Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
the apparatus is coupled to the conventional three - point linkage of a tractor 20 ( shown only partly , in , phantom line , in fig1 a , 1b and 2 ), by a cross - beam 43 having two spaced forwardly extending brackets 44 which are pivotally connected at 45 to the lower draft links 18 of the tractor . a further inverted v - shaped bracket 46 extends upwardly from the cross - beam 43 and is pivotally connected at 47 to the central top link 19 by intermediate link 100 of the tractor . the tractor carries a hydraulic pump , fed from twin hydraulic reservoirs ( not shown ) and driving various parts of the apparatus to be indicated later . the cross - beam 43 supports two gathering drums 49 , which are symmetrically disposed one on either side of the central longitudinal axis of the tractor and are tilted upwardly of the direction of travel and the apparatus by an angle of between 10 and 20 ° to the vertical . the two drums 49 are substantially identical and only one will be described in detail . each drum is journalled , at its upper part , in a transmission casing 50 having bearings in which is rotatable a horizontal shaft 51 . a bevel gear transmission , not shown , coupled to the shaft 51 with a vertical shaft 52 ( see fig4 ) which extends down through a further casing 53 and to which gathering sweeps are pivotally connected in a manner which will be described later . the shaft 51 has mounted on the rear end thereof a pulley 54 . an endless drive belt 55 encircles the pulley 54 and another pulley 56 is driven through an overload clutch 48 mounted on a shaft 57 which is rotatable in bearings mounted on the beam 43 . the end of this shaft 57 remote from the pulley 56 is connected through universal couplings 59 with the power take - off shaft 60 of the tractor . as best seen in fig1 the pulley 54 of the two transmission assemblies and the pulleys 56 are staggered fore - and - aft . the power take - off thus transmits a drive through the endless belt transmission to the two vertical shafts 52 . as best seen in fig4 the lower end of each shaft 52 is rotatable in bearings 61 within the lower end of the tube 53 . a hub 62 is keyed onto the lower end of the shaft 52 being clamped by a clamping nut 63 between a washer 64 and a spacer 65 which engages the inner race 66 of the bearing 61 . the race 66 of the bearing is retained on the shaft 52 by a spring clip 67 . the spacer 65 includes an upstanding flange 68 which rotates within a recess 69 in an annular ring 61a which surrounds the bearing 61 within the tube 53 . the flange 68 thus protects the bearing 61 and prevents foreign matter finding its way up onto the bearing . the hub 62 has pivotally mounted within it three equally spaced horizontal and tangential shafts 70 . a respective spring 71 acts indirectly on each shaft 70 so that pivotal movement of the shaft in a clockwise direction takes place against the action of the spring 71 : the upper end of the spring ( not shown ) engages one of several spaced abutments on the drum 85 , and selection of the appropriate abutment allows the spring loading to be varied . the hub is formed in two parts 62a and 62b which are clamped together by bolts 72 , the two parts 62a and 62b being enclosed between the two parts 73 and 74 of a two part metal casing . the upper part 74 of the casing is welded to the spacer 65 . the opposite ends of each shaft 70 project into a cut - away portion of the hub , and secured to the ends of each shaft by screws 76 are the limbs 77 of the forked end of a gathering sweep 78 . a shaped member 79 welded to each limb of the sweep partially embraces each end of the shaft . each sweep 78 extends outwardly and downwardly away from its associated shaft 70 and is formed at its outer extremity with an inclined gathering portion 78a . each sweep 78 carries a pair of spaced upstanding lugs one of which being indicated at 77a , which together support a peg 77b parallel to shaft 70 . the peg 77b engages a shaped block 77c against the upper surface of which the lower end of spring 71 abuts . each sweep 78 is urged downwardly by the action of spring 71 . the lowermost part of each gathering drum comprises a domed cap 80 which is welded to a plate 81 which is clamped to the hub 62 by the aforementioned bolts 72 . disposed above the cap 80 is a ring 82 of equal diameter . the ring 82 and cap 80 are cut - away to provide apertures , as at 83 through which the sweeps 78 project and which are of sufficient size to permit up - and - down pivoting movement of the sweeps on the shafts 70 . the ring 82 and cover 80 are secured together between the sweeps 78 by welded spacing pieces 84 . the ring 82 has welded to it the lower end of a drum 85 which encircles the tube 53 . the upper end of the drum 85 is located by three ball races ( not shown ) triangularly disposed and riding inside a ring 86 ( see fig3 ) carried by the cross - beam 43 . the sweeps of the two gathering drums are oppositely handed and the transmission to the drums causes them to contra - rotate in synchronism . as best seen in fig5 the sweeps rotate in the direction indicated by the arrows when the apparatus is moving in the direction of the arrow x . since the sweeps 78 are capable of flexing up - and - down resiliently relatively to the rotating drum it is possible for them to follow the contours of uneven ground without digging into the ground or riding over any cane stalks . this is an extremely important feature of the apparatus since , as has already been mentioned , sugar cane is normally grown on ground formed into ridges and furrows . during operation of the drums the links at the rear of the tractor are put in their &# 34 ; floating &# 34 ; condition so that the weight of the gathering assemblies is taken by a ground - following roller 26 and the sweeps 78 are free follow the contours of the ground . counterbalancing springs ( not shown ) may be provided to take some of the weight of the gathering assemblies in this &# 34 ; floating &# 34 ; condition , and thus relieve some of the load on the ground - following roller 26 . should the front end of the apparatus rear up during use , the pivot 47 will automatically move to the right ( in fig1 ) until it hits a stop pad 91 on the main frame 42 ; thus further upward movement is prevented and the apparatus tends automatically to right itself . in an alternative construction the springs 71 are replaced or assisted by other forms of resilient restraint acting to resist upward pivoting movement of the sweeps . for example each sweep may be biassed downwardly by a rubber bush connected between each sweep and its associated shaft . in this case the bushes are shaped as and replace the bearings which receive the shafts 70 . in a preferred arrangement the shafts and bushes are in threaded engagement since in such an arrangement the threads will absorb the axial loads on the bearings . to elevate and clean a swath of at least partially flattened sugar cane , the apparatus follows an apparatus of the kind described and claimed in british pat . no . 1 , 424 , 511 which has flattened the cane into a swath and severed the stalks of flattened cane approximately at ground level by breaking the stalks at their weak base points . the apparatus of the present invention is passed over the swath of flattened cane in a direction opposite to that in which the flattening and severing apparatus has passed . the swath of cane is approached tops - first , lifted from the ground by the contra - rotating sweeps , guided between the drums and , the canes are then accelerated tops first across a gap 25 and up an inclined elevating plate or ramp 23 by a belt conveyor 27 , which is driven from shaft 57 by drive 101 ( see fig1 a ) and drive 102 ( see fig1 b ). the plate 23 and belt conveyor 27 are mounted on the main frame 42 of the apparatus . the conveyor 27 accelerates the cane from the trashy swath and across gap 25 leaving trash unsupported by cane toward the bottom of the swath . this trash therefore collapses into the gap being swept back as it falls down and eventually is trapped beneath a full width ground following roller 26 so that it cannot be swept up plate 23 by canes being pulled onto conveyor 27 . it will be appreciated that the stalks of cane as they are accelerated will have their leaves broken back against their direction of growth , and will be stripped off the stalk . thus , leafy material is stripped from the canes as they are pulled from the swath and falls , together with trash and leaves broken during the flattening process , to the ground as the canes are accelerated rearwardly . when the canes are short , the initial gathering and lifting is aided by lightly pressing down the swath in front of the gathering sweeps by a resilient sheet ( not shown ). as the stalks are elevated , freely rotatable rollers 28 on pivoted swinging arms 28a which are in turn pivotably connected to the main frame 42 press the elevated material against the elevating conveyor 27 . the second gap 29 is of sufficient width for any remaining leafy material and trash to fall downwards onto the ground , whilst being sufficiently short in width to allow all but the very shortest lengths of cane stalk to travel across it and up a ramp 106 and enter a nip indicated generally at 30 . the nip 30 is defined by two contra - rotating elements 38 , driven from shaft 57 , via drive 110 and gear box 111 , by drives 101 and 103 ( see fig1 a ), and fig6 shows these elements in greater detail in end elevation . the elements 38 are of four - fingered design , and two strips of flexible belting 38a are secured in the manner shown to each four - fingered paddle 38b with an overlap at 39 , and polyurethane foam 40 is adhered to its respective strips of belting 38a and is packed between two opposed quadrants of each cylindrical drum so formed . the elements are so synchronised that portions 39 form the nip , and it will be appreciated that this particular form of drum deals effectively with rocks , stones and similar obstructions which may be elevated with the swath , by allowing each drum to assume non - circular profiles during operation and hence allowing the creation of a nip of varying size . the elements are so synchronised that respective portions 39 of the two elements approach one another to grip the cane stalks of the elevated swath individually and accelerate them rearwardly through the nip . it will be appreciated that this rearward pulling of individual cane stalks from the swath increases the stripping and cleaning effect . the cleaned cane stalks pass through the nip and the leafy material and trash which cannot be accelerated like the cane , drops through the gap 29 . as the cane stalks come through the nip 30 , spaced contro - rotating paddle fans 31 , which are rotatably mounted on the main frame 42 by means ( not shown ) and which are driven from shaft 57 by drives 101 and 102 ( see fig1 a ) and respective drives 104 ( see fig1 b ), create air draughts in directions against and at an angle to the direction of travel 33 of the stalks . fig7 shows these fans in end elevation ; the extremeties of each four - fingered paddle are overlaid with flexible rubber flaps , and the fans are driven . as the cane stalks enter the nip 30 the outer flexible leaves ( such as , for example the leaves growing from the weak point at the base of the cape top ) are frictionally engaged by the surface of the drums 38 and hence tend to curl around the drums as the cane stalks come through the nip . the air currents from the fans confirm the leaf wrap around the drums . the outer leaves of the top , of each cane , and hence the top are restrained whilst the drums 38 continue to drive the respective stalk through the nip causing the top to break off at its weak point as the cane emerges from the nip . the rubber paddles 38b act as moving edges against which the top can break off . those tops , which are on the top of the canes , may be thrown into an optional collecting cage 17 above the main frame 42 of the apparatus by the uppermost of fans 31 and by the uppermost of drums 38 . thus with an apparatus embodying the present invention , a separate cane topper ( such as that described and claimed in british pat . no . 1 , 427 , 930 could be dispensed with . the cleaned and topped canes are finally guided through fan shrouds 41 and deposited into a bin 36 which travels on wheels 37 and is vertically and horizontally hinged at 87 to the main frame 42 of the apparatus . as shown in fig1 c , the lower section 88 of the bin is split into two halves 88a , 88b , each of which can be swung about pivots 89 by hydraulic rams 90 into a position shown in fig1 c in phantom outline , to discharge the cane stalks downwardly . although the apparatus described is used for gathering and cleaning leafy green unburnt sugar cane , an apparatus embodying the invention could be used to gather , elevate and clean a swath of at least partially flattened sugar cane which has first been burnt to remove most of the leafy material from the sugar cane . in either case , the apparatus on its propelling vehicle may be passed over the swath of cane in the same direction as that of the cutting apparatus which flattens and severs the cane ; although the separation of leaf and cane would then be inferior and it may be necessary to first &# 34 ; top &# 34 ; the canes using , for example , the apparatus of british pat . no . 1 , 427 , 930 . in this case , an apparatus embodying the present invention may comprise simply the contra - rotating drums , ground - following supporting means and nip elements . the cane swath would be individually nipped as before and flung rearwardly behind such a machine , and to help the gathering effect the gap 25 would be eliminated and the plate 23 extend forward under the sweeps . it will be appreciated that in any of the embodiments described above , the rotating sweeps will tend to break off any unsevered cane at its weak base point . they may be deliberately used to do this if the swath of cane has been merely flattened , and not separately severed , by whatever apparatus previously passed over it .	0
the pressure - sensitive adhesive compositions of this invention are particularly suitable for sealing the faceplate of an ostomy appliance to skin surfaces surrounding a patient &# 39 ; s stoma , with such compositions having physical characteristics especially advantageous for that use . for such purposes , the composition would be formed into a wafer having a thickness of about 0 . 010 to 0 , 090 inches backed by a thin , flexible , thermoplastic backing layer along one of its faces , with such backing layer then being directly or indirectly secured to a pouch . the opposite side or face of the wafer -- its bodyside surface -- would be covered by a removable protective covering , such as a siliconized release sheet , until use . ideally , the backing would be composed of a thermoplastic elastomer such as a polyurethane film , or a copolyester film of the type marketed under the designation hytrel by dupont ( wilmington , del .) or polyether - block amide film marketed under the designation pebax by elf atochem ( philadelphia , pa . ), but other non - elastomeric films , foams and non - woven materials may be used . the composition is a substantially homogeneous mixture of selected components forming an adhesive viscoelastic continuous phase in which water - absorbing and swellable hydrocolloid particles are dispersed . an essential component of the continuous phase is a blend of elastomers composed substantially entirely of about 2 to 15 percent ( preferably 3 to 7 percent ) by weight of one more high molecular weight polyisobutylenes and about 5 to 20 percent by weight ( preferably 7 to 14 percent ) of one or more styrene block copolymers . &# 34 ; high molecular weight &# 34 ; here refers to a polyisobutylene having a viscosity average molecular weight within the range of about 750 , 000 to 2 , 350 , 000 ( preferably about 1 , 000 , 000 to 1 , 900 , 000 ) as determined from intrinsic viscosity measurement in diisobutylene at 20 degrees c . such polyisobutylenes are commercially available and are known , for example , under the designations vistanex mm - l80 , mm - l100 , mm - l120 , and mm - l140 from exxon corp ., houston , tex . a styrene block copolymer or copolymers suitable for blending with such high molecular weight polyisobutylene ( s ) may be identified generally as styrene - olefin - styrene block copolymers . particularly suitable for this purpose are styrene - isoprene - styrene and styrene - butadiene - styrene block copolymers , both of which are commercially available , for example , from shell chemical and other suppliers . a styrene - isoprene - styrene block copolymer marketed as kraton 1107 ( shell chemical ) is believed particularly suitable , but other kraton copolymers , such as kraton 1100 , 1101 , 1102 are also considered suitable . petrolatum is most advantageously used as the hydrocarbon plasticizer component in the adhesive barrier composition of this invention , although it has been found that mineral oil may also be used . petrolatum is relatively viscous and non - flowing at room temperature , as compared to mineral oil , and these properties are believed desirable in achieving a pliant viscoelastic , and cohesive skin barrier composition . in general , the composition should contain about 6 to 20 percent by weight of petrolatum or mineral oil plasticizer , the preferred range being about 8 to 15 percent by weight . the skin barrier compositions of this invention also include one or more water soluble hydrocolloid gums which are capable of absorbing moisture and preventing such moisture from disrupting adhesion to skin surfaces . the preferred hydrocolloid gums are sodium carboxymethylcellulose and pectin , although minor amounts of other hydrocolloid gums such as gelatin , guar gum , locust bean gum , sodium - calcium alginates , gum karaya and mixtures thereof , may be included . the hydrocolloid content of the composition should fall generally within the range of about 35 to 65 percent ( preferably about 40 to 55 percent ) by weight , with the preferred hydrocolloid content consisting essentially of pectin and sodium carboxymethylcellulose in a ratio of approximately 2 to 1 . the barrier composition should also contain one or more hydrocarbon tackifier resins homogeneously distributed in and forming part of the continuous phase of the composition . particularly effective results have been obtained with an aliphatic hydrocarbon resin tackifier commercially available from hercules inc . ( wilmington , del .) as piccotac 95 , although other tackifiers such as the trimethylol propane esters of rosin ( staybelite ester 10 from hercules ) or the pentaerythritol esters of rosin ( pentalyn h from hercules ) might also be used . other tackifiers that are believed suitable for use in the barrier composition of this invention are beta pinene or cyclopentadiene resins that are also commercially available . in general , the tackifier content should fall within the range of about 10 to 35 percent by weight , preferably about 20 to 30 percent by weight . in addition , the barrier composition may include up to about one percent by weight of a suitable antioxidant such as irganox 1010 or irganox 1076 ( ciba geigy ). other commercially - available antioxidants might also be used . the barrier compositions of this invention are prepared by first blending the elastomers -- the high molecular weight polyisobutylenes and styrene block copolymers -- with antioxidant in a heavy duty mixer , such as a high shear sigma blade mixer , with heating at a temperature of about 120 degrees c . to 150 degrees c . blending is continued with the addition of plasticizer , preferably petrolatum and , in a final blending stage , the hydrocolloids are mixed with the continuous - phase components at a temperature of about 80 degrees c . to 100 degrees c . until a homogeneous adhesive skin barrier mixture is produced . the adhesive mass is then extruded and calendered or pressed to the desired thickness ( about 0 . 010 to 0 . 090 inches ) on a sheet of silicone - coated release paper and a flexible backing member of thermoplastic film or other material is laminated to the other face of the adhesive barrier layer . in subsequent steps , the laminate is cut to form wafers or blankets of the desired size and shape and the backing layers are secured , preferably by heat sealing , to the walls of pouches ( for one - piece appliances ) or to coupling rings capable of being detachably connected to such pouches ( for two - piece appliances ). in either case , the wafers of skin barrier composition , backed by flexible backing layers , become the annular faceplates for adhesive sealing attachment to the peristomal skin surfaces of patients . if desired , such faceplates may be manufactured to include other features , such as the intermediate attaching ring and microporous patch of u . s . pat . no . 4 , 213 , 458 or the floating flange construction of u . s . pat . no . 4 , 419 , 100 , the disclosures of which are incorporated by reference herein . pressure - sensitive skin barrier compositions embodying the invention were prepared consisting of the following ingredients on a percent weight basis : ______________________________________ examples ( 1 ) ( 2 ) ( 3 ) ( 4 ) 5 ) ( 6 ) ______________________________________high mw polyisobutylene 3 . 6 3 . 6 5 5 3 . 6 5 ( vistanex mm - l100 ) styrene - isoprene - styrene 8 . 4 8 . 4 8 5 8 . 4 5copolymer ( kraton 1107 ) petrolatum 9 . 9 9 . 9 14 . 9 9 . 9 -- 14 . 9mineral oil -- -- -- -- 9 . 9 -- tackifier ( piccotac 95 ) 24 36 18 25 24 20antioxidant ( irganox 1010 ) 0 . 1 0 . 1 0 . 1 0 . 1 0 . 1 0 . 1sodium carboxymethyl - 19 19 18 20 19 20cellulosepectin 35 23 18 35 35 35gelatin -- -- 18 -- -- -- ______________________________________ the high molecular weight polyisobutylene , styrene - isopyrene - styrene copolymer , and antioxidant were blended in a sigma blade mixer with heating ( at about 130 degrees c .) for approximately 10 minutes . the plasticizer ( petrolatum or mineral oil ) was then added to the blend and mixed for approximately 25 minutes , followed by the addition of tackifier , sodium carboxymethylcellulose and pectin and , in example 5 , gelatin . mixing was continued at about 90 degrees c . for approximately 40 minutes until a homogeneous mass was obtained . the mass was allowed to cool , flattened to the desired thickness on sheets of silicone - coated release paper , and cut to form wafers . in some cases the opposite surface of each wafer was covered with a film of thermoplastic elastomer ( hytrel ) of 0 . 0012 inches thick and in other cases the opposite surface of each wafer was covered by silicone - coated release paper so that both release sheets could be removed for product testing . pressure - sensitive skin barrier compositions not embodying the invention but prepared for analysis on a comparative basis with examples 1 - 6 contained the following ingredients on a percent weight basis : ______________________________________ examplesingredient ( 7 ) ( 8 ) ( 9 ) ( 10 ) 11 ) ______________________________________high mw polyisobutylene -- 13 -- 12 3 . 6 ( vistanex mm - l100 ) low mw polyisobutylene 8 -- -- -- 24 ( vistanex lm - mh ) styrene - isoprene - styrene 6 -- 12 -- 8 . 4copolymer ( kraton 1107 ) butyl 065 rubber 16 . 25 -- -- -- -- petrolatum -- 14 . 9 9 . 9 9 . 9 9 . 9mineral oil 11 . 5 -- -- -- -- tackifier ( piccotac 95 ) -- 18 24 24 -- tackifier ( pentalyn h ) 12 . 75 -- -- -- -- antioxidant 0 . 5 0 . 1 0 . 1 0 . 1 0 . 1 ( irganox 1010 ) sodium carboxymethyl - 15 18 19 19 19cellulosepectin 15 18 35 35 35gelatin 15 18 -- -- -- ______________________________________ examples 7 through 11 were prepared in accordance with the general procedure outlined in examples 1 - 6 . example 7 is of the same composition disclosed in example 1 of u . s . pat . no . 5 , 059 , 189 and is believed to be of the same or substantially the same formulation as that of a commercial product ( durahesive ). in this example , the compositions of examples 1 - 11 were each tested for dynamic absorption of fluid under laboratory conditions intended to simulate actual conditions of use . for test purposes , each sample took the form of a circular wafer of 3 . 25 inches in diameter and a thickness of 0 . 070 inches covered on one side with an thermoplastic elastomeric film ( hytrel ) of 0 . 0012 inches thick . a circular opening of 0 . 75 inches in diameter extended through the center of each sample , including its hytrel backing layer . the opposite side of each wafer was secured to a double - faced adhesive mounting sheet ( avery fasson fast tape 445 ) with an opening in register with the opening of the sample , the purpose of the mounting sheet being to permit attachment and removal of the sample from the surface of the test apparatus without damaging the sample by reason of removal forces . the dynamic absorption test apparatus included a mounting plate of rubber having a smooth vertical surface simulating a skin surface and having a central horizontal opening therethrough simulating a stoma opening . fluid circulation passages through the plate were connected by tubing to a pump and a heater for the circulation of water through the plate at a simulated body temperature of 35 - 40 degrees c . a reservoir containing water was connected by soft tubing of 1 / 16 inches id to the central opening of the mounting plate and a cam - equipped peristaltic pump flexed the wall of the tubing at a frequency of 20 cycles per minute to advance water at room temperature from the reservoir into the opening of the plate at a rate of approximately 1 , 500 mililiters per 24 hours . each sample was adhered by means of the double - faced adhesive sheet to the surface of the mounting plate with its opening in register with the opening of the plate , and the apparatus was operated so that water from the reservoir would be dripped into the opening of the plate and allowed to pass through the opening of the sample . at intervals of 2 , 7 , 10 and 14 days , each sample of barrier material was removed and weighed to determine the cumulative weight gain by reason of water absorption . the results are tabulated below : __________________________________________________________________________dynamic absorption ( weight gain in grams ) sample ( according to example nos . ) days 1 2 3 4 5 6 7 8 9 10 11__________________________________________________________________________ 2 0 . 24 0 . 13 0 . 12 0 . 28 0 . 4 0 . 59 0 . 67 0 . 62 0 . 54 0 . 69 0 . 58 7 1 . 7 0 . 81 1 . 15 1 . 47 1 . 35 3 . 53 3 . 66 2 . 28 2 . 62 2 . 2 2 . 3110 2 . 83 1 . 09 1 . 82 2 . 38 2 . 16 4 . 96 5 . 33 3 . 93 2 . 98 3 . 02 2 . 9214 5 . 2 1 . 72 2 . 69 4 . 7 3 . 73 6 . 77 7 . 76 * d 4 . 04 * d 4 . 61 * __________________________________________________________________________ samples 1 - 6 utilize this invention and , with the exception of example 6 , the weight gain based on water absorption at 2 and 7 days was less than that of samples 7 - 11 . the letter &# 34 ; d &# 34 ; indicates that samples 8 and 10 disintegrated after the 10th day and did not survive the 14 day testing cycle . visual inspection of sample 7 revealed that the saturation front had advanced to its outer margin by the 12th day revealing that such sample had become inoperative in preventing leakage in a radial direction from its inner to outer margins . by the 14th day , the saturation fronts for samples 9 and 11 had also reached the outer margins . the asterisks (*) for samples 7 , 9 and 11 therefore denote that such samples had become inoperative in preventing leakage by or before the end of the test period . by contrast , in all of the samples 1 - 6 , the saturation fronts had advanced more slowly in radial directions and not reached the outer margins by the end of the 14 - day test period . with regard to samples 1 and 7 , the test results are consistent with what has been observed clinically . sample 1 is a wafer having an adhesive compositon of this invention as it now appears in a commerical product and sample 7 is believed to be representative of a barrier product ( durahesive ) that does not embody this invention but is also commercially available . clinical investigations support the observation that in actual practice wafers having a composition corresponding to that of sample 7 absorbs more fluid , with the saturation fronts advancing more rapidly to the outer margins and substantially reducing the weartime by several days , in comparison with wafers having the composition of sample 1 . this example reveals the results of tests on the samples of examples 1 through 11 when such samples ( with hytrel backings and release paper removed ) were immersed in simulated urine and their weight gain in grams was measured at intervals of 1 , 6 and 24 hours . the following results were obtained : ______________________________________absorption of simulated urine ( weight gain in grams ) sample ( according to example nos . ) hours 1 2 3 4 5 6 7 8 9 10 11______________________________________1 1 . 4 0 . 9 1 1 . 6 1 . 3 1 . 3 1 . 1 1 . 9 1 . 6 2 . 3 1 . 16 2 . 4 1 2 . 3 2 . 8 2 . 5 2 . 2 2 . 7 6 . 9 3 . 5 6 . 9 3 . 324 5 . 5 1 . 8 5 . 1 5 . 6 5 . 5 4 . 7 5 . 7 10 . 5 5 . 6 11 . 8 7______________________________________ the tensile properties of the barrier compositions of examples 1 through 11 were tested on an instron machine ( type 4501 ) and the stress and strain of each sample was measured both at peak and at break . in addition , the stresses at 10 percent , 20 percent and 50 percent strain were measured . for purposes of such testing , strips of barrier material without backing were cut , each strip having a width of half an inch . the ends of each strip were placed in the jaws of the machine at an initial separation of one inch , and the jaws were separated at a crosshead speed of 2 . 5 inches per minute . the tests produced the following data revealing the tensile or cohesive strength of the respective barrier materials : __________________________________________________________________________tensile properties examples ( according to example nos .) 1 2 3 4 5 6 7 8 9 10 11__________________________________________________________________________stress @ peak 14 . 7 16 . 6 7 . 9 9 . 3 11 . 4 5 . 8 6 . 8 15 32 . 5 10 8 . 1 ( psi ) strain @ peak 224 450 158 46 207 43 39 46 238 34 41 (%) stress @ break 9 . 1 11 . 8 5 . 4 3 . 4 8 . 5 2 4 . 1 5 . 1 17 . 1 -- 3 . 1 ( psi ) strain @ break 657 876 445 1146 530 541 793 548 343 -- 215 ( psi ) stress @ 10 % 5 5 . 4 2 . 2 4 . 8 3 . 7 2 . 9 2 . 6 10 . 1 5 . 7 6 . 2 4strain ( psi ) stress @ 20 % 7 . 5 7 . 2 4 . 1 7 . 2 5 . 8 4 . 4 4 . 8 13 . 3 9 . 2 8 . 5 6 . 3strain ( psi ) stress @ 50 % 10 . 9 9 . 2 6 . 3 9 . 1 8 . 8 5 . 6 6 . 7 14 . 7 15 9 . 9 7 . 9strain ( psi ) __________________________________________________________________________ for purposes of measuring compression set for the barrier compositions of examples 1 - 11 , one inch diameter samples of each barrier material were cut . then the samples between release paper were placed on a hard level surface in an oven set at 60 degrees c . and 5 kg weights were placed on each sample . after one hour , the samples were removed from the oven and their diameters were measured to the nearest thousandths of an inch at four locations : 0 , 45 , 90 and 135 degrees . the average of such measurements was computed for each sample and the compression set at one hour , as a percentage of the original diameter , was calculated as follows : ## equ1 ## where d 1 represents original diameter and d 2 represents average final diameter . ______________________________________compression set (% of original diameter increase ) samples ( according to example nos . ) 1 2 3 4 5 6 7 8 9 10 11______________________________________42 50 40 33 58 57 58 58 25 49 53______________________________________ while in the foregoing , embodiments of the invention have been disclosed in considerable detail for purposes of illustration , it will be understood by those skilled in the art that many of these details may be varied without departing from the spirit and scope of the invention .	2
polyether ether ketone resin in the present invention is represented , for example , by the following chemical formula , specific example include aromatic polyether ether ketones developed by imperial chemical industries , ltd . ## str1 ## the polyether ether ketone resin used may be in the form of a powder , tube or film . it is applied to the outside of a metal pipe by coating , sticking , electrostatic coating , flame spraying , fluidized - bed coating , fitting , shrink fittings or winding , etc . thereafter it is attached to the outer surface of the pipe using pressure with fusing at about 350 °- 450 ° c . under a mechanical pressure of 30 - 1000 g / cm 2 to form the desired electrical insulating coating . an example of a useful metal conduct pipe is a steel pipe ; and stainless steel pipes having excellent corrosion resistance and good electric conductivity are preferably used . although the length of the conduct pipe depends upon the depth of the oil sand layer under the ground , a length of about 200 - 600 m or so is generally required . in the following , embodiments of the conduct pipe covered with the electrical insulating material of the present invention are illustrated . fig1 is a partial sectional view of an end part of the conduct pipe covered with the electrically insulating material . as shown in fig1 the outside of a metal conduct pipe ( 2 ) connecting with an electrode ( 1 ) is covered with a polyether ether ketone resin . generally , the conduct pipe ( 2 ) must have a length of about 200 - 600 m . accordingly , since the steel pipes or the stainless steel pipes generally each has a length of 5 - 50 m , they are connected together when inserting the end part of the conduct pipe into the oil sand layer . fig2 is a partial sectional view of the conjunction part of the conduct pipe covered with the electrically insulating material . as shown in fig2 when connecting a conduct pipe ( 2a ) covered with the electrical insulating material ( 3a ) to a conduct pipe ( 2b ) covered with the electrical insulating material ( 3b ), the end parts of the conduct pipes ( 2a ) and ( 2b ) are processed so as to have a taper screw ( 5 ) to connect each pipe by means of a coupling ( 4 ). in this case , the conjunction part , namely , the surface of the coupling ( 4 ), and the end parts of the conduct pipes are covered with an electrical insulating material ( 3c ). this prevents leakage of electricity from the conjunction part . while the invention has been described with reference to a conduct pipe covered with an electrically insulating material useful in an electrode apparatus for collecting underground hydrocarbon resources , it is not to be construed that the invention is limited thereto . in other words , the conduct pipe of the present invention can also be used as a pipe for oil pipeline , a conduit of chemical plant , etc . in the following , the method of covering with the insulating layer ( 3 ), ( 3a ), ( 3b ) or ( 3c ) of the polyether ether ketone resin and properties of the insulating layer are illustrated in detail with reference to examples and comparative example , but the present invention is not limited to these examples . a tape of polyether ether ketone resin film having a thickness of 0 . 05 mm and a width of 30 mm was wound round a conduct pipe 20 times . each wrapping overlapped the one below by half width of the tape . the film obtained had a thickness of 2 mm on the outside of the conduct pipe . the outermost layer of the film wound on the conduct pipe was pressed by means of an iron plate under a pressure of 100 g / cm 2 while revolving the conduct pipe in an electric furnace at 380 ° c . to form an insulating layer of the polyether ether ketone resin on the conduct pipe . tensile strength ( kg / cm 2 ) at 25 ° c . and dielectric breakdown voltage ( kv / mm ) of the resulting insulating layer and those of the insulating layer after dipping in hot water at 300 ° c . for 500 hours are shown in table 1 . an experiment was carried out by the same procedure as in example 1 , except that polytetrafluoroethylene resin was used instead of the polyether ether ketone resin . characteristics of the resulting insulating layer are shown in table 1 . table 1______________________________________ initial value after hot water treatment dielectric dielectric tensile breakdown tensile breakdown strength voltage strength voltage ( kg / cm . sup . 2 ) ( kv / mm ) ( kg / cm . sup . 2 ) ( kv / mm ) ______________________________________example 1 1050 35 970 32comparative 75 30 10 8example 1______________________________________ it can be understood from table 1 that the conduct pipe covered with the insulating layer which is obtained by attaching a polyether ether ketone resin using pressure with fusing at 380 ° c . has excellent mechanical and electrical characteristics . these characteristics are hardly deteriorated after the hot water treatment . a conduct pipe heated to 360 ° c . was immersed in a polyether ether ketone resin powder having a particle size adjusted to 150 - 250 microns by a fluidized - bed coating process to form a powder layer having a thickness of 1 mm on the conduct pipe . then , the powder attached to the conduct pipe was pressed by means of an iron plate under a pressure of 50 g / cm 2 while revolving the conduct pipe in an electric furnace at 400 ° c . to form an insulating layer of the polyether ether ketone resin on the conduct pipe . characteristics of the resulting insulating layer were similar to those of the insulating layer obtained in example 1 . as described above , the conduct pipe covered with an electrical insulating material of the present invention has an insulating layer which is excellent in electrical properties , mechanical properties and hot water resistance . accordingly , it is suitable as a conduct pipe for collecting underground hydrocarbon resources by an electrically heating method . while the invention has been described in detail and with reference to the specific embodiments thereof , it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof .	4
according to the invention two virtual calls are used for information transfer in the backward direction , i . e . from a switching arrangement to which a first virtual call is set up . more precisely , the solution consists in providing and keeping a call reference in order to relate the two virtual calls which are set up in opposite directions to each other . in general terms , when the first virtual call in the forward direction is released , a second virtual call is set up in the opposite direction . this can also be interpreted as a virtual call being reverted . however , when speaking of a first and a second virtual call , also the second virtual call can be segmented and for example if the dpnss 1 signalling system is used , rules for segmentation are given in the dpnss 1 specification . [ 0038 ] fig1 is an illustration of the signalling that is performed in order to be able to send more information in the backward direction from a second switching arrangement nb to a first switching arrangement na than can be contained in a single message . a call reference to a virtual call is then created in the first switching arrangement na which particularly comprises system specific data such that na and nb can communicate with each other and understand each other , but no other switching arrangements , particularly no transit switching arrangements , cf . fig2 understand the content of the call reference . the call reference is then stored in na and na initiates a virtual call set up through sending a call set up message ( 1 ) to nb which contains information about the created call reference . the call reference is then stored in the destination switching arrangement nb which disconnects the call by sending a disconnect message ( 2 ) to na . in na all internal connections related to the virtual call , particularly the first virtual call , are kept but na acknowledges the disconnection of the first virtual call through sending an acknowledge message ( 3 ) to nb . nb then initiates a new or second virtual call intended for na and reuses the call reference previously created by na . nb then sends a call set up message ( 4 ) to na , including the stored call reference . when na receives a call set up message ( 4 ) from nb , na uses the received call reference ( i . e . the initial call reference ) and connects the new virtual call or the second virtual call to the kept internal connections . then it is possible to send the information requested by na or intended for na as segmented messages . now , the segmented messages are transferred ( 5 1 , 5 2 , 5 3 ) to na . segmented messages are sent until all information has been transferred . when all information is received , a disconnection of the ( second ) virtual call is initiated through sending of a disconnect message ( 6 ) from na to nb . then all connections are released in nb which sends an acknowledge message ( 7 ) to na which then releases all its connections related to the virtual call . [ 0039 ] fig2 is a figure similar to fig1 but wherein a transit exchange nx is supposed to be provided between na and nb . as in the embodiment referred to in fig1 a call reference is created in na and the call reference is also stored in na . na then sends the call reference to the destination exchange , which is nb , and a call set up message ( 1 a , 1 b ) is sent via nx . the call reference is stored in nb and the call is disconnected , disconnect message ( 2 a , 2 b ) is sent via nx to na . in na all internal connections related to the virtual call are kept , and na sends an acknowledge message ( 3 b ) to nx and all connections in nx are released and an acknowledge message ( 3 a ) is sent to nb . nb now initiates a new virtual call from nb to na . the stored call reference is sent in call set up messages ( 4 a , 4 b ). in na the received call reference is used and a new call is connected to the kept internal connections . then segmented messages ( 5 a 1 , 5 b 1 and 5 a 2 , 5 b 2 ) are sent until all information has been transferred . when all the information is received in na , na initiates a disconnection of the call through sending a disconnect message ( 6 a ) to nx which sends a disconnect message ( 6 b ) to nb which then releases all the connections related to the virtual call . an acknowledgement ( 7 a ) is sent from nx to na which releases all connections related to the virtual call and an acknowledge message ( 7 b ) is also sent from nb to nx and all connections are released in nx . in other aspects the functioning is the same as that discussed with reference to fig1 . in fig3 a particular implementation of a communications system using dpnss 1 is illustrated . for call set up specific messages isrm / ssrm are used and for call release crm / cim are used , as will be more thoroughly described below . according to the inventive concept it is also possible to add manufacturer specific information in dpnss 1 messages . as in the preceding embodiment a call reference is created and stored in exchange d 1 . it is sent as manufacturer specific data to exchange d 2 by an isrm ( initial service request message ) initiating a virtual call . d 2 then stores the call reference and initiates a release of the virtual call by a crm ( clear request message ) but it keeps all internal connections . d 1 acknowledges the release but keeps all internal connections . at this point all eventually seized transit exchanges ( not shown ) are released and only the end points are kept . an acknowledgement , a cim ( clear indication message ), is sent to d 2 . d 2 then initiates a new virtual call using the same call reference as in the previous virtual call initiated by d 1 . this is done through sending an isrm ( initial service request message ) as discussed above . the actual information transfer can then start . in this direction , the so called backward direction , more than one message can be used for the information transfer , and a number of ssrms ( subsequent service request message ) are sent . subsequent ssrms can carry the information as manufacturer specific data . when all the information has been received in d 1 , d 1 releases the virtual call by sending a crm ( clear request message ) which is acknowledged by a cim ( clear indication message ) from d 2 to d 1 . the message types are further discussed in “ digital private network signalling system no . 1 ( dpnss 1 ), btnr 188 , section 4 , issue 6 , pages 1 - 25 , january 1995 , describing the message types and forms . this document is herewith incorporated herein by reference thereto . in btnr 188 , section 15 , issue 4 , pages 1 - 8 , december 1989 , supplementary service , non - specified information describes the sending of non - specified information and how , for example , a supplementary information identifier can be included in call set up messages . this document is also incorporated herein by reference thereto . btnr 188 , section 4 , annex 2 , issue 6 , pages 1 - 6 , january 1995 , describes coding and definition of supplementary information identifiers and btnr 188 , section 6 , issue 6 , pages 3 - 12 , describes simple telephony calls within dpnss 1 and btnr 188 , section 5 , issue 5 , page 17 , december 1989 , describes the concept of virtual calls within dpnss 1 . these documents are also incorporated herein by reference . particularly , the invention may be implemented for transfer of roaming information from a home location node or home location exchange of a mobile station roaming into another node or a visited node . the information may for example relate to authentication information which generally is too much information to be carried in one single message , why segmented messages are needed . segmented messaging is allowed on set up of a virtual call , but not on a virtual call release as such . therefore , segmented messages are not allowed following on a release , whereas a call set up is interpreted as an initiation signal enabling transmission of segmented messages . this is , however , solved through the inventive concept , through which the direction of a virtual call is changed through the setting up of another virtual call . [ 0045 ] fig4 illustrates a method in a flow diagram starting with the creation of a call reference in exchange 1 , wherein the call reference also is stored , e . g . in a database 100 . a call set up message relating to set up of a virtual call and including call reference information is then sent to exchange 2 , 101 . then may e . g . be examined if there is a need to send information in segmented messages from exchange 2 to exchange 1 , 102 . if not , i . e . if there is only need for sending a short message which can be contained in one single message , the information is transferred to exchange 1 , 102 a . if , on the other hand , larger amounts of information are requested , the call reference is stored in storing means in exchange 2 and the virtual call is disconnected , 103 . all the internal connections related to the virtual call are kept in exchange 1 , 104 and exchange 1 acknowledges disconnection of the virtual call to exchange 2 , 105 . exchange 2 then initiates a new virtual call intended for exchange 1 and a call set up message is sent , including the call reference that was created for the first virtual call ( in the step 100 ), 106 . exchange 1 then uses the received call reference and connects the new virtual call to the kept internal connection , 107 . then segmented messages containing the wanted information are sent to exchange 1 , 108 . the call is disconnected when all information has been received in exchange 1 , 109 , and all connections are released in exchange 2 , 110 , whereupon exchange 1 releases all connections , 111 . finally , the disconnection is acknowledged , 112 . it is an advantage of the invention that more data than can be carried by a virtual call in the backward direction can be sent when the virtual call direction is changed or , in other words , if a second virtual call is set up in a direction opposite to that of the first virtual call . in for example dpnss 1 up to 135 octets of data can be sent instead of 45 which is the limit for unsegmented messages , i . e . in the direction only allowing segmented messages , which would be the case if a second virtual call were not set up . this makes it possible to increase the capacity in a dpnss 1 network since no speech channels need to be occupied for information transfer that can be carried out by virtual calls . this is , of course , also the case for other networks using asymmetrical protocols where limited information transfer is possible in one direction , but segmentation can be used in the opposite direction . the invention is , of course , not limited to the explicitly illustrated embodiments , but it can be varied in a number of ways within the scope of the appended claims .	7
the vehicle seat , an aircraft seat in particular , shown in fig1 has an adjustable - inclination back rest 10 with integrated head rest 12 . in its lower part , back rest 10 effects transition to the seat component or thigh rest 14 , in which a female occupant , represented in outline , has been seated in the seat illustrated . the seat component 14 is accommodated by a seat shell 16 , preferably of a plastic material , and has at least one tilting arm rest 18 . to enhance seating comfort , arm rest 18 is in its lowered passenger position in the illustration in fig1 . the seat shell 16 and accordingly the seat component 14 rest on a seat frame support 20 which permits fastening of the vehicle seat to a vehicle floor 22 by suitable fastening means 24 . the fastening means , as well as the structure of the seat frame support 20 , are conventional and thus will not be described further in detail . the seat frame support 20 includes a front cross brace 26 and rear cross brace 28 in the area of the back rest 10 . the two cross braces 26 and 28 secure the seat shell 16 at the bottom , and thus , the seat component 14 over its entire width . toward the vehicle floor 22 , the two cross braces 26 and 28 are spaced apart by supports 30 and 32 connected to each other on their lower ends by a floor brace 34 . a diagonal brace 36 , which as viewed in the line of sight to fig1 , extends between the lower end of each support 30 and the upper end of each support 32 . the seat frame support 20 is preferably a light - weight construction made in particular of aluminum materials . a folding table 38 , which serves the occupant of the following seat as a table top when the vehicle seats are mounted in a row , may be mounted in the rear area of the back rest 10 . the design in question as described for vehicle seats , such as that for aircraft passenger seats or passenger seats in commercial vehicles such as buses , is generally known and is not be discussed in detail . in addition to possible adjustments referred to for the back rest 10 , other optional seat adjustments may be provided , with respect to the seat component 14 in particular . in the embodiment shown in the figures , a pivot - mounted and lockable pivot support arm 40 is mounted in assignable positions in the area of the front cross brace 26 on the seat frame support 20 . support arm 40 has both a foot rest 42 and a leg rest 44 in the form of a calf support . hence , the rest 42 / 44 is a multipurpose feature , that is , it may be used optionally either for foot support or for leg support , as desired by the current occupant of the seat . the width selected for the rest in question is such that the seat occupant may optionally place one leg or foot , but possibly also both legs or feet on the rests . from the viewpoint of ergonomics , the seat permits dynamic seating by means of this rest , so that increased seating comfort even on long flights or over great road distances is achieved , with space conserved and at low cost . in an embodiment not shown here , as a corresponding modification of the support arm , the rest 42 / 44 could also be hinge - connected to the rear cross brace 28 , so that a seat occupant next in the row of seats might use the rest for his legs . preference is to be given , however , to the embodiment illustrated in fig1 and fig2 . both the foot rest 42 and the leg rest 44 represent a component of a common bracing component 45 . the foot rest 42 is mounted on one surface of the bracing component 45 , while leg rest 44 is mounted on the opposite other surface of the bracing component 45 . if the leg rest 44 is in the form of a calf rest , the associated area of the bracing component 45 may in addition be shaped so that the requirements of the body outline of the current seat occupant are taken into account . in the illustration presented in fig1 , the rest has been swung to a position in which it acts as a leg rest 44 , especially as calf support . the leg rest 44 is accordingly provided with flexible padding 46 which results in greater support comfort and yet permits reliable support in the calf area . the illustration presented in fig2 shows a vehicle seat as illustrated in fig1 , but one now occupied by a male passenger , the leg rest 44 swung down and the foot rest 42 facing upward as the leg rest 44 with padding 46 faces downward . to achieve reliable support for the foot of the seat occupant , the foot rest 42 is in the form of a solid plate . damage to the soft padding 46 of the leg rest 44 underneath is prevented . the rest is pivoted on the front end of the support arm 40 to provide for the swinging movement of the rest referred to above . the support arm 40 , as particularly shown in fig3 and 4 , is pivotally mounted centrally on the foot or leg rest 42 , 44 . for the pivotable connection , side two retaining flanges 48 are mounted opposite each other on the foot rest 42 . a shaft 50 of the support arm 40 extends through flanges 48 so that the free end of the support arm 40 is held between them . the respective retaining flanges 48 divide the foot rest 42 into a right and a left support area for the feet of the seat occupant ( see fig2 ). in the area of the shaft 50 , spring elements ( not shown ) may be mounted between the rests 42 , 44 and the support arm 40 , so that in both instances the respective support for the leg or foot is spring loaded and the tilt of the rest is automatically adjusted to the ergonomics of the seat occupant . the support process involved is in each instance spring - assisted . the spring assistance may also be present exclusively to assist leg support or foot support . as seen in fig2 in particular , the bottom side of the support arm 40 presents a stop surface 52 for the foot rest 42 . as is also to be seen in fig4 , the plate - like foot rest 42 is provided with knob - like raised areas 54 which permit a sort of massage function in the event that the seat occupant has removed his / her shoes and uses the foot rest 42 accordingly . as fig2 also shows , the shaft 50 is hinge - connected between support arm 40 and rest 42 , 44 to the support flanges 48 so that the latter are displaced backward slightly relative to the ankle joint of the respective seat occupant . this has been found to be especially user - friendly . the support arm 40 has two shanks 56 and 58 mounted at an assignable angle to each other . these shanks define between them an obtuse angle , preferably one with a value of 135 °. the shank 58 facing toward the seat frame support 20 is hinge - connected or pivoted to the latter by way of a rotary element 60 with an integrated locking feature . in the embodiment illustrated in fig3 and 4 , the rotary part 60 with the integrated locking feature is hinge - connected or pivoted directly to the upper front cross - brace 26 of the vehicle seat . preferably , however , as in the embodiment shown in fig1 and 2 , the rotary element 60 is an integral component of a flange - like coupling piece 62 , which in turn is rigidly connected at its end opposite the rotary element 60 to the cross brace 26 . as a result of the accompanying projection determined by the coupling flange 62 , as is illustrated in fig1 and 2 in particular , the support arm 40 with rests 42 , 44 may be swung backward in the direction of the pair of front supports 30 so that the rest can be positioned behind the front edge of the seat of the seat element 40 . if the rest is needed again , it may be returned or pivoted clockwise to a service position from the storage position shown in fig1 and 2 into which the rest was swung away counterclockwise . the support arm 40 with rests 42 , 44 may be stopped in a specific position by way of the rotary element 60 with integrated locking feature divided into specific steps . the locking feature in the steps referred to may have subdivisions such that a virtually continuous setting is guaranteed for the rests 42 , 44 . the support arm 40 with associated rests 42 , 44 , in turn , may be designed as a lightweight structure , preferably made of an aluminum material , this being a significant factor especially in aircraft construction . because of the mounting of the rests 42 , 44 to be pivotable around the shaft 50 and in view of the plurality of pivot positions in relation to the rotary element 60 , a large number of options for adaptation to the particular seat occupant are provided and may be changed during operation . a distinct increase in seating comfort in the sense of dynamic seating is achieved . in addition , the arrangement of the present invention is well suited for a resting position of the seat occupant , for example , when the occupant is sleeping . because of the complete pivoting away of the rests by way of the support arm 40 , these rests are not in the occupant &# 39 ; s way if the occupant does not need them . in the event of an accident , these rests may be securely stored away , and thus , contain no accident risk . the arrangement illustrated is suitable especially in view of its space - saving design for aircraft passenger seats and for seats in commercial vehicles such as buses . while one embodiment has been chosen to illustrate the invention , it will be understood by those skilled in the art that various changes and modifications can be made therein without departing from the scope of the invention as defined in the appended claims .	1
preferred embodiments of the present invention will be described herein below with reference to the accompanying drawings . in the following description , well - known functions or constructions are not described in detail since they would obscure the invention in unnecessary detail . fig3 is a block diagram illustrating the construction of a decoder according to an embodiment of the present invention . referring to fig3 , the decoder can include a branch metric calculation ( bmc ) unit 301 , an add compare select ( acs ) unit 303 , a survivor path memory 305 , a traceback ( tb ) unit 307 , an error determination unit 308 , an output buffer 313 , and an ml searching unit 315 . the error determination unit 308 can include a crc block 309 and a reverse crc block 311 . the bmc unit 301 calculates an approximate degree between reception data input to the bmc unit 301 of the decoder and a predetermined code sequence output from an encoder , and outputs a branch metric ( bm ). the acs unit 303 performs addition and comparison using , as inputs , the bm calculated by the bmc unit 301 and a metric of a previous state that has been stored in advance , in order to select a survivor path of each state most approximate to a transmitted code sequence , and calculates a state metric of the survivor path . selected survivor path information is stored in the survivor path memory 305 . the traceback unit 307 performs a traceback operation on a path having a high probability that the path is an original path through which transmission has been made based on information stored in the survivor path memory 305 . the error determination unit 308 determines if an error has been found according to a crc check . here , the error determination unit 308 of the decoder performs a crc check and a reverse crc check operating the crc check in a reverse order , simultaneously , to determined if an error has been generated . unlike a decoder of a general mobile system , the error determination unit 308 performs the crc check and the traceback operation , simultaneously , in order to solve a delay limitation caused by the crc check . the crc block 309 of the error determination unit 308 arbitrarily sets an initial register value of the crc block 309 , and determines if an error has been generated by comparing a crc value attached to the end of input data with the initial register value . the reverse crc block 311 of the error determination unit 308 can be formed by making a connection path opposite to that of the crc block 309 and forming the same structure as that of the crc block 309 . that is , the reverse crc block 311 sets an initial register value to a crc value of input data , receives the input data in a reverse order , and determines if an error has been generated using the initial value of the reverse crc block 311 . thus far the apparatus for improving a decoding performance in a mobile communication system has been described . hereinafter , a method for improving a decoding performance in a mobile communication system using the above - described apparatus according to the embodiment of the present invention will now be described . fig4 is a flowchart illustrating a decoding operation of a decoder according to an embodiment of the present invention . referring to fig4 , the decoder starts a decoding operation in step 401 , and performs a traceback operation on a received signal in step 403 . after that , the decoder performs a reverse crc check in step 405 , and determines if an error has been generated according to the reverse crc checkin step 407 . here , unlike a decoder of a general mobile system , the decoder performs the traceback operation and the reverse crc check simultaneously in order to solve a delay limitation caused by the crc check . a method for solving a delay caused by the crc check in the decoder will be described with reference to fig5 . when it is determined that an error has been generated according to the reverse crc check , the decoder again performs the reverse crc check in step 411 . meanwhile , when it is determined that an error has not been generated according to the reverse crc , the decoder outputs a corresponding decoded result in step 409 , and ends the process . though fig4 illustrates the reverse crc process , which is an error check process , is performed simultaneously with the traceback operation according to the exemplary embodiment of the present invention , the present invention can be similarly applied to all error check processes as well as the reverse crc process . fig5 is a flowchart illustrating an operation process of a decoder for improving a decoding performance according to an embodiment of the present invention . here , the operation process of the decoder is described on the assumption that a reverse crc check and a traceback operation are simultaneously performed on a received signal . referring to fig5 , the decoder sets an initial register value of a reverse crc block to a crc value of input data in step 501 , and again receives the input data in a reverse order in step 503 . after that , in step 505 , the decoder compares a crc value of the reversely input data with the initial register value set in step 501 , and checks a comparison result of step 505 in step 507 . when the crc value of the reversely input data and the initial register value are identical to each other as a result of the comparison in step 505 , the decoder determines there is no error in step 509 . meanwhile , when the crc value of the reversely input data and the initial register value are not identical to each other as a result of the comparison in step 505 , the decoder determines that an error has been generated in step 511 . for example , in the case where the decoder receives data whose crc value is “ 11 . . . 11 ”, the decoder sets an initial register value of a reverse crc block to “ 11 . . . 11 ”, which is the same value as the crc value of the input data , and reversely receives the input data . after that , the decoder compares a crc value of the reversely input data with the initial value of the reverse crc block . when the crc value of the reversely input data and the initial value of the reverse crc block are identically “ 11 . . . 11 ”, the decoder determines that there is no error . when the crc value of the reversely input data and the initial value of the reverse crc block are not both equal to “ 11 . . . 11 ”, the decoder determines that an error has been generated . fig6 a is a diagram illustrating a crc check process of the decoder according to an embodiment of the present invention . referring to fig6 a , the decoder sets all initial register values of a crc block to “ 11 . . . 11 ” and receives input data . accordingly , the decoder determines if there is an error according to the crc check by comparing a crc value attached to the end of the input data with “ 11 . . . 11 ”, which is the initial register value . fig6 b is a diagram , illustrating a reverse crc check process of a decoder according to an embodiment of the present invention . referring to fig6 b , the decoder sets all initial register values of a reverse crc block to a crc value of input data received in advance , and again receives in a reverse order the input data received in advance . accordingly , the decoder determines if there is an error according to the reverse crc check by comparing a crc value attached to the end of the reversely input data with the crc value of the input data received in advance , which is the initial register value . fig7 is a timing diagram illustrating an operation process of a decoder according to an exemplary embodiment of the present invention . referring to fig7 , in the case of receiving an input signal , the decoder performs an acs operation on the input signal and performs a traceback operation . here , the decoder outputs a result regarding the traceback operation , and simultaneously performs a reverse crc process ( 701 ). at this point , when checking if an error has been generated according to the reverse crc check , the decoder outputs a result regarding a second traceback operation , and simultaneously again performs a reverse crc process ( 703 ). the operation time of the above - described decoder is compared with that of a conventional decoder with reference to the accompanying drawings . first , assuming that a decoder according to the present invention and a conventional decoder operate under the same circumstance before the operation times of the two decoders are compared , a decoding time of the conventional decoder is 6 w ( refer to fig2 in description of related art section ), and a decoding time of the decoder according to the present invention is 4 w . in other words , when the decoder according to the present invention is used , a processing time can be shortened by 2 w in comparison with the decoding time of the conventional decoder , which means the decoding performance improves by about ⅓ compared with the decoding performance of the conventional decoder . fig8 is a view illustrating a crc check process of a decoder according to another exemplary embodiment of the present invention . referring to fig8 , as described above , the decoder performs a reverse crc check and a crc check simultaneously . the above error check process is a method for shortening the time needed to perform an error check in the case where a decoding bit is long . in this method , a crc check is performed in the left side ( 801 ), and a reverse crc check is performed in the right side ( 803 ), so that whether an error has been generated is determined by determining if the register values of the two sides are identical to each other at an intermediate point . in other words , the decoder sets initial register values of a crc block to “ 11 . . . 11 ”, and sets initial register values of a reverse crc block to a crc value of input data in order to simultaneously determine if an error has been generated . as described above , to improve a decoding performance of a mobile communication system , the present invention can reduce a time required to perform a traceback operation , and performing an error check process such as a reverse crc check , which is a reverse process of a crc check , and thus shorten a decoding time . the decoder to which the present invention is applied can shorten the decoding time of a decoder used for a general mobile communication system to ⅔ of the prior art . although the invention has been shown and described with reference to certain preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims . therefore , the scope of the present invention should not be limited to the above - described embodiments but should be determined by not only the appended claims but also the equivalents thereof .	7
the present art is normally intended for use with human patients , as well as various veterinary applications . for simplicity , this combined human or animal use will be referred to as use in mammals , although of course such devices could also be used in appropriate non - mammal animals such as birds , reptiles , and amphibians , etc ., as appropriate . it should also be understood that although the examples of cutting unwanted plaque deposits in arteries are used throughout this disclosure , the actual invention may be used for a broader variety of applications , including removing tumors , getting biopsies , etc . in arteries , veins , and any other tubular or roughly tubular body lumen . for brevity , non - proximally driven rotating cutter catheters will usually be referred to in the specification as distal driven designs . however it should be understood that wherever appropriate , alternative non - proximally driven designs such as circumference driven designs are also included in this general description . nomenclature : the handle end of the catheter is the proximal location , and the nose cone tip of the catheter is the distal location . fig1 shows an overview of the device . the device typically consists of an operator handle ( 101 ) which remains outside the body . the handle may optionally contain a battery , and a motor ( 102 ) which may provides torque for a rotary cutter , and additionally one or more optional control switches ( 103 ). the catheter also has a long narrow tube ( shaft ) ( 104 ), and the cutting atherectomy head ( 105 ). the catheter tube or shaft ( 104 ) will typically consist of a flexible tube , which is often hollow and capable of passing a guide wire , as well as optionally other materials such as drugs and contrast materials , control wires , drive shafts , sensors , sensor fibers or wires , ultrasonic signals , and the like . in some embodiments , the hollow tube may contain a shaft or hollow shaft capable of transmitting torque from a motor mounted in the handle ( 102 ) to a rotary cutter ( 106 ) mounted in the atherectomy head . this rotary cutter ( 106 ) will usually be exposed to the outside environment through a window ( 107 ). the relative positions of the rotary cutter ( 106 ) and the window ( 107 ) may optionally be controlled by the operator , and optionally the cutter may be moved relative to the window edge to open or close the window ( exposing or hiding the circular cutter ) under operator control . torque may be communicated to the rotary cutter ( 106 ) by a variety of means so long as these means to not obscure either the window or the hollow space in the tube on the side of the catheter proximal to the window . some of these torque ( rotary motion ) imparting means include indirect , off - axis , mechanical gearing or other means ( 108 ). in other embodiments , the catheter tube ( 104 ) may transmit electrical power , pressure , or chemicals capable of driving an electric motor , turbine , or chemical motor which can be mounted in the atherectomy head . the head will also usually contain a flexible or moveable nose cone region or nose region ( 109 ), which in some embodiments may be connected to the rigid body of the head by one or more hinge pins or other means . this flexible nose - cone region will be capable of being deformed by the operator from a straight to a bent position so that the nose , by pressing against one wall of a body lumen , will generate an opposite force that will tend to move the cutter ( 106 ) and window ( 107 ) against an opposite wall of a body lumen , thus enabling the cutter to cut material from selected zones of a body lumen under operator control . the catheter &# 39 ; s nose ( 109 ) usually has a tapered or conical a traumatic design intended to allow the catheter head to easily migrate through arteries . it may be composed of softer materials , and may additionally have an internal coiled spring or other means to allow the tip to bend somewhat as needed to migrate through torturous arteries and other body lumen structures . fig2 a shows a close - up of the cutting atherectomy head ( 105 ). the head will typically consist of a hollow body ( 201 ) connected to the catheter tube ( 104 ), and a tapered nose , ( 109 ) usually connected to the front ( distal portion ) of the hollow body by at least one hinge ( 202 ). the head ( 105 ) will additionally consist of at least a window ( 107 ) and rotating cutting wheel ( 106 ). the unit may also optionally have holes or ports ( 203 ), ( 204 ), ( 205 ) and appropriate inner hollow spaces for accommodating an optional guide wire . this optional guide wire helps the operator thread the catheter head through torturous arteries or other body lumens , and will be discussed in more detail in fig4 . as previously discussed , prior art atherectomy catheter designs taught proximally driven rotating cutting wheel designs . that is , the rotating wheel would ( 106 ) would under previous art have been directly coupled to a drive shaft coming from catheter tube ( 104 ) by a coupling mechanism aligned with the axis of wheel ( 106 ). the prior art proximal - drive teaching had certain advantages . it was compatible with simple and robust designs , and also minimized the cross - section ( width ) of the catheter head , which was again desirable because this helped the head migrate through torturous artery channels . the prior art proximal drive design also allowed large amounts of torque to be communicated through the drive shaft to the cutting wheel by rotation , and also allowed the relative angle of the cutting wheel to be adjusted in the catheter head by transverse motion of the rotating shaft relative to the outer catheter sheath . thus an operator could , by transverse motion of the catheter &# 39 ; s inner rotating shaft , both communicate rotation to the cutting head , and also adjust the cutting head &# 39 ; s relative orientation to catheter head windows ( opening and closing the window , for example ) or alternatively , in fixed window designs , adjust the angle of the cutting head or control to what extent the cutting head protrudes out through a catheter window . however , as previously discussed , the prior art proximal design had one big drawback . the drawback was that proximal drive rotary shaft and coupling mechanism occupied essentially all of the hollow space ( 206 ) in the inside of the catheter head ( i . e . proximal to the window ( 107 ) and cutter ( 106 ). as a result , in prior art designs , the only space that was available to store cutter shavings ( typically plaque shavings ) was in the hollow nosecone ( 109 ). unfortunately this hollow nosecone , which needed to be tapered in order to pass easily through arteries , typically had very limited internal volume and storage capacity . examples of such proximally driven cutters that store plaque shavings in the distal side in a conical nose include the previously discussed silverhawk device . as previously discussed , this prior art device , although very functional , filled up quickly with shavings . when this happened , the device had to be stopped , removed from the body , the contents of the nose removed , and then reinserted into the body and threaded to the correct region again . as previously discussed , this was undesirable because it extended the length of procedures , and was burdensome for the physician and patient . as previously discussed , by departing from the mechanically simpler proximally driven designs of prior art , and instead moving to a mechanically more complex non - proximally driven design ( such as a distally driven or circumference driven design ), the substantially larger space ( 206 ) on the proximal side of the cutter wheel ( 106 ) can now be opened up and used to store plaque shavings . although due to the higher complexity , previous designs taught away from such configurations , this more complex design is justified by the subsequent savings in catheter cleaning time and effort . whereas earlier designs , due to limited nosecone plaque storage space ( 109 ), could potentially waste hours of physician and patient times through tedious multiple removal and cleaning steps , these wasted hours can now be reduced or eliminated . the additional time can be used to do a more complete job of plaque removal as needed . given the extremely small diameter available to catheters , however , this alternative design poses many challenges . either the rotating cutting wheel needs to be coupled to its rotational power source by an indirect linkage , or alternatively the cutting wheel needs to be powered from the distal end . various types of indirect linkage are possible , and the present invention is not intended to be limited to any one means . in one embodiment of the invention , the mechanism may involve indirectly coup ling the cutting wheel ( 106 ) to the torque or rotation transmitting catheter drive shaft from the catheter tube ( 104 ) by an indirect gearing means so that torque is transmitted from the drive shaft to the outer diameter of the cutting wheel from the distal direction . in one example , a rotating drive shaft from the flexible catheter tube ( 104 ) turns a first axial aligned gear ( 210 ) which , through one or more transfer gears ( 211 ), transfers power to an off - axial drive shaft ( 212 ). this off - axial drive shaft ( 212 ), typically will be connected closely to the main body of the catheter head ( 201 ) by a coupling mechanism ( not shown ) that allows the drive shaft to rotate . off - axial drive shaft ( 212 ) then transfers power to the rotating cutter ( 106 ) by a second gearing mechanism ( 213 ). many other mechanisms are also possible , and these are discussed in more detail in fig5 . a second advantage of the present invention &# 39 ; s distal side driven design over the earlier proximal driven art is that the distal driven design allows the cutter wheel ( 106 ) to be mounted on a carriage mechanism ( not shown ) so that it can also be used to open and close the window ( 107 ) as directed by the operator . this can allow the cutter wheel to be gradually closed by the operator , so as to allow simultaneously shearing off and trapping any dangling plaque that still may be attached to the side of an artery wall . as per the earlier silverhawk catheter designs , usually , the angle of the present art catheter &# 39 ; s nose ( 109 ), relative to the rest of the catheter head body ( 201 ), will be under the control of the operator so as to act to press the cutting wheel against the target plaque with the desired degree of pressure . as per the earlier silverhawk catheter design , plaque cutting can be facilitated by deflecting the cutting wheel ( 106 ) so that it protrudes slightly through the window ( 107 ). this way the exposed tip of the cutting wheel may freely shave away stiff regions of exposed plaque that might not otherwise bend to extend inside the catheter window . this deflection may be achieved by a cam mechanism ( not shown ). cam mechanisms of this type were previously taught by applications ser . nos . 10 / 896 , 741 ; 10 / 288 , 559 ; 10 / 027 , 418 , the contents of which are incorporated herein by reference . the rotating cutting wheel may have sharp edges composed of tungsten carbide and the like . in other configurations , a wheel need not be used , and instead an alternate cutting device such as laser , radio frequency electrodes , ultrasonic vibrating knives , may be used . in still other configurations , a cutting wheel can have its cutting effectiveness enhanced by coupling its rotary cutting action with laser , radio frequency electrodes , ultrasonic vibration , and the like as needed . device dimensions : typically the catheter cutting head ( 201 ) will have a diameter between about 1 to 2 . 2 millimeters . the cutting window ( 107 ) will typically have a length of about 1 . 2 to 2 . 5 millimeters . in embodiments where the cutting wheel contains a cam or other orientation control mechanism that allows the wheel to extend slightly outside the window , the wheel orientation control mechanism may allow the wheel to at least temporarily be locked into a position that allows the cutting outer edge of the wheel to extend about 0 . 025 to 0 . 64 mm outside the cutting window . this allows the operator to move the catheter head along the target region of plaque , and shave off a long thin portion of this plaque while doing so . the cutting wheel ( 106 ) will typically have a diameter of about 1 . 14 mm , and may have a straight edge , a beveled edge ( which allows removal of plaque without damaging the underlying artery lumen ), or a fluted edge depending upon the needs of the specific application . usually the cutting wheel will be mounted on a shuttle or cam mechanism to allow the operator to adjust the protrusion of the wheel from the window , or alternatively the angle of the wheel or even the location of the wheel relative to the window opening ( causing the window to be open , partially closed , or fully closed by the wheel ). the cutting wheel will typically rotate at speeds appreciably faster than 100 rotations per minute ( rpm ), preferably about 8 , 000 rotations per minute ( rpm ). the cutting edge of the blades may be optionally hardened by an appropriate coating , such as me - 92 , tungsten carbide , or other suitable materials as taught by u . s . pat . nos . 4 , 771 , 774 ; 5 , 242 , 460 ; 5 , 312 , 425 ; 5 , 431 , 673 ; and 5 , 674 , 232 , the contents of which are incorporated herein by reference . as previously discussed , the action of blade can be facilitated by ultrasonic vibration , laser cutting , radio frequency electrodes , and the like . if this option is elected , appropriate mechanisms ( i . e . a piezoelectric ultrasonic vibrator , laser diode or optical fiber , electrodes , etc .) may also be provided in the catheter head to drive the blade as needed . if the action of the ultrasonic , laser , or electrode cutter is sufficiently robust enough as to make it a spinning blade unnecessary , then the blade may either not be spun up , or the blade rotary mechanism may be omitted , or a non - rotating blade may be used . in many embodiments , it will be useful to allow the location and orientation of the catheter head ( 201 ), nose ( 109 ), and cutting window / wheel region ( 106 / 107 ) to be identified by x - ray fluoroscopy by constructing these regions out of suitable combinations of translucent and radio opaque materials , thus , for example , enabling the region distal to the cutting head to be distinguished from the region proximal to the cutting head . in addition to fluoroscopy localization , other modalities , such as light ( optical ) and sonic ( ultrasonic ) localization methods may also be used . here orientation may be facilitated by running a fiber optic strand through the catheter ( 104 ) ( not shown ) to an appropriate location on the catheter head , and determining the location and orientation of the head by optical means . alternatively an ultrasonic transducer or pickup may be incorporated into the catheter head . typically the flexible outer catheter tube ( 104 ) between the handle ( 101 ) and the head ( 105 ) will have a length between 50 cm and 200 cm , a diameter between 1 french ( 0 . 33 mm ) and 12 french ( 4 mm ), and will usually be between 3 french ( 4 mm ) and 9 french ( 3 mm ) in diameter . the catheter body will often be made from extruded organic polymers such as polyvinylchloride , polyurethane , polyester , polytetrafluoroethylene ( ptfe ), silicon rubber , or similar materials . the catheter body may be reinforced as needed with wires , coils , or filaments as needed to give the body additional strength and to control rigidity and pushabiliy . portions of the catheter head ( 105 ) ( distal region of the catheter ) will often be rigid or partially rigid , and can be made from materials such as metals , hard plastics , composite materials , niti steel ( optionally coated with titanium nitride , tantalum , me - 92 ® or diamonds . usually stainless steel or platinum / iridium will be used . the length of the middle portion of the catheter head may often vary between about 5 to 35 mm ( 201 ), and will usually be between about 10 to 25 mm , however alternative lengths ( longer or shorter ) may also be used . as previously discussed , the extreme distal end of the catheter head ( the nose ) ( 109 ) will usually be made to be both flexible and a traumatic so as to allow the catheter to be threaded through arteries , veins , or other body lumens with maximum ease and minimum trauma . because , in this design , the nose is no longer used to store plaque , this nose design may be optimized to accommodate the distal drive mechanism and also optimized to allow easy passage of the catheter through arteries . in some cases , the distal tip will have an inner coil construction to maximize flexibility . the distance between the rigid part of the catheter head and the distal end tip of the flexible catheter nose will typically be between 10 and 30 mm , but may vary as needs dictate . fig2 b shows the catheter head with the catheter nose cone ( 109 ) in the angled , drooped or bent configuration . typically this nose angle will be adjustable by the operator , either through a cam mechanism ( not shown ) coupled through the catheter tube ( 104 ) to the operator handle ( 101 ), or through selection of materials with appropriate rigidity / elasticity and bendability so that the operator may adjust the nose angle to an appropriate level by pulling or pushing on the catheter handle ( 101 ) and tube ( 104 ). fig2 b shows that in this configuration , nose cone ( 109 ) is bent relative to body ( 201 ). this bending is a simple way to effectively increase the cross sectional area of the catheter , and is used to force the cutting edge of the catheter against the appropriate target zone . in the confines of a narrow body lumen such as an artery , nose cone ( 109 ) is deflected until it contacts a body lumen wall ( i . e . the opposite wall of the artery ). this pushes ( or “ urges ”) cutting window ( 107 ) and cutter ( 106 ) in the opposite direction . if appropriately directed , this will push , force , or urge the cutter against the appropriate target zone ( usually a region of the artery occluded or partially occluded with plaque ). once the cutter is in proper position , with the correct amount of “ force ” or “ push ” dialed in by the angle of the nose deflection , the catheter can then be moved by the operator , shaving away unwanted plaque material . fig3 shows a diagram of the catheter head of the present invention cutting plaque ( 301 ) from an artery wall ( 302 ). in this configuration , the catheter &# 39 ; s nose ( 109 ) has been deflected at enough of an angle to contact the opposite artery wall ( 303 ). the cutting wheel ( 106 ) has been forced up against the plaque ( 301 ) and has already cut away a section of this plaque ( 304 ). a dangling region of plaque ( 305 ) is entering the hollow catheter body ( 206 ) through the window ( 107 ). here , the operator controls the speed and extent of plaque removal by using control ( 101 ) to partially retract the catheter head over the plaque by pulling on catheter tube ( 104 ), while wheel ( 106 ) is spinning and exposed to the plaque through window ( 107 ). excess plaque ( 306 ) is stored in the hollow region of the catheter head ( 206 ). the drawing is not to scale , in actuality ; the available storage space ( 206 ) will typically be substantially larger than the storage space of nosecone ( 109 ). often , it may be advantageous to use a guidewire as a type of monorail to quickly direct catheters to the correct target zones . usually such guidewires will have diameters between about 0 . 010 ″ and 0 . 032 ″, usually around 0 . 014 ″. when this option is desired , the catheter may be designed to be compatible with guidewire use . fig4 shows one possible way in which the catheter of the present invention may work with a guide wire . in this example , guidewire ( 401 ) is threaded up through hollow catheter tube ( 104 ). in order to allow the head &# 39 ; s cutting mechanism to operate freely and without risk of entanglement from a guide wire , it may be useful to have the guide wire exit from the main catheter tube through a first proximal exit port on the head ( 203 ), thus skipping the storage area ( 206 ) window ( 107 ) and plaque cutting ( 106 ) regions of the head . in this configuration , the guide wire would then typically reenter the nose cone ( 109 ) at opening ( 204 ), travel through the nose end of the head for a short distance , and then finally exit the head again through a third exit port or opening ( 205 ), often located near the tip of the catheter &# 39 ; s nose ( 109 ) at the extreme distal end of the catheter in some embodiments , it may also be desirable to protect the portion or portions of the guidewire that is briefly external to the catheter head ( 402 ) by a guidewire tube / lumen or a telescoping guidewire tube / lumen ( 403 ). such guidewire protection lumens may have a length between about 2 and 14 cm , or even longer as needed to accommodate longer heads with higher plaque storage volumes . this telescoping guidewire lumen protects both the guidewire and the patient &# 39 ; s artery linings from inadvertent excessive pressure while the catheter head traverses narrow arteries , and also insures that the guidewire never comes into contact with window ( 107 ) or cutter ( 106 ). in some embodiments , the telescoping guidewire lumen may serve a secondary purpose by also acting as a means to transmit torque ( 212 ) from a rotating shaft in the catheter tube ( 104 ) to the cutting wheel ( 106 ) as previously shown and discussed in fig2 a . this dual - action role ( guidewire protection / torque transmission ) helps to minimize the cross section area of the catheter head when an off - axis drive mechanism is used . in still another embodiment , lumen ( 403 )/ drive shaft ( 212 ) can consist of one or more nested hollow tubes so that an inner tube may rotate and conduct torque to drive wheel ( 106 ), yet the outerpart of the lumen may be substantially stationary as to avoid tangling with a body lumen . the guide wire may still progress through the hollow inner core of this nested structure . many other combinations of drive mechanisms , catheter configurations , and sensor configurations are also possible , and some of these are shown in fig5 a and 5b . as shown in fig5 a , the rotary cutter ( 106 ) does not necessarily have to be coupled to a rotating shaft of any sort from catheter tube ( 104 ). rather , the rotary cutter may be adequately driven from the distal end of the catheter by means of a small electric motor or turbine ( 501 ). this motor or turbine may in turn derive power from catheter tube ( 104 ) and in some embodiments handle ( 101 ) as well by appropriate wires or miniature pressure or chemical tubes ( not shown ) progressing up catheter tube ( 104 ). as shown in fig5 b , in some embodiments , the catheter head ( 105 ) may additionally have various imaging or positional sensors , such as ultrasound transducer arrays , optical fibers , coherence tomography devices , infrared sensors , directional ultrasonic sensors , etc . mounted on the catheter head or nose region ( 502 ), ( 503 ). in one embodiment , the orientation of the sensor or sensors may be directed by the operator to give information as to the status of the plaque and / or artery of or other body lumen that is facing the cutting window of the catheter . this can allow the operator to determine if the catheter is in the proper orientation relative to its intended target . examples of such sensors were described in more detail in application ser . no . 10 / 421 , 980 , the contents of which are incorporated herein by reference . fig5 b also shows yet another embodiment in which the plaque storage container ( 506 ) is extended to now also include some of the hollow core of the catheter tube itself ( 104 ). with this configuration , handle ( 101 ) may be hooked up to a suction or cleaning device , as needed , to give the catheter a near infinite ability to accommodate plaque shavings . with this configuration , the catheter need never be removed from the body until the complete plaque removal task is accomplished .	0
