cord from being exposed to the environment . the blades of the symmetric units are flush with one another , creating a single cutting site along the umbilical cord . each unit also has a clamp ( 23 ) with small saw - toothed edges . once closed , these edges form a tight seal around the umbilical cord tissue to stop the flow of blood . unlike the cutting blade ( 22 ), the teeth of the clamp are dulled in order to securely clamp the cord without severing it . an ergonomically designed handle ( 24 ) is formed by the s - curved shape of the two symmetric units ( 21 ). the placement of the handle gives the user extra leverage at the end of the cutting stroke to ensure that the umbilical cord is completely severed . it also provides an obvious gripping point ; the shape of the handle allows the user &# 39 ; s thumb to rest in the curved portion on one side and the user &# 39 ; s index finger to rest in the curved portion on the other side . each unit has a barrel hinge , allowing the device to be manufactured as two symmetric parts ( 25 ). the two hinges of the symmetric units are in parallel to provide a single axis of rotation for a smooth cutting motion . the ratchet - locking system ( 26 ) is incorporated with the barrel hinge ( 25 ). once closure of the device begins , the ratchet - locking system prevents the symmetric units from being reopened after use . with each small movement toward closing the device , successive ratchet locks will take hold and prevent the device from being opened wider than the current position . this is important because reopening would nullify many of the safety and disinfectant features of the device . the press fit extrusions ( 27 ) temporarily hold the two symmetric units together until the umbilical cord has been severed . after cutting , the units are pulled apart to form separate entities , and one unit remains attached to the infant until the stump of the umbilical cord atrophies and falls off . the symmetric units contain a small reservoir , providing space for a disinfectant packet ( 28 ). in one motion , the blade travels through the packet during the cutting motion , releasing the contents onto the severed end of the umbilical cord . in the third embodiment illustrated in fig7 , 8 and 9 , two symmetric units composed of a sufficiently hard plastic material to cut umbilical tissue embedded with an rfid chip fit together and form an oval shape ( 31 ). this guides the umbilical tissue to the center of the device , producing an even cutting motion as the device is being closed . the use of two identical units allows the orientation of the device to be irrelevant during use . each unit has a saw - toothed chamfered cutting blade with a semi - circular shape to allow for an even cutting motion ( 32 ). the chamfered edges of the blade provide shearing strength , thereby allowing the blade to be manufactured in the same hard plastic as the rest of the device ( 31 ). once closed , the edge of each unit produces a seal , preventing the umbilical cord from being exposed to the environment . each blade is completely enclosed by its respective symmetric unit ; therefore , there are two cutting sites along the umbilical cord . each unit also has a clamp ( 33 ) with small saw - toothed edges . once closed , these edges form a tight seal around the umbilical cord tissue to stop the flow of blood . unlike the cutting blade ( 32 ), the teeth of the clamp are dulled in order to securely clamp the cord without severing it . a separate ergonomically designed handle forms an s - curved shape around the two symmetric units ( 34 ). the placement of the handle gives the user extra leverage at the end of the cutting stroke to ensure that the umbilical cord is completely severed . it also provides an obvious gripping point ; the shape of the handle allows the user &# 39 ; s thumb to rest in the curved portion on one side and the user &# 39 ; s index finger to rest in the curved portion on the other side . the separate handle also provides added protection from umbilical blood that could leak through the space between the symmetric units ( 31 ). each unit has a barrel hinge to reduce the number of manufacturing parts ( 35 ). the two hinges of the symmetric units and the hinge of the handled holder are all in parallel to provide a single axis of rotation for a smooth cutting motion . the hook locking system ensures the device does not reopen once the cutting motion is complete ( 36 ). this is important because reopening would nullify many of the safety and disinfectant features of the device . four flared locking bars allow the two symmetric units to slide out of the handled holder ( 37 ). after cutting , the units are pulled apart to form separate entities , and one unit remains attached to the infant until the stump of the umbilical cord atrophies and falls off . the symmetric units contain a small reservoir , providing space for a disinfectant packet ( 38 ). in one motion , the blade travels through the packet during the cutting motion , releasing the contents onto the severed end of the umbilical cord . the following is a list of reference numerals for fig1 , 2 , 3 and 4 : 7 press fit extrusions to temporarily hold two units together the following is a list of reference numerals for fig5 and 6 : 27 press fit extrusions to temporarily hold two units together the following is a list of reference numerals for fig7 , 8 and 9 : 37 four flared locking bars to connect units to handled holder it will be understood that each of the elements described above , or two or more together may also find a useful application in other types of methods differing from the type described above . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can , by applying current knowledge , readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute essential characteristics of the generic or specific aspects of this invention set forth in the appended claims . the foregoing embodiments are presented by way of example only ; the scope of the present invention is to be limited only by the following claims .	0
in fig1 there is shown an unfolded piece of material 1 from which a container is made according to a preferred method of the invention . this piece 1 is folded along the folding line 2 . the cuts for forming filling opening 3 and for forming the flaps 4 having lower edges a , a &# 39 ;, b and b &# 39 ; are made at the upper edge ( i . e . the folding line ) and at the lower edges , respectively , of the piece 1 , and preferably after the piece 1 has been folded . to illustrate the flaps 4 more clearly , two of them are shaded . if the container is to be made with , for instance , eight flaps instead of four , cuts would also have to be made along the broken lines 5 at the lower edges of piece 1 . the adjacent portions of two side edges 6 are joined together along the illustrated dotted lines , whereupon the bottom flaps are joined together in pairs such that each flap is joined to the diametrically opposite flap . specifically , in the illustrated case of four flaps , the edges are joined together a to a &# 39 ; and b to b &# 39 ;. alternatively the container can be made from two pieces of material each having a width equal to half of piece 1 shown in fig1 . such two pieces are joined together along the edges d - e and f - g shown in fig1 before folding along the folding line 2 . cutting to form the filling opening 3 and the bottom flaps 4 will therefore be unnecessary , and the container will have four vertical side seams . the container can also be made from one piece of material having half the width and double the length of that shown in fig1 . in this case also , four side seams must be made , but only one bottom seam because the inner bottom is formed by the middle of the piece of material connecting two opposite sides of the bag . the outer bottom is then formed by sewing together the two ends of the piece of material at the bottom of the other opposite sides . fig2 is a perspective view of the preferred container as viewed from below , such that the joints 8 and 8 &# 39 ; of the flaps , formed by joining edges a to a &# 39 ; and b to b &# 39 ; as discussed above , are visible . fig3 shows a design in which the folding line 2 constitutes one of the vertical edges of the container . in this embodiment the upper edge of the container must be joined together , whereby its load carrying capacity is reduced depending on the relationship between the tenacity of the warp of the material and that of the joints , as compared with the preferred design shown in fig1 . in fig4 there is shown a design with a conventional open top made from a piece of material in the form of a circular woven , transversely cut hose . however , flat fabric having one or more vertical side seams can also be used . the container shown can be closed by lashing or by bunching and can be lifted by a clamping hook , a strap with a noose or similar device . the bead 7 , made by folding and sewing the upper edge , prevents the grip from slipping out . separate loops can also be fastened to the container &# 39 ; s top section . this design also includes pairs of flaps 4 are joined together at their lower edges such that a is joined to a &# 39 ; and b to b &# 39 ;. fig5 shows a design made from a circular woven piece of material in the form of a transversely cut hose . such a piece of material should have a width equal to the container &# 39 ; s total height when flattened . cuts for the filling opening 3 are made at the center of its upper edge , and the cuts for the flaps 4 are made at the lower edge , so that a = a &# 39 ; = b / 2 , as shown in the drawing . the hose is cut along the edges a and a &# 39 ;, the side edges 6 are joined together as indicated by the dotted lines and finally the flaps 4 so formed are joined together at the lower edges a and a &# 39 ; after the flaps are folded . two flaps are formed by the material extending upwardly from the folded edge b , the lower edges of these flaps being already joined . flexible containers according to norwegian patent application no . 4350 / 73 , corresponding to british pat . no . 1 , 475 , 019 , and the present invention were tested dynamically . each container was hoisted up in a stand by means of a hook attached to a chain . a strain gauge for measuring the load on the container was coupled between the chain and the stand . during the tests the containers were filled with 800 kgs of free - flowing bulk material and they were allowed to fall a distance , in the following table called the maximum drop height , corresponding to the height to which the lower end of the chain was hitched up before being suddenly released . by the end of the free fall the container was stopped abruptly by the chain . the course of the load was measured by the gauge and registered on a recorder . the containers were tested as the drop height was increased between each test until failure of the container occurred . the maximum drop height and maximum load given in the table show the drop height and corresponding recorded load to which the container was exposed before failing . apart from a few cases where the seams had failures , the containers ruptured somewhat below the top of the loops . this means that the loops and the bottom as such can take up higher loads than the container fabric itself . the flexible containers were manufactured by two companies named i and ii in the table . this explains to some extent the scatter in the test results . table : ______________________________________container max . drop max . loaddesign manfact . test no . height mm kgs______________________________________acc . to 1 160 3040norw . appl . i 2 220 4000no . 4350 / 73 3 220 4240 4 280 4720 5 205 3360 6 250 3840 ii 7 295 4080 8 250 3240average values 235 3815according tothe invention i 9 325 5360 10 415 6240 11 295 5480 12 385 4640 13 475 5400 ii 14 415 5360 15 475 5680average values 397 . 8 5451______________________________________ it is evident from the above experiments that the new bottom design according to the present invention makes it possible to expose a filled container to greater loads than the previously known design according to the above mentioned norwegian patent application . calculated on the basis of drop height and recorded maximum load , the new container can absorb 69 % more impact energy and withstand 43 % higher dynamic loads . the flexible container according to the invention therefore is not only stronger than conventional previously known containers , but can also be made by a simple method , and additionally the new bottom design does not require higher consumption of material than the container according to norwegian application no . 4350 / 73 corresponding to british pat . no . 1 , 475 , 019 . it will be apparent that various modifications of the above described specific structural arrangements and operations may be made without departing from the scope of the present invention .	1
above in connection with the description of the prior art reference was made to fig1 - 4 , and in the next description of the invention and its preferred embodiments reference will be made mostly to fig5 a - 10 . in the figures , the same reference numbers are used for corresponding parts . fig5 a , 5 b and 5 c show a part of the rack or wall 501 seen from the front ( fig5 a ), from above ( fig5 b ) and from the side ( fig5 c ). for shortness , the following description will concentrate on a shelf on which the boards are placed in a vertical position , but it will be clear to a person skilled in the art that the board holders can also be formed on the walls of the rack , whereby the boards would be placed in a horizontal position . according to the invention , a number of bubble - like embossments 502 are formed on the shelf . adjacent embossments mean two embossments which are side by side at the same distance from the front edge of the shelf . consecutive embossments mean two embossments on the same imaginary line which is perpendicular to the front edge of the shelf . the distance d between two adjacent embossments is the same as the thickness of the edge of a board which is intended to be installed by using the board holders according to the invention , added by a certain tolerance , which can be specified by testing ; one suitable tolerance is 0 . 6 mm . the distance k between consecutive embossments is not important for the invention . it is advantageous to make at least two rows of consecutive embossments on the shelf to provide support for the edge of the board on at least two points , but this is not necessary . if the boards are small and / or the embossments reach over a relatively large part of the shelf in the direction perpendicular to the front edge of the shelf ( at least a third of the length of the board ), consecutive embossments are not needed . fig5 a , 5 b and 5 c show a shape of the edges of the bubble - like embossments , which is advantageous for the invention but not limiting . seen from above , the bubble - like embossments are shaped like squares with rounded corners , which shape provides many advantages . in the first place , the edge 503 of such an embossment at the side of the front edge of the shelf covers the space between two adjacent board places entirely , whereby it is not possible to put the board in any other places than the ones determined by the board holders . this ensures that the connectors of each board meet the counterparts on the mother board directly and safely . it is advantageous that the corners 504 on the side of the front edge of the shelf are rounded , because they guide the board pushed between the embossments easily on place . it is also advantageous that those of the consecutive embossments which are further from the front edge of the shelf have rounded comers at least on the side of the front edge of the shelf for the above mentioned reason : when the board is pushed on place , it is easily placed a little askew at first , but the rounded comers of the next embossment help to straighten the board and place it correctly . in addition , the rounded comers provide a finished impression and they do not damage the boards or injure the fingers of the person handling them . the fact that the two sides 503 and 510 of the embossment , which differ substantially from the intended direction of the edge of the circuit board are parallel , also has an important advantage , which will be dealt with later in connection with the description of the manufacturing method . seen from the front and the sides , the edges of the bubble - like embossments shown in fig5 a - 5 c are shaped so that they rise from the level of the surface of the shelf in about a 90 degree angle at first but are then rounded towards a horizontal direction . seen from the front or the side , the bubble - like embossment looks like a letter d , the rounded part of which is pointed at right angles outward from the surface of the shelf and elongated in the direction of the shelf surface . this shape also provides some advantages . the sharp angle 505 to the surface of the shelf ensures that it is easy to slide the board between two adjacent embossments , because the edge of the board lies against the even part which remains between the embossments . on the other hand , the rounding 506 at the upper edges of the embossments is advantageous for the safety of operation , because a rounded edge does not damage the boards or injure the fingers of the installer . the profile formed by the edge of the embossment has a stiffening effect on the shelf , whereby it does not bend easily even if many heavy boards were placed on it . the profile formations 507 and 508 in the direction of the front edge of the shelf also contribute to making the shelf more rigid . the invention does not limit the formation of the shelf in addition to the manufacture of board holders according to the invention . in fig5 a - 5 c , a ventilation hole 509 is formed in the middle of each embossment . each embossment reaches almost from one circuit board to another in the direction of the front edge of the shelf . this makes the ventilation hole in the middle of the embossment rather large , which contributes to efficient ventilation . the ventilation hole could also be round , oval or consist of many smaller holes . the invention does not limit the size , shape or number of ventilation holes formed in the middle of the embossment and does not even require that there should be ventilation holes in the embossments , but if implemented in the manner shown in fig5 a to 5 c , the board holders and ventilation holes support each other and ensure efficient ventilation . in the manufacturing process , the ventilation holes are preferably made before their edges are bent as the edges of the bubble - like embossments . in addition to a square with rounded corners , other shapes shown in fig6 can also be used as the basic forms of a bubble - like embossment and ventilation hole . in the figure it is assumed that the front edge of the shelf is at the bottom of the figure . however , the shapes where the bubble - like embossment does not comprise two parts of considerable length , which are substantially straight and parallel and the direction of which differs considerably of the intended direction of the edge of the circuit board do not provide the advantage of scalability , which will be described in the following description of the manufacturing tool and method . it is also possible to form ventilation holes in other parts of the shelf than in the middle of the bubble - like embossments . in one preferred embodiment of the invention there are as many ventilation holes placed between the consecutive bubble - like embossments as is possible without substantially reducing the strength of the shelf . a suitable size and number of ventilation holes can then be found by testing . fig7 shows the working surface of a tool according to the invention which is particularly suitable for the manufacture of board holders according to the invention in which the shape of the embossments comprises a part of considerable length and substantially in the direction of the front edge of the shelf . here it is assumed that the embossments are shaped like squares rounded at the comers as shown in the fig5 a to 5 c . the embossments are preferably manufactured by forcing or pressing the board at the desired point with great force between two such tool pieces in which the working surfaces pressing against each other have complementary patterns . in view of the invention , it is sufficient to describe one of these tool pieces . this pressing or embossing is also called hammering . one alternative for forming bubble - like embossments on a metal sheet is to manufacture a convex tool of the shape and size of the bubble - like embossment , by means of which each embossment would be made separately . however , it will be seen from fig7 that the tool 700 according to the preferred embodiment of the invention is based on a different principle . its basic form is an h . in fig7 the upper parallel lines of the h are as long as the lower parallel lines of the h , but this is not significant in view of the invention ; the upper parallel lines can also have different length from the lower parallel lines . in addition , the upper parallel lines can be mutually of different length and so can also the lower parallel lines be , but it is nevertheless advantageous that the combined length of the upper and lower line on the right side is the same as the combined length of the upper and lower line on the left side . the transverse line in the middle of the h corresponds to the space between two adjacent bubbles , the width of which is marked with d in fig5 a . fig8 a and 8 b illustrate how the tool shown in fig7 can be used to form bubble - like embossments of different sizes or board holders at different distances from each other . in fig8 a the tool is moved between strikes corresponding to adjacent embossments in the direction of the edge 812 of the shelf a distance h 1 , whereby in the latter strike the upper ends of the h of the tool hit exactly the same points where its lower ends were in the former strike . the result is a board holder with the largest distance between boards which can be made with the tool . the distance h 1 is the same as the height of the h of the tool . in fig8 b the tool is moved between strikes corresponding to adjacent embossments a distance h 2 , whereby in the latter strike the upper ends of the h of the tool hit the points where its lower ends started to turn towards the transverse line in the former strike . the adjacent strikes thus overlap for a distance ( h 1 - h 2 ). the result is a board holder with the smallest distance between boards which can be made with the tool . the distance h 2 is the same as the height of the h of the tool reduced by the length of the upper or lower vertical line of the h in the direction in which the upper or lower vertical line is shorter . board holders for different distances between boards can be manufactured by selecting a distance between h 1 and h 2 as the transfer distance of the tool between strikes . the invention does not require that the distance between boards would be the same throughout the whole shelf . in practice , the shelves are manufactured in a sheet metal working centre , where the width of the embossments ( the transfer distance of the tool between adjacent strikes ) can vary even after each embossment . it is particularly advantageous that there is no need to change the tool when varying the distance but different distances between boards can be implemented simply by programming the desired transfer distances to the sheet metal working centre . one tool can be used to manufacture thousands of shelves before it must be sharpened , and after sharpening it can be used again for a long time . although the wording “ moving the tool ” was used in the above description , it is naturally also possible to keep the tool on place while the surface - being worked on is moved . in general , it can be stated that the tool is moved in relation to the surface being worked on , which definition covers all alternatives of moving the tool or the surface being worked on . the distance between boards is somewhat dependent on the standard used in the dimensioning of the mother board . according to one standard , the basic measurement of the dimensioning of the mother board is a tenth of an inch ( about 2 . 5 mm ), whereby a suitable distancing of boards could be , for instance , one board per inch . according to another standard , in the mother board the basic measurement is millimetres and not parts of an inch , whereby a suitable distancing between boards could be one board per each 30 millimetres . the fact that one tool can be used to make board holders for different distances between boards is called the advantage of scalability in this patent application . in order to achieve that , it is not essential that the parallel parts of the edges of the bubble - like embossments should have the same direction as the front edge of the shelf : it is sufficient that they differ substantially from the intended direction of the edge of the circuit board . fig8 c and 8 d show the manufacture of bubble - like embossments for different distances between boards where the parallel sides 810 and 811 of the embossments are at skew angles to the front edge 812 of the shelf . then the manufacturing tool must be moved between adjacent strikes in some other direction than the direction of the front edge of the shelf , and the adjacent bubble - like embossments are not at equal distances from the front edge of the shelf . fig9 is a cross - section of a bubble - like embossment , which provides even better rigidity than the above embodiments . in this embodiment , the edges 901 of the ventilation hole are bent towards the surface of the shelf . the more profiling is made on the edge of the bubble - like embossment and / or ventilation hole the more rigid it becomes , but then the shape of the tool used in the manufacture also becomes more complicated . fig1 shows a device rack 1000 , in which shelves with board holders according to the invention are used . the mother boards or other boards are not shown in fig1 . in different devices the boards can be of different sizes , and that can be provided for in the invention in many ways . one way is to use modular construction in the shelf of the rack , whereby one shelf can consist of one or more consecutive modules . in fig1 a shelf 1001 and a corresponding upper shelf 1002 , on which the upper edge of the boards placed on shelf 1001 is supported and on which the board holders are on the lower surface consist of a front part 1001 a ( 1002 a ) and a back part 1001 b ( 1002 b ). the upper shelves in the same rack are intended for shorter boards , whereby the shelves 1003 and 1004 consist of only one shelf module . the shelves are fastened to the walls 1005 and 1006 preferably with screws or pop rivets . boards of different sizes can be provided for by making holes in the walls at different heights , whereby the vertical distance between shelves can be selected according to the size of boards to be installed between them .	8
referring now to the drawing , depicted therein at fig1 is an exemplary sawhorse 20 constructed in accordance with , and embodying , the principles of the present invention . this sawhorse 20 comprises a first leg structure 22 , a second leg structure 24 , an engaging member 26 , and first and second locking assemblies 28 and 30 . the first leg structure 22 comprises an inner hinge member 32 , while the second leg structure 24 comprises an outer hinge member 34 . the sawhorse 20 is constructed such that the inner hinge member 32 is nested within the outer hinge member 34 in a manner that allows the first and second leg structures 22 and 24 to rotate relative to each other about a pivot axis a . the locking assemblies 28 and 30 extend between the leg structures 22 and 24 and move between a locked position in which the leg structures are in an open configuration as shown in fig1 and an unlocked position in which the leg members are free to rotate towards each other from the open configuration . the engaging member 26 is attached to the outer hinge member 34 by first and second attachment assemblies 36 and 38 . when in the open configuration shown in fig1 the first and second leg structures 22 and 24 engage the ground or floor 40 to space the engaging member 26 from the ground or floor 40 . the engaging member 26 thus forms a stable support surface for a workpiece , platform , or other member . as discussed briefly above , the inner hinge member 32 is nested within the outer hinge member 34 . the outer hinge member 34 is formed by a hollow , cylindrical tube or the like made out of substantially rigid material such as steel , plastic , or the like ( see table 2 below ). the inner hinge member 32 is also generally cylindrical and has an outer diameter that is slightly smaller than the inner diameter of the outer hinge member 34 . as perhaps best shown in fig5 in use an outer surface 42 of the inner hinge member 32 engages an inner surface 44 of the outer hinge member 34 . by this means , loads are transferred from the engaging member 26 through the attachment assemblies 36 and 38 , through the outer hinge member 34 and to the inner hinge member 32 and thus the first leg structure 22 . additionally , as the inner hinge member 32 engages the outer hinge member 34 along the entire length of this member 34 , the loads transferred between the hinge members 32 and 34 are borne across a relatively large area . further , given the inherent rigidity provided by the cylindrical hinge members 32 and 34 , the hinge function performed by these members 32 and 34 is very stable and durable . referring now to fig3 and 4 , it can be seen that the engagement of the inner hinge member 32 with the outer hinge member 34 allows the leg structures 22 and 24 to rotate between an open configuration ( fig3 ) and a closed configuration ( fig4 ). it should be noted that hinge members 32 and 34 need not be cylindrical , and the inner hinge member 32 need not be hollow , to perform the function as described with reference to fig3 , and 5 . to the contrary , the sawhorse 20 would function basically as described with other cross - section configurations such as rectangular , ovoid , triangular , etc . however , the cylindrical configuration shown in the drawings is preferred as this configuration will provide the least amount of resistance to the rotation of the inner hinge member 32 relative to the outer hinge member 34 and can be formed of readily available parts . referring now back to fig1 for a moment , the construction and operation of the sawhorse 20 will be described in further detail . referring initially to the first leg structure 22 , fig1 shows that , in addition to the inner hinge member 32 , the structure 22 comprises a first leg member 46 , a second leg member 48 , and a spacing member 50 . similarly , the second leg structure 24 comprises a first leg member 52 , a second leg member 54 , and a spacing member 56 . fig1 also shows that the inner hinge member 32 forming a part of the first leg structure 22 is longer than the outer hinge member 34 forming a part of the second leg structure 24 . the first leg member 46 of the first leg structure 22 is securely attached to a first end 58 of the inner hinge member 32 . this attachment is preferably formed by welding or the like , but may be formed by a mechanical structure such as a bolt or a chemical structure as an adhesive . the second leg member 48 of the leg structure 22 is similarly attached to a second end 60 of the inner hinge member 32 . the spacing member 50 is connected between lower ends 62 and 64 of the first and second leg members 46 and 48 . during assembly of the first leg structure 22 , the outer hinge member 32 is first placed over the inner hinge member 42 such that , when the leg members 46 and 48 are attached to the hinge member 32 , the outer hinge member 34 is arranged around the inner hinge member 32 and between the leg members 46 and 48 . the outer hinge member 34 thus may not be removed from the inner hinge member 32 without removing at least one of the legs 46 and 48 therefrom . although not necessary , production and use of the sawhorse 20 is simplified if the inner hinge member 32 is parallel to the spacing member 50 , the leg members 46 and 48 are parallel , and the leg members 46 and 48 extend at a right angle from the inner hinge member 32 and spacing member 50 . the resulting leg structure 22 is generally rectangular in shape with a large opening in the middle , although other configurations such as trapezoidal may be adapted for this intended purpose . the second leg structure 24 is similarly configured , although slightly smaller in overall size because the outer hinge member 34 is shorter than the inner hinge member 32 . in particular , the first leg member 52 is connected to a first end 66 of the outer member 34 , while the second leg member 54 is connected to a second end 68 of the outer hinge member 34 . the spacing member 56 is connected between lower ends 70 and 72 . with the first and second leg members 52 and 54 , again , the exact shape of the second leg structure 24 is somewhat arbitrary , but the generally rectangular shape of the preferred sawhorse 20 simplifies manufacture and use of the sawhorse 20 . the locking assemblies 28 and 30 are identical and only the locking assembly 28 will be described herein in detail . the locking assembly 28 comprises a first rigid member 74 , a second rigid member 76 , and a sleeve member 78 . a first end 80 of the locking assembly 28 is rotatably attached to the first leg member 46 of the first leg structure 22 . a second end 82 of the locking assembly 28 is similarly rotatably attached to the first leg member 52 of the second leg structure 24 . the sleeve member 78 is pivotally attached both to the rigid member 74 and the rigid member 76 such that , when the locking assembly 28 is connected between the leg members 46 and 52 , the sleeve member 78 engages the rigid members 74 and 76 to maintain the locking assembly 28 in a locked position whereby the ends 80 and 82 thereof are spaced a fixed distance apart . in this locked position , the sleeve member 78 cannot move downwardly . however , to move the locking assembly 28 into an open position , the sleeve member 78 is raised . this allows the ends 80 and 82 of the locking assembly to move together , thereby allowing the leg members 46 and 52 connected thereto also to move together . thus , the leg structures 22 and 24 may rotate towards each other into the closed position shown in fig4 . other locking assemblies that perform the same function are well - known in the art . and , given the applicant &# 39 ; s disclosure herein , it would be clear that other known locking assemblies may be substituted for the exemplary assemblies 28 and 30 . referring again to fig1 it can be seen that ground engaging members 74 , 76 , 78 , and 80 are placed on the leg members 46 , 48 , 52 , and 54 , respectively . these ground engaging members 74 , 76 , 78 , 80 are made of resilient material to prevent the rigid leg members 46 , 48 , 52 , 54 from scratching the surface 40 on which the sawhorse 20 is placed . referring now to fig1 and 5 , depicted therein in detail are the attachment assemblies 36 and 38 employed to fasten the engaging member 26 onto the outer hinge member 34 . these attachment assemblies 36 and 38 are identical , and only the assembly 38 will be descried herein in detail . the attachment assembly 38 basically comprises an attachment plate 82 welded or otherwise securely affixed to the outer hinge member 34 . the assembly 38 further comprises screws 84 and 86 which extend through the attachment plate 82 and into the engaging member 26 . this attachment assembly 38 thus allows the engaging member 26 to be securely fastened to the outer hinge member 34 but still reduces the likelihood that a tool such as a saw used in conjunction with the sawhorse 20 will become damaged . it should be recognized that , while the exemplary sawhorse 20 employs a flat plate with screws extending therethrough to form the attachment assembly 38 , given the teachings of the present application , one of ordinary skill in the art would recognize that a number of other methods may be used to fasten the engaging member 26 onto the outer hinge member 34 . these alternative methods would include a tray having peripheral flanges that extend upward along the engaging member 26 , with screws horizontally extending through these flanges into the engaging member 26 , a clamp assembly which does not physically penetrate the engaging member 26 , forming spikes on an outer surface 88 of the outer hinge member 34 that extend into the engaging member 26 and any other arrangement by which a wooden engaging member can be attached to a member that performs the function of the outer hinge member 34 . additionally , fig3 and 4 show that the attachment plate 82 extends at an angle relative to the plane of the second leg structure 24 . this angle is determined such that the attachment plate 82 is substantially horizontal when the sawhorse 20 is in use . referring now to fig6 depicted therein are first and second sawhorses 20a and 20b constructed in the same manner as the sawhorse 20 described above . the sawhorses 20a and 20b are shown arranged next to each other such that the second leg structure 24a of the first sawhorse 20a is nested within the first leg structure 22b of the second sawhorse 20b . this arrangement allows the engaging members 26a and 26b of the sawhorses 20a and 20b to be arranged very close to each other to accommodate very narrow or small workpieces . attached herewith are two tables defining certain parameters to the present invention . the first table relates to certain dimensions l 1 through l 6 and t 1 through t 3 identified in the drawings . the dimensions l 1 through l 6 are lengths of indicated components in inches , while the dimensions t 1 through t 3 are inner diameters of certain specified tubular members . table 1 contains the actual values for the currently preferred embodiment , a first preferred range of values , and a second preferred range of values . table 2 comprises the preferred material selected fort certain of the components identified by reference characters in the first column as well as known alternates to the preferred materials . it should be clear from the foregoing that the present invention may be embodied in other specific forms without departing from the essential characteristics thereof . the present embodiments are therefore to be considered in all respects as illustrative and not restrictive , the scope of the invention being indicated by the appended claims rather than by the foregoing description ; all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein . table 1______________________________________ first pref . second pref . preferred range range______________________________________1 . sub . 1 35 1 / 2 &# 34 ; 30 &# 34 ;- 40 &# 34 ; 24 &# 34 ;- 48 &# 34 ; 1 . sub . 2 34 &# 34 ; 28 1 / 2 &# 34 ;- 38 1 / 2 &# 34 ; 22 1 / 2 &# 34 ;- 46 1 / 2 &# 34 ; 1 . sub . 3 27 3 / 4 &# 34 ; 28 &# 34 ;- 32 1 / 2 &# 34 ; 16 &# 34 ;- 41 &# 34 ; 1 . sub . 4 29 7 / 8 &# 34 ; 22 1 / 2 &# 34 ;- 47 7 / 8 &# 34 ; 22 1 / 2 &# 34 ;- 55 7 / 8 &# 34 ; 1 . sub . 5 9 1 / 2 &# 34 ; 8 &# 34 ;- 10 &# 34 ; 8 &# 34 ;- 13 1 / 2 &# 34 ; 1 . sub . 6 14 3 / 4 &# 34 ; 12 &# 34 ;- 15 &# 34 ; 12 &# 34 ;- 20 &# 34 ; t . sub . 1 3 / 4 &# 34 ; id 1 / 2 &# 34 ;- 1 &# 34 ; -- t . sub . 2 1 / 2 &# 34 ; id 1 / 2 &# 34 ;- 1 &# 34 ; -- t . sub . 3 3 / 4 &# 34 ; id 3 / 4 &# 34 ;- 1 1 / 4 &# 34 ; -- ______________________________________ table 2______________________________________element preferred alternates______________________________________46 - 56 18 gauge emt 18 gauge steel tube ; 16 gauge steel tube ; structural steel square tube34 18 gauge emt 18 gauge steel tube ; 16 gauge steel tube ; structural steel square tube32 18 gauge emt 18 gauge steel through schedule 40 pipe according to aisc specification manual ; structural steel square tube74 - 80 polypropylene gum rubber plastic______________________________________	1
the following pharmacologically - active imidazole compounds may be prepared by the method of this invention : indanylimidazoles , as described in pct int . appl . wo 97 12874 which is hereby incorporated by reference in its entirety . imidazole - alkyl carbazole or fluorenyl compounds , as disclosed in pct int . appl . wo 9626927 - a1 which is hereby incorporated by reference in its entirety . phenyl - alkyl - imidazoles , as disclosed in u . s . pat . no . 5 , 578 , 616 which is hereby incorporated by reference in its entirety . imidazoylalkyl compounds substituted with a heterocyclic ring containing one nitrogen atom , as disclosed in pct int . appl . wo 99 / 24421 and 98 / 23224 which is hereby incorporated by reference in its entirety . 2 -( 1h - 4 ( 5 )- imidazoyl ) cyclopropyl derivatives , as disclosed in u . s . pat . no . 6 , 008 , 240 which is hereby incorporated by reference in its entirety . imidazole derivatives , as disclosed in pct int . appl . wo 09928315 - a1 which is hereby incorporated by reference in its entirety . heterocyclic - substituted imidazole derivatives , as disclosed in pct int . appl . wo 9924421 - a1 which is hereby incorporated by reference in its entirety . thiourea and isothiourea derivatives , as disclosed in pct int . appl . wo 01 / 09128 a1 which is hereby incorporated by reference in its entirety . imidazole derivatives as disclosed in mor et al ., il farmaco , 55 , 2000 , pp . 27 – 24 which is hereby incorporated by reference in its entirety . n -( imidazoylalkyl ) substituted cyclic amines , as disclosed in pct int . appl . wo 200023438 - a1 which is hereby incorporated by reference in its entirety . imidazole derivatives , as disclosed in pct int . appl . wo 96 / 29315 which is hereby incorporated by reference in its entirety . piperidinylimidazoles as disclosed in european patent application 0 591 027 a1 which is hereby incorporated by reference in its entirety . preferably , the method of the present invention may be used to prepare the imidazoles disclosed in u . s . pat . no . 6 , 329 , 369 which is hereby incorporated by reference in its entirety . the method of the present invention may be practiced in a liquid phase reaction medium , under an inert atmosphere , e . g . argon , at a temperature between 50 and − 100 ° c ., preferably between − 20 and 25 ° c . and more , preferably between − 15 and 0 ° c ., e . g . at room temperature . the reaction may be carried out at any operable pressure , e . g . atmospheric pressure . the reaction time may vary from 1 hr . to 6 hrs ., preferably from 2 hrs . to 4 hrs . the reaction product may be separated from the liquid phase reaction medium by methods known in the prior art , e . g . distillation , crystallization , etc . thus , a compound having selective agonist activity at the α2b or α2b / 2c adrenergic receptor subtype ( s ) as compared to the 2a adrenergic receptor subtype , as disclosed in u . s . pat . no . 6 , 329 , 369 is prepared by the method of this invention . wherein the dotted lines represent optional bonds provided that two double bonds may not share a common carbon atom ; r 5 is h or lower alkyl ; x is c ( h ) r 1 , wherein r 1 is h or lower alkyl , but r 1 is absent when the bond between x and the ring represented by is a double bond ; y is o , n , s , ( cr 1 2 ) y , wherein y is an integer of from 1 to 3 , — ch ═ ch — or — y 1 ch 2 —, wherein y 1 is o , n or s ; x is an integer of 1 or 2 , wherein x is 1 when r 2 , r 3 or r 4 is bound to an unsaturated carbon atom and x is 2 when r 2 , r 3 or r 4 is bonded to a saturated carbon atom ; r 2 is h , halogen , hydroxy , lower alkyl , alkoxy , alkenyl , acyl , alkynyl , or , when attached to a saturated carbon atom , r 2 may be oxo ; r 3 and r 4 are , each , h , halogen , lower alkyl , alkenyl , acyl , alkynyl , aryl , e . g . phenyl or naphthyl , heteroaryl , e . g . furyl , thienyl , or pyridyl , and substituted aryl or heteroaryl , wherein said substituent may be halogen , lower alkyl , alkoxy , alkenyl , acyl , alkynyl , nitro , cyano , trifluoromethyl , hydroxy , etc . or , together , are —( c ( r 2 ) x ) z —; — y 1 ( c ( r 2 ) x ) z ′—; — y 1 ( c ( r 2 ) x ) y y 1 —; —( c ( r 2 ) x )— y 1 —( c ( r 2 ) x )—; —( c ( r 2 ) x )— y 1 —( c ( r 2 ) x )—( c ( r 2 ) x )— and — y 1 —( c ( r 2 ) x )- y 1 —( c ( r 2 ) x )— wherein z is an integer of from 3 to 5 , z ′ is an integer of from 2 to 4 and x and y are as defined above , and further either end of each of these divalent moieties may attach at either r3 or r4 to form a condensed ring structure shown generally as and the rings formed may be totally unsaturated , partially unsaturated , or totally saturated provided that a ring carbon has no more than 4 valences , nitrogen no more than three and o and s have no more than two . in another aspect of the invention in the above compound is represented by the formula wherein x may be c ( h ) r 1 and r 1 is h . in said compound of formula ii , r 2 may be h and in such furanyl derivatives of formula ii , r 3 and r 4 together may be ( ch ) 4 , or r 3 may be h and r 4 may be t - butyl , or r 3 and r 4 may be h , or r 3 may be h and r 4 may be methyl or ethyl . alternatively , in the compound of formula i , r 1 may be methyl and alternatively , in said compounds of formula ii , r 2 may be h and in such thienyl derivatives of formula ii , r 3 and r 4 , together , may represent ( ch 2 ) 4 , or r 3 may be phenyl and r 4 may be h , or r 3 and r 4 , together , may represent ( ch 2 ) 3 s , or r 3 and r 4 may be h , or r 3 and r 4 , together , may represent ( ch ) 4 , or may be r 3 may be h and r 4 may be methyl , or r 3 may be bromo and r 4 may be h , or r 3 may be hydrogen and r 4 may be chloro , or r 3 may be methyl and r 4 may be hydrogen . in such cyclohexyl derivatives of formula ii , r 2 may be hydrogen and r 3 and r 4 may , together , represent ( ch ) 4 , or r 2 may be oxo and r 3 and r 4 , together , may be ( ch ) 4 , or r 2 may be hydrogen or oxo and r 3 and r 4 , together , may represent ( ch ) 2 s , or r 2 may be hydrogen and r 3 and r 4 may , together , represent ( ch 2 ) 4 , forming an octahydronaphthalene , or r 2 may be oxo and r 3 and r 4 may , together , represent ( ch 2 ) 4 , or r 2 may be oxo and r 3 and r 4 , together , may represent ( ch ) 2 c ( ch 3 )( ch ), or r 2 may be hydrogen and r 3 and r 4 , together , may represent s ( ch 2 ) 2 , or r 2 , r 3 and r 4 may be h , or r 2 may be oxo and r 3 and r 4 , together , may represent ( ch ) 2 c ( och 3 ) ch , or r 3 and r 4 together may represent — y 1 — c ( r 2 ) x — c ( r 2 ) x — y 1 — wherein y 1 is n , forming a tetrahydroquinoxaline wherein r 2 may be hydrogen or oxo . alternatively , in the compounds of formula ii may represent a tetrahydroquinoline radical wherein r 3 and r 4 together are — y 1 — c ( r 2 ) x — c ( r 2 ) x — c ( r 2 ) x — wherein y 1 is n . in such tetrahydroquinoline derivatives ( r 2 ) x may be hydrogen or oxo ; or may represent a tetrahydroisoquinoline radical wherein r 3 and r 4 together are — c ( r 2 ) x — y 1 — c ( r 2 ) x — c ( r 2 ) x — wherein y 1 is n and ( r 2 ) x may be hydrogen or oxo . in such cyclopentyl derivatives of formula ii , r 2 may be h and r 3 and r 4 , together , may represent ( ch ) 4 , or r 2 may be oxo and r 3 and r 4 , together , may represent ( ch ) 4 , or r 2 may be hydrogen and r 3 and r 4 , together , may represent ( ch 2 ) 3 . in another aspect of the invention , y is ( ch 2 ) 3 and x may be ch and r 2 may be oxo or x may be ch 2 and r 2 may be h and r 3 and r 4 , together , may represent ( ch ) 4 . alternatively , r 3 and r 4 , together , may represent ( ch ) 4 , y may be ch 2 c ( cr 1 2 ) 2 wherein r 1 is hydrogen , or y may be — ch2c ( me )— and r 2 may be hydrogen or oxo . in such phenyl derivatives of formula i , x may be ch 2 , r maybe h or ch 3 , r 2 , r 3 and r 4 may be h , or r 3 and r 4 , together , represent o ( cr 2 ) 2 o to provide a 1 , 4 - benzodioxan derivative . in such compound of formula iii , x may be c ( h ) r 1 , r 1 , r 2 , r 3 and r 4 may be h and y may be o or s . in such compounds of formula iv , y 1 may be o , r 2 may be oxo and x is ch or ch 2 , or one of r 2 is hydroxy and the other may be h , or r 2 may be h . in such compounds of formula iv , y 1 may be s , x may be ch 2 and r 2 may be oxo , or r 2 may be h and x may be ch and r 2 may be oxo . to prepare the compounds of u . s . pat . no . 6 , 329 , 369 the starting cyano compound has the formula “ pharmaceutically acceptable salt ” refers to those salts which retain the biological effectiveness and properties of the free bases and which are obtained by reaction with inorganic acids such as hydrochloric acid , hydrobromic acid , sulfuric acid , nitric acid , phosphoric acid , methanesulfonic acid , ethanesulfonic acid , p - toluenesulfonic acid , salicylic acid and the like . “ alkyl ” refers to a straight - chain , branched or cyclic saturated aliphatic hydrocarbon . preferably , the alkyl group has 1 to 12 carbons . more preferably , it is a lower alkyl of from 1 to 7 carbons , most preferably 1 to 4 carbons . typical alkyl groups include methyl , ethyl , propyl , isopropyl , butyl , isobutyl , tertiary butyl , pentyl , hexyl and the like . the alkyl group may be optionally substituted with one or more substituents are selected from the group consisting of hydroxyl , cyano , alkoxy , ═ o , ═ s , no 2 , halogen , dimethyl amino , and sh . “ alkenyl ” refers to a straight - chain , branched or cyclic unsaturated hydrocarbon group containing at least one carbon - carbon double bond . preferably , the alkenyl group has 1 to 12 carbons . more preferably it is a lower alkenyl of from 1 to 7 carbons , most preferably 1 to 4 carbons . the alkenyl group may be optionally substituted with one or more substituents selected from the group consisting of hydroxyl , cyano , alkoxy , ═ o , ═ s , no 2 , halogen , dimethyl amino , and sh . “ alkynyl ” refers to a straight - chain , branched or cyclic unsaturated hydrocarbon containing at least one carbon - carbon triple bond . preferably , the alkynyl group has 1 to 12 carbons . more preferably it is a lower alkynyl of from 1 to 7 carbons , most preferably 1 to 4 carbons . the alkynyl group may be optionally substituted with one or more substituents selected from the group consisting of hydroxyl , cyano , alkoxy , ═ o , ═ s , no 2 , halogen , dimethyl amino , and sh . “ aryl ” refers to an aromatic group which has at least one ring having a conjugated pi electron system and includes carbocyclic aryl , heterocyclic aryl and biaryl groups . the aryl group may be optionally substituted with one or more substituents selected from the group consisting of halogen , trihalomethyl , hydroxyl , sh , oh , no 2 , amine , thioether , cyano , alkoxy , alkyl , and amino . “ alkaryl ” refers to an alkyl that is covalently joined to an aryl group . preferably , the alkyl is a lower alkyl . “ carbocyclic aryl ” refers to an aryl group wherein the ring atoms are carbon . “ heterocyclic aryl ” refers to an aryl group having from 1 to 3 heteroatoms as ring atoms , the remainder of the ring atoms being carbon . heteroatoms include oxygen , sulfur , and nitrogen . thus , heterocyclic aryl groups include furanyl , thienyl , pyridyl , pyrrolyl , n - lower alkyl pyrrolo , pyrimidyl , pyrazinyl , imidazolyl and the like . “ hydrocarbyl ” refers to a hydrocarbon radical having only carbon and hydrogen atoms . preferably , the hydrocarbyl radical has from 1 to 20 carbon atoms , more preferably from 1 to 12 carbon atoms and most preferably from 1 to 7 carbon atoms . “ substituted hydrocarbyl ” refers to a hydrocarbyl radical wherein one or more , but not all , of the hydrogen and / or the carbon atoms are replaced by a halogen , nitrogen , oxygen , sulfur or phosphorus atom or a radical including a halogen , nitrogen , oxygen , sulfur or phosphorus atom , e . g . fluoro , chloro , cyano , nitro , hydroxyl , phosphate , thiol , etc . “ amide ” refers to — c ( o )— nh — r ′, wherein r ′ is alkyl , aryl , alkylaryl or hydrogen . “ thioamide ” refers to — c ( s )— nh — r ′, wherein r ′ is alkyl , aryl , alkylaryl or hydrogen . “ amine ” refers to a — n ( r ″) r ′″ group , wherein r ″ and r ′″ are independently selected from the group consisting of alkyl , aryl , and alkylaryl . “ thioether ” refers to — s — r ″, wherein r ″ is alkyl , aryl , or alkylaryl . “ sulfonyl ” refers to — s ( o ) 2 — r ″″, where r ″″ is aryl , c ( cn )═ c - aryl , ch 2 cn , alkyaryl , sulfonamide , nh - alkyl , nh - alkylaryl , or nh - aryl . as disclosed above , it is important that the cyano compound does not have a benzylic or allylic hydrogen at the position alpha to the cyano group . thus , the following cyano compounds are excluded from the method of the present invention . specific examples of cyano compounds useful in the method of the present invention and the resulting imidizoles are as follows : the invention is further illustrated by the following examples which are illustrative of a specific mode of practicing the invention and is not intended as limiting the scope of the appended claims . a 2 l three necked flask equipped with a mechanical stirrer , condenser with an argon inlet , and addition funnel was charged with dimethylformamide ( 450 ) ml ) and sodium hydride ( 17 . 4 g , 0 . 72 mol ). to this mixture , formamide ( 2 )( 21 . 1 g , 0 . 69 mol ) dissolved in 50 ml of dimethylformamide was added dropwise over a period of 30 min . the reaction was then heated to 120 ° c . in an oil bath . the mixture changed from gray to brown over a period of 45 min . the resulting suspension was cooled to 60 ° c . and chloromethyltrimethylsilane ( 1 ) ( 84 . 6 g , 0 . 69 mol ) was then added all at once . the reaction was heated to 120 ° c . and stirred overnight . the reaction was filtered and the filtrate distilled . the product was obtained at 130 – 140 ° c . @ 12 torr to give 70 . 6 g of 3 ( 78 %). a 2 l three necked flask equipped with a mechanical stirrer , thermometer , and an addition funnel with an argon inlet was charged with trimethylsilylmethylformamide ( 3 ) ( 69 . 4 g , 0 . 53 mol ), diisopropylamine ( 144 . 5 g , 1 . 43 mol ), and dichloromethane ( 520 ml ). the solution was cooled in a dry ice - acetone bath to an internal temperature of − 20 ° c . to this solution phosphorus oxychloride ( 89 . 5 g , 0 . 583 mol ) dissolved in 80 ml of dichloromethane was added at such a rate as to maintain the temperature around − 20 ° c . the time for complete addition was approximately 75 min . the cooling bath was replaced with an ice water bath and the pink suspension was stirred at 0 ° c . for 1 hr . the reaction was then diluted with 1 l aqueous solution of 293 g of potassium carbonate cooled to 0 ° c . the cooling bath was removed and the resulting mixture was stirred an additional 1 hr . the layers were separated and the aqueous phase was extracted with 2 × 200 ml of dichloromethane . the organic phases were combined , washed with 2 × 250 ml of aqueous ammonium chloride , and dried over sodium sulfate . the solvent was removed on a rotary evaporator at 32 ° c . until the pressure dropped to 60 torr . the resulting brown residue was distilled and the impure product was collected at 50 ° c . @ 0 . 2 torr the receiving flask was cooled in a dry ice - acetone bath . the distillate was redistilled at 80 – 87 ° c . @ 90 torr to give 33 g of product 4 ( 55 %). under an argon atmosphere potassium tert - butoxide ( 2 . 47 g , 0 . 02 mol ) was added to 15 ml of dimethoxyethane . a brown suspension formed immediately . the flask was cooled in a room temperature water bath . to this mixture a solution of trimethylsilylmethyl isocyanide ( 3 . 39 g , 0 . 03 mol ) and 3 - cyclohexene - 1 - acetonitrile ( 2 . 42 g , 0 . 02 mol ) in 5 ml of dimethoxyethane was added over period of 25 min . the reaction was stirred an additional 15 min . and hplc analysis showed 71 % imidazole ( 7 ) and 26 % silylimidazole ( 6 ). after an additional 30 min . potassium fluoride ( 1 g , 0 . 017 mol ) was added and the reaction was refluxed an additional 8 hr . the reaction was cooled to room temperature , diluted with 50 ml of brine , and extracted with 50 ml of ethyl acetate . the organic layer was washed with 50 ml of brine , filtered through 1 ps paper and the solvent was removed on a rotary evaporator to give 2 . 5 g of a brownish - red oil . two identical reactions were combined and flash column chromatographed on 50 g of flash silica gel with 10 g of anhydrous sodium sulfate on top . the column was eluted with 100 ml portions of ethyl acetate for the first 4 fractions and 10 % methanol in ethyl acetate for fraction 5 – 8 . the product came off the column in fractions 5 and 6 to give 3 . 6 g of an oil upon removal of the solvent in vacuo . the oil crystallized upon tituration with hexanes to give 3 . 4 g of light brown solid that was 100 % pure by hplc analysis in overall yield of 52 %. hplc : column : phenominex prodigy - 5 micron , 250 mm ; mobile phase ; water : a 1 meoh ; 5 : 45 : 40 ( a1 is mode of 700 ml water , 300 ml methanol , 3 ml triethylamine with enough phosphoric acid to give ph 3 . 4 ). the retention time of the imidazole was 2 . 8 min . and the silylated imidazole showed a retention time of 6 . 2 min . in a 1l three neck round bottom flask , a mixture of nacn ( 51 g , 1 . 04 mol ) in anh . dmso ( 200 ml ) was heated to 75 – 80 ° c . to this slurry was added , drop wise , a solution of 4 ( 218 . 16 g , 0 . 86 mol ) in dmso ( 300 ml ) ( the addition time was 45 min .). after the addition finished , the reaction mixture was left stirring at 80 ° c . for another 2 h . completion of the reaction was monitored by nmr for the disappearance of cyclopent - 3 - enylmethyl - 4 - methylbenzenesulfonate . the reaction mixture was then cooled and diluted with water ( 200 ml ) and extracted with hexane ( 5 × 250 ml ). the combined organic layers were washed with brine ( 200 ml ) and dried ( mgso 4 ). the solvent was then removed under vacuo to obtain the product 8 as a yellow oil in 91 . 58 g ( 99 %). the crude product showed some impurities in ca . 10 % ( by 1 h nmr integration ) but was used in the next step without purification . 1 h nmr ( cdcl3 ) δ : 2 . 20 ( m , 2h ), 2 . 40 ( m , 2h ), 2 . 70 ( m , 3h ), 5 . 70 ( s , 2h ). in a 2l three neck bottom flask , a mixture of t - buok ( 115 g , 1 . 02 mol ) in anh . thf ( 500 ml ) was cooled to − 15 ° c . to this slurry was added a mixture of ( 91 . 58 g , 0 . 85 mol ) and tmsch 2 nc ( 144 ml , 1 . 02 mol ) in anh . thf ( 400 ml ) via an addition funnel at a rate such that the temperature was maintained at 0 . 15 ° c . the cooling bath was removed and the reaction mixture was left stirring for 2 . 5 h . the completion of reaction was monitored by tlc ( 5 % meoh in ch 2 cl 2 ) for the disappearance of 8 . the reaction mixture was then worked up by washing with water ( 400 ml ). the aqueous layer was extracted again with ch 2 cl 2 ( 2 × 250 ml ). the combined organic layers were washed with brine ( 300 ml ) and dried ( mgso 4 ). after the solvent was removed , a mixture of products was obtained as a dark brown oil . to the crude reaction mixture was added with a solution of tbaf - xh 2 o ( 100 g , 0 . 38 mol ) in thf ( 400 ml ) and 12m tbaf in thf ( 100 ml , 0 . 1 mol ). the reaction mixture was then stirred at 70 ° c . for 16 h . the completion of the desilylation was monitored by 1 h nmr . the solvent was removed from the reaction mixture under vacuo . the residue was then dissolved with acetone ( 300 ml ) and was treated with a solution of oxalic acid ( 78 g , 0 . 87 mol ) in acetone ( 300 ml ). the mixture was stirred for 15 min . at room temperature . the resulting solid was collected by filtration and was rinsed with acetone ( 2 × 20 ml ) to obtain a light brown solid including an oxalate salt in 112 g ( 55 %). 1 h nmr ( d6 - dmso ) δ : 2 . 05 ( m , 2h ), 2 . 40 ( m , 2h ), 2 . 50 – 2 . 75 ( m , 3h ), 5 . 70 ( s , 2h ), 7 . 15 ( s , 1h ), 8 . 35 ( s , 1h ). the oxalate salt was liberated by dissolving in 2n naoh ( 500 ml ) and extracted with ch 2 cl 2 ( 3 × 250 ml ). the combined organic layers were dried ( mgso 4 ) and the solvent was removed under vacuo to obtain a brown oil , which solidified upon standing at room temperature , in 67 . 94 g ( 53 % from 8 ). 1 h nmr ( cdcl 3 ) δ : 2 . 10 ( m , 2h ), 2 . 50 ( m , 2h ), 2 . 75 ( m , 3h ), 5 . 70 ( s , 2h ), 6 . 80 ( s , 1h ), 7 . 70 ( s , 1h ). in accordance with the procedure of example 3 , isobutyronitrile is reacted with trimethylsilymethylisocyanide to yield 4 ( 5 )- isopropylimidazole . in accordance with the procedure of example 3 , benzonitrile is reacted with trimethylsilymethyl isocyanide to yield 4 ( 5 )- phenylimidazole . in accordance with the procedure of example 3 , trimethylacetonitrile is reacted with trimethylsilylmethyl isocyanide to yield 4 ( 5 )- t - butylimidazole . in accordance with the procedure of example 3 , α , α - dimethylbenzylcyanide is reacted with trimethylsilylmethyl isocyanide to yield 4 ( 5 )- α , α - dimethylbenzylimidazole . in accordance with the procedure of example 3 , 3 - cyanopyridine is reacted with trimethylsilylmethyl isocyanide to yield 4 ( 5 )-( 3 - pyridyl ) imidazole . in accordance with the procedure of example 3 , thiophene - 2 - carbonitrile is reacted with trimthylsilylmethyl isocyanide to yield 4 ( 5 )-( 2 - thienyl ) imidazole . in accordance with the procedure of example 3 , thiophene - 3 - carbonitrile is reacted with trimethylsilylmethyl isocyanide to yield 4 ( 5 )-( 3 - thienyl ) imidazole . in accordance with the procedure of example 3 , 3 - phenylpropionitrile is reacted with trimethylsilylmethyl isocyanide to yield 4 ( 5 )-( 2 - phenethyl ) imidazole . while particular embodiments of the invention have been described , it will be understood of course that many obvious modifications can be made and it is intended to include within this invention any such modifications as will fall within the scope of the appended claims . for example , instead of trimethylsilymethyl isocyanide trimethyl ( lower alkyl ) methyl isocyanide may be used in any of the above examples to provide imidazoles of the formula	2
hereinafter , an embodiment of the present invention will be described with reference to the drawings . fig1 is a block diagram showing a structure of a recording / reproducing apparatus according to an embodiment of the present invention . as shown in fig1 , a recording / reproducing apparatus 100 according to this embodiment includes image signal input units 1 and 3 , audio signal input units 2 and 4 , an input image processing unit 5 , an input audio processing unit 6 , an image feature detection unit 7 , an audio feature detection unit 8 , a recording unit 9 , and a recording medium 10 . the recording / reproducing apparatus 100 also includes a reproducing unit 11 , an output image processing unit 12 , an output audio processing unit 13 , a user interface unit 14 , a cpu ( central processing unit ) 15 , and a ram ( random access memory ) 16 . the image signal input units 1 and 3 are various wire communication terminals or wireless communication units . examples of the wire communication terminals include an s terminal , an rca terminal , a dvi ( digital visual interface ) terminal , an hdmi ( high - definition multimedia interface ) terminal , and an ethernet ( registered trademark ) terminal . a usb ( universal serial bus ) terminal , an ieee 1394 terminal , or the like may also be used therefor . examples of the wireless communication units include a wireless lan , a bluetooth ( registered trademark ), a wireless usb , and a wireless hdmi . the wire communication terminal and the wireless communication terminal are not limited to those . from each of the image signal input units 1 and 3 , an image signal of a video content is input to the recording / reproducing apparatus 100 and supplied to the input image processing unit 5 through various cables or wireless networks . here , the video content refers to a content shot with a camcorder or the like or a content on the internet , for example . the audio signal input units 2 and 4 are also various wire communication terminals or wireless communication units , and examples thereof are nearly the same as the terminals and the units described above except for the s terminal and the dvi terminal . from each of the audio signal input units 2 and 4 , an audio signal of an image content is input to the recording / reproducing apparatus 100 and supplied to the input audio processing unit 6 through the various cables or wireless networks . in addition , the image signal input units 1 and 3 and the audio signal input units 2 and 4 each may be , for example , a tuner and an antenna input terminal for inputting an image signal and an audio signal included in a digital broadcast signal into the recording / reproducing apparatus 100 via an antenna ( not shown ). the input image processing unit 5 performs various signal processings such as a digital conversion processing and an encoding processing on the input image signal , and then outputs the signal to the image feature detection unit 7 and the recording unit 9 as a digital image signal . the input audio processing unit 6 performs various signal processings such as a digital conversion processing and an encoding processing on the input audio signal , and then outputs the signal to the audio feature detection unit 8 and the recording unit 9 as a digital audio signal . the image feature detection unit 7 detects a face image ( face image area ) that indicates a person &# 39 ; s face from image signals supplied from the input image processing unit 5 , and calculates a face evaluation value for evaluating a certainty of the face image area . the audio feature detection unit 8 detects a person &# 39 ; s voice from audio signals supplied from the input audio processing unit 6 , and calculates a voice evaluation value for evaluating a volume of the detected voice . the recording unit 9 multiplexes the image signals supplied from the input image processing unit 5 and the audio signals supplied from the input audio processing unit 6 , and records the multiplexed signals on the recording medium 10 . as the recording medium 10 , a built - in recording medium such as an hdd and a flash memory and a portable recording medium such as an optical disc and a memory card may be used . as the optical disc , a bd , a dvd , a cd , and the like may be used . the recording medium 10 stores various video contents , various programs , data , and the like . in a case where the recording medium 10 is the built - in recording medium , the recording medium 10 stores an os , and various programs and data for performing a detection processing of the face image , a detection processing of the voice , a learning processing of these detection processings , an audio editing processing of the video content , and the like . in a case where the recording medium 10 is the portable recording medium , the recording / reproducing apparatus 100 is additionally provided with a built - in recording medium ( not shown ) for recording the various programs and data mentioned above . the reproducing unit 11 reads the multiplexed image signals and audio signals recorded on the recording medium 10 to separate them , decodes the separated image signals and audio signals , and supplies the image signals to the output image processing unit 12 and supplies the audio signals to the output audio processing unit 13 . as a compression format of the image signal and the audio signal , mpeg ( moving picture expert group )- 2 or mpeg - 4 may be used , for example . the output image processing unit 12 performs various signal processings such as an analog conversion processing and an osd ( on screen display ) processing , and outputs the image signal to an external apparatus such as a liquid crystal display connected to the recording / reproducing apparatus 100 or to a liquid crystal display incorporated in the recording / reproducing apparatus 100 . the output audio processing unit 13 performs various signal processings such as the analog conversion processing , and outputs the audio signal to the external apparatus or the built - in liquid crystal display . examples of the user interface unit 14 include an operation button , a switch , a mouse , a keyboard , and an infrared - ray - signal reception unit of a remote controller . various instructions by a user &# 39 ; s operation are input to the user interface unit 14 and output to the cpu 15 therefrom . the cpu 15 accesses the ram 16 and the like as appropriate , and performs overall control on blocks of the recording / reproducing apparatus 100 . the ram 16 is used as a work area and the like of the cpu 15 , and temporarily stores an os ( operating system ), a program , processing data , and the like . an external audio source 17 is an external apparatus such as a pc and various av equipments , and stores an audio signal ( hereinafter , referred to as bgm sound ) of bgm ( or sound effect ) to be inserted in the video content , and inputs the audio signal to the cpu 15 through various interfaces . alternatively , the external audio source 17 may be a recording medium incorporated in or mounted on the recording / reproducing apparatus 100 , e . g ., the recording medium 10 . next , an operation of the recording / reproducing apparatus 100 structured as described above will be described . in this embodiment , the recording / reproducing apparatus 100 can edit the video content to insert in the video content the bgm sound stored in the external audio source 17 . when the bgm sound is inserted , the recording / reproducing apparatus 100 detects a face image from the image signal of the video content and detects a voice from the audio signal , as described above . based on this , the recording / reproducing apparatus 100 judges whether the insertion of the bgm sound is appropriate or not . in particular , for the detection of the face image , the recording / reproducing apparatus 100 performs a learning processing as a preprocessing . the learning processing will be described in the following . fig2 is a diagram conceptually illustrating the learning processing for the detection of the face image . as shown in fig2 , in the recording medium 10 of the recording / reproducing apparatus 100 , face image sample data that indicates samples of face images of various persons and non - face image sample data that indicates samples of non - face images are compiled as a database and stored as data for learning . the image feature detection unit 7 of the recording / reproducing apparatus 100 filters the sample image data stored in the face image sample database and the non - face image sample database by a feature filter , extracts individual face features , and detects a feature vector ( feature data ). as shown in fig2 , the feature filter detects some parts and masks other parts of rectangles in an image . with the use of the feature filter , a positional relationship among eyes , eyebrows , a nose , cheeks , and other parts is detected from the face image sample data as a face feature , and a configuration of an object other than the face , a positional relationship among constituents of the object , and the like are detected from the non - face image sample data as a non - face feature . the feature filter is not limited to the rectangular feature filter , and a separation degree filter for detecting a feature of a circular form , a gabor filter for detecting positional relationships among the parts of the face based on edges in specific directions , or the like may be used . for the detection of the face feature , in addition to the feature filter , brightness distribution information and skin color information may be used , for example . here , it is difficult for the image feature detection unit 7 to recognize the size and position of the face area based on the sample image data . accordingly , in a case where a size of a frame of the feature filter is changed and the feature filtering is performed , the image feature detection unit 7 recognizes , as the size of the face area , a size of the feature filter when the most probable detection value is obtained , and extracts the face feature . in addition , in a case where an entire area of the sample image data is scanned by the feature filter , the image feature detection unit 7 recognizes , as the position of the face area , a position of the feature filter when the most probable detection value is obtained , and extracts the face feature . the image feature detection unit 7 generates a multidimensional feature vector based on the features extracted from the face image sample data and the non - face image sample data . then , the image feature detection unit 7 represents the feature vector by a multidimensional vector space , and generates a discriminant function by statistical machine learning . the generated discriminant function is stored in the recording medium 10 or the like and used when the face image is detected from the video content as the editing target . further , instead of a discriminant analysis processing using the discriminant function , discriminant analysis processings using machine learning methods such as a support vector machine ( svm ), ada - boost , and a neural network may be performed . in this case , instead of the discriminant function , a processing module for performing the discriminant processing is incorporated in the recording / reproducing apparatus 100 . the same holds true for a processing involving the discriminant function in the following description . next , a description will be given on a processing of editing the video content and inserting bgm data in the video content by the recording / reproducing apparatus 100 in this embodiment . fig3 is a flowchart showing a flow of a bgm insertion processing to the video content by the recording / reproducing apparatus 100 . as shown in fig3 , first , the editing target video content is read from the recording medium 10 , or input from the image signal input unit 1 or 3 and the audio signal input unit 2 or 4 . subsequently , the cpu 15 extracts from the video content an image signal and an audio signal of predetermined sections ( predetermined number of continuous frames ) ( step 31 ). the extracted image signal of the predetermined section is supplied to the image feature detection unit 7 , and the extracted audio signal of the predetermined section is supplied to the audio feature detection unit 8 . subsequently , the image feature detection unit 7 detects a face image area from the image signal of the predetermined section by using the discriminant function ( step 32 ). fig4 is a diagram conceptually showing the detection processing of the face image area . as shown in fig4 , the image feature detection unit 7 filters the image signal of the predetermined section with the feature filter , detects the face feature , and generates the multidimensional feature vector . then , the image feature detection unit 7 puts a value of each dimension of the feature vectors into a variable of each dimension of the discriminant function , and judges whether the image signal includes the face image area based on whether an output of the discriminant function is positive or negative . then , the image feature detection unit 7 calculates a face evaluation value tf for evaluating the certainty of the face image detection based on the output value of the discriminant function ( step 32 ). the face evaluation value refers to an output value of the discriminant function that is expressed in percentage when the feature vector is generated based on predetermined , definite face image data and the generated feature vector is input to the discriminant function . subsequently , the audio feature detection unit 8 detects a section including a person &# 39 ; s voice from the audio signal of the predetermined section ( step 34 ). fig5 is a diagram conceptually showing a voice detection processing . in fig5 , power of the audio signal of the predetermined section is indicated . a waveform a shown in fig5 indicates a person &# 39 ; s voice , and a waveform b shown in fig5 indicates a sound other than the person &# 39 ; s voice . as shown in fig5 , first , the audio feature detection unit 8 sets a threshold value ath relating to the audio power in order to remove a noise influence . then , when average power in the predetermined section is larger than ath , the audio feature detection unit 8 judges that the section is an audio section . when the average power is smaller than ath , the audio feature detection unit 8 judges that the section is a non - audio section . that is , in fig5 , the audio signal other than the waveforms a and b is determined to be a signal of the non - audio section . in the audio section , the person &# 39 ; s voice includes a consonant , a vowel , an intake of breath , and the like , and therefore has a feature in that a continuous section of predetermined power or more is shorter than that of the sound other than the voice in music and the like . by using this feature , the audio feature detection unit 8 sets a threshold value tth relating to a time period . in a case where an average continuous time period in which the predetermined power or more is obtained is smaller than tth , the audio feature detection unit 8 judges that the section is a voice section , and in a case where the average continuous time period in which the predetermined power or more is obtained is larger than tth , the audio feature detection unit 8 judges that the section is a non - voice section . subsequently , the audio feature detection unit 8 calculates a voice evaluation value tv based on a volume ( power level or amplitude ) of the detected voice ( step 35 ). the voice evaluation value refers to a value indicating the power level of the voice that is expressed in percentage with a maximum power level of the voice that can be detected being 1 . subsequently , the cpu 15 judges whether the face evaluation value tf is equal to or larger than a predetermined threshold value tfs ( step 36 ). when the face evaluation value tf is equal to or larger than the threshold value tfs ( yes ), the cpu 15 judges whether the voice evaluation value tv is equal to or larger than a predetermined threshold value tvs ( step 37 ). when the voice evaluation value tv is equal to or larger than tvs ( yes ), the cpu 15 sets a weighting factor k of the bgm sound to a predetermined weight k 1 that is smaller than 0 . 5 , and sets a weighting factor m of the audio signal of the video content to 1_ − k 1 . for example , k 1 is set to 0 . even when being not 0 , k 1 is set to a value as close to 0 as possible . in step 37 , when the voice evaluation value tv is smaller than the threshold value tvs ( no ), the cpu 15 sets the weighting factors k and m based on the face evaluation value tf and the voice evaluation value tv ( step 39 ). that is , although both the weighting factors k and m are not 0 or 1 , the weighting factor k is set to be smaller than the weighting factor m . in step 36 , when the face evaluation value tf is smaller than the threshold value tfs ( no ), the cpu 15 judges whether the voice evaluation value tv is equal to or larger than the predetermined threshold value tvs ( step 40 ). when the voice evaluation value tv is equal to or larger than the threshold value tvs ( yes ), the cpu 15 sets the weighting factors k and m based on the face evaluation value tf and the voice evaluation value tv ( step 41 ). that is , although both the weighting factors k and m are not 0 or 1 , the weighting factor k is set to be larger than the weighting factor m . in step 40 , when the voice evaluation value tv is smaller than the threshold value tvs ( no ), the cpu 15 sets the weighting factor k to a predetermined weight k 2 that is larger than 0 . 5 and sets the weighting factor m to 1 − k 2 . for example , k 2 is set to 1 . even when being not 1 , k 2 is set to a value as close to 1 as possible . the cpu 15 edits the video content for each predetermined section ( for each frame ) of the video content based on the weighting factors k and m set as described above , and inserts the bgm sound input from the external audio source 17 ( step 43 ). the cpu 15 performs the above processings on the whole predetermined sections of the video content , or performs the above processings until the user or the like gives an instruction of stopping the processings ( steps 44 and 45 ). the cpu 15 multiplexes the video content that has been edited with the original image signal eventually , and stores the multiplexed content in the recording medium 10 as a new video content . fig6 is a table showing setting processings of the weighting factors k and m described above . as shown in fig6 , weighting factors of four patterns are set depending on whether the face evaluation value is equal to or larger than the threshold value tfs and whether the voice evaluation value is equal to or larger than the threshold value tvs . fig7 is a graph showing relationships between the frame images and each of the face evaluation value , the voice evaluation value , the weighting factors k and m , and the video content . frames f 1 to f 6 shown in fig7 indicate parts of frames of the video content including scenes of a school athletic meet shot with a camcorder or the like , as an example . as shown in fig7 , in the frames f 1 and f 2 of the video content , faces are so small that face image areas are not detected by the image feature detection unit 7 . accordingly , the face evaluation value is small ( smaller than the threshold value tfs ). further , in the sections of the frames f 1 and f 2 , the scenes are shot from a distance , so persons &# 39 ; voices are hardly collected . accordingly , the voice evaluation value is small ( smaller than the threshold value tvs ). therefore , in those sections , the weighting factor k of the bgm sound is set to be high , and the weighting factor m of the audio signal of the content is set to be low . as a result , the edit processing is performed so that unspectacular scenes can be more attractive . in the frames f 3 and f 4 , persons are shot in closeup slightly , and collected voices are somewhat louder . accordingly , in those sections , the weighing factors k and m are respectively set according to the face evaluation value and the voice evaluation value . therefore , the persons &# 39 ; voices are left , and at the same time , an effect of the bgm insertion can be obtained . in other words , when the face evaluation value is equal to or larger than the threshold value tfs and the voice evaluation value is smaller than the threshold value tvs , the image feature detection unit 7 sets the weight of the bgm sound to be lower , with the result that a voice of a person who shows up in the image can be emphasized . further , when the face evaluation value is smaller than the threshold value tfs and the voice evaluation value is equal to or larger than the threshold value tvs , the image feature detection unit 7 sets the weight of the bgm sound to be higher , with the result that the effect of the bgm can be increased instead of the persons &# 39 ; voices unrelated to the image . in the frames f 5 and f 6 , the persons are shot in closeup to such an extent that their faces can be clearly detected . accordingly , the face evaluation value is large ( equal to or larger than the threshold value tfs ). further , the power level of the detected voices is large , and therefore the voice evaluation value is also large ( equal to or larger than the threshold value tvs ). thus , in those sections , the weighting factor k is set to be low , and the weighing factor m is set to be high . accordingly , the person &# 39 ; s voice is emphasized , with the result that the person can be further impressed . as described above , according to this embodiment , the bgm sound is inserted in the video content based on the face evaluation value and the voice evaluation value . therefore , the bgm sound can be inserted while effectively leaving the audio signal in the original video content depending on the scenes . as a result , as compared to a case where the bgm sound is just monotonously inserted , a more impressive , memorable video content can be obtained . the present invention is not limited to the above embodiment , and can of course be variously modified without departing from the gist of the present invention . in the above embodiment , the image feature detection unit 7 may detect an animal &# 39 ; s face image in addition to the person &# 39 ; s face image . further , the audio feature detection unit 8 may detect an animal &# 39 ; s voice in addition to the person &# 39 ; s voice . in the above embodiment , the image feature detection unit 7 may not only just detect the face image but also recognize a specific person &# 39 ; s face image . the face recognition processing is performed after the face detection processing by the discriminant function . for the face recognition processing , an edge strength image , a frequency intensity image , a high order autocorrelation , a color conversion image , or the like can be used . fig8 is a diagram conceptually showing a face recognition processing using the edge strength image . as shown in fig8 , in the recording medium 10 or the like , grayscale images and edge strength images are stored as feature data ( dictionary pattern ) of a person whose face is to be recognized . the image feature detection unit 7 extracts a grayscale image and an edge strength image as the feature data from a detected face image . then , the image feature detection unit 7 performs a comparison processing between the extracted grayscale image and edge strength image and the stored grayscale images and edge strength images of the person whose face is to be recognized by a pattern matching , with the result that the face image of the specific person can be recognized . in this case , the image feature detection unit 7 expresses a recognition rate ( matching rate ) of the face image in percentage , and may regard the recognition rate as the face evaluation value . in a case where information on face feature points such as eyes and nose is obtained , the image feature detection unit 7 can also use the information in addition to the edge strength image and the like . by the above processing , it is possible to insert the bgm into the video content in accordance with the recognition rate of the specific person &# 39 ; s face , for example , in accordance with the recognition rate of only a face of a user &# 39 ; s child from among multiple children as in the example of fig7 . as a result , the video content that has been edited can be more impressive . in the above embodiment , the audio feature detection unit 8 may not only just detect the voice but also recognize a specific person &# 39 ; s voice . the voice recognition processing is performed as follows . for example , the audio feature detection unit 8 performs a frequency analysis on a signal of a voice of a person to be recognized , detects a spectral characteristic thereof , stores it in the recording medium 10 or the like , and performs a comparison processing ( pattern matching ) with the detected voice spectral characteristic . as the spectral characteristic , a spectral peak frequency of each of a consonant part and a vowel part , a spectral interval , and the like are used . further , intervals or the like of the intake of breath differ among individuals . therefore , the audio feature detection unit 8 may also use information on the intervals of the intake of breath in addition to the spectral characteristic . in this case , the audio feature detection unit 8 expresses a voice recognition rate ( matching rate ) in percentage , and regards the voice recognition rate as the voice evaluation value . by the processing , it is possible to insert the bgm into the video content in accordance with the voice recognition rate of the specific person , with the result that the video content that has been edit can be more impressive . in the above embodiment , in a case where the face evaluation value is smaller than the threshold value tfs and the voice evaluation value is equal to or larger than the threshold value tvs , the image feature detection unit 7 sets the weight of the bgm sound to be high . in this case , however , the image feature detection unit 7 may set the weight of the bgm sound to be low inversely . with this setting , both voices of the person as the shooting target and the person who shoots the target can be left . in addition , in a case where the voices can be recognized , even when the voice of the person who performs shooting is recognized but the face evaluation value is smaller than the threshold value tfs , the weight of the bgm sound may be set to be low , if the voice evaluation value of the voice of the person who performs shooting is equal to or larger than the threshold value tvs . with this setting , the voice of the person who performs shooting can be more reliably and effectively left . in the above embodiment , the recording / reproducing apparatus 100 does not carry out the learning processing for the voice detection processing , but may of course carry out the learning processing . in the above embodiment , the present invention is applied to the recording / reproducing apparatus as an example , but may of course be applied to other electronic apparatuses such as a pc , a digital video camera , mobile av equipment , a mobile phone , and a game machine .	6
with reference now to the drawings , the preferred embodiment of the d - ring is herein described . it should be noted that the articles “ a ”, “ an ”, and “ the ”, as used in this specification , include plural referents unless the content clearly dictates otherwise . with reference to fig1 - 7 , the d - ring is essentially a toroid , which is to say it is a two - dimensional base shape rotated about a central axis . the two - dimensional shape may be any desirable shape including but not limited to an ellipse or polygon . the preferred d - ring 10 is actually two semi - toroids and features a flat side 12 and a rounded side 16 . a divider 14 generally bisects the d - ring 10 into two sections , bridging two transitional areas of the d - ring 10 . the semi - toroids may be of different base shapes and may have two different central axes which may or may not be parallel to each other ( thus forming two or more ring planes ). for purposes of this application and the appended claims , single toroids and such conglomerations of two or more partial toroids shall be called “ toroidal bodies ” and the minor diameter or “ thickness ” of any toridal body at any given point will defined by the base shape of the toridal body at that given point . two sockets 18 are located at the two ends of the divider 14 . the sockets 18 are generally round , according to the shape of most modern swivels , but any shape may be used so long as it fits a swivel . they also tend to be thicker than the body of the d - ring 10 . in addition , it should be noted that while two sockets are provided for ambidextrous fitting of the sling swivel , additional sockets may yet be provided . the divider 14 buttresses the two sockets and provides additional reinforcement to them . along the periphery of the sockets are a number of slots 20 , 22 . these slots are provided to interface with ball bearings utilized in modern push - button quick detach sling swivels . the two interior slots 22 are , in actuality , bores parallel to a minor diameter “ d ” which is in turn orthogonal with the ring plane . each of these bores presents an oblong slot where the bore and socket interface ( fig1 , 11 ). it should be noted that the position of the slots 20 , 22 shown are exemplary and that they may be positioned along any portion of the periphery of the sockets 18 . thus , there may be more or less than 4 slots which may be bores , slots or partial bores and they may or may not be orthogonal to the ring plane . in use , shown in fig8 , the d - ring 10 is sewn into one or more straps 24 , 26 of a sling . swivels 30 are also provided in the sling system . basically , the swivel 30 has a plug body 32 out of which a loop , or bail , 34 projects . at the base of the plug body 32 , is a plurality ( usually 4 ) of spring biased ball bearings 36 . various methods of spring biasing these ball bearings are known and used within the art . the swivel 30 is then inserted into either of the sockets 18 and the ball bearings 36 then interface with slots 20 , 22 , locking the swivel into place . the location and size of the slots 20 , 22 also inhibit rotation of the swivel about its axis , requiring the swivel to be removed and re - inserted ( fig9 ) should a larger degree of rotation is needed . a number of variations may be made to the described preferred embodiment and still fall within the purview of the invention . first , the number of the sockets 18 may be increased and placed at any advantageous location on the d - ring . the preferred embodiment of this invention is that at least two sockets will be present on opposite sides of the d - ring so as to accomplish the object of ambidexterity . having two sockets on the same side , while not preferred , is still within the purview of this invention . the sockets need not be diametrically opposite as is depicted in the figures and the further addition of 1 , 2 , or 3 more sockets will not prevent at least one pair of sockets from being on “ opposite ” sides . differing socket number and position may require slightly different designs of the divider 14 in order to provide adequate support . the divider 14 can also be eliminated if desired , though it is not preferable . second , the overall shape of the d - ring may also be altered so that it may be a perfect torus , a square , or any other shape a user may find to be advantageous . likewise , while described as being a circle , even using the term “ diameter ” to describe its width , the base shape of the ring body may be any suitable shape to allow connection of slings or sling straps to the ring . in practice , the d - ring may be manufactured out of any suitable material including metals , polymers , or composites . identifying and marketing indicia may be placed effectively on the divider 14 . the d - ring may also be used for slings other than for firearms . although the present invention has been described with reference to preferred embodiments , numerous modifications and variations can be made and still the result will come within the scope of the invention . no limitation with respect to the specific embodiments disclosed herein is intended or should be inferred .	8
the present invention provides for a voice - driven user interface that allows a user to use voice commands to perform tasks , or a series of tasks , through a variety of end software applications using standard software configurations . in one exemplary embodiment , as shown in fig1 , the user 1 uses a headset 2 with an attached microphone 2 a or other voice - transmission device , such as a standalone microphone , to give voice commands which are transmitted via wires or wirelessly 3 to an interface program module 5 residing on a computer 4 or device equipped with a microprocessor . the interface program module then interfaces with the chosen end software application 6 by converting the vocal commands into appropriate inputs for that application 6 . communication can be through an appropriate cable or ethernet connection , wirelessly ( such as , but not limited to , bluetooth ), or other means 3 . communications may be secure and / or encrypted . end software applications include , but are not limited to , any commonly - used and accepted software application , such as ms word , excel , access , powerpoint , internet explorer , and the like . the end software application does not need to be modified or reprogrammed , as the conversion of vocal commands given by the user to input and commands recognized by the end software is handled by the interface program module 5 . in one exemplary embodiment , the interface program module 5 contains a vocabulary of command words and phrases . a particular word or phrase used as a vocal command can be associated with a series or sequence of commands or words or input for a particular application 6 , and the giving of that vocal command can cause that sequence to be executed or inputted . in one embodiment , the vocabulary database is restricted in size , so the amount of education and “ training ” that is needed for voice recognition is minimized . the meaning of a particular vocal command may be the same or may vary for different applications 6 . feedback can be given to the user in a variety of ways , visually and aurally . thus , for example , the user can received aural feedback through the speakers 2 b on a headset 2 or a standard set of speakers 7 , repeating vocal commands that have been given , reporting the status or result of a process or command sequence ( e . g ., “ command executed ”), or prompting the user for additional input if needed or desired . while the user may view a monitor attached to the computer for visual feedback , a projection unit 8 may be used to project the display on a large screen 9 , wall , or similar object , whereby the user can receive visual feedback without being at the computer . in one exemplary embodiment , the interface program module 5 may incorporate a speech recognition engine . alternatively , the interface program module 5 may interface with currently available speech recognition engines , including but not limited to dragon naturally speaking and via voice . in one exemplary embodiment , input from the user is solicited through templates 20 . templates 20 may be pre - constructed for use with particular applications , or may be created by the user , as shown in fig2 . templates created by the user may be saved ; accordingly , a particular template need only be created once . in an exemplary embodiment , a user creates a template 20 by initiating a template creation process 12 . the user is prompted to enter certain information , including but not limited to , ( a ) the name of the template 13 , ( b ) the type of the template ( or the group that it belongs to ) 14 , ( c ) the question ( s ) to be asked by the interface control module when the template is used 15 , ( d ) the type of data expected in response to the question asked 16 , and ( e ) whether a response to the question is required 17 . the template also may be created so as to incorporate a “ value list ” 18 of acceptable responses that are considered valid for a particular question . the use of a value list may thus limit acceptable verbal responses to a few options , significantly improving recognition accuracy . in another exemplary embodiment , the question to be asked can be input as a typed question during template creation , which will then be converted to digitized speech asking the question when the template is run , or the question may be recorded by the user as a spoken phrase that is digitally stored and played back when the template is run , thus providing a more human aspect to the interface . in another exemplary embodiment , all data handled or used by the interface program module 5 , including any vocabulary data , is stored in a database 9 . the database 9 may be a simple flat - file database , or a relational database . the use of the present invention is further illustrated by the following , non - exclusive examples . a golf course superintendent equipped with the present invention could monitor and adjust his or her nitrogen mix in the fertilizing process , while at the same time , on a real - time basis , have knowledge and receive warnings where the nearest lightning threats are , as well as the locations of golfers . exemplary commands needed by the superintendent are as follows : “ open fertilizercalc , local noaa weather and memberfind ”. this command would “ maximize ” the already running end software programs covering fertilization management , weather reports , and the location of golfers on the course . the superintendent could then followup by saying “ increase nitrogen by 0 . 1 grams / liter for 14 days , advise nearest lightning threat , and find sammy jones ”. the superintendent would then receive feedback through the headset , such as “ command executed . lightning strike 3 . 5 miles northwest . jones 95 yards from 14th pin .” an accountant or attorney equipped with the present invention could inspect , review , tag and enter notes regarding a large number of documents . while reviewing a box of documents 10 , the accountant or attorney could enter vocal commands and information about critical or important documents as they are seen , including information about the substance of the document and its location . the transcription can be projected onto a wall in the document production room , so the user does not have to be at the computer while reviewing the documents . thus , for example , the user can enter domain specific settings for the rows and columns , such as “ john s ”=“ jonathan s smith ”. the data can then be defined for the remaining columns in the spreadsheet and one - word vocalizations can then be confirmed aurally and visually . the remaining data can then be assigned to each cell in the program that was pre - defined by the voice software . thus , this software aids the streamlining and efficient data collection to increases productivity and frees time for the professional to complete additional tasks . the present invention is useful in any application where the user cannot direct his or her attention to a computer screen , is required to move around , or is required to operate with his or hands free . further non - exclusive examples of users benefiting from such applications include pilots , musicians , entymologists , archaelogists , farmers , air traffic control , homeowners , and pet owners . for example , if a collared pet gets within a certain distance of a pet door or doorway to the outside , the homeowner working several rooms away can be aurally told via headset that “ spot wants out . respond please .” the homeowner can then give the desired vocal command ( e . g ., “ yes ” or “ no ”). another commercial use of this invention could be found in the auto industry . the voice - activated software could be used in conjunction with an excel based spreadsheet . the domain specific definitions could be set for such categories as make , model , number of doors , color and engine size , and lot numbers . the voice - activated software could then verbally prompt the manager ( who may move freely throughout the car lot ) during the inventory task to speak all the information as input . these data cells would be simultaneously entered into the appropriate excel columns as previously defined . the present invention also could be used in conjunction with current television technology . a consumer could purchase a tv with the voice interface installed . the owner would then program the domain specific channels for menus with classifications of channel genres . for example , “ sports ” vocalized by a user would pull up several different channels such as espn and espn 2 and espn classic . the user would then verbally choose one of these channels . entities that have alternative vocalizations with consistent meanings also can use the present invention . for example , an autistic child that has a consistent pattern of vocalizations ( but otherwise limited speech and vocabulary ) with an understood meaning could program domain specifications into the interface software . these responses could then be converted to aural specific words . the present invention also may have application in non - human research , such as studies in both the primate and marine environments . enhancements beyond sign language with primates could become a possibility since there is a consistent pattern of vocalizations within the primate sub - divisions . dolphins , porpoises and the like similarly have consistent alternative patterns of communication . in another exemplary embodiment , a user may operate a pre - established or previously created template 20 to access one or more databases 9 containing information about a topic of interest . in one alternative configuration , as seen in fig3 the user 1 could identify a particular object or item or condition through a series of questions posted by the interface to the user by means of the template . a bird enthusiast or ornithologist , for example , upon spotting a bird of unknown specie 30 , could initiate the program interface by saying “ what type of bird ?” or alternatively , “ activate template , identify bird ” into the headset , which would cause the interface to initiate the bird identification template and establish a connection o the database . the interface would then ask the user a series of questions in order , such as “ primary color ?” as the user responds with an appropriate answer ( e . g ., “ blue ”) to each question , the interface would proceed down the decision - tree - like series of questions ( as determined by the template ) until the final determination of specie is made . the same method would apply to other types of objects or conditions the user is attempting to identify , including , but not limited to , flowers , snakes , trees , insects , planes , automobiles , mechanical conditions , medical diagnoses , building inspection , and the like . each type of object or condition would have a pre - determined template with questions to be posed to the user . the template questions and structure would be designed to best suit the category of object ( s ) being identified . the template would be activated verbally , pose questions verbally , and receive responses verbally . the availability of a wireless headset , linked to a nearby computing device , such as a laptop or handheld pocketpc , means that the user need not leave the location of observation to access a stack of books at a library , sit at a computer somewhere and conduct an internet search , or even use their hands . this method of learning and exploring and identifying new items and objects would be particularly appealing in the field of education . students would not only have an enjoyable means of identifying objects , but would learn an identification methodology useful for particular categories ( including the important questions for that particular field ). the student gains knowledge of the classification process and the application of the scientific method . thus , it should be understood that the embodiments and examples have been chosen and described in order to best illustrate the principals of the invention and its practical applications to thereby enable one of ordinary skill in the art to best utilize the invention in various embodiments and with various modifications as are suited for particular uses contemplated . even though specific embodiments of this invention have been described , they are not to be taken as exhaustive . there are several variations that will be apparent to those skilled in the art . accordingly , it is intended that the scope of the invention be defined by the claims appended hereto .	6
a method for preparing a semiconductor wafer and a solid state imaging device according to the present invention will hereinafter be described with reference to the accompanying drawings . first , a process for preparing a semiconductor substrate or wafer according to an embodiment of the present invention will be explained referring to fig3 . first of all , a silicon ingot 10 is obtained through the crystal growth process using the cz method . the silicon ingot 10 has , for example , a diameter of 6 inches , a crystal orientation & lt ; 100 & gt ;, and also has phosphor doped therein . a specific resistance or resistivity ( design value ) of the silicon ingot 10 is in a range from 8 to 12 ωcm , its oxygen concentration oi satisfies [ oi ]≈ 1 . 5 × 10 18 atoms / cm 3 , and its carbon concentration cs satisfies [ cs ] & lt ; 1 × 10 16 atoms / cm 3 . after pulling up the ingot 10 , it is subjected to a polishing work so as to have a cylindrical configuration in order to determine its diameter as the ingot 10 , subjected to a crystal face orientating and forming an orientation flat . then , in a slicing process 1 , the silicon ingot 10 is sliced by a slicing blade 11 with an inner periphery blade in a known manner to obtain a silicon wafer 10a . in the next beveling process 2 , a grinding wheel 12 is pushed against the silicon wafer 10a to chamfer it . in a lapping process 3 , next , in order to remove a damage of the silicon wafer 10a or its irregular thickness during slicing the wafer 10a the silicon wafer 10a is subjected to a lapping work . the lapping work is carried out by mechanically lapping a plurality of such wafers 10a positioned on a carrier 13 by using , e . g ., no . 1200 al 2 o 3 . then , in an etching process 4 , the wafers 10a are subjected to the etching process to remove damaged portions caused by the lapping process and so on . this etching process is performed by isotropic etching . the etching process is carried out by using an etching solution 14 of a mixture of hf , hno 3 and ch 3 cooh so that the wafers are etched away by a thickness in a range from 10 to 5 μm at one side . subsequently , the silicon wafers 10a are cleaned with use of aqueous solution of nh 4 oh and h 2 o 2 . after this cleaning process , the silicon wafers 10a are subjected to the annealing process in a gas ambient containing hydrogen according to the present invention . that is , the silicon wafers 10a are disposed within a quartz tube 15 , h 2 gas 16 is supplied into the tube , and then the wafers are subjected to the annealing process in a gas ambient of 100 % of h 2 gas 16 supplied thereto , for example , at a temperature of 1050 ° c . for 30 minutes . a specific resistance of the wafer , which variations have been large due to the generation of thermal donors prior to the annealing process , becomes stably within a range from 8 to 11 ωcm after the annealing process . thus , it will be appreciated that the annealing process can provide a thermal donor killer effect . next , in a polishing process 6 , the surfaces of the silicon wafers 10a are polished by injecting an abrasive material 17 through primary and secondary polishing processes by an amount of about 8 μm to obtain their mirror finished surfaces . in this figure , reference numeral 18 denotes a plate , and 19 a cloth . thereafter , in a mirror surface cleaning process 7 , the wafers are subjected to a final cleaning work to obtain final semiconductor substrates , i . e ., final silicon wafers 10h . the higher the temperature is and the longer the treatment time is , the annealing process using the hydrogen gas affects up to the more inner part of the wafer 10a . as a consequence , the annealing conditions and polishing conditions must be determined taking such influences into consideration . with respect to each of the silicon wafer thus prepared according to the present embodiment and a silicon wafer prepared according to the prior art thermal donor killer annealing process ( that is , the wafers are subjected to an annealing operation in an n 2 gas ambience at 1050 ° c . for 30 minutes ), a thermally oxidized film ( sio 2 film ) of 25 nm thick is formed thereon at 1000 ° c ., an al gate electrode is formed on the oxidized film to thereby form a mos diode , and then the resultant wafers or diodes are subjected to measurements of their gate breakdown voltage . the measurement results are shown in fig4 . in this case , when a gate area of the wafer is set at 0 . 45 cm 2 and a breakdown current is at 5 μa , ones of the wafers having a breakdown electric field of higher than 8 mv / cm were evaluated as good products . it will be seen from fig4 that the gate oxidation film or sio 2 film according to the present embodiment has a remarkably improved breakdown voltage . according to the aforesaid embodiment , fine oxygen precipitates and point defect clusters can be removed by subjecting the silicon wafer 10a after the etching process 4 to an annealing process in an h 2 gas ambience at 1050 ° c . for 30 minutes . at the same time , the thermal donors can be removed through the above annealing process . as a result , there can be prepared a semiconductor wafer which is free of thermal donors , fine oxygen precipitates and point defects . the annealing temperature can be set at such a value higher than 500 ° c . that allows decomposition or removal of such defects , and preferably the annealing temperature is in a range from 900 ° to 1250 ° c . while the wafers have been treated in an ambient containing 100 % of h 2 gas in the foregoing embodiment , the present invention is not limited to the specific example and the treatment may be carried out in a gas ambience containing a mixture gas such as a forming gas ( n 2 + h 2 ) or the like . in this connection , the higher the hydrogen concentration is , the greater the effect is . further , although the hydrogen annealing process according to the present invention may be carried out between the slicing process 1 and the cleaning process 7 after polishing , most preferably the hydrogen annealing process may be performed after the etching step 4 where the damaged portions caused by the lapping process and impurities have been removed through this etching process , and before the final polishing process 6 . this is because lots of surface impurities exist on the wafer prior to the etching process , and so , if the annealing process is performed before the etching process , the impurities tend to be diffused into the interior of the wafer through the annealing process . in contrast , if the annealing process is performed after the polishing process , the surface of the wafer possibly becomes highly rough due to the annealing . while explanation has been made as to the preparing method of the silicon wafers in the above - mentioned embodiment , the present invention may be applied also to preparing methods of other semiconductor wafers . it has been confirmed that the hydrogen gas can usually work well as the molecular state of the hydrogen annealing process , but the atom or plasma state of hydrogen may also exhibit good effect . semiconductor wafers usable in the present invention include ones obtained by the czochralski ( cz ) method , magnetic - field - applied czochralski ( mcz ) method or floating zone ( fz ) method or the like . a method for preparing a solid state imaging device according to another embodiment of the present invention will be described with reference to fig5 a to 5f . this embodiment corresponds to a case where the present invention is applied to the preparation of a solid state imaging device constituting the ccd type solid state imaging element shown in fig1 . the present embodiment is arranged so that , immediately before forming a gate insulating film for charge transfer , a sensor insulating film to be formed in a photo receptor portion or both the insulating films , a semiconductor wafer is subjected to the annealing process in an ambient containing hydrogen at a temperature higher than 500 ° c . and desirably in a range between 700 ° c . and 1250 ° c . as a consequence , such defects as fine defects in the vicinity of the surface of the wafer and secondary crystalline defects can be suppressed in generation , whereby white defects thereof can be reduced and its gate breakdown voltage can be improved . as shown in fig5 a , first , a well region 22 of a second conductivity type or a first p - type is formed on a silicon substrate ( wafer ) 21 of a first conductivity type , for example , an n - type , and then an n - type impurity and a p - type impurity are selectively introduced by the ion implantation technique within the first p - type well region 22 , thereby forming an n - type transfer channel region 24 , a p - type channel stop region 25 and a second p - type well region 27 which constitutes a vertical register . as shown in fig5 b , then , a resultant wafer thus obtained is subjected to the annealing process in a gas ambience containing 100 % of h 2 gas , for example , at 1000 ° c . for 30 minutes . subsequently , as shown in fig5 c , a resultant wafer is subjected to the oxidizing process at 1000 ° c . to form thereon an sio 2 film 29 of about 30 nm thick . then , as shown in fig5 d , an si 3 n 4 film 30 and an sio 2 film 31 are sequentially formed on the entire surface of the sio 2 film 29 , and then the sio 2 film 29 , si 3 n 4 film 30 and sio 2 film 31 at the portion where a photo sensor 28 is to be formed are selectively etched away . in this respect , a gate insulating film 32 is formed by the n - type transfer channel region 24 , a region to be formed as a read gate portion 37 , the sio 2 film 29 , si 3 n 4 film 30 and sio 2 film 31 on the p - type channel stop region 25 . thereafter , a transfer electrode 33 of a polycrystalline silicon layer is formed on the gate insulating film 32 , to thereby form a vertical register 38 which is formed of the n - type transfer channel region 24 , the gate insulating film 32 and the transfer electrode 33 . thereafter , a region corresponding to the photo sensor 28 is subjected to the ion implantation process to form an n - type impurity diffusion region 23 . though not illustrated , of course , even in the case of processing a horizontal register , the wafer is subjected to the annealing process in the 100 %- h 2 gas ambient at 1000 ° c . for 30 minutes prior to the formation of the gate insulating film thereof . as shown in fig5 e , a resultant wafer is again subjected to the annealing process in the 100 %- h 2 gas ambient at 1000 ° c . for 30 minutes . subsequently , as shown in fig5 f , a sio 2 film 39 of about 30 nm thick as a sensor insulating film is formed on a part of the wafer corresponding to the photo sensor 28 . at the same time , the sio 2 film 39 is also formed even on the surface of the transfer electrode 33 made of polycrystalline silicon . thereafter , though not shown in fig5 f , a p - type positive - charge accumulation region 26 is formed on the surface of the n - type impurity diffusion region 23 of the photo sensor 28 , an interlayer insulating film 34 made of psg or the like is formed on the entire surface of the wafer including the transfer electrode 33 , and then an al light shielding film 35 is formed to obtain such the ccd type solid state imaging device 40 as shown in fig2 . in accordance with the present embodiment , immediately prior to the formation of the insulating films , that is , immediately prior to the formation of the sio 2 film 29 serving as the gate insulating film and immediately prior to the formation of the sio 2 film 39 serving as the sensor insulating film , the wafer is subjected to the annealing process in the h 2 gas ambient at 1000 ° c . for 30 minutes . therefore , fine oxygen precipitates present in the surface of the silicon substrate , secondary defects , si x o y clusters and the like can be removed . as a result , in the photo sensor 28 , a leak current flowing through the pn junction forming the photo receptor portion can be reduced , and a dark current can be decreased , and hence white defects as the defects on the screen of the imaging device can be reduced . in the gate insulating film , further , defects in the sio 2 film 29 and in the interface between the sio 2 film 29 and the silicon substrate , and further in the active region under the sio 2 film 29 can be reduced , whereby the breakdown voltage of the gate insulating film can be improved and a transfer failure can be improved . although the wafer has been treated in the 100 %- h 2 gas ambient in the foregoing embodiment , the present invention is not limited to the specific example , and a gas ambience containing a mixture gas ( n 2 + h 2 ) as a forming gas may be employed like the prior art shown in fig3 . the temperature and time period of the annealing process are arbitrarily determined dependent on the amount and distribution of defects , the hydrogen diffusion length or the like , and on the structure of the imaging devices . the annealing temperature may be set at a value higher than 500 ° c . and desirably in a range between 700 ° c . and 1250 ° c . the insulating film may comprise only the sio 2 film formed by using the chemical vapor deposition ( cvd ) technique or the thermal oxidation technique or may comprise a composite film formed by at least the sio 2 film and the si 3 n 4 film . the present invention can attain much remarkable effect when employing the former insulating film than the latter . according to the aforesaid embodiment , the annealing process has been carried out in the ambient containing hydrogen immediately prior to the formation of the gate and sensor insulating films 32 and 39 . however , the annealing process may also be effected in the hydrogen - contained ambient only immediately prior to the formation of the gate insulating film 32 or only immediately prior to the formation of the sensor insulating film 29 . in this case , enhancement in the breakdown voltage of the gate insulating film , improvement in the transfer deterioration and reduction in white defects as ones on the screen of the imaging device can be realized advantageously . in accordance with the present invention , there can be prepared a good quality of semiconductor substrate which , through an annealing process in a hydrogen - contained ambient in the course of preparing the semiconductor substrate , can be made free of not only thermal donors ( si x o y clusters ) present immediately after pulling up of its crystal but also defects such as fine oxygen precipitates and point defect clusters or the like , which removal would be impossible in the prior art . in a process for preparing a solid state imaging device in accordance with the present invention , an annealing process is carried out in such an ambient as to contains hydrogen immediately prior to the formation of the insulating film , whereby there can be prepared a reliable solid state imaging device which can eliminate fine oxygen precipitates present in the surface of a semiconductor substrate and secondary defects or the like , which removal would be impossible in the prior art , can reduce white defects appearing on the screen of the imaging device and can remove a transfer failure . having described the preferred embodiments of the invention with reference to the accompanying drawings , it is to be understood that the invention is not limited to those precise embodiments and that various changes and modifications thereof could be effected therein by one skilled in the art without departing from the spirit or scope of the invention as defined in the appended claims .	7