the present invention provides a general method for the synthesis of open metal carbonyl clusters , which in one embodiment are bound by with three calixarene phosphine ligands for steric protection against aggregation . metal carbonyl clusters are clusters containing metal bonds to a bound carbonyl , which cluster can also contain other ligands such as phosphine , carbene , etc . the open metal clusters comprise either ( i ) easily co - labile ligands , e . g ., a tertiary amine ligand or ( ii ) a coordinatively unsaturated site consisting of a co vacancy . the synthesis of the open site in both cases requires the selective oxidation of bound co ligands to co 2 , using a selective oxidant such as trimethylamine oxide . by an “ open ” metal cluster is meant for the purposes of the present invention having one or more carbonyls of the metal cluster missing . the sites formerly held by the missing carbonyls can be either occupied with a co - labile ligand , such as trimethylamine , and / or having a vacant site altogether . a labile , or co - labile , ligand for the present purposes is one that is readily removed upon treating the cluster with co . thus , for the present purposes , an open cluster is one where the site that used to be occupied with co , before opening , is able to be readily recarbonylated and reoccupied upon treatment with co . this can be done , for example , upon treating the cluster with co gas at ambient conditions . if rebinding of the co is not readily accomplished , the cluster is not considered open . prior art clusters where the co has been replaced with an anion such as br are not open as the cluster is not recarbonylated upon treatment with a co atmosphere . the anions , such as bromine , are strongly coordinated and are not readily replaced upon treatment with a co atmosphere . see , for example , williams et al ., j . am . chem . soc ., 2010 , 132 pages 14018 - 14020 ; and , shekkar , et al ., j . am . chem . soc ., 2012 , 134 , pages 4700 - 4708 . the “ open ” nature of the metal cluster has been found possible by using a selective oxidant to react with the closed cluster to create the open sites . co - labile ligands besides trimethylamine oxide include compounds having a lone pair of electrons on oxygen such as ethers ; amines ; ammonia ; dioxygen or nitrogen . in general , the co - labile ligands can be any nitrogen - containing compound coordinating through a nitrogen or any oxygen - containing compound coordinating through an oxygen . as noted above , the open metal clusters of the present invention can be regenerated to the corresponding closed cluster by binding co ligands to the open sites , e . g ., upon treating the cluster with co gas at ambient conditions . in one embodiment , the metal carbonyl cluster is an open ir 4 carbonyl cluster bound with three calixarene phosphine ligands for steric protection against aggregation . calixarene related compounds and ligands are known and in general are useful for steric protection against aggregation . such compounds and ligands are described , for example , in pct / us10 / 55686 , “ metal colloids with accessible metal surfaces ”, filed nov . 5 , 2010 ; and pct / us10 / 53818 , “ calixarene - bound iridium - containing metal colloids ”, filed oct . 22 , 2010 , with the subject matter of both applications being incorporated herein by reference in their entirety . the example below demonstrates a present synthesis of an open ir 4 carbonyl cluster that is bound with three calixarene phosphine ligands and an easily co - labile trimethyl amine ligand at the open site , which used to be occupied by the strongly binding ligand co . as a comparison of the two clusters l and l ′ as defined in fig1 shows , a sterically bulky calixarene phosphine ligand is important for preserving the stability of the ensuing open cluster . when the ligand is replaced with a smaller , less sterically demanding diphenylmethylphosphine ( pph 2 me ), for example , cluster aggregation can ensue upon synthesizing an open cluster . the synthesis of an open cluster is schematically represented in fig2 , starting with the parent l 3 closed cluster shown in fig1 . an example of a typical synthesis procedure follows . 100 μl of a 0 . 13 mm solution of me 3 no in dichloromethane ( corresponds to 0 . 13 mmol me 3 no ) were added to a solution of ir 4 ( co ) 9 [ t - butyl - calix [ 4 ] arene ( opr ) 3 ( och 2 pph 2 )] ( l 3 ) ( 51 mg , 0 . 013 mmol , in 3 ml decane ). the mixture was stirred for 1 hour . decarbonylation was accompanied by an immediate change in color of the solution containing the cluster from initial yellow ( corresponding to the parent l 3 closed cluster in fig1 ) to brown . the decarbonylation process could be followed using in - situ ( time - resolved ) ftir spectroscopy as shown in fig3 for 1787 cm − 1 ( bridging ) and 1988 cm − 1 ( terminal ). this data shows the decarbonylation to be complete in approximately 10 min , and to result in loss of both terminal and bridging co ligands . there appears to be a more significant decrease in the bridging versus terminal co band intensity . this trend is paralleled for data in the integrated co band intensity for the bridging and terminal regions . the fully integrated co band intensity drops from 100 % to about 93 % for terminal co and to 73 % for bridging co during decarbonylation . the synthesis of l 3 cluster open with amine ligands shown in fig2 was also followed via nmr spectroscopy , by performing the decarbonylation as stated above except using deuterated decane - d14 as solvent . fig4 shows the 1 h nmr spectra both before and after addition of me 3 no . the appearance of a singlet peak at 2 . 6 ppm with a relative intensity corresponding to ˜ 9h indicates the presence of coordinated me 3 n as ligand . 31 p nmr spectra do before and after addition of me 3 no appear unchanged , and , importantly , do not show any evidence of phosphine ligand oxidation ( i . e . no phosphine oxide resonances as would be expected in the vicinity of 23 ppm ). next , the decarbonylated cluster l 3 open with amine ligand ( right ) in fig2 was recarbonylated , in order to assess the accessibility and stability of the open cluster , in a decane solution at room temperature . this was performed as follows : a solution of the l 3 cluster open with amine ligand ( 51 mg [ 0 . 013 mmol ] in 3 ml decane ) was exposed to a co gas atmosphere ( 1 . 2 atm ) for a period of 1 hour . during that time , there was a visual color change of the solution from the brown color characteristic of l 3 cluster open with amine ligand to a yellow color reminiscent of the parent l 3 closed cluster . the degree of recarbonylation in solution can be quantitatively assessed in order to provide direct evidence of the stability of the open clusters in decane solution at room temperature , since only stable clusters are anticipated to be accessible for recarbonylation . after exposure to of the l 3 cluster open with amine ligand to a co atmosphere , ftir spectra were recorded and compared to spectra of both l 3 closed as well as l 3 cluster open with amine ligand . these spectra are shown in fig6 . the total integrated intensity for terminal and bridging co bands increased from values quoted above for l 3 cluster open with amine ligand to values corresponding to 96 % ( for terminal ) and 86 % ( for bridging ) of the integrated co band intensity present in l 3 closed . the similarity of the integrated co band intensity between recarbonylated and l 3 closed strongly suggests stability of the l 3 open with amine cluster in decane solution at room temperature . the integrity of the cluster following recarbonylation can also be followed via nmr spectroscopy . the 1 h nmr spectrum of the recarbonylated cluster in fig4 shows a partial decrease in the bound trimethylamine resonance corresponding to 25 % of its value in l 3 cluster open with amine ligand . this suggests that some bound amine remains , likely due to equilibrium limitations in the closed system used for recarbonylation . no change in the 31 p nmr spectrum was observed after recarbonylation , as shown in fig5 . the data above suggests a lack of cluster aggregation during decarbonylation as well as recarbonylation , especially the ftir data in fig6 showing the similarity of the original bands and bands in the recarbonylated cluster , as discussed above . further direct confirmation of cluster stability was assessed using dynamic light scattering ( dls ). dls data for l 3 closed and l 3 cluster open with amine ligand is shown in fig7 . this data unequivocally demonstrates that there is no cluster aggregation accompanying decarbonylation , as the particle size remains virtually unchanged for clusters consisting of l 3 closed and l 3 cluster open with amine ligand . this result is drastically different , as significant aggregation is observed , when the sterically bulky calixarene phosphine consisting of ligand l shown in fig1 is replaced with a smaller phosphine consisting of ligand l ′ in fig1 . when treating a decane solution of cluster l 3 ′ closed with me 3 no in a similar manner as described above for l 3 closed , a yellow - brownish precipitate forms from the initially transparent yellow decane solution . the ftir spectrum of the supernatant solution is shown in fig8 and demonstrates a significant loss of both bridging and terminal co band intensity . no recarbonylation is observed upon treating this supernatant solution with co ( 1 . 2 atm for 1 hour ) as shown in fig8 . dynamic light scattering data in fig9 show the clear presence of large particles after decarbonylation with me 3 no . these particles average in size between 500 nm - 600 nm are a result of cluster aggregation . alternatively , as discussed above , open clusters can be synthesized comprising a coordinatively unsaturated site comprising a co vacancy . this vacancy is expected to be a highly active catalyst site , since many reactions depend on highly coordinatively unsaturated sites for catalysis . such catalysis would include , among others , hydrogenolysis , ammonia synthesis , oxygen dissociation , propylene and acrolein oxidation , co oxidation , coking , and water - gas shift reactions . further , in general , the open metal carbonyl clusters of the present invention can be used as catalysts for reducing an organic molecule by contacting the organic molecule with the open metal carbonyl cluster and a reductant . the reducing step can comprise hydrogenation . the organic molecule can be an alkyl hydrocarbon substituted or unsubstituted . the catalytic process can also involve oxidizing an organic molecule by contacting the organic molecule with an open metal carbonyl cluster of the present invention and an oxidant . the oxidation process can comprise hydroxylation . the open site can be created by reacting the open metal cluster having a co - labile ligand with a strong acid to remove / coordinate with the co - labile ligand . for example , triflic acid can be used to remove the ligand trimethylamine from an open metal cluster . the trimethylamine would be coordinated with the triflic acid ( cf 3 so 3 h ). other strong acids can also be used , depending on the co - labile ligand . the synthesis of such an open cluster , labeled l 3 open without amine , is schematically represented in fig1 , and can proceed as follows : to a solution of l 3 open with amine ( 51 mg [ 0 . 013 mmol ] in 3 ml decane ), 1 μl of cf 3 so 3 h was added . the brown solution turned yellow and a reddish precipitate formed , which is presumed to comprise the [ me 3 nh ][ cf 3 so 3 ] salt . the synthesis of a vacant site via disappearance of the resonance representing coordinated trimethylamine can be monitored via 1 h nmr spectroscopy in hexane - d14 . the 1 h nmr spectra before and after cf 3 so 3 h addition as recorded in hexane - d14 are shown in fig1 . the spectra show that the me 3 n ligand peak at 3 ppm has disappeared after addition of one equivalent of the acid . no further appearance of [ me 3 nh ][ cf 3 so 3 ] is observed in the spectrum , which suggests that the precipitate is not soluble in hexane and the solution contains exclusively the yellow l 3 open cluster without amine . the 31 p nmr spectra shown in fig1 demonstrate a lack of phosphine oxidation in all clusters . the stability of the l 3 open without amine cluster was investigated using dls , following decarbonylation of l 3 closed , cf 3 so 3 h treatment , and filtration . the data in fig1 show that no aggregation of ir 4 clusters to larger aggregates occurs , as the size of the l 3 open without amine cluster matches that measured for l 3 closed in fig7 . this is presumably the result of the protection afforded by the three bulky calixarene phosphine ligands . as further evidence of the accessibility and stability of the vacant site in the l 3 open without amine cluster , recarbonylation was performed and monitored via ftir spectroscopy . this was performed by treating a decane solution of l 3 open without amine ( 51 mg ( 0 . 013 mmol ) in 3 ml decane ) with co gas atmosphere ( 1 . 2 atm ) for 1 hour . no color change was observed , i . e . solution remained yellow . after exposure of l 3 open without amine to co atmosphere , ftir spectra were recorded and compared to spectra of l 3 open without amine prior to recarbonylation . there is a drastic change in the ftir bands for l 3 open without amine following treatment of l 3 open with amine with cf 3 so 3 h and filtration . this is seen in fig1 . the decrease in co band intensity relative to l 3 closed ( shown as a solid black line in fig1 ) is a result of decarbonylation whereas the change of the co band pattern in the infrared spectrum may indicate a change in the cluster structure . however , a significant increase in co band intensity is observed after co exposure of l 3 open without amine , during recarbonylation . the recarbonylated spectrum shown in fig1 ( dash - dotted line ) is unlike the spectrum of l 3 closed , further suggesting the synthesis of a different small - sized cluster . in order to investigate gas - phase processes including catalysis using clusters l 3 closed and l 3 open with amine , both clusters were separately supported onto an aerosil - 500 silica support consisting of hydroxylated aerosil silica pretreated to a temperature of 500 ° c . and stored under inert ( water - and air - free conditions ). any suitable conventional catalyst support can be used to support the present open metal clusters . the support can comprise silica , alumina , carbon , magnesium , ceria , or any other support known in the art . a typical synthesis for supporting such a cluster follows : a solution of either l 3 closed or l 3 open with amine ( 51 mg [ 0 . 013 mmol ] in 3 ml hexane ) was added to a suspension of silica ( aerosil 500 , 949 mg [ 15 . 795 mmol ] in 20 ml hexane ). the suspension was stirred for 1 hour until the solution became colorless and virtually all cluster compounds were transferred to the silica - solid phase . the solvent was evaporated under vacuum and the resulting powder was dried overnight under vacuum at room temperature . the obtained material contains 1 weight % of iridium are referred to as l 3 open with amine @ aerosil 500 and l3 closed @ aerosil 500 . characterization of l 3 open with amine @ aerosil 500 was first performed by monitoring the changes accompanying recarbonylation via treatment with co at room temperature . the degree of recarbonylation in the material was quantitatively assessed by monitoring co bands in the infrared using in - situ ftir spectroscopy . ftir spectra after exposure of l 3 open with amine @ aerosil 500 to co atmosphere are shown in fig1 . following co treatment , the total integrated intensity for terminal and bridging co bands increased by 9 . 0 % and 1 . 4 %, respectively . such an outcome is rather similar to the degree of recarbonylation observed for l3 open with amine in solution ( i . e . see fig6 ). the slightly decreased recarbonylation capacity observed for l 3 open with amine @ aerosil 500 may be due to the presence of the silica surface , which is expected to act as a ligand and partially compete for open coordination sites / sites occupied with co - labile ligands such as amine . the relatively slow timescale of the recarbonylation observed in fig1 , in comparison with the short times represented in fig8 , are likely due to mass transport effects through the silica wafer , which is synthesized for the in - situ ftir measurement ( the wafer may have limited porosity and particles inside may take longer to recarbonylate ). notwithstanding these minor differences , the ability to recarbonylate most of the open sites in l 3 open with amine @ aerosil 500 demonstrates that , even when supported on partially dehydroxylated silica , most of the open sites remain available and accessible . the catalytic activity of l 3 open with amine @ aerosil 500 and of l 3 closed @ aerosil 500 was tested for the ethylene hydrogenation reaction . the reactions were carried out in once - through packed - bed flow reactors at a temperature of 40 c and atmospheric pressure . the packed bed ( 250 mg of catalyst ) was loaded into a u - shaped reactor ( with air - free stopcock closures ) in an argon - filled glovebox , and installed into the flow system to avoid contacting the catalyst with air . the process lines , and subsequently the packed bed , were purged with he ( 99 . 999 % purity ). the temperature was measured by using a thermocouple placed inside the reactor and immediately upstream of the packed bed . the reactant gases ( 10 ml / min h 2 and 3 ml / min c 2 h 4 ) were diluted in a stream of he flowing at 50 ml / min . an online mks ftir ( multigas 2030 ) was used to analyze the reaction products . one example of the utility of the l 3 open with amine @ aerosil 500 containing an ir 4 cluster with an easily co - labile ligand ( e . g . amine ) is shown in the hydrogenation of ethylene . the formation of ethane was immediately observed ( fig1 ) in the conversion catalyzed by l 3 open with amine @ aerosil 500 . the activity increased slightly and was stable for times on stream of more than 12 hours . formation of ethane in the conversion catalyzed by l 3 closed @ aerosil was only measured at extended times on stream . ethane formation , shown in table 1 , increased by approximately one order of magnitude from 8 ppm in the conversion catalyzed by l 3 closed @ aerosil 500 to 68 ppm in the conversion catalyzed by the l 3 open with amine @ aerosil 500 . the clusters are protected against aggregation on the support and maintain their activity at times on stream greater than 12 hours . these data show that the l 3 open with amine @ aerosil 500 , in which the ir 4 contains an easily co - labile ligand and is sterically protected , results in a more active catalyst for ethylene hydrogenation . the stability of catalyst l 3 open with amine @ aerosil 500 under ethylene hydrogenation reaction conditions at 40 ° c . can also be characterized using in - situ ftir spectroscopy . as shown in fig1 , l 3 open with amine @ aerosil 500 undergoes further decarbonylation during ethylene hydrogenation catalysis at 40 ° c ., as evidenced by the further loss in bridging and terminal band integrated intensity up to ˜ 41 hours time on stream in fig1 . the integrated intensity of the terminal and bridging co bands decreased by 8 . 3 % and 47 . 5 %, respectively , relative to the integrated peak intensities before hydrogenation . recarbonylation of the used catalyst at room temperature via switching to a co flow ( atmosphere ) after ethylene hydrogenation catalysis results in full recarbonylation , to the extent that co is observed to reoccupy the vacant sites created both during ethylene hydrogenation catalysis as well as during the initial decarbonylation with trimethylamine oxide . the latter point can be clearly observed by the lower initial bridging co band intensity relative to the final measured one after recarbonylation . indeed , after recarbonylation , the peak intensities corresponding to terminal and bridging co bands increased to 7 . 6 % and 1 . 1 %, respectively , relative to the initial values prior to hydrogenation of ethylene . these results are similar to the extent of recarbonylation shown in fig1 above and show that decarbonylation occurring during both treatment with trimethylamine oxide and ethylene hydrogenation catalysis are fully reversible . this in turn strongly suggests a lack of catalyst degradation via aggregation during these processes , since , if such aggregation were occurring , recarbonylation would not be expected to be reversible , as shown in fig1 . the catalytic significance of having an open site can also be observed under more forceful conditions in a related catalysis experiment , where pretreatment of the catalyst via oxidation is performed prior to measuring the catalysis rate . this was accomplished by first performing ethylene hydrogenation at 50 ° c ., followed by exposure of the packed bed to a mixture of dry air ( praxair aio . oxd ) flowing at 60 ml / min and he ( 99 . 999 % purity ) flowing at 10 ml / min for 12 hours . the latter procedure completes the catalyst pretreatment . subsequently , the catalytic activity for ethylene hydrogenation of the pretreated catalyst is measured . the results are shown in fig1 when using l 3 open with amine @ aerosil 500 . after the aforementioned pretreatment , the catalyst activity as represented by the ethane formation rate increases to achieve a new maximum at 12 hours time on stream . the catalyst is relatively stable for the subsequent 12 - 15 hours of time on stream in fig1 , though there is slight deactivation observed at longer times on stream . the formation of ethane was increased by nearly one more order of magnitude ( table 2 ), from 245 to 1766 ppm ethane , when comparing the rate in the first catalytic cycle during the pretreatment procedure versus after pretreatment ( and oxygen treatment using dry air ). these data show that the l 3 open with amine @ aerosil 500 catalyst , which is sterically protected , can be activated by exposure to oxygen ( in this instance via dry air ) to create a stable catalyst and active catalyst . performing a similar pretreatment and catalysis except using l 3 closed @ aerosil 500 results in a 26 % lower activity ( i . e . 26 % lower measured ppm of ethane in the catalyst bed effluent for same number of iridium sites in reactor ). comparing this result with the one shown in table 2 clearly shows the benefit to having open sites be present , even under forcing pretreatment conditions involving oxygen . fig1 shows the intensity change of selected carbonyl bands of l 3 open without amine @ aerosil 500 when treated with co gas . the data show no change for terminal carbonyl ligands and a slight increase of 4 % for bridging carbonyl ligands . these data are similar to recarbonylation characteristics that were observed for l 3 open without amine in solution ( see fig1 ), and suggests that extensive cluster aggregation does not occur . the following examples are provided as specific illustrations , and are not meant to be limiting . synthesis of ir 4 ( co ) 7 [ t - butyl - calix [ 4 ] arene ( opr ) 3 ( och 2 pph 2 )] 3 n ( me ) 3 ( also called l 3 open with amine ). a 100 μl of a 0 . 13 mm solution of me 3 no in dichloromethane ( corresponds to 0 . 13 mmol me 3 no ) were added to a solution of ir 4 ( co ) 9 [ t - butyl - calix [ 4 ] arene ( opr ) 3 ( och 2 pph 2 )] 3 ( 51 mg , 0 . 013 mmol , in 3 ml decane ). the mixture was stirred for 1 hour . decarbonylation was accompanied by an immediate change in color of the solution containing the cluster from initial yellow ( corresponding to the parent l 3 closed cluster in fig2 ) to brown . the decarbonylation process is followed using in - situ ( time - resolved ) ftir spectroscopy as shown in fig3 for 1787 cm − 1 ( bridging ) and 1988 cm − 1 ( terminal ). this data shows the decarbonylation to be complete in approximately 10 min , and to result in loss of both terminal and bridging co ligands . there appears to be a more significant decrease in the bridging versus terminal co band intensity . this trend is paralleled for data in the integrated co band intensity for the bridging and terminal regions . the fully integrated co band intensity drops from 100 % to about 93 % for terminal co and to 73 % for bridging co during decarbonylation . the synthesis of l 3 open with amine cluster was also followed via nmr spectroscopy , by performing the decarbonylation as stated above except using deuterated decane - d14 as solvent . fig4 shows the 1 h nmr spectra both before and after addition of me 3 no . the appearance of a singlet peak at 2 . 6 ppm with a relative intensity corresponding to ˜ 9h indicates the presence of coordinated me 3 n as ligand . 31 p nmr spectra do before and after addition of me 3 no appear unchanged , and , importantly , do not show any evidence of phosphine ligand oxidation ( i . e . no phosphine oxide resonances as would be expected in the vicinity of 23 ppm ). synthesis of ir 4 ( co ) 7 [ t - butyl - calix [ 4 ] arene ( opr ) 3 ( och 2 pph 2 )] 3 ( also called l 3 open without amine ). the synthesis is schematically represented in fig1 , and proceeds as follows . to a solution of l 3 open with amine ( 51 mg ( 0 . 013 mmol ) in 3 ml decane ), 1 μl of cf 3 so 3 h was added . the brown solution turned yellow and a reddish precipitate formed , which is presumed to consist of the [ me 3 nh ][ cf 3 so 3 ] salt . the synthesis of a vacant site via disappearance of the resonance representing coordinated trimethylamine is monitored via 1 h nmr spectroscopy in hexane - d14 . the 1 h nmr spectra before and after cf 3 so 3 h addition as recorded in hexane - d14 are shown in fig1 . the spectra show that the me 3 n ligand peak at 3 ppm has disappeared after addition of one equivalent of the acid . no further appearance of [ me 3 nh ][ cf 3 so 3 ] is observed in the spectrum , which suggests that the precipitate is not soluble in hexane and the solution contains exclusively the yellow l 3 open without amine . the 31 p nmr spectra shown in fig1 demonstrate a lack of phosphine oxidation in all clusters . synthesis of ir 4 ( co ) 7 [ t - butyl - calix [ 4 ] arene ( opr ) 3 ( och 2 pph 2 )] 3 n ( me ) 3 @ aerosil 500 . ir 4 ( co ) 7 [ t - butyl - calix [ 4 ] arene ( opr ) 3 ( och 2 pph 2 )] 3 n ( me ) 3 ( also called as l 3 open with amine @ aerosil 500 ). a solution of l 3 open with amine ( 51 mg ( 0 . 013 mmol ) in 3 ml hexane ) was added to a suspension of silica ( aerosil 500 , 949 mg ( 15 . 795 mmol ) in 20 ml hexane ). the suspension was stirred for 1 hour until the solution became colorless and virtually all cluster compounds were transferred to the silica - solid phase . the solvent was evaporated under vacuum and the resulting powder was dried overnight under vacuum at room temperature . the obtained material contains 1 weight % of iridium are referred to as l3 open with amine @ aerosil 500 . characterization of l 3 open with amine @ aerosil 500 was first performed by monitoring the changes accompanying recarbonylation via treatment with co at room temperature . the degree of recarbonylation in the material was quantitatively assessed by monitoring co bands in the infrared using in - situ ftir spectroscopy . ftir spectra after exposure of l 3 open with amine @ aerosil 500 to co atmosphere are shown in fig1 . following co treatment , the total integrated intensity for terminal and bridging co bands increased by 9 . 0 % and 1 . 4 %, respectively . such an outcome is rather similar to the degree of recarbonylation observed for l3 open with amine in solution ( i . e . see fig6 ). the ability to recarbonylate most of the open sites in l 3 open with amine @ aerosil 500 demonstrates that , even when supported on partially dehydroxylated silica , most of the open sites remain available and accessible . synthesis of ir 4 ( co ) 9 [ t - butyl - calix [ 4 ] arene ( opr ) 3 ( och 2 pph 2 )] 3 @ aerosil 500 ( also called as l3 closed @ aerosil 500 ). ir 4 ( co ) 9 [ t - butyl - calix [ 4 ] arene ( opr ) 3 ( och 2 pph 2 )] 3 referred as l 3 closed . a solution of l 3 closed ( 51 mg ( 0 . 013 mmol ) in 3 ml hexane ) was added to a suspension of silica ( aerosil 500 , 949 mg ( 15 . 795 mmol ) in 20 ml hexane ). the suspension was stirred for 1 hour until the solution became colorless and virtually all cluster compound was transferred to the silica - solid phase . the solvent was evaporated under vacuum and the resulting powder was dried overnight under vacuum at room temperature . the obtained material contains 1 weight % of iridium are referred to as l3 closed @ aerosil 500 . catalytic activity of ir 4 ( co ) 7 [ t - butyl - calix [ 4 ] arene ( opr ) 3 ( och 2 pph 2 )] 3 n ( me ) 3 @ aerosil 500 ( l 3 open with amine @ aerosil 500 ). catalytic activity was tested for the ethylene hydrogenation reaction . the reactions were carried out in once - through packed - bed flow reactors at a temperature of 40 c and atmospheric pressure . the packed bed ( 250 mg of catalyst ) was loaded into a u - shaped reactor ( with air - free stopcock closures ) in an argon - filled glovebox , and installed into the flow system to avoid contacting the catalyst with air . the process lines , and subsequently the packed bed , were purged with he ( 99 . 999 % purity ). the temperature was measured by using a thermocouple placed inside the reactor and immediately upstream of the packed bed . the reactant gases ( 10 ml / min h 2 and 3 ml / min c 2 h 4 ) were diluted in a stream of he flowing at 50 ml / min . an online mks ftir ( multigas 2030 ) was used to analyze the reaction products . the formation of ethane was immediately observed ( fig1 ) in the conversion catalyzed by l 3 open with amine @ aerosil 500 . the activity increased slightly and was stable for times on stream of more than 12 hour . steady - state (& gt ; 12 hour time on stream ) formation of ethane in hydrogenation of ethylene at 40 c was 68 ppm . catalytic activity of ir 4 ( co ) 7 [ t - butyl - calix [ 4 ] arene ( opr ) 3 ( och 2 pph 2 )] 3 n ( me ) 3 @ aerosil 500 ( l 3 open with amine @ aerosil 500 ). catalytic activity was tested for the ethylene hydrogenation reaction , where pretreatment of the catalyst via oxidation is performed prior to measuring the catalysis rate . this was accomplished by first performing ethylene hydrogenation at 50 ° c ., followed by exposure of the packed bed to a mixture of dry air ( praxair aio . oxd ) flowing at 60 ml / min and he ( 99 . 999 % purity ) flowing at 10 ml / min for 12 h . the latter procedure completes the catalyst pretreatment . subsequently , the catalytic activity for ethylene hydrogenation of the pretreated catalyst is measured . the results are shown in fig1 when using l 3 open with amine @ aerosil 500 . after the aforementioned pretreatment , the catalyst activity as represented by the ethane formation rate increases to achieve a new maximum at 12 hour time on stream . the formation of ethane was increased by nearly one more order of magnitude ( table 2 ), from 245 to 1766 ppm ethane , when comparing the rate in the first catalytic cycle during the pretreatment procedure versus after pretreatment ( and oxygen treatment using dry air ). in order to verify the stability of the open site on l 3 open without amine @ aerosil 500 , recarbonylation via co treatment was performed and quantitatively assessed via in situ ftir spectroscopy . fig1 shows the intensity change of selected carbonyl bands of l 3 open without amine @ aerosil 500 when treated with co gas . the data show no change for terminal carbonyl ligands and a slight increase of 4 % for bridging carbonyl ligands . these data are similar to recarbonylation characteristics that were observed for l 3 open without amine in solution ( see fig1 ), and suggests that extensive cluster aggregation does not occur .	2
to provide insight to the present invention , the following material from pending application ser . no . 12 / 315 , 898 is presented . turning now to fig1 , there is shown a basic well known demonstrative ellipsometer system comprising a spectroscopic source ( ls ) of a beam of electromagnetic radiation , a variable attenuator ( va ), an optional rotating compensator , a sample ( sm ) stage ( stg ), an optional collecting means ( cl ), and analyzer ( a ) and a detector ( det ). it is noted that the variable attenuator ( va ) can be comprised of two polarizers which can be adjusted with respect to one another to control the intensity of electromagnetic radiation which passes therethrough . continuing , fig1 and 2 show an incident beam ( bi ) of electromagnetic radiation reflecting as reflected beam ( br ) from a sample ( sm ) with a specular surface . note that the normal to the surface provides a reference for identifying angle - of - incidence ( aoi ) and angle - of - reflection ( aor ). note that a plane - of - incidence is defined as including both the locus of the incident beam ( bi ) and said normal ( n ). fig3 a shows an incident beam ( bi ) of electromagnetic radiation reflecting from a sample ( sm ) with an irregular surface . said fig3 a shows how the normal ( n ) to the sample ( sm ) surface varies in direction with position on said sample ( sm ), such that electromagnetic radiation reflected at various locations proceed along different loci . note that only a small amount of reflected electromagnetic radiation , from the peaks of the shown texture pattern , proceeds toward a detector . this can lead to far to low an intensity entering the detector to be analyzed . fig3 b shows how re - orienting the sample ( sm ) in fig3 a can increase the amount of electromagnetic radiation reflected from facet ( a ) toward a detector ( det ) by presenting the breadth of — a — facet ( a ) to so direct reflected electromagnetic radiation . fig4 a shows how further re - orienting the sample ( sm ) of fig3 b can greatly increase the amount of electromagnetic radiation reflected therefrom toward a detector ( det ) by positioning a plurality of facets ( a ) as shown to reflect electromagnetic radiation toward said detector ( det ). note that the planes of the facets ( a ) in fig4 a and 4 c are substantially parallel to one another . this is important as electromagnetic radiation can simultaneously reflect from all such facets of a properly oriented sample , and enter the detector ( det ). this increases the intensity of the electromagnetic beam reflecting from said facets which enters the detector , which electromagnetic radiation can be analyzed as it is substantially similar , in important aspects , to specularly reflected electromagnetic radiation . as indicated in the disclosure of the invention section of this specification , achieving this result is a primary goal of the 898 application invention . it is noted that simply adjusting the angle - of - incidence of a beam of electromagnetic radiation onto a textured surface of a sample , and adjusting the textured sample surface orientation can be undertaken with a goal of simply increasing intensity entering the detector ( det ), without regard to wherefrom on the textured sample surface reflection of electromagnetic radiation into the detector ( det ) occurs . this can lead to acquisition of data which can not be analyzed because too large a component of the electromagnetic radiation received by the detector ( det ) is noisy or depolarized etc . however , where essentially all reflected electromagnetic radiation is from substantially parallel facets , the data acquired is typically very good and its analysis can provide insightful information . it is also noted that if the textured surface of said sample is coated with a thin film , ellipsometric data obtained over a spectroscopic range of wavelengths can be analyzed to evaluate physical and optical properties of said thin film . fig4 b 1 and 4 b 2 are included to show that a texture pattern can comprise other than grooves as shown in fig3 a - 4 c , and show , respectively , top and side views of a sample ( sm ) which comprises a textured surface with a multiplicity of faceted pyramid shaped structures , with fig4 b 2 indicating facet texturing can be present on front and back of a sample . this can occur , for instance , where a sample ( sm ) is placed into an anisotropic etch bath without protecting the back side thereof . as described in the disclosure of the invention section , the 898 application invention methodology can beneficially make use of data obtained from the backside of such a sample , in evaluating physical and optical properties of a thin film on the front side thereof . note , data obtained from regions comprising and not comprising a thin film on the one side thereof , or obtained from different , but essentially similar samples which in combination provide both film present and absent regions can be used as well , and all said possibilities should be considered as functionally equivalent . fig4 c shows how orienting the sample ( sm ) shown in fig4 b 1 and 4 b 2 much as the sample ( sm ) of fig3 a and 3 b is oriented in fig4 a can lead to increased reflected electromagnetic radiation reflected therefrom toward a detector . for emphasis , note that where a group of substantially parallel facets ( a ) on a textured sample ( sm ) surface are oriented to provide optimum intensity of electromagnetic radiation reflecting therefrom into a detector ( det ) ( eg . such as shown in fig4 a and 4 c ), reflections from other facets which are not so oriented , and for that matter contacts and the like deposited onto the textured surface of the sample ( sm ), are directed away from the detector ( det ). see fig3 a for instance , which indicates ( scattered ) electromagnetic radiation ( em ) which is directed away from a detector ( det ) and ( em to detector ) which is reflected thereinto . this is a beneficial result as it reduces scattered reflected components from entering the detector ( det ) and adversely affecting the data provided thereby because of entered noise and depolarizing effects etc . fig3 c - 3 f are copied from u . s . pat . no . 7 , 230 , 699 and are mentioned at this point to demonstrate priority provided by said 699 patent via cip status . fig3 c shows a sample ( s ) with an irregular surface . fig3 d shows a means ( stg ) for use in rotatably orienting the sample of fig3 c . fig3 e and 3 f show how orienting said sample can control the angle - of - incidence ( aoi ) to said sample ( s ), and therevia increase the amount of electromagnetic radiation reflected therefrom toward a location at which is positioned a detector by controlling the angle - of - incidence ( aoi ). fig3 g is included to demonstrate well known euler angles theta ( θ ), phi ( φ ) and psi ( ψ ), which give insight to how the effect of tilting and rotating a sample can be described conventionally . for instance , the euler theta ( θ ) describes sample ( sm ) tilt with respect to a stage ( stg ) frame ( sf ) as said terminology is used herein , and the euler phi ( φ ) describes sample ( sm ) rotation in the plane of the sample ( sm ) surface . continuing , fig5 a shows an ellipsometer system , much as shown in fig1 , but with the stage ( stg ) oriented vertically , and being supported by a stage frame ( sf ) and stage rotation means ( sr ). fig5 b better shows how the vertically oriented stage of fig5 a . fig5 c shows a perspective view of how the stage ( stg ) rotation effecting means ( sr ) and the stage ( stg ) per se . of fig5 a and 5 b can be rotated in the stage frame ( sf ). fig5 d shows a side view of the system in fig5 c , with a sample ( sm ) mounted to the stage ( stg ) per se . compare fig5 d with fig4 a and 4 c , with the assumption that the incident beam ( bi ) is approaching said sample ( sm ) in a plane perpendicular to the plane of the paper . note that both rotation of the stage rotation means ( rm ) in the stage frame ( sf ), and rotation of the stage ( stg ) in said stage rotation means ( rm ) can be applied to optimally orient the sample ( sm ) for ellipsometric investigation so that as much as is possible of electromagnetic radiation reflected from the sample ( sm ) enters the detector in fig5 a . the described combination of a stage frame ( sf ), stage rotation means ( sr ) and stage ( stg ) as shown in fig5 a - 5 d is believed not to have been previously applied in ellipsometer systems to orient textured samples ( sm ) therein to enable ellipsometric investigation thereof , where said sample ( sm ) orientation is demonstrated in fig4 a and 4 c , particularly in the case of where spectroscopic ellipsometry is practiced to investigate a textured sample ( sm ) over a spectrum of wavelengths . this is further the case where ellipsometric data obtained from , for instance , the backside of a sample ( sm ) that has texturing on both the front ( fs ) and backside ( bs ) ( see fig4 b 2 ), but also has a thin film ( tf ) being present only on the front side ( fs ) ( see fig4 b 3 ), is analyzed by using results obtained by investigating the back side ( bs ) in arriving at physical and optical properties of the thin film ( tf ) on the front side . such a situation can present in solar cell samples that have an anti - reflective coating on the front side ( fs ) thereof , for instance . fig5 e shows a source ( ls ) of a beam ( b ) of electromagnetism , a control polarizer ( p 2 ), an optional compensator ( c ), a beam polarizer ( p ), a sample ( sam ), an analyzer ( a ) and a detector ( det ). fig5 f shows an arbitrary demonstrative effect on intensity ( i ) of a beam ( b ′) as compared to the intensity of beam ( b ) provided by a source ( ls ). note the baseline intensity ( i ) when said control and beam polarizers ( p 2 ) and ( p ) aligned , and that rotating the control polarizer ( p 2 ) with respect to the beam polarizer ( p ) has a uniform effect over the wavelength spectrum . adding a control compensator ( c ) can cause selective increased attenuation of the mid - wavelength region and provide a more uniform intensity spectrum . note also that at least one system compensator ( sc ) can be incorporated into the system . ( it is noted that where a berek - type control compensator , which has its optical axis perpendicular to a surface thereof which a beam enters is used , the terminology “ rotation ” thereof should be interpreted to mean a tipping thereof to position the optical axis other than parallel to the locus of the beam which passes therethrough , and where the control compensator has its optical axis in the plane of a surface thereof which a beam enters is used , rotation should be interpreted to means an actual rotation about a perpendicular to said surface ). it is disclosed that rotation of the control polarizer or compensator can be automated , optionally via a signal in a feedback circuit ( fb ). it is noted that the direction of tilt - rotation shown in fig5 d can be considered to be positive or negative , and the 898 application invention is sufficiently broad to include a corresponding negative or positive , respectively , tilt - rotation . it is also noted that any type of ellipsometer or the like can be applied in practicing the methodology of the 898 application invention , such as rotating polarizer , rotating analyzer , rotating compensator , or even phase modulation ellipsometers . some exemplary experimentally acquired data is included , in fig6 a - 6 d , to provide insight to results that were obtained by application of the 898 application invention methodology . fig6 a demonstrates the effect of tilting a textured sample ( sm ) with respect to the stage frame ( sf ) plane , ( as demonstrated by fig5 c and 5 d ), on intensity as a function of angle - of - incidence ( aoi ). note that the intensity a fig5 a detector ( det ) receives is significantly decreased by tilting a sample ( sm ) by 45 degrees , with respect to the stage frame ( sf ) plane . this alone would not be beneficial , but fig6 b demonstrates that even though intensity is reduced by said sample ( sm ) tilt , the shown psi ( ψ ) signal to noise ratio , ( as a function of wavelength ), is greatly improved . this is because the diverted intensity reducing electromagnetic radiation is that which scatters from variously oriented facets as opposed to electromagnetic radiation which reflects from a multiplicity of facets which are parallel to one another . that is , even though less signal intensity arrives at the detector ( det ), the signal which is received by the detector ( det ) is of a higher quality , and when analyzed provides superior results . fig6 c further shows that rotating a titled sample ( sm ), ( with a textured surface ), in the plane of the sample ( sm ) surface , ( see fig5 c ), can also improve signal to noise ratio , ( as a function of wavelength ). fig6 d demonstrates that angle - of - incidence ( aoi ) can also have an affect on the signal to noise ratio in psi ( ψ ) data , ( as a function of wavelength ). note that at 65 degrees ( aoi ), as indicated by features of the plot , the data is noisy compared to the better defined psi ( ψ ) data achieved at 75 and 85 degrees ( aoi ). ( note , data quality is indicated by enhanced data plot magnitude change vs . wavelength ). finally , fig7 a - 7 h provide sample data and fitting psi and delta plots which demonstrate the important aspects of the present invention . fig7 a - 7 b are presented to demonstrate the need for a correction factor in the mathematical model of a sample . said plots show data for an uncoated silicon substrate with pyramidal texturing measured at 65 degree angle of incidence . for a polished substrate , the experimental data would easily be described using a model with silicon substrate optical constants and a thin native oxide ( 1 - 3 nm ). as can be seen in the two graphs 7 a and 7 b , this native silicon model does not match actual psi and delta measurements . if the oxide thickness is presumed to vary , the best mode to match the psi data occurs with 24 nm of sio2 . however , this can not be correct as the same model moves delta further away from the experiment . thus , this shows a correction is necessary to compensate the effect of the pyramidal texturing when applying the standard modeling approach for ideal samples . fig7 c and 7 d are presented to show the effect of including a scatter matrix correction in the mathematical model of a sample . data for uncoated , textured silicon can be described by adding a “ correction matrix ” that is multiplied by the ideal sample matrix for native - oxide coated silicon wafer . the match to the experimental data , both with ( solid lines ), and without ( dashed lines ), this correction matrix , is shown . this correction could then be used for additional samples to nominally extract results without the strong effects caused by the textured surface , provided the texturing is repeatable from sample - to - sample . fig7 e - 7 h show the effect of including a correction factor in mathematical models of two samples having different thicknesses of a thin film thereupon . for some samples it may not be possible to obtain an uncoated textured surface . in this case , the correction factor can be determined by using a multi - sample analysis where more than one sample with nominally the same coating , but different thickness thereof , are modeled using the same correction factor . two data sets , ( ie . for sample 1 and sample 2 ), for nitride - coated textured silicon are shown . the two nitride coatings are nominally the same as regards refractive index , but they have different film thickness on their surfaces . it is noted that data analysis involves use of simultaneous regression onto the two data sets corresponding to the two samples , which process breaks correlation between thin film thickness and refractive index for both . fig7 e - 7 h data were first modeled without a correction factor , ( see dashed lines ). next , both data sets for samples 1 and 2 were fit simultaneously ( multi - sample analysis ) with a single correction factor to fit the underlying texture effects , ( see solid lines ). this provides consistent “ correction ” for similar samples of this coating on different substrates . having hereby disclosed the subject matter of the present invention , it should be obvious that many modifications , substitutions , and variations of the present invention are possible in view of the teachings . it is therefore to be understood that the invention may be practiced other than as specifically described , and should be limited in its breadth and scope only by the claims .	6
hereafter , a wireless transmit / receive unit ( wtru ) includes but is not limited to a user equipment , mobile station , fixed or mobile subscriber unit , pager , or any other type of device capable of operating in a wireless environment . when referred to hereafter , a base station ( bs ) includes but is not limited to a node - b , site controller , access point or any other type of interfacing device in a wireless environment . further , it is noted that , the notion of common physical channel ( cpch ) relates to transmission and / or reception of any type of control information and encompasses all common physical channels including primary common control physical channel ( pccpch ) on which the broadcast channel ( bch ) is transmitted and the secondary common control physical channel ( sccpch ) on which the forward access channel ( fach ) is transmitted . when reference is made to cpch timeslots , it is noted that the cpch timeslots are the timeslots in which a cpch is being transmitted . further , when a cell is said to be handling user traffic , the cell may be transmitting , receiving , or transmitting and receiving user traffic . in order to ensure adequate cpch reception , wireless communication systems may have to dedicate a plurality of timeslots for the cpch throughout the system . allocating a plurality of timeslots as cpch timeslots allows one cell , say cell a , to transmit its cpch in a different timeslot than a neighboring cell , say cell b in order to reduce the amount of intercell interference perceived by the wtru trying to detect the cpch of one of the two cells . however , the cpch timeslot used by cell a to transmit its cpch is not used by cell b where cell b uses another cpch timeslot to transmit its cpch . as explained further in connection with method 200 , however , the present invention enables cell b to handle user traffic in the cpch timeslot used by cell a , and vice versa . that is , cell a may handle user traffic in the cpch timeslot used by cell b . referring initially to fig1 , there is shown three cells 102 , 104 , 106 . assume , the wireless communication system to which cells 102 , 104 , 106 belong has allocated timeslots 1 , 2 , and 3 for transmission of the cpch . that is , timeslots 1 , 2 , and 3 are cpch timeslots . further assume that cell 102 is transmitting its cpch in timeslot 1 , cell 104 is transmitting its cpch in timeslot 2 , and cell 106 is transmitting its cpch in timeslot 3 . according to the present invention , a particular cell may reuse cpch timeslots used by other cells to transmit their cpch , for purposes of handling user traffic in the particular cell , assuming the cpch timeslots being used by the other cells to transmit cpch are different from the cpch timeslot being used by the particular cell to transmit its own cpch . that is , taking cell 102 as an example , cell 102 is able to handle user traffic ( i . e . dch traffic ) in timeslots 2 and 3 at a particular power level that will not result in unacceptable cpch performance degradation in cells 104 and 106 . cells 104 and 106 will permit cell 102 to reuse their cpch timeslots for user traffic so long as such reuse does not result in degradation of cpch performance for their own users . the power level at which one cell may handle user traffic in a cpch timeslot being used by another cell to transmit its cpch is denoted p max _ dch _ cpch . to further explain , assume cell 102 is reusing the cpch timeslot used by cell 104 for cpch , which as explained above is timeslot 2 , for user traffic . cell 104 will allow cell 102 to use timeslot 2 for user traffic so long as cell 102 ′ s use of timeslot 2 does not result in degradation of cpch performance in cell 104 . this requires the system to perform the following actions : monitor cpch performance in each cell , identify any cpch performance degradation in a cell due to reuse of the cpch timeslot by other cells to transmit user traffic , and finally identify the cell ( s ) responsible for potential cpch performance degradation and ensure that the adequate cpch performance level is restored . there are many ways in which a cell may monitor cpch performance . for example , the system may collect , in each cell , cpch quality metrics reported by each mobile . the metrics are preferably collected by base stations ( bss ) operating within the system . examples of cpch quality metrics specific to the primary common control physical channel ( pccpch ), for example , include but are not limited to bch reading time and signal - to - interference ratios ( sir ) perceived by a wtru on the pccpch . similarly , examples of cpch quality metrics specific to the sccpch include but are not limited fach block error rate ( bler ), fach bit error rate ( ber ), and signal - to - interference ratios ( sir ) perceived by a wtru for the sccpch . each cpch quality metric collected by a cell is preferably associated with a specific area of the cell . an area of a cell can be represented as an angular section of the cell or any arbitrary division of the overall geographical area of the cell . in order for the bs of a cell to associate each cpch quality metric it collects to a specific area of a cell , it has to be able to locate the position of the wtru which reported the cpch quality metric . possible ways in which the system can identify the location of the wtru include but are not limited to the use of global positioning systems ( gps ) in the wtru and triangulation techniques based on delay of arrivals , or measured power from neighboring bs . as each cell in the system is able to collect cpch quality metrics from a large number of wtrus and associate them to specific areas of the cell , the system is able to obtain , for each area of each cell , a distribution of the cpch quality metric . an example of the form that could take this distribution is a histogram in which each bin would correspond to a small interval of the quality metric . prior to the system trying to reuse the cpch timeslots for user traffic , the system collects enough statistics from the wtrus to obtain statistically stable distributions for each area of each cell . these distributions are referred to as baseline cpch quality distributions and will be used by the system as a comparison benchmark in order to identify any degradation in cpch quality in any area of any cell . if the system identifies an area of a cell where cpch performance is degraded , the system identifies the cell responsible for the interference and reduces this interference to a level which would restore the previous state where cpch quality was deemed acceptable . to achieve this , the system preferably uses a database containing a pre - determined mapping which associates each area of each cell with its strongest interfering cell ( s ). therefore , where cell 104 identifies area 108 , for example , as being the area of unacceptable cpch performance , it is evident that the cause of the degradation is cell 102 ′ s reuse of timeslot 2 for user traffic . in this case , in cell 102 , timeslot 2 is identified as aggressive , meaning reuse of timeslot 2 by cell 102 has resulted in degradation of cpch performance in the cell 104 which is using timeslot 2 to transmit its cpch . therefore , cell 102 has to decrement the power it is using for user traffic in timeslot 2 and is no longer able to try to increase the power at which it reuses timeslot 2 for user traffic . it is noted that cell 102 may have timeslot 2 tagged as aggressive while other cells such as , for example 106 , may have timeslot 2 tagged as non - aggressive . that is , timeslot 2 may be considered aggressive with respect to cell 102 , but not cell 106 meaning cell 106 can still reuse timeslot 2 for user traffic . referring now to fig2 , there is shown a method 200 wherein timeslots used in a wireless communication system for transmitting the cpch ( i . e . cpch timeslots ) may be reused for user traffic . it is noted that method 200 may be implemented in any number of cells as desired . method 200 begins with step 202 where , for each cell a tag is placed on the cpch timeslots that the cell is not using to transmit its own cpch . the tag identifies cpch timeslots as being non - aggressive , meaning they are not causing degradation of another cell &# 39 ; s cpch performance . also , in step 202 , for each cell , the power at which the cell is permitted to transmit user traffic in a cpch timeslot ( i . e . p max _ dch _ cpch ) is set to zero for all cpch timeslots . that is , for each cell , the p max _ dch _ cpch of each cpch timeslot is set to zero . further , in step 202 , the system collects cpch quality metrics for each area of each cell , thus obtaining statistically stable baseline distributions that will be used as benchmarks in step 214 . from step 202 , the method 200 proceeds to step 204 where , for each cell , a tag is placed on the cpch timeslot that the cell is using to transmit its own cpch as aggressive . this will prevent a cell from handling user traffic in a cpch timeslot that the cell is using itself for transmission of the cpch . in step 206 , it is determined whether all cells have all their cpch timeslots either set as aggressive or have their p max _ dch _ cpch set to p max where p max corresponds to the maximum power a bs is allowed or able to transmit in a timeslot . for example , p max for a bs allowed or able to transmit up to 43 dbm is 43 dbm . if the result of step 206 is yes , the method 200 ends in step 208 . by way of explanation , when a cell has a cpch timeslot tagged as aggressive , it indicates that the cell is already transmitting at a power beyond which it would degrade the cpch reception of at least one of its neighboring cells . when a cell has a cpch timeslot for p max _ dch _ cpch is set to p max , it indicates that the cell is already fully reusing this cpch timeslot for user traffic . therefore , if either of the above - mentioned conditions are fulfilled for all cpch timeslots of all cells , the system is in a state where cells are not able to further increase the reuse of cpch for user traffic . in other words , the system is in a state where cells are not able to further increase p max _ dch _ cpch of any of their cpch timeslots and the method 200 ends . if the result in step 206 is no , the method 200 proceeds to step 210 . in step 210 , for each cell , the p max _ dch _ cpch of each cpch timeslot that is not tagged as aggressive and has its p max _ dch _ cpch set lower than p max , is incremented by a predetermined amount , say p_increment . then , in step 212 , the system collects measurements on cpch performance and obtains , for each area of each cell , distributions of cpch quality metrics . in step 214 , it is determined whether the cpch performance is unacceptable in any area of any cell . this is accomplished by comparing the distribution of cpch quality measurement collected for every area of every cell with the baseline distributions collected in step 202 and identifying any area having unacceptable quality measurements . if no , the method 200 returns to step 206 . if yes , the method 200 proceeds to step 218 . then , the cell ( s ) that are causing the cpch performance degradation is identified ( step 218 ). this is accomplished by looking up a database containing a predetermined mapping which associates each area within each cell to their strongest interfering cell ( s ) so that where degradation is identified in a particular area , the system knows who the offending cell ( s ) is ( are ). for example , referring back to fig1 , area 108 is mapped to cell 102 . in step 220 , p max _ dch _ cpch of the offending cell ( s ) is decremented by p_increment for the cpch timeslot where cpch performance degradation was measured and that cpch timeslot is tagged as aggressive with respect to the offending cell ( s ) identified in step 218 . once step 220 is complete , the method 200 returns to step 206 . referring now to fig3 , there is shown a wireless communication system 300 wherein timeslots used in a wireless communication system for transmitting the cpch ( i . e . cpch timeslots ) may be reused for user traffic . the system includes at least one radio network controller ( rnc ) 302 and a plurality of cells 304 , 306 , 308 . in this embodiment , the system 300 is shown as being deployed with an omnidirectional deployment wherein there is a bs 305 , 307 , 309 for each cell 304 , 306 , 308 . the system 300 could of course be deployed with a sectored deployment , wherein a single bs is provided for cells 304 , 306 , 308 . as explained above , a plurality of timeslots are typically designated as cpch timeslots and are used by the cells for transmitting the cpch . assume , in this embodiment that three timeslots 1 , 2 , 3 , have again been designated as cpch timeslots for system 300 . therefore , all of the cells making up system 300 will transmit their cpch in one of the three cpch timeslots . for simplicity , only three cells 304 , 306 , 308 of system 300 are shown , but of course system 300 may have any number of cells as desired . because there are only three cells , each cell may use a different cpch timeslot for transmitting its cpch . where there are more cells , they will share the allocated cpch timeslots in the same manner . that is , where there are ninety cells and three cpch timeslots , for example , each of the ninety cells will use one of the three cpch timeslots for transmitting its cpch . in system 300 , assume cell 306 is transmitting its cpch in cpch timeslot 1 , cell 304 is transmitting its cpch in cpch timeslot 2 , and cell 308 is transmitting its cpch in timeslot 3 . for each area of each cell , cpch performance is monitored and if it becomes unacceptable , the area within the cell where the unacceptable cpch is concentrated is identified . therefore , the bs 305 , 307 , 309 of cells 304 , 306 , 308 each include a processor 310 , 312 , 314 for collecting cpch readings or any other metric of cpch performance from wtrus operating within their cell . where cpch is identified as being unacceptable in any of the cells , the locations of the wtrus that are reporting the poor cpch measurements is identified . the bs 305 , 307 , 309 of cells 304 , 306 , 308 may each include a separate processor 316 , 318 , 320 for locating wtrus , or that functionality may be performed in processors 310 , 312 , 314 . the rnc 302 to which data collected in each cell is reported also includes at least one processor 322 for determining when cpch has degraded to an unacceptable level and coordinating each cell &# 39 ; s reuse of cpch timeslots for user traffic . in coordinating each cell &# 39 ; s reuse of cpch timeslots for user traffic , the rnc 302 will inform each cell at p max _ dch _ cpch they may transmit user traffic , if at all , in the cpch timeslots being used by their neighboring cells to transmit cpch . where cpch performance has degraded to an unacceptable level in a particular area of any particular cell , say cell 306 , as a result of another cell &# 39 ; s , say cell 308 , reuse of the cpch timeslot cell 306 is using to transmit its cpch ( i . e . cpch timeslot 1 ), the rnc 302 will ensure the bs 309 of cell 308 decreases the power at which it is reusing timeslot 1 for user traffic back to a level which does not impair cpch performance in cell 306 . the rnc 302 will preferably prevent cell 308 from further increasing the power ( i . e . p max _ dch _ cpch ) that is used for user traffic in cpch timeslot 1 . it is important to note that the present invention may be implemented in any type of wireless communication system employing any type of time division duplex ( tdd ) technology , as desired . by way of example , the present invention may be implemented in umts - tdd , tdscdma , or any other type of wireless communication system . further , while the present invention has been described in terms of various embodiments , other variations , which are within the scope of the invention as outlined in the claim below will be apparent to those skilled in the art .	7
at the outset , it should be appreciated that like drawing numbers on different drawing views identify identical , or functionally similar , structural elements of the invention . while the present invention is described with respect to what is presently considered to be the preferred aspects , it is to be understood that the invention as claimed is not limited to the disclosed aspects . furthermore , it is understood that this invention is not limited to the particular methodology , materials and modifications described and as such may , of course , vary . it is also understood that the terminology used herein is for the purpose of describing particular aspects only , and is not intended to limit the scope of the present invention , which is limited only by the appended claims . unless defined otherwise , all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs . although any methods , devices or materials similar or equivalent to those described herein can be used in the practice or testing of the invention , the preferred methods , devices , and materials are now described . for purposes of the invention , the following financial terms or financial parameters are defined by their translations from internet performance parameters as follows . these terms are well - defined for credit risk , yet have not previously been defined for operational risk . once the invention produces values for these terms , they may be manipulated by banks or other parties in the same manner as the equivalent terms for credit risk , for example in computing capital withholding for basel ii . the invention also includes steps of summarization and reporting that manipulate some of these terms . probability of default ( pd ): calculation of pd involves determining which customers of a bank will be affected by a given type of anomaly , and then calculating how many of them will be affected , how frequently , how severely , and how long . loss given default ( lgd ): calculation of lgd involves combining estimates of each customer &# 39 ; s use of the internet to reach the bank and the value of that use to the customer . such value is then used to estimate how likely the customer is not to perform transactions that are delayed or interrupted by anomalies . exposure at default ( ead ). the invention combines the value of each customer &# 39 ; s transactions to the bank with lgd to estimate exposure at default , which is the amount the bank stands to lose because of anomalies . the value of a customer &# 39 ; s transaction to the bank can be twofold : the direct income to the bank in fees for the transaction or the value of customer &# 39 ; s account to the bank ( see m , below ). maturity ( m ). the invention calculates maturity ( m ), which is the remaining proportion of a contract or account that each banking customer has with the bank for some time into the future . fig1 illustrates the steps or aspects of the present invention for determining internet financial risk . fig2 depicts an example of an internet financial risk , a nonredundant route . fig3 provides further detail regarding fig1 . fig3 further shows how the invention works , in particular , how the financial terms or parameters are related . the following should be viewed in light of fig1 through 3 . in fig2 , router 1 , router 2 , and router 3 are nonredundant routers on a nonredundant route to server 1 and server 2 . if any of router 1 , router 2 , or router 3 fail , server 1 and server 2 will be cut off from the internet . if router 4 or router 5 fails , there is less likelihood that server 1 or server 2 will be cut off , because if router 4 fails traffic could be routed through the router 5 , and the reverse . such topological analysis of networks is well known in the computer science discipline of graph theory , including the recent literature about scale - free networks ; yet its ongoing application to frequent and regular measurements of actual internet topology is novel . even if a link or path does not completely fail , its performance may be degraded . problems with performance of a server may produce contributory disruption to third parties with which that server shares network pathways . in fig2 , if server 1 is being attacked by a distributed denial of service ( ddos ) or being affected by a worm that is not specifically targeted at that server , the resulting excess traffic may slow down router 1 , which in turn can affect the perceived performance of server 2 as seen by its users . such combination of topological analysis with performance measurements and analysis is novel , and the application of such performance and topological analysis to quantification of business risk is especially novel . the invention uses information collected directly from the internet , also referred to as input information or primary input information that is collected and processed by any means known in the art to detect and categorize certain features . it should be understood that the invention is not limited to any particular means for producing such information the internet . however , the invention expects the input information to have characteristics as follows ; see fig1 . data collection : appropriate data collection gathers internet performance data using techniques that simultaneously record topology ( including routes , paths , and changes over time ) and performance ( including loss and latency ). the techniques used are able to measure a significant proportion of the critical infrastructure of the entire internet . anomaly detection : appropriate anomaly detection detects anomalies that are significant both across large parts of the internet and in smaller parts , whether geographical , topological , or by industry . anomaly characterization : appropriate anomaly characterization assigns characteristics such as type , severity , duration , and effects to each detected anomaly . types of anomaly may include denial of service ( dos ) attacks , worms , congestion , routing flaps , and other degradation , denial , or disconnection of internet connectivity . the invention also uses secondary external information , that is , information external to the internet in the sense of not being collected directly from the internet by probes or passive monitoring . fig1 illustrates how the invention combines such external information with the input information in data fusion . fig3 provides further detail about which external information is used at which steps of the invention . successive financial terms may require increasing amounts of external information compared to primary information to compute , for example lgd usually requires more external information than pd , and m more than lgd . for that matter , m could be determined entirely in terms of external information , yet m is of no use for calculating internet operational risk without the primary input information , and of little use without pd , lgd , and ead . 1 . translation into financial terms : translation of internet anomalies into financial performance parameters such as probability of default ( pd ), loss given default ( lgd ), exposure at default ( ead ), and remaining economic maturity ( m ) of the exposure . see fig3 for illustration of further detail about these translation steps . 2 . summarization for banking customers : aggregation of anomalies over time for historical performance and predictions and detailed examination of specific anomalies . 3 . reporting for banking customers : reporting details of specific anomalies as they occur . 4 . data fusion : fusion of historical and current data from carriers , enterprises , news media , and others for calibration of accuracy and reliability . in comparison to known prior art , the invention combines elements of network performance and of financial quantification in application to financial risk management of internet operations . the invention involves several steps or aspects that are continually repeated with feedback loops . the invention uses primary input information from ongoing comprehensive measurement of internet topology for nonredundancy or overload ( perils ), as well as of actual variations in accessibility or performance ( anomalies ). the invention itself analyses , aggregates , and synthesizes such data along with external information from other sources in order to translate it into relevant financial terms . the invention then summarizes those results over time , and also reports them as they occur . see fig3 . probability of default ( pd ): an example peril is a nonredundant route . as noted above , a nonredundant route is one example of an internet financial risk . a given part of the internet may be reachable only through one path . if a router or link along that path fails , that part of the internet will be cut off . if that route fails , that will be an anomaly in which customers reached through that route will be cut off . topological examination such as is described for fig2 can show such routes and which customers are reachable through them . the invention determines the probability of failure of such a peril by calculating the frequency of similar failures over time . for each type of peril that the invention has determined to affect banking customers , the invention then multiplies the frequency of that peril by the number of customers affected by that peril , yielding the probability of default ( pd ). most of the calculation of pd can be done using the primary input information from the internet itself . however , it is also useful to know which enterprises are customers of which banks , and that usually requires external information from the banks themselves , or from insurers , industry analysts , or other third parties ; see fig3 . loss given default ( lgd ): calculation of lgd involves combining estimates of each customer &# 39 ; s use of the internet to reach the bank and the value of that use to the customer . some information about the customer &# 39 ; s use of the internet may be derivable from the primary input information from the internet itself , but information about the value the customer places on such uses will normally come from external information from the bank itself , or from insurers or from other third parties ; see fig3 . such value is then used to estimate how likely the customer is not to perform transactions that are delayed or interrupted by anomalies . the invention then calculates the likely proportion of loss . for example , a funds transfer can be estimated to be at least as valuable to the customer as the amount of funds transferred . a sale of some stock may be estimated to be worth to the customer the dollar amount of the transaction minus any fees . if a customer cannot perform a transaction at a given time , the customer may simply perform the same transaction at a later time , in which case there is no loss given that particular default . for example , a customer trying to review a bank statement will probably simply review it on a different day . or in some cases a customer may simply not perform that particular transaction at all . for example , a customer trying unsuccessfully to sell a stock on one day may decide not to sell it the next day , in which case the loss to the bank is whatever fees the bank would have received . however , a customer trying to sell a stock the day before a quarterly earnings announcement may not be able to obtain the same results on a different day . if earnings are down and the price of the stock goes down , the customer may lose the difference in the price of the stock . and the bank may lose the customer . so lgd for the customer is the stock price difference , while lgd for the bank may be the customer &# 39 ; s account . lgd is calculated as a proportion , so in the bank statement example lgd for the bank is close to 0 , while for the example of stock sale before earnings call the lgd for the bank is closer to 1 . exposure at default ( ead ): the invention combines the value of each customer &# 39 ; s transactions to the bank with lgd to estimate exposure at default , which is the amount the bank stands to lose because of anomalies . the value of the customer &# 39 ; s transactions to the bank may be different from the value of those transactions to the customer ; for example , the customer may already have other sources of the same transactions . the value of the customer to the bank may be different from the sum of the value of the customer &# 39 ; s transactions to the bank ; for example , the customer may have prestige value to the bank , or the customer may be using other resources of the bank such as customer service that are not directly compensated . such weights to the values to the bank of transactions or customers require additional external information to compute . setting aside such considerations , the value of a customer &# 39 ; s transaction to the bank can be twofold : the direct dollar income to the bank in fees for the transaction or the dollar value of customer &# 39 ; s account to the bank ( see m , below ). either of these are best found using external information from the bank itself , or estimates from third parties such as insurers or industry analysts ; see fig3 . maturity ( m ). the invention calculates maturity ( m ), which is the remaining proportion of a contract or account that each banking customer has with the bank for some time into the future . internet performance anomalies could cause a customer to cease being a customer , so the entire remaining expected income from a customer &# 39 ; s open accounts or contracts may be at risk . information on maturity of each customer &# 39 ; s accounts is supplied by the bank , and is then combined with pd and lgd to produce a long - term component of ead . in the interests of privacy , the bank can take pd and lgd for each customer and combine it with m per customer internally . alternatively , the invention may use estimates of m from third parties , but it is likely that information about m directly from the bank holding the contract will be more precise ; in either case , some external information is usually necessary to calculate m . the invention summarizes results by aggregating estimates of probable effects over time ; see fig3 . such historical aggregation of internet and financial performance over time can be useful to banks in documenting their actual performance for use in calculating financial reserves required by basel ii . the invention reports details of specific anomalies as they occur . such reports can be tailored for use by technical operations , by customer support , or by management for planning purposes . the invention uses data fusion to incorporate relevant secondary external information that was not collected directly from the internet by means of active or passive monitoring . such external information may include historical and current data from carriers , enterprises , news media , and others for calibration of accuracy and reliability . the invention uses further external information in various steps of the invention , as illustrated in fig1 and 3 . computer system . the invention can be implemented “ by hand ,” that is , through the use of manual calculations . however , in some aspects , a general purpose computer is programmed to perform the steps described above .	6
at the outset , it is to be understood that like reference numerals are intended to identify the same structural elements , portions or surfaces consistently throughout the several drawing figures , such at elements , portions or surfaces that may be further described or explained by the entire written specification , of which this detailed description is a part . unless otherwise indicated , the drawings are intended to read ( that is , cross - hatching , arrangement of parts , proportion , degree , et cetera ) together with the specification , and are considered to be a portion of the entire written description . as used in the description , the terms “ horizontal ,” “ vertical ,” “ left , right ,” “ up ,” “ down ,” as well as adjectival and adverbial derivatives thereof ( for example , “ horizontally ”, “ rightwardly ”, “ upwardly ,” et cetera ) refer to the orientation of the illustrated structure as the particular drawing figure faces the reader . similarly , the terms “ inwardly ” and “ outwardly ” generally refer the orientation of a surface relative to its axis of elongation , or axis of protestation , as appropriate . turning now to fig1 , shown therein is a system block diagram of a rechargeable battery power system 10 having a battery assembly 48 . the battery assembly 48 includes a battery 50 having multiple uses and includes a battery housing 54 that houses the battery 50 . the rechargeable battery power system 10 has an alternating current ( hereinafter referred to as ac ) electric motor 12 and may be embodied as other types of motors in other preferred embodiments , a variable frequency motor driver 14 , a battery management system 16 , and the battery 50 . the battery 50 is a lithium - ion battery in one of the preferred embodiments , and in other preferred embodiments may be a lithium nickel manganese cobalt oxide ( nmc ) battery , a lithium cobalt battery ( lco ), a lithium iron phosphate battery ( lfp ); a lithium manganese oxide battery ( lmo ); and , a lithium nickel cobalt aluminum battery ( nca ). the rechargeable battery power system 10 also includes a visual display 22 . fig2 is a perspective view of the battery assembly 48 , and fig3 shows an exploded view of the battery assembly 48 . as shown in fig3 the battery 50 has first and second module banks 61 , 63 that are substantially identical . the first module bank 61 is made from a first group of modules 55 , and the second module bank 63 is made from a second group of modules 57 . in turn , the first and second groups of modules 55 , 57 are each made from individual modules commonly designated 53 , and each module 53 has individual cells commonly designated 51 . the cells 51 are embodied as rechargeable electrochemical cells in one of the preferred embodiments and are for storing electrical energy . in one preferred embodiment each module 53 has eight ( 8 ) cells 51 that are electrically connected to one another , and the modules 53 are electrically connected to one another to form the groups of modules 55 . in other preferred embodiments each module 53 may have more or less than eight cells 51 . the first module bank 61 is electrically connected to a bus bar 136 for allowing current to flow to the terminal boxes 96 . and , there are connector bus bars 138 that connect the first and second module banks 61 , 63 as shown in fig4 , the there is a module 53 that has a module case 67 and the cells 51 are stacked together and supported in the module case 67 . module terminals 69 extend from the module case 67 and the module terminals 69 may be electrically connected to other modules 53 . the electric motor 12 shown in fig1 is embodied as a three phase ac induction motor , but in other preferred embodiments other electric motor types may be used . the ac motor has a rotor 30 , a stator 32 , and an output shaft 34 that delivers output rotary power to a driven object , for example a hydraulic pump . as shown in fig1 , the ac induction motor 12 receives first , second and third drive lines 36 , 38 , 40 , one for each phase , and the first , second and third drive lines 36 , 38 , 40 are driven by the variable frequency motor driver 14 . it is pointed out that in other preferred embodiments other electric motors may be used , for example a permanent magnet ac ( pmac ) motor may be used . the rotation speed of the ac induction motor 12 ranges from zero to 8 , 000 ( or more ) revolutions per minute . in one of the preferred embodiments the ac induction motor 12 is air cooled . the variable frequency motor driver 14 receives power from first and second direct current ( dc ) voltage lines 44 , 46 from a battery 50 , and then it converts electrical power into three phase ac voltage provided on the first , second and third drive lines 36 , 38 , 40 . in addition , the variable frequency driver motor 42 is able to change the frequency and amplitude characteristics of the voltage on each of the first , second and third drive lines 36 , 38 , 40 so as to be able to control rate of rotation and / or output torque of the ac induction motor 12 . the battery 50 is a lithium - ion type battery . the battery 50 is connected to the battery management system 16 on battery lines 52 . the battery 50 stores electrical energy provided by the battery management system 16 and provides electrical energy to the variable frequency motor driver 14 . the battery management system 16 has a battery management interface 17 for connection to an external power source , such that when the battery management system 16 is connected to an external power source through the battery management interface 17 , power is delivered over the battery lines 52 to charge the battery 50 . as shown in fig2 and 3 and as previously mentioned , the battery housing 54 of the battery assembly 48 includes opposed first and second side walls 56 , 58 and opposed first and second end walls 60 , 62 and a base wall 64 . the first and second opposed side walls 56 , 58 and the opposed first and second end walls 60 , 62 extend from and are joined to the base wall 64 . the battery housing 54 also has a housing cover 66 that is joined to the first and second opposed side walls 56 , 58 and the opposed first and second end walls 60 , 62 such that it is opposite the base wall 64 . the cover 66 , the first and second opposed side walls 56 , 58 , the opposed first and second end walls 60 , 62 and base wall 64 may be connected by any suitable method , for example with nuts and bolts , screws , welds , and the like . as shown in fig3 , the first sidewall 56 is layered and includes a metal layer 68 and first and second foam layers 70 , 72 , and a plastic sheet 74 . the plastic sheet 74 in other preferred embodiments is a polycarbonate resin sheet , or a thermoplastic sheet . polycarbonate resin sheets can be made of lexan . lexan is a registered trademark of sabic innovative plastics ip b . v . having a business address of plasticslaan 1 , 4612 px , bergen op zoom , netherlands and is commercially available the first foam layer 70 abuts against and is joined with the metal layer 68 , and the first foam layer 70 abuts against and is joined with the second foam layer 72 . the second foam layer 72 also abuts against and is joined with the plastic sheet 74 . the second side wall 58 is structurally identical to the first side wall 56 and includes a metal layer 68 a , first and second foam layers 70 a , 72 a , and a plastic sheet 74 a . the first foam layer 70 a abuts against and is joined with the metal layer 68 a , and the first foam layer 70 a abuts against and is joined with the second foam layer 72 a , and the second foam layer 72 a abuts against and is joined with the plastic sheet 74 a . the metal layer 68 , the first foam layer 68 , the second foam layer 72 and the plastic sheet 74 are joined with an adhesive . the cover 66 of the battery housing 54 has opposed exterior and interior sides 78 , 80 and a service disconnect 82 is joined to and extends from the exterior side 78 . the service disconnect incapacitates the battery 50 , preventing the possibility of electric shock to a service technician , or damage to the battery during service or repair . joined to the interior side 80 is a rubber sheet 84 a foam cover sheet 86 is joined to the rubber sheet 84 , such that the rubber sheet 84 is disposed between the interior side 80 and the foam cover sheet 86 . the first end wall 60 is joined to a first end wall foam sheet 88 , and the second end wall 62 is joined to a second end wall foam sheet 90 . the second end wall 62 has an exterior end wall surface 92 and a current sensor 94 is mounted to the second end wall 62 and abuts the exterior end wall surface 92 . in addition , terminal boxes 96 are mounted to the second end wall 62 and abut the exterior end wall surface 92 . terminals 98 and a monitor wiring inlet 100 are mounted to the second end wall 62 . the base wall 64 has a metal base wall sheet 102 having opposed interior and exterior metal base wall surfaces 104 , 106 . joined to the interior metal base wall surface 104 is a first base wall rubber sheet 108 that is joined to a second base wall rubber sheet 110 . the battery housing 54 of the battery assembly 48 is mounted on a pair of brace members 112 a , 112 b that have channel - shaped cross sections . in particular , isolation mounts 114 are threaded to the base wall 64 and the brace channel 112 a , 112 b such that they isolate the battery housing 54 from a surface that supports the brace channels 112 a , 112 b . as previously described , the battery 50 has first and second module banks 61 , 63 that are substantially identical and that are disposed internal to the battery housing 54 . as shown in fig3 a gap 128 extends from the first module bank 61 to the second module bank 63 and disposed in the gap 128 are first and second separator foam sheets 130 , 134 . disposed between the first and second separator foam sheets 130 , 134 is a separator support plate 132 . the separator support plate 132 is made of metal in one of the preferred embodiments so that the battery housing 54 is strong and durable and capable of withstanding various external loads imposed thereon , and the separator support plate serves as a thermal barrier between first and second module banks 61 . 63 . it is pointed out that the battery 50 does not need an active cooling system to be cooled because of its configuration and will not overheat when used in connection with the applications and embodiments to be described presently . thus , the battery 50 can be completely sealed from the environment , protecting against intrusion of water or other contaminants common in harsh environments . in addition , the battery 50 has a high energy density and thus can provide a long run time on as single charge and can be used in construction applications . as shown in fig1 , the visual display 22 is connected to the variable frequency motor driver 14 by a first visual display line 140 , and the battery management system 16 is connected to the visual display 22 by a second visual display line 142 . the visual display 22 receives inputs ( battery data 59 and variable frequency motor driver data 14 a ) by way of the first and second visual display lines 140 , 142 , and displays the battery data 51 and variable frequency motor driver data 14 a that pertains to the operation of the variable frequency motor driver 14 and the battery 50 . use of the rechargeable battery power system 10 having a battery 50 with multiple uses begins with connecting the rechargeable battery power system 10 to the battery 50 by way of the interface 17 , the battery management system 16 detects the connection made to the interface 17 and controls the flow of power through the interface 17 to charge the battery 50 . power continues to flow from the external electrical power source through the interface 17 and to the battery 50 until the battery 50 is fully charged . it is pointed out that the interface 17 may be disconnected from the external electrical power source prior completely charging the battery 50 . the external electrical power is most commonly the power grid , but maybe be the source may be a generator , for example a portable diesel powered generator . the ac induction motor 12 is typically mounted on a surface or on a vehicle frame . the output shaft 34 is coupled to a drive object or driven shaft prior to actuating the ac induction motor 12 . when the ac induction motor 12 is actuated the variable frequency motor driver 14 causes electrical power to flow from the battery 50 to the ac induction motor 12 . in particular , the variable frequency motor driver 14 causes a sinusoidal voltage to flow in each of the first , second and third drive lines 36 , 38 , 40 . the variable frequency motor driver 14 controls the frequency and amplitude of the voltage in the first , second and third drive lines 36 , 38 , 40 in order to control the speed and power output of the ac induction motor 12 . the visual display 22 provides an active display of operating information from the variable frequency motor driver 14 . then , when the charge in the battery 50 is depleted , the interface 17 is reconnected to the electrical power source in order to recharge the battery 50 as described . it is pointed out that the battery 50 is adaptable for use in virtually any application requiring electrical power including vehicles , machines , homes , businesses and the like . in other words , the applications wherein the battery 50 may by employed and used is without limit . fig5 - 8 show a second embodiment wherein there is a machine rechargeable battery power system 200 provided for use in a piece of equipment 298 that requires a source of power , for example an excavator 300 . turning now to fig5 , the machine rechargeable battery power system 200 has the main components that include an a variable frequency ac induction motor 210 , a variable frequency motor driver 230 , a battery management system 260 , and a lithium - ion battery 280 all disposed in a motor system housing 205 . in one of the preferred embodiments the battery 280 is structurally identical to the previously described battery assembly 48 having a battery 50 and a battery housing 54 , and in other preferred embodiments the battery 280 can be made more powerful by the addition of identical third and fourth banks of module banks . the machine rechargeable battery power system 200 further includes a visual display 240 , a throttle 270 , and a voltage converter 274 . the variable frequency ac induction motor 210 is a three phase ac induction motor , and in other preferred embodiments an electric motor of other types may be used . the variable frequency ac induction motor 210 has a rotor 211 , a stator 215 , and an output shaft 212 that delivers output rotary power to a driven object . variable frequency induction ac induction motors are commercially available and are well known to those having ordinary skill in the art and are therefore not described herein in greater detail . the variable frequency ac induction motor 210 receives three drivelines 214 a , 214 b and 214 c , one for each phase . the variable frequency motor driver 230 drives the drivelines 214 a , 214 b and 214 c . the variable frequency ac induction motor 210 also contains a temperature sensor 217 that measures the temperature of the variable frequency ac induction motor 210 , and a sensor 218 that measures the speed of the rotor 211 . the variable frequency ac induction motor 210 also includes a cooling system 214 that is an air cooled system in one embodiment and is a fluid cooling system in other preferred embodiments . cooling a motor with air or fluid is well known to those having ordinary skill in the art and is therefore not described in greater detail herein . the variable frequency motor driver 230 received power from the first and second dc voltage lines 250 a , 250 b and converts electrical power into three phase ac voltage provided on the drive lines 214 a , 214 b and 214 c . variable frequency motor drivers are commercially available , and are well known to those having ordinary skill in the art and therefore they are not described in greater detail herein . the variable frequency motor driver 230 is able to change the frequency and amplitude characteristics of the voltage on each of the drive lines 214 a , 214 b and 214 c so as to control rotation rate and / or output torque of the variable frequency ac induction motor 210 . a databus interface 232 is a can bus interface , however , other bus interfaces may be used as well . the databus interface 232 receives and transmits information , commands , status , faults , and other similar information utilized by the machine electric motor system 200 . the variable frequency motor driver 230 also has analog controls from the battery management system 260 . the power received by the variable frequency motor driver 230 from dc voltage bus lines 250 a , 250 b is provided by the battery 280 . the variable frequency motor driver 230 contains the databus interface 232 . the databus interface 232 allows the variable frequency motor driver 230 to transmit and receive operating information , commands , statuses , and faults within and used by the utilized by the machine electric motor system 200 . the variable frequency motor driver 230 also has a driver cooling system 234 that is air cooled in a preferred embodiment , and other preferred embodiments the driver cooling system 234 is a liquid cooling system . the variable frequency motor driver 230 also has a driver temperature sensor 236 for measuring the temperature of the variable frequency motor driver 230 . the variable frequency motor driver 230 also has a driver controller 237 that in one of the preferred embodiments is a logic based controller such as a recontroller / microprocessor / cpu / fpga / cpld , that may be programmed to cause the variable frequency motor driver 230 to properly control the voltage and / or power on the drive lines 214 a , 214 b and 214 c the throttle 270 is connected to the variable frequency motor driver 230 and provides variable frequency motor driver 230 information pertaining to a user &# 39 ; s desired operating parameters . in particular , the throttle may be a variable resistor coupled to a manual controller , providing the variable frequency motor driver 230 with a voltage level that represents the desired speed or torque provided by the electric motor . the throttle may also be a hall effect sensor , or other device capable of controlling a voltage level to the variable frequency motor driver 230 . the variable frequency motor driver 230 is coupled or otherwise joined to both the battery 280 and the battery management system 260 through first and second voltage lines 250 a , 250 b . a switch 284 is located on analog communication lines 285 connected to the variable frequency motor driver 230 , allowing switch 284 to act as an on / off switch or kill switch , capable of cutting off power to the variable frequency motor driver 230 . as shown , the first voltage line 250 a has a current sensor 264 arranged adjacent to the battery pack 280 in order to measure the current flowing in and out of the battery 280 . a fuse 286 is located within the battery 280 and is capable of stopping electric current flow in the event the current flow is too high . as described above , the battery 280 may be embodied to be identical to the previously described battery 50 and comprises cells 51 and modules 53 of lithium - ion batteries . the cells may be arranged in a 28 serial by 13 parallel array in one of the preferred embodiments . other lithium iron type batteries are also suitable for use . the cells 51 in the battery 280 and the battery 50 are commercially available . additionally , lithium - ion batteries are well known to those having ordinary skill in the art and therefore are not described in greater detail herein . it is pointed out that the battery 280 and battery 50 may have cells from a different battery provider and may have a different cell arrangement in order to provide different voltage , capacity , maximum current , or battery housing envelope characteristics . battery 280 is connected to the battery management system 260 via battery lines 271 . the battery 280 stores electrical energy provided by the battery management system 260 and provides electrical energy to the variable frequency motor driver 230 . the battery management system 260 for use in connection with any embodiment mentioned herein . battery management systems are commercially available and are well known to those having ordinary skill in the art and are therefore not described in greater detail herein . the battery management system 260 has a battery management interface 278 for connection to an external electrical power source , for example the power grid or a generator . when the battery management system 260 is connected to the external power source through the battery management interface 278 , power is delivered over battery lines 271 in order to charge the battery 280 . the battery management system 260 also contains management system controller 261 for providing logic control for charging and monitoring the battery 280 and communicating with other system components over a management system data bus interface 262 . the data management system 260 also contains a charger 263 that converts voltages and provides current to the battery 280 while recharging . data management systems are commercially available and are well known to those having ordinary skill in the art and therefore they are not described in greater detail herein . the battery management system 260 controls current provided by the charger 263 and further includes voltage sensors 255 , current sensor 264 and thermistors for controlling the charging process of the battery pack 280 . the voltage converter 274 is coupled to the battery management system 260 through first and second converter lines 276 a , 276 b and is also connected to first and second voltage lines 250 a , 250 b that are dc . the voltage converter 274 provides efficient voltage conversion from one voltage to another . in particular , the voltage converter 274 is capable of stepping down the voltage of the battery pack 280 to twelve volts ( hereinafter referred to as 12v ) that is needed by logic management components in the battery management system 260 and other 12v components of the machine electric motor system 200 . the voltage converter output may range from 12v to about 13 . 