according to a preferred embodiment of the invention , non - toxic plasminogen activators are used , which comprise at least one element of the so called cymogene triade . a comparable triade is known from the catalytic center of serine proteases of the chymotrypsine family consisting of three interacting amino acids aspartate 194 , histidine 40 and serine 32 . however , this triade does not exist in t - pa which belongs also to the family of chymotrypsine like serine proteases . nevertheless , it is known , that the directed mutagenesis of native t - pa for the purpose of introducing at least one of the above amino acids at a suitable position results in a reduced activity of the pro - enzyme ( single chain t - pa ) and to an increased activity of the mature enzyme ( double chain t - pa ) in the presence of fibrin . therefore , the introduction of at least one amino acid of the triade — or of an amino acid with the respective function in the triade — can increase the cymogenity of t - pa ( i . e . the ratio between the activity of the mature enzyme an the activity of the pro - enzyme ). as a result the fibrin specificity is remarkably increased . this is due to conformational interaction between the introduced amino acid residue and / or amino acid residues of the wild type sequence . it is known that the mutagenesis of the native t - pa with substitution of phe305 by his ( f305h ) and of ala 292 by ser ( a92s ) leads to a 20 - fold increase of the cymogenity , whereas the variant f305h alone already leads to 5 times higher cymogenity ( e l madison , kobe a , gething m - j ; sambrook j f , goldsmith e j 1993 : converting tissue plasminogen activator to a zymogen : a regulatory triad of asp - his - ser ; science . 262 , 419 - 421 ). in the presence of fibrin these t - pa mutants show an activity increase of 30 . 000 times ( f305h ) and 130 . 000 times ( f305h , a292s ) respectively . in addition these mutants comprise a substitution of arg275 to r275e in order to prevent cleavage by plasmin at the cleavage site aug275 - ile276 , thereby converting the single chain t - pa to the double chain form . the mutant site 275e alone leads to a 6 . 900 fold increase of the fibrin specificity of t - pa ( k tachias , madison e l 1995 : variants of tissue - type plasminogen activator which display substantially enhanced stimulation by fibrin , in : journal of biological chemistry 270 , 31 : 18319 - 18322 ). the positions 305 and 292 of t - pa are homologous to the positions his40 and ser32 of the known triade of the chymotryptic serine proteases . by the corresponding substitutions introducing histidine or respectively serine , these amino acids can interact with the aspartate 477 of t - pa resulting in a functional triade in the t - pa mutants ( madison et al ., 1993 ). these t - pa mutants can be used for the treatment of stroke according to the invention because they show no or — compared to wild type t - pa — a significantly reduced neurotoxicity due to their increased fibrin specificity . for the purpose of disclosure of the mentioned t - pa mutants f305h ; f305h ; a292s alone or in combination with r275e we incorporate the publications of madison et al ., ( 1993 ) and tachias and madison ( 1995 ) hereby are fully incorporated by reference . the increase of fibrin specificity of plasminogen activators can alternatively be achieved by a point mutation of asp194 ( or an aspartate at a homologous position ). plasminogen activators belong to the group of serine proteases of the chymotrypsin family and therefore comprise the conserved amino acid asp194 , which is responsible for the stability of the catalytic active conformation of the mature proteases . it is known that asp194 interacts with his40 in the cymogenic form of serine proteases . after the cymogene is activated by cleavage this specific interaction is interrupted and the side chain of the asp194 rotates about 170 . degree . in order to form a now salt bridge with ile16 . this salt bridge essentially contributes to the stability of the oxyanione pocket of the catalytic center of the mature serine proteases . it is also present in t - pa . the introduction of a point mutation replacing asp194 prima facie impedes the formation or respectively the stability of the catalytic confirmation of serine proteases . despite this the mutated plasminogen activators show a significant increase of activity in the presence of their co - factor fibrin — especially in comparison to the mature wild type form — which can only be explained in a way that the interaction with fibrin allows a conformational change promoting catalytic activity ( l strandberg , madison e l , 1995 : variants of tissue - type plasminogen activator with substantially enhanced response and selectivity towards fibrin co - factors , in : journal of biological chemistry 270 , 40 : 2344 - 2349 ). in conclusion , the asp194 mutants of the plasminogen activators show a high increase of activity in presence of fibrin which enables their use according to the invention . in a preferred embodiment according to the invention , a mutant t - pais used , in which asp194 is substituted by glutamate ( d194e ) or respectively by asparagine ( d194n ). in these mutants the activity of t - pa is reduced 1 to 2000 fold in the absence of fibrin , whereas in the presence of fibrin , an increase of activity by a factor of 498 . 000 to 1 . 050 . 000 can be achieved . these mutants can further comprise a substitution of arg15 to r15e , which prevents the cleavage of the single chain t - pa at the peptide bond arg15 - ile18 by plasmin , leading to the double chain form of t - pa . this mutation alone increases the activation of t - pa by fibrin by the factor 12 . 000 . for reasons of disclosure of the t - pa mutations at positions 194 and 15 , the publications of strandberg and madison ( 1995 ) are fully incorporated by reference . an increase of the fibrin dependency of plasminogen activators can also be achieved by the introduction of point mutations in the so called “ autolysis loop ”. this element 18 known from trypsine ; it can also be found as a homologous part in serine proteases and is especially characterized by three hydrophobic amino acids ( leu , pro and phe ). the autolysis loop in plasminogen activators is responsible for the interaction with plasminogen . point mutations in this area can have the effect that the protein - protein interaction between plasminogen and plasminogen activators cannot be effectively formed any longer . these mutations are only functionally relevant in the absence of fibrin . in the presence of fibrin , they , in contrast , are responsible for an increased activity of the plasminogen activators ( k song - hua , tachias k , lamba d , bode w , madison e l , 1997 : identification of a hydrophobic exocite on tissue type plasminogen activator that modulates specificity for plasminogen , in : journal of biological chemistry 272 ; 3 , 1811 - 1816 ). in a preferred embodiment t - pa is used showing point mutations in the positions 420 to 423 . if these residues are substituted by directed mutagenesis this increases the fibrin dependency of t - pa is increased by a factor up to 61 . 000 ( k song - hua et al .). song - hua et al . examined the point mutations l420a , l420e , s421g , s421e , p422a , p422g , p422e , f423a and f423e . these publications are fully incorporated by reference for disclosure of the use according to the invention . according to a further advantageous embodiment a modified tissue plasminogen activator with an amino acid sequence according to seq id no . 1 ( fig1 ) is used . this modified t - pa differs from the wild type t - pa by the exchange of the hydrophobic amino acids in the position 420 to 423 in the autolysis loop as follows : his420 . asp421 , ala422 and cys423 . this t - pa preferentially contains a phenyl alanine at the position 194 . further the position 275 can be occupied by glutamate . advantageously the position 194 is occupied by phenyl alanine . further , a modified urokinase can be used according to the invention . the urokinase according to the invention can comprise the amino acid sequence according to seq id no . 2 ( fig9 ) in which the hydrophobic amino acids of the autolysis loop are substituted by val420 , thr421 . asp422 and ser423 . advantageously the urokinase is carrying an ile275 and a glu194 . this mutant shows — in comparison to wild type urokinase — a 500 - fold increased fibrin specificity . both mutants — urokinase as well as t - pa — were analyzed in semi quantitative tests and showed a increased fibrin specificity in comparison to the wild type t - pa . the plasminogen activator ( dspa ) from the saliva of the vampire bat ( desmodus rotundus ) also shows a highly increased activity in the presence of fibrin — in specific a 10 . 000 - fold increase . thus it can be used preferentially according to the invention . the term dspa comprises four different proteases , which fulfill an essential function for the vampire bat , namely an increased duration of bleeding of the wounds of pray ( cartwright , 1974 ). these four proteases ( dspaα1 , dspaα2 , dspaβ , dspaγ ) display a high similarity ( homology ) to each other and to the human t - pa . they also show similar physiological activities , leading to a common classification under the generic term ospa . ospa is disclosed in the patents ep 0 352 119 a1 and of u . s . pat . nos . 6 , 008 , 019 and 5 , 830 , 849 which are hereby fully incorporated by reference for purpose of disclosure . dspaα1 so far is the best analyzed protease from this group . it has an amino acid sequence with a homology greater than 72 % in comparison to the known human t - pa amino acid sequence ( kratzschmar et al , 1991 ). however , there are two essential differences between t - pa and dspa . firstly all dspa has full protease activity as a single chain molecule , since it is — in contrast to t - pa — not converted into a double chain form ( gardell et al ., 1989 ; kratzschmar et al ., 1991 ). secondly , the catalytic activity of dspa is nearly absolutely dependent on fibrin ( gardell et al ., 1989 ; 8ringmann et al ., 1995 ; toschie et al ., 1998 ). for example the activity of dspaα1 is increased 100 . 000 fold in the presence of fibrin whereas the t - pa activity is only increased 550 fold . in contrast , dspa activity is considerably less strongly induced by fibrinogen , since it only shows a 7 to 9 fold increase ( bringmann et al ., 1995 ). in conclusion , dspa is considerably more dependent of fibrin and much more fibrin specific as wild type t - pa which is only activated 550 - fold by fibrin . because of its fibrinolytic characteristics and the strong similarity to t - pa , dspa is an interesting candidate for the development of a thrombolytic agent . despite this , the therapeutic use of dspa as a thrombolytic agent was restricted to the treatment of myocardinal infarction in the past , because — due to the contribution of t - pa to the glutamate induced neurotoxicity — no justified hopes existed , that a plasminogen activator which is related to t - pa could reasonably be used for a treatment of acute stroke . surprisingly it has been shown that dspa has no neurotoxic effects even though it shows a high resemblance ( homology ) to t - pa and even though the physiological effects of the molecules are comparable to a large extent . the above conclusion led to the idea that dspa after all may be successfully used as a thrombolytic agent for the therapy of stroke without causing severe risks of neuronal tissue damage . especially interesting is the fact , that dspa can also be used later than 3 hours after the onset of stroke symptoms . a further teaching of the present invention that evolved from the above findings is the option to modify or produce further plasminogen activators in such a way that they reveal the essential characteristics of dspa , especially the lack of the neurotoxicity of t - pa . the basis for this is the investigated relationship between structure and biochemical effects , making if possible to transform neurotoxic plasminogen activators into non - neurotoxic plasminogen activators and thereby to produce non - neurotoxic plasminogen activators on the basis of known or newly discovered neurotoxic plasminogen activators . the new teaching is based on in vivo comparative examinations of the neurodegenerative effect of t - pa on one side and of dspa on the other side which are performed by using the so called kainic acid model and a model for the examination of nmda induced lesion of the striatum . the kainic acid model ( also kainic acid injury model ) is based on the stimulation of the neurotoxic glutamate cascade by the external application of kainic acid ( ka ) as an agonist of the glutamate receptor of the kainic acid type ( ka type ) and of the nmda and ampa glutamate receptors . using a t - pa deficient mouse stem as an experimental model it was possible to show that the sensitivity of the laboratory animals against kainic acid only reached the level of wild type mice after a supplementary application of external t - pa . in contrast , an infusion of an equimolar concentration of dspa under the same experimental conditions does not restore the sensitivity to kainic acid ( ka ). it was concluded that the neurotoxic effect of t - pa was not induced by dspa . a summary of these results is shown in table 2 . quantitative examinations based on this model revealed that even a 10 - fold increase of the dspa concentration could not restore the sensitivity of the t - pa deficient mice to the ka treatment whereas already a 10 - fold lower t - pa concentration led to ka induced tissue damages . this leads to the conclusion that dspa possesses an at least 100 fold lower neurotoxic potential as t - pa with respect to the stimulation of the neurodegeneration after ka treatment ( see also fig7 and 8 ). in the second model of neurodegeneration , the possible effects of t - pa as well as dspa on the stimulation of the nmda dependent neurodegeneration were compared to wild type mice . for this purpose , nmda ( as an agonist of the glutamate receptor of the nmda type ) was injected in wild type mice alone or in combination with either t - pa or dspa . this model allows the comparison of the effects of these proteases under conditions , which always lead to a neurodegeneration and to an influx of plasma proteins due to the break down of the blood brain barrier ( chen et al . 1999 ). while working on this model the injection of nmda led to reproducible lesions in the striatum of mice . the volume of lesions was increased by a combined injection of t - pa and nmda by at least 50 %. the co - injection with dspaα1 in contrast did not lead to an increase or extension of the lesions caused by nmda . even in the presence of plasma proteins which can freely diffuse in the region of the lesion induced by nmda , dspa did not result in an increase neurodegeneration ( see also table 3 ). these results show that fibrin - free dspa — in contrast to t - pa — behaves like an almost inert protease in the central nervous system of a mammal and also of a human — and therefore does not contribute to the neurotoxic effects caused by ka or nmda . despite of the prejudice against the therapeutic use of t - pa like proteins in stroke , this lacking neurotoxicity makes dspa a suitable thrombolytic agent for the treatment of acute stroke . first results of the clinical trials show the transferability of these results also for the treatment of stroke in humans . it was found that significant improvements can be achieved in patients after a successful perfusion ( improvement by 8 points nihss or nihss score 0 to 1 ). table 1 shows the data . the lacking neurotoxicity of dspa and of the other non - neurotoxic plasminogen activators ( see above ) offer the special advantage in stroke treatment that the use of these plasminogen activators — in contrast to the wild type t - pa — is not limited to a short maximum period of only 3 hours after the onset of stroke . in contrary , the treatment can be initiated later — for example after 8 hours or even later , since there is nearly no risk of stimulating excitotoxic responses . first clinical trials with dspa prove a safe treatment of patients even in a time range of over 6 to 9 hours after the onset of stroke symptoms . this option of a timely unlimited treatment with non - neurotoxic activators is of special importance , since it allows for the first time to treat patients with acute stroke symptoms safely even when diagnosis is delayed or the onset of the stroke cannot be determined with sufficient security . in the prior art , this group of patients was excluded from thrombolytic therapy with plasminogen activators due to unfavorable risk estimation . consequently , an essential contra - indication for the authorized use of a thrombolytic agent for stroke is eliminated . dspa as well as further non - neurotoxic plasminogen activators show no tissue damaging side effects . however , it can be advantageous to apply them in combination with a neuroprotective agent for the treatment of stroke in order to limit the tissue damages induced by the glutamate occurring naturally in the human body . neuroprotective agents inhibiting the glutamate receptor competitively or noncompetitively can be used . useful combinations are e . g . with the known inhibitors of the glutamate receptors of the nmda type , the kainic acid type or the quisqualate type , as for example apv , aph , phencyclidine , mk - 801 , dextrorphane or cetamine . further a combination with cations can be advantageous since cations , especially zn - ions , block the cation channel regulated by the glutamate receptor and can therefore reduce neurotoxic effects . in a further advantageous embodiment , non - neurotoxic plasminogen activators can be combined with at least one further therapeutic agent or with a pharmaceutically tolerable carrier . the combination with a therapeutic agent which supports the reduction of tissue damage by vitalizing the cells is especially advantageous , since it contributes to the regeneration of already damaged tissue or serves for the prevention of further stroke incidents . advantageous examples are combinations with antibiotics as quinones , anticoagulants as heparin or hirudin as well as with citicholine or acetylsalicylic acid . a combination with at least one thrombin inhibitor can also be advantageous . preferentially , thrombomodulin and thrombomodulin analogs like for example solulin , triabin or pallidipin can be used . further combinations with anti - inflammatory substances are advantageous , since they influence the infiltration by leucocytes . wild - type mice ( c57 / black 6 ) and t - pa deficient mice ( t - pa −/− mice ) ( c57 / black 6 ) ( carmeliet et al ., 1994 ) were supplied by dr . peter carmeliet , leuven , belgium . the assessment of proteolytic activity in brain tissue following infusion of either t - pa or dspaα1 was performed by zymographic analysis ( granelli - piperno and reich , 1974 ). after an infusion over a period of seven days into the hippocampus , mice were anaesthetised , then transcardially perfused with pbs and the brains removed . the hippocampus region was removed , transferred to eppendorf tubes and incubated in an equal volume ( w / v ) ( approx . 30 - 50 μm ) of 0 . 5 % np - 40 lysis buffer containing no protease inhibitors ( 0 . 5 % np40 , 10 mm tris - hcl ph 7 . 4 , 10 mm nacl , 3 mm mgci 2 , 1 mm edta ). the brain extracts were homogenized by means of a hand - held glass homogeniser and left on ice for 30 minutes . the samples were then centrifuged and the supernatant was removed . the amount of proteins present was determined ( bio - rad - reagent ). the proteolytic activity in the samples and the brain tissue extracts was determined by zymographic analysis according to the method of granelli , piperno and reich ( 1974 ). the samples with recombinant proteins ( up to 100 nm ) or the brain tissue extracts ( 20 μg ) were subjected to a ( 10 %) sds - page under non - reducing conditions . the gels were removed from the plates , washed in 1 % triton x 100 for 2 hours and then overlaid onto an agarose gel containing polymerized fibrinogen and plasminogen ( granelli , piperno and reich , 1974 ). the gels were incubated at 37 ° c . in a humified chamber until proteolysed zones appeared . 4 . intra - hippocampal infusion of t - pa , dspa and subsequent injection of kainic acid the kainic acid injury model was based on studies of tsirka et al . ( 1995 ). the animals were injected intraperitoneally ( i . p .) with atropine ( 4 mg / kg ) and then anaesthetised with an i . p . injection of sodium pentobarbitol ( 70 mg / kg ). afterwards mice were placed in a stereotaxic frame and a micro - osmotic pump ( alzet model 1007d , alzet calif . usa ) containing 100 μl of either pbs or recombinant human t - pa ( 0 . 12 mg / ml , 1 . 85 μm ) or dspaα . 1 ( 1 . 85 μm ) was implanted subcutaneously between the shoulder blades . the pumps were connected via sterile tubes to a brain cannula and inserted through a burr opening made through the skull at coordinates bregma − 2 . 5 mm , midiolateral 0 . 5 mm and dorsoventral 1 . 6 mm in order to introduce the liquid near the midline . the cannula was fixed at the desired position and the pumps were allowed to infuse the respective solutions at a rate of 0 . 5 μl per hour for a total of 7 days . two days after infusion of the proteases the mice were reanaesthetised and again placed in the stereotaxic frame . afterwards 1 . 5 nmol of kainic acid ( ka ) in 0 . 3 μl pbs was injected unilaterally into the hippocampus . the coordinates were : bregma − 2 . 5 mm , medial - lateral 1 . 7 mm and dorsoventral 1 . 6 mm . the excitotoxin ( ka ) was delivered for a duration of 30 seconds . after the kainic acid treatment the injection needle remained at these coordinates for further 2 minutes in order to prevent a reflux of the liquid . five days after ka injection , the animals were anaesthetised and transcardially perfused with 30 ml pbs followed by 70 ml of a 4 % paraformaldehyde solution , post fixed in the same fixative followed by incubation in 30 % sucrose for further 24 hours . coronal sections ( 40 μm ) of the brain were then cut on a freezing microtome and either counter - stained with thionin ( bdh , australia ) or processed for immunohistochemical examination as described below . the quantification of neuronal loss in the ca1 - ca3 hippocampal subfields was performed as previously described ( tsirka et al ., 1995 ; tsirka et al ., 1996 ). five consecutive parts of the dorsal hippocampus from all treatment groups were prepared taking care that the parts indeed comprised the place of the ca - injection and lesion area . the hippocampal subfields ( ca1 - ca3 ) of these sections were traced by means of camera lucida drawings of the hippocampus . the entire lengths of the subfields was measured by comparison to 1 mm standards traced under the same magnification . the lengths of tissue with viable pyramidal neurons ( having normal morphology ) and lengths of tissue devoid of neurons ( no cells present , no thionin staining ) was determined . the lengths , representing intact neurons and neuronal losses over each hippocampal subfield were averaged across sections and the standard deviations were determined . wild type mice ( c57 / black 6 ) were anaesthetised and placed in a stereotaxic frame ( see above ). mice then received an unilateral injection of 50 nmol nmda in the left stratum , injected alone or in combination with either 46 μm rt - pa or 46 μm dspaα1 . as controls t - pa and dspa were also injected alone ( both at a concentration of 46 μm ). the injection coordinates were : bregma − 0 . 4 mm , midiolateral 2 . 0 mm and dorsoventral 2 . 5 mm . the solutions ( 1 μl total volume for all treatments ) were transferred over a period of 5 minutes at a rate of 0 . 2 μl / min and the needle was left in place for further 2 minutes after the injection in order to minimize the reflux of fluid . after 24 hours the mice were anaesthetised and perfused transcardially with 30 ml pbs followed by 70 ml of a 4 % paraformaldehyde solution , post fixed in the same fixative for 24 hours with followed by incubation in 30 % sucrose for further 24 hours . brains were then cut ( 40 μm ) on a freezing microtome and mounted onto gelatin coated glass slides . the quantification of the striatal lesion volume was performed using the method described by callaway et al . ( 2000 ). ten consecutive coronal sections spanning the lesioned area were prepared . the lesioned area was visualised using the callaway method and the lesion volume was quantified by the use of a micro computer imaging device ( mciod , imaging research inc ., brock university , ontario , canada ). immunohistochemistry was performed using standard methodologies . coronal sections were immersed in a solution of 3 % h . sub . 2o . sub . 2 and 10 % methanol for 5 minutes followed by an incubation in 5 % normal goat serum for 60 minutes . the sections were incubated over night either with an anti - gfap antibody ( 1 : 1 . 000 ; dako , carpinteria , calif ., usa ) for the detection of astrocytes , with an anti - mac - 1 : antibody ( 1 : 1 . 000 : serotec . raleigh , n . c ., usa ) for the detection of microglia or with polyclonal anti - dspa antibodies ( schering ag , berlin ). after rinsing , the sections were incubated with the appropriate biotinylated secondary antibodies ( vector laboratories , burlingame , calif ., usa ). this was followed by a final incubation with avidin / biotin - complex ( vector laboratories , burlingame , calif ., usa ) for 60 minutes before visualisation with 3 , 3 ′- diaminebebcidine / 0 . 03 % h 2 o 2 . sections were then mounted on gelatin coated slides , dried , dehydrated and coverslipped with permount . 1 . infusion of t - pa or dspa disperses into the hippocampus of t - pa −/− mice and retains proteolytic activity the initial experiments were designed to confirm that both dspa and t - pa retain their proteolytic activity for the 7 day period of the infusion . to this end , aliquots of t - pa and dspa ( 100 nmol ) were incubated at 37 ° c . and at 30 ° c . for 7 days in a water bath . in order to determine the proteolytic activity , 5 fold serial dilutions of the probes were subjected to sps - page under non - reducing conditions and proteolytic activity was assessed by zymographic analyses . an aliquot of t - pa and dspa which had been kept frozen for a period of 7 days was used as a control . as can be seen in fig1 there was only a minor loss of dspa or t - pa activity at an incubation with either 30 ° c . or 37 ° c . over this period of time . 2 . t - pa and dspa activity is recovered in hippocampal extracts prepared from t - pa −/− mice following infusion first it had to be confirmed that the infused proteases were present in the brain of the infused animals and also retained their proteolytic activity while being in this compartment . to address this point , t - pa −/− were infused for seven days with either t - pa or dspa ( see above ). mice were then transcardially perfused with pbs and the brains removed . the ipsilateral and contralateral hippocampal regions were isolated as well as a region of the cerebellum ( taken as a negative control ). tissue samples ( 20 μg ) were subjected to sds - page and zymographic analysis according to the description in the methods section . as can be seen in fig2 , both t - pa and dspa activities were detected in the ipsilateral region of the hippocampus , while some activity was also detected on the contralateral side . this indicates that the infused proteases not only retained their activity in the brain but had also diffused within the hippocampal region . as a control , no activity could be detected in the extract prepared from the cerebellum . to further confirm that dspa had indeed diffused into the hippocampal region , coronal brain sections of t - pa −/− mice were analysed immunohistochemically after dspa infusion . dspa - antigen was detected in the hippocampal region with the most prominent staining in the area of the infusion site . this result confirms that the infused idpa is soluble and is indeed present in the hippocampus . 4 . dspa infusion does not restore kainic - acid mediated neurodegeneration in vivo t - pa −/− mice are characteristically resistant to kainic acid ( ka ) mediated neurodegeneration . however , intrahippocampal infusion of rt - pa completely restores the sensitivity to ka - mediated injury . to determine whether dspa could be substituted for t - pa in this model , t - pa −/− mice were infused intrahipocampically with either t - pa or dspa using a mini - osmotic pump . for both groups 12 mice were tested . 2 days later the animals were injected with kainic acid and left to recover . 5 days later the animals were killed and the brains removed and prepared ( see above ). as controls , t - pa −/− mice were also infused with pbs prior to ka treatment ( n = 3 ). coronal brain sections were prepared and the neurons detected by nissi staining as shown in fig4 , t - pa −/− mice infused with pbs were resistant to subsequent challenge with ka . however , infusion of recombinant t - pa restored sensitivity to ka treatment . in contrast , infusion of the same concentration of dspa into the hippocampal region did not alter the sensitivity of the animals to ka . a quantitation of those results was based on data obtained from 12 mice in each group . in 2 of the 12 mice infused with dspa a small extend of neurodegeneration was observed . the reason for that in unclear and possibly not related to the presence of dspa . the combined data consider this minor effect that was observed in the case of these 2 animals . all 12 mice treated with t - pa were sensitive against the ka treatment . these results show that in case of an infusion of tpa or dspaα1 in equimolar concentrations only the administering of t - pa led to the restoration of sensitivity to ka induced neurodegeneration . the restauration of the ka sensitivity of the t - pa −/− mice caused by a t - pa infusion also results in a microglia activation ( rogove et al ., 1999 ). to assess the degree of microglial activation following t - pa or dspa infusion and subsequent ka treatment , coronal sections of mice were subjected to an immunohistochemical staining for activated microglia cells using the mac - 1 antibody . the resaturation of ka sensitivity following t - pa infusion resulted in a clear increase in mac - 1 positive cells . this was not observed in mice infused with dspa . hence , the presence of dspa does not result in the activation of microglia cells following ka treatment 6 . titration of dspa and t - pa in the mice hippocampus region . the concentration of t - pa used for the infusion was based on the concentration described by tsirka et al . ( 1995 ) ( 100 μl of 0 . 12 mg / ml [ 1 . 85 μm ]). the ka - injury experiments were repeated using a 10 - fold lower of t - pa ( 0 . 185 μm ) and a 10 - fold higher amount of dspa ( 18 . 5 μm ). the lower t - pa concentration was still able to restore the sensitivity to ka treatment ( n = 3 ). of special interest was the finding that the infusion of 10 fold increased dspa concentration only caused a little neuronal loss following ka treatment . these data strongly point out that dspa does not lead to an increase of sensitivity to ka . 7 . effect of t - pa and dspa on nmda - dependent neurodegeneration in wild type mice the effects of t - pa and dspa were also examined in a model of neurodegeneration in wild type mice . the injection of t - pa in the striatum of these mice provably led to an increase of the neurodegenerative effects caused by the glutamate analogue nmda ( nicole et al ., 2001 ). nmda was injected into the striatal region of wild type mice in the presence of t - pa or dspa ( each 46 μm ) with a total volume of 1 μl . after 24 hours the brains were removed and the size of the lesions was quantified according to the callaway method ( callaway et al ., 2000 ) ( see above ). as can be seen in fig4 , injection of nmda alone caused a reproducible lesion in all treated mice ( n = 4 ). when t - pa and nmda were applied together , the size of the lesions was increased about 50 % ( p & lt ; 0 . 01 , n = 4 ): in a clear contrast the co - injection of nmda and the same concentration of dspa did not lead to an increase in lesion size compared to nmda alone . injection of t - pa or dspa alone did not lead to a detectable neurodegeneration . the lacking effect of t - pa when being administered alone is consistent with the results of nicole et al . ( 2001 ). these data show that the presence of dspa does not increase neurodegeneration even during a neurodegenerative event . in order to confirm that the injection of dspa had indeed spread into the hippocampal region , immunohistochemistry was performed on coronal sections by use of the dspa antibody . the examination showed that dspa did indeed enter the striatal region . indirect chromogen tests of the t - pa activity were performed using the substrate lys - plasminogen ( american diagnostica ) and spectrocyme pl ( american diagnostics ) according to madisan e . l ., goldsmith e . j ., gerard r . d ., gething m .- j ., sambrook j . f . ( 1989 ) nature 339 721 - 724 ; madison e . l o ., goldsmith e . j ., gething m . j ., sambrook j . f . and bassel - duby r . s . ( 1990 ) proc . natl . acad . sci . u . s . a 87 , 3530 - 3533 as well as madison e . l ., goldsmith e . j ., gething m . j ., sambrook j . f . and gerard r . d . ( 1990 ) j . biol . chem . 265 , 21423 - 21426 . tests were performed both in the presence and absence of the co - factor desafib ( american diagnostica ), desafib is a preparation of soluble fibrin monomeres gained by the cleavage of highly pure human fibrinogen with the protease batroxobin . batroxobin cleaves the arg 15 - gly . 17 - binding in the a . α .- chain of fibrinogen and thereby releases fibrinopeptid a . the resulting des - aa - fibrinogen representing fibrin i monomers is soluble in the absence of the peptide gly - pro - arg - pro . the concentration of lys - plasminogen was varied from 0 . 0125 up to 0 . 2 μm in the presence of desafib and from 0 . 9 to 16 μm in absence of the co - factor . indirect chromogen standard tests were performed according to the publications cited above . probes of 100 μl total volume containing 0 . 25 - 1 ng enzyme , 0 . 2 μm lys - plasminogen and 0 . 62 mm spectrocyme pl were used . the tests were performed either in the presence of buffer , 25 μg / ml desafib , 100 μg / ml cyanogen bromide fragments of fibrinogen ( american diagnostica ) or 100 μg / ml of the stimulatory 13 amino acid peptide p368 . the analysis were performed in microtiter - plates and the optic density was determined at a wave length of 405 nm every 30 seconds for 1 hour in a “ molecular devices thermomax ”. the reaction temperature was 37 ° c .	2
fig1 shows the circuit diagram of a magnetic resonance antenna device 1 according to the invention . it has an amplifier 2 to amplify the transmission signals to be emitted by a magnetic resonance antenna 3 . a circulator 4 according to the invention and that has three terminals i , ii and iii is connected between the amplifier 2 and the magnetic resonance antenna 3 . if the correct operating field is present at the ferrite structure of the circulator 4 ( not shown in detail here ), signals are relayed from the terminal i to the terminal ii , from the terminal ii to the terminal iii and from the terminal iii to the terminal i , as indicated by the arrow . in this way power reflected from the magnetic resonance antenna 3 is essentially entirely fed via the terminal iii to a power dump 5 , thus a reflection - free terminator . the amplifier 2 therefore does not need to be over - dimensioned . the circulator 4 should be suitable to be operated in the external magnetic field of a magnetic resonance apparatus , so an optimally wide selection of positioning possibilities should be available . various embodiments of the circulator 4 are presented with reference to fig2 through 4 . fig2 shows a first embodiment of a circulator 4 a in cross section . it comprises a ferrite structure 6 that is covered on both sides by iron plates 7 that serve as homogenization elements and generate between them a homogeneous magnetic field aligned perpendicular to the ferrite structure 6 . due to the cross section view , only the terminals i and ii are visible . the circulator 4 a is arranged in an external magnetic field that in this case is too weak to serve as an operating field for the ferrite structure 6 . therefore a field conductor device is provided that has a field conductor element 8 tapering conically toward the ferrite structure 6 . this causes the field lines to be compressed toward the ferrite structure 6 ( as shown by the arrows representing the field curve ) so that a stronger field exists there that can serve as an operating field for the ferrite structure 6 . the field is relayed outward again by means of an additional field conductor element 9 that is arranged on the side opposite the field conductor element 8 . a non - magnetic housing 10 is provided to stabilize the circulator 4 a . with a simple design it is accordingly possible to shape the external magnetic field so that it can be used as an operating field for the ferrite structure 6 . moreover , it is noted that the circulator 4 a can also be slightly angled relative to the external field since — due to the limit conditions — the field lines always enter into the field conductor element 8 perpendicularly , such that the angle is corrected again . given varying orientations of the external field , a displacement device can also be provided by means of which the circulator 4 a can be pivoted . this is not shown in detail here . the field conductor elements 8 and 9 are composed of a material with optimally high magnetic permeability in order to conduct the field as optimally as possible . a second embodiment of the present invention is shown in fig3 . components of the circulator 4 b that coincide with those of the first exemplary embodiment are designated with the same reference characters . a ferrite structure 6 is again provided that , in this case however , is not enclosed by iron plates , although this would also be possible here . the circulator 4 b comprises an electromagnet 11 that is geometrically dimensioned so that it can be placed precisely on the ferrite structure 6 with its central passage opening . an optimally direct connection of the ferrite structure 6 to a core 12 of the electromagnet 11 can be realized in this way . the core 12 is extended so that it is in contact with the shield housing 13 that completely surrounds the arrangement . the shield housing 13 is part of the field conductor device and also it serves as a yoke to close the field lines of the field generated by the electromagnet 11 . when completely closed , this magnetic circuit is by a cooling element 14 arranged on the opposite side of the ferrite structure 6 in relation to the electromagnet 11 , which cooling element 14 is designed so that it also serves as a field conductor element . as mentioned , the shield housing 13 is part of the field conductor device . a good portion of the field lines of the external field are conducted by this around the inside of the shield housing 13 , as is again indicated by the arrows . another portion of the field lines of the external field traverse the inside of the shield housing 13 across the core 12 , the ferrite structure 6 and the cooling element 14 . the field conductor device ( comprising the shield housing 13 , the core 12 and the cooling element 14 ) is now designed so that the external magnetic field is attenuated such that it can essentially serve as an operating field for the ferrite structure 6 . in order to generate an optimal operating field , the electromagnet 11 is correspondingly fed with current . the cooling element 14 belongs to a cooling device 15 fashioned as a water cooler that is provided in order to counteract the heat development due to the electromagnet 11 . water supplied via the feed and discharge line 16 is conducted through channels provided inside the cooling element 14 . the activation of the cooling device 15 ensues by means of a control device 17 via which the electromagnet 11 and a displacement device ( indicated at 18 only for clarity ) with whose help the circulator 4 b can be tilted are also activated . according to everything stated in the preceding , given a fixed current feed to the electromagnet 11 the magnetic field present in the ferrite structure 6 is dependent on the strength and possibly orientation of the external magnetic field . however , at the same time it applies that the optimal operating field is dependent on the temperature of the ferrite structure 6 . however , the circulator 4 b is fashioned to react dynamically to such variations of the operating conditions and thus to achieve an optimal operating field ( and thus an optimal functionality ) of the circulator at any time . for this purpose , the circulator 4 b comprises a magnetic field sensor 19 arranged in the shield housing 13 in the form of a hall probe with which the external magnetic field can be measured . furthermore , a temperature sensor 20 is provided between the core 12 and the ferrite structure 6 , thus directly adjoining the ferrite structure 6 . both the magnetic field sensor 19 and the temperature sensor 20 deliver their measurement data to the control device 17 where , using the data about the external magnetic field , it is checked whether the optimal operating field required based on the temperature measurement data is still maintained given the current operating conditions . if that is not the case , the control device is fashioned to activate the electromagnet 11 and the displacement device 18 so that an optimal operating field is again present in the ferrite structure 6 . not shown in detail in fig3 is an additional possibility to adjust the magnetic field in the ferrite structure 6 that can also be used in the first exemplary embodiment . an adjustable air gap can thus be provided in the magnetic circuit or , respectively , on the path of the field lines of the external field . for example , it would be conceivable to detach the upper part of the core 12 and to direct it through the shield housing 13 so that its distance from the lower part of the core 12 can be varied . an adjustment device that can also be controlled by the control device 17 can be provided for this . an additional degree of freedom for the adjustment of the field results in this way since scatter field losses occur due to the air gap . this means that the greater the air gap , the smaller the field at the ferrite structure 6 . the control device 17 does not have to be arranged outside of the circulator 4 b , as shown here ; rather , it can naturally also be advantageously integrated into this . the positions of the sensors can also be selected differently . fig4 shows a third exemplary embodiment of a circulator 4 c according to the invention , wherein here the activation electronics and the magnetic field are not shown for clarity . a ferrite structure 6 is arranged between two iron plates 7 as homogenization elements . respectively arranged on opposite sides of the ferrite structure 6 is an electromagnet 11 a , 11 b , wherein the electromagnets 11 a and 11 b are coils of identical design . the magnetic circuit is closed by a yoke 21 . a temperature sensor 20 and a magnetic field sensor 19 are also provided in turn in this case . naturally , a shield housing can also additionally be provided at the circulator 4 c so that ultimately less field penetrates inside and the operating field is essentially determined by the electromagnets 11 a and 11 b . other field conductor elements can also be used . additionally , it is also reasonable here to provide a cooling device 15 ( which is only indicated in fig4 , however ). additional adjustment possibilities can also be realized in the circulator 4 c . for example , the yoke 21 can be adjusted in terms of its height so that an air gap can be formed in the magnetic circuit . a displacement device to tilt the circulator 4 c can also be associated with said circulator 4 c , or this can possess such a displacement device . the electromagnets 11 , 11 a and 11 b each can be fashioned as coils . if the circulator 4 is provided for use in a magnetic resonance apparatus , for the most part fields in the range of multiple tens or multiple hundreds of mt are used . for comparison : the optimal operating field of a ferrite structure 6 can be approximately 47 mt at 30 ° c ., for example , approximately 40 mt at 70 ° c . for an operation under such conditions the coils can exhibit inductances of 80 to 120 mh , for example . fig5 shows a magnetic resonance apparatus 22 according to the invention that has a magnetic resonance antenna device 1 according to the present invention . although modifications and changes may be suggested by those skilled in the art , it is the intention of the inventors to embody within the patent warranted heron all changes and modifications as reasonably and properly come within the scope of their contribution to the art .	6
description is now made of one embodiment of the present invention . the present embodiment is applied to a surface wave resonator utilizing a bgs wave shown in fig2 . in the resonator 4 shown in fig2 the direction of polarization p is extended in the direction parallel to the electrode fingers 2a and 3a of the comb electrodes 2 and 3 , as described above . consequently , if the ac electric field is applied between the comb electrodes 2 and 3 , the surface wave having only a shear wave component , that is , the bgs wave is generated . a surface wave resonator 4 to which the present embodiment is applied is structurally the same as that shown in fig2 . for description , however , its cross - sectional structure is schematically shown in fig1 . respective electrode fingers 2a and 3a of comb electrodes 2 and 3 are so adapted as to have a width of λ / 4 when λ is taken as the wavelength of a surface wave , through they have a width of λ / 8 in the vicinities of free end surfaces 1a and 1b . in addition , the piezoelectric resonator 4 may be so designed that the width ( the distance between the end surfaces 1a and 1b ) of a piezoelectric substrate 1 is an integral multiple of λ / 2 . when the above described surface wave resonator 4 is designed using a given piezoelectric material , however , ripples and an unnecessary spurious mode appear on impedance - frequency characteristics after completion thereof even if the precision of the free end surfaces 1a and 1b is increased . the inventors of the present application have paid attention to the above described elastic stiffness constants c 33 d and c 44 e of the piezoelectric material , to fabricate various surface wave resonators 4 which differ in the ratio c 33 d / c 44 e and measure their characteristics . the results show clearly that impedance - frequency characteristics on which ripples and an unnecessary spurious mode hardly occur in the vicinity of the antiresonance frequency and between the resonance and antiresonance frequencies are achieved when c 33 d / c 44 e is 5 . 9 . fig5 shows characteristics measured using as the piezoelectric material one having composition of pb ( sn 1 / 2 sb 1 / 2 ) o 3 - pbtio 3 - pbzro 3 and containing 46 mol % of zr and 2 . 5 mol % of sn and sb . fig3 shows characteristics in the conventional example using as a material whose ratio of c 33 d to c 44 e is 3 . 4 one having the same composition as described above and containing 69 mol % of zr and 2 . 5 mol % of sn and sb . furthermore , when frequency characteristics of surface wave resonators which are made different in the ratio c 33 d / c 44 e are measured , the results shown in the following table 1 are obtained . table 1______________________________________c . sub . 33 . sup . d / c . sub . 44 . sup . e frequency characteristics______________________________________5 . 9 ◯ 5 . 2 ◯ 4 . 0 x3 . 1 x3 . 2 x3 . 6 x4 . 2 ◯ ______________________________________ in table 1 , a mark of × is put when ripples and an unnecessary spurious mode occur on the frequency characteristics and a mark of ◯ is put when ripples and an unnecessary spurious mode hardly occur on the frequency characteristics , to indicate whether or not the frequency characteristics are good . as can be seen from the results of the table 1 , if a piezoelectric material whose ratio of c 33 d to c 44 e is more than 4 is used , a bgs wave in which ripples and unnecessary response hardly occur is excited . consequently , if a surface wave resonator having a structure shown in fig1 and 2 is constructed using such a piezoelectric material , it is possible to realize a resonator utilizing a bgs wave which is small in size and has good frequency characteristics . examples of the piezoelectric material used for constructing the above described surface wave resonator according to the embodiment include piezoelectric ceramics having various compositions . a surface wave device to which the present invention is also applied is not limited to the above described surface wave resonator . that is , the present invention is applicable to filter devices such as a transversal filter and a double - mode filter . for example , as shown in fig6 a , a double - mode filter 30 using grating reflectors is so adapted that grating reflectors 33 and 34 are provided in side parts of an interdigital transducer portion 32 for constituting a filter . it is needless to say that the present invention can be also applied to such a filter 30 to remove a spurious mode . furthermore , as shown in fig6 b , if not reflectors but the same end surface reflectors as those shown in fig1 are utilized , it is possible to rapidly decrease the length of a piezoelectric substrate 41 in the direction of the surface wave propagation . although the present invention has been described and illustrated in detail , it is clearly understood that the same is by way of illustration and example only and is not to be taken by way of limitation , the spirit and scope of the present invention being limited only by the terms of the appended claims .	7
it should be understood that the description of this preferred embodiment is merely illustrative and that it should not be taken in a limiting sense . in the following detailed description , several specific details are set forth in order to provide a thorough understanding of the present invention . it will be obvious , however , to one skilled in the art that the present invention may be practiced without these specific details . with reference to fig3 through fig8 one preferred embodiment of a inductive - coupled plasma apparatus according to the invention is described . a characteristic etching pattern shown in fig3 and fig4 indicates the fact that the etched portions of the surface of the dielectric window coincide with a configuration of the spiral coil . to explain the above mentioned fact in detail according to fig4 portions indicated by numerals 1 , 3 , 4 and 6 are etched portions and portions indicated by numerals 2 and 5 are portions deposited with particles . according to the etched pattern , the etched portions are all disposed underneath the coil . the high potentials on the coil cause some degree of capacitive coupling , particularly in the vertical direction of the coil ( or in an orthogonal direction between the coil and the dielectric window ). this capacitive coupling collects ions , which results in etching at the particular regions of the dielectric window disposed underneath the coil . therefore , some particular regions of the dielectric window disposed underneath the coil are etched more excessively than other regions . therefore , the shield of a preferred embodiment of the present invention as illustrated in fig6 includes two regions . the first regions indicated by 62 - 1 , 62 - 2 , 62 - 3 and 62 - 4 corresponding to the coil are not opened and the second regions 64 - 1 , 64 - 2 , 64 - 3 and 64 - 4 corresponding to areas disposed between the turns of coil are open . the first regions 62 - 1 , 62 - 2 , 62 - 3 and 62 - 4 are disposed underneath the coil and are added between the coil and the dielectric window to protect the surface of the dielectric window against capacitive coupling in the vertical direction . the second regions 64 - 1 , 64 - 2 , 64 - 3 and 64 - 4 are disposed at locations corresponding to areas between the turns of the coil and are arcuate - split or concentric split shaped . in the present invention , the shield is manufactured by the following steps according to fig5 . at first step s 500 , the etching process is carried out using the plasma , and in the next step s 510 , a characteristic pattern of etched portions on the surface of the dielectric window is examined . in the next step s 520 , first portions of the dielectric window that are etched and second portions that are deposited are designated , and in the next step s 530 , the shield having a first portion corresponding to the first portions of the dielectric window and a second portion to be opened corresponding to the second portions of the dielectric window is manufactured . and in final step s 540 , the shield is disposed so that the second portion is disposed at locations corresponding to areas between the coils . however , it is to be understood that the shape of the slits of the shield according to the present invention is not limited to the disclosed preferred embodiments . on the contrary , it is intended to cover various modifications and similar arrangements . with reference to fig7 - 9 , shields of preferred embodiments of the present invention are described . shield 60 of a preferred embodiment of the present invention is added between the coil 44 and the dielectric window 42 shown in fig8 . the coil 44 is supplied with power by rf power supply source 48 . a coil holder 46 holds the coil 44 . the shield 60 is fixed to at least one shield holder 70 . the shield holder 70 includes a slit 72 to contain an extending portion 66 of the shield 60 and a screw hole 74 for coupling a screw 76 . in a preferred embodiment of the present invention , as most clearly seen in fig7 a central portion 51 of coil 44 is open . a first portion 50 , 52 of the coil 44 is disposed corresponding to a first cover portion 62 - 1 of the shield 60 , a second portion 54 is disposed corresponding to a second cover portion 62 - 2 of the shield 60 , a third portion 56 of the coil 44 is located corresponding to a third cover portion 62 - 3 and a fourth portion 58 of the coil 44 is located corresponding to a fourth cover portion 62 - 4 . as described above , portions of the shield 60 corresponding to locations underneath the coil are portions having no hole or slit , but portions of the shield corresponding to locations underneath gaps between the turns of coils are portions that are opened , or for example having slits or holes . portions having no hole protect the dielectric window against capacitive coupling . thus , particular portions of the dielectric window corresponding to locations underneath the coil are not excessively etched . referring to fig8 an inductive - coupled plasma apparatus including a shield having multiple slits is illustrated . the shield 60 is added between the coil 44 supported by the coil holder 46 and the dielectric window 42 . the shield 60 is supported by the shield holder 70 . in the slit 72 of the shield holder 70 , the extending portion 66 of the shield 60 is inserted . a shield according to another preferred embodiment of the present invention is illustrated in fig9 . the apparatus shown in fig9 includes a helical coil 86 , a shield 84 disposed concentrically within the coil 86 , and an internal tube 82 of a low loss dielectric insulating material , e . g ., of quartz . a lower end of the coil 86 is electrically connected to the shield 84 by a screw 90 . the shield 84 can be mounted on the internal tube 82 or coupled to the inner wall of a process chamber by a coupling mechanism . the coupling mechanism includes a support member 110 and an extending member 100 of the shield 84 . the support member 110 may be coupled to an extending member 100 with a screw 120 . the support member 110 can be connected with the process chamber . the shield 84 is provided with a number of helically extending and circumferentially spaced slits 88 . the shape of the slits 88 correspond to the shape of the helical coil 86 . in the present invention , the shield may be made of an aluminum metal , or a copper metal which has a good conductive property . also , the surface of the shield can be coated with a silver , which increases conductivity and prevents corrosion . in a preferred embodiment of the present invention , the thickness of the shield may preferrably be between 0 . 5 mm and 2 . 0 mm . according to a shield of the present invention , it is possible to prevent etching on the surface of the dielectric window at locations corresponding to areas underneath coils . this prevention reduces contamination of the semiconductor wafer and improves the yield of the semiconductor process . further , it is possible to prolong the average span of the dielectric window , which results in production cost savings . the invention has been described using exemplary embodiments . however , it is to be understood that the scope of the invention is not limited to the disclosed preferred embodiments . on the contrary , it is intended to cover various modifications and similar arrangements . such modifications are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims .	7
referring to fig1 a driven plate 1 , an input member of the clutch disc , is connected by means of a plurality of damper springs 4 to a flange 3 of a hub 2 , an output member , in a well - known way . the driven plate 1 has a number of ( e . g ., 4 ) radially outwardly protruding projections 5 integrally formed therewith . each projection 5 extends relatively long in the circumferential direction of the clutch disc . a pair of ceramic metal friction members 6 are fixed by means of rivets 10 - 13 to both sides of each projection 5 in such manner as will be hereinafter described . the configuration of each friction member 6 is substantially same as that of the projection 5 , and in the embodiment illustrated the projection 5 protrudes at circumferentially opposite ends thereof slightly beyond the friction members 6 . in fig2 each friction member 6 at the flywheel or input side ( at the righthand side in fig2 ) is mounted to the projection 5 through a core plate 20 . the core plate 20 is a flat plate having generally same dimensions and shape as the friction member 6 . the friction member 6 is securely fixed to the core plate 20 over its entire surface through adhesive bonding or otherwise . the opposite side of the core plate 20 relative to the friction member 6 is held in close contact with the projection 5 over its entire area , being fixed by rivets 12 , 13 to the projection 5 . each friction member 6 at the opposite side ( i . e ., at the pressure plate side ) is fixed to the corresponding projection 5 through two cushioning plates 21 and one core plate 22 which are disposed between the friction member 6 and the projection 5 . the core plate 22 is a flat plate having same dimensions and shape as the above mentioned core plate 20 , and the friction member 6 is securely fixed to one side of the core plate 22 over its entire area through adhesive bonding or otherwise . the two cushioning plates 21 are arranged in the circumferential direction , being positioned between the core plate 22 and the projection 5 . the cushioning plates 21 are generally similar in size and shape to the core plate 22 , but as can be seen from fig2 they are bent or curved in their circumferential section and fixed to the projection 5 and core plate 22 , as will be hereinafter described , so as to be ready for being axially compressed . in fig2 the direction of arrow a represents the direction of rotation of the clutch disc and numeral 25 designates the front end portion of each cushioning plate 21 in the direction of rotation a , the rear end portion of the cushioning plate 21 being designated by numeral 26 . in the non - compressed condition ( disconnected clutch condition ) as shown , the front end portion 25 is in contact with the surface of the projection 5 so that it is away from the core plate 22 . the rear end portion 26 is in contact with the core plate 22 , being thus away from the projection 5 . a crest portion 27 adjacent the front end of the cushioning plate 21 is fixed by rivets 10 , 11 as it is held in close contact with the core plate 22 , while a bottom portion 28 adjacent the rear end of the cushioning plate 21 is fixed to the projection 5 by rivets 12 , 13 . in order to fix the rivets 10 - 13 in position as above noted , the projection 5 , core plates 20 , 22 and cushioning plates 21 are provided with holes for rivet insertion or rivet mounting , and the friction members 6 are also provided with holes 30 opening through their surface . in addition to these holes 30 , each friction member 6 is provided with notches 31 - 34 as shown in fig1 which are open through its friction surface . in fig1 if the friction member 6 is segmented into five radially extending sections a - e ( i . e ., sections extending in the circumferential direction of the clutch disc ), the rivets 10 and 12 are arranged in alternate intervals in circumferentially spaced relation in section b adjacent the outer periphery . the rivets 11 and 13 are arranged in alternate intervals in circumferentially spaced relation in section d adjacent the inner periphery . notches 31 are provided at three locations in circumferentially spaced relation in the outermost section a . notches 32 are provided at three locations in circumferentially spaced relation in the innermost section e . notches 33 are provided at circumferentially opposite end portions of the friction member 6 in section c , a radially median section . notches 34 are provided at three locations in circumferentially spaced relation in the median section c . in the embodiment illustrated , notches 31 - 33 are generally semi - circular notches opening through edge portions of the friction member 6 , and notches 34 are circular notches ( or holes ) opening through the surface of the friction member 6 . it is understood , however , that these notches may be varied in configuration in various ways ; for example , notches 34 may be configured to be radially ellipsoidal . the notches 31 , 32 , and 34 are arranged at circumferentially staggered positions relative to the rivets 10 - 13 , but their positions may be varied . the provision of notches 31 - 34 as above described means that either holes 30 or notches 31 - 34 are arranged in scattered condition on the friction surface of each friction member 6 in sections a - e , with the result that the effective friction area of the friction member 6 in each of the sections a - e can be generally equalized . therefore , in each clutch engagement operation , the operating conditions ( such as transmission torque , force of pressure contact , and slide condition ) in the area of pressure contact between the flywheel and the pressure plate on one hand and the friction members 6 on the other hand are generally equalized , the surface of pressure contact being thus prevented from being subjected to local wear . according to the arrangement of the invention as above described , rivets 10 - 13 are accommodated within holes 30 opening through the surface of each friction member 6 to thereby eliminate the need for the cushioning plates 21 projecting circumferentially relative to the friction member 6 . thus , the cushioning plates 21 can be compacturized and reduced in weight , and further the effective pressure contact area of the friction member 6 can be increased . furthermore , in the embodiment shown wherein friction contact areas of various radial portions of the friction member 6 are generally equalized , such inconvenience that friction contact surfaces of the friction member 6 , flywheel , and pressure plate are noticeably subject to radially local wear can be eliminated .	5
turning more particularly to the drawings , fig1 shows a flexible football cradle support belt 2 designed to be worn around the waist of a football player being trained to carry a football in a desired manner , said belt having first 3 and second 4 ends and first 3 a and second 4 a fasteners , said fasteners being designed to fasten said belt around said player &# 39 ; s waist . fig1 . further shows said belt 2 supporting a cradle support 6 , said cradle support attached to a football support cradle 5 , said support cradle supporting a standard , regulation american football 1 , having two tapered ends and a central ball section progressively enlarged between the two ends . fig1 further shows said football 1 inserted into said football support cradle 5 , said cradle having two football support straps , the first said support strap having front 7 and rear 8 sections and the second said support strap having front 9 and rear 10 sections , first said front 7 and rear 8 sections attached to said cradle support 6 to form a first loop , second said front 9 and rear 10 sections attached to said cradle support 6 to form a second loop , said first and second loops securely supporting said football 1 . fig1 further shows front 11 and rear 12 connecting straps having first and second ends , said first end of front connecting strap 11 attached to said first front support strap section 7 , said second end of front connecting strap 11 attached to said second front support strap section 9 , said first end of rear connecting strap 12 attached to said first rear support strap section 8 , said second end of rear connecting strap 12 attached to said second rear support strap section 10 . said football support cradle allows said football to be raised to the level of the abdomen of the player , but does not allow said football to be raised above the level of the abdomen of the player . fig2 shows a football player 13 , said support belt 2 encircling waist of said player , said football 1 , said first 7 and second 9 football support straps , said front 11 and rear 12 connecting straps , a first 14 and second arm 15 of said player holding said football 1 and said football cradle at the level of the player &# 39 ; s abdomen , said first arm 14 beneath said football and said second arm 15 above said football , said first and second arms and player &# 39 ; s hands holding said football in a secure pocket . fig3 shows a standard , regulation american football 1 , a flexible flap 17 having front and rear surfaces , said football 1 attached to the front surface of said flap 17 by a non - removable attachment 21 , said flap supported by a waist belt 16 having front and rear surfaces and first 19 and second 20 ends , having first 19 a and second 20 a fasteners , said flap 17 attached to rear surface of said belt by non - removable attachment 18 . the fasteners 3 a and 4 a preferably have complementary hook and loop elements . fasteners 19 a and 20 a preferably have complementary hook and loop elements . the first fasteners 3 a , 19 a may have loop type fastening elements and the second fasteners 4 a , 20 a may have complementary hook type fastening elements . it is also understood that the first fasteners 3 a . 19 a may have hook type fastening elements and the second fasteners 4 a , 20 a may have complementary loop type fastening elements . the fasteners 3 a and 4 a , and 19 a and 20 a , may have conventional buckle fastener or snap latch design , or other secure conventional fastener design . the belt 2 , 16 preferably is made of a strong , flexible synthetic polymer fabric , but may be made of leather or other strong , flexible material . the cradle support 6 preferably is made of a strong , flexible synthetic polymer fabric , but may be made of leather or other strong , flexible material . the cradle support 6 preferably has front and rear portions forming a loop adapted to insertion of the belt 2 , providing removable attachment of the belt 2 to the cradle support 6 . the cradle support 6 may optionally be non - removably attached to the belt 2 , by conventional attachment means including stitching , adhesive or other attachment means . the front and rear football support strap sections 7 , 8 , 9 , 10 preferably are made of strong , elastic , flexible polymer material , but may be made of any strong , flexible material . the first support strap sections 7 , 8 preferably are made of a single , continuous , elastic , flexible material ; optionally , said first front support strap section 7 is attached by any conventional means to said first rear support strap section 8 , including stitching , adhesive or other attachment means . the second support strap sections 9 , 10 preferably are made of a single , continuous , elastic , flexible material ; optionally , said second front support strap section 9 is attached by any conventional means to said second rear support strap section 10 , including stitching , adhesive or other attachment means . the first 7 and second 9 front support strap sections preferably are connected by connecting strap 11 ; optionally said support strap sections are not connected . the first 8 and second 12 rear support strap sections preferably are connected by connecting strap 12 ; optionally said support strap sections are not connected . said connecting straps are attached to said support strap sections by stitching , flexible adhesive or other conventional attachment means . the football 1 may be a standard , regulation american football , or another football having a size , shape , material or other feature adapted to an individual player , including a smaller football adapted for use by a younger player . the material of the football is preferably leather , but may be plastic or plastic foam for the training of smaller or younger players . the loops formed by the football support straps preferably have circumferences approximating the circumference of the football chosen for use for training in carrying the football , at a point midway between the enlarged midsection of the football and the pointed ends of the football . in the most preferred embodiment of the invention , the football support straps are made of elastic , flexible polymer material and the circumferences of the loops formed by the football support straps are slightly smaller than the circumference of the football chosen for use , at a point midway between the enlarged midsection of the football and the pointed ends of the football , and the elastic loops can be stretched to insert the football , providing very secure support for the football . the flap 17 is preferably of any strong and flexible fabric , most preferably of polyester or polyamide synthetic fabric , but may be of any leather , synthetic or natural fabric or flexible film . the football attachment 21 may be of any strong and flexible adhesive . the flap attachment 18 may be any conventional attachment means , preferably stitching , any strong and flexible adhesive or a combination of stitching and any strong and flexible adhesive . in use of the preferred device , the football player inserts the football 1 into the cradle support loops and initiates the ball - carrying exercise by grasping the football 1 and pulling the football and cradle upwards towards his chest , resulting in the football 1 being positioned in a horizontal orientation at his abdomen . the player then supports the football 1 , as specified by the coach or trainer , and runs towards an opposing player or line of players . in use of the second embodiment of the device , the football player initiates the ball - carrying exercise by grasping the football 1 and pulling the football and flap upwards towards his chest , resulting in the football 1 being positioned in a horizontal orientation at his abdomen . the player then supports the football 1 , as specified by the coach or trainer , and runs towards an opposing player or line of players . typically , the player forms a protective pocket by placing the first forearm against his lower abdomen , under the horizontally oriented football 1 and the second forearm against his upper abdomen , above the horizontally oriented football 1 , and holds one end of the football 1 with each hand . the device of the invention encourages the desired holding and carrying of the football 1 , and the desired stance and posture of the player . the location of the belt 2 , 16 at the waist of the player , and the location of the attached football 1 in the cradle encourage the player to crouch to reach the football 1 , and also limit the distance of the football 1 above the waist to the level of the abdomen , when the football 1 is carried . the player is thus encouraged to assume and maintain a desired crouching stance , resulting in a lowered center of gravity , greater stability and reduced vulnerability to being tackled , slowed or stopped by opposing players . the location and horizontal orientation of the football 1 also encourages the desired formation and maintenance of a protective pocket for the football 1 by the player &# 39 ; s arms and hands , and by the crouched posture , resulting in a reduced likelihood that opposing players can dislodge the football 1 or disrupt the player &# 39 ; s control of the football 1 . the location and horizontal orientation of the football also encourage the desired horizontal orientation and squaring of the player &# 39 ; s shoulders , resulting in greater stability in approaching and encountering opposing players or line of players . it is to be understood that while certain forms of this invention have been illustrated and described , it is not limited thereto except insofar as such limitations are included in the claims and allowable functional equivalents thereof .	0
referring initially to fig1 , a drive sprocket 20 has a plurality of sprocket teeth 23 , 26 disposed in pairs 27 around the periphery of the sprocket 20 . the sprocket 20 also has a central opening 29 that is formed in the shape of a square . the square shaped opening 29 is sized to receive a square shaft 30 ( fig1 ) for rotating the sprocket 20 to drive a modular belt 32 ( fig3 ). the central opening 29 may be formed in other shapes to accommodate different shaft geometries as will be evident to those of ordinary skill in the art based on this disclosure . a large first opening 35 which may be oval - shaped as shown is formed in the body of the sprocket 20 . the first opening 35 is located between adjacent pairs 27 of teeth and is arranged such that it aligns with the hinge area of the module belt 32 when the belt 32 is engaged with the sprocket 20 as best shown in fig3 . as shown the teeth 23 are formed by a pair of side walls 38 , 41 ( opposite to wall 38 ); a pair of end walls 44 , 47 ; and a top wall 50 . the teeth 26 are formed by a pair of side walls 53 , 56 ( opposite to wall 53 ); a pair of end walls 59 , 62 ; and a top wall 65 . the top walls 50 and 65 are angled relative to their respective side walls such that the top walls 50 and 65 are disposed in spaced apart relation and somewhat aligned with respect to their planar top surfaces . the sprocket 20 also has recessed curved portions 68 extending from the end of the first openings 35 toward the center of the sprocket 20 . the curved recessed portions 68 extend toward the teeth 23 , 26 and terminate at a shelf - like portion 71 between the respective teeth . turning to fig2 , the teeth 23 , 26 are disposed in two rows along the periphery of the drive sprocket 20 . the teeth 23 , 26 are offset along the circumference of the sprocket and are disposed on opposite sides of a central axis 28 such that during driving of the modular belt 32 one of the teeth engages with one of the link ends 33 of the belt 32 and another tooth engages with the transverse rib 34 on the belt 32 . the shelf portion 71 extends between adjacent teeth 23 , 26 and is bordered on opposite sides by the curved recessed portions 68 . turning to fig3 , the sprocket 20 is shown engaged with the modular belt 32 . the teeth 23 , 26 engage with the link ends 33 and transverse rib 34 of the respective belt modules 36 . the teeth 23 , 26 fit on opposite sides of the transverse rib 34 and provide tracking for the belt 32 . also , the first openings 35 provide large openings and improved access to the hinge areas for cleaning when the belt 32 passes over the drive sprocket 20 . the curved recessed portions 68 also provide room near the hinge and guide the cleaning fluid into the critical hinge area . turning to fig4 and 5 , the end wall 47 of the tooth 23 may be disposed at an angle such that the face of the tooth 23 reduces the contact surface to the belt 32 and “ squeezes ” away residuals that may become trapped between the belt 32 and the sprocket 20 . in fig6 , an alternate embodiment of the sprocket 20 is shown . sprocket 60 has the same design for the teeth 23 , 26 and the first openings 35 and curved , recessed portions 68 but also includes openings 63 which are relatively large and are positioned around the periphery of the central shaft opening . the openings 63 may be desired to improve the accessibility for water jets applied from the sides of the sprocket 60 . this alternate design does not necessarily improve the cleaning of the hinge areas . turning to fig7 - 9 , an alternate embodiment of the sprocket body that is particularly suitable for molding is shown . sprocket 80 has a central opening 81 and has larger curved , recessed portions 83 that follow the offset ( with respect to the circumference as best shown in fig8 ) arrangement of the sprocket teeth pairs 86 , 89 . the teeth are disposed in pairs 91 with each tooth on opposite sides of a central axis 94 . the curved recessed portion 83 extends from the end wall 92 of one tooth 86 to the end wall 95 of the next tooth 86 on the same side of the sprocket 80 . a first opening 98 formed between adjacent teeth 86 , 89 provides an opening around the hinge area . the pairs 91 of sprocket teeth 86 , 89 provide for engagement of the transverse rib 34 and link end 33 of belt 32 as shown in fig9 . the recessed portion 83 is disposed at an angle β with respect to the radial axis 93 . the angle β may be altered as necessary to improve the flow of cleaning fluid . turning to fig1 - 13 , an alternate embodiment of the sprocket is shown . sprocket 110 has a central opening 114 . sprocket 110 increases the open space between the sprocket 110 and the hinge of the belt 32 . the sprocket 110 may be used where tracking is not needed such as where the belt 32 is guided by guiding profiles on the edge of the belt 32 . as best shown in fig1 , the sprocket 110 has a single row of teeth pairs 113 , 116 without any offset . due to the wider teeth 113 , 116 and the closed v - shape of the space 118 between the teeth 113 , 116 , the sprocket 110 contact area is larger and may negatively effect the cleaning properties of the sprocket 110 . the sprocket 110 also includes a curved , recessed portion 121 . the recessed portion 121 extends to a first opening 124 that aligns with the hinge area of belt 32 as shown in fig1 . fig1 illustrates an arrangement of a spraying system include a manifold 150 with spray heads 153 arranged adjacent to sprockets 20 such that cleaning fluid 156 can be sprayed through the curved recessed portions 68 into the first openings 35 below the hinge areas of the modular belts 32 as they pass over the drive sprocket 20 . turning to fig1 , another embodiment of the sprocket is shown . a drive sprocket 200 has a plurality of sprocket teeth 203 , 206 disposed in pairs 207 around the periphery of the sprocket 200 . the sprocket 200 also has a central opening 209 that is formed in the shape of a square . the square shaped opening 209 is sized to receive a square shaft 30 ( fig1 ) for rotating the sprocket 200 to drive a modular belt 32 as shown in fig1 . a plurality of first openings 215 are disposed around the periphery of the sprocket 200 between the pairs 207 . the first openings 215 extend inward toward the center of the sprocket 200 and terminate along a curved inner wall 218 . a plurality of second openings 221 are disposed between the first openings 215 and the central opening 209 . the second openings 221 may be desired to improve the accessibility of water jets applied from the sides of the sprocket 200 . sprocket 200 does not include recessed portions or grooves below the first opening 215 . the sprocket 200 is intended to have smooth surfaces with large openings to provide access to the hinge area of the belt and to allow easier cleaning of the sprocket itself . in fig1 , the teeth 203 , 206 are disposed in two rows along the periphery of the drive sprocket 200 . the teeth 203 , 206 are offset along the circumference of the sprocket 200 and are disposed on opposite sides of a central axis 230 . during driving of the modular belt 32 one of the teeth engages with one of the link ends 33 of the belt 32 and another tooth engages with the transverse rib 34 on the belt 32 . the transverse rib 34 on the belt 32 fits in the space 238 between the teeth 203 , 206 . turning to fig1 , the sprocket 200 is shown engaged with the modular belt 32 . the teeth 203 , 206 engage with the link ends 33 and transverse rib 34 of the respective modules 36 . the teeth 203 , 206 fit on opposite sides of the transverse rib 34 and provide tracking for the belt 32 . also , the first openings 215 provide large openings and improved access to the hinge areas for cleaning when the belt 32 passes over the drive sprocket 200 . as indicated by arrow 250 the first openings 215 align with the hinge areas of the belt 32 as the belt 32 passes over the sprocket 200 . while the invention has been described in connection with certain embodiments , it is not intended to limit the scope of the invention to the particular forms set forth , but , on the contrary , it is intended to cover such alternatives , modifications , and equivalents as may be included within the spirit and scope of the invention as defined by the appended claims .	8
fig1 depicts a prior art layout of cables prior to the movement of the mobile conveyor . individual cables 101 , 102 and 103 , each 400 m in length , are laid out in combination parallel to the path that the conveyor will move , which is in the direction of arrow a . cable 101 has on one end 101 a , which in the depicted view is the left end , an electrical connector or plug ( not shown ) that is wired into the electric house 104 which provides electrical power to the cable . on cable 101 &# 39 ; s other , i . e . right , end there is electrical plug 101 b . cables 102 and 103 each have an electrical plug , respectively 102 a and 103 a on each cable &# 39 ; s left end that is located closer to electric house 104 and a plug , respectively 102 b and 103 b , on each cable &# 39 ; s opposite , i . e . right , end that is located further from electric house 104 . fig2 is the first in a sequence showing the procedure , according to one prior art method , for powering a mobile conveyor as it traverses a path in a mining environment in the direction of arrow a . reel 105 , from which cable 106 has been unwound , is fixedly mounted on a mobile conveyor 108 . in the position depicted in fig2 , the mobile conveyor has advanced approximately half the distance of cable 101 , i . e . approximately 200 yards in the direction of arrow a . cable 106 has been unwound to its complete length and has an electrical plug 106 a on one end , with a plug on its other end 106 b being hard wired into the junction box ( not shown ) proximate to the reel . plug 106 a is connected to plug 101 b of cable 101 to thereby provide power from the electric house 104 to the mobile conveyor 108 . fig3 depicts reel 105 having drawn up essentially all of cable 106 while the mobile conveyor 108 moved approximately 200 m in the direction of arrow a . mobile conveyor 108 still maintains electrical connection with electric house 104 . in fig4 , the mobile conveyor 108 has moved another 200 m in the direction of arrow a , in the process unwinding essentially all of cable 106 from reel 105 . with the cable having been completely drawn out from reel 105 , mobile conveyor cannot to move any further in the direction of arrow a and still maintain an electrical connection with electric house 104 . the relocation of cable 106 is now required . in fig5 the path the relocation of cable 106 will take , as represented by dotted line 107 , is depicted . plug 106 a must be disconnected from plug 101 b and the cable is moved over 400 meters after which plug 101 b is connected to the male plug 102 b at the far right end of cable 102 , that is , the end of cable 102 furthest from the electric house 104 . this requires moving cable weighing over 2000 kg 400 meters in a matter that will not unduly stress the cable . in fig6 the movement of the cable has been completed . furthermore , plug 106 a is connected with plug 102 b and plug 101 b is connected to plug 102 a to complete the connection of electric house 104 to reel 105 . in fig7 cable 106 is drawn up by reel 105 as the mobile conveyor has moved another 200 meters in the direction of arrow a to be roughly aligned with the right end of cable 102 . in fig8 the mobile conveyor 108 has moved another 200 meters to the right in the direction of arrow a and the cable has been drawn out from reel 105 . for the mobile conveyor to continue to move in the direction of arrow a cable 106 must be again moved in the manner depicted in fig5 , that is cable 106 &# 39 ; s plug 106 a must be disconnected from plug 102 b , moved 400 meters in the direction of arrow a , and connected to plug 103 b . to complete the connection to reel 105 , plug 102 b is connected to plug 103 a . fig9 - 19 depict one embodiment of the present invention for powering a mobile conveyor such as a mobile tripper 208 . as shown in fig9 , the cables 201 - 204 ( also referred to as , respectively , the first , second , third and fourth laid out cables ) are laid out in a manner roughly adjacent to and in combination approximately parallel to the mobile conveyor &# 39 ; s predetermined path . the cables however are not laid out end to end in the manner shown in fig1 , but are folded back upon themselves , approximately in the form of a thin letter “ v ”, so that when so laid out the ends of each cable , and therefore the plugs located at the ends ( 201 a and b , 202 a and 202 b and so on ), are placed proximate to each other and are located nearer to a stationary power source , i . e . electrical house 214 , than the foldover points ( also referred to as the “ fold ”) in each cable at the base or point of the “ v ”, represented as 201 c , 202 c , 203 c and 204 c . as depicted , the cables are 400 m in length , although it is understood that this is not a required length of the cables , and the length can vary depending upon the requirements of the practitioner . another feature of the present invention is that reel 215 is constructed with a plug that is adaptable to be wired into an adjacent junction box on the conveyor , which plug is designed to be easily and quickly connected to and disconnected from a plug from a power cable . thus , a cable delivering power to the reel from a power source removed from the conveyor does not have to be hard wired into the junction box . thus , as depicted in fig9 , plug 201 b is connected to the electric house and its opposite plug 201 a is connected to a mating plug ( not shown in the figure ) on reel 215 . it is one of the advantages of this embodiment of the present invention that a dedicated cable ( in the manner of cable 106 as seen in fig1 - 8 ) is not needed for reel 215 . therefore , when reel 215 is electrically connected to a junction box located on mobile conveyor 208 , and cable 201 is used to supply power from electrical house 214 to reel 215 , mobile conveyor 208 will be supplied with electrical power . with reference to fig1 , as the mobile conveyor 208 moves in the direction of arrow a , and toward fold 201 c , reel 215 picks or spools up cable 201 until the reel is full when conveyor 208 comes up adjacent to fold 201 c . at this point the cable , which was folded back upon itself when initially laid out , is easily flipped over at point 201 c in the manner described herein . reel 215 will commence to unwind cable 201 as the conveyor moves in the direction of arrow a toward cable 202 . fig1 shows conveyor 208 having advanced another 200 meters , that is , with essentially the entire length of cable 201 having spooled out and the reel being substantially empty of cable . in fig1 , plug 201 a is disconnected from reel 215 and connected with plug 202 b of cable 202 . as depicted line 202 is live , but no power is depicted going to conveyor 208 . in fig1 , plug 202 a is connected to reel 215 , with conveyor 208 therefore becoming live . it is seen that by utilizing the present method there is much less cable handling and moving than in prior art systems , as moving the cable over long distances is not required . this sequence will be repeated for each of cables 203 and 204 as mobile conveyor 208 continues to move in the direction of arrow a . fig1 shows the mobile conveyor at the end of the run in the direction of arrow a with plug 204 a being connected into the conveyor and all of the cables being live . in fig1 conveyor 208 now begins to move on its reverse path in the direction of arrow b . reel 105 has drawn up its maximum capacity of cable 204 . in fig1 cable 204 has been substantially unreeled is folded back upon itself at point 204 c as the reel continues to move from right to left in the direction of arrow b . in fig1 plug 204 a is disconnected from reel 215 . mobile conveyor 208 is therefore without power . in fig1 plug 204 b has been disconnected from female plug 204 a , cable 204 is therefore no longer live , and is now folded back upon itself and is in the initial position depicted in fig9 . plug 203 a has been connected to reel 215 , thus reestablishing power to reel 215 and therefore the mobile conveyor . this sequence is repeated as the mobile conveyor continues to retrace its path in the direction of arrow b . fig1 shows the conveyor at the far left of its run , where it is in the same position as it was in fig9 . the sequence as shown can be repeated indefinitely , if desired . fig2 - 21 depict the cable reel 400 advantageously used in the present invention . one unique feature of cable reel 400 is plug 401 which is wired into the reel and which permits a mating plug 402 on one end of a power cable , such as cable 403 in the figure , to be quickly connected and disconnected . reel 400 further comprises cable reel drive unit 404 . cable diverter 406 is associated with and is proximate to the reel , and aids in directing the power cable utilized in conjunction with the reel , particularly at the foldover points . cable diverter 406 has cover 411 , with diverter 406 being mounted on machine frame 405 . cable reel 400 further has section 410 , which is also depicted in fig2 , which is removable as shown by arrow d to permit a power cable to have access to the interior of the reel . fig2 shows the reel section 410 which is removable as per arrow d , diverter cover plate 411 , removable as per arrow f , which together allow the cable 403 , with plug 402 attached to it , to be conveniently removed as per arrows e and to thereafter permit the rapid installation of the next cable in the series . fig2 illustrates flipover 420 , including a removable cover plate 421 , on the flipover to allow convenient installation / removal of the cable in the flipover . the flipover is optionally utilized at a foldover point in the cable , i . e . 201 c , 202 c etc . it &# 39 ; s advantageous to have a flipover at that point when the cable begins to loop back in the opposite direction when the conveyor passes by . when the cable begins to fold back on itself — that is , from the v position to a straight cable or vice versa , a flipover is employed to support the cable so it doesn &# 39 ; t fold too severely back on itself so when conveyor passes over at that point and sweeps along the cable the cable won &# 39 ; t become damaged from too much stress . on the mobile conveyor &# 39 ; s return run the flipover will reverse the process and begin turning the cable over on itself . the use of a flipover is further illustrated in fig2 - 26 . fig2 shows the cable reel 400 and mobile conveyor 430 on the left side of flipover 420 while moving in the direction of arrow a . in the case where the mobile conveyor 430 is traveling toward the flipover 420 , the cable reel 400 is rotating counterclockwise and reeling in the cable . flipover 420 is configured in part with a left semicircle 422 and a right semicircle 423 , both adaptable to receive cable 403 . diverter 406 diverts the cable 403 to the right in the direction of flipover 420 , in which the cable loops around left semicircle 421 and folds back on itself . fig2 shows the cable reel 400 and mobile conveyor 430 directly over the flipover 420 . the diverter 406 directs the cable 403 straight down toward flipover 420 . fig2 shows the cable reel & amp ; mot on the right side of the filpover and moving away from the flipover in the direction of arrow a . as the mot is traveling away from the filpover , the cable reel is rotating clockwise and spooling out the cable 403 . diverter 406 diverts the cable 403 to the left in the direction of flipover 420 , in which the cable loops around right semicircle 423 and folds over as it begins to be laid out more or less straight . fig2 to 36 depict an alternate embodiment of this invention , in which two cable reels are utilized . in this embodiment the cables do not have to be folded back on themselves when laid out . fig2 shows the initial position of cable reels 315 and 325 . both reels are loaded with cable to their full capacity , which in this case is 400 m of cable , with reel 315 holding first section of cable 301 and reel 325 holding second section of cable 302 . both reels are wired into a junction box ( not shown ) on the conveyor and each reel has a plug electrically connected to the junction box which is capable of easily being connected to and disconnecting a mating plug on the end of a power cable . as depicted , plug 301 a of cable 301 is connected into reel 315 , and plug 301 b is connected to electric house 314 . thus cable 301 is powered up along with reel 315 , and therefore the conveyor — to which the reel is electrically connected — has power . conversely , while plug 302 a of cable 302 is connected into a plug in reel 315 , plug 302 b , on the opposite end of cable 302 , remains unconnected . therefore , reel 325 is not powered . cables 303 and 304 ( respectively the third and fourth section of cable ) are laid out sequentially , although not all the cable has to be laid out in advance of the conveyor &# 39 ; s operation , and one or more cables can be laid out while the conveyor is in operation . cables 303 and 304 are laid out end to end and approximately parallel to the path to be taken by conveyor 308 . in fig2 conveyor 308 has moved approximately 400 m to the right in the direction of arrow a . reel 315 has unspooled cable 301 . alternatively , the relative positions of the cables and reels as shown in fig2 can be arrived at if reel 325 initially starts out empty , but in connected to cable 302 , with cable 302 being laid out in the same manner as cables 303 , 304 and 305 . in such a case as the conveyor moved in the direction of arrow a reel 325 would have spooled up cable 302 while reel 315 was unspooling and laying out cable 301 in the manner depicted in fig2 and 28 . in fig2 : ( a ) plug 301 a has been disconnected from reel 315 and is connected with the plug 302 b , whose opposite member plug 302 a is connected in reel 325 ; and ( b ) cable 303 &# 39 ; s plug 303 a is been connected with reel 315 . reel 325 is now powdered up , while reel 315 is not . fig3 depicts the conveyor having moved further to the right in the direction of arrow a . reel 325 has substantially unspooled cable 302 , and reel 315 has drawn up cable 303 . in fig3 plug 302 a has been disconnected from reel 325 , which is empty , and plug 302 a is now connected with plug 303 b . as a result full reel 315 , in which plug 303 a remains connected , is now powdered up by having a direct electrical connection with electric house 314 . plug 304 a is now connected with empty reel 325 , and reel 325 is not powered up . in fig3 the conveyor has moved further to the right . reel 315 has unspooled cable 303 and reel 325 has drawn up cable 304 . in fig3 , plug 303 a has been disconnected from reel 315 and connected with plug 304 b , thus powering up full reel 325 . empty reel 315 is no longer powered up . in fig3 the conveyor has again moved 400 m in the direction of arrow a . reel 325 has unspooled cable 304 . reel 315 remains empty . the conveyor 308 is now positioned to start on return leg in the direction of arrow b , with reel 325 remaining powered as it begins to take up cable . as shown , for the majority of the conveyor &# 39 ; s run when one reel is spooling up cable the other reel is unspooling . during the run of the conveyor in the direction of arrow a , the reel unspooling the cable is live in that it maintains a direct connection with the electric house , while the reel spooling up cable is not powered up . in the return run in the direction of arrow b , the opposite is the case , in that the reel spooling up the cable is “ live ”, while the reel unspooling cable is not powered up . fig3 is a plan view of the two reel embodiment of the present invention . preferably , there is a small horizontal offset ← x → between the two cable reels 315 and 325 . this offset is to avoid interference between the cables and as they are picked up and laid down by the reels , and make it easier to swap cable ends at the transition points . fig3 is an elevation view of the two reel embodiment showing the reels 315 and 325 , diverters 320 a and 320 b , as mounted on the conveyor 308 framework . it is to be understood that the form of this invention as shown is merely a preferred embodiment . various changes may be made in the function and arrangement of parts ; equivalent means may be substituted for those illustrated and described ; and certain features may be used independently from others without departing from the spirit and scope of the invention as defined in the following claims .	7
under a first aspect , the invention consists of a catalyst for electrochemical reduction of oxygen comprising a noble metal sulphide supported as a single well - defined crystalline phase on a conductive carbon ; preferably , the noble metal catalyst of the invention is a single crystalline phase of a binary or ternary rhodium or ruthenium sulphide . in the case of binary rhodium sulphides expressed by the general formula rh x s y , the inventors have found that the manufacturing methods of the prior art invariably lead to a mixed - valence system at least comprising the species rh 2 s 3 , rh 17 s 15 , and rh 3 s 4 with some amount of metallic rhodium ( rh 0 ). of all these species , rh 17 s 15 characterised by a crystal lattice corresponding to the ( pm - 3m ) space group is the most active , followed by monoclinic ( c2 / m ) rh 2 s 3 , while the remaining species present little or no activity and in some cases a lesser stability . rh 0 is unstable in hydrochloric acid electrolysis conditions , and accounts for the quickest rhodium leaks during operation . in accordance with the processes of u . s . pat . no . 6 , 149 , 782 and u . s . pat . no . 6 , 967 , 185 for example , the typical amount of rh 17 s 15 is a little higher than 70 % of the overall rhodium sulphide species . the inventors have surprisingly found that a single crystalline phase of ( pm - 3m ) rh 17 s 15 on active carbon can be prepared by suitably modifying the environmentally - friendly manufacturing process disclosed in u . s . pat . no . 6 , 967 , 185 . the term single crystalline phase is used hereafter to mean a more than 90 % pure crystal phase ; in the cases of the ( pm - 3m ) rh 17 s 15 catalyst according to the invention , the single crystal phase obtained is about 95 % pure with no detectable rh 0 . the method for manufacturing a single crystalline phase of ( pm - 3m ) rh 17 s 15 on active carbon comprises the steps of : reacting a precursor salt of rhodium , for instance rhcl 3 , with a sulphur source such as a thiosulphate or thionate species in the presence of a strong reducing agent and of conductive carbon particles , thus precipitating an amorphous sulphide species on the carbon particles recovering the slurry , preferably by filtration heat treating the recovered slurry in inert atmosphere at a temperature of 500 to 1250 ° c . until obtaining a single crystalline phase corresponding to ( pm - 3m ) rh 17 s 15 . besides thiosulphates and thionates , other sulphur sources can be used to initiate the metathesis step characterising the method of the invention : tetrathionates such as na 2 s 4 o 6 . 2h 2 o and other similar thionate species such as dithionates , trithionates , pentathionates and heptathionates are all fit for this purpose , and also gaseous so 2 possesses both the reducing power and the sulphur availability to produce amorphous m x s y moieties on a selected support . the support carbon particles have preferably a surface area comprised between 200 and 300 m 2 / g , and the preferred specific loading of the resulting rhodium sulphide on carbon is comprised between 12 and 18 %. the sequence of addition of the reactants is critical to obtain the desired product : to the solution containing the suspended carbon particles and the rhodium precursor salt , the selected sulphur source ( for instance a tiosulphate or thionate species ) is added , so that the metathesis process can initiate . simultaneously or immediately after , depending on the specific reaction , a strong reducing agent , defined as a species with a reduction potential below 0 . 14 v / she , is added in small aliquots . as reducing agent , sodium borohydride ( nabh 4 ) is preferred , but other suitable reactants include lialh 4 , hydrazines , formaldehyde and metallic aluminium , zinc or antimony . the reducing agent as defined has a reduction potential below the one of s 0 / s − 2 couple : in this way , it can achieve the instantaneous metathesis of the metal ions and of the thiosulphate part , directly forming amorphous rhodium sulphide on the carbon support particles while preventing the formation of discrete reduction states , which are the main factor controlling the yield and phase distribution of the different sulphide moieties . the method of the invention can be applied to the manufacturing of other single crystalline phases of noble metal sulphides , including not only sulphides of a single metal ( binary sulphides ) but also of two or more metals ( ternary sulphides and so on ). this proves particularly useful in the case of ruthenium sulphides , because also in this case the method of the invention gives rise to the most active and stable single crystalline phase . by applying the method of the invention , binary ( rus 2 ) and ternary ( ru x m z s y ) ruthenium sulphides , m being a transition metal preferably selected among w , co , mo , ir , rh , cu , ag and hg , precipitate in a single crystalline phase with lattice parameters corresponding to a pyrite - type lattice ( pa 3 space group ). the resulting ( pa 3 ) rus 2 or ru x m z s y catalysts turn out to be more active and more stable in the hydrochloric acid electrolysis conditions than mixed - valence ruthenium sulphide systems of the prior art . the preferred catalyst specific loading and selected carbon support are the same applying for rhodium sulphide ; also the method of manufacturing is substantially the same , even though suitable temperatures for the thermal treatment may vary from 150 to 1250 ° c . the specific reaction pathway of the method according to the invention has the main advantage to intervene on the reduction potentials of the metals and the thionic moieties preventing the formation of discrete reduction states , which are the main factor controlling the yield and proper phase composition of the selected chalcogenide moiety as mentioned above . the method of the invention promotes the instantaneous metathesis of the metal ions and the thionic part . for instance , by reacting the chloride form of a transition metal such as rhodium , whose aqueous hydrolysis gives a ph in the range of 1 to 1 . 5 , with sodium tetrathionate dihydrate ( na 2 s 4 o 6 . 2h 2 o ) and sodium borohydride ( nabh 4 ) in the presence of carbon , it is possible to directly synthesise amorphous rh x s y supported on carbon . the reaction is conducted at room temperature and can be followed by ph and spot tests . at completion , the slurry is collected and heat - treated in inert environment for a sufficient time to provide the required single phase rhodium sulphide supported catalyst . the same procedure can be used to obtain other binary and ternary sulphides with specific crystal phase distributions . in some cases , the kinetics and yield of the reaction can be improved by adding catalytic amounts of metals such as al , sn , co and others . the disclosed catalysts are suitable for being incorporated in gas - diffusion electrode structures on electrically conductive webs as known in the art . the manufacturing of rhodium and of ruthenium sulphide catalysts according to the invention are disclosed in the following examples , which shall not be understood as limiting the invention ; suitable variations and modifications may be trivially applied by one skilled in the art to manufacture other carbon supported - single crystalline phase sulphide catalysts of different noble and transition metals relying on the method of the invention without departing from the scope thereof . fig1 shows an x - ray diffractogram of a rhodium sulphide catalyst prepared according to the method of the invention . fig2 shows the peaks of rh 17 s 15 phase . described herein is a method to precipitate a rhodium sulphide single crystalline phase on carbon according to the method of the invention ; precipitation reactions of other noble metal sulphide catalysts ( such as the sulphides of ruthenium , platinum , palladium or iridium ) only require minor adjustments that can be easily derived by one skilled in the art . 7 . 62 g of rhcl 3 . h 2 o were dissolved in 1 l of deionised water , and the solution was refluxed . 7 g of vulcan xc 72 - r high surface area carbon black from cabot corporation were added to the solution , and the mix was sonicated for 1 hour at 40 ° c . 8 . 64 g of ( nh 4 ) 2 s 2 o 3 were diluted in 60 ml of deionised water , after which a ph of 7 . 64 was determined ( sulphur source ). 4 . 14 g of nabh 4 were diluted into 60 ml of deionised water ( reducing agent ). the rhodium / vulcan solution was kept at room temperature and stirred vigorously while monitoring the ph . in this case , the sulphur source and reducing agent solutions were simultaneously added dropwise to the rhodium / vulcan solution . during the addition , ph , temperature and colour of the solution were monitored . constant control of the ph is essential in order to avoid the complete dissociation of the thionic compound to elemental s 0 . the kinetics of the reaction is very fast , therefore the overall precipitation of the amorphous sulphide occurs within few minutes from the beginning of the reaction . cooling the reaction can help in slowing the kinetics if needed . the reaction was monitored by checking the colour changes : the initial deep pink / orange colour of the rhodium / vulcan solution changes dramatically to grey / green ( reduction of rh + 3 to rh + 2 species ) and then colourless upon completion of the reaction , thus indicating a total absorption of the products on carbon . spot tests were also carried out in this phase at various times with a lead acetate paper ; limited amount of h 2 s was observed due to a minimal dissociation of the thionic species . the precipitate was allowed to settle and then filtered ; the filtrate was washed with 1000 ml deionised water to remove any excess reagent , then a filter cake was collected and air dried at 110 ° c . overnight . the dried product was finally subjected to heat treatment under flowing argon for 2 hours at 650 ° c ., resulting in a weight loss of 22 . 15 %. the resulting carbon supported catalyst was first characterised in a corrosion test , to check its stability in a hydrochloric acid electrolysis environment . for this purpose , part of the sample was heated to boiling in a chlorine - saturated hcl solution , at the same conditions disclosed in example 4 of u . s . pat . no . 6 , 149 , 782 . the resulting solution was colourless , not even showing the characteristic trace pink of the more stable forms of rhodium sulphide of the prior art . an x - ray diffractogram of the rhodium sulphide catalyst is shown in fig1 . rh x s y usually obtained by precipitation is characterised by a balanced phase mixture of at least three rh — s phases : orthorhombic ( pbcn ) rh 2 s 3 , monoclinic ( c2 / m ) rh 3 s 4 , and primitive cubic ( pm - 3m ) rh 17 s 15 . the rh 2 s 3 phase is an electronic insulator built of alternating rhs 6 octahedra . the average rh — rh bond distance of 3 . 208 å ( compared to 2 . 69 å in fcc rh metal ) thus removes any possibility of direct rh — rh bonding . in contrast , the rh 17 s 15 phase possesses semiconductor properties at room temperature . in addition , rh 17 s 15 consists of rh 8 octahedra with an average rh — rh distance of 2 . 59 å . the rh 3 s 4 phase , with its metallic rh 6 octahedra eaves , is an active site for o ( h ) adsorption . the upper part of the figure shows the diffractogram on top and the characteristic peaks of the different rh — s phases below : the comparison clearly shows how the rh 17 s 15 phase is absolutely predominant (& gt ; 95 %) with a characteristic set of 4 peaks at 2θ = 37 . 38 − 40 . 68 ° representing the ( 104 ), ( 114 ), ( 223 ), and ( 024 ) reflections , and the high intensity peaks at 47 . 64 and 52 . 16 ° indicating the ( 333 ) and ( 044 ) reflections . this is even more evident in fig2 , where the characteristic peaks of the rh 17 s 15 phase are superposed to the xrd spectrum . a ruthenium cobalt ternary sulphide ( 3 : 1 ) catalyst was prepared in a similar manner as the one of example 1 , the difference being that the thionic reagent is now part of the metal ion solution , thus the metathesis reaction occurs in - situ on the metal ion sites . 7 . 62 g of rucl 3 . xh 2 o were dissolved in 1 l of deionised water , and the solution was refluxed . 2 . 46 g of cocl 2 . xh 2 o were also added to the ru containing solution and refluxed as above . 8 g of vulcan xc72 - r high surface area carbon black from cabot corporation were added to the solution , and the mix was sonicated for 1 hour at 40 ° c . 17 . 5 g of ( nh 4 ) 2 s 2 o 3 were diluted in 100 ml of deionised water , after which a ph of 7 . 72 was determined , then added to the catalyst / vulcan solution ( sulphur source ). 6 . 54 g of nabh 4 were diluted into 100 ml of deionised water ( reducing agent ). the sulphur source solution containing ruthenium , cobalt and vulcan carbon black was kept at room temperature and stirred vigorously while monitoring the ph . once the reducing agent solution was prepared , it was added dropwise to the sulphur source solution . during the addition of the reagents , ph , temperature and colour of the solution were monitored . constant control of the ph is essential in order to avoid the complete dissociation of the thionic compound to elemental s 0 . as for example 1 , also in this case the kinetics of the reaction is very fast therefore the overall precipitation of the amorphous sulphide occurs within few minutes from the beginning of the reaction . cooling the reaction can help in slowing the kinetics if needed . the reaction was monitored by checking the colour changes : the initial deep brown / orange colour of the initial solution changes dramatically to colourless upon completion of the reaction , thus indicating a total absorption of the products on the carbon . spot tests were also carried out in this phase at various times with a lead acetate paper ; limited amount of h 2 s was observed due to a minimal dissociation of the thionic species . moreover , no co 0 ( metal ) was observed ; spot test for such particular metal is very straightforward because of the magnetic proprieties of co 0 . the precipitate was allowed to settle and then filtered ; the filtrate was washed with 1000 ml deionised water to remove any excess reagent , then a filter cake was collected and air dried at 110 ° c . overnight . the dried product was finally subjected to heat treatment under flowing nitrogen for 2 hours at 500 ° c ., resulting in a weight loss of 32 . 5 %. the resulting carbon supported catalyst was subjected to the same corrosion and electrochemical tests of the previous example , showing identical results . actual performances in hydrochloric acid electrolysis of the catalyst prepared according to the method of the invention and incorporated in a gas - diffusion structure on a conductive web as known in the art were also checked . different samples of the catalysts of examples 1 and 2 were prepared , mixed to a ptfe dispersion and incorporated into conventional flow - through gas diffusion electrode structures on carbon cloth . all the electrodes were compared to a standard state - of - the - art supported rh x s y electrode for hydrochloric acid electrolysis , according to the teaching of u . s . pat . nos . 6 , 149 , 782 and 6 , 967 , 185 ( sample 0 ). such electrodes were tested as oxygen - consuming cathodes in a 50 cm 2 active area laboratory cell against a standard anode , making use of a by - product aqueous hydrochloric acid solution from an isocyanate plant . the overall cell voltage was recorded at two different current densities , namely 3 and 6 ka / m 2 , and the corresponding values are reported in table 1 . all of the tested electrode samples showed an excellent catalytic activity , resulting in a sensible voltage decrease with respect to the electrode activated with a rhodium sulphide catalyst of the prior art ( sample 0 ). equivalent rhodium sulphide catalysts were obtained also by using sodium trithionate , tetrathionate and heptathionate precursors previously prepared according to known procedures , with minor adjustments easily derivable by one skilled in the art . analogous corrosion and electrochemical results were obtained also in these cases . the above description shall not be understood as limiting the invention , which may be practised according to different embodiments without departing from the scopes thereof , and whose extent is solely defined by the appended claims . in the description and claims of the present application , the word “ comprise ” and its variations such as comprising and “ comprises ” are not intended to exclude the presence of other elements or additional components .	7