5v . fig6 is a block diagram for a battery system , drive system , and instruments and controls for the electric motor system . fig7 shows another preferred embodiment the piece of equipment 298 is embodied as an excavator that has been used and powered by an internal combustion engine 302 , for example a gas or diesel engine , and having an engine cooling system 304 , and a hydraulic pump 301 . there is also a frame 310 that supports the engine 302 on frame support bars 312 that are supported by the frame 310 . mounting engines on frames 310 is well known to those who have ordinary skill in the art and therefore not described in greater detail herein . as shown in fig8 , the excavator 300 is modified . first the internal combustion engine 302 and associated engine cooling system 304 are removed , along with the frame support bars 312 , and this results in a battery recess 309 being formed in the excavator 300 . then , a battery support plate 320 is welded or otherwise joined to the frame 310 . after installation of the battery support plate 320 the previously described battery 50 or battery 280 in is placed on battery support plate 320 . in particular , in the previously described a pair of brace members 112 a , 112 b contact the battery support plate 320 and are secured to the battery support plate 320 with fasteners 326 , for example bolts and nuts . in addition , as shown there is the variable frequency motor driver 230 that controls the variable frequency ac induction motor 210 , that in , turn rotates and spins a hydraulic pump 328 . a pump cooling system 330 cools the hydraulic fluid pumped by the hydraulic pump 328 . the variable frequency motor driver 230 , hydraulic pump 328 and pump cooling system 330 are mounted to and supported on a new support structure 332 mounted to the frame 310 of the excavator 300 and thus have been relocated . the previously described battery management system 260 is also provided and disposed on the excavator 300 . the throttle 270 and visual display 240 are disposed in the cab 334 of the excavator 300 . in another preferred embodiment the excavator 300 is newly manufactured and constructed to have the machine rechargeable battery power system 200 and features described immediately above , in which case there is no need to modify the excavator 300 . thus , the present machine rechargeable battery power system 200 provides for a method of rebuilding excavators 300 comprising the acts of : providing an excavator 300 powered by an internal combustion engine 302 ; modifying the frame 310 of the excavator 300 such that it is capable of supporting a support plate 320 and fitting a support plate 320 on the frame 310 for supporting the battery 280 ; providing a battery 280 and fixedly supporting the battery 280 on the support plate 320 ; installing a variable frequency motor driver 230 and the variable frequency ac induction motor 210 such that they are supported on the support structure 332 affixed on the frame 310 ; providing the hydraulic pump 328 and a pump cooling system 330 for cooling the hydraulic fluid pumped by the hydraulic pump 328 , which are relocated from their placement in the internal combustion engine 302 ; and , providing the battery management system 260 and disposing the battery management system 260 , the throttle 270 and the visual display 240 in the cab 334 of the excavator 300 . the above - described method of rebuilding a piece of used equipment 298 , for example excavators 300 that have been used , provides for a method of generating income . for example and as shown in fig1 , there is a service provider entity 400 such as a service store , rebuild company , or a manufacturer that is capable of replacing internal combustion engines 302 with the battery 50 , 280 and other power system components , comprise the electric motor system 10 . a customer entity or business commonly designated 402 provides a piece of equipment 298 that has been used to the service provider entity 400 , or the service provider entity 400 purchases a piece of equipment 298 that has been used , and the service provider entity 400 replaces the internal combustion engine 302 with a the battery 50 , 280 and other system components as described above . the service provider entity 400 then charges a fee to the customer entity 402 for labor and cost of the battery 50 , 280 and system , or the service provider entity 400 re - sells the piece of equipment 298 to generate income . in other preferred embodiments , the service provider entity 400 makes pieces of equipment 298 that are new with the battery 50 , 280 and system components built into the piece of equipment 298 and sells the piece of equipment 280 and to generate a profit . it is pointed out that the machine rechargeable battery power system 200 and the rechargeable battery power system 10 are not limited to just excavators 300 , but they may be used in virtually all construction equipment 298 , for example , new and used paving machines , rollers , graders , paving machines , loaders , tractors and trucks and other machines that require a power source . thus , virtually any piece of equipment 298 having an internal combustion engine 302 , for example a gas or diesel engine , and having the engine cooling system 304 , and a hydraulic pump 301 may be modified to accept the machine rechargeable battery power system 200 and be equipped with the machine rechargeable battery power system 200 . first , the internal combustion engine 302 and associated engine cooling system 304 are removed , and that results in a battery recess 309 being defined in the piece of equipment 298 . then the support plate 320 is welded or otherwise joined to the frame 310 of the piece of equipment . next , a battery 280 is moved into the battery recess 309 and mounted to the frame 310 of the piece of equipment 298 . after installation of the battery support plate 320 the battery 50 or battery 280 is placed on battery support plate 320 that is supported on the pair of brace members 112 a , 112 b . fig9 shows another preferred embodiment wherein there is a light tower 400 having a light tower housing 401 wherein a light tower housing 401 is shown prior to installation on a tower frame 402 , with arrow z designating the direction the light tower housing 401 is to be moved . the tower frame 402 is mounted on wheels 404 and a tongue 406 extends from the tower frame 402 . a retractable tongue support 408 extends from the tongue 406 and supports the tower frame 402 on the ground 405 when in an extended position as shown . the tongue 406 is for towing the light tower 400 after the retractable tongue support 408 is moved into a retracted position . there is also a light tower 420 that is supported on the frame 402 , and the light tower 420 is telescopic and has a base portion 423 that houses an extendable portion 421 that can be raised and lowed in the directions of arrows x and y , respectively . the extendable portion 421 can be manually raised and lowered with , for example a hand crank 430 . the raising and lowering light towers in well known to those having ordinary skill in the art and therefore is not described in greater detail herein . the extendable portion 421 supports a light array 432 that includes four light fixtures 434 with light bulbs 435 . in one of the preferred embodiments the lights bulbs 435 are embodied as led &# 39 ; s and in other embodiments the may be incandescent light bulbs . supported on and joined to the tower frame 402 is a battery assembly 48 and in particular the battery housing 54 that holds the battery 50 . lead lines extend from the battery 50 to a tower inverter 440 that converts dc power from the battery 50 to ac power . inverter lead lines 442 extend from the tower inverter 440 to the light bulbs 435 . the housing 54 also supports a control panel 446 , and supports a charging port 448 so that the battery 50 may be charged from virtually any power source . as shown in fig9 , the battery 50 for use with the light tower 420 is designed such that it only has a first module bank 61 and the separator support plate 132 is not present . this is due to the fact that the light tower 420 will not have a need for such a large amount of power in some preferred embodiments . it is pointed out that the use of the machine rechargeable battery power system 200 and the rechargeable battery power system 10 are provide for power with no pollution at a work , job or activity site , a minimal amount of noise at such sites , and no fuels need at the sites . in addition , because there is no noise and there is no messy odiferous fuels used at the sites the rechargeable battery power system 10 and rechargeable battery power system 200 can be used day or night . thus , workers can work throughout the night without disturbing the neighborhood or city in which they are working . additionally , the machine rechargeable battery power system 200 and the rechargeable battery power system 10 can be used indoors , whereas toxic emissions from an internal combustion engine 302 would prohibit it from being used indoors . in addition , the above - described battery 50 can be used by itself to supply electric power ( noah - something we should mention , right ?) it will be appreciated by those skilled in the art that while the rechargeable battery power system 10 and the machine rechargeable battery power system 200 and methods for providing rechargeable battery systems have been described in connection with particular embodiments and examples , the rechargeable battery power system 10 and the machine rechargeable battery power system 200 methods associated therewith are not necessarily so limited and that other examples , uses , modifications , and departures from the embodiments , examples , and uses may be made without departing from the rechargeable battery power system 10 and the machine rechargeable battery power system 200 , and all these embodiments are intended to be within the scope and spirit of the appended claims .	7
the device represented in fig1 for implanting endoprosthesis 1 has basically a tubular , flexible outer body 2 and an elongated , flexible core element 3 . tubular outer body 2 is represented in lengthwise section from break line x to its distal end . at its proximal end , tubular body 2 is provided with a handle 5 . elongated core element 3 is placed in tubular body 2 , where core element 3 is designed to be longer than tubular body 2 and also has a handle 6 . toward its distal end , core element 3 exhibits a region b , which serves to receive endoprosthesis 1 . this region b exhibits at its proximal end a shoulder 8 made from x - ray opaque material . distally contiguous to this is a section 9 , the diameter of which is reduced . following section 9 is an area 10 in which a relief in the form of a stamping 11 is impressed and which exhibits a somewhat larger diameter than section 9 preceding it . the form of relief or stamping 11 corresponds to the structure of the inner surface of folded endoprosthesis 1 . contiguous to area 10 lies a section 13 that exhibits approximately the same diameter as section 9 . following this is a ring 14 , which is also made of x - ray opaque material and which is designed to be somewhat larger in diameter than section 13 . finally , at its distal end , core element 3 has a blunt , cone - shaped tip 15 . extending the entire length of core element 3 is a lumen 16 in which a guide wire 17 can be inserted . for the sake of better clarity , endoprosthesis 1 is depicted outside of the device and folded up in this representation . in this way , the correlation between the form of stamping 11 and that of folded endoprosthesis 1 can be seen . it can also be clearly seen from this representation that the length of area 10 , which is provided with stamping 11 , is shorter than the length of the endoprosthesis ; it preferably totals approximately 10 - 50 % of the length of the endoprosthesis . as a result of this length of stamping 11 , the flexibility of the device in region b of endoprosthesis 1 is affected as little as possible by the piled up material and the form locking in the stamping area . on the other hand , however , a reliable form - locking connection between enclosed endoprosthesis 1 and core element 2 is guaranteed . fig2 shows the device in a ready - to - use condition . here endoprosthesis 1 is enclosed folded up between core element 3 and tubular outer body 2 . at the same time , the inner surface of endoprosthesis 1 meshes with core element 3 along stamping 11 impressed in area 10 . stamping 11 corresponds to the structure of the inner surface of endoprosthesis 1 , so that a large number of form - locking meshing sites are formed between area 10 of core element 3 and endoprosthesis 1 . since the individual threads of a layer of endoprosthesis 1 diverge when the latter is folded up , differences in the location of the threads with respect to stamping 11 could result in the region of the proximal and distal ends of endoprosthesis 1 . for this reason , it is advantageous to provide sections 9 and 13 , which have a smaller diameter than area 10 , between the latter , which is provided with stamping 11 , and the ends of endoprosthesis 1 . a first type model of the device can be seen in fig3 in an enlarged cross section along line a -- a of fig2 . endoprosthesis 1 is enclosed between tubular outer body 2 and core element 3 . the distance between the outer diameter of core element 3 and the inner diameter of tubular outer body 2 is chosen in such a way that the inner layer of endoprosthesis 1 is pressed into the recesses resulting from stamping 11 . the depth of stamping 11 corresponds to approximately 50 % of the thickness of the inner layer of the semifinished material used in endoprosthesis 1 . in this case , a thin wire is used as the semifinished material for manufacturing endoprosthesis 1 . however , the same ratio applies if endoprosthesis 1 is punched out , for example , from thin sheet metal or is made of strip metal . the above - mentioned depth of stamping 11 ensures a good form - locking connection between core element 3 and endoprosthesis 1 by means of a large number of form - locking meshing sites 20 and guarantees , in addition , sure radial separation and unfolding of released endoprosthesis 1 , because the form - locking connection does not affect the relative motion of the layers of semifinished material in relation to one another . a second type model of the device is illustrated in fig3 a in an enlarged cross section along line a -- a in fig2 . in this example , core element 3 has a coating or sheath 3a . the advantage of such a coating or sheath 3a is that it can exhibit properties other than those of core element 3 . the change in diameter required in this area can be easily obtained as well by means of this sheath or coating 3a . thus , for example , the thermoplasticity of core element 3 can be lower than that of coating or sheath 3a . consequently , the depth of stamping 11 can be easily influenced by the thickness of coating or sheath 3a . sheath 3a can be manufactured very easily , for example , by shrinking a contracting tube onto core element 3 . the operation of the device is explained by means of fig4 . using the device , endoprosthesis 1 is inserted folded ( fig2 ) in a body canal 22 , which is only indicated schematically , in the known manner and is advanced until the distal end region b of the device is positioned so that enclosed endoprosthesis 1 is at the desired location in body canal 22 . at the same time , the advance of folded endoprosthesis 1 in body canal 22 is monitored by means of known processes such as fluoroscopy . the location of endoprosthesis 1 is readily visible due to x - ray opaque rings 8 and 14 , which are fitted on core element 3 in the area of the two ends of enclosed endoprosthesis 1 . once endoprosthesis 1 is in the intended final position , core element 3 is locked into position and endoprosthesis 1 is slowly released by pulling back tubular outer body 2 . the two handles 5 and 6 are used for this purpose . since endoprosthesis 1 is self - expanding , the released portion begins to unfold and rest against the inner wall of body canal 22 . in unfolding , the length of endoprosthesis 1 is shortened accordingly . since there is a direct connection between the shortening of endoprosthesis 1 and the inner diameter of body canal and the diameter of endoprosthesis 1 in its inserted , unfolded state but the final amount of expansion is not known exactly , the final position of unfolded endoprosthesis 1 cannot be determined with certainty beforehand . thus the position of endoprosthesis 1 must also be monitored during the unfolding . if monitoring shows that it is positioned correctly , endoprosthesis 1 can be completely released by pulling back tubular body 2 to the area of shoulder 8 of core element 3 . if , however , it is discovered during the unfolding that endoprosthesis 1 is not in the correct position , it can be folded back up again in tubular body 2 by moving tubular body 2 forward . this makes it possible for endoprosthesis 1 to then be repositioned accordingly and released again in the new position in the manner described above . by means of a form - locking connection between endoprosthesis 1 and core element 3 , which is achieved via stamping 11 , which corresponds to the structure of the inner surface of endoprosthesis 1 , and via endoprosthesis 1 , which meshes with stamping 11 , it can be ensured , on the one hand , that the forces exerted to move core element 3 with respect to outer body 2 can be kept to a minimum and , on the other hand , that sure radial separation of self - expanding endoprosthesis 1 from core element 3 is still guaranteed even after a long period of storage . in short , sure and reliable operation is achieved by way of a device with this design . it can also be manufactured easily and inexpensively . the process for producing a stamping for this type of device can go as follows : an endoprosthesis 1 is pushed unfolded onto region b of core element 3 . then endoprosthesis 1 is folded up in the area of section 9 of core element 3 in which there is no stamping . next , tubular outer body 2 is pushed forward up to the proximal end of area 10 of core element 3 . endoprosthesis 1 is secured in position in this way . endoprosthesis 1 is subsequently folded up in the area where it is exposed by a pressing die , which is in itself known , and pressed by the pressing die on area 10 of core element 3 . the pressing die is now warmed with hot air so that endoprosthesis 1 , which has been pressed together , is heated and in this way pressed into the thermoplastic material of core element 3 or into its coating or sheath 3a . after removing the pressing die , tubular outer body 2 is pushed forward until its distal end lies against the back side of tip 15 of core element 3 and endoprosthesis 1 is thus completely enclosed . a corresponding process is utilized if a hardened plastic is used instead of the thermoplastic material . while this process is being carried out , it is absolutely imperative that shoulder 8 does not rest against the proximal end of endoprosthesis 1 . it automatically rests against the proximal end of endoprosthesis 1 once endoprosthesis 1 comes unmeshed from core element 3 upon release . shoulder 8 serves then as an abutment for endoprosthesis 1 when the remaining portion of the endoprosthesis still enclosed in tubular body 2 is released . obviously , processes are also conceivable in which the same endoprosthesis is always used to form the stamping . furthermore , it is also possible to impress the stamping by means of a positive cast of an endoprosthesis formed on the pressing die .	0
the methodologies and control strategies of the present disclosure are directed to the coating on the creping cylinder surface . various types of chemistries make up the coating on the creping cylinder surface . these chemistries impart properties to the coating that function to improve the tissue making process . these chemistries will be collectively referred to as performance enhancing materials ( pem / pems ). an exemplary description of these chemicals and a method to control their application are discussed in u . s . pat . no . 7 , 048 , 826 and u . s . patent publication no . 2007 / 0208115 , which are herein incorporated by reference . in one embodiment , one of said plurality of apparatuses utilized is an eddy current sensor . the differential method can involve an eddy current and an optical displacement sensor . in one embodiment , the differential method comprises the steps of : applying the eddy current sensor to measure the distance from the sensor to a surface of the creping cylinder and applying an optical displacement sensor to measure the distance from the coating surface to the sensor . in a further embodiment , the optical displacement sensor is a laser triangulation sensor or a chromatic type confocal sensor . fig1 depicts an illustration of the sensor combination consisting of an eddy current sensor and an optical displacement sensor . the eddy current ( ec ) sensor operates on the principle of measuring the electrical impedance change . the ec produces a magnetic field by applying an alternating current ( ac ) to a coil . when the ec is in close proximity to a conductive target , electric currents are produced in the target . these currents are in the opposite direction of those in the coil , called eddy currents . these currents generate their own magnetic field that affects the overall impedance of the sensor coil . the output voltage of the ec changes as the gap between the ec sensor and target changes , thereby providing a correlation between distance and voltage . in this application the ec sensor establishes a reference between the sensor enclosure and the creping cylinder surface . the second sensor mounted in the enclosure optically measures the displacement of the sensor with respect to the film surface . the optical displacement sensor can be either a triangulation type such as micro - epsilon ( raleigh , n . c .) model 1700 - 2 or a chromatic type such as micro - epsilons optoncdt 2401 confocal sensor . these sensors work on the principle of reflecting light from the film surface . when variations in the coating optical properties exist due to process operating conditions , sensor monitoring location , or properties of the pem itself , then a high performance triangulation sensor such as keyence lkg - 15 ( keyence — located woodcliff lake , n . j .) may be warranted . the keyence triangulation sensor provides a higher accuracy measurement with built in algorithms for measuring transparent and translucent films . variation in the transmission characteristics in both the cross direction ( cd ) and machine direction ( md ) may warrant a sensor adaptable to the different coating optical characteristics and the higher performance triangulation sensor can switch between different measurement modes . in general the majority of commercial triangulation sensors will produce a measurement error on materials that are transparent or translucent . if the film characteristics are constant , angling the triangulation sensor can reduce this error . however , sensor rotation for measurements on processes that have a high variability in the film characteristics is not an option . both the optical and ec sensors provide the required resolution to monitor pem films with expected thickness & gt ; 50 microns . the film thickness is obtained by taking the difference between the measured distances from the ec and optical displacement sensor . the sensors are housed in a purged enclosure , as shown in fig1 . purge gas ( clean air or n 2 ) is used for sensor cooling , cleaning , and maintaining a dust free optical path . cooling is required since the enclosure is positioned between 10 - 35 mm from the steam - heated creping cylinder . additional cooling can be used , if needed , by using a vortex or peltier cooler . purge gas exiting the enclosure forms a shielding gas around the measurement zone to minimize particulate matter and moisture . particulate matter can impact the optical measurement by attenuating both the launched and reflected light intensity . whereas moisture condensing on the light entrance and exit windows of the enclosure will cause attenuation and scattering . the ec sensor is immune to the presence of particulate matter and moisture . for industrial monitoring on a creping cylinder ( also known as a yankee dryer ), the sensor module shown in fig1 would be mounted on a translation stage as illustrated in fig2 . before installation , the positioning of the sensors must be calibrated on a flat substrate to obtain a zero measurement reading . this is necessary since the positioning of the ec and optical displacement sensor can be offset differently relative to the substrate surface . the calibration step is necessary to adjust the position of each sensor to insure a zero reading when no film is present . installation of the sensor module on the industrial process involves mounting the module at a distance in the correct range for both sensors to operate . by translating the module in the cd as the cylinder rotates a profile of the film thickness and quality can be processed and displayed . the processed results are then used for feedback control to activate the appropriate zone ( s ) for addition of pem , other chemicals , or vary application conditions , e . g ., flow rate , momentum , or droplet size . in addition , if the film quality ( thickness or uniformity ) cannot be recovered , then an alarm can be activated to alert operators of a serious problem , e . g ., cylinder warp , doctor blade damage or chatter , severe coating build - up , etc . finally , three measurement locations are identified in fig2 . measurements on the film thickness and quality can be made between the doctor and cleaning blade ( 1 ), after the cleaning blade ( 2 ), or before the web is pressed on to the cylinder ( 3 ). a single location or multiple locations can be monitored . laboratory results using the combination of ec and optical displacement ( triangulation ) sensor are shown in fig3 . in this case dynamic measurements are made on a 95 mm diameter cast iron cylinder rotating at ˜ 16 - 20 rpm ( revolutions per minute ). half of the cylinder was coated with pem . in the pem coated portion of the cylinder a bare spot (˜ 20 mm dia .) was made to simulate a defect region . fig3 shows the corrected signal ( eddy - triangulation ) starting in the bare metal region . translating the sensor combination to the coated region shows an average offset of ˜ 27 microns due to the coating . here the signal is negative , which represents a decrease in distance of 27 microns between the sensor and cylinder due to thickness of the coating . at 300 seconds the sensor combination was translated back to the bare metal area . initially the signal appears higher , (˜ 5 microns ) requiring further adjustment to position the sensors closer to the original measurement location . this anomaly is likely an artifact of the laboratory system because of the sensors not measuring the exact same area and the small radius of curvature with the small - scale setup . industrial monitoring on 14 - 18 ft diameter cylinders should minimize these effects , since the sensors would essentially view the cylinder as a flat plate . finally , a demonstration to detect the coating defect was made by translating the sensors at ˜ 375 seconds to the region containing the bare spot . here the average coating thickness measured was ˜ 30 microns . this is within 3 microns of the results from the region between 200 - 300 seconds . the appearance of a spike in the signal that approaches − 10 microns identifies the presence of a coating defect . as the bare spot rotates through the measurement zone the signal approaches 0 microns . the 10 micron offset measured is attributed to residual coating in the defect area . the results from fig3 are summarized in table 1 for corrected data as well as raw triangulation and ec data . recorded measurements from the ec and triangulation sensor are shown in fig4 for monitoring the bare metal region . the 40 - 50 micron oscillations observed in the measurement reflect the wobble in the cylinder rotation . by applying the correction ( ec - triangulation ) the wobble is reduced to ˜ 10 microns , as shown in fig5 . for industrial monitoring this variation will likely be reduced as the spatial location of the ec sensor approaches the optical displacement measurement spot and reduces the curvature effects . similarly fig6 and 7 show results for monitoring the coated region . in this case , the corrected data shown in fig7 has a variation between 15 - 20 microns . this larger variation in the data is likely due to surface non - homogeneities of the film . both frequency and amplitude analysis of the signal can provide information on the quality of the coating . the measurement spot size of the triangulation sensor is 30 microns . therefore , the triangulation sensor easily resolves non - uniformities in the surface . monitoring results from the coated region with the defect are shown in fig8 and 9 . the eddy current signal in fig8 does not show evidence of the defect . whereas the triangulation measurement indicates the presence of a defect by the sharp narrow spike . in the corrected signal shown in fig9 the sharp spike from the coating defect is easily resolved . another example showing the detection of uniformities is shown in fig1 . in this case , synchronous data collection was performed with a coated cylinder rotating at 59 rpm . the lhs figure shows a profile of the coating relative to the cylinder surface . the non - uniformity in the coating thickness is evident , but the surface is relatively smooth . the rhs figure shows the same coating subjected to chattering conditions through the interaction of a doctor blade and coating . comparing the two cases clearly shows the sensor system &# 39 ; s ability to capture degradation in the surface quality of the coating . detecting chattering events is critical on the yankee process to perform corrective maintenance that minimizes the impact on product quality and asset protection . moisture , which may affect the differential calculation , can also be accounted for ; specifically moisture can be calculated from the dielectric constant derived from a capacitance measurement . this data can be utilized to decide whether any change in thickness is a result of moisture or the lack of a coating . another way of looking at the capacitance is that it is a safeguard for a measurement obtained by the described differential method ; it provides a more in - depth analysis of the coating itself , e . g . behaviors of the coating such as glass transition temperature and modulus , which is useful in monitoring and controlling the coating on the creping cylinder surface . one method of accounting for moisture content in the coating is by looking at capacitance and another way is to utilize a moisture sensor . other techniques may be utilized by one of ordinary skill in the art . in one embodiment , the method incorporates a dedicated moisture sensor such as the one described in wo2006118619 based on optical absorption of h 2 o in the 1300 nm region , wherein said reference is herein incorporated by reference . this will give a direct measurement of the moisture level in the film without interferences that the capacitance monitor could experience due its dependence on the dielectic constant of both the coating and moisture . in another embodiment , the method additionally comprises : applying a capacitance probe to measure the moisture content of the coating ; comparing the capacitance measurement with the differential method measurement to determine the effect of moisture on the coating thickness ; and optionally adjusting the amount and distribution of the coating on the creping cylinder surface in response to the effect moisture has on thickness as determined by the differential method and / or adjust the amount of the coating . the method can use a module that houses multiple sensors as shown in fig1 . the module is similar to the one presented in fig1 , but with additional sensor elements . the module in fig1 includes a capacitance probe and an optical infrared temperature probe . capacitance probes such as lion precision , st . paul , minn . are widely used in high - resolution measurements of position or change of position of a conductive target . common applications in position sensing are in robotics and assembly of precision parts , dynamic motion analysis of rotating parts and tools , vibration measurements , thickness measurements , and in assembly testing where the presence or absence of metallic parts are detected . capacitance can also be used to measure certain characteristics of nonconductive materials such as coatings , films , and liquids . capacitance sensors utilize the electrical property of capacitance that exists between any two conductors that are in close proximity of each other . if a voltage is applied to two conductors that are separated from each other , an electric field will form between them due to the difference between the electric charges stored on the conductor surfaces . capacitance of the space between them will affect the field such that a higher capacitance will hold more charge and a lower capacitance will hold less charge . the greater the capacitance , the more current it takes to change the voltage on the conductors . the metal sensing surface of a capacitance sensor serves as one of the conductors . the target ( yankee drum surface ) is the other conductor . the driving electronics induces a continually changing voltage into the probe , for example a 10 khz square wave , and the resulting current required is measured . this current measurement is related to the distance between the probe and target if the capacitance between them is constant . where c is the capacitance ( f , farad ), ε is the dielectric property of the material in the gap between the conductors , a is the probe sensing area , and d is the gap distance . the dielectric property is proportional to the material &# 39 ; s dielectric constant as ε = ε r ε 0 , where ε r is the dielectric constant and ε 0 is the vacuum permittivity constant . for air , ε r = 1 . 006 and for water , ε r = 78 . depending on which two parameters are being held constant , the third can be determined from the sensor &# 39 ; s output . in the case of position , d is measured where air is usually the medium . for our application in yankee systems , the variability of ε r in the total gap volume is the measured parameter . in this case , the gap is composed of three main components air , film or coating that could also contain fibrous material , and moisture . a mixture dielectric constant can be expressed as where φ is the volume fraction with the subscript and superscript referencing the component material ( a = air , w = water , f = film ). using eq 1 and 2 the change in capacitance due to the presence of moisture is given by where c fw is the capacitance for film containing moisture and c f is the dry film . taking the log and rearranging eq . 3 an expression for the volume fraction on moisture is given by for monitoring the yankee film , the mixture capacitance c fw is measured directly with the capacitance probe . the temperature dependent dielectric constant for water is obtained from literature values . the volume fraction of moisture is then obtained by knowing the dry film capacitance , which can be determined from the film thickness measurement using the optical sensor and knowing the dielectric constant of the film . the average dielectric constant for the gap volume is proportionally composed of that for air and the coating . the more coating in the gap , the larger the average dielectric constant is . by controlling d and a , any sensitivity and range can be obtained . because capacitance is sensitive to the moisture content of the coating , it may be difficult to separate out variation in coating thickness from changes in moisture content . by incorporating the set of sensors ( ec , optical displacement , and capacitance ) in the module shown in fig1 , this information provides a means of cross checking the film thickness and information on the moisture content of the coating . the ec sensor provides a baseline reference distance for real - time correction used in both the optical displacement and capacitance . the capacitance averages over a much larger area compared to the optical probe . for example , a capacitance probe using a gap distance of 0 . 005 m would use a 19 mm diameter sensing probe head . the measurement area would be 30 % larger than the probe head . whereas optical displacement probes measure an area of 20 microns to 850 microns depending on the probe used . the higher resolution measurement from the optical probes will show sensitivity to smaller variation on the coating surface . however , the average measurement from the optical probe over a larger area will give similar results as the capacitance . differences between the capacitance and optical probe reading can then be attributed to moisture content in the film provided the dielectric constant of the coating is known . an infrared ( ir ) temperature probe such as omega ( stamford , connecticut ) model os36 - 3 - t - 240f can provide useful information on the temperature profile of the creping cylinder . since pem &# 39 ; s will respond differently depending on temperature , temperature information can be used to adjust the chemical composition and level of pems applied to the cylinder . in one embodiment , the method further comprises : ( a ) applying an ir temperature probe to measure the temperature profile of the creping cylinder ; ( b ) applying an ir temperature probe to measure the coating temperature needed to correct for the temperature dependent moisture dielectric constant ; and ( c ) applying the corrected moisture dielectric constant to the capacitance measurement to determine the correct coating moisture concentration . the addition of the ir temperature probe in the sensor module provides information on the temperature profile of the crepe cylinder . this is useful in identifying temperature non - uniformities on the crepe cylinder . in addition , the temperature can be used to correct the dielectric constant of the coating . for example , the dielectric constant for water can vary from 80 . 1 ( 20 ° c .) to 55 . 3 ( 100 ° c .). in one embodiment , the method further comprises applying an ultrasonic sensor to measure the modulus of the coating , and optionally wherein the modulus value is used to measure the hardness of the coating . the ultrasonic sensor is used to detect the viscoelastic property of the coating . the propagation of sound wave ( reflection and attenuation ) through the film will depend on the film quality , e . g ., hard versus soft . information on the film properties can be used for feedback to a spray system for controlling the spray level or adjusting the spray chemistry , e . g ., dilution level , to optimize the viscoelastic film property . as stated above , an interferometer may be utilized in measuring thickness . other analytical techniques , such as the ones described in this disclosure can be utilized in conjunction with an interferometry method . in addition , the differential method can be used in conjunction with a methodology that utilizes an interferometer to measure thickness of the coating . in one embodiment , the method uses interferometry to monitor the coating thickness . if the coating has sufficient transmission , then the use of multiple sensors can be reduced to a single probe head as illustrated in fig1 . in this case , light is transported to the probe by fiber optic cable . reflected light from both surfaces of the film is collected back into the fiber probe for processing to extract coating thickness information . several different techniques can be used for processing the collected light . industrial instruments such as scalar technologies ltd . ( livingston , west lothian , uk ) uses a spectral interferometry technique based on measuring the wavelength dependent fringe pattern . the number of fringes is dependent on the film thickness . alternatively , lumetrics inc . ( west henrietta , n . y .) instrument based on a modified michelson interferometer determines thickness based on the difference in measured peaks resulting from each surface . monitoring the coating on the crepe cylinder with an interferometry probe can be made at any of the locations illustrated in fig2 . the main requirement is that the film has sufficient transmission for the light to reflect off the internal surface , i . e ., near the substrate . one unique feature of the interferometry measurement is the ability to measure coating layers . this capability can be utilized at monitoring location 3 shown in fig2 . at this location the coating is not fully dry and is free from process disturbances such as from the pressure roll that applies the tissue sheet to the creping cylinder , direct contact with the web , doctor blade , and cleaning blade . an interferometry sensor at this location provides the thickness of the freshly applied coating . this aids in knowing the spatial distribution of the coating prior to any disturbances . for example , knowing the coating thickness before and after process disturbances can identify inefficiencies in the spray system , areas experiencing excessive wear , or other dynamic changes . as stated above , the methodologies of the present disclosure provide for optionally adjusting the application rate of said coating in one or more defined zones of said creping cylinder to provide a uniformly thick coating in response to the thickness of said coating . various types of apparatuses can carry out this task . in one embodiment , the method controls the spray zones based on measurements collected during normal operating conditions . for example , measurements from the sensor or sensor ( s ) discussed above are used to establish a baseline profile on the crepe cylinder . the baseline data is then used to track process variances . upper and lower control limits established around the baseline profile data ( film thickness , film quality , moisture level , viscoelasticity , temperature , etc .) is used to track when process deviations occur . if any of the process monitoring parameters falls outside the limits , then corrective action is taken with the zone control spray application system . in another embodiment , the plurality of apparatuses are translated across the yankee dryer / creping cylinder to provide profiles of thickness and / or moisture content and / or temperature , and / or modulus . in another embodiment , the plurality of apparatuses are located between a crepe blade and a cleaning blade , after the cleaning blade , or prior to a tissue web being pressed into the coating , or any combination of the above . in another embodiment , the plurality of apparatuses are purged with a clean gas to prevent fouling , mist interference , dust interference , overheating , or a combination thereof	3
referring to fig1 and 2 , the fastener of this invention includes a first fastening member 5 located in a plug 3 and a latch cavity 15 formed in a rear wall of a receptacle 11 located in a socket 1 . the socket 1 has a casing 10 housing the receptacle 11 therein and a power cable 17 at one end of the casing 10 for connecting with an electric device desired . beside the rear wall , the receptacle 11 has two side walls , a top opening and a front opening which has two side flanges 111 for holding the plug 33 securely in the receptacle 11 . inside the receptacle 11 , there is an insert 13 which has a pair of spaced conductive terminals 131 that in turn have a bottom end electrically connecting with the power cable 17 . the terminals 131 may couple with the plug 3 vertically from the top opening as shown in fig1 . the insert 13 may also be turned 90 degrees to have the terminals 131 laid horizontally to couple directly with an external power source through the front opening . the plug 3 includes a power source end 31 upon which two or three power terminals 311 may be provided to couple with an external power source and a body 33 for being mounted into the receptacle 11 . at the bottom of the body 33 , there are slots ( not shown in the figures ) engageable with the terminals 131 to establish electrical connection between the external power source with the electric device through the power terminals 311 , terminals 131 and power cable 17 . at the engaged position , the first fastening member 5 engages with the latch cavity 15 as shown in fig2 . following description will offer more details of their structural relationship . the first fastening member 5 is movable in a fastener slot 35 formed in a top wall of the body 33 . it has a first button 51 at the top thereof and a first latch bar 53 at the bottom . the first latch bar 53 further has a latch head 531 with a slant - in front side at one end and a latch tail 533 at another end . the latch tail 533 further engages with a spring strip 7 which is fixed to a first spring mounting 331 extended from the rear wall of the body 33 . when the plug 3 is not in use and is separated from the socket 1 as shown in fig1 the spring strip 7 restrains the latch bar 53 at the latch tail 533 to have the latch head 531 protruding out of the rear wall of the body 33 . while sliding the body 33 of the plug 3 into the receptacle 11 of the socket 1 , the slant front side of the latch head 531 is firstly pushed by the rear wall to move the latch bar 53 backward against the spring strip 7 , and the latch bar 53 resumes its original state ( as shown in fig2 ) as soon as the latch head 531 engages with the latch cavity 15 . at the position shown in fig2 the spring strip 7 presses the latch tail 533 to its original state so that the latch bar 53 may engage securely with the latch cavity 15 . the plug 3 thus may be held securely in the receptacle 11 of the socket 1 . when there is a need to disengage the electric device from the power source , the first button 51 is pushed in the direction toward the latch tail 533 . upon moving the first button 51 backward , the latch head 531 will be moved away from the latch cavity 15 . the plug 3 is then free to move out of the receptacle 11 . the first button 51 may be made in a desirable size and shape to make the operation simple and easy . in another embodiment of the fastener ( not shown in figures ), the latch cavity 15 may be located in a side wall of the receptacle 11 rather than in the aforesaid rear wall shown in fig1 . in such an event , the latch bar 53 and latch head 531 should also be arranged correspondingly to engage with a side latch cavity . the spring strip 7 may be made of selective material and size for providing the latch bar 53 with adequate strength in engaging with the latch cavity 15 . the latch cavity 15 and the latch head 531 may be formed in any desired shape such as wedge , barrel , square , triangle and the like . due to the material property of the metal used for spring strip 7 , enough engaging force can be provided for the fastener of the present invention , and the fatigue and rupture problem in a conventional plastic - made fastener can be avoided . the first button 51 may be located at the top of the body 33 and can be arranged far away from the engaging position of the plug 3 and the socket 1 . such an arrangement offers more flexibility in the design on the dimension and shape of the plug 3 and the socket 1 . fig3 illustrates another embodiment of this invention . the insert 13 has an insert body 130 that has angular recesses 133 formed symmetrically in the front , bottom and rear sides thereof . on the rear wall of the receptacle 11 and below the latch cavity 15 , there is a positioning bulge 107 which is engageable with one of the angular recesses 133 so that the insert 13 may be positioned in the socket casing 10 precisely and quickly at a desired angle . fig3 also shows an embodiment variation of this invention . at opposing lateral sides of the insert body 130 , there are two spring bores 139 formed therein ; bore one 139 on each lateral side . each spring bore 139 is used to hold a spring 135 and a spring head 137 . the spring head 137 has one end forming a spindle manner which is pivotally engageable with one of two apertures 103 located in the corresponding lateral walls of the receptacle 11 . therefore , the insert 13 may be pivotally held in the receptacle 11 by means of the spring heads 137 . the insert 13 is then able to turn about the apertures 103 from a vertical position to a horizontal position . the socket casing 10 has a pair of respective terminal slots 101 below the insert 13 to enable the lower portion of the terminals 131 be accommodated therein when the insert 13 is turned . the terminal slots 101 may have conductive contact with the lower ends of the terminals 131 and also forming conductive connection with the power cable 17 . in order to make the rotation of the rotational insert 13 smooth and durable , the rear wall of the receptacle 11 may form a tongue - shaped elastic arm 105 with the positioning bulge 107 located at the free end of the arm 105 . the elastic arm 105 may be formed by cutting a u - shaped through groove in the rear wall of the socket casing 10 . the bulge 107 is thus capable of elastic engagement with one of the angular recesses 133 when the insert 13 rotates and contacts against the arm 105 . of course , in the embodiment of the recesses 133 and bulge 107 , the position of the angular recesses 133 and the positioning bulge 107 may be switched with each other and still achieve same result . that is , the bulges are formed on the locations where the recesses 133 are located and a recess is formed on the location where the bulge 107 is located . fig4 illustrates a further embodiment of this invention . in the receptacle 11 , there is provided with a horizontal stop bar 109 located above the insert 13 ; so that any undesirable objects may be prevented from dropping into the receptacle 11 and making contact with the insert 13 . in this embodiment , the plug body 33 should have a respective slot opening to enable the stop bar 109 to pass through during assembly . fig5 and 6 show yet another embodiment of this invention for the socket 1 engaging with a conversion plug 4 capable of converting outlet of the aforesaid insert 13 to another type of outlet for connecting with a different power supply . the engagement of the conversion plug 4 and the receptacle 11 is mostly like the one set forth above . however in the casing 40 , there is a conversion socket 41 that may couple with the terminals in the socket 1 to establish an electric link . the conversion socket 41 is preferably made by any standard specification such as a two - port type , three - port type , or any other type that conforms industry standards . in the conversion plug 4 as shown , there is a movable second fastening member 43 that includes a second button 431 exposed outside the plug 4 and a second latch bar 433 , in which the second latch bar 433 also has a latch head engageable with the socket casing 10 and a latch tail 7 engageable with a spring like the embodiment shown in fig2 . both embodiments ( i . e ., those in fig2 and 6 ) basically provide the same function and effect already set forth above . the main difference is the size and location of the second button 431 and the first button 51 . apparently , in the application of the present invention , the location and the size of the fastener can be various embodied , and be determined upon deciding the power supply types and design requirements . it may thus be seen that the objects of the present invention set forth herein , as well as those made apparent from the foregoing description , are efficiently attained . while the preferred embodiments of the invention have been set forth for purpose of disclosure , modifications of the disclosed embodiment of the invention as well as other embodiments thereof may occur to those skilled in the art . accordingly , the appended claims are intended to cover all embodiments which do not depart from the spirit and scope of the invention .	7
the cleavage procedure in the present invention for liberating the desired peptide from the solid support ( resin ) after the completion of peptide assembly is described in detail . the cleavage apparatus shown in fig1 is used as a typical embodiment of the present invention . step ( 1 ): after solid - phase peptide synthesis in a continuous flow method , i . e ., acylation ( coupling ) and subsequent removal of the nα - protecting group , is complete , the column used for the synthesis , as such , is attached to the cleavage apparatus shown in fig1 as a synthesis reaction column 1 . when a solid - phase peptide synthesis is conducted in a batch - wise manner , the resulting peptidyl resin is packed in the reaction column 1 . step ( 2 ): as washing liquids , methanol , t - butyl methyl ether and diethyl ether , in this order , are supplied to the synthesis reaction column 1 through line i to wash the peptidyl resin obtained . alternatively , each washing liquid may be supplied from a funnel 2 to a flask 3 and further to the synthesis reaction column 1 to wash the peptidyl resin . after washing , the resulting waste liquid is discharged through line e . by supplying nitrogen gas 8 under increased pressure to the synthesis reaction column 1 through the line f , purging the synthesis reaction column 1 and discharging the gas through line g , the peptidyl resin in the synthesis reaction column 1 is dried . it is also possible to dry the peptidyl resin by supplying nitrogen gas 7 , in place of nitrogen gas 8 , under increased pressure to the synthesis reaction column 1 through lines a , b , c and d , purging the synthesis reaction column 1 and discharging the gas through line e . however , when peptide synthesis is conducted in a batch - wise manner and the dry resin can be packed in the reaction column 1 , this operation may be omitted . step ( 3 ): by supplying nitrogen gas 8 under increased pressure to the synthesis reaction column 1 through line f and discharging it through line g , the inside of synthesis reaction column 1 is dried . step ( 4 ): the cleavage cocktail is supplied from the funnel 2 to the flask 3 ( preferably eggplant - type flask ). the cleavage cocktail in the flask 3 enters the synthesis reaction column 1 through lines c and d . the lines c and d function as cleavage cocktail transport lines in the cleavage apparatus . it is necessary to control the temperature in the flask 3 in some cases , depending on the type of the peptide which is subject to cleavage and the type of side chain protecting groups . in this case , cooling or heating is added as necessary using an outside bath 6 whose temperature can be controlled by a microprocessor . for example , when amino acids constituting the peptide are acid - labile , it is preferable to cool the cleavage cocktail to about 4 ° c . before its injection into the synthesis reaction column 1 to prevent side reactions . although it is sometimes preferable to change the temperature over time , for example , at the initial and intermediate stages of reaction , all these conditions depend on the type of the peptide which is subject to cleavage and the type of side chain protecting groups , and preferable conditions for each case are known to those skilled in the art . usually , a cooled cleavage cocktail is commonly used at the initial stage . step ( 5 ): nitrogen gas 8 is supplied under increased pressure to the synthesis reaction column 1 through the line f , to return the cleavage cocktail , which has entered the synthesis reaction column 1 in step ( 4 ), to the flask 3 through the above - described cleavage cocktail transport lines ( i . e ., lines d and c ). step ( 6 ): the cleavage cocktail in the flask 3 is again injected into the synthesis reaction column 1 through the cleavage cocktail transport lines ( i . e ., lines c and d ). step ( 7 ): the above - described steps ( 5 ) and ( 6 ) are repeated in about 9 to 18 cycles ( for about 90 minutes at intervals of about 5 to 10 minutes ) to complete cleavage for the desired peptide . it is necessary , however , to take longer intervals than usual , i . e ., for about 5 to 8 hours at intervals of about 20 to 30 minutes , when the desired peptide contains arg ( mtr ) or arg ( pmc ) residues . step ( 8 ): after completion of cleavage , nitrogen gas 8 is supplied under increased pressure through the line f as necessary to completely return the cleavage cocktail to the flask 3 . co - washing is performed . specifically , after a small amount of tfa or acetic acid for washing is supplied from the funnel 4 to the synthesis reaction column 1 through the line h , nitrogen gas 8 is supplied under increased pressure to the synthesis reaction column 1 through the line f to purge the cleavage cocktail remaining in the resin in the column , along with the above - described tfa or acetic acid , into the flask 3 . next , nitrogen gas 7 is supplied to the flask 3 through lines a and b , followed by bubbling under cooling conditions ( under 10 ° c . ). at this time valve 12 is closed to allow exhaust through line j . the peptide concentration in the cleavage cocktail can be increased by this procedure . in some cases , this procedure increases the peptide yield . step ( 9 ): dry diethyl ether is added to the flask 3 from the funnel 2 . alternatively , diethyl ether is supplied from the funnel 4 to the flask 3 through the line d . also , diethyl ether can be supplied to the flask 3 with a pump 13 or by application of increased pressure on the bottle of diethyl ether through the lines i and c . in these cases , nitrogen gas 8 or 9 is supplied to the flask 3 through the lines f , d and c or lines i and c , followed by stirring with bubbling . during this operation it is preferable to cool the flask 3 using the outside bath 6 . although the time required for this procedure is about 0 . 5 hours , the peptide yield may increase in some cases when the flask 3 is kept standing under cooling conditions overnight . as needed , when the desired peptide is aliphatic or not solidified by diethyl ether , petroleum ether or n - hexane can be used in combination with or in place of diethyl ether . after the above procedure , the flask 3 is detached , and the precipitate therein is collected by filtration , which is then dried to yield the desired peptide in a crude form . step ( 10 ): the resulting crude peptide is purified by an appropriate conventional method . in the above - described steps ( 1 ) through ( 10 ), each valve operation , pressure control , reagent addition and other operations can be automated , for example , using a computer . the present invention is hereinafter described in more detail by means of the following working example , but the present invention is not limited by it . the desired peptide , his - lys - thr - asp - ser - phe - val - gly - leu - met - nh 2 ( seq id no : 1 ), is synthesized by an ordinary continuous flow synthesis using the following resin : resin : tentagel sram ™ ( manufactured by rapp polymer germany ) to remove nαfmoc group , piperidine ( 20 % in dmf ) is used . the following amino acid derivatives are used in 4 - fold excess : ______________________________________fmoc - met - oh 6 . 24 gfmoc - leu - oh 5 . 94 gfmoc - gly - oh 4 . 99 gfmoc - val - oh 5 . 70 gfmoc - phe - oh 6 . 51 gfmoc - ser ( tbu )- oh 6 . 44 gfmoc - asp ( otbu )- oh 6 . 91 gfmoc - thr ( tbu )- oh 6 . 68 gfmoc - lys ( boc )- oh 7 . 87 gfmoc - his ( trt )- oh 10 . 41 g______________________________________ each coupling is carried out with reagents bop ( benzotriazol - 1 - yl - oxy - tris ( dimethylamino ) phosphonium hexafluorophosphate ), hobt ( 1 - hydroxybenzotriazole ) and nmm ( n - methylmorpholine ) in the presence of dmf as a reaction solvent . after the nα fmoc group is removed , the peptide is cleaved from the solid support and side chain protecting groups are simultaneously removed using the cleavage apparatus of the present invention shown in fig1 . specifically , the column used for peptide synthesis , as such , is first attached to the cleavage apparatus shown in fig1 as the synthesis reaction column 1 ( above - described step ( 1 )). next , methanol , t - butyl methyl ether and diethyl ether , as washing liquids , are supplied in this order from the funnel 2 to the flask 3 ( eggplant - type flask ) and then to the synthesis reaction column 1 to wash the peptidyl resin , instead of supplying them to the synthesis reaction column 1 through line i . after washing , the waste liquid is discarded through line e ( above - described step ( 2 )). furthermore , to discard the ether remaining in the flask 3 , the flask 3 is replaced with a new one before proceeding to the next step . next , nitrogen gas 7 is supplied under increased pressure through line a , passed through lines b , c and d , and then discharged through line e to dry the inside of the synthesis reaction column 1 ( above - described step ( 3 )), after which a cleavage cocktail ( a mixture of 94 % tfa , 5 % anisole and 1 % ethanedithiol , 150 ml ) is supplied from the funnel 4 to the flask 3 . nitrogen gas 7 is supplied under increased pressure through line a , and the cleavage cocktail in the flask 3 is transferred to the synthesis reaction column 1 through cleavage cocktail transport lines ( lines c and d ) to fill the synthesis reaction column 1 therewith ( above - described step ( 4 )). nitrogen gas 8 is supplied under increased pressure to the synthesis reaction column 1 through line f , and the cleavage cocktail , which has entered the synthesis reaction column 1 , is returned to the 1000 - ml flask 3 through cleavage cocktail transport lines ( lines d and c ) ( above - described step ( 5 )). next , the cleavage cocktail in the flask 3 is again injected to the synthesis reaction column 1 through cleavage cocktail transport lines ( lines c and d ) ( above - described step ( 6 )). the procedures of the above - described steps ( 5 ) and ( 6 ) are repeated for about 90 minutes at intervals of about 5 to 10 minutes to complete the cleavage of the desired peptide ( above - described step ( 7 )). after completion of cleavage , nitrogen gas 8 is supplied through line f to purge the cleavage cocktail into the flask 3 ( above - described step ( 8 )). nitrogen gas 7 is supplied to the flask 3 through lines a and b , and while bubbling , a part of the cleavage cocktail is removed to reduce its volume ( above - described step ( 9 )). during this operation the flask 3 is cooled using the outside bath 6 . in this example , the above - described procedures are automatically performed using a computer . next , 850 ml of dry diethyl ether are added from the funnel 2 to the flask 3 , and the flask is kept standing under cooling conditions for 3 hours . then , the flask 3 , in which the peptide precipitates , is detached , and the precipitate is collected by filtration and dried to yield 5 g of the desired peptide in a crude form . the crude peptide is subject to sequence analysis to confirm the desired amino acid sequence . in addition , fab - ms using kratos ms50 reveals a mass number [ m + h ] + of 1134 . 5 . reverse phase hplc trace of this crude peptide is shown in fig2 . the present invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims . __________________________________________________________________________sequence listing ( 1 ) general information :( iii ) number of sequences : 1 ( 2 ) information for seq id no : 1 :( i ) sequence characteristics :( a ) length : 10 amino acids ( b ) type : amino acid ( d ) topology : linear ( ii ) molecule type : peptide ( iii ) hypothetical : no ( v ) fragment type : internal ( ix ) feature :( a ) name / key : modified - site ( b ) location : 10 ( d ) other information : / label = amidated / note =&# 34 ; c - terminal methionine is amidated .&# 34 ;( xi ) sequence description : seq id no : 1 : hislysthraspserphevalglyleumet1510	2
reference will now be made in detail to the embodiments of the present invention , examples of which are illustrated in the accompanying drawings . a system package can be used by integrating a system on package ( sop ), a system in package ( sip ), and a multi - chip module ( mcm ). hereinafter , the various embodiments of the present invention will be described in detail with reference to the accompanying drawings . when inserting reference numerals into the constituents in the respective drawings , although the constituents are illustrated in different drawings , so far as the constituents are the same , they are described to have the same reference numeral , where possible . the detailed description for the well - known function and constitution , judged to make the gist of the invention obscure , will be omitted . fig2 is a cross - sectional view showing a system package using flexible opto - electric wiring according to one embodiment of the present invention . the system package includes a first rigid substrate 200 , a flexible substrate 210 , and a second rigid substrate 220 . the rigid substrate can be made of thermosetting resin , ceramic , teflon and similar materials , for example , it can be made of thermosetting epoxy resin ( fr - 4 ) called by ‘ prepreg ’. the flexible substrate can be made of polyimide or similar materials . a point of reference between the rigidity and flexibility of the substrates is the possibility of substrate warpage . that is , the rigid substrate is not bent three - dimensionally after being hardened , except to a very minor extent . on the other hand , the flexible substrate is the sheet of film - type materials and is characteristic of three - dimensionally bent and curved substrate . the flexible substrate , according to the invention , can be manufactured by the following process . first , optical waveguide sheets , comprised of the metal thin - film mirror tilted to the left or right , are laminated in the flexible substrate and electrically wired . then the flexible substrate is inserted into the middle of the rigid substrate . the mechanical alignment or connection between the flexible substrate and the rigid substrate is made by using guide pins and holes ( not shown in fig2 ). on the other hand , the electrical connection between the flexible substrate and the rigid substrate is performed by via holes ( not shown in fig2 ). the first rigid substrate 200 and the second rigid substrate 220 include a light source 202 , a photo detector 222 , a first integrated circuit 204 , a second integrated circuit 224 , a mirror 206 , and a package cover 226 . the flexible substrate 210 includes an optical waveguide 212 and an electrical wire 214 . referring to fig2 , the first rigid substrate 200 and the second rigid substrate 220 are connected by using the flexible substrate 210 that can be easily bent , thereby forming the system package . although not shown in the drawing , the integrated circuit is formed on the flexible substrate , and the integrated circuit system package can be configured of only the flexible substrate . further , one system package can be formed in a desired structure by using the plurality of rigid substrates 200 / 220 and the plurality of flexible substrates 210 . the first rigid substrate 200 includes a light source 202 that is an optical integrated element and comprises a first integrated circuit 204 that is configured of a digital integrated circuit , an analog integrated circuit , and a high frequency integrated circuit . the first integrated circuits 204 are mounted on the inside and outside of the first rigid substrate 200 and can be electrically connected through a system board 230 and an electric socket 232 that exist on the outside . the data signals input by the external system board 230 are applied to the first integrated circuits 204 through an internal electrical wire 214 in the first rigid substrate 200 and the data signals received in the first integrated circuit 204 are processed using the processor in the inside of the integrated circuit , electric - optic converted , and then transmitted to the optical waveguide 212 of the flexible substrate 210 via the light source 202 . the flexible substrate 210 comprises the electrical wire 214 and the optical waveguide 212 and the electrical wire 214 can be used for low - speed data transmission , a control signal line , a power supply line , and a ground line , and the like . the optical waveguide 212 can be used for high - speed data transmission , clock and control signal lines , and the like . thereby , the optical signal transmitted at high - speed through the optical waveguide 212 has no signal interference between the signal lines , unlike the high - speed electrical signals , making it possible to make the transmission length long . the second rigid substrate 220 receives the optical signals transmitted by the first rigid substrate 100 via the flexible substrate 210 through the photo detector 222 and the received signals are opto - electric - converted using the second integrated circuit 224 , processed according to the processor inside of the integrated circuit , and transmitted to the external system board 230 . at this time , in order to transmit the optical signals passing through the light source 202 and the photo detector 222 of the first and second rigid substrates 200 and 220 to the optical waveguide 212 of the flexible substrate 210 , a mirror 206 is installed inside of the first and second rigid substrates 200 and 220 at a predetermined angle ( for example , 45 °), thereby transmitting and receiving the signals without loss . the first and second integrated circuits 204 and 224 may be formed with various electronic elements such as capacitors , inductors , and resistors , and the like and the first and second integrated circuits 204 and 224 use a package cover 226 such that they can be protected from foreign materials such as dust . the package is formed in an order of the rigid substrate - flexible substrate - rigid substrate , but it is not particularly limited thereto . therefore , the package may be formed of the rigid substrate having the integrated circuit mounted thereon and the flexible substrate having the integrated circuit mounted thereon or may be formed of only the flexible substrate having the integrated circuit mounted thereon . fig3 and 4 are a view showing the structure of the system package using the bending properties of the flexible substrate according to one embodiment of the present invention . fig3 shows a vertically stacked system package , and fig4 shows plane type of system package ( i . e ., formed on a plane ). fig5 is a view showing a computer having a system package mounted therein according to one embodiment of the present invention . a system package 400 can be effectively installed in a small space by using the flexible opto - electric wiring . the flexible opto - electric wiring comprises the optical waveguides and the electrical wires that are formed on the inside and outside of the flexible substrate that can be easily bent . fig6 is a view showing a system package using flexible opto - electric wiring including an auxiliary device according to another embodiment of the present invention . the system package may comprise at least one auxiliary device 500 formed between the vertically stacked rigid substrates 300 as shown in fig3 or fig5 . the auxiliary device 500 is not particularly limited , but may comprise a heat dissipation device ( heat sink ) and an electromagnetic wave shielding device , and the like . according to the installation of the auxiliary device 500 , the errors in signals caused by the electromagnetic wave interference due to the heat and signals , which are generated by the integrated circuits 110 , 120 , 130 , and 140 are prevented , making it possible to accurately transmit data . fig7 is a flow chart showing the signal processing method of the integrated circuit system package according to another embodiment of the present invention . referring to fig7 , at step s 600 , the high - speed data signals are applied from an external system board having the integrated circuit system package mounted thereon to the inside of the first rigid substrate via an electrical socket . at step s 610 , which includes electrical to optical conversion , the data signals applied to the inside of the first rigid substrate are processed through the first integrated circuit mounted on the rigid substrate via the wiring substrate and the processed electrical signals are converted into the optical signals . at step s 620 , which includes transmitting the signals , the converted optical signals are transmitted through the optical waveguides of the flexible substrate via the light source and transmitted to the photodetector of the second rigid substrate connected to the flexible substrate . at this time , the interference between the signals is minimized at the time of transmitting the data at high speed through the transmission of the optical signals , such that the data transmission length is not limited and the data can be transmitted up to a long distance . at step s 630 , the optical signals received from the first rigid substrate are converted into the electrical signals in the second integrated circuit , processed through the processor of the second integrated circuit , and transmitted to the external system ( s 640 ). in other words , the signals processed through the processor of the second integrated circuit can be transmitted to a third rigid substrate through the second flexible substrate or transmitted to the external system board having the second rigid substrate mounted thereon through the electrical socket . further , the electrical signals processed in the second rigid substrate are reversely subjected to the above processes and transmitted to the first rigid substrate , making it possible to process them in parallel with each other by using all the processors of the first integrated circuit and the second integrated circuit . while the invention has been described with reference to exemplary embodiments , it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention . in addition , many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the essential scope thereof . therefore , it is intended that the invention not be limited to the particular embodiments disclosed for carrying out this invention .	7
as shown in fig1 a fastener 10 according to a preferred embodiment of the present invention includes a substantially cylindrical head 12 and a shaft 14 , coaxial with the substantially cylindrical head 12 , and extending from a longitudinal end of the head 12 . the head 12 is preferably formed from a resilient material that is preferably injection molded over the shaft 14 . of course , it is within the scope of the invention to securely affix the head 12 to the shaft 14 using other known expedients , such as adhesives or mechanical couplings . the shaft 14 preferably has a pointed end 16 and a helical thread 18 provided thereon so that the fastener 10 can be threaded into a vertical support . the head 12 preferably includes an ergonomic gripping element in the form of an annular indentation 19 approximate the shaft , allowing a user to comfortably and securely grip the head 12 by placing his or her thumb and index finger in the indentation 19 . the resilient material of the head 12 combined with its ergonomic shape uniquely enables the fastener 10 of the present invention to be gripped and driven into a vertical support ( wall ) by hand , without the use of tools . the grip also facilitates increased stability while the push - pin is being thrust into the support . while the use of the threads 18 is not necessary , the threads 18 will make it easier for the fastener 10 to be driven into the vertical support by the user ( manually twisting the fastener ) and will also provide additional surface area to retain the fastener 10 in the vertical support once installed . the head 12 also includes a substantially flat longitudinal end surface 20 adapted to abut a flat surface of a wall or a vertical support and includes a plurality of resilient , annular projections 22 axially distributed therealong from the opposite longitudinal end 24 of the head . as shown in fig2 once the fastener 10 has been driven into a support 26 the annular projections 22 are provided to mount an object 28 to the support 26 . the object 28 includes a hole or channel 30 extending into a substantially flat end surface 32 thereof , where the hole or channel 30 includes upper and lower walls 34 , 36 and where the distance between the upper and lower walls 34 , 36 is slightly less than the diameter of the projections 22 of the fastener such than when the hole or channel 30 of the object 28 is pressed against the head 12 of the fastener , 10 as shown by arrows a , the resilient projections 22 will deform somewhat allowing the head 12 to be received within the hole or channel 30 . when the head 12 is received within the hole or channel 30 , the resilient projections 22 provide a friction fit between the head 12 and the walls 34 , 36 of the hole or channel 30 , thereby facilitating in mounting the object 28 to the support 26 . referring back to fig1 the circumferential leading edges 37 of the annular projections 22 are preferably tapered to facilitate easy insertion of the head 12 into the hole or channel 30 . because of the unique design of the head 12 , the object 28 may be easily mounted to the support 26 , without necessitating the use of hand tools , such as hammers , screwdrivers , drills , etc . of course , one may use such hand tools and still fall within the scope of the invention as defined herein . the friction fit between the head 12 and the object 28 also facilitates removal of the object 28 from the support 26 without necessitating the use of any hand tools since the friction fit provided by the head does not necessarily “ lock ” the object 28 to the fastener 10 . referring again to fig2 the longitudinal end surface 20 of the fastener abutting the support 26 assures uniform distance from the surface of support 26 to the opposite longitudinal end 24 of the fastener ; and when the flat longitudinal end surface 20 hits the flat surface of the support 26 as the user is manually pushing the fastener into the support , the user will be assured that the fastener is successfully and securely installed . in an exemplary embodiment of the fastener 10 , the head 12 is molded from a resilient plastic material such as nylon 66 ; the diameters of the annular projections are approximately 12 mm ; the axial length of the head is approximately 12 mm ; and the shaft 14 is heat treated # 1022 carbon steel and extends approximately 15 mm from the longitudinal end 20 of the head . of course , those of ordinary skill in the art will recognize that other suitable materials and dimensions for the fastener may be used , while still falling within the scope of the invention as defined herein . with such an exemplary embodiment , a hole or channel 30 will be approximately 15 mm deep and have a spacing of approximately 10 to approximately 11 mm between the upper and lower walls 34 , 36 . again , other suitable dimensions will be recognized by those of ordinary skill in the art , while still falling within the scope of the invention defined herein . as shown in fig3 - 5 , an example object to be mounted to a vertical support according to a preferred embodiment of the present invention is a comer shelf 38 . the corner shelf 38 is a triangular shaped , planar board having a pair of substantially flat side edges 40 , 42 meeting at a 90 ° angle . milled within each of these edges 40 , 42 is a substantially rectangular ( in cross - section ) channel 44 , providing an upper wall 46 and a lower wall 48 within the channel 44 . the remaining edge 50 of the triangular board may include beveled surfaces for decorative purposes . as shown in fig6 the comer shelf 38 may be mounted to a comer formed by two adjoining walls 52 , 54 according to the following steps . first , a straight edge is held against a first one of the walls 52 at a desired height and a light pencil line 56 is drawn along the top of the straight edge . this step is repeated for the other wall 54 to provide line 58 . next , at least two of the fasteners 10 are driven into each wall 52 , 54 along the pencil lines 56 , 58 . preferably , one of the fasteners should be two inches out from the comer and the other should be 1 inch in from the end of the comer shelf &# 39 ; s mounting slot 44 . the remaining step is to push the comer shelf 38 against the exposed heads of the fasteners 10 as shown by arrow b in fig6 such that the mounting slot 44 is pressed against each of the exposed heads of the fasteners 10 and such that the projections on each of the exposed heads of the fasteners 10 deform to allow the heads to be received within the slot 44 , thereby providing a friction fit between the exposed heads of the fasteners 10 and the slot 44 . this friction fit securely mounts the corner shelf 38 to the corner formed by the two walls , 52 , 54 . the fasteners 10 provide a friction fit with the corner shelf 38 to prevent the shelf from easily pulling away from the walls , 52 , 54 , while also providing a load bearing capability , so that the comer shelf 38 may bear a substantial surface load ( the shelf 38 of the exemplary embodiment is rated at 25 lbs .). it will be apparent to those of ordinary skill in the art that the use of more fasteners 10 will allow the comer shelf 38 to bear an even greater load . the annular projections 22 of the fasteners 10 provide a sufficient amount of axial surface area for the friction fit between the fasteners 10 and the slot 44 where it is not necessary for the angle between the two walls 52 , 54 to be absolutely square ( one will realize that many corners in homes or offices are not absolutely square when using the exemplary embodiment ). as shown in fig7 an alternate object for mounting to a vertical support is a straight shelf 60 having a horizontal channel 62 milled into the substantially flat longitudinal end surface 64 of the shelf . this channel 62 is adapted to receive a plurality of the fasteners 10 previously secured into a vertical support . the fasteners 10 provide a friction fit within the channel 62 , thereby securely mounting the shelf 60 to the vertical support . in this embodiment , the shelf also includes a pair of brackets 66 extending downward from a lower surface 68 of the shelf , where the brackets 66 are adapted to abut the vertical support when the shelf is mounted to the vertical support using the fasteners 10 , thereby preventing the shelf 60 from pivoting downward on the fasteners 10 . the above two shelves 38 , 60 are merely examples of objects that can be mounted to a vertical support using the fasteners 10 . it will be apparent to those of ordinary skill in the art that the fasteners of the present invention may also be used to mount other types of objects to other types of supports ( even horizontal supports such as ceilings ), while still falling within the scope of the present invention . for example , the system of the present invention may be obviously adapted to mount picture frames , towel hooks , wall accessories , and decorations . it is not necessary for the head of the fastener to be cylindrical . as shown in fig8 one alternate embodiment of the fastener 68 includes a head 70 that is substantially rectangular in cross - section and a threaded shaft 72 affixed to , and extending from the geometric center of the rectangle . the head 70 includes a plurality of rib projections 74 extending from an upper surface thereof and another plurality of rib projections 76 extending from a lower surface thereof ( although it is within the scope of the invention to provide only one of such projections extending from either the upper or lower surface of the head ). the vertical height of the head 70 provided by the projections 74 , 76 is slightly greater than the vertical distance between the upper and lower walls 34 , 36 of the channel ( fig2 ), thereby providing a friction fit when the channel 30 is pressed over the head 70 of the fastener . this head 70 would provide more gripping area than the head 12 of fig1 but may make mounting of the object to the support slightly more difficult since the head 70 would have to be horizontally aligned with the channel extending into the object . the head may include indentations ( not shown in this embodiment ) respectively extending into the upper and lower surfaces of the head that provide ergonimic gripping areas on the head 70 to facilitate secure and comfortable gripping of the head 70 between a user &# 39 ; s thumb and index finger ( each of which are maintained within one of the indentations ). while the apparatuses and processes herein described in the above description and summaries constitute exemplary embodiments of the present invention , it is to be understood that the invention is not limited to these precise apparatuses and processes , and that changes may be made therein without departing from the scope of the invention as defined by the claims . additionally , it is to be understood that the invention is defined by the claims and it is not intended that any limitations or elements describing the exemplary embodiments herein are to be incorporated into the meaning of the claims unless such limitations or elements are specifically listed in the claims .	8
preferred embodiments of the present invention will be described hereafter with reference to drawings . fig1 is a diagrammatic perspective view showing the exterior of a mechanism unit 1 of a disc player used for automobiles . at the front surface , the mechanism unit 1 of the disc player provides a disc insertion port 2 where a large disc d 1 or small disc d 2 is inserted and ejected . an arrow a shows the disc insert direction , and the opposite direction indicates the disc eject direction . together , the disc insert direction and disc eject direction are collectively referred to as the disc insert / eject direction . fig2 is a diagrammatic perspective view showing the mechanism unit 1 of the disc player by breaking out an upper unit 3 and a lower unit 4 . fig3 shows a top plane view of the upper unit 3 ; and fig4 shows a top plane view of the lower unit 4 . the upper unit 3 , as shown in fig2 and fig3 , comprises an upper frame 5 ( shown by a virtual line ), a disc detection mechanism 6 , a disc size determination mechanism 7 , a disc positioning mechanism 8 , a clamping mechanism 9 , and a portion of a loading mechanism 10 . the lower unit 4 comprises , as shown in fig2 and fig4 , a lower frame 11 , a damper 12 consisting of three buffer members , a pickup unit 15 including a turntable 13 with a built - in magnet and a pickup 14 , a circuit substrate 16 providing a control circuit , and another portion of the loading mechanism 10 . the upper frame 5 consisting of a nearly rectangular metal plate , as shown in fig2 and fig3 , has side panels formed by bending downward from four sides of a top panel 17 , and superposition units 20 , 21 are provided at the front and rear respectively in the disc insert / eject direction of the right and left side panels 18 , 19 . further , the lower frame 11 consisting of a nearly rectangular metal plate , as shown in fig2 and fig4 , has side panels which are formed by bending upward from the four sides of a bottom panel 22 , and superposition units 25 , 26 are provided at the front and rear respectively in the disc insert / eject direction of the right and left side panels 23 , 24 . furthermore , combining the upper frame 5 and lower frame 11 is performed by superimposing the mutually corresponding superposition units and fixing by screw 27 . the top panel 17 , as shown in fig2 and fig3 , forms a long recess in the lateral direction through extrusion processing facing downward from the upper surface and such area becomes a second mounting unit 28 , and the other area is a first mounting unit 29 . further , at a stepped unit 30 between the first and second mounting units 29 , 28 , a notch 31 is provided appropriately . moreover , the second mounting unit 28 together with guide projections 203 which will be described hereafter constitutes a disc guide 32 , making the rear side thereof the disc feeding path . at the lower surface of the first mounting unit 29 , a portion of the disc detection mechanism 6 , a disc size determination mechanism 7 , a disc position mechanism 8 , a clamping mechanism 9 , and a portion of the loading mechanism 10 are loaded . at the upper surface of the bottom plate 22 of the lower frame 11 , as shown in fig2 and fig4 , each of the bodies 33 of the three dampers 12 are fixed . further , a head 34 of each damper 12 is attached at a part of the pickup unit 15 , and the pickup unit 15 is supported in a floating state in relation to the lower frame 11 through these dampers 12 . furthermore , as shown in fig4 , the circuit substrate 16 at the right side of the pickup unit 15 in the drawing is attached to the bottom plate 22 . five switches in the control circuit are arranged on the circuit substrate 16 . a first switch 35 detects when either a large or small disc is inserted from the disc insertion port 2 . a second switch 36 detects when either a large or small disc is loaded completely on the turntable 13 . a third switch 37 detects when a large disc d 1 is discharged . a fourth switch 38 detects when a small disc d 2 is discharged . a fifth switch 39 as a disc insert detection switch detects when either a large or small disc is inserted within the disc player . meanwhile , the right side plate 24 of the lower frame 11 is a bent piece 40 where the rear is bent inward , and a loading motor 41 that is a part of the loading mechanism 10 is loaded at the bent piece 40 . the loading motor 41 is connected to the control circuit on the circuit substrate 16 by wires . a worm gear 43 is loaded at a shaft 42 of the loading motor 41 . further , at the interior surface of the right side panel 24 , a lower gear group 44 is equipped which receives the rotation of the worm gear 43 . fig5 is a top plane view showing the disc detection mechanism 6 and the disc size determination mechanism 7 . the disc detection mechanism 6 comprises a pair of right and left and horizontally rotating disc detection members 45 , 46 , a pair of right and left partial gears 47 , 48 constituting an interlocking mechanism , and a pair of right and left coil springs 49 . the disc detection mechanism 6 is installed on the lower surface of the first mounting unit 29 and the upper surface of the second mounting unit 28 . the disc detection members 45 , 46 detect whether an inserted disc size is large or small and are thereby mounted with the ability to rotate freely respectively at spindles 50 , 51 which protrude to the lower surface of the first mounting unit 29 , and extend to the vicinity of the disc insertion port 2 passing through the upper surface side of the second mounting unit 28 from the notch 31 , and which have detection units 52 , 53 ( refer to fig2 ) which extend downward at each extended end . both disc detection members 45 , 46 have the ability to rotate freely within the range of the notch 31 , and maintain their initial position by causing a part to attach at the end of the notch 31 through the energizing force of the coil spring 49 . further , the detection members 45 , 46 have spindles 50 , 51 and concentric gear units 54 , 55 . furthermore , a coupling pin 56 at the disc detection member 45 of the left side and a coupling pin 57 at the disc detection member 46 of the right side are arranged respectively . at the lower surface side of both disc detection members 45 , 46 , inclined ribs 58 , 59 are provided which incline so as to gradually increase in height when progressing downward from the vicinity of each gear unit 54 , 55 towards the vicinity of each coupling pin 56 , 57 . moreover , elastic pieces 60 , 61 are provided in the vicinity of the inclined ribs 60 , 61 , and always elastically crimped at the lower surface of the first mounting unit 29 so that the generation of rattle noise by the vibration of detection members 45 , 46 can be prevented . the pair of partial gears 47 , 48 is mounted with the ability to rotate freely between both disc detection members 45 and 46 of the upper surface of the second mounting unit 28 through spindles 62 , 63 . each partial gear , 47 , 48 has concentric first gear units 64 , 65 , second gear units 66 , 67 , and hooks 68 , 69 ; and the second gears 66 , 67 are mutually engaged , and each first gear unit 64 , 65 is respectively engaged to the gear units 54 , 55 of each disc detection member 45 , 46 . further , the coil spring 49 is hung between each hook 68 , 69 and the second mounting unit 28 ; and the detection units 52 , 53 of both disc detection members 45 , 46 are energized in a direction to become closer to each other . in addition , in each partial gear 47 , 48 , recessed units 70 , 71 with one cog lacking are provided at each end of the first gear units 64 , 65 , and salient units 72 , 73 which overlap with each gear unit 54 , 55 are provided at the disc detection members 45 , 46 . the width measurement of the salient units 72 , 73 is set to be sufficiently wider than the cog width of the gear units 54 , 55 , and when a disc is not inserted , the recessed units 70 , 71 and salient units 72 , 73 can be mutually interlocked . these recessed units 70 , 71 and salient units 72 , 73 are used as a guide for alignment in order to easily attach both disc detection members 45 , 46 and the partial gears 47 , 48 to the second mounting unit 28 and the first mounting unit 29 . further , because the load at the start is received by the salient units 72 , 73 , in order to enhance the strength of the gear units 54 , 55 , there is no need to go to the trouble of using an expensive material or increase the thickness of the cogs . the disc size determination mechanism 7 comprises a reciprocating member 74 which is the large disc detection means , a rotating member 75 which is the latching means , a locking member 76 , and a spring 77 for energizing in order to rotate the rotating member 75 . the disc size determination mechanism 7 is loaded at the lower surface side of the first mounting unit 29 at the left back location in the drawing of the disc detection mechanism 6 . the reciprocating member 74 is formed in a slender plate , and arranged so that the lengthwise direction is directed towards the disc insert / eject direction . the reciprocating member 74 at the front end has a long hole 78 which is at a right angle to the disc insert / eject direction , and the coupling pin 56 of the disc detection member 45 is engaged into the long hole 78 , and operates with rotation of the disc detection member 45 , and reciprocates in the disc insert / eject direction . further , the reciprocating member 74 projects a cylindrical pin 79 upward in the vicinity of the rear end , and , on the rear surface , also has a thin wall 80 that extends the entire length in the lengthwise direction . the thin wall 80 regulates excessive bias in the left direction of the disc at the time of disc insertion and ejection . the rotating member 75 is attached on the lower surface of the first mounting unit 29 through a spindle 81 with the ability to rotate freely at the back location in the drawing of the reciprocating member 74 , and energized in the counterclockwise direction by the spring 77 . this rotating member 75 is also formed in a slender plate , and arranged so that the lengthwise direction is directed towards the disc insert / eject direction with a long opening in the lengthwise direction . furthermore , the rotating member 75 provides a hook 82 at the front end , and further provides a first latching unit 83 for latching a large disc at the middle of the right surface , and a second latching unit 84 for latching a small disc at the front end of the right surface respectively . moreover , in the opening described above , a cam surface 85 which inclines to increase the height from nearly the center towards the back is provided at the left side surface , and a third latching unit 86 for latching the pin 79 is also provided at the right side surface . the locking member 76 is axially supported with the ability to rotate freely at the lower surface of the first mounting unit 29 , and which has a pressed wall 87 which extends from the vicinity of the rotation axis to the front , and a cylinder 88 located at the furthest position from the rotation axis and to the left side of the rotation axis , and a space where the hook 82 of the rotating member 75 can enter appropriately is provided between the pressed wall 87 and the cylinder 88 . fig6 is a top plane view showing the disc positioning mechanism 8 and the clamping mechanism 9 . as shown in fig6 , the disc positioning mechanism 8 comprises a pair of right and left stopper members 89 , 90 which is the stopper means , a trigger member 91 which is the disc loading detection means , and an energizer spring , which is not illustrated , for energizing by rotating the right side stopper member 90 in the clockwise direction in the drawing . the disc positioning mechanism 8 is arranged at the back side of the clamp mechanism 9 . the pair of right and left stopper members 89 , 90 constituting stopper means is mounted with the ability to rotate freely at the spindles respectively , in other words , at the lower surface side of the first mounting unit 29 through a rotating member attachment mechanism 247 which will be described hereafter . both stopper members 89 , 90 have spindles and concentric gear units 94 , 95 , and which are composed so as to rotate by engaging those gear units 94 , 95 in mutual synchronization . the gear units 94 , 95 are thicker than other parts in order to increase the strength , and the thickened portion is shown within an arc hole 96 provided in the first mounting unit 29 ( refer to fig1 ). both stopper members 89 , 90 provide stopper units 97 , 98 constituting common stoppers enabled to contact with either a large disc d 1 or a small disc d 2 inserted . both stopper units 97 , 98 are formed in nearly a cylindrical shape projected downward and located in the disc feeding path . further , each of the stopper members 89 , 90 provide pressed units 99 , 100 used for a large disc , pressed units 101 , 102 used for a small disc , and elastic pieces 103 , 104 respectively . each elastic piece 101 , 102 is crimped at all times at the lower surface of the first mounting unit 29 , and which prevents the generation of a rattle noise by the vibration of each of the stopper members 89 , 90 . at the left side of the stopper member 89 , a first latch receiving unit 105 and a recess shaped second latch receiving unit 106 is further provided . in addition , the stopper members 89 , 90 are energized in the direction having the stopper units 97 , 98 coming closer to each other by the energized springs which are not illustrated . the trigger member 91 is nearly t shaped , and the lower end of the vertical piece thereof is mounted at nearly the center of the lower surface of the stopper member 90 through a spindle 107 . further , one end of the horizontal piece of the t shape is a disc contact unit 108 , and a pressing unit 109 protruding downward is provided at the other end . the clamping mechanism 9 comprises a damper 110 , a damper releasing means 112 composed of a pair of linking mechanisms 111 arranged bilaterally - symmetric across the axial center line of the damper 110 , and a driving means 113 . the damper 10 , as shown in fig7 , comprises a damper member 114 made of a synthetic resin , a magnetic plate 115 which is the magnet yoke embedded in the turntable 13 , and a felt 116 applied to the upper surface of the magnetic plate 115 . the damper member 114 provides a flat surface unit 117 where the upper surface center is low for only that thickness of the magnetic plate 115 , a plurality of protrusions 118 arranged equiangularly in a circumferential direction at this flat surface unit 117 , and a center hole 119 . further , the outer circumference surface is a taper surface 120 which becomes a proportionally narrower diameter as progressing downward ( refer to fig2 ). meanwhile , the magnetic plate 115 is nearly a triangle shape , and which has a semi - hit unit 121 which protrudes downward so as to engage with the center hole 119 of the damper member 114 and the small holes 122 which have the same number of protrusions 118 . further , after the protrusions 118 of the damper member 114 are inserted into the small holes 122 respectively and placed on the flat surface unit 117 , the tip ends of the protrusions 118 are flattened and attached to the damper member 114 . in addition , the method for attaching the damper member 114 and the magnetic plate 115 is not limited to that described above , and a binding material may be used , or ultrasonic welding may be used . the felt 116 can be pasted on the upper surface of the semi - hit unit 121 directly if the adhesive sheet is pasted on the lower surface . the thickness of the felt 116 is set to be slightly higher than the upper surface of the damper 114 and the magnetic plate 115 . each of the linking mechanisms 111 comprises a damper releasing member 123 , a front linking member 124 , and a rear linking member 125 as shown in fig8 . the releasing member 123 extends a pair of mutually parallel arms 127 from the salient surface side of a circular arc unit 126 , and the recessed surface side of the circular arc unit 126 is the taper surface 128 which becomes a proportionally narrower diameter as progressing downward . the front linking member 124 is constructed so that one end of a pair of legs 129 is coupled with the cylinder 130 and both legs 129 are mutually parallel ; and the other end of each of the legs is mounted with the ability to rotate freely at the inner surface of each arm 127 and in the vicinity of the circular arc unit 126 through a metallic rotation or rotational axis 131 . further , the rear linking member 125 is also constructed so that one of each end of a pair of legs 132 is coupled with the cylinder 133 and both legs 132 are mutually parallel ; and the other end unit of each leg 132 is mounted with the ability to rotate freely at the inner surface of each arm 127 and the vicinity of the end unit through the metallic rotation axis 131 . the link span between the front linking member 124 and the rear linking member 125 are the same . in addition , the “ link span ” here indicates a space between the rotation axial line in relation to the upper frame 5 and the rotation axial line in relation to the releasing member of the front or rear linking member 124 , 125 . the linking member 111 constituted in such manner is attached to the lower surface of the first mounting unit 29 through a nearly rectangular parallelepiped base 134 and a sheet metal 135 making a rectangular attachment plate . the base 134 has grooves 136 , 137 which are parallel to each other at both ends of the upper surface , and a fixed axis 138 which is circumferentially segmented in four directions is provided in a protruded manner between both grooves 136 , 137 . the sheet metal 135 is constituted so that the right and left edges are bent upwards once and bent horizontally outward along the way and making these as pressing units 139 , 140 , and a large hole 141 is provided in the middle area . as shown in fig9 , after each of the cylinders 130 , 133 of the front linking member 124 and rear linking member 125 are engaged in the grooves 136 , 137 of the base 134 with the ability to revolve freely , the sheet metal 135 is superimposed on the upper surface of the base 134 , and then , the pressing units 139 , 140 of the sheet metal 135 are laid on each of the cylinders 130 , 133 . subsequently , the fixed axis 138 of the base 134 is engaged into the attachment hole provided at the first mounting unit 29 through the large hole 141 of the sheet metal 135 , and the linking mechanism 111 is attached at the lower surface of the first mounting unit 29 . the driving means 113 , as shown in fig6 , is arranged between the damper releasing means 112 and the disc position mechanism 8 , and which comprises a pair of right and left transferring members 142 , 143 , and a pair of right and left synchronizing gears 144 , 145 . both transferring members 142 , 143 are slender , and the lengthwise direction is facing an orthogonal direction in relation to the disc insert / eject direction , while being arranged laterally symmetrical on the same straight line , and mounted at the lower surface of the first mounting unit 29 with the ability to transfer in the lengthwise direction . further , the synchronizing gears 144 , 145 are mounted on the lower surface of the first mounting unit 29 between both transferring members 142 , 143 . each of the transferring members 142 , 143 has pressing pieces 146 , 147 and racks 148 , 149 in the vicinity of one end adjacent to each other , and each of the racks 148 , 149 are engaged to the corresponding synchronizing gears 144 , 145 respectively so as to move synchronizing in reverse direction from each other . and then , when both transferring members 142 , 143 move in the separating direction , the pressed units 99 , 100 used - for a large disc or pressed units 101 , 102 used for a small disc of the stopper members 89 , 90 are pressed by the pressing pieces 146 , 147 so that the left side stopper member 89 can rotate in the clockwise direction , and the right side stopper 90 can rotate in the counterclockwise direction in a synchronized motion . further , in the vicinity of the other end of each of the transferring members 142 , 143 , first pressing units 150 , 151 which lower the releasing member 123 by pressing the leg 132 of each of the rear linking member 125 at the time of moving in the separating direction , and second pressing units 152 , 153 which raise the releasing member 123 by pressing the leg 132 at the time of moving towards each other are provided . furthermore , a pressing unit 154 is also provided at the left side transferring member 142 , for rotating the locking member 76 in the clockwise direction in fig6 by pressing the pressed wall 87 of the locking member 76 at the time of moving in the separating direction . moreover , an engagement protrusion 155 is formed at the lower surface of the other end unit of the right transferring member 143 . the loading mechanism 10 comprises , as shown in fig1 , an activating means 156 , a power transfer mechanism 157 , a feeding means 158 , a detection means 159 , and the loading mortar 41 . the activating means 156 comprises a sliding member 160 arranged at the right back area of the lower surface of the first mounting unit 29 , and a guidance rack plate 161 arranged at the right center area of the lower surface of the first mounting unit 29 , and both of them have the ability to move in the disc insert / eject direction . the sliding member 160 is a thin plate made of synthetic resin , and the pressed unit 162 is formed at the lower surface side , and the pressed unit 162 slides in the disc eject direction pressed by the pressing unit 109 of the trigger member 91 . further , a protruding unit 163 which protrudes downward is provided at the right edge in the drawing . the guidance rack plate 161 is a thin plate made of synthetic resin in the shape of a crank , and which has a rack 164 at the lower edge of the bottom portion within the drawing and a hook 165 near the center area ( refer to fig1 ). when the sliding member 160 slides towards the disc eject direction , the top end in the drawing is pressed by the protruding unit 163 of the sliding member 160 , and moves in the same direction , and this makes the rack 164 engage with the power transfer mechanism 157 . the power transfer mechanism 157 is based on gear groups , and which comprises a lower gear group 44 mounted on the interior surface of the right side plate 24 of the lower frame 11 , an upper gear group 166 mounted on the interior surface side of the right panel 19 of the upper frame 5 , and a gear plate 167 ( refer to fig1 ). further , the lower gear group 44 is mounted in the back half of the right side plate 24 of the lower frame 11 , in other words , at the lower half of the side plate ; and the upper gear group 166 is mounted at the front half of the right side plate 19 of the upper frame 5 , in other words , mounted at the upper half of the side plate directly or through the gear plate 167 . the lower half of the side panel and the upper half of the side panel are interlocked as shown in fig1 , and the lower gear group 44 and the upper gear group 166 are mesh connected . the feeding means 158 is driven by the loading motor 41 through the power transfer mechanism 157 . the lower gear group 44 comprises a first gear 168 , a second gear 169 , and a third gear 170 which are all axially supported at the interior surface of the right side plate 24 of the lower frame 11 . these are all two - step gears , and the first gear 168 is engaged with the worm gear 43 by having the large gear of the first step as the helical gear . a large gear which is the first step of the second gear 169 is engaged to a small gear which is the second step of the first gear 168 , and a large gear which is the first step of the third gear 170 is engaged with a small gear which is the second step of the second gear 169 , so that the rotation of the loading motor 41 can be slowed in stages . the upper gear group 166 , as shown in fig1 , comprises a fourth gear 171 , a fifth gear 172 , a sixth gear 173 , and a seventh gear 174 which are all two - step gears . the fourth gear 171 and the fifth gear 172 are axially supported directly in the interior surface of the right side plate 19 ; however the seventh gear 174 together with the gear plate 167 are axially supported in the interior surface of the right side plate 19 through the mutual spindle 175 ; and sixth gear 173 is axially supported at the gear plate 167 , and the large gear which is the second step is engaged at all times with the small gear which is the first step of the seventh gear 174 . the large gear which is the first step of the fourth gear 171 is engaged with the small gear which is the second step of the fourth gear 171 so that the rotation of the third gear 170 can be further slowed in stages and transferred to the fifth gear 172 . the small gear which is the first step of the sixth gear 173 has the ability to detach in relation to the large gear which is the first step of the fifth gear 174 , so that the rotation of the fifth gear 172 can be transferred to the seventh gear 174 by increasing the speed at the sixth gear 173 at this time . further , the worm gear 43 loaded on the loading motor 41 , first gear 168 , second gear 169 , third gear 170 , fourth gear 171 , and fifth gear 172 constitute an operation means . the gear plate 167 is a metallic plate , and the right end in fig1 is bent inward making a slide contact receiving unit 176 , and an engaging pin 177 is provided near the center in the drawing . the gear plate 167 , the engaging pin 177 , and the sixth gear 173 which is axially supported to the gear plate 167 , constitute a clutch means which suitably interrupts the power transfer path between the operation means and a roller 178 . the feeding means 158 , as shown in fig1 , comprises the roller 178 , a roller supporter 179 , a slider 180 to control the roller position , a cam plate 181 , and the disc guide 32 . the roller 178 is constituted by inserting a metallic roller axis 184 into a pair of taper cylinders 182 , 183 made of synthetic rubber which gradually becomes smaller in size from the outer end to the inner end . both ends of the axis 184 protrude from the outer end of the taper cylinders 182 , 183 , and a small collar 185 is attached at one end of the protruding axis 184 , and a large collar 186 and a roller gear 187 are attached at the other end . the cog width of the roller gear 187 is about 2 mm , and at the outer surface of the cogs , a cylindrical collar 188 is placed . the roller supporter 179 is made of a metallic plate , and has right and left side panels 190 which are formed by bending upward at the right and left ends of a flat plate 189 which is laterally long , and these right and left side panels extend from the flat plate 189 to the back . the right and left side panels 190 have a shaft hole 191 at nearly the middle area respectively , and each shaft hole 191 is inter - fit into the axis not illustrated that protrudes to the interior surfaces of the right and left side panels 18 , 19 on the frame 5 , and is mounted with the ability to rotate freely vertically between both side panels 18 , 19 . further , the small collar 185 and the large collar 186 are supported respectively by the extended portion of the right and left side panels 190 , and the roller 178 is supported with the ability to rotate freely . the rear edge of the flat plate 189 is a mountain fold edge 192 which is bent towards the reverse surface . this mountain fold edge 192 is also a v shape recess which is nearly bilaterally symmetric in the drawing of the flat plate ; however the inclined angle is about 1 degree which is very slight in relation to the shaft center line of the roller . furthermore , a pair of right and left curved units 193 , which are bent upward , is provided at the front edge of the flat plate 189 . when the roller 178 is placed at the lower side , in other words , the disc is inserted into the playback position , these curved units 193 are placed at the upper side to plug the disc insertion port 2 and prevent a double disc insertion . in addition , the roller supporter 179 is energized at all times in the direction where the roller 178 is raised by the spring which is not illustrated . as shown in fig1 , the slider 180 is a slender form and is mounted on the lower surface of the first mounting unit 29 by directing the lengthwise direction to the disc insert / eject direction with the ability to move in the disc insert / eject direction . this slider 180 has a sliding contact unit 194 at the front end in the drawing with a protruding unit at the rear side , and has an inclined surface 195 constituting a protruding cam as the roller separation unit where the front edge inclines downward as progressing to the rear side , and a cam groove 196 as the power interruption unit at the further rear side on the right side surface . the engaging pin 177 of the gear plate 167 is inserted into the cam groove 196 . at the further rear side of the cam groove 196 , a rack unit 197 is provided ; and at the left side unit of the rear end in the drawing , an engaging unit 198 which protrudes downward is provided . the rack unit 197 selectively engages with a small gear which is the second step of the fifth gear 172 . in addition , the cam groove 196 is provided in the slider 180 , and the engaging pin 177 is provided on the gear plate 167 with the present embodiment ; however , it is not limited to that described above , and the pin may be provided in the slider and the cam groove may be on the plate . the cam plate 181 is mounted on the lower surface of the first mounting unit 29 , and a cam groove 199 is provided at the front half in the drawing . the cam groove 199 is formed to extend in the disc insert / eject direction , and the middle area is made to be an inclined unit which inclines to the right side as it progresses to the rear , and the engaging protrusion 155 of the transferring member 143 is inserted into the cam groove 199 . the front right side wall of the cam groove 199 is composed of an elastic piece 200 which extends to the front side in the drawing , and a stopper 201 is provided at the tip of the elastic piece 200 . further , in the deepest area in the drawing , a prismatic shaped second switch pressing unit 202 protrudes downward . furthermore , at the right side of the front end of the cam plate 181 in the drawing , a hole which is not illustrated is provided for inserting the engaging unit 198 of the slider 180 so that the cam plate 181 can move integrally with the slider 180 . moreover , a spring which is not illustrated is attached in the space with the guidance rack plate 161 so that the cam plate 181 can follow when the guidance rack plate 161 is moved by the spring energizing force . in addition , the cam plate 181 stably maintains a termination location before and after movement by a reversal spring which is not illustrated . the disc guide 32 comprises the second mounting unit 28 of the upper frame 5 and four guiding projections 203 ( only one of them is illustrated ). each guiding projection 203 is attached at the lower surface of the second mounting unit 28 where the lengthwise direction is orthogonal to the disc insert / eject direction and mutually paired laterally by positioning at the near side and far side of the roller 178 . a bulging unit 204 where the front half of the rectangular region of the center is bulged downward , is provided in the second mounting unit 28 , and a plurality of positioning holes 205 are provided at the right and left thereof in order to mount each guiding projection 203 respectively . the positioning holes 205 are formed by connecting a small circular hole 206 and a large circular hole 207 , and the large circular hole 207 side is directed towards the bulging unit 204 . each of the guiding projections 203 having the large heads provides engaging protrusions 208 in the same number as each of the positioning holes 205 . a surface ( lower surface ) that contacts with the disc of each guiding projection 203 is inclined so as to incline upward as it progresses to the center area from the lateral end of the mounting unit 28 ( moving away from the shaft center line of the roller 178 ) in a mounted state to the lower surface of the second mounting unit 28 . in addition , each of the guiding projections 203 are composed of synthetic resins and all of them are identical forms and sizes . in the attaching of each of the guiding projections 203 , first , a plurality of engaging protrusions 208 are inserted through from the large circular holes 207 side of each of the positioning holes 205 . and then , when the engaging protrusions 208 are moved to the small circular hole 206 side by sliding the guiding protrusions 203 outward while pressing against the lower surface of the second mounting unit 28 , the large size heads of the engaging protrusions 208 move to the small circular hole 206 side , the engaging protrusions 208 are prohibited from slipping out from the positioning holes 205 , and the guiding projections 203 are mounted on the lower surface of the second mounting unit 28 . the detection means 159 , as shown in fig1 , comprises a position detection member 209 and an actuator 210 which are arranged at the front right side in fig1 . the position detection member 209 , as shown in fig1 , is arranged on the lower surface side of the first mounting unit 29 while the lengthwise direction is directed to the disc insert / eject direction , and which has a wall which protrudes upward in the left side area in the drawing of a prismatic shaped body 211 , and a coupling piece 213 having a long hole 212 extending to the left side is provided at the top surface of the wall . the body 211 provides a first switch pressing unit 214 to press the first switch 35 , a third switch pressing unit 215 to press the third switch 37 , and a fourth switch pressing unit 216 to press the fourth switch 38 which are arranged at the circuit substrate 16 . the position detection member 209 is mounted on the lower surface of the slider 180 with the ability to freely move in the disc insert / eject direction , and which inserts the coupling pin 57 of the disc detection member 46 into the long hole 212 and moves in the disc insert / eject direction by interlocking with the rotation of the disc detection member 46 . the actuator 210 has a spindle hole 217 at the front side in the drawing and is axially supported at the right side panel 19 of the upper frame 5 with the ability to rotate freely by inserting the supporting axis ( indicated by the virtual line ) of the roller supporter 179 to this hole 217 . a fifth switch pressing unit 218 is formed at the back side in the drawing to press the fifth switch 39 ( refer to fig4 ). further , a vertically long loop unit 219 is provided at the front side of the switch pressing unit 218 in the drawing . within this loop unit 219 , the collar 188 of the roller 178 is inserted . in order for the actuator 210 to share the supporting axis with the roller supporter 179 , the spindle hole 217 needs to be located more to the front side than the roller 178 ; and because the fifth switch pressing unit 218 also needs to be located more to the back side than the roller 178 in order to press the fifth switch 39 located further to the back than the roller 178 , the loop unit 219 which shows the collar 188 arranged at the roller axis 184 is provided so that the actuator 210 does not interfere with the roller axis 184 . further , a torsion spring which is not illustrated is hung between the roller supporter 179 and the actuator 210 , and when the roller supporter 179 starts rotating by inserting a disc , the actuator 210 also follows and starts rotating so that the fifth switch 39 is pressed by the fifth switch press unit 218 . as shown in fig4 , the pickup unit 15 comprises a turntable 13 having a built - in magnet , a pickup 14 to playback or record the disc , a feed motor means 220 to drive the pickup 14 , a pickup support means 221 to support the pickup 14 , and a pickup chassis 222 for carrying these . the pickup chassis 222 made of a metallic plate has a large opening 223 at the center , and the turntable 13 , pickup 14 , and the feed motor means 220 are arranged together to the inside of the large opening 223 . at the three locations around the chassis 222 , a damper attachment 224 is provided in which a portion is opened and is formed by stepped bend processing . the turntable 13 is attached to the right lower area of the pickup chassis 222 in the drawing , and the center of the turntable 13 becomes nearly the center of the mechanism unit 1 of the disc player . the pickup 14 is arranged within the large opening 223 with the ability to reciprocate between the vicinity of the turntable 13 and the upper area of the pickup chassis 222 diagonally in the drawing . this pickup 14 is attached to the pickup chassis 222 through the pickup support means 221 . the feed motor means 220 comprises a feed motor 227 providing a feed screw 226 having spiral grooves , and a motor support plate 228 to support those . the motor support plate 228 fixes the feed motor 227 at one end , and supports the tip of the feed screw 226 at the other end with the ability to revolve freely ; and the feed screw 226 is attached on the rear side of the pickup chassis 222 accommodating the moving direction of the pickup 14 . the pickup support means 221 comprises a main - guide 229 and a sub - guide 230 arranged so as to be parallel to each other , a main - guide tracking adjustment means 231 and a sub - guide tracking adjustment means 232 , and a pickup feed plate 233 . because the location of one end of the main - guide 229 is fixed on the lower surface side of the pickup chassis 222 , the main - guide tracking adjustment means 231 exclusively adjusts the tracking by only the other end of the main - guide 229 . the main - guide tracking adjustment means 231 , as shown in fig1 , comprises a coil spring 234 to energize the main - guide 229 in the tracking direction at a uniform elastic force , an adjusting plate 235 made of a blade spring to receive the elastic force of the spring 234 by the opposite side of the main - guide 229 to regulate the tracking direction movement of the main - guide 229 , and a main - guide adjust screw 237 which is screwed into the rear surface of the pickup chassis 222 via a through hole 236 ( refer to fig1 ) provided at a portion of the adjusting plate 235 . the adjusting plate 235 has a three - staged flat surface which includes , in order from the top of the drawing , an upper stage 238 , a middle stage 239 , and a lower stage 240 . the upper stage 238 is fixed to the lower surface side of the pickup chassis 222 , and the lower stage 240 is attached to the main - guide 229 from the lower side so that the main - guide 229 can be supported . as shown in fig1 , the middle stage 239 has a hole 241 resembling a u shape for providing flexibility to the area connected with the upper stage 238 , and further has the through hole 236 at in an area near to the lower stage 240 . adjustment of the main - guide 229 in the tracking direction is performed by moving the main - guide 229 in the vertical direction in fig1 through fastening / loosening of the main - guide adjust screw 237 . the sub - guide tracking adjustment means 232 , as shown in fig1 , comprises a pair of right and left sub - guide supporting plates 242 to support both ends of the sub - guide 230 , a pair of right and left compressed springs 243 arranged at both ends of the sub - guide 230 , a pair of right and left sub - guide adjust screws 244 screwed into the rear surface side of the pickup chassis 222 by passing through the hole provided at the sub - guide supporting plate 242 . one end of both sub - guide supporting plates 242 is bent upward respectively in the drawing , and the tip of the sub - guide 230 is fit together and supported by insertion into the hole provided at the bending member . further , the adjust screw 244 is inserted through the compressed spring 243 between the pickup chassis 222 and the sub - guide supporting plate 242 . the adjustment of the sub - guide 230 in the tracking direction is performed by moving the sub - guide 230 vertically by fastening / loosening each of the sub - guide adjust screws 244 . further , with the pickup feed plate 233 , as shown in fig4 , one end is fixed at the pickup 14 , and a screw head 246 formed by cut - bending is provided at the other end , and then the screw head 246 is engaged in the spiral groove of the feed screw 226 . by so doing , the power of the feed motor 227 is transferred to the pickup feed plate 233 from the feed screw 226 , and the pickup 14 is driven by the power of the feed motor 227 . a rotating member attachment mechanism 247 comprises a supporting member 248 and a fixing member 249 as shown in fig1 . both the supporting member 248 and the fixing member 249 are formed of synthetic resin . the supporting member comprises a circular shaped plate 250 , a support cylinder 251 , and a fixing tube 252 as shown in fig1 . the support cylinder 251 protrudes on one surface of the circular shaped plate 250 and on the same axis with a circular center hole 253 of the circular shaped plate 250 ; and the fixing tube 252 which protrudes longer than the support cylinder 251 on one surface of the circular shaped plate 250 by connecting to the circular center hole 253 . the fixing tube 252 has a taper surface 254 at the inner circumference of the top end which reduces in size to a smaller diameter towards the top end , and which also is circumferentially segmented in four directions . the taper surface 254 is formed further to the front of the inner circumference than the top end of the support cylinder 251 . the fixing member 249 , as shown in fig1 , comprises a pressing unit 255 and an end plate 256 provided at the rear anchor of the pressing unit 255 . the pressing unit 255 forms a cylindrical shape , and the top rim is a tapered slide contact rim 257 which is inserted into the fixing tube unit 252 through the circular center hole 253 of the circular shaped plate 250 . the spindles 50 , 51 , 62 , 63 in fig5 and the spindle 107 in fig6 may also mount both disc detection members 45 , 46 , both partial gears 47 , 48 , and both stopper members 89 , 90 to the first mounting unit 29 as shown in fig3 by the rotating member attachment mechanism 247 . likewise , the trigger member 91 may be mounted to the second mounting unit 28 . fig1 shows an example of the attachment method of the rotating components by the rotating member attachment mechanism 247 to describe how the stopper member 89 is mounted to the first mounting unit 29 of the upper frame 5 . as shown in fig1 , first , the support cylinder 251 is engaged to the hole provided in the stopper member 89 . next , the portion longer than the support cylinder 251 of the fixing tube 252 is engaged to a circular fixing hole 258 provided in the first mounting unit 29 . when the pressing unit 255 of the fixing member 249 is engaged into the fixing tube 252 while the slide contact rim 257 of the pressing unit 255 contacts with the taper surface 254 of the fixing tube unit 252 , and in that state the fixing member 249 is compressed until the end plate 256 is attached to the circular shaped plate 250 , the taper surface 254 is pressed by the slide contact rim 257 , and the top end of the fixing tube unit 252 slightly rolls back outward . by so doing , the top end of the fixing tube 252 is extended outward further than the circular fixing hole 258 of the first mounting unit 29 , and the supporting member 248 is fixed tightly to the first mounting unit 29 , and the stopper member 89 is mounted with the ability to freely rotate in relation to the first mounting unit 29 . an operation of the mechanism unit 1 of the disc player is described hereafter . first , a description will be given of the operation until a disc inserted from the disc insertion port 2 is loaded into the playback position . fig2 shows the state in which a large disc d 1 or a small disc d 2 is inserted from the disc insertion port 2 between the detection units 52 , 53 of the disc detection member 45 , 46 and the circumference of the disc makes contact with both detection units 52 , 53 . from this state , as shown in fig2 , when the disc is inserted while expanding the interval between the detection units 52 , 53 by pushing the disc , the disc detection members 45 , 46 start rotating . the disc detection member 45 of the left side is connected to the reciprocating member 74 , and the disc detection member 46 of the right side is connected to the position detection member 209 , so if both disc detection members 45 , 46 rotate in a direction which causes the corresponding detection units 52 , 53 to separate , then the reciprocating member 74 and the position detection member 209 move to the disc insert = direction . when the position detection member 209 moves to the disc insert direction , first , the fourth switch pressing unit 216 of the member 209 presses the fourth switch 38 to turn on . when the position detection member 209 further moves to the disc insert direction , the first switch pressing unit 214 of the member 209 presses the first switch 35 to turn on , and the motor 41 is activated by detecting the disc insertion . the rotation of the motor 41 is transferred to roller 178 through the power transfer mechanism 157 , and the roller 178 starts rotating in the clockwise direction in fig1 . when the disc is inserted between the roller 178 and the guide projection 203 ( refer to fig1 ) of the disc guide 32 , the roller 178 is pushed downward by the disc , and the roller supporter 179 barely rotates in the clockwise direction in fig1 centering around the shaft hole 191 . while the roller 178 is pressed downward , the actuator 210 also rotates in the clockwise direction in fig1 by the energizing force of the spring not illustrated which is placed through the space with the actuator 210 , the fifth switch pressing unit 218 presses the fifth switch 39 . by so doing , the fifth switch 39 turns on and the insertion of the disc is detected . the disc is clamped by the roller 178 and the disc guide 32 and fed by the rotation of the roller 178 . fig2 shows the state in which a large disc d 1 or small disc d 2 is fed by the roller 178 , and the center of the disc arrives between both detection units 52 , 53 . first , when a small disc d 2 is inserted , even if the center of the small disc d 2 arrives between both detection units 52 , 53 , the pin 79 will not reach to the cam surface 85 of the rotating member 75 because the rotation amounts of both disc detection members 45 , 46 are small and the moving amounts of the reciprocating member 74 are also small . further , because the displacement of the position detection member 209 is also small , the third switch pressing unit 215 does not move to the position of the third switch 37 , so the third switch 37 maintains the off state . meanwhile , when a large disc d 1 is inserted , both disc detection members 45 , 46 rotate in large measure before the center of the large disc d 1 arrives between both detection units 52 , 53 . therefore , the reciprocating member 74 moves a large amount , and the pin 79 slides and makes contacts with the cam surface 85 of the rotating member 75 causing the member 75 to rotate in the clockwise direction in the drawing . further , the displacement of the position detection member 209 is also large , and the third switch 37 turns on by the third switch pressing unit 215 . when feeding of a disc further proceeds from the state of fig2 , when a small disc d 2 is inserted , both disc detection members 45 , 46 recover to the initial position prior to insertion of the disc while the detection members 45 , 46 slide and make contact with the circumference surface of the small disc d 2 due to the energizing force of the coil spring 49 . the circumference surface of the small disc d 2 makes contact with the disc contact unit 108 of the trigger member 91 causing the trigger member 91 to rotate in the clockwise direction . by this rotation , the pressing unit 109 of the trigger member 91 presses the pressed unit 162 of the slide member 160 causing the slide member 160 to move in the disc eject direction . further , as shown in fig2 , the small disc d 2 slightly pushes the disc contact unit 108 causing the circumference surface to make contact with each of the stopper units 97 , 98 of both stopper members 89 , 90 . at this time , the left side stopper member 89 latches the first latch receiving unit 105 to the second latching unit 84 of the rotating member 75 , so the left side stopper member 89 is prohibited from turning in the clockwise direction and the right side stopper member 90 is prohibited from turning in the counterclockwise direction , and the small disc d 2 is fed slightly farther in than the preset loading position until contacting with both stopper units 97 , 98 and stops . on the other hand , when a large disc d 1 is inserted , the feeding process continues from the state in fig2 until the circumference surface makes contact with each of the stopper members 97 , 98 , and because the rotating member 75 rotates in the clockwise direction in the drawing as the cam surface 85 thereof is pressed by the pin 79 of the reciprocating member 74 , the first latch receiving unit 105 of the stopper member 89 is not latched to the second latching unit 84 , and the stopper units 97 , 98 of both stopper members 89 , 90 rotate in a direction to mutually separate by being pressed by the circumference surface of the large disc d 1 . further , the large disc d 1 pushes both stopper units 97 , 98 by the circumference surface , and at the same time also pushes the disc contact unit 108 of the trigger member 91 causing the trigger member 91 to rotate in the clockwise direction in relation to the stopper member 90 . by so doing , the pressing unit 109 of the trigger member 91 presses the pressed unit 162 of the sliding member 160 causing the sliding member 160 to move in the disc eject direction . as feeding of the large disc d 1 further progresses , as shown in fig2 , the left side stopper member 89 is latched to the first latching unit 83 of the rotating member 75 of the second latch receiving unit 106 of the left side stopper member 89 . accordingly , both stopper members 89 , 90 are prohibited from further rotation , and the large disc d 1 contacts both stopper units 97 , 98 and stops when the disc d 1 is fed to the preset loading position . in this process , both disc detection members 45 , 46 only slightly return with the reciprocating member 74 while sliding and contacting the detection members 45 , 46 to the circumference surface of the large disc d 1 by the energizing force of the coil spring 49 ; however , both disc detection members 45 , 46 are prohibited from returning thereafter together with the reciprocating member 74 because the pin 79 of the reciprocating member 74 is latched to the third latching unit 86 of the rotating member 75 . moreover , even in the case where either a large disc d 1 or a small disc d 2 is inserted , when the sliding member 160 is moved in the disc eject direction pressed by the trigger member 91 , the guidance rack plate 161 together with the sliding member 160 moves to the disc eject direction , as shown in fig1 and fig1 , and the rack 164 of the guidance rack plate 161 is engaged with the small gear of the fifth gear 172 . at this time , the fifth gear 172 is already rotating receiving the driving force of the motor 41 , so the guidance rack plate 161 moves to the disc eject direction by the driving force of the motor 41 . then , the cam plate 181 follows by the energizing force of the spring not illustrated hung across the guidance rack plate 161 and the cam plate 181 , and the slider 180 which moves integrally with the cam plate 181 moves to engage the rack unit 197 with the small gear of the fifth gear 172 . in this manner , the slider 180 moves in the disc eject direction by the power of the motor 41 . the engaging pin 177 of the gear plate 167 is inserted to the cam groove 196 of the slider 180 ; therefore , the engaging pin 177 moves with the cam groove 196 by the movement of the slider 180 . then , the gear plate 167 rotates in the counterclockwise direction centering the spindle 175 as shown with the virtual line in fig1 , and the sixth gear 173 supported axially by the gear plate 167 separates from the fifth gear 172 . in this way , the power transfer path from the motor 41 throughout the roller 178 is interrupted and the rotation of the roller 178 stops . in other words , when a disc contacts both stopper units 97 , 98 , the rotation of the roller 178 stops immediately ; therefore , there is no useless rotation while the roller 178 is in contact with the disc , and there is no fear of damaging the data recording surface of the disc by the rotation of the roller 178 . meanwhile , because the driving force of the motor 41 continues to be transferred to the fifth gear 172 ; the slider 180 engaged with the fifth gear 172 moves further to the disc eject direction causing the clutch means to switch to the interruption side . in other words , the roller 178 is separated from the disc ( refer to fig1 ) contacting the inclined surface 195 of the slider 180 to the large collar 186 of the roller 178 . at this time , the roller supporter 179 rotates in the clockwise direction in the drawing centering the shaft hole 191 while opposing the energizing force of the spring not illustrated which is hung across between the actuator 210 . when the slider 180 moves to the disc eject direction , the cam plate 181 also moves integrally ; however , as shown in fig6 , before the cam plate 181 moves , the engaging protrusion 155 of the right side transferring member 143 is located at the foremost position in the drawing within the cam groove 199 of the cam plate 181 . from this state , when the cam plate 181 moves to the disc eject direction , the engaging protrusion 155 moves to the furthermost area along the cam groove 199 as shown in fig2 , and thereby , the right side transferring member 143 moves to the right side in the drawing , and the left side transferring member 142 moves synchronously to the left side . as described above , when the right and left transferring members 142 , 143 are separated from each other , the releasing member 123 is lowered by pressing the legs 132 of the right and left linking mechanisms 111 by each of the first pressing units 150 , 151 respectively . fig2 shows the state when releasing the damper member 114 from the turntable 13 while clamping the circumference area of the damper member 114 by the taper surface 128 of the right and left releasing members 123 ( the prior state of the cam plate 181 movement ). from this state , when the right and left transferring members 142 , 143 move in a direction to separate from each other , as shown in fig2 , the first pressing units 150 , 151 of the transferring members 142 , 143 press the leg 132 of the rear linking member 125 , and the rear linking member 125 rotates along with the front linking member 124 centering the cylinder 133 , and the right and left taper surfaces 128 move downward to the right and left while forming a circular trajectory . accordingly , these taper surfaces 128 draw apart to the right and left while lowering the damper member 114 . when the damper member 114 moves close enough to the turntable 13 standing - by at the lower side of the damper member 114 , the taper surfaces 128 separate from the damper member 114 and move to a position to clamp the disc in cooperation with the turntable 13 ; and the disc is clamped by the magnetic force between the damper 110 and the turntable 13 . at this time , if a small disc d 2 is loaded , the disc is returned to the designated loading position by the taper surface of the damper member 114 , and separated from the stopper units 97 , 98 . meanwhile , at the final stage of right and left movement , after the wall surfaces of the pressed units 99 , 100 used for a large disc of the stopper members 89 , 90 are pressed by the pressing pieces 146 , 147 and the disc is clamped with the damper 110 and the turntable 13 , both transferring members 142 , 143 , as shown in fig2 , separate the stopper units 97 , 98 from the disc by slightly rotating the stopper units 97 , 98 of both stopper members 89 , 90 in the direction to separate from each other . fig2 shows the state when a large disc d 1 is inserted ; however , when a small disc d 2 is inserted , the wall surfaces of the pressed units 101 , 102 used for a small disc of the stopper members 89 , 90 are pressed , and then the stopper units 97 , 98 are separated from the circumference surface of the disc . further , at the final stage where the cam plate 181 moves to the disc eject direction , when the second switch pressing unit 202 of the cam plate 181 detects the completion of disc insertion by turning on the second switch 36 , the loading motor 41 stops . in this manner , the disc is arranged in the playback position and the loading of the disc is complete . the relationships between the insertion of a large disc d 1 , small disc d 2 and the turning on and off of the first switch 35 through fifth switch 39 are shown in the following table , and by turning each switch on and off , a determination is made whether the inserted disc is a large disc d 1 or a small disc d 2 . incidentally , when a disc is not inserted , the first switch 35 through the fifth switch 39 are all turned off . next , a description will be given hereafter of the operation to discharge to a position where a disc located in the playback position can be retrievable from the disc insertion port 2 . fig2 shows the state where a large disc d 1 is arranged at the playback position , and when the eject button not illustrated is pressed while in such condition , the loading motor 41 activates . by this activation , the slider 180 ( refer to fig1 ) through the power transfer mechanism 157 starts moving to the disc insert direction . by so doing , the cam plate 181 moves with the slider 180 , thereby separating the second switch pressing unit 202 from the second switch 36 and turning off the second switch 36 . when the slider 180 moves further in the disc insert direction , the engaging protrusion 155 of the transferring member 143 arrives at the front inclined surface from the furthermost area of the cam groove 199 of the cam plate 181 . in this manner , the right side transferring member 143 returns to the left side , and the left side transferring member 142 returns to the right side , and the state changes from that in fig2 to fig2 . at this time , the first pressing unit 150 , 151 of each of the transferring members 142 , 143 separate from the leg 132 of the linking mechanism 111 ; however , the second pressing unit 152 presses the leg 132 inward from the outside instead , and the rear linking member 125 rotates with the front linking member 124 centering the cylinder 133 , and the right and left taper surfaces 128 move upward to the right and left while forming a circular trajectory . at this time , the right and left taper surfaces 128 scoops up the circumference edge of the damper member 114 , and the damper 110 releases the turntable 13 . meanwhile , the stopper members 89 , 90 pressed by the pressing pieces 146 , 147 of each of the transferring members 142 , 143 are released allowing the return of both stopper units 97 , 98 rotating in the direction to be closer to each other by the energized spring not illustrated . further , the stopper units 97 , 98 push the exterior of the large disc d 1 , and the large disc d 1 is pushed out to the disc eject direction . at that time , the trigger member 91 also rotates in the counterclockwise direction together with the stopper member 90 and pushes out to a position where the large disc d 1 is retrievable from the disc insertion port 2 . when the slider 180 further moves to the disc insert direction , the large collar 186 heretofore pressed by the inclined surface 195 of the slider 180 rises when the pressure exerted by the inclined surface 195 is released causing the roller 178 to make contact with the disc ( refer to fig1 ). at that time , the roller supporter 179 rotates in the counterclockwise direction in the drawing . at the final stage in which the slider 180 moves in the disc insert direction , the engaging pin 177 of the gear plate 167 which engages with the cam groove 196 arrives at the cam surface as shown in fig1 , and the gear plate 167 rotates in the clockwise direction centering the spindle 175 . by so doing , the sixth gear 173 axially supported in the gear plate 167 engages with the fifth gear 172 , and the driving force of the loading motor 41 is transferred even to the roller 178 initiating rotation in the disc eject direction of the roller 178 . and then , the large disc d 1 is discharged by the rotation of the roller 178 . when the large disc d 1 is discharged by the roller 178 , both stopper members 89 , 90 return to their initial positions prior to disc insertion shown in fig2 ; and both detection units 52 , 53 follow the circumference surface of the large disc d 1 as both disc detection members 45 , 46 rotate to discharge further . at that time , when the center of the large disc d 1 moves beyond both detection units 52 , 53 , both disc detection members 45 , 46 rotate in the direction to become closer to each other . by the rotation of both of these disc detection members 45 , 46 , the reciprocating member 74 moves to the disc eject direction , and the rotating member 75 rotates in the counterclockwise direction by the energizing force of the spring 77 along the pin 79 of the reciprocating member 74 . at that time , the stopper member 89 is returned to its initial position , so the rotating member 75 can rotate without being restricted by the stopper member 89 . when the third switch pressing unit 215 of the position detection member 209 which is linked with the disc detection member 46 is removed from the third switch 37 as shown in fig2 , the third switch 37 is turned off thereby detecting the completion of the discharge of the large disc d 1 and stopping the motor 41 . in the case of discharging a small disc d 2 , when the fourth switch pressing unit 216 of the member 209 separates from the fourth switch 38 thereby detecting the completion of the disc discharge and stopping the motor 41 . in addition , the taper surface 120 is used for the damper member 114 , and the taper surface 128 is used for the releasing member 123 respectively with the present embodiment ; however , it is not be limited to these , and the component force to release the damper member 114 from the turntable 13 can be obtained by the releasing member 123 even if a taper surface ( inclined surface ) is provided only to at least one of either the damper member 114 or releasing member 123 . further , the linkage span is the same with the front linking member 124 and the rear linking member 125 with the present embodiment ; however , it is not limited to this , and an incline occurs with the releasing member in relation to the damper even if the linkage span of the rear linking member 125 is slightly longer than the linkage span of the front linking member 124 ; therefore , the detachment force of the damper in accompany with the rotation of the front linking member 124 and the rear linking member 125 can be greatly enhanced .	6
referring to fig1 a perspective view of retaining module 100 for retaining a card such as an expansion card , an adapter card , or a terminator card , in a computer system is shown . retaining module 100 includes support frame 102 , shown in fig1 having a four - sided , rectangular shape . however , support frame 102 may be sized and shaped as required to accommodate a variety of card shapes and sizes . wall portion 104 substantially covers one side of support frame 102 to prevent air flow from passing through retaining module 100 as explained hereinbelow . edge 106 extends around and overhangs at least a portion of the perimeter of support frame 102 . edge 106 stabilizes retaining module 100 when it is inserted in a cartridge in a computer system . edge 106 may also be used as a handle to facilitate inserting and removing retaining module 100 . these features are further described hereinbelow . retaining module 100 includes one or more mounting platforms 108 as required to aid in supporting a card and to provide clearance between components and / or wiring on a card and retaining module 100 . it is recognized that various shapes and sizes of mounting platform 108 are suitable for use with the present retaining module 100 . mounting platform 108 may also be located at various positions relative to support frame 102 . further , mounting platform 108 may be constructed independently of other portions of retaining module 100 and attached to any portion of retaining module 100 using any suitable attachment method such as a bonding process . alternatively , mounting platform 108 may be formed integrally with support frame 102 and / or other portions of retaining module 100 . various fastening structures may also be positioned on mounting platform fig1 and 1a show u - shaped mounting platform 108 extending around three sides of the outer portion of support frame 102 . one or more side portions of mounting platform 108 include fastening structure , shown in fig1 and 1 a as one or more pegs 110 and flexible clips 112 for supporting and retaining card 114 on mounting platform 108 . peg 110 engages a corresponding opening or hole 116 in card 114 . card 114 is supported by base portion 118 , which has a cross - sectional area that is larger than the cross - sectional area of hole 116 in card 114 . base portion 118 prevents further movement of card 114 toward mounting platform 108 , thereby preventing damage to any components or wiring that may be located near the edge of card 114 . it is also recognized that card 114 may not have any components or wiring near its outer edge . in this situation , base portion 118 is not required and the edges of card 114 may rest directly on mounting platform 108 . peg 110 may be formed independently of base portion 118 and attached to base portion 118 using any suitable attachment means . alternatively , peg 110 may be formed integrally with base portion 114 through various known manufacturing processes such as injection molding . fastening structure may also be included on other portions of retaining module 100 instead of or in addition to fastening structure on mounting platform 108 . flexible clip 112 , shown in more detail in fig1 b , includes tapered portion 120 adjacent stepped portion 122 . flexible clip 112 is located on mounting platform 108 so that the outer edge of card 114 slides along tapered portion 120 as card 114 moves along peg 110 . stem portion 124 of flexible clip 112 is constructed of resilient material that flexes when lateral force is applied to tapered portion 120 . stem portion 124 returns substantially to its former configuration when the force is released . to remove a card 114 from retaining module 100 , lateral force is applied to tapered portion 120 to move stepped portion 122 away from the edge of card 114 . stem portion 120 returns substantially to its unflexed position when force is released . it should be noted that various fastening structures known in the art are suitable for use in addition to or instead of peg 110 and flexible clip 112 . frictional forces may be used as another alternative instead of or in addition to other fastening structures for retaining card 114 . for example , edge 106 or support frame 102 may be sized and constructed of suitable material to engage edges of card 114 and retain card 114 through frictional force . card 114 includes tabs 126 that carry electrical signals to and from components on card 114 from electrical lands in a slot 130 . the particular embodiment of retaining module 100 shown in fig1 and 1a is useful for inserting card 114 in cartridge 206 as shown in fig2 . each cartridge 206 overlays an expansion . slot ( not shown ) in motherboard 208 . motherboard 208 is the main circuit board inside a computer system which holds one or more processing units , memory , and expansion slots and connects directly or indirectly to every part of the computer system . each cartridge 206 is also capable of receiving one of various devices including combination microprocessor / heatsink structures 210 and retaining module / card structures 212 . the devices have exposed tabs 126 that mate with the expansion slot 130 ( fig1 a ). thus , it is important in the present invention for tabs 126 to be exposed and for the structure of retaining module 100 not to interfere with inserting tabs 126 in the expansion slot 130 . devices known as single edge contact ( sec ) cartridges 206 shown in fig2 and 3 are used in computer systems , such as those currently available from intel corporation , santa clara , calif ., having the deschutes microprocessors and slot 1 or slot 2 interfaces . the slot 1 interface accommodates two central processing units ( cpus ), namely , 333 - mhz pentium ii microprocessors that run at 66 mhz bus clock . the slot 2 interface accommodates up to four cpus , namely 350 - 450 mhz pentium ii microprocessors that run using a 100 mhz system bus . fig2 and 3 show a slot 2 interface having four sec cartridges 206 . the deschutes microprocessors are mounted in cartridge 206 using combination heatsink / microprocessor structure 210 that includes fins 214 to disperse heat from the microprocessor as air flow from cooling fans ( not shown ) passes by fins 214 . when a heatsink / microprocessor structure 210 is not installed in one or more of the expansion slots , a terminator card , such as card 114 ( fig1 ), is inserted in the expansion slot to alleviate problems that may occur when an expansion slot is left vacant . in the slot 1 and slot 2 interface systems , the terminator cards are fairly large and require supporting structure to stabilize and retain them in sec cartridge 206 . this support is provided in the embodiment of retaining module 100 shown in fig1 by support frame 102 and edge 106 . as shown in fig2 the combination retaining module / card structures 212 are sized to slip into and out of sec cartridge 206 , and yet fit snugly enough within sec cartridge 206 to reduce or even prevent movement of card 114 in the expansion slot . in this embodiment , retaining module 100 also facilitates proper installation of card 114 as it serves as a guide through cartridge 206 . when a terminator card is positioned in a vacant expansion slot , it is desirable for air flow to be directed past heatsink fins 214 . in the embodiment of retaining module 100 shown in fig1 through 2 , wall portion 104 and edge 106 are designed to force air flow from cooling fans ( not shown ) past fins 214 of heatsink / microprocessor structure 210 by blocking air flow through retaining module 100 . this is useful in situations where card 114 , such as a terminator card , does not include many active components and therefore requires little or no air flow for cooling . in situations where card 114 does require cooling , wall portion 104 may cover only a portion of one side of support frame 102 , or wall portion 104 may not be required . additionally , depending on cooling requirements , the length and / or width of edge 106 may be reduced along one or more sides to allow air flow past card 114 . an important feature of the present retaining module 100 is edge 106 on the upper periphery of support frame 102 . this portion of edge 106 functions as a handle to facilitate inserting and removing card 114 from a cartridge , such as sec cartridge 206 . the dimensions and shape of retaining module 100 allow clearance between card 114 and the upper portion of edge 106 when card 114 is positioned in retaining module 100 . as shown in fig2 this clearance creates a cavity that allows fingers or other suitable device to be used as a handle 216 for grasping edge 106 and support frame 102 . handle 216 facilitates installing and removing retaining module 100 . in fig3 when retaining module 300 is inserted intermediate cartridges 302 and 304 that are occupied by other devices such as heatsink / microprocessor structure 306 and retaining module 308 , it may be difficult to access handle 216 ( fig2 ) in retaining module 300 . in this situation , one option is to remove the device , shown in fig3 as retaining module 308 , occupying cartridge 304 adjacent intermediate retaining module 300 to gain access to handle 216 . alternatively , edge 106 may be modified or additional structure may be added so that retaining module 308 does not have to be removed first . one , alternative is to reduce the width of edge 106 on the upper periphery over a short length to allow access to handle 216 using a small implement . another alternative is to grasp intermediate retaining module 300 along the sides of support frame 314 to remove intermediate retaining module 300 from cartridge 312 at least enough to gain access to handle 216 . note that finger - tip size indentations or raised ridges may be added near the upper portion of the sides of support frame 314 to improve the user &# 39 ; s grasp . it is recognized that the foregoing examples are just a few of the variety of alternatives that are possible to help remove retaining module 300 from cartridge 312 and the foregoing examples are not intended to limit the present invention to specific configurations . the present retaining module 100 is constructed on non - conductive materials such as plastic or rubber . various manufacturing processes may be used to fabricate the components individually and attach them together in the desired configuration , or to form the components in integral units . advantageously , the present invention provides retaining module 100 that protects the card as it is installed and removed . the handle 216 provides structure for a user to grasp instead of potentially damaging the card or its components by putting fingers or other tools directly on the card itself . the handle 216 also allows the user to gain a firmer grasp and to apply force evenly when installing and removing the card . the present invention is thus expected to improve reliability and the useful life of adapter and terminator cards . when a card , such as a terminator card , requires little or no cooling , the present invention contributes to system reliability by forcing air flow from cooling fans toward cartridges containing microprocessor and heatsink structures instead of allowing the air flow to pass by the terminator card . other embodiments of retaining module 100 can be sized and shaped for use in computer systems in addition to computer systems with slot 1 and slot 2 interfaces . while the invention has been described with respect to the embodiments and variations set forth above , these embodiments and variations are illustrative and the invention is not to be considered limited in scope to these embodiments and variations . accordingly , various other embodiments and modifications and improvements not described herein may be within the spirit and scope of the present invention , as defined by the following claims .	7
this invention provides the advantages of single - ended signaling , such as lower cost and power , while at the same time achieves detection speed and performance comparable to those of differential - pair signaling . the present invention also provides better receiver sensitivity than that achieved in the pseudo - differential signaling technique . in addition , this invention achieves twice the data transfer rate of the differential - pair signaling technique for the same number of data traces . a method of the present invention provides much simpler multiple reference generation and post - processing to achieve robust and more sensitive data detection . fig1 shows receiver 100 , in accordance with one embodiment of this invention . receiver 100 includes differential amplifier 101 and 102 that compares a single - ended data signal provided at terminal 103 against reference signals v refh and v refl at terminals 104 and 105 , respectively , these comparisons determine differentially whether a high or low logic signal is received at terminal 103 . reference voltages v refh and v refl at terminals 104 and 105 may be set , for example , at reference voltages vih and vil , representing the design trip or threshold points for logic circuits . the reference signals may be provided , for example , by the transmitter to one or more receivers , or may be locally generated . vih and vil reference may also be tapped from the power rail ring of vih and vil respectively . in one embodiment , additional detectors may be provided to detect the complementary phases clock + and clock − of a two - phase clock signal , if required . differential amplifier 101 compares the input data signal at terminal 103 with reference voltage vih , while differential amplifier 102 compares the input data signal at terminal 103 with the other reference signal vil . as differential amplifier 101 receives reference voltage vih , differential amplifier 101 detects a logic low state in the data signal much earlier than differential amplifier 102 , because the voltage difference at the input terminals of differential amplifier 101 . similarly , differential amplifier 102 , receiving reference voltage vil detects a logic high state earlier than differential amplifier 101 . differential amplifiers 101 and 102 , pmos transistors 108 and 109 and nmos transistors 110 and 111 form a “ schmitt - trigger ”. when the output values of differential amplifers 101 and 102 at terminals 106 and 107 agree ( i . e ., either both pmos transistors 108 and 109 are conducting , or both nmos transistors 110 and 111 are conducting ), an output signal — which is logically an inversion of the data signal at terminal 103 — is provided at terminal 112 . as one of differential amplifiers 101 and 102 develop its output signal faster , as discussed above , the output signal at terminal 112 develops only after the later one of the signals at terminals 106 and 107 has developed . when the output values of differential amplifiers 101 and 102 at terminals 106 and 107 disagree with each other , the output value at terminal 112 remains unchanged . the voltages v dd ( supply voltage ), v refh and v refl are not limited to the values described above . in any implementation , the appropriate values for voltages v dd , v refh and v refl depend upon process , technology and application . in fact , they may even be dynamically changed . as more advanced and faster data rate process and technology are developed , the suitable values for v dd , v refh and v refl generally decrease . one suitable application for the signaling scheme of this invention is in an interface with dynamic random access memory circuits (“ dram circuits ”). for example , in a ddr 2 circuit ( i . e ., 2 nd generation double data rate dram circuit ), v dd is nominally 1 . 8 volts , with v refh and v refl set to be 0 . 2 volts above and below one - half of voltage v dd , respectively ( i . e ., nominal v refh = 1 . 1 volts and nominal v refl = 0 . 7 volts ). in such an application , it is possible to have v refh and v refl at 0 . 125 volts above and below one - half of voltage v dd , respectively ( i . e ., v refh = 10 . 125 and v refl = 0 . 775 volts ). similarly , in a ddr 3 circuit ( i . e ., 3 rd generation double data rate dram circuit ), v dd is nominally 1 . 5 volts , with v refh and v refl set to be 0 . 175 volts above and below one - half of voltage v dd , respectively ( i . e ., nominal v refh = 0 . 925 volts and nominal v refl = 0 . 575 volts ). in such an application , it is possible to have v refh and v refl at 0 . 10 volts above and below one - half of voltage v dd , respectively ( i . e ., v refh = 0 . 85 and v refl = 0 . 65 volts ). as mentioned above , v refh ( e . g ., vih ) and v refl ( or vil ) can be dynamically adjustable ( or dynamically scaling ) instead of having fixed values . adjustments may depend on the length of the communication channel between the transmitter and the receiver . for example , for a supply voltage v dd of 1 . 5 volts , the data strengths on transmitter side are voh = 1 . 2 volts ( i . e ., logic high ) and vol = 0 . 3 volts ( i . e ., at logic low ). in memory applications , the communication channel is typically short ( e . g ., about 8 inches ). however , for a switch application or a router application , the communication channel is much longer ( e . g ., 32 inches or more ). for the same transmitting strength at the transmitter , the strength of the signal received over a short communication channel is typically much higher than the strength of the signal received over a longer communication channel . for example , data transmitted at voh = 1 . 2 volts and vol = 0 . 3 volts may be received at vih = 0 . 925 volts and vil = 0 . 575 volts , respectively , at the receiver after transmission over an 8 - inch communication channel . the same transmitted data at voh = 1 . 2 volts and vol = 0 . 3 volts may be received at vih = 0 . 85 volts and vil = 0 . 65 volts after transmission over a 32 - inch communication channel . hence , the values of v refh and v refl should be adjusted ( or dynamically scaled at the receiver circuit ) for different applications , according to the communication channel length . in one implementation , the input buffer for the data signal drives two conductors or traces , which are internally connected to the comparators for comparing with vih and vil , respectively . vih and vil can be sourced from the global vih and vil reference signals for the entire integrated circuit . these vih and vil reference signals are distributed throughout the integrated circuit globally by power rail rings , which distribute the vih and vil reference signals internally to all input buffers . thus , the layout for input data line wiring for a signaling technique under this invention is much simpler and cleaner than that of the jazio technology , which requires transmitting data , clock + & amp ; clock − signals externally as input signals to the receiver . greater signal integrity performance is therefore achieved due to simpler and better wiring scheme . fig2 shows receiver circuit 200 , in accordance with a second embodiment of the present invention . to facilitate comparison between fig1 and fig2 , like elements in the figures are assigned like reference numerals . as shown in fig2 , receiver circuit 200 includes receiver circuit 100 , and additionally , pmos transistors 113 and 114 , nmos transistors 115 and 116 , and cross - coupled inverters 118 and 119 . the output signals of differential amplifiers 101 and 102 at terminals 106 and 107 are also provided to the gate terminals of pmos transistor 114 and nmos transistor 115 , respectively . terminal 120 provides the final output value of receiver circuit 200 . because the value at terminal 112 does not change until after the later one of the output values of differential amplifiers 101 and 102 has developed , when the data signal at terminal 103 changes state , the previous output value at terminal 112 , in conjunction with the earlier one of the output values at terminals 106 and 107 to arrive , changes the output value at terminal 119 , prior to the change in output value at terminal 112 . pmos transistors 113 and 114 and nmos 115 and 116 form a early detector . the output value at terminal 119 is latched into cross - coupled inverters 118 and 119 to provide a latched output value at terminal 120 . therefore , differential amplifiers 101 and 102 provide an enhanced sensitivity with a larger eye opening for next - stage multiple comparators and post processing circuits to detect the data signal . differential sensing with enhanced sensitivity at the receiver is achieved with only one signal trace per data bit . the techniques of the present invention may be used in high speed memory applications ( e . g ., the xdr and ddr memory buses ), large parallel high speed bus applications with enhanced bus signal integrity . bus signal integrity is enhanced because the complex coupling due to switching in the vicinity of crowded traces is reduced . the hardware described above , including any logic or transistor circuit , may be generated automatically by computer based on a description of the hardware expressed in the syntax and the semantics of a hardware description language , as known by those skilled in the art . applicable hardware description languages include those provided at the layout , circuit netlist , register transfer , and schematic capture levels . examples of hardware description languages include gds ii and oasis ( layout level ), various spice languages and ibis ( circuit netlist level ), verilog and vhdl ( register transfer level ) and virtuoso custom design language and design architecture - ic custom design language ( schematic capture level ). the above detailed description is provided to illustrate specific embodiments of the present invention and is not intended to be limiting . numerous modifications and variations within the scope of the invention are possible . the present invention is set forth in the following claims .	7
the present invention provides an efficient system and method for mining patterns that may include thousands of items in a few scans of the data . according to the present invention , a novel sampling - based approach is devised . given a random sample of the data , a chernoff bound , or other statistical modifier , is used to estimate the set of patterns whose significances in the sample are very close to the threshold so that there is no sufficient statistical confidence to tell whether the pattern would be significant or not in the entire dataset . in one embodiments , let y be a random variable whose domain is r . the domain of a random variable is defined as the difference between the maximum possible value and the minimum possible value of the random variable . for example , in the context of the present invention , the significance is usually a number between 0 and 1 , and r is less than or equal to 1 . suppose that n independent observations of y are available , and the mean is avg ( y ). the chernoff bound states that with probability 1 - delta , the true mean of y is at least avg ( y )- e , where e = r 2  ln  ( 1 delta ) 2  n . for example , assume that the domain of a random variable is 1 and avg ( y ) is the mean of 10 , 000 samples of the random variable . then , the true value of the random variable is at least avg ( y )- 0 . 0215 with 99 . 99 % confidence . similarly , with probability 1 - delta , the expected value of variable y is at most avg ( y )+ e . this provides the opportunity to estimate the range of the significance of each pattern from a set of samples . given a set of sample data and a threshold min_sig , with probability 1 - delta , a pattern p is significant if sig_s ( p )& gt ; min_sig + e and is insignificant with probability 1 - delta if sig_s ( p )& lt ; min_sig − e , where sig_s ( p ) is the significance of the pattern in the sample data . those patterns ( referred to as ambiguous patterns ) whose significances in the sample are between min_sig − e and min_sig + e remain undecided and need further examination . because the sample size is usually limited by the memory capacity and the distribution - independent nature of chernoff bound provides a very conservative estimation , the number of ambiguous patterns may be very large . according to the apriori property , if a pattern does not satisfy the user - specified significance threshold , any of its superpatterns will not satisfy , and hence need not be examined . if a pattern satisfies the threshold , all of its subpatterns will also satisfy and need not be examined . hence , the order of examining ambiguous patterns provides for computational efficiency . an ordered pruning is therefore provided to conduct the examination of these ambiguous patterns in an orderly manner according to the pruning power each ambiguous pattern may provide . the ambiguous pattern with the most pruning power is chosen first as the candidate pattern for evaluation . a greedy algorithm can be developed to repeatedly choose the pattern with the most pruning power among the remaining ambiguous patterns until the memory is filled up . a scan of the data is then performed to compute the significances of this set of patterns and the result is used to prune the space of ambiguous patterns . this iterative process continues until the remaining set of ambiguous patterns can be held all together in memory . another scan of the data is sufficient to finalize the set of significant patterns . as a result , the expected number of scans through the data is minimized . in most cases , a couple ( e . g ., 1 - 5 ) of scans of the data are sufficient . the present invention provides a sampling - based method which is devised to efficiently mine long patterns that satisfy a user - specified significance threshold . the chernoff bound is employed to estimate the set of ambiguous patterns with very high confidence . instead of using a level - wise search , an ordered pruning is performed on the set of ambiguous patterns so that the expected number of passes through the dataset is minimized . it should be understood that the elements shown in fig1 - 6 may be implemented in various forms of hardware , software or combinations thereof . preferably , these elements are implemented in software on one or more appropriately programmed general purpose digital computers having a processor and memory and input / output interfaces . the methods and system as depicted in fig1 - 6 may be implemented by programming code in one or more software applications . referring now to the drawings in which like numerals represent the same or similar elements and initially to fig1 a system / method for mining significant patterns is shown in accordance with the present invention . in block 101 , a full scan of the entire dataset is performed . a set of significant items are generated and random samples of data are taken . then , in block 102 , the set of ambiguous patterns are identified based on the sample data . a pattern p is regarded as an ambiguous pattern if p &# 39 ; s significance in the sample data is too close to the threshold min_sig to tell whether p would be significant or not with sufficiently high confidence . this set of ambiguous patterns are further verified against the entire dataset in block 103 . further details of these blocks will be described herein below . referring to fig2 a method for discovering the set of significant items and taking a random sample of data via a single scan of the dataset , as shown in block 101 of fig1 is illustratively depicted . in block 201 , an initialization is performed . a set of n random numbers are drawn between 1 and the size of the dataset and are stored in rn . an index i is set to 0 . the set sample is set to empty and a counter sig ( d j ) is initialized to 0 for each item d j where j = 1 , 2 , . . . , m . the number of samples n is subject to the memory size , i . e ., n should be as large as possible given that the sample data can be held in memory all together . a decision block 202 determines whether the end of the dataset is reached . if not , the next data record x is taken and the index i is incremented by 1 , in block 203 . a test is made in decision block 204 to determine whether the index i is one of the random numbers in rn . if so , x is put in sample in block 205 . in block 206 , the significance sig ( d j ) is updated for each item appearing in x before looping back to decision block 202 . since the meaningful formula to calculate the significance of a pattern may be different in different applications , this step should be performed accordingly . as a simple example , if the number of occurrences is used as a measure of significance , then sig ( d j )& lt ;— sig ( d j )+ 1 should be performed in this step . this procedure continues until the end of the dataset is reached . then , in block 207 , the set of significant items are identified and stored in l 1 . referring to fig3 a system / method of identifying the set of ambiguous patterns based on the sample data using chernoff bound , as shown in block 102 of fig1 is illustratively depicted . in block 301 , an index k is set to 1 and two sets sp and ap are set to empty . sp and ap will be used to store the sets of significant patterns and ambiguous patterns in the sample data . in addition , let c k and l k denote the set of generated candidate k - patterns and the set of significant or ambiguous k - patterns in the sample data . in block 302 , the index k is incremented by 1 and c k is generated from l k − 1 as follows . a k - pattern p is added to c k if there exists k distinct sub - patterns of p in l k − 1 . a test is then made in decision block 303 to determine whether c k is empty . if not , the process enter a loop in block 304 where for each pattern p in c k , sig_s ( p ) is computed from the sample data and the domain r of sig ( p ) is computed in block 305 . according to the apriori property , the significance of a pattern is less than or equal to that of any item in this pattern . thus , the domain of sig ( p ) can be estimated as the minimum value of the significance of any item in p . then , the value e is also computed accordingly in block 305 to enable the use of chernoff bound . the process then enters a decision block 306 to determine whether sig_s ( p ) is greater than min_sig + e . if so , p is significant and is put in sp k in block 307 . otherwise , another test is made to determine whether sig_s ( p ) is greater than min_sig − e in decision block 308 . if so , p is considered an ambiguous pattern and is put in ap k in block 309 . the process then loops back to block 304 . after all patterns in c k have been examined , the process enters a function block 310 where l k is computed by taking the union of sp k and ap k , and sp and ap are updated to include sp k and ap k , respectively . referring to fig4 a system / method for verifying the set of ambiguous patterns ap against the entire dataset via ordered pruning is shown for block 103 of fig1 . the process begins with a test in decision block 401 to determine whether the memory can hold all counters for the set of ambiguous patterns . if not , the set of patterns in sp , whose super - patterns are all in ap ( i . e ., not in sp ) are identified and stored in sb in function block 402 . similarly , the set of patterns in ap , whose super - patterns are all not in ap are identified and stored in ib . these two sets of patterns act as the “ floor ” and the “ ceiling ” of the space occupied by ambiguous patterns in the pattern lattice . then , in block 403 , the set of patterns on a halfway ( hw ) layer between sb and ib ( i . e ., halfway between the “ ceiling ” and “ floor ”) are computed and counters for these ambiguous patterns are initialized in memory . in block 404 , the entire dataset is scanned to compute sig ( p ) for each halfway pattern p and the result is used to update ap in block 405 as follows . for each halfway pattern p , if sig ( p )≧ min_sig , then p and all p &# 39 ; s sub - patterns are labeled as significant patterns and removed from ap ; otherwise , p and all p &# 39 ; s super - patterns are labeled as insignificant patterns and removed from ap . the process then loops back to decision block 401 . if the memory is sufficient to hold counters for all patterns in ap , then a counter sig ( p ) is initialized for each pattern p in ap in block 406 , and the entire dataset is scanned to compute sig ( p ) in block 407 . the halfway layer is preferably since the patterns on the halfway layer can provide the most pruning effect , and the result can slash the space of ambiguous patterns by at least half . other intermediate layers may also be employed and are contemplated by the present invention . referring to fig5 an example is shown for pruning patterns in accordance with the present invention . a pattern d 1 is in sp and the pattern d 1 d 2 d 3 d 4 d 5 is in ap . patterns d 1 d 2 d 3 , d 1 d 2 d 4 , d 1 d 2 d 5 , d 1 d 3 d 4 , d 1 d 3 d 5 , and d 1 d 4 d 5 are halfway patterns between d 1 and d 1 d 2 d 3 d 4 d 5 . if a halfway pattern turns out to be significant , then all of its sub - patterns are significant . otherwise , the pattern is insignificant , and all of its super - patterns are insignificant as well . sp or ap would collapse to the halfway layer if these halfway patterns have homogeneous labels ( i . e ., either all are significant or all are insignificant ). in this case , the space of ambiguous patterns is reduced by half . a more interesting scenario is that the halfway patterns have mixed labels ( i . e ., some of them are significant while the rest are not ), which turns out to provide even more pruning effect . referring to fig6 assume that d 1 d 2 d 3 and d 1 d 2 d5 are significant ( marked with solid circles on the halfway layer ) while the remaining patterns ( indicated by dashed circles on the halfway layer ) are insignificant . by applying the apriori property , d 1 , d 1 d 2 , d 1 d 3 , and d 1 d 5 should also be significant . similarly , d 1 d 2 d 3 d 4 , d 1 d 2 d 3 d 5 , d 1 d 2 d 4 d 5 , d 1 d 3 d 4 d 5 , and d 1 d 2 d 3 d 4 d 5 are all insignificant . note that only d 1 d 4 still remains ambiguous . challenges are posed to the design of mining algorithms because data sets may be very large ( e . g ., only a small fraction of the entire data set can be held in memory at once ) and patterns may be substantially long ( including a large number of items or events ). even with the help of the well - known apriori property , the traditional level - wise algorithm becomes very slow . according to the present invention , a novel sampling - based approach is provided . given a random sample of the data , the chernoff bound is used to estimate the set of ambiguous patterns whose significances in the sample are very close to a threshold so that there is no sufficient statistical confidence to tell whether the pattern would be significant or not in the entire dataset . an ordered pruning is also provided to conduct the examination of these ambiguous patterns in an orderly manner according to the pruning power each ambiguous pattern may provide . as a result , the expected number of scans through the data is minimized . having described preferred embodiments of a system and method for mining long patterns ( which are intended to be illustrative and not limiting ), it is noted that modifications and variations can be made by persons skilled in the art in light of the above teachings . it is therefore to be understood that changes may be made in the particular embodiments of the invention disclosed which are within the scope and spirit of the invention as outlined by the appended claims . having thus described the invention with the details and particularity required by the patent laws , what is claimed and desired protected by letters patent is set forth in the appended claims .	8