fig1 shows a first presently preferred embodiment of the present invention in the form of an elbow 10 such as an elbow tube as utilized with broiler burners in a gas stove . as discussed above , the elbows , such as elbow 10 , are utilized to transition from external to internal to the oven compartment particularly for self - cleaning ovens with broiler elements which can often reach temperatures of about 900 degrees fahrenheit or more and also be subjected to harsh chemicals such as oven cleaner chemicals inside the oven . an aluminum element would not fare well in such an environment . accordingly , the preferred embodiment is preferably made of steel such as cold - rolled steel which has been treated such as with a chrome plating process or other appropriate pre - selected material . other appropriate materials may be utilized with other embodiments . elbow 10 is comprised of a tube 12 having a first 14 and a second end 16 . between first and second ends 14 , 16 , there is normally a bend 18 such as an elbow bend as illustrated . flange 21 is also normally provided with bores 15 , 17 shown in phantom to connect to an internal oven wall ( not shown ) or other connection location . first and second segments 20 , 22 on either side of the bend 18 and / or flange 21 , if provided , can be provided as required by manufacturers to accommodate particular styles of oven equipment . other segments could be provided and / or other design criteria accommodated with other embodiments . first segment 24 of first tube 12 preferably provides an outwardly flared segment extending from first portion 20 to a second segment 26 . second segment 26 is preferably provided with internal threads 28 which can be tapped to provide an internally threaded second segment 26 after providing the outwardly flared first segment 24 . internal or inner surface 30 of outwardly flared first segment 24 preferably is at least relatively smooth if not deburred , if necessary , so as to be in a proper condition as will be described in further detail below . the applicant has manufactured the elbow 10 by taking a straight segment of stainless steel tubing , bending it to provide bend 18 , and utilizing a flow drill to compress and expand the first end 14 to provide the outwardly flared segment 24 as well as the second segment 26 . second segment 26 may then be tapped to provide internal threads 28 . second segment 26 may have a relatively consistent inner and / or outer diameter as shown or taper like first segment 24 for other embodiments . in performing the flow drill process , the 0 . 065 thickness of first pipe wall portion 32 is transitioned to about a 0 . 040 thickness at second pipe wall portion 34 . thus , a wall reduction of somewhere between about 25 % to 50 % occurs , and more thoroughly about ⅓ of the thickness of the wall decreases at least in some portion of a first segment 24 , and second segment . furthermore , as this process occurs , the length is shortened at the first end 14 as first end 14 is compressed towards the second end 16 during the flow drilling process . a shortening of about 0 . 075 has been measured during this process . outwardly second segment 26 may have a relatively constant internal diameter particularly after tapping , such as about 0 . 58 which stands in contrast to the inner diameter of about 0 . 25 of tube segments 20 , 22 . the inner diameter increases from roughly doubles and preferably increases the fact of somewhere between about 1 . 5 times the original inner diameter to about three times , and more preferably , about two times the inner diameter . after tapping second segment 26 can cooperate with a 7 / 16 external threads shown as nut threads 36 provided a nut 40 . one will note that nut 40 is identically shown in the various embodiments as is the construction of the first end 14 . other nuts 40 could be provided with other embodiments . the difference in the embodiments of fig2 and fig3 is that the connections for other connected tube 42 , 44 are slightly different . a relatively straight segment of the tube 44 is illustrated for a first connection . a ferrule 46 is shown provided towards the first end 48 and then as the compression nut 40 is directed by screwing its threads relative to the second segment 26 and outwardly flared section 24 to provide a fluid tight seal against the inner surface 30 of the first section 24 . the ferrule 46 is simultaneously compressed against the exterior surface 43 of the tube 44 . the first end 48 of the tube 44 may also contact the internal surface 30 of the second segment 26 to assist in providing a fluted tight seal as well . in the presently preferred embodiment of fig2 , one or more beads illustrated as first and second beads 60 , 62 can be provided toward a first end 64 of tube 42 . more or fewer beads 60 , 62 may be provided in other embodiments . in this construction , the first tube 42 effectively provided with a built in ferrule . as the compression nut 40 is tightened with threads 36 relative to threads 28 , at least one bead 62 is placed in contact with the inner surface 30 of the outwardly flared first section 24 and possibly in combination with the first end 64 contacting internal surface 30 to provide a fluid tight seal . other beads such as first bead 60 could also contact inner surface 30 . in this embodiment , the only possible source of fluid leakage is past the external portion of first bead 62 . in the embodiment of fig3 , a leakage could occur along internal surface 70 of the ferrule 52 as well as along an external surface 72 of the ferrule 52 . providing one or more beads such as 60 , 62 is a process discussed in various other patents other than that of the applicant such as u . s . pat . no . 5 , 573 , 285 and others . the second end 16 may be machined to provide inwardly directed threads 81 which can then cooperate with a screw in orifice 80 . orifice 80 may have outwardly directed threads which can provide a situation where the second end 16 is internally tapped such as to provide 5 / 16 threads internal to the inner bore . then , a cooperating orifice 80 such as shown in fig5 can be screwed therein with outwardly directed threads 82 . the inwardly directed threads 84 at the second end 16 . in addition to having the outwardly directed threads 82 , the outwardly directed threads 82 are preferably spaced by channel 86 from first row conical section 88 which may begin radially at the termination of the threads 82 and can extend radially outwardly preferably at least a substantial portion of the thickness of the tube portion 22 , if not past tube portion 22 so that when the orifice 80 is screwed on to the second section 22 , the first conical section 88 effectively forms a seal at the second end 16 as shown in fig1 and 5 to form a fluid tight seal . the flats 90 can cooperate with a wrench to provide the appropriate amount of torque . the orifice 80 provides a measured flow path to a air shutter ( not shown ) internal to an oven and to provide a fuel / gas mixture to an internal broiler element for use by a gas oven . numerous alterations of the structure herein disclosed will suggest themselves to those skilled in the art . however , it is to be understood that the present disclosure relates to the preferred embodiment of the invention which is for purposes of illustration only and not to be construed as a limitation of the invention . all such modifications which do not depart from the spirit of the invention are intended to be included within the scope of the appended claims .	8
with reference to fig1 , a metering rod assembly is illustrated and identified generally by reference numeral 10 . the metering rod assembly 10 is illustrated as a component of a machine for applying a coating to paper during a paper manufacturing process . it will be appreciated that the metering rod assembly 10 is supported by a support 12 adjacent a roller 14 which advances a web of paper 16 between the metering rod assembly 10 and the roller 14 . although not shown , it is well known that an applicator is generally provided upstream of the metering rod assembly 10 for applying a coating liquid to the web 16 . the coating is applied in excess and the metering rod assembly 10 is utilized to remove excess coating from the web 16 to achieve a desired coating thickness . the metering rod assembly 10 generally includes a base member 30 that is mounted to the support 12 . with additional reference to fig2 and 3 , the base member 30 includes a channel 34 opening to a face or surface 36 thereof . the channel is generally defined by first and second sidewalls 40 a and 40 b that are spaced about a central plane a - a of the channel 34 . in this embodiment , the first and second side walls 40 a and 40 b of the channel 34 extend at a non - zero angle 41 relative to a central plane a - a of the channel 34 such that the mouth of the channel 34 is wider than a base portion of the channel 34 . the channel 34 further includes upper and lower retention slots 42 a and 42 b for receiving corresponding retention elements on a rod bed insert , as will be described below . a rod bed insert 46 is received in the channel 34 and includes a metering rod slot 50 in which a metering rod 54 is supported . the rod bed insert 46 is configured to be closely received within the channel 34 , with first and second sidewalls 56 a and 56 b of the insert 46 have a mating shape and slope to the first and second side walls 40 a and 40 b of the channel 34 . the rod bed insert 46 includes a narrow or necked - down portion 57 connecting the first and second sidewalls 56 a and 56 b allowing the insert 46 to flex about the necked - down portion 57 to accommodate insertion and / or removal of the metering rod 54 from the metering rod slot 50 . the rod bed insert 46 includes a pair of tab portions 58 a and 58 b that serve as retaining elements when the rod bed insert 46 is inserted in the channel 34 . as best seen in fig1 and 2 , the retention tabs 58 a and 58 b extend into corresponding retention slots 42 a and 42 b at the base of the channel 34 . once the tabs 58 a and 58 b are secured in the slots 42 a and 42 b , the interference between the tabs 58 a and 58 b and the base member 30 restricts withdrawal of the rod bed insert 46 from the channel 34 . returning to fig1 , a pressure tube 60 is supported adjacent the base member 30 and configured to apply a force along the plane a - a to place the metering rod 54 in compressing engagement with the roller 14 , as is conventional . in the illustrated embodiment , the pressure tube 60 acts along the plane a - a . the pressure tube 60 can also be configured to apply pressure along a plane offset from the plane a - a . unlike prior art metering rod assemblies , a single pressure tube is utilized to not only place the metering rod 54 into compressive engagement with the roller 14 , but also to clamp the metering rod 54 and / or rod bed insert 46 in the base member 30 . to this end , it will be appreciated that when force is applied to a rear surface 64 of the base member 30 , the force is transmitted through the base member 30 and rod bed insert 46 to the metering rod 54 . a reactive force is applied to the metering rod 54 by the roller 14 which tends to force the metering rod 54 deeper into the rod bed insert 46 . the net effect is that surfaces 40 a and 40 b are urged towards each other thereby clamping the rod bed insert 46 and / or metering rod 54 in the channel 34 of the base member 30 . as the force urges the insert 46 deeper into the channel 34 , the interaction of the sloping surfaces 56 a and 56 b with sloping surfaces 40 a and 40 b urges the sides of the insert 46 together gripping the rod more tightly . it will be appreciated that , for a given pressure applied to the base member 30 by the pressure tube 60 , the clamping force can be altered by changing the angle of surfaces 40 a and 40 b relative to the plane a - a . for example , a relatively shallow angle , such as 20 degrees , will produce more clamping force on the rod bed insert 46 than a relatively steeper angle , such as 40 degrees . accordingly , depending on the specific application , the clamping effect can be tuned to achieve desired performance . for example , an application requiring light pressure on the metering rod may benefit from a relative steep angle of side walls 40 a and 40 b ( greater clamping force at lower pressure on the metering rod ), while an application requiring higher pressure on the metering rod may benefit from a more shallow angle ( less clamping force at higher pressure on the metering rod ). turning to fig4 , another exemplary metering rod assembly is illustrated and identified generally by reference numeral 80 . this embodiment is essentially identical to the metering rod assembly 10 of fig1 - 3 , with the exception of a hinge feature of the base member . accordingly , the assembly 80 includes a base member 82 having a mounting portion 84 adapted to be secured to a support ( not shown ), a head portion 86 , and a reduced cross - section hinge portion 88 connecting the head portion 86 and the mounting portion 84 . a rod bed insert 92 is received in a channel 94 of the base member 82 in a similar manner to the rod bed insert 46 of fig1 - 3 . the channel 94 includes first and second side walls 95 a and 95 b spaced about an axis or plane b - b . in this embodiment , the hinge portion 88 facilitates flexing of the head portion 86 relative to the mounting portion 84 when a force is applied to the head portion 86 , such as by a pressure tube ( e . g ., pressure tube 60 of fig1 ). such flexing generally rotates the head portion 86 counterclockwise relative to the mounting portion 84 such that an upper jaw 96 including side wall 95 a is urged towards a lower jaw 98 including side wall 95 b thereby clamping the rod bed insert 92 and / or a metering rod in the channel 94 of the base member 82 . in this embodiment , it may be advantageous to position the pressure tube to apply force to the head portion 86 at a position above plane b - b to increase the levering effect and clamping force generated . as with the embodiment of fig1 - 3 , the angle of side surfaces 95 a and 95 b relative to plane b - b can dictate the level of clamping force generated when the metering rod assembly is in use . unlike the previous embodiment , however , the present embodiment optionally allows for elimination of the angled side walls of the channel 94 since the upper jaw 96 is urged towards lower jaw 98 resulting in a clamping effect independent of the clamping effect generated by angled side walls . the exemplary embodiment has been described with reference to the preferred embodiments . obviously , modifications and alterations will occur to others upon reading and understanding the preceding detailed description . it is intended that the exemplary embodiment be construed as including all such modifications and alterations insofar as they come within the scope of the appended claims or the equivalents thereof .	8
in the following description , various embodiments of the present invention will be described . for purposes of explanation , specific configurations and details are set forth in order to provide a thorough understanding of the embodiments . however , it will also be apparent to one skilled in the art that the present invention may be practiced without the specific details . furthermore , well - known features may be omitted or simplified in order not to obscure the embodiment being described . the kinematic linkage structures and control systems described herein are particularly beneficial in helping system users to arrange the robotic structure of a procedure on a particular patient . along with actively driven manipulators used to interact with tissues and the like during treatment , robotic surgical systems may have one or more kinematic linkage systems that are configured to support and help align the manipulator structure with the surgical work site . these set - up systems may be actively driven or may be passive , so that they are manually articulated and then locked into the desired configuration while the manipulator is used therapeutically . the passive set - up kinematic systems may have advantages in size , weight , complexity , and cost . unfortunately , a plurality of manipulators may be used to treat tissues of each patient , the manipulators may each independently benefit from accurate positioning so as to allow the instrument supported by that instrument to have the desired motion throughout the workspace , and minor changes in the relative locations of adjacent manipulators may have significant impact on the interactions between manipulators ( with poorly positioned manipulators potentially colliding or having their range and / or ease of motion significantly reduced ). hence , the challenges of quickly arranging the robotic system in preparation for surgery can be significant . one option is to mount multiple manipulators to a single platform , with the manipulator - supporting platform sometimes being referred to as an orienting platform . the orienting platform can be supported by an actively driven support linkage ( sometimes referred to herein as a set - up structure , and typically having a set - up structure linkage , etc .) the system may also provide and control motorized axes of the robotic set - up structure supporting the orienting platform with some kind of joystick or set of buttons that would allow the user to actively drive those axes as desired in an independent fashion . this approach , while useful in some situations , may suffer from some disadvantages . in particular , it may be difficult to locate a drive button for all the elements of a complex system so that each is accessible to users approaching the system in all its potential configurations . while individual clutch buttons might also be used to release the brake or drive system , the possibility of confusion may remain between buttons having different functions . furthermore , both sterile and non - sterile members of a surgical team may want to articulate some joints or linkages ( such as by grabbing differing locations inside or outside the sterile field ). hence a more intuitive and flexible user interface would be desirable . this is particularly true of an orienting platform for use in multi - quadrant surgery , or for a structure that supports a plurality of surgical manipulators and may pivot about an axis extending at least roughly vertically so as to orient the manipulators relative to a patient on a surgical table or other support . referring now to the drawings , in which like reference numerals represent like parts throughout the several views , fig1 is a plan view illustration of a minimally invasive robotic surgical ( mirs ) system 10 , typically used for performing a minimally invasive diagnostic or surgical procedure on a patient 12 who is lying down on an operating table 14 . the system can include a surgeon &# 39 ; s console 16 for use by a surgeon 18 during the procedure . one or more assistants 20 may also participate in the procedure . the mirs system 10 can further include a patient side cart 22 ( surgical robot ) and an electronics cart 24 . the patient side cart 22 can manipulate at least one removably coupled tool assembly 26 ( hereinafter simply referred to as a “ tool ”) through a minimally invasive incision in the body of the patient 12 while the surgeon 18 views the surgical site through the console 16 . an image of the surgical site can be obtained by an endoscope 28 , such as a stereoscopic endoscope , which can be manipulated by the patient side cart 22 to orient the endoscope 28 . the electronics cart 24 can be used to process the images of the surgical site for subsequent display to the surgeon 18 through the surgeon &# 39 ; s console 16 . the number of surgical tools 26 used at one time will generally depend on the diagnostic or surgical procedure and the space constraints within the operating room among other factors . if it is necessary to change one or more of the tools 26 being used during a procedure , an assistant 20 may remove the tool 26 from the patient side cart 22 , and replace it with another tool 26 from a tray 30 in the operating room . fig2 is a perspective view of the surgeon &# 39 ; s console 16 . the surgeon &# 39 ; s console 16 includes a left eye display 32 and a right eye display 34 for presenting the surgeon 18 with a coordinated stereo view of the surgical site that enables depth perception . the console 16 further includes one or more input control devices 36 , which in turn cause the patient side cart 22 ( shown in fig1 ) to manipulate one or more tools . the input control devices 36 can provide the same degrees of freedom as their associated tools 26 ( shown in fig1 ) to provide the surgeon with telepresence , or the perception that the input control devices 36 are integral with the tools 26 so that the surgeon has a strong sense of directly controlling the tools 26 . to , this end , position , force , and tactile feedback sensors ( not shown ) may be employed to transmit position , force , and tactile sensations from the tools 26 back to the surgeon &# 39 ; s hands through the input control devices 36 . the surgeon &# 39 ; s console 16 is usually located in the same room as the patient so that the surgeon may directly monitor the procedure , be physically present if necessary , and speak to an assistant directly rather than over the telephone or other communication medium . however , the surgeon can be located in a different room , a completely different building , or other remote location from the patient allowing for remote surgical procedures . fig3 is a perspective view of the electronics cart 24 . the electronics cart 24 can be coupled with the endoscope 28 and can include a processor to process captured images for subsequent display , such as to a surgeon on the surgeon &# 39 ; s console , or on another suitable display located locally and / or remotely . for example , where a stereoscopic endoscope is used , the electronics cart 24 can process the captured images to present the surgeon with coordinated stereo images of the surgical site . such coordination can include alignment between the opposing images and can include adjusting the stereo working distance of the stereoscopic endoscope . as another example , image processing can include the use of previously determined camera calibration parameters to compensate for imaging errors of the image capture device , such as optical aberrations . fig4 diagrammatically illustrates a robotic surgery system 50 ( such as mirs system 10 of fig1 ). as discussed above , a surgeon &# 39 ; s console 52 ( such as surgeon &# 39 ; s console 16 in fig1 ) can be used by a surgeon to control a patient side cart ( surgical robot ) 54 ( such as patent side cart 22 in fig1 ) during a minimally invasive procedure . the patient side cart 54 can use an imaging device , such as a stereoscopic endoscope , to capture images of the procedure site and output the captured images to an electronics cart 56 ( such as the electronics cart 24 in fig1 ). as discussed above , the electronics cart 56 can process the captured images in a variety of ways prior to any subsequent display . for example , the electronics cart 56 can overlay the captured images with a virtual control interface prior to displaying the combined images to the surgeon via the surgeon &# 39 ; s console 52 . the patient side cart 54 can output the captured images for processing outside the electronics cart 56 . for example , the patient side cart 54 can output the captured images to a processor 58 , which can be used to process the captured images . the images can also be processed by a combination the electronics cart 56 and the processor 58 , which can be coupled together to process the captured images jointly , sequentially , and / or combinations thereof . one or more separate displays 60 can also be coupled with the processor 58 and / or the electronics cart 56 for local and / or remote display of images , such as images of the procedure site , or other related images . processor 58 will typically include a combination of hardware and software , with the software comprising tangible media embodying computer readable code instructions for performing the method steps of the control functionally described herein . the hardware typically includes one or more data processing boards , which may be co - located but will often have components distributed among the robotic structures described herein . the software will often comprise a non - volatile media , and could also comprise a monolithic code but will more typically comprise a number of subroutines , optionally running in any of a wide variety of distributed data processing architectures . fig5 a and 5b show a patient side cart 22 and a surgical tool 62 , respectively . the surgical tool 62 is an example of the surgical tools 26 . the patient side cart 22 shown provides for the manipulation of three surgical tools 26 and an imaging device 28 , such as a stereoscopic endoscope used for the capture of images of the site of the procedure . manipulation is provided by robotic mechanisms having a number of robotic joints . the imaging device 28 and the surgical tools 26 can be positioned and manipulated through incisions in the patient so that a kinematic remote center is maintained at the incision to minimize the size of the incision . images of the surgical site can include images of the distal ends of the surgical tools 26 when they are positioned within the field - of - view of the imaging device 28 . surgical tools 26 are inserted into the patient by inserting a tubular cannula 64 through a minimally invasive access aperture such as an incision , natural orifice , percutaneous penetration , or the like . cannula 64 is mounted to the robotic manipulator arm and the shaft of surgical tool 26 passes through the lumen of the cannula . the manipulator arm may transmit signals indicating that the cannula has been mounted thereon . fig6 is a perspective schematic representation of a robotic surgery system 70 , in accordance with many embodiments . the surgery system 70 includes a mounting base 72 , a support linkage 74 , an orienting platform 76 , a plurality of outer set - up linkages 78 ( two shown ), a plurality of inner set - up linkages 80 ( two shown ), and a plurality of surgical instrument manipulators 82 . each of the manipulators 82 is operable to selectively articulate a surgical instrument mounted to the manipulator 82 and insertable into a patient along an insertion axis . each of the manipulators 82 is attached to and supported by one of the set - up linkages 78 , 80 . each of the outer set - up linkages 78 is rotationally coupled to and supported by the orienting platform 76 by a first set - up linkage joint 84 . each of the inner set - up linkages 80 is fixedly attached to and supported by the orienting platform 76 . the orienting platform 76 is rotationally coupled to and supported by the support linkage 74 . and the support linkage 74 is fixedly attached to and supported by the mounting base 72 . in many embodiments , the mounting base 72 is a movable and floor supported , thereby enabling selective repositioning of the overall surgery system 70 , for example , within an operating room . the mounting base 72 can include a steerable wheel assembly and / or any other suitable support features that provide for both selective repositioning as well as selectively preventing movement of the mounting base 72 from a selected position . the mounting base 72 can also have other suitable configurations , for example , a ceiling mount , fixed floor / pedestal mount , a wall mount , or an interface configured for being supported by any other suitable mounting surface . the support linkage 74 is operable to selectively position and / or orient the orienting platform 76 relative to the mounting base 72 . the support linkage 74 includes a column base 86 , a translatable column member 88 , a shoulder joint 90 , a boom base member 92 , a boom first stage member 94 , a boom second stage member 96 , and a wrist joint 98 . the column base 86 is fixedly attached to the mounting base 72 . the translatable column member 88 is slideably coupled to the column base 86 for translation relative to column base 86 . in many embodiments , the translatable column member 88 translates relative to the column base 86 along a vertically oriented axis . the boom base member 92 is rotationally coupled to the translatable column member 88 by the shoulder joint 90 . the shoulder joint 90 is operable to selectively orient the boom base member 92 in a horizontal plane relative to the translatable column member 88 , which has a fixed angular orientation relative to the column base 86 and the mounting base 72 . the boom first stage member 94 is selectively translatable relative to the boom base member 92 in a horizontal direction , which in many embodiments is aligned with both the boom base member 92 and the boom first stage member 94 . the boom second stage member 96 is likewise selectively translatable relative to the boom first stage member 94 in a horizontal direction , which in many embodiments is aligned with the boom first stage member 94 and the boom second stage member 96 . accordingly , the support linkage 74 is operable to selectively set the distance between the shoulder joint 90 and the distal end of the boom second stage member 96 . the wrist joint 98 rotationally couples the distal end of the boom second stage member 96 to the orienting platform 76 . the wrist joint 98 is operable to selectively set the angular orientation of the orienting platform 76 relative to the mounting base 72 . each of the set - up linkages 78 , 80 is operable to selectively position and / or orient the associated manipulator 82 relative to the orienting platform 76 . each of the set - up linkages 78 , 80 includes a set - up linkage base link 100 , a set - up linkage extension link 102 , a set - up linkage parallelogram linkage portion 104 , a set - up linkage vertical link 106 , a second set - up linkage joint 108 , and a manipulator support link 110 . in each of the set - up linkage base links 100 of the outer set - up linkages 78 can be selectively oriented relative to the orienting platform 76 via the operation of the a first set - up linkage joint 84 . in the embodiment shown , each of the set - up linkage base links 100 of the inner set - up linkages 80 is fixedly attached to the orienting platform 76 . each of the inner set - up linkages 80 can also be rotationally attached to the orienting platform 76 similar to the outer set - up linkages via an additional first set - up linkage joints 84 . each of the set - up linkage extension links 102 is translatable relative to the associated set - up linkage base link 100 in a horizontal direction , which in many embodiments is aligned with the associated set - up linkage base link and the set - up linkage extension link 102 . each of the set - up linkage parallelogram linkage portions 104 configured and operable to selectively translate the set - up linkage vertical link 106 in a vertical direction while keeping the set - up linkage vertical link 106 vertically oriented . in example embodiments , each of the set - up linkage parallelogram linkage portions 104 includes a first parallelogram joint 112 , a coupling link 114 , and a second parallelogram 116 . the first parallelogram joint 112 rotationally couples the coupling link 114 to the set - up linkage extension link 102 . the second parallelogram joint 116 rotationally couples the set - up linkage vertical link 106 to the coupling link 114 . the first parallelogram joint 112 is rotationally tied to the second parallelogram joint 116 such that rotation of the coupling link 114 relative to the set - up linkage extension link 102 is matched by a counteracting rotation of the set - up linkage vertical link 106 relative to the coupling link 114 so as to maintain the set - up linkage vertical link 106 vertically oriented while the set - up linkage vertical link 106 is selectively translated vertically . the second set - up linkage joint 108 is operable to selectively orient the manipulator support link 110 relative to the set - up linkage vertical link 106 , thereby selectively orienting the associated attached manipulator 82 relative to the set - up linkage vertical link 106 . fig7 is a perspective schematic representation of a robotic surgery system 120 , in accordance with many embodiments . because the surgery system 120 includes components similar to components of the surgery system 70 of fig6 , the same reference numbers are used for similar components and the corresponding description of the similar components set forth above is applicable to the surgery system 120 and is omitted here to avoid repetition . the surgery system 120 includes the mounting base 72 , a support linkage 122 , an orienting platform 124 , a plurality of set - up linkages 126 ( four shown ), and a plurality of the surgical instrument manipulators 82 . each of the manipulators 82 is operable to selectively articulate a surgical instrument mounted to the manipulator 82 and insertable into a patient along an insertion axis . each of the manipulators 82 is attached to and supported by one of the set - up linkages 126 . each of the set - up linkages 126 is rotationally coupled to and supported by the orienting platform 124 by the first set - up linkage joint 84 . the orienting platform 124 is rotationally coupled to and supported by the support linkage 122 . and the support linkage 122 is fixedly attached to and supported by the mounting base 72 . the support linkage 122 is operable to selectively position and / or orient the orienting platform 124 relative to the mounting base 72 . the support linkage 122 includes the column base 86 , the translatable column member 88 , the shoulder joint 90 , the boom base member 92 , the boom first stage member 94 , and the wrist joint 98 . the support linkage 122 is operable to selectively set the distance between the shoulder joint 90 and the distal end of the boom first stage member 94 . the wrist joint 98 rotationally couples the distal end of the boom first stage member 94 to the orienting platform 124 . the wrist joint 98 is operable to selectively set the angular orientation of the orienting platform 124 relative to the mounting base 72 . each of the set - up linkages 126 is operable to selectively position and / or orient the associated manipulator 82 relative to the orienting platform 124 . each of the set - up linkages 126 includes the set - up linkage base link 100 , the set - up linkage extension link 102 , the set - up linkage vertical link 106 , the second set - up linkage joint 108 , a tornado mechanism support link 128 , and a tornado mechanism 130 . each of the set - up linkage base links 100 of the set - up linkages 126 can be selectively oriented relative to the orienting platform 124 via the operation of the associated first set - up linkage joint 84 . each of the set - up linkage vertical links 106 is selectively translatable in a vertical direction relative to the associated set - up linkage extension link 102 . the second set - up linkage joint 108 is operable to selectively orient the tornado mechanism support link 128 relative to the set - up linkage vertical link 106 each of the tornado mechanisms 130 includes a tornado joint 132 , a coupling link 134 , and a manipulator support 136 . the coupling link 134 fixedly couples the manipulator support 136 to the tornado joint 132 . the tornado joint 130 is operable to rotate the manipulator support 136 relative to the tornado mechanism support link 128 around a tornado axis 136 . the tornado mechanism 128 is configured to position and orient the manipulator support 134 such that the remote center of manipulation ( rc ) of the manipulator 82 is intersected by the tornado axis 136 . accordingly , operation of the tornado joint 132 can be used to reorient the associated manipulator 82 relative to the patient without moving the associated remote center of manipulation ( rc ) relative to the patient . fig8 is a simplified representation of a robotic surgery system 140 , in accordance with many embodiments , in conformance with the schematic representation of the robotic surgery system 120 of fig7 . because the surgery system 140 conforms to the robotic surgery system 120 of fig7 , the same reference numbers are used for analogous components and the corresponding description of the analogous components set forth above is applicable to the surgery system 140 and is omitted here to avoid repetition . the support linkage 122 is configured to selectively position and orient the orienting platform 124 relative to the mounting base 72 via relative movement between links of the support linkage 122 along multiple set - up structure axes . the translatable column member 88 is selectively repositionable relative to the column base 86 along a first set - up structure ( sus ) axis 142 , which is vertically oriented in many embodiments . the shoulder joint 90 is operable to selectively orient the boom base member 92 relative to the translatable column member 88 around a second sus axis 144 , which is vertically oriented in many embodiments . the boom first stage member 94 is selectively repositionable relative to the boom base member 92 along a third sus axis 146 , which is horizontally oriented in many embodiments . the wrist joint 98 is operable to selectively orient the orienting platform 124 relative to the boom first stage member 94 around a fourth sus axis 148 , which is vertically oriented in many embodiments . each of the set - up linkages 126 is configured to selectively position and orient the associated manipulator 82 relative to the orienting platform 124 via relative movement between links of the set - up linkage 126 along multiple set - up joint ( suj ) axes . each of the first set - up linkage joint 84 is operable to selectively orient the associated set - up linkage base link 100 relative to the orienting platform 124 around a first suj axis 150 , which in many embodiments is vertically oriented . each of the set - up linkage extension links 102 can be selectively repositioned relative to the associated set - up linkage base link 10 along a second suj axis 152 , which is horizontally oriented in many embodiments . each of the set - up linkage vertical links 106 can be selectively repositioned relative to the associated set - up linkage extension link 102 along a third suj axis 154 , which is vertically oriented in many embodiments . each of the second set - up linkage joints 108 is operable to selectively orient the tornado mechanism support link 128 relative to the set - up linkage vertical link 106 around the third suj axis 154 . each of the tornado joints 132 is operable to rotate the associated manipulator 82 around the associated tornado axis 138 . fig9 illustrates rotational orientation limits of the set - up linkages 126 relative to the orienting platform 124 , in accordance with many embodiments . each of the set - up linkages 126 is shown in a clockwise limit orientation relative to the orienting platform 124 . a corresponding counter - clockwise limit orientation is represented by a mirror image of fig9 relative to a vertically - oriented mirror plane . as illustrated , each of the two inner set - up linkages 126 can be oriented from 5 degrees from a vertical reference 156 in one direction to 75 degrees from the vertical reference 156 in the opposite direction . and as illustrated , each of the two outer set - up linkages can be oriented from 15 degrees to 95 degrees from the vertical reference 156 in a corresponding direction . in use , it will often be desirable for a surgical assistant , surgeon , technical support , or other user to configure some or all of the linkages of robotic surgical system 140 for surgery , including the set - up structure linkage , the set - up joints , and / or each of the manipulators . included among the task in configuring these linkages will be positioning the orienting platform 124 relative to first stage member 94 about vertical fourth sus axis 148 of wrist joint 98 . a joint drive motor 121 and / or brake system 123 is coupled to wrist joint 98 , with one exemplary embodiment including both a drive 121 and brake 123 . additionally , a joint sensor system will typically sense an angular configuration or position of wrist joint 98 . an exemplary user interface , system , and method for manually configuring the system for use will be described herein with reference to manual articulation of orienting platform 124 by articulation of wrist joint 98 about fourth sus axis 148 , as schematically illustrated by arrow 127 . it should be understood that alternative embodiments may be employed to articulate one or more alternative joints of the overall kinematic system , including one or more alternative joints of the set - up structure , one or more of the set - up joints , or one or more of the joints of the manipulators linkages . use of the exemplary embodiment for articulating the motorized wrist joint embodiments may allow a user to efficiently position manipulators 82 . the manual articulation of wrist joint 98 as described herein can improve speed and ease of use while manually docking manipulators 82 to their associated cannulas 64 , as shown in fig5 b . fig1 shows a center of gravity diagram associated with a rotational limit of a support linkage for a robotic surgery system 160 , in accordance with many embodiments . with components of the robotic surgery system 160 positioned and oriented to shift the center - of - gravity 162 of the robotic surgery system 160 to a maximum extent to one side relative to a support linkage 164 of the surgery system 160 , a shoulder joint of the support linkage 164 can be configured to limit rotation of the support structure 164 around a set - up structure ( sus ) shoulder - joint axis 166 to prevent exceeding a predetermined stability limit of the mounting base . fig1 schematically illustrates a method for positioning orienting platform 124 by articulating wrist joint 98 . as generally described above , robotic system 140 may be used in a master following mode to treat tissues and the like . the robotic system will typically halt following , and will start 131 a configuration mode which allows a user to manually configure the orienting platform in a desired orientation about fourth sus axis 148 . once the configuration mode has been entered , the current angle θ c of wrist joint 98 , as sensed by the joint sensor system , is set as the desired angle θ d in step 133 . if a cannula is mounted to any of the manipulators supported by platform 124 , the system may apply the brake to the wrist joint and exit the configuration mode so as to inhibit manual movement of the wrist joint via step 135 . while in the configuration mode , when the platform is not moving about the wrist joint the system processor will typically transmit signals to the joint motor associated with wrist joint 98 so as to maintain the set desired angle θ d . hence , when the system is bumped , pushed , or pulled lightly the wrist motor may urge the platform back toward the desired angle by applying a joint torque per an error e that varies with the difference between the sensed joint position and the desired joint position : this driving of the joint toward the desired pose in step 137 will often be limited to allow a user to overcome the servoing of the wrist joint by applying sufficient effort 139 against the linkage system . for example , when the joint sensing system indicates a displacement of the joint beyond a threshold amount , when the torque being applied to the motor to counteract the applied force reaches a threshold amount , when a sensed force applied to the linkage system distally of the joint exceeds a threshold amount , or the like , the processor may halt servoing of the wrist joint to counteract articulation of the joint . in some embodiments there may be a time element of the effort threshold to overcome the servoing , such as by halting servoing in response to a torque that exceeds a threshold for a time that exceeds a threshold . still other options are possible , including more complex relationships between the threshold force or torque and time , sensing that the force is applied to a particular linkage or subset of linkages supported by the wrist ( or other articulatable joint ), and the like . in an exemplary embodiment , a joint sensor between the orienting platform and the rest of the setup structure system provides a signal used to estimate torque applied to the orienting platform , and the joint displacement and servo stiffness are used to estimate a disturbance torque applied to the surgical arms and / or setup joints . in an additional exemplary embodiment , the error signal may be filtered so as to make the system more sensitive to transient pushes than slow or steady - state signals . such error filtering may make the trigger more sensitive while limiting false triggers when the setup structure is on a sloped surface . when a user pushes or pulls on one or more of the surgical manipulators , the set - up joint linkages , or directly on the platform with an effort sufficient to exceed the desired articulation threshold the user is able to rotate the orienting platform without having to fight the servo control . although servoing so as to counteract the user movement of the platform is halted in step 141 , drive signals may still be sent to the wrist motor . for example , friction compensation , gravity compensation , momentum compensation , and or the like may be provided 143 by applying appropriate drive signals during manual movement of the platform . exemplary compensation drive systems are more fully described in us patent publication 2009 / 0326557 in the name of neimeyer and entitled “ friction compensation in a minimally invasive surgical apparatus ,” in us patent publication 2011 / 0009880 in the name of prisco et al . and entitled “ control system for reducing internally generated frictional and inertial resistance to manual positioning of a surgical manipulator ,” and the like . in some embodiments , the system may employ joint range of motion limits alone or in addition to the drive signals when servoing is halted . such range of motion limits may respond similar to servoing when a user pushes beyond a range motion limit except they are one sided . once the user has manually articulated to wrist near the desired orientation , the user will tend to slow the platform down and upon reaching the desired configuration will halt movement of the platform . the system takes advantage of this , and as the joint sensor indicates that movement of the platform falls below a desired threshold of zero the processor may , in response , re - set the desired joint angle and re - initiate servoing ( or braking ) so as to inhibit movement from that joint position . as the user may want to reverse direction of the manual joint articulation to correct any overshoot , the processor may not re - engage the servo until the articulation speed remains below a threshold for a desired dwell period . other variations are within the spirit of the present invention . thus , while the invention is susceptible to various modifications and alternative constructions , certain illustrated embodiments thereof are shown in the drawings and have been described above in detail . it should be understood , however , that there is no intention to limit the invention to the specific form or forms disclosed , but on the contrary , the intention is to cover all modifications , alternative constructions , and equivalents falling within the spirit and scope of the invention , as defined in the appended claims . the use of the terms “ a ” and “ an ” and “ the ” and similar referents in the context of describing the invention ( especially in the context of the following claims ) are to be construed to cover both the singular and the plural , unless otherwise indicated herein or clearly contradicted by context . the terms “ comprising ,” “ having ,” “ including ,” and “ containing ” are to be construed as open - ended terms ( i . e ., meaning “ including , but not limited to ,”) unless otherwise noted . the term “ connected ” is to be construed as partly or wholly contained within , attached to , or joined together , even if there is something intervening . recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range , unless otherwise indicated herein , and each separate value is incorporated into the specification as if it were individually recited herein . all methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context . the use of any and all examples , or exemplary language ( e . g ., “ such as ”) provided herein , is intended merely to better illuminate embodiments of the invention and does not pose a limitation on the scope of the invention unless otherwise claimed . no language in the specification should be construed as indicating any non - claimed element as essential to the practice of the invention . preferred embodiments of this invention are described herein , including the best mode known to the inventors for carrying out the invention . variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description . the inventors expect skilled artisans to employ such variations as appropriate , and the inventors intend for the invention to be practiced otherwise than as specifically described herein . accordingly , this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law . moreover , any combination of the above - described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context . all references , including publications , patent applications , and patents , cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein .	0
several embodiments described herein relate to methods and apparatus for use in connection with the translation and use of electronic business data in one or more computer networks . as will be apparent , however , the methods and apparatus are equally applicable in connection with any suitable type of data and files . in one embodiment , the system is composed of four modules . the first module is primary and is composed of activation functions . the second module consists of the sales function . it is further composed of the purchase , invoice , and authorization transactions . the third module is the shipping function . it is composed of shipping status and product return transactions . the fourth module is the accounts receivable function which is composed of payment authorization , sales on account , and account status transactions . with respect to business information data that will be used , the present embodiment is a system which provides full e - commerce functionality from the trading partner &# 39 ; s or third party &# 39 ; s computer system to the client &# 39 ; s back office , including software such as a specific accounting software application used by the client . with respect to the functionality , the system can function with a diverse variety of front office systems as well as a diverse number of back office systems . the present invention provides the means for a group of data to be used by one or more applications which may not be otherwise compatible . a back office system is typically composed of one or more servers , and a suite of software applications that provide a backbone for the client &# 39 ; s internal business operations . the commerce server &# 39 ; s operating system would normally compliment the back office operating system , for example windows 98 by microsoft . some examples of software application suites that would be found in the back office are people soft , myob and peachtree . various methods and systems for identifying business information data on a remotely - hosted database are also disclosed . broadly , one system method includes the steps of : ( 1 ) processing , at an originating computer , transaction data from an application suite ; ( 2 ) generating standardized data transactions , based on earlier definitions of what that data should be ; ( 3 ) sending , from the originating computer to a destination computer , the standardized transaction data ; ( 4 ) receiving , at the destination computer , transaction data from the originating computer ; ( 5 ) generating transaction data based on the attributes of the destination computer , and storing the transaction data in a file on the destination computer ; and ( 6 ) processing , at the destination computer , transaction data from the data file into a target application suite . the disclosed embodiments provide a means for users to manage their business and financial information in various servers over a computer network . in return , e - business companies such as business - to - consumer ( b2c ) companies are supplied the opportunity to provide services of value to their customers by having a more dynamic interface from the front office , for instance their web site , to the back office software application suites , and vice versa . in addition , computers are being used to automatically exchange data with other businesses as in a business - to - business ( b2b ) situation , and between geographically diverse offices within the same business , also known as a business - to - enterprise ( b2e ) situation . computers and other intelligent devices are becoming required for the management and sharing of data , and the present invention takes advantage of the intelligence and flexibility of these devices to create better ways of managing , sorting , sharing , exchanging and interacting with various forms of data . in a hypothetical situation , a client would approach a vendor selling a product and / or service , and request the same product and / or service . the vendor may then need to either install physical hardware or adapt existing hardware to accommodate the requirements of the present invention . for example , a client would typically have a network system with an application server such as an ibm pentium iii based system running the microsoft windows nt operating system . this application server would further have the client &# 39 ; s business applications relating to financial , sales , account receivable , accounts payable , shipping software modules or packages . examples of these software packages include the peachtree accounting software , the intuit quickbooks software package , and other legacy software systems . using the various software applications , the client starts the exchange of information leading to the completion of the intended business function . this business function would typically begin with an exchange of business information , which includes locations , contact names , product catalog , and monetary rates . the client would then send a “ purchase order ”, which describes the intent of the client to purchase a product and / or service from the vendor . the purchase order is followed by the “ invoice ”, which details the products and / or services being purchased and includes pricing , fees , costs , and accepted payment methods . the invoice is followed by the “ payment authorization ,” which identifies the payment method , accounting information and financial institution from which funds will be drawn . the vendor finalizes the business function when payment is received and the client &# 39 ; s account has been balanced in the system . more detailed description is provided , to teach one skilled in the art , how to make and use the best mode of the inventions . phase i is the activation phase , where the invention is installed and configuration information is established , as it relates to the functionality of the present invention . phase ii is the processing phase , where the individual transactions which make up business conversations or exchanges , are handled . [ 0082 ] fig1 . shows a block diagram of a system 100 which includes a plurality of servers connected through one or more networks 104 and 105 . as shown in fig1 the computer system 100 includes a web host server 101 , a third party server 102 , a commerce server 103 , and an application server 106 . each server shown in fig1 may include a plurality of servers corresponding to the single server , all of which function within a system 100 . for example , application server 106 may include one or more “ control ” servers and one or more “ database ” servers . if the internet is utilized as one or more of network 104 , web servers , which are not shown , may also be used as intermediary servers within network 104 . [ 0083 ] fig1 further describes the interrelationship between the basic components used in activating , initializing and operating the present embodiment of the invention . the commerce server 103 is connected to the application server 106 via a network connection 105 which could also be any suitable direct connection . the commerce server 103 could also be co - located whereby equipment owned by a client can be located with other elements of the present invention in order to provide the best interconnection between devices . it is also possible that there could be more than one application server 106 as well as more than one commerce server 103 . all servers in system 100 may be either local or remote in reference to the physical location of commerce server 103 . in addition to user interaction through direct keyboard input and display output , each server in system 100 of fig1 may allow the ability to start processes and direct resources from an appropriately connected , remote user workstation . the present invention generates transactions that can function over any standard network to which the commerce server is connected , in this instance networks 104 and 105 . server 103 directs resources on server 106 using rpc over network 105 . examples of a typical network 104 or a typical network 105 , with which the present invention could function , are a wan ( wide area network ), a communications network that covers a wide geographic area such as state or country , a lan ( local area network ) or a network generally contained within a building or complex , or man ( metropolitan area network ), a network that generally covers a city or suburb . further examples are a large network made up of a number of smaller networks , and the internet , which is made up of many millions of computers in more than one hundred countries . [ 0086 ] fig2 is a diagram of the web host server 101 of fig1 which may be representative of one or more other web host servers . web host server 101 includes a central processing unit ( cpu ) 201 , a random access memory ( ram ) 202 , a read only memory ( rom ) 203 , a communications port 204 , and a data storage device 206 . cpu 201 is coupled to communications port 204 so that a user can communicate over network 104 . although not shown , web host server 101 may also include various input / output ( i / o ) devices , such as a keyboard , mouse , visual display , and speakers for audio for the user . web host server 101 also runs an operating system , which may be unix , linux , or any other suitable operating system . data storage device 206 may be a hard disk drive , cd - rw drive , flash array , or other mass storage device , and includes a local database files 207 , local programs 208 , and plug - in communications and common files 209 . [ 0087 ] fig3 is a diagram of a third party server 102 of fig1 which may be representative of one or more other third party servers . third party server 102 includes a central processing unit ( cpu ) 301 , a read only memory ( rom ) 303 , a random access memory 302 , a communications port 304 , and a data storage device 306 . cpu 301 is coupled to communications port 304 so that a third party server 102 can communicate over network 104 . although not shown , third party server 102 may also include various input / output ( i / o ) devices , such as a keyboard , mouse , visual display , and speakers for audio for the user . third party server 102 also runs an operating system , which may be unix , linux , or any other suitable operating system . data storage device 306 may be a hard disk drive , cd - rw drive , flash array , or other mass storage device , and includes a local database files 307 , local programs 308 , and communications and common files 309 . the communications and common files 309 , would preferably consist of another fully installed and configured version of the present invention , but may consist of merely a compatible plug - in communications object and substantiating data . [ 0088 ] fig4 is a diagram of a commerce server 103 of fig1 which may be representative of one or more other commerce servers . commerce server 103 includes a central processing unit ( cpu ) 401 , a random access memory 402 , a read only memory 403 , a communications port 404 , a communications port 405 , and a data storage device 406 . cpu 401 is coupled to communications port 404 so that commerce server 103 can communicate over network 104 , and cpu 401 is coupled to communications port 405 so that commerce server 103 can communicate over network 105 . although not shown , commerce server 103 may also include various input / output ( i / o ) devices , such as a keyboard , mouse , visual display , and speakers for audio for the user . commerce server 103 also runs an operating system , which may be windows nt , windows 98 , or any other suitable operating system . data storage device 406 may be a hard disk drive , cd - rw drive , flash array , or other mass storage device , and would preferably include local programs 407 , local database files and tables 408 , and transaction queues and logs 409 . local programs 407 contains executable programs 410 , a suite of program files 411 , and an initialization file 412 . local database and tables 408 contains a trading partner profile table 413 , an overall database structure 414 , a business transaction map 415 , and a client sql data table 416 . transaction queues and activity log 409 contains a transaction engine queue 417 , a reply requirements queue 418 , a transaction engine outbound queue 419 , a symbolic data stream ( sds ) transaction queue 420 , a transport protocol outbound queue 421 , and an activity log 422 . [ 0090 ] fig5 is a diagram of an application server 106 of fig1 which may be representative of one or more application servers . application server 106 includes a central processing unit 501 , a random access memory 502 , a read only memory 503 , a communications port 504 , and a data storage device 506 . cpu 501 is coupled to communications port 504 so that application server 106 can communicate over network 105 . although not shown , application server 101 may also include various input / output ( i / o ) devices , such as a keyboard , mouse , visual display , and speakers for audio for the user . application server 101 also runs an operating system , which may be windows nt , windows 98 , or any other suitable operating system . data storage device 506 may be a hard disk drive , cd - rw drive , flash array , or other mass storage device , and would preferably include local database files 507 , local programs 508 , and back office application 509 . generally , files that contain business transaction data may reside locally at commerce server 103 or remotely at application server 106 . typical examples of a business data file are an invoice form , a purchase order form , an account status form , and a payment remittance advice form . many embodiments described herein relate to data that are business information stored in digital files . it is noted that many terms herein such as data , records , tables , fields , characteristics , and user - determined characteristics should be construed in context of a technical application , such as in a computer software application , and should not be read as the same as any mental or “ paper & amp ; pencil ” type objects . the fields , separately or together ( depending on the design and file ) uniquely identify the data within local databases and tables 408 . one of the tables is the trading partner profile table 413 , which is the defining information for both the client and the customer network locations as well as the client and customer formal business structures . examples of fields include profile name , internet protocol ( ip ) address , allowed transactions , and transaction format . examples of transaction formats are edi , xml and edifact . another table found in the local databases and tables 408 is the overall database structure 414 , which contains the defining information for the source of all the data in the commerce server 103 , including information as to how the data is accessed by other servers , and information on where the data is used . examples of fields in the overall database structure 414 include field name , source , access method , allowable values , data types , data sizes , and whether the field is required or optional . another table found in the local databases and tables 408 is the business transaction map 415 , which contains the defining information for managing the transaction flow and individual transactions in system 100 , depending on the type of interface required of the commerce server 103 . a map of the specific transactions , as required for communication with the back office , is maintained . examples of fields in the business transaction map 415 include transaction identifier , additional business conversation transactions , and business transaction standards . an example of a business transaction standard could be a requirement that there be a three day hold on shipping for any credit card purchases completed within system 100 . another table in the local databases and tables 408 is the client sql data table 416 , which is the source of information for the populating of data in outbound transactions , and the source of verification information for inbound transactions . table 416 may contain one or more types of data including customer data , accounting data , shipping data , and product data . [ 0097 ] fig6 shows an overview of the activation of the method , system and apparatus of system 100 . preferably , step 601 is performed , according to a previously established configuration , to independently act after some initial setup which is not shown , where it may execute periodically , as in the application of electrical power to the commerce server 103 as shown in fig1 . on the other hand , step 601 may be performed in response to a user input at commerce server 103 ( or any suitable workstation connected to network 105 ), such as a selection to “ run ” an executable software file , for example startup . exe . beginning at start block 600 of fig6 step 601 determines the existence of the initialization file 412 . step 601 asks the operating system of the commerce server 103 , through the use of a “ system call ”, if the file is physically present at a predetermined location on the storage medium 406 of commerce server 103 , by reading a descriptive file header contained in the file , or by other means . if step 601 determines the local file 412 is not present on server 103 , step 602 initiates and enables the interview process as further shown in fig7 . [ 0099 ] fig7 is a flow diagram of an overview of the interview process . beginning at start block 700 of fig7 step 701 checks again if initialization file 412 exists in local programs and execution 407 . it is necessary for this step to check again as the interview process of fig7 may have been initiated from another process , and in such a case , it would be necessary to perform step 703 to populate initialization file 412 . if step 701 determines the initialization file 412 is not present , step 702 loads predetermined default values to the entry screen on commerce server 103 and initiates step 704 , which is shown more fully in fig8 . [ 0101 ] fig8 is a flow diagram showing an overview of the interview business function . beginning at start block 800 of fig8 step 801 displays one or more interview entry forms at commerce server 103 . in step 802 , the user answers one or more questions in associated fields to which the user at server 103 would respond and input data 806 as appropriate . examples of data or identifiers comprising data 806 , which would be input by the user at server 103 , include : whether or not the client uses a web site , the client &# 39 ; s business name and address , the client &# 39 ; s type of business , the identity of the client &# 39 ; s back office software being used , and other data preferably contained in the edi838 transaction . step 803 determines if the required data 806 is complete , and if not , control returns to step 801 . this process is repeated until either the user cancels and ends the entire process or the required data is deemed complete by step 803 . once step 803 is complete , data 806 is used in step 804 to populate the trading partner profile table 413 , the overall database structure 414 , the business transaction map 415 , and the client &# 39 ; s sql data table 416 . once step 804 is completed , finish block 805 is reached and step 704 of fig7 is complete . next , step 705 of fig7 further shown in fig9 interviews the user for application and utilization information . beginning at start block 900 of fig9 step 901 displays one or more interview entry screens at commerce server 103 . in step 902 , the user answers one or more questions in associated fields to which the user would respond and input data 907 as appropriate . examples of data 907 include : accepted and used edi transactions , specific data elements to be used , allowable values , and other data such as is contained in the edi868 . step 903 determines if the required data is complete and if not , control returns to step 901 . this process is repeated until either the user cancels and ends the entire process or the required data is deemed complete by step 903 . once the data 907 is deemed complete by step 903 , step 904 uses data 907 to populate the trading partner profile table 413 , the overall database structure 414 , the business transaction map 415 and the client &# 39 ; s sql data table 416 . once step 904 is complete , step 905 initializes the queues and activity log so that they are in a clean , ready to use condition . once step 905 is complete , finish block 906 is reached and step 705 of fig7 is complete . the next step in fig7 step 706 , saves all initialization data to initialization file 412 . once step 706 is completed , finish block 707 is reached and step 602 of fig6 is completed . step 603 of fig6 shown more fully in fig1 , then loads and activates objects . fig1 is an overview diagram of the loading and activation of objects . although fig1 shows a flow diagram in a linear fashion , steps 1001 through 1006 run concurrently , and are not dependent on each other . beginning with step 1001 , the resource center object is loaded and activated . step 1001 , the resource center object , is shown more fully in fig1 . from start block 1100 in fig1 , step 1101 checks and clears any orphan processes by enumerating the task list of commerce server 103 , searching for running objects and requesting the commerce server 103 operating system to halt any such processes . next , step 1102 connects to the registered url proxy in order to obtain the tcp / ip port assignment and verify connectivity . step 1103 loads the user interface form in display memory at commerce server 103 and hides the form . step 1104 loads the program &# 39 ; s icon to the system tray if the operating system of commerce server 103 allows this function . once steps 1101 through 1104 complete , step 1105 places the resource center into an event wait state . in the event wait state , the resource center object waits for one of three menu events to occur . in one situation , the activate resource center event 1107 opens the user interface form ( step 1110 ) allowing the user at commerce server 103 to effect changes in the initialization and configuration data contained in initialization file 412 . in a second situation , the update maps event 1108 allows the user at commerce server 103 to save the initialization data ( step 1111 ) to the initialization file 412 . the activate resource center and update maps events result in returning to the event wait state . the end process event ( step 1106 ) allows the user at commerce server 103 to shut down the entire application ( step 1109 ) ending the process at finish block 1112 . once the resource center establishes the event wait state in step 1105 , step 1002 of fig1 , further shown in fig1 , loads and activates the back office communications object . beginning at start block 1200 , initialization data 412 is retrieved ( step 1201 ). next , in step 1202 , the back office client is started and the process handle is stored in active memory for future use . step 1203 , using data from the client sql data table 416 , ensures that the local database files 507 of the application server 106 are the preferred environment . next , step 1204 processes transactions in transit from the sds transaction queue 420 . a request is made of the back office application 509 for customer and product data in local database files 507 ( step 1205 ). lastly , step 1206 uses the requested data to compare with , and modify if necessary , existing client sql data table 416 before ending at finish block 1207 . step 1002 of fig1 is also now completed . the edi translator object is next started in step 1003 . step 1003 is further shown in fig1 . beginning at start block 1300 , the edi translator object assumes an event wait state ( step 1301 ). step 1302 occurs when an event requests translation service from this translator object , preferably a request from another process to translate edi data . once the event 1302 is triggered , the event wait state ends and step 1303 extracts the header information to be used in parsing the data in the request . step 1304 loads electronic form data preferably from the edi standard transaction , edi868 , which allows the translator to build a data structure to hold the information contained in the request . step 1305 extracts the data from the request , builds the edi data structure and returns the extracted data to the requesting process 1306 . the process ends at finish block 1307 , which also completes step 1003 of fig1 . the xml translator is then started in step 1004 , which is further shown in fig1 . [ 0109 ] fig1 is a diagram of the loading and activation of the xml translator object . beginning at start block 1400 of fig1 , the xml translator object assumes an event wait state 1401 . events in step 1402 occur from other processes requesting translation service from this translator object . once an event triggers step 1402 , step 1403 extracts the header information from the request for use in parsing the data in the request . step 1404 loads parsing information from the xml header which allows the translator to build a data structure to hold the information contained in the request . step 1405 extracts the data from the request , builds the xml data structure and returns the extracted data to the requesting process 1406 . the process ends at finish block 1407 , which also completes step 1004 of fig1 . next , step 1005 of fig1 initializes the business to business ( b2b ) communications object . step 1005 is further shown in fig1 . beginning at start block 1500 , the b2b object first determines if there is an existing port connection available ( step 1501 ). if an assigned port is not available , step 1502 requests a new port connection while it keeps track of the number of times a port connection is requested . step 1503 determines if too many requests have been made , preferably ten or more times , and if so , communications are not established and finish block 1509 is reached . if the request count is not exceeded in step 1503 , processing continues at step 1501 to again determine if an assigned port is available . once step 1501 determines the assigned port is available , steps 1504 and 1505 are initiated concurrently . step 1504 requests product and / or catalog information from back office application 509 , and step 1506 translates data preferably to edi format . step 1505 requests customer and other related information from back office application 509 and step 1507 translates the data preferably into edi format . in finalizing the parallel processing of steps 1506 and 1507 , step 1508 activates the initiator and responder event states , and it sets an environment variable which indicates that inbound and outbound business to business transactions are allowed to occur . once step 1508 is complete , finish block 1509 is reached , step 1005 in fig1 is completed , and b2b connectivity is established . next , step 1006 of fig1 , using data from initialization file 412 , determines if the business to consumer ( b2c ) communications object is to be initialized , and if it is to be initialized , step 1007 starts the web host communications object , which is further shown in fig1 . beginning at start block 1600 of fig1 , step 1601 determines if there is an existing port connection available . if there is no existing port connection assigned , step 1602 requests a new port connection while counting the number of times a port connection is requested . step 1603 determines if the request count has exceeded a preset limit . if the request count is exceeded , step 1611 then sets a flag indicating that the web host is offline , no communications are established , and finish block 1615 is reached . if the request count is not exceeded in step 1603 , processing continues at block step 1601 to again determine if a port is available . once step 1601 determines that a port has been assigned , the next steps , step 1604 , step 1605 , and step 1606 are processed concurrently . step 1604 sends a communications initialization packet , which is not shown , to the web host server 101 , and step 1607 waits for an reply . step 1605 requests product and / or catalog information from the back office application 509 , and step 1608 translates the data from step 1605 preferably to edi format . step 1606 requests customer and other related information from the back office application 509 , and step 1609 translates the data from step 1606 preferably to edi format . once steps 1607 , 1608 and 1609 complete with timeouts , if necessary to synchronize completion , step 1610 determines if the web site server 101 has sent a valid reply . if the reply is determined to be invalid , or no reply is received , step 1611 sets a flag to indicate the web host server 101 is offline , and the process ends at finish block 1615 . if step 1610 determines that the web host server reply is valid , step 1612 , using data from table 414 , translates the data formatted in steps 1608 and 1609 to a format suitable for the web host server 101 , preferably xml . the translated data is then sent in step 1613 to the web host server 101 . step 1614 establishes the initiator and responder event states , which allow the processing of inbound and outbound business to consumer transactions . the process ends at finish block 1615 and step 1007 of fig1 is simultaneously completed . finish block 1008 of fig1 is reached and step 603 of fig6 is also completed . next , step 604 of fig6 as further shown in fig1 , initializes the environment and the connectivity . beginning at start block 1700 , step 1701 enumerates the processing list of commerce server 103 , where all processes currently running are placed in a list and given reference numbers . step 1702 then checks the process list to determine whether the back office application 509 process is present . if step 1702 finds that the process is present , step 1703 sends a request using the reference number to close the process and control returns to step 1701 . if step 1702 determines the back office application 509 process is not running control continues to step 1704 . step 1704 sets a status flag indicating that the application server 106 is online . step 1707 keeps count of the number of times step 1706 is reached , and then starts the back office application 509 . step 1705 grabs the process id ( pid ) number assigned by the operating system . step 1706 then ensures that the back office application 509 is responding . if the back office application 509 response is confirmed , control continues to step 1709 . otherwise , step 1707 determines whether the count limit , being counted from step 1706 , has been exceeded . if the limit in step 1707 is determined to be exceeded , step 1708 sets a flag indicating the back office application is offline and control continues to step 1709 . if the limit in step 1707 is determined not to be exceeded , control returns to step 1701 . step 1709 , using data from overall database structure 414 , if present , sets the web host server flag to on - line and establishes the network connection to the web host server 101 , which results in either a valid reply from the web host server 101 , a timeout resulting in no reply , or a determination that the connection is not applicable , as in the case where a client is not using the web host server 101 option . step 1710 validates the reply from the web host server 101 . if step 1710 detects a timeout or invalid reply , then step 1711 determines whether the request count has exceeded a preset limit , preferably ten . if the limit is not exceeded , control continues to step 1709 . otherwise , step 1712 sets a flag indicating the web host server is offline and control continues to step 1721 . if step 1710 determines the reply from web host server 101 is valid , step 1713 checks the transaction engine queue 417 to determine if there is a transaction destined for the web host server 101 waiting to be processed . if there is a such a transaction waiting to be processed , step 1714 reads that transaction . step 1715 writes the transaction to the activity log 422 and checks the data for required elements and values . step 1716 determines if the transaction is valid . if the transaction in step 1716 is not valid , step 1719 clears the transaction from the transaction engine queue 417 and control resumes at step 1713 . if the transaction in step 1716 is determined to be valid , step 1717 checks the installed modules in executable program 410 for the presence of the correct module . step 1717 performs this check in order to determine if the executable program 410 is capable of processing the transaction . if step 1717 finds an acceptable module installed , step 1718 sends the transaction to the transaction engine outbound queue 419 resulting in a valid outbound transaction . step 1719 then clears the transaction from the transaction engine queue 417 and control resumes at step 1713 . if step 1717 determines that the executable program 410 does not have the necessary module to process the transaction , step 1719 clears the transaction from the transaction engine queue 417 and control resumes at step 1713 . once step 1713 determines that there are no more transactions to be processed from the transaction engine queue 417 , step 1720 initializes queue 417 to a ready state . step 1721 then sets the environment flags and starts the transaction flow , as further shown in fig3 . once step 1721 is complete , finish block 1722 is reached , step 604 of fig6 is completed , and finish block 605 of fig6 is reached . currently , the exchange of information between trading partners uses the available methods of transport , such as smtp , ftp and http . these methods incorporate a third party server , of the type specific to the method , to act as the facilitator of the exchange . for example , when using smtp , simple mail transport protocol , to send information to a trading partner , the data resides for a period of time on a smtp server . this result of multiple copies of data residing on various servers subjects the information to possible theft or unwanted disclosure . the present invention incorporates a method of transporting information to trading partners without using these conventional protocols . this method includes a point - to - point , secure transfer protocol , which sends the information directly to the intended responder using high level encryption . it precludes the use of third party servers and as a result , avoids their inherent flaws . [ 0131 ] fig1 is a flow diagram of the installation of the transport protocol . preferably , step 1801 is performed in response to input at commerce server 103 , wherein the user directs the transport protocol to be installed on commerce server 103 . beginning at start block 1800 of fig1 , step 1801 first decompresses the program and supporting files , and it then copies those files to a temporary location on commerce server 103 . step 1802 then installs the program and files to the install location and registers the program with the operating system of commerce server 103 . step 1803 creates the local profile record in the trading partner profile table 413 , as further shown in fig1 . fig1 is a flow diagram of the create local profile function . beginning at start block 1900 of fig1 , step 1901 solicits the local ip address from the operating system of commerce server 103 . step 1902 then gathers information about the ip port settings . step 1903 next checks the trading partner profile table 413 for any existing local profiles . step 1904 requests an ip port assignment from the operating system , and step 1905 queries the user for registration information , such as name , e - mail address and registration number . step 1906 then writes the registration and local profile information to the trading partner profile table 413 . once step 1906 is complete , finish block 1907 is reached and step 1803 of fig1 is complete . next , step 1804 establishes a communications session with a registration server , which is not shown , and once established , sends the current registration information the server . preferably , the registration server returns licensing information , which allows the transport protocol to fully function . if the registration step is not completed , the lack of licensing information will cause the transport protocol to function in a demonstration mode , which will in turn limit the present invention to a fixed number of allowable trading partner profiles , preferably 5 , and which will prevent the ability of the present invention to be used on a network , in which the trading partner profile data table 413 may be located on a remote system . step 1805 next updates the data in trading partner profile table 413 , if applicable , which then results in the full functionality of the transport protocol . next , step 1806 registers the responder server process with the systems startup group . preferably , this step will result in the starting of the responder process each time commerce server 103 is activated . next , step 1807 starts the responder server process which is further shown in fig2 . [ 0135 ] fig2 shows a flow diagram of the responder process . beginning at start block 2000 of fig2 , step 2001 determines if the trading partner profile table 413 exists . if table 413 does not exist , a new table is created ( step 2002 ) and control continues to step 2003 . if step 2001 determines that table 413 does exist , step 2003 checks trading partner profile table 413 for the existence of a local profile within the table . if no local profile record exists , step 2004 creates the local profile record by starting the create local profile process , as further shown in fig1 . once step 2004 is complete , step 2005 asks the user at commerce server 103 if the local profile record is to be written to trading partner profile table 413 . if the user indicates the local profile record is valid to write , the local profile record is stored in trading partner profile table 413 and control returns to step 2003 . if , in step 2005 , the user indicates the record is not to be stored , the local profile is discarded and control is directed to finish block 2007 , bypassing the start of the transport protocol listener process . once step 2003 determines there is a local profile record , control continues to step 2006 , where the transport protocol listener process , as shown in fig2 , is initiated . once step 2006 is completed , finish block 2007 of fig2 is reached , and finish block 1808 of fig1 is reached . [ 0137 ] fig2 and fig2 are event state transition diagrams representing the initiator and the responder , respectively , of an exchange of data . these figures show the progression from event wait state to event wait state , the sequence of events needed , and the actions performed as a result of each event , in order to advance through the diagram and complete a session . a session begins with the initiator in state block 2101 of fig2 and the responder in state block 2201 of fig2 . that same session ends with the initiator returning to state block 2101 and the responder returning to state block 2201 , regardless of how the diagrams are traversed . in a normal session the initiator , starting from state block 2101 of fig2 , sends a session request package , which includes the initiator &# 39 ; s ip / port information and signature data . once the session request package has been sent , control then moves to state block 2102 . the responder , after receiving the session request , checks the trading partner profile table 413 for the initiator &# 39 ; s profile . if the profile is not found , the responder creates a temporary profile in the responder &# 39 ; s trading partner profile table 413 to facilitate the initial exchange of data . if the profile is found , the responder then generates a new session key pair and replies with a session confirm , which includes the responder &# 39 ; s public session key , signature and profile data . the responder then moves to state block 2202 . this exchange establishes initial information and opens the tcp / ip communication path upon which to exchange encoded data . after the initiator receives confirmation of the tcp / ip connection from the responder &# 39 ; s session confirm , the initiator generates a session key pair and generates a key request , which includes the initiator &# 39 ; s public session key , signature , and profile data . the key request is then encoded with the responder &# 39 ; s public session key and sent to the responder . additionally , if the responder &# 39 ; s trading partner profile was not found in the initiator &# 39 ; s trading partner profile table 413 , or the information is old , the profile in the initiator &# 39 ; s trading partner profile table 413 is updated with the responder &# 39 ; s new profile , which is contained in the session confirm . the initiator then moves to state block 2103 . the responder , after receiving the key request , confirms the key request has been encoded correctly . a correct key request would preferably arrive encoded with the responder &# 39 ; s public session key , and the responder would then determine whether the key request is correctly formatted after decoding . additionally , if the initiator &# 39 ; s trading partner profile was not found in the responder &# 39 ; s trading partner profile table 413 , or the information is old , the profile in the responder &# 39 ; s table 413 is updated with the initiator &# 39 ; s new profile , contained in the key request . responder then sends a key confirm and moves to state block 2203 . at this point , along with the establishment of a highly secure tcp / ip connection through the exchange of public encryption keys created for this session , the trading partners involved in the exchange are identified . at each state throughout the exchange , if the established communications protocol is maintained , common problems such as bottlenecking , flooding and denial of service ( dos ) attacks are eliminated . additionally , a secure path of communication within the session is enforced . if the transport protocol is breached at any event wait state from either partner , an abort package is sent from the partner detecting the breach and both partners return to their respective idle states , ending the session . the initiator , now waiting at state block 2103 , then receives the key confirm , thereby allowing the exchange of data packages to proceed . the initiator sends a data package containing the transaction waiting to be sent , and moves to state block 2104 . if additional data packages are waiting to be sent , the initiator remains in state block 2104 . otherwise , the initiator proceeds to state block 2105 . after receiving a data package , the responder replies with a package confirm and remains in state block 2104 . if the initiator sends additional data packages , then each package sent receives a matching package confirm from the responder . this activity continues until the initiator sends an end request and moves to state block 2105 . both initiator and responder would then return to their respective idle states , and the session would end . [ 0145 ] fig2 is a flow diagram of the transport protocol listener , which establishes the responder process when a request arrives . beginning at start block 2300 of fig2 , step 2301 shows the transport protocol listener in an event wait state . step 2302 , the arrival of a new request , triggers the processing of step 2303 . in step 2303 , the inbound session request is received . step 2304 next checks a queue limit counter to determine if this request can be processed . if the queue limit is exceeded , control continues to step 2311 , where an error message is written to the activity log 422 , the inbound request is dropped , and the listener process returns to the event wait state in step 2312 . if the queue limit is not exceeded in step 2304 , control continues at step 2305 , where the queue limit counter is incremented . step 2306 , using data from table 413 , determines if the initiator of the request has a current trading partner profile record . if the initiator &# 39 ; s profile record is not found in table 413 , a temporary profile record is added to table 413 to allow for the continued processing of this session and to facilitate the exchange of more detailed trading partner profile information . once step 2307 completes , or once step 2306 determines the profile record is present in trading partner profile table 413 , control continues to step 2308 , where the transport protocol shell , further shown in fig2 , is initiated to handle the remainder of the communications exchange with the present trading partner . step 2309 updates the initiator &# 39 ; s profile data in trading partner profile table 413 and step 2310 writes the activity to activity log 422 . step 2312 returns the transport protocol listener to the event wait state . [ 0148 ] fig2 is a flow diagram of the transport protocol &# 39 ; s user interface . beginning with start block 2400 , an outbound request arrives in block 2401 and triggers step 2402 which receives the outbound request and validates the information to be sent . step 2403 checks the trading partner profile table 413 to determine the responder to the request . if no responder is identified in the request , control continues to step 2404 , where the user is queried to select a profile from trading partner profile table 413 , after which control returns back to step 2403 . when step 2403 identifies the responder , control continues to step 2405 , where session information , such as date and time , is recorded in trading partner profile table 413 . step 2406 then creates the request structure , and step 2407 initiates the session request , as further shown in fig2 . once the session request ends , finish block 2408 is reached . [ 0150 ] fig2 is a flow diagram of the transport protocol shell which is initiated from the transport protocol listener of fig2 each time an inbound request is received . the transport protocol shell remains active until the session is complete . beginning from start block 2500 of fig2 , each time an inbound request is received during the session , step 2501 checks the request to determine if it contains a protocol package . if a protocol package is received in the request , step 2524 initiates the protocol package process . step 2524 is further shown in fig3 . if the request does not contain a protocol package , step 2502 , using data from table 413 , determines the current session information for the trading partner sending the request . if step 2502 determines a session has not been started , step 2503 examines the request to determine if it is a session request . if step 2503 determines the request does not contain a session request , the request is ignored and control moves to finish block 2525 . if step 2503 determines a session request is present , control continues to step 2515 , where the session request is initiated . step 2515 is further shown in fig2 . once the session request has finished in step 2515 , finish block 2525 is reached . if step 2502 determines a session has been started , control continues with step 2504 , which determines the partner whom initiated the session . if step 2504 determines that system 100 is not the initiator , control continues with step 2505 . step 2505 determines if a session request is present . if a session request is found , control continues with step 2515 , where the session request is initiated , as further shown in fig2 . if a session request is not found in step 2505 , control continues with step 2507 . step 2507 determines if a key request is present . if a key request is found , control continues with step 2517 , where the key request is initiated . step 2517 is further shown in fig2 . if a key request is not found in step 2507 , control continues to step 2509 . step 2509 determines if a data package is present . if a data package is found , control continues to step 2519 , where the send data package is initiated . step 2519 is further shown in fig2 . if a data package is not found in step 2509 , control continues to step 2511 . step 2511 determines if a session end is present . if a session end is found , control continues to step 2521 , where the session end is initiated . step 2521 is further shown in fig2 . if a session end request is not found in step 2511 , control continues to step 2513 . if step 2504 determines that system 100 is the initiator , control continues with step 2506 . step 2506 determines if the package contains a session confirm . if a session confirm is found , control continues to step 2516 , where the key request is processed . step 2516 is further shown in fig2 . if a session confirm is not found in step 2506 , control continues to step 2508 . step 2508 determines if a key confirm is present . if a key confirm is found , control continues to step 2518 , where the send data package is initiated . step 2518 is further shown in fig2 . if a key confirm is not found in step 2508 , control continues with step 2510 . step 2510 determines if a package confirm is present . if a package confirm is found , control continues to step 2514 . step 2514 determines if there are more packages to send . if step 2514 determines that more data packages are to be sent , control continues to step 2518 , where the sending of the next data package is initiated . if there are no more data packages to be sent , control continues to step 2520 , where the session end is initiated . step 2520 is further shown in fig2 . if a package confirm is not found in step 2510 , control continues to step 2512 . step 2512 determines if an end confirm is present . if an end confirm is found , control continues with step 2522 , where the close session is initiated , as further shown in fig3 . if an end confirm is not found in step 2512 , control continues with step 2513 . step 2513 determines if a session abort / error is present . if a session abort / error is found , control continues to step 2523 , where the abort / error report is initiated . step 2523 is further shown in fig3 . if a session abort / error is not found in step 2513 , control continues to step 2522 , where the close session is initiated . step 2522 is further shown in fig3 . beginning at start block 2600 of fig2 , step 2601 preliminarily determines the identity of the session initiator . if commerce server 103 is the initiator , control continues to step 2602 , where the responder is identified . step 2603 builds the session request header information . step 2604 builds the session request cargo and control continues to step 2608 . if step 2601 determines the session was initiated by a trading partner found in table 413 , control continues to step 2605 , where the initiator is identified . step 2606 builds the session confirm header , and step 2607 builds the session confirm cargo . control then continues to step 2608 . step 2608 generates the outbound request and writes the request to transport protocol outbound queue 421 . step 2609 initiates the send outbound request , and is further shown in fig3 . after the send outbound request finishes in step 2609 , finish block 2610 is reached . [ 0166 ] fig2 is a flow diagram of the key request process . beginning at start block 2700 of fig2 , step 2701 determines the identity of the key request initiator . if commerce server 103 is the initiator , control continues to step 2702 , which identifies the particular responder of the message . step 2703 builds the key request header information , step 2704 builds the key request cargo , and control continues to step 2708 . if step 2701 determines the session was initiated by the trading partner , control continues with step 2705 , where the initiator is identified . step 2706 then builds the key confirm header . step 2707 next builds the key confirm cargo and control continues with step 2708 . step 2708 generates the outbound request and writes it to transport protocol outbound queue 421 . step 2709 initiates the send outbound request , as further shown in fig3 . once the request has been sent in step 2709 , finish block 2710 is reached . [ 0169 ] fig2 is a flow diagram of the send data package . beginning at start block 2800 of fig2 , step 2801 determines the identity of the send data package initiator . if commerce server 103 is the initiator , control continues to step 2802 , where the responder is identified . step 2803 builds the data package header information , step 2804 builds the data package cargo , and control continues to step 2808 . if step 2801 determines that the session was initiated by a trading partner , then control continues to step 2805 , where the particular initiator is identified . step 2806 builds the data package confirm header , step 2807 builds the data package confirm cargo , and control continues to step 2808 . step 2808 generates the outbound request and writes it to transport protocol outbound queue 421 . step 2809 initiates the send outbound request , as further shown in fig3 . once the request has been sent to the trading partner , finish block 2810 is reached . [ 0172 ] fig2 is a flow diagram of the session end . beginning at start block 2900 of fig2 , step 2901 determines the identity of the session initiator . if commerce server 103 is the initiator , control continues to step 2902 , where the particular responder is identified . step 2903 builds the session end request header and step 2904 builds the session end request cargo . after step 2904 is completed , control continues to step 2908 . if step 2901 determines the session was initiated by a trading partner , control continues to step 2905 where the particular initiator is identified . step 2906 builds the session end confirm header and step 2907 builds the session end confirm cargo . once step 2907 is completed , control continues to step 2908 . step 2908 generates the outbound request and writes it to transport protocol outbound queue 421 . step 2909 , further shown in fig3 , initiates the send outbound request . once step 2909 is completed , finish block 2910 is reached . [ 0175 ] fig3 is a flow diagram of an abort / error message . beginning at start block 3000 of fig3 , step 3001 determines the identity of the abort / error initiator . if commerce server 103 is the initiator , control continues to step 3002 , where the abort / error type is determined . step 3003 then builds the error or abort message , and step 3004 , as further shown in fig3 , initiates the close session . step 3005 writes a new request to transport protocol outbound queue 421 to re - queue the erred request . after step 3005 is complete , control continues to step 3009 . if step 3001 determines the session was initiated by a trading partner , step 3006 determines the type of error or abort , and step 3007 builds the error or abort reply message . step 3008 , as further shown in fig3 , then initiates a close of the current session . once step 3008 is complete , control continues to step 3009 . step 3009 generates the abort / error message and writes it to transport protocol outbound queue 421 . next , step 3010 , further shown in fig3 , sends the message to the trading partner . once step 3010 is complete , finish block 3011 is reached . [ 0178 ] fig3 is a flow diagram of the close session . beginning at start block 3100 of fig3 , step 3101 identifies the session using data from trading partner profile table 413 . next , step 3102 writes information to table 413 indicating that the session is closed . once step 3102 is completed , finish block 3103 is reached . [ 0179 ] fig3 is a flow diagram of the send outbound request . beginning at start block 3200 of fig3 , step 3201 shows send outbound request in an event wait state . step 3202 , the arrival of an outbound request in the transport protocol outbound queue , triggers the processing of step 3203 . once triggered , step 3203 then receives the outbound request , and step 3204 determines if request contains a data package . if step 3204 determines that a data package is being sent , step 3205 assembles the package based on the package contents structure 2811 . if step 3204 determines a data package is not present , control continues to step 3206 . step 3206 determines whether the request is a session request or a session confirm . if the request is not a session request nor a session confirm , step 3207 compresses and encodes the package cargo using the public key obtained in the session confirm ( for the responder ), or the key request ( for the initiator ). if step 3206 determines that the request is a session request or session confirm , control continues to step 3208 . step 3208 then sends the outbound request across network 104 to the trading partner , and step 3209 writes the results of the send to activity log 422 . after step 3209 is complete , finish block 3210 is reached . [ 0182 ] fig3 is a flow diagram of the protocol package . from start block 3300 of fig3 , step 3301 , using data from trading partner profile table 413 , checks the authority of the initiator . step 3302 then determines if the initiator is authorized . if initiator is not authorized , control continues to step 3308 where a security error message is written to activity log 422 , and then the process ends at finish block 3309 . if step 3302 determines that the initiator is authorized to proceed , step 3303 then determines if the protocol package contains a request for data . if the protocol package does contain a request for data , step 3306 gathers the requested data from trading partner profile table 413 and step 3307 initiates the send outbound request . step 3307 is further shown in fig3 . once the outbound request has been sent , finish block 3309 is reached . if step 3303 does not find a request for data in the protocol package , control continues to step 3304 . step 3304 then determines if the protocol package contains a trading partner profile update . if the package does not have an update , the process ends at finish block 3309 . if step 3304 determines that a profile update is contained in the protocol package , step 3305 updates the information in table 413 , and the process ends at finish block 3309 . in a business environment , the seed of every business transaction is sown with an exchange of information . this exchange , between trading partners , is known as a “ business agreement ” and would typically contain information similar to that described in edi standards as the edi838 trading partner profile and the edi868 electronic forms structure . once these two important sources of information are exchanged , the basis for all future exchanges of transactions is established . the trading partner profile and electronic forms data are stored , along with additional data to facilitate a network connection , in the trading partner profile table 413 of fig4 . in essence , the trading partner profile table 413 allows the present invention to : 1 ) recognize each trading partner &# 39 ; s business identity ; 2 ) determine what mutually agreed upon transactions may be exchanged ; 3 ) determine where the data is located within each transaction ; and 4 ) determine the allowable values for each element of those transactions , every time an exchange of data with the trading partner occurs . [ 0187 ] fig3 is an overview of the inbound and outbound transaction flows , which occur in tandem , on the commerce server 103 of fig1 . transactions move in a bi - directional flow , inbound and outbound , through the sub - processes , completing predetermined paths according to instructions found in the business transaction map 415 of fig4 . from start block 3400 of fig3 , inbound transactions coming from network 104 are received in step 3401 , as further shown in fig3 , where they are unpacked , decoded and validated . the inbound transactions are then passed individually to step 3402 , as further shown in fig3 , where each transaction is identified and parsed to internal data structures . once completed , the data from step 3402 is passed to step 3403 , which then determines what additional transactions are necessary to complete the business conversation . step 3403 also routes those transactions to their appropriate destinations . some of those transactions in step 3403 will continue to step 3404 , which is further shown in fig3 . finish block 3405 ends the inbound transaction flow . additionally , from start block 3406 in fig3 , outbound transactions , preferably in the form of output data from application server 106 , are received in step 3407 . step 3407 , as further shown in fig4 , is where the data is parsed to an internal data structure and sent to step 3408 . step 3408 , as further shown in fig4 , creates the client sql table 416 , if needed , and updates the table 416 . next , step 3403 , as further shown in fig3 , determines what additional transactions are necessary to complete the business conversation and routes those transactions to their appropriate destinations . some of those transactions in step 3403 will continue to step 3409 , further shown in fig4 , where the transactions are packaged , encoded and sent across network 104 to their final destination . the outbound transaction flow ends at finish block 3410 . the inbound and outbound flow of transactions occur through the use of queues . queues are files in which data is stored sequentially and retrieved in the order in which the data was stored , commonly known as the first in , first out rule . this allows each sub - process to process their respective data and pass it to the next sub - process independent of the need for the receiving sub - process to be actively waiting for this data . one advantage to this method is in the ability of each sub - process to re - queue a transaction when processing of the transaction is not possible due to timing or lack of needed data . the major advantage to this approach is that each component sub - process ensures that data being used or stored at any particular point in the present invention is not lost or corrupted . these sub - processes , each independent of the other , assume control of their respective queue file , and are aware of both content and size in each of the files . events are triggered when a new request arrives in each sub - process queue . each sub - process would then perform its inherent function and the data would subsequently move along the given transaction flows . [ 0191 ] fig3 is a diagram of the overall flow of transactions through the present invention and fig3 is a diagram of the flow of transactions through the individual sub - processes . since each sub - process is an independent part of the transaction engine flow , each sub - process is described hereinafter as separate from each other . the first process flow shown in fig3 begins at inbound request 3501 . the inbound request 3501 is the event trigger for step 3502 which in turn initiates step 3401 . step 3401 is further shown in fig3 . the process flow in step 3401 results in the update of the transport protocol outbound queue 421 with the inbound request . from start block 3600 of fig3 , step 3601 receives and unpacks the inbound request and logs the request in activity log 422 . next , in step 3602 , the initiator and responder are determined using the trading partner profile table 413 . step 3603 then decodes and decompresses the request using a pre - established and exchanged pair of encryption keys . next , step 3604 , using overall database structure 414 , determines the output destination of the contents of the inbound request . the destination of the contents would be located in any allowable directory , on any compatible device connected to network 105 , and would include , but not be limited to an ascii text file or a dynamic data exchange ( dde ) which is electronically passed to any program which allows dde and has been given the rights to execute such a file . further , if the inbound request is edi structured , step 3605 sends a standard edi997 functional reply to the transport protocol outbound queue 421 to confirm receipt of the request . then , in step 3606 , the contents are output to the determined destination , either in file format as shown in block 3606 , or in dde format as in block 3607 . the sub - process ends at finish block 3608 . the transaction engine inbound process , as further shown in fig3 , is the preferred destination of the inbound transaction . the next sub - process in fig3 begins with the receipt of an inbound request 3503 in the transport protocol outbound queue 421 , which is the event trigger . step 3503 triggers the transaction engine inbound process , step 3402 , which is further shown in fig3 . this sub - process results in update of the transaction engine queue 417 . from start block 3700 , inbound request 3503 triggers step 3701 where the request is parsed into individual transactions and a record of the inbound request is written to activity log 422 . step 3702 then queries the trading partner profile table 413 for the initiator &# 39 ; s existing profile data . next , step 3703 checks the parsed transactions for a trading partner profile record . if step 3703 determines that no trading partner profile information is included in the transaction ( s ), then control continues to step 3705 . if step 3703 determines that a trading partner profile record is included in the transaction ( s ), then step 3704 determines if the initiator &# 39 ; s profile and all necessary information , such as allowed contents and formats , is present , and uses the information to update the trading partner profile table 413 . control then continues to step 3705 . step 3705 , using data from table 413 , determines if the initiator has a profile present . if step 3705 determines that the initiator has not supplied a valid or complete trading partner profile , control would continue to step 3708 . an example of a profile that is not a valid or complete trading partner profile is one that does not have information contained in the edi868 , information that would describe the contents and structure of a transaction included in the inbound request . after an error message is sent to the transaction engine queue 417 in step 3708 , the process ends at finish block 3710 . if step 3705 determines that the initiator has a valid and complete trading partner profile in table 413 , step 3706 prepares a data structure for each transaction . step 3707 then determines whether or not the parsed transactions are valid and complete by comparing the contents to the pre - defined data structure . if step 3707 determines that any one of the transactions is invalid or incomplete , then step 3708 prepares an error response message and sends the error message to the transaction engine queue 417 . once step 3708 has sent the error message , the process ends at finish block 3710 . if step 3707 determines that all parsed transactions are valid and complete , step 3709 formats the data to a pre - defined data structure and sends the transaction to the transaction engine queue 417 . once the transaction has been sent to queue 417 , the process ends at finish block 3710 . the next sub - process shown in fig3 begins with a transaction arriving in the transaction engine queue 417 . an event trigger , inbound transaction 3504 , initiates step 3403 , which is further shown in fig3 . [ 0198 ] fig3 is a flow diagram of the transaction engine shell . beginning at start block 3800 , a transaction arrives either in the transaction engine queue 417 or the reply requirements queue 419 and triggers step 3801 . step 3801 first writes the transaction to the activity log 422 then step 3801 , using data from the business transaction map 415 , the client sql data table 416 , and the reply requirements queue 419 , determines the destination of the transaction ( inbound to the back office application , or outbound to a trading partner ), and any additional transactions needed to complete the business conversation . for example , a purchase order transaction will be followed by an invoice transaction , and an invoice transaction will be followed by a payment authorization transaction . in addition , a business conversation may also include an exchange of confirmations for each of the above example transactions . additional requirements processed in step 3801 consist of transactions that are yet to be processed by the application server 106 , transactions that are determined ready to be sent out to trading partners , transactions that are determined to be processed in the future , and transactions that are incomplete . as necessary , the results of step 3801 are sent to and processed concurrently in steps 3802 , 3803 , and 3804 . in step 3802 , any transaction which must wait to be processed or that is considered incomplete due to its lack of required data , is written to the reply requirements queue 418 for future processing . in step 3803 , any transaction being sent to the application server 106 is formatted and written to the sds transaction queue 420 . in step 3804 any transaction ready to send to the trading partner is formatted and written to the transport protocol outbound queue 421 . steps 3802 , 3803 and 3804 end concurrently at finish block 3805 . the next sub - process shown in fig3 begins with a transaction arriving in the reply requirements queue 418 . an event trigger , step 3505 , initiates step 3403 , which is further shown in fig3 . the next sub - process shown in fig3 begins with a transaction arriving in the sds transaction queue 420 . event trigger 3506 , initiates step 3404 , which is further shown in fig3 . [ 0203 ] fig3 is a flow diagram of the sds inbound . from start block 3900 , step 3901 receives and reads the transaction and , using data from overall database structure 414 , determines the routing path and presentation method for processing the transaction . the presentation method preferably includes a choice of : the direct application of data to an identified database , the dynamic data exchange ( dde ) with another application , the output of data as text to a file , or the presentation of the data to the graphical user interface of the back office application 509 in the form of simulated keystrokes . step 3902 , using data from overall database structure 414 , formats the transaction according to the method determined , and step 3903 sends the transaction to the application server 106 according to the determined method . once step 3903 is complete , the process ends at finish block 3904 . the next sub - process flow shown in fig3 begins with the receipt of the outbound transaction 3508 created by application server 106 in step 3508 . the outbound transaction 3508 is the event trigger 3509 initiates step 3407 which is further shown in fig4 . additionally , files created by the back office application 509 can also be an outbound transaction 3508 and act as an event trigger . these files , from the back office application 509 , preferably initiate step 3407 at a predetermined interval of time . [ 0205 ] fig4 is a flow diagram of the sds outbound . from start block 4000 , step 4001 receives , reads and parses the outbound data 3508 found in the outbound transaction 3509 , using the overall database structure 414 to determine the structure and location of the data . next , step 4002 formats the transaction and writes the transaction to the transaction engine outbound queue 419 . the process ends at finish block 4003 . the next sub - process shown in fig3 begins with an outbound transaction 3510 arriving in the transaction engine outbound queue 419 . outbound transaction 3510 initiates step 3408 , which is further shown in fig4 . [ 0207 ] fig4 is a flow diagram of the transaction engine outbound . beginning at start block 4100 , an outbound transaction 3510 arrives in the transaction engine outbound queue 419 and initiates step 4101 . step 4101 , using data from the overall database structure map 414 , parses the outbound data to the client &# 39 ; s sql data table 416 . step 4102 , using both data from the outbound transaction 3510 , now residing in the client sql data table 416 , and from the reply requirements queue 418 , determines if this transaction is related to a prior future requirement in the reply requirements queue 418 . if step 4102 determines that any data is required to process the current outbound transaction , then step 4103 builds new outbound requests , whose requirements have been fulfilled , to the transaction engine queue 417 . step 4104 then writes to the reply requirements queue 418 any future transaction requirements needed to complete the business conversation related to this transaction . the process ends with finish block 4105 . the next sub - process in fig3 begins with an outbound request 3511 arriving in the transport protocol outbound queue 421 and which results in the initiation of step 3409 . in step 3511 , an outbound request arrives and initiates step 3409 , which is further shown in fig4 . [ 0209 ] fig4 is a flow diagram of the transport protocol outbound . from start block 4200 , an outbound request 3511 arrives in the transport protocol outbound queue 421 and triggers receipt of the request in step 4202 . step 4203 , using data from trading partner profile table 413 , then determines the responder and forwarding path details . step 4204 next determines if the responder exists in trading partner profile table 413 . if the responder does not exist in table 413 , step 4205 determines the license status of the product . if the product is licensed , step 4207 stores the new responder information in trading partner profile table 413 and continues to step 4206 . if the product is not licensed , step 4208 generates an error message , sends the message to the originating process , and the process ends at finish block 4211 . if step 4204 determines that the responder exists in trading partner profile table 413 , then step 4206 compresses and encodes the package , step 4209 writes the outbound request to the activity log 422 and step 4210 sends the request to the responder over network 104 . the process ends at finish block 4211 .	6