before explaining the disclosed embodiment of the present invention in detail , it is to be understood that the invention is not limited in its application to the details of the particular arrangement shown since the invention is capable of other embodiments . also , the terminology used herein is for the purpose of description and not of limitation . the invention is a continuation in part of u . s . patent application ser . no . 11 / 485 , 762 filed jul . 13 , 2006 , which is a continuation - in - part of u . s . patent application ser . no . 10 / 725 , 082 filed dec . 2 , 2003 , now u . s . pat . no . 7 , 111 , 424 , and is a continuation - in - part of u . s . design patent application ser . no . 29 / 267 , 729 filed oct . 20 , 2006 which is a divisional of u . s . design patent application 29 / 259 , 347 filed may 5 , 2006 , all of which are incorporated by reference . the invention can use the fore grips that were described and shown in reference to the parent and copending inventions . for example , a plurality of legs can be concealed within the fore grip or gun handle and is coupled to a sliding piston assembly that is also concealed within the handle . a catch system that protrudes from the sliding piston assembly is attached to the sliding piston assembly and interfaces with a spring - loaded fulcrum release mechanism positioned at the top of the handle . a cutout within the top of the handle provides a housing for the release mechanism . a compression spring can be positioned between the sliding piston assembly and the bottom of the first cylindrical cutout and this spring , when under expansion , drives the sliding piston assembly downward toward the bottom of the fore grip . at the bottom of the fore grip , a recessed locking ring or plug is secured by threads into the fore grip , and is positioned to prevent the sliding piston assembly from over - travel and thus exiting the fore grip . the legs are connected to the bottom of the piston via a hinge or pivot point , and when the legs are released from confinement within the fore grip , the legs expand outwards until fully deployed . another fore grip can be an ergonomic fore grip for mounting to a firearm to stabilize the firearm , that has a top end and a bottom end with an opening there through , a mount for attaching the top end of the fore grip to a firearm , a pair of legs having an upper hinged end and a bottom end , a catch member that holding the legs in a closed position substantially inside the fore grip , a switch for releasing the catch member and allowing the bottom end to slide out from the opening in the fore grip , and an expansion spring positioned between the legs for causing the legs to pivot outward relative to the hinged end so that the legs expand outward in a triangular configuration . this fore grip can include a generally cylindrical handle with a stacked configuration of grooves and elongated vertical flat surface edges on opposite sides of the handle . the switch can be a flush mounted button with a serrated face . the switch can be a recess mounted button with a serrated face . the switch can be a depressible button having a catch portion that interlocks with a catch member adjacent to the hinged end of the legs , wherein depressing the button causes the catch portion to release the catch member allowing the legs to drop out from underneath the fore grip . behind the switch can be a spring for pushing an outer face of the button to expand outward from a side of the fore grip . the expansion spring in the fore grip can include a torsion spring having each end abutting against an upper inner surface of each leg . the fore grip can include a generally cylindrical handle for housing the pair of legs with the hinged end , the catch member , the switch and the expansion spring , a screwable cap for covering a bottom opening on the handle having an opening smaller in diameter than the opening in the handle , wherein the cap permits and limits the sliding of the legs from underneath the handle when the legs are deployed . the handle can include a void space or female orifice to hold an accessory switch such as but not limited to a depressible switch , for activating an accessory unit , such as but not limited to a light . a cap cover can cover the void space or female orifice . a tension fit pin can hold the cap cover in place . each of the legs can include telescoping legs to allow adjustment of the leg lengths for uneven terrain . each of the legs can include integral molded angled feet formed with a hollow backside and metal reinforcement member . the mount on the fore grip can include members for clamping the fore grip to a weapon , and a screwable member for fastening the rail members about a portion of the weapon . the fore grip can also include a second spring for causing the legs to drop below the fore grip . the legs can also drop from fore grip by gravity . alternatively , inertial actuation ( jerking or flipping the fore grip ) can result in the legs being deployed downward and then expanded out by an expansion spring . a novel method of actuating a leg stand from the fore grip on a weapon can include the steps of attaching a generally cylindrical fore grip handle with irregular side surfaces as a fore grip to a weapon , depressing a button located on an upper side surface of the handle , releasing a catch member that supports a pair of hinged legs by the depressing of the button , dropping foot ends of the legs from underneath the handle , and expanding the pair of legs outward relative to the hinged end as the legs leave the handle to a deployed position . the step of dropping can be by the expanding of a spring against an upper portion adjacent of the hinged ends of the legs in downward direction . the step of dropping can be by releasing the legs downward gravity . alternatively , inertial actuation ( flipping and jerking motions ) can result in the legs dropping out from the fore grip . also , physically pulling the legs downward after the side switch is activated can be done . a listing of the fore grip ball seat and stacking plate designator references for use with the subject canting invention embodiments will now be described . 2 operator 6 firearm / weapon 10 fore grip . 20 handle . 22 inside walls of handle 30 retainer cap . 32 ledge inside cap 36 cone shape inner angled edge 36 40 leg . 50 ball yoke . 54 rounded outer walls of yoke 60 yoke compression spring . 70 rubber o - ring . 80 torsion spring . 90 leg pivot pin . 100 contact point between retainer cap and legs . 110 support surface . 120 handle centerline perpendicular to support surface in resting position . 130 handle centerline tilted left from resting position . 140 handle centerline tilted right from resting position . 150 canting plate 160 rail clamp . 162 protruding ridge 164 protruding ridge 168 upper inwardly facing clamp edge 170 forward clamp block . 172 indentation portion 173 e - shaped cut - outs 174 indentation portion 175 locking slot with outer hexagon shape 178 upper inwardly facing clamp edge 180 aft clamp block . 182 indentation portion 183 longitudinal through - slot 184 indentation portion 185 locking slot with outer hexagon shape 188 upper inwardly facing clamp edge 190 tilting rail . 192 pair of slots on one side of rail 193 longitudinal side slot 194 , 196 angled rail edges 200 clamp screw . 210 tilt release button . 220 pivot nut . 230 clamp bolt . 240 pivot shaft . 250 tilt lock shaft . 260 tilt release spring . 270 lock pin collar . 280 tilt rail lock pin . 290 lock pin spring . 300 leaf stud . 310 tilt leaf spring . 320 weapon mounting rail 330 fore grip 340 tilt stop pin . fig1 is a right side view of a ball canting fore grip 10 of the handle 20 with legs 40 extended . fore grip 10 and legs 40 can be a vertical fore grip with bipod legs such as the one shown and described in the inventor &# 39 ; s previous u . s . pat . no . 7 , 111 , 424 to gaddini , as well as the fore grips shown and described in the inventors u . s . patent application ser . no . 11 / 485 , 762 filed jul . 13 , 2006 , and u . s . design patent application ser . nos . 29 / 267 , 729 filed oct . 20 , 2006 and 29 / 259 , 347 filed may 5 , 2006 , all of which are incorporated by reference . a preferred example of the fore grip 10 with bipod legs 40 is for allowing two legs 40 to be concealable within a fore grip handle , where the legs can drop down and expand into a stand for supporting a firearm 6 , such as a rifle , and the like . in the inventor &# 39 ; s previous patent , one example of the fore grip included a plurality of legs that are concealed within the fore grip are coupled via a hinge to a spring piston assembly . a spring - loaded fulcrum release mechanism holds the piston assembly in a compressed and locked position . when the piston assembly is released upon activation of the spring - loaded fulcrum release mechanism , the legs are driven downwards by the piston and upon being released from the confinement of the fore grip are deployed outwards to a locked position by a hinge or pivot mechanism . the legs have feet that are designed so that , when the legs are concealed within the handle , the feet seal off the deployment and spreader mechanisms from entrance of any debris , material etc that may interfere with the deployment of the bipod . fig2 shows a lower cross - sectional side view of fore grip 10 of fig1 along arrows x showing the modified yoke and retainer cap . fig3 is an enlarged view of a portion of the canting components 30 , 100 of fig2 . fig4 is another lower cross - sectional view of the fore grip 10 of fig2 showing the fore grip handle 20 tilted to the left . fig5 is another lower cross - sectional view of the fore grip 10 of fig2 showing the fore grip handle 20 tilted to the right . referring to fig1 - 5 , the novel fore grip 10 is to allow the handle 20 to cant ( lean to the right or to the left ) independent of the support legs 40 . this makes the firearm / weapon 6 mount less rigid and provides a limited range of canting or rocking motion to track targets . the novel fore grip 10 includes features of the inventor &# 39 ; s previously patented and patent pending fore grips with bipods referenced above with a novel retainer cap 30 and the ball yoke 50 referring to fig2 - 5 , the slidable ball yoke 50 can be affixed to legs 40 . the yoke 50 can slide freely up and down the inside of the tubular handle 20 drawing the legs 40 inside and outside of the handle 20 as it slides . in the inventor &# 39 ; s previous patent and patent pending models , a close clearance between the walls 54 of the yoke 50 and the interior walls 22 of the handle 20 discouraged any radial or “ rocking ” motion when the legs 40 were deployed . the novel ball yoke 50 shown in fig2 - 5 can have rounded convex shaped side walls 54 like a ball , and the like , to allow for a limited “ rocking ” motion of the yoke 50 when the legs 40 are deployed . additionally , a flexible o - ring 70 can be used that can sit on a surface portion of an inner ledge 32 on to the screwable retainer cap 30 . the yoke 50 can rest on the o - ring 70 when the legs 40 are deployed . the o - ring 70 can provide a semi - rigid surface for the yoke 50 to move against when the handle 20 cants ( leans to the right or to the left ). the retainer cap 30 has also has an inner edge modified to accommodate the “ rocking ” movement of the yoke 50 . in the inventors previous patent and patent pending inventions , the outer upper surface of the legs 40 can seat firmly against the entire inside surface of a “ cone ” shape machined inside of the retainer cap 30 . in the inventor &# 39 ; s previous models , this created a very stable assembly where any “ rocking ” motion was not possible . to allow for a rocking motion this , the “ cone ” shape inner angled edge 36 machined inside of the retainer cap 30 has been angled to provide a pivotable “ point ” of contact 100 between the deployed legs 40 and the retainer cap 30 . this “ point ” 100 creates a fulcrum about which the deployed legs 40 can rock and slide in canting motions . fig6 is a front view of an operator 2 using the fore grip handle 20 of the preceding figures with a firearm 6 , with the fore grip handle 20 in a stationary none canting position . fig7 is another front view of fig6 showing the fore grip handle 20 in canting positions . fig8 is a side view of the operator 2 with firearm 6 and fore grip handle 20 in a stationary none canting position . fig9 is another side view of fig8 showing the fore grip handle 20 in canting positions . fig1 is a front view of the firearm 6 and fore grip 10 of the preceding figures in a stationary none canting position . fig1 is another front view of fig1 of the firearm 6 and fore grip 10 canting to the left at approximately ten degrees . fig1 is another front view of fig1 of the firearm 6 and fore grip 10 canting to the right at approximately ten degrees . the canting components 50 , 22 , 40 , 100 , 36 can be loose to allow the operator of the firearm to easily adjust by a “ rocking ” type motion a desired canting position of the firearm . alternatively , the canting components can be tightly oriented so that the deployed legs 40 can remain in a generally fixed in a canted position when the operator 2 cants the handle 20 to the left or to the right . while the above drawing figures show maximum canting degrees of up to approximately 10 degrees , the invention can include greater than approximately 10 degrees . although the preferred embodiment is shown for use with the inventors &# 39 ; previous fore grip having bipod legs , the invention can be used with other fore grips with leg stands having two , three or more legs , as needed . similar to the previous embodiment , this embodiment can also be used with the inventors &# 39 ; previous fore grips , which were disclosed in the inventors previous patent and other patents pending listed above , that are incorporated by reference . fig1 is a top perspective view of a stacking canting plate 150 for the fore grip 330 ( shown in later drawings ). fig1 is a front view of the stacking canting plate 150 of fig1 . fig1 is a top view of the stacking canting plate 150 of fig1 along arrow t . fig1 is a bottom view of the stacking canting plate 150 of fig1 along arrow b . fig1 is a left side view of the stacking canting plate 150 of fig1 along arrow l . fig1 is a right side view of the stacking canting plate 150 of fig1 along arrow r . fig1 is an exploded perspective view of the stacking canting plate 150 of fig1 . referring to fig1 - 19 , the stacking canting plate 150 can include a pair of moveable rail clamps 160 with respective clamp screw tightening knobs 200 . the clamps 160 have side protruding ridges 162 , 164 that can interlock and mateably attach about indentation portions 172 , 174 and 182 , 184 on one side of forward clamp block 170 and aft clamp block 180 . on the opposite side of forward clamp block 170 can be clamp bolt 230 with threaded end that passes through a locking hole - slot 175 to threadably attach to clamp screw tightening knob 200 . on the opposite side of aft clamp block 180 can be another clamp bolt 230 with threaded end that passes through a locking hole - slot 185 to another clamp screw tightening knob 200 . the locking hole - slots 175 and 185 can have a hexagon shape so as to receive the hexagon head of clamp bolts 230 . on a side wall of forward clamp block can be an e shaped cut - outs that appears to be on its &# 39 ; back , with the upper ( left ) and lower ( right ) cut - out grooves of the e being substantially identical , and the middle cut - out groove having a generally circular shape . sandwiched between side facing walls of the forward clamp block 170 and aft clamp block 180 can be an elongated tilting rail 190 . the tilting rail 190 can include tilt stop pins 192 having one end inserted partially into mateable sized slots 192 of on one end of the tilt rail 190 , and the opposite ends of the pins 192 protruding into the left and right cut - out grooves of the e shaped cut - out so that the pins can move slightly up or down in the respective left and right cut - out grooves . the operation of these features are further described and shown in reference to fig2 - 29 . referring to fig1 - 19 , inside of a longitudinal slot 195 in tilting rail 190 can be a pivot shaft 240 which can be a generally elongated rod with threaded ends 241 , 249 extending out both ends of the tilting rail 190 . one threaded end 241 can pass through the middle cut - out groove of the e - shaped cut - out 173 and be threadably attached to a pivot nut 220 on an opposite outer wall of the forward clamp block 170 . the opposite threaded end 249 of the pivot shaft 240 can be threadably attached to another pivot nut 220 on an opposite side of the aft clamp block 180 . a tilt leaf spring 310 such as a flat straight piece of bendable metal can be positioned in the back cut - out portion of the e shaped cut - out 173 so that a forward end portion 242 of the pivot shaft 240 rests on the leaf spring 310 . the operation of these features is shown and described in reference to fig2 - 29 . referring to fig1 - 19 , located in longitudinal side slot 193 of the tilting rail 190 can be a lock spin spring 290 which has an outer end that abuts against a tilt rail lock pin 280 . inside of a longitudinal through - slot 183 of the aft clamp block 180 can be a lock pin collar 270 tilt lock shaft 250 , tilt release spring 260 and tilt / canting release button 210 . the operation of these features is described in reference to fig3 - 33 . fig2 is an exploded perspective view of a bottom portion of a firearm 6 having weapon mounting rail 320 that can be generally an upside down elongated t - shape , that is separated from both the stacking canting plate 150 and the fore grip 330 . the fore grip can one a concealable and collapsible bipod such as the one labeled fore grip 10 in the preceding figures , and which is further described in the inventors &# 39 ; previous patent and other patents pending referenced above , that are all incorporated by reference . fig2 is another perspective view of the fore grip 330 clamped to the stacking canting plate 150 , which are separated from the firearm lower mounting rail 320 . referring to fig1 - 19 and 21 , the upper mount portion on the fore grip 330 can include grippable clamp members 332 , 334 for clamping the fore grip 330 about the angled rail edges 194 , 196 on opposite sides of the tilting rail 190 of the stacking canting plate 150 . a screwable knob type member 335 can lock the fore grip 330 to the stacking canting plate 150 . fig2 is a perspective assembled view of the stacking canting plate 150 clamped to both the firearm lower rail 320 and the fore grip 330 . referring to fig1 - 19 and 22 , the upper inwardly facing clamp edges of the forward clamp block 170 and the aft clamp block 180 can grip about one side edge of the weapon mounting rail 320 . the upper inwardly facing clamp edges 168 of both rail clamps 160 can grip about the opposite side edge of the weapon mounting rail 320 with knobs / screws 200 tightened to lock the canting stacking plate 150 to the firearm 6 . fig2 is an end view of the assembled stacking canting plate 150 and firearm lower rail 320 and fore grip 330 of fig2 where the firearm 6 is in an upright vertical ( neutral ) position . fig2 is another end view of the assembled stacking canting plate 150 and firearm lower rail 320 and fore grip 330 of fig2 with the firearm 6 canting to the left . fig2 is another end view of the assembled stacking canting plate 150 and firearm lower rail 320 and fore grip 330 of fig2 with the firearm 6 canting to the right . fig2 is another top view of an enlarged stacking canting plate 150 of fig1 . fig2 is a cross - sectional right side view of the stacking canting plate 150 of fig2 along arrows xx when the firearm 6 of fig2 is in a vertical ( neutral ) position . fig2 is another cross - sectional right side view of the stacking canting plate 150 of fig2 when the firearm 6 of fig2 is canting to the left . fig2 is another cross - sectional right side view of the stacking canting plate 150 of fig2 when the firearm 6 of fig2 is canting to the right . the operation of canting ( leaning to the left , and leaning to the right ) will now be described . referring to fig1 , 19 , and 23 - 29 , left and right tilt stop pins 340 that are fixably positioned by tilting rail 190 can move up and down in the outer vertical cut - out slots of e - shaped cut - out 173 . canting to the left will now be described . referring to fig1 , 19 , 23 , 24 , 27 and 28 , the tilt leaf spring 310 is pushed down on the right side by right tilt stop pin 340 , which is pressed in the tilt rail . the tilt leaf spring 310 then wants to return the tilt rail 190 to the neutral position . canting to the right will now be described . referring to fig1 , 19 , 23 , 25 , 27 and 29 , the tilt leaf spring 310 is being pushed down on the left side by the left tilt stop pin 340 , which is pressed into the tilt rail 190 . the tilt leaf spring 310 then wants to return the tilt rail 190 to the neutral position . fig3 is a partial upper right cross - sectional view of the stacking canting plate 150 of the preceding figures with cant release button 210 in an extended out canting - lock position . fig3 is a cross - sectional view of the partial stacking canting plate 150 of fig3 along arrows ss . referring to fig3 - 31 , the “ out ” position of the tilt release button 210 indicates the tilt rail 190 is locked in the neutral position previously shown and described in reference to fig2 , and 27 . in this position , the tilt rail lock pin 280 is extended into the aft clamp block 180 , where this configuration locks the tilt rail 190 in the neutral position . in the lock position , the firearm 6 and canting plate 150 and fore grip 330 are in a fixed orientation to one another where no canting ( leaning / twisting ) can take place . fig3 is a partial upper right cross - sectional view of the stacking canting plate 150 of fig3 with cant release button 210 in a depressed canting - release position . fig3 is a cross - sectional view of the partial stacking canting plate 150 of fig3 along arrows st . referring to fig3 - 33 , the “ in ” depressed position of the tilt release button indicates that the tilt rail 190 is unlocked . here , the tilt rail lock pin is being pushed into the tilt rail 190 by the tilt lock shaft 250 where this configuration releases the tilt rail 190 to be able to cant to the left or to the right . for the unlock position , the operator must constantly always depress button 210 to allow the canting effects . once button 210 is released , spring 290 will expand and move tilt rail lock pin 280 through lock pin collar 270 and into aft clamp block 180 , and spring 260 will move tilt lock shaft 250 and extend button 210 to an extended lock position . again , depressing button 210 moves these components in the opposite direction . the canting stacking plate components can be loose to allow the operator of the firearm to easily adjust by a “ rocking ” type motion a desired canting position of the firearm . alternatively , the canting components can be tightly oriented so that the deployed legs of the fore grip can remain in a generally fixed in a canted position when the operator 2 cants the fore grip to the left or to the right . while the above drawing figures show maximum canting degrees of up to approximately 10 degrees , the invention can include greater than approximately 10 degrees . although the preferred embodiment is shown for use with the inventors &# 39 ; previous fore grip having bipod legs , the invention can be used with other fore grips with leg stands having two , three or more legs , as needed . although the invention describes limiting the rocking motion to canting ( leaning to the left and to the right ), the invention can be deployed so that the weapon can tilt forward and backward , which is perpendicular to canting the firearm . also , the invention canting mounts can also allow the weapon to rotate in vertical neutral positions . the invention will also allow for rotating the weapon while the weapon is canting or tilting . the invention can be useful to accommodate weapons for uneven terrain , such as a hill , rocky terrain and the like . the invention allows for the weapon to be supported on the terrain in one location to fire different shots at different orientations ( up , down , to the left , to the right , on all axes , rotational axes , different combinations , and the like ) without moving the legs supporting the weapon . setting - up time and shot accuracy is greatly improved , by allowing a marksman to engage targets in a wide range of locations without having to physically change the position of the weapon support legs . while the invention has been described , disclosed , illustrated and shown in various terms of certain embodiments or modifications which it has presumed in practice , the scope of the invention is not intended to be , nor should it be deemed to be , limited thereby and such other modifications or embodiments as may be suggested by the teachings herein are particularly reserved especially as they fall within the breadth and scope of the claims here appended .	5
deuterium ( d or 2 h ) is a stable , non - radioactive isotope of hydrogen and has an atomic weight of 2 . 0144 . hydrogen naturally occurs as a mixture of the isotopes 1 h ( hydrogen or protium ), d ( 2 h or deuterium ), and t ( 3 h or tritium ). the natural abundance of deuterium is 0 . 015 %. one of ordinary skill in the art recognizes that in all chemical compounds with a h atom , the h atom actually represents a mixture of h and d , with about 0 . 015 % being d . thus , compounds with a level of deuterium that has been enriched to be greater than its natural abundance of 0 . 015 %, should be considered unnatural and , as a result , novel over their non - enriched counterparts . all percentages given for the amount of deuterium present are mole percentages . it can be quite difficult in the laboratory to achieve 100 % deuteration at any one site of a lab scale amount of compound ( e . g ., milligram or greater ). when 100 % deuteration is recited or a deuterium atom is specifically shown in a structure , it is assumed that a small percentage of hydrogen may still be present . deuterium - enriched can be achieved by either exchanging protons with deuterium or by synthesizing the molecule with enriched starting materials . the present invention provides deuterium - enriched lenalidomide or a pharmaceutically acceptable salt thereof . there are thirteen hydrogen atoms in the lenalidomide portion of lenalidomide as show by variables r 1 - r 13 in formula i below . the hydrogens present on lenalidomide have different capacities for exchange with deuterium . hydrogen atoms r 1 - r 3 are easily exchangeable under physiological conditions and , if replaced by deuterium atoms , it is expected that they will readily exchange for protons after administration to a patient . hydrogen atoms r 9 and r 12 - r 13 may be exchanged for deuterium atoms by the action of a suitable base such as t - buok / t - buod . the remaining hydrogen atoms are not easily exchangeable for deuterium atoms . however , deuterium atoms at the remaining positions may be incorporated by the use of deuterated starting materials or intermediates during the construction of lenalidomide . the present invention is based on increasing the amount of deuterium present in lenalidomide above its natural abundance . this increasing is called enrichment or deuterium - enrichment . if not specifically noted , the percentage of enrichment refers to the percentage of deuterium present in the compound , mixture of compounds , or composition . examples of the amount of enrichment include from about 0 . 5 , 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 12 , 16 , 21 , 25 , 29 , 33 , 37 , 42 , 46 , 50 , 54 , 58 , 63 , 67 , 71 , 75 , 79 , 84 , 88 , 92 , 96 , to about 100 mol %. since there are 13 hydrogens in lenalidomide , replacement of a single hydrogen atom with deuterium would result in a molecule with about 8 % deuterium enrichment . in order to achieve enrichment less than about 8 %, but above the natural abundance , only partial deuteration of one site is required . thus , less than about 8 % enrichment would still refer to deuterium - enriched lenalidomide . with the natural abundance of deuterium being 0 . 015 %, one would expect that for approximately every 6 , 667 molecules of lenalidomide ( 1 / 0 . 00015 = 6 , 667 ), there is one naturally occurring molecule with one deuterium present . since lenalidomide has 13 positions , one would roughly expect that for approximately every 86 , 671 molecules of lenalidomide ( 13 × 6 , 667 ), all 13 different , naturally occurring , mono - deuterated lenalidomides would be present . this approximation is a rough estimate as it doesn &# 39 ; t take into account the different exchange rates of the hydrogen atoms on lenalidomide . for naturally occurring molecules with more than one deuterium , the numbers become vastly larger . in view of this natural abundance , the present invention , in an embodiment , relates to an amount of an deuterium enriched compound , whereby the enrichment recited will be more than naturally occurring deuterated molecules . in view of the natural abundance of deuterium - enriched lenalidomide , the present invention also relates to isolated or purified deuterium - enriched lenalidomide . the isolated or purified deuterium - enriched lenalidomide is a group of molecules whose deuterium levels are above the naturally occurring levels ( e . g ., 8 %). the isolated or purified deuterium - enriched lenalidomide can be obtained by techniques known to those of skill in the art ( e . g ., see the syntheses described below ). the present invention also relates to compositions comprising deuterium - enriched lenalidomide . the compositions require the presence of deuterium - enriched lenalidomide which is greater than its natural abundance . for example , the compositions of the present invention can comprise ( a ) a μg of a deuterium - enriched lenalidomide ; ( b ) a mg of a deuterium - enriched lenalidomide ; and , ( c ) a gram of a deuterium - enriched lenalidomide . in an embodiment , the present invention provides an amount of a novel deuterium - enriched lenalidomide . examples of amounts include , but are not limited to ( a ) at least 0 . 01 , 0 . 02 , 0 . 03 , 0 . 04 , 0 . 05 , 0 . 1 , 0 . 2 , 0 . 3 , 0 . 4 , 0 . 5 , to 1 mole , ( b ) at least 0 . 1 moles , and ( c ) at least 1 mole of the compound . the present amounts also cover lab - scale ( e . g ., gram scale ), kilo - lab scale ( e . g ., kilogram scale ), and industrial or commercial scale ( e . g ., multi - kilogram or above scale ) quantities as these will be more useful in the actual manufacture of a pharmaceutical . industrial / commercial scale refers to the amount of product that would be produced in a batch that was designed for clinical testing , formulation , sale / distribution to the public , etc . in another embodiment , the present invention provides a novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof . wherein r 1 - r 13 are independently selected from h and d ; and the abundance of deuterium in r 1 - r 13 is at least 8 %. the abundance can also be ( a ) at least 15 %, ( b ) at least 23 %, ( c ) at least 31 %,( d ) at least 38 %, ( e ) at least 46 %, ( f ) at least 54 %, ( g ) at least 62 %, ( h ) at least 69 %, ( i ) at least 77 %, ( j ) at least 85 %, ( k ) at least 92 %, and ( 1 ) 100 %. in another embodiment , the present invention provides a novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 1 - r 3 is at least 33 %. the abundance can also be ( a ) at least 67 %, and ( b ) 100 %. in another embodiment , the present invention provides a novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 9 and r 12 - r 13 is at least 33 %. the abundance can also be ( a ) at least 67 %, and ( b ) 100 %. in another embodiment , the present invention provides a novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 1 - r 3 , r 9 , and r 12 - r 13 is at least 17 %. the abundance can also be ( a ) at least 33 %, ( b ) at least 50 %, ( c ) at least 67 %, ( d ) at least 83 %, and ( e ) 100 %. in another embodiment , the present invention provides a novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 4 - r 6 is at least 33 %. the abundance can also be ( a ) at least 67 %, and ( b ) 100 %. in another embodiment , the present invention provides a novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 7 - r 8 is at least 50 %. the abundance can also be ( a ) 100 %. in another embodiment , the present invention provides a novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 10 - r 13 is at least 25 %. the abundance can also be ( a ) at least 50 %, ( b ) at least 75 %, and ( c ) 100 %. in another embodiment , the present invention provides an isolated novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof . wherein r 1 - r 13 are independently selected from h and d ; and the abundance of deuterium in r 1 - r 13 is at least 8 %. the abundance can also be ( a ) at least 15 %, ( b ) at least 23 %, ( c ) at least 31 %,( d ) at least 38 %, ( e ) at least 46 %, ( f ) at least 54 %, ( g ) at least 62 %, ( h ) at least 69 %, ( i ) at least 77 %, ( j ) at least 85 %, ( k ) at least 92 %, and ( 1 ) 100 %. in another embodiment , the present invention provides an isolated novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 1 - r 3 is at least 33 %. the abundance can also be ( a ) at least 67 %, and ( b ) 100 %. in another embodiment , the present invention provides an isolated novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 9 and r 12 - r 13 is at least 33 %. the abundance can also be ( a ) at least 67 %, and ( b ) 100 %. in another embodiment , the present invention provides an isolated novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 1 - r 3 , r 9 , and r 12 - r 13 is at least 17 %. the abundance can also be ( a ) at least 33 %, ( b ) at least 50 %, ( c ) at least 67 %, ( d ) at least 83 %, and ( e ) 100 %. in another embodiment , the present invention provides an isolated novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 4 - r 6 is at least 33 %. the abundance can also be ( a ) at least 67 %, and ( b ) 100 %. in another embodiment , the present invention provides an isolated novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 7 - r 8 is at least 50 %. the abundance can also be ( a ) 100 %. in another embodiment , the present invention provides an isolated novel , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 10 - r 13 is at least 25 %. the abundance can also be ( a ) at least 50 %, ( b ) at least 75 %, and ( c ) 100 %. in another embodiment , the present invention provides novel mixture of deuterium enriched compounds of formula i or a pharmaceutically acceptable salt thereof . wherein r 1 - r 13 are independently selected from h and d ; and the abundance of deuterium in r 1 - r 13 is at least 8 %. the abundance can also be ( a ) at least 15 %, ( b ) at least 23 %, ( c ) at least 31 %,( d ) at least 38 %, ( e ) at least 46 %, ( f ) at least 54 %, ( g ) at least 62 %, ( h ) at least 69 %, ( i ) at least 77 %, ( j ) at least 85 %, ( k ) at least 92 %, and ( 1 ) 100 %. in another embodiment , the present invention provides a novel mixture of , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 1 - r 3 is at least 33 %. the abundance can also be ( a ) at least 67 %, and ( b ) 100 %. in another embodiment , the present invention provides a novel mixture of , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 9 and r 12 - r 13 is at least 33 %. the abundance can also be ( a ) at least 67 %, and ( b ) 100 %. in another embodiment , the present invention provides a novel mixture of , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 1 - r 3 , r 9 , and r 12 - r 13 is at least 17 %. the abundance can also be ( a ) at least 33 %, ( b ) at least 50 %, ( c ) at least 67 %, ( d ) at least 83 %, and ( e ) 100 %. in another embodiment , the present invention provides a novel mixture of , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 4 - r 6 is at least 33 %. the abundance can also be ( a ) at least 67 %, and ( b ) 100 %. in another embodiment , the present invention provides a novel mixture of , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 7 - r 8 is at least 50 %. the abundance can also be ( a ) 100 %. in another embodiment , the present invention provides a novel mixture of , deuterium enriched compound of formula i or a pharmaceutically acceptable salt thereof , wherein the abundance of deuterium in r 10 - r 13 is at least 25 %. the abundance can also be ( a ) at least 50 %, ( b ) at least 75 %, and ( c ) 100 %. in another embodiment , the present invention provides novel pharmaceutical compositions , comprising : a pharmaceutically acceptable carrier and a therapeutically effective amount of a deuterium - enriched compound of the present invention . in another embodiment , the present invention provides a novel method for treating multiple myeloma comprising : administering to a patient in need thereof a therapeutically effective amount of a deuterium - enriched compound of the present invention . in another embodiment , the present invention provides an amount of a deuterium - enriched compound of the present invention as described above for use in therapy . in another embodiment , the present invention provides the use of an amount of a deuterium - enriched compound of the present invention for the manufacture of a medicament ( e . g ., for the treatment of multiple myeloma ). the present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof . this invention encompasses all combinations of preferred aspects of the invention noted herein . it is understood that any and all embodiments of the present invention may be taken in conjunction with any other embodiment or embodiments to describe additional more preferred embodiments . it is also to be understood that each individual element of the preferred embodiments is intended to be taken individually as its own independent preferred embodiment . furthermore , any element of an embodiment is meant to be combined with any and all other elements from any embodiment to describe an additional embodiment . the examples provided in the definitions present in this application are non - inclusive unless otherwise stated . they include but are not limited to the recited examples . the compounds of the present invention may have asymmetric centers . compounds of the present invention containing an asymmetrically substituted atom may be isolated in optically active or racemic forms . it is well known in the art how to prepare optically active forms , such as by resolution of racemic forms or by synthesis from optically active starting materials . all processes used to prepare compounds of the present invention and intermediates made therein are considered to be part of the present invention . all tautomers of shown or described compounds are also considered to be part of the present invention . “ host ” preferably refers to a human . it also includes other mammals including the equine , porcine , bovine , feline , and canine families . “ treating ” or “ treatment ” covers the treatment of a disease - state in a mammal , and includes : ( a ) preventing the disease - state from occurring in a mammal , in particular , when such mammal is predisposed to the disease - state but has not yet been diagnosed as having it ; ( b ) inhibiting the disease - state , e . g ., arresting it development ; and / or ( c ) relieving the disease - state , e . g ., causing regression of the disease state until a desired endpoint is reached . treating also includes the amelioration of a symptom of a disease ( e . g ., lessen the pain or discomfort ), wherein such amelioration may or may not be directly affecting the disease ( e . g ., cause , transmission , expression , etc .). “ therapeutically effective amount ” includes an amount of a compound of the present invention that is effective when administered alone or in combination to treat the desired condition or disorder . “ therapeutically effective amount ” includes an amount of the combination of compounds claimed that is effective to treat the desired condition or disorder . the combination of compounds is preferably a synergistic combination . synergy , as described , for example , by chou and talalay , adv . enzyme regul . 1984 , 22 : 27 - 55 , occurs when the effect of the compounds when administered in combination is greater than the additive effect of the compounds when administered alone as a single agent . in general , a synergistic effect is most clearly demonstrated at sub - optimal concentrations of the compounds . synergy can be in terms of lower cytotoxicity , increased antiviral effect , or some other beneficial effect of the combination compared with the individual components . “ pharmaceutically acceptable salts ” refer to derivatives of the disclosed compounds wherein the parent compound is modified by making acid or base salts thereof . examples of pharmaceutically acceptable salts include , but are not limited to , mineral or organic acid salts of the basic residues . the pharmaceutically acceptable salts include the conventional quaternary ammonium salts of the parent compound formed , for example , from non - toxic inorganic or organic acids . for example , such conventional non - toxic salts include , but are not limited to , those derived from inorganic and organic acids selected from 1 , 2 - ethanedisulfonic , 2 - acetoxybenzoic , 2 - hydroxyethanesulfonic , acetic , ascorbic , benzenesulfonic , benzoic , bicarbonic , carbonic , citric , edetic , ethane disulfonic , ethane sulfonic , fumaric , glucoheptonic , gluconic , glutamic , glycolic , glycollyarsanilic , hexylresorcinic , hydrabamic , hydrobromic , hydrochloric , hydroiodide , hydroxymaleic , hydroxynaphthoic , isethionic , lactic , lactobionic , lauryl sulfonic , maleic , malic , mandelic , methanesulfonic , napsylic , nitric , oxalic , pamoic , pantothenic , phenylacetic , phosphoric , polygalacturonic , propionic , salicyclic , stearic , subacetic , succinic , sulfamic , sulfanilic , sulfuric , tannic , tartaric , and toluenesulfonic . table 1 provides compounds that are representative examples of the present invention . when one of r 1 - r 13 is present , it is selected from h or d . table 2 provides compounds that are representative examples of the present invention . where h is shown , it represents naturally abundant hydrogen . numerous modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that within the scope of the appended claims , the invention may be practiced otherwise that as specifically described herein .	0
[ 0016 ] fig1 shows a preferred embodiment of a phone according to the invention , and it will be seen that the phone , which is generally designated by 1 , comprises a user interface having a keypad 2 , a display 3 , an on / off button 4 ( present in the top of the phone and therefore not visible in the present view ), a speaker 5 , and a microphone 6 ( openings present in the bottom of the phone and therefore not visible in the present view ). the phone 1 according to the preferred embodiment is adapted for communication via a cellular network , such as the gsm 900 / 1800 mhz network . according to the preferred embodiment the keypad 2 has a first group 7 of keys as alphanumeric keys , one softkey 8 , a cursor navigation key 10 ( scroll up / down ), and a “ clear ”- key 9 for erasing letters in text in the display 3 , jumping steps down in the menu structure and rejecting calls . the present functionality of the soft key 8 is shown in separate fields ( softkey - label ) in the display 3 just above the softkey 8 . the softkey 8 is a multifunction key and its present function depends on the state of the phone 1 . the softkey 8 gives access to the menu , the phonebook and call handling . [ 0018 ] fig2 schematically shows the most important parts of a preferred embodiment of the phone , said parts being essential to the understanding of the invention . the processor 18 controls the communication with the network via the transmitter / receiver circuit 19 and an internal antenna 20 . the microphone 6 transforms the user &# 39 ; s speech into analogue signals , the analogue signals formed thereby are a / d converted in an a / d converter ( not shown ) before the speech is encoded in a digital signal processing unit 14 ( dsp ). the encoded speech signal is transferred to the processor 18 , which i . e ., supports the gsm terminal software . the processor 18 also forms the interface to the peripheral units of the apparatus , including a ram memory 17 a and a flash rom memory 17 b , a sim card 16 , the display 3 and the keypad 2 ( as well as data , power supply , etc .). the digital signal - processing unit 14 speech - decodes the signal , which is transferred from the processor 18 to the earpiece 5 via a d / a converter ( not shown ). the antenna according to the preferred embodiment of the invention is a pifa ( planar inverted f - antenna ) and includes an ground plane being provided by the shield 29 of the printed circuit board ( pcb ) of the phone , one radiator plate 24 mounted on an antenna blank 21 and two pogopin connectors 30 . the antenna structure is shown in fig3 . the antenna blank is made of ixef ( the ixef compounds are a family of semi - crystalline polyarylamide thermoplastics reinforced with glass fibers and / or mineral fillers essentially for injection molding and manufactured by solvay ) and the radiator plate of 0 . 15 mm thick new silver . ultrasonic welding ( depending on vendor ) assembles the two parts . an inner cover 26 of the phone 1 is preferably also made of the same resin as the antenna blank 21 . the antenna blank 21 has two taps 23 for being received in two channels 32 provided in the inner cover 26 . when the tabs 22 are received in the channels 32 , the blank 21 may follow a guided movement towards the closed position , where a tongue 22 of the antenna blank 21 cooperates with a recess 25 on the inner cover 26 for providing a snap connection between the antenna blank 21 and the inner cover 26 . just below the antenna cavity 28 there is provided a battery cavity 31 for receiving a battery box ( not shown ). the front and rear covers of the phone are visible in fig1 but are removed in fig3 . the front and rear covers are of the type described in gb 9903260 . 9 . the two pogopin connectors 30 are shown in enlarged scale in fig5 . the pogopin connectors 30 are provided as spring loaded contacts with bleeding holes in the base contact ( barrel ), it consists of a metal barrel 33 , an internal metal spring ( not visible ) and a plunger 34 ( moving part ). the spring in the connector is under constant load in contact position . the antenna blank 21 is clicked on the inner - cover frame 26 of the phone . this construction avoids the dielectric body of the antenna ( antenna blank ) being placed between the radiator plate 24 and the ground plane of the antenna ( pcb - shield 29 ). this structure is important to reduce the dielectric loss in the antenna . the dominating part of the field generated by the antenna will be between the radiator plate 24 and the ground plane ( shield 29 ). by not having dielectric material in this area the loss is reduced . the dielectric properties of the antenna blank 21 are still important for the performance . the permittivity of the ixef material is approximately 4 and it does load the antenna . this type of antenna structure may be called a superstrate loaded antenna ( without or substantially without dielectric material between the radiator plate 24 and the ground plane ( shield 29 ). by providing the antenna blank 21 as a “ snap on ” structure it will be possible to access the radio signal on the assembly line at the factory in order to verify the performance of the transmitter 18 . therefore , there is no need to provide a separate rf - connector , which is usually used for performance verification . by being able to remove the antenna relatively easily , it is made possible to connect test equipment to the radio transmitter through the antenna connectors — both during the manufacturing and at after market service . in design of the radiator shape a number of aspects must be taken into account . first of all the battery , which during use is placed in the battery cavity 31 , has a large influence on antenna performance . also it should be designed so that influence of hand and fingers of the user is minimized . the way these things are handled is to put the high voltage point ( the end 44 of the gsm part ) of the patch at the top of the phone — as far away from the battery as possible . the high voltage point of the patch turned out to be the one having the biggest coupling to the battery . the feeding points of the antenna 47 are provided close to the top of the antenna . the ground pin is closest to a slot 45 and the signal pin starts a quarter wave resonant element . this antenna has a part — indicated by an arrow 40 — corresponding to the gsm part , which is “ active ” in both bands ( 900 mhz and 1800 mhz ). in gsm ( 900 mhz ) this part 40 corresponds to quarter wave resonance , while in pcn ( 1800 mhz ) the part has a higher order resonance . a part corresponding to pcn part is a pcn match stub 41 . the pcn match stub 41 matches the higher order resonance of the pcn band . this antenna can basically be described by a u - shaped gsm part 40 and a pcb match stub 41 between the two arms of the u - shaped gsm part 40 . the patch antenna is constructed in such a way it can be tuned quite independently in the two bands . in pcn it is a question of making the pcn stub shorter or longer . by removing one or more of the dotted parts of the pcn adjustment part 42 , the pcn frequency will increase without affecting the gsm frequency . in gsm the unique feature of making the slot longer at the same time reduces the size ( area ) of the pcn stub . this means that even though the pcn frequency is tuned down by making the slot longer and this effect is balanced out by reducing the size of the pcn stub 41 . the radiator plate 24 is punched out of a metal sheet and mounted to the inner surface of the antenna blank 21 . this mounting is done by means of ultra sonic welding of the tab on the blank 21 extending through a plurality of holes 46 of the radiator plate 24 . the form of the radiator plate 24 is shown in fig4 . hereby it becomes possible during manufacture to adjust the match of the pcn band of the antenna by cutting off smaller or bigger parts of the pcn adjustment part 42 . in design of this antenna , bandwidth is an important parameter . in order to enhance the bandwidth , the distance between the end 44 of the gsm part and the pcn stub is separated as far as the area allows . this distance ( the width of the slot 45 ) may be reduced to tune down the resonance frequency since coupling is increased . however in order to keep a sufficient bandwidth it is preferred to keep distance between the two parts above a certain level . another bandwidth enhancing feature is to keep the structure as simple as possible in the sense that the current should avoid making strong bends . this has influence on the gsm part but is less critical for the pcn stub . by removing one or more of the dotted parts of the gsm adjustment part 43 , the gsm frequency will decrease without affecting the pcn frequency . the current path for gsm will increase . the same will count for the pcn current path , but the size reduction of the pcn stub 41 will compensate for this . the main effects of the antenna describe above is the highest voltage is designed for the top of the phone in order to minimize coupling to the battery . furthermore the coupling between the end of the gsm part and the pcn stub is minimized in order to increase the bandwidth of the antenna . the two bands of the antenna are designed so independent tuning of gsm and pcn is obtained . gsm is tuned by changing the length of the signal path by making the slot bigger , though at the same time making the pcn stub area smaller . by having such a design the pcn resonance will be almost constant when making a gsm tuning . the simple structure of the radiator gives the current a natural flow on the patch , which increases the bandwidth of the antenna .	7
fig1 shows the typical surface after the laser treatment . the entire surface of the aluminum oxide ceramic was then subjected to plasma coating with hydroxyl apatite . for the first time it was possible to detect on this surface a few spots on which the hydroxyl apatite coating could be detected . nevertheless it was not possible even after this preliminary treatment to apply a continuous coating . fig2 and 3 show the surfaces of the lasered and hydroxyl apatite ( ha ) coated specimens . surprisingly it was possible according to the invention to coat a ceramic component , preferably a component made of aluminum oxide ceramic , with hydroxyapatite if the surface of the ceramic component is coated with a titanium layer . by the method of the invention it is surprisingly possible for the first time to deposit hydroapatic on the surface of a ceramic component , with sufficient strength of adhesion . according to the invention , first ceramic components are provided with a thin titanium coating , for example by pvd ( physical vapor deposition ). according to the invention , the surface of the ceramic component can be previously roughened ,— ground or lasered , for example . the thickness of the titanium layer was about 1 μm ; a coating 5 μm thick also led to success . fig6 shows the transverse section of a specimen coated in this manner . the hydroxyapatite layer was sprayed onto this intermediate layer . the transverse section of this built - up coating is represented in fig7 and 8 at different enlargements . preferably , before the hydroxyapatite is applied by plasma coating , for example , the titanium intermediate layer is subjected also to a sand blasting process to improve adhesion . an especially high strength of adhesion is achieved if the titanium coating is given a roughness of r a ≈ 40 - 50 μm . a scratch test on the hydroxyapatite coating confirmed the outstanding strength of adhesion of the coating . preparation of a transverse section was possible without problems . the measurement of the strength of adhesion was made on five different specimens . the individual values are summarized in table 1 . from the values obtained by the strength - of - adhesion measurements it can be seen that tensions are surprisingly achieved which are in the range of that of hydroxyapatite coatings on tial6v4 alloys . according to the invention , it is also possible , instead of the conventional titanium intermediate coating , an intermediate coating of the tial6v4 alloy can be deposited , for example by the pvd method . fig9 shows the typical building of layers in the preparation of transverse sections . the corresponding strengths of adhesion are listed in table 2 . specimen force [ n ] tension [ mpa ] 1 582 1 . 9 2 700 2 . 2 3 400 1 . 3 4 498 1 . 6 a ceramic component in the form of a cylindrical test specimen was used in the tests . the cylinders , with a diameter of 20 mm and a thickness of 2 mm , were made by the conventional press - turn manufacture as greenbodies , subjected to hot isostatic pressure and annealed . the sintered bodies were then machined with diamond tools to achieve final shape . other methods for the manufacture of ceramic components can , of course , also be used . used as the material was a known aluminum oxide material , such as the one known as biolox ® material , for example . with the present invention it is thus for the first time possible by providing a titanium intermediate coating to deposit hydroxyapatite directly onto ceramic components . the ceramic components that can be made by the method of the invention are also subject matter of the present invention . thus , according to the invention , ceramic components can for the first time be made , which can be used for medical purposes , for example as prostheses . such prostheses display an improved ingrowth characteristic .	0
the present invention relates to a method for making an intravascular stent . the underlying structure of the stent can be virtually any stent design , whether of the self - expanding type or of the balloon - expandable type and whether metal or polymeric . thus metal stent designs such as those disclosed in u . s . pat . no . 4 , 733 , 665 issued to palmaz , u . s . pat . no . 4 , 800 , 882 issued to gianturco or u . s . pat . no . 4 , 886 , 062 issued to wiktor could be used in the present invention . for example , the configuration of the stent 1 shown in fig3 is such , that a wire has a reversing bend pattern 2 so that controlled radial expansion of the stent 1 is accomplished by the force generated by an inflating balloon 3 . when acted upon by the inflating balloon 3 , the stent 1 expands radially by controlled deformation and tension applied to the pattern 2 of the wire . the expanded larger diameter will conform to the inside of the vessel 4 and maintain intimate contact with the inside wall due to the low memory level of the deformable metal used for the wire . the stent could be made of virtually any bio - compatible material having physical properties suitable for the design . for example , tantalum and stainless steel have been proven suitable for many such designs and could be used in the present invention . also , stents made with biostable or bioabsorbable polymers such as poly ( ethylene terephthalate ), polyacetal , poly ( lactic acid ), poly ( ethylene oxide )/ poly ( butylene terephthalate ) copolymer could be used in the present invention . although the stent surface should be clean and free from contaminants that may be introduced during manufacturing , the stent surface requires no particular surface treatment in order to retain the coating applied in the present invention . both the inner and outer surfaces of the stent may be provided with the coating according to the present invention . in order to provide the coated stent according to the present invention , a solution which includes a solvent , a polymer dissolved in the solvent and a therapeutic substance dispersed in the solvent is first prepared . it is important to choose a solvent , a polymer and a therapeutic substance that are mutually compatible . it is essential that the solvent is capable of placing the polymer into solution at the concentration desired in the solution . it is also essential that the solvent and polymer chosen do not chemically alter the therapeutic character of the therapeutic substance . however , the therapeutic substance only needs to be dispersed throughout the solvent so that it may be either in a true solution with the solvent or dispersed in fine particles in the solvent . examples of some suitable combinations of polymer , solvent and therapeutic substance are set forth in table 1 below . table 1______________________________________polymer solvent therapeutic substance______________________________________poly ( l - lactic chloroform dexamethasoneacid ) poly ( lactic acetone dexamethasoneacid - co - glycolic acid ) polyether n - methyl tocopherolurethane pyrrolidone ( vitamin e ) silicone xylene dexamethasoneadhesive phosphatepoly ( hydroxy - dichloro - aspirinbutyrate - co - methanehydroxyvalerate ) fibrin water heparin ( buffered saline ) ______________________________________ the solution is applied to the stent and the solvent is allowed to evaporate , thereby leaving on the stent surface a coating of the polymer and the therapeutic substance . typically , the solution can be applied to the stent by either spraying the solution onto the stent or immersing the stent in the solution . whether one chooses application by immersion or application by spraying depends principally on the viscosity and surface tension of the solution , however , it has been found that spraying in a fine spray such as that available from an airbrush will provide a coating with the greatest uniformity and will provide the greatest control over the amount of coating material to be applied to the stent . in either a coating applied by spraying or by immersion , multiple application steps are generally desirable to provide improved coating uniformity and improved control over the amount of therapeutic substance to be applied to the stent . the polymer chosen must be a polymer that is biocompatible and minimizes irritation to the vessel wall when the stent is implanted . the polymer may be either a biostable or a bioabsorbable polymer depending on the desired rate of release or the desired degree of polymer stability , but a bioabsorbable polymer is probably more desirable since , unlike a biostable polymer , it will not be present long after implantation to cause any adverse , chronic local response . bioabsorbable polymers that could be used include poly ( l - lactic acid ), polycaprolactone , poly ( lactide - co - glycolide ), poly ( hydroxybutyrate ), poly ( hydroxybutyrate - co - valerate ), polydioxanone , polyorthoester , polyanhydride , poly ( glycolic acid ), poly ( d , l - lactic acid ), poly ( glycolic acid - co - trimethylene carbonate ), polyphosphoester , polyphosphoester urethane , poly ( amino acids ), cyanoacrylates , poly ( trimethylene carbonate ), poly ( iminocarbonate ), copoly ( ether - esters ) ( e . g . peo / pla ), polyalkylene oxalates , polyphosphazenes and biomolecules such as fibrin , fibrinogen , cellulose , starch , collagen and hyaluronic acid . also , biostable polymers with a relatively low chronic tissue response such as polyurethanes , silicones , and polyesters could be used and other polymers could also be used if they can be dissolved and cured or polymerized on the stent such as polyolefins , polyisobutylene and ethylene - alphaolefin copolymers ; acrylic polymers and copolymers , vinyl halide polymers and copolymers , such as polyvinyl chloride ; polyvinyl ethers , such as polyvinyl methyl ether ; polyvinylidene halides , such as polyvinylidene fluoride and polyvinylidene chloride ; polyacrylonitrile , polyvinyl ketones ; polyvinyl aromatics , such as polystyrene , polyvinyl esters , such as polyvinyl acetate ; copolymers of vinyl monomers with each other and olefins , such as ethylene - methyl methacrylate copolymers , acrylonitrile - styrene copolymers , abs resins , and ethylene - vinyl acetate copolymers ; polyamides , such as nylon 66 and polycaprolactam ; alkyd resins ; polycarbonates ; polyoxymethylenes ; polyimides ; polyethers ; epoxy resins , polyurethanes ; rayon ; rayon - triacetate ; cellulose , cellulose acetate , cellulose butyrate ; cellulose acetate butyrate ; cellophane ; cellulose nitrate ; cellulose propionate ; cellulose ethers ; and carboxymethyl cellulose . the ratio of therapeutic substance to polymer in the solution will depend on the efficacy of the polymer in securing the therapeutic substance onto the stent and the rate at which the coating is to release the therapeutic substance to the tissue of the blood vessel . more polymer may be needed if it has relatively poor efficacy in retaining the therapeutic substance on the stent and more polymer may be needed in order to provide an elution matrix that limits the elution of a very soluble therapeutic substance . a wide ratio of therapeutic substance to polymer could therefore be appropriate and could range from about 10 : 1 to about 1 : 100 . the therapeutic substance used in the present invention could be virtually any therapeutic substance which possesses desirable therapeutic characteristics for application to a blood vessel . this can include both solid substances and liquid substances . for example , glucocorticoids ( e . g . dexamethasone , betamethasone ), heparin , hirudin , tocopherol , angiopeptin , aspirin , ace inhibitors , growth factors , oligonucleotides , and , more generally , antiplatelet agents , anticoagulant agents , antimitotic agents , antioxidants , antimetabolite agents , and anti - inflammatory agents could be used . antiplatelet agents can include drugs such as aspirin and dipyridamole . aspirin is classified as an analgesic , antipyretic , anti - inflammatory and antiplatelet drug . dypridimole is a drug similar to aspirin in that it has anti - platelet characteristics . dypridimole is also classified as a coronary vasodilator . anticoagulant agents can include drugs such as heparin , coumadin , protamine , hirudin and tick anticoagulant protein . antimitotic agents and antimetabolite agents can include drugs such as methotrexate , azathioprine , vincristine , vinblastine , fluorouracil , adriamycin and mutamycin . a 1 % solution of dexamethasone in acetone was made , forming a clear solution . the solution was placed in an airbrush reservoir ( badger # 200 ). wiktor type tantalum wire stents were sprayed with the solution in short bursts while rotating the stents . the acetone quickly evaporated from the stents , leaving a white residue on the stent wire . the process was continued until all of the stent wires were coated . the drug elution rate for the stent was determined by immersing the stent in phosphate buffered saline solution ( ph = 7 . 4 ). traces of dexamethasone were observed to remain on the immersed stents for less than 31 hours . a 2 % solution of dexamethasone in acetone was made , forming a solution with suspended particles of dexamethasone . the solution was placed into a tube . wiktor type tantalum wire stents were dipped rapidly and were allowed to dry . each stent was dipped into the solution 12 - 15 times to provide a white surface coating . two stents were placed on an angioplasty balloon and were inflated on the balloon . approximately 80 % of the dexamethasone coating flaked off of the stents . a solution of 1 % dexamethasone and 0 . 5 % poly ( caprolactone ) ( aldrich 18 , 160 - 9 ) in acetone was made . the solution was placed into a tube . wiktor type tantalum wire stents were dipped rapidly and were allowed to dry . each stent was dipped into the solution 12 - 15 times to provide a white surface coating . a stent so coated was expanded on a 3 . 5 mm angioplasty balloon causing a significant amount of the coating to become detached . a solution of 1 % dexamethasone and 0 . 5 % poly ( l - lactic acid ) ( medisorb ) in acetone was made . the solution was placed into a tube . wiktor type tantalum wire stents were dipped rapidly and were allowed to dry . each stent was dipped into the solution 12 - 15 times to provide a white surface coating . a stent so coated was expanded on a 3 . 5 mm angioplasty balloon causing only a small portion of the coating ( less than 25 %) to become detached ) a solution including a 2 % dispersion of dexamethasone and a 1 % solution of poly ( l - lactic acid ) ( cca biochem mw = 550 , 000 ) in chloroform was made . the solution was placed into an airbrush ( badger ). wiktor type tantalum wire stents were sprayed in short bursts and were allowed to dry . each stent was sprayed with the solution about 20 times to provide a white surface coating . a stent so coated was expanded on a 3 . 5 mm angioplasty balloon . the coating remained attached to the stent throughout the procedure . a solution including a 2 % dispersion of dexamethasone and a 1 % solution of poly ( l - lactic acid ) ( cca biochem mw = 550 , 000 ) in chloroform was made . the solution was placed into an airbrush ( badger # 250 - 2 ). wiktor type tantalum wire stents were suspended from a fixture and sprayed in 24 short bursts ( 6 bursts from each of the four directions perpendicular to the stent axis ) and were allowed to dry . the resulting stents had a coating weight of about 0 . 0006 - 0 . 0015 grams . three of the stents were tested for long term elution by placing one stent in 3 . 0 ml of phosphate buffered saline solution ( ph = 7 . 4 ) at room temperature without stirring . the amount of dexamethasone eluted was evaluated by measuring absorbance at 244 nm in a uv - vis spectrophotometer . the results of this test are given in fig1 . a solution including a 2 % dispersion of dexamethasone and a 1 % solution of poly ( l - lactic acid ) ( medisorb 100 - l ) in chloroform was made along with a control solution of 1 % of poly ( l - lactic acid ) ( medisorb 100 - l ) in chloroform . the solutions was placed into an airbrush ( badger # 250 - 2 ). wiktor type tantalum wire stents were expanded on a 3 . 0 mm balloon , suspended from a fixture and sprayed in 16 short bursts ( 2 - 3 bursts of about 1 second followed by several minutes drying time between applications ). the resulting dexamethasone - coated stents had an average coating weight of about 0 . 0012 grams while the polymer - coated stents had an average polymer weight of about 0 . 0004 grams . the stents were sterilized in ethylene oxide . three of the sterilized dexamethasone - coated stents were tested for long term elution by placing one stent in 3 . 0 ml of phosphate buffered saline solution ( ph = 7 . 4 ) at room temperature without stirring . the amount of dexamethasone eluted was evaluated by measuring absorbance at 244 nm in a uv - vis spectrophotometer . the results of this test are given in fig2 . dexamethasone - coated stents and polymer - coated control stents were implanted in the coronary arteries of 8 pigs ( n = 12 for each type ) according to the method set forth in &# 34 ; restenosis after balloon angioplasty -- a practical proliferative model in porcine coronary arteries ,&# 34 ; by robert s . schwartz , et al , circulation 82 ( 6 ): 2190 - 2200 , december 1990 , and &# 34 ; restenosis and the proportional neointimal response to coronary artery injury : results in a porcine model &# 34 ; by robert s . schwartz et al , j am coll cardiol ; 19 ; 267 - 74 february 1992 with the result that when compared with the controls , the dexamethasone - coated stents reduced the amount of proliferation associated with the arterial injury . it will be appreciated by those skilled in the art that while the invention has been described above in connection with particular embodiments and examples , the invention is not necessarily so limited and that numerous other embodiments , examples , uses , modifications and departures from the embodiments , examples and uses may be made without departing from the inventive concepts .	0
modern financial indexes , such as value / growth indexes , are designed to reflect the behavior of active managers . the success of these indexes is gauged to a large degree by their ability to capture these behaviors . and while the modern financial indexes may be successful in this regard , they fail to prove effective for other purposes . further , as investors increasingly gravitate toward total return investments ( hedge funds , etc .) style indexes that simply mirror the broader market volatility become increasingly irrelevant to the problems of asset allocation and performance attribution . modern portfolio theory suggests constructing an optimal asset portfolio by using risk and return data to determine the proportions of various types of portfolio assets . portfolio theory thus works best when asset - type choices are distinct — when available asset classes or groups are as different as possible . the construction of an optimally efficient portfolio depends on this differentiation . modern financial indexes , designed to reflect investment strategies of active managers , fail to accommodate this goal . value and growth indexes , for example , overlap significantly in various important characteristics : that which makes these indexes characteristically similar to the managers makes them characteristically similar to each other . this high degree of overlap among known financial indexes provides inadequate differentiation and distinct choices in selecting assets for an optimally efficient portfolio . desirable investment portfolios tend to focus in a securities market around the moderate middle of the growth - value continuum ; investors can then make opportunistic forays to the extremes ( e . g ., greater growth or fundamental cheapness ). this indicates that both value and growth indexes are populated — at least at their extremes — with risky investments . this risk overlap confounds the risk - return tradeoffs on which modern portfolio theory depends . an index framework which addresses varying risk characteristics is thus required . the present invention meets this requirement and solves problems with known financial indexes by providing a volatility - based index framework . recognizing that investors share the goal of earning the highest level of return for any level of risk , a volatility - based index framework provides investors with valuable information about , among other things , the most distinct choices in risk . distinct choices both broaden and strengthen investors &# 39 ; opportunity set . volatility style indices also provide a surprising and effective new way to categorize and evaluate securities for various purposes including determining asset classes , market benchmarking , portfolio analysis , and evaluating fund performance . ‘ security ’ is a broad term extending across a broad reach of investable asset classes and their constituent securities ; the term is to be given its ordinary and customary meaning to a person of ordinary skill in the art ( i . e ., it is not to be limited to a special or customized meaning ) and includes , without limitation , equity ( common stock , preferred , convertible issues ), debt ( bonds , banknotes , debentures ), real estate , currency investments , so - called alternate assets such as natural resources , precious metals , commodities , venture capital , hedge funds , and investable strategies . focusing on volatility does not forfeit insights provided by other fundamental measures ; it amplifies them , rather , thus allowing more effective choices in the search for superior risk - adjusted returns ( e . g ., as measured by alpha ). investors can use the volatility style indices to gain insights into the risk - return opportunities among various investments . the volatility style indices can be structured to span the broad market , thus allowing plug - and - play compatibility with the capital asset pricing model ( capm ) and other aspects of modern portfolio theory . further , the volatility fracture provided by a volatility - based index framework facilitates tradeoffs between equity risk and other asset classes . as discussed later , a volatility - based index framework demonstrably provides greater differentiation in choices for security exposure , not only with regard to risk , but also with regard to other equally important indicators such as cumulative or average return and sharpe ratio . further still , volatility style indices are demonstrably persistent , with a low turnover among the indices , which facilitates predictability . fig1 illustrates a schematic diagram of examples of system and computer - readable medium embodiments provided in accordance with the present invention . an index provider 110 , market data provider 120 , financial service provider 130 , and investor 151 can communicate over a network . the network can include , for example and without limitation , wires or wireless data networks ( e . g ., networks utilizing t1 , e1 , t2 , e2 , t3 , e3 , ds4 , e4 , ds1 , ds2 , ds3 , 1 mb ethernet , 10 mb ethernet , 100 mb ethernet , 1 gb ethernet , 10 gb ethernet , backplane ethernet , resilient packet ring , frame relay , vdsl , adsl , dsl , fcs , fddi , firewire , scsi , fiberchannel , ficon , escon , sts - 1 , oc - 1 , oc - 3 , oc - 12 , 25 oc - 48 , oc - 192 , oc - 768 , atm uni , atm nni , wifi , wimax , atm , or the like ), connections through a networked medium or media ( e . g ., the internet , an extranet , an intranet , a wide area network ( wan ), a local area network ( lan ), or the like ), and various devices ( e . g ., hubs , routers , switches , relays , vpn servers , firewalls , intrusion detection systems , nat devices , aggregators , or the like ). network 101 can also include , for example , various combinations of these and other systems and communications technologies . in various embodiments , the network 101 supports secure communications , for example , using various security techniques ( operating , e . g ., at various network layers ), including but not limited to secure sockets layer ( ssl ), layer 2 tunneling protocol ( l2tp ), transport layer security ( tls ), tunneling tls ( ttls ), ipsec , http secure ( https ), extensible authentication protocol , ( eap ), and the like . as shown in fig3 , an index provider 110 is associated with an interface module 113 , an index service module 111 , and a data store 112 . the index service 111 can generate volatility style indices , for example , using data stored in data store 112 or obtained from the network ( e . g ., from market data provider 120 ). the index service can also provide on request current and historical data for volatility style indices . the data store 112 can store current and historical securities data , generated index information , user data , and any other data needed by the index provider . an interface 113 can provide access to services provided by the index service . for example , the financial service provider 130 or investor 151 can request updated index information from the index provider through the interface 113 . if a volatility style index is manages as a mutual fund , exchange - traded fund , or the like , the interface can provide real - time fund data , order processing , and any related functionality . the interface can have an api component 114 for programmatic interaction with the index provider . in various embodiments , the api component can allow hardware or software devices connected to the network to obtain automatically index information and other data provided by the index provider 110 . a market data provider 120 is associated with an interface module 123 , a market data service module 121 , and a data store 122 . the market data service 121 can provide current and historical market data ( e . g ., fundamental or technical indicators , news releases , real - time trade data , and other market data ). the data store 122 can store current and historical market data , and any other information required by the market data provider 120 or other entities on the network . an interface 123 can provide access to services provided by the market data provider 120 . for example , the index service provider 110 , financial service provider 130 , or investor 151 can request updated market information from the market data provider 120 through the interface 123 . in various embodiments , detailed analyses or comparisons can be requested via the interface and processed by the market data service 121 . the interface can have an api component for programmatic interaction with the market data provider . the interface can have an api component 124 for programmatic interaction with the market data provider . in various embodiments , the api component can allow hardware or software devices connected to the network to obtain automatically market data and other information provided by the market data provider 120 . a financial service provider 130 is associated with an interface module 133 , a financial transaction service module 131 , and a data store 122 . the financial transaction service 131 can process securities transactions and complete other market operations for other entities such as and index provider 110 or investor 151 . the data store 132 can store securities information , account information , trade information , or any other data needed by the financial service provider 130 . an interface 133 can provide access to services provided by the financial service provider 130 . for example , the index service provider 110 , market data provider 120 , or investor 151 can carry out securities transactions , check trade status , review account information , transfer assets , or the like through the interface 133 . the interface 133 can have an api component 134 for programmatic interaction with the financial service provider . in various embodiments , the api component 134 can allow hardware or software devices connected to the network 101 to initiate automatically market transactions or utilize other services provided by the financial service provider 120 . in various aspects , the investor 151 can be operatively associated with one or more computer systems 152 or devices 153 . these systems and devices can include , for example and without limitation , a cell phone , smart phone , tablet computer , laptop , netbook , desktop computer , personal entertainment device , electronic book reader , other wireless device , set - top or other television box , media player , game platform , kiosk , or any other electronic device with appropriate interface and communication facilities . it is to be understood that the figures and descriptions of embodiments of the present invention have been simplified to illustrate elements that are relevant for a clear understanding of the present invention , while eliminating , for purposes of clarity , other elements . those of ordinary skill in the art will recognize , however , that these and other elements may be desirable for practice of various aspects of the present embodiments . because such elements are well known in the art , and because they do not facilitate a better understanding of the present invention , a discussion of such elements is not provided herein . it can be appreciated that , in some embodiments of the present methods and systems disclosed herein , a single component can be replaced by multiple components , and multiple components replaced by a single component , to perform a given function or functions . except where such substitution would not be operative to practice the present methods and systems , such substitution is within the scope of the present invention . examples presented herein , including operational examples , are intended to illustrate potential implementations of the present method and system embodiments . it can be appreciated that such examples are intended primarily for purposes of illustration . no particular aspect or aspects of the example method , product , computer readable media , and / or system embodiments described herein are intended to limit the scope of the present invention . it should be appreciated that figures presented herein are intended for illustrative purposes and are not intended as construction drawings . omitted details and modifications or alternative embodiments are within the purview of persons of ordinary skill in the art . furthermore , whereas particular embodiments of the invention have been described herein for the purpose of illustrating the invention and not for the purpose of limiting the same , it will be appreciated by those of ordinary skill in the art that numerous variations of the details , materials and arrangement of parts / elements / steps / functions may be made within the principle and scope of the invention without departing from the invention as described in the appended claims . fig2 illustrates an example of a process for generating volatility style indices using a volatility - based index framework . it should be noted that the process of fig2 is only an example of an embodiment , and that alternative embodiments can be provided as discussed herein . the process starts at step 201 . at step 210 , a collection of securities is received . for example the collection of securities can be retrieved by the index service 111 from the index provider data store 112 or from the market data provider 120 . these securities can represent the entire market or a subset thereof . the securities in the collection can be selected based on any desired characteristic such as security type , industry type , country , or size ( e . g ., as measured by market capitalization ). in various embodiments , the securities are selected , for example by index service 111 , to represent most or all of the tradable securities market , or most or all of the tradable securities in a particular asset class . in such embodiments , the volatility style indices generated using the volatility - based index framework will collectively represent the entire market , or at least the entire market for a particular asset class . in various other embodiments , the selected securities need not represent the entire market . the securities collection can be stored in volatile or persistent memory , for example , of the index service 111 . the security collection can be stored along with any other available data ( e . g ., current and historical performance information , correlation data , and the like ). at step 215 , market data and other parameters for the securities in the collection is received . for example , index service 111 can retrieve detailed information regarding the securities collection from market data provider 120 . this market data can include , for example , information about current and historical pricing data , outstanding shares , dividends , leverage , yield , trading activity , earnings , yield , growth , value , momentum , the like , and combinations of the same . the market data can be stored in association with the stored securities data , for example in the index provider &# 39 ; s data store 112 or in memory associated with the index service 111 . further processing can also be performed on the received data . for example , the index service 111 can determine correlations among securities or derive other performance - related metrics . results can be stored , for example , in the index provider data store 112 . at step 220 , one or more primary split metrics are determined . in various embodiments , the primary split metrics can be determined by the index provider 111 . the primary metrics can be any sortable data associated with each security . in various embodiments , the primary metrics can include default probability or maturity for a bond index or country of origin or a stock &# 39 ; s market capitalization . in other embodiments , a primary metric can be float ( market capitalization minus closely held shares ). using standard terminology , securities with a higher relative market capitalization or float are referred to as large or high - cap stocks ; securities with lower relative market capitalization or float are referred to as small or low - cap stocks . at step 225 , the securities are sorted by the selected primary metrics . for example , the securities in the collection can be sorted by the index service 111 according to market capitalization or float . at step 230 , the sorted securities collection is split into two or more groups of securities . group membership is preferably mutually exclusive , but in various embodiments it can be overlapping . together , the groups can contain all or a substantial portion of the securities in the collection . for example , the sorted collection of securities can be split into two groups , one containing securities with higher relative market capitalization and one with securities containing lower relative market capitalization . the two groups can be equally sized or one can be larger than the other . in some embodiments , the first group contains the 1000 securities with the highest market capitalization and the second segment contains the 2000 securities with the next highest market capitalization , excluding the 1000 securities included in the first group . in other embodiments , the groups can be allocated such that the groups have a determined relationship along a fundamental or technical indicator such as country or region of origin , or total market capitalization of member securities . this division of the collection of securities into two or more groups can represent a first dimension on which the securities collection is divided . where the securities collection is divided into two groups based on float or market capitalization , the two groups can represent a divide between large and small securities . it should be noted that division along one or more primary split metrics is optional . in various embodiments , index construction can be carried out by classifying securities according to volatility alone , or by dividing along various other metrics only after volatility classification . further , dividing a collection of securities along one or more primary split metrics is a flexible process that can have multiple steps . for example , dividing along one or more split metrics can be repetitive , iterative , or sequential . in various embodiments , securities can first be divided based on asset type , further divided based on country of origin , and divided again based on market capitalization . this iterative process , which results in three hierarchical levels of division , is an example of dividing a securities collection along one or more primary metrics . at step 235 , volatility data is determined for the securities in each group . for example , historical price , volume , or other fundamental or technical indices can be obtained from data store 112 or from market data provider 120 by the index service 111 and used to obtain a volatility measure for each security . in various embodiments , the standard deviation of a securities price over an interval of time is used as a measure of volatility . for example , a volatility measure can be a long term volatility measure calculated by determining the standard deviation of a security &# 39 ; s price over a historical period of 60 months . the resolution of the pricing data can depend on , among other things , the historical period over which the volatility measure is calculated . for example , where 60 - month long term volatility is used , the volatility measure can be calculated using daily , monthly , or weekly price data . it should be noted that various other measures of volatility can be used . at step 240 , the securities in each group are sorted according to their determined or calculated volatilities . for example , where the collection of securities is divided into two groups representing small and large securities , the securities in each group can be sorted according to their relative volatilities . at step 245 , each group can be further divided into two or more sub - groups 250 based on volatility . sub - group membership is preferably mutually exclusive , but in various embodiments it can be overlapping . together , the sub - groups can contain all or a substantial portion of the securities in the corresponding group . for example , the securities in each group can be divided into two sub - groups : a high volatility subgroup comprising the most volatile securities in the group , and a low volatility subgroup comprising the remaining lower volatility securities . it is important to note that each group can be divided into any number of sub - groups . for example , a group can be divided into low , medium , and high volatility sub - groups . in some embodiments , each subgroup can comprise approximately the same number of securities . for example , where a group representing large securities is divided into low and high volatility subgroups , each subgroup can contain exactly or approximately half of the securities in the group of large securities . in other embodiments , the two or more sub - groups can have different numbers of constituents . for example , in various embodiments , the sub - groups can be allocated such that the subgroups have a determined relationship along a fundamental or technical indicator such as total market capitalization of member securities . each of the sub - groups 250 created by dividing the groups can represent a distinct volatility style index in the volatility - based index framework . data corresponding to the generated volatility style indices can be stored , for example , in index provider data store 112 and requested over the network 101 from the index provider 110 . fig3 shows a representation of volatility style indices 300 in a volatility - based index framework . when the construction of the one or more subgroups 250 is complete , each subgroup represents a distinct index in the volatility - based index framework . for example , where a securities collection is divided into two groups based on float or market capitalization and each of these groups is divided into two subgroups based on long term volatility , the index framework produces four distinct indices : large low volatility 310 , large high volatility 311 , small low volatility 312 , and small high volatility 313 . price , volume , and any other fundamental or technical data can be tracked independently for each index . the above describes only a few examples of generating volatility - based frameworks . in various other embodiments , for example , a volatility - based framework can be constructed without dividing a securities collection by a primary metric . in such cases , the securities collection can be grouped and divided by volatility alone , or by volatility first followed by other dimensions . it should also be understood that all grouping and division into subgroups , at all levels of index construction , can be into any number of groups . it can be understood that one or more steps of the methods described herein may be performed using , for example , any of the computer systems 310 , 306 a , and 314 a . also , in various embodiments of the present invention , market data may be input and stored on , for example , any of the data storage media 306 b , 314 b and / or on a storage medium or media on the computer system 310 a . the term “ computer - readable medium ” is defined herein as understood by those skilled in the art . it can be appreciated , for example , that method steps described herein may be performed , in certain embodiments , using instructions stored on a computer - readable medium or media that direct a computer system to perform the method steps . a computer - readable medium can include , for example and without limitation , memory devices such as diskettes , compact discs of both read - only and writeable varieties , digital versatile discs ( dvd ), optical disk drives , hard disk drives , solid state drivers , rom ( read only memory ), ram ( random access memory ), prom ( programmable rom ), eeprom ( extended erasable prom ), and other suitable computer - readable media . a computer readable medium can also include memory storage that can be physical , virtual , permanent , temporary , semi - permanent and / or semi - temporary . results of testing indicate that a volatility - based index framework can provide unexpected advantages over other indexes . fig4 shows a chart of historical cumulative returns over time for a volatility - based index framework comprising four volatility style indices . these volatility indices correspond to large low volatility , large high volatility , small low volatility , and small high volatility indices . size ( large or small ) describes market capitalization — minus closely held shares — of the securities in the index . the four indices are mutually exclusive , and together they represent substantially the entire market . as time increases , the cumulative returns of the four volatility indices become more distinct and take more definite and stable relative positions . generally , the small high volatility index has the lowest cumulative returns over time . the large high volatility index tends to have the next highest return over time . the small low volatility index generally has the second highest returns , followed by the small low volatility index which exhibits the best cumulative return performance over time . with few exceptions , this ordering of the indices &# 39 ; cumulative returns appears clearly in the chart . this ordering , however , indicates a key insight of the present invention which produces beneficial results over other techniques : rather than a division of cumulative returns along security size ( e . g ., as would be the case if the two indices with higher cumulative returns were either both of the large or both of the small volatility style indices ), the clear division in cumulative returns is between the degrees of volatility . the two indices with the highest cumulative returns were the large low volatility and small low volatility indices . the two indices with the lowest cumulative returns were the large high volatility and small high volatility indices . this indicates that the clearest distinction among index securities , with respect to cumulative returns , is among securities with differing volatilities . regardless of size , the high volatility securities tend to be associated with lower cumulative returns , and the low volatility securities tend to be associated with higher cumulative returns . that volatility provides the clearest distinction among cumulative returns is a groundbreaking development that immediately implicates modern portfolio theory : portfolio theory works best when choices are distinct — when available asset classes or groups are as different as possible . it is this differentiation on which the construction of an optimally efficient portfolio depends . volatility thus presents a surprising and effective new way to categorize securities for various purposes including determining asset classes , market benchmarking , portfolio construction , portfolio analysis , and fund performance . fig5 is a table further illustrating the advantages of a volatility - based index framework . the table shows a comparison between a volatility - based index framework and a growth - value division , as indicated by various metrics calculated using historical data . the volatility - based index framework comprises large low volatility , large high volatility , small low volatility , and small high volatility style indices . the growth - value indices comprise large value , large growth , small value , and small growth indices . for each index , historical data was used to calculate the yearly excess return , volatility , and sharpe ratio . the sharpe ratio provides a measure of excess return per unit of risk ; it characterizes how well the return of an asset compensates an investor for risk taken . in the large indices , the difference between the excess returns of the large low volatility style index and the large high volatility style index is 6 . 