pioneer brand hybrid 33y18 shows excellent yield and high test weight and is consistently high yielding over much of the corn belt . hybrid 33y18 presents good gray leaf spot resistance and improved stalk strength with a tall plant stature . hybrid 33y18 demonstrates excellent early growth and late season plant intactness . pioneer brand hybrid 33y18 is a single cross , yellow endosperm , dent maize hybrid with outstanding yield in its maturity . hybrid 33y18 has a relative maturity of approximately 112 based on the comparative relative maturity rating system for harvest moisture of grain . hybrid 33y18 is best adapted for the central corn belt , northeast and southeast regions of the united states . this hybrid has the following characteristics based on the data collected primarily at johnston , iowa . table 1__________________________________________________________________________variety description informationvariety = 33y18__________________________________________________________________________ 1 . type : ( describe intermediate types in comments section ): 2 1 = sweet 2 = dent 3 = flint 4 = flour 5 = pop 6 = ornamental 2 . maturity : heatdays units075 1 , 347 . 5 from emergence to 50 % of plants in silk075 1 , 356 . 0 from emergence to 50 % of plants in pollen003 0 , 060 . 0 from 10 % to 90 % pollen shed068 1 , 129 . 0 from 50 % silk to harvest at 25 % moisture standard sample 3 . plant : deviation size0 , 296 . 5 cm plant height ( to tassel tip ) 4 . 95 20 , 131 . 5 cm ear height ( to base of top ear node ) 16 . 26 20 , 019 . 7 cm length of top ear internode 2 . 12 101 average number of tillers 0 . 00 21 . 0 average number of ears per stalk 0 . 00 21 . 0 anthocyanin of brace roots : 1 = absent 2 = faint 3 = moderate 4 = dark standard sample 4 . leaf : deviation size010 . 2 cm width of ear node leaf 0 . 00 10089 . 8 cm length of ear node leaf 2 . 83 1006 . 6 number of leaves above top ear 0 . 28 10042 . 0 degrees leaf angle ( measure from 2nd leaf above 0 . 00 2 ear at anthesis to stalk above leaf ) 03 leaf color dark green ( munsell code ) 5gy442 . 0 leaf sheath pubescence ( rate on scale from 1 = none to 9 = like peach fuzz ) 5 . 5 marginal waves ( rate on scale from 1 = none to 9 = many ) 8 . 0 longitudinal creases ( rate on scale from 1 = none to 9 = many ) standard sample 5 . tassel : deviation size06 . 0 number of primary lateral branches 3 . 11 10033 . 5 branch angle from central spike 16 . 26 270 . 3 cm tassel length ( from top leaf collar to tassel 1 . 56 27 . 5 pollen shed ( rate on scale from 0 = male sterile to 9 = heavy shed ) 11 anther color pink ( munsell code ) 01 glume color light green ( munsell code ) 5gy661 . 0 bar glumes ( glume bands ): 1 = absent 2 = present28 peduncle length ( cm . from top leaf to basal branches ) 6a . ear ( unhusked data ): 1 silk color ( 3 days after emergence ) light green ( munsell code ) 2 . 5gy862 fresh husk color ( 25 days after 50 % silking ) medium green ( munsell code ) 5gy6621 dry husk color ( 65 days after 50 % silking ) buff ( munsell code ) 2 . 5y841 position of ear at dry husk stage : 1 = upright 2 = horizontal 3 = pendant upright4 husk tightness ( rate of scale from 1 = very loose to 9 = very tight ) 2 husk extension ( at harvest ): 1 = short ( ears exposed ) 2 = medium (& lt ; 8 cm ) medium 3 = long ( 8 - 10 cm beyond ear tip ) 4 = very long (& gt ; 10 cm ) standard sample 6b . ear ( husked ear data ): deviation size19 cm ear length 0 . 71 1048 mm ear diameter at mid - point 0 . 71 10205 gm ear weight 17 . 68 1018 number of kernel rows 0 . 71 102 kernel rows : 1 = indistinct 2 = distinct distinct1 row alignment : 1 = straight 2 = slightly curved 3 straight9 cm shank length 0 . 71 102 ear taper : 1 = slight 2 = average 3 = extreme average standard sample 7 . kernel ( dried ): deviation size14 mm kernel length 0 . 71 108 mm kernel width 0 . 00 105 mm kernel thickness 0 . 71 1041 % round kernels ( shape grade ) 41 . 01 21 aleurone color pattern : 1 = homozygous 2 = segregating homozygous7 aluerone color yellow ( munsell code ) 10yr7127 hard endosperm color yellow ( munsell code ) 10yr7123 endosperm type : normal starch 1 = sweet ( su1 ) 2 = extra sweet ( sh2 ) 3 = normal starch 4 = high amylose starch 5 = waxy starch 6 = high protein 7 = high lysine 8 = super sweet ( se ) 9 = high oil 10 = other33 gm weight per 100 kernels ( unsized sample ) 0 . 71 2 standard sample 8 . cob : deviation size24 mm cob diameter at mid - point 0 . 00 1014 cob color red ( munsell code ) 10r36 cob strength 1 = weak 2 = strong 9 . disease resistance ( rate from 1 ( most susceptible ) to 9 ( most resistant ); leave blankif not tested ; leave race or strain options blank if polygenic ): a . leaf blights , wilts , and local infection diseases anthracnose leaf blight ( colletotrichum graminicola ) common rust ( puccinia sorghi ) common smut ( ustilago maydis ) 0 eyespot ( kabatiella zeae ) goss &# 39 ; s wilt ( clavibacter michiganense spp . nebraskense ) 6 gray leaf spot ( cercospora zeae - maydis ) helminthosporium leaf spot ( bipolaris zeicola ) race5 northern leaf blight ( exserohilum turcicum ) race4 southern leaf blight ( bipolaris maydis ) race0 southern rust ( puccinia polysora ) stewart &# 39 ; s wilt ( erwinia stewartii ) other ( specify ) b . systemic diseases8 corn lethal necrosis ( mcmv and mdmv ) head smut ( sphacelotheca reiliana ) maize chlorotic dwarf virus ( mdv ) maize chlorotic mottle virus ( mcmv ) 4 maize dwarf mosaic virus ( mdmv ) sorghum downy mildew of corn ( peronosclerospora sorghi ) other ( specify ) c . stalk rots4 anthracnose stalk rot ( colletotrichum graminicola ) diplodia stalk rot ( stenocarpella maydis ) fusarium stalk rot ( fusarium moniliforme ) gibberella stalk rot ( gibberella zeae ) other ( specify ) d . ear and kernel rots aspergillus ear and kernel rot ( aspergillus flavus ) 0 diplodia ear rot ( stenocarpella maydis ) 6 fusarium ear and kernel rot ( fusarium moniliforme ) 3 gibberella ear rot ( gibberella zeae ) other ( specify ) banks grass mite ( oligonychus pratensis ) corn worm ( helicoverpa zea ) leaf feeding silk feeding mg larval wt . ear damage corn leaf aphid ( rhopalosiphum maidis ) corn sap beetle ( carpophilus dimidiatus european corn borer ( ostrinia nubilalis ) 5 1st generation ( typically whorl leaf feeding ) 7 2nd generation ( typically leaf sheath - collar feeding ) stalk tunneling0 cm tunneled / plant fall armyworm ( spodoptera fruqiperda ) leaf feeding silk feeding mg larval wt . maize weevil ( sitophilus zeamaize northern rootworm ( diabrotica barberi ) southern rootworm ( diabrotica undecimpunctata ) southwestern corn borer ( diatreaea grandiosella ) leaf feeding stalk tunneling cm tunneled / plant two - spotted spider mite ( tetranychus urticae ) western rootworm ( diabrotica virgifrea virgifera ) other ( specify ) agronomic traits : 6 staygreen ( at 65 days after anthesis ) ( rate on a scale from 1 = worst to excellent ) 4 . 0 % dropped ears ( at 65 days after anthesis ) % pre - anthesis brittle snapping % pre - anthesis root lodging15 . 5 post - anthesis root lodging ( at 65 days after anthesis ) 11 , 250 kg / ha yield ( at 12 - 13 % grain moisture ) __________________________________________________________________________ comparisons of characteristics of pioneer brand hybrid 33y18 were made against pioneer brand hybrids 3335 , 3394 , and 32k61 , which are similar in adaptation to 33y18 . table 2a compares pioneer hybrid 33y18 and pioneer hybrid 3335 . the results show that both hybrids exhibit above average yields and hybrid 33y18 has significantly lower harvest moisture and significantly higher test weight than hybrid 3335 . hybrid 33y18 demonstrates significantly better seedling vigor than hybrid 3335 . hybrid 33y18 shows a significantly taller plant and a significantly higher ear placement than hybrid 3335 . hybrid 33y18 exhibits a significantly better stay green score and shows significantly better resistance to stalk lodging and brittle stalk than hybrid 3335 . both hybrids exhibit above average early stand counts . hybrid 33y18 exhibits significantly better resistance to gray leaf spot and shows a superior and significantly higher resistance to feeding by second generation european corn borer than hybrid 3335 . table 2b compares pioneer hybrid 33y18 and pioneer hybrid 3394 . the results show that hybrid 33y18 demonstrates an above average and significantly higher yield and a significantly higher test weight than hybrid 3394 . both hybrids demonstrate an above average seedling vigor and early stand count . hybrid 33y18 shows a significantly taller plant and a significantly higher ear placement than hybrid 3394 . hybrid 33y18 exhibits a significantly better stay green score and shows significantly better resistance to stalk lodging and brittle stalk than hybrid 3394 . hybrid 33y18 exhibits significantly better resistance to gray leaf spot and shows a superior and significantly higher resistance to feeding by second generation european corn borer than hybrid 3394 . table 2c compares pioneer hybrid 33y18 and pioneer hybrid 32k61 . the results show that hybrid 33y18 exhibits above average and significantly higher yields and significantly lower harvest moisture than hybrid 32k61 . both hybrids exhibit high test weights . hybrid 33y18 demonstrates both significantly better seedling vigor and early sand count than hybrid 32k61 . hybrid 33y18 shows a significantly taller plant and a significantly higher ear placement than hybrid 32k61 . both hybrids have above average stay green scores , and above average resistance to stalk lodging and brittle stalk . hybrid 33y18 exhibits better resistance to gray leaf spot and shows a very good and better resistance to feeding by second generation european corn borer than hybrid 32k61 . table 2a__________________________________________________________________________hybrid comparison reportvariety # 1 = 33y18variety # 2 = 3335__________________________________________________________________________ prm bu bu tst sdg est gdu gdu prm shd acr acr mst wt vgr cnt shd slk abs abs abs % mn % mn abs % mn % mn % mn % mn__________________________________________________________________________total sum 1 112 115 175 . 3 105 100 57 . 3 113 104 104 104 2 1 . 13 113 173 . 8 104 102 55 . 4 104 103 101 101 locs 36 28 123 123 125 69 81 85 39 24 reps 36 28 139 139 141 82 88 97 42 24 diff 1 2 1 . 4 1 2 1 . 8 9 1 2 3 pr & gt ; t . 022 + . 000 # . 541 . 423 . 017 + . 000 # . 008 # . 526 . 000 # . 000 # __________________________________________________________________________ stk plt ear rt sta stk brt grn drp glf cnt ht ht ldg grn ldg stk app ear spt % mn % mn % mn % mn % mn % mn % mn % mn % mn abs__________________________________________________________________________total sum 1 102 106 110 96 121 103 106 110 100 5 . 7 2 102 99 95 106 103 97 95 95 102 4 . 5 locs 151 63 63 30 79 67 16 9 22 20 reps 192 69 69 38 87 73 23 9 24 25 diff 0 6 15 11 18 7 12 15 2 1 . 2 pr & gt ; t . 999 . 000 # . 000 # . 006 # . 000 # . 000 # . 004 # . 089 * . 329 . 000 # __________________________________________________________________________ nlf slf ant hd mdm fus dip ecb ecb ecb blt blt rot smt cln cpx ers ers dpe 1lf 2sc abs abs abs abs abs abs abs abs abs abs abs__________________________________________________________________________total sum 1 4 . 9 4 . 0 4 . 5 100 . 0 7 . 5 4 . 0 5 . 9 3 . 3 100 . 0 5 . 0 7 . 3 2 5 . 1 7 . 0 3 . 3 100 . 0 5 . 5 4 . 5 4 . 4 3 . 0 100 . 0 3 . 0 4 . 6 locs 4 1 2 1 1 2 4 2 1 1 10 reps 8 2 4 4 2 4 7 3 1 1 11 diff 0 . 3 3 . 0 1 . 3 0 . 0 2 . 0 0 . 5 1 . 5 0 . 3 0 . 0 2 . 0 2 . 8 pr & gt ; t . 391 . 344 . 500 . 058 * . 500 . 001 # __________________________________________________________________________ * = 10 % sig + = 5 % sig # = 1 % sig table 2b__________________________________________________________________________hybrid comparison reportvariety # 1 = 33y18variety # 2 = 3394__________________________________________________________________________ prm bu bu tst sdg est gdu prm shd acr acr mst wt vgr cnt shd abs abs abs % mn % mn abs % mn % mn % mn__________________________________________________________________________total sum 1 112 115 177 . 2 105 100 57 . 3 113 104 104 2 109 112 164 . 3 97 92 56 . 0 129 102 101 locs 37 29 133 133 135 69 82 84 40 reps 37 29 155 155 157 81 91 95 44 diff 3 3 12 . 9 8 8 1 . 3 16 2 3 pr & gt ; t . 000 # . 000 # . 000 # . 000 # . 000 # . 000 # . 000 # . 130 . 000 # __________________________________________________________________________ gdu stk plt ear rt sta stk brt grn slk cnt ht ht ldg grn ldg stk app % mn % mn % mn % mn % mn % mn % m % mn % mn__________________________________________________________________________total sum 1 104 102 106 110 96 123 104 107 110 2 100 101 95 98 106 80 99 99 101 locs 25 153 64 64 36 83 72 15 9 reps 26 193 72 72 48 93 83 21 9 diff 4 1 11 12 10 43 4 8 8 pr & gt ; t . 000 # . 019 + . 000 # . 000 # . 005 # . 000 # . 020 + . 049 + . 113__________________________________________________________________________ drp glf nlf mdm fus dip ecb ecb ecb ear spt blt cpx ers ers dpe 1lf 2sc % mn abs abs abs abs abs abs abs abs__________________________________________________________________________total sum 1 100 5 . 8 5 . 0 4 . 5 6 . 5 4 . 0 100 . 0 5 . 0 7 . 3 2 97 2 . 1 6 . 0 3 . 5 4 . 0 8 . 0 100 . 0 1 . 0 4 . 8 locs 22 15 1 1 2 1 1 1 10 reps 24 15 2 2 2 1 1 1 11 diff 2 3 . 7 1 . 0 1 . 0 2 . 5 4 . 0 0 . 0 4 . 0 2 . 5 pr & gt ; t . 306 . 000 # . 344 . 007 # __________________________________________________________________________ * = 10 % sig + = 5 % sig # = 1 % sig table 2c__________________________________________________________________________hybrid comparison reportvariety # 1 = 33y18variety # 2 = 32k61__________________________________________________________________________ prm bu bu tst sdg est gdu gdu prm shd acr acr mst wt vgr cnt shd slk abs abs abs % mn % mn abs % mn % mn % mn % mn__________________________________________________________________________total sum 1 113 115 181 . 5 105 99 57 . 5 111 105 103 104 2 115 117 170 . 9 98 105 57 . 1 101 98 105 106 locs 20 18 72 72 75 41 49 48 23 18 reps 20 18 76 76 79 42 53 53 25 18 diff 2 2 10 . 6 7 6 0 . 4 11 7 2 2 pr & gt ; t . 000 # . 000 # . 001 # . 000 # . 000 # . 123 . 009 # . 000 # . 000 # . 000 # __________________________________________________________________________ stk plt ear rt sta stk brt grn drp glf cnt ht ht ldg grn ldg stk app ear spt % mn % mn % mn % mn % mn % mn % mn % mn % mn abs__________________________________________________________________________total sum 1 102 106 110 94 110 104 105 115 99 5 . 4 2 98 104 101 96 124 105 106 122 101 5 . 1 locs 97 46 46 21 49 49 8 4 14 17 reps 123 51 51 21 54 53 13 4 15 22 diff 4 2 9 1 14 0 1 8 1 0 . 4 pr & gt ; t . 000 # . 009 # . 000 # . 811 . 002 # . 999 . 176 . 186 . 435 . 061 * __________________________________________________________________________ nlf slf ant hd mdm fus dip ecb ecb blt blt rot smt cln cpx ers ers 1lf 2sc abs abs abs abs abs abs abs abs abs abs__________________________________________________________________________total sum 1 4 . 9 4 . 0 4 . 5 100 . 0 7 . 5 4 . 0 5 . 8 3 . 3 5 . 0 7 . 8 2 4 . 5 7 . 0 4 . 5 100 . 0 5 . 0 2 . 8 5 . 7 4 . 8 6 . 0 6 . 4 locs 4 1 2 1 1 2 3 2 1 5 reps 8 2 4 4 2 4 4 3 1 5 diff 0 . 4 3 . 0 0 . 0 0 . 0 2 . 5 1 . 3 0 . 2 1 . 5 1 . 0 1 . 4 pr & gt ; t . 215 . 999 . 344 . 808 . 205 . 052 * __________________________________________________________________________ * = 10 % sig + = 5 % sig # = 1 % sig comparison data was collected from strip tests that were g by farmers . each hybrid was grown in strips of 4 , 6 , 8 , 12 , etc . rows in fields depending on the size of the planter used . the data was collected from strip tests that had the hybrids in the same area and weighed . the moisture percentage was determined and bushels per acre was adjusted to 15 . 5 percent moisture . the number of comparisons represent the number of locations or replications for the two hybrids that were grown in the same field in close proximity and compared . comparison strip testing was done between pioneer brand hybrid 33y18 and pioneer brand hybrids 3335 , 3394 , and 32k61 . the comparisons come from all the hybrid &# 39 ; s adapted growing areas in the united states . these results are presented in table 3 . the results show hybrid 33y18 demonstrates a significant yield advantage over hybrid 3394 and shows a significant yield advantage in the weighted average for all the comparison hybrids . the weighted average yield advantage for all the comparison hybrids is 5 . 2 bushels per acre and ranges from 9 . 9 to 1 . 5 . hybrid 33y18 demonstrates a significant income advantage to the farmer over hybrid 3335 and hybrid 3394 and shows a significant income advantage in the weighted average for all the comparison hybrids . the weighted average adjusted gross income advantage for all the hybrids is $ 16 . 48 per acre and ranges from $ 26 . 06 to $ 9 . 92 . hybrid 33y18 shows a significant lower harvest moisture advantage over hybrid 3335 and hybrid 32k61 and shows a significant lower harvest moisture advantage in the weighted average for all the comparison hybrids . hybrid 33y18 exhibits a significant test weight advantage over all three hybrids . the yield and income advantage for hybrid 33y18 plus its advantage for other characteristics over these hybrids will make it an important addition for most of the areas where these hybrids are grown . table 3__________________________________________________________________________1996 performance comparison report for corn1 year summary of all standard test types income / pop stand roots testbrand product yield moist acre k / acre (%) (%) wt__________________________________________________________________________pioneer 37y18 163 . 8 22 . 6 468 . 68 24 . 7 89 84 57 . 3pioneer 3335 161 . 6 23 . 8 458 . 53 25 . 4 85 91 55 . 6advantage 2 . 2 1 . 2 10 . 15 - 0 . 7 4 - 7 1 . 7number of comparisons 108 108 108 79 66 44 99percent wins 59 69 62 27 60 4 85probability of difference 87 99 98 97 99 98 99pioneer 33y18 164 . 3 22 . 6 470 . 42 24 . 7 89 85 57 . 2pioneer 3394 154 . 4 21 . 7 444 . 36 25 . 1 90 91 56 . 1advantage 9 . 9 - 0 . 9 26 . 06 - 0 . 4 - 1 - 6 1 . 1number of comparisons 109 109 109 78 64 42 99percent wins 72 30 72 41 45 7 74probability of difference 99 99 99 82 84 96 99pioneer 33y18 156 . 1 22 . 6 446 . 55 24 . 6 86 91 57 . 5pioneer 32k61 154 . 6 24 . 6 436 . 63 24 . 9 92 97 56 . 8advantage 1 . 5 2 . 0 9 . 92 - 0 . 3 - 6 - 6 0 . 7number of comparisons 55 55 55 45 36 24 53percent wins 49 90 54 40 33 8 60probability of difference 49 99 87 63 96 86 99pioneer 33y18 162 . 5 22 . 6 464 . 90 24 . 7 88 86 57 . 3weighted avg 157 . 3 23 . 1 448 . 42 25 . 2 89 92 56 . 1advantage 5 . 2 0 . 5 16 . 48 - 0 . 5 - 1 - 6 1 . 2number of comparisons 272 272 272 202 166 110 251percent wins 62 58 64 35 48 6 76probability of difference 99 99 99 99 38 99 99__________________________________________________________________________ note : the probability values are useful in analyzing if there is a &# 34 ; real &# 34 ; difference in the genetic potential of the products involved . high values are desirable , with 95 % considered significant for real differences . characteristics of pioneer hybrid 33y18 are compared to pioneer hybrids 3335 , 3394 , and 32k61 in table 4 . table 4 shows that hybrid 33y18 exhibits excellent yield ability . hybrid 33y18 presents outstanding resistance to stalk lodging and shows better resistance to stalk lodging than hybrid 3335 and hybrid 3394 . hybrid 33y18 also demonstrates exceptional stay green and shows a better stay green score than hybrid 3335 and hybrid 3394 . hybrid 33y18 exhibits a very good test weight rating , which is higher than the test weight rating for hybrid 3335 and hybrid 3394 . hybrid 33y18 shows an above average early growth value . hybrid 33y18 exhibits a higher plant and ear height than all three of the comparison hybrids . hybrid 33y18 shows a very good brittle stalk value , which is better than all three of the comparison hybrids . hybrid 33y18 presents a very good value for resistance to gray leaf spot , which is better than the resistance values shown for hybrid 3335 and hybrid 3394 . hybrid 33y18 also demonstrates a superior value for resistance to second generation european corn borer feeding , which is better than the resistance values for all three of the comparison hybrids . the excellent yield shown by hybrid 33y18 , combined with its other favorable agronomic characteristics should make it an important hybrid in its area of adaptation . table 4__________________________________________________________________________hybrid patent comparison - characteristicspioneer hybrid 33y18 vs . pioneer hybrids 3335 , 3394 and__________________________________________________________________________32k61 silk phy gdu gdu sta tstvarietyrm crm crm silk phy yld h / pop l / pop sil r / l grn wt__________________________________________________________________________33y18112 115 112 1440 2710 9 8 9 8 4 8 73335 113 113 114 1410 2770 9 8 9 4 7 7 63394 110 111 110 1390 2660 8 8 8 7 7 7 632k61114 116 114 1450 2770 9 8 8 8 8__________________________________________________________________________ plt ear brt hsk glf nlf ant mdm fus ecbvarietye / g ht ht d / e stk cvr spt blt rot cpx ers 25c__________________________________________________________________________33y186 8 8 5 6 4 6 5 4 4 6 63335 5 7 5 6 3 3 5 4 3 4 4 43394 8 5 6 4 4 4 2 5 4 3 4 532k616 7 6 5 3 5 6 5 5 3 5 5__________________________________________________________________________ this invention includes hybrid maize seed of 33y18 and the hybrid maize plant produced therefrom . the foregoing was set forth by way of example and is not intended to limit the scope of the invention . as used herein , the term plant includes plant cells , plant protoplasts , plant cell tissue cultures from which maize plants can be regenerated , plant calli , plant clumps , and plant cells that are intact in plants , or parts of plants , such as embryos , pollen , ovules , flowers , kernels , ears , cobs , leaves , seeds , husks , stalks , roots , root tips , anthers , silk and the like . duncan , williams , zehr , and widholm , planta , ( 1985 ) 165 : 322 - 332 reflects that 97 % of the plants cultured which produced callus were capable of plant regeneration . subsequent experiments with both inbreds and hybrids produced 91 % regenerable callus which produced plants . in a further study in 1988 , songstad , duncan & amp ; widholm in plant cell reports ( 1988 ), 7 : 262 - 265 reports several media additions which enhance regenerability of callus of two inbred lines . other published reports also indicated that &# 34 ; nontraditional &# 34 ; tissues are capable of producing somatic embryogenesis and plant regeneration . k . p . rao , et al ., maize genetics cooperation newsletter , 60 : 64 - 65 ( 1986 ), refers to somatic embryogenesis from glume callus cultures and b . v . conger , et al ., plant cell reports , 6 : 345 - 347 ( 1987 ) indicates somatic embryogenesis from the tissue cultures of maize leaf segments . thus , it is clear from the literature that the state of the art is such that these methods of obtaining plants are , and were , &# 34 ; conventional &# 34 ; in the sense that they are routinely used and have a very high rate of success . tissue culture of maize is described in european patent application , publication 160 , 390 , incorporated herein by reference . maize tissue culture procedures are also described in green and rhodes , &# 34 ; plant regeneration in tissue culture of maize ,&# 34 ; maize for biological research ( plant molecular biology association , charlottesville , va . 1982 , at 367 - 372 ) and in duncan , et al ., &# 34 ; the production of callus capable of plant regeneration from immature embryos of numerous zea mays geneotypes ,&# 34 ; 165 planta 322 - 332 ( 1985 ). thus , another aspect of this invention is to provide cells which upon growth and differentiation produce maize plants having the genotype of 33y18 . maize is used as human food , livestock feed , and as raw material in industry . the food uses of maize , in addition to human consumption of maize kemels , include both products of dry - and wet - milling industries . maize , including both grain and non - grain portions of the plant , is also used extensively as livestock feed , primarily for beef cattle , dairy cattle , hogs , and poultry . industrial uses of maize include production of ethanol , maize starch in the wet - milling industry and maize flour in the dry - milling industry . the industrial applications of maize starch and flour are based on functional properties , such as viscosity , film formation , adhesive properties , and ability to suspend particles . the maize starch and flour have application in the paper and textile industries . other industrial uses include applications in adhesives , building materials , foundry binders , laundry starches , explosives , oil - well muds , and other mining applications . plant parts other than the grain of maize are also used in industry . stalks and husks are made into paper and wallboard and cobs are used for fuel and to make charcoal . the seed of the hybrid maize plant and various parts of the hybrid maize plant can be utilized for human food , livestock feed , and as a raw material in industry . although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity and understanding , it will be obvious that certain changes and modifications may be practiced within the scope of the invention , as limited only by the scope of the appended claims . applicant has made a deposit of at least 2500 seeds of hybrid maize line 33y18 with the american type culture collection ( atcc ), rockville , md . 20852 u . s . a ., atcc deposit no . 209600 . the seeds deposited with the atcc on jan . 27 , 1998 were taken from the deposit maintained by pioneer hi - bred international , inc ., 700 capital square , 400 locust street , des moines , iowa 50309 - 2340 since prior to the filing date of this application . this deposit of the hybrid maize line 33y18 will be maintained in the atcc depository , which is a public depository , for a period of 30 years , or 5 years after the most recent request , or for the enforceable life of the patent , whichever is longer , and will be replaced if it becomes nonviable during that period . additionally , applicant has satisfied all the requirements of 37 c . f . r . §§ 1 . 801 - 1 . 809 , including providing an indication of the viability of the sample . applicant imposes no restrictions on the availability of the deposited material from the atcc ; however , applicant has no authority to waive any restrictions imposed by law on the transfer of biological material or its transportation in commerce . applicant does not waive any infringement of its rights granted under this patent .	8
fig1 is a block diagram of a beat counting apparatus of the present invention . the following provides an overview of the fig1 apparatus ; additional details will be provided in subsequent sections hereinbelow . in fig1 a digitized acoustical signal comprising a sequence of digital data points or samples is input on line 110 to down - sampling unit 101 which down - samples the input digital signal by a factor of , for example , ten and provides a decimated signal on line 111 . group - summing unit 103 groups the data points of the decimated signal into groups of 30 , for example , and forms a group sum of the absolute values of every 30 data points of the decimated signal and outputs the group - summed signal on line 113 . onset detecting unit 105 employs a smooth - and - differentiate processor and detects the onset peaks of energy modulation in the group - summed signal on line 113 and generates on line 115 a train of pulses , hereinafter called the onset peak train , which coincides with the onset peaks . the onset peak train is illustrated , for example , in fig2 ( d ) and in fig3 . beat - counting unit 107 performs a pulse - matching process by comparing , in accordance with an algorithm described in detail below , the onset peak train on line 115 with a set of unit pulse sequences of different periods and determines the one of the unit pulse sequences that most closely matches the period of the onset peak train . from this period , the beats per minute ( bpm ) are calculated , and an output representing the bpm is provided on line 117 . stability enhancement unit 109 employs a check - frame decision making process on the bpm reported on line 117 and provides a stabilized bpm report on line 119 . a detailed discussion of the components of the fig1 apparatus will now be provided . digital audio signals are usually sampled at 44 . 1 khz . direct processing of the signals would require tremendous computational power from the processor . however , with regard to beat perception , a large portion of the data carries unimportant information . accordingly , retaining all of the details of the waveform is unnecessary . this is especially true when the signal will later be smoothed . the present invention employs two steps in reducing the data redundancy . first , the original signal is down sampled by a factor of ten , and second , every 30 data points are summed . these two steps effectively reduce the sampling rate to 147 hz , i . e ., by a factor of 300 , and greatly reduce the computational load of the dsp . the justification for this is described below . a major concern with regard to down sampling of a signal involves aliasing . however , the present invention recognizes that aliasing is not a real issue when there is no need to rely on the spectrum of the signal . it is the envelope of the waveform that matters for an onset detector . as long as the sampling rate can preserve the envelope and onsets of a waveform , it should be acceptable . based on the assumption that the maximum beats per minute ( bpm ) are 180 , which corresponds to three beats per second , a sampling rate of 147 hz should suffice . however , directly down sampling the signal to 147 hz poses a threat regarding the precision . first , some of the onsets might disappear with the 299 data points that are neglected . secondly , the coarse temporal resolution of the signal waveform would degrade the performance of the onset detector . in order to tackle these problems , the present invention employs the aforementioned “ group summing ” method , which involves , rather than discarding data points , summing them up . in other words , after the 10 : 1 decimation of the original signal , the points are grouped into groups of 30 , and each group is represented by the scaled sum of the absolute values of their members . this procedure turns out to be more than what it first seems . because of the fact that group - summing performs data smoothing and , at the same time , preserves the peaks with width of the group dimension , it not only reduces sample points but also assists in onset detection . this can be seen from fig2 ( b ) where the onsets of the original signal have been redefined as prominent peaks after group summing . with this concise version of the signal ( i . e ., achieved after decimation and group - summing ), the following calculation can be done in a much more efficient way than is the case with many other beat counter algorithms . for certain strong - beat music pieces , the peaks formed by the down - sampling and group - summing units 101 and 103 described above provide sufficient information for beat counting without the need of onset detection . however , to ensure better quality and broader application , an onset detector 105 is incorporated into the beat - counting system of the present invention . this onset detector 105 is a smooth - and - differentiate processor which in itself is known to those skilled in the art and can be easily found in the existing literature ( for example “ two - dimensional signal and image processing ” by jae s . lim ptr prentice hall ). the specific computation adopted in the algorithm of the present invention will now be briefly described . first , the group - summed signal is smoothed by a low pass filter which is 100 milliseconds long with a cutoff frequency at about 20 hz ( the filter is 7 - tab when the sampling rate is 147 hz ). then , the differentiation is performed as follows . the difference between every other sample point is calculated to extract the sharp transitions of the smoothed signal . the reason for taking the difference of every other point is to extract the sharp transitions of the smoothed signal and to make the peaks stand out more clearly by avoiding some fine fluctuation of the smoothed signal . alternatively , since only half of the data in the smoothed signal is needed , the smoothed signal can be calculated for every other point while taking the straight difference . the second method saves the dsp half of the effort of computing the convolution between the signal and the filter . finally , a rectifier is used to set to zero the data points whose values fall below zero . this is done under the assumption that onsets only concern the rising of the signal amplitude not the opposite . the results are shown in the graphs of fig2 ( c ) and ( d ). the onset peaks of the onset peak train of fig2 ( d ), which suggest the beat locations , are then used for beat counting in beat counting unit 107 of fig1 . beat counting unit 107 receives the onset peak train from onset peak detecting unit 105 and performs a pulse matching process to estimate the bpm as described below . the beat counting algorithm of the present invention , when compared with the resonator phase - locking technique , has a different approaching concept and different implementation . the theory of phase - locking is to liken the human beat perception system to a resonator , which , when properly tuned , can identify the frequency of a noise - affected periodic signal . a problem with this approach is that the resonator needs to process the whole input signal and monitor every single output data for some period in order to determine the waveform pattern and come up with a frequency number . this might be the way humans perceive pitch , but it is not exactly the way they achieve beat perception . it would be more natural to say that humans perceive rhythm by first locating an onset , looking back in their memory for recently perceived onsets , and then studying the regularity of the occurrences of the onsets . with regard to beat perception , the information between beats does not really contribute . with this in mind , the present invention employs a novel algorithm which ignores most of the unnecessary processes . this algorithm , as opposed to the autocorrelation and the resonator phase - locking algorithms which operate on every sample , processes only those data points which lie at the top of certain pulse peaks . in the present invention , these points are denominated “ peak points ” ( fig3 ). the techniques of the present invention for searching and pulse matching are implemented as described below . the onset peak train generated by the onset detector 105 is segmented into frames of about two seconds long . a peak profile is defined by those successive points inside a frame with values higher than a threshold t calculated as : where a and m are , respectively , the average and the maximum of all data points within an onset peak train frame . in fig3 the threshold t is indicated by the dashed line , and the peak points are indicated by the asterisks . the peak point is the data point with the greatest value in the peak profile . the pulse matching process is as follows . first , it is assumed that the peak point is at a beat position , and the onset peak train is compared with a set of unit pulse sequences of different periods . fig4 ( b ) shows an onset peak train , and fig4 ( a ) and 4 ( b ) show examples of unit pulse sequences . the period of the unit pulse sequence best matching the period of the onset peak train is selected as a candidate for the onset peak train period . the determination of the match is made mathematically as described below . a function sum i ( n ) is calculated by adding the values of ten onset peak train data points matched by the unit pulses before and / or after the peak point . a match is defined as a coincidence in time . sum i ( n ) is expressed as : sum i ( n )= x ( m )+ x ( m + n )+ x ( m + 2 n )+ . . . + x ( m − n )+ x ( m − 2 n ) ( 1 ) where x is the onset peak train signal , i is the selected peak point index , m is the peak point position , and n is the unit pulse period , which ranges from 20 to 80 ( which corresponds to bpm values 55 to 180 ). the inclusion of x ( m ) in the sum means that all unit pulse sequences must have at least one pulse right at the peak point i . if there exists a beat pattern matching a unit pulse sequence with period n , sum i ( n ) would show a maximum at unit pulse period n = n . since there is certainly no guarantee that peak point i is really “ on the beat ,” it is not sufficient merely to maximize sum i ( n ). accordingly , the present invention includes the following further processing steps . sum i ( n ) is calculated for all peak points in the frame , and the values are accumulated to yield another function sum ( n ), as defined in equation ( 2 ): the value n , which results in the greatest sum ( n ), is determined to be the beat period in terms of the points of the onset peak train . it should be noted that no matter how large n is , ten data points are always summed , expecting the beat pattern to repeat itself ten times . also , when carrying out equation ( 1 ), a forward sum is performed first , i . e ., adding up the data after m , until the frame boundary is reached , then a backward sum is performed , until ten data points have been added . the memory size , as a result , should be sufficiently large to store data points of previous frames for all n &# 39 ; s . the amount of the memory buffer used in the process varies with the beat period , ranging from 200 ( 20 × 10 ) to 800 ( 80 × 10 ) points . this is quite natural because it resembles the way the human perception network works in that a longer time is required to set up the beat feeling for slow - paced music than for fast - paced music . it should be noted also that , as shown in fig3 only four peak points are selected out of 150 points in the frame . if the logic of autocorrelation or resonator phase locking were followed , 30 times more computation would be needed for the task . although fig3 shows only one particular example , it is adequate to show how the present invention saves computation time . moreover , due to the group - summing technique of the present invention , the memory size is comparatively smaller than what would be needed using a prior art technique . fig5 demonstrates one of the sum ( n ) functions of the onset peak train frame in fig3 and fig4 ( b ). here , the best period ( n = 44 ) is successfully estimated by the highest peak . this period is related to the actual beat period by just a time factor resulting from sample reduction . after the beat period is determined , bpm can be calculated accordingly . stability enhancing unit 109 receives the bpm output from beat counting unit 107 and employs a check - frame decision making procedure to yield a stabilized bpm output on line 119 . the beat counting system described above updates the values of bpm every frame , which is two seconds based on the value of the parameters chosen above . in each frame , the beat period is determined by the value of n which maximizes sum ( n ) in equation ( 2 ). this is based on the theory that the period best coinciding with the onset peaks is the time duration of a quarter note . one possible scenario is that , for some time interval , the most frequently occurring note undergoes a change from a quarter note to another note , for example , an eighth note . as a result , the calculated period differs by , for example , a factor of two . if the change occurs over a short time period , the human &# 39 ; s sense of beat will not be altered because of the integer - ratio - relationship of the two note values . however , the computerized beat counter would report a very different bpm value . this phenomenon , along with the actual presence of some short - term abnormal change of the beat pattern , results in some instability of the bpm reporting system . in order to improve the robustness of the beat counter , the present invention employs a method which allows the short - term fluctuation to be avoided without compromising the accuracy of beat calculation . this method will now be described in detail with reference to fig8 ( a ) and 8 ( b ). first , the bpm value for a first frame 1 of a music piece is calculated using the novel beat - counting algorithm described in the previous sections . this bpm is assumed to be reported based on the duration of a quarter note just found . this frame is denominated a full - processed frame for the reason that the beat period , n , is determined by evaluating sum ( n ) among all possible values of n ranging from 20 to 80 in the illustrative process described above , thus resulting in sum ( n ) being a global maximum . as for the next frame , i . e ., frame 2 in fig8 ( a ), which is tentatively denominated a check - frame , the process is simplified . here , sum ( n ) is evaluated only between n = n − 10 and n = n + 10 . in other words , n is the beat period determined for frame 1 ; if , by way of example , n = 44 , sum ( n ) for frame 2 would be evaluated only between n = 34 and n = 54 , rather than n = 20 and n = 80 as with a full - processed frame . the purpose is to check if n still yields a peak in sum ( n ) locally . the idea is that , even when the eighth note dominates in the current frame , the quarter note should still retain preference among its neighbors and present itself as a local maximum in sum ( n ). as long as sum ( n ) is a local maximum , bpm of the previous frame is reported for the current check - frame , and the next frame , i . e ., frame 3 in fig8 ( a ), would still be a check - frame . if , on the other hand , sum ( n ) is not a local maximum , bpm of the previous frame is reported for frame 2 , but the next frame , i . e ., frame 3 in fig8 ( a ), is set as a full - processed frame . it should be noted that bpm is only updated in a full - processed frame and never in a check - frame . if sum ( n ) is not a maximum , this suggests that a dramatic change of the rhythm and a new bpm should be determined without the bounds of the previous results . if the change is short term compared with the frame size , the old bpm will report , and there is a greater confidence level in confirming that the pace of the music does change . fig8 ( b ) is a flow chart illustrating the check - frame decision technique described above . step 800 initiates processing of the “ next ” frame which , as it is being processed , is denominated the current frame . in step 801 , the current frame ( frame 1 ) is handled as a full - processed frame , and n for this frame is determined by making sum ( n ) a global maximum . the bpm for this frame is updated in step 803 corresponding to beat period n . in step 805 , processing of the next successive frame ( frame 2 ), which is a check - frame , is begun , and in step 807 , a determination is made as to whether sum ( n ) is a local maximum for this frame . regardless of whether the answer is yes or no , n is assigned to this frame ( frame 2 ) since it is a check - frame , and the bpm is not updated for this frame . if step 807 determines that sum ( n ) is a local maximum for this frame , the next frame ( frame 3 ) is also treated as a check - frame . if step 807 determines that sum ( n ) is not a local maximum , the next frame ( frame 3 ) will be handled as a full - processed frame by proceeding to step 800 . steps 801 - 809 would then be carried out with respect to this frame ( frame 3 ). it will be apparent that all frames of the onset peak train may be processed in this manner . as can be seen , the decision making process employing the check - frame adds error resilience to the beat counter apparatus of the present invention . the only cost is the speed of the response to actual beat changes . as is apparent , the method must wait two frames to report a new value of bpm . with a frame two seconds long , it would seem that there will be a four seconds delay in response to the change . however , in actuality , no human being can foresee the beat change right at its beginning . human beat perception has delays , too . humans must wait to receive a couple of new beats to discern whether the beat pace has changed or not . the delay depends on the beat period which could be as long as two seconds if bpm is 60 . as a result , the delay is not a problem . moreover , even with regard to this “ four seconds ,” there is a way to get around it when the algorithm is used on a cd player which has speed 2 × or higher . with the high speed , the algorithm can actually “ foresee ” the future by utilizing the buffer ; in other words , it can be fed with the data of the frame after the frame to which the dj is currently listening . the actual situation would be such that , when the dj is listening to a check - frame which suggests a new bpm , the algorithm is preparing to update the value before the dj finishes that check frame . the delay can thus be cut to less than two seconds . fig6 ( a ) and ( b ) show the bpm values of a rock song ( semi - charmed life by third eye blind ) reported by the algorithm of the present invention with and without stability enhancement . it is apparent from fig6 ( a ) and 6 ( b ) that the check frame decision making greatly stabilizes the system . the bpm values reported without stability enhancement jump mostly among values having ratios close to those of two small integers , such as 2 / 3 . this is due to the variability of music progressing rather than a real change of rhythm . a good beat counter should not be confused by this phenomenon . it should be noted that , by stabilizing the bpm reporting system , it is not blinded from detecting the real change . in fact , the system is capable of responding to a tempo change . fig7 shows the bpm values for a two - minute sound file generated by manually pasting one sound sample to another using a waveform editor . the sound file has a sudden tempo change at about one minute into the file , estimated between the 27 th and 28 th frames in the graph . as can be seen , the system started its response at the 29 th value , although it seems to need a transition time before the new beat count is settled . this transition time is partly due to the requirement that ten data points should be added for sum ( n ) and partly due to the imperfect connection between the two independent sound points . for the former , the transition time depends on the new tempo and should be shorter when the value is higher than 60 beats per second , the value for the second half in fig7 . as for the latter , it should not be a concern because it does not happen in a well - behaved music piece . the performance of the computational speed is dramatic . it takes only eight seconds to process a 4 . 5 - minute song . it should be noted that all the values of the parameters are changeable . for example , the parameters can be set so as to yield a beat counter with greater computational complexity yet shorter response time . however , with reasonable change , the fast speed is guaranteed , allowing simultaneous operations of beat - counting with other sound effects , and this is exactly what the dj market needs . fig9 is a flow chart illustrating the overall system of the present invention . in step 901 , the input digital signal is down sampled by a predetermined factor ( for example , ten ) to produce a decimated signal comprising a plurality of first data points . in step 902 , the plurality of first data points are grouped into groups each of which comprise a predetermined number of the first data points ( for example , 30 ) of the decimated signal and the absolute values of the data points in each of the groups are summed to produce a group - summed signal comprising a plurality of second data points . step 903 includes deriving from the group - summed signal an onset peak train comprising a plurality of third data points in accordance with an algorithm which involves either setting the third data points to be identical to the second data points or processing the second data points in accordance with a smooth - and - differentiate algorithm to obtain the third data points . step 904 includes dividing the plurality of third data points of the onset peak train into a plurality of frames of uniform duration , and step 905 includes detecting , within each of the frames , peak profiles each comprising successive ones of the third data points having values greater than a predetermined threshold . step 906 includes detecting , within each of the peak profiles of each of the frames , a peak point having a greatest value among the successive ones of the third data points . in step 907 , a match is determined between the peak point and one of a plurality of unit data pulse sequences , having different periods , in accordance with a predetermined criterion , wherein the rhythmic beat is determined corresponding to the period of the one of the unit pulse sequences . step 908 includes performing a check frame decision making process as set forth in fig8 ( b ) in order to provide a stabilized output of the rpm . it will be apparent to those of ordinary skill in the art that all the values of the parameters used in the detailed description of the present invention set forth herein may be modified to meet the requirements of any specific implementation . moreover , although the present invention has been fully described by way of examples with reference to the accompanying drawings , it should be understood that numerous variations , modifications and substitutions , as well as rearrangements and combinations , of the preceding embodiments will be apparent to those skilled in the art without departing from the novel spirit and scope of this invention .	6
the preferred embodiments of the peroxide gels used to create the deformable trays according to the precepts of this invention are herein described . it should be noted that the articles “ a ”, “ an ” and “ the ”, as used in this specification , include plural referents unless the content clearly dictates otherwise . poly ( 2 - ethyl - 2 - oxazoline ) is commercially available in 50 , 000 , 200 , 000 and 500 , 000 m . w . varying viscosities and longevity of gels may be created based on the amount and weight of poly ( 2 - ethyl - 2 - oxazoline ) used and the desired strength of peroxide . as a guide , dental gels are preferred to be a viscosity between 1000 and 200 , 000 centipoise . in such ranges , peroxide concentrations may reach up to 50 % hydrogen peroxide using poly ( 2 - ethyl - 2 - oxazoline ) as a thickener . in its preferred form , a 30 % concentration may be obtained with a shelf life of six months at room temperature . the simplest preferred gel is obtained by mixing 50 % strength hydrogen peroxide with 200 , 000 m . w . poly ( 2 - ethyl - 2 - oxazoline ) in a ratio of 6 : 4 . additional strengths of peroxide gels may be obtained by utilizing additional solvents and different molecular weights of poly ( 2 - ethyl - 2 - oxazoline ). some common solvents include : water , ethanol , polyethylene glycols , polypropylene glycols , glycerin , and propylene glycol . any of these may be added for varying the consistency and properties of the gels created . however , each gel must be developed with the basic limitation that the strength of the peroxide in the gel makes the gel inherently more unstable . in the present invention , the resultant gels 15 are placed on preformed pieces of a backing 13 , such as parafilm ( a polymeric wax mixture ), as shown in fig1 . the backing provides stability for the resultant substance and a surface with which the tray may be touched for manipulation . the gels 15 are then dried through conventional processes . typical drying may be performed at temperatures of approximately 37 ° c . for 12 to 24 hours ( fig2 ). drying may also take place in any other suitable environment , including those of ambient air , room temperature , lower than room temperature , higher than room temperature , or vacuums . times and temperatures may vary for individual gel composition . when dried , the gels form a bleaching compound that will conform to a user &# 39 ; s dental arches and form a bleaching tray 10 without cracking or breaking ( fig3 ). the resultant compound is visco - elastic , and gelatinous , having a flexibility and consistency similar to the popular confection known as gummi worms , and will deform when removed from the backing material . the resultant tray is initially planar ; with a significant body of gelatinous whitening composition adhered to the backing . in use , fig4 - 6 , a user will take a tray 10 and wet it with water 20 . the gel will rehydrate and become more adhesive so that the tray will then be applied to the user &# 39 ; s teeth ( dental arch 30 ). the user will press and form the tray 10 around the dental arch 30 ( fig6 ), conforming it to the individual shape of the arch 30 and , ideally covering at least one , if not both , sides of the arch 30 . the user may , if desired , pre - fold the tray ( fig5 ) before applying it to the teeth . the tray 10 according to the present invention is therefore totally customizable and formable , creating a buccal wall 53 , a crease / bottom 56 and a lingual wall 59 . these walls and floor conform exactly to the user &# 39 ; s dental arch 30 ( fig6 ), mimicking the variations and individualities of a particular user &# 39 ; s arch . once treatment is completed , the user simply removes the tray . additional water may be needed to complete removal due to the adhesiveness of the tray 10 . due to the increased peroxide content in the whitening compound , time of treatment will be less than conventional prior art whitening methods . treatment may be accomplished in three days , rather than over the course of a week . as always , a second round of treatment may be initiated , but it is recommended that a user wait at least one day between courses of treatment due to the increased potency of the product . longer treatment times and courses may be utilized with lower concentration peroxide gels and may extend as long as a week of consecutive treatments . by way of example , the following formulations are supplied as examples of compositions for the gel according to the present invention . a true best mode will be dependent upon the desired attributes of the gels , and eventual trays , created . however these examples of possible gels all have the required consistency and bleaching power required by the present invention . it is , of course , to be understood that the following list is only for illustration and that any variation of these and other gels will fall within the purview of this invention . accordingly , it is to be understood that those skilled in the art will be capable of formulating an infinite number of possible gels and , as such , this list should not in any way be deemed limiting of the invention . 1 . 11 %— carbamide peroxide 2 . 43 %— poly ( 2 - ethyl - 2 - oxazoline ) m . w . 500 , 000 3 . 27 . 5 %— purified or distilled water 4 . 16 . 7 %— ethanol 5 . 1 . 0 %— poly acrylic acid 35 % m . w . 100 , 000 6 . 0 . 3 %— sucralose 7 . 0 . 4 %— peppermint oil usp 8 . 0 . 1 %— potassium hydroxide usp 1 . 17 %— carbamide peroxide 2 . 40 %— poly ( 2 - ethyl - 2 - oxazoline ) m . w . 500 , 000 3 . 25 . 5 %— purified or distilled water 4 . 15 . 7 %— ethanol 5 . 1 . 0 %— poly acrylic acid 35 % m . w . 100 , 000 6 . 0 . 3 %— sucralose 7 . 0 . 4 %— peppermint oil usp 8 . 0 . 1 %— potassium hydroxide usp 1 . 23 %— carbamide peroxide 2 . 37 %— poly ( 2 - ethyl - 2 - oxazoline ) m . w . 500 , 000 3 . 23 . 25 %— purified or distilled water 4 . 14 . 7 %— ethanol 5 . 1 . 0 %— poly acrylic acid 35 % m . w . 100 , 000 6 . 0 . 3 %— sucralose 7 . 0 . 4 %— peppermint oil usp 8 . 0 . 1 %— potassium hydroxide usp 9 . 0 . 25 %— sodium fluoride usp 1 . 27 %— carbamide peroxide 2 . 33 %— poly ( 2 - ethyl - 2 - oxazoline ) m . w . 500 , 000 3 . 25 %— purified or distilled water 4 . 13 . 2 %— ethanol 5 . 1 . 0 %— poly acrylic acid 35 % m . w . 100 , 000 6 . 0 . 3 %— sucralose 7 . 0 . 4 %— peppermint oil usp 8 . 0 . 1 %— potassium hydroxide usp 1 . 17 %— carbamide peroxide 2 . 50 %— poly ( 2 - ethyl - 2 - oxazoline ) m . w . 200 , 000 3 . 20 . 5 %— purified or distilled water 4 . 10 . 7 %— ethanol 5 . 1 . 0 %— citric acid 35 % m . w . 100 , 000 6 . 0 . 3 %— aspartame 7 . 0 . 4 %— peppermint oil usp 8 . 0 . 1 %— potassium hydroxide usp 1 . 27 %— carbamide peroxide 2 . 33 %— poly ( 2 - ethyl - 2 - oxazoline ) m . w . 500 , 000 3 . 25 %— purified or distilled water 4 . 13 . 2 %— ethanol 5 . 1 . 0 %— malic acid 35 % m . w . 100 , 000 6 . 0 . 3 %— phenyl alanine 7 . 0 . 4 %— banana flavoring 8 . 0 . 1 %— sodium hydroxide usp 1 . 11 %— hydrogen peroxide 2 . 43 %— poly ( 2 - ethyl - 2 - oxazoline ) m . w . 500 , 000 3 . 27 . 5 %— purified or distilled water 4 . 16 . 7 %— ethanol 5 . 1 . 0 %— poly acrylic acid 35 % m . w . 100 , 000 6 . 0 . 3 %— sucralose 7 . 0 . 4 %— peppermint oil usp 8 . 0 . 1 %— potassium hydroxide usp as can be seen , other ingredients include flavorings and sweeteners , solvents , plasticizers , and other elements for desired effect . it is , of course , readily conceived that other active ingredients may be added to the composition for more desired effects , with or without peroxide . such active ingredients may include and are not limited to fluoride , desensitizers , anti - microbials , anti - fungals , re - mineralizers , surfactants , nutraceuticals , pharmaceuticals and other medicaments . while it is not as preferred as poly ( 2 - ethyl - 2 - oxazoline ), polyvinylpyrrolidone (“ pvp ”) may be used in this invention with good results . again , proportions in formulas using pvp will vary according to desired characteristics and purposes . a specific list of possible additives includes , but is not limited to : desensitizers — potassium citrate , glutaraldehyde , sodium citrate , potassium nitrate , sodium nitrate and sodium and potassium salts of edta , and edta . anti - microbials — chlorhexidine , chlorhexidine gluconate , benzalkonium chloride , thymol , sodium chlorite , potassium chlorite , triclosan , methyl paraben , propyl paraben , sodium benzoate , benzalkonium chloride , cetyl pyridinium chloride , zinc chloride . re - mineralizers — potassium sucrose phosphate , sodium sucrose phosphate , sodium phosphate mono basic , sodium phosphate dibasic , sodium phosphate tri - basic , alone or in combination with one or more of the following : calcium fluoride , calcium hydroxide , calcium hydroxy apatite , sodium fluoride , potassium fluoride , sodium monofluorophosphate . surfactants — sodium lauryl sulfate , polysorbates , lauryl dimethyl amine oxide , cetyltrimethylammonium bromide , polyethoxylated alcohols , polyoxyethylene sorbitan octoxynol , n , n - dimethyldodecylamine - n - oxide , hexadecyltrimethylammonium bromide , polyoxyl 10 lauryl ether , polyoxyl castor oil , nonylphenol ethoxylate , cyclodextrins , lecithin , methylbenzethonium chloride . pharmaceuticals — amoxicillin , amoxil , biaxin , cefzil , cipro , levaquin , minocycline , penicillin , tetracycline , trimox , zithromax , astringent alums nutraceuticals — ascorbic acid , b - glucan , lutein , gallic acid , aloe vera , lactobacillus acidophilus , zinc , tocopherol , choline , q - 10 , b - carotene , lycopene , sodium carbonate , glutathione . flavors — peppermint oil , methyl salicylate , spearmint oil , cinnamon oil , artificial and natural fruit flavorings like banana flavoring , peach flavoring , and apple flavoring . although the present invention has been described with reference to preferred embodiments , numerous modifications and variations can be made and still the result will come within the scope of the invention . such modifications include increasing or decreasing viscosity and peroxide concentration for various purposes . no limitation with respect to the specific embodiments disclosed herein is intended or should be inferred .	0
it was found that , surprisingly , it is possible to condense polycarbonates by simple melting in a vacuum , optionally with bisphenols or suitable oligocarbonates with oh terminal groups , to produce , directly , polycarbonates of higher molecular weights . the present invention thus relates to processes for the condensation of polycarbonate , characterised in that polycarbonates may be condensed in the melt , usefully with the addition of bisphenols or oligocarbonates with oh terminal groups to accelerate the reaction , optionally using catalysts to obtain polycarbonates , which have a higher molecular weight than the starting polycarbonate . in the process according to the invention , the polycarbonate to be condensed , preferably bisphenol a - polycarbonate , as a granulate or ground pc moulded parts , is melted in a suitable vessel and then condensed in a reactor operating batch - wise or continuously . critical values for the reaction parameters for this are pressure , temperature and residence time . the condensation may be carried out in the presence of one or more catalysts . the reaction parameter ranges are 0 . 01 to 5 mbar , preferably 0 . 1 to 2 mbar , 250 - 350 ° c . melting temperature , preferably 280 - 320 ° c . the average residence time depends on the reaction vessel and is 0 . 01 to 0 . 3 hours for screw - type extruders and 0 . 2 to 4 hours for agitated tanks , kneading apparatus and disk or basket reactors . when using disk or basket reactors , residence times of 0 . 5 to 2 hours are preferred . with discontinuous processes , pressure and temperature may be varied in accordance with different schedules . continuous processes are normally run constantly under the suitable temperature and pressure conditions , pressure and temperature profiles being set along the length of the reactor . embodiments preferred , preferred in particular or most particularly preferred are those in which the parameters , definitions and explanations stated under preferred , preferred in particular or most particularly preferred , are used . however , the general definitions , parameters or explanations , or those listed in preferred ranges , given above and below may be combined arbitrarily with each other , i . e ,. between the particular ranges and preferred ranges . the polycarbonate used either already has an average concentration of phenolic terminal groups of over 100 ppm oh , preferably 100 - 1500 ppm , in particular 400 - 1000 ppm , or this is adjusted in the melt by adding a bisphenol , preferably bisphenol a , or oligocarbonates having terminal oh groups . when converting in the melt to higher molecular weights , volatile portions that are split off are discharged from the reactor as vapors . the small quantities arising here are sluiced out of the process by suitable means , which simplifies the process considerably . condensation may be carried out in agitated tanks , screw - or kneading apparatus , extruders , disk or basket reactors and in combinations of such apparatus . for continuous processes , extruders or basket or disk reactors , in particular basket or disk reactors are preferred , as disclosed in de appl . no . 1 011 98 51 or de - c2 44 47 422 . basket or disk reactors are also suitable for discontinuous processing . condensation may be accelerated by carrying it out in the presence of a condensation catalyst . suitable catalysts and the concentrations in which to use them may be taken from the literature ( chemistry and physics of polycarbonates , polymer reviews , h . schnell , vol . 9 , pages 44 - 51 , john wiley & amp ; sons , 1964 ; de - ps 1 031 512 ; ep - a 360 578 ; ep - a 351 168 ; u . s . pat . no . 3 , 442 , 854 ). alkali - or earth alkali compounds with an alkaline action and ammonium - or phosphonium salts , hereinafter described as onium salts , are preferred . phosphonium salts according to the invention are those of the formula ( iv ), wherein r 1 - 4 independently one of the others may be c 1 - c 10 - alkyls , c 6 - c 10 - aryls , c 7 - c 10 - aralkyls or c 5 - c 6 - cycloalkyls , preferably methyl or c 6 - c 14 - aryls , in particular methyl or phenyl , and x − may be an anion such as hydroxide , sulfate , hydrogen sulfate , hydrogen carbonate , carbonate , a halogenide , preferably chloride , or an alcoholate of the formula or , wherein r may be c 6 - c 14 - aryl or c 7 - c 12 - aralkyl , preferably phenyl . further preferred catalysts , which may be used alone or optionally in addition to an onium salt , are compounds of alkali metals and earth alkali metals with an alkaline action , such as hydroxides , alkoxides and aryloxides of lithium , sodium , potassium , magnesium and calcium , preferably of sodium . sodium hydroxide and sodium phenolate and the sodium bisphenolate of bisphenol a are most preferred . the polycarbonate is introduced into the condensing reactor preferably via a screw . if bisphenols or oligomers with oh terminal groups are added to increase the concentration of oh terminal groups , the screw serves as a mixing unit as well . a melting screen with or without a backwashing device may be positioned between the screw and the condensing reactor , to avoid contaminant particles having sizes that are ≧ 5 μm from the highly fluid melt . the melt flowing from the condensing reactor after polycondensation is discharged by means of a gear pump . here the melt may be fed over static mixers or extruders and mixed with additives to set special formulations of the polycarbonates produced before being fed on for granulation . suitable additives are disclosed e . g . in wo 99 / 55772 , pg . 15 - 25 , de appl . no . 10122496 . 6 and in “ plastics additives ”, r . gätchter and h . müller , hanser publishers 1983 . in principle , additives may be added at any point in the reaction , preferably before granulation . any bisphenol or an oligocarbonate having oh terminal groups may optionally be added to the polycarbonate to be condensed . the bisphenol or the oh - containing oligocarbonate on which the polycarbonate to be condensed is based , are preferred . the dosage , in terms of parts by weight , of the bisphenol or the oligocarbonate in relation to the weight of polycarbonate used is in the range 0 : 100 to 10 : 100 , preferably 0 . 1 : 100 to 5 : 100 , in particular 0 . 2 : 100 to 1 : 100 for the bisphenol and in the range 0 : 100 to 50 : 100 , preferably 0 . 5 : 100 to 30 : 100 , in particular 1 : 100 to 10 : 100 for the oligocarbonate . examples of bisphenols that may be used according to the invention or may also form the basis of the polycarbonate to be condensed may be found in wo - a1 01 / 05866 , pg . 6 - 8 . 4 , 4 ′- dihydroxybiphenyl , 4 , 4 ′- dihydroxydiphenyl sulphide , 2 , 2 - bis -( 4 - hydroxyphenyl )- propane ( bisphenol a ), 2 , 2 - bis -( 3 - methyl - 4 - hydroxyphenyl )- propane , 2 , 2 - bis -( 3 , 5 - dimethyl - 4 - hydroxyphenyl )- propane , 2 , 2 - bis -( 4 - hydroxyphenyl )- methane , 2 , 2 - bis -( 3 , 5 - dimethyl - 4 - hydroxyphenyl )- methane , 2 , 4 - bis -( 4 - hydroxyphenyl ) - 2 - methylbutane , 2 , 4 - bis -( 3 , 5 - dimethyl - 4 - hydroxyphenyl )- 2 - methylbutane , 1 , 1 - bis -( 4 - hydroxyphenyl )- cyclohexane , α , α ′- bis -( 4 - hydroxyphenyl )- p - diisopropylbenzene , 2 , 2 - bis -( 3 - chloro - 4 - hydroxyphenyl )- propane , 2 , 2 - bis -( 3 , 5 - dichloro - 4 - hydroxyphenyl )- propane , 2 , 2 - bis -( 3 , 5 - dibromo - 4 - hydroxyphenyl )- propane and 1 , 1 - bis -( p - hydroxyphenyl ) - 3 , 3 , 5 - trimethylcyclohexane are preferred . diphenols preferred in particular are 4 , 4 ′- dihydroxybiphenyl , 2 , 2 - bis -( 4 - hydroxyphenyl )- propane ( bisphenol a ) and 1 , 1 - bis -( p - hydroxyphenyl )- 3 , 3 , 5 - trimethylcyclohexane . 2 , 2 - bis -( 4 - hydroxyphenyl )- propane ( bisphenol a ) and 1 , 1 - bis -( p - hydroxyphenyl ) - 3 , 3 , 5 - trimethylcyclohexane are preferred most particularly , in particular 2 , 2 - bis -( 4 - hydroxyphenyl )- propane ( bisphenol a ). accordingly the oligomers obtained from these bisphenols may also be used according to the invention . the polycarbonate used has a weight average molecular weight ( m w ) of 15 , 000 to 30 , 000 , preferably 16 , 000 to 25 , 000 , in particular 17 , 000 to 22 , 000 , determined by measuring the relative solution viscosity in dichloromethane , calibrated by light scattering . a pc recyclate is preferred , in particular a pc recyclate from compact discs . the polycarbonates and copolycarbonates used may originate from the known interfacial or melt transesterification process and may therefore contain different chain stoppers . phenol , octylphenol , cumylphenol and t - butylphenol are suitable chain stoppers . other typical chain stoppers for polycarbonate may be taken from wo - a1 01 / 05866 , pg . 4 - 6 . there may also be mixtures of chain stoppers , e . g ., via the mixing of different polycarbonates . polycarbonates from the melt transesterification process preferably have the phenol of the diphenylcarbonate used for production as a chain stopper . single polycarbonate or a mixture of various polycarbonates may be condensed . the polycarbonates may differ with regard to their average molecular weight , the bisphenol used and / or the chain stopper , branching agent etc ., used . furthermore , the polycarbonates may contain chain branching agents such as are disclosed in wo - a1 01 / 05866 , pg . 8 - 9 . mixtures of polycarbonates , which are built up of the same bisphenol , in particular bisphenol a , are preferred . mixtures occur in particular when the pc recyclates from consumption waste and process scrap to be condensed are not of the same type . the polycarbonates obtainable by the process according to the invention may be processed on conventional machinery , for example , extruders or injection molding machines , to produce any type of molded articles , for example , films or sheets , in the conventional manner . furthermore , the polycarbonates according to the invention may also be mixed into other polymers , e . g ., polyolefins , polyurethanes , polyesters , abs and polystyrene . these materials are added preferably on conventional machines for the processing of polycarbonate , but may also be added at another stage in the production process as required . the invention also provides the polycarbonates obtainable by the process according to the invention themselves . they differ from primary material , in other words the known commercial material , by the presence of fluorescence - active centres , which fluoresce when irradiated with uv light , e . g ., black light . this optical effect can be used , e . g ., to aid plastic recognition in sorting processes for material recycling or to differentiate between a recyclate and a primary material . auxiliaries and reinforcing agents may be mixed into the polycarbonates according to the invention to change or improve certain properties . thermal — and uv stabilizers , flowing agents , mold release agents , flame - retardants , hydrolysis stabilizers , finely comminuted minerals , fibers , e . g . alkyl - and arylphosphites , - phosphates , - phosphanes , low - molecular carboxylic acid esters , halogen compounds , salts , chalk , quartz powder , glass and carbon fibers , pigments , dyes and combinations thereof , amongst others , may be considered for this purpose . such compounds are disclosed e . g . in wo 99 / 55772 , pg . 15 - 25 and in “ plastics additives ”, r . gätchter and h . müller , hanser publishers 1983 . these additives may be introduced into the melting and discharge screw or directly into the melting reactor , although the discharge unit is preferred . the polycarbonates produced according to the invention may be used for many mechanically demanding applications . they are thus suitable for the production of molded articles and extrudates of the most varied character . possible applications are safety screens , which , as is known , are needed in many areas of buildings , vehicles and aircraft , and as visors for crash helmets , blown articles ( see for example , u . s . pat . no . 2 , 964 , 794 ), for example , 1 to 5 gallon water bottles , translucent sheets , in particular multi wall sheets , for example , for covering buildings such as stations , greenhouses and lighting installations , thread and wire ( see for example , de - as 1 137 167 and de - os 1 785 137 ), translucent plastics with a glass fibre content for lighting purposes ( see for example , de - os 1 554 020 ), translucent plastics containing barium sulfate , titanium dioxide and / or zirconium dioxide or organic polymeric acrylate rubbers ( ep - a 634 445 , ep - a 269324 ) for the production of translucent and light - diffusing molded parts small , precision injection - molded parts , such as , for example , lens mounts ( polycarbonates containing glass fibres , which optionally also contain ca 1 - 10 wt . % mos 2 , in relation to the total weight , are used for this ), optical instrument parts , in particular lenses for cameras and camcorders ( see for example , de - os 2 701 173 ), light transmission media , in particular fiber - optic cables ( see for example , ep - a1 0 089 801 ), mobile telephone housings with improved resistance to perfume , after - shave and perspiration , applications in the automotive industry , where there may be contact with plastics and lubricants , such as , e . g ., bumpers , optionally in the form of suitable blends with abs or suitable rubbers , sports equipment such as , e . g ., slalom poles or ski boot buckles , household articles such as , e . g ., kitchen sinks and letter box housings , housings , such as , e . g ., electrical distributor cases , housings for electric toothbrushes and hairdryer housings , lamp covers for kitchen fittings with improved resistance to kitchen vapors , in particular , oil vapors , as well as other applications such as e . g . stable doors or animal cages . the following examples are intended to illustrate the object of the present invention without restricting it . ground pc from the de - lamination of compact discs by the process described in ep - a 537 567 ( pg . 1 , 2 , 5 , 6 ) was dried in the circulating air dryer ( 2 h / 120 ° c .) and then melted in a twin shaft screw zsk 25 ( werner & amp ; pfleiderer ), and continuously fed into a basket reactor operating at 300 ° c . a mixture containing a portion of the total polycarbonate to be condensed and bisphenol a ( the amount of bisphenol a being 0 . 25 wt . % relative to the total weight of polycarbonate to be condensed ) was introduced into the melting screw . in all , the pc feed stream ( containing polycarbonate and bisphenol a ) via the feed screw was 20 kg / h . no condensation catalyst was used . the condensation reactor was a drum with a melt inlet and outlet at the ends and a vacuum connection in the gas ( or vapor ) space , that is the volume above the melt , in which a shaft with disks , which dipped into the melt , slowly rotated . the speed of rotation was 0 . 8 revolutions per minute ; the average residence time of the melt was ca 180 minutes . the melt temperature was 300 ° c ., the pressure in the gas space of the reactor was 0 . 7 to 0 . 8 mbar . the condensed melt was discharged via a gear pump with attached granulating unit . the properties of the pc granulate thus obtained and the starting material are summarised in table 1 . similarly , low - molecular pc granulate from production waste was condensed to produce a higher - molecular polycarbonate . here bisphenol a was used in example d and condensation catalyst were not used . the material properties are summarized in table 2 . ground pc from the de - lamination of compact discs was condensed in an extruder . the extruder used was a twin shaft screw zsk 32 ( werner & amp ; pfleiderer ) 1 . 4 m long with a 0 . 8 m long de - aerating dome , beginning 0 . 4 m along the screw length . here too , melt condensation was carried out without the addition of a transesterification catalyst . before being added the material was dried in a recirculating air dryer ( 2 h / 120 ° c ). the results are summarized in table 3 . elongation at break , modulus of elasticity to iso 527 ; impact / notched impact strength to iso 180 / 1c or iso 180 / 4a ; phenolic oh photometrically with ticl 4 on the ti complex ; mvr to iso 1133 ; rel . solution viscosity on pc solution in dichloromethane ( 5 g pc / i ). it is clear that with the process according to the invention , the molecular weight of low - molecular polycarbonates ( a , d , f ) may be condensed to attain highly - viscous polycarbonates ( b , c , e , g ) with better mechanical properties such as elongation at break and impact / notched impact strength . although the invention has been described in detail in the foregoing for the purpose of illustration , it is to be understood that such detail is solely for that purpose and that variations may be made therein by those skilled in the art without departing from the spirit and scope of the invention except as it may be limited by the claims .	2
the invention relates to a method of manufacturing a sport ball having a pump mechanism that is disposed completely within the envelope of the sport ball except when the mechanism is being used to inflate the ball . the method of manufacture will best be understood by first considering the structure of the ball . referring first to fig1 to 7 of the drawings , a portion of a sport ball 10 is illustrated incorporating one embodiment of an inflation pump . the ball 10 which is illustrated is a typical basketball construction comprising a carcass having a rubber bladder 12 for air retention , a layer 14 composed of layers of nylon or polyester yarn windings wrapped around the bladder 12 and an outer rubber layer 16 . for a laminated ball , an additional outer layer 18 of leather or a synthetic comprises panels that are applied by adhesive and set by cold molding . the windings are randomly oriented and two or three layers thick . the windings form a layer which cannot be expanded to any significant degree and which restricts the ball from expanding to any significant extent above its regulation size when inflated above its normal playing pressure . this layer for footballs , volleyballs and soccer balls is referred to as a lining layer and is usually composed of cotton or polyester cloth that is impregnated with a flexible binder resin such as vinyl or latex rubber . located in the pump cylinder 28 is the pump piston 30 that is illustrated in both fig1 and 2 . the piston includes an annular groove 32 at the bottom end , which contains the spring 34 that forces the piston up in the cylinder 28 . also , at the bottom end of the piston 30 is a circumferential o - ring groove 36 containing an o - ring 38 . as seen in fig1 this o - ring groove 36 is dimensioned such that the o - ring 38 can move up and down in the groove 36 . the o - ring is forced into the position shown in fig1 when the piston 30 is pushed down . in this position , the o - ring seals between the cylinder wall and the upper flange 40 of the groove 36 . as shown in fig2 there are recesses or slots 42 in the groove 36 extending from just below the upper flange 40 down through the lower flange 44 . only one of these slots 42 is shown in fig2 but there are preferably two or more . when the piston 30 is forced up by the spring 34 , the o - ring 38 moves to the bottom of the groove 36 which opens up a by - pass around the o - ring through the recesses 42 so that the air can enter the cylinder 28 below the piston 30 . then , when the piston is pushed down , the o - ring moves back up to the top of the groove and seals to force the air out through the cylinder exit nozzle 46 . at the upper end of the piston are the two flanges 48 which cooperate with a cylinder cap 50 to hold the piston down in the cylinder and to release the piston for pumping . the cylinder cap 50 is fixed into the top of the cylinder 28 and the piston 30 extends through the center of the cylinder cap 50 . the cap 50 is cemented into the cylinder 28 . fig3 shows an isometric view of the bottom of the cylinder cap 50 and illustrates the open areas 52 on opposite sides of the central opening through which the two flanges 48 on the piston can pass in the unlocked position . in the locked position , the piston is pushed down and rotated such that the two flanges 48 pass under the projections 54 and are rotated into the locking recesses 56 . attached to the upper end of the piston 30 is a button or cap 58 that is designed to essentially completely fill the hole in the carcass and to be flush with the surface of the ball . this button may be of any desired material such as cast urethane or rubber . the cylinder cap 50 provides cushioning to the pump and should also be flexible to match the feel of the rest of the ball . its surface should be textured to increase grip . fig1 of the drawings shows a pump exit nozzle 46 but does not show the one - way valve that is attached to this exit . shown in fig4 is a one - way valve assembly 62 of the duckbill - type to be mounted in the exit nozzle 46 . this assembly comprises an inlet end piece 64 , an outlet end piece 66 and an elastomeric duckbill valve 68 captured between the two end pieces . the end pieces 64 and 66 are preferably plastic , such as a polycarbonate , and may be ultrasonically welded together . although any desired one - way valve can be used on the exit nozzle 46 and although duckbill valves are a common type of one way valves , a specific duckbill configuration is shown in fig4 and in greater detail in fig5 . the duckbill structure 68 is formed of an elastomeric silicone material and is molded with a cylindrical barrel 70 having a flange 72 . inside of the barrel 70 is the duckbill 74 which has an upper inlet end 76 molded around the inside circumference into the barrel 70 . the walls or sides 78 of the duckbill 74 then taper down to form the straight - line lower end with the duckbill slit 80 . the duckbill functions in the conventional manner where inlet air pressure forces the duckbill slit 80 open to admit air while the air pressure inside of the ball squeezes the duckbill slit closed to prevent the leakage of air . such a duckbill structure is commercially available from vernay laboratories , inc . of yellow springs , ohio . a pump assembly of the type described and illustrated in fig1 to 5 is preferably made primarily from plastics such as high impact polystyrene . although the assembly is small and light weight , perhaps only about 25 grams , it is desirable that a weight be added to the ball structure to counterbalance the weight of the pump mechanism . fig6 illustrates such an arrangement wherein a pump mechanism generally designated 82 is on one side of the ball and a standard needle valve 84 is on the opposite side of the ball . in this case , the material 86 forming the needle valve 84 is weighted . additional material can be added to the needle valve housing or the region surrounding the valve . alternatively , a dense metal powder such as tungsten could be added to the rubber compound . to improve the balance of the ball weights and patches may be added to the bladder at other locations . other forms of the invention may utilize different pump constructions and the precise sequence of manufacturing steps may vary in various forms of the invention . those skilled in the art will recognize the substantial benefits including the economies of construction inherent in allowing the pumping mechanism to be designed to accommodate the environmental considerations inherent in normal use of the sport ball and not the much harsher conditions that are encountered during the manufacturing process . in the process for manufacturing the sport ball 10 , a flat piece of rubber is formed into the shape of the ultimate sport ball 10 . in the case of most sport balls this will be spherical , although in other sport balls the shape may be something other than spherical . the method of forming the spherical or other contour from a flat piece of rubber is well known in the art . thereafter , in the preferred method of manufacture , two diametrically opposed openings are cut in the bladder . for convenience in describing the method of manufacture , reference will be made to a spherical ball . those skilled in the art will understand that despite the reference to a spherical ball , the method of the present invention may be applied to other sport balls having other shapes such as footballs . in the case of a spherical ball , diametrically opposed openings are dye - cut in the bladder . the method in accordance with the preferred form of the invention requires one of these openings for placement of the pumping apparatus and the other of the openings for placement of the weighted needle valve 84 . as noted above , the weighted needle valve 84 provides a counterbalance to the weight of the pumping apparatus that is diametrically opposed to the pumping apparatus in the preferred form of the present sport ball . as described above , the first of these openings has a boot 20 disposed therein . more particularly , the boot 20 is cemented to the bladder in the first opening . similarly , a standard needle valve 84 is cemented into the diametrically opposed second opening . as described above , the boot 20 has a central bore into which the pumping apparatus is ultimately inserted . before the manufacturing process step that includes depositing layers of reinforcing material over a bladder , the preferred form of the invention includes the step of inserting a molding plug 25 into the central bore of the boot 20 , as best seen in fig7 . the plug 25 is dimensioned and configured to have a circumferencially extending rib 27 that is dimensioned and configured to have an interfering fit with the groove 24 of the central bore or opening of the boot 20 . obviously , the groove 24 is also dimensioned and configured to engage with an interfering fit with the pump cylinder 28 of the pump apparatus as best shown in fig1 . incorporated into the carcass of the ball 10 during the formation is a rubber boot or housing 20 with a central opening and with a flange 22 that is bonded to the bladder using a rubber adhesive . the flange 22 of the boot 20 is located between the rubber bladder 12 and the layer of windings 14 . a molding plug 25 , shown in fig7 is inserted into the boot 20 opening just prior to the molding and winding process . the plug 25 maintains the shape of the central opening of the boot 20 and allows the bladder 12 to be inflated during the manufacturing process . preferably , the plug 25 is rubber although it may be aluminum , another metal or plastic . the plug 25 is preferably dimensioned and configured for an interference fit between the outer surface of the plug and the central opening of the boot 20 . this provides an air tight seal between the plug 25 and the boot 20 . in a preferred form of the invention the plug 25 will extend approximately 1⅛ inches into the interior of the ball 10 . the upper ( as viewed ) or opposite axial extremity is preferably dimensioned to be flush with the rubber outer layer 16 . thus , the plug 25 is installed in the boot 20 prior to the conventional addition of reinforcing windings and a rubber outer layer 16 . thereafter , the bladder 12 is inflated and followed by the addition of reinforcing windings 14 and followed by the addition of a rubber outer layer 16 . similarly , in the case of a aminated ball , the plug 25 is installed in the boot 20 before the addition of an outer layer 18 of leather or synthetic panels that are applied by adhesive and set by cold molding . those skilled in the art will recognize that the molding process for the butyl rubber bladder is typically at about 300 degrees fahrenheit and uses a 100 psi internal molding pressure in a process that takes about six minutes . thereafter , reinforcing windings are wrapped evenly around the outer surface of the bladder 12 until the bladder 12 is embraced by a layer of threads to form a strengthened structure . before starting the next step the threads that cover the plug 25 are moved away from the plug 25 so that they will not interfere with the later step of removing the plug 25 and inserting a pump 82 or other device . thereafter , a natural rubber layer 14 is molded onto the structure at a temperature of approximately 300 degrees fahrenheit with a 100 psi internal molding pressure in a process that takes about six minutes . in the case of some sport balls , the next step is lamination of composite panels onto the ball and setting of the panels by means of a molding process at 120 degrees fahrenheit with an internal pressure of about 100 psi . it is only after completion of all of these steps that the molding plug 25 with its circumferential rib 27 engaging the groove 24 of the boot 20 is removed from the boot 20 . typically , the plug 25 is removed from the ball by inserting a slender metal hooked shaped member along the interface between the boot 20 and the plug 25 . thereafter , the hook shape end is engaged with the inner extremity of the plug 25 and the plug is removed . after removal of the plug 25 the pump 82 is inserted into the boot 20 . more particularly , the central opening through the boot 20 and particularly the groove 24 cooperates with the flange 26 on the upper end of the pump cylinder 28 . the cylinder 28 can optionally be bonded to the boot using any suitable flexible adhesive ( epoxy , cyanoacrylate , urethane or other ). it will thus be seen that these process steps of installing a plug 25 into the boot 20 during manufacturing steps that require high temperatures followed by removal of the plug 25 and insertion of a pump 82 permits the use of a pump 82 that does not require a design criteria that requires the pump to tolerate the very high temperatures encountered in the ball manufacturing process and thus enables manufacture of a sport ball that can be competitively priced . although the method in accordance with the present invention has been described with respect to the molded sport balls those skilled in the art will recognize that the method also has application to stitched sport balls such as stitched footballs , soccer balls and volleyballs . similarly , although the method has been described with respect to a pump for inflating a sport ball those skilled in the art will recognize that the method has application to installing other devices such as a pressure gauge , a pressure relief valve , or other mechanism into a sport ball . those skilled in the art will recognize that various other modifications and rearrangements of the parts and process steps may be made without departing from the spirit and scope of the present invention and that the present invention is limited only by the following claims :	5
this disclosure , its aspects and implementations , are not limited to the specific components , frequency examples , or methods disclosed herein . many additional components and assembly procedures known in the art consistent with the transmission of identification via meta - data are in use with particular implementations from this disclosure . accordingly , although particular implementations are disclosed , such implementations and implementing components may comprise any components , models , versions , quantities , and / or the like as is known in the art for such systems and implementing components , consistent with the intended operation . this disclosure relates to , but is not limited to , a method and system for providing information in the form of meta - data that uses spread spectrum technology to create a meta - carrier used to create a smart beacon for a repeating relay device . particular implementations described herein are and may use , but are not limited to , field - programmable gate arrays ( fpga ), digital signal processors , application - specific integrated circuits ( asic ), programmable integrated circuits ( pic ), or microprocessors . this disclosure further describes systems and methods for providing information in the form of meta - data that is embedded as a low - energy density meta - carrier into a repeating relay device for use by terrestrial , airborne and space - based operation . the smart beacon may utilize techniques known in the art for digital , analog and radio frequency design methodologies to enhance existing and future relay devices for use in identifying the relay . aspects of this disclosure relate to methods and systems for creating a low - energy density meta - carrier for use as a smart beacon using spread spectrum spreading , modulation , transmission , reception , demodulation , despreading , decoding and processing of the meta - data that comprises the smart beacon . this disclosure relates to a method of embedding information regarding an electromagnetic transmission &# 39 ; s origin . a need exists for a method of identifying satellite transponders to reduce uncertainty of carrier assignment . therefore , a method of embedding information about the repeating relay within the repeating relay platform comprising a relay , transponder , or satellite is needed . information about the repeating relay may be carried in the form of meta - data information and may contain , but is not limited to , ephemeris data , the name of the repeating relay , name of the owner , orbital location , center frequency , passband , and transponder electromagnetic ( em ) polarization , etc . this meta - data eliminates ambiguity with regard to the satellite and transponder of operation . the methods and systems described herein allow a person of only moderate skill , for example , a person with only months of experience on earth station alignment techniques , to reliably align to the correct satellite and transponder assignment . various implementations of this disclosure are intended to be employed for an em emitting device , such as optical or radio frequency ( rf ) transmission equipment for point - to - point , point - to - multipoint and / or multipoint - to - multipoint for embedded information , an example of which is shown in fig1 . methods for providing transmission information via meta - data may be accomplished by spreading a very low - data rate carrier ( containing information about the desired carrier known as the “ meta - data ”) over a portion or the entire passband of the repeating relay &# 39 ; s transponder or transponders . the low - data rate carrier may be spread , or as it is known in the art , “ chipped ,” with a direct sequence spread spectrum ( dsss ) pseudo - random number ( prn ) sequence to create a low energy meta - carrier that may be placed over a portion or entire passband of the repeating relay . this process of spreading the very low - data rate carrier and placing it over a portion of or the entire passband is shown in fig2 a - d . one novel aspect of the disclosed methods and systems may involve using a large spreading factor that results in spreading the meta - carrier &# 39 ; s energy over a significantly large bandwidth , of many orders of magnitude , many times the original meta - data &# 39 ; s rate . the dispersion of energy may result in a miniscule amount of noise being added to the transponder &# 39 ; s spectrum . additionally , the act of spreading the meta - carrier information by many orders of magnitude ( hundreds , thousands or even millions of times ) may result in tremendous processing gain that can be realized to extract and separate the meta - carrier &# 39 ; s meta - data from the received transponder even when the transponder is used for transmission of information carriers . the meta - carrier may be placed on a single transponder or a plurality of transponders , if available , and the meta - data may be extracted by a receiving device from the embedded meta - carrier contained in the passband of the transponder . the spread spectrum meta - carrier may be placed over a portion or the entire passband of the transponder . additionally , another novel aspect of one or more of the disclosed methods and systems may involve the embedded meta - carrier being used as a smart beacon to identify the repeating relay . the large processing gain , as a result of spreading the meta - data &# 39 ; s meta - carrier over a portion or the entire passband of the relay &# 39 ; s transponder or transponders , may be utilized to separate the meta - carrier energy from the information carriers being supported by the transponders at the receiving device . the smart beacon may be utilized on a single transponder of a chosen em configuration , two orthogonal / opposite em configurations ( horizontal verses vertical or clockwise verses counter - clockwise ), and / or any combination of partial or all transponders of em configurations , and may contain similar or different meta - data for each transponder . particular implementations of insertion of transmission of meta - data information over a low - energy density meta - carrier for use as a smart beacon are disclosed herein and may be specifically employed in satellite communications systems . however , as will be clear to those of ordinary skill in the art from this disclosure , the principles and aspects disclosed herein may readily be applied to any electromagnetic ( if , rf and optical ) communications system , such as terrestrial or airborne broadcast networks without undue experimentation . fig1 depicts a satellite - based repeating relay being utilized by many devices that may both transmit and receive to / from the repeating relay . more specifically , fig1 illustrates a particular implementation of a satellite transmission system comprised of earth stations 100 such as the one shown in fig6 , communicating over a repeating relay 110 such as those shown in fig3 - 5 . the earth stations 100 and the repeating relay 110 may be separated by tens , hundreds or thousands of miles . in particular embodiments , the remote relay may operate over one or more of l - band , s - band , c - band , x - band , ku - band and / or ka - band , or any other suitable communication band . a repeating relay 110 may comprise a single input frequency that may be frequency up and / or down - converted and / or power amplified and re - transmitted . in the simplest configuration , the input to output of the relay 110 comprises the simplest form of a transponder . the “ bandwidth ” of a relay is known in the art as the “ passband .” the passband of a relay is the range between the lowest and highest frequency that may be passed through the repeating relay &# 39 ; s transponder . as shown in fig2 a - d , using the attributes of spread spectrum technology , a low - data rate data stream may be spread using dsss spreading with a prn sequence resulting in a low - energy density carrier that may be placed over a portion or entire passband of a transponder or transponders of a repeating relay . fig2 a - d illustrate the concept of the passband shown in the dashed lines with a center frequency as fc . the passband includes the lowest frequency ( shown to the left side of fc ) to the highest frequency ( shown to the right side of fc ), such that all frequencies between the two extremes are known as the passband . in the art , the passband may be defined as the point where the half power or by non - limiting example , 3 decibel ( 3 db ) of power is cut off ( or known as roll off ). the operation of particular embodiments of the disclosed methods may use a portion or the entire bandwidth in the 3 db passband of the transponder . one of ordinary skill in the art will recognize that this disclosure is not limited to a 3 db passband and as such , any appropriate passband may be used . a transponder may be utilized for the reception of user data in the form of a modulated carrier by modulation techniques know in the art , but not limited to , amplitude modulation ( am ), frequency modulation ( fm ), phase shift keying ( psk ), frequency shift keying ( fsk ), etc . the transponder may be configured to accept any modulated carrier or carriers that fall into the passband of the transponder and to frequency convert ( up and / or down ) and / or amplify the carriers and relay them from the repeating relay . in the described methods , spread - spectrum technology , such as but not limited to direct sequence spread - spectrum ( dsss ) technology may be utilized to spread low - data rate information , known as meta - data . this meta - data may contain , but is not limited to , ephemeris data , the name of the repeating relay , name of the owner , orbital location , center frequency , passband , and transponder electromagnetic ( em ) polarization , etc . the meta - data may then be spread via a spread spectrum technique known in the art as chipping which may include using a predetermined prn sequence that may result in each bit of the meta - data being spread by hundreds , thousands or even millions of times . the act of spreading the low - data rate meta - data may result in a meta - carrier that may be comprised of many hundreds , thousands or even millions of chips of each bit of information . chipping a meta - data stream with a prn sequence may result in a gain known in the art as “ processing gain .” the processing gain is the linear ratio of the chipping rate divided by the meta - data rate , and is commonly called the spread factor . the processing gain is typically known in terms of gain in decibels , and is calculated as 10 * log ( spread factor ). as a non - limiting example , a 10 - bit per second meta - data carrier may be spread over a 36 mhz transponder . the 36 mhz transponder may provide support for a 36 mega - chip per second ( 36 mcps ) carrier , resulting in the spread factor of 36 , 000 , 000 / 10 or 3 , 600 , 000 . expressed in terms of processing gain , the processing gain due to spreading may be 10 * log ( 3 , 600 , 000 ) or 65 . 56 db . the meta - carrier could be embedded into the noise floor of the transponder in a manner that has little to no impact to the user data carriers being supported by the transponder . the processing gain of 65 . 56 db may allow ample separation between the user data carriers , which appear as noise to the meta - carrier , such that the meta - carrier may be extracted using a receiver such as that shown in fig7 . as a second non - limiting example , a 10 - bit per second meta - data carrier may be spread over a 54 mhz transponder . the 54 mhz transponder may provide support for a 54 mega - chip per second ( 54 mcps ) carrier , resulting in the spread factor of 54 , 000 , 000 / 10 or 5 , 400 , 000 . expressed in terms of processing gain , the processing gain due to spreading may be 10 * log ( 5 , 400 , 000 ) or 67 . 32 db . the meta - carrier could be embedded into the noise floor of the transponder in a manner that has little to no impact to the user data carriers being supported by the transponder . the processing gain of 67 . 32 db may allow ample separation between the user data carriers , which appear as noise to the meta - carrier , such that the meta - carrier may be extracted using a receiver such as that shown in fig7 . as yet another non - limiting example , a 20 - bit per second meta - data carrier may be spread over a 72 mhz transponder . the 72 mhz transponder may provide support for a 72 mega - chip per second ( 72 mcps ) carrier , resulting in the spread factor of 72 , 000 , 000 / 20 or 3 , 600 , 000 . expressed in terms of processing gain , the processing gain due to spreading may be 10 * log ( 3 , 600 , 000 ) or 65 . 56 db . the meta - carrier may be embedded into the noise floor of the transponder in a manner that results in little to no impact to the user data carriers being supported by the transponder . the processing gain of 65 . 56 db may allow ample separation between the user data carriers , which appear as noise to the meta - carrier , such that the meta - carrier may be extracted using a receiver such as that shown in fig7 . fig3 - 5 demonstrate multiple configurations of repeating relays and show how each may be configured to provide a low - energy density meta - carrier that contains meta - data for a smart beacon using implementations of the described methods and systems . in the simplest embodiment of the method , the spread spectrum meta - carrier may be created at a transmission station and transmitted to the remote relay as shown in fig3 and embedded into one or a plurality of transponders . for each transponder to support the embedded carrier , for particular implementations of the methods described , a meta - carrier is transmitted for every transponder . fig3 demonstrates existing repeater relay technology used in the art where a meta - carrier containing meta - data may be transmitted to a relay repeater where the low - energy meta - carrier may be combined with the data carriers being supported by the repeating relay . the repeating relay of fig3 has no onboard processing of the meta - carriers other than to relay from the input ( receive antenna ) 300 , separate in the orthogonal mode transducer ( omt ) 310 , bandpass filter ( bpf ) 320 , amplify via a low - noise amplifier ( lna ) 330 , multiplex via a multiplexer 340 , frequency convert using a frequency converter 350 , linearize using a linearizer 360 , amplify with an amplifier 370 , multiplex to the proper em polarization configuration using a multiplexer 380 and feed to the omt 310 to the transmit antenna 390 feed for relay . the configuration of the transponders of the repeating relay may be comprised of a single transponder or a plurality of em transponders with or without overlapping frequencies such as the horizontal and / or left - hand circular type 1 transponders 800 and the vertical and / or right - hand circular type 2 em transponders 810 as shown in fig8 which depicts a particular embodiment of a repeating relay with transponders with common and overlaid frequencies with a plurality of em polarization configurations . in the particular embodiment shown in fig8 , no additional hardware ( analog or digital ) may be required to be added to the repeating relay . in a second embodiment , the meta - carrier may be transmitted as a spread spectrum carrier that may be created at a transmission station 100 and transmitted to the remote relay 110 as shown in fig4 . the carrier may be extracted by the onboard beacon extraction device 400 and it may be routed to the beacon injection device 410 where the meta - carrier may be embedded into one or a plurality of transponders . in this embodiment , additional hardware ( analog and / or digital ) may be required to be added to the repeating relay 110 . in a third embodiment , the meta - carrier may be transmitted as a non - spread spectrum carrier that may be created at a transmission station 100 and transmitted to the remote relay as shown in fig4 and extracted by the onboard beacon extraction device 400 . the non - spread spectrum carrier may then be spread on board the repeater relay 110 and it may be routed to the beacon injection device 410 where the meta - carrier may be embedded into one or a plurality of transponders . in this embodiment , additional hardware ( analog and / or digital ) may be required to be added to the repeating relay 110 . in a fourth embodiment , the meta - data may be transmitted as a spread spectrum or non - spread spectrum carrier that may be created at a transmission station 100 and transmitted , periodically or one time , to the remote relay as shown in fig5 . the meta - data may be extracted by the onboard beacon extraction device 400 and sent to the beacon processor 500 . the beacon processor 500 may store the meta - data and perform processing on the meta - data . the meta - data may be altered by the beacon processor 500 in a fashion that makes the information unique to each transponder or it may be the same information sent to each transponder . the meta - data may then be spread and modulated on the repeater relay 110 and sent to the beacon injection unit 410 for delivery to the output multiplexer 380 . in this embodiment , additional hardware ( analog and / or digital ) may be required to be added to the repeating relay 110 . in a fifth embodiment , the meta - data may be retained in the beacon processor 500 and loaded one time at the creation of the repeater relay 110 as shown in fig5 . the meta - data may be sent by the beacon processor 500 in a fashion that makes the information unique to each transponder or it may be the same information sent to each transponder . the meta - data may then be spread and modulated on the repeater relay 110 and sent to the beacon injection unit 410 for delivery to the output multiplexer 380 . in this embodiment , additional hardware ( analog and / or digital ) may be required to be added to the repeating relay 110 . one of ordinary skill in the art will recognize that the methods disclosed herein may rely on the use of spread spectrum technology but are not limited as such and may therefore utilize any methods of electromagnetic or optical transmission techniques using any known transmission method to transmit meta - data to a repeating relay . fig6 shows a diagram of a receiving site that utilizes the described method for receiving both user data and the meta - carrier containing the meta - data information about the repeating relay 110 . the receiving station 630 may comprise an antenna reflector that may be pointed to the repeating relay 110 as depicted in fig6 . the antenna reflector may be focused to a feed horn 600 where the received carrier from the repeater relay 110 may be focused and the omt 640 separates the carrier into the proper polarizations . a low noise block ( lnb ) amplifier 610 may be comprised of an lna and down - converter for converting the radio frequency ( rf ) signal to an intermediate frequency ( if ). in the art , the lnb amplifier 610 converts the rf ( l - band , s - band , c - band , x - band , ku - band , ka - band , etc .) to if at 70 / 140 mhz ( 50 mhz to 180 mhz ) or l - band ( 950 mhz to 2 , 150 mhz ). the output of the lnb amplifier 610 may then be sent to a coaxial connection 650 to the receiving device where the signal comprised of the low - energy meta - carrier and user data carriers . fig7 shows a block diagram of the receiving device using the disclosed methods where the low - energy density meta - carrier is received and extracted from the passband of the received transponder , de - spread , demodulate and decode and provided to the user as meta - data . the receiver section 700 may perform the appropriate receiver functions such as level setting via an automatic gain control ( agc ) and then spread spectrum de - spreading may be performed by a spread - spectrum despreader 710 . the despread meta - carrier may contain the meta - data for use by a receiving device to confirm , but is not limited to , information about a repeating relay &# 39 ; s source to include information , but not limited to , ephemeris data , the name of the repeating relay , name of the owner , orbital location , center frequency , passband , and transponder electromagnetic ( em ) polarization , etc . the following provides non - limiting examples of particular implementations and embodiments of transmission of identification via meta - data for repeating relays using spread - spectrum technology techniques : a space - based satellite relay may be configured to receive earth - based carriers and relay the carriers back to the earth . the carrier ( s ) may be received , combined , amplified and combined with a low data rate meta - data carrier . a satellite earth station transmits the meta - data via a spread spectrum carrier to a satellite with repeating relays ( transponders ). one carrier is transmitted towards the satellite . the meta - data in this carrier can contain ( but is not limited to ) the following information ; a ) satellite operator , b ) satellite name , c ) orbital location , d ) transponder numbers and associated center frequency assignments and electromagnetic polarizations . a space - based satellite relay may be configured to receive earth - based carriers and relay the carriers back to the earth . the carrier ( s ) may be received , combined , amplified and combined with a low data rate meta - data carrier . a satellite earth station transmits the meta - data via a spread spectrum carrier to a satellite with repeating relays ( transponders ). one carrier may be transmitted towards the satellite for each electromagnetic polarization ( one horizontal and one vertical or one clockwise and one counterclockwise ). the meta - data in this carrier can contain ( but is not limited to ) the following information : a ) satellite operator , b ) satellite name , c ) orbital location , d ) transponder numbers and associated center frequency assignments and electromagnetic polarizations . a space - based satellite relay may be configured to receive earth - based carriers and relay the carriers back to the earth . the carrier ( s ) may be received , combined , amplified and combined with a low data rate meta - data carrier . a satellite earth station transmits the meta - data via a spread spectrum carrier to a satellite with repeating relays ( transponders ). one carrier may be transmitted towards the satellite for each transponder of one electromagnetic polarization ( one horizontal or one vertical or one clockwise or one counterclockwise ). the meta - data in this carrier can contain ( but is not limited to ) the following information ; a ) satellite operator , b ) satellite name , c ) orbital location , d ) transponder numbers and associated center frequency assignments and electromagnetic polarizations . a space - based satellite relay may be configured to receive earth - based carriers and relay the carriers back to the earth . the carrier ( s ) may be received , combined , amplified and combined with a low data rate meta - data carrier . a satellite earth station transmits the meta - data via a spread spectrum carrier to a satellite with repeating relays ( transponders ). one carrier may be transmitted towards the satellite for each transponder of each electromagnetic polarization ( one horizontal or one vertical or one clockwise or one counterclockwise ). non - limiting examples of meta - data in this carrier include a ) satellite operator , b ) satellite name , c ) orbital location , d ) transponder numbers and associated center frequency assignments and electromagnetic polarizations . a satellite earth station may be configured to operate at an assigned center frequency , symbol rate and polarization to a satellite at a geo - equatorial location , polarization and frequency . for this example , the earth station may not be pointed to the proper satellite and begins transmission . this results in the wrong satellite being illuminated . in the event the improperly radiated satellite has the frequency assigned for use not for this carrier , the result may be an outage due to energy being injected into the satellite &# 39 ; s transponder that may then be re - transmitted along with the proper carrier to receiving devices . the method may allow one to detect , resolve and process the meta - data of the wrong satellite , thus providing information to the interfering earth station , alerting the operator of the earth station as to its improperly configured carrier . in particular implementations of the system described in examples 1 - 4 , a carrier may be uplinked to as part of an ad - hoc service and the service may only be required for a short duration . as an aid to the link provider , the reception of the meta - data carrier may be used as confirmation that the transmitter may be set up on the proper transponder . in particular implementations of the system described in examples 1 - 4 , a satellite earth station may be configured to operate a carrier at an assigned center frequency , symbol rate and polarization to a satellite at a particular frequency and geo - equatorial location . for this example if the earth station is pointed to the proper satellite but has an incorrect carrier center frequency , and begins transmission , this results in the wrong frequency of a satellite transponder being illuminated . in this event , the improperly radiated satellite transponder may have the frequency assigned for use , but not for this carrier . the result may be an outage due to energy being injected into the satellite &# 39 ; s transponder that may then be re - transmitted along with the proper carrier . the method may allow one to detect , resolve and process the satellite &# 39 ; s meta - data carrier , thus providing information to the operator of the earth station about their improperly configured carrier . in particular implementations of the system described in examples 1 - 4 , a satellite earth station may be configured to operate a carrier at an assigned center frequency , symbol rate and polarization to a satellite at a particular frequency and geo - equatorial location . for this example , if the earth station is pointed to the proper satellite but has an incorrect carrier center frequency , and begins transmission , this results in the wrong frequency of a satellite transponder being illuminated . in this event , the improperly radiated satellite transponder does not have the frequency assigned for use . the result may be a spurious carrier whose source may be difficult to identify . the method may allow one to detect , resolve and process the satellite &# 39 ; s meta - data carrier , thus providing information to the operator of the earth station about their improperly configured carrier . in particular implementations of the system described in examples 1 - 4 , a satellite earth station may be configured to operate a carrier at an assigned center frequency , symbol rate and polarization to a satellite at a particular frequency and geo - equatorial location . for this example , if the earth station is pointed to the proper satellite and has a correct carrier center frequency but the wrong symbol rate in excess of the assigned symbol rate and begins transmission , this results in the satellite transponder being illuminated with a carrier that crosses over into an adjacent channel . in this event , the improperly radiated satellite transponder has multiple carriers using the same frequency . the result may be an outage potentially of both adjacent carriers due to energy being injected into the satellite &# 39 ; s transponder that may then be re - transmitted along with the adjacent carrier . the method may allow one to detect , resolve and process the satellite &# 39 ; s meta - data carrier , thus providing information to the operator of the earth station about their improperly configured carrier . in particular implementations of the system described in examples 1 - 4 , a satellite earth station may be configured to operate a carrier at an assigned center frequency , symbol rate and polarization to a satellite at a particular frequency and geo - equatorial location . for this example if the earth station is pointed to the proper satellite , has a correct carrier center frequency , but an incorrect polarization and begins transmission , this results in the wrong frequency of a satellite transponder being illuminated . in this event , the improperly radiated satellite transponder has the frequency assigned for use , but not for this carrier . the result may be an outage due to energy being injected into the satellite &# 39 ; s transponder that may then be re - transmitted along with the proper carrier . the method may allow one to detect , resolve and process the satellite &# 39 ; s meta - data carrier , thus providing information to the operator of the earth station about their improperly configured carrier . in particular implementations of the system described in examples 1 - 4 , a satellite earth station may be configured to operate a carrier at an assigned center frequency , symbol rate and polarization to a satellite at a particular frequency and geo - equatorial location . for this example , if the earth station is pointed to the proper satellite , has a correct carrier center frequency , but an incorrect polarization and begins transmission , this results in the wrong frequency of a satellite transponder being illuminated . in this event , the improperly radiated satellite transponder does not have the frequency assigned for use . the result may be a spurious carrier whose source is difficult to identify . the method may allow one to detect , resolve and process the satellite &# 39 ; s meta - data carrier , thus providing information to the operator of the earth station about their improperly configured carrier . an airborne relay is configured to receive earth - based carriers and relay the carriers back to the earth . the carrier ( s ) may be received , combined , amplified and combined with a low - data rate carrier containing meta - data , including but not limited to , information regarding the airborne relay &# 39 ; s assigned location , owner , transponder identification , operating frequency , etc . for an airborne system , the bandwidth may be spread over one or many transponders . a terrestrial relay may be configured to receive terrestrial or airborne carriers and relay the carriers to the same or different geographic location ( s ). the carrier ( s ) may be received , combined , amplified and combined with a low - data rate meta - data carrier containing , but not limited to , information regarding the relay &# 39 ; s assigned location , owner , operating frequency , etc . for a terrestrial relay system , the bandwidth may be spread over one or multiple frequency allocations . in places where the description above refers to particular implementations of telecommunication systems and techniques for transmitting data across a telecommunication channel , it should be readily apparent that a number of modifications may be made without departing from the spirit thereof and that these implementations may be applied to other to telecommunication systems and techniques for transmitting data across a telecommunication channel .	7
before several embodiments are explained in detail , it is to be understood that the scope of the invention should not be limited to the details of the construction and the arrangement of the components set forth in the following description or illustrated in the drawings . also , it is to be understood that the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting . in this description , the terms “ communication device ,” “ wireless device ,” “ wireless communications device ,” “ mobile device ,” and “ handset ” are used interchangeably , and “ direct communication ,” “ group communication ,” and “ direct group communication ” are also used interchangeably . the term “ application ” as used herein is intended to encompass executable and non - executable software files , raw data , aggregated data , patches , and other code segments . further , like numerals refer to like elements throughout the several views . fig1 a illustrates an architecture of a communication system 100 for implementing one embodiment of the system . the group communication system 100 is also known as a push - to - talk ( ptt ) system , a net broadcast service ( nbs ), a dispatch system , or a point - to - multi - point communication system . in one embodiment , the group communication system 100 includes a group communication server ( gcs ) 102 , which may be deployed in either a centralized deployment or a regionalized deployment . the group communication server 102 may include , as known in the art , one or more processor , one or more memory units , and input / out hardware and software modules for various media communications , e . g ., internet protocol ( ip ) media communication . the group communication server 102 can handle both communication and billing functions or can share these functions with other servers and computer devices . the mobile devices 104 and 106 can be based on different technologies , such as code division multiplex access ( cdma ), time division multiplex access ( tdma ), frequency division multiplex access ( fdma ), the global system for mobile communications ( gsm ), orthogonal frequency division multiplexing ( ofdm ), or other protocols that may be used in a wireless communications network or a data communications network . the mobile devices ( mds ) 104 and 106 may request packet data sessions using a data service option . each md may use the session to register its ip address with the group communication server 102 to perform group communication initiations . each md may also have a private identification number assigned by its service provider and used for the ptt communications . though the mds 104 and 106 are shown in fig1 a in communication with one bs 110 , they may communicate through different bs 110 . in one embodiment , the group communication server 102 is connected to the service provider &# 39 ; s packet data service nodes ( pdsns ) 114 through service provider &# 39 ; s network 116 . mds 104 and 106 , upon requesting packet data sessions from the wireless infrastructure , may use the ip connectivity to connect to the group communication server 102 through the pdsns 114 . each pdsn 114 may interface to a base station controller ( bsc ) 116 through a packet control function ( pcf ) 108 and a network 112 . the pcf 108 may be co - located with the bsc 116 within a base station ( bs ) 110 . a pdsn 114 falls into one of several states , e . g ., active or connected state , dormant state , and null or inactive state . in the active or connected state , an active traffic channel exists between the participating md 104 and the bs 110 or bsc 116 , and either side may send data . in the dormant state , no active traffic channel exists between the participating md 104 and the bsc 116 , but a point - to - point protocol ( ppp ) link is maintained between the participating md 104 and the pdsn 114 . in the null or inactive state , there is no active traffic channel between the participating md 104 and the bsc 116 , and no ppp link is maintained between the participating md 104 and the pdsn 114 . each one of mds 104 and 106 can request packet data sessions . as part of establishing a packet data session , each md can be assigned an ip address . each md can perform a registration process to notify the group communication server 102 of the md &# 39 ; s ip address . registration can be performed using an ip protocol , such as session initiation protocol ( sip ) over user datagram protocol ( udp ). the ip address of a md then can be used to contact the md when the corresponding user is invited into or informed of a group communication . alternatively , a service provider can assign a private identification number to each md and this private identification number to be used during the group communication . once a communication is established , mds 104 and 106 and the group communication server 102 can exchange media and signaling messages . in one embodiment , media is exchanged between the participating mds and the group communication server 102 by using real - time protocol ( rtp ) over udp . the signaling messages can also be exchanged by using a signaling protocol over udp . typically , the ptt feature is implemented in through a half - duplex channel , and before sending a message , a mobile device must request the channel from the group communication server 102 . fig1 b illustrates a message flow between a mobile device 132 and a group communication server 102 . when a user at the mobile device 132 wants to communicate with a predesignated target group 134 of mobile devices , the mobile device 132 must first request a channel from the group communication server 102 . the mobile device 132 sends a channel request 136 to the group communication server 102 . if the channel is available , the group communication server 102 reserves the channel for the mobile device 132 and sends a channel grant message to the mobile device 132 . after the mobile device 132 receives the channel grant message , the mobile device 132 can send messages to the target group 134 as illustrated in fig1 c . the mobile device 132 sends a message 152 to the group communication server 102 . after receiving the message , the group communication server 102 identifies the target group 134 and broadcasts the message 154 to all mobile devices in the target group 134 . fig2 is a flow chart 200 for a user subscription process . before using the ptt feature for group communication , a user subscribes to the ptt service , step 202 , and designates a target group , step 204 . the ptt feature may be offered as a pre - pay service , where a user pays an amount to the service provider and the service provider will deduct services charges from this amount every time the user uses the ptt service . alternatively , the ptt feature may be billed on a monthly basis like traditional telecommunications services and each use of the ptt service will be deducted from the monthly total , as opposed to the charging only for airtime . after subscribing to the ptt feature , the subscriber may designate a target group with whom the user wishes to communicate directly through group communication services of the ptt feature . generally , other subscribers of the ptt feature are included in this target group and they are listed in the target group through their user identification numbers , which can be either private identification numbers , ip addresses , mobile identification numbers ( mins ), or electronic identification numbers ( eins ). if a target has already been set , the subscriber may join this target group and designate it as his target group . fig3 is a flow chart 300 for a subscription process at the group communication server 102 . the group communication server 102 receives a subscription request from a user , step 302 , and establishes an account for the user , step 304 . the group communication server 102 may also receive a target group from the user , step 306 . the group communication server 102 receives a list of user identification numbers designated as a target group and stores them as the target group for the user , step 308 . fig4 is a flow chart 400 for a group communication process at a mobile device 104 . the mobile device 104 checks whether the user wants to initiate a direct communication with his target group , step 402 . the mobile device 104 detects that the user is ready to initiate a group communication when the user pushes a “ push - to - talk ” button on the mobile device 104 . the mobile device 104 may have a dedicated push - to - talk button or alternatively may use an existing button or a combination of buttons on its keypad to active the direct group communication feature . generally , the direct group communication is through a half - duplex channel , and only one party is allowed to send a message or a data to the target group at any time . before sending a message , the mobile device 104 requests a channel , step 406 , from the group communication server 102 . if the channel is not available , the mobile device 104 is stopped from sending the message to the target group . if the channel is available , the mobile device 104 is allowed to send the message to the group communication server 102 , step 410 . the group communication server 102 will distribute the message to all members listed in the target group . the message can be an audio or data message . an audio message could be a talk from the user ; a data message could a data stored in the mobile device 104 that the user wants to share with the members in the target group . it should be noted that the mobile device 104 can determine the group for communication in an ad hoc manner , that it , designate members to receive the communication , as opposed to reliance on group identifications stored at the group communication server 102 . during a group communication , while the mobile device 104 is not sending messages , it can receive messages from other group members . the mobile device 104 checks whether a group message is received , step 404 . if a group message is received , step 412 , the mobile device 104 plays the message to the user , step 414 . after playing the message , the mobile device 104 goes back to the routine of checking if the user is ready to send a message and if a message is received from the group communication server 102 . fig5 is a flow chart for a group communication process 500 at a group communication server 102 . the group communication server 102 receives a channel request , step 502 , from a mobile device 104 , when the user of the mobile device 104 is ready to send a message to his target group . the group communication server 102 checks whether a channel is available , step 504 . if the channel is not available , the group communication server 102 sends a channel busy signal to the requesting mobile device , step 506 . if the channel is available , the group communication server 102 identifies the user of the mobile device 104 , step 508 , verifies that he is a subscriber , or alternatively , if the user has a pre - paid account for the group communication service , that there is enough credit in the user &# 39 ; s account . the user may be identified by the ein or min assigned to the mobile device . the user can also be prompted to enter a user identification and a password . after identifying the user , the group communication server 102 assigns the channel to the user , step 510 . the group communication server 102 may also check the user &# 39 ; s identity before checking the channel availability . if the user has not subscribed to the group communication services , or the user has no credit left in his account , the group communication server 102 preferably does not check for the availability of the channel . alternatively , the user can be billed for the specific direct communication made at the time . after assigning the channel to the user , the group communication server 102 receives a message , step 512 , from the mobile device 104 . the group communication server 102 retrieves a target group information , step 514 , and forwards the message from the mobile device 104 to every member listed in the target group , step 516 . after sending the message to the target group , the group communication server 102 resets the channel making it available for use by other members of the target group . the group communication server 102 can start to track network usage from the moment when the channel is granted to the user , and the group communication server 102 records network usage information , step 518 . such step is necessary in case all intended group connections cannot be bridged . fig6 is an example of a usage record 600 . the group communication server 102 may create a record for each usage of the network resources . the record may include , as way of example and not limitation , a user identification information ( uid ) 602 , the target group information 604 , the number of actual recipients of the communication 606 , an indication on whether the user initiated the group communication 608 or the user was a mere recipient of the group communication 610 , the actual duration of the group communication 612 , and an indication of the type of the message 614 . the service provider may place different charges for the group communication service . for example , the charge may depend on the number of members in the target group or the number of actual recipients . in some embodiments , the group communication server 102 will need to inquire which members of the target group is available , and the message is only sent to those members who are available . the group communication server 102 can also place different charges for initiating a group communication versus receiving a group communication . the size of the message may also be a factor in pricing , since a large message tends to use more network resources . finally , the type of the message may also impact the cost of the group communication . an audio message may be cheaper that a multi - media message , where audio , video , and data are included in one message . for ad hoc groups created from the mobile device 104 , the group communication server 102 will store the appropriate information for the group communication conducted by the mobile device 104 . once a billing record 600 is generated for each group communication instance . the group communication server 102 may determine the cost of the group communication for each user and such cost is deducted from the user &# 39 ; s account , if the user has a pre - paid service account . alternately , the mobile device 104 can keep resident pay information , such as available credit , and decrement the balance , and perform such function separately and / or mirroring information stored at other servers on the network , to include group communication server 102 . the following is a use scenario of one embodiment of the system . a user signs up the group communication on a pre - pay basis . an account is opened for the user and a pre - pay amount is associated with the account . the user joins an existing group formed by his co - workers and this group is designated as the target group associated with the user &# 39 ; s account . when the user wants to talk to his co - workers using his mobile device , the user pushes a direct communication button ( also known as push - to - talk button ). upon activation of this button , the mobile device sends a request for a channel to the group communication server 102 . the request is sent through a wireless network . the group communication server receives the channel request , verifies the user , and grants the channel to the user . while the channel is granted to the user , it will not be accessible to other members of the target group . the group communication server also starts tracking network usage . after receiving the channel from the group communication server 102 , the user speaks to the mobile device while holding the push - to - talk button . the user &# 39 ; s speech is sent from the mobile device to the group communication server 102 . the group communication server retrieves the target group information associated with the user and forwards the user &# 39 ; s speech ( message ) to all members listed in the target group . it is possible that not all the members in the target group are available to receive the communication from the user . if a member is not available , the group communication server can deliver the message to a mailbox associated with this member , if the receiving member has subscribed to a mailbox service . the group communication server 102 can count the delivery of a message to the mailbox as a normal delivery . after delivering the message to the target group , the group communication server 102 creates a record for the communication . the record indicates that the user is the creator of the group communication , the target group has , e . g ., 12 people , and the actual number of recipients , e . g ., is 10 , the duration of the message is 5 seconds , and the type of the message is audio . the cost associated with this communication will be deducted from the user &# 39 ; s account . after sending his message to the target group , the user may receive a reply message from one of the members of the target group , and the reply message may be a picture followed by comments from this replying member . the group communication server 102 may check the user &# 39 ; s account before sending the reply message to the user . if the user &# 39 ; s account indicates that there is no available credit , the group communication server may not deliver the reply message to the user . if there is available credit , then the reply message is delivered to the user . after the delivery of the reply message , a record will be created for this reply , and it will indicate the user is a recipient of the reply message , the message lasted , e . g ., 10 seconds , and the message type is multi - media ( graphics and audio ). the group communication service provider can set up different charges for different uses . for example , the service provider can charge the user for only group communications initiated by the user and not charge any communication for the group communications where the user is a merely recipient . the service provider may also charge for only the message delivered and not charge for the message destined to the target group members who are not available . alternatively , the service provider can charge for all network usages , whether or not a message is delivered to any recipient . those of skill in the art would understand that other charge criteria , or any combination of criteria , may be implemented . those of skill would further appreciate that the various illustrative logical blocks , modules , circuits , and algorithm steps described in connection with the embodiments disclosed herein may be implemented as electronic hardware , computer software , or combinations of both . to clearly illustrate this interchangeability of hardware and software , various illustrative components , blocks , modules , circuits , and steps have been described above generally in terms of their functionality . whether such functionality is implemented as hardware or software depends upon the particular application and design constraints imposed on the overall system . skilled artisans may implement the described functionality in varying ways for each particular application , but such implementation decisions should not be interpreted as causing a departure from the scope of the present invention . the various illustrative logical blocks , modules , and circuits described in connection with the embodiments disclosed herein may be implemented or performed with a general purpose processor , a digital signal processor ( dsp ), an application specific integrated circuit ( asic ), a field programmable gate array ( fpga ) or other programmable logic device , discrete gate or transistor logic , discrete hardware components , or any combination thereof designed to perform the functions described herein . the steps of a method or algorithm described in connection with the embodiments disclosed herein can be embodied directly in hardware , in a software module executed by a processor , or in a combination of the two . a software module may reside in ram memory , flash memory , rom memory , eprom memory , eeprom memory , registers , a hard disk , a removable disk , a md - rom , or any other form of storage medium known in the art . an exemplary storage medium is coupled to the processor , such that the processor can read information from , and write information to , the storage medium . in the alternative , the storage medium is integral to the processor . the processor and the storage medium can reside in an asic . the asic may reside in a user terminal . in the alternative , the processor and the storage medium can reside as discrete components in a user terminal . the description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention . various modifications to these embodiments may be readily apparent to those skilled in the art , and the generic principles defined herein may be applied to other embodiments , e . g ., in an instant messaging service or any general wireless data communication applications , without departing from the spirit or scope of the invention . thus , the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein . the word “ exemplary ” is used exclusively herein to mean “ serving as an example , instance , or illustration .” any embodiment described herein as “ exemplary ” is not necessarily to be construed as preferred or advantageous over other embodiments .	7
referring to fig1 an enlarged side sectional view of the auto tether lid lifting device in a closed position . the embodiment in this drawing shows the semi flexible and resilient safety hook 95 that is bow shaped mounted directly to the underside of the single outer lid 38 with fasteners 120 . the tip of the semi flexible and resilient safety hook 95 upper most surfaces is shown slightly higher than the bottom surface of roller 93 indicating the resilient flexibility . the semi flexible and resilient safety hook 95 tip is also formed so as not to have a sharp or pointed end for safety . the semi flexible and resilient safety hook 95 flexes slightly when the roller 93 automatically attached as the container 20 is pushed into position . when the two wheeled container 20 is rolled backwardly into position the roller 93 roles backwardly once contact is made with the semi flexible and resilient safety hook 95 . the material for the semi flexible and resilient safety hook 95 must also be non - corrosive , light weight , and economically feasible . an example of the type of material that can be used with great success is aluminium ⅛ ″ flat bar of 6061 variety . this particular material retains its shape lifting roller 93 and the attached container lid 19 . once attached the container lid 19 is held shut with the container lid 19 only lifting a minimal distance before the bottom of the semi flexible and resilient safety hook 95 touches the container lid 19 outer surfaces under the single outer lid 38 until activated . referring to fig2 the same enlarged left side sectional view of the auto tether lid lifting device is shown in an open position . this drawing demonstrates how the roller 93 rolls backwardly further on the semi flexible and resilient safety hook 95 as the single outer lid and container lid 19 transitions together . this active movement of the roller 93 accommodates the differential in placement of the container lid 19 hinge and the housing enclosure lid 38 as they transition from a closed to open position . this interaction allows the container lid 19 to stay in close proximity to the underside of the housing enclosure lid 38 as it opens . the roller 93 pivots on projections 94 that extend centrally from each side of the roller 93 . projections 94 are formed from having material removed from each side of the roller 93 when being turned on a lathe . a material used for the roller 93 can be oil impregnated nylon often used as bearing stock . the height of the projections from each side of the roller 93 is equal . the roller 93 length fits between the container lid 19 side wall 90 and side wall 91 formed into container lid 19 . the projections 94 then extend from the ends of roller 93 to penetrate the thickness of the container lid 19 . the first side wall 90 and second side wall 91 have inline location holes or knock outs formed that fit the projections 94 extending from each side of the roller 93 . the side wall 90 and side wall 91 are resilient enough to outwardly expand as the roller 93 is pressed into place until the projections 94 slip into the location hole . when both projections 94 are fit into side wall 90 and side wall 91 the side walls return to an equilibrium position . when the side walls are in equilibrium the width of the roller 93 provides space so that it can rotate freely between side wall 90 and sidewall 91 . the height of the roller 93 placed above the inner outer surface of the container lid 19 provides clearance for the semi flexible and resilient safety hook 95 . the roller 93 also provides a centrally located handle on top of the container lid 19 when the two wheeled container is not tethered to the housing enclosure lid 38 . without roller 93 installed the container lid functions as a conventional container lid 19 . the shape of the formed container lid provides water run off surface and a symmetrical structural configuration that adds rigidity to the generally square shaped container lid 19 . referring to fig3 an embodiment is shown with a container 20 having a production molded container lid 19 that has provisions for mounting roller 93 . the provisions consisting of side wall 90 and side wall 91 formed into container lid 19 . inline hole knock outs are also formed into the container lid 19 for holding projections 94 so that roller 93 is pivotally coupled . the placement of the roller 93 is below the outer surface of the container lid 19 conforming to the american national standard for two wheeled waste containers . the placement of roller 93 is also above the central container lid 19 outer surface providing clearance for the semi flexible and resilient safety hook 95 for attaching and detaching . the ghosted line shows the container lid 19 in a closed position attached to the semi flexible and resilient safety hook 95 after being pushed into position . the container 20 shown in solid line is then shown pulled away from the single outer lid 38 automatically releasing or detaching from the semi flexible and resilient safety hook 95 rolling on wheels 52 . the space between the formed container lid 19 side wall 90 and side wall 91 provides the necessary clearance for the semi flexible and resilient safety hook 95 during operation from a closed to open position . this space below the outermost surface of the container lid 19 between side wall 90 and side wall 91 also provides clearance for the semi flexible and resilient safety hook 95 when attaching and detaching the roller 93 for operation . the rearward width of this space allows for an off center approaches of the container 20 as it is rolled backwardly or pushed under the housing enclosure lid 38 . referring to fig4 a user is shown accessing several containers 20 using foot pedal 27 while holding trash , recycling , and compost collection bags in both hands . the left side wall 12 is shown with a partial section removed in order to show wheel 52 on one of the containers 20 . also shown foot pedal 27 is used to operate a housing enclosure lid 38 outfitted with three sets of the present invention tethering each of the container lids 19 . housing enclosure lid 38 is shown in an open position with each semi flexible and resilient safety hook 95 suspending each respective roller 93 that have rolled backwardly . a base 45 is also shown as part of the housing structure providing structural support for the housing enclosure . there are many variations of housing enclosures that are constructed for the purpose of storing these types of wheeled containers 20 . some housing enclosures are available without bases or partial bases , still others provide cross pieces spanning between left side wall 12 and right side wall 13 . the height of the roller 93 allows for the lowest point of semi flexible and resilient safety hook 95 to clear the top of container lid 19 . this then allows for the container 20 to be rolled towards or away from this position on wheels 52 . although the disclosure describes and illustrates various embodiments of the invention , it is to be understood that the invention is not limited to these particular embodiments . many variations and modifications will now occur to those skilled in the art of two wheeled hinge lidded container manufacturing . for full definition of the scope of the invention , reference is to be made to the appended claims .	8
set forth below is a description of what are currently believed to be the preferred embodiments and / or best examples of the invention claimed . future and present alternatives and modifications to these preferred embodiments are contemplated . any alternatives or modifications which make insubstantial changes in function , in purpose , in structure or in result are intended to be covered by the claims of this patent . referring first to fig1 - 3 , a water container such as water bottle 20 is shown , together with a preferred embodiment of the filter shutoff device of the present invention , generally referred to as 30 . while it is preferred that water bottle 20 have threads 35 that allow threaded connection with mating threads 25 on the neck of water bottle 20 , a threaded connection is not required . referring to fig3 filter shutoff device 30 is sized and shaped to permit its placement within opening 27 of water cooler housing 26 . ( the particular water dispenser chosen for use is of little importance to the present invention .) for this purpose , filter device 30 may include an enlarged rim or neck 37 that rests on the top peripheral wall 27 a of aperture 27 . referring now to fig4 - 6 , one preferred embodiment of filter device 30 includes the following components : filter cap 80 ; plunger 90 ; spring 57 ; support or media retaining ring 33 ; and upper and lower filter pads 32 a , 32 b . upper pad 32 a is preferably sonic - welded to ring 33 , inside rim 33 a ; lower pad 32 b is preferably sonic - welded to the lower interior of filter housing 36 . pads 32 a , 32 b maintain the filter media , such as activated charcoal 64 , in place within filter housing 36 . during assembly , plunger 90 is placed down through within center opening 92 a of plunger 90 . spring 57 compresses against plunger 90 and , in turn , is compressed by retaining ring 33 ; compression is maintained on plunger 90 for the reasons described below . filter cap 80 may be sonic - welded to the upper surface of filter housing 36 since , in the preferred embodiment , filter shutoff 30 is designed to be replaced , rather than cleaned and re - used , when the useful life of the filter is over . filter housing 36 is preferably generally cylindrical in shape , as shown , and includes passages 38 ( fig1 ) in its lower surface which permit water passage through the lower end of filter housing 36 . ribs 113 on the outer surface of housing 36 facilitate gripping of the housing by the user . filter cap 80 includes vent holes 120 which , in the preferred embodiment shown , are six in number . referring to fig8 a preferred form of plunger 90 includes an annular top surface 92 with a restricted throat opening 92 a . legs 93 project downwardly from top surface 92 and include projections 93 b and retaining tabs 93 a . annular wall 91 and legs 93 are separated by arcuate openings such as u - shaped openings , as shown . referring to fig7 and 10 , filter cap 80 has an inner annular wall 83 with internal threads 35 . annular wall 83 houses an opposing series of angled teeth , lower teeth 81 and upper teeth 82 . prior to installation of a water bottle , projection 93 b of plunger 90 is in an upper position in between upper teeth 82 . upon installation of water bottle 20 , projection 93 b will move straight down about ¼ inch ( equal to the distance that the lower edge of the water bottle must travel to meet the filter cap threads 35 ) until projection 93 b lies between two lower teeth 81 . as the water bottle is threaded onto the filter cap , projection 93 b will continue to move downward between the two lower teeth 81 . referring to fig2 , projection 93 b preferably traverses the path shown by circuit 188 . filter cap 80 and plunger 90 are preferably designed such that projection 93 b does not touch either the upper surface 82 a of upper teeth 82 or the lower surface 81 b of lower teeth 81 ( see fig1 ), so that projection 93 b is not stressed during use . while other dimensions may obviously be used , in a preferred embodiment upper teeth may have a length equal to the length of projection 93 b teeth 81 . for example , in the preferred embodiment , the shorter and longer sides of upper teeth 82 may have a length of 0 . 062 and 0 . 109 inches , respectively , while the shorter and longer sides of lower teeth 81 may have a length of 0 . 253 and 0 . 294 inches , respectively . ( the individual teeth may vary slightly in length , given the individual sections of the collapsible cored use to mold the filter cap .) by designing the filter cap so that the lower teeth 81 are longer than the upper teeth 82 , this ensures that follower projection 93 b will index over and into position so that when threading the filter cap onto the bottle , projection 93 b will continue down the correct channel between the lower teeth , and avoid backtracking of projection 93 b due to clockwise rotation of the threading action . in operation , and referring now to fig7 - 16 , plunger 90 rotates as filter shutoff device 30 is replaced and connected to new water bottles . plunger rotation is caused by the interaction of projection 93 b with opposing angled teeth 81 , 82 . during normal water dispensing and filter use , plunger 90 is positioned at a vertical level that permits threaded connection of threads 35 of filter cap 80 with threads 25 on the neck of bottle 20 ( fig2 ). plunger 90 is maintained by spring 57 in the highest vertical position permitted . as plunger 90 incrementally rotates during the successive use of water bottles , projection 93 b moves within opposing teeth 81 , 82 , which are off - set and angled to induce this rotation . ( this continues until retaining tab 93 a reaches locking window 84 . upon locking , which is further discussed below , plunger 90 is locked at a vertical level such that the plunger covers threads 35 and interferes with engagement of the threads by a water bottle . referring to fig1 - 16 , “ lead - in ” angled surfaces 93 a 1 , and 84 a of retaining tab 93 a and locking window 84 , respectively , are provided . these surfaces are angled to allow the locking tab to cam its way onto the inside surfaces of window “ frame ” 84 a as a result of the rotation of plunger 90 during the last few iterative movements of projection 93 b between teeth 81 , 82 , just prior to the locking of tab 93 within window 84 . this camming action flexes leg 93 toward the filter throat until retaining tab 93 a clears ramped surface 84 a and enters the window itself . the locking mechanism is also designed to reduce the risk of losing the locking function , as now described . referring to fig1 , if the user tries to connect the bottle threads to filter shutoff device 30 after the locking mechanism has been engaged ( and , thus , retaining tab 93 a lies within locking window 84 ), a downward force is exerted on plunger 90 by the water bottle end . this pushes retaining tab 93 a against the bottom surface 84 b of locking window 84 . bottom surface 84 b and the adjacent bottom surface of locking tab 93 a are each angled slightly in a downward direction moving away from filter throat 91 a . this results in locking tab 93 a having a tendency to “ bury ” itself deeper into locking window 84 , rather than trying to slide back toward the filter throat and losing engagement with the locking window . referring to fig9 and 11 , opening 85 is provided as a relief , to ensure that projections 93 b on the plunger do not shear off as the plunger is installed . in addition , opening 85 provides a visual indication to the installer , giving the installer the ability to choose the number of iterations necessary before lock - up of the filter occurs . for example , in the device shown in fig1 , fifty teeth 81 , 82 and three openings 85 are provided about the inner circumference of cap 80 . the positions of openings 85 allow a design in which , by initially locating the plunger so that projection 93 b is situated in an opening 85 , filter shutoff device 30 can be configured to provide any number of iterations necessary to correlate the volume of bottles being used and the filter rating , and trigger filter lock - up . the openings of plunger 90 should be appropriately sized , as now described . first , plunger top 92 is preferably provided with a restricted circular throat 92 a , to reduce water hammer through the plunger . in the preferred embodiment , this opening has a diameter of about ¾ inches , which is 0 . 442 in 2 . once the opening in plunger top 92 is sized , the vertical slots in apron 91 of plunger 90 are then sized , by providing slots having an area such that the effective surface area of the openings permitting water travel out the side annular walls of plunger 90 is equal to the surface area of throat opening 92 a in plunger top surface 92 . given this preferred plunger size and configuration , it was found that water will fill the upper chamber of the filter , i . e ., above media retaining ring 33 and below cap 80 , relatively slowly , such that water will not be permitted to pass through vent holes 120 . in a particularly preferred embodiment , an early warning signal may be used to notify the user of the impending end of the filter &# 39 ; s useful life . for example , a red flag may be sprung into position within the center of the filter when 90 % of the filter &# 39 ; s useful life has expired . as another example , bi - colored icons or a graduated bi - color band 191 ( fig1 ) may be used to indicate that the useful life of the filter is nearing an end , by matching dot or projection 190 on rotating plunger top surface 92 , for example , with band 191 . filter cap 80 carrying opposed teeth 81 , 82 may be manufactured by machining a collapsible core , such as those available from detroit mold engineering of detroit , owned by cincinnati millicron ( catalog no . cc - 402 - pc ). when designing the teeth , a proper draft angle is required to insure release from the molding surface . each of the teeth has a different shape depending on where they are located on the collapsing core . the collapsing action of the dme core is inward , or perpendicular to the primary draw angle of the mold , and works with a specific number of pie shaped segments , as disclosed in u . s . pat . nos . 3 , 247 , 548 and 3 , 660 , 001 , incorporated herein by reference . these pie shapes , usually consisting of twelve segments , may have two different sizes , e . g ., six large and six small . each segment should be machined separately . another aspect of the invention concerning vent holes 120 is now discussed . referring to fig3 when water bottle 20 is inverted into a dispensing position , a seal is created between shutoff filter rim 37 and bottle seat ledge 27 a . to allow continuous dispensing without lock - up , air passes from outside the filter through vent holes 120 in filter cap 80 ( fig6 ), and into water bottle 20 . when the filter is initially installed on the bottle and the bottle is rotated into the functioning position , during the time that water flows down and wets and fills the filter media , the water flow path that presents the least amount of resistance , and thus the path the water actually travels , is through the vent holes . this is believed due to a water hammer effect such that the existing air already in the filter will tend to escape through these vent holes , carrying water with it . this initial condition may result in some ( less than about 1 cc .) untreated water escaping through the vent holes and into the treated water . this initial condition may result in a failure to comply with nsf regulations regarding lead treatment , for example . to solve this problem , a reduced throat diameter “ d ” ( fig6 ) is provided , e . g ., the throat diameter was reduced from about 2 inches to about ¾ inches , for example . in the preferred embodiment , six vent holes 120 are provided on the upper surface of filter cap 80 , and pass completely through the filter cap . one preferred size of the vent holes is about 0 . 031 inches ; however the vent holes may be sized larger , in which case fewer than six may be used . vent holes 120 permit air to escape from the filter , and flow between the bottle threads and into the water bottle . using this restricted throat diameter , when water bottle 20 is inverted , water slowly passes into filter shutoff device 30 , such that the water level in the device slowly rises . in a particularly preferred embodiment , 0 . 7266 minutes was required for 3500 ml . of water to flow through a filter shutoff device having a throat diameter of about ¾ inches ( a fill rate of 4 , 817 ml ./ min ), whereas only 0 . 1728 minutes was required for the same volume of water to flow through an identical filter with a throat diameter of about 1 . 5 inches ( a fill rate of 20 , 255 ml ./ min ). it was noted that water hammer continued to cause water passage through the vent holes until the fill rate was reduced below about 7 , 500 ml ./ min . unlike prior art designs , even during the filling stage and before the water reaches its final level within the filter due to the pressure head created by the bottle neck , the water level never reaches above the level of vent holes 120 . with this design , then , water never flows out through the vent holes , allowing nsf compliance , and reducing spillage and mess . referring now to fig1 - 25 , an alternative embodiment of the filter shutoff device of the present invention , generally referred to as 130 , is shown . referring first to fig1 , filter cap 180 has opposed vertical walls 139 ending in tabs 139 a designed to removably snap into the opening formed by rim 141 a of ring 141 . the outside walls 141 b of ring 141 preferably taper , as shown , to make room for this removable snap fit . a filter , not shown , is contained within opening 152 created by this connection referring still to fig1 - 25 , filter cap 180 is assembled to a monitoring and locking device , generally referred to as 140 , which consists of rotary indexing ring 141 and stationary ring 143 . ring 141 includes a number of teeth 144 a axially spaced about the upper internal periphery of the ring , and a flexible or spring - loaded tab 145 positioned along the outside edge of ring 141 , having a distal end 145 a and a function described further below . ring 143 includes a curved annular disc 144 with two curved springs 146 , which may be helically - shaped , opposing tabs 148 on the ring periphery , and two opposed indexing tabs 147 . indexing tabs 147 each have triangular projections 147 a , 147 b , preferably shaped as shown . referring now to fig2 - 25 , during normal water dispensing and operation of the filter , teeth 144 a are positioned as shown in fig2 . each time filter shutoff device 130 is removed from an empty water bottle 20 and threaded to a new water bottle , device 140 is shaped , sized and configured to provide an rotary indexing movement such that tab 147 is advanced in a counter - clockwise direction ( as seen when looking downward on device 130 ) the distance of one tooth , as now explained . each time device 130 is removed from an empty water bottle , ring 143 is forced upward by springs 146 , causing two adjacent teeth 144 a to be positioned adjacent triangular projection 147 b , as shown in fig2 . the interaction of the leading tooth 144 a 1 against projection 147 b causes an incremental counter - clockwise rotation of ring 144 and indexing tab 147 ( when viewing device 130 from a downward direction ). then , when a new water bottle is threadably attached to device , 130 , ring 143 is forced in a downward direction by the neck of the bottle . when this occurs , indexing tab 147 b moves downward as well so that leading tooth 144 a 1 now contacts projection 147 a , causing another incremental counter - clockwise rotation of ring 144 and indexing tab 147 , as shown in fig2 , such that trailing tooth 144 a 2 is in the position that leading tooth 144 a 1 of fig2 previously occupied . in this manner , ring 143 is continued to be advanced in a rotary direction until the disassembly of device 130 from an empty water bottle causes spring - loaded tab 145 to reach opening 150 in vertical wall 139 of filter cap 180 . now , distal edge 145 a , which was earlier prevented from doing so ( see fig1 ), enters opening 150 and halts further rotary movement of ring 143 and indexing tab 147 , as shown in fig1 - 20 . when this occurs , device 130 can no longer be threadably connected to a new water bottle since the presence of distal end 145 a within opening 150 prevents downward movement of ring 143 , so that ring 143 remains in a position that covers internal threads 135 of filter cap 180 , as shown in fig2 . as will now be understood , the components of filter monitoring and locking device 140 may be shaped and oriented such that the number of teeth used corresponds to the number of bottles which may be used before the filter is disabled . for example , if 45 teeth are used for 3 - gallon bottles , then the filter disable device will activate after 135 gallons of water have been used . in an alternative preferred embodiment , shown in fig2 - 28 , filter monitoring and locking device 240 is of one - piece construction , and includes a single molded component consisting of upper ring 243 and lower ring 241 . indexing tab 247 extends down from ring 244 and includes an upper opening 247 c with a pointed tab 245 . indexing tab 247 also includes a lower , stepped series of openings 247 d . in a similar manner as described above , ring 243 and tab 247 are rotary indexed in a counter - clockwise direction ( again , when viewing device 240 from above ) by the stepped orientation and interaction of openings 247 d with teeth 244 a , as shown in fig2 and 28 . as the filter shutoff device is used , removed and then connected to a new water container , tab 247 rotates and pointed tab 245 moves within succeeding angled openings 260 . when tab 247 reaches a position permitting the entry of tab 245 into opening 270 on ring 241 ( fig2 ), further rotary movement of ring 243 ceases , disabling the filter shutoff device by preventing its threaded connection with water container 20 . it will be understood that the filter shutoff device of the present invention may be used with water containers other than the inverted water bottles shown in the drawings . for example , the device may be used with water pitchers or sports bottles . it will also be understood that the filter shutoff device may be used with a variety of water dispensing devices , and a variety of filters , other than those specifically described here . while the invention has been described with reference to a threaded connection between filter shutoff device 30 and water bottle 20 , it will be understood that device 30 may be modified for use with water containers that are not intended to be threadably connected to device 30 . for example , filter shutoff device 30 could be used with non - threaded connections between device 30 and water bottle 20 such as those described in u . s . pat . nos . 5 , 222 , 531 and 5 , 289 , 855 , incorporated herein by reference , such that a cap could be press - fit onto the filter device . as another example , instead of both the water container and the filter shutoff device having threads , one could have a partial thread and the other a simple projection that would engage the partial thread when the filter shutoff device is rotated ; this could act as a helical ramp for the projection , pulling the two components tightly together . the above description is not intended to limit the meaning of the words used in the following claims that define the invention . rather , it is contemplated that future modifications in structure , function or result will exist that are not substantial changes and that all such insubstantial changes are intended to be covered by the claims .	2
hereinafter , the present invention will be described more in detail referring to the following non - limiting examples . an aqueous zinc chloride solution was prepared by completely dissolving 100 g of zinc oxide ( grade 1 zinc oxide , sakai chemical industry co ., ltd ., sakai , japan ) in an aqueous hydrochloric acid solution containing 250 g of 35 - mass % hydrochloric acid ( extra pure grade ) and 350 g of purified water . to the prepared aqueous zinc chloride solution , 14 . 7 g of gallium nitrate octahydrate was added , and mixed the mixture until gallium nitrate octahydrate was completely dissolved to form a transparent solution . separately , prepare an aqueous ammonium bicarbonate solution was prepared by dissolving 230 g of ammonium bicarbonate ( extra pure grade ) in 1500 g of purified water . the above - mentioned aqueous zinc chloride solution in which gallium nitrate was dissolved was added to the aqueous ammonium bicarbonate solution over 120 minutes to produce precipitate . next , 150 ml of an aqueous solution containing 23 . 5 g ( corresponding to 5 g as sio 2 ) of sodium metasilicate nonahydrate ( extra pure grade ), and 10 - mass % sulfuric acid were simultaneously added while the flow rates were adjusted so as to keep ph within the range of 7 to 9 over 90 minutes . then , the obtained precipitate was sufficiently washed , separated from the liquid phase , and dried at 130 ° c . over 5 hours . next , the dried powder was pulverized by an agate mortar to give a precursor to be fired . the precursor to be fired was put in an alumina boat and heated to 700 ° c . at the heating rate of 200 ° c ./ hour using a tubular furnace while a mixed gas of 0 . 21 l / minute of nitrogen gas and 0 . 09 l / minute of hydrogen gas was circulated . after being kept as it was for 2 hours , the substance was cooled to room temperature to give ultrafine zinc oxide a - a . the average primary particle diameter of the ultrafine zinc oxide a - a was 0 . 025 μm . ultrafine zinc oxide a - b was obtained in the same manner as example a - 1 , except that the amount of sodium metasilicate nonahydrate ( extra pure grade ) was set to be 4 . 7 g ( corresponding to 1 g as sio 2 ). the average primary particle diameter of the ultrafine zinc oxide a - b was 0 . 034 μm . ultrafine zinc oxide a - c was obtained in the same manner as example a - 1 , except that the amount of sodium metasilicate nonahydrate ( extra pure grade ) was set to be 47 . 0 g ( corresponding to 10 g as sio 2 ). the average primary particle diameter of the ultrafine zinc oxide a - c was 0 . 018 μm . ultrafine zinc oxide a - d was obtained in the same manner as example a - 1 , except that 14 . 7 g of gallium nitrate octahydrate was replaced with 14 . 8 g of aluminum chloride hexahydrate . the average primary particle diameter of the ultrafine zinc oxide a - d was 0 . 030 μm . ultrafine zinc oxide a - e was obtained in the same manner as example a - 1 , except that 14 . 7 g of gallium nitrate octahydrate was replaced with 10 . 8 g of indium chloride tetrahydrate . the average primary particle diameter of the ultrafine zinc oxide a - e was 0 . 035 μm . ultrafine zinc oxide a - f was obtained in the same manner as example a - 1 , except that 14 . 7 g of gallium nitrate octahydrate was replaced with 34 . 3 g of gallium nitrate octahydrate . the average primary particle diameter of the ultrafine zinc oxide a - f was 0 . 016 μm . ultrafine zinc oxide a - g was obtained in the same manner as example a - 1 , except that the firing temperature was set to 800 ° c . in lieu of 700 ° c . the average primary particle diameter of the ultrafine zinc oxide a - g was 0 . 031 μm . an aqueous zinc chloride solution was prepared by completely dissolving 100 g of zinc oxide ( grade 1 zinc oxide , sakai chemical industry co ., ltd ., sakai , japan ) in an aqueous hydrochloric acid solution containing 250 g of 35 - mass % hydrochloric acid ( extra pure grade ) and 350 g of purified water . to the prepared aqueous zinc chloride solution , 14 . 7 g of gallium nitrate octahydrate was added , and mixed the mixture until gallium nitrate octahydrate was completely dissolved to form a transparent solution . separately , an aqueous ammonium bicarbonate solution was prepared by dissolving 230 g of ammonium bicarbonate ( extra pure grade ) in 1500 g of purified water . the aqueous zinc chloride solution in which gallium nitrate was dissolved was added to the aqueous ammonium bicarbonate solution over 120 minutes to produce precipitate . then , the obtained precipitate was sufficiently washed , separated from the liquid phase , and dried at 130 ° c . over 5 hours . next , the dried powder was pulverized by an agate mortar to give a precursor to be fired . the precursor to be fired was put in an alumina boat and heated to 700 ° c . at 200 ° c ./ hour while circulating a mixed gas of 0 . 21 l / minute of nitrogen gas and 0 . 09 l / minute of hydrogen gas using a tubular furnace . after being kept as it was for 2 hours , the substance was cooled to room temperature to give silica - free ultrafine zinc oxide a - h . the average primary particle diameter of the ultrafine zinc oxide a - h was 0 . 13 μm . silica - free ultrafine zinc oxide a - i was obtained in the same manner as comparative example a - 1 , except that 14 . 7 g of gallium nitrate octahydrate was replaced with 14 . 8 g of aluminum chloride hexahydrate . the average primary particle diameter of the ultrafine zinc oxide a - i was 0 . 35 μm . silica - free ultrafine zinc oxide a - j was obtained in the same manner as comparative example a - 1 , except that 14 . 7 g of gallium nitrate octahydrate was replaced with 10 . 8 g of indium chloride tetrahydrate . the average primary particle diameter of the ultrafine zinc oxide a - j was 0 . 53 μm . ultrafine zinc oxide a - k was obtained in the same manner as example a - 1 , except that the firing temperature was set to 900 ° c . in lieu of 700 ° c . the average primary particle diameter of the ultrafine zinc oxide a - k was 0 . 21 μm . the synthesis conditions and bet specific surface area of the ultrafine zinc oxides obtained in the above - mentioned examples a - 1 to a - 7 and comparative examples a - 1 to a - 4 are illustrated in table 1 . in 50 ml of pure water , each 0 . 2 g sample of the ultrafine zinc oxide was added . then , hydrochloric acid ( for analysis use ) was further added thereto , and mixed the mixture until it became a completely transparent solution . the obtained aqueous solution was transferred to a 100 ml measuring flask , and pure water was added in the flask to adjust the total volume to be 100 ml . the obtained aqueous solution was analyzed by icp emission spectrophotometer ( sps 1700 hvr model , seiko instruments inc ., chiba , japan ). using a previously produced analytical curve , the amount of the element having a valence number of 3 or more and the amount of silica were determined . then the determined amounts of the element or silica were converted by calculation to the amount relative to the amount of zinc oxide . table 1 illustrates the amounts of the element having a valence number of 3 or more represented by mol amount per mol of zno . the amounts of silica are represented by mass % in the prepared substance . evaluation of heat ray shielding ability in the form of thin film heat ray shielding abilities of the ultrafine zinc oxides obtained in the examples a - 1 to a - 7 and comparative examples a - 1 to a - 4 were tested as follows . each ultrafine zinc oxide - dispersed coating material was prepared by mixing 2 . 36 g of each ultrafine zinc oxide , 5 . 5 g of alkyd resin varnish ( beckosol j - 524 , dainippon ink and chemicals , inc ., tokyo , japan ), 2 . 8 g of melamine resin varnish ( super beckamine j - 820 , dainippon ink and chemicals , inc .) and 5 . 7 g of xylene ( extra pure grade ) and dispersing them together with 30 g of 1 . 5 mmφ glass beads using a paint conditioner over 180 minutes . next , a small amount of the dispersion coating material was sampled on a glass plate and formed into a film using a no . 12 bar coater and successively baked at 130 ° c . over 30 minutes to give each film for evaluation . the optical transmittance of the film for evaluation was measured by uv - vis - nir spectrophotometers ( v - 570 type spectrophotometer and iln 471 type integration apparatus , jasco corp ., tokyo , japan ). the transmittances at 550 nm and 1900 nm are illustrated in table 2 . table 2 shows that the zinc oxide containing ga of examples a - 1 to a - 3 , a - 6 and a - 7 became desirable zinc oxide fine particles having high visible light transmittance at 550 nm and significantly low near infrared ray transmittance at 1900 nm . the results of zinc oxide of comparative examples a - 1 and a - 4 , show that the specific surface area was considerably decreased and transparency was lost since the zinc oxide of comparative example a - 1 did not contain silica as the sintering - preventing agent , and the zinc oxide of comparative example a - 4 was fired at temperature as high as 900 ° c . on the other hand , the results of the zinc oxides of examples a - 4 and a - 5 , which contained al and in respectively , showed that the zinc oxides had excellent properties such as high visible light transmittance at 550 nm and low near infrared ray transmittance at 1900 nm as compared with the silica - free zinc oxide of comparative examples a - 2 and a - 3 . an aqueous zinc chloride solution was prepared by completely dissolving 100 g of zinc oxide ( grade 1 zinc oxide ) in an aqueous hydrochloric acid solution containing 250 g of 35 - mass % hydrochloric acid ( extra pure grade ) and 350 g of purified water . to the prepared aqueous zinc oxide solution , 15 . 9 g of scandium chloride hexahydrate ( reagent ) was added and mixed the mixture to dissolve zinc oxide until the solution became transparent . separately , an aqueous sodium carbonate solution was prepared by 154 . 6 g of sodium carbonate ( extra pure grade ) was dissolved in 1546 g of purified water . the aqueous zinc oxide solution in which scandium chloride was dissolved was added to the aqueous sodium carbonate solution over 120 minutes to produce precipitate . then , the precipitate was sufficiently washed , separated from liquid phase , and dried at 130 ° c . over 5 hours . next , the dried powder was pulverized in an agate mortar to give a precursor compound . the precursor compound was set in a magnetic crucible and fired at 400 ° c . for 1 hour using a muffle furnace to give a mixed oxide of scandium and zinc . under stirring condition , the mixed oxide was put in 1000 g of purified water and successively , 90 ml of an aqueous solution containing 14 . 2 g ( corresponding to 3 g as sio 2 ) of sodium metasilicate nonahydrate ( extra pure grade ) and 10 - mass % sulfuric acid ( reagent ) were simultaneously added while the flow rates were adjusted as to keep ph within the range of 7 to 9 over 90 minutes . then , the obtained precipitate was sufficiently washed , separated from the liquid phase and dried at 130 ° c . over 5 hours . the dried powder was subsequently pulverized by an agate mortar to give a precursor to be fired . the precursor to be fired was put in an alumina boat and heated to 700 ° c . at the heating rate of 200 ° c ./ hour using a tubular furnace while a mixed gas of 0 . 285 l / minute of nitrogen gas and 0 . 015 l / minute of hydrogen gas was circulated . after being kept as it was for 2 hours , the substance was cooled to room temperature to give ultrafine zinc oxide b - a . the average primary particle diameter of the ultrafine zinc oxide b - a was 0 . 021 μm and the volume resistivity value of the ultrafine zinc oxide b - a was 521 ωcm . ultrafine zinc oxide b - b was obtained in the same manner as example b - 1 , except that 15 . 9 g of scandium chloride hexahydrate ( reagent ) was replaced with 23 . 5 g of yttrium nitrate hexahydrate ( reagent ). the average primary particle diameter of the ultrafine zinc oxide b - b was 0 . 031 μm and the volume resistivity value of the ultrafine zinc oxide b - b was 665 ωcm . ultrafine zinc oxide b - c was obtained in the same manner as example b - 1 , except that 15 . 9 g of scandium chloride hexahydrate ( reagent ) was replaced with 18 . 0 g of indium chloride tetrahydrate ( for chemical use ). the average primary particle diameter of the ultrafine zinc oxide b - c was 0 . 041 μm and the volume resistivity value of the ultrafine zinc oxide b - c was 459 ωcm . ultrafine zinc oxide b - d was obtained in the same manner as example b - 1 , except that 15 . 9 g of scandium chloride hexahydrate ( reagent ) was replaced with 23 . 4 g of gallium nitrate octahydrate ( reagent ). the average primary particle diameter of the ultrafine zinc oxide b - d was 0 . 024 μm and the volume resistivity value of the ultrafine zinc oxide b - d was 333 ωcm . ultrafine zinc oxide b - e was obtained in the same manner as example b - 1 , except that 15 . 9 g of scandium chloride hexahydrate ( reagent ) was replaced with 23 . 0 g of aluminum nitrate nonahydrate ( jis extra pure grade ). the average primary particle diameter of the ultrafine zinc oxide b - e was 0 . 022 μm and the volume resistivity value of the ultrafine zinc oxide b - e was 474 ωcm . ultrafine zinc oxide b - f was obtained in the same manner as example b - 1 , except that 15 . 9 g of scandium chloride hexahydrate ( reagent ) was replaced with 11 . 6 g of titanium ( iv ) chloride ( reagent ). the average primary particle diameter of the ultrafine zinc oxide b - f was 0 . 024 μm and the volume resistivity value of the ultrafine zinc oxide b - f was 514 ωcm . an aqueous zinc chloride solution was prepared by completely dissolving 100 g of zinc oxide ( grade 1 zinc oxide ) in an aqueous hydrochloric acid solution containing 250 g of 35 mass % hydrochloric acid ( extra pure grade ) and 350 g of purified water . separately , an aqueous sodium carbonate solution was prepared by dissolving 154 . 6 g of sodium carbonate ( extra pure grade ) in 1546 g of purified water . the aqueous zinc oxide solution was added to the aqueous sodium carbonate solution over 120 minutes to produce precipitate . then , the precipitate was sufficiently washed , mixed with 3 . 8 g of boric acid ( extra pure grade ) and stirred for 20 minutes . next , the obtained slurry was evaporated and dried at 130 ° c . and the obtained dried powder was pulverized in an agate mortar to give a precursor compound . the precursor compound was set in a magnetic crucible and fired at 400 ° c . for 1 hour using a muffle furnace to obtain a mixed oxide of boron and zinc . the mixed oxide was put in 1000 g of purified water with stirring , and successively , 90 ml of an aqueous solution containing 14 . 2 g ( corresponding to 3 g as sio 2 ) of sodium metasilicate nonahydrate ( extra pure grade ) and 10 - mass % sulfuric acid ( reagent ) were simultaneously added while the flow rates were adjusted as to keep ph within the range of 7 to 9 over 90 minutes . then , the obtained precipitate was sufficiently washed , separated from the liquid phase and dried at 130 ° c . over 5 hours . next , the dried powder was pulverized by an agate mortar to given a precursor to be fired . the precursor to be fired was put in an alumina boat and heated to 700 ° c . at the heating rate of 200 ° c ./ hour using a tubular furnace while a mixed gas of 0 . 285 l / minute of nitrogen gas and 0 . 015 l / minute of hydrogen gas was circulated . after being kept as it was for 2 hours , the substance was cooled to room temperature to give ultrafine zinc oxide b - g . the average primary particle diameter of the ultrafine zinc oxide b - g was 0 . 021 μm and the volume resistivity value of the ultrafine zinc oxide b - g was 536 ωcm . ultrafine zinc oxide b - h was obtained in the same manner as example b - 1 , except that 15 . 9 g of scandium chloride hexahydrate ( reagent ) was replaced with 26 . 7 g of cerium nitrate hexahydrate ( extra pure grade ). the average primary particle diameter of the ultrafine zinc oxide b - h was 0 . 019 μm and the volume resistivity value of the ultrafine zinc oxide b - h was 543 ωcm . ultrafine zinc oxide b - i was obtained in the same manner as example b - 1 , except that 15 . 9 g of scandium chloride hexahydrate ( reagent ) was replaced with 27 . 4 g of europium nitrate hexahydrate ( reagent ). the average primary particle diameter of the ultrafine zinc oxide b - i was 0 . 022 μm and the volume resistivity value of the ultrafine zinc oxide b - i was 540 ωcm . ultrafine zinc oxide b - j was obtained in the same manner as example b - 1 , except that 15 . 9 g of scandium chloride hexahydrate ( reagent ) was replaced with 23 . 8 g of ytterbium chloride hexahydrate ( reagent ). the average primary particle diameter of the ultrafine zinc oxide b - j was 0 . 025 μm and the volume resistivity value of the ultrafine zinc oxide b - j was 692 ωcm . ultrafine zinc oxide b - k was obtained in the same manner as example b - 1 , except that 15 . 9 g of scandium chloride hexahydrate ( reagent ) was replaced with 3 . 7 g of aluminum nitrate nonahydrate ( jis extra pure grade ). the average primary particle diameter of the ultrafine zinc oxide b - k was 0 . 026 μm and the volume resistivity value of the ultrafine zinc oxide b - k was 547 ωcm . ultrafine zinc oxide b - l was obtained in the same manner as example b - 1 , except that 15 . 9 g of scandium chloride hexahydrate ( reagent ) was replaced with 69 . 1 g of aluminum nitrate nonahydrate ( jis extra pure grade ). the average primary particle diameter of the ultrafine zinc oxide b - l was 0 . 035 μm and the volume resistivity value of the ultrafine zinc oxide b - k was 481 ωcm . ultrafine zinc oxide b - m was obtained in the same manner as example b - 5 , except that 90 ml of the aqueous solution containing 14 . 2 g ( corresponding to 3 g as sio 2 ) of sodium metasilicate nonahydrate ( extra pure grade ) and 10 - mass % sulfuric acid ( reagent ) were replaced with 90 ml of an aqueous solution containing 5 . 7 g ( corresponding to 3 g as zro 2 ) of zirconium chloride ( reagent ) and 10 - mass % sodium hydroxide aqueous solution ( reagent ). the average primary particle diameter of the ultrafine zinc oxide b - m was 0 . 026 μm and the volume resistivity value of the ultrafine zinc oxide b - m was 450 ωcm . ultrafine zinc oxide b - n was obtained in the same manner as example b - 5 , except that 90 ml of the aqueous solution containing 14 . 2 g ( corresponding to 3 g as sio 2 ) of sodium metasilicate nonahydrate ( extra pure grade ) and 10 - mass % sulfuric acid ( reagent ) were replaced with 90 ml of an aqueous solution containing 7 . 0 g ( corresponding to 3 g as sno 2 ) of tin ( iv ) chloride pentahydrate ( extra pure grade ) and 10 - mass % sodium hydroxide aqueous solution ( reagent ). the average primary particle diameter of the ultrafine zinc oxide b - n was 0 . 027 μm and the volume resistivity value of the ultrafine zinc oxide b - n was 593 ωcm . ultrafine zinc oxide b - o was obtained in the same manner as example b - 5 , except that 90 ml of the aqueous solution containing 14 . 2 g ( corresponding to 3 g as sio 2 ) of sodium metasilicate nonahydrate ( extra pure grade ) and 10 - mass % sulfuric acid ( reagent ) were replaced with 90 ml of an aqueous solution containing 19 . 1 g ( corresponding to 3 g as mgo ) of magnesium nitrate hexahydrate ( extra pure grade ) and 10 - mass % sodium hydroxide aqueous solution ( reagent ). the average primary particle diameter of the ultrafine zinc oxide b - o was 0 . 028 μm and the volume resistivity value of the ultrafine zinc oxide b - o was 608 ωcm . ultrafine zinc oxide b - p was obtained in the same manner as example b - 5 , except that 90 ml of the aqueous solution containing 14 . 2 g ( corresponding to 3 g as sio 2 ) of sodium metasilicate nonahydrate ( extra pure grade ) and 10 - mass % sulfuric acid ( reagent ) were replaced with 90 ml of an aqueous solution containing 4 . 6 g ( corresponding to 3 g as hfo 2 ) of hafnium chloride ( reagent ) and an aqueous solution of 10 - mass % sodium hydroxide ( reagent ). the average primary particle diameter of the ultrafine zinc oxide b - p was 0 . 020 μm and the volume resistivity value of the ultrafine zinc oxide b - p was 632 ωcm . ultrafine zinc oxide b - q was obtained in the same manner as example b - 5 , except that 14 . 2 g ( corresponding to 3 g as sio 2 ) of sodium metasilicate nonahydrate ( extra pure grade ) was replaced with 3 . 8 g ( corresponding to 0 . 8 g as sio 2 ) of sodium metasilicate nonahydrate ( extra pure grade ). the average primary particle diameter of the ultrafine zinc oxide b - q was 0 . 054 μm and the volume resistivity value of the ultrafine zinc oxide b - q was 893 ωcm . ultrafine zinc oxide b - r was obtained in the same manner as example b - 5 , except that 14 . 2 g ( corresponding to 3 g as sio 2 ) of sodium metasilicate nonahydrate ( extra pure grade ) was replaced with 71 . 1 g ( corresponding to 15 g as sio 2 ) of sodium metasilicate nonahydrate ( extra pure grade ). the average primary particle diameter of the ultrafine zinc oxide b - r was 0 . 012 μm and the volume resistivity value of the ultrafine zinc oxide b - r was 352 ωcm . ultrafine zinc oxide b - s was obtained in the same manner as example b - 5 , except that reducing firing temperature was set to 600 ° c . in lieu of 700 ° c . the average primary particle diameter of the ultrafine zinc oxide b - s was 0 . 017 μm and the volume resistivity value of the ultrafine zinc oxide b - s was 647 ωcm . ultrafine zinc oxide b - t was obtained in the same manner as example b - 5 , except that reducing firing temperature was set to 850 ° c . in lieu of 700 ° c . the average primary particle diameter of the ultrafine zinc oxide b - t was 0 . 051 μm and the volume resistivity value of the ultrafine zinc oxide b - t was 145 ωcm . an aqueous zinc chloride solution was prepared by completely dissolving 100 g of zinc oxide ( grade 1 zinc oxide , sakai chemical industry co ., ltd .) in an aqueous hydrochloric acid solution containing 250 g of 35 - mass % hydrochloric acid ( extra pure grade ) and 350 g of purified water . to the prepared aqueous zinc oxide solution , 0 . 46 g of aluminum nitrate nonahydroxide ( jis extra pure grade ) was further added and mixed the mixture until aluminum nitrate nonahydroxide was completely dissolved to form a transparent solution . separately , an aqueous sodium carbonate solution was prepared by dissolving 154 . 6 g of sodium carbonate ( extra pure grade ) in 1546 g of purified water . the above - mentioned aqueous zinc oxide solution in which aluminum nitrate nonahydrate was dissolved was added to the aqueous sodium carbonate solution over 120 minutes to produce precipitate . then , the precipitate was sufficiently washed , separated from liquid phase , and dried at 130 ° c . over 5 hours . the dried powder was subsequently pulverized in an agate mortar to give a precursor compound . the precursor compound was set in a magnetic crucible and fired at 400 ° c . for 1 hour using a muffle furnace to give a mixed oxide of aluminum and zinc . under stirring condition , the mixed oxide was put in 1 , 000 g of purified water and successively , 90 ml of an aqueous solution containing 14 . 2 g ( corresponding to 3 g as sio 2 ) of sodium metasilicate nonahydrate ( extra pure grade ) and 10 - mass % sulfuric acid ( reagent ) were simultaneously added while the flow rates were adjusted as to keep ph within the range of 7 to 9 over 90 minutes . then , the obtained precipitate was sufficiently washed , was separated from the liquid phase , and dried at 130 ° c . over 5 hours . the dried powder was subsequently pulverized by an agate mortar to obtain a precursor to be fired . the precursor to be fired was put in an alumina boat and heated to 700 ° c . at the heating rate of 200 ° c ./ hour using a tubular furnace while a mixed gas of 0 . 285 l / minute of nitrogen gas and 0 . 015 l / minute of hydrogen gas was circulated . after being kept as it was for 2 hours , the substance was cooled to room temperature to obtain ultrafine zinc oxide b - u . the average primary particle diameter of the ultrafine zinc oxide b - u was 0 . 027 μm and the volume resistivity value of the ultrafine zinc oxide b - u was 35 , 000 ωcm . ultrafine zinc oxide b - v was obtained in the same manner as comparative example b - 1 , except that 0 . 46 g of aluminum nitrate nonahydrate ( jis extra pure grade ) was replaced with 115 . 2 g of aluminum nitrate nonahydrate ( jis extra pure grade ). the average primary particle diameter of the ultrafine zinc oxide b - v was 0 . 045 μm and the volume resistivity value of the ultrafine zinc oxide b - v was 581 ωcm . ultrafine zinc oxide b - w was obtained in the same manner as comparative example b - 1 , except that 0 . 46 g of aluminum nitrate nonahydrate ( jis extra pure grade ) was replaced with 23 . 0 g of aluminum nitrate nonahydrate ( jis extra pure grade ), and 14 . 2 g ( corresponding to 3 g as sio 2 ) of sodium metasilicate nonahydrate ( extra pure grade ) was replaced with 0 . 95 g ( corresponding to 0 . 2 g as sio 2 ) of sodium metasilicate nonahydrate ( extra pure grade ). the average primary particle diameter of the ultrafine zinc oxide b - w was 0 . 153 μm and the volume resistivity value of the ultrafine zinc oxide b - w was 376 ωcm . ultrafine zinc oxide b - x was obtained in the same manner as comparative example b - 3 , except that 14 . 21 g ( corresponding to 3 g as sio 2 ) of sodium metasilicate nonahydrate ( extra pure grade ) was replaced with 142 . 0 g ( corresponding to 30 g as sio 2 ) of sodium metasilicate nonahydrate ( extra pure grade ). the average primary particle diameter of the ultrafine zinc oxide b - x was 0 . 007 μm and the volume resistivity value of the ultrafine zinc oxide b - x was 1 , 276 ωcm . ultrafine zinc oxide b - y was obtained in the same manner as example b - 5 , except that reducing firing temperature of 700 ° c . was replaced with 500 ° c . the average primary particle diameter of the ultrafine zinc oxide b - y was 0 . 014 μm and the volume resistivity value of the ultrafine zinc oxide b - y was 950 ωcm . ultrafine zinc oxide b - z was obtained in the same manner as example b - 5 , except that reducing firing temperature was set to 1 , 000 ° c . in lieu of 700 ° c . the average primary particle diameter of the ultrafine zinc oxide b - z was 0 . 536 μm and the volume resistivity value of the ultrafine zinc oxide b - z was 30 ωcm . ultrafine zinc oxide ( finex - 50 , manufactured by sakai chemical industry co ., ltd .) was used as ultrafine zinc oxide b - α . the average primary particle diameter of the ultrafine zinc oxide b - α was 0 . 021 μm and the volume resistivity value of the ultrafine zinc oxide b - α was 22 , 870 , 000 ωcm . in 50 ml of pure water , each 0 . 2 g sample of the ultrafine zinc oxide was added . then , hydrochloric acid ( for analysis use ) was further added thereto and mixed the mixture until it became a completely transparent solution . the obtained aqueous solution was transferred to a 100 ml measuring flask , and pure water was added in the flask to adjust the total volume to be 100 ml . the obtained aqueous solution was analyzed by icp emission spectrophotometer ( sps 1700 hvr model , seiko instruments inc ., chiba , japan ). using a previously produced analytical curve , the amount of the element having a valence number of 3 or more and the amount of the metal compound were determined . then the determined amounts of the element or silica were converted by calculation to the amount relative to the amount of zinc oxide . table 3 illustrates the amounts of the element having a valence number of 3 or more represented by mol amount per mol of zno . the amounts of the metal compound are represented by mass % in the prepared substance . evaluation of heat ray shielding ability in the form of thin film the ultrafine zinc oxides obtained in the above - mentioned examples b - 1 to b - 20 and comparative examples b - 1 to b - 7 was tested as follows . each ultrafine zinc oxide - dispersed coating material was obtained by mixing 2 . 36 g of each ultrafine zinc oxide , 5 . 5 g of alkyd resin varnish ( beckosol j - 524 , dainippon ink and chemicals , inc ., tokyo , japan ), 2 . 8 g of melamine resin varnish ( super beckamine j - 820 , dainippon ink and chemicals , inc . ), and 5 . 7 g of xylene ( extra pure grade ) and dispersing them together with 55 g of 0 . 8 mmφ zirconia beads using a paint conditioner over 180 minutes . then , a small amount of the dispersion coating material was sampled on a glass plate and formed into a film using a no . 12 bar coater and successively baked at 130 ° c . over 30 minutes to give each film for evaluation . the optical transmittance of the film for evaluation was measured by uv - vis - nir spectrophotometers ( v - 570 type spectrophotometer and iln 471 type integration apparatus manufactured by jasco corp ., tokyo , japan ). the transmittance values at 550 nm and 1900 nm are illustrated in table 3 . further , the optical transmittance spectrum curves of examples b - 4 and b - 5 which had significant effect of the present invention and comparative examples b - 3 and b - 7 are illustrated in fig1 . the volume resistivity values of ultrafine zinc oxides obtained in examples b - 1 to b - 20 and comparative examples b - 1 to b - 7 were determined by the following method . a cylinder made of vinyl chloride and having an inner diameter of 20 mmφ was loaded with 0 . 8 g of each sample and the sample was sandwiched between conductive cores having a function as electrodes in both sides and a load of 200 kgf was added to the sample by hand press . keeping this state , the resistivity value between both ends of the electrodes was measured by a tester . the volume resistivity value was calculated from the resistivity value according to the following equation : [ volume resistivity value ( ωcm )]=[ resistivity value ( ω )]×[ press surface area ( cm 2 ) of sample ]/[ thickness ( cm ) at the time of pressing ] the ultrafine zinc oxides were observed by a scanning electron microscope ( jsm - 7000 f , jeol ltd ., tokyo , japan ). the transmission electron microscopic photographs of example b - 5 and comparative example b - 3 are illustrated in fig2 and fig3 . each of the ultrafine zinc oxide - dispersed coating materials obtained in the method of evaluation example b - 1 was sampled on a glass plate with a size of 10 cm × 12 cm and a thickness of 3 mm and formed into a film on the entire surface of one face using a no . 14 bar coater and baked at 130 ° c . over 30 minutes to give each evaluation film . a 17 × 21 × 12 . 5 cm ( depth × width × height ) box , which insulates heat radiation to outside or reception from outside was used for evaluation . the center of the top face of the box was cut off in 9 cm square . the evaluation film was set on the cut off part of the top face of the box and an incandescent lamp was turned on at a distance of 12 . 5 cm above the evaluation film . the temperature was measured using a thermocouple set at a distance of 12 . 5 cm under the evaluation film . the schematic drawing of an apparatus is illustrated in fig4 . the relation of time from the turning on of the incandescent lamp and the temperature are illustrated in fig5 . table 3 shows the ultrafine zinc oxides of b - a to b - j obtained in examples b - 1 to b - 10 within the scope of the present invention have excellent properties , such as an average primary particle diameter of 0 . 1 μm or smaller , high visible light transmittance at 550 nm , and significantly low near infrared ray transmittance at 1900 nm , since they contained the elements having a valence number of 3 or more . table 3 further shows that all of the ultrafine zinc oxides of b - a to b - j have a volume resistivity value of 1000 ωcm or lower and accordingly the ultrafine zinc oxides of the present invention also have good conductivity . table 1 shows that the ultrafine zinc oxides of b - k and b - l obtained in examples b - 11 and b - 12 , were , ultrafine zinc oxides having both of good near infrared ray shielding ability and conductivity as the same as the above case , even in the case of altering the content of al , an element having a valence number of 3 or more . table 1 also shows that the ultrafine zinc oxides of b - m to b - p obtained in examples b - 13 to b - 16 were ultrafine zinc oxides having both of good near infrared ray shielding property and conductivity , as the same as the above case , even in the case of using various kinds of sintering - preventing components according to the present invention . table 1 further shows that the ultrafine zinc oxides of b - q and b - r obtained in examples b - 17 and b - 18 were ultrafine zinc oxides having both of good near infrared ray shielding property and conductivity , although the amounts of si , a sintering - preventing component were altered . it was also true for the case of the ultrafine zinc oxides of b - s and b - t obtained in examples b - 19 and b - 20 , although the reducing firing temperatures were changed . on the contrary , the ultrafine zinc oxide b - u obtained in comparative example b - 1 was inferior in infrared ray shielding ability and a high volume resistivity value , although b - u contained al as an element having a valence number of 3 or more . this is because the amount of al was insufficient . the ultrafine zinc oxide b - v obtained in comparative example b - 2 showed decreased optical transmittance at 550 nm and high optical transmittance at 1900 nm . the reason why the properties were insufficient was assumed that the amount of al as an element having a valence number of 3 or more was so high that excess al was deposited in the grain boundaries and visible light was scattered . this resulted in inferior transparency and a low infrared ray shielding property . the ultrafine zinc oxide b - w obtained in comparative example b - 3 showed decreased of transmittance at 550 nm . the reason why the properties were insufficient was assumed that amount of si as a sintering - preventing component is significantly low , and the particles were sintered to each other at the firing temperature applied in the present invention , and thus the particles were coarsened . the ultrafine zinc oxide b - x obtained in comparative example b - 4 showed insufficient infrared ray shielding ability , since the amount of si , as a sintering - preventing component , was large and therefore , the proportion of zinc oxide containing an element having a valence number of 3 or more was lowered . the b - 4 showed a high volume resistivity value , since surplus sintering preventing component si insulated particles each other . the ultrafine zinc oxide b - y obtained in comparative example b - 5 showed a low infrared ray shielding ability since the reducing firing temperature was low , and thus the element having a valence number of 3 or more were not sufficiently diffused in the zinc oxide crystal . the ultrafine zinc oxide b - z obtained in comparative example b - 6 showed a large average primary particle diameter and a significantly low visible light transparency , since the reducing firing temperature was high . therefore , even if the sintering - preventing agent was added , particles were sintered to each other and coarsened . the ultrafine zinc oxide b - α of comparative example b - 7 showed a high volume resistivity value , since it is pure zinc oxide and containing no element having a valence number of 3 or more . thus , b - α has substantially no infrared ray shielding ability . further , fig5 shows the results of temperature measurement with the lapse of time obtained by evaluation example b - 4 . in the case of a binder only and the evaluation film of comparative example b - 7 , the temperature was considerably increased since it has substantially no infrared ray shielding ability . on the contrary , in the case of examples b - 4 and b - 5 , it is apparent that the infrared ray shielding ability of the evaluation films , which were placed between the incandescent lamp as a heat source and the thermocouple , contributed to suppress the temperature increase . an ultrafine zinc oxide obtained by a method of producing the ultrafine zinc oxide of the present invention can be used for coating compositions , thermoplastic resin compositions , ink compositions and the like . a coating composition , thermoplastic resin composition , and ink composition provided by the present invention can be applied as an infrared ray shielding material and a conductive material to a substrate of glass or the like .	2
[ 0017 ] fig6 shows a generalized ink jet printer 20 . the particular printer illustrated in fig6 is a wide format printer suitable for printing on print media 32 greater than about 36 inches in width . those skilled in the art will recognize that the principles described herein are also applicable to others sizes of printers , including both wide format and standard office format printers . the principles described here are applicable to different types of ink jet or direct marking printing technologies , such as thermal ink jet or piezo - electric ink jet . the printer includes a housing 22 , and a user interface 24 . the user interface includes a graphical display 26 and switches or buttons 28 , 30 and other elements for interaction between the printer and the user . a media transport mechanism , such as powered rollers ( not shown ), moves the print medium 32 in a media travel direction 34 . those skilled in the art are familiar with such media transport mechanisms . one or more printheads 41 - 48 ( fig1 and 2 ) are contained in the housing . the printheads travel in a printhead travel direction 36 . the printheads 41 - 48 use ink jetting , such as thermal ink jet or piezo - electric ink jet technology , to eject drops of ink from nozzles 50 in nozzle plates 51 - 58 on the bottom of the printheads ( fig3 and 4 ) as the printheads travel in the printhead travel direction . these ink drops are directed toward a print medium to form dots on the print medium . the dots deposited on the print medium form a swath of an image as the printhead moves across the print medium . after the image swath is printed , the media transport mechanism of the printer advances the media in a media travel direction . the media travel direction is substantially transverse or perpendicular to the printhead travel direction . the media transport mechanism generally advances the print medium approximately the width of the printheads after a swath of the image is printed , so that the printheads can print an adjacent swath of the image . a controller 60 is configured or programmed to control the operations of the printer , including movement of the printhead ( s ), the ejection of ink drops from the printhead ( s ), and the movement of print medium . the printheads 41 - 48 are shown stylistically in fig1 . although plural separate printheads are shown , the principles described herein can be used with a single printhead that includes separate printhead sections . thus , references herein to a set of printheads incorporate a set of printhead sections of a single printhead . the printheads shown are marked with a color representative of the color that particular printhead ejects , for ease of understanding the description . actual printheads need not be so colored . a first set of the printheads 41 - 44 includes one printhead for ejecting each color of the set of colors used by the printer . the first set of printheads is arranged in a first color order in the printhead travel direction . in the illustrated example , the printheads of the first set are arranged , from right to left , black ( k ) printhead 41 , cyan ( c ) printhead 42 , magenta ( m ) printhead 43 , and yellow ( y ) printhead 44 . these printheads of the first set deposit the ink in the first color order ( kcmy ) as the printheads move in a first or forward printhead travel direction 36 a from left to right across the print medium . a second set of the printheads 45 - 48 includes a printhead for ejecting each of the colors of the same set of colors provided by the first set of printheads . the printheads of the second set of printheads are arranged in a color order that is different from the first color order of the first set of printheads 41 - 44 . in particular , the color order of the second set of printheads is opposite the color order of the first set of printheads . thus , if the first set of printheads 41 - 44 is arranged ( right to left ) black , cyan , magenta , and yellow , the second set of printheads 45 - 48 is arranged , from right to left , yellow ( y ) printhead 45 , magenta ( m ) printhead 46 , cyan ( c ) printhead 47 , and black ( k ) printhead 48 . thus , as the printheads move in the forward printhead travel direction 36 a , the printheads 45 - 48 of the second set deposit the ink in the second color order ( ymck ). each printhead 41 - 48 has a plurality of ink ejection nozzles 51 - 58 on a nozzle plate that faces the media . as seen in fig3 and 4 , each printhead has a column of ink ejection nozzles , with the column oriented substantially perpendicular to the printhead travel direction 36 . those skilled in the art will recognize that other arrangements of nozzles can be used . the nozzles 55 - 58 of the printheads 45 - 48 of the second set of printheads are offset in a direction other than the printhead travel direction from the nozzles 51 - 54 of the printheads 41 - 44 of the first set of printheads . in particular , the printhead nozzles of the first set of printheads are offset from the printhead nozzles of the second set of printheads in a direction transverse ( perpendicular ) to the printhead travel direction , which is essentially the same as the media travel direction 34 . in fig1 - 4 , the offset of the printhead nozzles is illustrated as offset of the printheads themselves . fig1 - 4 show the offset in an exaggerated amount to facilitate the understanding of the principles described herein . in the illustrated implementation , the nozzles 51 - 54 of the printheads 41 - 44 of the first set are aligned with one another in the printhead travel direction . in addition , the nozzles 55 - 58 of the printheads 45 - 48 of the second set are aligned with one another in the printhead travel direction . the nozzles 51 - 54 of the printheads of the first printhead set are offset from the nozzles 55 - 58 of the printheads of the second printhead set approximately the distance between adjacent dots formed by the ink drops ejected from the printheads . in the illustrated example , each printhead has a single column of nozzles oriented in the media travel direction ( transverse to the printhead travel direction ), and the printer has two printheads of each color . to print an image with a resolution of 360 dots per inch in the media travel direction , each printhead has 180 nozzles per inch in that media travel direction , so that the spacing in the media travel direction between adjacent nozzles on a single printhead is { fraction ( 1 / 180 )} inch ( 70 . 5 um ). the printheads of the same color from the first and second sets of printheads are offset from one another in the media travel direction by a distance d that is approximately the spacing between dots in the printed image , or { fraction ( 1 / 360 )} inch ( 35 . 2 um ). in this way , the two printheads of a particular color print alternating rows of dots in the printhead travel direction . for example , the nozzles 51 of the black printhead 41 of the first set and the nozzles 58 of the black printhead 48 of the second set are offset from one another in the media travel direction by approximately { fraction ( 1 / 360 )} inch ( 35 . 2 um ). the nozzles 52 of the cyan printhead 42 of the first set are aligned with the nozzles 51 of the first black printhead 41 . the nozzles 57 of the second cyan printhead 47 are aligned with the nozzles 58 of the second black printhead 48 , and offset from the nozzles 52 of the first cyan printhead 42 . as is known to those familiar with the printing arts , the printer deposits drops of the printer ink colors on top of one another in various combinations to produce the desired printed colors . referring now to fig5 the first printheads 41 - 44 deposit a first set of ink drops of the specified set of colors on a set of first points on the print medium as the printheads move in the first , or forward printhead travel direction 36 a . the ink drops deposited on the first points of the print medium form rows of ink dots 61 - 64 are oriented in the printhead travel direction . the second printheads 45 - 48 deposit ink drops of the specified set of colors on a set of second points on the print medium to form rows of ink dots 65 - 68 that are interleaved between the rows of ink dots 61 - 64 deposited by the first set of printheads . alternating rows of dots are deposited by the printheads of the first and second sets of printheads , respectively . the deposited ink dots 61 - 68 shown in fig5 are highly exaggerated to illustrate the principles involved . in addition , the dots are shown with their component individual colors , although in practice , the colors would merge to form the finished color . the printheads 41 - 44 of the first set deposit ink drops in the first color order ( black 61 , cyan 62 , magenta 63 , yellow 64 ) on the first points as the printheads move in the forward printhead travel direction 36 a ( toward the right in fig1 - 5 ). as the printheads move in the forward direction , the printheads 45 - 48 of the second set of printheads deposit ink drops on a set of second points in the second color order ( yellow 65 , magenta 66 , cyan 67 , black 68 ). in the illustrated example , this second color order is the reverse of the first color order . to the extent that color differentiation or hue variation arises based on the order in which the colors of the set of colors are deposited on the print medium , such hue variation is between adjacent rows of ink dots on the print medium . for example , with 360 dots per inch , the centers of each dot 61 - 64 and 65 - 68 is approximately { fraction ( 1 / 360 )} inch ( 35 . 2 um ) in diameter . the rows of ink dots are so closely spaced , and sufficiently fine that such hue variation between adjacent rows is invisible to the human eye . thus , the colors printed in this forward image swath appear uniform to the human eye . after the printhead has traversed the width of the print medium and deposited a swath of the image to be printed , the media transport mechanism moves the print medium 32 in the media travel direction 34 . the media transport mechanism generally moves the medium by a distance approximately equal to the dimension of the printheads in the media travel direction ( which may be considered the length of the printheads ). the printheads then move in the reverse printhead travel direction 36 b ( right to left in fig1 - 5 ). as the printheads move in the reverse printhead travel direction , they deposit ink drops of the specified set of colors on other sets of points in the print medium . as the printheads move in the reverse printhead travel direction 36 b , the second set of printheads 45 - 48 deposit ink drops on the print medium in the same color order as the first set of printheads 41 - 45 did in the forward printhead travel direction 36 a as the printheads move in the reverse printhead travel direction 36 b , on a particular point , the black printhead 48 of the second set deposits a black drop 78 first , followed by the cyan printhead 47 of the second set depositing a cyan drop 77 . then the second magenta printhead 46 deposits a magenta drop 76 , and finally the second yellow printhead 45 deposits a yellow drop 75 . thus , the printheads 45 - 48 of the second set of printheads deposit ink drops on a set of third points on the print medium in the first color order ( kcmy ). the printheads of the first set of printheads ( moving in the reverse printhead travel direction 36 b ) deposit ink drops on a set of fourth points in the second color order ( ymck ). the first yellow printhead 44 deposits a yellow drop 74 , followed by the first magenta printhead 43 depositing a magenta drop 73 . then , the first cyan printhead 42 deposits a cyan drop 72 , and the first black printhead 41 deposits a black drop 71 . again , hue variations between the dots 75 - 78 formed by the printheads of the second set , and the dots 71 - 74 formed by the printheads of the first set as the printhead moves in the reverse printhead travel direction are generally not visible to the human eye . the printheads can be arranged and operated so that nozzles of the first set of printheads 41 - 44 deposit the ink drops forming the “ last ” row of dots 69 in the forward image swath and the ink drops forming the “ first ” row of dots 70 in the reverse image swath . as seen in fig5 such an arrangement continues the alternating color order in which the dots are “ built .” thus , any resulting hue variation is no more than one dot in width , too small to be generally visible . however , benefit is still achieved if the second set of printheads 45 - 48 deposits the “ first ” row of dots of the reverse image swath . such an arrangement would yield two adjacent rows of dots deposited in the same color order , any color hue variation between such rows is still sufficiently small that it would generally not be visible to the human viewer . [ 0030 ] fig7 shows an implementation of the present invention having printheads in which printheads of a first set of printheads 141 - 144 are aligned to produce one set of rows of dots . the printheads 141 - 144 of the first set are grouped together . printheads of a second set of printheads 145 - 148 are aligned to fill in the intervening rows of dots between the rows of dots produced by the printheads 141 - 144 of the first set . the nozzles of the printheads 145 - 148 of the second set are offset from the nozzles of the printheads 141 - 144 of the first set in the media travel direction by an amount approximately equal to the distance between adjacent dots formed by the printheads . the nozzle offset can be provided by offsetting the printheads themselves . although a one dot offset is advantageous , essentially any number of odd numbers of dots offset can be used , with appropriate stitching of the images from the different swaths of the printhead as it moves across the medium . the offset is determined by the size of the dot formed by each ink drop as it is deposited on the print medium . referring to a printhead construction of a current design as shown in fig8 two or more printheads of each color are positioned adjacent one another in the printhead travel direction , and offset from one another in the media travel direction . two black printheads 81 , 82 are offset from one another in the media travel direction 34 by a distance approximately equal to the spacing of an odd number of resulting printed dots . generally , the offset distance is approximately equal to the spacing of adjacent dots . similarly , the two cyan printheads 83 , 84 are offset from one another . one of the cyan printheads 83 is aligned with one of the black printheads 81 , and the other cyan printhead 84 is aligned with the other of the black printheads 82 . the two magenta printheads 85 , 86 are offset from one another and aligned with corresponding ones of the cyan and black printheads . the two yellow printheads 87 , 88 are also offset from one another and aligned with the corresponding ones of the magenta , cyan , and black printheads . the printheads of fig8 deposit ink drops to form ink dots on the print medium as shown in fig9 . all of the dots forming a swath of the image are deposited in the same color order . as seen in fig9 the dots formed as the printhead moves in a forward printhead travel direction 36 a ( left to right across the print medium ) are formed with the black dot 91 , 92 first , the cyan dot 93 , 94 next , then the magenta dots 95 , 96 , and finally the yellow dots 97 , 98 . these first dots form a forward swath of the printed image . as the printhead moves in the reverse printhead travel direction 36 b ( after the media has been moved ), the dots forming the reverse swath of the image are all formed by first depositing yellow dots 107 - 108 , then magenta dots 105 , 106 , then cyan dot 103 , 104 , and finally black dots 101 , 102 . all of the dots 101 - 108 on that reverse swath of the image are formed with the ink being deposited in the same order . for colors in which the hue differs depending on the order in which the ink colors are deposited , the portion of the image formed of the dots in the forward swath may differ slightly from the portion of the image formed by the dots in the reverse swath . because the entire swath of the image has the same hue , variation between the hue of the forward swath and the hue of the reverse swath is likely to be visible to the human eye . with the preceding teaching , those skilled in the art will be able to identify various modifications to the specific implementations described that do not depart from the invention . for example , different configurations or orders of printheads , as well as different combinations of individual and multiple printheads can be formed . in addition , different types of ink ejection technology , including thermal ink jet and piezoelectric ink jet , as well as others can be used . therefore , the present invention is not limited to the specific implementations described above .	1