71 . the difference between the excess returns of the large value and large growth indices is only 2 . 9 , considerably less than the volatility - based index difference . because differentiation among different classes of securities , especially in returns , is eminently important for asset allocation in portfolio theory , the greater difference in excess returns between the large high volatility and large low volatility indices indicates a better , more distinct division of securities . similarly , in the small indices , the difference in the sharpe ratios of the small low volatility and small high volatility style indices is 10 . 62 . this difference is considerably greater than the difference of 6 . 06 in the sharpe indices of the small value and growth indices . again , these greater differences in the sharpe ratios of low and high volatility style indices as opposed to growth - value indices illustrate the much more effective differentiation and distinction of market securities provided by a volatility - based index framework . volatility style indices provide another great advantage over other indexes : equity volatility has persistence . high volatility securities are much more likely to have high volatility in subsequent periods while low volatility securities are likely to have low volatility ; average volatility securities remain generally average . from an investment perspective , persistence translates into ease of prediction for subsequent volatility . this represents a significant improvement over priced denominated metrics ( book / price , earnings / price ) where price is inherently unpredictable and is frequently characterized by a “ random walk ” process . consequently , persistence results in low turnover among the volatility style indices . thus a security in a low volatility index will tend to remain there when the indexes are recalculated ( e . g ., on a yearly basis ). this is a highly desirable index characteristic as all investors , particularly those that are tax - exposed , benefit from lower levels of transaction costs . fig6 shows a chart illustrating the persistence of volatility . as can be seen long term volatility maintains sharper distinctions over time than more ephemeral price - denominated measures . as discussed , volatility style indices can be used effectively in constructing an optimal portfolio . in modern portfolio theory , the investable market is divided into a number of asset classes . these broad asset classes can be created by dividing the investable market along various dimensions including but not limited to fundamental security type ( e . g ., stocks , bonds , options , futures , and the like ), country or market of origin , or security characteristics ( e . g ., large - small and value - growth ). each asset class is assigned an expected return and risk level ( e . g ., as standard deviation or variance ), and a covariance matrix is constructed reflecting the correlations among the variances of the various asset classes . constructing an optimal portfolio is then viewed as a mean - variance optimization problem , whereby an optimal combination of asset classes is found for each level of investor risk tolerance . an optimal combination of asset classes will specify the proportion of the portfolio which should be invested in each asset class . for a given level of expected return , the optimal portfolio will consist of the combination of asset classes that provides the least risk . fig7 shows an example of a portfolio constructed from asset classes including u . s . bonds , private equity , u . s . large growth equity , u . s . large value equity , u . s . small growth equity , u . s . small value equity , international large capitalization equity , and international small capitalization equity . as can be seen , the u . s . public equities market has been divided into four sectors , each with its own asset class : large growth , large value , small growth , and small value . risk , return , and covariance data is determined for each of these asset classes and an optimal portfolio is constructed . portfolio construction , however , is limited to the listed asset classes . if these asset classes do not represent a meaningful division of investable securities , determining optimal proportions of these asset classes yields a minimally useful result . because modern portfolio theory suggests constructing an optimal portfolio by using risk and return data to determine the proportions of various asset classes , portfolio construction works best when asset - type choices are distinct — when available asset classes or groups are as different as possible . the construction of an optimally efficient portfolio depends on this differentiation . as shown , however , volatility style indices , when compared to conventional growth - value divisions , provide greater differentiation in choices for security exposure , not only with regard to risk , but also with regard to other equally important indicators such as cumulative or average return and sharpe ratio . thus , volatility style indices can be used in place of alternative market indexes ( e . g ., growth - value indexes ) during portfolio construction to provide more distinct choices in asset classes . ultimately , this can lead to the construction of a more efficient investment portfolio with more return for any given level of portfolio risk . fig8 shows an example of portfolio construction using volatility style indices instead of traditional value - growth indexes . as can be seen , the u . s . public equities market has been divided into four individual sectors , each with its own asset class : large high volatility , large low volatility , small high volatility , and small low volatility . these volatility - based asset classes can be mutually exclusive , and collectively exhaustive . each of these asset classes , for example , can correspond to one of the volatility style indices in a volatility - based index framework as described herein . thus , these volatility style indices can substantially represent the public u . s . equities market . risk , return , and covariance data , provided for example by an index provider , can be determined for each of the asset classes represented by the volatility style indices . with these data , the volatility style indices can , in various embodiments , stand in place of other asset classes traditionally used in portfolio construction to represent the u . s . public equities market ( e . g ., growth - value indexes ). it should be kept in mind that the volatility - based index framework can be applied to any or all securities markets . thus , the bond market , futures market , options market , and all other markets can be divided into asset classes along the volatility dimension , or along the volatility dimension in combination with another dimension . further still , the collective market of investable securities can also be divided along the volatility dimension . in any case , division along the volatility dimension can include division into two groups representing , for example , low and high volatility ; notably , however , more than two groups can also be used to represent the volatility dimension . for example , in various embodiments , a collection of securities can be divided into three groups ( e . g ., representing low , normal , and high volatilities ) or into 10 groups ( representing volatility deciles ). using the volatility style indices along with the other asset classes , an optimal portfolio can then be constructed . fig8 shows a constructed portfolio &# 39 ; s proportion of — and expected return for — each asset class ( including the four volatility style indices ) for the years 1994 , 1999 , and 2004 . notably , and in contrast to the conventional portfolio of fig7 , the two u . s . large equity indexes are not held in similar proportions ; the u . s . large low volatility index consistently makes up significantly more of the portfolio than the u . s . large high volatility index . also in contrast to the conventional portfolio , the two u . s . small equity indexes are not held in similar proportion ; the u . s . small low volatility index consistently makes up significantly more of the portfolio than the u . s . small high volatility index . these differences from the allocation of fig7 &# 39 ; s conventional portfolio arise from the additional information provided by the volatility style indices . a better , more informed choice of asset classes can thus be made . fig9 shows another example of portfolio construction using volatility style indices instead of traditional value - growth indexes . in the portfolio of fig9 , in contrast to the portfolio of fig8 , the volatility style indices do not include an upward correction for the expected returns of high volatility securities . as can be seen , this effectively reduces to zero the portfolio allocations to both high volatility indices ( the large high volatility index and the small high volatility index ). this occurs because given two asset classes with equal expected returns , modern portfolio theory will prefer the asset class with lower risk . fig1 shows the performance results of two portfolios constructed using volatility style indices compared to the results of two conventional portfolios . a base case portfolio , consisting of 40 % bonds and 60 % equities , is shown along with a portfolio constructed using standard growth - value style allocation . also shown are portfolios constructed using volatility style indices . one of the volatility - based portfolios includes an upward bias in expected returns for high volatility securities , while the other volatility - based portfolio does not . as can be seen , the two portfolios constructed using volatility style indices produced the highest returns ( 7 . 82 % and 8 . 09 %). furthermore , the volatility - based portfolio not including the upward return bias , while producing the highest return , also produced the lowest volatility and downside risk . both volatility - based portfolios produced higher returns and lower standard deviations than the standard style portfolio . because investors desire both higher return and less risk , the volatility - based portfolios outperformed the standard growth - value style portfolio . further still , the volatility - based portfolio not including the upward return bias yielded the best overall performance , in terms of both risk and return . this clearly illustrates the advantages of a volatility - based index framework . passive investing often involves funds that represent broad swaths of a given market . financial indices such as those described herein may be used to create an investment fund that substantially replicates the movements of a broad segment of the market , including , for example , the entire market or a portion of the market represented by one of the financial indices . an index fund , also called an index tracker or index tracker fund , may be an “ investment ” fund , e . g . a mutual fund or exchange - traded fund , designed to replicate a specific index . “ index fund ” is a broad term extending across a broad reach of investment funds or collective investment vehicles ; the term is to be given its ordinary and customary meaning to a person of ordinary skill in the art and includes , without limitation , open - end funds , closed - end funds , mutual funds , and exchange - traded funds . an index fund may replicate or track a financial index by holding all the securities in the financial index , or by holding securities that represent a statistical market sample of the financial index ( which can be accomplished through synthetic indexing or other index - representing or index - enhancing techniques ). in synthetic indexing , for example , the securities held by the index fund may be held in proportion to the securities held by the financial index . volatility style indices such as those described herein , like other financial indices , may be tracked by an index fund . tracking may be instituted by purchasing the securities held by the fund or by setting rules for purchasing and selling securities that are substantially similar to the rules or method of constructing the index . a volatility style index fund may be created by retrieving information about a volatility style index constructed according to the method of fig2 herein . data corresponding to the generated volatility style indices can be retrieved , for example , from the index provider data store 112 . the index fund may purchase and sell securities according to the allocation of securities in one or more groups or sub - groups described at step 245 of fig2 . a volatility style index fund may be created by following the method of fig2 and purchasing or selling actual securities in one or more groups or sub - groups described at step 245 of fig2 . shares in an index fund may be sold , for example , as mutual fund shares or as securities in an exchange - traded fund . many investment strategies have unique requirements regarding , among other things , desired risk and return profiles . for example , target - date funds are structured to have an evolving risk - return profile which progressively favors less risky securities as the target date approaches . thus , over time , asset allocation in these funds shifts to accommodate the evolving target profile . in such strategies , asset classes providing clear choices in risk are particularly important , as it is the changing level of acceptable risk which drives the reallocation of assets . volatility style indices provide the distinct risk choices necessary to make such reallocation as accurate and as efficient as possible . by providing clear , persistent volatility divisions among various securities , volatility style indices allow an investment manager to more precisely tailor her investment strategy — including asset allocation — for the client &# 39 ; s desired target risk - return profile . as discussed above , known indices fail to provide such a clear distinction , resulting in inefficient asset allocation schemes which are not able to target effectively a narrow risk - return profile . many other specialized investment scenarios and holdings ( for example and without limitation , liability - driven investments , management of insurance capital , nuclear decommissioning trusts , the like , and combinations of the same ) have similarly specific risk - return requirements . for the same reasons discussed , volatility style indices provide an efficient and effective way to achieve these specific requirements . without the distinctive choices in risk provide by a volatility - based index framework , conventional asset classes simply provide insufficient choices to construct portfolios narrowly tailored to target a specific range of risk - return characteristics . as discussed above , a volatility - based index framework can be used effectively in constructing an optimal portfolio by replacing too broad asset classes and inefficiently constructed indexes . volatility style indices , however , can also be used more generally in existing investment strategies which rely on distinct asset classes created by partitioning investable securities around various dimensions . many modern investing strategies rely on partitioning the market of investable securities into various asset classes based on various characteristics , including for example legal distinctions ( e . g ., between debt , equity , and warrants ). asset class divisions , however , can be created even within a single securities market . splitting equity markets based on stock market capitalization ( e . g ., large cap , mid cap , and small cap ) is a well - known treatment reflecting the difference in behavior among these equity segments . in traditional growth - value style allocation , for example , the u . s . public equities market is partitioned by market capitalization as well as growth - value measures such as book - to - price ratios or earnings - to - price ratios . together , the sub - asset classes ( which can themselves be referred to and treated as asset classes ) created by this growth - value partitioning should represent the whole u . s . public equities market . volatility style indices can be used in any modern investing strategy which utilizes distinct asset classes . in such strategies , some or all of the asset classes can be supplanted by volatility style indices . the volatility style indices should together represent the same portion of the market as that collectively represented by the replaced asset classes . for example , in various embodiments , asset classes ( which can also be referred to as sub - asset classes ) created by dividing a securities market according to growth - value characteristics can be replaced with asset classes created by dividing the securities market according volatility . in general , any number of broader asset classes in an investment strategy can be replaced by taking the union of the asset classes to be replaced , calculating the volatilities for the securities in the union , sorting the securities by volatility , and dividing the sorted securities into volatility - based groups ( e . g ., groups containing securities with similar or at least contiguous volatilities ). the volatility - based groups can then be substituted in the investment strategy for the replaced asset classes . necessary technical and fundamental measures for the new volatility - based groups can be calculated or inputted into the investment strategy and used to recalibrate the strategy for the asset classes . in various embodiments , asset classes representing distinct fundamental security types ( e . g ., stocks , bonds , options , and futures ) can be replaced with volatility - based asset classes containing mixtures of the various fundamental types . a volatility - based style index framework can be used effectively in analyzing and evaluating investment manager performance . investment managers are increasingly committed , at least in part , to zero - beta or alternative beta strategies ; while more traditional managers aim for a conventional market - like beta of 1 . 0 strategy . volatility style indices can provide insight into the performance of both approaches to investing . fig1 and 12 show style analyses of quality strategy , an active investment strategy of gmo , an investment management firm . fig1 shows a style analysis of gmo &# 39 ; s quality strategy using traditional value - growth indexes . as shown in the first chart , the strategy &# 39 ; s style favors large capitalization equities , but is divided equally between value and growth . the second chart shows that the strategy is described by a relatively even distribution of assets among a risk free asset , large - cap value equities , and large - cap growth equities . chart 3 shows how well the asset allocation of chart 2 ( the style benchmark ) describes the returns of the strategy . r - squared is a statistical measure that represents the percentage of the strategy &# 39 ; s return profile that can be explained by movements in a portfolio corresponding to the asset allocation of chart 2 . as shown , the growth - value based asset distribution of chart 2 — the style benchmark — describes 84 . 5 % of the strategy &# 39 ; s return profile . chart 4 shows the strategy &# 39 ; s cumulative returns compared to the style benchmark . fig1 , on the other hand , shows a style analysis of the same gmo quality strategy using volatility style indices . as shown in the first chart , the strategy &# 39 ; s style , as before , favors large capitalization equities ; this time , however , the strategy clearly favors low volatility equities over their high volatility alternatives . this provides important information about distinct choices made by the strategy manager not clearly illustrated in the analysis of fig1 . the second chart no longer shows an even distribution of assets . instead , the overwhelming majority of the portfolio is described by the large low volatility style index . again , this provides more important information about asset allocation decisions made by the fund manager that is not described by the analysis of fig1 . chart 3 shows how well the asset allocation of chart 2 ( the style benchmark — this time including the volatility style indices ) describes the returns of the strategy . as shown by the r - squared value of the style benchmark , the asset allocation using volatility - based indices describes 87 . 5 % of the strategy &# 39 ; s return profile . this indicates that the asset allocation using a volatility - based index framework better describes the strategy &# 39 ; s true return profile . the term “ benchmark ” used above with respect to fig1 refers to a method of assessing portfolio performance . a benchmark is a standard to which something can be compared . “ benchmarking ” is a broad term that may refer creating a standard to which something can be compared ; the term is to be given its ordinary and customary meaning to a person of ordinary skill in the art and includes , without limitation , financial indices such as the s & amp ; p 500 , the dow jones industrial average , or the lipper indexes . fig1 illustrates an example of a process for benchmarking investment fund or investment managers using an index framework . at step 1310 of fig1 , benchmark performance data may be determined . the benchmark performance data may be determined by , for example , by selecting an index . the benchmark performance data may include market data including , for example , information about current and historical price or value , returns , dividends , leverage , yield , trading activity , earnings , growth , momentum , the like , and combinations of the same . at step 1320 , data related to an investment fund or an investment manager may be determined . the data related to an investment fund or an investment manager may be related to , for example , an investment fund comprised of securities of a particular asset class or a subset of the entire market . the data related to an investment fund or an investment manager may include market data . the step 1310 may occur before or after the step 1320 . if step 1320 is performed before step 1310 , the benchmark performance data may be determined at least in part by selecting an index comprised of securities similar to the securities that comprise all of or a portion of the investment fund or investment manager portfolio . at step 1330 , the data related to an investment fund or investment manager may be compared with the benchmark performance data . fig1 illustrates an embodiment of a process for benchmarking investment fund or investment managers using a volatility - based index framework . it should be noted that the process of fig1 is only an example of an embodiment , and that alternative embodiments can be provided , for example , by using one or more of the alternatives discussed herein . the process for benchmarking according to the embodiment of fig1 may begin at step 1410 . at step 1410 , a volatility style index may be selected . the volatility style index may be an index created according to the process of fig2 . the volatility style index may be an index of the entire market or a subset thereof . the volatility style index may also be a sorted securities collect , a group , or a subgroup as discussed herein with reference to fig2 . the volatility style index may be , for example , an index representing one or more large - cap , low volatility securities . in some embodiments , the index may be created by the same entity that performs the benchmarking process either before or during the benchmarking process . in some embodiments , the index may be constructed by a different entity than the creator of the benchmark . the constructed index may then be retrieved by the benchmarking entity . at step 1415 , information about a volatility style index may be retrieved . the information may be retrieved using a computer system , e . g . the computer system of fig1 . the information about a volatility style index may include market data , asset classification data , asset allocation data , and / or volatility - based benchmark performance data . at step 1420 , volatility - based benchmark performance data is determined . in various embodiments , determining the volatility - based benchmark performance data may simply require selecting the data to be used for comparison from the information about a volatility style index . in some embodiments , the volatility - based benchmark performance data may be determined by selecting one or more pieces of market data . the selected market data may then be used as the volatility - based benchmark performance data . in some embodiments , the selected market data may be used to calculate the volatility - based benchmark performance data . such calculations may include , for example , adding one or more prices of securities to represent a market capitalization of an index or all or some portion of an investment fund . at step 1430 , information about an investment fund or investment manager may be retrieved . the information may be retrieved using a computer system , e . g . according to the computer system of fig1 . the information about an investment fund manager may include information such as fund performance data for one or more investment funds managed by the investment manager . fund performance data may include market data about the fund or securities in the fund , for example , information about current and historical price or value , dividends , leverage , yield , trading activity , earnings , growth , momentum , the like , and combinations of the same . in various embodiments , the fund performance data may include total market capitalization of the securities held by the investment fund or funds managed by the investment manager at certain times , such as at regular intervals . after the information about the investment fund or the investment manager is retrieved , the process may continue by analyzing the information retrieved about the investment fund or the investment manager . this analysis may proceed by at least one of steps 1440 and 1445 , and may include both steps , as indicated in fig1 . at step 1440 , the investment fund or the investment manager may be classified using information retrieved about the investment fund or investment manager . the information used to classify the investment manager or investment fund may be asset classification data . asset classification data may include market data , including characteristics such as security type , industry type , country , or size ( e . g ., as measured by market capitalization ). in various embodiments , the investment manager or investment fund may be classified based on one characteristic , such as volatility . in other various embodiments , the investment manager or investment fund may be classified based on more than one characteristic , such as a large - cap , low volatility fund classification or a small - cap , high growth , high volatility fund classification . at step 1445 , asset allocation data may be generated that describes the distribution of securities among the classifications represented in the asset classification data . for example , asset allocation data may include market data , including characteristics such as security type , industry type , country , or size ( e . g ., as measured by market capitalization ). asset allocation data may include the same or substantially similar information as asset classification data . in various embodiments , the asset allocation data may describe all the securities held by one or more investment funds based on one or more characteristics , such as capitalization or volatility . in other various embodiments , the asset allocation data may be describe one or more collection of securities that represents a subset of all the securities held by one or more investment funds based on one or more characteristics , such as a large - cap , low volatility subset . after either or both steps 1420 and 1445 , the process may continue . at step 1450 , the fund performance data ( which may include the classification of the investment fund or investment manager ), the asset classification data , the asset class distribution , or the asset allocation data , may be compared with the volatility - based benchmark performance data . this comparison may be made using calculations , such as an r - squared calculation , between the investment fund or investment manager performance and the volatility - based benchmark performance data , such as the volatility index performance . the calculation may be made using alternative measures . in further various embodiments , the comparison may be made using tabled or graphical representations , and the steps described above can be accomplished in different sequences . as can be seen from the preceding analyses , a volatility - based index framework can provide a more effective and more descriptive way of analyzing and evaluating a manager &# 39 ; s performance . in addition to providing insights into a manager &# 39 ; s investment philosophies and strategies , effective style analysis can be used to determine whether a manager has skill , and therefore whether her active management fees are worth paying . in order to properly gauge such performance , a proper benchmark for the manager is required . by providing an asset portfolio that more closely mirrors the active manager &# 39 ; s strategy ( e . g ., constructed using style analysis as shown above ), volatility style indices can provide such a benchmark . the performance of the manager can then be compared to the volatility - based benchmark . a manager who outperforms her benchmark in terms of risk or return can be given a positive evaluation , and investment in the manager &# 39 ; s fund can be increased . a manager who sometimes or consistently underperforms her benchmark in terms of risk or return can be given a negative evaluation , and investment in the manager &# 39 ; s fund can be decreased . it should be understood that various embodiments of the techniques and methods described herein may be used , for example and without limitation , to create and publish an index , to license a portfolio of assets corresponding to an index , to offer a security that is linked to an index that is created using the techniques and methods described herein , to offer an exchange traded fund ( etf ), mutual fund , unit investment trust , or the like that replicates the performance of an index that is created using the techniques and methods described herein , and to develop an investment strategy based on an index that is created using the techniques and methods described herein or to create and manage a portfolio . securities indices may use certain measures of market data as input when constructing the index framework . for example , a value index may use book - to - price ratio measure as an input in constructing an index , or a growth index may use a long - term growth forecast measure as an input in constructing an index . securities indices may preferably use more than one measure as an input in constructing an index . in construction of a volatility - based securities index , individual stock information ( e . g ., market data including current and historical pricing data , outstanding shares , dividends , leverage , yield , trading activity , earnings , yield , etc .) on prior volatility may be used . measures used as input in constructing a volatility - based securities index can incorporate total return information ( e . g ., price changes plus dividend payout ). each measure may be retrieved , calculated , or otherwise determined using one or more of a number of different methods . for example , a volatility measure may be calculated using a standard deviation , a variance , interquartile range , or any other measure of statistical dispersion across a data set . each measure may further include data from over a number of different lengths of time or at different intervals . for example , a volatility measure may be calculated by determining the standard deviation of a volatility measure from five or more years in the past , for example , using monthly observations . shorter - term calculations of volatility measures over less than two years may use weekly or daily performance histories . as discussed above , volatility measures can have the statistical property of persistence meaning that low volatility stocks in one period can be more likely to have sustained low volatility in the next period . likewise , high volatility stocks can be more likely to sustain their high volatility . persistence characteristics can provide a rich taxonomy to classify stocks and subsequently construct volatility - based securities indices . construction of volatility - based securities indices may benefit from inclusion of robust fundamental information on each constituent security . however , even some of the most widely used fundamental measures for investment analysis may not be equally useful in the construction of indices of every type of style . for example , construction of a growth index may not benefit from inclusion of market capitalization data , but may benefit from inclusion of measures like growth forecasts and price ratios . in the construction of a volatility - based securities index , some widely used fundamental measures may be less useful and other fundamental measures may be more useful . many fundamental measures for investment analysis may be computed using a price ratio , which may be further described as a measure of market capitalization . for example , many fundamental measures in investment analysis are computed using a price ratio and may be treated as price / fundamental ratio . ( in practice , however , the inverse of the price / fundamental ratio may be used to facilitate computations .) further , since stock prices can be inherently unstable , price denominated measures may change rapidly even in the absence of new fundamental information , e . g . data that may be reasonably expected to impact the price or value of a security . due to inherent instability that may exist independently of fundamental information , price measures calculated as volatility measures may be less useful as an input in the construction of a volatility - based securities index . in a further example , forecasted earnings and forecasted earnings growth may be used as a fundamental measure in investment analysis . forecasted earnings and forecasted earnings growth , along with some other forecasted measures , may depend heavily on the analyst , method of analysis , input data for the analysis , and other factors . forecasted earnings and forecasted earnings growth , whether forecast over a short - term future period or a long - term future period , may contain little fundamental information and may introduce random change into measures used as input into a volatility - based securities index . some examples of fundamental measures in investment analysis that may be less useful as inputs in construction of a volatility - based securities index may include : price / earnings ( historical ); earnings ( historical )/ price ; price / earnings ( forecast ); earnings ( forecast )/ price ; price / book value ; book / price ; price / dividend payout ; dividend yield ; price / sales ; sales / price ; and earnings growth ( forecast ). fig1 - 19 show charts of some of the fundamental measures listed above . each chart shows a volatility - based index framework comprising four volatility style indices . these volatility indices correspond to large low volatility 1540 , large high volatility 1530 , small low volatility 1520 , and small high volatility 1510 indices . size ( large or small ) describes market capitalization minus closely held shares of the securities in the index . the four indices are mutually exclusive , and together they represent substantially the entire market . fig1 shows a chart of price / earnings ratios for a volatility - based index framework comprising four volatility style indices . fig1 shows a chart of price / forecast earnings ratios for a volatility - based index framework comprising four volatility style indices . fig1 shows a chart of price / book ratios for a volatility - based index framework comprising four volatility style indices . the variations in price to book ratio over time may provide support for the statement that price to book ratios provide less fundamental information as to value . fig1 shows a chart of dividend yields for a volatility - based index framework comprising four volatility style indices . fig1 shows a chart of price / sales ratios for a volatility - based index framework comprising four volatility style indices . fig1 - 19 may support the assertion that certain inputs , including price / earnings ( historical ); price / earnings ( forecast ); price / book value ; dividend yield ; and price / sales may vary in volatility more significantly over time than other input variables , resulting in a reduced statistical property of persistence . reduced persistence may reflect higher dependence on outside factors , for example , the method of analysis , and lower dependence on the fundamental value of the security . further measures may also be less useful as inputs for a volatility - based securities index . one premise of the construction of a volatility - based index , among others , may be that the relationship between risk and return across the market is demonstrably broken . under this assumption , use of certain measures of risk , including measures of either market risk ( e . g . systematic risk ) or specific risk ( e . g . residual risk ) or both may constitute using data that , under the premise , is also demonstrably broken . some examples of risk measures that depend on market or specific risk that may be less useful as inputs in construction of a volatility - based securities index may include : in the construction of a volatility - based securities index , some fundamental measures may be more useful . many variables ( e . g ., fundamental measures ) may be well suited to augmenting volatility classifications . for example , fundamental measures dependent on fundamental information may be more likely to fluctuate due to data that can reasonable impact the value of a security . further , measures or inputs that may not be denominated by price or market value may be more useful in the construction of a volatility - based securities index . some examples of fundamental measures in investment analysis that may be more useful as inputs in construction of a volatility - based securities index may include : management effectiveness ; return on equity ; return on assets ; net share repurchase activity ; leverage , which may include indicators such as debt / assets , debt / equity , interest coverage , or debt rating / default risk ; and earnings success , which may include indicators such as historical earnings growth rate and earnings variability . fig2 shows a chart of return on equity for a volatility - based index framework comprising four volatility style indices . the chart of fig1 shows a volatility - based index framework comprising four volatility style indices . these volatility indices correspond to large low volatility 1540 , large high volatility 1530 , small low volatility 1520 , and small high volatility 1510 indices . the four indices are mutually exclusive , and together they represent substantially the entire market . according to the chart , the large low volatility input remains stable over time . the other input vary more than the large low volatility input over time , with the most significant first and second order variations occurring in the small high volatility input . this chart may provide support for the statement that certain inputs , including return on equity , may provide higher quality fundamental information for a volatility analysis . weighting scheme for measures of constructing a volatility - based securities index framework any number of variables may be used as inputs in the construction of a volatility - based securities index framework . the simplicity or complexity of the vsi weighting scheme will be a function of the number of variables used and the number of indices to be created . objective or subjective weightings of the variables may be used to create an aggregate score upon which the stocks can be partitioned as shown in the method of fig2 , e . g . into groups according to low and high volatility , or into subgroups according to multiple dimensions such as market capitalization and volatility . assignment to respective volatility - based groups on the indices can be facilitated using statistical models ( e . g . linear or non - linear regression models , probit analysis , etc .) or employing bayesian models which impose asubjective limitations on factors . the advantage of rules - based assignment models allows for a more objective framework upon which to create historical simulations of the indices . in a simple implementation , a single measure of volatility / stability can be used to create two indices each containing identical amounts of market capitalization or free float . for example , a volatility - based securities index may be constructed by retrieving information relating to a set of securities , potentially including one or more type of market data , and calculating a variance of a single variable , for example , earnings , over a historical five year period on a monthly basis . the set of securities may then be listed , grouped , or sorted , or even just provided with , the volatility calculation . in this implementation , a simple ordinal ranking may suffice to create a useful volatility - based index . in a slightly more complex implementation , multiple variables or factors may be used . an objective rule - based weighting analysis may be established . for example , for each security , construction of the volatility - based securities index may require calculating a standard deviation of a single variable such as price over a five year period using monthly intervals and calculating a standard of a single variable such as earnings over a five year period . each calculated measure , in this implementation , price volatility and earnings variability , may be weighted . the weighting may be achieved by first normalizing the calculated measures and second averaging the normalized measures . the set of securities may then be listed , grouped , or sorted , or even just provided with , the volatility calculation . even more complex implementations may be used , potentially even including factors that are more or less useful to the volatility analysis . other methods of weighting , normalization , and calculation may further be used . it should be understood that various embodiments and implementation of the techniques and methods described herein may be used , for example and without limitation , for any of the uses listed herein . those of ordinary skill in the art will recognize , however , that these and other elements may be desirable for practice of various aspects of the present embodiments and implementations .	6
fig1 shows the schematic illustration of the basic principle according to the invention of the optical delay of a radiation fraction in an interferometric distance measuring arrangement . in such an arrangement for measuring industrial workpieces , a laser beam is generated as measuring radiation ms by a frequency - modulated , i . e ., tunable laser source 1 , wherein it has a coherence length of greater than 1 mm , preferably of greater than 60 mm . in the optical beam path used for measuring the surface of the workpiece , a delay component is incorporated , which has two optical couplers 2 , one of which is designed as a beam splitter for the measuring radiation of the frequency - modulated laser source 1 , wherein this radiation is split into two radiation fractions . one of the two radiation fractions is guided undelayed via the distance to be measured to the target and back again to the radiation detector , while the other fraction passes through at least one optical delay element or a delay section 3 , by which one of the radiation fractions is time - delayed in relation to the other radiation fraction such that the resulting delay corresponds to twice the run time of the measuring radiation to a distance located outside the coherence length . in the ideal case , this distance will correspond to the distance to be measured to the surface of the workpiece or to another target , but can also deviate therefrom . according to the invention , however , the delay section 3 is designed such that the time delay corresponds to a distance which lies within a distance range which at least partially also contains possible measuring distances which are greater than the coherence length . according to the invention , the lower limit of the distance range can also already lie outside the coherence length . therefore , according to the invention , a second radiation field , which is delayed in relation thereto , is added to the tuned radiation field of the prior art . both radiation fields are superimposed again at the radiation detector , wherein one of them was guided via the delay section . instead of the one signal of the arrangement of the prior art , two signals are now generated , which are mutually shifted in accordance with the delay section and propagate in the measuring interferometer . in the ideal case , both traversed sections , i . e ., optical length of the delay section and twice the distance to the target , can be identical , so that a synchronization of the radiation fields on the detector occurs . in the normal case , however , it is sufficient if the delay caused by the delay section is sufficiently close with respect to time to the delay caused by the run section to the target and back again . the maximum extent of the difference or the required chronological proximity is predefined by the measuring range of the arrangement , i . e ., the measuring arrangement can still process the runtime differences or optical path length differences , which lie within the measuring range , during the measurement . the measuring range is a function of the coherence length in this case . according to the invention , the measuring range already existing in arrangements of the prior art is therefore shifted in the direction toward the target , so that another operating point displaced on the target side results . the maximum extent of the shift is limited here in principle only by the maximum implementable time delay possibility , i . e ., in the normal case , the optical length of the delay section . finally , the delay caused by the target measurement with respect to the signal running in the reference section of the reference interferometer as a local oscillator is reduced by the delay section , so that a smaller effective measuring distance results in comparison to the undelayed arrangement . the conditions of the reception on the radiation detector and therefore the interferometric measuring principle used having its restrictions of the measuring range , which are predefined by the coherence length , are therefore fundamentally maintained . however , the location of the measuring range is shifted in space , so that in the case of unchanged coherence length and target - related relative relationships of the interferometer , the maximum measuring distance thereof is changed by the delay section . fig2 illustrates a first exemplary embodiment of a delay section 3 having fixed length for the distance measuring arrangement according to the invention , wherein the optical delay section 3 is designed in mach - zehnder configuration . the radiation field generated by the laser source 1 is guided via a collimator 4 and split by a first polarizing beam splitter 2 ′ into two differently polarized radiation fractions , wherein the optical connection between laser source 1 , collimator 4 , and first beam splitter 2 ′ is preferably embodied in fiber construction having a polarization - obtaining fiber . in this exemplary embodiment in mach - zehnder configuration , a n - polarized radiation fraction 5 is directly relayed , while in contrast the σ - polarized radiation fraction 6 is guided via the interferometer having an arm length of approximately 10 cm and an inversion prism 8 and finally combined again with the other radiation fraction . as a possible design variant , it is advantageous to use a laser source 1 which emits in a polarization mode , so that together with the use of a polarization - obtaining fiber as a connection , a coupling at 45 ° into the interferometer is possible , which in turn allows a uniform splitting into the two differently polarized radiation fractions . alternatively or additionally , however , a polarization controller connected upstream of the delay section 3 can also be used . both radiation fractions 5 and 6 are guided back together in a second polarizing beam splitter 2 ″ and relayed via a 45 ° polarizer and a collimator 4 , wherein the connections can again also be embodied in fiber construction here . to achieve sufficient stability of the interferometer arrangement , the walls 7 thereof can be embodied in zerodur . the effect of the optical delay unit according to the invention is explained in fig3 , wherein the field strength is illustrated in relation to the time , i . e ., in the time domain . the laser source generates a radiation field , which is split into two radiation fractions , wherein e ( ν , t ) designates the undelayed fraction and e ( ν , t − τ ) designates the radiation fraction delayed by τ = 2δl / c . in this case , δl corresponds to the length of respectively one of the two arms of the mach - zehnder interferometer of the delay section and c corresponds to the speed of light . both radiation fractions e ( ν , t ) and e ( ν , t − τ ) then propagate jointly and offset in time through the interferometric measuring arrangement . fig4 shows the schematic illustration of the interferometric measuring arrangement in a measuring device of the prior art for measuring surfaces , as is known , for example , from wo 2009 / 036861 a1 . such an arrangement uses a frequency - modulated laser source 1 for generating at least one laser beam and a radiation detector 11 for receiving the measuring radiation ms , which is backscattered from a surface 13 . the frequency - modulated laser source is preferably designed , for example , as a fiber ring laser , such that it has a coherence length of greater than 1 mm , in particular in the range from 1 mm to 20 cm , for example , a central wavelength between 1 . 3 and 1 . 55 μm and a tunable wavelength range of greater than 40 nm at a dynamic line width of less than 0 . 02 nm at a coherence length of 60 mm or more . the frequency - modulated laser source 1 is thus a laser source using which light which is tunable in its wavelength can be emitted within the wavelength range , i . e ., light which is frequency - modulated in its light frequency or is tunable in its light color . the coherence length therefore also permits measurements over a depth or distance range of several centimeters . the present invention thus relates to wavelength - tuned interferometry . an interferometric measuring principle using a laser source 1 which emits in a modulated manner with respect to the wavelength , i . e ., with variable wavelength , is applied , wherein the measurements are performed in the frequency domain . in this case , the laser radiation generated by a laser source 1 , for example , a laser diode , is modulated , by traversing a wavelength ramp and therefore changing the radiation in its emission frequency , for example . such a wavelength ramp can be designed in this case as a classic ramp , i . e ., having a sequence of wavelengths to be traversed which rises or falls substantially linearly . alternatively , however , the set of the different wavelengths can also be optionally modulated , i . e ., in a way deviating from the linearly arrayed sequence , as long as only the set of the wavelengths is acquired and modulated once during one traverse of the ramp . the concept of the wavelength ramp therefore comprises in the broader meaning a set of different wavelengths which can indeed be moved into a rising or falling sequence , but are not necessarily traversed and modulated in this sequence . however , a preferred embodiment is designed having a sequence of alternating rising and falling linear ramps . the laser radiation generated by the laser source 1 is coupled via an optical coupler 10 into the interferometer construction used for measuring , which is designed in common path geometry , i . e ., a partially shared interferometer beam path for a measuring interferometer arm and a reference interferometer arm . the light , which is modulated in its frequency , from the tunable laser source 1 , which is applied at the input of the delay section 3 , is thus modulated in its wavelength . the reference interferometer arm is defined in this case by a reflection at the optical exit surface of a gradient index lens , so that a constant , in particular known distance is fixed , wherein further back reflections are avoided . the reference surface therefore lies in a transceiver optic 12 , which integrates the components of the transmitter and receiver optics , within the beam shaping optic used for emitting the laser beam . the measuring interferometer arm is defined , in contrast , by the reflection at the surface 13 to be measured . the back - reflected light of a measuring interferometer arm and a reference interferometer arm is finally guided back via the optical coupler 10 onto the beam detector 11 , which is preferably designed as an ingaas detector having a bandwidth of greater than 100 mhz . finally , the distance δl to be measured can be determined in an analysis unit . in addition , a calibration interferometer ( not shown here ) having an optical detector 5 can also be used for taking into consideration or compensating for nonlinearities in the tuning behavior , wherein this calibration interferometer can be embodied in particular in an etalon configuration or mach - zehnder configuration . such a measuring arrangement can be integrated , for example , in a sample head of a coordinate measuring device for scanning measurement , as is known , for example , from wo 2009 / 036861 a1 . the structural construction of such a sample head for such a measuring device is illustrated in fig5 . the coordinate measuring device has in this case guide means for the defined scanning guiding of the sample head over the surface to be measured and the sample head has at least one emission and reception beam path for the emission of measuring radiation ms of the interferometric distance measuring arrangement . the sample head is guided by an arm element 14 and a joint 15 as guide means in a defined scanning manner over the surface to be measured , wherein a rotation of the joint 15 with respect to the arm element 14 is also possible . by way of the rotational ability in relation to the arm element 14 and the downstream joint 15 , the sample head can well follow angled or strongly varying surface profiles . fundamentally , however , still further rotational or translational degrees of freedom can be integrated in the guide means , to allow a further improved guiding of the sample head . the sample head has at least one surface - side emission and reception beam path of the measuring beam ms . in this embodiment , the beam paths are guided through a thin tube , which contains the transceiver optic 12 . the radiation detector itself or optical waveguides for relaying to a radiation detector integrated at another location can already be arranged in the thicker part 16 adjoining this tube . the sample head is controlled by the guide means such that the condition of substantially perpendicular incidence of the laser beam on the surface is maintained , in particular a deviation of +/− 5 ° to the surface normal is not exceeded . the sample head can in this case be moved such that it is moved continuously having constant alignment relative to the surface tangent , in particular having emission and reception beam path oriented perpendicularly to the surface tangent . fig6 schematically shows the integration of transceiver optic 12 into the tube of the sample head . in this design , a fiber 12 a is used for guiding the measuring radiation ms to be emitted and also to be reflected . the emission is performed in this case through a gradient index lens 12 b arranged in the tubular part , which emits the measuring radiation onto the surface 13 to be measured and couples the measuring radiation ms reflected therefrom back into the fiber 12 a . fig7 shows the integration of a delay section into the arrangement from fig4 to implement a first exemplary embodiment of the interferometric measuring arrangement according to the invention . behind the laser source 1 and a first beam splitter 2 for the measuring radiation , which splits it into two radiation fractions , at least one optical delay section 3 is incorporated , by which one of the radiation fractions can be time - delayed in relation to the other radiation fraction such that the delay which can be generated corresponds to twice the run time of the measuring radiation ms to a distance lying outside the coherence length , wherein this distance d to be measured can correspond to the surface of the target 13 . by way of the use according to the invention of the delay section 3 , measurements can now also be carried out to targets , the distance of which to the measuring arrangement is outside the boundaries set by the coherence length , but in particular is greater than the coherence length . in this first exemplary embodiment , the delay section 3 is arranged in the beam path before the transceiver optic 12 , so that the delay occurs before the emission . this first exemplary embodiment can also have in the interferometric distance measuring arrangement a further interferometer as a calibration interferometer , wherein this can also be embodied in etalon configuration or mach - zehnder configuration . fig8 a - b and fig9 a - b illustrate the radiation fields in the frequency domain for a first example and a second example of the length of the delay section in the arrangement of the first exemplary embodiment . fig8 a - b show the graphic representation in the frequency domain for a first example , wherein by way of the use of a measuring interferometer arm and a reference interferometer arm and by way of the two radiation fractions , a total of four radiation fields are generated , which are superimposed during the interferometric distance measurements on the radiation detector . the reflections of the reference arm as a local oscillator and of the target in the measuring arm are delayed in relation to one another by the runtime via the target distance d . since two radiation fractions are coupled into the interferometric measuring arrangement having the reference arm and the measuring arm , a total of four interfering radiation fields therefore result on the radiation detector , wherein in the figures , the undelayed radiation fields are indicated with 1 and the delayed radiation fields are indicated with 2 and also l is indicated for the local oscillator ( reference arm ) and t is indicated for the target ( measuring arm ). as a result of the frequency modulation of the laser radiation , a time interval or a run section difference also corresponds in this case to a spectral difference δf . the detected intensity i is a product of the radiation fields in the time or frequency domain , the fourier transformation ft of the intensity i is a folding of the fourier transformation ft of the fields e . e ( t )= e l1 ( t )+ e l2 ( t − τ mz )+ e t1 ( t − τ t )+ e t2 ( t − τ t − τ mz ) in this case , e l1 ( t ) designates the undelayed radiation fraction which only runs via the reference section , e l2 ( t − τ mz ) designates the delayed radiation fraction which only runs via the reference section , e t1 ( t − τ t ) designates the undelayed radiation fraction which runs via the target distance , and finally e t2 ( t − τ t − τ mz ) designates the radiation fraction which is both delayed and also runs via the target distance . in this case , τ mz represents the runtime of the radiation fractions guided via the delay section , and τ t represents the runtime of the radiation fractions which run via the target distance . the spectral intervals δf ( 2l ) and δf ( 2d ) can be represented as functions of the optical path differences l and d . in the graphic representation in the frequency domain of fig8 a , therefore four frequencies of the four radiation fractions or radiation fields result , from which the four beat frequencies shown in fig8 b result after the folding . the delayed radiation field interferes with the undelayed field in this case , so that an enlargement of the target distance or of the corresponding spectral interval δf ( 2d ), indicated by the arrow in fig8 a , results in a change of the frequency e ( f t1 , t ) and therefore the shift shown in fig8 b of the beat frequency i l2 _ t1 . for a frequency modulation with an increase of the optical frequency f , the first undelayed reflection has the highest frequency e ( f l1 , t ) at the time t . after the folding , the interference term of the two l fields has the highest intensity , but is suppressed because of its location outside the coherence range . the lowest beat frequency component i l2 _ t1 of the interference of the radiation fields e ( f t1 , t ) and e ( f l2 , t ), in contrast , represents the desired useful signal . fig9 a - b show the graphic representation in the frequency domain for a second example of the radiation fields for the first exemplary embodiment , in which the delay caused by the delay component is selected to be greater than the runtime via the target section or is greater than twice the runtime of the measuring radiation to the surface to be measured . in this case , the enlargement shown in fig9 a of the target distance d or of the corresponding spectral interval δf ( 2d ) results in a reduction of the beat frequency for i l2 _ t1 in fig9 b . such a shift can offer advantages , since in this case the beats i l1 - t2 and i t1 _ t2 + i l1 _ l2 are also shifted toward higher frequencies and therefore can be suppressed more strongly because of coherence . in general , both sides of the coherence length with the exception of a direct - current region become usable by shifting the operating range outside the normal coherence length . however , the unambiguity is lost and care must be taken so that the correct side of the operating distance is selected . fig1 shows the schematic illustration of a second exemplary embodiment of the interferometric measuring arrangement according to the invention , in which the delay section 3 is incorporated in the beam path after the integrated transceiver optic 12 in an arrangement according to fig4 , so that the splitting into the radiation fractions with delay of one of the parts only occurs after the reception and immediately before the radiation detector 11 . according to the invention , the entire delay can also be caused by different partial delay sections , however , which can also be arranged at various points of the beam path , if the desired total delay or optical path difference results for a radiation fraction . a third exemplary embodiment of an interferometric measuring arrangement according to the invention is schematically illustrated in fig1 . while in the first and second exemplary embodiments , fixed delay sections of a defined length are used , in this case , with a construction otherwise unchanged from the first exemplary embodiment according to fig7 , a number of delay sections of different length which can be switched over is used , so that a plurality of selectable discrete delay times is provided . a certain overlap between the delay sections in conjunction with the possible coherence length can be advantageous in the calibration of the individual delay sections . in this case , the length difference between the delay sections is somewhat less than the coherence length , whereby a measuring range overlap occurs . upon leaving one range , one also reaches the next range by switching over to the next delay length . the same distance can then be measured using two delay sections , which permits an assumption of a distance calibration . the delay sections can be formed in this case as fibers , as are available as standard components for applications of optical coherence tomography . thus , for example , the producers general photonics , newport , ozoptics , and santec offer as standard products fiber - coupled optical delay sections having delay times of up to 350 ps or a length of 110 mm . alternatively to delay sections which can be switched over , according to the invention , continuously or discreetly adjustable variants of delay sections , for example , interferometers having adjustable arm lengths , can also be used . the effect of a delay section on measurements is illustrated in the following fig1 to 19 on the basis of simple simulation results . in this case , fig1 shows the illustration of a coherence curve for the following simulations , which illustrate signal strengths and coherence effects . the fundamental coherence curve is defined as follows : coh ⁡ ( z ) = ⅇ - ( 2 ⁢ ⁢ z · ln ⁡ ( 2 ) l coh ) 2 with z as an optical path difference and a coherence length of l coh := 50 mm . length : d l := 0 m reflectivity : r := 1 % oscillator - laser field : e l ( t ):= e laser ( t , d l )·√{ square root over ( r )} target - laser field : e t ( t ):= e laser ( t , d t )·√{ square root over ( r · l )} fig1 shows the beam cross section for a first simulation example of a distance measuring arrangement of the prior art without delay section . the parameters for this example having a target distance of 30 mm and an optical path difference of 60 mm resulting therefrom read as follows : distance up to the beam waist : d w 0 := 25 mm na := w 0 z 0 ⁡ ( w 0 ) = 0 . 00411 and a power level , resulting from the target loss , of − 58 dbm , wherein the albedo of a dark metal surface assumed as a target is set at 10 %. distance z ( horizontal ) and beam cross section ( vertical ) are each specified in millimeters . for the sake of simplicity , to illustrate the coherence influence , it is applied as a modulation loss in the fourier space , i . e ., the fourier transformed p ′= ft ( p ) of the detected power p =( e · ē ) is multiplied by the coherence function p = p ′· coh . the distance d or the optical path difference ( opd t ≈ 2 · d in air ) corresponds to the frequency f via the equation the associated tomogram of the received signal for the first simulation example is illustrated in fig1 , wherein the power level in db is plotted against the optical path difference d specified in millimeters . in reality , from a distance of 30 mm , the detection limit is reached because of coherence losses and noises . therefore , in the simulation which does not consider these influences , the required signal strength should lie above the threshold , which is illustrated by a dashed line , of − 60 db , so that the conditions prevailing in reality can be taken into consideration . as can be seen in the figure , the signal strength , shown by solid lines , without delay according to the invention reaches its maximum at an optical path difference of 60 mm or at a target distance of 30 mm and is therefore slightly above the sensitivity of approximately − 60 db . fig1 shows the illustration of the beam cross section for a second simulation example . the target distance is now 10 cm , so that an optical path difference ( opd ) of 200 mm results . the numeric aperture corresponds to the first simulation example from fig1 . the distance to the beam waist is 100 mm , so that the exit pupil has a diameter of 0 . 857 mm . as can be seen from the associated tomogram of the received signal illustrated in fig1 , the maximum of the signal strength is significantly below the threshold of − 60 db to be set for realistic conditions , and is therefore for below a level of detectability . this is contrasted with the results of a simulation having introduction according to the invention of a delay , as illustrated in fig1 for the second simulation example . a possible range is predefined by the coherence length of the laser in the case of the selection of the optical path difference of the delay section opd mz . for a good signal analysis without delay , the distance or the opd t thereof should be in the range of the coherence length : if a delay section is used , this range is shifted by the opd mz of this section : so that for the selection of the length of the delay section , the possible range results from in this case , which is also described by fig8 , an enlargement of the target distance results in an enlargement of the measured beat frequency , which corresponds to the so - called “ normal ” measuring range . the utilization of the other range , corresponding to fig9 , is also possible , in which the delay section is greater than the opd of the distance and the enlargement of the target distance results in a reduction of the beat frequency , the so - called “ inverse ” measuring range : if the unambiguity of the measuring range — normal or inverse — can be determined by a movement of the target , for example , the delay distance can be in both ranges : d = 100 mm → opd t = 200 mm and l coh = 50 mm , and the restriction to the normal measuring range , the delay section must be in the range if a delay section is used , the laser field consists of two terms , wherein they are mutually delayed and d mz designates the length of the delay section according to the invention ( in air , the equation the losses generated by the splitting and guiding together of the radiation field are taken into consideration by the factor ¼ . the target distance is again 10 cm and therefore the optical path difference ( opd t ) is 200 mm . to cause a delay , an additional section of the length of , for example , d mz = 90 mm ( opd = 180 mm ) is introduced for one of the two radiation fractions , which lies within the possible normal range . in the tomogram , the effects of three of the four resulting beat frequencies are now identifiable . at 200 mm , the normal signal assignable to the target is recognizable , while in contrast at 180 mm , the signal associated with the delay section occurs . at 20 mm , the interference signal of delayed local oscillator radiation field and undelayed measuring interferometer radiation field , i . e ., the interferometer arm comprising the target , is recognizable . the interference signal located at 380 mm , composed of delayed local oscillator radiation field and delayed measuring interferometer radiation field , is not shown in the figure for reasons of clarity . the signal at 20 mm is , in spite of the additional losses of 6 db caused by the delay section , still above the sensitivity threshold and therefore well detectable . fig1 shows the illustration of the beam cross section for a third simulation example of a distance measuring arrangement according to the invention having an optic optimized for a target distance of 100 mm . the following parameters apply for this simulation example : distance up to the beam waist : d w 0 := 100 mm na := w 0 z 0 ⁡ ( w 0 ) = 0 . 01974 the albedo of a dark metal surface assumed as a target is set in this example at 10 %, so that a power level resulting from the target loss of − 44 dbm results . the numeric aperture can therefore be enlarged by the factor 5 and the losses can be reduced by 7 dbm , which means a correspondingly higher signal strength . the associated tomogram of the received signal is illustrated in fig1 for the third simulation example with delay according to the invention . the significant exceeding of the detectability threshold at 20 mm can be recognized clearly . fig2 shows a concrete embodiment of the delay section 3 illustrated in fig2 . the coupling is performed from below into a first 50 % beam splitter 2 ′″. a first radiation part 6 propagates in drilled - out and sealed air channels in a zerodur part 7 . a second radiation fraction 5 to a second 50 % beam splitter 2 ″″, which guides together both radiation fractions 5 and 6 again . the two radiation fractions 2 ′″ and 2 ″″ can be manufactured from sio 2 , for example , and the coupling and decoupling surfaces thereof can have an antireflective coating . the inversion prism 8 from fig2 is embodied with the two illustrated reflectively coated ( for example , with gold ) zerodur parts 8 ′ and 8 ″. the density in the air channels does not change via temperature and the optical path remains constant . the paths within the beam splitter are identical for both interferometer arms . the illustrated part 3 of the mach - zehnder interferometer is therefore athermal .	6
while the instant invention is applicable broadly to any fused silica refractory shape , such as blocks , plates , brick , and the like , it will be discussed in detail herein with respect to brick . an essential criterion of the present invention is the use of a high purity fused silica ( sio 2 ). as used herein the term &# 34 ; high purity &# 34 ; means at least 98 wt . %, preferably 99 . 5 wt . % silica , most preferably 99 . 5 wt . % and higher . moreover , as is conventional in brick making , it is preferred to use a fused silica particle size distribution from about - 4 to - 325 mesh ( tyler standard ). the remaining essential component of the mix is the bonding system and this consists of high purity collodial silica solution and a high purity ammonium lignosulfonate . the colloidal silica solution should have a solids content of 30 to 50 wt .%. the purity level of the solution should be 99 + wt . % silica plus aqueous vehicle . the viscosity of the solution should be less than 30 centipoise at room temperature . the ph of the solution is not critical with solutions having low and high ph being equally effective . as to the high purity ammonium lignosulfonate it is preferred that it have an ash content of less than about 3 wt .%, preferably less than about 2 wt . %, and contain less than about 0 . 25 wt . % calcium in the ash . it is preferred not to utilize any other constituents in the mix and in the resultant finished products . the brick can be formed from the mix simply by admixing the fused silica and the bonding system , forming the desired brick shape with a conventional impact press , and then firing the brick . the brick is preferably fired at high temperatures , i . e ., about 2100 ° to 2200 ° f . with a hold time sufficient for the mass to reach thermal equilibrium , but not for such extended time that the brick devitrify to more than 10 % crystalline silica , as measured by quantitative x - ray diffraction . for a conventional kiln load of pressed brick a sufficient hold time will probably range between 5 to 10 hrs . only routine experimentation is needed to obtain the optimum balance between hold time and obtaining the desired set physical properties since each kiln will vary somewhat in its ability to fire a given load of brick because of differences in heating sources , design and the like . the result is a fused silica brick with a density of above 120 pcf with a porosity of about 9 to 12 % and having a room temperature modulus of rupture above 1000 psi . with respect to proportions , the bonding system is a plus addition to the silica refractory and is added in an amount of about 3 to 8 wt .% correspondingly 97 to 92 wt . % the fused silica . with respect to the components of the binder system itself while equal parts by weight of each can be utilized , it is preferred to use about 3 parts by wt . of the collodial silica to 2 . 5 parts by wt . of the ammonium lignosulfonate . the invention will be further described in connection with the following examples which are set forth for purposes of illustration only . a series of four mixes were prepared and brick formed therefrom on an impact press . the resultant brick were then tested for bulk density , strength , and porosity . the mix formulation , brick - forming conditions , and test results are set forth in table i below . in addition the brick were compared to two commercial silica brick mixes , visil brand vitreous silica brick ( a pressed composition ) and masrock brand fused silica brick prepared by slip casting . table i__________________________________________________________________________ example no . 1 2 3 4 visil masrock__________________________________________________________________________fused silica , 4 / 10 mesh 30 % fused silica , 10 / 20 20 % fused silica , 20 / 50 15 % fused silica , 50 / 100 5 % fused silica , - 325 30 % plus additionscolloidal silica * 3 . 0 -- 1 . 1 -- colloidal silica ** -- 3 . 0 -- -- ammonium lignosulfonate 2 . 5 2 . 5 -- 5 . 5 ( 51 % solids ) stearic acid flakes -- -- 3 . 0 -- water ( deionized ) -- -- 1 . 9 -- brick size 9 × 4 . 5 × 3 . 0 &# 34 ; impact time , sec . 20 25 25 35bulk density at press , pcf 124 124 117 125bulk density after 121 121 113 121drying , pcfproperties after firingto 2050 ° f . linear change - 0 . 2 0 . 0 - 0 . 2 -- modulus of rupture , psi 1280 -- ( 1 ) -- 915 2580on whole brickbulk density , pcf 119 -- -- 118 122apparent porosity , % 12 . 7 -- -- 14 . 3 12 . 4apparent specific gravity 2 . 19 -- -- 2 . 21 2 . 20properties after firingto 2100 ° f .% linear change -- 0 . 3 -- -- modulus of rupture , psi 1560 -- -- on whole brickbulk density , pcf 119 -- -- apparent porosity , % 12 . 6 -- -- apparent specific gravity 2 . 19 -- -- properties after firingto 2150 ° f .% linear change -- -- - 0 . 1modulus of rupture , psi 1250 -- 600 915 2580on whole brickbulk density , pcf 121 -- 119 118 122apparent porosity , % 11 . 7 -- 12 . 9 14 . 3 12 . 4apparent specific gravity 2 . 20 -- 2 . 18 2 . 21 2 . 20properties after firingto 2175 ° f .% linear change - 0 . 3 -- -- modulus of rupture , psi 1730 -- -- on whole brickbulk density , pcf 122 -- -- apparent porosity , % 10 . 7 -- -- apparent specific gravity 2 . 19 -- -- cold crushing strength , psi 7150 -- -- 5390 9730on 2 × 2 × 3 &# 34 ; cubes : air permeability , centi - 0 . 5 -- -- 0 . 6 -- darcysx - ray diffraction analysis % quartz & lt ; 1 -- -- 8 tr % cristobalite & lt ; 1 -- -- 5 & lt ; 1 % amorphous ( by difference ) 99 + -- -- 87 99 + properties after firingto 2200 ° f .% linear change - 0 . 6 - 0 . 33 -- modulus of rupture , psi 1900 1870 -- 915 2580bulk density , pcf 122 123 -- 118 122apparent porosity , % 9 . 9 9 . 6 -- 14 . 3 12 . 4apparent specific gravity 2 . 18 2 . 17 -- 2 . 21 2 . 10x - ray diffraction analysis % quartz & lt ; 1 & lt ; 1 -- 8 tr % cristobalite 4 2 -- 5 & lt ; 1 % amorphous ( by difference ) 96 98 -- 87 99 + __________________________________________________________________________ * ph 3 ** ph 9 ( 1 ) because this mix had such low density , no further tests were performe thereon . individual brick of example 1 were burned at one of each of the five burns , that of example 2 were burned only at 2200 ° f ., and that of example 4 were burned only at 2150 ° f . table 1 clearly shows that fused silica brick made with high purity fused silica grain and high purity binders could be made and fired to 2175 ° f . without detectable loss of their amorphous state . the low porosity of 10 . 7 % and 99 + % amorphous state was quite unexpected since it is well known that above 2000 ° f . amorphous silica has the tendency to devitrify and silica of high purity , 99 + %, tends to be sluggish its ability to sinter . while the invention has been described in connection with a preferred embodiment , it is not intended to limit the scope of the invention to the particular form set forth , but on the contrary , it is intended to cover such alternatives , modifications , and equivalents as may be included within the spirit and scope of the invention as defined by the appended claims .	2
the figures described above and the written description of specific structures and functions below are not presented to limit the scope of what applicants have invented or the scope of the appended claims . rather , the figures and written description are provided to teach any person skilled in the art to make and use the inventions for which patent protection is sought . those skilled in the art will appreciate that not all features of a commercial embodiment of the inventions are described or shown for the sake of clarity and understanding . persons of skill in this art will also appreciate that the development of an actual commercial embodiment incorporating aspects of the present inventions will require numerous implementation - specific decisions to achieve the developer &# 39 ; s ultimate goal for the commercial embodiment . such implementation - specific decisions may include , and likely are not limited to , compliance with system - related , business - related , government - related and other constraints , which may vary by specific implementation , location , and from time to time . while a developer &# 39 ; s efforts might be complex and time - consuming in an absolute sense , such efforts would be , nevertheless , a routine undertaking for those of skill in this art having benefit of this disclosure . it must be understood that the inventions disclosed and taught herein are susceptible to numerous and various modifications and alternative forms . most of the current design for scale - out storage systems rely upon relatively large individual storage systems that must be connected by at least a single very high - speed , high bandwidth interconnections in order to provide the needed bandwidth for the users and provide the required transfer bandwidth to each storage element . the present invention provides an alternative to this design technique using a dedicated fabric network that can be used in combination with a multi - dimensional topology capable of a distributed non transparent switching architecture used to interconnect each single storage node . this approach provide better bandwidth and scalability that the traditional one using a less network bandwidth per single network channel , resulting in a less expensive architecture a modern scale - out storage system must provide high bandwidth , have low latency in data access , must be continuously available , must not lose data , and its performance must scale as its capacity scales . existing large scale storage systems have some of these features but not all of them . this situation is not acceptable in an environment where big data set data are need to be continuously , efficiently and quickly available for intensive processing . in the present invention we introduce the concept of an architecturally simplified storage node where the inside storage capacity can be relatively small . these storage nodes are connected together in a parallel way using a dedicate data plane . each of these node provide at least one secondary network interface that is use for external connectivity , like for example , but not limited to , datacenter connectivity , pr external commuting nodes connectivity . with this architecture in mind 1000 s and more of these nodes can be densely connected together using multidimensional network topologies , like e . g . but not limited to hypercubes , 2d torus or 3d torus , introducing the concept of massively parallel distributed storage architecture as new way to build efficient storage systems . in general , one petabyte of storage capability can be achieved , with this approach , using e . g . 2048 elements with 512 gb of capacity each or e . g . 8192 elements of 128 gb each . if these storage units are organized in a multidimensional parallel array , closely interconnected together , with each single node - to - node link channel capable of a real bandwidth of 1 . 4 gbyte / s , they could deliver respectively 700 giga byte per seconds with more than 40 mega iops and more than 11 terabytes per second of bandwidth and more than 0 . 6 giga iops , using standard pcie ssds . copy of the single data could also be distributed on multiple discrete nodes creating a high level of data redundancy where if a single entire node failed , data would still be available in another node . fig1 . shows , in a preferred embodiment , the architecture of a possible storage node . the storage node comprises at least a main board 100 with inside : a cpu ( 1 ), a least one , single or multi - core , with its local ram memory ( 1 a ), at least one disk ( 2 ), for example , but not limited to , pcie , sas or sata ssds or other equivalent devices , at least single or multiport network interface controller ( 3 ), used to connect other storage nodes through the storage fabric ( 101 ), at least a supplementary network interface controller nic ( 4 ) used for user external ( datacenter or user ) connections . the cpu ( 1 ) is equipped with a dedicated embedded flash ( 5 ) or other boot capable devices , like , for example , a dedicated disk , that is used for system boot and initialization . the elements ( 1 ), ( 2 ), ( 3 ), ( 4 ) can be combined , entirely or in part , in a single system on chip using dedicate asic , fpgas . fig . 2 shows , in a preferred embodiment , a possible realization of the storage system proposed based on a data plane realized in hypercube network topology . the choice of the hypercube topology and any related hypercube derived topologies is due to the topological properties of the hypercube that fits very well with the goal of the proposed storage architecture . the n - dimensional hypercube is a highly concurrent loosely coupled multiprocessor based on the binary n - cube topology . machines based on the hypercube topology have been considered as ideal parallel architectures for their powerful interconnection features . more in detail the hypercube interconnection ( 1 ) is used to connect all the storage element nodes ( n 1 a ) together . the hypercube is logically composed by many basic groups ( 4 ) according with the hypercubes mathematical description and each of this group is represented , in that example , but not limited to , by a multiport fabric switch ( 8 ). each of these multi - port switches represents a hypercube vertex . each of these multiport switches has the same number of fabric ports used to connect together other switches , inside the fabric , creating the network ; the number of ports is strictly related with the hypercube topological dimension . according with the literature for an hypercube we have n ( number of vertex )= 2 ̂ in ( number of network links ) that for example means that a 64 vertex hypercube require 6 network links per vertex . one of the ports of the switch is used to connect the storage node using an opportune local interface . these switches can be embedded into the storage node as showed in the detail ( a ). in this way , a single storage node represents each hypercube vertex . in a different embodiment , each single vertex of the hypercube is composed of an external switch that is used to connect multiple nodes together as shown in the detail ( b ). in this case each single vertex of the hypercube is represented by an independent switch that is used to connect at least one single storage node to the hypercube based fabric . in detail , the group ( a ) shows an hypercube group composed by the hypercube vertex ( 6 a ),( 6 b ),( 6 c ),( 6 d ),( 6 e ),( 6 f ),( 6 g ) organized as 3d cube ( 2 ̂ 3 vertex ), as shown in detail ( a 2 ). each vertex is directly connected to a single storage node . the storage node ( 3 a ) is connected to the vertex ( 6 a ), the storage node ( 3 b ) is connected to the vertex ( 6 b ) and so on . each storage node is connected with the other nodes in the group using a point - to - point connection . the detail ( b ) shows how a different organization of the storage nodes can be created using multiple switches connected to the hypercube vertex instead of using the direct connection between the vertex and the storage node as described in the detail ( a ). in this case the hypercube group ( b ) has many external switch connections to each hypercube vertex group ( 6 a ),( 6 b ),( 6 c ),( 6 d ),( 6 e ),( 6 f ),( 6 g ). one switch per single vertex of the hypercube . each switch has multiple ports for hypercube fabric connection ( 8 a ) and multiple ports ( 8 b ) that are used to connect the storage nodes ( 2 ). the detail ( c ) show how these switches can be organized . the switch ( 8 ), has n ports ( 8 a ) dedicated to the connection with the hypercube fabric , and has x ports ( 8 b ) dedicated to the connection with the storage nodes . note that number x can be different from number n . the main advantage of this configuration is the lower cost and the major flexibility of the final storage architecture compared with the solution described by the detail ( a ). other topologies can be used to achieve the same level of parallelism like , but not limited to , k - ary d - cube topologies and derivate . each of the storage nodes have at least secondary interface that is used for the external connectivity . fig3 . represent , conceptually , how the storage system can be connected on the existing environment . multiple storage nodes ( 1 ) are connected together using the storage data plane fabric ( 3 ) by the , dedicated , network interface ( 3 a ). the resulting system is connected to the external world using the user fabric ( 2 ) by the , dedicated , network interface ( 2 a ). the advantages of this architecture is the complete separation from the user network and the storage data plane . this implementation permit to off load the user fabric from the operation related to the storage organization and permit to achieve a linear scalability in terms of access bandwidth to the system .	7