referring now to the figures of the drawings in detail and first , particularly , to fig1 thereof , there is seen a printing press 1 having a lithographic printing unit 2 and a delivery 3 for sheets 4 made of printing material . the printing unit 2 includes , for offset printing , a printing form cylinder 5 , a blanket cylinder 6 and an impression cylinder 7 . the delivery 3 has a sheet transport device 77 having a first chain conveyor 8 and a second chain conveyor 9 which transport the sheets 4 to a delivery stack 10 and rotate synchronously with one another in the process . the first chain conveyor 8 includes front gripper bars 11 for holding the sheets 4 at their respective leading sheet end 4 . 1 or edge ( front edge ), and the second chain conveyor 9 includes rear gripper bars 12 for holding the sheets 4 at their respective trailing sheet end 4 . 2 or edge ( rear edge ). the gripper bars 11 , 12 act as holding devices for holding the sheets 4 at both ends . with reference to fig2 , it is seen that the first chain conveyor 8 includes a pair of endless chains 90 which carry the front gripper bars 11 between them , and the second chain conveyor 9 includes another pair of endless chains 140 which carry the rear gripper bars 12 between them . each sheet 4 is therefore held fixedly , during its transport which takes place in a running direction 13 , through the use of a front gripper bar 11 and at the same time through the use of a rear gripper bar 12 . a powdering apparatus seen in fig1 has a nozzle bar 14 which is disposed within circulating paths of the chain conveyors 8 , 9 . the nozzle bar 14 is disposed at a spacing a relative to the sheet transport path and substantially also with respect to the printed sheet 4 which sags a little between the gripper bars 11 , 12 . the spacing a is at least 80 mm and at most 300 mm . the spacing preferably lies in a range of from 100 mm to 200 mm . as is shown in fig2 , the first chain conveyor 8 has one gearwheel or chain sprocket 80 on each of a drive side and an operating side and the respective endless chain 90 which circulates around the latter . the endless chains 90 of the first chain conveyor 8 carry the gripper bars 11 which lead between them in the running direction 13 , in order to hold the leading sheet ends 4 . 1 of the sheets 4 . the second chain conveyor 9 likewise includes a chain sprocket 130 on each of the two machine sides and the respective endless chain 140 which circulates around the latter . the endless chains 140 of the second chain conveyor 9 carry the trailing gripper bars 12 between them , in order to hold the sheet ends 4 . 2 which trail in the running direction 13 . each one of the leading gripper bars 11 , together with a respective one of the trailing gripper bars 12 , forms a gripper bar pair which holds the respective sheet 4 fixedly at both ends during its transport which takes place toward the delivery stack 10 . as a result of a phase adjustment of one chain conveyor 8 relative to the other chain conveyor 9 , the format of a gripper bar spacing between the rear gripper bar 12 and the front gripper bar 11 of each gripper bar pair can be set as a function of the sheet length of the respective print job . a sheet support 180 which lies toward the drive side and a sheet support 190 which lies toward the operating side , are structurally identical with one another and serve to press the respective sheet 4 against the circumferential surface of the impression cylinder 7 . the sheet supports 180 , 190 are constituent parts of a delivery drum 430 of the delivery 3 . the delivery drum 430 is configured in a skeleton construction , and can be adjusted along its geometrical rotational axis 200 , which is also the rotational axis of the chain sprockets 80 , 130 , in an infinitely variable manner . therefore , the delivery drum 430 can be adjusted from a format setting ( shown with a solid line in fig2 ) for a maximum sheet width of the sheets 4 to a format setting ( indicated with a phantom line in fig2 ) for a minimum sheet width , as well as into intermediate positions which lie between these two extreme positions for medium sheet widths . in each format setting , the drive - side sheet support 180 is aligned with one printfree side edge and the operating - side sheet support 190 is aligned with another printfree side edge , of the respective sheet 4 . the sheet supports 180 , 190 are mounted in such a way that they can be displaced axially by motor , between those chain sprockets of the chain conveyors 8 , 9 which are disposed on the drive side and those chain sprockets which are disposed on the operating side . the drive ( motor , gear mechanism ) which is required for the axial displacement of the sheet supports 180 , 190 that can take place optionally toward one another or away from one another , is not shown in fig2 for reasons of improved clarity . fig3 shows the nozzle bar 14 which extends substantially over the entire width of the printed sheet 4 . the nozzle bar 14 includes nozzles 78 which are disposed in a row . in the simplest case , the nozzle bar 14 could be a tube , in the wall of which the nozzles 78 are formed as bores . in the case which is more relevant in practice , the nozzle bar 14 includes a holding crossmember , to which the nozzles 78 are fastened as nozzle heads . in the example which is shown in the drawing , an effective length l of the nozzle bar 14 is precisely 1 meter . each nozzle 78 ejects an air flow in the form of a powder air flow 79 , which guides the powder in the direction of the printed sheet 4 . the outlet velocity of the air flow from the nozzle 78 is approximately 170 meters per second . the powder air flows 79 exert forces on the printed sheet 4 when they impinge on it . the force which results from these forces is denoted by the designation f and is 4 . 0 newtons . the force f is a specific force which is related to a length unit ( 1 meter ) of the nozzle bar 14 .	1
referring now in detail to the drawings for the purpose of illustration and the preferred embodiments of the present invention , the slowly releasing composition of bioactive polypeptides as shown in fig1 to 14 , comprises at least one bioactive polypeptide , at least one tocopherol compound , and a lecithin . the tocopherol compound is selected from the group consisting of the bioactive polypeptide according to the present invention includes all the known bioactive polypeptides , for examples , growth hormones , insulin , interferon , interleukin ii , tumor necrosis factor , colony stimulating factor and derivatives thereof . of the bioactive polypeptides , somatotropin is very suitable for the present invention due to its short half - life thereof in vivo . examples for somatotropins include animal somatotropins such as bovine somatotropin , porcine somatotropin , goat or sheep somatotropin , salmon growth hormone , eel growth hormone and human growth hormone . the somatotropin can be obtained from a pituitary gland of animal . alternatively , the somatotropin may be obtained by recombinant dna - technology . the polypeptide may be used in the form bound or unbound to metal in the present invention . however , the bound form is not necessary , because the composition has the sufficient durability although the polypeptide is not bound with metal or any materials conventionally used for decreasing the solubility of the polypeptide in an aqueous solution in this field . tocopheryl acetate , tocopherol , and derivatives thereof used in the composition of the present invention have pharmacological activities as well as its function in delaying the release of the polypeptides . for examples , tocopherol compound helps the normal reproduction in a rat , a mouse , a guinea pig , a pig , or fowls , prevent the defects of muscle development in a young sheep , a calf or a dog , prevent softening of brain , irregulation of muscle movement , hardening of muscle , underexercise and tetanus in a chicken , and prevent steatitis in a mink , a pig , or a cat . the composition of the present invention contains an assistant release delaying agent as well as tocopherol compound for the purpose of more excellent durability . various assistant delaying agents are known . particularly , choline derivatives , aluminum monostearate , calcium stearate , wax , carnauba wax , and paraffine are preferable to other known assistant delaying agents . as an assistant delaying agent of the present invention , one or more compounds selected from a group consisting of compounds listed above are used . especially , choline derivatives are preferred . examples of choline derivatives include phosphatidyl choline , lysophospholipid , plasmalogen , sphingomyelin etc . phosphatidyl choline can be extracted from soybean , bovine liver , bovine heart or egg yolk . the amount of the bioactive polypeptides used in the composition is wide . the lower limit is a minimum amount of polypeptide required to exert its effect in the body . the upper limit is a maximum amount of polypeptide capable of being contained in the tocopherol component used . without any special purpose , it is not necessary to use the polypeptide in an excess amount . when the total of the tocopherol component and the assistant delaying agent is 100 % by weight , the assistant delaying agent is conventionally 2 to 10 % by weight , preferably 2 to 7 % by weight , more preferably 2 to 5 % by weight , and the tocopherol component is the rest . the composition of the present invention may be prepared by mixing at least one tocopherol component and an assistant delaying agent and then combining at least one bioactive polypeptide thereto . alternative method comprises dispersing at least one bioactive polypeptide in an assistant delaying agent and then combining the dispersion with tocopherol component . the tocopherol component and an assistant delaying agent are added to a beaker . the beaker is placed in an oil bath at a temperature between about 130 ° c . and 160 ° c ., preferably 140 ° c . and 150 ° c , for about 10 to 40 minutes , preferably 20 to 30 minutes . in prior arts , the polypeptide must be used in the form bound to metal or transition metal to decrease the solubility and it is used in an excess amount to make up for the loss resulted from the initial burst effect . but , the composition of the present invention has an excellent durability without any binding of the polypeptide to the metal . the present invention has no problems such as side - effects occurred from metal bound to the polypeptide . the tocopherol component used in the present invention has a pharmacological functions such as the preventation or alleviation of the sensitive response against foreign materials in vivo . furthermore , according to the present invention , the initial releasing of the effective component is reasonable and the bioavailability is increased . both of the preparation and the administration of the composition become simple and convenient . the present invention will now be described in more detail in connection with the following examples which should be considered as being exemplary and not limiting the present invention . 500 ml of bovine somatotropin ( 18 mg / ml produced by lucky ltd .) and 3 g of l - α - phosphatidyl choline ( l - α - lecithin ) extracted from soybeans were mixed in a homomixer for 10 minutes and operated in a microfluidizer at 40 ° c . for 5 minutes . this emulsion was put into a bottle , rapidly cooled to - 70 ° c . using dry ice and acetone and then lyophilized . the lyophilized mixture was ground and 161 . 8 mg ( bovine somatotropin content 100 mg ) was suspended in 1 ml of tocopheryl acetate . the mixture was homogenized in a homomixer for 5 minutes . thus obtained somatotropin compositions were injected to animals and tested for the effect on the body weight . the test was carried out using female sd rats weighing about 80 to 100 g . the rats were subjected to a peripharyngeal method to eliminate their pituitaries . after 2 weeks , their body weights were measured at regular time everyday for 1 week . the rats whose body weights were not changed were selected , and subjected to as follows ; bovine somatotropin compositions were injected to three hypophysectomized rats subcutaneously into their abdominal region by an amount of 0 . 1 ml per head . as a control group , only tocopheryl acetate was injected . their body weights were measured at regular time everyday , the increase rate of the body weight to one before injection was calculated . the results are shown in table 1 and fig1 . the composition was prepared according to the same procedure as in example 1 , except that l - α - phosphatidyl choline was not passed through a microfluidizer . the compositions were tested by the same method as example 1 and the results are shown in table i and fig1 . table 1______________________________________the rate of body weight affected from the injectionof the bovine somatotropin compositions , % day example 1 example 2 control______________________________________1 8 . 1 7 . 5 - 0 . 22 18 . 4 13 . 5 - 0 . 83 21 . 4 19 . 8 - 1 . 24 28 . 2 24 . 2 - 1 . 05 30 . 3 28 . 6 0 . 06 31 . 5 29 . 5 - 1 . 67 33 . 4 32 . 6 - 0 . 48 35 . 8 34 . 9 - 0 . 59 38 . 0 35 . 1 - 1 . 210 38 . 0 37 . 3 - 1 . 511 41 . 9 40 . 3 - 1 . 212 43 . 6 39 . 1 - 0 . 513 44 . 3 40 . 8 - 1 . 314 47 . 2 40 . 7 - 1 . 215 47 . 2 40 . 5 - 0 . 3______________________________________ the composition was prepared according to the same procedure as in example 1 , except that 200 ml of porcine somatotropin ( 24 mg / ml ) and 1 . 58 g of l - α - phosphatidyl choline were used . thus obtained compositions were tested by the same method as example 1 and the results are shown in table 2 and fig2 . the composition was prepared according to the same procedure as example 3 , except that 0 . 5 ml of tocopherol acetate and 0 . 5 ml of sesame oil were used . the compositions were tested by the same method as example 1 and the results are shown in table 2 and fig2 . the composition was prepared according to the same procedure as example 4 , except that peanut oil instead of sesame oil was used . the compositions were tested by the same method as example 1 and the results are shown in table 2 and fig2 . table 2______________________________________the increase rate of body weight affected from the injectionof the porcine somatotropin compositions , % day example 3 example 4 example 5 control______________________________________ 1 6 . 6 4 . 6 8 . 1 - 0 . 2 2 13 . 6 2 . 5 13 . 4 - 0 . 8 3 19 . 7 15 . 0 12 . 4 - 1 . 2 4 22 . 6 14 . 3 13 . 9 - 1 . 0 5 25 . 5 14 . 9 15 . 4 0 . 0 6 29 . 0 15 . 7 16 . 4 - 1 . 6 7 31 . 8 16 . 1 18 . 9 - 0 . 4 8 33 . 5 16 . 3 18 . 7 - 0 . 5 9 36 . 3 17 . 5 21 . 1 - 1 . 210 35 . 2 17 . 02 3 . 0 - 1 . 511 37 . 6 19 . 2 25 . 2 - 1 . 212 41 . 1 19 . 9 26 . 4 - 0 . 513 43 . 7 21 . 2 27 . 5 - 1 . 314 43 . 5 18 . 5 28 . 2 1 . 215 47 . 7 20 . 4 30 . 2 0 . 316 48 . 3 20 . 0 31 . 4 0 . 017 50 . 3 20 . 5 32 . 6 - 1 . 218 50 . 9 22 . 6 32 . 4 - 0 . 119 51 . 8 22 . 6 33 . 0 - 0 . 420 53 . 0 22 . 7 34 . 0 0 . 0______________________________________ the composition was prepared according to the same procedure as example 1 , except that 1 ml of tocopheryl acetate and 33 mg of l - α - phosphatidyl choline were mixed in a homomixer and hereto the 100 mg of lyophilized porcine somatotropin was added . the compositions were tested by the same method as example 1 and the results are shown in table 3 and fig3 . the composition was prepared according to the same procedure as example 3 , except that 2 ml of tocopheryl acetate was used . the compositions were tested by the same method as example 1 and the results are shown in table 3 and fig3 . the composition was prepared according to the same procedure as example 3 , except that peanut oil instead of tocopheryl acetate was used . the compositions were tested by the same method as example 1 and the results are shown in table 3 and fig3 . table 3______________________________________the increase rate of body weight affected from the injectionof the porcine somatotropin compositions , % day example 6 example 7 example 8 control______________________________________1 6 . 2 8 . 0 4 . 7 - 0 . 22 14 . 1 14 . 8 10 . 1 - 0 . 83 19 . 7 20 . 7 10 . 0 - 1 . 24 23 . 4 22 . 1 10 . 4 - 1 . 05 23 . 3 23 . 3 11 . 1 0 . 06 23 . 4 24 . 9 11 . 9 - 1 . 67 23 . 1 26 . 2 12 . 9 - 0 . 48 26 . 3 24 . 3 6 . 9 - 0 . 59 26 . 6 28 . 3 10 . 8 - 1 . 210 25 . 9 31 . 5 9 . 9 - 1 . 511 26 . 7 32 . 3 9 . 6 - 1 . 212 27 . 2 33 . 5 11 . 8 - 0 . 513 28 . 7 35 . 2 12 . 5 - 1 . 314 30 . 5 37 . 1 13 . 7 - 1 . 215 30 . 4 35 . 6 12 . 1 - 0 . 3______________________________________ the composition was prepared according to the same procedure as example 1 , except that 400 ml of bovine somatotropin ( 23 mg / ml ) and 3 . 102 g of l - α - phosphatidyl choline were mixed . 13 . 3 mg of lyophilized mixture bovine somatotropin content 10 mg was added to 1 ml of tocopherol acetate . the compositions were tested by the same method as example 1 and the results are shown in table 4 and fig4 . the composition was prepared according to the same procedure as example 9 , except that 66 . 5 mg of lyophilized mixture ( bovine somatotropin content 50 mg ) was added to 1 ml of tocopheryl acetate . the compositions were tested by the same method as example 1 and the results are shown in table 4 and fig4 . the composition was prepared according to the same procedure as example 1 , except that 100 mg of lyophilized bovine somatotropin without l - α - phosphatidyl choline was mixed with 1 ml of tocopheryl acetate . the compositions were tested by the same method as example 1 and the results are shown in table 4 and fig4 . example 1 , except that 1 ml of tocopherol acetate and 20 mg of aluminum monostearate were heated to 150 ° c . for 5 minutes and then cooled to room temperature 100 mg of bovine somatotropin without l - α - phosphatidyl choline was suspended in this mixture . the compositions were tested by the same method as example 1 and the results are shown in table 4 and fig4 . the composition was prepared according to the same procedure as example 12 , except that bovine somatotropin bound to zn was used . the compositions were tested by the same method as example 1 and the results are shown in table 4 and fig4 . table 4______________________________________the increase rate of body weight affected from the injectionof the bovine somatotropin composition , % example example example example example con - day 9 10 11 12 13 trol______________________________________1 8 . 7 8 . 8 7 . 3 7 . 9 5 . 5 - 0 . 22 12 . 2 13 . 9 8 . 8 15 . 5 9 . 9 - 0 . 83 13 . 9 16 . 1 9 . 6 22 . 4 12 . 4 - 1 . 24 15 . 2 20 . 9 8 . 9 24 . 0 15 . 5 - 1 . 05 16 . 3 24 . 2 10 . 5 28 . 0 17 . 2 0 . 06 17 . 2 27 . 8 10 . 8 30 . 0 19 . 0 - 1 . 67 16 . 9 25 . 5 12 . 6 31 . 7 22 . 5 - 0 . 48 18 . 1 29 . 0 14 . 1 31 . 3 22 . 8 - 0 . 59 18 . 9 30 . 6 14 . 1 32 . 2 23 . 8 - 1 . 210 17 . 1 30 . 2 14 . 8 34 . 1 25 . 9 - 1 . 511 19 . 2 33 . 5 17 . 2 36 . 1 29 . 3 - 1 . 212 19 . 6 34 . 4 16 . 4 36 . 7 28 . 2 - 0 . 513 20 . 2 35 . 2 18 . 2 43 . 6 29 . 4 - 1 . 314 20 . 4 32 . 9 19 . 2 46 . 5 31 . 3 - 1 . 215 21 . 9 36 . 1 18 . 1 45 . 4 29 . 1 - 0 . 3______________________________________ the composition was prepared according to the same procedure as example 1 , except that 1 ml of tocopheryl acetate and 20 mg of polyethylene glycol - 75 lanolin ( peg - 75 lanolin or solan e ) were mixed in a homomixer and hereto 100 mg of bovine somatotropin bound to zn was added . the compositions were tested by the same method as in example 1 and the results are shown in table 5 and fig5 . the composition was prepared according to the same procedure as example 14 , except that 1 ml of tocopherol acetate and 33 mg of arlacel 165 ( a complex of glyceryl monastearate and peg - 100 stearate ) instead of peg - 75 lanolin was used . the compositions were tested by the same method as example 1 and the results are shown in table 5 and fig5 . the composition was prepared according to the same procedure as example 12 , except that the spray - dried bovine somatotropin instead of the lyophilized bovine somatotropin was used . the compositions were tested by the same method as example 1 and the results are shown in table 5 and fig5 . the composition was prepared according to the same procedure as example 12 , except that 10 mg of aluminum monostearate and 10 mg of cholesterol were used . the compositions were tested by the same method as example 1 and the results are shown in table 5 and fig5 . table 5______________________________________the increase rate of body weight affected from the injectionof the bovine somatotropin compositions , % con - day example 14 example 15 example 16 example 17 trol______________________________________1 6 . 9 4 . 1 8 . 5 6 . 7 - 0 . 22 10 . 9 10 . 3 11 . 7 9 . 9 - 0 . 83 13 . 7 13 . 3 16 . 1 10 . 2 - 1 . 24 16 . 7 16 . 6 16 . 1 11 . 0 - 1 . 05 17 . 2 18 . 1 16 . 3 12 . 5 0 . 06 19 . 2 19 . 6 16 . 9 11 . 8 - 1 . 67 21 . 6 20 . 3 18 . 7 12 . 5 - 0 . 48 23 . 4 19 . 1 20 . 0 12 . 5 - 0 . 59 22 . 6 20 . 4 19 . 6 12 . 3 - 1 . 210 22 . 8 20 . 5 21 . 2 13 . 2 - 1 . 511 23 . 9 20 . 6 21 . 0 12 . 4 - 1 . 212 23 . 1 21 . 6 20 . 6 15 . 1 - 0 . 513 23 . 9 21 . 5 19 . 9 11 . 9 - 1 . 314 24 . 6 21 . 6 22 . 0 14 . 1 - 1 . 215 24 . 0 19 . 8 21 . 9 11 . 3 - 0 . 3______________________________________ the composition was prepared according to the same procedure as example 12 , except that zn - bound bovine somatotropin was used . the compositions were tested by the same method as example 1 and the results are shown in table 6 and fig6 . the composition was prepared according to the same procedure as example 12 , except that zn - bound porcine somatotropin instead of bovine somatotropin was used . the compositions were tested by the same method as example 1 and the results are shown in table 6 and fig6 . table 6______________________________________the increase rate of body weight affected from the injectionof the bovine somatotropin compositions , % day example 18 example 19 control______________________________________1 8 . 0 5 . 9 - 0 . 22 13 . 6 10 . 4 - 0 . 83 17 . 9 12 . 3 - 1 . 24 14 . 8 14 . 4 - 1 . 05 13 . 5 14 . 7 0 . 06 17 . 3 14 . 1 - 1 . 67 21 . 0 14 . 6 - 0 . 48 22 . 8 17 . 3 - 0 . 59 16 . 7 16 . 9 - 1 . 210 24 . 6 14 . 3 - 1 . 511 26 . 4 17 . 6 - 1 . 212 28 . 2 17 . 1 - 0 . 513 27 . 9 18 . 4 - 1 . 314 30 . 3 15 . 3 - 1 . 215 30 . 5 17 . 5 - 0 . 3______________________________________ 30 ml of tocopherol acetate and 600 mg of aluminum monostearate were put into a 50 ml - beaker . separately , a beaker containing 150 ml of tocopheryl acetate was heated at 150 ° c . on a temperature - controlled hot plate stirrer . the content of the former beaker was added to the latter and the mixture was heated in an oil bath with stirring bar for 20 minutes to dissolve aluminum monostearate . the mixture was removed from the bath , kept under vacuum and allowed to cool to 25 ° c . on cooling , the solution converted to a thick gel . 3 g of bovine somatotropin produced by lucky ltd . was added to the gel and heated to 40 ° c . after stirring for 2 hours , 10 ml of composition was filled in a 20 ml - syringe having a 15 gauge needle . the compositions were injected into two holstein cows in the second trimester of their second lactation . the compositions were injected subcutaneously in the suprascapular region . two cows were used as a control group without any injection . the daily milk production was accumulated . the increase ratio of the increase rate in an injected group to one in a control group was calculated as following ; ## equ1 ## table 7______________________________________cumulative average daily milk production , kg / dayday injected group control group increase ratio (%) ______________________________________ - 5 - 0 24 . 5 27 . 9 - --- 7 27 . 6 27 . 5 14 . 3 - 14 27 . 8 27 . 7 13 . 9 - 21 27 . 3 27 . 8 11 . 7 - 30 26 . 6 27 . 8 8 . 7______________________________________ blood samples were analyzed for bovine somatotropin . representative analyses by radioimmunoassay are shown in table 8 and fig8 where the concentrations of bovine somatotropin in blood serum are expressed in nanograms per milliliter . table 8______________________________________the average concentration of bovine somatotropinin serum , ng / mlday injected group control group______________________________________ - 2 9 . 2 16 . 90 187 . 7 48 . 21 75 . 1 22 . 73 61 . 3 13 . 35 58 . 4 41 . 37 60 . 0 31 . 39 69 . 3 28 . 611 54 . 9 21 . 113 33 . 4 11 . 315 24 . 9 16 . 017 24 . 4 13 . 319 43 . 5 28 . 921 55 . 7 29 . 323 54 . 2 22 . 230 54 . 2 23 . 7______________________________________ milk samples were analyzed for bovine somatotropin . representative analyses by radioimmunoassay are shown in table 9 and fig9 . table 9______________________________________the average concentration of bovinesomatotropin in milk , ng / mlday injected group control group______________________________________ 5 0 . 3310 0 . 320412 0 . 3184 0 . 353720 0 . 3557 0 . 267728 0 . 3237 0 . 381235 0 . 3098 0 . 3043______________________________________ the composition was prepared and tested according to the same procedure as example 20 , except that 5 ml of composition was injected . the increase ratio and the concentration of bovine somatotropin in serum and milk are shown in table 10 , 11 , 12 and fig1 , 11 , 12 . table 10______________________________________cumulative average daily milk production , kg / dayday injected group control group increase ratio (%) ______________________________________ - 5 - 0 25 . 7 25 . 7 --- 7 27 . 5 24 . 4 12 . 2 - 14 27 . 9 25 . 0 11 . 4 - 21 27 . 1 24 . 9 8 . 5 - 28 26 . 6 24 . 5 8 . 9______________________________________ table 11______________________________________the average concentration of bovinesomatotropin in serum , ng / mlday injected group control group______________________________________ - 1 15 . 0 10 . 11 79 . 5 17 . 05 38 . 4 12 . 38 40 . 3 9 . 212 24 . 9 14 . 215 18 . 7 13 . 319 14 . 5 8 . 422 20 . 4 11 . 227 17 . 9 15 . 529 21 . 2 14 . 2______________________________________ table 12______________________________________the average concentration of bovinesomatotropin in milk , ng / mlday injected group control group______________________________________ 6 0 . 3296 0 . 304316 0 . 3450 0 . 393121 0 . 3700 0 . 413828 0 . 3819 0 . 3483______________________________________ test was carried out using 3 holstein cows in the middle period of the lactation . 7 . 5 ml of bovine somatotropin compositions including l - α - phosphatidyl choline was injected to them . as a control group , only tocopherol acetate was injected to other 3 holstein cows . for comparison , the daily milk production was measured for 2 weeks before injecting the compositions . the compositions were injected subcutaneously in the suprascapular region . after the injection , the milk production was measured everyday and the data are shown in table 13 and fig1 . table 13______________________________________the daily milk production before and afterthe injection , kg / dayday injected group control group______________________________________ - 14 16 . 6 14 . 9 - 13 15 . 8 14 . 9 - 12 14 . 9 11 . 6 - 11 16 . 6 15 . 3 - 10 15 . 8 13 . 5 - 9 15 . 1 12 . 8 - 8 14 . 1 12 . 1 - 7 14 . 9 13 . 1 - 6 15 . 1 14 . 1 - 5 14 . 8 13 . 7 - 4 14 . 6 13 . 5 - 3 14 . 7 13 . 5 - 2 15 . 1 13 . 6 - 1 13 . 0 13 . 20 15 . 8 12 . 91 18 . 3 13 . 42 18 . 4 14 . 13 17 . 5 14 . 34 19 . 0 13 . 45 20 . 2 14 . 46 19 . 7 14 . 57 18 . 1 13 . 58 19 . 8 14 . 19 17 . 5 14 . 210 19 . 2 15 . 411 19 . 0 16 . 012 20 . 0 17 . 013 18 . 8 15 . 514 17 . 8 15 . 615 17 . 2 15 . 516 18 . 3 16 . 817 17 . 9 16 . 918 16 . 8 14 . 419 17 . 5 16 . 420 16 . 5 14 . 821 15 . 6 15 . 122 16 . 0 15 . 523 16 . 9 15 . 324 16 . 7 15 . 725 17 . 3 16 . 026 16 . 5 15 . 827 15 . 1 15 . 128 17 . 3 16 . 6______________________________________ before the injection and the 3rd , 7th , 14th , 21st and 28th days after the injection , the blood sample was collected . blood samples were analyzed for bovine somatotropin by radioimmunoassay . the resukts are shown in table 14 and fig1 . table 14______________________________________the bovine somatotropin concentration in serum , ng / mlday injected group control group______________________________________0 15 . 175 15 . 0953 35 . 699 15 . 1957 21 . 678 15 . 5011 415 . 123 14 . 5162 113 . 851 14 . 4602 814 . 483 12 . 393______________________________________ test was carried out using 15 castrated hogs weighing about 60kg . the porcine somatotropin compositions including l - α - phosphatidyl choline were injected by an amount of 1 . 2 ml per head to 5 hogs , and by an amount of 1 . 8 ml per head to other 5 hogs . the other 5 hogs were used as control group without any injection . before the injection and everyweek after the injection , their body weights were measured at regular time . the average daily gain ( adg , kg / day ) was calculated . the feed efficiency ( fe ) was calculated as follows ; ## equ2 ## the back fat thickness ( ft ) was measured and the decrease ratio of ft was calculated . the results are shown in table 15 . table 15______________________________________average daily weight gain and feed efficiencyfrom the injection of porcine somatotropin control injected injected group group 1 group 2______________________________________1st week : adg 1 . 00 0 . 97 1 . 03fe 3 . 05 3 . 26 2 . 752nd week : adg 0 . 96 0 . 77 0 . 87fe 3 . 36 4 . 48 4 . 163rd week : adg 1 . 07 0 . 98 1 . 00fe 3 . 14 2 . 95 3 . 454th week : adg 0 . 90 1 . 05 1 . 09fe 4 . 35 3 . 57 3 . 135th week : adg 0 . 84 0 . 81 1 . 04fe 5 . 05 4 . 37 3 . 656th week : adg 1 . 09 1 . 14 1 . 08fe 4 . 91 4 . 04 4 . 301st - 6th weeks : adg 0 . 98 0 . 96 1 . 02fe 3 . 65 3 . 50 3 . 46increase rate -- 4 . 1 5 . 2 % of fe (%) 1st - 6th weeks : decrease rate -- 6 % 9 % of ft (%) ______________________________________ the porcine somatotropin compositions prepared as in example 19 were injected by an amount of 0 . 9 ml per head every three weeks to 5 hogs , by an amount of 1 . 8 ml per head every three weeks to other 5 hogs [ injected group 2 ], and by an amount of 6 mg per head everyday to other 5 hogs ( daily injected group ). the other 5 hogs were used as control group without any injection . their body weights were measured every 2 weeks . adg , fe , the increase rate of fe and the decrease rate of fe were determined as in example 23 and the results are shown in table 16 . table 16______________________________________average daily gain and feed efficiencyfrom the injection of porcine somatotropin daily control injected injected injected group group group 1 group 2______________________________________1st - 2nd weeks : adg 1 . 01 0 . 85 1 . 06 1 . 02fe 2 . 92 2 . 60 2 . 79 2 . 703rd - 4th weeks : adg 0 . 91 1 . 04 1 . 09 1 . 04fe 3 . 87 2 . 68 2 . 98 3 . 095th - 6th weeks : adg 0 . 88 0 . 98 0 . 64 1 . 01fe 3 . 67 3 . 14 5 . 06 3 . 651st - 6th weeks : adg 0 . 93 0 . 95 0 . 93 1 . 02fe 3 . 45 2 . 79 3 . 37 3 . 16increase rate -- 19 . 1 % 2 . 3 % 8 . 4 % of fe (%) 1st - 6th weeks : decrease rate -- 39 % 24 % 11 % of ft (%) ______________________________________ the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included in the scope of the following claims .	0
fig1 a - 1h show the manufacturing process of the first embodiment of this invention . in the figures , a grin - sch - sqw ( graded index - separate confinement heterostructure single quantum well ) structure is used as the quantum well structure , and a substrate is integrated with a frequency tunable dbr laser , an am modulator and a pm modulator . in this case , disordering is controlled with the dose level in si ion implantation and the growing process is divided into the first and second epitaxy steps . ion implantation is conducted after the first epitaxy step , and the temperature increased in the second epitaxy step is used for the thermal processing subsequently to the ion implantation . as shown in fig1 a , substrate 1 has sequentially grown on it a buffer layer 2 , a cladding layer 3 , a grin layer 4 , an active layer , another grin layer 6 , and a guiding layer 7 . the grin layer 4 , the active layer 5 and the grin layer 6 construct a quantum well structure . the quantum well structure is disordered by ion implantation and thermal processing . at the time of ion implantation , a mask 8 having a window open on the region where the optical device is to be formed is set on the guiding layer 7 to control the dose level according to the band gap required for the optical device . fig1 b through 1d show the mask shapes for forming a waveguide region for connecting individual optical devices , a refractive index control region for variably controlling refractive index against radiated light and an absorption coefficient control region for variably controlling absorption coefficient against radiated light . si is used as the implantation ion , and the dose levels for each region are denoted respectively as s 1 , s 2 and s 3 , provided the following relation below holds : the quantum well structure is disordered by thermal processing after the ion implantation . the degree of disordering varies depending on the dose level of the particular region . the disordering of a quantum well structure by the ion implantation and thermal processing is described in : masashi uematsu & amp ; fumihiko yamagawa , &# 34 ; compositional disordering of si - implanted gaas / algaas superlattices by rapid thermal annealing &# 34 ;, jpn . j . appl . phys . vol . 26 , no . 8 , august 1987 , pp . l1407 - l1409 . fig1 e through 1h show the steps after completion of the ion implantation . in the steps after the ion implantation , a grating is formed on the surface of the guiding layer 7 corresponding to the position where a dbr region is to be formed as shown in fig1 e . then , as shown in fig1 f , a cladding layer 10 and a cap layer 11 are grown , and etched in a mesa structure as shown in fig1 g . electrodes 12 - 1 , 12 - 2 are then formed as shown in fig1 h . as the temperature rises while the cladding layer 10 and the cap layer 11 are grown , the heat is used for the thermal processing subsequent to the ion implantation . fig2 shows a cross section of the semiconductor optical device in the longitudinal direction of the mesa structure while fig3 shows the cross section along the line 3 -- 3 in fig2 . the semiconductor optical device is obtained by using the quantum well structure which has not been disordered as an active region 21 , forming a waveguide 22 on the waveguide region , a phase control region 23 , a dbr region 24 and a pm modulation region 25 on the refractive index control region , and an am modulation region 26 on the absorption control region . fig4 a - 4d show the changes in the energy band caused by disordering . fig4 a shows the state prior to disordering , fig4 b and 4c show the states where disordering has progressed , and fig4 d shows the state where the disordering is completed . as the disordering progresses , the effective width of the well decreases , the first quantum energy level changes , and the band gap increases . the region which is not disordered maintains the band gap of epitaxial growth . this region is used as the active region 21 . the frequency oscillated by the region 21 is determined by the band gap thereof . the band gap is expanded by disordering in the absorption control region , and the absorption edge is slightly shifted toward the side of the short wavelength . this in turn shifts the absorption edge corresponding to the band gap toward the short wave from the oscillation wavelength of the region 21 . under the normal state , it becomes transparent . but if electric current or voltage is applied on the region , the edge is shifted toward the long wave side , and the region may be used as an am modulation region 26 using the changes in absorption coefficient . as the dose level of the refractive index control region is larger than that of the absorption region , that region is subjected to a large degree of disordering . the band gap thereof is far greater than that of the absorption coefficient control region , and thus is less susceptible to changes in an absorption coefficient by electric current or voltage . when electric current or voltage is applied , however , the refractive index is changed due to the effect of plasma , stark shift , etc . utilizing such changes in the refractive index , the region may be used as the phase control region 23 , the dbr region 24 , and the pm modulation region 25 . disordering progresses in the waveguide region further to increase the band gap . the absorption edge shifts toward the side of shorter wave , and the waveguide loss becomes smaller . the region may , therefore , be used as the waveguide 22 . the active region 21 , the phase control region 23 , the dbr region 24 and the structure neighboring them form a frequency tunable dbr laser , the am modulation region 26 and the structure neighboring it forms an am modulator , and the pm modulation region 25 and the structure neighboring it form a pm modulator . the operation of the frequency tunable dbr laser is described in detail in s . murata , i . mito and k . kobayashi , &# 34 ; over 720 ghz ( 5 . 8 nm ) frequency tuning by a 1 . 5 μm dbr laser with phase and bragg wavelength control regions &# 34 ; electronics lett ., vol . 23 , no . 8 , apr . 9 , 1987 . fig5 shows the al mole fraction of the quantum well structure of the semiconductor optical device which was actually manufactured . in this embodiment , gaas was used as the active layer 5 while al ga as was used as the grin layers 4 , 6 and the guiding layer 7 . the width lz of the active layer 5 ( quantum well width ) was 7 . 5 nm , the width l of the grin layers 4 , 6 was 150 nm and the width lg of the guide layer 7 was 50 nm . using si as the implantation ion , the quantum well structure was implanted with ions under the following conditions : dose levels : s 1 = 1 × 10 12 - 1 × 10 15 cm - 2 . dose levels : s 2 , s 3 = 1 × 10 11 - 1 × 10 13 cm - 2 . the region was processed as shown in fig1 e through 1h to form the semiconductor optical devices shown in fig2 and 3 , and their operations were confirmed . the temperature of the second epitaxy step ( fig1 f ) was 770 ° c . in 40 minutes . the table below shows the result of measurement of waveguide losses against si dose levels . ______________________________________si dose level waveguide loss ( cm . sup .- 1 ) ______________________________________1 . 5 × 10 . sup . 13 cm . sup .- 2 5 . 01 . 0 × 10 . sup . 13 cm . sup .- 2 4 . 40 . 7 × 10 . sup . 13 cm . sup .- 2 12 . 0______________________________________ the values in the table were obtained when measurement was taken under the following conditions : the above embodiment shows a case where the degree of disordering was controlled by the dose level of ion implantation , but it may be controlled by the implanted ion species . for instance , p . mei , t . ven - katesan , s . a . schwarz , n . g . stoffel , j . p . harbison , d . l . hart and l . a . florez taught , in their paper titled &# 34 ; comparative studies of ion - induced mixing of gaas - alas superlattices &# 34 ;, appl . phys . lett . 52 ( 18 ), may 2 , 1988 , pp . 1487 - 1479 , that the degree of disordering was controlled by selecting the species of implantation ions similar thermal process was carried out . the quantum well structure shown in fig5 of the quantum well width lz = 7 . 5 nm , the width of the grin layer 4 , 6 lg = 100 nm , the width of the guide layer 7 lg = 50 nm were implanted under the following conditions : dose level s 1 : 1 × 10 12 - 1 × 10 14 cm - 2 . dose level s 2 s 3 : 1 × 10 12 - 1 × 10 14 cm - 2 . fig6 a - 6f show the manufacturing process of the second embodiment of this invention . a sample product using grin - sch - sqw structure as the quantum well structure will be described below . as shown in fig6 a , an n - type buffer layer 2 , an n - type cladding layer 3 , a grin layer 4 , a sqw active layer 5 , a grin layer 6 and a guide layer 7 where formed epitaxially in this order on an n - type gaas substrate 1 . the composition of the layers from the n - type cladding layer 3 to the guide layer was al x ga 1 - x as , and the mole fraction x and the thickness thereof are as follows : then , as shown in fig6 b , ions were implanted on the two regions which were to be facets . the distance a between the two regions was 1000 μm . si ions were used , the implantation energy was 100 kev , and the dose level was 1 × 10 13 cm - 2 . the guide layer 7 was etched as shown in fig6 c to form a rib waveguide 20 . then , a p - type cladding layer 10 and a p - type cap layer 11 were grown as shown in fig6 d . their mole fractions x and thickness were respectively as follows : the high temperature during the growth of the cladding layer 10 and the cap layer 11 was used for thermal processing after implantation . as shown in fig6 e , the cap layer 10 and the cladding layer 11 were partially etched to form a ridge structure for current confinement , and an upper electrode 12 - 2 was formed after sio 2 insulating layer 13 had been deposited . a lower electrode 12 - 1 was formed on the reverse surface of the substrate 1 . lastly , as shown in fig6 f , the upper electrode 12 - 1 was removed correspondingly to the region which was to be a facet as shown in fig6 b , and cleaved to form disordered regions having the width of 50 μm on both sides of the semiconductor laser . the distance b between the cleaved facets was 1100 μm . a device shown in fig6 f was cleaved inside the disordered two regions for comparison . the distance c between cleaved facets was 900 μm . fig7 through 9 show the result of measurement of characteristics of the thus obtained embodiment and the comparison . the graphs in fig7 and 8 show the relation of the output power and the injected current measured in the comparison and the embodiment . pulsed light was generated from this embodiment and the comparison devices at 20 ° c ., in the time width of 400 ns and at the duty ratio of 0 . 1 %. as a result , cod was caused when the output reached 354 mw in the comparison device . but in this embodiment , the output was saturated with the heat generated at 623 mw causing no cod . as stated above , the cavity length was 1100 μm in this embodiment , and was 900 μm in the comparison device . the effect of disordering was quite obvious even though the cavity length differed . fig9 shows an example of measurement of output power in relation to injected current when one of the facets was covered with an anti - reflection coating while the other facet was covered with a high reflection coating . the anti - reflection coating used had the refractive index of 1 %, and the high reflection coating 97 %. the conditions in temperature and light emission were the same as above . the output in this example was saturated at 1 . 3 w and no cod was caused . as shown in fig4 a - 4d , when disordering was fully completed , the band gap increased up to the value of the barrier layer . if facets of a quantum well structure are disordered , the band gap in the regions will increase to eliminate absorption completely . fig1 through 13 show the manufacturing process of a dbr laser , a frequency tunable dbr laser , a ror laser , and a frequency tunable ror laser as the third to the six embodiments according to this invention . the ror laser and the frequency tunable ror laser are shown in plane view in fig1 f and 13f . in the manufacturing process of a dbr laser , in a manner similar to those shown in fig1 a - 1h , an active region and dbr regions were formed within the rib waveguide 20 . dbr regions were provided on both sides of the active region in this embodiment . a grating was provided on the dbr region and the quantum well structure thereof was disordered . the upper electrode 12 - 2 was removed except for the active region , and the remaining portion was used as a driving electrode 12 - 3 . in the process for the frequency tunable dbr laser , an active region , a phase control region and a dbr region were formed within the rib waveguide 20 . the upper electrode 12 - 2 was split to form a driving electrode 12 - 3 , a phase control electrode 12 - 4 and a frequency tuning electrode 12 - 5 in respective regions . in the process for the ror laser , the active region 21 and the dbr region were formed separately in different waveguides and a coupling region 40 was provided in a manner to couple propagated lights between the separate waveguides . the dbr regions 24 were provided on both sides of the coupling region 40 . in order to make the frequency oscillated by the ror laser tunable , the waveguide on the side of the active region 21 is provided with a phase control region 23 , the active region 21 with a driving electrode 12 - 3 , the phase control region 23 with a phase control electrode 12 - 4 and the dbr region 24 and the regions therebetween with the frequency tuning electrode 12 - 5 . ror such as above is described in detail in rudolf f . kazarinov , charles h . henry , and n . anders olsson , &# 34 ; narrowband resonant optical reflectors and resonant transformers for laser stabilization and wavelength division multiplexing &# 34 ;, ieee journal of quantum electronics , vol . qe - 23 , no . 9 , september , 1987 . the semiconductor laser using an ror as an extra - cavity is described in detail in n . a . olsson , c . h . henry , r . f . kazarinov , h . j . lee , b . h . johnson and k . j . orlowsky , &# 34 ; narrow linewidth 1 . 5 μm semiconductor laser with a resonant optical reflector &# 34 ;, appl . phys . lett . 51 ( 15 ), october 1987 . as to the technology for integrating semiconductor laser with rors on the same substrate , the present applicant has filed a patent application ( jpa sho 63 - 218981 ). although the above embodiments describe the cases where 28 si was used as ions to be implanted , other ions may be used to realize this invention process . so far as a quantum well structure is used , the semiconductor laser may have any structure for confining light or other purposes . therefore , this invention process is applicable to the manufacturing steps for broad area semiconductor lasers or for laser arrays .	8
preferred embodiments of the invention can be understood in the context of a broadband communications system and a local network system . note , however , that the invention may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein . for example , transmitted broadband signals may include at least one of video / audio , telephony , data , and internet protocol ( ip ) signals , to name but a few . additionally , receiving devices ( i . e ., a primary device and a plurality of remote devices ) included in a local network system receiving the transmitted broadband signals may include a set - top terminal ( stt ), a television , a computer , a personal digital assistant ( pda ), or other device . furthermore , a networked peripheral device is explained in the context of a vcr or dvd player , but it is envisioned that the peripheral device can be an advanced record / playback device , such as a digital camcorder or an mp3 player . all examples given herein , therefore , are intended to be non - limiting and are provided in order to help clarify the description of the invention . the present invention is directed towards a networked multimedia system including a networked peripheral device , such as a record / playback device , that can be shared among a plurality of receiving devices . briefly , the peripheral device is preferably connected to the primary device and , advantageously , operated from any receiving device in the network . it will be appreciated , however , that the peripheral device can also be connected to any of the remote devices and shared among all receiving devices in the network . accordingly , a user only needs to purchase one main peripheral device that can be operated from each receiving device in the network as if the peripheral device is collocated with each receiving device . a networked multimedia system ( nms ) is described in copending u . s . patent application ser . no . 10 / 342 , 670 , filed jan . 15 , 2003 , the disclosure and teachings of which are hereby incorporated by reference . as taught therein , the nms is typically located within a subscriber &# 39 ; s premises . it will be appreciated , however , that the nms can also be used in a multi - unit dwelling , business , school , hotel , or hospital , among others . advantageously , the nms allows a plurality of receiving devices in the premises to be locally networked ( i . e ., home - networked ). one of the receiving devices typically acts as the server or primary device ( i . e ., the primary set - top terminal ( stt )). the primary stt receives and forwards upon request broadband multimedia presentations ( e . g ., analog or digital television channels ( i . e ., audio / video signals ), ip signals , video - on - demand ( vod ) signals , administrative signals , etc .) throughout the local network to the plurality of remote devices ( i . e ., client devices ). furthermore , the remote devices may each request of and seamlessly receive from the primary stt resident presentations ( e . g ., a stored or recorded presentation , or the interactive program guide ) and / or request access to a peripheral device ( e . g ., a vcr or dvd player ) that may be connected to the primary stt or , alternatively , to any one of the remote devices , for example . additionally , the remote devices may independently receive presentations from and send upstream signals to the communications network . accordingly , the remote devices may be simplified , less - costly versions of the primary stt but are capable of utilizing , via the nms , some or all of the advanced hardware and software features , such as memory , a mass storage device , software applications , or infrastructure for transmitting signals to coupled devices and the headend , that are available in the primary stt . fig1 is a simplified block diagram depicting a non - limiting example of a conventional broadband communications system 100 . in this example , the communications system 100 includes a headend 110 that is coupled to a local network ( ln ) 101 via a communications network ( cn ) 130 . the cn 130 may be any network that is suitable for carrying , preferably downstream and upstream , broadband multimedia signals , such as audio / video signals , ip signals , telephony signals , or data signals to name but a few . the cn 130 may be , for example , a hybrid fiber / coax ( hfc ) network , a fiber - to - the - home ( ftth ) network , a satellite network , or a fixed wireless network ( e . g ., mmds ), among others . the headend 110 may include one or more server devices ( not shown ) for providing broadband signals , such as video , audio , and / or data signals , to the stt 105 via the cn 130 . the headend 110 and the stt 105 cooperate to provide a user with a variety of services . the services may include , for example , analog or digital broadcast television services and channels , video - on - demand ( vod ) services , and / or pay - per - view ( ppv ) services , among others . each broadcast television channel typically provides a sequence of television presentations corresponding to a television station ( e . g ., abc , nbc , cbs , or fnn , to name a few ) and is typically identified by a channel number ( e . g ., channel 2 , channel 3 , channel 4 , etc .) that is available to a user at all times . additionally , ppv services are typically transmitted to the stt 105 at all times , but can only be viewed on the stt 105 as provisioned . on the other hand , the stt 105 typically requests a vod service and , in response , the headend 110 transmits the presentation downstream to the stt 105 . the ln 101 includes a set - top terminal ( stt ) 105 that provides the broadband signals to remote devices 140 - 1 and 140 - 2 , and , optionally , to additional remote devices including , for example , remote device 140 - 3 . the stt 105 may be coupled to the remote devices either directly or via one or more other devices . it will be appreciated that the stt 105 may be a stand - alone unit or may be integrated into another device , such as , for example , a television or a computer . additionally , the remote devices may be located in different rooms than where the stt 105 is located . further information regarding the ln 101 is provided in copending u . s . patent application ser . nos . 10 / 263 , 160 ; 10 / 263 , 270 ; and 10 / 263 , 449 , which were filed on oct . 2 , 2002 , the disclosure and teachings of which are hereby incorporated in their entirety by reference . a preferred embodiment of the networked multimedia system ( nms ) including a networked peripheral device fig2 is a block diagram illustrating one preferred embodiment of the nms 200 that is suitable for use in the broadband communications system of fig1 . the nms 200 includes a primary stt 205 , a splitter / isolator module ( sim ) 210 , and a plurality of remote devices 215 - n . briefly , the sim 210 receives downstream broadband signals from , for example , a headend or satellite and subsequently provides the downstream signals to the primary stt 205 or to both the primary stt 205 and any one or all of the plurality of remote devices 215 - n depending on the implementation . upon command from at least one of the remote devices 215 - n , the primary stt 205 may also forward selected real - time downstream signals and / or stored content signals to the requesting remote device ( s ) 215 - n via the sim 210 . more specifically , the plurality of remote devices 215 - n communicates with the primary stt 205 by sending reverse control / command signals via coaxial cable 220 , 221 - n requesting , for example , stored presentations , real - time signals , or an interactive guide . it will be appreciated that other wired mediums , such as telephone lines or data cables , may be used so long as the transport format accommodates the desired transmission medium . advantageously , in accordance with the present invention , the plurality of remote devices 215 - n have access to all of the primary stt &# 39 ; s hardware and software functionality , along with receiving downstream signals directly from the headend via the sim 210 . in this manner , the remote devices 215 - n may have limited resources , such as not including a storage device or a connected record / playback device , thereby decreasing the overall costs to the service provider and the subscriber while offering advanced services to all of the remote devices that are networked to the primary stt 205 . fig2 also illustrates a simplified , non - limiting block diagram of selected components of the primary stt 205 in accordance with one preferred embodiment of the present invention . in other embodiments , a primary stt 205 may include only some of the components shown in fig2 , in addition to other components that are not shown . importantly , however , the primary stt 205 includes a processor 230 , a tuner system 235 , a storage device 240 , a modulator 245 , and a remote device communications receiver 250 . in operation , downstream signals ( i . e ., signals typically ranging from 45 mhz to 850 mhz ) are transmitted via the sim 210 to a low pass filter in diplex filter 255 , which provides the downstream signals to the tuner system 235 . a plurality of tuners ( not shown ) included in the tuner system 235 are used to tune to frequency ranges that include content signals indicative of presentations , such as an analog or digital television channel , a ppv event , a vod presentation , etc . for example , a vod presentation may , in response to a user request , be received from the headend in the frequency range around 755 mhz , which corresponds to a particular television channel , such as channel 210 . the user , therefore , selects the television channel 210 and , in response , a tuner in the tuner system 235 tunes to the frequency range around 755 mhz and extracts the received vod presentation &# 39 ; s content signals . depending upon the implementation , the tuned vod presentation is then provided to a viewing display 225 for viewing , the storage device 240 for storing , and / or the modulator 245 for modulating and subsequent transmission to the plurality of remote devices 215 - n . additionally , the user may wish to record the presentation using a peripheral device , such as a vcr . in the event that a remote device 215 - n , upon user input , requests a presentation from the primary stt 205 , a reverse command signal is transmitted from the remote device 215 - n to the primary stt 205 via the sim 210 . the remote device command receiver 250 receives and demodulates the command signal according to its transmission method , such as frequency - shift keying ( fsk ) or on - off keying ( ook ) transmission . the processor 230 subsequently receives the demodulated command signals indicative of the requested action ( e . g ., requesting a presentation ) and in accordance therewith instructs the tuner 235 to tune to , for example , a channel carrying a real - time downstream signal , or the processor may retrieve a stored presentation from the storage device 240 . the presentation &# 39 ; s content signals are then provided to the modulator 245 , which modulates the selected presentation prior to forwarding to the sim 210 . a preferred embodiment of the present invention uses a quadrature amplitude modulation ( qam ) modulator , which may be used for effectively transmitting signals over coaxial cable in a cable television environment . other embodiments may include a quadrature phase - shift keying ( qpsk ) modulator in a satellite environment , an 8vsb ( 8 - vestigial sideband ) modulator in a digital terrestrial environment in the u . s ., and a cofdm ( coded orthogonal frequency division multiplexing ) modulator in a digital terrestrial environment in europe , or alternatively an analog modulator . the modulated presentation is up - converted to a predetermined higher frequency , which is preferably greater than the highest frequency used in the communications network 130 ( fig1 ), with , for example , a uhf converter 260 . in other words , the selected presentation is up - converted to a high frequency channel , such as channel 134 , which may have a frequency range from 852 mhz to 858 mhz . it will be appreciated that other frequency ranges can be used , however , so long as the predetermined frequency is within the range that is tunable by the plurality of remote devices 215 - n . in this example , the service provider would provide downstream signals in the range from 45 mhz to approximately 840 mhz . accordingly , the up - converted signals at around 855 mhz would not interfere with the downstream signals that are concurrently provided via the common coax 220 , 221 - n to the primary stt 205 and the remote devices 215 - n . the up - converted presentation is subsequently provided to the sim 210 via a high pass filter in the diplex filter 255 . furthermore , fig2 illustrates a block diagram of a sim 210 that comprises passive splitter / isolation components in accordance with the present invention . more specifically , a band reject filter ( brf ) 265 rejects the frequencies ( e . g ., from 852 mhz to 858 mhz ) of the selected nms presentation , thereby not allowing the presentation to leave the nms 200 and enter the communications network 130 . it will be appreciated , therefore , that the nms presentation is reflected off the brf 265 and routed to a splitter 270 for transmission to the plurality of remote devices 215 - n . a high pass filter ( hpf ) 275 is included to ensure that the reverse command signals provided by the plurality of remote devices 215 - n are reflected and routed to the primary stt 205 and similarly not transmitted to the communications network 130 . it will be appreciated that , if there are significant internal power losses , an amplifier ( not shown ) can also be included to amplify the downstream signals as necessary . fig3 is a simplified diagram of one preferred embodiment of a remote stt device 215 - n that is suitable for use in the nms of fig2 . it will be appreciated that the remote device 215 - n may be identical to the primary stt 205 and just share the storage device contents and connected peripherals of the primary stt 205 . alternatively , the remote devices 215 - n may be a simplified or conventional version of the primary stt 205 . a processor 305 and a tuner system 310 , which may be a simplified processor and only one tuner , may be included to extract channels from the received downstream broadband signals . additionally , decryptors and decoders ( not shown ) may be included to decode encoded signals for proper processing and display . the remote devices 215 - n may also include a user input receiver 315 , such as an ir receiver or an rf receiver , that receives signals from a remote control 320 , such as an ir remote control or an rf remote control , but is not required . the reverse command signals , which typically originate from user input commands ( e . g ., tuned channels , nms functions such as access to peripheral devices , ipg display , etc . ), are transmitted via the coaxial cable 221 - n that are routed between the remote devices 215 - n and the sim 210 . it will be appreciated that though the coaxial cables 221 - n are shown as separate cables , a common coaxial cable can be used tying the remote devices 215 - n together so long as the processor 305 of each networked remote device 215 - n is configured to understand and reject other remote device &# 39 ; s reverse command signals . a preferred embodiment of the present invention processes and transmits the reverse command signals that are indicative of user input commands using frequency shift keying ( fsk ) and utilizes existing components that are typically included in a conventional remote set - top terminal . more specifically , a qpsk modulator ( not shown ) is typically included in the upstream transmitter 325 for modulating conventional upstream signals , which are signals typically ranging from 5 mhz to 40 mhz , for transmission to the headend and , in accordance with the present invention , for modulating the reverse command signals , which are signals typically at a frequency around 2 . 5 mhz , that are routed throughout the nms 200 . accordingly , the qpsk modulator has an adjustable tuning frequency that modulates the reverse command signals and the upstream signals to a different frequency . in this manner , the reverse command signals do not interfere with conventionally transmitted upstream signals that may be provided by the remote devices 215 - n . according to the preferred embodiment , the remote device command receiver 250 includes an fsk demodulator for demodulation . it will be appreciated , however , that the reverse command signals may alternatively be transmitted using , for example , on - off keying ( ook ) or any other serial data transmissions , and the command receiver 250 can include any demodulator that is in accordance with the reverse command signal transmission used . after demodulation , the command receiver 250 sends signals indicative of the reverse command signal , such as , for example , requesting a recorded programs list , to the processor 230 for processing accordingly . fig4 depicts a networked system 400 including a networked peripheral device 405 that can be operated from any of the receiving devices 410 , 215 - n in accordance with the present invention . preferably , along with the primary device 410 , the remote devices 215 - n access and operate the peripheral device &# 39 ; s functionality and subsequently receive the media presentation from the peripheral device via the primary device 410 and the network 400 . more specifically , upon user input , the remote devices 215 - n send reverse command signals indicative of control operations , such as selecting a disc that may be included in a high disc capacity dvd player and play , pause , stop , fast - forward , and rewind commands that may operate the peripheral device 405 . additionally , a user may send reverse command signals requesting the peripheral device 405 to record a selected downstream signal that is received at the primary device 410 . alternatively , a user may manually turn on and play the media presentation signals in the peripheral device 405 . the primary device 410 can then broadcast the media presentation signals to the plurality of remote devices 215 - n . each remote device 215 - n simply tunes to the modulated channel and begins receiving and presenting the media presentation signals to a connected viewing display ( not shown ). notably , however , except for the physical act of inserting a media presentation , such as a cassette or a disc , into the peripheral device 405 , all other commands can be performed by each of the remote devices 215 - n . in other words , the remote devices 215 - n operate the peripheral device 405 as if it were directly connected to each remote device 215 - n . furthermore , the remote devices 215 - n that are not communicating with or receiving signals from the peripheral device 405 can concurrently receive content signals from the communications network 130 or modulated signals from the primary device 410 . fig5 illustrates a block diagram of the interaction between the primary device 410 and the peripheral device 405 . it will be appreciated that the peripheral device cables , such as power cables , audio / video cables , etc ., may be connected to the primary device 410 and the viewing display 225 in a known manner . in the preferred embodiment , an infrared ( ir ) cable 505 is connected via an ir connector to an ir port 510 on the primary device 410 . on the opposite end of the cable 505 , an ir emitter 515 is located in close proximity to an ir sensor 520 , which is located on the outside of the peripheral device 405 . it will be appreciated that the ir sensor 520 is typically included on any consumer electronics device that can be operated by a remote control . accordingly , ir signals that are indicative of control functions ( e . g ., play , pause , fast - forward , rewind , record , etc .) are transmitted from the primary device 410 to the peripheral device 405 . fig6 is an example of a networked peripheral device ( npd ) listing 600 that includes , for example , manufacturers and models for a variety of consumer electronics ( e . g ., vcr , dvd player , mp3 player , camcorder , etc .). prior to control of the peripheral device 405 , a user selects the coupled peripheral device 405 from the list 600 that is stored in the primary device 410 . once selected , the processor 230 is updated to include the peripheral device &# 39 ; s specifications in order to transmit appropriate commands . a preferred embodiment is to access the peripheral device listing 600 by , for example , selecting a “ settings ” button on the remote control or a “ settings ” menu on the interactive program guide ( ipg ). the manufacturer and model of the peripheral device 405 is selected from the list 600 of stored models and then saved for future access by the processor 230 . by way of example , the user can implement the arrows 610 via the remote control until the correct manufacturer is highlighted . in this case , the user can then select , for example , a toshiba dvd player 615 . fig7 is an example of an interactive program guide 700 including a channel for the networked peripheral device ( npd ) screen ( e . g ., toshiba dvd screen ) 715 . notably , the interactive program guide 700 can be updated via the processor 230 to include the selected manufacturer of the peripheral device 405 that can subsequently be accessed by all remote devices 215 - n . by way of example , in accordance with the present invention , the primary device 410 receives reverse command signals from one or a plurality of remote devices 215 - n indicating a request for the ipg 700 . from the ipg 700 , a user can subsequently select the npd screen 715 that may display operating commands for the device 405 , among other listings associated with the particular peripheral device 405 . for example , the screen may also include the title ( s ) of the cassette or disc , if programmed into the processor 230 , that is currently installed or playing in the peripheral device 405 . fig8 illustrates an example of the npd screen 800 that the user may use from any of the receiving devices 410 , 215 - n in order to control the networked peripheral device 405 . from the npd screen 800 , the user may select a disc in the case where there are numerous discs in a dvd player , for example , and choose to play the selected presentation . furthermore , additional operating options on the screen may include play , pause , fast - forward , stop , etc . alternatively , the remote control may include buttons representing play , stop , record , etc . in this case , the remote device 215 - n can be programmed to accept these operations directly from the remote control and send reverse command signals accordingly . the remote device 215 - n sends the selected reverse command signal that is indicative of the operating command to the primary device 410 . subsequently , the remote device command receiver 250 ( fig4 ) and the processor 230 process the signals according to the selection . an appropriate ir signal is then provided from the processor 230 via the ir port 510 to the sensor 520 . further information regarding a multi - room interactive program guide can be found in co - pending u . s . patent application attorney docket a - 8621 , filed on mar . 31 , 2003 , the disclosure and teachings of which are hereby included by reference . referring again to fig5 , a peripheral processor 525 receives the ir signals indicating the requested command signals and provides operating signals accordingly . a media presentation device 530 receives the operating signals and , for example , reads and transmits the media presentation signals that have been recorded onto a media presentation ( e . g ., a cassette , disc , or hard - drive ). if the media presentation signals have been digitally compressed and stored on , for example , a disc , the digitally compressed signals are typically provided to an mpeg decoder 535 . more specifically , in accordance with certain copyrights that have been obtained by , for example , movie producers , the media presentation signals must be decoded to an analog or ntsc ( national television standards committee ) signal . in this manner , an mpeg decoder 535 decodes the media presentation and provides the analog signals via an output port 540 of the peripheral device 405 to an input port 545 of the primary device 410 . furthermore , when an analog signal is received from the peripheral device 405 , an analog to digital converter ( adc ) digitizes the analog signal and an encoder 550 ( e . g ., an mpeg ( moving pictures experts group encoder ) subsequently encodes , or digitally compresses , the analog signal for transmission throughout the network system 400 . it is envisioned that the peripheral device 405 can provide signals in any format . for example , the primary device 410 may receive signals in an analog video format ( including standard definition and high definition ), uncompressed digital video ( including dvi , and hdmi ), and compressed digital video ( mpeg - 2 or dv ( digital video )), for example . the primary device 410 distinguishes the signal format by the connector that connects the peripheral device 405 with the primary device 410 . by way of example , analog signals use a baseband or high - definition input port ( e . g ., connector 545 ). a dvi ( digital video interface ) connector 555 carries uncompressed digital video . furthermore , a firewire connector ( ieee 1394 ) 560 conveys compressed digital video ( in either mpeg - 2 or dv format ). the primary device 410 can , therefore , use the connector type information to determine whether the incoming video needs to be digitized and / or compressed . additionally , the processor 230 has access to the firewire connector 360 and understands that the incoming signals are compressed digital signals . once the signals are available in compressed digital format , the signals are transmitted to the modulator 245 for modulation or the storage device 240 for storage . subsequently , the modulator 240 modulates the media presentation signals and the uhf converter 260 converts the signals to a higher frequency . the signals are then provided to the sim 210 for routing to the remote device 215 - n . additionally , the user may wish to store the media presentation signals on the storage device 240 . accordingly , the reverse command signals are processed and the processor 230 instructs the media presentation signals to be routed to the storage device 240 . further information regarding the storage device 240 and routing stored media presentation signals to any one or more remote devices 215 - n is detailed in copending u . s . patent application ser . no . 10 / 342 , 670 filed on jan . 15 , 2003 . accordingly , systems and methods have been provided that allow remote devices in a network operate a networked peripheral device . in other words , a user need only purchase one peripheral device that can be used from any device in the network . it should be emphasized that the above - described embodiments of the invention are merely possible examples , among others , of the implementations , setting forth a clear understanding of the principles of the invention . many variations and modifications may be made to the above - described embodiments of the invention without departing substantially from the principles of the invention . all such modifications and variations are intended to be included herein within the scope of the disclosure and invention and protected by the following claims . in addition , the scope of the invention includes embodying the functionality of the preferred embodiments of the invention in logic embodied in hardware and / or software - configured mediums .	7
referring now more particularly to the drawing in fig1 the engine protection device and system 100 is used in association with an internal combustion engine , which includes a engine throttle level 102 , moveable in a speed increase direction as shown by arrow a by a connecting throttle rod 9 connected to and actuated by operators control lever 104 by the rod 22 is connected between said control lever 104 and throttle rod 9 . between rod 22 and rod 9 is the engine protection device 10 controlled by the engine protection control system 106 . the engine protection system 106 includes engine protection device 10 that shortens or lengthens the distance between operators control level 104 and throttle 102 to provide full range speed control or decreased speed control through movement of throttle 102 . the engine protection device 10 includes a relatively small diameter , elongated compressed air cylinder assembly 10 . said air cylinder assembly 10 includes a tubular body 12 , threaded end plug 14 , oil seal 22 , a bushing 18 which is retained by snap rings 20 . the piston 24 with o - ring 26 moves to the right under air pressure from line 113 . the right end portion of the throttle rod 22 forms a piston rod or the piston 24 . the piston rod is slidably positioned in sealed relation through the bushing 18 , the inward end of rod 22 is attached to the piston 24 . the left end portion of the throttle rod 9 is secured to the end plug in cylinder assembly 10 . a return spring 103 is used to urge cylinder assembly 10 to the right to its idle position . a first conduit 113 is attached to the air cylinder assembly to the left of the piston . a port 11 allows air to escape from 207 . the pressurized air comes from oil pressure valve 4 through t - fitting 112 into line 218 , through the normal open thermo cooling water valve 214 and into line 113 . the oil pressure valve 4 is in a normally closed position . valve 4 is set to quickly open pressurized air inlet 310 at a prescribed predetermined oil pressure at oil inlet 302 . the oil enters through line 304 and moves piston 311 to the left in chamber 301 . piston 311 moves when the oil pressure overcomes the force of spring 315 , when piston 311 moves , it in turn shifts the spool valve 8 and 8 &# 39 ; opening air inlet 310 and closing outlet 316 . when spool valve 8 is moved into an open position it allows compressed air to move from 310 to point 317 and on to t - fitting 112 . the pressurized air also moves through line 218 to control the cylinder assembly 10 . pressurized air from t - fitting 112 also moves to the inlet of pressure air regulator 318 . this low pressure regulator will allow a reduced air pressure to exit through the small line 319 that feeds compressed air into chamber 319 . this air pressure aids the biasing means 315 in moving piston 311 and spool valve 8 and 8 &# 39 ; to the right . spool 8 &# 39 ; is closed and spool 8 is opened to allow air from line 218 to escape . the chamber 319 on the end of the oil pressure valve 4 is to provide very precise downshift . the preciseness can be regulated by shims 320 placed underneath the spring 315 . the shims adjust the spring tension . therefore the selected downshift air pressure can be practically any desired pressure that is needed in order to give the internal compression engine full protection . the oil pressure valve 4 may have an initial upshift of twenty psi regulated by the spring pressure at 315 and a downshift piston as low as 4 pounds per square inch ( psi ) and some as high as twenty psi . oil comes into the oil pressure valve 4 from the engine oil pump not shown under pressure at 302 and proceeds into chamber 301 , and moves piston 311 to the position shown to make pedal 104 operable . spool 8 &# 39 ; is positioned as shown in an open condition allowing air under pressure from a tank and pump , not shown , past point p where the spool 8 &# 39 ; is open . the pressurized air moves through 112 to regulator 318 such as c . a . norgren co ., 5400 s . delaware street , littleton , colo . 70120 , miniature relieving type general purpose regulator . regulator 318 will let air pass into line 319 at a lower pressure . the pressure regulated air is added to chamber 319 after the spool valve is placed into the position shown . this places added pressure in opposition as shown by an arrow m . spool 8 &# 39 ; will move to the right when the oil pressure at 304 equals the pressure of spring 315 and that added air pressure in 319 . this improved oil pressure valve provides an improved system because the pressure to the right on 311 after a very short time x allows a close downshift at the start pressure , for example twenty psi . in the past the piston 311 would for example , with a particular spring and shim setting move to the left at twenty psi but would move to the right only after an oil pressure drop to zero psi or five psi . a required drop down to about zero or five psi could allow operation and damage of the engine . by adding air pressure in 319 and using the shims one can calibrate the down shift so that the spools 8 and 8 &# 39 ; move to the right at anywhere from twenty psi oil pressure down to 5 . for example , one could have spools move to the left at twenty psi oil pressure and move to the right at eighteen psi . this provides better control of the oil pressure in the engine and provides shut down to idle the engine when low pressure occurs . for example , if one loses oil pressure all of a sudden in an engine and you want to reduce engine speed real fast when the engine pressure reaches eighteen pounds per square inch to bring the engine to an idle speed , this engine control device will perform the task . it will perform the task in a case where you get fuel oil dilution in a diesel engine , because the oil pressure will drop slowly . this control device will automatically place the throttle in idle when eighteen psi is reached . when the running engine moves oil through the fuel pump puts to 304 into cavity 301 moving piston 311 to the left to the position shown in fig1 pressurized air will flow from 310 past point p into t - fitting 112 to line 218 into the open hot water cooling system control valve , a shutter stat valve model no . 36000 by kysor catlillac of catlillac , mich ., and to the speed control cylinder 10 . the air pressure from 310 is placed in body 12 to position the piston 24 connected to rod 22 at 212 in the running position with air under pressure to the left of the piston . that places the throttle 102 in the phantom 102 &# 39 ; position . the engine can then be controlled by the foot pedal or throttle lever as shown at 104 . if there is a loss in pressure to the set pressure , such as eighteen psi , piston 311 will move to the right under the force of spring 315 and the reduced pressure at 319 . the shuttle valve 8 and 8 &# 39 ; will move to the right cutting off the pressure air from 310 and open the exit to 316 to allow air pressure to be released to atmosphere . the pressure in line 218 , shutter valve 214 , line 113 and chamber 114 is reduced to cause the piston 24 in body 12 to move to the off position , placing the piston 24 into the phantom view position 24 &# 39 ;. the foot pedal or throttle lever will move to the phantom position 104 &# 39 ; and the throttle will move to the position 102 . body 19 will be pulled to that position by the contracting spring 103 . the engine is brought to an idle speed and removes control over the engine speed from the operator . the operator cannot press the pedal or throttle lever down any further . therefore the engine will be saved from overheating or running without proper oil pressure . it should be noted that if only spring 10 were used at the left of the valve members 8 and 8 &# 39 ;, you would have to either have a soft spring to provide quick movement of the piston 311 to the left under oil pressure and slow movement back at zero to five psi to release the air pressure or you would have to install a heavy spring that would provide slow initial movement to the left at an unacceptable high pressure and a shift pressure moving the piston to the right . the present invention includes an additional air pressure through line 319 after a time delayed fromt the initial shift to the left so that close shift to the right may occur at a pressure close to the initial pressure . an oil pressure valve 4 is connected to a source of hydraulic pressure on the engine and is used to regulate pressurized air flow through the protection device . the oil pressure valve 4 and the water temperature valve 214 are used to low idle the engine . the water temperature or thermo valve 214 , relieving type is attached by pipe thread to engine cylinder head or water manifold ( not shown ). the heat sensor of the thermo valve being immersed in engine water coolant . air under pressure flows through conduit , into thermo valve which is normally open then through conduit and flexible conduit into the cylinder assembly 10 . this air under pressure will entend the cylinder assembly into its working length . should engine coolant temperature rise above predetermined level , valve will compress a spring 215 until the valve is firmly against its seat thereby stopping air flow to the cylinder assembly 10 . air trapped in the cylinder assembly 10 will flow through the system out exit 316 . air will enter exit 11 and the engine will be brought to idle or stop . this invention is an improvement to u . s . pat . no . 4 , 485 , 781 which disclosure is incorporated by reference into this application . referring to fig2 when no pressurized air is available , the system may be designed to work on a vacuum . by connecting the vacuum source as 310 &# 39 ; and allowing air to enter at 316 &# 39 ;, and changing the t - fitting to an elbow 112 &# 39 ; and plugging the end of chamber 319 and modifying the device 10 is by connecting 113 &# 39 ; into old port 11 in fig1 and allowing port 11 &# 39 ; to become a vent the system will operate . when vacuum is used instead of compressed air the downshifting will be close to the initial shifting pressure . the instant invention has been shown and described herein in what is considered to be the most practical and preferred embodiment . it is recognized , however , that departures may be made therefrom within the scope of the invention and that obvious modifications will occur to a person skilled in the art .	5
the present invention will be clearer from the following description when viewed together with the accompanying drawings , which show , for purpose of illustrations only , the preferred embodiment in accordance with the present invention . referring to fig1 - 5 , an adjustable multi - function support assembly in accordance with a preferred embodiment of the present invention comprises an extension mechanism 10 including a first tube 20 , a second tube 30 , an assistant sleeve 40 and a positioning device 50 , a first abutting mechanism 60 and a second abutting mechanism 70 . the extension mechanism 10 is adjustable in length and abuts against the predetermined positions by both ends thereof . the extension mechanism 10 includes the first tube 20 , the second tube 30 , the assistant sleeve 40 and the positioning device 50 . the first tube 20 is a hollow tube . one end of the first tube 20 is disposed with a connecting portion 21 which includes a positioning block 22 . the positioning block 22 of the connecting portion 21 is formed on the inner wall of the first tube 20 and formed with a thread hole 23 . the wall of the first tube 20 is formed with a plurality of positioning holes 24 that are alternately arranged or not alternately arranged . the respective positioning holes 24 are staggered with respect to each other . the second tube 30 is a hollow tube . one end of the second tube 30 is disposed with a connecting portion 31 including two through holes 32 . the two through holes 32 are aligned with each other for an insertion of a bolt 33 . the other end of the second tube 30 is formed with two positioning holes 34 in the tube wall thereof . the assistant sleeve 40 is a hollow structure . an inner diameter of the assistant sleeve 40 is bigger than an outer diameter of the first tube 20 . an outer diameter of the assistant sleeve 40 is smaller than an inner diameter of the second tube 30 . one end of the assistant sleeve 40 includes a flange 41 surrounding the outer wall thereof . the assistant sleeve 40 is formed with two positioning holes 42 in wall thereof . the assistant sleeve 40 is inserted into the second tube 30 first , and then the flange 41 of the assistant sleeve 40 abuts against the second tube 30 to prevent the assistant sleeve 40 from slipping into the second tube 30 . the positioning holes 42 of the assistant sleeve 40 are aligned with the positioning holes 34 of the second tube 30 . the positioning device 50 includes a bolt 51 and a fastener 52 . the outer diameter of the bolt 51 of the positioning device 50 is smaller than the inner diameter of the positioning hole 24 of the first tube 20 . one end of the bolt 51 is radially disposed with a stopping flange 511 on the outer wall thereof , and the other end of the bolt 51 is radially formed with a through hole 512 . the fastener 52 is u - shaped . the bolt 51 is correspondingly inserted into the positioning holes 24 of the first tube 20 , the positioning holes 42 of the assistant sleeve 40 and the positioning holes 34 of the second tube 30 , and the stopping flange 511 of the bolt 51 abuts against the outer wall of the second tube 30 . the though hole 512 of the bolt 51 is exposed outside for an insertion of the fastener 52 to prevent the disengagement of the bolt 51 due to the outside - force , so that the positioning device 50 is substantially inserted into the positioning holes 24 of the first tube 20 , the positioning holes 42 of the assistant sleeve 40 and the positioning holes 34 of the second tube 30 . the first abutting mechanism 60 includes a support block 61 , a screw 62 and an anti - slip block 63 . the support block 61 is a round bowl - shaped structure and formed with a thread hole 611 in the closed end thereof . the thread hole 611 of the support block 61 is aligned with the thread hole 23 of the connecting portion 21 of the first tube 20 . the screw 62 is screwed into the thread hole 611 of the support block 61 of the first abutting mechanism 60 and the thread hole 23 of the connecting portion 21 of the first tube 20 . the anti - slip block 63 is a round disc - shaped structure and engaged in the open end of support block 61 . the second abutting mechanism 70 includes a first support block 71 , a second support block 72 , a screw 73 and an anti - slip block 74 . both ends of the first support block 71 are axially formed with two flanges 711 . the flange 711 of one end of the first support block 71 includes two through holes 712 . the outer diameter of the flange 711 of this end is smaller than the inner diameter of the connecting portion 31 of the second tube 30 . the two through holes 712 of the flange 711 of this end are aligned with the two though holes 32 of the connecting portion 31 of the second tube 30 for an insertion of the bolt 33 . the first support block 71 is axially formed with a thread hole 713 at the center thereof . the second support block 72 is a round basin - shaped structure and axially formed with a thread hole 721 in the closed end thereof . both ends of the screw 73 are screwed into the thread hole 713 of the first support block 71 and the thread hole 721 of the second support block 72 . the anti - slip block 74 is a round disk - shaped element to be engaged in the open end of the second support block 72 . the connecting portion 21 of the first tube 20 and the connecting portion 31 of the second tube 30 can substitute for each other , but the premise is that , the connecting portion 21 of the first tube 20 must be assembled to the first abutting mechanism 60 , and the connecting portion 31 of the second tube 30 must be assembled to the second abutting mechanism 70 . a positioning device 80 can be substituted for the above positioning device 50 . the positioning device 80 ( as shown in fig1 and fig1 ) includes a bolt 81 , two assistant sleeve elements 82 and two engaging abutting elements 83 . the outer diameter of the bolt 81 is smaller than the inner diameter of the positioning hole 24 of the first tube 20 . the bolt 81 is longer than the diameter of the second tube 30 , and each end of the bolt 81 is axially formed with a positioning concave 811 . each assistant sleeve element 82 is axially formed with a sleeve hole 821 at the center thereof . the inner diameter of the sleeve hole 821 of the assistant sleeve element 82 is greater than the outer diameter of the bolt 81 . one end of each engaging abutting element 83 is formed with a stopping flange 831 , and the other end is formed with a positioning protrusion 832 to be inserted into the positioning holes 24 of the first tube 20 , the positioning holes 42 of the assistant sleeve 40 and the positioning holes 34 of the second tube 30 . both ends of the bolt 80 are exposed outside the second tube 30 , so that the assistant sleeve elements 82 can be mounted on both ends of the bolt 81 by use of the sleeve holes 821 and abut against the outer wall of the second tube 30 . subsequently , the positioning protrusions 832 of the engaging abutting elements 83 are inserted into the positioning concaves 811 of the bolt 81 to let the stopping flanges 831 of the engaging abutting elements 83 abut against the assistant sleeve elements 82 , so that the positioning device 80 is substantially inserted into the positioning holes 24 of the first tube 20 , the positioning holes 42 of the assistant sleeve 40 and the positioning holes 34 of the second tube 30 . the aforementioned is the summary of the positional and structural relationship of the respective components of the preferred embodiment in accordance with the present invention . for a better understanding of the present invention , its operation and function , reference should be made to fig1 - 11 : after the first tube 10 , the second tube 30 and the assistant sleeve 40 of the extension mechanism 10 are assembled together , the positioning holes 24 of the first tube 20 can be moved in the second tube 30 by means of the assistant sleeve 40 . after the total length of the first tube 20 and the second tube 30 is adjusted to a proper length , the positioning device 50 ( please refer to fig2 - 3 ) is inserted into the positioning holes 24 of the first tube 20 , the positioning holes 42 of the assistant sleeve 40 and the positioning holes 34 of the second tube 30 , thus offering the function of easily adjusting the length of the extension mechanism 10 according to the requirements . after that , the first abutting mechanism 60 and the second abutting mechanism 70 are assembled to the connecting portion 21 of the first tube 20 and the connecting portion 31 of the second tube 30 of the extension mechanism 10 , respectively . the anti - slip block 63 of the first abutting mechanism 60 ( as shown in fig4 ) and the anti - slip block 74 of the second abutting mechanism 70 ( as shown in fig5 ) are used to enhance the required friction for abutting against the first tube 20 and the second tube 30 of the extension mechanism 10 . the present invention is called multi - functional support assembly , mainly because the support assembly of the present invention is suitable for many objects . there are several embodiments described as follows , such as hanger , basketball backstop , cylindrical sand bag , hammock , spherical sand bag and dartboard . as shown in fig6 , two extension mechanisms 10 are used together with a hanger . both ends of the hanger are assembled to the positioning holes 24 of the first tubes 20 of the two extension mechanisms 10 for hanging clothes . as shown in fig7 , the extension mechanism 10 is used together with a basketball backstop . the rear side of the basketball backstop is assembled to the positioning holes 24 of the first tube 20 of the extension mechanism 10 for playing basketball . as shown in fig8 , two extension mechanisms 10 are used together with a hanger and a cylindrical sand - bag . both ends of the hanger are assembled to the positioning holes 24 of the first tubes 20 of the two extension mechanisms 10 for hanging clothes . the cylindrical sand - bag is positioned to the positioning holes 24 of the first tube 20 of one of the extension mechanisms 10 by means of two clamping elements and a support element for playing boxing . as shown in fig9 , two extension mechanisms 10 are used together with a hammock . both ends of the hammock are assembled to the positioning holes 24 of the first tubes 20 of the two extension mechanisms 10 for supporting a human body . as shown in fig1 , an extension mechanism 10 is used together with a spherical sand bag . the spherical sand bag is positioned to the positioning holes 24 of the first tube 20 of the extension mechanism 10 by means of two clamping elements and a support element for playing boxing . as shown in fig1 , an extension mechanism 10 is used together with a dartboard . one side of the dartboard is assembled to the positioning holes 24 of the first tube 20 of the extension mechanism 10 for darting . the above hanger , basketball backstop , cylindrical sand bag , hammock , spherical sand bag and dartboard can be used together with at least one extension mechanism 10 . to summarize , the structure disclosed by the present invention can quickly offer a multi - function object for use by assembling the most simplified structures , substantially having the advantage of wide application range . while we have shown and described various embodiments in accordance with the present invention , it is clear to those skilled in the art that further embodiments may be made without departing from the scope of the present invention .	5
fig3 illustrates an improved version of the tension sensing means 60 shown in fig2 . conventionally , to allow for optimum use of the length of the tailgate or return end or station 51 , a wear strip 101 is installed to guide the conveyor 16 down to the track or race 54 a level . the tensioning means , or tension sensor 104 , of fig3 , comprises a wear strip 101 including a wear plate 108 that contacts the top surface of the conveyor 16 . the wear plate 108 is supported by a wear strip support 112 , and the wear plate 108 is connected to the wear strip support 112 by a pin 116 at one end and a load - sensing pin 120 at the other end . the wear plate 108 engages the top surface of the conveyor 16 , and changes the path or trajectory of the movement of the conveyor 16 . this contact and change in direction of the conveyor 16 causes a force to be applied on the wear plate 108 . the load - sensing pin 120 that connects the wear plate 108 to the wear strip support 112 senses this force . the output from the load - sensing pin 120 is then be used to determine the tension of the conveyor 16 , and to adjust the tension , as needed , using any conventional chain tensioning system , such as the joint 48 and pistons 32 and 34 and circuitry of fig1 . an alternate and preferred embodiment 124 of the tension sensor is illustrated in fig4 . in fig4 , a load cell 128 is located between a wear plate 132 and a wear strip support 136 . the load cell 128 , which is illustrated in fig6 , is a cylinder including a plurality of spaced apart passageways 130 through the cylinder . within the passageways are load sensors ( not shown ), which measure the compression force on the load cell 128 . by placing the load cell 128 between the wear plate 132 and the wear strip support 136 , the load cell 128 responds to the force applied to the wear plate 132 by the conveyor 16 . in order to provide redundancy , as shown in the preferred embodiment illustrated in fig4 , two spaced apart load cells 128 are placed between the wear plate 132 and the wear strip support 136 . more particularly , the wear strip support 136 includes a cavity 138 that receives the load cells 128 , and the wear plate 132 is connected to the wear strip support 136 by means of a screw 140 . fig5 illustrates a perspective view of the load sensor 124 mounted on the conveyor apparatus 10 at the return end 51 . as shown , the cavity 138 receiving the load cells 128 can be formed by a plate 142 secured to the wear strip support 36 . this provides ready access to the load cells 128 from adjacent the conveyor apparatus 10 , without the need for significant disassembly of conveyor parts . this thus permits ready access and repair of the tension sensor 124 , when the need arises . the disclosure also illustrates , in fig7 , the providing of two such tension sensors on such a conveyor apparatus 10 . more particularly , in this embodiment , the conveyor 16 includes the two spaced apart chains 18 , and the plurality of flights or flight bars 20 that are connected and spaced apart but between the two chains 18 . each conveyor flight 20 has a first end and a second end . each flight bar end is spaced apart from its respective adjacent chain . a tension sensor , such as the tension sensor illustrated in fig2 , 3 and 4 above , is provided in a respective wear strip for each one of the two conveyor chains 18 . each tension sensor 124 is electrically connected via a line 154 to a comparator 158 . in the preferred embodiment , as illustrated in fig7 , the part of the conveyor that contacts the tension sensor 124 is the end or tip of the flight bar 20 . in other embodiments , not shown , a tension sensor 124 can be placed above each of the chains , instead of the flight tips . the tip of the flight bar 20 will only contact the wear strip intermittently . as a result , the tension sensor 124 will only produce intermittent signals . to eliminate transient load spikes and to allow for the odd missing flight bar 20 , the tension sensor 124 collects a rolling average reading over 20 or so flight bars . as each flight bar tip passes along the load sensor , even at a constant chain tension , the signal varies due to the changing geometry of the system . the tension sensor 124 records the peak signal value as each flight bar 20 passes over the wear plate 132 . if the rolling average peak reading is too low , then the tension means moves the joint 48 to stretch the chain , or vice versa . the tension means is initialized by establishing a required peak signal value by stopping the conveyor with a flight bar under the sensor , fitting a temporary load transducer to the chain itself , and then moving the joint 48 to tension the static chain . when the chain is at the required tension , the tension sensor 124 stores the signal , and it is this signal value that the tension sensor 124 maintains while the conveyor is running . the above overview is a simplified version of the sensor signal management system , and applies to steady chain load increase or decrease during the coal cutting cycle . the tension sensor 124 must also deal with special events such as starting a full conveyor or the rapid unloading of a conveyor , like when the shearer stops cutting . collecting a rolling average signal cannot respond quickly enough to deal with these events , so advance action must be taken . for example , the sprocket is extended to significantly stretch the chain before loaded conveyor startup to prevent generation of slack chain . in the event of a chain break , the tension in the two chains 18 will be different . the outputs of the tension sensors 124 are compared by a comparing means , comparator 158 , and in the event of a significant difference , the operation of the conveying apparatus 10 can be stopped so the broken chain can be repaired . in the preferred embodiment , the tension sensors 124 are provided adjacent the top race of the return end of the conveyor apparatus . if additional sensors or sensing of the tension at other locations in the conveying apparatus is desired , other tension sensors 124 , in other locations , can be used . the use of the two tension sensors 124 is also beneficial , for the output from the tension sensors 124 can be averaged to produce a more accurate indication of overall conveyor tension . the comparator 158 forms a part of the chain tensioning system such as the joint 48 and pistons 32 and 34 and circuitry of fig1 . as illustrated in fig8 , an auxiliary or secondary conveyor 200 is located at one end of a conveyor apparatus 210 . the material on the conveyor 16 leaves the conveyor and is dumped onto the auxiliary conveyor 200 . during operation of the conveyor apparatus 210 , the location of the conveyor apparatus 210 may move relative to the location of the auxiliary conveyor 200 . currently , operators need to make various adjustments in order to try to accommodate such movement . this can result in difficulty maintaining conveyor operation . the improvement in this disclosure is , in order to accommodate some movement of the conveyor apparatus 210 relative to the auxiliary conveyor 200 , the conveyor apparatus frame accommodates sliding movement at both ends . at one end , the sliding movement adjusts the tension of the conveyor 16 , and sliding movement at the other end accommodates movement of the conveyor apparatus 210 relative to the auxiliary conveyor 200 . if the conveyor apparatus 210 moves relative to the auxiliary conveyor 200 , an operator can move the sliding end of the conveyor 210 adjacent the auxiliary conveyor 200 . movement of the sliding end of the conveyor 210 can also be occasioned by the use of tensioning means , as described hereinafter , as used on the tensioning end 51 of the conveyor 16 . only in this instance , the movement is not intended to effect the tension of the conveyor 16 , but the location of the end of the conveyor apparatus 210 relative to the auxiliary conveyor 200 . when movement at this end of the conveyor occurs , the chain tension does change , so the other end of the conveyor apparatus 210 is adjusted by the automatic tensioning means to return the conveyor 16 back to the appropriate tension . movement of the sliding end of the conveyor 210 adjacent the auxiliary conveyor 200 much overcome the maximum working chain tensions ( which are at there highest as these top chains reach this frame ; plus significant sliding friction due to the typical large size and weight of the main gate equipment . more particularly , a driven drum / sprocket 312 is appropriately coupled to a conveyor drive motor 322 . operation of motor 322 causes the sprocket intermeshing with the dual chains 18 to advance the conveyor 16 . more particularly , as illustrated in fig8 and 11 , in addition to the hydraulic pistons 32 and 34 spanning the joint 48 at the return end 51 , a pair of sidewalls 324 forming a first portion of a “ split frame ” of the main gate end of the conveyor apparatus serves to rotatably support the drum / sprocket 312 . the sidewalls 324 are illustrated as being telescopingly engaged with a second pair of sidewalls 326 forming a second portion of the frame and , which collectively with sidewalls 324 , comprise the aforementioned split frame . the telescoping joint , indicated generally by character numeral 348 , permits the frame portions to be moved relative to one another . relative movement at the joint 348 between the adjacent sidewalls 324 and 326 thus causes the distance span between the drum / sprockets 312 and 14 to vary accordingly . the conveyor 16 can be provided with increased or reduced tension depending upon the direction of adjusting movement of the supporting drum / sprockets with respect to each other . to provide this relative movement , the conveyor assembly 310 has a pair of hydraulic cylinders 328 and 330 , each mounted on and secured to an adjacent sidewall 326 . the cylinders have respective pistons 332 and 334 , each of which is operatively coupled to a sidewall 324 in any known and expedient manner . the location of the conveyor apparatus relative to the auxiliary conveyor is further illustrated in fig9 . if desired , in lieu of operator correction of the location of the conveyor apparatus , the conveyor apparatus can be physically connected by a bar 352 to the auxiliary conveyor . in this instance , tension is maintained at this end of the conveyor by some tensioning means , such as the tensioning means previously described . but in order to accommodate some movement in the event the auxiliary conveyor and main conveyor change location , either a hydraulic accumulator ( now shown ), or some relief valve ( now shown ) must be provided in the hydraulic tensioning means in order to allow for the movement of this sliding end of the conveyor apparatus 210 . when this end of the conveyor apparatus 210 adjusts by movement of the auxiliary conveyor 200 , then tension is corrected , as described before , by the return end 51 . the problem of conveyor apparatus movement relative to the auxiliary conveyor is especially relevant where a pair of conveyor apparatus is used . as illustrated in fig1 a and 10 b , it is known to use one conveyor adjacent a coal face , and a second conveyor apparatus behind the roof supports to collect coal that falls from the longwall roof as the longwall advances . in this instance , the double sliding frame ends would be used with both conveyor apparatus . additionally the frame - sliding 48 and 348 can be adjusted to correctly align the conveyor end with both edges of the coal block , moving both the return end frame and delivery end frame at the same time to maintain correct chain tension during this adjustment . this would not be a normal requirement or mode of operation as the position of the return end frame to coal block is less critical in most cases . this aspect of the disclosure thus has the following benefits . manual or automatic control of the delivery end frame sliding module makes fine adjustments for optimum discharge of material from the extendable longwall armored face conveyor to the cross beam stage loader conveyor . since the changes in the overall length of the conveyor , as a result of adjusting the delivery end sliding frame module will change the chain tension , adjustments must be in small increments and effected slowly to give the automatic chain tensioning system time to react . at all times it is the automatic chain tensioning system that controls and maintains correct chain tension , not the adjustment of the delivery end frame module . various other features and advantages of the disclosure will be apparent from the following claims .	1
the following description describes embodiments of a technique to handle sensors in a context aware platform . in the following description , numerous specific details such as logic implementations , resource partitioning , or sharing , or duplication implementations , types and interrelationships of system components , and logic partitioning or integration choices are set forth in order to provide a more thorough understanding of the present invention . it will be appreciated , however , by one skilled in the art that the invention may be practiced without such specific details . in other instances , control structures , gate level circuits , and full software instruction sequences have not been shown in detail in order not to obscure the invention . those of ordinary skill in the art , with the included descriptions , will be able to implement appropriate functionality without undue experimentation . references in the specification to “ one embodiment ”, “ an embodiment ”, “ an example embodiment ”, indicate that the embodiment described may include a particular feature , structure , or characteristic , but every embodiment may not necessarily include the particular feature , structure , or characteristic . moreover , such phrases are not necessarily referring to the same embodiment . further , when a particular feature , structure , or characteristic is described in connection with an embodiment , it is submitted that it is within the knowledge of one skilled in the art to affect such feature , structure , or characteristic in connection with other embodiments whether or not explicitly described . embodiments of the invention may be implemented in hardware , firmware , software , or any combination thereof . embodiments of the invention may also be implemented as instructions stored on a machine - readable medium , which may be read and executed by one or more processors . a machine - readable medium may include any mechanism for storing or transmitting information in a form readable by a machine ( e . g ., a computing device ). for example , a machine - readable medium may include read only memory ( rom ); random access memory ( ram ); magnetic disk storage media ; optical storage media ; flash memory devices ; electrical , optical , acoustical or other similar signals . further , firmware , software , routines , and instructions may be described herein as performing certain actions . however , it should be appreciated that such descriptions are merely for convenience and that such actions in fact result from computing devices , processors , controllers , and other devices executing the firmware , software , routines , and instructions . fig1 is a block diagram of an example network suitable for implementing a method for secure exchange of context data between users and devices , in accordance with one example embodiment of the invention . in one embodiment , network 100 may comprise secure exchange engine 102 , cloud network 104 , context data 105 , devices 106 , 108 and 110 , and web applications 112 , 114 and 116 . devices 106 , 108 and 110 may include applications 118 , 122 and 126 and sensors 120 , 124 and 128 , respectively . in one embodiment , a user of device 106 may subscribe to a service for securely exchanging context data between users and devices , which may be implemented by secure exchange engine 102 . secure exchange engine 102 may represent hardware or software or a combination of hardware and software residing anywhere within cloud network 104 , which may represent the internet or a local network . devices 106 , 108 and 110 may represent any type of computing or communication or entertainment device including , but not limited to phones , laptops , desktops , netbooks , tablets , set - top boxes , etc . the user of device 106 may register device 106 along with other devices and / or web applications among which the user authorizes the exchange of context data . in one embodiment , the user may authorize the exchange of context data with web application 112 , but not web application 114 . in one embodiment , the user may authorize the exchange of context data with web application 116 only when a particular mode is active , for example a shopping or tourist mode , but not when a normal mode is active . the user may also limit the types and amount of access provided to other devices or users . for example , device 108 may also belong to the user of device 106 and may have more permission to context data than device 110 , which may belong to a different user . in one embodiment , context data 105 is generated by sensors 120 and communicated over the internet to secure exchange engine 102 . the generation of context data 105 may indicate a location , activity level , mood , schedule , desire or any other context information of device 106 or its user . in one embodiment , sensors 120 are handled according to patent application ser . no . 12 / 340 , 516 , entitled , “ handling sensors in a context aware platform ,” filed dec . 19 , 2008 , which is herein incorporated by reference in its entirety . after receiving context data 105 , secure exchange engine 102 may selectively forward context data 105 without user input based on permissions previously established by the user of device 106 . for example , secure exchange engine 102 may forward context data 105 to device 108 and web application 112 , based on the nature of context data 105 and the access levels of the various devices and applications . applications 118 may affect device 106 in response to actions taken by other devices or web applications in response to context data 105 . for example , applications 118 may display on a screen of device 106 information generated by web application 114 in response to context data 105 . applications 118 ( and 122 and 126 ) may include a proxy agent for managing connectivity to secure exchange engine 102 and synchronizing shared context data and access control policies between secure exchange engine 102 and the local device . this proxy agent may have constant network connection with secure exchange engine 102 for real - time synchronization or may only be occasionally connected , depending on the platform . an embodiment of the secure exchange engine 102 , which may support secure exchange of context data between users and devices is illustrated in fig2 . in one embodiment , the secure exchange engine 200 may comprise application programming interface ( api ) 202 , registration interface 204 , control logic 206 , access permissions and modes 208 , and memory 210 . api 202 allows provisioned devices to discover context data available from peer devices , access and update existing context data , and manage account settings . api 202 may be exposed in both a representational state transfer ( restful ) and near - real - time variant . the former may enable simple integration with third party web services and occasionally connected devices , while the latter may enable scenarios where up - to - the - second sharing is necessary . in one embodiment , all communications with secure exchange engine 200 uses mutually authenticated secure connections to protect data in transit and ensure that all access control policies are properly applied . in one embodiment , secure exchange engine 200 is authenticated using transport layer security ( tls ) and clients are authenticated using oauth . registration interface 204 allows a user to add and remove devices from their accounts , control data retention policies , and configure access control policies for sharing among their devices and other users . registration interface 204 may edit and store policies as permissions and modes 208 , where permissions represent the limits as to type , duration and other limits of access to context data for a device or application . modes provide an opportunity for a user to quickly change to an alternate pre - established set of permissions . control logic 206 may allow secure exchange engine 200 to implement a method for secure exchange of context data between users and devices , for example as described in reference to fig4 . control logic 206 may represent any type of microprocessor , controller , asic , state machine , etc . control logic 206 may provide secure exchange engine 200 with the ability to receive context data 105 . control logic 206 may utilize cloud network 104 to broadcast context data to authorized devices and applications . in one embodiment , control logic 206 compares context data 105 with access permissions and modes 208 to develop an authorized broadcast list . in another embodiment , control logic 206 makes context data available for pulling by authorized devices and applications . in one embodiment , memory 210 is present to store ( either for a short - term or a long - term ) context data to be pushed to , or pulled by , authorized devices and applications . fig3 is a flow chart of an example method of establishing context data permissions , in accordance with one example embodiment of the invention . in block 302 , registration interface 204 of secure exchange engine 200 may authenticate a user . in one embodiment , a secure login is provided . in one embodiment , a secure network link with a device associated with the user is established . in block 304 , registration interface 204 of secure exchange engine 200 may allow the user to register devices and applications to send and / or receive context data . in one embodiment , device 108 may be registered to only receive context data from device 106 , but not to share any of its own context data . in block 306 , registration interface 204 of secure exchange engine 200 may allow the user to limit access for authorized devices and applications . in one embodiment , a web application may be allowed to receive only certain types context data , for example just location information . in block 308 , registration interface 204 of secure exchange engine 200 may allow the user to associate alternate permissions with a mode setting . in one embodiment , a web application may be allowed to receive context data only when a certain mode , for example a tourist mode , is active . fig4 is a flow chart of an example method implemented by a secure exchange engine , in accordance with one example embodiment of the invention . in block 402 , control logic 206 of secure exchange engine 200 may implement the policies and procedures of the secure engine . in block 404 , control logic 206 waits for the arrival of context data 105 . in one embodiment , context data 105 may come from sensors 120 . in one embodiment , context data 105 may come from applications 118 . in block 406 , after context data is received , control logic 206 may determine devices and applications with permission to receive the context data . in one embodiment , control logic 206 compares the context data 105 to the current access permissions and modes 208 to determine the authorized web applications and devices . in block 408 , secure exchange engine 200 may selectively forward the context data to authorized web applications and devices . in one embodiment , api 202 is used to broadcast the context data to authorized web applications and device applications . in one embodiment , api 202 makes the context data available for downloading by authorized web applications and device applications . fig5 is a block diagram of an example storage medium including content which , when accessed by a device , causes the device to implement one or more aspects of one or more embodiments of the invention . in this regard , storage medium 500 includes content 502 ( e . g ., instructions , data , or any combination thereof ) which , when executed , causes the system to implement one or more aspects of methods described above . the machine - readable ( storage ) medium 500 may include , but is not limited to , floppy diskettes , optical disks , cd - roms , and magneto - optical disks , roms , rams , eproms , eeproms , magnet or optical cards , flash memory , or other type of media / machine - readable medium suitable for storing electronic instructions . moreover , the present invention may also be downloaded as a computer program product , wherein the program may be transferred from a remote computer to a requesting computer by way of data signals embodied in a carrier wave or other propagation medium via a communication link ( e . g ., a modem , radio or network connection ). although embodiments of the present invention have been described with reference to a number of illustrative embodiments thereof , it should be understood that numerous other modifications and embodiments can be devised by those skilled in the art that will fall within the spirit and scope of the principles of this invention . more particularly , reasonable variations and modifications are possible in the component parts and / or arrangements of the subject combination arrangement within the scope of the foregoing disclosure , the drawings and the appended claims without departing from the spirit of the invention . in addition to variations and modifications in the component parts and / or arrangements , alternative uses will also be apparent to those skilled in the art . certain features of the invention have been described with reference to example embodiments . however , the description is not intended to be construed in a limiting sense . various modifications of the example embodiments , as well as other embodiments of the invention , which are apparent to persons skilled in the art to which the invention pertains are deemed to lie within the spirit and scope of the invention .	6
the present invention comprises a dice game which is capable of ( 1 ) providing similation of a regular dice cube bearing pips on it from one to six in number and ( 2 ) causing the display pips to change from one to six in a random and realistic manner which indicates to players that dice are being rolled . this invention uses transistors and integrated circuits . it was determined that so as to make a realistic presentation of the dice that it would be necessary to illuminate seven pips rather than six since the one or ace must be in the center of the pseudo die to give a realistic appearance . the display determines what the entire logic package requires and the circuitry and design were arranged to give this desired display . fig1 illustrates in block form the overall system and apparatus including the display and dice control cabinet 11 on the face which are mounted the dice display 21 through 30 with 5 in the lower row and 5 in the upper row . this unit is also shown in larger scale in fig2 . as shown in fig2 each of the dice 21 through 30 are provided with seven pips which can be illuminated with light emitting diodes led . a push button roll activator button 31 starts the dice to roll . each of the dice has a lock out or hold switch 41 through 50 which will cause the dice to hold or retain its present indication during the next roll if such hold or lock out switch 41 through 50 associated with each of the dice 21 through 30 is depressed . indicators such as leds 61 through 70 are mounted adjacent the dice 21 through 30 . a number of integrated circuits 81 cause the dice 21 through 30 to be illuminated in a random manner such that one or more of the seven pips are lighted . a number of random generators 82 supply inputs to the die logic circuit 81 and these random generators are activated by a series of ten roll circuits 83 which consists of integrated circuits . the roll switch 31 is shown in three places in fig1 and is connected to the roll circuits 83 as well as the roll count lock out circuit 86 . lock out circuit 84 is connected to the circuits 83 and the console 11 and it prevents a specific die 21 through 30 which has been selected to be locked out or held from changing during the next roll . the roll / counter lock out 86 operates in a manner such as to permit 1 , 2 , 3 or more pressings of the roll switch 31 and no more and is preset by a maintenance man or at the factory . fig2 is an enlarged detailed view of the hand held dice control display unit 11 . it includes a special slide switch 96 which is also shown in fig3 and is arranged so that it can activate the required number of dice needed for a specific game and it can select two , five or ten dice . as illustrated in fig3 as the switch 96 is moved downwardly , its contact 97 continues to engage the grounded contact 98 and in the first position illustrated in fig3 the switch 96 is off so that none of the dice are energized . when the switch is moved down to the first position so that contact 97 engages the contact 99 and the lead 102 connected so the dice 22 and 23 will be grounded through the contact 97 and 98 and the dices 22 and 23 will be energized . this position is used for the game of craps , for example . if the contact 97 is moved down to the third position , the contact 97 will engage contacts 98 , 99 and 100 and the leads 102 and 103 will be grounded so the five dice 21 through 25 will be energized . in the fourth position , the contact 96 will engage the contacts 98 , 99 , 100 and 101 and the leads 102 , 103 and 104 will be grounded so all ten dice will be energized . a switch 94 turns on lier &# 39 ; s dice and indicators 91 , 92 and 93 respectively indicate the number of rolls as , for example that 1 , 2 or 3 rolls have occurred . a reset switch 32 allows reset for certain games . fig4 illustrates the circuitry required for one single die . an integrated circuit type 7476 uses three sections of j - k flip - flop circuits 117 , 118 and 119 which are connected as shown and are driven by a suitable clock pulse on lead 116 and are interconnected with three sections of or gates 110 , 111 , 112 connected as shown . two sections of nand gates 113 and 114 which may be formed of a integrated circuit type 7400 are connected as shown and a one section and gate 115 connected as shown are connected so as to drive the pips of the dice as , for example , the die 21 . it is noted that each of the die has seven pips and all of the elements are clocked or pulsed by a series of randomly generated pulses arriving at lead 116 which is the clock input to a 7476 dual j - k flip - flop integrated circuit . since there are ten dice which are to be driven and two sections of j - k flip - flop are obtainable in a single integrated circuit 15 model 7476s will be required to operate the entire ten dice . the pips on the dice 21 will be energized in rotation going through the complete cycle of six numbers one by one for as long as the pulses arrive from the random generators 82 . fig5 a and 5b illustrate a bounce free ( no squitter ) switch 42 which is used to provide a single squitter - free pulse to the clk circuitry of the roll control circuits after a choice of a number has been selected . the circuits consist of two sections of a 4049 hex inverter buffer 124 and 125 . for ten bounce free activating switches 42 four integrated circuits type 4049 are required but four invertor segments per game will not be utilized . the switch 41 is for die number 21 , the switch number 42 is for die number 22 , switch number 43 is for die number 23 , the switch 44 is for die number 24 , the switch 45 is for die number 25 , and the switch 46 is for die number 26 . the gates 128 and 129 are connected to die 21 . the gates 127 and 130 are connected to die 22 , and the gates 123 and 126 are connected to the die 23 , etc . fig6 a illustrates the random number generator 150 which can be an integrated circuit type 555 and it produces a series of pulses 151 as long as the roll switch 31 supplies vcc voltage to the 555 timers that are used . resistor r1 connected between pins 3 and 6 on the integrated circuit 150 is used to provide a realistic appearance of the rolling dice on the seven pips of each die . it has been determined that values of 150 , 000 to 180 , 000 ohms for resistor r1 operates satisfactorily . if the value of this resistor is too large , then the led pips will appear continuously to be lighted while if the value is too small the rate of roll of the dice will be slow and the die number can to some extent be controlled . the value for resistor r1 given above allows the dice to appear to roll and yet cannot be stopped on any one number . fig6 b shows the interconnections of the pips on the dice as , for example , the dice 21 . the pips are lettered t , u , v , w , x , y and z and the leads 174 , 173 , 172 , 171 are connected as shown . pips are also numbered 161 through 167 as shown . the pip 167 ( w ) is used for rolling a one , a three or a five but is not used in 2 , 4 or 6 . the t z pips are used for 2 , 3 , 4 , 5 or 6 . pips u and v are used solely for generating six and lead 174 is used in generating a six , a four and a five but is not used for generating a two or a three . fig6 c illustrates an external charging circuit of conventional design which can be used when a battery operated unit is to be utilized which uses a battery e and has a negative terminal 179 and a positive terminal 176 . when the battery e is to be charged a plug 177 is connected to the battery leads 175 , 179 to charge it . fig7 illustrates the circuit for driving the lock out indicators 61 through 66 which are connected to an integrated circuit 301 which may be a type 7474 and a hex non - inverting buffer 181 which may be a type 4050 . dropping resistors and green colored led 61 through 66 can be used . when the roll circuit 150 is clocked out by switch 31 , the not - q or negative outputs of the ic7474 301 goes low activating the leds 61 through 66 for that particular lock out switch . since these leds remain out at other times or when rolling dice or until the lock out selection is made and this is interlocked with the roll circuitry the associated die will be able to be rolled as long as the green lock out led 61 through 66 is out and it cannot be rolled if the associated led 61 through 66 is lighted . fig8 illustrates the interlocking of the roll system . the integrated circuit 180 which can be a dual flip / flop type 7474 can be cleared by reset switch 32 which drops the inputs on pins 1 and 13 concurrently on each and all integrated circuits to ground . this places vcc on pins 5 and 9 which are q1 and q2 at a value of vcc which is supplied to integrated circuit 182 which may be a type 4066 quad bilateral analog switch connected so as to turn off the roll voltage normally coming through the contacts of the roll switch 31 and the resting closed circuit of the vcc input pins of the integrated circuit type 555 timers on one of the random generators of which there are a total of ten circuits . it is to be noted that after the reset pin 4 and pin 10 of the 4066 vcc voltage each time the dice are rolled by pressing the roll switch 31 unless contacts 310 and 311 are opened . the dice will then cycle rapidly through pips 1 - 6 and stop on one of these configurations when the roll dice switch 31 is released . this takes place only if the q1 and q2 outputs on the d flip - flop 180 is high at application of voltage vcc . if however the lock out circuit is implemented by the type 4049 hex inverter buffer integrated circuit 181 being locked out by lock out switch 41 the d flip - flop will flip and q1 and q2 will go low towards or near ground and pins 4 and 10 of the integrated circuit 182 type 4066 will open and that particular dice will no longer be rolled . the rest of the dice not locked out will behave normally and can be rolled by pressing the roll switch 31 . it is necessary to make use of a bounce - free switch which is implemented by two sections of the quad type 4049 integrated circuit 181 . once locked out , the 7474 integrated circuit 180 will stay at ground on q1 and q2 until the reset 32 is pressed . fig9 illustrates a part of the circuitry for the refinement of the overall system which makes use of an integrated circuit to provide a roll interrupt circuit coupled to a series of indicators showing the roll count to prevent the use of an illegal number of rolls that is more than the particular game in use allows . coupled to the roll switch 31 through resistors and capacitors shown is another type 555 integrated timer circuit 222 which has a different configuration than the other 555 circuits and is designed to provide a single ten millisecond pulse each time the roll switch 31 is depressed . this is done by using a separate section on the roll switch . the single pulse from the 555 pulse generator 222 is supplied to a type 4017 counter / divider integrated chip type 4017 , number 220 in a count and hold circuit . it has a &# 34 ; x &# 34 ; limit as to the count permitted may be set from 0 to 9 by simple circuit changes . in the invention , a count of three was chosen and when the game is activated none of the indicators 91 , 92 or 93 are lighted . when the roll switch 31 has once been depressed signifying one roll , than light 91 will be illuminated . when the roll button 31 has been pressed a second time , the dice will roll and the indicator 92 will be lighted . when the roll switch 31 is pressed a third time , the dice will roll and the light 93 will be lighted . if the roll switch 31 is pressed again , the dice will not roll and all the lights 91 , 92 and 93 will go out . since after the third roll , the close out voltage generated at pin 10 of the integrated circuit 220 will open the contacts of the adjacent 4066 decade counter / divider integrated circuit type 4066 across contacts 310 and 311 shown in fig8 . this circuit prevents any more transfer of energy for rolling through the 4066s to the random generators . when the reset switch is pressed for other circuitry , a separate section on switch 31 resets 220 the 4017 decade counter / divider by dropping it back to zero for the next player and game . if the game of craps is played , the roll counter and interrupt circuitry is bypassed since an unlimited number of rolls is permitted in craps until certain external events take place . all other games in the present invention permit only three rolls and hence this is the present setting . it is to be realized of course that other number of rolls can be set . it is to be noted that if a player tries to take a fourth roll all the counter lights go out indicating that he has attempted to cheat . fig1 illustrates a possible configuration of the invention where a central computer unit 250 is connected to units 251 through 254 for different players so that they might play . fig1 illustrates a video presentation display 255 which is connected to player consoles 256 and 257 . there are many games which can be played on dice man , such as &# 34 ; craps &# 34 ;, &# 34 ; hi - lo &# 34 ;, &# 34 ; ship - captain - crew &# 34 ;, &# 34 ; poker &# 34 ; or &# 34 ; liars dice &# 34 ;. once the dice man box is set to the selected game the lights will be lighted properly for that game , and the roll counter preset accordingly . all that is then needed is to proceed with the game according to its &# 34 ; rules of play &# 34 ;. as many players as wish may play at once but one player is the shooter &# 34 ; who is selected &# 34 ; each player rolling two dice for high point . the one with the highest point plays first , and the roll advances around clockwise from him after he has lost it , and in order . the shooter then places some sum of money in front of him and announces the amount . this is his center bet and each other player is invited to fade it , or any part of it . the players may share it amongst them . the shooter is betting to win and the faders are betting he will lose . the shooter then presses the roll button and releases it when he is satisfied that the dice are rolled enough . two dice will be lit with a number from one to six . this is the shooter &# 39 ; s point . if seven or eleven appears on the first roll , the shooter wins . if two ( snake - eyes ), or three ( craps ), or twelve ( again craps ), appears the shooter loses . the shooter retains the roll , however , in both the above 3 cases , settles his bets and continues to roll again . points - if the shooter &# 39 ; s first number with two dice that appear is four , five , six , eight , nine or ten the bets are not settled and the shooter must roll again to settle the bet . if on the roll the shooter gets the same point before he gets a seven , he wins , collects his bet and puts out another new bet , and proceeds as before . if he rolls a seven before he rolls his point , the shooter loses and his opponents collect the bet and the next player on the left accepts the roll and places his bet , etc . if the current shooter choses after his roll of a winner he may settle his bets and voluntarily pass the roll to the next player . when the shooter wins it is known as a pass ; when he loses it is known as a miss . any number may play , each having one turn . the dice are rolled by pushing the roll button . in his turn the player may roll the dice once , twice or three times . his object is to get the best possible poker hand . the hands rank : five of a kind ( high ), four of a kind , full house ( three of a kind and a pair ), three of a kind , high straight ( two to six ), low straight ( ace , now counted as one - to five ), two pair , one pair , high card . ties are broken by rolling again , after an additional bet is placed in the pot . ( center of table ). after his first roll ( pushing the roll button ) player may lock - out any of the five dice displayed by pushing the lockout button under the dice . a green lite will come on showing that that number is locked - out and it will not roll again when the roll button is pushed . after his second roll the player may do as above ; i . e . select one or more dice to be held by pushing the lock - out button under the dice so chosen . the third roll determines his final hand , and all numbers should be locked - out . the roll counter will go out if the roll button is pushed for the fourth time but no dice will roll after the third roll is taken . after any roll ( first , second et al ) the player may choose to stay on the count shown -&# 34 ; stick with these &# 34 ;, and he should lock - out all dice . there is no penalty or bonus for making a selected hand in one or two rolls . the highest hand wins , in accordance with the above ranking of hands . if hands tie each of the players of these hands rolls again but not the non - tiers , one ranks as an acehigh for all hands except a low straight where it counts as a one . five dice are used , and any number may play . each player in turn has a maximum of five rolls . from each roll , he must keep at least one die , which he does by locking - out that die by pushing the button underneath that die . he may , of course , keep as many as he chooses or he may roll the remaining dice again , up to a total of three rolls . at each roll the roll counter will change from a yellow to green to red and on the fourth will go out , but it will not roll after the third roll , i . e . only three rolls may be taken . after the first roll the roller decides to &# 34 ; go high &# 34 ; or &# 34 ; go for low &# 34 ; and must stick with this decision . after any roll the player may stick with his roll and announce to the other players , after locking out the dice ( all five ), that he made &# 34 ; x x x &# 34 ; in one roll or two rolls , or &# 34 ; all the way &# 34 ; three rolls . the roll then passes to the next player , and he tries to beat the first player &# 39 ; s high or low score in the same number of rolls . e . g . if the first player made 29 in two rolls , the second player must make more than 29 in two rolls to win . if the first player announces &# 34 ; going for low &# 34 ; and makes 14 in one roll the second player must make less than 14 in one roll . the roller may stand at any time on any count and announce it to the other players for bettering . if any two players tie , they play another game amongst themselves to determine the winner . in this game , hi - lo dice is played with five ( 5 ) dice . in liar &# 39 ; s dice as in poker , it is possible for the inferior hand to win . in fact of all the dice games based on poker hands this is the only one that allows for play comparable with the card game . two players play , having five dice and a separate dice man cassette each . these are interconnected via hard wire to a central computer , which &# 34 ; deals &# 34 ; out the dice and keeps score ; as well as several other things . neither player should be able to see the other &# 39 ; s dice man cassette . after each roll the entire five dice are read as a poker hand on the bottom series of dies in the hand held cassette of the roller . ace ranking high - above the six , in every combination except straights where it always ranks below the two ( deuce ). the rank of hands are : five of a kind ( high ), four of a kind ; full house ; high straight ( 6 high ); low straight ( 5 high ); three of a kind ; two pair ; one pair ; high card . to begin a game , each player presses the roll button and counts the total of his pips ( as in hi - lo ). the highest number of points wins and rolls first . he is then the &# 34 ; caller &# 34 ;. the winner of each roll becomes the caller and rolls first , in the next game . a game is two of three &# 34 ; deals &# 34 ;, or four or as agreed upon including a single &# 34 ; deal &# 34 ;. to begin a &# 34 ; deal &# 34 ; both players press the roll button and when satisfied that the roll is long enough ( the dice have been shaken enough ) lets it go and a series of five dice numbers will appear on the lower set of dice . the caller may then say he is satisfied by pressing the &# 34 ; ok &# 34 ; button which will light a green lite on his opponents cassette . if the white light lights on the opponents cassette the opponent may elect the same alternate . if either one is satisfied the &# 34 ; deal &# 34 ; is played out . if both are dissatisfied , which will be shown by a red light instead of a green &# 34 ; go ahead lite &# 34 ;, the cassette is reset by pushing the replay button . the caller may pass the buck by saying &# 34 ; either way &# 34 ; by pushing the no choice button which will light a yellow lite on the opponents cassette . the opponent may then decide to play or not and pushes the &# 34 ; go ahead &# 34 ; button or the replay button as desired . when the first roll stands , the caller must announce his ( supposed ) hand , which must first be indexted in by pushing the separate buttons above upper dies in turn , i . e . number one dice , number two dice , etc . these will slowly roll from 1 to 6 and when the die desired is gotten the roll button should be released and the &# 34 ; lock - out &# 34 ; button under that dice pressed . this will &# 34 ; preserve &# 34 ; that selection . the next dice is then selected in a similar manner until all five dice are chosen to make up the hand desired ; e . g . four aces , full house , two pair , et al . once the real hand is chosen and the liar &# 39 ; s hand selected in and all are locked - out the &# 34 ; display hand &# 34 ; is pressed and the liar &# 39 ; s hand , the top row of dice will appear on the opponents cassette but not the real hand . the central computer will also record the twohands , into memory . the cardinal rule of the game is that a player may announce any hand he pleases , regardless of what his roll actually is . he does this by choosing 5 die in the top row and locking these in and transmitting them to his opponent . in reply to any such announcement the other player ( the opponent ) must do one of two things : push the liar button on his cassette or ( 2 ) announce a higher hand . the act of pushing the liar button is saying &# 34 ; i don &# 39 ; t believe you and i call your bluff . if he has a as good or better then announced the player who called &# 34 ; liar &# 34 ; loses , but if it is inferior , he loses . each player is entitled , after his first roll , to make two additional rolls , of some or all of his dice . for example , having rolled 4 , 4 , 2 , 5 , 6 he may save the pair of 4 &# 39 ; s by pressing the lock - out underneath those two dice , and roll the other three dice by pressing the roll button again , and so on . at the end of three rolls the count lites will go blank and no more rolls will be possible ( the roll button is disabled ). if on the second roll the player gets another four he may lock it out and roll the last two dice to try to better his &# 34 ; hand &# 34 ;. if the second player , when he receives his possible liar &# 39 ; s hand does not at once press the liar button he must call a high hand , but before he does so he is entitled to make one or both of his additional rolls ( having done so he may not change his mind and declare liar by pushing the liar button ). ship , captain , crew is played with the five dice array , which will automatically light when the cassette is set to ship , captain , crew . the roll button is pressed and five different die will lite on various numbers . the player must get a 6 before a five or four or any other number . this is the ship . if no ship is gotton on the first roll the dice must be rolled again and again ( up to a maximum of three times when the cassette will automatically lock - out ). once a 6 is achieved , the player must get a five which is the captain . then one may try for a 4 . once the ship , captain , crew is gotten and locked out any remaining dies are counted at face value and the amount is called the cargo . the highest amount of cargo wins , but first one must have a ship , to have a captain , to have a crew , to have some cargo . if on the first or second roll , ship , and a captain , or even a ship , a captain , and a crew is achieved , the player may lock these out and call off the amount of his cargo , or choose to roll the second or third time to get more cargo . he must have his 6 , 5 and 4 at all times before counting cargo . if the first player ( the caller and winner of the last game ) gets a good hand in one roll , or in two , he announces &# 34 ; cargo of seven &# 34 ; or &# 34 ; cargo of 3 , in one roll &# 34 ; or &# 34 ; cargo of three in two rolls &# 34 ;, and the second and all the following rollers must beat his score in the same number of rolls . the best hand would be three sixes a five and a four , since this would give the ship , the captain , crew plus a cargo of 12 in one roll . although the invention has been described with respect to preferred embodiments , it is not to be so limited as changes and modifications can be made which are within the full intended scope of the invention as defined by the appended claims .	6
with reference now to the drawings , and in particular , to fig1 thereof , the preferred embodiment of the new and improved reflective propeller safety cover embodying the principles and concepts of the present invention and generally designated by the reference number 10 will be described . specifically , the present invention includes four major components . the major components are the bag , drawstring , slide lock , and reflective tape strips . these components are interrelated to provide the function of preventing rear - end accidents when the present invention is secured over a propeller of a motorboat . more specifically , it will be noted in the various figures that the first major component is the bag 12 . the bag is formed of a fluorescent orange cloth material . the bag has a central axis and a generally circular flat bottom wall 14 and a side wall 16 integrally coupled to the periphery of the bottom wall . the side wall is extended from the bottom wall to terminate at an edge 18 . as shown in fig4 the bag has a fixed axial length as defined between the bottom wall 14 and the edge 18 along the central axis and an exterior diameter that is about 72 % greater than the fixed axial length . the side wall and bottom wall of the bag thereby define a hollow interior 20 . this interior is sized for holding the propeller of a motorboat . the edge of the bag thereby defines a mouth 22 . the mouth allows access to the interior of the bag for receiving a propeller . the edge of the bag is further turned back upon itself and secured to the side wall to create an annular channel 24 adapted to receive a drawstring therein . the side wall further includes a lower portion 26 and an upper portion 28 . the lower portion is located adjacent to the bottom wall and has a generally concave shape as referenced with respect to the interior . as shown by the cross section of the bag in fig6 the lower portion of the side wall has a larger radius of curvature than the upper portion of the side wall . the upper portion is positioned adjacent to the mouth and has a generally convex shape as referenced with respect to the interior . the side wail of the bag includes a generally rectangular aperture 30 disposed therethrough . this aperture allows the bag to be drained . this aperture also allows a propeller disposed within the interior of the bag to be air dried . the bag also includes a flap secured adjacent to the aperture and thus creates a door 32 . the door has a pair of parallel side edges and an end edge extended therebetween . the bag also includes a pile type fastener 34 secured about the periphery of the aperture and a complimentary pile type fastener 36 secured about the periphery of the door . the pile type fasteners are coupled together in one position to close the door and thus prevent access to the interior of the bag through the aperture . the fasteners are also decoupled from each other in another position to open the door and thus allow access to the interior through the aperture . the second major component is the drawstring 40 . the drawstring is elongated and flexible in structure and has two free ends . the drawstring is disposed within the channel 24 to thereby define an adjustable loop between the ends . the ends of the drawstring are extended from the channel at an adjacent location through the side wall . the loop formed by the drawstring is adjustable in a tightened configuration around the mouth for closing the mouth and thus preventing access to the interior of the bag . the loop formed by the drawstring is also adjustable in a loosened orientation for opening the mouth and thus allowing access to the interior of the bag . the third major component is the slide lock 50 . the slide lock is formed of an elastomeric type material . the slide lock is slidably secured to the free ends of the drawstring . the slide lock is slidable upon the drawstring and is used for setting and locking the adjustment of the loop in a tightened orientation or a loosened orientation . the fourth major component is the reflective tape strips 60 the present invention includes a plurality of reflective tape strips . the reflective tape strips are coupled to the bottom wall of the bag . the reflective tape strips provide a visual indication when light is shined thereupon to thereby indicate the presence of the bag . the present invention serves as a safety marker which attaches over the propeller of a motorboat when the motorboat is towed on a trailer for preventing rear - end accidents . the present invention resembles a cloth bag with drawstrings . the bag is of a florescent orange color so that it may be easily seen in daylight . light reflective tape is also stitched on or adhered to the bottom wall of the bag to reflect light from headlights so that it may be easily seen when driving at night . the present invention can be made in several sizes to accommodate various motor boat propeller sizes . to utilize the present invention , the mouth of the bag is opened and placed over a propeller of an outboard motor of a boat . the bag is then secured by pulling on the drawstrings to close the mouth around the propeller shaft . the slide lock is then pushed up against the bag to ensure that the bag stays securely coupled to the propeller . the drawstrings are then tied around the propeller shaft of the motor so that the present invention will not blow off when driving . simply untie the drawstrings , push back the slide lock , and remove the present invention before placing the motor in water . the present invention is very easy to apply and remove . the florescent orange color of the bag and reflective tape thereon make it highly visible at all times . the present invention effectively signals drivers who might not otherwise notice that the propeller protrudes dangerously from a towed trailer . the present invention signals drivers not to tailgate , thus helping to prevent rear - end accidents . as to the manner of usage and operation of the present invention , the same should be apparent from the above description . accordingly , no further discussion relating to the manner of usage and operation will be provided . with respect to the above description then , it is to be realized that the optimum dimensional relationships for the parts of the invention , to include variations in size , materials , shape , form , function and the manner of operation , assembly and use , are deemed readily apparent and obvious to one skilled in the art , and all equivalent relationships to those illustrated in the drawings and described in the specification are intended to be encompassed by the present invention . therefore , the foregoing is considered as illustrative only of the principles of the invention . further , since numerous modification and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described , and accordingly , all suitable modification and equivalents may be resorted to , falling within the scope of the invention .	1
as shown in fig1 , a clean release magnet according to the present invention , generally designated 10 , may include a clear pressure sensitive carrier layer 11 having a permanent adhesive ( not shown ) applied to the back surface thereof so as to enable permanent affixation of clean release magnet 10 onto any type of product or item . clear pressure sensitive carrier layer 11 may alternatively have a clean release adhesive ( not shown ) applied to its back surface , instead of the permanent adhesive . as shown in fig2 , a flexible magnet 12 may be affixed to the clear pressure sensitive carrier layer 11 with a clean release adhesive 13 . clean release adhesive 13 allows flexible magnet 12 to be peeled off or removed from clear pressure sensitive carrier layer 11 , without leaving a tacky or sticky residue on flexible magnet 12 or on the exposed surface of clear pressure sensitive carrier layer 11 . although layer 11 has been denoted as a clear pressure sensitive carrier layer , it should be evident that layer 11 may be clear , opaque or have printing thereon , or any combination thereof , as would be apparent to a skilled artisan . moreover , it should be apparent that magnet 12 may be flexible or rigid . referring to fig1 , a printed filmic face 14 may be adhered to flexible magnet 12 with an adhesive layer 15 to allow for either removable or fixed attachment to flexible magnet 12 . printed filmic face 14 may be made of conventional label stock , such as plain paper , embossed or glossy paper , pvc ( polyvinyl chloride ), pet ( polyethylene terephlatate ), or tyvek . clear pressure sensitive carrier layer 11 may be substantially coextensive with flexible magnet 12 and / or printed filmic face 14 or instead may be substantially smaller than flexible magnet 12 and / or printed filmic face 14 . as shown next in fig3 , clean release magnet 10 may be permanently attached onto a product 16 by the permanent adhesive ( not shown ) on the back of clear pressure sensitive carrier layer 11 . in use , clean release magnet 10 may be removed from product 16 and placed onto a metallic object ( i . e . a refrigerator ). as described above , it should be noted that when clean release magnet 10 is removed from clear pressure sensitive carrier layer 11 , the back side of clean release magnet 10 and the front side of clear pressure sensitive carrier layer 11 are non - tacky . referring next to fig4 , upon removal of clean release magnet 10 from product 16 , any pre - printed label 17 on product 16 is visible through clear pressure sensitive carrier layer 11 . alternatively , if layer 11 is opaque or has printing thereon , clean release magnet 10 may be removed from product 16 to reveal the printing on layer 11 . an alternate embodiment of clean release magnet 10 will now be described in detail . in the alternate embodiment of clean release magnet 10 , instead of using clear pressure sensitive carrier layer 11 as discussed above , as shown in fig5 , 3 - σ label stock may be used . 3 - σ label stock , generally designated 19 , consists of a standard label carrier 21 with a self adhesive backing layer 22 for permanent affixation to a product ( not shown ). the top of standard label carrier 21 has a clear film of dry - release glue 23 thereon disposed in a circular pattern 24 . it should be noted that dry - release glue 23 is present on all areas of the surface of standard label carrier 21 , except within the boundaries of the circles in circular pattern 24 . a second layer of clear film 25 , having a permanent adhesive layer 26 on its top surface , is affixed to standard label carrier 21 by dry - release glue 23 . flexible magnet 12 may be affixed to clear film 25 by permanent adhesive layer 26 . the absence of dry - release glue 23 in the circles in circular pattern 24 facilitates removal of flexible magnet 12 affixed to clear film 25 from standard label carrier 21 . accordingly , when flexible magnet 12 is removed from the product , clear film 25 remains permanently affixed to flexible magnet 12 by permanent adhesive layer 26 , and standard label carrier 21 remains affixed to the product . therefore when flexible magnet 12 is removed from the product , clear film 25 affixed thereto has a “ ghost image ” of dry - release glue 23 outlined by circular pattern 24 , and standard label carrier 21 affixed to the product also has a “ ghost image ” of dry - release glue 23 outlined by circular pattern 24 . for the alternate embodiment of clean release magnet 10 including the 3 - σ label stock , instead of clear film 25 affixed to flexible magnet 12 , film 25 may include printing thereon . additionally , a coupon or game piece ( not shown ) may be overlaid on the top surface of standard label carrier 21 and / or the top surface of flexible magnet 12 . the manufacturing method for clean release magnet 10 will now be described in detail . in order to manufacture clean release magnet 10 , advertising or promotional materials , may be printed on a continuous roll of pressure sensitive , self - adhering label material ( not shown ), denoting a first roll made of printed filmic face 14 , which is placed on a first spindle ( not shown ). the label material may have a pressure sensitive backing layer ( not shown ) and , as described above , may be made of conventional label stock , such as plain paper , embossed or glossy paper , pvc ( polyvinyl chloride ), pet ( polyethylene terephlatate ), or tyvek . the label material may be retained on a roll ( not shown ) so as to be easily inserted into a machine ( not shown ) for subsequent processing . in the rolled configuration , the pressure sensitive backing on the label material may remain attached to the label material . a roll of flexible magnet 12 and a roll of clear pressure sensitive carrier layer 11 having a backing layer ( not shown ), may be simultaneously fed through a machine so that flexible magnet 12 is affixed to the upper side of clear pressure sensitive carrier layer 11 by using clean release adhesive 13 . the merged material may be re - wound onto a single roll , denoting a second roll , which is placed on a second spindle ( not shown ). the rolls of printed filmic face 14 on the first spindle and flexible magnet 12 on the second spindle may then be simultaneously fed into the machine . as these rolls are fed into the machine , the pressure sensitive backing layer ( not shown ) on printed filmic face 14 is removed and printed filmic face 14 is applied to the top surface of flexible magnet 12 by virtue of adhesive layer 15 on printed filmic face 14 . thus , the rolls on the first and second spindles are “ married ” as they simultaneously go through the machine . as these rolls are fed through the machine , a calibrator ( not shown ) keeps register of the rolls , and the combination of materials described above on the “ married ” roll are also simultaneously die cut into desired shapes and sizes . the depth of the cut may extend through printed filmic face 14 , flexible magnet 12 and clear pressure sensitive carrier layer 11 only , and not through the backing layer on clear pressure sensitive carrier layer 11 . this cut divides the material of the “ married ” roll into a usable matrix and waste matrix . the waste matrix may be automatically stripped and rewound onto a waste roll ( not shown ) and the usable matrix made of the newly die cut material , including flexible magnets 12 affixed to clear pressure sensitive carrier layer 11 , may come off the machine on another roll ( not shown ). thus , in a single step , the rolls of printed filmic face 14 on the first spindle and flexible magnet 12 on the second spindle may be simultaneously fed into the machine , and a roll of newly die cut material , including printed filmic face 14 affixed to flexible magnets 12 , which is in turn affixed to clear pressure sensitive carrier layer 11 , may be output from the machine . alternatively , instead of the single step discussed above , the first roll including printed filmic face 14 may be merged with and adhered to the second roll of flexible magnet 12 and clear pressure sensitive carrier layer 11 to form a third roll ( not shown ) of the combination of materials . next , the third roll may be re - fed into the machine to die cut the combination of materials , described above , into desired shapes and sizes . as the third roll is die cut , the depth of the cut may extend through printed filmic face 14 , flexible magnet 12 and clear pressure sensitive carrier layer 11 only , and not through the backing layer . thus the cut divides the material of the third roll into a usable matrix and waste matrix . the newly die cut material may then be rewound to form a fourth roll ( not shown ) and any of the waste matrix may be automatically discarded , leaving the individual printed die - cut clean release magnets 10 affixed on the backing layer . the clean release magnets 10 created on the fourth roll , or created on the roll formed in the single step described above , may then be individually applied by hand or by machine at a rapid rate , for example , to a customer &# 39 ; s product 16 to firmly attach clean release magnet 10 by the self - adhesive back side of clear pressure sensitive carrier layer 11 . if clean release magnets 10 are applied by machine , the backing layer may be removed as waste and discarded . as described above and as shown in fig3 and 4 , when clean release magnets 10 is removed form the consumer product 16 , clear pressure sensitive carrier layer 11 is left on the product 16 . the exposed surfaces of clean release magnet 10 and clear pressure sensitive carrier layer 11 are clear and non - tacky ( of slightly - tacky ) so that any pre - printed label 17 on product 16 is un - obscured , and product 16 and clean release magnet 10 are easy to handle , respectively . it should be apparent that the manufacturing method described above is only exemplary , and many other variations of the described method may be used to manufacture clean release magnet 10 , as would be apparent to a skilled artisan . for the above - described embodiments and manufacturing method of clean release magnet 10 , it should be evident that clean release magnet 10 can be used for a variety of purposes and provides a consumer with a utilitarian and semi - permanent reminder of the product and brand name of the producer of the product . clean release magnet 10 may be manually or automatically applied to , for example a postcard mailer , or the like . moreover , since the clean release magnet is capable of being affixed to the inside or outside of the product packaging or container , from an fda standpoint , it can be used with food products , thereby reducing concerns about contamination of the food products by the magnetic label and its components . although particular embodiments of the invention have been described in detail herein with reference to the accompanying drawings , it is to be understood that the invention is not limited to those particular embodiments , and that various changes and modifications may be effected therein by one skilled in the art without departing from the scope or spirit of the invention as defined in the appended claims .	1
referring to fig1 the apparatus will include a nostril adapter 11 . nostril adapter 11 is a commercially available product that has two nozzles , each of which fits within a nostril ( not shown ) of a user . adapter 11 connects to a flexible tube 13 that leads to a low pressure compressor 15 . adapter 11 and tube 13 make up an interface for supplying air pressure to the user . compressor 15 draws in ambient air and will compress it to a variable pressure which can be selected . increasing the pressure will increase the flow rate of the air through the tube 13 . a conventional pressure transducer 17 is connected by a pneumatic tube 19 to the tube 13 for sensing pressure in the tube 13 . pressure transducer 17 will monitor the dynamic pressure that exists in the interface comprising the tube 13 and adapter 11 . this pressure is substantially the same as in the upper airway passages of the user . the pressure within the tube 13 will depend not only on the compressor 15 , but also on the user &# 39 ; s breathing . the pressure transducer 17 will monitor all of the waveforms and convert these pressure changes into analog electrical signals . the signals from the pressure transducer 17 pass to an electronic amplifier and filter 21 of conventional design . after amplification , filter 21 will block frequencies received from the pressure transducer 17 that are not associated with snoring waveforms . laboratory tests have determined that the waveforms associated with snoring will have frequencies within the range of about 20 hz to 120 hz . these signals are passed and the rest blocked . fig2 illustrates a typical analog electrical signal 18 after passing through filter 21 that would indicate snoring . the frequencies within the waveforms of signal 18 are within 20 to 12 . 0 hz . the filtered signals 18 are rectified by a conventional rectifier 20 and passed to a conventional peak detector 22 . peak detector 22 will detect the contours of the waveforms of the signal 18 . the result is digitized by a conventional analog to digital converter 24 . fig3 illustrates the results , with waveform 27 being processed from the analog waveform 18 of fig2 . there are two large envelopes 28 and 30 and a smaller envelope 35 . the vertical lines within the envelopes 28 , 30 and 35 represent samples taken of the amplitudes at constant time intervals . preferably , there are 100 samples taken per second , with each sample having an amplitude that is proportional to a particular point on the envelopes 28 , 30 and 35 . a noise threshold 29 will be selected to eliminate signals having amplitudes below a selected level . the numerals 31 , 33 and 37 represent the durations in real time of the envelopes 28 , 30 and 35 . the durations 31 , 33 , 37 begin and end at the points where the envelopes 28 , 30 and 35 intersect the noise threshold line 29 . laboratory tests have determined that a typical waveform associated with a snore lasts about 0 . 4 seconds . the microprocessor 23 computes running averages of durations of past waveforms detected beginning with the particular session with that user . preferably , the microprocessor 23 will maintain values of the past ten durations , average the middle eight values , and multiply the average by a fraction to determine a threshold average , which is preferably 60 percent of the computed average . if the present duration exceeds the threshold average , it will be noted . if not , the microprocessor 23 will consider the present envelope to be other than associated with snoring . for example , the duration 31 likely might exceed 60 percent of the average . if duration 31 has a value within the middle eight of the last ten , a new average will be computed to compare with duration 37 . duration 37 will likely not meet the threshold test , therefore envelope 35 will not be counted as a snoring waveform . even if duration 37 does not fall within a middle eight values of the last ten durations , it will be considered when computing new threshold averages for subsequent envelopes . also , the energy level will be computed for each envelope 28 , 30 , 35 . the energy level is the area of each envelope 28 , 30 , 35 . the area is the summation of the amplitudes of the vertical sample lines within the durations 31 , 33 , 37 . similarly , the microprocessor 23 computes an area average based on the middle eight values of the last ten areas . the average threshold area is preferably 60 percent of this average . the present area is compared to the average threshold area . if the present envelope has an area that exceeds the average threshold area , and if the present envelope has a duration that exceeds the average threshold duration , the microprocessor 23 will enter a count . the present area will be considered when updating the average threshold area for subsequent envelopes , even if the present area did not exceed the average threshold . the threshold area and the threshold durations are reduced by 20 percent if no snoring waveforms are detected within a one minute period . the 20 percent reduction in threshold area and duration occurs each one minute period that is free of snoring waveforms until a selected minimum for each is reached . the envelopes 28 and 30 will likely result in a count for each . the small envelope 35 located between the two envelopes 28 , 30 will likely not be counted . the microprocessor 23 will continue to make counts when the areas and durations exceed the threshold values , with the threshold values continuously being updated . if the counts of envelopes that meet the threshold values reach a selected number within a certain time period , then the microprocessor 23 will recognize this as sleep disorder breathing snoring . in the preferred embodiment , there must be a snoring waveform that is counted within 30 seconds from the termination of the last snoring waveform counted . three of these counts must occur before the microprocessor 23 recognizes this as sleep disorder breathing snoring . for example , if envelopes 28 and 30 met the threshold area and duration values , but envelope 35 did not , then envelope 30 would need to commence within 30 seconds of the termination of envelope 28 . also , another envelope that met the threshold values would have to occur within 30 seconds of the termination of the envelope 30 . the termination and commencement points are the points where the envelopes pass the noise threshold line 29 . initially , the compressor 15 will be operating at a minimum pressure , for example 5 cm of water . if sleep disorder breathing snoring is detected , as described above , the microprocessor 23 will increase the pressure of compressor 15 by an increment . for example , initially the increase might be 2 cm of water . if after the initial increase of pressure , sleep disorder breathing snoring is still detected by three snoring envelope counts within 30 second time periods of each other , the microprocessor 23 will again increase the pressure by another 2 cm of water . this incremental increase can go on until a maximum pressure level has been reached . preferably the maximum level is about 15 cm of water . if the maximum level does not stop the snoring being detected , then an alarm 25 will be signaled to sound an alarm . if during a 20 minute interval , no more sleep disorder breathing snoring is detected by microprocessor 23 , the microprocessor 23 will direct the compressor 15 to decrease in a controlled manner . the compressor 15 will decrease in one embodiment about one cm of water pressure during every 20 minute interval in which no sleep disorder breathing snoring is detected . in operation , a user &# 39 ; s breathing will create a generally sinusoidal curve within interface 1 which includes adapter 11 and tube 13 that represents the intake and expelling of air . tests have determined that the pressure waveform will be modulated if a person begins to snore . snoring creates a wave pattern that has an identifiable frequency . snoring thus creates a waveform that can be distinguished from other fluctuations in the pressure which might be due to coughing , body movement and the like . laboratory tests have also determined that a positive flow of air into the user &# 39 ; s airway passages will in many cases cause the snoring to cease and also will avoid the occurrence of sleep disorder breathing such as apnea and hypopnea . compressor 15 will supply air pressure to the user through tube 13 at a selected minimum level . pressure transducer 17 will monitor the air pressure . filter 21 will amplify and pass only waveforms 18 having frequencies of interest , as illustrated in fig2 . the signals are conditioned by the rectifier 20 , peak detector 22 and a / d converter 24 to the form shown in fig3 . the durations 31 , 33 and 37 of envelopes 28 , 30 and 35 will be compared to a running average threshold value . the areas or energy levels of the envelopes 28 , 30 and 35 will be computed and compared to a running average threshold value . if the present values of the durations 31 , 33 , 37 and areas exceed the minimum threshold averages , then the envelopes 28 , 30 and 35 will be counted as waveforms associated with sleep disorder breathing . if a selected number of the waveforms associated with snoring are counted within a certain time period of each other , then the microprocessor will cause the compressor 15 to increase its pressure for a certain time period . if after a selected time , no further sleep disorder breathing snoring is detected , the microprocessor 23 will cause compressor 15 to decrease its pressure . if sleep disorder breathing snoring continues , the microprocessor 23 will cause the compressor 15 to further increase its pressure up to a maximum level . the invention has significant advantages . the low air pressure utilized while sleep disorder breathing is not occurring is much more comfortable to the user than the higher pressures required continuously during the prior art systems . if the system fails to stop the snoring , thereby indicating sleep disorder breathing , an alarm can be sounded to wake other people or the person to avoid a potentially dangerous situation . the system automatically adapts to the level of air flow required by the user during the night . while the invention has been shown in only one of its forms , it should be apparent to those skilled in the art that it is not so limited but is susceptible to various changes without departing from the scope of the invention . for example , humidity and temperature control devices may be incorporated to further the comfort to the user .	0
the inventive composition generally includes a biocide system , which includes a primary biocide and a ph buffering component . the primary biocide is selected according to the nature of the microorganisms sought to be controlled , for example , a quaternary ammonium salt . the ph buffer is an electrically - activated acid / salt or base / salt composition that aids in breaking down the cell walls of microorganisms for the delivery of the primary biocide without causing irritation to the skin of the livestock . by way of example , a suitable ph buffer is disclosed in u . s . pat . no . 7 , 824 , 524 , which is incorporated by reference herein in its entirety , or in a u . s . patent application ser . no . 13 / 346 , 160 , entitled “ reactive , non - corrosive , and dermal - friendly composition and methods for manufacturing ” which is also incorporated by reference herein in its entirety and filed contemporaneously with this patent application . the ph buffer is chosen for compatibility with the primary biocide . along with the primary biocide , the inventive composition includes a surfactant which helps disperse the biocidal system disperse on the treated surfaces of the pen along with a thickening agent , which helps keep the biocidal system in contact with the treated surfaces of the pen . further , the inventive composition includes a carrier which helps dissolve the other components and aids in the delivery of the biocidal system . additionally , the inventive composition may include other substances which do not contribute to its antimicrobial function but add to the usability of the product ; for example , the composition may include dyes and fragrances . the disclosed compositions comprise from about 0 . 05 % to about 0 . 75 % by weight of a biocidal system . the biocidal system comprises at least about 75 % by weight of a primary biocide primary biocide and at least about 5 % by weight of a ph buffering component ph buffer component . the ph buffer is chosen for compatibility with the primary biocide . suitable biocides include quaternary ammonium compounds chosen from ( c12 - c14 alkyl ) ( c1 - c2 dialkyl ) benzyl ammonium salts , n —( c12 - c18 alkyl ) heteroaryl ammonium salts , and n —[( c12 - c14 alkyl ) ( c1 - c2 dialkyl )] heteroarylalkylene ammonium salts . non - limiting examples of the ( c12 - c14 alkyl ) ( c1 - c2 dialkyl ) benzyl ammonium salts include ( c12 - c14 alkyl ) dimethyl - benzyl ammonium chloride , ( c12 - c14 alkyl ) dimethylbenzyl ammonium bromide , and ( c12 - c14 alkyl ) dimethylbenzyl ammonium hydrogen sulfate . non - limiting examples of the n —( c12 - c18 alkyl ) heteroaryl ammonium salts include cetyl pyridinium chloride , cetyl pyridinium bromide , and cetyl pyridinium hydrogen sulfide . for the n —( c12 - c18 alkyl ) heteroaryl ammonium salts other anions can be used . further examples of quaternary ammonium compounds suitable for use as the primary biocides include cetyltrimethylammonium chloride , stearyltrimethylammonium chloride , isostearyltrimethylammonium chloride , lauryltrimethylammonium chloride , behenyltrimethyl - ammonium chloride , octadecyltrimethylammonium chloride , cocoyltrimethyl ammonium chloride , cetyltrimethylammonium bromide , stearyltrimethylammonium bromide , lauryl - trimethylammonium bromide , isostearyllauryldimethylammonium chloride , dicetyldimethyl - ammonium chloride , distearyldimethylammonium chloride , dicocoyldimethylammonium chloride , gluconamidopropyldimethylhydroxyethylammonium chloride , di -[ polyoxyethylene ( 2 )] oleylmethylammonium chloride , dodecyldimethylethylammonium chloride , octyldihydroxyethylmethylammonium chloride , tri [ polyoxyethylene ( 5 )]- stearylammonium chloride , polyoxypropylenemethyldiethylammonium chloride , lauryl - dimethyl ( ethylbenzyl ) ammonium chloride , behenamidopropyl - n , n - dimethyl - n -( 2 , 3 - dihydroxypropyl ) ammonium chloride , tallowedimethylammoniopropyltrimethylammonium dichloride , and benzalconium chloride . a second group of suitable biocides includes copper , zinc , silver , salts of chlorides , chlorites , perchlorates , hypochlorates , hypochlorites , sulfates , sulfites , bisulfates and bisulfites . also , colloid metal such as silver , gold , copper and zinc have superior biocidal properties . colloidal silver , gold , copper and zinc are extracted and created as ultrafine ( 0 . 010 - 0 . 001 micron ) particles . a third group of suitable biocides include organic acids which are safe under the fda gras guidelines for food production yet still effective in controlling bacteria . the basic principle action of organic acids on bacteria is that non - dissociated organic acids can penetrate a bacterium cell wall and cause disruption due to the fact it cannot tolerate a wide internal and external ph gradient . with the passive diffusion of organic acids into the bacteria , the acids will dissociate and lower the bacteria &# 39 ; s internal ph , leading to an environment that will inhibit or stop the growth of bacteria and viruses . the anionic part of the organic acids that cannot escape the bacteria in its dissociated form will accumulate within the bacteria and disrupt many metabolic functions . this will cause the osmotic pressure inside the cell to increase which state is incompatible with bacterial survival . the first group of suitable organic acids is lactic , acetic , formic , fumaric , citric , oxalic , adipic and uric . the second group of suitable organic acids is the carboxylic acids , whose acidity is associated with their carboxyl group — cooh . sulfonic acids , containing the group — so2oh , are relatively stronger acids . the relative stability of the conjugate base of the acid determines its acidity . in some biological systems more complex organic acids such as l - lactic , citric , and d - glucuronic acids are formed . these use the hydroxyl or carboxyl group . the third group of suitable organic acids are humic , sebacic , stearic , gallic , palmitic , caffeic , glyoxylic , fulvic , carnosic , anthranilic , ellagic , lipoic , chlorogenic , rosmarinic , phosphoric , methacrylic , oleanic , nitrohumic , florocinnamic , hexaflorosilicic , hydrofluoric , hydroxycitric and silicofluoric . the fourth group of suitable organic acids is fruit acids . the acids in fruits are chiefly acetic , malic , citric , tartaric , oxalic , and in some instances boric . malic acid is present in apples , pears , currants , blackberries , raspberries , quince , pineapple , cherries , and rhubarb . citric acid is found in lemons , oranges , grapefruit , lemons , limes , quince , gooseberry , strawberry , raspberry , currant , and cranberry . tartaric acid occurs in grapes . boric acid is found in many fresh fruits and vegetables . mandelic acid is present in almonds . the fifth group of suitable organic acids is beta hydroxy acids which is a type of phenolic acid . salicylic acid is a colorless crystalline organic acid whose main active ingredient obtained from this source is a monohydroxiybenzoic acid . the sixth group of suitable organic acids is a class of products that break biofilm . biofilms are the protective layer / barrier that surround bacteria . some species are not able to attach to a surface on their own but are often able to anchor themselves to the matrix or the bacteria cells . it is during this colonization that the cells are able to communicate via its quorum sensing ability . once colonization has begun , the biofilm grows through a combination of cell division and recruitment . the final stage of biofilm formation is known as development and is the stage in which the biofilm is established and may only change in shape and size . the development of a biofilm may allow an aggregate cell colony to be increasingly resistant . a biofilm &# 39 ; s hard protective surface can be broken by lactobacillus sc nisin which is produced by fermentation using the bacterium lactococcus lactis . this is obtained from the culturing of lactococcus lactis on natural substrates , such as milk or dextrose , and is not chemically synthesized . this is a peptide which is produced by the food grade dairy starter bacterium lactococcus lactis . a seventh group of suitable organic acids is natural enzymes . enzymes are proteins that catalyze chemical reactions and range from just 62 amino acid residues . typically , these are protease , lipase , diastase and cellulase enzymes . enzymes are usually very specific as to which reactions they catalyze and the substrates that are involved in these reactions . the shape , charge and hydrophilic / hydrophobic nature characterize the enzymes . the disclosed composition comprises a ph buffer that is a low ph dermal safe composition with the following range of specifications : a biocidal , dermal , non - corrosive acid composition , having a maximum proton count of 1 . 5 × 10 ̂ 25 , an embodied conductivity range of from 250 mv to 1500 mv and a 0 . 1 % solution of the composition having a ph of under 2 . 0 . the ph buffer component of the present invention can be a highly protonated , supercharched , low ph , non - corrosive composition . by way of example , such a composition disclosed in u . s . pat . no . 7 , 824 , 524 , which is incorporated by reference herein in its entirety or in a u . s . patent application ser . no . 13 / 346 , 160 , entitled “ reactive , non - corrosive , and dermal - friendly composition and methods for manufacturing ” which is also incorporated by reference herein in its entirety and filed contemporaneously with this patent application , both of which should be understood to be applicable to the present invention . in addition , other biocidal , dermal , non - corrosive acid compositions could be used providing they have a maximum proton count of 1 . 5 × 1025 , an embodied conductivity range of from 250 mv to 1500 mv and a 0 . 1 % solution of the composition having a ph of under 2 . 0 . the disclosed compositions may comprise from about 0 . 05 % to about 5 . 0 % by weight of a cationic surfactant having an hydrophile - lipophile balance (“ hlb ”) of from about 5 to about 30 . one aspect of the disclosed compositions comprises a cationic or ionic surfactant having an hlb of from about 12 to about 18 . a further aspect of the disclosed compositions comprises a cationic or ionic surfactant having an hlb of from about 13 to about 16 . another embodiment of the disclosed compositions comprise from about 0 . 1 % to about 4 . 0 % by weight of a cationic or ionic surfactant . suitable cationic or ionic surfactants for use in the disclosed compositions include polyoxyethylene c6 - c12 alkylphenyl ethers , polyoxyethylene sorbitan tri ( c12 - c18 )- alkanoates , polyoxyethylene sorbitan di ( c12 - c18 )- alkanoates , polyoxyethylene sorbitan mono -, di -, and tri -( c12 - c18 )- alkanoates , and polyoxyethylene c12 - c20 alkyl ethers . one category of suitable cationic or ionic surfactants for use in the disclosed compositions is the polyoxyethylene c6 - c12 alkylphenyl ethers having the formula : wherein y is a c6 - c12 alkyl unit and n is an index from 5 to 40 . non - limiting examples of c6 - c12 alkylphenyl ethers includes polyoxyethylene ( 5 ) isooctylphenyl ethers sold under the tradenames igepal ™ ca - 520 and igepal ™ co - 520 , polyoxyethylene ( 8 ) isooctylphenyl ethers sold under the tradename triton ™ x - 114 , polyoxyethylene ( 9 ) nonylphenyl ether sold under the tradename igepal ™ co - 630 , polyoxyethylene ( 10 ) isooctylphenyl ether sold under the tradename triton ™ x - 100 , polyoxyethylene ( branched ) nonylphenyl ethers sold under the tradename triton ™ n - 101 , polyoxyethylene ( 12 ) nonylphenyl ether sold under the tradename igepal ™ co - 720 , polyoxyethylene ( 12 ) isooctylphenyl ether sold under the tradename igepal ™ ca - 720 , polyoxyethylene ( 40 ) nonylphenyl ether sold under the tradename igepal ™ co - 890 , and polyoxyethylene ( 40 ) isooctylphenyl ether sold under the trade name triton ™ x - 405 . another category of cationic or ionic surfactants for use in the disclosed compositions are polyoxyethylene sorbitan mono -, di -, and tri -( c12 - c18 )- alkanoates , non - limiting examples of which include polyoxyethylene ( 20 ) sorbitan trioleate sold under the tradename tween ™ 85 , polyoxyethylene ( 20 ) sorbitan monooleate sold under the tradename tween ™ 80 , polyoxy - ethylene ( 20 ) sorbitan monostearate sold under the tradename tween ™ 60 , polyoxyethyl - ene ( 20 ) sorbitan monopalmitate sold under the tradename tween ™ 40 , and polyoxyethyl - ene ( 20 ) sorbitan monolaurate sold under the trade name tween ™ 20 . a further category of cationic or ionic surfactants for use in the disclosed compositions are polyoxyethylene c9 - c20 alkyl ethers , non - limiting examples of which include ethoxylate alcohols having the formula : wherein r is a linear or branched alkyl group having from 6 to 20 carbon atoms and m is an integer of about 2 to about 20 . on example of suitable ethoxylate alcohol surfactants are the neodol ™ ethoxylated alcohols from shell chemicals . non - limiting examples of suitable ethoxylated alcohols include neodol ™ 91 - 5 , neodol ™ 91 - 6 , neodol ™ 91 - 8 , neodol ™ 91 - 9 , neodol ™ 23 - 6 . 5 , 15 neodol ™ 25 - 5 , neodol ™ 25 - 7 , neodol ™ 25 - 9 , neodol ™ 25 - 12 , neodol ™ 45 - 7 , and neodol ™ 135 - 7 , available from basf . the disclosed compositions further may comprise from about 0 . 1 % to about 4 % by weight of a thickening agent . suitable thickening agents include hydroxynethyl cellulose , hydroxyethyl cellulose , methylcellulose , hydroxypropyl cellulose , methyl cellulose , carboxy methylcellulose , emulsifying waxes , alkyl triammonium methosulfate , and ceteraryl octanoate . although the disclosed compositions are aqueous based , certain ingredients may require the presence of a more lipophilic solvent for proper stabilization . preferred additional solvents are polyhydric alcohol solvents , or “ polyol ” solvents , such as the polyalkylene glycols having alkylene moieties containing about 2 - 3 carbon atoms , preferably the polyethylene glycols . molecular weight ranges of from about 200 - 4000 are preferred for the polyalkylene glycols ( e . g ., propylene glycol ). other examples of thickeners are polysaccharides and linear sulfated polysaccharides of natural origin , which increase the viscosity increase in solution , even at small concentrations . these can be classified as uncharged or ionic polymers natural gums obtained from seaweeds . these are agar , alginic acid sodium alginate , carrageenan ( kappa , iota or lambda ), gum arabic , gum ghatti , gum tragacanth , karaya gum , guar gum , locust bean gum , beta - glucan , chicle gum , dammar gum , glucomannan , mastic gum , psyllium seed husks , spruce gum , tara gum gellan gum and xanthan gum . another example of a suitable thickener poylsaccharides is starch which can be unmodified or modified using acid , enzymes , alkaline , bleached , oxidized , acetylated , hydroxpropylated , octenylsuccinic anhydride , carboxyethylated , phosphate , hydroxypropyl , and acetylated oxidated ), cationic , cold water , pregelatinized and instant starch . one embodiment of the disclosed compositions , utilizes hydroxyethyl cellulose in amounts of 0 . 5 %, 0 . 6 %, 0 . 7 %, 0 . 8 %, 0 . 9 %, and 1 % by weight of the composition adjusted for the emollient system and for the final method of applying the composition to the domesticated animal in need of treatment . in a further embodiment , the thickener can be xanthan gum in amounts of 0 . 5 %, 0 . 6 %, 0 . 7 %, 0 . 8 %, 0 . 9 %, and 1 % by weight of the composition adjusted for the emollient system and for the final method of applying the composition to the domesticated animal in need of treatment . the balance of the disclosed compositions may comprise a carrier . the carrier can be any suitable material that can dissolve the active ingredients and co - ingredients and deliver the biocidal system to the infected areas of the animal being treated . water is a convenient carrier for liquid embodiments of the disclosed composition . however , alcohols can be used to assist in the dissolving of the ingredients prior to dilution with water . embodiments of the disclosed compositions include gels , sprays , foams and creams , especially for treating cases wherein the infection may be chronic and the animal must be isolated from the rest of the animals and given more intense treatment . the disclosed compositions can further comprise one or more dyes at levels of from about 0 . 001 % to 0 . 5 %. non - limiting examples of suitable dyes are alizarine light blue b ( c . i . 63010 ), carta blue vp ( c . i . 24401 ), acid green 2g ( c . i . 42085 ), astrogen green d ( c . i . 42040 ), supranol cyanine 7b ( c . i . 42675 , maxilon blue 3rl ( c . i . basic blue 80 ), drimarine blue z - rl ( c . i . reactive blue 18 ), alizarine light blue h - rl ( c . i . acid blue 182 ), fd & amp ; c blue no . 1 and fd & amp ; c green no . 3 . ( see u . s . pat . no . 4 , 248 , 827 and u . s . pat . no . 4 , 200 , 606 , both incorporated herein by reference .). other colors which can be lakes that may be used are fd & amp ; c blue no . 1 — brilliant blue fcf , ( blue shade ), fd & amp ; c blue no . 2 — indigotine , ( dark blue shade ), fd & amp ; c green no . 3 — fast green fcf , ( turquoise shade ), fd & amp ; c red no . 40 — allura red ac , ( red shade ), fd & amp ; c red no . 3 — erythrosine , ( pink shade , commonly used in glace cherries ), fd & amp ; c yellow no . 5 — tartrazine , ( yellow shade ), fd & amp ; c yellow no . 6 — sunset yellow fcf , e110 ( orange shade ) another adjunct ingredient suitable for use in the compositions disclosed herein includes fragrances , for example , fragrances as disclosed in u . s . pat . no . 6 , 013 , 618 included herein by reference in its entirety . the selection and proportions of specific components for the inventive biocidal system will be based on the particular microorganisms to be controlled and the method of delivery , and other factors known to a person of skill in the art and / or easily derived from routine engineering using this disclosure as a guideline . by way of example , tables i - vi show the selection and proportions of specific components suitable for a biocidal system for use as a bovine pen spray . these compositions are provided as non - limiting examples of effective compositions . the amount of each component is measured in grams . the disclosed compositions can be used for various applications with the application route and dosage regimen dictated by the amount of bacteria , viruses or parasites present . as an example of possible applications of the invention , the compositions can be used on bedding , pens , hutches , its surroundings and on animals and / or stemming from microbial infections . the composition can be applied as a cleanser , scrub ( cleanser with abrasive properties ), spray , foam , lotion , or gel . the following procedures can be used to evaluate the disclosed compositions against various microorganisms . the results below further indicate the effectiveness of the disclosed compositions . bacterial tests were completed at biological consulting services of north florida , inc . on the following strains : e . coli ( atcc 15597 ), salmonella enterica ( atcc baa - 711 ), methicillin resistant staphylococcus aureus ( mrsa ; baa - 44 ) and staphylococcus aureus atcc # 6538 . the results are documented in table a . viral tests were completed at biological consulting services of north florida , inc . on the following on the following orthomyxviridie virus atcc type ccl - 34 , influenza a / equi 2 ( atcc vr517 ) poliovirus 1 ( chat ; atcc vr - 1562 ), and rhinovirus 39 ( atcc vr - 340 ). the results are documented in table b . while particular embodiments of the present disclosure have been illustrated and described , it would be obvious to those skilled in the art that various other changes and modifications can be made without departing from the spirit and scope of the disclosure . it is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this disclosure .	0
it is unlikely that bios security of the type required by gaming applications and other sensitive applications will be built into the pc standard in the near future , because there is no real need for it in most applications . hence the only way to get this level of security is to customize the pc standard , and the embodiments of the present invention described below achieve this in a relatively inexpensive mariner . a pc is not designed for security and security against bios modification has not been a concern for the mainstream pc market . prior to this invention the only way to incorporate this level security was by directly incorporating it into the chips which make up the pc , as was done with the microsoft x - box . it is not feasible for a niche industry user to influence the pc industry to incorporate bios security into the pc standard , or to go to the expense of modify existing pc standard chips . embodiments of the invention are described below with reference to gaming machines , however embodiments may also be useful in other fields where a higher level of security is required , while using standard commercial designs . an example might be atm machines used in the banking industry . it would also be useful in implementing tcpa without making significant changes to the pc architecture standard . referring to fig2 to 10 of the drawings , embodiments of the invention provide bios protection in a processor by using a device which is transparent to the normal operation of the rest of the hardware , enabling the use of standard hardware components . it can easily be built into an otherwise standard pc motherboard and provide a high level of security . fig1 shows a standard pc architecture which employs a commonly used standard pc motherboard chipset ( the intel 845g chipset ), which is comprised of two chips , the graphics and memory controller hub ( gmch ) 12 , and i / o controller hub ( ich4 ) 14 . the bios 18 is interfaced via the ich4 using the intel standard low pin count ( lpc ) interface 16 . one such bios chip is the stmicroelectronics m5ofw040 . in fig1 , the processor is a pentium 4 cpu 11 which interfaces to the remainder of the system via the gmch 12 . memory 13 is also connected to the gmch as is the ich4 , 14 . referring to fig2 , in one preferred implementation of the present invention , a bios protection device 17 is provided in an otherwise standard pc hardware configuration ( i . e . the configuration of fig1 ), the bios protection device being an integrated circuit inserted between an i / o controller 14 and the bios memory device 18 . this arrangement is shown in more detail in fig3 , in which it can be seen that the lpc interface can be used between the ich4 14 , the bios protection device 17 and bios 18 . the bios protection device 17 appears to the ich4 14 as if it were a bios device , and the bios protection device 17 appears to the bios 18 as if it were an ich4 device . referring to fig4 , the lpc interface 16 employs multiplexed address and data lines between the i / o controller hub 14 and the bios memory device 18 . address and data information on the internal ( pc side ) lpc bus 24 passes to the “ a ” input of an lpc multiplexer 22 , within the bios protection device 17 , and depending on the state of the multiplexer 22 passes to the internal ( bios side ) lpc bus 25 . the lpc multiplexer 22 is a bi - directional switch which provides a bi - directional connection for multiplexed addresses and data between either of the inputs ‘ a ’& amp ; ‘ b ′ and the ‘ output &# 39 ; depending on the state of the a / b input which in this case is controlled by the reset line 23 . the ‘ b input ’ of the lpc multiplexer 22 is connected to the authenticator 21 by a further internal lpc bus 26 . the authenticator 21 contains the reset circuit for the motherboard and holds the motherboard in a reset state while authentication takes place . after power on , the protection device enters the verification mode where it verifies the contents of the bios . while in verification mode the authenticator 21 within the protection device asserts the reset line 23 to hold the rest of the motherboard in reset while the bios is being interrogated and to provide enhanced security in the event that authentication fails . alternately , to prevent malfunction , instead of using the reset function , the protection device can insert wait cycles into external bios access until authentication is successfully completed . while in reset the multiplexer circuit 22 routes the address from the authenticator to the output and hence bios 18 , allowing the authenticator to read the contents of the bios from the lpc bus 16 / 25 . after authentication has been successful and reset is negated , the multiplexer routes the address from the ich4 14 to the bios 18 , allowing the cpu 11 to read the bios 18 . the external circuit used would be similar to that shown in fig3 , where the existing circuit uses an ich4 device . in normal operation , after the bios has been successfully authenticated , the protection device is transparent to the operation of the standard ich4 and bios devices , and has no effect on the functions of the motherboard . standard software verification techniques can then be used to provide further protection for the application software running on the processor . to authenticate the bios , the bios protection device 17 reads the contents of the bios chips 18 and verifies that the contents are valid against a cryptographic digital signature embedded in the bios at a known location . the public key of the signature is stored in the authenticator 21 of the bios protection device 17 where it cannot be tampered with . if the bios is successfully authenticated the bios protection device moves to its transparent mode of operation and releases the reset and enables any extra functionality provided within the protection device . if authentication fails the bios protection device enters the error mode , where access to the bios is disabled , the system remains in reset , and any extra functions of the protection chip are disabled . therefore even in a physical arrangement where it is easy to access and modify the contents of the bios , security is preserved . the arrangement described above , allows industry standard designs to be easily enhanced to support a much stronger level of security against tampering . a single security device can be used to protect multiple different boards , requiring only that the board &# 39 ; s memory interface be supported . with the arrangement described above , while it would still be possible to tamper with the bios by replacing the protection device with a substitute circuit that did not have protection , this is much more difficult than simply removing a socketed bios device as is possible with existing systems . the protection device may incorporate further unrelated functions of the board , such that if it were removed it would be difficult to duplicate its functions . preferably these functions would be necessary to the operation of the board , and are disabled if the bios verification fails . hence the protection device cannot be easily replaced by a simple circuit without the protection feature as this would require that the extra functions must also be duplicated . in a simple example the reset control circuit for the board is implement in the protection device , and any replacement device would have to replicate the reset function for the motherboard to operate . to make tampering even more difficult , the protection device should be soldered directly to the circuit board , such that it is difficult to remove . although it is possible to remove when it is soldered in , it is relatively time consuming and risks damage to the board , and is therefore expensive and / or increases the chance of detection . referring to fig5 , the protection device may convert from one bios hardware interface to another . this may be a useful function itself , allowing a different memory device to be used than the standard one . for example using a pc in gaming application it may be preferred to use a pc chipset , such as the intel 845g with lpc bios interface 16 , and eprom in dip package for the bios chip 18 . the eprom has the advantages ( in gaming applications ) of being physically easier to handle and is unable to be reprogrammed in circuit . this also enhances security , as it is a significant function that must be replaced if the protection device is to be removed . to achieve this , the protection device 17 would include a bus converter 28 which multiplexes / de - multiplexes the internal lpc bus 25 to create a separate address bus 27 and data bus 29 carrying address and data signals to and from the bios device 18 . in another example , a gaming machine such as the aristocrat technologies mk6 product uses eprom to store the game . referring to fig6 , the protection device 32 may be implemented between the cpu and eprom 33 and to the cpu the protection device will appear as a direct interface to the eprom when in transparent mode . further , the mk6 product uses a field programmable gate array ( fpga ) to interface the cpu bus and eprom , and ( with minor modifications to the board ) the protection device can be integrated into the fpga . this fpga controls a large proportion of the functionality of the motherboard and would be very difficult to replace . fig3 shows the entire bios memory interface passing through the protection device . it is also possible to simply tap the protection device onto most of the signals provided that the standard memory interface is not driven when in reset ( when the protection device needs to drive the signals ). a reduced pin count protection device could be cheaper to implement . if none of the signals is interrupted by the protection device 17 it can simply be removed leaving a functioning but unprotected circuit . therefore , at least one signal should be interrupted by the protection device 17 , but in some implementations it may be not necessary to interrupt all signals to provide an adequate level of security . the circuit of fig6 shows a trade - off where the eprom address and control signals 34 , 35 are interrupted between the bios interface 37 of the i / o controller 31 by the protection device 32 , but the data signals 36 and the bios device 33 , are not . the reset signal 38 is again preferably generated by the protection device 32 . this will typically save 8 or 16 pins on the protection device , but is still secure . the data lines 36 must still be connected to the protection device 32 to enable the bios memory 33 to be read and the signature verified . referring to the block diagram of fig7 , the simple implementation for an eprom based bios ( with separate address and data lines ) of the type used in fig6 is illustrated . the protection device consists of an authenticator 41 , address multiplexer 42 , and optional extra functionality 43 . the authenticator 41 controls the modes of the protection device 31 and performs cryptographic authentication of the contents of the bios 33 ( of fig6 ). the reset signal 38 is also generated by the authenticator 41 . in gaming applications regulators often require that memory devices are not capable of being updated in the gaming product , but many modern systems are capable of electronic updating of the bios . the protection devices 17 , 32 need not affect the operation of bios firmware update , but if required , firmware updating can easily be disabled by arranging the protection devices 17 , 41 to not pass updates to the bios 18 , 33 . one possible attack on the security provided by a protection device of the type described above , is to provide an external circuit with two bios &# 39 ; s , an authentic original and a tampered version . while the protection device 17 , 41 authenticates the bios ( and the board is held in reset ) the authentic bios is enabled into the circuit , and when the board is not reset the tampered version is enabled instead . thus the protection device authenticates one device and the cpu executes the other . while such an attack would be difficult to perform undetected , it is theoretically possible . referring to fig8 , an enhanced protection device 51 incorporates an internal program storage memory , called the protected program storage 52 , into which bios data is copied as it is authenticated . once successfully authenticated , all cpu access to the authenticated region of bios memory accesses the copy in the protected program store 52 instead of the bios chip 18 , 33 . hence swapping an authentic bios chip for another will not affect security . the board is held in reset by asserting the reset signal 38 , while the authenticator 41 reads the bios eprom 18 , 33 by asserting the oe_out signal 39 and reading data via the data in bus 36 , while at the same time writing the read eprom data to the protected program storage memory 52 . when the reset signal 38 is asserted the address multiplexer 42 selects the address 34 a from the authenticator 41 to be output allowing the authenticator 42 to read the bios device 18 , 33 , while when reset signal 38 is negated the multiplexer 42 selects the address 34 from the main cpu 11 , allowing the cpu to read the bios 18 , 33 . once the authenticator 41 has successfully authenticated the bios data the reset signal 38 is negated to enable normal operation of the cpu 11 . data out 361 ) to the cpu 11 passes through a tri - state buffer 57 which is enabled by the oein signal 56 from the cpu 11 , while the oe_out signal 39 is always generated by the authenticator 41 because all reads to the bios 18 , 33 are initiated via the protection device 51 . ideally the entire contents of the bios 18 , 33 will be authenticated and stored in the internal memory 52 , however bios chip capacity is quite large and may be expensive to duplicate . to save cost a subset of the bios may be authenticated by the bios protection device 51 , and the software in authenticated portion of the bios is responsible for authenticating the remaining part of the bios using cryptographic digital signatures when executed by the cpu 11 . the authenticated subset is sufficient to authenticate and load the remaining bios into the computers main memory , from which it then executes . referring to fig9 , a protection device is shown in which the protected program storage 52 has a smaller memory capacity than the external bios device 18 , 33 . the operation of this device is similar to that of fig8 , with the addition of a cpu address comparator ( protected access detector ) 53 and data multiplexer ( mux ) 54 . in this implementation only a portion of the bios device 18 , 33 is authenticated , and this portion is read into the protected program storage 52 , as previously described . when the cpu attempts to read the bios at an address that is within the range that has been authenticated , as determined by the protected access detector 53 , the data 36 a is returned to the cpu from the protected program storage 52 , as selected by the data multiplexer 54 . when the cpu 11 reads the bios at an address that is outside the range that has been authenticated , as determined by the protected access detector 53 , the data 36 is returned to the cpu 11 from the external bios device 18 , 33 , as selected by the data multiplexer 54 . data out 36 b to the cpu 11 again passes through a tri - state buffer 57 which is enabled by the oe_in signal 56 from the cpu 11 , however in the case the oe_out signal 39 is generated by gating the oe signal 56 a from the authenticator 41 with the oe_in signal 56 from the cpu in and gate 58 such that the bios 18 , 33 is only enabled when allowed by the authenticator 41 ( i . e . when a read of non - copied content is required ). prior to successful authentication the data bus to the cpu may be disabled to make it more difficult to tamper with the circuit . the data bus is not necessarily tri - state , since tampering with a driven data pattern . is more difficult to tamper with than a tri - state bus . fig1 shows the changes required to the circuit of fig6 when the protection device 51 of fig8 or 9 is used . it will be appreciated by persons skilled in the art that numerous variations and / or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described . the present embodiments are , therefore , to be considered in all respects as illustrative and not restrictive .	6
fig1 shows a magnetic recording tape transport apparatus 6 which is provided with an operating lever device 4 according to an embodiment of this invention . in this embodiment , the magnetic recording tape transport apparatus 6 is a tape recorder using what is called a micro cassette 8 , one of the selling points of which lies in compact design or miniaturization . the operating lever device 4 is provided with a flat first base plate 10 inside the housing of the magnetic recording tape transport apparatus 6 , as shown in fig2 . in front of the first base plate 10 , as shown in fig2 a flat second base plate 12 is disposed parallel thereto at a given space therefrom . arranged between the first and second base plates 10 and 12 are first to fifth operating levers 14 , 16 , 18 , 20 and 22 formed of flat metal plates . as shown in fig2 the first to fifth operating levers 14 , 16 , 18 , 20 and 22 are vertically elongated and substantially parallel to one another . the respective lower ends of the first to fifth operating levers 14 , 16 , 18 , 20 and 22 project from the lower edges of the first and second base plates 10 and 12 into the outside space . a plurality of guide projections 26 are formed on the front surface of the first base plate 10 . as shown in fig2 some of the guide projections 26 are in contact with the vertically extending right and left edges of the first to fifth operating levers 14 , 16 , 18 , 20 and 22 . having their vertical edges in slide contact with the guide projections 26 , the first to fifth operating levers 14 , 16 , 18 , 20 and 22 are allowed to move only in the vertical direction . rightwardly projected portions are formed on the right - hand side faces of the first and fifth operating levers 14 and 22 , and the lower end faces of the projected portions are in contact with the guide projections 26 in the state shown in fig2 . the positions of the first and fifth operating levers 14 and 22 in this state are defined as their first positions . as shown in fig2 vertically extending slots 28 are formed in the first to fourth operating levers 14 , 16 , 18 and 20 . stoppers 30 fixed on the front surface of the first base plate 10 are in contact with the upper end faces of the slots 28 of the second to fourth operating levers 16 , 18 and 20 . the position of the second to fourth operating levers 16 , 18 and 20 in this state are defined as their first positions . urging means 32 are fitted in the slots 28 of the first to third operating levers 14 , 16 and 18 . in this embodiment , the urging means 32 is formed of a compression coil spring , the upper end of which abuts on the lower end face of the first base plate 10 , and the lower end of which abuts on the lower end face of the slot 28 . the diameter of the urging means 32 is only a little greater than the sum of the thicknesses of the first and second base plates 10 , 12 and the thickness of each one of the first to third operating levers 14 , 16 and 18 . therefore , the urging means 32 projects only slightly from the back surface of the first base plate 10 into the outside space . the urging means 32 urge the first to third operating levers 14 , 16 and 18 to be located at their respective first positions . a rightwardly projected support portion 34 is formed on the right - hand side face of the fourth operating lever 20 . a notch 36 is formed on the right - hand side face of the fifth operating lever 22 . two elongate holes 38 are formed in the first base plate 10 so as to cross with the upper end face ( viewed in the figure ) of the support portion 34 of the fourth operating lever 20 and with a lower end face of the notch 36 of the fifth operating lever 22 , respectively . terms &# 34 ; upper &# 34 ; and &# 34 ; lower &# 34 ; indicate the upper and lower sides of the figure , unless otherwise specified . urging means 40 are disposed in the elongate holes 38 , respectively . in this embodiment , the urging means 40 are constituted by torsion coil springs , respectively . the upper ends of the urging means 40 are respectively hooked at a projection formed at the upper end face of the support portion 34 of the fourth operating lever 20 and a projection formed on the lower end face of the notch 36 of the fifth operating lever 22 . the lower ends of the urging means 40 are fixed onto the back surface of the first base plate 10 in the vicinities of the lower ends of the elongate holes 38 . therefore , the urging means 40 urges the fourth and fifth operating levers 20 and 22 toward the first positions thereof . in front of the support portion 34 , a magnetic head 42 is disposed ahead of the front surface of the second base plate 12 . the magnetic head 42 is fixed on the support portion 34 by means of a leg ( not shown ) passed through a hole ( not shown ) formed in the second base plate 12 . in front of the fifth operating lever 22 , a erase head 44 is disposed ahead of the front surface of the second base plate 12 . the erase head 44 is fixed on the fifth operating lever 22 by means of a leg ( not shown ) passed through a hole ( not shown ) formed in the second base plate 12 . leftwardly projected first and second engaging portions 46 and 48 are formed at the upper end portions of the first and second operating levers 14 and 16 respectively . the intersectional region between the upper end face and left - hand side face of each one of the first and second engaging portions 46 and 48 is chamfered to form a first or second slant face 50 or 52 . the intersectional regions between the upper end face and the left - and right - hand side faces of the third operating lever 18 are chamfered to form two third slant faces 54 and 56 . the intersectional region between the upper end face and left - hand side face of the fourth operating lever 20 is chamfered to form one fourth slant face 58 . an indentation is formed in the upper end face of the support portion 34 , and the fourth engaging portion 60 projects to the right in the indentation , as shown in fig2 . the intersectional region between the upper end face and right - hand side face of the fourth engaging portion 60 is chamfered to form the other fourth slant face 62 , as shown in fig2 . the intersectional region between the upper end face and right - hand side face of the support portion 34 is chamfered to form a chamfer portion 64 . formed on the upper end portion of the left - hand side face of the fifth operating lever 22 is a left projected fifth engaging portion 66 . a fifth slant face 68 which has a tilt to the right is formed on the upper end faces of the fifth engaging portion 66 and fifth operating lever 22 . between the upper end portion of the first operating lever 14 and the upper end portion of the second operating lever 16 , and between the upper end portion of the fourth operating lever 20 and the upper end portion of the fifth operating lever 22 , cassette positioning pins 94 are fixed on the front surface of the first base plate 10 , respectively , as shown in fig2 . the front ends of the cassette positioning pins 94 penetrate the second base plate 12 to be located ahead thereof . between the respective upper end portions of the third and fourth operating levers 18 and 20 , a capstan 96 is rotatably mounted on the first base plate 10 . the front end of the capstan 96 penetrates the second base plate 12 to be located ahead thereof . as shown in fig2 a first gear 98 and a flywheel 100 are concentrically fixed to the rear end of the capstan 96 at the back side of the first base plate 10 . a driving belt 102 is wound round the peripheral surface of the flywheel 100 and the output shaft of an electric motor 104 which is fixed on the first base plate 10 , as shown in fig2 . between the upper end portion of the third operating lever 18 and the upper end portion of the fourth operating lever 20 , a first rotating lever 106 is mounted on the front surface of the first base plate 10 so as to be able to rotate coaxially with the capstan 96 . the first rotating lever 106 extends vertically , and can rotate between the first and second base plates 10 and 12 . a backwardly projected shaft is fixed to the back surface of the upper end portion of the first rotating lever 106 . this shaft is passed through a hole 108 formed in the first base plate 10 . and a second gear 110 is rotatably attached to the rear end of the shaft at the back side of the first base plate 10 . the second gear 110 is in mesh with the first gear 98 . in this embodiment , as shown in fig2 the second base plate 12 is notched at the region located below the capstan 96 and facing the second to fifth operating levers 16 , 18 , 20 and 22 . accordingly , the lower end portion of the first rotating lever 106 is not opposite to the second base plate 12 . the right - hand end portion of a horizontally extending flat coupling member 112 is rotatably mounted on the front surface of the lower end portion of the first rotating lever 106 . the left - hand end portion of the coupling member 112 lies on the front surface of the second operating lever 16 . the thickness of the coupling member 112 is equal to that of the second base plate 12 . thus , the coupling member 112 is located within a space between the respective front faces of the first rotating lever 106 and the second operating lever 16 , which face the second base plate 12 , and the front surface of the second base plate 12 , which is to bear the tape cassette 8 set in the tape recorder as the tape recorder 6 . accordingly , the coupling member 112 does not project ahead of the front surface of the second base plate 12 . a backwardly projected guide pin 114 is fixed to the back surface of the left - hand end portion of the coupling member 112 . the guide pin 114 is fitted in a guide hole 116 in the second operating lever 16 . the guide hole 116 extends straight in the vertical direction and has a tilt to the right . the guide pin 114 of the coupling member 112 is positioned at the upper end of the guide hole 116 . a horizontally extending slot 118 is formed in the coupling member 112 . passed through the left - hand end portion of the slot 118 is a shaft 120 which protrudes forwardly from the first base plate 10 between the right - hand side face of the second operating lever 16 and the left - hand side face of the third operating lever 18 . the outer peripheral surface of the shaft 120 is in contact with the horizontally extending upper and lower end face portions of the inner peripheral surface of the slot 118 of the coupling member 112 . over the upper end faces of the third and fourth operating levers 16 and 20 , first and second reel shafts 122 and 124 are rotatably mounted on the first base plate 10 . the front ends of the first and second reel shafts 122 and 124 penetrate the second base plate 12 to be located ahead of the front surface of the second base plate 12 . third and fourth gears 126 and 128 are concentrically fixed to the rear ends of the first and second reel shafts 122 and 124 at the back of the first base plate 10 . the third gear 126 is in mesh with the second gear 110 . the position of the first rotating lever 106 in this state is defined as its first position . a fifth gear 130 is rotatably attached to the back surface of the first base plate 10 . the fifth gear 130 is located within the locus of movement of the second gear 110 described as the first rotating lever 106 rotates clockwise from its first position as shown in fig2 and is in mesh with the fourth gear 128 . between the first and second base plates 10 and 12 , as shown in fig2 a flat auxiliary operating lever 132 lies over the respective upper end faces of the first to fifth operating levers 14 , 16 , 18 , 20 and 22 . the auxiliary operating lever 132 has an elongate shape extending horizontally . as shown in fig2 some of the guide projections 26 are in contact with the horizontally extending upper and lower end faces of the auxiliary operating lever 132 . having its upper and lower end faces in slide contact with the guide projections 26 , the auxiliary operating lever 132 is allowed to move only in the horizontal direction . as shown in fig2 an upwardly projected portion 134 is formed on the upper end face of the auxiliary operating lever 132 . the vertically extending left - and right - hand side faces of the upwardly projected portion 134 , as shown in fig2 are subjected to opposite urging forces applied by an urging means 136 which is disposed between the first and second base plates 10 and 12 . the auxiliary operating lever 132 ceases to move horizontally at the position where the two urging forces of the urging means 136 are balanced with each other . this position of the auxiliary operating lever 132 is defined as its first position . in this embodiment , the urging means 136 is formed of a bent , u - shaped leaf spring , having a pair of leg portions severally in contact with the left - and right - hand side faces of the upwardly projected portion 134 of the auxiliary operating lever 132 . in this embodiment , the upper end of the u - shaped leaf spring is bent to the right , as shown in fig2 . the upper end face of the bending portion abuts against a stopper 137 fixed on the front surface of the first base plate 10 . the dimension of the leaf spring along the thickness of the operating lever device 4 can be made smaller than that of a coil spring . as shown in fig2 downwardly projected first to fourth hanging portions 138 , 140 , 142 and 144 are formed at the portions of the auxiliary operating lever 132 facing the upper end faces of the first to fourth operating levers 14 , 16 , 18 and 20 . a rightwardly projected first and second engaged portions 146 and 148 are formed at the lower end portions of the first and second hanging portions 138 and 140 . the intersectional region between the lower end face and right - hand side face of each one of the first and second engaged portions 146 and 148 , as shown in fig2 is chamfered to form a first or second auxiliary slant face 150 or 152 . the first and second auxiliary slant faces 150 and 152 vertically face the first and second slant faces 50 and 52 of the first and second operating levers 14 and 16 , respectively . between the second hanging portion 140 and the third hanging portion 142 , a downwardly projected stopper 154 is formed on the lower end face of the auxiliary operating lever 132 . the distance between the left - hand side face of the second hanging portion 140 and the right - hand side face of the first engaged portion 146 of the first hanging portion 138 is greater than the distance between the right - hand side face of the upper end portion of the first operating lever 14 and the left - hand side face of the first engaging portion 46 . the distance between the left - hand side face of the stopper 154 and the right - hand side face of the second engaged portion 148 of the second hanging portion 140 is greater than the distance between the right - hand side face of the upper end portion of the second operating lever 16 and the left - hand side face of the second engaging portion 48 . the intersectional region between the left - hand side face and lower end face of the third hanging portion 142 is chamfered to form one third auxiliary slant face 156 . the one third auxiliary slant face 156 vertically faces the other third slant face 56 of the third operating lever 18 . as shown in fig2 the right - hand side face of the third hanging portion 142 has a tilt to the upper right to form a third auxiliary slant face 158 . as shown in fig2 the right - hand side face of the fourth hanging portion 144 has a tilt to the upper right to form a fourth auxiliary slant face 160 . a vertically extending second rotating lever 162 lies between the upper end portion of the fourth operating lever 20 and the upper end portion of the fifth operating lever 22 , as well as between the first and second base plates 10 and 12 . the second rotating lever 162 is pivotally mounted substantially at the middle on the front surface of the first base plate 10 , and can rotate along the front surface of the first base plate 10 . a leftwardly extending fourth engaging portion 164 is formed at the lower end portion of the left - hand side face of the second rotating lever 162 . the intersectional region between the left - hand side face and lower end face of the fourth engaging portion 164 is chamfered to form a slide contact surface 166 , which vertically faces the other fourth slant face 62 of the fourth operating lever 20 . one of the guide projections 26 is in contact with the right - hand side face of the upper end portion of the second rotating lever 162 so that the second rotating lever 162 is allowed to rotate only in the counterclockwise direction from its first position as shown in fig2 . the position of the second rotating lever 162 in this state is defined as its first position . the second rotating lever 162 is urged to be located in the first position by an urging means 167 which is disposed between the first and second base plates 10 and 12 . between the respective upper end portions of the second rotating lever 162 and the fifth operating lever 22 , a downwardly projected first hook member 168 is formed on the lower end face of the auxiliary operating lever 132 . as shown in fig2 the left - hand side face of the first hook member 168 faces the right - hand side face of the upper end portion of the second rotating lever 162 with a given horizontal space between them . an upwardly projected second hook member 172 is formed on the left - hand end portion of the upper end face of the auxiliary operating lever 132 . the intersecting portion between the right end of the upper end face of the auxiliary operating lever 132 and the right - hand side face thereof is chamfered to form a slant face 173 . a flat drive member 174 is disposed between the slant face 173 and the lower end face of the bending portion of the urging means 136 . the flat drive member 174 extends vertically . the upper end face of the flat drive member 174 is in contact with the lower end face of the bending portion of the urging means 136 , while the lower end face thereof is in contact with the slant face 173 of the auxiliary operating lever 132 . the guide projection 26 is in contact with the left - hand side face of the flat drive member 174 . the flat drive member 174 is allowed only to move vertically by sliding the left - hand side face thereof along the guide projection 26 . the flat drive member 174 has a projection 175 extending to the right from the right - hand side face thereof , as shown in detail in fig3 . the upper end face of the projection 175 is in contact with a slant face 177 of a projection depending from an eject lever 176 . the eject lever 