[ 0042 ] fig1 shows a grip 1 according to the invention , which comprises a shank 2 and a head 3 which are connected to one another by means of a pivot 4 . a cleansing element according to the invention is diagrammatically depicted by 5 . the shape of the cleansing element and the shape of the head 3 are not subject to any particular limitations , but are preferably slightly egg - shaped , as can be seen in fig1 b . advantageously , the external dimensions of the cleansing element 5 are slightly greater than those of the head 3 . this promotes hygienic use of the grip 1 . [ 0043 ] fig2 shows a perspective view of an embodiment of a cleansing element 5 which comprises a u - shaped incision 6 . the lip 7 , i . e . the material inside the u - shaped incision , can be bent out , as shown in fig2 . [ 0044 ] fig3 shows another embodiment of a cleansing element 5 with an h - shaped incision 8 . the u - shaped lips 9 which are formed in this case can also be bent outwards . the lips 7 and 9 of the cleansing elements 5 shown in fig2 and 3 are used to attach the said cleansing elements to the head 3 of a grip 1 , the head 3 comprising suitable attachment openings 15 which will be discussed below . [ 0046 ] fig4 and 5 show two successive operating steps of a holder 10 for a cleansing assembly according to the invention . the holder 10 for the cleansing assembly comprises two compartments 11 and 12 . the first compartment 11 is used to hold stack of cleansing elements 5 , and the second compartment 12 is used to store the grip 1 and to attach a new cleansing element 5 to the said grip 1 . in the vicinity of the base , the compartments 11 and 12 are in communication with one another by means of an opening 13 . one of the cleansing elements 5 ′ can be pushed through the said opening 13 out of the compartment 11 into the compartment 12 by means which are not shown . these may , for example , be a slide device which can be actuated by foot . other means are also suitable , such as hand - actuable means or the like . a press - on projection 14 according to the invention is present on the base of the compartment 12 . the way in which the press - on projection 14 operates will be explained in more detail below . [ 0049 ] fig6 shows , in three steps a , b and c , the way in which a cleansing element 5 in accordance with fig2 is attached to the head 3 of a grip according to the invention , using a press - on projection 14 . the head 3 of the grip 1 comprises , on its underside , an attachment opening 15 which is to a large extent closed off by a hinged resilient lip 16 . furthermore , the head 3 comprises a stop 17 on the inside in the vicinity of the attachment opening 15 . when a cleansing element 5 has been introduced into the compartment 12 via the opening 13 and the grip 1 is lowered onto it , the position shown in fig6 a will be reached . when the grip 1 is pressed further downwards into the compartment 12 , the lip 7 will be forced out of the cleansing element 5 into the attachment opening 15 by means of the press - on component 14 , with the resilient lip 16 being opened up . the lip 7 will gradually be pressed further upwards as the grip 1 is moved further into the compartment 12 . ultimately , the position shown in fig6 c is reached . when the grip 1 is taken out of the compartment 12 , the cleansing element 5 is unambiguously attached to the head 3 , because the lip 7 is clamped between the stop 17 and the resilient lip 16 . resilient lip 16 is in this case an additional attachment means . [ 0052 ] fig6 d shows a perspective view of part of the inside of the underside of the head 3 with the cleansing element 5 in accordance with fig2 attached to it . this figure clearly shows the action of the stop 17 and the resilient lip 16 for securely clamping the lip 7 . reference is now made to fig7 with regard to the way in which a cleansing element 5 in accordance with fig3 is attached . in this case too , a cleansing element 5 is introduced into the compartment 12 via the opening 13 . as a result of the grip 1 being moved downwards into the compartment 12 , the lips 9 can be moved into an attachment opening 15 in the underside of the head 3 through interaction with the press - on projection 14 . in this case , the attachment opening 15 does not comprise a stop or resilient lip . in this embodiment , the material of the cleansing element 5 is important , since it has to be sufficiently rigid to be able to clamp the cleansing element 5 in the attachment opening 15 of the head 3 of the grip 1 as a result of the lips 9 being bent over . the cleansing element 5 is therefore attached as a result of frictional engagement between the lips 9 and the attachment opening 15 . a diagrammatic plan view is shown in fig7 c of the underside of the head 3 , with the lips 9 attached inside the attachment opening 15 . in this case too , the grip 1 is ready for use once it has been removed from the compartment 12 . of course , it is equally possible to use different shapes of incisions , with correspondingly adapted attachment openings . for example , two or more u - shaped or h - shaped incisions which are spaced apart from one another in the cleansing element can be used in combination with a corresponding number of attachment openings in the head 3 . consideration may also be given to cross - shaped or star - shaped incisions and the like . the following fig8 and 9 show two ways in which a cleansing element can be released from the attachment means after it has been attached . [ 0057 ] fig8 a and b show the way in which the cleansing element in accordance with the embodiment shown in fig6 is released , and fig9 a and b show the way in which the cleansing element in accordance with the embodiment shown in fig7 is released . in fig8 the resilient lip 16 is provided with a pull rod 19 . when this pull rod 19 is moved in the direction of the arrow , the cleansing element 5 can be released . by contrast , the embodiment shown in fig9 comprises a push rod 20 which can push the cleansing element 5 out of the opening 15 . to this end , this push rod is provided with a spherical component 21 in the vicinity of the head 3 . [ 0059 ] fig1 shows a plan view of a head 3 of a grip 1 with a cleansing element 5 with two t - shaped coupling components 22 attached to it . the width of the coupling components is therefore locally greater than the dimension of the attachment openings 15 , so that they can engage behind the material of the head 3 . in this way , the cleansing element is securely attached to the grip and the possibility of the cleansing element falling out of the grip is completely prevented . finally , fig1 shows a cleansing element 5 with three substantially h - shaped incisions 8 which are spaced apart from one another . when a cleansing element 5 of this nature is attached to a head 3 of a grip 1 , three sets of u - shaped lips 9 as shown in fig3 are formed . this ensures improved attachment of the cleansing element 5 to the head 3 over the entire bottom surface of the head 3 .	0
referring to fig1 , a prior art automatic tire inflation system known as mtis system manufactured by pressure systems international of san antonio , tex ., is shown . the reference numeral 100 generally indicates the rotary air connection for supplying air from an air supply on a vehicle in an automatic tire inflation system for a vehicle to rotating tires . the numeral 112 generally indicates one axle or spindle , a hubcap 114 is provided at each end of the axle 112 for retaining lubricant in the wheel bearings , and an air supply 116 either directly in the axle 112 or through an interior conduit ( not shown ) in the inside of the axle 112 supplies air to the rotary air connection through the inside of the axle . a pneumatic rotary union generally indicated by the reference numeral 120 is supported and positioned in the center of the axle 112 , such as by force fit plug 220 , but sealingly engages the interior of the axle 112 by seal 124 as air is injected directly into the inside of the axle 112 . the rotary union 120 has a first stationary part or stator 128 having a passageway 136 therethrough . the passageway 136 is in communication with the air supply 116 . a first resilient rotary seal 138 is supported in the passageway 136 and encircles the passageway 136 . the union 120 includes a second rotatable part or rotor including a tubular member 142 having a first end 144 and a second end 146 . the second end 146 is coaxially extendible through and is longitudinally and rotationally movable in the passageway 136 and sealably engages the rotary seal 138 and is in communication with the air supply 116 . the first end 144 of the tubular member 142 is sealably connected to the air connection or through tee 152 on the hubcap 114 through a seal 150 . the air connection 152 or through tee is provided on the hubcap 114 for connection to the tire or tires through air hoses ( not shown ) at the end of the axle 112 . the end 144 of the tubular member 142 includes a shoulder which includes a bearing 101 . in operation , air is supplied through the stationary part 128 of the rotary union 120 , through the rotatable member 142 , the through tee 152 and to the tires . the system 100 includes the air pressure supply 116 and a suitable warning system such as a flow switch 32 a and a warning indicator light 34 a in the event of loss of air pressure . the hub cap 114 also includes a plurality of air vent holes 160 and a yieldable rubber vent shield 162 normally closing the vents 160 but opening and allowing the escape of air in the event of a leak from the system 100 into the inside compartment of the hubcap 114 . the shield 162 is supported from the through tee 152 which is threadably secured by threads 164 to the wall of the hubcap 114 and supports one end of the rotatable member or rotor 142 . lubrication to the inside of the hubcap 114 is accomplished by a side fill plug 170 on the outer diameter of the hubcap 114 . this fill method requires tools for unscrewing the plug 170 and does not allow for checking lubrication levels . while hubcap 114 includes a sight glass 172 , it is usually caked up with lubricant and is not usable . in addition , if the position of the truck is such that the plug 170 is not an up position , then the vehicle will have to be rotated to bring the plug 170 into an up position for replenishing the lubricant supply . on a plurality of tires on a vehicle , this can be time - consuming . the through tee 152 can be unscrewed from the hubcap 114 , after disconnecting air hoses to the tires ( not shown ) and remove the rotor 142 for repair . however , the stationary part or stator 128 cannot be removed without removing the hubcap 114 . referring now to fig2 , 4 and 5 , the reference numeral 10 generally indicates the rotatable air connection of the present invention for supplying air from an air supply on a vehicle in an automatic tire inflation system for a vehicle to the rotating tires ( not shown ). the numeral 12 generally indicates one axle or spindle , a hubcap 14 is provided at each end of the axle 12 for retaining lubricant to the wheel bearings ( not shown ) and an air supply 16 , either directly in the axle 12 , or through an interior conduit ( not shown ) in the inside of the axle 12 for supplying air to the rotary connection through the inside of the axle . a pneumatic rotary union generally indicated by the reference numeral 20 is supported and positioned in the center of the axle 12 , such as by force fit plug 22 , but sealingly engages the interior of the axle 12 by a seal 24 if air is injected directly into the inside of the axle 12 . the rotary union 20 has a first stationary part 28 threadably secured into the center of the plug 22 by threads 23 , a passageway 36 therethrough and a hexagonal head 37 . the passageway 36 is in communication with the air supply 16 . a first resilient rotary seal 38 is supported in the passageway 36 and encircles the passageway 36 . the union 20 includes a second rotatable part or rotor including a tubular member 42 having a first end 44 and a second end 46 . the second end 46 is coaxially extendible through and is longitudinally and rotationally movable in the passageway 36 and sealably engages the rotary seal 38 and is in communication with the air supply 16 . the first end 44 of the tubular member 42 is sealably connected to the air connection or through tee 52 on the hubcap 14 through a seal 50 . the air connection 52 or through tee is provided on the hubcap 14 for connection to the tire or tires ( not shown ) at the end of the axle 12 through air hoses 55 and 57 ( fig5 ). the end 44 of the tubular member 42 includes a shoulder which includes a bearing 11 . in operation , air 16 is supplied through the stationary part 28 of the rotary union 20 . the inflation system 10 includes any suitable warning system such as a flow switch 32 and a warning indicator light 34 for indicating when the air pressure is leaking . the above description is generally disclosed in u . s . patent application ser . no . 10 / 186 , 951 entitled “ rotary air coupling connection with bearing for tire inflation system ,” which is herewith incorporated by reference . in the present invention the hubcap 14 includes an opening 58 ( fig5 ) coaxially aligned with the rotary union 20 . a plug 60 is releasably supported in the opening 68 and said plug includes a threaded support opening 62 coaxially aligned with the rotary union 20 . the plug 60 includes one or more air vents 64 , here shown as six , positioned outside of the support opening 62 . the support opening 62 supports the through tee 52 in the opening 62 and in turn supports one end of the rotatable part 42 of the rotary union 20 and a vent shield 66 covering the outside of the air vents 64 . the hubcap opening 58 is of a size for adding and visually inspecting lubrication level in the inside of the hubcap 14 and for passing a socket wrench for engaging the head 37 of the stator member 28 for removing the stator member 28 through the hubcap opening 58 without removing the hubcap 14 . for example only , the opening 58 may be 1 . 625 inches in diameter . the plug 60 consists of a rigid material for providing a firm support for the through tee 52 and for example only may consists of a hard plastic such as delrin . the plug 60 includes a head 68 at a first end for abutting the outside of the hubcap 14 and an extension 70 extending through and beyond the inside of the hubcap 14 and terminating in a second end 72 . a circular seal 74 surrounds the plug 60 intermediate the first end 68 and the second end 72 and seals against the inside of the hubcap 14 and releasably holds the plug in position in the hubcap opening . however , the plug 60 may be easily removed from the opening 58 and a knurled surface is provided on the head 68 for that purpose . in addition , the plug 60 may be blown out the opening 58 in the event the air vents fail to exhaust the air . and if the plug 60 is blown out of opening 58 it will not be lost on the highway as occurs with conventional vent plugs since it is secured to lines 55 and 57 by the through tee 52 . as best seen in fig3 , the plug 60 includes an extension 70 and surfaces exposed to the interior of the hubcap 14 which are positioned to direct lubrication in the hubcap away from the air vents 64 so that if oil passes through vent holes 64 of the plug 60 it may be centrifugally ejected onto the face of the hubcap 14 . also in the event of a leak in the air pressure system less of the lubricant may be blown out of the hubcap 14 . the surfaces include an interior surface 76 outside of the air vents 64 and the interior surface 76 taper outwardly towards the second end 72 of the plug 60 for centrifugally directing lubrication away from the air vent 64 when the hubcap is rotating . the interior surface 76 may include a second outwardly directed tapered surface 78 . in addition , the plug 60 includes an exterior surface 80 adjacent the second end 72 of the plug 60 which includes a recess surrounding the exterior surface for directing lubrication away from the air vent 64 while the hubcap is static . for example , the overall length of the plug 60 may be one inch and the diameter of the head may be two inches . the taper 78 may be greater than the taper 76 and by way of example may be 45 °. referring now to fig5 , the combination of the through tee fitting 52 and plug 60 may be popped out or manually removed from the opening 58 without disconnecting the air hoses 55 and 57 . lubricant on the interior of the hubcap 14 may be replaced and visually observed . if desired , the plug 60 may be unscrewed from the through tee fitting 52 , the lines 55 and 57 removed , and the rotor 42 repaired . additionally , stator 28 may be threadably removed from the plug 22 . thus , all of the wear parts in the rotary union 52 may be inspected , repaired and replaced without removing the hubcap 14 . thus , a minimum of tools , a minimum of expertise , and a minimum of time and expense are required to perform minor repairs on the wear portions of the system 10 of the present invention . although the present invention and its advantages have been described in detail , it should be understood that various changes , substitutions and alterations can be made herein without departing from the invention as defined by the appended claims . moreover , the scope of the present application is not intended to be limited to the particular embodiments of the process , machine , manufacture , composition of matter , means , methods and steps described in the specification . as one will readily appreciate from the disclosure , processes , machines , manufacture , compositions of matter , means , methods , or steps , presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized . accordingly , the appended claims are intended to include within their scope such processes , machines , manufacture , compositions of matter , means , methods , or steps .	1
a first embodiment of a tranmission mechanism for a motor driven toy according to the present invention will now be described with reference to fig1 to 7 . a high speed transmission gear 112 and a slow gear 114 are fixedly mounted on a common sleeve 150 . the gear 112 has a greater diameter than that of the slow gear or pinion 114 . the common sleeve 150 is freely rotatable around a shaft 116 indicated by a dotted line . in the same manner as in the prior art transmission described above , the high speed gear 112 is engaged with reduction gears ( not shown ) and is driven by motor torque so that the gear 112 is rotated together with the slow speed gear 114 . on an output shaft 118 are fixedly mounted driven means such as a pair of tires , a stop 122 and a cam sleeve element 124 . an associated cam sleeve portion 126 is integrally formed with an output gear 128 which is engaged with the above - described high speed gear 112 . the output gear 128 is integrally formed with a high torque gear 130 . the high torque gear 130 is provided with four round projections 154 as best shown in fig7 . a clutch mechanism 138 includes the projections 154 and recesses 156 as shown in fig6 . the four projections 154 are positioned at equal intervals concentrically on one surface of the high torque gear 130 . in the same manner , the eight recesses 156 are positioned at equal intervals concentrically on one surface of a synchronizing gear 152 . it is preferable to provide the recesses so that the distances between adjacent recesses are smaller than the diameters of the round projections in order to provide smooth engagement between the recesses and projections . thus , the projections 154 and recess 156 are engageable with each other . it is also preferable that the diameters of the projections 156 be somewhat smaller than those of the recesses . this is effective to provide a suitable displacement between the recesses and the projections in the engagement state to thereby provide smooth engagement between the slow speed gear 114 and the synchronizing gear 152 and between the slow speed gear 114 and the output gear 130 . the synchronizing gear 152 and the high torque gear can be simultaneously engaged with the slow gear 114 and are slidable in the axial direction . the synchronizing gear 152 , the gears 128 and 130 and the cam sleeve 126 are biased to normally move rightwardly . the cam sleeve 126 has a slanted cam surface 127 while the fixed cam sleeve 124 has an associated cam surface 125 . in operation , when the vehicle is driven on a flat or downward grade surface , that is , when a low load is applied to the vehicle , the high speed gear 112 is rotated through the reduction gears ( not shown ) by the motor in engagement with the output gear 128 which is retained at the rightmost end while the cam surface 127 of the cam sleeve portion 126 is in full contact with the cam surface 125 of the fixed cam surface 124 . thus , the rotational torque of the motor is transmitted to the driven members , that is , the tires 120 in the same manner as in the prior art . however , in the transmission gear system according to the present invention , it should be noted that for high - speed torque operation the high speed gear 130 and the synchronizing gear 152 are rotated in the direction indicated by the arrow 144 at the same rotational speed and the two gears are not engaged with any other gears to thereby apply a smooth rotational torque to the output shaft 118 during high - speed low torque operation . when low - speed high - torque is necessary for the vehicle due to the load applied to the wheels , the load applied to the wheels is transmitted to the output gear 128 through cam action between the surfaces 125 and 127 . as a result , the output gear 128 is moved leftward against the spring 136 disengaging from the high speed gear 112 . at this time , the synchronizing gear 152 is rotated synchronously with the slow gear 114 by assistance of the clutch mechanism 138 while the projections 154 are engaged with or disengaged from the recesses 156 , the output gear 128 is completely disengaged from the high speed gear 112 , and the rotation of the high torque gear 130 is simultaneously synchronized with the rotation of the slow gear 114 . the synchronizing gear 152 serves to absorb the difference in circumferential rotational speeds between the high speed gear 112 and slow speed gear 114 to thereby completely eliminate shock caused in a changeover between high - speed low - torque and low - speed high - torque operations . thus , at low - speed high - load operation the slow speed gear 114 is directly engaged with the high torque gear 130 and hence the output gear 128 so that the torque is transmitted to the output shaft without action of the clutch mechanism . this advantageously simplifies the torque transmission during high - load operation . fig8 shows another embodiment of the present invention in which a modified fixed cam sleeve 124a is engaged with an associated axially movable cam sleeve 126a . the cam sleeve 124a has a forward direction slanted cam surface 125a and a reverse direction slanted cam surface 125b while the cam sleeve 126a has a forward direction slanted cam surface 127a and a reverse direction slanted cam surface 127b . the remainder of the structure is the same as that of the previous embodiment of the invention . the operation of the embodiment is substantially similar . the transmitted torque from the motor can be reversed by the high speed gear 112 in a manner well - known in the art . it is , therefore , possible to operate the vehicle in reverse . this is due to the fact that for high - speed low - torque operation the output gear 128 is engaged only with the high speed gear 112 while for low - speed high - torque operation the high torque gear 130 is engaged with the slanted gear 114 . the present invention has been described with reference to specific preferred embodiments thereof although the invention is not limited thereto .	0
the preferred embodiments of the present invention will be hereinafter described in detail with reference to the accompanying drawings , in which like reference numerals refer to like parts . fig1 is a block diagram schematically showing a main structure of respective image forming systems according to first to fourth embodiments of the present invention . a user file 11 is a file of an image or a document which a user can use . a print application 10 is an application to be operated by the user and is provided for selection of a file to be printed from the user file 11 . in addition , the print application 10 is provided with a function for converting the selected file into print data and delivering the print data to a printer service unit 30 . a database file 21 is a file in which print data and ids of print paper are recorded in association with each other . a database application 20 includes a registration function , a reference function , and a deletion function . the registration function of the database application 20 allows registration of the print data and the ids in a one - to - multiple relation . in other words , the registration function allows registration of plural ids for one body of print data . by supplying an id to the database application 20 , the reference function of the database application 20 allows sending back of print data corresponding to the id . by supplying an id to the database application 20 , the deletion function of the database application 20 allows deletion of print data corresponding to the id . a print control unit 40 is firmware which controls all operations relating to printing . an output paper id monitor unit 50 is capable of : communicating with an rfid 80 , which is attached to a print paper 90 which has just undergone printing shown in fig6 , in a non - contact manner with each other ; always monitoring an output paper id detector 70 ( fig4 and 5 ), which reads out id information specific to the rfid 80 ; and when the id is detected , immediately informing the print control unit 40 of the id . a print request id monitor unit 60 is capable of communicating with the rfid 80 , which is attached to the print paper 90 on which an image which a user desires to copy is printed , in a non - contact manner with each other ; always monitoring a print request id detector 71 ( fig5 ), which reads out id information specific to the rfid 80 ; and when the id is detected , immediately informing a printer service unit 30 of the id . the printer service unit 30 is software which communicates with the print application 10 , the database application 20 , the print control unit 40 , and the print request id monitor unit 60 and controls operations of the entire system . the printer service unit 30 performs control of normal printing and extra copy printing . functions of the print application 10 , the database application 20 , and the printer service unit 30 can be realized by software using a computer as described later . the user file 11 and the database file 21 are accumulated in a storage unit such as a hard disk drive in a computer as described later and are used when executing the respective applications . here , operation for normal printing will be described . the user executes the print application 10 , selects a file which the user desires to print from the user file 11 , and instructs the print application 10 to print the file . when the printing instruction is received , the print application 10 reads out the designated user file 11 , converts the user file 11 into print data , and delivers the print data to the printer service unit 30 . the printer service unit 30 transfers the delivered print data to the print control unit 40 . the print control unit 40 creates a bitmap image on the basis of the transferred print data and controls a print mechanism of a printer 200 in fig2 , described later , to print the bitmap image on the print paper 90 . in parallel with this print operation , the id of the print paper 90 to be outputted is monitored through the output paper id monitor unit 50 . the output paper id monitor unit 50 monitors an output signal of the output paper id detector 70 and , when the print paper 90 passes , detects the id of the paper . when the id information is detected , the output paper id monitor unit 50 informs the print control unit 40 of the id information . when the printing is completed , the print control unit 40 informs the printer service unit 30 of the completion of the printing together with the id information informed from the output paper id monitor unit 50 . the printer service unit 30 informs the database application 20 of the id information informed from the print control unit 40 together with the print data . the database application 20 registers the informed print data and id information in the database file 21 in association with each other . then , when the registration of the print data and the id information in the database file 21 is completed , the printer service unit 30 informs the print application 10 of the completion of the print operation based upon the delivered print data . when the notification of the completion of the print operation is received from the printer service unit 30 , the print application 10 informs the user of completion of the printing . a user brings an rfid part of the print paper 90 , on which an image for which the user desires to print extra copies is printed , close to the print request id detector ( fig4 ) 71 , and causes the print request id detector 71 to read the id . the print request id detector 71 informs the printer service unit 30 of the id information . the printer service unit 30 sends the informed id information to the database application 20 and instructs the database application 20 to retrieve print data corresponding to this id information from the database file 21 . the database application 20 retrieves the registered database file 21 . if the print data corresponding to this id information exists , the database application 20 sends the related print data to the printer service unit 30 . if the print data does not exist , the database application 20 returns information indicating failure of retrieval to the printer service unit 30 . if the print data is sent back from the database application 20 , the printer service unit 30 transfers the print data to the print control unit 40 . the print control unit 40 creates a bitmap image on the basis of the transferred print data and controls the print mechanism of the printer 200 to execute printing on the print paper 90 . in parallel with this print operation , the id of the print paper 90 to be outputted is monitored through the output paper id monitor unit 50 . when the id is detected , the output paper id monitor unit 50 informs the print control unit 40 of the id information . when the printing is completed , the print control unit 40 informs the printer service unit 30 of the completion of the printing together with the id information informed from the output paper id monitor unit 50 . the printer service unit 30 sends the id information informed from the print control unit 40 to the database application 20 . the database application 20 registers the print data , for which extra copies have been printed , and the informed id information in the database file 21 in association with each other . in other words , every time one image of print data registered in the database file 21 is printed , id information for the print data is registered anew . fig2 shows an external view of the image forming system according to the first embodiment of the present invention . fig3 is a block diagram schematically showing an internal structure of the image forming system according to this embodiment . as shown in fig3 , the functions of the print application 10 , the user file 11 , the database application 20 , the database file 21 , and the printer service unit 30 are included in a computer 100 , and the functions of the print control unit 40 , the output paper id monitor unit 50 , and the print request id monitor unit 60 are included in the printer 200 . the computer 100 and the printer 200 are connected via a network . the user file 11 and the database file 21 are saved in a hard disk in the computer 100 . fig4 is an external view of the printer 200 . in the printer 200 , paper is fed from the back of a main body thereof and discharged from the front of the main body after printing . in a course of the printing , specific id information incorporated in the rfid 80 attached to the print paper 90 is read by the output paper id detector 70 . in addition , the print request id detector 71 is provided in the upper front part of the main body separately from the output paper id detector 70 . when the part of the printed print paper 90 where the rfid 80 is attached is brought close to the upper front part of the main body , the specific id incorporated in the rfid 80 of the printed print paper 90 is read by the print request id detector 71 . the output paper id monitor unit 50 includes the output paper id detector 70 , and the print request id monitor unit 60 includes the print request id detector 71 . fig5 is a block diagram showing an internal structure of the output paper id detector 70 and the print request id detector 71 . the output paper id detector 70 and the print request id detector 71 each include an antenna 72 , an electric power circuit 73 , and a receiving circuit 74 . the electric power circuit 73 causes a high - frequency current to flow to the antenna 72 connected to the electric power circuit 73 . in other words , the electric power circuit 73 supplies electric power to the antenna 72 . at this point , the amplitude of the high - frequency current to be supplied to the antenna 72 is controlled to be constant . in addition , the electric power circuit 73 detects the high - frequency current and sends a signal of the high - frequency current to the receiving circuit 74 . the receiving circuit 74 restores id information according to a change in the signal based upon the high - frequency current from the electric power circuit 73 . the output paper id detector 70 and the print request id detector 71 each output the id information restored by the receiving circuit 74 . fig6 is an external view of the print paper 90 . as shown in fig6 , the rfid 80 is attached to an upper left portion of the print paper 90 . fig7 is a block diagram showing the internal structure of the rfid 80 . as shown in fig7 , the rfid 80 includes an antenna 81 , an electric power circuit 82 , a control circuit 83 , a nonvolatile memory 84 , and a transmission circuit 85 . the electric power circuit 82 receives high - frequency power , which is supplied from the output paper id detector 70 and the print request id detector 71 , through the antenna 81 . subsequently , after rectifying the received high - frequency power , the electric power circuit 82 supplies the power to the control circuit 83 , the nonvolatile memory 84 , and the transmission circuit 85 . when the power is supplied , the control circuit 83 reads out specific id information in the nonvolatile memory 84 after elapse of a predetermined time and converts the id information into serial data . the transmission circuit 85 supplies a modulation signal to the electric power circuit 82 in accordance with the serial data converted from the id information in the control circuit 83 . the electric power circuit 82 varies its amount of power consumption in response to the modulation signal from the transmission circuit 85 . this variation in power consumption is sent to the output paper id detector 70 or the print request id detector 71 through the antenna 81 . consequently , the output paper id detector 70 and the print request id detector 71 can obtain the id information of the rfid 80 . in this manner , according to the present embodiment , in the case where the user desires to record an image , which is already printed once , on another recording paper again , the user can print the desired image anew with a simple operation of causing the printer 200 to read the rfid attached to the recording paper on which the desired image is printed . therefore , it is unnecessary to retrieve desired image data from the user file 11 of the computer 100 . fig8 is a block diagram showing the structure of the image forming system according to the second embodiment of the present invention . in the image forming system of the present embodiment , the component relating to the database is arranged on a network , which differs from the image forming system in the first embodiment . in other words , in the image forming system of the present embodiment , unlike the structure shown in fig3 , the database application 20 and the database file 21 are arranged in a computer 300 separate from the computer 100 , in which the print application 10 and the printer service unit 30 are provided , and the computer 100 and the computer 300 are connected via a network . accordingly , both computers 100 and 300 are provided with network service units 101 and 301 , respectively . in addition , the computer 100 including the printer service unit 30 , is also connected to the printer 200 including the print request id detector 71 and the like via a network . if id information detected by the print request id detector 71 is sent to the database application 20 from the printer 200 through the computer 100 , it is possible to execute printing of a file corresponding to the id information as described above . fig9 and 10 are block diagrams showing structures of the image forming systems according to the third embodiment and the fourth embodiment of the present invention , respectively . the structure of the image forming system in the third embodiment of the present invention is different from the structure of the image forming system shown in fig8 in that the printer 200 and the computer 100 are connected via a network . in addition , the structure of the image forming system according to the forth embodiment of the present invention is different from the structure of the image forming system shown in fig8 in that the print request id monitor unit 60 is separated from the printer 200 , a request input apparatus 400 including the print request id monitor unit 60 is provided anew , and the request input apparatus 400 and the computer 300 are connected via a network . accordingly , computers 100 and 300 , printer 200 and request input apparatus 400 are provided with network service units 101 , 301 , 201 and 401 , respectively . it is needless to mention that the image forming system shown in fig9 or fig1 realizes the same actions and effects as the image forming systems shown in fig3 and 8 . the present invention is not limited to the structures described in the first to fourth embodiments , and it is possible to arrange every part of the block components shown in fig3 on a network . in addition , a system configuration may be adopted in which the respective block components shown in fig3 may be arranged on a network in plural . according to the above - mentioned embodiments , in order to copy a print , an rfid part of the print , which a user desires to copy , is made to react to an id detection unit of a printer or an independent id detector to recognize print contents from id information of the print to thereby print the print contents . therefore , an image quality of an image on a copied print is never deteriorated compared with that on an original print and the image on the copied print is not inclined . in addition , it is unnecessary to retrieve an original file of an image which a user desires to copy . further , it is also possible to collectively manage documents according to a history of copying in a database . furthermore , although depending upon a structure of a printer to which the image forming system of the present invention is applied , it is also possible to adopt a single id detector , which has both the functions of the output paper id detector 70 and the print request id detector 71 , as alternative means . moreover , according to the above - mentioned embodiments , print data and ids of print paper are recorded in association with each other in the database file 21 . however , the present invention can further register other information on the print data . examples of the other information on the print data include an id of a computer which executes print processing and an id of application software which is controlled the print processing in the computer . when the print processing is executed by a user once , the information on the print data and the print data are registered in association with each other in the database file 21 . in the case in which the user desires to copy this print data later , the user inputs the ids of the computer and the application software using input means such as a keyboard . the database application 20 retrieves print data corresponding to the inputted information from the database file 20 and informs the printer service unit 30 of a result of the retrieval . in the case in which the print data is returned from the database application 20 , the printer service unit 30 transfers the print data to the pertinent application software and causes the pertinent computer to execute print processing . in addition , it is also possible to incorporate the database application 20 and the database file 21 in the printer 200 . in this case , it is possible to copy a print on the basis of the printing method unique to the present invention with the printer 200 alone . moreover , when a print is copied , in addition to an id of print paper on which an image to be copied is printed , an id of print paper on which the image is copied is also registered in association with the pertinent print data in the database file 21 , whereby it is possible to copy the print data using any one of those kinds of print paper from then on . note that , in the present invention , a size of print paper is not limited , and the present invention is applicable to print paper of any size . in addition , print data is not limited to image data , and the present invention is applied to text data or the like . in addition , the objects of the present invention are also attained by providing a storage medium having stored therein program code of software , which realizes the functions of the above - mentioned embodiments , to a system or an apparatus , and by causing a computer ( or a cpu or an mpu ) of the system or the apparatus to read out and execute the program code stored in the storage medium . in this case , the program code itself read out from the storage medium realizes the functions of the above - mentioned embodiments , and the program code itself and the storage medium having stored therein the program code constitute the present invention . as the storage medium for supplying the program code , for example , a flexible disk , a hard disk , an optical disk , a magneto - optical disk , a cd - rom , a cd - r , a magnetic tape , a nonvolatile memory card , a rom , or the like can be used . in addition , the present invention includes not only the case in which the functions of the above - mentioned embodiments are executed by causing the computer to execute the read - out program code , but also a case in which an os ( a basic system or an operating system ) or the like running on the computer performs actual processing partly or entirely on the basis of an instruction of the program code , realizing the functions of the above - mentioned embodiments by the processing . moreover , the present invention also includes a case in which , after the program code read out from the storage medium is written in a memory provided in a function extending board inserted in the computer or a function extending unit connected to the computer , a cpu or the like provided in the function extending board or the function extending unit performs actual processing partly or entirely , thereby realizing the functions of the above - mentioned embodiments by the processing . many widely different embodiments of the present invention may be constructed without departing from the spirit and scope of the present invention . it should be understood that the present invention is not limited to the specific embodiments described in the specification , except as defined in the appended claims .	1
in the embodiments of the method shown in fig1 - 3 , an elastic yarn component 14 is unwound overhead from a supply package 14a , and a relatively inelastic yarn component 1 is withdrawn from a package 1a . the elastic yarn component 14 is preferably a highly elastic spandex yarn composed of one or more continuous filaments , and the inelastic yarn component 1 is a multifilament yarn of a thermoplastic material , such as nylon , or polyester . preferably , the elasticity of the elastic yarn component is at least about ten times that of the inelastic yarn component . a yarn guide 27 is arranged coaxially to the supply package 14a , and a similar yarn guide 4 is arranged coaxially to the supply package 1a . the elastic yarn component is withdrawn by a feed system 28 and then advanced to a delivery roll system 12 . the thermoplastic yarn component 1 is unwound from the supply package 1a and guided through the yarn guide 4 by means of a feed system 5 . the yarn component 1 then loops 360 ° about a draw pin 29 , and is withdrawn from the draw zone by a draw roll system 30 to then be likewise advanced to the delivery system 12 . although the yarn components are both withdrawn by the delivery system 12 , they are preferably guided separately from each other , as is shown in fig1 a . following the delivery system 12 , the yarn components are brought together and guided through an air jet entangling nozzle 19 , and withdrawn therefrom by a delivery roll system 31 . in this regard , the components are preferably brought together only after or immediately before they enter the nozzle 19 . subsequently , the resulting composite yarn is wound on a package 24 , which is rotatably driven on its circumference by a drive roll 25 . prior to being wound onto the package 24 , the composite yarn passes over an oiling roll 20 which is positioned in an oil tank 21 , and then through the yarn delivery roll system 31 . schematically indicated at 35 is a conventional yarn traversing system . in the illustrated embodiments of fig1 - 3 , the method of the invention proceeds as follows . the thermoplastic yarn component 1 is drawn between the feed system 5 and the draw system 30 . in so doing , the draw point or draw zone forms on or after the draw pin 29 . the circumferential speed of the delivery system 28 for the elastic yarn component is adjusted to the circumferential speed of the delivery system 12 , so that both the thermoplastic yarn component and the elastic yarn component advance to the delivery system in a tensioned condition , with the tension of the elastic yarn component being preferably between 0 . 1 and 0 . 3 cn / dtex , whereas the tension of the thermoplastic , low - elasticity yarn component ranges from 0 . 2 to 0 . 8 cn / dtex . the circumferential speed of the delivery roll system 31 for the resulting composite yarn is at least 2 % and preferably 6 % to 9 %, less than the circumferential speed of the delivery system 12 . while the methods shown in fig1 - 3 differ from each other by the spreading treatment , the latter serves in all embodiments to loosen the fiber assembly of the individual filaments of the inelastic yarn component , which is held together by adhesive and cohesive forces . in the method of fig1 the spreading treatment occurs in the draw zone . a yarn guide 33 with two contact edges 33 . 1 and 33 . 2 and a blade 34 which projects between the two contact edges 33 . 1 and 33 . 2 , serves as a spreading device . the yarn is guided between the contact edges 33 . 1 and 33 . 2 and the blade , thereby being tensioned and spread along the edge of the blade . in the method of fig2 the spreading device comprises a nozzle 32 , as is described in more detail in the aforesaid patent application p 38 35 169 . 2 and as described below with respect to fig5 . also , the two yarn components are preferably guided separately through the delivery system 12 , as seen in fig1 a . in the method of fig3 a nozzle 32 is likewise provided to serve as the spreading device . however , the nozzle 32 of this embodiment is arranged directly before the entangling nozzle 19 for the treatment by an air jet . in the embodiment of fig4 the method of the present invention is integrated into a false twist operation . in particular , a supply package 1a with a thermoplastic yarn component 1 , is creeled on a pin 3 of a creel 2 which is shown in part . the yarn component 1 is guided through a centrally arranged yarn guide 4 and withdrawn by a feed system 5 . the feed system 5 is driven by a motor 7 . as it passes through the feed system 5 , the yarn component is pressed by a contact roll 6 , which is biased by a spring against the surface of the feed system 5 . subsequent to the deflecting guides 8 , the yarn component is guided over a heater plate 9 and a subsequent cooling plate 10 before it enters into a false twist unit 11 , which in the illustrated embodiment is a friction false twist apparatus comprising a plurality of rotating disks . a feed system 12 withdraws the yarn component from the false twist zone . the feed system 12 is driven by a motor 13 . the yarn component is pressed against the surface of the feed system 12 by means of an apron looped about two freely rotatable rolls . the elastic yarn component 14 is wound on a supply package 14a , and which is supported on a rocking arm 17 and rests with its circumference on a drive roll 15 . the drive roll 15 is driven by a motor 16 in such a manner that the elastic yarn component is unwound . the elastic yarn component is guided over a deflecting roll 18 separated from and parallel to the thermoplastic yarn into the feed system 12 . only in or preferably after the feed system 12 , the yarn components are brought together , and they then enter into the air nozzle 19 , which is an entanglement nozzle . the two components are guided into the nozzle 19 at the same speed , and preferably they are separated from each other in the manner shown in fig1 a . the function of the entangling nozzle is to form entanglements between the individual filaments of the two yarn components which recur in a more or less regular sequence . behind the entangling nozzle 19 , the now combined composite yarn is guided over an oiling roll 20 , which is driven by a motor 22 at a slow speed . subsequently , the yarn advances over a deflecting guide 23 and through a traversing system ( not shown ) to a takeup package 24 . the package 24 rests on drive roll 25 , which is driven by motor 26 at a defined speed . preferably , a delivery system 31 as indicated in dashed lines is arranged between the entangling nozzle 19 and the takeup package 24 . the speed of the delivery system 31 is adjustable irrespective of the speed of the other yarn feed systems and drive rolls 15 and 25 respectively . the thermoplastic yarn component used in the present method may be partially oriented , and it is drawn between the feed systems 5 and 12 . consequently , the feed systems 12 and 5 are driven at a speed ratio of 1 . 1 : 1 up to 2 : 1 , with a yarn tension of 0 . 3 to 0 . 8 cn / dtex developing before the feed system 12 . the drive roll 15 of the supply package for the elastic yarn component is driven at a circumferential speed which is clearly less than that of feed system 12 . the speed ratio ranges from 1 : 2 to 1 : 4 . as a result , the tension of the elastic yarn component ranges from 0 . 1 to 0 . 4 cn / dtex before the feed system 12 . when the delivery system 31 is absent , the speed of drive roll 25 for the package 24 is lower , such as 4 % to 10 %, and preferably 6 % to 9 %, than the speed of the feed system 12 . however , the speed of the composite yarn immediately following its being guided through the nozzle 19 is substantially greater than , and preferably more than twice , the speed at which the elastic yarn component is withdrawn from its supply package . if a delivery system 31 is provided , these speed ratios will apply to the feed system 12 and the delivery system 31 . the relative yarn tension at the takeup is very low , since the tensile forces are here taken up only by the portion of the elastic yarn component in the composite yarn . however , the denier is substantially equal to the sum of the individual filaments . the drop of the relative yarn tension results from the fact that the absolute tension of the elastic yarn component before the feed system amounted to 7 cn in one example , whereas the absolute tension of the composite yarn behind the entangling nozzle was 5 cn . between the feed system 12 and the takeup , it is also possible to guide the yarn through a heating system before the air nozzle , or preferably after the nozzle and before the delivery system 31 , so as to smooth the tendency of the previously twisted thermoplastic yarn to twist . a special feature of the method of the present invention is that the yarn components are brought together only in or shortly before the entangling nozzle . if this is not so , the two yarn components will end up in a combination , which is caused by the tendency of the previously false twisted yarn to crimp and thereby disturb the appearance of the composite yarn . on the other hand , it has been shown that the bringing together of the elastic yarn component and the thermoplastic yarn component should occur as late as possible , preferably only after the feed system at the end of the false twist zone , if a combination of the two yarns by the tendency to crimp of the thermoplastic yarn is to be avoided . the friction false twister 11 may be of the type shown in u . s . pat . no . 3 , 813 , 868 , or u . s . pat . no . 4 , 339 , 915 , or u . s . pat . no . 4 , 377 , 932 . these false twisters apply frictional forces to the filaments transversely to the axis of the yarn component . also , the frictional forces act not only to rotate the filaments around the axis of the component , but also to spread the filaments transversely to the axis and to loosen the interconnection between the filaments . finally , it has also be found that the thermoplastic yarn component must be supplied to the entangling nozzle at a speed which leads to an extensive relaxation of the thermoplastic yarn in the combining zone . if not , the thermoplastic , low - elasticity yarn will not participate in the interlacing and entangling by the air jet treatment , and the intermingling and entangling of the yarns will turn out to be less intensive . on the other hand , a relaxation of the composite yarn must be limited , so that any interference with the method is avoided . in contrast thereto , the takeup speed must be selected to be sufficiently high so that neither very soft , instable , and unusable packages , nor intolerably hard packages with yarn damages are produced . shown in fig5 is a longitudinal sectional view of a suitable spreading nozzle 32 , which can be used in the method of fig2 or 3 . as illustrated , the nozzle comprises a yarn tube 43 which is mounted with its lower end in a block 39 . a compressed air connection 38 terminates in a collecting chamber 51 , which in turn leads to two compressed air channels 49 which are formed in an upper block 40 . the two compressed air channels extend along the outer circumference of the yarn tube , their diameter being smaller than that of the yarn tube . the inner boundary of the compressed air channels is formed by the outside wall of the yarn tube . the compressed air channels are diametrically opposite to each other with respect to the yarn tube . the outer walls of the compressed air channels are convergent with respect to the axial direction of the yarn tube and form a cross section with a minimum width 46 . two balls 42 are mounted on posts 41 which are fixed to the upper block 40 , so as to define a narrow gap 44 which is located between the balls 42 and which is above the outlet of the yarn tube 43 . the channels 49 exit into the open space below the balls 42 . both the channels and the yarn tube 43 are aligned with the gap 44 . the yarn tube 43 and the two compressed air channels 49 are arranged , together with the centers m of two balls 42 in a plane , in which the continuous yarn is guided and spread to open its individual filaments . thus in operation , the air exiting the channels 49 is directed to the gap 44 , and the air tends to smoothly adhere to the surface of the two balls . thus the balls cause a spreading action of the air , which in turn spreads the filaments which are entrained in the air stream . in the drawings and specification , there has been set forth a preferred embodiment of the invention , and although specific terms are employed , they are used in a generic and descriptive sense only and not for purposes of limitation .	3
as employed herein , the term &# 34 ; roughened surface &# 34 ; will refer to a surface of either a rotatable plate or stationary plate which is adapted to contact a specimen to be rheologically examined with the surface being discontinuous either due to ( a ) outwardly projecting elements of the plate material , or ( b ) pores which pass through the entire plate . the apparatus shown in fig1 may have a conventional support frame consisting of a pedestal 2 with four vertical posts 4 , 6 and two spaced behind plates 4 and 6 ( not shown ), which may be of the same shape as those shown , supporting an upper platform 8 . the upper and lower plate system 12 which will be discussed hereinafter as a stationary plate 18 which receives a rotatable plate 20 . transducer 22 underlies and is operatively associated with stationary plate 18 such that when axial rotation is effected in one of the directions indicated by arrow a , either in repeated 360 ° degree cycles of rotation in the same direction , or in an oscillating movement , the stresses will result in the stationary plate 18 receiving through the specimen forces which may be projected in three orthogonal directions and torque . this series of forces applied to transducer 22 will result in a plurality of output signals over lead 24 to processor 26 which may be any sort of computer means . the processor 26 converts the output of transducer 22 which is the nature of a charge to a voltage and emits an output signal over lead 28 to data acquisition and control unit 30 which delivers the signals to computer means 32 for processing and storage over lead 33 . the computer means 32 will determine the rheological properties viscosity of the material . such properties may be viscosity and stresses in a direction normal to the rotatable plate 20 . these properties may be stored , computer enhanced , displayed or made the subject of hard copy as desired . among the suitable transducers , usable as transducer 22 , is a piezoelectric four component transducer available from kistler instrument corporation . suitable software for use in the computer means 32 is that sold by national instruments under the trade designation labview . the wide range capability in respect of loads on the transducer 22 facilitates use of the system of the present invention with a wide range from granular materials , such as coal and rice , for example , to thick sludge similar to bread making dough , for example . the transducer 22 will generally provide output signals which are responsive to the torque and axial force . if a coordinate system has the x and y axes in the plane of shear , which is generally parallel to the plates 18 , 20 , with the z axis directed upwardly , the transducer will provide a reading of ( a ) the axial force along the z axis , i . e ., normal to the shear plane and ( b ) two forces that are perpendicular to one another in the plane of shear . the torque represents a moment about the z axis . when the rotatable plate 20 and the stationary plate 18 are coaxial the two forces normal to each other in the plane of shear during axial 360 ° rotation or oscillation will generally be zero , i . e ., when the rheometer is in a torsional configuration . the forces monitored to determine rheological properties are , therefore , the normal or z axis force and the moment force which represents torque . a motor 40 , which is energized over lead 45 by a suitable power supply 42 through lead 43 to control means 44 is shown overlying the plate assembly 12 . the motor is adapted to effect rotary movement of rotatable plate 20 . it will be appreciated that the control means 44 receives control signals from computer means 32 through a data acquisition and control unit 30 over lead 34 . this facilitates electrical switching to effect operation of the motor 40 in a first mode which provides continuous 360 ° axial rotation of rotatable plate 20 and in a second mode which provides for angular oscillation of rotatable plate 20 through a desired arc which may be on the order of + 90 ° to - 90 ° at 15 hz , + 35 ° to - 35 ° at 25 hz and + 90 ° to - 90 ° at 50 hz , for example . the output of the motor 40 is converted to the desired speed through an appropriate gear box 48 and delivers rotary motion to output shaft 50 . in order to facilitate relative separating movement between stationary plate 18 and rotary plate 20 , the plate 20 is adapted to be translated axially moving with an assembly that rides on liner bearings 54 . once the specimen is in place , axial movement of the plate 20 in the reverse direction , i . e ., toward the stationary plate 18 is also effected to effect initial compaction of the specimen . control of operation of this function is effected by computer means 32 by its labview software by emitting appropriate signals through acquisition and control unit 30 over lead 60 to control means 61 which may be a three - axis controller of the type available from nulogic . power supply 63 has output over lead 65 enter control means which emits a signal over lead 67 to servo motor 66 and through a gear box 68 to ball screw and nut 62 which moves shaft 70 vertically in an up and down path . shaft 70 is fixedly secured to upper support 72 which has four depending supports with 74 and 76 being shown , secured to lower support 80 which , in turn , is secured to the liner bearings 54 . the motor shaft 50 is coupled to plate shaft 90 using a low or no backlash coupler 84 . the vertical orientation of the plate shaft 90 is achieved with assistance of bearing assembly 86 which , in the form shown , has two tapered roller bearings . the rotatable upper plate 20 is mounted on shaft 90 and may easily be changed , if desired , for the particular specimen being tested . referring to fig2 there is shown a more detailed view of rotary plate 20 and stationary plate 18 , as well as transducer 22 . it will be noted that the rotatable plate 20 is fixedly secured to annular flange 92 of shaft 90 with bolts 100 , 102 securing an upper portion 104 of the rotatable plate to a lower portion 106 of the rotatable plate . the stationary plate 18 has an upwardly projecting annular wall and is generally cupshaped . plate 18 defines an upwardly open chamber 110 which is of greater diameter than rotatable plate 20 so that the rotatable plate can be received within chamber 110 . the lower plate has two elements 120 , 122 with a pair of bolts 124 , 126 securing the assembly . in essence , this approach provides means for replacing plate elements 106 and 122 , which are generally circular , after wear or in the event of damage . an important aspect of the present invention is that the lower surface 130 of plate dement 106 , which is the portion of the plate which faces the specimen which will be received in chamber 110 , is roughened . the degree of toughening may be varied depending on the material being analyzed . similarly , surface 132 of stationary plate portion 122 has its surface , which will face and contact the specimen , roughened . it will be appreciated that the transducer 22 has an annular plate 140 fixedly secured to the upper end thereof which , in turn , is secured to the lower surface of stationary plate 18 such that forces applied to the stationary plate 18 will be transferred to the transducer 22 to facilitate an electrical output signal over lead 24 to processor 26 . a pedestal supporting base 142 is secured to the lower surface of transducer 22 . fig3 is similar to fig2 except shows the plates 20 , 18 in relative closed position such that chamber 110 is relatively small . a specimen would normally be placed into the chamber with the roughened surfaces 130 , 132 being in intimate contact therewith and penetrating the same to provide firm interengagement . the specimen , which would fill chamber 110 , has not been shown for clarity of illustration . referring now to fig4 a , there is shown by way of an example , a part of lower portion 106 of the rotatable plate wherein a plurality of integrally formed projections 160 , which preferably cover the entire surface of lower portion 106 . the projections 160 have a height &# 34 ; h &# 34 ; which may generally be in the range of about 10 microns to 1 cm . the projections 160 preferably will have a shape which has alternating peaks and grooves . the size and shape may vary , as to granular materials , to correspond generally to the size and shape of the granular materials and will be uniformly spaced from each other such that the entire roughened surface will have projections of generally uniform shape and dimension with the identical relative spacing . it will be appreciated that the roughened surface 132 ( fig3 ) of stationary plate element 122 may have substantially identical configuration as plate element 106 . the plates may preferably be made of steel , stainless steel , cast iron , copper , brass , aluminum , resinous plastic or plexiglas with the roughened projections 160 being integrally formed therein . an alternate embodiment is shown in fig4 b wherein the plate element 106 &# 39 ; has a plurality of similarly configurated projections 160 &# 39 ; provided by a coating which may consist of abrasive containing materials , or materials such as sand , coal , powder , grain or other suitable materials glued or otherwise fixed to the surface of the plate . fig4 c shows a portion of a roughened surface of the present invention wherein the surface 164 cooperates with a plurality of generally rectangular projections 166 , 168 having a rectangular shape in plan and defining a plurality of grooves 170 therebetween . fig4 d has a plurality of projections 172 cooperating with surface 174 to define a plurality of grooves , such as 176 . fig4 e has a plurality of projections 180 having curved sidewalls 182 defining grooves 184 . fig4 f has a plurality of projections 186 generally similar to those of fig4 a , but having a larger base 188 between projections 186 . grooves 190 which , in the form shown , are generally u - shaped may be of any desired shape . fig4 g has a plurality of projections 192 with grooves 194 therebetween . it will be appreciated from fig4 a through 4g that various projection shapes , sizes and relative spacing provided are examples of different size grooves and different roughened surfaces . these roughened surfaces , if desired , may be provided by coatings or be integrally formed . when granular material is subjected to rheological analysis by the system of the present invention , it is preferred that the average size and shape of the granules approximate the height and shape of the projections 160 . in the case of a slurry , thick sludge , bread making dough , or the like , the surface projections will preferably be large enough so that slipping between the test material and the sample does not occur . in general , these projections are in the shape shown in fig4 a with the depth of the projection being about 5 mm to 10 mm depending upon the consistency of the sample . even in test materials , such as light grease , which adhere to the surface of the plate , the plate surfaces need to be roughened to resist stick slip . while initially there might be no slipping , once the rotatable plate moves above a certain shear rate , the material starts to slip without use of the projections . referring to fig5 and 6 , a further embodiment of the present invention will be considered . this embodiment is adapted for use with gas - solid mixtures . while it has been known to attempt to do studies on gas having entrained solids , there has not been an effective means of rheologically evaluating the mixture of both . in this embodiment of the invention , the lower plate 218 is generally cup - shaped and provides an upwardly open chamber 210 which receives the specimen . the rotatable upper plate 220 is not only mounted for axial rotation as indicated by arrow b , either through repeated 360 ° cycles or by oscillation through an arc , which may be on the order of + 90 ° to - 90 ° at 15 hz , + 35 ° to - 35 ° at 25 hz , and + 9 ° to - 9 ° at 50 hz , but also may be subjected to axial movement to separate plates 218 , 220 to facilitate sample insertion and relative closing movement to permit plate 220 to enter cavity 210 to provide the desired specimen receiving volume between the circular plates 218 , 220 . it will be noted that underlying stationary plate element 230 is a chamber 232 which is adapted to receive air . similarly , overlying plate element 240 is a chamber 242 which is adapted to receive air . as is shown in fig6 upper plate 240 has a plurality of pores 244 which will cover essentially the entire plate with all of the pores 244 being essentially the same size and generally equally spaced from each other . the pore sizes of both plates 230 , 240 and spacings are preferably identical for most specimens . the pore openings 244 should be such that they are smaller than the average size of the solid particulate material entrained in the gas to resist clogging of the pores by the solid particles . in the event the process is employed to determine rheological properties of fine powders , the plates may be made of sintered material of various pore sizes to obtain micro - pores . the mechanics of performing the rheological testing may be essentially as that described with respect to fig1 with certain supplemental apparatus and practices being employed . a compressor 250 provides air through tube 252 and air filter 254 which is adapted to remove material entrained within the air . tube 252 is in communication with chamber 232 and introduces air into the chamber which air passes upwardly through the pores in plate 230 to impinge upon the sample which is a mixture of gas and solids and maintain the solids distributed within the gas . ( if the solids in the specimen are mixed with a gas other than air , it may be desirable to provide an airtight chamber around the plates 218 , 220 and employ circulating gas in lieu of air in order to resist contamination of the gas by air .) the air then flows out of chamber 210 through pores in plate 240 into chamber 242 . the air in chamber 242 is exhausted through tubes 260 , 262 and , respectively , air filters 264 , 266 so as to remove any undesired entrained particles . when the apparatus is not in operation , nozzle 270 may be employed to pump air into chamber 242 to clear any clogged pores that may be in the plate in plate 240 after the experiment . it will be apparent that , if desired , the plates 230 , 240 may be substituted for by plates having different porosity for particular types of samples or experimental needs . by providing for more effective interengagement relatively slip - free interaction between the rotary plate and the stationary plate , on the one hand , and the specimen , more accurate results regarding the rheological properties of the specimen , such as viscosity , may be obtained . normal stress differences may be determined based on the mathematical model to be employed to describe the behavior of the specimen being tested . the integrally formed roughened surfaces of the present invention may be created by any desired means , such as milling machines , electrochemical machines or for very small projections , chemical etching techniques . referring to fig7 and 8 , a further embodiment of the present invention will be considered . this embodiment is suitable for use with materials where the normal forces exhibited by the material under shear are small or where there is a need to measure local forces normal to the plane of shear , such as in the case of biological fluids , polymer solutions , and the like . in this embodiment of the invention , the stationary lower plate 271 is generally cup - shaped and provides an upwardly open chamber 272 which receives the specimen . the overlying rotatable plate 280 is structured to be received within chamber 272 . the bottom surface of the lower plate 271 is made out of a flexible membrane 273 , the underside of which consists of an electrically conducting membrane 274 . fig8 shows the details of the stationary bottom plate 271 which consists of a unique transducer . the flexible membrane 273 is separated from the rigid bottom surface 275 by means of a relatively small fluid gap 276 , which may be filled with air or any non - conducting liquid or gas . the rigid bottom surface 275 has embedded in it a plurality of small metallic plates 277 which may be the size of a pin head and which are connected to an electronic circuit 285 . the electronic circuit 280 is electrically connected to conductive membrane 274 by lead 278 and to the rigid bottom surface 275 by lead 279 . the output signal from electronic circuit is transferred by lead 281 to capacitive measurement unit 282 and which outputs signals over lead 283 to data acquisition unit 284 . the embedded metallic plates 277 and the conducting membrane 274 form the two plates of a series of capacitors . in testing a specimen , when a load is applied to the flexible membrane 273 , the gap between the conducting membrane and the embedded metallic plates 277 changes which , in turn , changes the capacitance at each of the locations where the embedded metallic plates 277 are located . knowing the capacitance at each location , one can determine the deflection of the membrane 273 from its initial position and the force required to achieve this deflection . before the stationary plate 271 is placed in the instrument , it is calibrated using a known load and known gap between the conducting membrane 273 and the embedded metallic plates 277 . the top plate 280 can be either a plate 290 &# 39 ; cooperating with a stationary plate 271 &# 39 ; or a cone 290 &# 34 ; cooperating with a stationary plate 271 &# 34 ;, for example , as shown in fig9 a and 9b . this transducer is ideal for measuring the forces in small sample volumes as is the case with bio - fluids , such as blood , plasma , polymer solutions , and the like . in addition , knowledge of the local normal forces will greatly enhance the ability to characterize the rheological properties of the samples . referring to fig1 , a flow chart of the processing of data received within computer means , such as computer 32 in fig1 will be considered . the measured axial force 300 and torque 302 pass through data acquisition unit 306 and to computer 308 . also introduced into the computer 308 is the mathematical material model 312 which is processed by the axial force and torque equation 314 with the output going to computer 308 . the computer 308 processes the actual measured data on the axial force and torque and the mathematical material model employing data analysis and regression employing the least squares method . the output of the computer 308 provides the material parameters 310 and statistical analysis 312 . the final output 316 provides the mean , standard deviation , and variance of the material parameters based on a comparison of the actual data entering computer 308 from data acquisition unit 306 with the mathematical model predictions of axial force and torque supplied to computer 308 by axial force and torque equation unit 314 . it will be appreciated , therefore , that the present invention provides an effective means for enhancing the efficiency of rotary rheometers in working with a wide variety of specimen materials . in one embodiment , this is accomplished by providing &# 34 ; toughened surfaces &# 34 ; on at least one of the two plates and , preferably , on both with the degree of roughness being adjusted according to the nature of the material being processed . all of this is accomplished in a manner which is readily adaptable to existing rotatable rheometers merely by changing the nature of the plate . in another embodiment , a deformable capacitive sensor is provided within the base of the stationary plate . whereas particular embodiments of the invention have been described herein for purposes of illustration , it will be evident to those skilled in the art that numerous variations of the details may be made without departing from the invention as set forth in the appended claims .	6
referring now to the drawings in greater detail , fig1 illustrates a fragmentary jet engine 10 having a nacelle 12 and inlet cowl 13 , with an opening 14 around which a combination bird deflector and air replacement structure 15 is either permanently or detachably mounted . a generally conically shaped bird deflector 16 includes bars 18 ( fig2 ) extending outwardly from a central nose 20 in an equally spaced relationship . a plurality of bar segments 22 having progressively shorter lengths are secured between the adjacent outwardly extending bars 18 . for larger deflectors 16 , the segments 22 are progressively farther apart as they approach the nose 20 . the cross - sectional shapes of the various bars 18 and 22 may be one of round , four - sided , or triangular , with pointed edge directed outwardly . the various shapes may affect air flow differently at engine full power . suitable fasteners represented at 24 in fig1 may consist of a full round or other shaped flanges 26 to connect the combination structure 15 around the jet engine inlet . as shown in fig3 , a bird deflector 30 has an upper half formed by downwardly extending and converging arcuate - shaped bars 32 , and a lower half formed by upwardly extending and converging arcuate - shaped bars 32 , the two halves meeting as a rounded forward nose 34 . a plurality of progressively shorter cross bars 36 are mounted between adjacent arcuate - shaped bars . as shown in fig4 , a deflector 40 is a canopy type structure with downwardly extending arcuate bars 42 which terminate in a spaced apart relationship to form a partial circle 44 below the center of engine inlet , simulating an eagle &# 39 ; s beak . bottom bars 46 are bent as much as necessary to extend rearwardly from the partial circle 44 . cross bars 48 may be secured between adjacent bars 42 and 46 . as shown in fig1 , 2 , 3 and 4 , a frustum 50 , which may be a frustum - like element of any shape , such as conforming to the shapes shown in fig5 a , 5 b , 5 c , and 5 d , has a large opening 52 and a small opening 54 connected respectively between any of the three bird deflector embodiments and the jet engine inlet opening 14 . the various rear ends of the longitudinal bars 18 , 32 , and 42 are suitably secured , as by welding , to the large end 52 of the frustum 50 . alternately , both the small opening 54 and the rear ends of the longitudinal bars may be secured adjacent the engine inlet opening 14 , with the large opening 52 extended around the bird deflector . it is a theory of this invention embodiment that the air flow blocked by the bird deflector components can be replaced by the air flow against the inside portion of the frustum 50 surface not blocked by the various deflector bars in front thereof , and then directed inwardly in front of the jet inlet 14 . as such , the total air flow being sucked into the jet engine inlet will be equal to that which would normally occur when the bird deflector and air replacement combination are not in place . some acceleration of the air through the converging length of the frustum 50 surface will have occurred in the sense of it being a large nozzle . as a further alternate embodiment of the invention , in lieu of the frustum 50 , a tube 56 , or conduit of any shape , such as the shapes shown in fig5 , is provided intermediate any of the above described bird deflector designs and a suitable connection 58 around the inlet 14 of the jet engine body 12 . spaced apart openings 60 , such as holes or edge notches ( not shown ) are formed adjacent the rear end of the tube 56 . spaced apart streamlined channels 62 are formed at their bottom surfaces to conform to the outer surface of the tube 56 . each channel 62 is open at the front end 64 as a round or oval shape and closed at the rear 66 , with a bottom edge opening 68 ( fig9 ) matching a respective opening 60 in the rear of the tube 56 . thus , air entering each front opening 64 will flow through openings 68 and 60 into the tube 56 to then be sucked into the jet engine inlet 14 . as shown in fig1 , the channel 62 may have its opening conform to , and be open against , the outer surface of the tube 56 . the total air flow through the channels 62 must substantially equal the total air flow that is blocked by the bird deflector elements . as such , it is a theory of this second invention embodiment that the total air flow entering the jet inlet will equal the normal air flow therein when the deflector and replacement assembly are not in place . to further deflect birds outwardly , the front channel ends 64 may be sloped rearwardly . while the channels 62 serve to replace air being blocked by the bird deflector components , their efficiency may be improved by being formed as either a nozzle 62 a ( fig1 ) or a venturi tube 62 b ( fig1 ), or by having an orifice 64 ( fig1 ) formed in the channel . a nozzle 62 a is a conduit with a variable cross - sectional area in which a fluid accelerates into a high - velocity stream . it may be convergent - divergent or simply convergent . a venturi tube 62 b is a device that consists of a gradually decreasing nozzle through which the fluid is accelerated , followed by a gradually increasing diffuser section that eliminates flow separation and allows the fluid to nearly regain its original pressure head . an orifice 64 is a plate that is mounted inside a channel 62 , and has a sharp edged aperture through which the fluid in the channel is accelerated . as a still further alternate embodiment of the invention , it is also conceivable that the inlet cowl 13 of a jet engine may be modified to become an integral part of an air replacement apparatus . for example , the cowl 13 may have the shape of the frustum 50 of fig1 , 3 , and 4 . referring now to fig1 , the cowl 13 , with its usual progressively expanding shape , replaces the tube 56 and has the openings 60 foamed therein . the channels 62 , with their openings 68 aligned with the openings 60 , are mounted around the cowl . preferably , the channels are shaped to attach to the cowl with a feathered rear edge to keep the height as low as possible . as such , each modified cowl 13 arrangement is secured to the body 12 or nacelle in the usual manufacturing manner . some one of the above bird deflectors is mounted around the jet inlet 14 . as a further possible air replacement embodiment , and realizing that bird deflectors of any shape in front of the jet inlet hamper air flow suction , there may be some current engine cowl designs that lend themselves to modification . for example , the cowl of the above referenced me262 junkers mumo 004 engine , for one , is a gradual arcuate continuation of the nacelle in which the engine is mounted . as such , this invention embodiment teaches extending the cowl 13 as a cylinder to the plane of the normal inlet and having an inwardly extending flange 69 to provide a vertical frontal surface around an opening 14 a equivalent to the usual inlet 14 . small spaced - apart openings 70 are formed completely around that frontal surface flange 69 to receive a total air flow substantially equal to the air flow being blocked by the longitudinal and lateral bars of a bird deflector secured by suitable fasteners to the flange 69 immediately adjacent the opening 14 a . this air replacement embodiment is shown in fig1 and 16 , with the original cowl shape shown in phantom lines in fig1 . in keeping with the aim to replace as much air as possible both through and around a bird deflector , it is noted that many nacelle 12 and cowl 13 shapes are streamlined to have the air inlet 14 as a smaller diameter than that of the nacelle 12 . as such , with a suitable bird deflector in place , i . e ., secured by a suitable fastening arrangement 24 around the air inlet 14 , the spaced - apart circumferential openings 60 , as shown in fig1 , are formed around the cowl 60 . a cylinder 72 , or frustum is connected at its rear in a suitable manner , as by welding , to the usual connection between the nacelle 12 and the cowl 13 , or immediately behind the openings 60 , and extends to the plane of inlet 14 , or just past the openings 60 . in this embodiment , a substantial amount of air is sucked in by the jet engine through the opening 74 ( fig1 ), and thence , almost immediately , through the cowl openings 60 to make up for the air being blocked by the bird deflector components . tests would determine the required number and preferable cross - sectional shapes of bars 18 , 32 , 42 and 46 , bar segments 22 , and cross bars 36 and 46 , i . e . round , triangular , or rectangular , that would be most suitable for deflecting birds of sizes ranging from sparrows to herons , while presenting as small a total area as possible . tests would also determine the type of metal alloy , such as a titanium alloy , or plastic , or suitable carbon fiber materials , such as possibly in carbon nanotube technology , for the bars and cross bars which could be as small in cross - section as possible , and light weight , while being strong enough to withstand the impact of various size birds . in keeping with the theories of the invention embodiments , air flow tests in a test facility for a given engine model could determine the compatible deflector design and any of the frustum or tube and channel shapes or cowl modifications which provide a total air flow equivalent to the air flow which would occur if no deflector and air replacement apparatus were present . while three bird deflector , two add - on air replacement embodiments and several original cowl air replacement embodiments of the invention have been shown and described , other modifications thereof are possible . once the amount of air that is blocked by a particular bird deflector is measured , as in a test facility , further cowl modifications may be readily tested . for example , in lieu of the cowl having either a sloped or a frustum shape , it could have a tubular shape with the bird deflector secured to the forward end thereof , thereby admitting additional air . additionally , sloping cowls on some nacelle streamlined shapes could simply be perforated for testing , without the cover 72 shown in fig1 , 18 .	1
1 . cloning , expression and purification of 222delt / l74w and δex - 2 pp13 variants ( fig2 ) a . polymerase chain reaction ( pcr ) for the 222de 1 t / l74w mutation variant based on a polymorphism analysis of the pp13 gene and correlation with the occurrence of polymorphism and the development of preeclampsia , the sequence of pp13 wild type ( fig5 ) was used as a template to generate the 222delt / l74w ( also referred to herein as the truncated ) sequence by pcr techniques . two primers were designed with the following sequences : a sense primer : cgaatccatgtcttctttacccgtgc ( seq . id . no : 12 ) and an anti - sense primer : the restriction site sequences of bamh i and sac i were introduced in the sense and anti - sense primers respectively . both primers were synthesized by sigma - genosys . to amplify the truncated pp13 dna sequence , 1 ng of wild type pp13 dna ( in plasmid ) was used as a template . 0 . 1 - 1 μm of the above mentioned specific primers , 1 u of pfu dna polymerase ( promega ), 200 μm dntp - mix and pfu dna polymerase × 10 buffer . pcr was carried out at the following high temperature cycles : 94 ° c . for 2 min , 94 ° c . for 30 sec , 60 ° c . for 30 sec and 72 ° c . for 1 min over 35 cycles . a final extension was carried out at 72 ° c . for 4 min and the pcr product , analyzed by agarose gel and revealing the expected size of 288 bp , was stored at 4 ° c . until use . screening of a cdna library derived from a preeclamptic placenta revealed an exon - 2 deleted ( also referred to herein as the spliced ) sequence ( deletion of 30 amino acids ) of pp13 . based on nucleotide sequence analysis of the deleted pp13 variant , a set of primers was designed to flank the full length of the dna . two primers were designed with the following sequences : a sense primer : 5 ′- cgatacggatccatgtcttctttacccgtgc - 3 ′ ( seq . id . no : 14 ) and an anti - sense primer : 5 ′- taagtcgagctcattgcagacacacactgagg - 3 ′ ( seq . id . no : 15 ). both primers were synthesized by sigma - genosys . to amplify the deleted δex - 2 pp13 dna sequence , 1 ng of deleted pp13 dna was used as a template , 0 . 1 - 1 μm of the above mentioned specific primers , 1 u of pfu dna polymerase ( promega ), 200 μm dntp - mix and pfu dna polymerase × 10 buffer . pcr was carried out at the following high temperature cycles : 94 ° c . for 2 min , 94 ° c . for 30 sec , 55 ° c . for 30 sec and 72 ° c . for 1 min over 35 cycles . a final extension step was carried out at 72 ° c . for 4 min and the pcr product , analyzed by agarose gel and revealing the expected size of 338 bp , was stored at − 20 ° c . until use . the resulting pcr fragments were inserted into a puc57 - t cloning vector ( t - cloning kit # 1212mbi fermentase ) and the clones containing the insert were selected and sequenced by automated dna sequencing at the biological services at the weizmann institute , rehovot , israel . 2 - cloning of the truncated and spliced form dna into expression vectors . a - ligation : the pcr products of the truncated and spliced pp13 dna were purified using a qiaquick pcr purification kit prior to ligation . the purified pp13 dna product ( 1 μg ) and the expression vector pqe 30 ( 0 . 5 μg , qiagen ) were digested with bamh i and sac i ( 20 u each , new england biolabs - neb ) in nebuffer bamh i and nebuffer sac i , respectively . insert : vector ratios of 3 : 1 , 1 : 1 and 1 : 3 were used for ligation of the digested pcr product dna with 50 ng of digested pqe - 30 using 100 u of t4 ligase ( neb ) and t4 ligase buffer for 2 hr at 22 ° c . b - transformation : the ligation mixture was transformed into m15 ( prep4 ) cells ( qiagen ) and 10 μl of the ligation mixture were added to 100 μl competent m15 prep4 ) cells for 10 min in ice and then transferred to a 42 ° c . water bath for 50 sec . after heat shock , the mixture was placed on ice for another 2 min and 900 μl of lb medium was added to the transformation reaction and incubated for 60 min at 37 ° c . with shaking of approximately 225 rpm . 10 - 100 μl of the cells were plated on lb agar plate containing 100 μg / ml ampicillin ( sigma ) and 25 μg / ml kanamycin ( sigma ) for overnight at 37 ° c . c - screening for positive colonies : 20 single colonies grown on the plate were picked and cultured in 2 ml lb medium containing ampicillin ( 100 μg / ml ) and kanamycin ( μg / ml ) for overnight at 37 ° c . with 225 rpm shaking . plasmid dna was purified from each colony culture with wizard plus sv minipreps dna purification system ( promega ). the presence of the pp13 dna insert was tested by pcr as follow : the pcr reaction ( 20 μl volume ) composed of 1 ng of dna template , 0 . 1 - 1 μm truncated pp13 and spliced variant specific respective primers and 10 ml of × 2 ready mix for pcr ( bio - lab ltd ). the pcr conditions were as detailed above . pcr products were separated on 1 . 5 % agarose and the dna bands were visualized in las - 3000 image system ( fuji ). the potential positive clones ( 4 ) were selected according to the calculated size of the pcr product . the final dna sequence of each clone was determined by sequencing carried out in the multi - disciplinary laboratories unit ( rappaport institute of medical science — technion , haifa ). based on verified sequence analyses , one positive clone was selected for expression of the protein and inoculated in 20 ml of lb medium containing ampicillin and kanamycin at 37 ° c . for overnight with shaking . the culture was mixed 1 : 50 in lb medium containing antibiotics and grown at 37 ° c . until reaching an od600 of 0 . 6 . the expression of the protein was induced with 1 mm — isopropyl - b - d - thiogalactopyranoside - iptg for 3 hrs . bacterial cells were harvested by centriftigation at 4000 g × 20 min at 4 ° c . the cell pellet was stored until use at − 80 ° c . aliquots were tested by sds - page analysis to determine the molecular weight of the recombinant protein . based on sds - page analysis , the recombinant , truncated pp13 was localized to be trapped in the inclusion bodies . the method used to obtain soluble polypeptides was as follows . cell pellet was resuspended in lysis buffer containing 20 mm tris - hcl , ph 8 , 150 mm nacl , 5 mm imidazole and protease inhibitor ( roche ), 10 % glycerol and incubated with 0 . 2 mg / ml lysozyme ( sigma ) for 1 hr at 4 ° c . the cells were disrupted by sonication on ice 6 × 10 sec of 200 w or alternatively disrupted by applying pressure of 1000 psi in minicell french press ( thermo ). soluble proteins were discarded and the pellet containing the inclusion bodies ( 0 . 75 gr ) was resuspended in binding buffer ( 20 mm tris - hcl , ph 8 . 0 , 300 mm nacl , 5 mm imidazole , 6 m urea , pmsf , complete ( protease inhibitor — roche ), 1 mm dtt and 10 % glycerol ). after 1 hr of incubation at room temperature , the insoluble proteins were discarded by centrifugation at 20 , 000 g for 20 min ( ss34 rotor , sorval - rc ). the soluble fraction was filtered through 0 . 45 μm pore size filters and mixed with 1 ml of pre - equilibrated ni - nta agarose ( qiagen ) for 1 hr at rt . the refolding of the bound recombinant truncated pp13 was performed on the column using a step - wise linear 6 - 0 m urea gradient . first the ni - nta agarose column was washed with 10 ml of wash buffer ( 20 mm tris - hcl , ph 8 . 0 , 300 mm nacl , 20 mm imidazole , 6 m urea , pmsf , complete , 1 mm dtt and 10 % glycerol ) followed by washing the column with 10 ml of refolding buffers ( wash buffer containing 4 , 2 , 1 , 0 . 5 and 0 m urea ). bound recombinant pp13 was eluted with 5 ml of elution buffer ( 20 mm tris - hcl , ph 8 . 0 , 300 mm nacl , 0 . 5 m imidazole , pmsf , complete , 1 mm dtt and 10 % glycerol ). recombinant , truncated pp13 protein was dialyzed against tbs ( 20 mm tris - hcl , ph - 8 , 150 mm nacl ) and diluted with equal volume of 60 % glycerol in tbs and stored at − 80 ° c . until use . the protein concentration was determined by bradford assay and stored at − 20 ° c . for further analysis . recombinant truncated and spliced pp13 variants ( 1 - 5 μg ) were resuspended in sample buffer in the presence of 5 % β - mercaptoethanol and boiled for 5 min at 95 ° c . proteins were loaded on 15 % sds - page and separated by applying 120 volts for approximately 2 hrs . to visualize the protein bands , the gel was washed with h 2 o for min and stained for 1 hr with gelcode reagent ( pierce ). the staining reagent traces were removed by several washes with h 2 o until reaching enough clarity of the stained pp13 . the approximate molecular size of the pp13 protein variants was determined by molecular weight standard proteins which were separated in parallel on the same gel and compared to the calculated molecular size of the protein based on its amino - acid composition . the gel is shown in fig3 . it may be seen that the native , wild - type pp13 has the highest molecular size ( appx . 16 - 17 kda ), followed by the spliced ( appx . 14 - 15 kda ) and the truncated ( appx . 12 - 13 kda ) variants . the elisa test was used to test the recognition of the truncated recombinant pp13 by anti - pp13 monoclonal antibodies . briefly , micro - plate wells were coated with 1 - 10 μg / ml of the recombinant wild - type , truncated and spliced pp13s for 2 hrs at 37 ° c . followed by blocking the free binding sites by 1 % bovine serum albumin - bsa in carbonate buffer for 1 hr . coated proteins were incubated with serial dilution of the following monoclonal antibodies : clones 27 - 2 - 3 , 215 - 28 - 3 and 534 - 16 and anti - histidine ( control ) for overnight at 4 ° c . unbound antibodies were washed with phosphate buffer saline containing 0 . 05 % tween - 20 . goat anti - mouse igg conjugated to hrp was used for detecting bound antibodies followed and tmb was used a substrate for the hrp . the optical density of the resulting enzymatic product was measured with an elisa reader at 650 nm . the reaction was stopped after 30 min and the optical density was re - measured at 450 vs . 650 nm . the results are shown in fig4 a , 4 b and 4 c . it may be seen that while the wild type pp13 reacted with the specific anti - pp13 antibodies , the truncated and spliced variants did not ( fig4 a & amp ; 4b ). all of the pp13 proteins reacted with the control anti - histidine antibody ( fig4 c ). this may provide an explanation for the observation that during the first trimester , a woman with high risk for preclampsia has a low measured amount of pp13 in her bodily substances . wild type , truncated and spliced pp13s were absorbed to nitrocellulose membrane ( biorad ) and free binding sites were blocked with 5 % milk in tris buffer saline ph 8 . 0 ( tbs ) for 1 hr . membrane was incubated with anti pp13 monoclonal antibodies ( clones 27 - 2 - 3 , 215 - 28 - 3 and 534 - 16 ) for 2 hrs at 37 ° c . and free antibodies were washed with tbs - tween 20 . to detect bound anti - pp13 antibodies , a secondary antibody of goat anti - mouse igg conjugated to hrp enzyme was added to the membrane and incubated for 90 min at room temperature ( rt ) followed by discarding the free excess antibodies by washes as indicated above . enhanced chemiluminescene ( ecl ) reagents were used as a substrate for the hrp and the signals were visualized , captured and analyzed by using the las3000 image system ( fuji ). the following is a description of the identification and analysis of the 222deltt / l74w mutation , with reference to fig9 a - 9e . intronic oligonucleotide primer sets for pcr were designed to flank each of the four lgals - 13 gene exons as well as a short portion of the 5 ′ and 3 ′ untranslated regions . each generated amplicon was subjected to multiphor sscp / heteroduplex analysis ( fig9 b ). conformational variants were further characterized by automated sequencing and where appropriate , by restriction enzyme analysis . the intronic variants were genotyped in a small group of primigravida patients ( n & lt ; 20 ). the identified deletion was further characterized in a larger cohort ( n & gt ; 80 ) of primigravida patient who developed early ( ga & lt ; 34 weeks ) preeclampsia , their infants and a matched control group of ˜ 100 individuals , comprising healthy mothers and unrelated newborn infants . the results of the analysis are summarized in the table below ( fig9 a ). four sequence variants were identified in this cohort . the majority of the preeclamptic patients carried 1 - 2 mutations in the pp13 gene . among them , the 222deltt / l74w mutation associated with truncated pp13 was discovered in 6 % preeclamptic ( 5 % hetro and 1 % homozygotes , compared to 1 % among control ), and 8 % of their infants ( compared to 4 % in the control ) inferring a higher proportion among the early ( ga & lt ; 34 weeks ) preeclampsia vs . control and an inferred paternal contribution to the route of transfer to the newborn . point mutations between exons 2 and 3 , that could be critical for the development of spliced variants in exon 2 ( mutation ivs2 - 22a & gt ; g and ivs2 - 36a & gt ; g )) appear only in the preeclamptic cases ( 15 % and 28 % respectively ) and only in a heterozygous form , and are also detected at a little higher frequency in the newborns ( 19 % and 37 % respectively ) the deletion ( t ) frame - shift mutation ( 222deltt / l74w ) was detected in exon - 3 in preeclamptic patients , their infants and paternal contribution was inferred in several cases . the mutation is predicted to create a novel 28 or 27 c terminal region which is 38 or 37 amino acids shorter than the wild - type pp13 . the mutant exon 3 . 1 sscp / hetroduplex was run in a gel against the wild type ( fig9 b ). the mutant delt222 /— was analyzed using an electropherogram ( fig9 c ). an alignment of the amino acid sequences of lgals13 wt and lgals13delt is shown in fig9 d . the delt frameshift creates a new 27aa terminal region ( underlined ) which is 37aa shorter than the wild type peptide . fig9 e shows the relative positions of the different mutants with respect to the wild type gene .	8