176 is disposed on the front surface of the first base plate 10 so as to be pivotal perpendicularly thereto , as shown in fig3 . a fifth engaged portion 178 extending to the right is formed on the lower end of the right - hand side face of the first hook member 168 of the auxiliary operating lever 132 . the intersecting portion between the right - hand side face of the fifth engaged portion 178 and the lower end face thereof is chamfered to form a fifth auxiliary slant face 180 . the fifth auxiliary slant face 180 vertically faces the fifth slant face 68 . the first and second operating levers 14 and 16 are coupled with a first signal generator sg1 . when one of the first and second operating levers 14 and 16 stops upward movement from its first position against the urging force of the urging means 32 , the first signal generator sg1 produces a first electric signal to rotate the output shaft of the motor 104 in one direction at relatively high speed , thereby rotating the capstan 96 and the first gear 98 in the direction indicated by arrow a in fig2 at relatively high speed . the fourth operating lever 20 is coupled with a second signal generator sg2 . when the fourth operating lever 20 stop upward movement from its first position against the urging force of the urging means 40 , the second signal generator sg2 produces a second electric signal to rotate the output shaft of the motor 104 in one direction at relatively low speed , thereby rotating the capstan 96 and the first gear 98 in the direction indicated by arrow a in fig2 at relatively low speed . at the same time , the second signal generator sg2 causes the magnetic head 42 to function as a reproducing head . the fifth operating lever 22 is coupled with a third signal generator sg3 . when the fifth operating lever 22 stops upward movement from its first position against the urging force of the urging means 40 , the third signal generator sg3 causes the magnetic head 42 to function as a recording head . in this embodiment , the first to third signal generators sg1 , sg2 and sg3 are of conventional arrangements . in this embodiment , each one of the first and second operating levers 14 and 16 constitutes first operating lever means as described in the claims . and , in this embodiment , the third operating lever 18 constitutes second operating lever means as described in the claims . furthermore , in this embodiment , the drive member 174 and the eject lever 176 constitute ejecting means as described in the claims . there will now be described the operation of the operating lever device 4 according to the one embodiment of this invention which is constructed in the above - mentioned manner . the second base plate 12 is shown in fig2 but not shown in fig3 to 13 for avoiding the complication of drawing . as shown in fig4 the first and second reel shafts 122 and 124 are fitted with first and second reel hubs 184 and 186 , respectively , of the tape cassette 8 . in this state , the capstan 96 is in contact with the back surface of a magnetic recording tape 188 between the first and second reel hubs 184 and 186 . when the fourth operating lever 20 is pressed upward , it moves up from its first position against the urging force of the urging means 40 . the one fourth slant face 58 of the upwardly moving fourth operating lever 20 comes into slide contact with the fourth auxiliary slant face 160 of the auxiliary operating lever 132 , causing the auxiliary operating lever 132 to move from its first position to the left against the urging force of the urging means 136 . also , the other fourth slant face 62 of the fourth engaging portion 60 of the upwardly moving fourth operating lever 20 comes into slide contact with the other slide contact surface 166 of the second rotating lever 162 , causing the second rotating lever 162 to rotate counterclockwise from its first position against the urging force of the urging means 167 . when the fourth engaging portion 60 engages the fourth engaged portion 164 of the second rotating lever 162 , as shown in fig4 the fourth operating lever 20 stops moving upwardly . the position of the fourth operating lever 20 in this state is defined as its second position . the horizontal position of the auxiliary operating lever 132 when the fourth operating lever 20 is located in its second position shown in fig4 is defined as a second position of the auxiliary operating lever 132 . when the fourth operating lever 20 is located in its second position , the second signal generator sg2 causes the motor 104 to rotate the capstan 96 in the clockwise direction as indicated by arrow a in fig4 at fixed relatively low speed . the rotation of the capstan 96 is transmitted through the first to third gears 98 , 110 and 126 to the first reel shaft 122 , which then rotates in the direction indicated by arrow b . moreover , when the fourth operating lever 20 is located in its second position , a pinch roller ( not shown ) is brought into contact with the front surface of the magnetic recording tape 188 . this pinch roller holds the tape 188 in conjunction with the capstan 96 . thus , the tape 188 is wound around the first reel hub 184 after it is drawn out from the side of the second reel hub 186 by the capstan 96 and the pinch roller . furthermore , when the fourth operating lever 20 is located in its second position , the magnetic head 42 comes into contact with the front surface of the magnetic recording tape 188 , as shown in fig4 . moreover , when the fourth operating lever 20 is located in its second position , the second signal generator sg2 causes the magnetic head 42 to function as the reproducing head . in this state , therefore , information previously recorded on the magnetic recording tape 188 is reproduced by the magnetic head 42 as the tape 188 runs from the second reel hub 186 to the first reel hub 184 at the fixed speed . thus , a playback mode is established in the tape recorder 6 which is provided with the operating lever device 4 according to this embodiment . this means that the fourth operating lever 20 serves as a reproducing or playback lever in the tape recorder 6 . when the auxiliary operating lever 132 is located in its second position , the loci of the upward movement of the right - hand side face of the upper end portion of the first operating lever 14 and the left - hand side face of the first engaging portion 46 are located between the right - hand side face of the first engaged portion 146 of the first hanging portion 138 of the auxiliary operating lever 132 and the left - hand side face of the second hanging portion 140 , as shown in fig4 . further , the loci of the upward movement of the right - hand side face of the upper end portion of the second operating lever 16 and the left - hand side face of the second engaging portion 48 are located between the right - hand side face of the second engaged portion 148 of the second hanging portion 140 of the auxiliary operating lever 132 and the left - hand side face of the stopper 154 , as shown in fig4 . therefore , when the fourth operating lever 20 is located in its second position , the first or second operating lever 14 or 16 can be moved upward from its first position against the urging force of the urging means 32 . when the first operating lever 14 is moved upward from its first position against the urging force of the urging means 32 to locate the first engaging portion 42 of the first operating lever 14 above the first engaged portion 146 of the first hanging portion 138 of the auxiliary operating lever 132 , the first electric signal produced from the first signal generator sg1 causes the output shaft of the motor 104 to rotate in one direction at relatively high speed , thereby rotating the capstan 96 and the first gear 98 in the direction indicated by arrow a in fig3 at relatively high speed . the position of the first operating lever 14 in this state is defined as its second position . when the first operating lever 14 is moved upward from its first position against the urging force of the urging means 32 , the pinch roller is separated from the magnetic recording tape 188 in the tape cassette 8 . at such time , the tape 188 is released from the joint hold by the pinch roller and the capstan 96 . the relatively fast rotation of the first gear 98 in the direction indicated by arrow a is transmitted through the second gear 110 to the third gear 126 . then , the third gear 126 rotates in the direction indicated by arrow b in fig4 at relatively high speed , so that the magnetic recording tape 188 in the tape cassette 8 is quickly fed from the second reel hub 186 to the first reel hub 184 . thus , a fast - forward mode is established in the tape recorder 6 which is provided with the operating lever device 4 according to this embodiment . this means that the first operating lever 14 serves as a fast - forward lever in the tape recorder 6 . while the magnetic recording tape 188 is quickly fed from the second reel hub 186 to the first reel hub 184 in the aforesaid manner , the magnetic head 42 functioning as the reproducing head is in contact with the tape 188 , as shown in fig4 . it is therefore possible to set up playback mode in the state that the magnetic recording tape 188 travels at relatively high speed . if the upward pressing force on the first operating lever 14 is removed , then the first operating lever 14 is moved downward by the urging force of the urging means 32 to be located in its first position . when the auxiliary operating lever 132 is in its second position , the other third auxiliary slant face 158 of the third hanging portion 142 vertically faces the one third slant face 54 of the third operating lever 18 . therefore , if the third operating lever 18 is moved upward from its first position against the urging force of the urging means 32 , the one third slant face 54 of the third operating lever 18 comes into slide contact with the third auxiliary slant face 158 of the third hanging portion 142 , thereby causing the auxiliary operating lever 132 to move from its second position to the left against the urging force of the urging means 136 , as shown in fig5 . then , the left - hand side face of the first hook member 168 of the auxiliary operating lever 132 abuts on the right - hand side face of the upper end portion of the second rotating lever 162 , as shown in fig5 to cause the second rotating lever 162 to rotate counterclockwise against the urging force of the urging means 167 . thereupon , the third operating lever 18 stops moving upwardly . the position of the third operating lever 18 in this state is defined as its second position . also , the position of the auxiliary operating lever 132 in this state is defined as its third position . when the second rotating lever 162 rotates counterclockwise , the fourth engaged projection 164 of the second rotating lever 162 is disengaged from the fourth engaging portion 60 of the fourth operating lever 20 , as shown in fig5 . then , the fourth operating lever 20 is moved downward by the urging force of the urging means 40 to be located in its first position . when the fourth operating lever 20 is located in its first position , the second signal generator sg2 ceases to produce the second electric signal , thus stopping the rotation of the output shaft of the motor 104 and disabling the magnetic head 42 , which is off the magnetic recording tape 188 in the tape cassette 8 , as shown in fig5 from functioning as the reproducing head . thus , a stop mode is established in the tape recorder 6 which is provided with the operating lever device 4 according to this embodiment . this means that the third operating lever 18 serves as a stop lever in the tape recorder 6 . if the upward force having been so far applied to the third operating lever 18 against the urging force of the urging means 32 is removed , the third operating lever 18 is moved downward by the urging force of the urging means 32 to be located in its first position . as the third operating lever 18 moves from its second position to the first position , the auxiliary operating lever 132 is moved to the right by the urging force of the urging means 136 and is returned to its first position . if the third operating lever 18 is pushed up again when the auxiliary operating lever 132 is located in its first position , the other third slant face 56 of the third operating lever 18 comes into slide contact with the other third auxiliary slant face 156 of the third hanging portion 142 of the auxiliary operating lever 132 , thereby causing the auxiliary operating lever 132 to move to the right from its first position against the urging force of the urging means 136 , as shown in fig6 . the slant face 173 of the auxiliary operating lever 132 is brought into slidable contact with the flat drive member 174 . the flat drive member 174 is then moved upward against the urging force of the urging means 136 . the projection 175 of the flat drive member 174 comes in slidable contact with the slant face 177 of the projection of the eject lever 176 from the position shown in fig7 . the eject lever 176 is then pivoted to intersect or become inclined relative to the first base plate 10 , as shown in fig8 . the eject lever 176 causes a member ( not shown ) which faces the bottom surface of the housing of the tape cassette 8 to move to the front side in fig6 thereby moving the tape cassette 8 in the same direction . at this time , first and second reel hubs 184 and 186 of the tape cassette 8 which are fitted on the first and second reel shafts 122 and 124 of the tape recorder 6 are released therefrom . when the force acting on the third operating lever 18 is removed , the third operating lever 18 returns to the first position thereof by the urging force of the urging means 32 . suppose that the fourth operating lever 20 is located in its second position , as shown in fig4 . in this state , the fifth auxiliary slant face 180 of the auxiliary operating lever 132 in its second position vertically faces the fifth slant face 68 of the fifth operating lever 22 , as shown in fig4 . moreover , if the fifth operating lever 22 is pressed upward , it moves up from its first position against the urging force of the urging means 40 . at this time , the fifth slant face 68 of the fifth operating lever 22 is brought into slide contact with the fifth auxiliary slant face 180 of the auxiliary operating lever 132 . thereupon , the auxiliary operating lever 132 moves from its second position shown in fig4 to the left against the urging force of the urging means 136 . before the auxiliary operating lever 132 is located in its third position shown in fig5 the fifth engaged portion 178 of the auxiliary operating lever 132 and the fifth engaging portion 66 of the fifth operating lever 22 engage each other . then , the fifth operating lever 22 stops its upward movement . the position of the fifth operating lever 22 in this state is defined as its second position . further , the position of the auxiliary operating lever 132 in this state is defined as its fourth position ( fig9 ). when the fifth operating lever 22 is located in its second position , the erasing head 44 comes into contact with the surface of the magnetic recording tape 188 , as shown in fig9 . at that time , the third signal generator sg3 causes the magnetic head 42 to function as the recording head . in this state , therefore , information collected by means of a microphone ( not shown ) attached to the tape recorder 6 is recorded on the magnetic recording tape 188 by the magnetic head 42 as the tape 188 runs from the second reel hub 186 to the first reel hub 184 at the fixed speed . thus , a recording mode is established in the tape recorder 6 which is provided with the operating lever device 4 according to this embodiment . this means that the fifth operating lever 22 serves as a recording lever in the tape recorder 6 . when the auxiliary operating lever 132 is in its fourth position , the upper end face of the first operating lever 14 vertically faces the lower end face of the second hanging portion 140 of the auxiliary operating lever 132 , as shown in fig9 . at the same time , the upper end face of the second operating lever 16 vertically faces the lower end face of the stopper 154 of the auxiliary operating lever 132 , as shown in fig9 . accordingly , if the first or second operating lever 14 or 16 is pressed upward when the tape recorder 6 is in the recording mode , then the upper end face of the first or second operating lever 14 or 16 will abut on the lower end face of the second hanging portion 140 or the stopper 154 of the auxiliary operating lever 132 . it is therefore impossible to locate the first or second operating lever 14 or 16 in its second position . thus , the fast - forward or fast rewinding mode cannot be established while the tape recorder 6 is in the recording mode . the fourth and fifth operating levers 20 and 22 in their respective second positions are returned to their respective first positions by the urging forces of the urging means 40 , respectively , by locating the third operating lever 18 to its second position to bring the auxiliary operating lever 132 to its third position , thereby disengaging the fourth engaged projection 164 of the second rotating lever 162 and the fifth engaged portion 178 of the auxiliary operating lever 132 from the fourth engaging portion 60 of the fourth operating lever 20 and the fifth engaging portion 66 of the fifth operating lever 22 , respectively . if the first operating lever 14 is pressed upward against the urging force of the urging means 32 when the first to fifth operating levers 14 , 16 , 18 , 20 and 22 are in their respective first positions , as shown in fig2 then the first slant face 50 of the first operating lever 14 comes into slide contact with the first auxiliary slant face 150 of the first hanging portion 132 of the auxiliary operating lever 132 to cause the auxiliary operating lever 132 to move from its first position to the left against the urging force of the urging means 136 . before the auxiliary operating lever 132 reaches its third position , the first engaging portion 46 of the first operating lever 14 engages the first engaged portion 146 of the first hanging portion 138 of the auxiliary operating lever 132 , as shown in fig1 . thereupon , the first operating lever 14 stops its upward movement . the position of the first operating lever 14 in this state corresponds to its second position . thus , the fast - forward mode is established in the tape recorder 6 . the position of the auxiliary operating lever 132 is defined as its fifth position . the second auxiliary slant face 152 of the auxiliary operating lever 132 in the fifth position vertically faces the second slant face 52 of the second operating lever 16 . if the second operating lever 16 is pressed upward against the urging force of the urging means 32 when the first operating lever 14 is in its second position , the second slant face 52 of the second operating lever 16 comes into slide contact with the second auxiliary slant face 152 of the second hanging portion 140 of the auxiliary operating lever 132 in its fifth position , thus causing the auxiliary operating lever 132 to move from its fifth position to the left against the urging force of the urging means 136 . when the left - hand side face of the second engaging portion 48 of the second operating lever 16 comes into contact with the right - hand side face of the second engaged portion 148 of the second hanging portion 140 of the auxiliary operating lever 132 , the first engaging portion 46 of the first operating lever 14 is disengaged from the first engaged portion 146 of the first hanging portion 138 of the auxiliary operating lever 132 , and the first operating lever 14 is returned to its first position by the urging force of the urging means 32 . thereafter , if the second operating lever 16 is further moved upward , the second engaging portion 48 of the second operating lever 16 engages the second engaged portion 148 of the second hanging portion 140 of the auxiliary operating lever 132 , as shown in fig1 . thereupon , the second operating lever 16 stops its upward movement . the position of the second operating lever 16 in this state is defined as its second position . the position of the auxiliary operating lever 132 in this state corresponds to its fifth position . the first auxiliary slant face 150 of the first hanging portion 138 of the auxiliary operating lever 132 in the fifth position vertically faces the first slant face 50 of the first operating lever 14 in its first position . as the second operating lever 16 moves from its first position to the second , the coupling member 112 , which has its guide pin 114 guided by the guide hole 116 of the second operating lever 16 , moves from the position shown in fig2 to the left . as the coupling member 112 moves to the left , the first rotating lever 106 rotates clockwise from its first position shown in fig2 . thus rotated , the first rotating lever 106 keeps the second gear 110 apart from the third gear 126 of the first reel shaft 122 . when the coupling member 112 stops its leftward movement , that is , when the second operating lever 16 is located in its second position , the second gear 110 of the first rotating lever 106 comes to be in mesh with the fifth gear 130 , as shown in fig1 . the position of the first rotating lever 106 in this state is defined as its second position . when the second operating lever 16 is located in its second position , the first signal generator sg1 generates the first electric signal and the output shaft of the motor 104 rotates in one direction at relatively high speed , causing the capstan 96 and the first gear 98 to rotate in the direction indicated by arrow a in fig1 at relatively high speed . when the second operating lever 16 is moved upward from its first position against the urging force of the urging means 32 , the pinch roller is removed from the magnetic recording tape 188 in the tape cassette 8 . thus , the tape 188 is released from the joint hold by the pinch roller and the capstan 96 . in fig1 , the magnetic recording tape 188 of the tape cassette 8 and the second base plate 12 are omitted so as to understand the movement of the first to fifth gears 98 , 110 , 126 , 128 and 130 more easily . the relatively fast rotation of the first gear 98 in the direction indicated by arrow a is transmitted through the second gear 110 to the fifth gear 130 . then , the fourth gear 128 rotates in the direction indicated by arrow c in fig1 at relatively high speed , so that the magnetic recording tape 188 in the tape cassette 8 is quickly rewound from the first reel hub 184 fitted on the first reel shaft 122 to the second reel hub 186 fitted on the second reel shaft 124 . thus , a fast rewinding mode is established in the tape recorder 6 which is provided with the operating lever device 4 according to this invention . this means that the second operating lever 16 serves as a fast rewinding lever in the tape recorder 6 . if the auxiliary operating lever 132 is shifted from its fifth position shown in fig1 to its third position by locating the third operating lever 18 in its second position , the second engaging portion 48 of the second operating lever 16 is disengaged from the second engaged portion 148 of the second hanging portion 140 of the auxiliary operating lever 132 , and the second operating lever 16 is returned to its first position by the urging force of the urging means 32 . thereupon , the coupling member 112 , having its guide pin 114 guided by the guide hole 116 of the second operating lever 16 , moves to the right to locate the first rotating lever 106 in its first position , as shown in fig2 . a modification of the operating lever device 4 will be described with reference to fig1 and 13 . a third inverted l - shaped rotating member 190 is disposed beyond the second hook member 172 and between the first and second base plates 10 and 12 . the substantially central part of the third rotating member 190 is pivoted to the front surface of the first base plate 10 . the third rotating member 190 is free to rotate along the front surface of the first base plate 10 . the left - hand side face of the lower end of the third rotating member 190 abuts against the right - hand side face of the second hook member 172 of the auxiliary operating lever 132 . the lower end surface of the projection of the third rotating member 190 which extends to the left is brought into contact with a portion of an eject lever 192 . this portion is separated from the center of rotation of the eject lever 192 disposed on the first base plate 10 . with the above arrangement , if the third operating lever 18 is located in the second position , the auxiliary operating lever 132 is moved to the right of the first position against the urging force of the urging means 136 , as shown in fig1 . the second hook member 172 causes the third rotating member 190 to rotate in the counterclockwise direction . the third rotating member 190 causes the eject lever 192 to intersect or become inclined relative to the first base plate 10 . the eject lever 192 causes a member ( not shown ) which faces the bottom surface of the housing of the tape cassette 8 to move in the direction which intersects the first base plate 10 , as shown in fig1 . therefore , the first and second reel hubs 184 and 186 of the tape cassette 8 fitted on the first and second reel shafts 122 and 124 , are released therefrom . although an illustrative embodiment of this invention has been described in detail herein , it is to be understood that the invention is not limited to such embodiment , and that various changes and modifications may be effected therein by one skilled in the art without departing from the scope or spirit of the invention .	6
by way of disclosing a preferred embodiment , and not by way of limitation , there is shown in fig1 an assembly of mated molded parts comprising a bearing cap 10 which includes in its general organization a first part 12 , or upper half , and a second part 14 , or lower half . together , the parts form a circular disk having a central circular opening 16 for the passage of a shaft , the retention of a bearing , or the like . other , noncircular shapes are possible within the scope of the invention . for example , if the bearing cap is used at the end of a piston connecting rod , first part 12 may have an integral connecting rod portion extending therefrom . at either side of the central opening , the first and second parts 12 , 14 are mated together along diametrically disposed planes 18 , 20 . the parts are held together in assembled relationship by bolts 22 , screws , or other suitable fasteners which extend through holes as more fully described below . the parts are preferably formed of cast aluminum . a suitable material is 380 aluminum . details of the first part 12 , or upper half , are shown in fig2 and 3 . the first part 12 is in the form of a semicylinder , or half ring , having an outer surface 24 , an inner surface 26 , and a pair of planar mating surfaces 28 disposed at either side of the central opening through which the shaft will pass . the first part is formed with a pair of countersunk bores 29 through which fasteners will pass when the bearing cap is assembled . an integral protrusion 30 extends from each of the mating surfaces 28 disposed axially perpendicularly to the mating surfaces . each protrusion includes an outwardly narrowing frustoconical portion 32 , an enlarged head 34 , and a neck portion 36 joining the frustoconical portion to the head . the neck portions 36 form areas of reduced cross - sectional area across which the protrusions may be fractured to separate the heads 34 from the frustoconical portions 32 . an apparatus and method for manufacturing the bearing cap of the invention are shown in fig4 - 9 . in fig4 it may be seen that the die half 40 is formed with two cavities 42 , 44 and a bifurcated passageway 46 for introducing molten metal into the cavities . as is well known in the art , an identical , mating die half is used with the die half shown in the figures . cavity 42 is used to separately cast the first parts 12 of the bearing cap . as such , cavity is generally semicylindrical with two smaller recess 48 corresponding to the protrusions 30 shown in fig2 . cavity 44 is cylindrical , and conforms to the overall shape of the fully assembled bearing cap as shown in fig1 . as shown in fig4 cores 50 are positioned in the cavity 42 prior to casting the first parts 12 . as is well known in the art , these cores will prevent metal from filling the countersunk bores 29 ( fig2 ). the cores are removed after the bearing cap is fully cast . two die halves are brought together , and molten metal is introduced into the cavity 42 . as shown in fig5 a first part 12 is thus formed . next , as shown in fig6 the newly formed first part 12 is removed from the cavity 42 . the first part 12 is inverted and placed in the lower portion of cavity 44 . new cores 50 are placed in the cavity 42 . similarly , cores 52 are placed in the upper portion of the cavity 44 in alignment with the countersunk bores formed in the first part 12 . the protrusions 30 of the first part 12 extend upwardly into the unoccupied upper portion of the cavity 44 . next , the two die halves are again brought together , and molten metal is introduced into both cavities 42 and 44 . as shown in fig7 this results in the formation of a second bearing cap first part 12 &# 39 ; in the cavity 42 , and the formation of a bearing cap second part 14 in the upper portion of the cavity 44 . the second part 14 is thus perfectly mated to the first part 12 . the newly cast metal of the second part 14 does not adhere to the previously cast metal of the first part 12 which allows the two parts to be subsequently separated . the bearing cap 10 thus formed is then removed from the die 40 . the cores 50 , 52 are removed . bearing cap 12 &# 39 ; is transferred to the cavity 44 . the steps illustrated in fig6 and 7 are repeated , with each cycle producing a fully formed bearing cap 10 and a separate first part 12 . as shown in fig8 the metal of the second part 14 of a newly formed bearing cap 10 completely envelops the protrusions 30 of the first part 1 . the heads 34 of the protrusions are captured by , and interlocked with , the second part . at this point , the central opening 16 of the bearing cap may be machined to the desired diameter and surface finish . if necessary , the countersunk bores such as bore 29 may be drilled to the correct diameter or tapped . the parts are rigidly held together during such machining by the protrusions and heads interlocked with the second part . to separate the two parts , a device having fingers 58 is inserted into the central opening 16 of the bearing cap . the fingers are then forcefully spread apart . as shown in fig9 the spreading apart of the fingers 58 causes the protrusions 30 to fracture and break at their neck portions 36 thus separating the bearing cap parts 12 , 14 . only a relatively small force is required to fracture the necks because of their small cross - sectional area . the heads 34 remain embedded in the second part 14 . the second part 14 thus formed is provided with planar mating surfaces 60 , inner surface 62 , and outer surface 64 which mate perfectly with the corresponding surfaces of the first part 12 . a frustoconical recess 66 is formed through each of the mating surfaces 60 . each recess 66 mates perfectly with the frustoconical portions 32 of the protrusions 30 of the first part 12 . thus , when the bearing cap is reassembled around a shaft or bearing , the frustoconical portions 32 and the recesses 66 guide the two parts together into perfect coalignment . the invention is not limited to casting or the use of metal . other forming techniques and other materials may be used . for example , assemblies according to the invention may be made using molded powdered metal or molded plastic . it is sufficient that the materials used be moldable to the extent that the material is initially flowable , formed into the desired shape , then hardened . the terms &# 34 ; molded &# 34 ; and &# 34 ; moldable &# 34 ; as used herein are intended to encompass all such forming techniques and materials . the invention is not limited to bearing caps and the manufacture of bearing caps . fig1 and 11 diagrammatically show an assembly 70 a first part 72 and a second part 74 which precisely fit together along confronting surfaces 76 , 78 . first part 72 is molded in the manner described above . first part 72 is molded with wedge - like protrusions 80 . second part 74 is molded against the first part 72 such that the protrusions 80 form the recesses 82 in the second part . in contrast to the protrusions 30 described above , protrusions 80 are wedge shaped rather than frustoconical . furthermore , protrusions 80 are not formed with enlarged heads . the enlarged heads may be omitted if it is not necessary to hold the parts together firmly prior to separation and reassembly . also , the material of the second part 74 may shrink as it hardens such that the protrusions 80 are grasped within the recesses 82 . the parts may be separated by pulling them apart such that the protrusions 80 are withdrawn from the recesses 82 . the assembly of parts according to the invention may be formed with only a single protrusion and recess , or with more than two . the mating surfaces of the parts , such as surfaces 76 and 78 in fig1 , need not be flat or planar . the assemblies shown in the figures are but illustrative of an unlimited variety of types , shapes , and configurations of assemblies which may be made according to the principles of the invention . the above description is that of a preferred embodiment of the invention . various alterations and changes can be made without departing from the spirit and broader aspects of the invention as set forth in the appended claims , which are to be interpreted in accordance with the principles of patent law , including the doctrine of equivalents .	5
fig1 - 3 all illustrate views of applicant &# 39 ; s present invention . applicant &# 39 ; s present invention provides , in footwear ( 10 ) typically , a shoe , sneaker , sandal , or the like , a first strap ( 12 ), and a second strap ( 14 ), the straps attached either directly or indirectly to a sole ( 16 ) of the footwear . the straps are designed to help secure the footwear to the foot of the wearer . first strap ( 12 ) is attached at a near end ( 12b ) to the sole , either directly or indirectly , indirectly by means of attachment as by attachment to an upper . at removed end ( 12b ) of the strap is found a first velcro ® pad ( 18a ), ( for example , having a barbed section ,) for engagement with a second velcro ® pad ( 18b ) ( for example , having a loop section ) located on removed end ( 14b ) of second strap ( 14 ) such that the two straps may be releasably and overlappingly secured , one to the other by means of the velcro ® securement pads ( 18a and 18b .) turning now to the details of applicant &# 39 ; s invention , it is seen that first strap ( 12 ) has a bottom surface ( 12d ) and a top surface ( 12c ). typically , these straps are made of leather , approximately 0 . 060 to 0 . 075 inches thick . at the removed end of the first strap , the leather or other suitable material is carefully split into an upper sheet , or section 20a , and a lower sheet , or section 20b . this splitting is done in the manner set forth in u . s . patent application ser . no . 08 / 518 , 040 , now abandoned the specification and drawings of which are incorporated herein by reference . the longitudinal extent of the split is dictated by the size of the velcro ® pad intended to be located on the strap . as is seen in the adjoining figures , the pad ( 18a ) is stitched typically by double stitching ( 22 ) to lower section ( 20b ) such that pad ( 18a ) is on bottom surface ( 12d ) near or at removed end ( 12b ) of the first strap ( 12 ). stitching ( 22 ) may be single or double and in any particular pattern . moreover , pad ( 12a ) may also have a self - adhesive on the backing thereof to attach directly to bottom surface ( 12d ) or may also be glued thereto . following splitting of the removed end and securing the velcro ® pad , the two sections are rejoined , by using a suitable cement or glue and pressing the upper section ( 20a ) to lower section ( 20b ) and allowing the glue to dry . the result of this procedure is an aesthetically pleasing strap wherein the top surface of the removed end of the strap is unmarred by stitching yet the velcro ® pad or the like is securely held to the strap by stitching . additionally , a second stitching here illustrated by single stitching ( 26 ) in fig3 may be utilized in which the two sections ( upper and lower ) are stitched together along with the pad . further , because the pad is already firmly adhered , as by stitching or the like , to the strap , a final single stitching ( 26 ) may be provided with narrower margins ( a ) than has heretofore been possible . that is , without these splitting and securing steps , if single stitching ( 26 ) is utilized to secure the pad to the strap ( rather than splitting , stitching and gluing ), a sufficiently wide margin at ( a ), typically at least 1 / 8 inches , is required to prevent the pad from pulling loose , after repeated use , from the underside of the strap . the same procedure is typically utilized at removed end ( 14b ) of second strap ( 14 ). intended within the disclosure and claims of the invention herein described is the utilization of the splitting process with any sheet - like material designed to assist in securing footwear to the foot of the wearer . for example , sheet - splitting with attachment to one section thereof may be utilized with materials shaped other than straps , as for example , overlapping panels serving as closure means for securing footwear to the wearer &# 39 ; s foot . moreover , while the illustrations feature the use of hook and loop fastener pads of the velcro ® type for locking cooperative engagement , one to the other , snaps may also be utilized with the split / reglue method of applicant &# 39 ; s present invention . terms such as &# 34 ; left ,&# 34 ; &# 34 ; right ,&# 34 ; &# 34 ; up ,&# 34 ; &# 34 ; down ,&# 34 ; &# 34 ; bottom ,&# 34 ; &# 34 ; top ,&# 34 ; &# 34 ; front ,&# 34 ; &# 34 ; back ,&# 34 ; &# 34 ; in ,&# 34 ; &# 34 ; out ,&# 34 ; and the like are applicable to the embodiments shown and described in conjunction with the drawings . these terms are merely for purposes of description and do not necessarily apply to the position or manner in which the invention may be constructed for use . although the invention has been described in connection with the preferred embodiment , it is not intended to limit the invention &# 39 ; s particular form set forth , but on the contrary , it is intended to cover such alternatives , modifications , and equivalences that may be included in the spirit and scope of the invention as defined by the appended claims .	1
as noted above , provenance has broad application to data and workflow intensive processes . it is a particularly important issue , for example , in hydrocarbon reservoir management workflows where various data objects are involved , including uncertain reservoir models , reservoir measurements , simulation results , and production schedules . by way of example and not limitation , embodiments of the present invention are described in the context of hydrocarbon reservoir management workflows . other areas in which aspects of the present invention may find application include , for example , distributed organ transplant management , electronic healthcare records , digital art and / or literature libraries , and a variety of engineering data analysis applications such as aerospace research and development . returning to the example of hydrocarbon resource management , in both the exploration and production environments domain experts may prefer to be able to trace these data objects , so as to know when , where , how and by whom these data objects were created . this information can help domain experts to determine a measurement of the trustworthiness of the data objects , so that they can achieve good data quality control and data reliability maintenance . for example , it may be useful to distinguish the case where subsurface conditions are modeled based on pseudo cores versus cases where conditions are measured by actual well logging as a domain expert may place greater confidence in logged data over modeled data . data provenance , or lineage , can provide domain experts with this kind of information . when used in quality control applications , the provenance information may include ancestral data objects of the data , settings and intermediate results of workflows which create the data , etc . with data provenance domain experts can go back through the whole derivation history of data objects , check repeatability of the workflow , debug workflow executions , find the origins of errors , and learn whether there are data accuracy propagations within or between workflows . a typical reservoir operation setting involves the use of many legacy tools which were not designed to interact with each other . among the most important of these tools are the simulators for the reservoirs , surface facilities , etc . legacy data sets have various data formats including unstructured ( ascii ), structured data in xml format and databases , data only accessible through specialized api invocations , and the like . furthermore , typical oilfield operations involve multiple classes of users and stakeholders , with different specializations and roles across departmental boundaries . as will be appreciated , these users may have different requirements , different terminology and vastly different workflows , both from an input and an output perspective . as a result , integration of reservoir management involves both application integration and data integration . in a typical reservoir management workflow , domain experts use data objects created by other applications or workflows as input , and integrate a set of applications ( which may have been wrapped as web - services ) to produce output data objects through some predefined steps . the output data may be used by other applications or workflows as input . a set of such workflows may be integrated together to form a higher level workflow . a higher level workflow usually involves the work of multiple departments and may last for a long time ( e . g ., on the scale of a year or more ). in an embodiment of the present invention , in order to compose provenance from individual workflows to get an integrated provenance view that combines together multiple workflows , both provenance within a workflow and across workflows are collected in accordance with a provenance integration framework . in this approach , the term internal provenance is used to refer to provenance information derived from within a workflow instance , which includes data derivation relationship , workflow settings , and intermediate results , etc . likewise , external provenance is used to indicate the provenance information derived from data that is passed between workflows . the external provenance provides information regarding which workflows the input / integrated data objects come from . external provenance pertains primarily to the input and output of workflows , and not to the internal data of a workflow . by managing both internal and external provenance , the inventors provide a system and method that may allow a user or a domain expert to obtain a comprehensive provenance view . particular examples of internal and external provenance are discussed further , below . for a particular workflow , a provenance model may be defined to specify what provenance information should be collected , and to convert unstructured raw provenance data into structured provenance information . that is , it may include definitions , formats , relationships and operations for provenance information . a provenance model can be considered to represent domain experts &# 39 ; view about the workflow and its data objects . it may be built based on the domain and the use of the provenance information . as applied to reservoir management , wherein workflows may be created by different departments that may focus on different domains ( e . g ., reservoir engineering , production engineering , facilities engineering , and business management ), diverse provenance models may be developed for the workflows &# 39 ; internal provenance . these provenance models may also lead to different approaches to storing provenance information ( e . g ., resource description framework repositories or relational databases ). considering the large number of provenance models and continuity of developing new provenance models , it is not generally efficient or scalable to unify these internal provenance models . when domain experts retrieve multiple workflows &# 39 ; internal provenance ( which are under a common higher level workflow ), some methods should be provided to map data objects under different provenance models . the framework in accordance with an embodiment of the present invention may include functionality for capturing data provenance in legacy tools . in an embodiment , this functionality operates by analyzing the log of legacy tools to detect and annotate the data derivation relationship involved in the legacy tools . this functionality may be implemented , for example , in a provenance web - service module . in a particular example of external provenance , a data object a is used by a first workflow w 1 as an input object . data object a may have been created by another workflow w 2 , thus there is a need to connect provenance captured in the two different workflows together . because a may , in some cases , have been imported into w 1 manually ( e . g ., through copy & amp ; paste ), downstream users may not know which workflow created it . if the provenance data is stored in a distributed way , users may also have difficulty determining the provenance of the data object a . in an embodiment of the present invention , a framework for supporting diverse provenance models and easing provenance integration is provided . as schematically illustrated in fig1 , a number of workflows 102 a - 102 e , which are in general different from each other , form the workflow layer . for each workflow , or for a number of related workflows , a provenance model and its corresponding provenance data store , or repository , may be wrapped as a provenance service 104 a , 104 b , 104 c , and a service oriented architecture ( soa ) may be used to aggregate provenance services in a provenance index service 106 . in this way , a newly introduced provenance service involving a corresponding new provenance model may , in principle , be integrated into the existing framework . users may submit provenance query requests to ask for the internal provenance about a particular data object or group of data objects , which , in general , are themselves outputs of workflows whose provenance is stored in the provenance repository . as illustrated in the figure , a user can interact with the provenance index service directly to browse the external provenance , or interact directly with the provenance services . within the framework , a provenance index service is provided . the provenance index service can connect multiple workflows &# 39 ; internal provenance by mapping their input / output data objects , and locate users &# 39 ; provenance requests to corresponding provenance services . external provenance information may be published into the provenance index , and used to connect distributed internal provenance together . a set of models including , for example , a semantic model based on domain knowledge is defined to express the external provenance and the provenance index . in a particular example , a framework in accordance with an embodiment of the invention can be applied to oilfield management . for the purposes of this example , a number of relevant terms may be defined : a well is an entity that produces oil , water , and gas . a block is a set of wells . the production of a block is the sum of the production of its constituent wells . the oil , water , or gas production for a well or a block is often represented by a “ recovery curve ” or a “ decline curve ” for that well or block . the production should be under the constraints of surface facility capacity , which refers to the facility and export system capacities over the life of the reservoir . a generic workflow used to forecast and optimize future oil production can then be described . in general , the workflow has five input data sets : block history data , well production data , block data , recovery curve data , and surface facility constraints data . block history data depicts the historical production data of a block which is collected from the real production history . well production data holds the production information for a well . because the workflow does the forecasting at the block level , well production data of the wells which belong to a block will be aggregated in another input data structure called block data . some other information about the block &# 39 ; s property is also included in block data . the well production data and the block data can both be seen as data about the reservoir deliverability and well capacity . the example workflow combines these data with data of surface facility constraints , which is also an input of the workflow , to forecast and optimize the future production . fig2 depicts a general process for the example workflow 200 . in each time step 202 of a control loop , the block production result is forecast up to that time . as a final result 204 , the workflow will provide only a final optimization and forecasting result , but the data involved in each time step may likewise have value as an intermediate result . domain experts may have a need to access these data so that they are able to review the workflow and check the data &# 39 ; s quality and trustworthiness . therefore , in an embodiment , the intermediate results may comprise internal provenance information for this workflow . because this data may become quite large , it may be stored , for example , in a separate relational database ( not shown ). for this example , then , a number of relational database tables comprise the internal provenance model , and time step can be used to distinguish different data records . the inputs , 206 , 208 , 210 , 212 , 214 , may also involve complex processes . for example , reservoir deliverability and well capacity data , including well production data 208 and block data 210 , can be generated by a number of different methods , implemented together or in the alternative . each method may itself involve several workflows which include , for example , lab tests , seismic simulators , and production simulators , etc . according to different accuracy and timeliness requirements , domain experts may choose different methods to generate the reservoir deliverability and well capacity data . meanwhile , complete surface facility constraints data generally take into account factors like fluid properties , surface equipment , and even market and transportation conditions . all these workflows are under the direction of a higher level workflow which employs integrated workflows or applications to achieve overall system optimization . in this case , data will generally flow across workflows belonging to different departments , that is , data objects may be shared between workflows . the origin of the input data of different workflows forms a basis for determining external provenance . for example , the external provenance service of the forecasting workflow may record which other workflow instances create the data objects contained in well production data 208 , block data 214 , and surface facility constraints 212 . in order to collect provenance information from applications that are not previously designed for providing it , methods to annotate and extract data relationship from logs generated by legacy applications may be defined . in this regard , an ontology of a provenance model is first defined to describe the formalized provenance information . a extended semantic rich workflow model is used to capture provenance in a workflow context . such context provides semantic information for provenance annotation . a workflow instance detection algorithm is then used to identify the workflow instances within which provenance can be annotated and extracted . the provenance index service can be configured to map the input data objects of a workflow instance to the output data objects of other workflow instances . moreover , it may record the addresses of provenance services so that domain experts can use it to locate any provenance service . by way of example , in use , a user may track data provenance using provenance service 104 a first , and find that a particularly important data object is imported from another workflow and that its provenance information is not stored in the repository of 104 a . in this event , the provenance service 104 a may be configured to contact the provenance index service 106 , and to inquire which workflow created the data object , and from which provenance service the provenance information can be retrieved . the provenance index service 106 will reply to service 104 a by providing the address of the target provenance service , for example , service 104 b , along with a formatted query suitable for interrogating service 104 b . once the reply is received , 104 a contacts 104 b submitting the formatted query it received from the index service 106 . upon receiving the reply from 104 b , the result may be provided to the user . as connections are built up through responses to user queries , the additional connection information may be cached or placed into permanent storage as part of the index service so that the same data mapping will be available for future requests . the user may then continue to query the system until satisfied that sufficient provenance information has been obtained . while this embodiment makes use of one node that can be considered to be central , it should not become a bottleneck because it does not store all the provenance data records themselves . instead of including all of the provenance data within the index service 106 , it only includes a portion of the data ( for example , metadata ) and the external provenance for each provenance service . that is , data mapping is done on - demand , rather than mapping the entire model from the beginning . this means that , in general , storage and computational costs for the index service 106 service can be relatively low . as new workflows are introduced into the framework , respective new provenance services along with their respective new provenance model and repositories can be added into the provenance framework . after a new provenance service is built , the service administrator will register the new service to the provenance index service with some required information , which includes , for example , the address of the service , the involved workflows , the input and output data objects of the workflows ( i . e ., the external provenance ), and the querying interface of the service , etc . where a particular workflow does not include built - in provenance logging , other approaches may be used to derive internal provenance for that workflow . as an example , the software used to perform the workflow may include a logging function that does not itself track provenance or natively provide for extraction of provenance information . in this case , data relationship rules can be used to extract provenance information . for a particular workflow , a set of data relationship extraction rules may be defined based on an understanding of the various processes that make up the workflow . by way of example , an upscaling workflow is one in which a fine scale grid ( such as a permeability model for a subsurface region ) is converted into a coarse scale grid . as will be appreciated , such upscaling can provide a reduced computational requirement for flow modeling calculations . applied to the upscaling workflow example , a rule can be defined m 1 : & lt ; upscaling , grid_a , grid_b & gt ;→ derives , where upscaling is the workflow , grid_a is the fine scale grid , grid_b is the coarse scale grid and derives is the relationship ( i . e ., grid_b is derived from grid_a ). once a suitable set of extraction rules is created for a given workflow , it may be applied to the workflow and internal provenance information may be derived . the provenance index service 106 may include , for example , three models , a data model , a domain model and a provenance service model . the data model may be defined as a schema for the external provenance . data objects and workflow instances are defined in this model . furthermore , the data model is used to match data objects from different workflows . the domain model may be implemented as a semantic model which expresses the domain knowledge contained in provenance information . domain entities and their relationships may be defined in this model , and may be mapped to data objects captured in provenance information . in this way domain experts who take charge of different workflows can use common vocabulary to discuss external provenance information . the provenance service model may be used to capture the semantics of provenance services so that they can be located and invoked . this model may be imported into the data model so as to express the relationships between workflows and provenance services . in general , an ontological approach may be used to define the provenance service models . one schema for defining the ontology is illustrated in fig3 . this schema illustrates an example of a set of input / output relationships between data objects and workflow instances . in this schema , the model records who runs aspects of a workflow and who , or what process , creates the data objects . this information can be used , for example , to evaluate quality based on known information regarding the creator . furthermore , it may be used to facilitate contact between domain experts in one department with the person who ran the workflow where an object pertains to a workflow of another department . in the example of reservoir management workflows , especially in some simulation workflows , domain experts may adjust a simulator model &# 39 ; s setting to calculate a group of simulation results . by comparing these results they can decrease the uncertainty in the simulation . in this case , the “ parameterization ” relationship , illustrated in the upper left corner of the schema , to capture the relationship among these results . likewise , from the parameterization relationship a workflow &# 39 ; s evolution history may be observable . because an important use of provenance information is for data quality control , data quality ( lower left corner ) may be defined in this schema . identification of data objects that are used in multiple workflow instances , a five dimensional identification tuple can be assigned : d =& lt ; n e , n i , w , s , t & gt ; in the data model where n e is the data object &# 39 ; s name / id defined in external provenance ( i . e ., a “ public ” name in the provenance index ), n i is the data object &# 39 ; s name / id defined in some internal provenance ( which can be seen as a “ private ” name of the data object ), w is the workflow instance in which the data object &# 39 ; s provenance information is captured , s is the provenance service which stores w &# 39 ; s internal provenance , and t indicates the relationship between the data object and the workflow instance ( input or output ). in this example , n e and n i may be not the same because a data object may have a different name / id in a given workflow &# 39 ; s internal provenance . however , because each data object has only one “ public ” name n e in the provenance index , we can link multiple tuples with the same n e so as to match the same data objects appearing in different workflows . the domain model contains an ontology that models the domain entities in reservoir management . data objects contained in external provenance are mapped to this domain ontology . for the example described above , block , well and their containment relationship are defined in the ontology , and these concepts and relationships may be mapped to well production data and block data . with the help of this domain model domain experts can understand the data objects from the domain level . in the model , a 4 - tuple d o =& lt ; k , n d , c , p & gt ; may be used to define a domain object where k is the kind / class of the domain object , n d is the name of the domain object , c is a list of domain objects d o 1 , d o 2 , d o 3 , . . . which are contained by d o , and p is the domain object which contains d o . in this tuple , c and p indicate the children - parent relationships among domain entities . other relationships among domain objects may be defined . for example , the tuple r =& lt ; d d , d ,& gt ; may be used to express relationships in which d d and d , are the two domain objects between which the relationship is acting . the provenance service model includes an address of the service and interfaces of the service . as described above , users invoke the interface to retrieve internal provenance from a provenance service located in a certain address . the interface provides a list of parameters for users to specify the particular internal provenance of interest . referring again to the forecasting workflow example , domain experts may not want to check the whole forecasting process . instead , they may only want to check the intermediate results in one period of forecasting time . in this regard , functionality can be included that allows domain experts to use a parameter in the interface to specify this checking period . likewise , for different data objects the same provenance service may provide different interfaces . a 3 - tuple s =& lt ; n s , a s , i & gt ; may be used to present the provenance service model where n s is the name of the provenance service , a s is the address of the service , and i = i 1 , i 2 , i 3 , . . . i i defines a list of interfaces 1 - i . for each interface i i , a 2 - tuple i i =& lt ; d , p & gt ; where d = d 1 , d 2 , d 3 , . . . is the list of data objects whose provenance can be retrieved by using the interface i i and p = p 1 , p 2 , p 3 , . . . , where each p i is a 2 - tuple & lt ; n i , v i & gt ; and p represents the parameters of the interface . in an example of operation of an embodiment , each provenance service is initially registered in the provenance index service . when a workflow instance ( e . g ., the forecasting workflow described previously ) is processed , the internal provenance is recorded in the provenance repository ( which may be implemented as a relational database for the forecasting workflow ) of a respective provenance service . meanwhile , information pertaining to the workflow instance ( e . g ., the user who run the workflow ) and the input and output data objects are sent to the provenance index . the external provenance information is modeled using the ontology schema defined above , for example . in the forecasting workflow example , the external provenance information may include information about the time and users of the workflow processing , and the data objects contained in the five input data sets ( i . e ., block history data , well production data , block data , recovery curve data , and surface facility constraints data ) and the output data set ( i . e ., the forecasting production result ). if a domain expert only wants to learn the provenance information at a coarse level , external provenance may be retrieved from the provenance index directly . for example , from the external provenance recorded in the forecasting workflow , domain experts can learn what data objects and what workflow instance created the specific forecasting production result . they can also retrieve the external provenance about the well production data from the provenance index service to learn the general process of generating well production data . if , however , the domain expert wants to get the detailed provenance about the forecasting production result , the data matching functionality of the provenance service index may be used to query other provenance services and obtain the internal provenance about those input data sets . the domain expert can repeat this process so as to track provenance across workflows . likewise , internal provenance may be customized by specifying the parameters of the provenance service interface . in a particular embodiment , a relational database such as oracle ® is used to store the internal provenance of the forecasting workflow . in a typical forecasting workflow , a simulator that calculates forecasting production results for each month of the forecasting period forms the nucleus . as intermediate results ( and internal provenance data ) both the input and output data objects of the simulator for each month are recorded as relational database table . as noted above , these intermediate results can be significant for domain experts to judge the data quality and debug the forecasting simulator . for example , a table which uses & lt ; blockname & gt ; as the key is used to store the static ( i . e ., unchanged over the forecast time frame ) property values of the blocks . complementarily , a table with the key & lt ; blockname , time & gt ; is used to store dynamic property values of blocks . these two tables together store the data objects in the block level . for the well level , another two tables with the keys & lt ; blockname , wellname & gt ; and & lt ; blockname , wellname , time & gt ; are used to store the corresponding well level static and dynamic data objects . the provenance repository of the forecasting workflow is wrapped as a web service using apache axis2 . the provenance service provides an interface though which users can retrieve the provenance information of a specific data object . by giving different parameter values users can even specify the level and granularity of the provenance information . for example , users can check the intermediate results for a block or just a well in as short as one - individual - month time or as long as several years &# 39 ; time . after the processing of one workflow instance , a provenance service will annotate the domain concepts defined in the domain model to the workflow &# 39 ; s input / output data objects , and publish these data objects and the workflow instance &# 39 ; s settings to the provenance index service as external provenance information . web ontology language ( owl ) is used in the provenance index service to implement the semantic models , while a java - based semantic web framework such as jena is used as the inference engine . for the provenance service model the owl - s ontology is used to represent web - service descriptions . data records are written as ontology items and may be stored in an ontology database . an example of a graphical user interface in accordance with an embodiment of the invention is illustrated in fig4 a - 4 g . in the example , a forecasting production workflow results in the generation of a data object 400 that in this example represents the result of the forecasting . a user wishing to determine the provenance of the data object 400 can click ( e . g ., right click ) on the data object 400 , opening a menu 402 that allows for selection of what type of provenance information the user would like to see . as seen in fig4 b , for example , the menu may allow for determination of the application used to create the data object or the data that was used by that application . fig4 c graphically illustrates the data object 400 and its connection with the application 402 ( in this case a forecasting workflow session ) that was used to create it . fig4 d , in turn , shows a menu item ( again , accessed by clicking , for example ) 406 that provides a link to the input data used in the forecasting workflow . fig4 e shows the result of selecting the menu item 406 , displaying the five data objects 408 - 416 that form the basis of the forecasting workflow session 402 . in the example , these include surface constraints data 408 , block historical data 410 , performance curve data 412 , well data 414 and block data 416 . by repeating the basis inquiry process , the user can determine that the performance curve data 412 is based on a normalization application 418 , as shown in fig4 f . fig4 g illustrates a continuation of this process , with the user selecting additional provenance information until reaching the desired end point of the inquiry . as shown , the normalization application 418 takes as an input forecast data 420 . the forecast data 420 in turn is derived from a reservoir simulator session 422 ( e . g ., chears ®). the simulator session 422 is , in this case , derived from a formatted data object 424 formatted for use with the specific simulator ( a chears deck ), while the formatted data object 424 is itself derived from two applications , a lab test 426 and a gocad session 428 . the end point may be , for example , an initial data object that has no further provenance , or simply a point that the user finds sufficient , beyond which he or she does not need to confirm provenance . as will be appreciated , such a user interface can be implemented using a computer having a user - readable display and user input devices such as a mouse and / or keyboard . the icons shown in fig4 a - 4 g may be shown in a window 430 as illustrated in fig4 g that may include such additional information as session identification information 432 and additional controls for altering aspects of the session such as a view or other parameters . although the invention has been described in detail for the purpose of illustration based on what is currently considered to be the most practical and preferred embodiments , it is to be understood that such detail is solely for that purpose and that the invention is not limited to the disclosed embodiments , but , on the contrary , is intended to cover modifications and equivalent arrangements that are within the spirit and scope of the appended claims . for example , it is to be understood that the present invention contemplates that , to the extent possible , one or more features of any embodiment can be combined with one or more features of any other embodiment .	6
the ldmos structure of the present invention is shown in fig2 . the key difference between the invention and the prior art structure shown in fig1 lies in the ldd portion of the device . as can be seen , the single n type layer 19 of the prior art structure has been replaced by a stacked ldd comprising three layers — n type layer 21 , p type layer 22 , and n type layer 23 . this modification of the prior art structure minimizes the drift region resistance while at the same time maintaining a high blocking voltage . layer 21 ( ldd 1 ) has a high doping concentration and junction depth that is sufficient to reduce the on - resistance of the device , while layer 23 ( ldd 3 ) has a low doping concentration and a deeper junction depth that serves to reduce the output capacitance . layer 22 ( ldd 2 ) has high p doping , which introduces additional negative charges that can cause pinch - off of the ldd 1 and ldd 3 regions . the totally depleted drift region supports the device breakdown voltage . shown in fig3 a and 3 b is a schematic comparison between a conventional ldd structure , such as the device of fig1 and the stacked ldd structure of the present invention . fig3 a shows a single layer ldd of the prior art having a single depletion layer 31 that extends into it from p − body 13 . fig3 b shows how ldd 2 helps to deplete ldd 1 and ldd 3 while it itself is also being depleted at the same time . this is possible because a reverse - biased voltage across the ldd 2 / ldd 1 and ldd 2 / ldd 3 junctions exists . this in turn is because ldd 2 is connected to p − body 13 , which is grounded , while ldd 1 and ldd 3 are connected to n + drain 18 which has a high applied positive bias . thus , in addition to a depletion layer due to the p − body ( prior art case ), ldd 1 and ldd 3 are depleted in both the lateral and vertical directions due to the existence of ldd 2 . assuming the doping levels and the junction depths are properly selected , it becomes possible to deplete all of the stacked ldd regions . thus the increase in the ldd 1 doping level ( which can be much higher than in a prior art device ) will reduce the on - state resistance of the device . therefore , the device current handling capability is improved . as a result , the ron of the stacked structure will be much lower than that of a conventional structure having the same bvds ( breakdown voltage source - to - drain ). the process of the present invention uses conventional ldmos process steps in a novel manner in order to form the structure of the present invention . referring once again to fig2 the process begins with the provision of a starting wafer 10 of p + silicon . and depositing thereon epitaxial layer , of p − silicon , 17 . then p + sinker region 11 that extends downwards from the top surface , through the p − epitaxial layer 17 into the p + substrate 10 is formed by means of ion implantation through a mask . this is followed by a drive - in diffusion . next , a layer of gate oxide 14 is grown on the top surface and a layer of phosphorus doped polysilicon 15 is deposited over it to a sheet resistance of about 10 ohms per square . the polysilicon is patterned and etched to form gate pedestal 15 . by p − body implant through a p − body mask , followed by a p − body diffusion process and n + source implant through a n + source mask , followed by an n + diffusion process ( ldmos double diffusion ), n + source region 12 is formed on one side of the gate pedestal ( on its left in this example ) as well as p − body 13 . the latter extends outwards from source region 12 and emerges at the top surface underneath gate oxide 14 . by ion implantation through a mask , drain region 18 is then formed on the opposite side of the gate , there being a separation region between gate 15 and drain region 18 for the ldd with a blank ldd implant . this separation region has a length of between about 2 and 40 microns . now follows a key feature of the invention . by ion implantation ( 60 kev arsenic at 7 × 10 12 per sq . cm ), n type layer 21 ( ldd 1 ) is formed in the separation region . this is followed by the formation of p type layer 22 ( ldd 2 ) using 45 kev boron at 7 × 10 12 per sq . cm located immediately below ldd 1 . n type layer 23 ( ldd 3 ) was placed immediately below ldd 2 by using 200 kev phosphorus at 2 . 5 × 10 12 per sq . cm . use of the above ion energies and fluences resulted in the ldd 1 layer having a resistivity between about 0 . 002 and 0 . 02 ohm cm and a thickness between about 300 and 2 , 000 angstroms . for ldd 2 , the resistivity was between about 0 . 007 and 0 . 05 ohm cm for a thickness of between about 1 , 000 and 3 , 000 angstroms while for ldd 3 the resistivity was between about 0 . 03 and 0 . 2 ohm cm and its thickness was between about 1 , 000 and 6 , 000 angstroms . provided the thicknesses and resistivities of the three layers fall within the ranges cited above , devices made this way ( i . e . the stacked ldmosfet of the present invention ) have breakdown voltages greater than about 70 volts , an on - resistance less than about 0 . 05 ohms per micron in the linear region , and a peak frequency response greater than 7 ghz . [ 0030 ] fig4 compares experimental i - v characteristics of the prior art with those of a stacked ldd rf ldmosfet made according to the teachings of the present invention . it can be seen that at vgs = 20v , for the same current level of 70 ma , the on - state voltage drop was 5 . 1v for the conventional rf ldmosfet ( curve family 41 ) while it is reduced to only 3v ( curve family 42 ) for the stacked ldd device , indicating an improvement of 70 % for von . at the same vgs of 20v , the saturation current of the prior art and stacked ldd devices is 105 ma and 175 ma , respectively , with a 67 % improvement in idsat . the measured breakdown voltage of the prior art and stacked structures were approximately 64v and 74v , respectively . thus , when compared to a device of the prior art , the stacked ldd structure provides a 16 % improvement in the off - state performance . dc - measurements of fabricated transistors produced the transfer characteristics shown in fig5 . an outstanding attribute of the stacked ldd device is the wide plateau of high transconductance between vgs = 3v and vgs = 10v . the on - state resistance of a ldmos mainly consists of channel resistance rch and drift region resistance rdrift . the total on - state resistance decreases with increasing gate bias . at a low gate bias , the value of the channel resistance is comparable to the drift resistance , and the drain current increases linearly with gate bias . at a high gate bias , due to the channel resistance being much lower than the drift resistance , the drain current is only affected by the drift resistance , and the gate easily loses its current control capability . the lower the drift region resistance , the stronger the gate control capability . this performance is very important for rf ldmos used in large signal power amplifiers . from fig4 it can be seen that , at a high gate bias , the stacked ldd structure has a much higher gate control capability compared with that of the prior art rf ldmos . this strong gate control capability is also shown in fig5 in which a wide and flat transconductance vs . vgs curve is obtained . at a gate voltage of 10v , the transconductance in the stacked ldd structure is 13 . 7 ms ( arrow 52 ) while it is 5 . 6 ms in the prior art device ( arrow 51 ). thus , the transconductance of the stacked ldd is approximately 2 . 4 times higher than that of the prior art rf ldmos . this means that the stacked ldd device has a lower inter - modulation distortion and higher power gain . thus , the upper limit of the usable output power is much higher for the stacked ldd device . in order to characterize the rf behaviors of the conventional and stacked ldd devices , on - wafer s - parameters were measured in the range from 0 . 5 ghz to 10 . 05 ghz using a hp 8510c network analyzer . the operating point of the device was varied between vgs = 3v and vgs = 15v at a fixed vds of 20v . the gate bias dependence of f t at vds = 20v in both the prior art and stacked ldd devices were obtained . referring now to fig6 corresponding to the gm behaviors in fig5 the cut - off frequency of the stacked ldd device ( curve 62 ) reaches its maximum of 7ghz at vgs = 5v , keeps its high level up to vgs = 10v , and then decrease continuously . at a gate voltage of 10v , the stacked ldd structure still has a 5 ghz cut - off frequency — a 108 % improvement over the prior art rf ldmos which is shown as curve 61 . while the invention has been particularly shown and described with reference to the preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made without departing from the spirit and scope of the invention .	7
the alpha - amylase of this invention is produced by two new strains of a clostridium that were isolated from mud hot springs in hveragerdi , iceland by dr . lars , g . ljungdahl and his co - workers at the university of georgia . they are gram - positive , spore - forming , thermophilic anaerobic bacteria . dr . ljungdahl has proposed the name clostridium thermoamylolyticum for these strains which are freely available to the public from the american type culture collection as clostridium sp . atcc 39 , 251 and atcc 39 , 252 . the microorganisms used for the preparation of the alpha - amylase of this invention are grown under anaerobic conditions in a medium which contains a soluble starch or maltodextrin as the carbohydrate source , a yeast extract plus vitamin and mineral solutions . the presence of maltose and maltotriose in the growth medium increases the amount of alpha - amylase formed , while glucose in the medium inhibits the formation of alpha - amylase . the optimum ph of the fermentation medium for the production of alpha - amylase is about 6 with strain atcc 39 , 251 , and about 7 with strain atcc 39 , 252 . the alpha - amylase produced by these microorganisms was excreted into the fermentation medium . sonication of the microbial cells failed to release any additional enzyme . this indicates that the alpha - amylase enzyme is an extracellular enzyme . the alpha - amylase enzyme was purified by removing the cells from the fermentation medium followed by precipitation of extraneous matter with calcium chloride . the enzyme solution was concentrated and further refined by adsorption of the amylase on granular starch . the partially purified amylase was removed from the starch and further purified by chromatography on an ultrogel column . the purified enzyme had a molecular weight of 75 , 000 ± 3 , 000 as determined by sodium dodecyl sulfate ( sds ) polyacrylamide gel electrophoresis . in the following descriptions of the preparation and properties of the alpha - amylase enzyme , all references to parts and percentages are by weight , unless expressly indicated to be otherwise . the solution to be analyzed is diluted with 0 . 0025 m calcium chloride solution to give a final concentration of about 0 . 25 unit of activity per ml . one ml of properly diluted enzyme solution is added to 10 ml of a 1 % soluble starch solution containing 0 . 03 m acetic acid buffer ( ph 6 . 0 ) and 0 . 03 m calcium chloride . the reaction is carried out for 10 minutes at 60 ° c . one ml of the reaction solution is put in a 100 - ml graduated flask containing 50 ml of 0 . 02n hydrochloric acid , and after adding 3 ml of 0 . 05 % iodine solution thereto , the total volume is made up to 100 ml by the addition of water . the blue color which develops is measured for absorbance at 620 nm . the amount of the enzyme required to decompose 10 mg / starch in 1 minute is defined as 1 unit . ## equ1 ## where , d 0 = absorbance of control solution ( water is added instead of the enzyme solution ) extracellular alpha - amylase enzyme preparations were obtained from two strains of clostridium sp ., atcc 39 , 251 and atcc 39 , 252 . medium preparation and cultivation of samples were carried out using standard anaerobic techniques as described by hungate , r . e ., &# 34 ; a roll tube method for cultivation of strict anaerobes &# 34 ;, in methods in microbiology , edited by j . r . norris and d . w . ribbons , vol . 3b , academic press , new york , 1969 , pp . 117 - 132 , and by miller and wolin , appl . microbiol ., 27 , 985 ( 1974 ). the medium used to produce seed and to maintain the stock culture of the organism had the following composition : ______________________________________seed mediumingredients concentration ( g / l ) ______________________________________starch ( lintner ) 20kh . sub . 2 po . sub . 4 1 . 5nh . sub . 4 cl 0 . 5na . sub . 2 hpo . sub . 4 . 12h . sub . 2 o 4 . 2mgcl . sub . 2 0 . 18yeast extract 2 . 0vitamin solution 0 . 5 ml / lmineral solution 50 ml / lresazurin ( 0 . 1 %) 1 ml / lreducing solution 40 ml / l______________________________________vitamin solutionvitamins mg / l______________________________________biotin 2folic acid 2pyridoxine . hcl 10riboflavin 5thiamine . hcl 5nicotinic acid 5pantothenic acid 5b . sub . 12 0 . 1 - p - aminobenzoic acid 5thioctic acid 5______________________________________reducing solutioningredients amount______________________________________naoh ( 0 . 2 -- n ) 200 mlna . sub . 2 s . 9h . sub . 2 o 2 . 5 gcysteine hcl . h . sub . 2 o 2 . 5 g______________________________________mineral solutioningredients mg / 100 ml______________________________________nitrilotriacetic acid 1500mgso . sub . 4 . 7h . sub . 2 o 3000mnso . sub . 4 . h . sub . 2 o 500nacl 1000feso . sub . 4 . 7h . sub . 2 o 100co ( no . sub . 3 ). sub . 2 . 6h . sub . 2 o 100cacl . sub . 2 100znso . sub . 4 . 7h . sub . 2 o 100kal ( so . sub . 4 ). sub . 2 10h . sub . 3 bo . sub . 3 10na . sub . 2 moo . sub . 4 . 2h . sub . 2 o 10na . sub . 2 seo . sub . 3 1______________________________________ viable cells could be maintained in the seed medium at room temperature for indefinite periods of time . in order to grow the microorganisms for production of enzyme , sterile seed medium was inoculated with cells and incubated at 56 ° c . under anaerobic conditions for approximately 30 hours . this produced rapidly - growing cells which were used to inoculate a fermentor . the volume of inoculum was from 1 to 5 % of the volume of the growth medium in the fermentor . this medium had the following composition : ______________________________________growth medium g / 100 ml______________________________________maltrin 100 . sup . a 1proflo . sup . b 5prymex . sup . c 1mgso . sub . 4 . 7h . sub . 2 o 0 . 5cacl . sub . 2 . 2h . sub . 2 o 0 . 06mncl . sub . 2 . 2h . sub . 2 o 0 . 001kh . sub . 2 po . sub . 4 0 . 13 ( nh . sub . 4 ). sub . 2 hpo . sub . 4 1______________________________________ . sup . a a 10 dextrose equivalent starch hydrolyzate available from the grain processing company , muscatine , iowa . . sup . b a cottonseed meal available from traders oil mill company , fort worth , texas . . sup . c a yeast extract available from amber laboratories , milwaukee , wisconsin . the ph of the medium was adjusted to 6 when the starting strain was atcc 39 , 251 . the ph was adjusted to 7 when the starting strain was atcc 39 , 252 . production runs were made in a 14 - liter fermentor using 10 liters of medium . the yield of extracellular alpha - amylase was 0 . 5 to 3 units per ml of fermentation broth . sonication of the cells failed to release any additional enzyme indicating that the enzyme was entirely extracellular . the crude alpha - amylase enzyme was purified by the following procedure . the fermentation broth was first filtered through glass wool to remove a gummy insoluble substance . cells were then removed from the filtrate by means of a sharples continuous scroll centrifuge , model 741 - 24 / 8r4 ( sharples corp ., philadelphia , pa . ), operated at 45 lbs pressure . to the clear supernatant was added sufficient calcium chloride to give a final concentration of about 1 . 5 % w / v and the mixture was stirred for 10 minutes . the bulky precipitate was removed by filtration and discarded . the clear , amber - colored filtrate was then concentrated by an amicon hollow - fiber ( hp - 10 ) concentrator , type ac2 , available from the amicon corp ., danvers , mass . concentration was carried out until the volume was between 500 and 1000 ml before concentrated ammonium hydroxide was added to bring the ph to 6 . the addition of ammonium hydroxide caused a second precipitate to form , which was removed by filtration . the concentrated filtrate was further purified by treatment with granular starch which had been equilibrated with a sodium acetate buffer solution containing 50 mm sodium acetate at ph 6 and 5 mm ca ++ . one gram of starch was used for every 300 units of enzyme . the mixture of starch and enzyme solution was stirred gently at room temperature for 60 minutes before the solid was collected by vacuum filtration . the starch cake containing bound alpha - amylase was resuspended in a small volume of ice cold sodium acetate buffer solution and again filtered after brief stirring . this washing procedure was repeated three times with cold sodium acetate buffer . washed starch cake was suspended in fresh sodium acetate buffer and incubated at 60 ° c . with occasional stirring for 60 minutes . during this time , the adsorbed alpha - amylase hydrolyzes the starch sufficiently to be released into solution . the mixture was then filtered , and the colorless filtrate , containing the alpha - amylase enzyme , was concentrated to a volume of about 3 ml by means of an amicon ultrafiltration cell ( amicon corp ., danvers , mass .) fitted with ym10 membrane of a 10 , 000 mr cut . the mixture was clarified by centrifugation at 10 , 000 × g for 10 minutes before the supernatant was loaded on a 1 . 5 × 85 cm column of acrylamide agarose gel , ultrogel aca 54 ( lkb producter ab , bromma , sweden ) which had been previously equilibrated with 50 mm sodium acetate buffer containing 100 mm nacl and 5 mm ca ++ . the column was eluted with the same buffer at a flow rate of 16 ml / hr . three ml fractions were collected and checked for alpha - amylase activity . the fractions containing enzyme activity were combined and stored in a refrigerator . their protein content was determined by the method of lowry , et al , j . biol . chem ., 193 , 265 - 275 ( 1951 ) using bovine serum albumin as a standard . the results of the purification procedure for two enzyme samples are given in tables i and ii . they show that the purified alpha - amylase has a specific activity of between 07 and 80 enzyme units per mg of protein . table i______________________________________purification of alpha - amylase from atcc 39 , 251 volume units units per yieldprocedure ( ml ) per ml mg protein (%) ______________________________________fermentation broth 6485 0 . 7 -- 100cacl . sub . 2 treatment 610 4 . 14 0 . 106 55 . 6and ultrafiltrationstarch affinity 120 16 . 35 33 . 03 43 . 3ultrogel aca 54 24 62 . 50 80 . 13 33 . 0column______________________________________ table ii______________________________________purification of alpha - amylase from atcc 39 , 252 volume units units per yieldprocedure ( ml ) per ml mg protein (%) ______________________________________fermentation broth 6920 2 . 69 -- 100cacl . sub . 2 treatment 325 23 . 6 -- 41 . 2and ultrafiltrationstarch affinity 100 77 . 4 -- 41 . 6ultrogel aca 54 70 87 . 2 73 . 8 32 . 8column______________________________________ the purified alpha - amylase was determined to be homogeneous by its migration as a single protein band when subject to polyacrylamide gel electrophoresis . the molecular weight of the enzyme was determined by sds polyacrylamide gel electrophoresis according to the procedure of laemmli , u . k ., nature , 227 , 680 - 685 ( 1970 ). by comparing the mobility of the alpha - amylase with that of standard proteins , a molecular weight of 75 , 000 ± 3 , 000 was estimated for the enzyme . this is considerably larger than the molecular weight of 51 , 000 determined for a purified sample of thermamyl 60l , an alpha - amylase derived from b . licheniformis . taka - therm , an alpha - amylase derived from another strain of b . licheniformis , has a reported molecular weight of 62 , 000 ( chiang , et al , die starke , 31 , 86 - 92 ( 1979 )). the thermostability of the purified alpha - amylase was compared with that of three other known alpha - amylases . the enzymes were diluted with 50 mm acetate buffer of the desired ph , containing 5 mm ca ++ , to make solutions containing 1 unit of enzyme activity per milliliter . bovine serum albumin was added to the diluted solutions to give a protein concentration of about 40 μg / ml . the solutions were incubated in taped screw - capped vials in a water bath at 60 ° c ., 80 ° c . and 90 ° c . at appropriate time intervals ( usually 10 , 20 , 30 , 60 and 90 minutes ), vials were removed from the water bath and immediately cooled in an ice bath . residual enzyme activity was assayed at 60 ° c . using the standard assay procedure . the half - life of the enzyme was calculated by linear regression . results given in table iii indicate that the enzyme of the present invention has much greater thermostability in the range of ph 4 . 2 - 4 . 5 than do the thermoduric enzymes from b . stearothermophilus and b . licheniformis . it has a half - life of greater than 70 hours at ph 4 . 2 and 60 ° c . table iii______________________________________thermostability of alpha - amylase half - life ( minutes ) 90 ° c ., 80 ° c ., 80 ° c ., 60 ° c ., enzyme ph 6 ph 4 . 5 ph 4 . 2 ph 4 . 2______________________________________alpha - amylase of 115 66 20 4320this inventionthermamyl . sup . a 266 13 2 . 3 36alpha - amylase of 108 22 2 . 6 94b . stearothermophilus . sup . bmaxamyl . sup . c 3 -- -- -- ______________________________________ . sup . a an alphaamylase from b . licheniformis available from novo laboratories , wilton , connecticut . . sup . b tamuri , et al , u . s . pat . no . 4 , 284 , 722 . . sup . c an alphaamylase from b . subtilis available from gb fermentation industries , inc ., des plaines , illinois . the alpha - amylase enzyme activity was analyzed by the standard procedure except that the ph of the substrate was varied from 3 . 5 to 7 . 0 using 100 mm buffer solutions of the following composition : citrate ( ph 3 . 5 ), acetate ( ph 4 to 6 ), and hepes ( ph 6 . 5 to 7 . 0 ). the relative activities at various phs given below indicate that the enzyme shows maximum activity at ph 5 . 0 . ______________________________________ percent ofph maximum activity______________________________________3 . 5 55 . 14 . 0 91 . 74 . 5 97 . 05 . 0 1005 . 5 92 . 66 . 0 86 . 66 . 5 77 . 77 . 0 59 . 8______________________________________ the effect of the reaction temperature on the purified enzyme was determined by performing the standard assay for alpha - amylase activity after incubating an enzyme solution at various temperatures and ph values for 10 minutes . at ph 6 , the temperature optimum was reached at slightly above 90 ° c . at ph 4 . 5 , the temperature for maximum activity was 85 ° c . with 80 % of the maximum activity being observed at 70 ° c . and 90 ° c . to a starch solution containing 20 % by weight on a dry solids basis of 80 - fluidity starch was added 20 units of the alpha - amylase enzyme per gram of starch . the ph of the mixture was adjusted to 4 . 5 before it was incubated at 70 ° c . samples of the hydrolyzed starch were removed after 24 and 96 hours , boiled to inactivate the enzyme , and analyzed for carbohydrate content by high performance liquid chromatography in accordance with the following technique . components were chromatographed by elution with water from a cation - exchange resin in the calcium form . the eluted components were detected by means of a differential refractometer . all carbohydrates were quantitated using an electronic integrator . the general procedure is that given in &# 34 ; analysis of carbohydrate mixtures by liquid chromatography &# 34 ;, am . soc . brew . chem . proc ., 1973 , pp . 43 - 46 . the resin used is aminex 50w - x4 ( 20 - 30μ ) in the calcium form , bio - rad laboratories , richmond , calif . the results are given in terms of degree of polymerization ( dp ) wherein dp 1 is the monosaccharide glucose , dp . sub . 2 is the disaccharide fraction , dp 3 is the trisaccharide fraction , and so on . the carbohydrate distribution is reported in table iv which also includes the carbohydrate distribution in a starch hydrolyzate prepared by thinning starch with the commercial alpha - amylase , thermamyl , under conditions which give solutions of comparable dextrose equivalent ( d . e .). these results demonstrate that the enzyme of the present application produces starch hydrolyzates with significantly different carbohydrate compositions from those produced by thermamyl . table iv__________________________________________________________________________action of alpha - amylase on starchenzymeatcc . sup . a atcc . sup . a atcc . sup . c atcc . sup . csource39 , 251 39 , 252 thermamyl . sup . b 39 , 251 39 , 252 thermamyl . sup . b__________________________________________________________________________d . e . 26 . 6 23 . 5 24 38 . 4 37 . 5 38dp . sub . 15 . 7 5 . 0 2 . 0 10 . 9 10 . 5 9 . 3dp . sub . 27 . 8 6 . 9 8 . 5 14 . 1 13 . 7 17 . 0dp . sub . 35 . 3 5 . 0 13 . 5 17 . 9 17 . 2 16 . 2dp . sub . 47 . 6 6 . 7 4 . 6 13 . 8 13 . 3 5 . 5dp . sub . 59 . 3 8 . 9 16 . 5 11 . 1 11 . 4 22 . 7dp . sub . 68 . 6 7 . 8 13 . 6 8 . 0 8 . 0 3 . 3dp . sub . 77 . 4 6 . 6 3 . 9 9 . 6 6 . 2 4 . 0 dp . sub . 8 . sup .+ 48 . 3 53 . 1 37 . 7 14 . 6 19 . 7 22 . 0__________________________________________________________________________ . sup . a after 24 hours of hydrolysis . . sup . b 80fluidity corn starch was hydrolyzed with thermamyl at 70 ° c ., ph 6 . 0 to the given d . e . . sup . c after 96 hours of hydrolysis . the foreoing tests demonstrate that there is provided by this invention an alpha - amylase enzyme that hydrolyzes starch at ph values between 4 and 4 . 5 . furthermore , the amylase is sufficiently thermostable at this ph to permit its use to hydrolyze starch at a temperature where the reaction rate is fast enough to be useful . while the invention has been described with specific embodiments thereof , it will be understood that it is capable of further modification and adaptations or variations as apparent to those skilled in the enzyme and starch hydrolysis art .	8
the following description of the preferred embodiments is merely exemplary in nature and is in no way intended to limit the invention , its application , or uses . according to a preferred embodiment of the present invention and referring generally to fig1 , a valve assembly 10 includes a solenoid 12 connectably attached to a valve body 14 at a valve body mounting face 16 . internal components of valve body 14 are generally loaded via a valve loading face 18 . a valve body inlet port 20 , and outlet port 22 and an exhaust port 24 are exemplary of fluid ports disposed via a fluid system service face 26 of valve body 14 . the invention is not limited to a particular orientation or quantity of ports . referring next to fig2 , components of the solenoid 12 include a pole plate 28 which forms an interface between solenoid 12 and valve body 14 via valve body mounting face 16 . a flux frame 30 formed generally at a perimeter of pole plate 28 provides an external limit for individual wires forming a coil 32 . coil 32 includes at least one or a plurality of individual wires 31 in one or more windings provided in wire sizes ranging from approximately 33 . 5 to 35 . 5 gauge . a first portion 33 of pole plate 28 is disposed within an internal cavity of coil 32 . an armature 34 is also positioned within the internal cavity of coil 32 . both pole plate 28 and armature 34 are typically provided of electrically conductive and magnetic materials such as iron . armature 34 is slidably disposed within a bushing 36 such that a bushing inner wall 38 is in slidable contact with an armature outer wall 40 . solenoid 12 is also provided with a cover 42 which seals solenoid 12 from the external environment . cover 42 is connected to flux frame 30 by an adapter 44 and one or more fasteners 46 . within cover 42 is disposed a current distribution plate 48 , which is in direct contact with a lead pin 50 . lead pin 50 is disposed within an insulating bushing 52 to electrically isolate lead pin 50 from cover 42 . electrical current provided to the windings of coil 32 is provided via lead pin 50 through current distribution plate 48 and a coil connector 54 . armature 34 is positioned as shown in fig2 in a de - energized condition of solenoid 12 . in this condition , an adjustment device 56 is in contact with armature 34 , forming a stop for armature 34 in the de - energized position . adjustment device 56 can be threaded such that the positioning of armature 34 can be adjusted by changing the engagement depth of adjustment device 56 within cover 42 . armature 34 displaces from the de - energized position in the direction of arrow “ x ” when current is supplied to coil 32 such that a magnetic flux is created between coil 32 , pole plate 28 and armature 34 . armature 34 is thereby drawn towards pole plate 28 . this translation in the direction of arrow “ x ” of armature 34 also displaces a pushpin 58 which is in direct contact with armature 34 . a clearance aperture 59 is provided within pole plate 28 to allow slidable displacement of pushpin 58 in either the energized direction of arrow “ x ” or the return ( de - energized ) direction of arrow “ y ”. pushpin 58 directly contacts a first end of a valve member 60 provided within valve body 14 . valve member 60 is slidably disposed within valve body 14 such that valve member 60 is displaceable in each of the directions of arrows “ x ” and “ y ”. in the solenoid de - energized position shown in fig2 , valve member 60 is in a closed position wherein fluid pressure in inlet port 20 is isolated from both outlet port 22 and exhaust port 24 . an end retainer 62 slidably receives a second end of valve member 60 and acts as a positive stop for the sliding motion of valve member 60 . end retainer 62 is fastenably connected , generally via threads , to valve body 14 . a biasing element 64 is positioned between and contacts both valve member 60 and end retainer 62 . biasing element 64 biases valve member 60 away from end retainer 62 and provides a normal biasing force in the direction of arrow “ y ” to return valve member 60 and pushpin 58 together with armature 34 in the direction of arrow “ y ” when solenoid 12 is de - energized . biasing element 64 and valve member 60 are positioned within a valve bore 65 of valve body 14 . valve member 60 is exemplary of a plurality of designs for a valve member . the invention is not limited to a particular design for valve member 60 . coil 32 is provided in a substantially rectangular or elliptical shape based on winding the individual wires of coil 32 about a bobbin 66 which is itself substantially rectangular or elliptically shaped . bobbin 66 includes a first end 67 and a second end 68 . a through - aperture 69 is created within bobbin 66 which slidably receives first portion 33 of pole plate 28 and also receives bushing 36 . referring generally now to fig3 , a cross - sectional geometry of solenoid 12 is provided . a coil width “ w ” is maximized within a total width of solenoid 12 . a plurality of apertures 70 are also shown , each aperture 70 providing access for a fastener ( not shown ) used to connectably mount solenoid 12 to valve body 14 . coil width “ w ” defines a short length axis of coil 32 . bushing 36 disposed within through aperture 69 of bobbin 66 defines an inner perimeter for coil 32 and a cross - sectional area “ s ” of armature 34 . a circle 72 having a diameter “ d ” represents a virtual cylindrical iron core having the same cross - sectional area as cross - sectional area “ s ”. circle 72 therefore represents only a virtual item used to establish a comparison to a theoretical circular iron core . expressed as an equation , s =( πd 2 / 4 ). diameter “ d ” of circle 72 and coil width “ w ” are related by the equation : d =( 0 . 4 to 0 . 8 ) w . a further relationship exists for armature 34 wherein a long axis “ a ” of armature 34 is related to the short axis or length “ b ” of armature 34 . the range or limits of a ratio of “ a ” to “ b ” for armature 34 are provided by the equation : 3 . 1 ≦ a / b ≦ 4 . 5 . providing the above range of the ratio of “ a ” to “ b ” for armature 34 permits maximizing a length “ l ” of coil 32 compared to coil width “ w ” such that a higher current and wattage can be used for coil 32 . it is common in the industry for solenoid operated valves to use an actuation wattage of approximately four to five watts . faster acting solenoids are available using approximately 16 watts of electrical power . a solenoid 12 of the present invention permits operation up to approximately 215 watts . this is accomplished by the geometry of coil 32 and armature 34 and in part through the use of smaller gauge wire within coil 32 , ranging from approximately 33 . 5 to 35 . 5 gauge . increasing the wattage for solenoid 12 provides a significantly faster acting valve assembly 10 because the higher wattage creates a greater magnetic flux in coil 32 which increases the travel speed of armature 34 . cycle time can be reduced from known 4 watt solenoid valve designs having cycle times of approximately 3 milliseconds to approximately 340 microseconds using a solenoid design according to the present invention . a further improvement of the valve assembly 10 of the present invention is provided by the use of a non - magnetic material , and preferably a brass material , for bushing 36 . a non - magnetic material used for bushing 36 and in particular a material such as brass provides a low coefficient of friction between armature 34 and bushing 36 . in addition , the non - magnetic nature of bushing 36 reduces the likelihood - of magnetic attraction between armature 34 and bushing 36 during its return travel to the non - energized position shown in fig2 . this further reduces the operating time of valve assembly 10 . the operating time of valve assembly 10 , i . e ., its operating cycle , is defined as the time required between the initiation of current flow to coil 32 and the initial displacement of armature 34 until armature 34 returns to the de - energized position shown in fig2 . an overall reduced cycle time is provided by valve assembly 10 of the present invention , permitting use of valve assembly 10 in operations such as sorting operations which require very high rates of material transfer and very low cycle times of the valves operating the sorting machinery . referring to fig4 , valve member 60 is shown positioned in an energized condition of solenoid 12 . a flow passage “ e ” is provided in this position between inlet port 20 and outlet port 22 . biasing element 64 is compressed and provides biasing force to return valve member 60 to the position shown in fig2 when solenoid 12 is de - energized . fig4 further shows an insert 74 having an inner wall 76 which slidably supports an upper end ( as shown in fig4 ) of valve member 60 . a passage 78 is longitudinally provided through valve member 60 allowing fluid at either end of valve member 60 to displace to the opposite end when valve member 60 translates in either the direction of arrow “ x ” or arrow “ y ”. the biasing force in the direction of arrow “ y ” provided by biasing element 64 redirects valve member 60 to the position shown in fig2 . fluid in a fluid / biasing member chamber 80 which partially encloses biasing element 64 is also displaced via passage 78 to allow translation of valve member 60 in either the direction of arrow “ x ” or arrow “ y ”. advantages of the present invention include the capability of using higher operating wattages to achieve faster cycle times and / or increased solenoid driving force for solenoid actuated valves , and providing a solenoid assembly less susceptible to wear from friction of the moving parts . a smaller wire size is also used which further increases the solenoid operating force and power generated by the solenoid . by using the geometry for a solenoid of the present invention , an improved cycle time at a given solenoid size is also provided . the description of the invention is merely exemplary in nature and , thus , variations that do not depart from the gist of the invention are intended to be within the scope of the invention . for example , additional ports or ports oriented in a different configuration from those shown in fig2 can be used . the geometry of valve member 60 can therefore vary to accommodate different valve port designs , locations and quantities . an exemplary size for a valve body of the present invention is approximately 0 . 81 in long ( 2 . 06 cm ), 0 . 66 in high ( 1 . 66 cm ) and 0 . 31 in depth ( 0 . 79 cm ). an exemplary size for a solenoid of the present invention is approximately 0 . 31 in deep ( 0 . 79 cm ) substantially matching the depth of the valve body , with a length and height of approximately ¾ of the valve body dimensions . these dimensions are exemplary only and the valve body and solenoid can be varied from these dimensions . such variations are not to be regarded as a departure from the spirit and scope of the invention .	5
fig1 depicts the sonic collar sheep protector 10 , having a bright colored ( i . e . orange ) collar section with audio openings 11 , capable of emitting at least one of five different audio sounds from five different alarm patterns . the bright color of the collar serves as a marker and allows the herdsmen to reduce the cost of marker sheep ( black sheep ) needed in the flock . the inner surface 12 of the collar or neck bend is flat and engages the area of the sheep &# 39 ; s neck where a predator is likely to attack . one or more strobe lights 13 may be recessed , even with or protrude slightly from a visible section of the collar , which is sewn or otherwise attached to the collar , so as to allow the inclusion of a control circuit , strobe light circuit and audio alarm circuit . the u - shaped device is placed about the sheep &# 39 ; s neck and fastened by a nylon strap 14 . the unit is powered by a primary battery pack 6 to 12 volts ( v ) and a 3 volt flash battery pack . diode d2 prevents reverse polarity damage . the light sensor section serves as the power switch for the control circuitry . this consists of a low power , high output , comparator ic ( integrated circuit ), texas instruments tlc3702 . with this chip a reference voltage is applied to the plus input . a voltage divider circuit consisting of r4 , r5 gives us a reference voltage of when the voltage applied to the minus input is less then the reference at the plus input , the output is switched to ground . when the minus input voltage rises above the reference voltage ( plus input ), the output is switched to v +- 0 . 6 volts . it is important to note here that the voltage at the minus input is also a voltage divider circuit consisting of r3 , and a photo resistor in series with r2 . r2 serves to increase the resistance from supply to ground in order to reduce the current draw . as the light changes so does the resistance of the photo resistor and therefore the voltage at the minus input . with the circuit as described , there would be an oscillation problem at the switching point since the light change is not a linear curve , therefore , r1 is added for hysteresis . when the switching occurs , the value of the reference now changes and this prevents switching back due to minor changes in light . the shock sensor includes a piezo ceramic bender , such as part number db - 20pb by project unlimited or other suitable motion detectors , a 1 / 2 &# 34 ; pvc pipe cap , a 3 / 8 &# 34 ; stainless steel ball and resistors r7 and r8 . when the ceramic resonator is struck by the ball it induces a voltage across r7 and r8 . the ratio of these two resistors sets the sensitivity voltage . r6 is used for current limiting while di protects the transistors from reverse voltage breakdown . q1 will sort the shock sensor signal to ground during the 10 minute shut - down period . q2 with r10 ( pull - up resistor ) form an inverter for the 10 second timer input . the two timers consist of a 7556 ic ( a cmos version of a dual 555 timer ), r9 and c5 set the time constant for the 10 second timer , r17 and c4 set the time constant for the 10 minute timer , r19 and c9 set the time constant for the reset delay , this allows the circuitry to stabilize during turn - on at dusk before the timer is activated ( i . e . prevents false turn on ). to operate the timer , q2 ( normally high ) is pulled low by the signal from the shock sensor , this turns on the ten second timer ( i . e . pin 5 goes high ) which in turn turns on q9 and q3 which powers the alarm circuits . when q9 turns on , it pulls pins 8 ( 10 minute timer input ) low , and this turns on the 10 minute timer , which turns on q1 , thereby preventing another trigger for 10 minutes . resistors r11 , r20 , r22 , r21 , r16 are bias resistors for q1 , q9 , q3 respectively . r18 is a pull - up resistor for q9 and the 10 minute timer trigger . d3 prevents any current flow to the trigger during the shut - down period ( day light ). c14 helps to stabilize the power supply line during switching activity . the strobe circuit is switched by a relay since the high power draw ( 1 to 3 amps ) drops excessive power across a transistor or fet . a 6 to 1400 turn ratio transformer is used in a switching power supply made up by q15 , c16 , r40 , d6 , the transformer and a 330 volt , 120 uf electrolytic capacitor . this converts the 3 volt supply to 300 volts to drive the flash circuit . for a flash , c18 charges to 180 volts , though r41 ( time delay ) and the trigger coil ( this limited current is not enough to trigger the flash ). at 180 volts , q14 the sidac or a triac q14 ( triggered by a diac d8 and a zenor diode d7 as shown in fig4 ) turns on , this shorts the c18 charge through the trigger primary coil , yielding 1400 volts out of the secondary to trigger the exon bulb . once triggered the flash bulb will discharge the supply capacitor down to approximately 15 volts , at which time the process repeats . it is important to note here that the voltage converter is not perfect and cannot maintain a regulated 300 volts , and that the delay between flashes is do to the recovery time needed for the switching supply to bring the supply capacitor back up to about 200 volts needed to trigger the flash . the separate supply for the flash is due to the high power draw of the flash . if the flash pulls the batteries down too soon the rest of the unit including the audio alarm will still function . multiple alarms can be configured by minor part changes here . the basic blocks here are a vco ( voltage controlled oscillator ) consisting of q6 , q7 , r27 , r29 , r23 , r24 , r28 , d4 , c11 , c12 where c11 and c12 allow easy modification of frequency range . r32 prevents excessive loading of the oscillator from the amp . for the amplifier , a standard inverter ic is used to drive a push - pull transistor amplifier . for the vco input there is a saw tooth generator , consisting of q4 , q5 , r25 , r26 , r30 , r31 , c6 , c8 and c10 . r25 can be varied for frequency control . an alternative vco input is a square waver generator consisting of u1 , r12 , r13 , r14 , r15 and c2 . r12 and c2 set up the time constant to control the frequency . a voltage divider can also be used as the vco input , yielding a single frequency output . the pcb ( printed circuit board ) is laid out with jumpers to allow the various configurations . by inserting a jumper in the block marked &# 34 ; dc &# 34 ; the voltage divider input to the vco will be used , similarly for &# 34 ; saw &# 34 ; for the saw tooth generator , or &# 34 ; sq &# 34 ; for the square wave generator . also three different variations of the vco are available , use jumper block labeled 1 2 3 ; no jumper yields one sound , a jumper across 1 and 2 yields another , and a jumper across 2 and 3 yields yet another . this last sound is similar to a wolf call and is never used at this time . another option , the audio circuits is to use a complete dc audio alarm tied between the collector of q3 and ground . two such alarms have been approved so far , they are a xl - 980 or xl - 960 by project unlimited . the components used in the sonic collar sheep protector have been chosen with consideration to low power and low cost while yielding high performance , and this is to be borne in mind if substituting parts . the rc time constant parts for the 7556 should be low leakage and tight tolerance since this is stretching the timing limits of this chip . the light sensor is set to turn the power on at a lower light level than where it turns the power off , and this spread in light level is adjustable by changing r1 . the light trigger level is adjustable by changing the voltage divider to the minus input . the shock sensor sensitivity can be changed by adjusting the voltage divider consisting of r7 and r8 . d5 is necessary to short the voltage kick back form the relay coil and c15 is a filter capacitor . the battery ( s ) 15 , are enclosed in a mold hard plastic case 16 , that protrudes slightly outward from the collar in a manner so that it does not interfere with the sheep &# 39 ; s comfort when the collar is around its neck . a contact plate 17 , in each end of the case , and the plates are soldered to conductor wires while they frictionally engage the battery terminals so as to allow ease of battery replacement . while the invention has been described with reference to a u - shaped design , it is important to note that many changes in the design configuration can be made without departing from the scope and spirit of the invention , which is defined by the appended claims .	0

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.