fig1 is discussed in conjunction with fig2 . fig1 is a rear perspective view of a grill pan 100 with a base 102 and a lid 101 pivotally registered to the base 102 by an adjusting hinge 115 . fig2 presents an exploded perspective view of individual components that make up a grill pan 100 according to an embodiment of the present invention . a base 102 supports a corrugated food cooking surface with grill rods 103 a , or grill veins , disposed at a distance from one another , and drain channels 103 b , or valleys , alternately positioned between the base grill veins 103 a . similarly , a lid 101 has grill veins 104 a disposed at a distance from one another , and channels or valleys 104 b alternately positioned between the lid grill veins 104 a . preferably , the lid grill veins 104 a are sized and spaced apart such that the lid grill veins 104 a rest in an interlocking position with the base grill veins 103 a when the lid 101 is placed in a closing position onto the base 102 for nonuse or storing purposes . in fig1 and 2 , an upstanding wall 105 surrounds the periphery of the base 102 and , advantageously , is of a height greater than the height of the base grill veins 103 a . two side portions 105 b of the wall 105 and a back portion 105 a of the wall 105 of the base 102 are adjacent to the grill veins 103 a . a front portion 105 c of the wall 105 , however , is spaced at a distance from the front edges of the grill veins 103 a . within this space is a collecting channel , or grease channel 106 , which runs transverse to the base grill veins 103 a . the collecting channel 106 provides for collecting grease , juice , and other food liquids , which are produced during a grilling process . as shown in the side section view , in fig2 , the base grill veins 103 a are positioned at a slight downward slope 107 , from a higher elevation at the back portion 105 a of the wall 105 of the base 102 to a lower elevation at the front portion 105 c of the wall 105 of the base 102 , in order to facilitate the flow of food liquids for easy disposal . grease , juice , and other food liquids may run along the sides of the base grill veins 103 a and temporarily collect in the drain channels 103 b alternately positioned between the base grill veins 103 a . the downward slope 107 of the base grill veins 103 a then provides for a natural flow of the grease , juice , and other food liquids into the collecting channel 106 , where it keeps until the grill pan 100 is removed from a conventional oven , or a convection oven . although fig1 - 5 present a rectangular base 102 and a rectangular lid 101 , the grill pan 100 of the present invention may have other shapes , including circular , oval , and polygonal shapes . as shown in fig2 , the collecting channel 106 has a top edge 108 , which is lower than the top edge of the front portion 105 c of the wall 105 of the base 102 . two indents 109 are positioned on the front portion 105 c of the wall 105 of the base 102 , above the upper edge 108 of the collecting channel 106 . the indents 109 extend through the width of the front portion 105 c of the wall 105 and allow for lift handles 110 to be hooked onto the upper edge 108 of the collecting channel 106 , allowing a user to lift and move the grill pan 100 without physically touching the grill pan 100 , which may be heated to oven temperatures . thus , a user may use the grill pan 100 safely without the worry of being burned and / or spilling food liquids from the grill pan 100 , which may be messy and dangerously hot . preferably , the lift handles 110 are made of a material that is able to withstand high temperatures , able to bear a heavy weight load , and is a poor heat conductor . for example , the lift handles 110 made be made of metal encased in wood or any other material capable of withstanding high temperatures and preventing heat conduction . according to a preferred embodiment , a portion of the lift handle 110 used to hook onto a grill pan 100 may comprise two metal prongs , formed generally parallel to one another and shaped such that the prongs provide a secure fit onto the grill pan 100 . the two prongs may be machined in a bent or angled position with respect to the remaining portion of the lift handle 110 , as shown in fig2 , however , one of ordinary skill would recognize that the lift handles 110 of the present invention may be formed into multiple configurations and still perform their necessary function . a lid 101 of the grill pan 100 includes grill veins 104 a similar to the base grill veins 103 a and disposed at a distance from one another , with channels 104 b alternately positioned between each grill vein 104 a . the lid grill veins 104 a extend from a back edge 111 a of the lid 101 to a front lip at a front edge 111 b of the lid 101 . the front lip provides a surface area for a lid lift lug 112 , or lid handle , and two indents 113 or grooves , which serve as clearance grooves for the lift handles 110 . the lid handle 112 may be positioned in the center of the front lip of the lid 101 , as shown in fig2 , and may be integrally formed from the same material as the lid 101 of the grill pan 100 , or it may be a separate attachment . optionally , the lid handle 112 may have an aperture 114 for hooking the lift handle 110 onto the lid handle 112 in order to lift the lid 101 to an opened position relative to the base 102 . as shown in fig1 and 2 , the clearance grooves 113 in the front lip of the lid 101 are positioned such that the clearance grooves 113 line up with the indents 109 in the front portion 105 c of the wall 105 of the base 102 . the clearance grooves 113 prevent the lid 101 from inhibiting the lift handles 110 ability to hook onto the top edge 108 of the collecting channel 108 when the lid 101 is in a closed or flat position , relative to the base 102 . the lid 101 of the grill pan 100 is pivotally registered to the base 102 via an 115 adjusting hinge , as shown in fig1 and 3 a - 3 b , where fig3 a and 3b . in a preferred embodiment , the adjusting hinge 115 includes a plurality of lid pivot guide pins 116 , as shown in fig1 and 2 , which protrude upwards from the back portion 105 a of the wall 105 of the base 102 and from a location inside the base 102 , where the location is disposed at a distance from the back portion 105 a of the wall 105 of the base 102 . the plurality of lid pivot guide pins 116 , as shown in fig2 , may be separate units that are attached to the base 102 , or may be integrally formed from the same material as the base 102 . the plurality of lid pivot guide pins 116 may include outer lid pivot guide pins , which are located along the back portion 105 a of the wall 105 of the base 102 , and inner lid pivot guide pins , which are positioned at a relatively short distance from the outer lid pivot guide pins , as shown in fig2 . the lid pivot guide pins 116 may be positioned generally perpendicular to the base grill veins 103 a , as shown in fig1 and 2 . alternately , other configurations of lid pivot guide pins 116 that allow the lid 101 to be pivotally registered to the base 102 are within the scope of the present invention . as shown in fig1 and 2 , a lid stop 117 is positioned between the two outer lid pivot guide pins 116 , and protrudes generally upward from the back portion 105 a of the wall 105 of the base 102 and generally perpendicular to the grilling surface . the lid stop 117 permits the lid 101 to rest in an opened position generally upright or perpendicular to the base 102 of the grill pan 100 , and also prevents the lid 101 from falling backwards when in the opened position . as shown in fig1 and 2 , a portion of the back edge of the lid 101 is formed into a smooth cylindrical edge , or bar portion 118 , and when the lid 101 is registered to the base 102 , the bar portion 118 is positioned between the lid pivot guide pins 116 of the base 102 , such that it “ slides ” between the lid pivot guide pins 116 . adjacent to the bar portion 118 is one or more hinge slots 119 carved into the lid 101 of the grill pan 100 , and are positioned generally parallel to the lid grill veins 104 a and generally perpendicular to the bar portion 118 . the bar portion 118 and the hinge slots 119 register the lid 101 to the base 102 with the bar portion 118 sliding between the outer and inner lid pivot guide pins 116 while the hinge slots 119 fit around the lid pivot guide pins 116 . to align the base 101 with the lid 102 , a lid pivot pin or bolt 120 may be attached to each outer end of the bar portion 118 of the lid 101 such that the lid pivot bolts 120 extend beyond the total length of the back portion of the wall 105 of the base 102 from one outer lid pivot guide pin 116 to the other outer lid pivot guide pin 116 . alternately , the lid pivot bolts 120 may be integrally formed from the same material as the lid 101 instead of being separate units for attachment . the adjusting hinge 115 allows the lid to move freely with respect to the base of the grill pan 100 . when food is placed onto the grill surface of the base 102 , the lid 101 adjusts to the height or thickness of the food and may lie generally flat on top of the food instead of at an angle . with the lid 101 lying generally flat , the grill pan 100 is easily placed into a conventional oven or a convection oven . additionally , a greater surface area of the lid 101 comes into contact with the food . advantageously , the lid 101 may be separated completely from the base 102 in order to be cleaned . fig3 a is a rear perspective view of a grill pan 100 , according to an embodiment of the present invention , with a lid 101 of the grill pan 100 placed in an opened position . as shown in both fig3 a and 3b , the lid 101 is pivotally registered to a base 102 of the grill pan 100 by an adjusting hinge 115 with a bar portion resting 118 between a plurality of lid pivot guide pins 116 , similar to fig1 . the lid 101 rests against a lid stop 117 , which permits the lid to rest in an open position generally perpendicular to the base 102 . fig3 b is a front perspective view of the same grill pan 100 . fig3 is a perspective view of a grill pan , according to an embodiment of the present invention , in a closed position while not in use . in this embodiment , a lid stop runs a length of a back portion of the wall portion between two lid pivot guide pins , and both the lid stop and the lid pivot guide pins are integrally formed from the same material as the base of the grill pan . additionally , slots carved into the lid are shown in greater detail . as will be appreciated , there are countless configurations for a grill pan that grills foods inside a conventional or convection oven . fig1 - 7 illustrate only a few possible configurations , and in no way should be construed as limiting the application of the inventive apparatus to those configurations . to the contrary , the invention is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims . the scope of the following claims is to be accorded the broadest interpretation so as to encompass all such modifications and equivalent structures and functions .	0
1 . a method for preparing menthone starting from isopulegol , wherein a rearrangement reaction is carried out , specifically a dehydrogenation / hydrogenation reaction , i . e . dehydrogenation of the oh group at the c1 atom to a keto group and a hydrogenation of the 1 - methylethenyl group at the c2 atom of isopulegol , in the liquid phase using a homeogeneously dissolved catalyst c , comprising at least one metal atom from group 8 , 9 or 10 , particularly 8 or 9 , of the periodic table ( iupac ). 2 . the method according to embodiment 1 , wherein the catalyst c has ruthenium or iridium as the central atom m . 3 . the method according to any of the previous embodiments , wherein the catalyst c comprises at least one phosphine ligand . 4 . the method according to embodiment 3 , wherein the catalyst c , in addition to having at least one phosphine ligand , has at least one further ligand l which is selected from the group consisting of co , hydrido , aliphatic olefins , cyclic olefins , carbocyclic aromatic systems , heteroaromatic systems , aldehydes , ketones , halides , c 1 - c 4 - alkanoate , methylsulfonate , methylsulfate , trifluoromethylsulfate , tosylate , mesylate , cyanide , isocyanate , cyanate , thiocyanate , hydroxide , c 1 - c 4 - alkoxide , cyclopentadienide , pentamethylcyclopentadienide and pentabenzylcyclopentadienide . non - limiting examples of aliphatic olefins are c 2 - c 4 - olefins , such as ethylene , propene , but - 1 - ene , but - 2 - ene , 2 - methylprop - 1 - ene , of cyclic olefins are cyclopropene , cyclobutene , cyclobutadiene , cyclopentadiene , cyclohexene , cyclohexadiene , cyclooctene , cyclooctadiene ; of carbocyclic aromatic compounds are benzene , naphthalene and anthracene , 1 - isopropyl - 4 - methylbenzene , hexamethylbenzene , of heteroaromatic compounds are pyridine , lutidine , picoline , pyrazine , of aldehydes are formaldehyde , acetaldehyde , propionaldehyde , butyraldehyde , isobutyraldehyde , valeraldehyde , isovaleraldhyde , benzaldehyde , of ketones are acetone , menthone , of halides are f , cl , br , i , of c 1 - c 4 - alkanoates are methanoate , ethanoate , n - propanoate and n - butanoate . 5 . the method according to any of the previous embodiments , where the catalyst c is selected from among the compounds : [ ru ( pr 3 ) 4 ( h ) 2 ] ( r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( pr 3 ) 3 ( h ) 2 ( co )] ( r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( pr 3 ) 3 ( h )( cl )( co )] ( r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( pr 3 ) 3 ( cl ) 2 ( co )] ( r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( pr 3 ) 3 ( cl ) 2 ] ( r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( l2 ) 2 ( h ) 2 ] ( l2 = 1 , 2 - bisdicyclohexylphosphinoethane , 1 , 2 - bisdiethylphosphinoethane , 1 , 2 - bisdiphenylphosphinoethane ), [ ru ( l2 )( pr 3 ) 2 ( h ) 2 ] ( l2 = 1 , 2 - bisdicyclohexylphosphinoethane , 1 , 2 - bisdiethylphosphinoethane , 1 , 2 - bisdiphenylphosphinoethane ; r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( l2 )( pr 3 )( co )( h ) 2 ] ( l2 = 1 , 2 - bisdicyclohexylphosphinoethane , 1 , 2 - bisdiethylphosphinoethane , 1 , 2 - bisdiphenylphosphinoethane ; r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( l2 )( pr 3 )( co )( h )( cl )] ( l2 = 1 , 2 - bisdicyclohexylphosphinoethane , 1 , 2 - bisdiethylphosphinoethane , 1 , 2 - bisdiphenylphosphinoethane ; r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( l3 )( h ) 2 ] ( l3 = triphos ), and [ ru ( l3 )( co )( h ) 2 ] ( l3 = triphos ), and [ ru ( l3 )( co )( h )( c )] ( l3 = triphos ) 6 . the method according to any of the previous claims , wherein the catalyst c is used in an amount of 1 to 5000 , 5 to 2000 or 10 to 1000 ppm parts by weight , based on 1 part by weight of isopulegol or of a mixture of one isopulegol with at least one different alcohol . 7 . the method according to any of the previous embodiments , wherein an isomer mixture of isopulegol is used as starting compound . 8 . the method according to any of the previous embodiments , wherein the product obtained is an isomer mixture of menthone . 9 . the method according to any of the previous embodiments , wherein the reaction is carried out without additional solvent . 10 . the method according to any of the preceding embodiments , wherein the reaction is carried out in the range from 100 to 250 ° c . 11 . a reaction product obtainable by a method according to any of the previous embodiments . 12 . the use of a reaction product according to embodiment 11 as a fragrance or flavouring . 13 . a composition comprising at least one reaction product according to embodiment 11 , wherein the composition is selected from foods , confectionery , chewing gum , beverages , cosmetics , toothpastes , mouth rinses , shampoos , toiletries , lotions , skincare products , medicaments and drugs . in the method according to the invention isopulegols and also mixtures of various isopulegols are used . thus , ( 1r , 2s , 5r )-(−)- isopulegol , ( 1r , 2s , 5r )-(−)- isopulegol , ( 1s , 2r , 5r )-(+)- isopulegol , ( 1s , 2r , 5s )-(+)- isopulegol , ( 1s , 2s , 5r )- 5 - methyl - 2 -( 1 - methylethenyl ) cyclohexanol or ( 1r , 2r , 5r )- 5 - methyl - 2 -( 1 - methylethenyl ) cyclohexanol or mixtures of these isopulegols are used as isopulegols . in the method according to the invention at least one catalyst complex is used which comprises at least one element selected from groups 8 , 9 and 10 of the periodic table ( according to iupac nomenclature ). the elements of group 8 , 9 and 10 of the periodic table comprise iron , cobalt , nickel , ruthenium , rhodium , palladium , osmium , iridium and platinum . preference is given to catalyst complexes which comprise at least one element selected from ruthenium and iridium . the active catalyst complex can be generated in its active form or else in situ from a simple metal precursor and a suitable ligand in the reaction mixture . suitable metal precursors are , for example , [ ru ( p - cymene ) cl 2 ] 2 , [ ru ( benzene ) cl 2 ] n , [ ru ( co ) 2 cl 2 ] n , [ ru ( co ) 3 cl 2 ] 2 , [ ru ( cod )( allyl )], [ rucl 3 * h 2 o ], [ ru ( acetylacetonate ) 3 ], [ ru ( dmso ) 4 cl 2 ], [ ru ( cyclopentadienyl )( co ) 2 cl ], [ ru ( cyclopentadienyl )( co ) 2 h ], [ ru ( cyclopentadienyl )( co ) 2 ] 2 , [ ru ( pentamethylcyclopentadienyl )( co ) 2 cl ], [ ru ( pentamethylcyclopentadienyl )( co ) 2 h ], [ ru ( pentamethylcyclopentadienyl )( co ) 2 ] 2 , [ ru ( indenyl )( co ) 2 c1 ], [ ru ( indenyl )( co ) 2 h ], [ ru ( indenyl )( co ) 2 ] 2 , ruthenocene , [ ru ( cod ) cl 2 ] 2 , [ ru ( pentamethylcyclopentadienyl )( cod ) cl ], [ ru 3 ( co ) 12 ], [ ircl 3 * h 2 o ], kircl 4 , k 3 ircl 6 , [ ir ( cod ) cl ] 2 , [ ir ( cyclooctene ) 2 cl ] 2 , [ ir ( ethene ) 2 cl ] 2 , [ ir ( cyclopentadienyl ) cl 2 ] 2 , [ ir ( pentamethylcyclopentadienyl ) cl 2 ] 2 and [ ir ( cyclopentadienyl )( co ) 2 ], [ ir ( pentamethylcyclopentadienyl )( co ) 2 ]. the catalyst complex preferably comprises as ligand a phosphine ligand with at least one unbranched or branched , acyclic or cyclic , aliphatic or aromatic residue comprising 1 to 12 carbon atoms , where individual carbon atoms may also be replaced by & gt ; p —. in terms of branched cyclic aliphatic residues , also included here are residues such as — ch 2 — c 6 h 11 , for example . suitable residues are , for example , methyl , ethyl , prop - 1 - yl , prop - 2 - yl , but - 1 - yl , but - 2 - yl , 2 - methylprop - 1 - yl , 2 - methylprop - 2 - yl , pent - 1 - yl , hex - 1 - yl , hept - 1 - yl , oct - 1 - yl , non - 1 - yl , dec - 1 - yl , undec - 1 - yl , dodec - 1 - yl , cyclopentyl , cyclohexyl , cycloheptyl and cyclooctyl , methylcyclopentyl , methylcyclohexyl , 2 - methylpent - 1 - yl , 2 - ethylhex - 1 - yl , 2 - propylhept - 1 - yl and norbonyl , phenyl , tolyl , mesityl and anisyl . the unbranched or branched , acyclic or cyclic , aliphatic or aromatic residue preferably comprises at least 1 and preferably a maximum of 10 carbon atoms . in the case of an exclusively cyclic residue in the abovementioned terms , the number of carbon atoms is 3 to 12 and preferably at least 4 and preferably a maximum of 8 carbon atoms . preference is given to ethyl , but - 1 - yl , sec - butyl , oct - 1 - yl and cyclohexyl , phenyl , tolyl , mesityl and anisyl residues . the phosphine group may comprise one , two or three of the abovementioned unbranched or branched , acyclic or cyclic , aliphatic or aromatic residues . these may be identical or different . the phosphine group preferably comprises three of the abovementioned unbranched or branched , acyclic or cyclic , aliphatic residues , with particular preference being given to all three residues being identical . preference is given to phosphines p ( n - c m h 2n + 1 ) 3 with m equal to 1 to 10 , particularly preferably tri - n - butylphosphine , tri - n - octylphosphine , triphenylphosphine , diphenylphosphinoethane , chiraphos , triphos and 1 , 2 - bis ( dicyclohexylphosphino ) ethane . as already mentioned above , individual carbon atoms may also be replaced by & gt ; p — in the said unbranched or branched , acyclic or cyclic , aliphatic residues . therefore , these also comprise polydentate , for example bi - or tridentate , phosphine ligands . these preferably comprise the if the phosphine group comprises still other residues than the abovementioned unbranched or branched , acyclic or cyclic , aliphatic residues , these generally correspond to those which are typically used elsewhere in phosphine ligands for organometallic catalyst complexes . examples include phenyl , tolyl and xylyl . the organometallic complex may comprise one or more , for example , two , three or four , of the abovementioned phosphine groups with at least one unbranched or branched , acyclic or cyclic , aliphatic or aromatic residue . the catalyst complex may comprise still other residues , which could be unchanged ligands such as co , olefins , cyclic olefins , dienes , cyclodienes , aromatic systems , aldehydes , ketones and anionic ligands such as fluoride , chloride , bromide , iodide , hydride , formate , acetate , propionate , butyrate , methylsulfonate , methylsulfate , trifluoromethylsulfate , tosylate , mesylate , cyanide , isocyanate , thiocyanate , hydroxide , alkoxide , cyclopentadienide , pentamethylcyclopentadienide and pentabenzylcyclopentadienide . [ ru ( pr 3 ) 4 ( h ) 2 ] ( r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( pr 3 ) 3 ( h ) 2 ( co )] ( r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( pr 3 ) 3 ( h )( cl )( co )] ( r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( pr 3 ) 3 ( cl ) 2 ( co )] ( r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( pr 3 ) 3 ( cl ) 2 ] ( r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( l2 ) 2 ( h ) 2 ] ( l2 = 1 , 2 - bisdicyclohexylphosphinoethane , 1 , 2 - bisdiethylphosphinoethane , 1 , 2 - bisdiphenylphosphinoethane ), [ ru ( l2 )( pr 3 ) 2 ( h ) 2 ] ( l2 = 1 , 2 - bisdicyclohexylphosphinoethane , 1 , 2 - bisdiethylphosphinoethane , 1 , 2 - bisdiphenylphosphinoethane ; r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( l2 )( pr 3 )( co )( h ) 2 ] ( l2 = 1 , 2 - bisdicyclohexylphosphinoethane , 1 , 2 - bisdiethylphosphinoethane , 1 , 2 - bisdiphenylphosphinoethane ; r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( l2 )( pr 3 )( co )( h )( cl )] ( l2 = 1 , 2 - bisdicyclohexylphosphinoethane , 1 , 2 - bisdiethylphosphinoethane , 1 , 2 - bisdiphenylphosphinoethane ; r = methyl , ethyl , butyl , hexyl , octyl , phenyl , tolyl , mesityl ), [ ru ( l3 )( h ) 2 ] ( l3 = triphos ), [ ru ( l3 )( co )( h ) 2 ] ( l3 = triphos ), [ ru ( l3 )( co )( h )( c )] ( l3 = triphos ). it can also be advantageous to add a base to the reaction mixture . suitable bases are lioh , naoh , koh , lih , nah , kh , ca ( oh ) 2 , cah 2 , lialh 4 , nabh 4 , libh 4 , na 2 co 3 , nahco 3 , li 2 co 3 , lihco 3 , k 2 co 3 , khco 3 , k 3 po 4 , na 3 po 4 , buli , meli , phli , tbuli , liome , lioet , liopr , lioipr , liobu , lioibu , liopent , lioipent , liohex , liohept , liooct , liobenz , lioph , kome , koet , kopr , koipr , kobu , koibu , kopent , koipent , kohex , kohept , kooct , kobenz , koph , naome , naoet , naopr , naoipr , naobu , naoibu , naopent , naoipent , naohex , naohept , naooct , naobenz , naoph , kn ( sime 3 ) 2 , lin ( sime 3 ) 3 , nan ( sime 3 ) 3 , nh 3 , rnh 2 ( where r 1 = unsubstituted or at least monosubstituted c 1 - c 10 - alkyl , h , (— c 1 - c 4 - alkyl - p ( phenyl ) 2 ), c 3 - c 10 - cycloalkyl , c 3 - c 10 - heterocyclyl comprising at least one heteroatom selected from n , o and s , c 5 - c 14 - aryl or c 5 - c 10 - heteroaryl comprising at least one heteroatom selected from n , o and s ), r 1 r 2 nh ( where r 1 , r 2 independently of each other are unsubstituted or at least monosubstituted c 1 - c 10 - alkyl , h , (— c 1 - c 4 - alkyl - p ( phenyl ) 2 ), c 3 - c 10 - cycloalkyl , c 3 - c 10 - heterocyclyl comprising at least one heteroatom selected from n , o and s , c 5 - c 14 - aryl or c 5 - c 10 - heteroaryl comprising at least one heteroatom selected from n , o and s ), r 1 r 2 r 3 n ( where r 1 , r 2 , r 3 independently of each other are unsubstituted or at least monosubstituted c 1 - c 10 - alkyl , h , (— c 1 - c 4 - alkyl - p ( phenyl ) 2 ), c 3 - c 10 - cycloalkyl , c 3 - c 10 - heterocyclyl comprising at least one heteroatom selected from n , o and s , c 5 - c 14 - aryl or c 5 - c 10 - heteroaryl comprising at least one heteroatom selected from n , o and s ). menthone is formed from isopulegol by the dehydrogenation of the hydroxy group to a carbonyl function with hydrogenation of the c — c double bond of the substrate . here a pure isomer of isopulegol and also an isomer mixture may be used . the menthone obtained from the reaction is a pure isomer or else is obtained as a mixture of isomers . the reaction is carried out preferably with (−)- isopulegol , in which case (−)- menthone and (+)- isomenthon are formed as the main product . in the context of the present invention , “ homogeneously catalysed ” is understood to mean that the catalytically active part of the catalyst complex is at least partly present dissolved in the liquid reaction medium . in a preferred embodiment , at least 90 % of the catalyst complex used in the method is present dissolved in the liquid reaction medium , more preferably at least 95 %, particularly preferably more than 99 %, and most preferably the catalyst complex is present completely dissolved ( 100 %) in the liquid reaction medium , based in each case on the total amount in the liquid reaction medium . the amount of the metal component in the catalyst , preferably ruthenium , is generally 0 . 1 to 5000 ppm by weight , based respectively on the total liquid reaction mixture in the reaction space . the reaction takes place in the liquid phase at a temperature of generally 20 to 250 ° c . the method according to the invention is preferably conducted at temperatures in the range from 100 ° c . to 200 ° c ., particularly preferably in the range from 100 to 180 ° c . the reaction is generally conducted at a total pressure of 0 . 1 to 20 mpa absolute , which can be either the autogenous pressure of the solvent or of the substrate at the reaction temperature or else the pressure of a gas such as nitrogen , argon or hydrogen . the method according to the invention is preferably conducted up to a total pressure of 10 mpa absolute , particularly preferably up to a total pressure of 1 mpa absolute . in the method according to the invention , the reaction may be conducted either with an additional solvent or without solvent addition . suitable solvents are , for example , aliphatic and aromatic hydrocarbons , aliphatic and aromatic ethers , cyclic ethers or esters . examples include , but are not limited to , solvents such as pentane , hexane , heptane , octane , nonane , decane , benzene , toluene , xylenes , mesitylene , anisole , dibutyl ether , diphenyl ether , dimethoxyethane , tetrahydrofuran , methyltetrahydrofuran , dioxane , ethyl acetate , butyl acetate or butyl butyrate . if the reaction is conducted without additional solvent , then the product also does not have to be separated from it , which simplifies the workup . in the embodiment without solvent , the reaction takes place in the reactants and in the product formed in the reaction . for the reaction in the liquid phase , at least one isopulegol and optionally the solvent , the metal catalyst or a suitable metal precursor , and the ligands , optionally with added base , are placed into a reaction space . the reaction may be conducted with the conventional apparatus and reactors for liquid - gas reactions known to a person skilled in the art , in which the catalyst is present dissolved homogeneously in the liquid phase . in principle , all reactors may be used in the method according to the invention which are basically suitable for gas - liquid reactions at the given temperature and the given pressure . suitable standard reactors for gas - liquid and for liquid - liquid reaction systems are given , for example , in k . d . henkel , “ reactor types and their industrial applications ”, in ullmann &# 39 ; s encyclopedia of industrial chemistry , 2005 , wiley - vch verlag gmbh & amp ; co . kgaa , doi : 10 . 1002 / 14356007 . b04 — 087 , chapter 3 . 3 “ reactors for gas - liquid reactions ”. examples include stirred tank reactors , tubular reactors or bubble column reactors . the input of isopulegol and optionally the solvent , the metal catalyst or a suitable metal precursor and the ligands , optionally with an additional base , can take place simultaneously or separately from one another . the reaction may be conducted in a discontinuous batch mode , or continuously or semi - continuously with recycling or without recycling . the mean residence time in the reaction space is generally 15 minutes to 100 hours . after the reaction , the product is separated , preferably by distillation , from unreacted reactants and optionally the solvent . the catalyst remains behind with the high boilers in the distillation bottoms and may be re - used . unreacted alcohol reactant may likewise be recycled back into the reaction . the thermal separation of the alcohol and of the ester takes place according to the prior art methods known to a person skilled in the art , preferably in an evaporator or in a distillation unit , comprising evaporator and column ( s ), which typically has trays , a structured packing or a random packing . the separation of the product may also take place by crystallization , extraction or absorption , although workup by distillation is preferred . unreacted reactant and the metal catalyst are preferably re - used in the reaction to facilitate a highly economical process . the invention is illustrated by , without being restricted to , the following examples : the gas chromatographic determinations are carried out as follows : the gc determination of the yields was carried out with an agilent system with a vf - 23 ms column ( 60 m , 0 . 25 mm , 0 . 25 μm ), helium as carrier gas and a flame ionization detector . the injector temperature was 250 ° c . ; the column temperature was increased during the measurement from 50 ° c . to 150 ° c . with a heating rate of 3 ° c ./ min , and then to 260 ° c . at 20 ° c ./ min . “ inert conditions ”: the procedures were conducted with exclusion of air and oxygen . the initial weighing of the reactant , solvent and catalyst took place in a glovebox , which is operated with purified nitrogen . the procedures outside the glovebox took place using standard schlenk techniques and argon as inert gas . yields : in the rearrangement of isopulegol to menthone , menthol and isopulegone occur as intermediates . with a longer reaction time or by recycling these intermediates , these can be further reacted to menthone , and thus do not constitute any loss of isopulegol with respect to the synthesis of menthone ( see illustrative reaction course in the graph shown in fig1 with respect to these components ). these secondary components are explicitly mentioned in the yields and selectivity for this reason . under inert conditions , 202 mg of [ ru ( pnoct 3 ) 4 ( h ) 2 ], 1 . 8 g of isopulegol and 10 ml of o - xylene ( anhydrous ) are weighed out in a glovebox into a 50 ml two - necked flask . the reaction mixture is then stirred at normal pressure for 12 hours under reflux cooling at an oil bath temperature of 133 ° c . after the reaction , the conversion and the yield of menthone ( sum of isomers ) is determined by gas chromatography ( area %). the conversion of isopulegol is 60 . 5 % with a selectivity for menthone ( isomer mixture of 66 . 2 % (−)- menthone , 33 . 8 % (+)- isomenthone ) of 47 . 3 %. selectivity for the secondary components : menthol 31 . 6 %, isopulegone 14 . 9 %, total selectivity ( menthone + menthol + isopulegone ) 93 . 8 %. under inert conditions , 116 mg of [ ru ( pnbu 3 ) 4 ( h ) 2 ], 54 mg of 1 , 2 - bis ( dicyclohexylphosphino ) ethane , 1 . 8 g of isopulegol and 10 ml of o - xylene ( anhydrous ) are weighed out in a glovebox into a 50 ml two - necked flask . the reaction mixture is then stirred at normal pressure for 12 hours under reflux cooling at an oil bath temperature of 133 ° c . after the reaction , the conversion and the yield of menthone ( sum of isomers ) is determined by gas chromatography ( area %). the conversion of isopulegol is 62 . 9 % with a selectivity for menthone ( isomer mixture of 61 . 7 % (−)- menthone , 38 . 3 % (+)- isomenthone ) of 31 . 9 %. selectivity for the secondary components : menthol 27 . 7 %, isopulegone 15 . 5 %, total selectivity ( menthone + menthol + isopulegone ) 75 . 1 %. under inert conditions , 116 mg of [ ru ( pnet 3 ) 4 ( h ) 2 ], 1 . 8 g of isopulegol and 10 ml of o - xylene ( anhydrous ) are weighed out in a glovebox into a 50 ml two - necked flask . the reaction mixture is then stirred at normal pressure for 12 hours under reflux cooling at an oil bath temperature of 133 ° c . after the reaction , the conversion and the yield of menthone ( sum of isomers ) is determined by gas chromatography ( area %). the conversion of isopulegol is 64 . 2 % with a selectivity for menthone ( isomer mixture of 70 . 0 % (−)- menthone , 33 . 0 % (+)- isomenthone ) of 45 . 2 %. selectivity for the secondary components : menthol 30 . 8 %, isopulegone 20 . 2 %, total selectivity ( menthone + menthol + isopulegone ) 96 . 2 %. under inert conditions , 404 mg of [ ru ( pnoct 3 ) 4 ( h ) 2 ], 3 . 6 g of isopulegol and 10 ml of o - xylene ( anhydrous ) are weighed out in a glovebox into a 50 ml glass autoclave . the reaction mixture is then stirred under autogenous pressure ( 0 . 5 bar positive pressure ) for 12 hours at an oil bath temperature of 130 ° c . after the reaction , the conversion and the yield of menthone ( sum of isomers ) is determined by gas chromatography ( area %). the conversion of isopulegol is 64 . 5 % with a selectivity for menthone ( isomer mixture of 65 . 8 % (−)- menthone , 34 . 2 % (+)- isomenthone ) of 46 . 3 %. selectivity for the secondary components : menthol 30 . 2 %, isopulegone 14 . 4 %, total selectivity ( menthone + menthol + isopulegone ) 90 . 9 %. under inert conditions , 404 mg of [ ru ( pnoct 3 ) 4 ( h ) 2 ], 3 . 6 g of isopulegol and 20 ml of o - xylene ( anhydrous ) are weighed out in a glovebox into a 50 ml glass autoclave . the reaction mixture is then stirred under autogenous pressure for 12 hours at an oil bath temperature of 150 ° c . after the reaction , the conversion and the yield of menthone ( sum of isomers ) is determined by gas chromatography ( area %). the conversion of isopulegol is 92 . 4 % with a selectivity for menthone ( isomer mixture of 65 . 6 % (−)- menthone , 34 . 4 % (+)- isomenthone ) of 51 . 1 %. selectivity for the secondary components : menthol 15 . 4 %, isopulegone 10 . 9 %, total selectivity ( menthone + menthol + isopulegone ) 77 . 4 %. under inert conditions , 460 mg of [ ru ( pnoct 3 ) 4 ( h ) 2 ], 8 . 6 g of isopulegol and 20 ml of o - xylene ( anhydrous ) are weighed out in a glovebox into a 50 ml glass autoclave . the reaction mixture is then stirred under autogenous pressure for 12 hours at an oil bath temperature of 170 ° c . after the reaction , the conversion and the yield of menthone ( sum of isomers ) is determined by gas chromatography ( area %). the conversion of isopulegol is 98 . 2 % with a selectivity for menthone ( isomer mixture of 65 . 4 % (−)- menthone , 34 . 6 % (+)- isomenthone ) of 89 . 6 %. selectivity for the secondary components : menthol 3 . 6 %, isopulegone 0 . 3 %, total selectivity ( menthone + menthol + isopulegone ) 93 . 5 %. under inert conditions , 300 mg of [ ru ( pnoct 3 ) 4 ( h ) 2 ] and 21 . 0 g of isopulegol are weighed out in a glovebox into a 50 ml glass autoclave . the reaction mixture is then stirred under autogenous pressure for 100 hours at an oil bath temperature of 170 ° c . after the reaction , the conversion and the yield of menthone ( sum of isomers ) is determined by gas chromatography ( area %). the conversion of isopulegol is 99 . 3 % with a selectivity for menthone ( isomer mixture of 64 . 3 % (−)- menthone , 35 . 7 % (+)- isomenthone ) of 86 . 4 %. selectivity for the secondary components : menthol 1 . 4 %, isopulegone 4 . 9 %, total selectivity ( menthone + menthol + isopulegone ) 92 . 7 %. under inert conditions , 610 mg of [ ru ( pnoct 3 ) 4 ( h ) 2 ] and 20 . 15 g of isopulegol are weighed out in a glovebox into a 100 ml glass flask . the reaction mixture is then stirred under reflux for 24 hours at an oil bath temperature of 170 ° c . after the reaction , the conversion and the yield of menthone ( sum of isomers ) is determined by gas chromatography ( area %). the conversion of isopulegol is 97 . 5 % at a selectivity for menthone ( isomer mixture of 63 . 1 % (−)- menthone , 36 . 9 % (+)- isomenthone ) of 84 . 0 %. selectivity for the secondary components : menthol 5 . 1 %, isopulegone 4 . 5 %, total selectivity ( menthone + menthol + isopulegone ) 93 . 7 %. under inert conditions , 610 mg of [ ru ( pnoct 3 ) 4 ( h ) 2 ] and 20 . 7 g of isopulegol are weighed out in a glovebox into a 100 ml glass flask . the reaction mixture is then stirred under reflux for 24 hours at an oil bath temperature of 180 ° c . after the reaction , the conversion and the yield of menthone ( sum of isomers ) is determined by gas chromatography ( area %). the conversion of isopulegol is 98 . 5 % at a selectivity for menthone ( isomer mixture of 63 . 0 % (−)- menthone , 37 . 0 % (+)- isomenthone ) of 88 . 7 %. selectivity for the secondary components : menthol 2 . 9 %, isopulegone 2 . 7 %, total selectivity ( menthone + menthol + isopulegone ) 94 . 3 %. the disclosure of the publications cited herein is expressly incorporated by way of reference .	2
the compositions of the present invention provide support for and promote strong immune systems . in a preferred embodiment , the compositions of the present invention are provided in a chewable delivery system and feature a targeted array of nutrients for building and nurturing immune health , especially when stress tends to bear down on the immune system . the preferred chewable delivery system of the compositions of the present invention optimizes the first - line defenses of the mucosal immune system . the oral cavity is the gate of entry to the immune system . the oral cavity mucus membrane cell receptors are activated by immunoreactive ingredients and communicate with the lymphatics , where activated lymphocytes spread signals to the blood and other tissues . the oral cavity epithelial cells and gi tract cells are sites for systemic absorption of smaller sized immunoreactive ingredients . also , immunoreactive ingredients react directly with bacteria , viruses , and fungi in the oral cavity and esophagus . those of ordinary skill in the art will recognize that supporting the mucus membranes that line the mouth , nose , lungs and digestive tract is beneficial since the majority of harmful invaders of the body must pass through these defenses . these membranes comprise the largest barrier in the body and form the first line of defense . when the mucosal immune response is triggered , it makes natural antibodies that “ arm ” saliva , tears , bronchial and nasal secretions , as well as fluids in the digestive tract , turning them into the body &# 39 ; s own powerful , natural antimicrobial wash . the preferred chewable delivery system enhances the ability of the nutrients in the compositions of the present invention to immediately react with mucus membranes in the mouth and esophagus to energize the immune system and begin the fight against bacteria . in addition , the uptake and immune system activities of nutrients from the compositions of the present invention begin in the mouth as they are chewed and continue in a cascade of immune responses throughout the immune system . the components of the compositions of the present invention bind to specific receptor sites that send signals directly to the lymphatic system — the roadway for the approximately trillion circulating white blood cells on patrol against invaders . the nutrient forces in the compositions of the present invention spread throughout the gastrointestinal ( gi ) tract where they facilitate normal cell proliferation , growth of beneficial gi bacteria , and discourage growth of bad bacteria . those of ordinary skill in the art will recognize that the lymphatic tissue in the gi tract is one of the major subdivisions of the immune system . everyday stress such as work , traffic , and taking care of a family can accelerate the body &# 39 ; s use of nutrients . a poor diet and sleep deprivation place additional demands on and challenge the immune system . the job of the immune system is to recognize and eliminate foreign particles and organisms and maintain balance in every part of the body . with the right nourishment , the immune system performs these functions quite admirably . under stress , however , the immune system has to work harder . because stress acts as a drain on nutrients , more nutritional support is needed for the immune system during periods of stress . also , if the immune system is unbalanced , it needs more nutritional power to assist in its efforts to compensate and achieve balance . when the immune defenses are weakened and unprepared , unwanted viruses work around system failures , microbes make themselves at home and toxins take hold . emotional stress is a silent threat to good health . while the signs of emotional stress may be recognized , one often fails to acknowledge the burden it places on the body . in addition , even when one knows they are physically stressed , whether from work or a workout , one often thinks that all that is needed is rest . but that may not be all the immune system needs to bounce back . in addition , one may fail to recognize the environmental stress the body incurs that can make the immune system work harder , or the dietary stress caused by making poor food choices . to help combat environmental stress the compositions of the present invention support the body &# 39 ; s ability to conduct cellular “ house cleaning ” by helping to remove heavy metals , toxins and damaged cellular material from cells . to help the body handle physical stress , the compositions of the present invention include peptides , amino acids and glycoproteins that engage the body &# 39 ; s natural ability to heal and repair itself . the components of the compositions of the present invention help trigger a cascade of immune signaling mechanisms . this is especially important when stress factors work against the immune system . glyconutrients help carry these immune signals to other cells . according to a preferred embodiment , the compositions of the present invention are combined with a complex of essential saccharides such as the dietary supplement sold by mannatech inc . of coppell , texas under the trade name “ ambrotose ®” the ambrotose ® product is preferably produced according to the methods and procedures set forth in international patent application publication number wo 98 / 06418 , the entire disclosure of which is hereby incorporated by reference herein . the combination of the compositions of the present invention and ambrotose ® complex provide a synergistic array of proteins , peptides , polypeptides , and glyco - proteins - nutrients that can help to achieve optimal health through an appropriately immunomodulated immune system . the compositions of the present invention preferably include ingredients that promote the production of new blood cells , cartilage formation and bone growth . the compositions of the present invention enhance muscle protein synthesis and insulin - like growth factor release in tissues . the compositions of the present invention also assist the body in regulating muscle protein breakdown and bio - regulation during stress . the present invention encompasses compositions , dietary supplements and methods for their use that include the following active components : ( a ) prime colostrum has the highest concentrations of immunoglobulins , interferons , proline - rich peptides , amino acids and vital enzymes produced by mammary tissue , being higher than those produced in ordinary colostrum . this provides the newborn with protection against viruses and bacteria and other health threats . besides providing the first complete food for the newborn , prime colostrum has such profound immuno - stimulating properties that administration of very small amounts activates the human immune system . in addition to this immune stimulation capability , prime colostrum provides immunoglobulins directly ( e . g . iga , igg , igm ) and also growth factors ( e . g . igf - i , tgf a and b ). it supplies immunomodulatory proline - rich peptides which moderate the activity of the immune system through their effect upon the thymus gland , stimulating under - active immune systems such as those of immuno - compromised persons , or moderating those that are over - active as in individuals with auto - immune diseases . prime colostrum slows muscle breakdown , improves protein synthesis and utilization , provides digestive enzymes , regulates blood sugar and stimulates growth and repair . in sum , prime colostrum contains powerful healing , growth and repair factors that activate numerous immune , healing , growth and repair systems and assist in synthesis , retention and repair of muscle , bone , nerve and cartilage . as the body ages , becomes weakened by illness , or is subjected to physical stresses , it produces less and less of the factors that are needed to overcome metabolic insults or infection and to heal quickly . see canadian patent application no . 2 , 279 , 791 , the entire disclosure of which is hereby incorporated herein by reference . ( b ) lactoferrin is an iron binding protein that occurs naturally in the body . it is secreted in milk , tears and saliva , and is expressed by white blood cells . lactoferrin is well known in the art as a biological regulator that performs many important functions in the body . these functions include maintaining a healthy balance in the digestive tract , helping the immune system and promoting healthy cell growth . dairy cattle provide a cost - effective source of lactoferrin for inclusion into a dietary supplement . lactoferrin from cows &# 39 ; milk can be prepared free of lactose . lactoferrin bioregulates iron , boosts the immune system , balances the digestive tract , increases energy and stamina , and promotes cell growth and healing . these broad , beneficial properties are surprising in view of the inability of bovine lactoferrin to bind to the lactoferrin receptors at the surface of the mucosal cells of human small intestine . ( c ) citrus pectin is a preferred component that endows the composition with additional benefits as a nutritional supplement . citrus pectin is a protein that contains galactose molecules on its surface which are able to bind lectins involved in the transmission within the body of certain types of cancer . ( d ) citric acid is a preferred component that may be incorporated to promote salivation and to adjust the acidity of the composition in order that solubility , activity and absorption of the components within the oral cavity is enhanced . ( e ) the β - glucan incorporated in the compositions of the present invention is disclosed in u . s . pat . nos . 5 , 223 , 491 , 5 , 397 , 773 , 5 , 519 , 009 , 5 , 576 , 015 , 5 , 702 , 719 , 5 , 705 , 184 , the entire disclosures of which are hereby incorporated herein by reference . glucans are polymers of glucose . such glucans may be derived from the cell walls of yeast . glucan extracted from yeast is a potent stimulator of the immune system . iron is a key mineral required by all microorganisms for maintenance and growth . excess iron in the intestines promotes pathogen growth and proliferation . lactoferrin from cows &# 39 ; milk is partially saturated with iron ( approximately 25 % of total saturation ) providing a dietary source of iron as well as a means of scavenging free iron from the oral cavity and digestive tract . lactoferrin works on contact to starve pathogens of iron so that the correct balance of beneficial bacteria develops and is maintained in the digestive tract . the growth of harmful bacteria that are poorly adapted to these conditions is inhibited . by sequestering iron and delivering it for use by the cells of the body &# 39 ; s internal tissues , lactoferrin improves digestion and boosts the body &# 39 ; s natural defense mechanisms . this generates more energy and increased stamina for physical activities and optimum health . lactoferrin and prime colostrum achieve their optimal effects when dissolved slowly in the mouth , rather than being swallowed directly in the form of a pill or capsule . slowly dissolving the lactoferrin and constituents of colostrum in the mouth permits their absorption into the capillaries at the surface of the oral cavity &# 39 ; s lining , which is able to occur before the lactoferrin and prime colostrum are exposed to the harsh degradatory conditions of the stomach and intestines . for example , bovine lactoferrin is less resistant to degradation in the human digestive tract than is human lactoferrin , and the lactoferrin receptors in the small intestine of humans will not bind bovine lactoferrin . thus administration of bovine lactoferrin to humans in a mucosal delivery format , such as a format that enables its absorption through the lining of the mouth , is particularly efficacious . immunoglobulins from colostrum also pass directly into the blood through the inner mucosal layer of the mouth . orally delivered prime colostrum stimulates the body to replace growth , healing and repair factors as needed and produce them naturally to achieve homeostasis . oral administration of citrus pectin has been shown to be effective for inhibiting spontaneous metastasis of a rat prostate cancer . chewable tablets , in contrast to pills or capsules , provide a ‘ mucosal delivery format ’ ( mdf ) for constituents which can be absorbed through the oral mucosal surface , such as the colostrum , lactoferrin or citrus pectin of the compositions of the present invention . in particular , the chewable tablets of the present invention are able to enhance the benefits associated with absorption of appropriate constituents through the oral epithelial mucosa and into the underlying lymphatic system , for they are designed to be chewed in the mouth ; such tablets are therefore a preferred mdf . the compositions of the present invention provide a nutritional and dietary supplement for immune support that features a chewable formula containing : colostrum , lactoferrin , 1 - 3 / 1 - 6 glucan ; and citrus pectin . the individual components of the composition may be obtained from commercial sources : colostrum ( which is dehydrated by standard spray - drying procedures known in the art ) from any processing facility approved by the united states food and drug authority ( fda ) such as immuno - dynamics , inc . of perry , iowa under the trade name “ prime colostrum ®”; lactoferrin from approved manufacturers such as dmv international nutritionals of frazier , n . y . ; the 1 - 3 / 1 - 6 glucan is commercially available from biopolymer engineering , inc . under the tradename “ beta right ™,” citrus pectin from approved distributors or manufacturers such as g . c . i . of los angeles , calif . ; flavors from approved distributors or manufacturers such as allen flavors , inc . of edison , n . j . manufacturing of the composition , the dietary supplement , and the oral dosage forms may each be performed using standard techniques well known to those of ordinary skill in the art which are appropriate for the food or pharmaceutical industries , such as at any fda approved facility . energizes a cascade of immune responses that begin in the mouth and proceed throughout the body . optimizes response of natural killer cells , b - cells and t - cells which seek out and destroy foreign substances . reacts with the specific cell receptors that cause the cells to engulf and destroy bacteria and cellular debris . initiates communication in the immune system which releases chemical messengers to fight infection and disease . binds iron so that it starves bad bacteria throughout the body — re - routing it to become more bio - available for beneficial uses . contains proteins that are combined with saccharides to make glycoproteins for hormones and enzymes used in immune regulation . table 1 below lists some of the biological activities of various components of the compositions of the present invention . preferred embodiments of the invention include compositions and dietary supplements , as described above , prepared in a ‘ mucosal delivery format .’ a particularly preferred embodiment is an oral dosage form that promotes absorption of the dietary supplement &# 39 ; s components through the epithelial lining of the oral cavity . examples of oral dosage forms that promote absorption of the dietary supplement &# 39 ; s components within the oral cavity are those that either encourage retention of the dose within the oral cavity for an extended period , or discourage swallowing of the dose . such exemplary oral dosage forms include those that are chewable , are appropriate for sucking , and / or encourage salivation , for example , lozenges , particularly chewable lozenges , chewable tablets and chewable gums . the addition of natural or artificial flavouring also encourages retention of the dosage form within the mouth , particularly with children , so that there is greater transfer of the active components through the lining of the oral cavity and into the bloodstream and / or the lymphatic system . such active components include the constituents of colostrum and the lactoferrin , as described above . the physical size and consistency of the dosage form may also be adapted to prevent premature swallowing of the delivered dose . a preferred period for which the dose should remain in the mouth for effective absorption is 30 seconds to 10 minutes , with better effects being observed at the longer retention times . larger chewable forms are appropriate for animals that would otherwise be likely to swallow such foodstuff with little mastication . further preferred embodiments are methods for promoting those beneficial effects in mammals described above , in which such oral dosage forms of these compositions and dietary supplements are administered . exemplary formulations for the dietary supplement of the present invention are described in the following examples . weight percentages indicated for each ingredient are percentages of the total weight of the end product . in a preferred embodiment of the present invention , the composition comprises the following ingredients cold pressed into a chewable lozenge of hardness 14 to 44 kp that is taken as a nutritional supplement one to five times per day : 150 mg to 200 mg bovine prime colostrum ( which is about 5 to about 40 weight percent ), 10 mg to 20 mg bovine lactoferrin ( which is about 0 . 333 to about 4 weight percent ), 5 mg modified citrus pectin ( which is about 0 . 167 to about 1 weight percent ), 1295 mg to 1945 mg dextrose ( which is about 43 . 2 to about 64 . 8 weight percent ), 7 . 5 mg to 12 . 0 mg citric acid ( which is about 0 . 25 to about 2 . 4 weight percent ), 4 . 5 to 15 . 0 mg natural and / or artificial flavour ( which is about 0 . 15 to about 0 . 5 weight percent ), 7 . 5 mg silicon dioxide ( which is about 0 . 25 to about 1 . 5 weight percent ), and 7 . 5 mg magnesium stearate and dextrose ( which is about 0 . 25 to about 1 . 5 weight percent ), to a total weight of 0 . 5 to 3 . 0 grams . the lozenge is chewed for 30 seconds to ten minutes to maximize absorption of the active ingredients through the lining of the oral cavity and their absorption into the blood and lymphatic system . in a preferred embodiment of the invention , each of the following ingredients is placed , in powdered form , into a commercial mixer : 150 parts bovine prime colostrum , ( about 10 weight percent ), 10 parts bovine lactoferrin ( about 0 . 667 weight percent ), 5 parts modified citrus pectin ( about 0 . 333 weight percent ), 1297 . 5 parts dextrose ( about 86 . 5 weight percent ), 7 . 5 parts citric acid ( about 0 . 5 weight percent ), 15 parts natural strawberry flavor ( about 1 . 0 weight percent ), 7 . 5 parts silicon dioxide ( about 0 . 5 weight percent ) and 7 . 5 parts magnesium stearate ( about 0 . 5 weight percent ). if necessary , the materials are passed through a # 10 - 12 mesh screen to remove aggregates . each of the procedures should be performed with precautions against exposure to the powders and dusts that are formed , and particularly against their inhalation . after 20 minutes of thorough mixing , cold pressing the composition in a tablet press set at a maximum pressure of 6 . 4 tons yields lozenges of weight 1500 mg and hardness 34 to 36 kp . in another preferred embodiment of the invention , each of the following ingredients is placed , in powdered form , into a commercial mixer following the same procedure as for example 2 : 200 parts ( about 9 . 09 weight percent ) bovine prime colostrum , 20 parts ( about 0 . 909 weight percent ) bovine lactoferrin , 5 parts ( about 0 . 227 weight percent ) modified citrus pectin , 1943 . 5 parts ( about 88 . 3 weight percent ) dextrose , 12 parts ( about 0 . 545 weight percent ) citric acid , 3 parts ( about 0 . 136 weight percent ) natural strawberry flavor , 1 . 5 parts artificial flavor ( e . g . vanilla , chocolate ) ( about 0 . 068 weight percent ), 7 . 5 parts ( about 0 . 341 weight percent ) silicon dioxide and 7 . 5 parts ( about 0 . 341 weight percent ) magnesium stearate . after mixing and cold pressing as in example 2 , lozenges of weight 2200 mg were formed which demonstrated a hardness of 34 to 36 kp . each of the following ingredients is placed , in powdered form , into a commercial mixer following the same procedure as for example 2 : 200 parts ( about 33 . 3 to about 50 weight percent ) bovine prime colostrum , 20 parts ( about 3 . 33 to about 5 . 0 weight percent ) bovine lactoferrin , 5 parts ( about 0 . 833 to about 1 . 25 weight percent ) modified citrus pectin , approximately 215 parts ( about 35 . 8 to about 53 . 8 weight percent ) dextrose and / or maltodextrin , approximately 10 parts stearic acid as binder ( about 1 . 67 to about 2 . 5 weight percent ). after mixing and cold pressing as in example 2 , lozenges of total weight 400 mg to 600 mg were formed . in another preferred embodiment , the invention comprises a composition in which the lactoferrin is present at a concentration of from about 10 mg to about 100 mg per 1500 mg total weight ( which is about 0 . 667 to about 6 . 67 % total weight ) and colostrum , present at a concentration of from about 125 mg to about 1250 mg per 1500 mg total weight ( which is about 8 . 33 % to about 83 . 3 % total weight ). in such a preferred embodiment , a 1500 mg dose is typically provided from one to about five times per day . supplementary doses may be warranted under particular nutritional or physiological conditions . additional preferred embodiments include such compositions for use as a dietary supplement that additionally comprise modified citrus pectin at a concentration of from about 1 . 5 mg to about 15 mg per dose ( which is about 0 . 100 to about 1 . 00 % total weight ). generally , the effective amount of glucan in a dietary composition prepared according to the present invention will preferably range from about 0 . 001 w / w % to about 10 w / w % of the composition , more preferably from about 0 . 1 w / w % to about 4 w / w %. an exemplary formulation for the dietary supplement of the present invention comprising β - glucan is as follows : a preferred embodiment of the dietary supplement of the present invention comprising β - glucan is as follows : mg / tablet ingredient weight % 9 . 7500 citric acid 0 . 626 1297 . 0000 dextrose 83 . 300 7 . 5000 magnesium stearate 0 . 482 7 . 5000 silicon dioxide 0 . 482 30 . 0000 stearic acid 1 . 930 5 . 0000 citrus pectin 0 . 321 10 . 0000 lactoferrin 0 . 642 20 . 4000 strawberry natural flavoring 1 . 310 150 . 0000 colostrum 9 . 630 20 . 0000 β - glucan 1 . 280 total : 1 , 557 . 1500 100 according to the foregoing examples , dietary supplements prepared according to the present invention comprise β - glucan in an amount from about 0 . 001 to about 10 weight percent , and one or more of colostrum , in an amount from about 5 to about 83 . 3 weight percent , lactoferrin , in an amount from about 0 . 909 to about 6 . 67 weight percent , and citrus pectin , in an amount from about 0 . 1 to about 1 . 25 weight percent . preferred embodiments further comprise citric acid , in an amount from about 0 . 25 to about 2 . 4 weight percent , dextrose , in an amount from about 35 . 8 to about 88 . 3 weight percent , magnesium stearate , in an amount from about 0 . 25 to about 1 . 5 weight percent , silicon dioxide , in an amount from about 0 . 25 to about 1 . 5 weight percent , stearic acid , in an amount from about 1 . 67 to about 2 . 5 weight percent , and a flavoring , in amount from about 0 . 15 to about 1 . 31 weight percent . following below is a certificate of analysis of the colostrum product sold by immuno - dynamics , inc . of perry , iowa : certificate of analysis lot # 555 first milking bovine colostrum powder protein ( n × 6 . 38 ) 53 . 4 % igg ( v . m . r . d ., pullman , wa ) 20 . 4 % = 38 . 2 % of protein total immunoglobulin 23 . 5 % = 44 . 0 % of protein igg ( bethyl labs , montgomery , tx 15 . 7 % fat 21 . 4 % lactose 9 . 5 % moisture 3 . 1 % total coliforms & lt ; 3 cfu / g presumptive salmonella neg ./ 25 g presumptive lead & lt ; 1 ppm nickel & lt ; 1 ppm arsenic & lt ; 0 . 4 ppm mercury & lt ; 0 . 20 ppm other typical analysis physical : color white / cream taste / odor creamy milk bulk density ( tapped ) 350 g / l solubility 200 g / l chemical : ph ( 10 % solution @ 20 c .) 6 . 4 ash 4 . 5 % microbiological : standard plate count & lt ; 3 , 000 cfu / g coliform count neg ./ 25 g e . coli neg ./ 25 g salmonella sp . neg ./ 25 g mold & amp ; yeast neg ./ 25 g mycobacterium bovis negative mycobacterium avis negative m . paratuberculosis negative storage : cool , dry area away from sunlight hazard data : food substance ; no known toxicities or overdoses special handling : none ; food substance ventilation : no special requirements those of ordinary skill in the art will recognize that the foregoing examples are exemplary of the dietary supplement compositions , and that the capsule size , specific amount of each ingredient , and the combination of ingredients can be varied as needed . the dietary supplement compositions of the present invention are preferably administered via the oral mucosal system . the above is a detailed description of particular embodiments of the invention . those of ordinary skill in the art should , in light of the present disclosure , appreciate that obvious modifications of the embodiments disclosed herein can be made without departing from the spirit and scope of the invention . all of the embodiments disclosed herein can be made and executed without undue experimentation in light of the present disclosure . the full scope of the invention is set out in the disclosure and equivalent embodiments thereof . the specification should not be construed to unduly narrow the full scope of protection to which the present invention is entitled . as used herein and unless otherwise indicated , the terms “ a ” and “ an ” are taken to mean “ one ”, “ at least one ” or “ one or more ”. the phrase “ substantially the same ” is taken to mean that a first amount , or property , is about 90 %- 110 %, preferably 95 %- 105 %, or more preferably 99 %- 101 %, of the value of a second amount , or property , respectively . the terms “ substantially ” or “ substantial ” are taken to mean a “ major portion ”, “ more than 50 %”, preferably “ more than 90 %”, or more preferably “ more than 95 %” of a particular amount or property .	0
the present embodiments are directed to an apparatus and method for protecting nails . in particularly useful embodiments , a nail protector is provided that covers a finger or toe nail and provides a stable cover over the nail to prevent contact with the nail . in one embodiment , the nail is protected from top and lateral contact , which is particularly helpful when the nail has been polished and has not yet dried . in one embodiment , the nail protection apparatus includes a flexible portion , which expands to receive a finger or toe and when restored holds the nail protection apparatus in place . the apparatus includes a cover or shield portion that extends over the nail , and a median ridge or raised area that supports that cover portion . the flexible portion includes a longitudinal extension portion that extends along the finger or toe to prevent the cover portion from rotating onto the nail . the present embodiments will illustratively be described in terms of protecting nails after a manicure or pedicure . however , the present invention is much broader and may be applicable as a nail or finger / toe protector for medical applications such as the loss of a nail due to an injury or due to an infection or other condition . referring now to the drawings in which like numerals represent the same or similar elements and initially to fig1 , a nail protector 100 is shown in accordance with one illustrative embodiment . nail protector 100 includes a cover portion 102 which is configured to cover a finger or toe nail of a user without contact to the nail itself . the cover portion 102 is permitted to cover the nail with a gap maintained between the nail and the cover portion 102 . this gap is maintained during use of the nail protector 100 as will be described in greater detail below . nail protector 100 includes two lateral supports 116 , which extend from the cover portion 102 . the lateral supports 116 are connected to the cover at portions 110 . portions 110 and surrounding areas are flexible to permit a gap 112 to be increased by permitting flexure in the direction of arrow “ a ”. to permit flexure of portion 110 and / or of side walls 106 , these portions may be formed from a flexible material . in some embodiments , the materials may include plastics , such as polyethylene , polycarbonate , rubber , etc ., metals , such as steel , brass , etc ., wood , or combinations thereof . the cross - sectional dimensions of side walls 106 may be configured to provide a restoring force to return the original gap size 112 . this assists in maintaining the nail protector 100 on a finger or toe of the user . side walls 106 may be tapered ( either larger or smaller ) as the distance from portions 110 increases . side walls 106 may also be of uniform thickness about the circumference of opening 114 . side walls 106 may follow any other variations in thickness as well to provide sufficient strength and restoring force to maintain gap 112 and secure the nail protector 100 on the user . nail protector 100 includes a ridge or extension portion 108 . the ridge 108 extends under the cover portion 102 nearer to the insertion point of a finger or toe in opening 114 . ridge 108 is configured to contact the skin of the finger or toe to provide support for the cover portion 102 and prevent contact of the cover portion 102 with the nail . in addition , nail protector 100 includes longitudinal extensions 104 which are configured to extend along the finger or toe of the user and prevent rotational motion of the cover portion 102 toward the nail . ridge 108 and longitudinal extensions 104 work together to provide support for the cover portion 102 and prevent rotational motion of the cover portion 102 toward the nail . lateral portions 116 prevent axial rotation of the cover portion 102 on the finger or toe , and employ a restoring force to prevent the nail protector 100 from slipping forward or backward along the finger or toe once the nail protector is in place . an insertion side of the nail protector 100 preferably includes radiused or rounded edges 120 to provide comfort for the wearer and ease application of the protector device . it should be understood that the present principles may be practiced with many different designs and configurations . the presently described embodiments are illustrative only and should not be construed as limiting . referring to fig2 , another view of the nail protector 100 of fig1 is illustratively depicted to show an underside of the nail protector 100 . the ridge 108 is shown extending over a sector of the perimeter of opening 114 below the cover portion 102 . ridge 108 includes generous transitions 204 to permit the nail protector 100 to be easily applied on a finger or toe , and for comfort . a top portion 206 of ridge 108 makes contact with the skin of a finger or toe . the internal upper portion of ridge 108 features a build up of material allowing for adequate nail clearance . ends 202 of lateral portion 116 are preferably rounded and provide sufficient material to extend below the finger or toe once positioned thereon . referring to fig3 , a further explanation of the functionality of the nail protector 100 will now be illustratively described using a cross - sectional view of nail protector 100 depicted on a finger 304 . if for example , a force f 1 is applied to the cover portion 102 , reaction forces f r1 and f r2 will maintain the cover portion 102 in its current position and prevent contact with a nail 302 of finger 304 . reaction force f r1 results from the longitudinal extensions 104 extending along finger 304 on an opposing side of the pivot point created by ridge 108 . reaction force f r2 is provided by contact with ridge 108 with finger 304 . as described previously , lateral portions 116 extend below finger 304 and provide support to generate reaction forces f r1 . nail protector 100 is therefore stable on the finger 304 , and prevents contact of the nail protector or other objects with nail 302 . the nail protector 100 may include other features to provide similar effects . these features are illustratively described below , but should not be construed as limiting . referring to fig4 , a nail protector 400 includes a cover portion 102 and one or two side portions 410 that can extend into a coil 420 . the cover portion includes a ridge 108 as before and employs the coil 420 to generate the reaction force f r1 ( fig3 ). in this way , the nail protector 400 is placed on a side of the finger or toe and the coil 420 is wrapped around the user &# 39 ; s finger to secure the nail protector 400 . the coil 420 is formed from a flexible material and is connected to or formed with the rest of the nail protector 400 . as before , the open ended ring permits the nail protector 400 ( or 100 ) to clamp onto the finger or toe to avoid passing over a painted nail . edges 412 of nail protector 400 are preferably bull - nosed and flared to serve as a necessary guide for placement on the finger . nail protectors 100 and 400 provide a rear stabilizer using longitudinal extensions 104 or using coil 420 ( fig1 ) for preventing the nail cover portion from making contact with the nail . referring to fig5 , a nail protector 500 is conceptually depicted showing a biased hinge 510 to permit opening and closing of a lateral side 512 of nail protector 500 . hinge 510 may include a spring 514 as a biasing means to bias the lateral side 512 in a closed position ( shown ). when the nail protector is to be placed on a finger the lateral side is opened in the direction of arrow “ b ”, the finger is then placed inside the nail protector 500 and the lateral side 512 is closed . an optical latch 516 may be employed to lock the lateral side 512 in place to secure the nail protector 500 to the finger of the wearer . fig5 has omitted features for simplicity of explanation , e . g ., the cover portion , the ridge and rear stabilization portions are not shown . referring to fig6 , a nail protector 600 may include a clasp 610 that rotates about a finger in the direction of arrow “ c ”. the clasp 610 is opened to permit a finger to be placed inside the nail protector 600 and then the clasp 610 is closed to secure the nail protector 600 to the finger of the wearer . the clasp 610 may be stowed on the side of a base portion 612 in the open position . fig6 has omitted features , e . g ., the cover portion , the ridge and rear stabilization portions , for simplicity . the clasp 610 may employ any known mechanical slides , concentric walls or other known elements for providing the mechanical features for sliding the clasp 610 into or out of a closed position . nail protectors 100 , 400 , 500 and 600 , in accordance with the present principles , may include additional features and modifications . in one embodiment , the cover portion 102 is formed from a clear resilient plastic material ( e . g ., polycarbonate ) so that the polished nail is visible . the construction material may include polypropylene , polyethylene , polycarbonate , etc . the nail protectors 100 , 400 , 500 and 600 may be fabricated to be disposable or reusable . reusable embodiments may include the use of washable or sterilizable materials . in either case , the nail protector is preferably ergonomic , light weight and recyclable . in addition , construction materials for the nail protector may be colored , textured or otherwise decorated to suit personal preferences . nail protectors 100 , 400 , 500 and 600 may include a plurality of sizes to permit proper fitting for a plurality of different sized fingers and toes . referring to fig7 , an insert 650 may be employed which detachably snaps into the cover portion 102 to provide the functions the stabilizer and of the lateral walls to hold the nail protector fast on the finger or toe . inserts 650 may provide the proper fit one the finger and lock into the cover portion 102 . the insert 650 as with the other nail protectors are made in accordance with standard finger / toe size dimensions . this is particularly useful for reusable nail protectors . the inserts 650 may be u - shaped and fit over the finger without going over the nail . then , the cover portion 102 may be attached over the insert 650 . the insert 650 may have a locking feature , such as a detent , snap , clasp , etc . to provide attachment to the nail protector 655 to complete a ring formed using both the insert 650 and the nail protector 655 . the inserts may be formed from plastics , metals , foams , etc . and may be utilized to accommodate various finger sizing . nail protectors in accordance with the present invention may be integrally formed as a single piece or may include a removable / detachable cover portion 102 to permit for interchangeable styles of the cover portion 102 . referring to fig8 , a flow diagram shows a method for employing a nail protector in accordance with the present invention . after a manicure / pedicure or a need for protecting nails arises , proper sized nail protectors ( or inserts ) are identified in block 702 . in block 704 , the nail protectors are applied to the fingers or toe from a lateral direction over a finger or toe without passing over the nail in a longitudinal direction . this includes spreading flexible parts , opening a hinge or clasp or otherwise attaching the nail protector to a finger / toe ( e . g ., using inserts and protector to connect and form a ring ). in block 706 , the finger / toe is permitted to heal or the nail permitted to dry . in block 708 , the nail protector is removed and disposed of , cleaned / sterilized or recycled . having described preferred embodiments of a nail protector and method ( which are intended to be illustrative and not limiting ), it is noted that modifications and variations can be made by persons skilled in the art in light of the above teachings . it is therefore to be understood that changes may be made in the particular embodiments disclosed which are within the scope and spirit of the invention as outlined by the appended claims . having thus described aspects of the invention , with the details and particularity required by the patent laws , what is claimed and desired protected by letters patent is set forth in the appended claims .	0
referring to fig1 , in an embodiment , the method of manufacturing the reverse conducting insulated gate bipolar transistor is provided , which includes the following steps . in step s 111 , an n - type substrate 110 is prepared . as shown in fig2 , the n - type substrate 110 is an n - type silicon substrate . in step s 112 , a gate oxide layer 121 is grown at a front side of the n - type substrate 110 . as shown in fig3 , the thickness of the gate oxide layer 121 is from 600 angstroms to 1500 angstroms . in step s 113 , a polysilicon gate 122 is deposited on the gate oxide layer 121 , as shown in fig3 . in step s 114 , a p well 123 is formed on the n - type substrate 110 by photoetching , etching and ion - implanting processes ( referring to fig5 ). referring to fig4 , an implantation window of the p well 123 is formed by selectively etching the polysilicon gate 122 and the gate oxide layer 121 by the photoetching process . referring to fig5 , a p - type impurity is implanted to the implantation window of the p well 123 by the self - aligned implantation process , and the p well 123 is formed by a drive - in process . in step s 115 , an n + region 124 and a front side p + region 125 are formed in the p well 123 by photoetching and ion - implanting processes ( referring to fig7 ). referring to fig6 , ions are selectively implanted to the p well 123 by the photoetching process , and the n + region 124 is formed by the drive - in process . referring to fig7 , ions are selectively implanted to the p well 123 by the photoetching process , and the front side p + region 125 is formed by the drive - in process . the n + region 124 is mainly configured as an emitter of the reverse conducting insulated gate bipolar transistor . in step s 116 , a dielectric layer 126 is deposited at the front side of the n - type substrate 110 . as shown in fig8 , the dielectric layer 126 is made of silicon dioxide and boro - phospho - silicate glass . in step s 117 , a protecting layer 127 is deposited on the dielectric layer 126 . as shown in fig9 , the protecting layer is made of silicon nitride . in step s 118 , the n - type substrate 110 is ground by a back side grinding process . in step 118 , the n - type substrate 110 is ground to the required thickness . in step s 121 , a back side p + region 131 is formed by implanting a p - type impurity to a back side of the n - type substrate 110 , as shown in fig1 . in step s 122 , a trench 132 is formed at the back side of the n - type substrate 110 by photoetching and etching processes . as shown in fig1 , in the embodiment , the trench 132 formed at the back side of the n - type substrate 110 is of a rectangle shape . of course , the trench 132 formed at the back side of the n - type substrate 110 is of a circle , an oval , a trapezium and other appropriate shapes . when the trench 132 formed at the back side of the n - type substrate 110 is of a rectangle shape , a depth of the trench 132 is from 1 to 20 μm , a width thereof is from 1 to 30 μm , and a distance between two adjacent trenches 132 is from 50 to 300 μm . in step s 123 , the trench 132 is filled by depositing polysilicon at the back side of the n - type substrate 110 , and the polysilicon at an area outside of the trench 132 is etched . as shown in fig1 , in step s 123 , the reverse conducting diode is formed by filling polysilicon in the trench 132 . the parameters of the reverse conducting diode at the back side of the manufactured reverse conducting insulated gate bipolar transistor can be adjusted by adjusting the doping concentration of polysilicon in the trench 132 , so that the difficulty of the adjusting process is low and it is easy to control the process . therefore , the manufacturing difficulty of the reverse conducting insulated gate bipolar transistor can be reduced . of course , the parameters of the reverse conducting diode at the back side of the reverse conducting insulated gate bipolar transistor can be also adjusted by adjusting a width and a depth of the trench 132 , or by adjusting the doping concentration of polysilicon in the trench 132 and the width and the depth of the trench 132 at the same time . therefore , the difficulty of the adjusting process of the reverse conducting insulated gate bipolar transistor can be reduced , and then the manufacturing difficulty thereof is reduced . in the embodiment , the polysilicon deposited in the trench 132 formed at the back side of the n - type substrate 110 is n - type polysilicon . the doping concentration of the polysilicon deposited in the trench 132 is 1e17 to 1e21 cm − 3 . in step s 124 , the protecting layer 127 at the front side of the n - type substrate is removed , as shown in fig1 . in step s 125 , a contact hole for shorting the n + region 124 and the front side p + region 125 is formed by selectively etching the dielectric layer 126 , and a front side metal layer 128 is formed . as shown in fig1 , from the manufacturing flow of the reverse conducting insulated gate bipolar transistor described above , it can be understood that step s 122 and step s 123 are performed after performing step s 116 . in other words , forming the trench 132 at the back side of the n - type substrate 110 and depositing the polysilicon in the trench 132 are performed after performing depositing the dielectric layer 126 at the front side of the n - type substrate 110 rather than after performing the whole front side process of the reverse conducting insulated gate bipolar transistor . such a manufacturing method has the following advantages . firstly , after the p - type impurity is implanted at the back side of the n - type substrate 110 in step s 121 , the following front side thermal processes such as the hole reflow process ( the hole reflow process is in forming the contact hole for shorting the n + region 124 and the front side p + region 125 by selectively etching the dielectric layer 126 and forming a front side metal layer 128 of step s 125 , and the temperature of the step s 125 is about 850 degrees centigrade ) and so on are performed . the activity of the p - type impurity at the back side of the n - type substrate 110 is very high without performing the annealing process individually . therefore , the step of the thermal annealing of the p - type impurity at the back side of the n - type substrate 110 can be omitted . further , the polysilicon in the trench 123 at the back side of the n - type substrate 110 and the polysilicon of the front side are processed separately , thus easily controlling the doping concentration of the polysilicon . in step s 126 , a passivation layer 129 is deposited at the front side of the n - type substrate 110 . as shown in fig1 , here , a pad area is formed by performing the etching process . in step s 127 , a back side metal layer 133 is formed by performing a back side metalized process at the back side of the n - type substrate 110 . in the embodiment , from the n - type substrate to an external , the back side metal layer 133 at the back side of the n - type substrate 110 comprises aluminum , titanium , nickel and silver , which are laminated in that order . in other words , the outermost layer is metal silver . in step s 128 , a carrier lifetime at a partial area 111 in the n - type substrate 110 is controlled by a local radiation technique . as shown in fig1 , in the embodiment , the local radiation technique radiates the n - type substrate 110 by using electron or proton to control the life of the carrier at a partial area 111 in the n - type substrate 110 . therefore , manufacturing of the reverse conducting insulated gate bipolar transistor is completed . the method of manufacturing the reverse conducting insulated gate bipolar transistor described above uses polysilicon for filling the trench at the back side of the reverse conducting insulated gate bipolar transistor . thus , the parameters of the reverse conducting diode at the back side of the reverse conducting insulated gate bipolar transistor can be controlled by only precisely controlling the doping concentration of polysilicon , resulting in a lower requirement of controlling the process . therefore , the method of manufacturing the reverse conducting insulated gate bipolar transistor has a lower requirement of controlling the manufacturing process , and a less difficulty of manufacturing . although the invention is illustrated and described herein with reference to specific embodiments , the invention is not intended to be limited to the details shown . rather , various modifications may be made in the details within the scope and range of equivalents of the claims and without departing from the invention .	7
a blank used to construct display modules for a foldable shelf display according to the present invention are depicted in fig1 and 2 generally at 10 and 20 , respectively . preferably , the blanks are made from cardboard stock having sufficient rigidity to maintain their shape yet remain light in weight . blank 10 comprises a series of wall panels 12 , 14 , 16 and 18 connected end to end foldably relative to each other about lines 21 , 22 , and 24 that may be perforated , scored , or otherwise weakened so that folding of the panels relative to each other occurs in a predetermined fashion . wall panels 14 and 16 when foldably aligned cooperatively provide a single rear wall panel 15 , as illustrated in fig5 . to provide a continuous wall structure , the free ends 26 and 28 of the blank are joined . the end 26 has an integral flap 30 which is bendable about a fold line 32 relative to panel 12 . the end 28 has an integral flap 34 which is bendable about a fold line 36 relative to panel 18 . an adhesive 38 of a type known to those skilled in the art is used to facially mate the inwardly folded flap 30 on panel 12 with the inwardly folded flap 34 on panel 18 such that the wall panels cooperatively form the continuous wall structure and bound a triangulated interior storage space 40 ( see fig5 ). a pair of flaps 42 and 44 are struck from and remain integral with side wall panel 12 , and a pair of flaps 46 and 48 are struck from and remain integral with wall panel 18 . flap 42 comprises a shelf panel 42a bendable about a fold line 42b . a free edge 42c has an integral marginal edge portion 42d which is bendable about a fold line 42e and has a notch 42f formed therein to define a tab 42g on the flap 42 . fold line 42b is preferably downwardly inclined with respect to fold line 21 , and shelf panel 42a is angularly cut at 42h for purposes later to be discussed . bending of flap 42 about fold line 42b establishes a generally rectangular opening 43 in panel 12 . similarly , flap 44 comprises a shelf panel 44a bendable about a fold line 44b . a free edge 44c has an integral marginal edge portion 44d which is bendable about a fold line 44e and has a notch 44f formed therein to define a tab 44g on the flap 44 . again , fold line 44b is preferably downwardly inclined with respect to fold line 21 , and shelf panel 42a is angularly cut at 44h . bending of flap 44 about fold line 44b establishes a generally rectangular opening 45 in panel 12 . flap 46 on side wall panel 18 comprises a shelf panel 46a bendable about a fold line 46b . a free edge 46c has an integral panel 46d which is bendable about a fold line 46e and has a notch 46f formed therein to define a tab 46g on the flap 46 . fold line 46b is downwardly inclined with respect to fold line 24 , and shelf panel 46a is angularly cut at 46h . bending of flap 46 about fold line 46b establishes a generally rectangular opening 47 in side wall panel 18 . similarly , flap 48 comprises a shelf panel 48a bendable about a fold line 48b . a free edge 48c has an integral panel 48d which is bendable about a fold line 48e and has a notch 48f formed therein to define a tab 48g on the flap 48 . again , fold line 48b is downwardly inclined with respect to fold line 24 , and shelf panel 48a is angularly cut at 48h . bending of flap 48 about fold line 48b establishes a generally rectangular opening 49 in side wall panel 18 . the steps for converting a display module from the flattened state illustrated in fig1 to a display state illustrated in fig8 are demonstrated in fig6 and 7 . as described above , initially the flap 30 on panel 12 is inwardly folded and facially mated with the inwardly folded flap 34 on panel 18 by means of a suitable adhesive 38 to form an upper display module 50 defining triangulated interior display or storage space 40 . integral panels 42d and 46d are then folded substantially 90 degrees about fold lines 42e and 46e , respectively , and the flaps 42 and 46 are inwardly folded substantially 90 degrees about fold lines 42b and 46b , respectively , to facially mate panels 42d and 46d . because of the downward inclination of fold lines 42b and 46b pointed out above , panels 42a and 46a each swing arcuately and slightly rearwardly to position the angular cuts at 42h and 46h adjacent rear wall panel 15 . notches 42f and 46f of tabs 42g , 46g are then engaged in an opening or slot 52 formed in rear wall panel 15 such that tabs 42g and 46g project through the rear panel to secure and support flaps 42 and 46 in juxtaposed relationship with one another to define a first shelf 54 slightly rearwardly inclined within the triangulated storage space 40 for placement of articles to be displayed . when the tabs are thus engaged , the angular cuts at 42h , 46h are colinear and braced against the rear wall panel 15 in close frictional engagement therewith , as shown in fig8 . as shown in fig1 the lower flap 44 is substantially identical to flap 42 in structure and orientation ; and the lower flap 48 is substantially identical to flap 46 in structure and orientation . thus in a manner similar to that described in relation to flaps 42 and 46 , integral panels 44d and 48d are folded substantially 90 degrees about fold lines 44e and 48e , respectively , and the flaps 44 and 48 are inwardly folded substantially 90 degrees about fold lines 44b and 48b , respectively , to facially mate panels 44d and 48d . notches 44f and 48f engage an opening or slot 56 formed in rear wall panel 15 such that tabs 44g and 48g project through the rear panel to secure and support flaps 44 and 48 in juxtaposed relationship with one another to define a second shelf 58 beneath first shelf 54 . again , the panels 44a and 48a each swing arcuately and slightly rearwardly to position the angular cuts 44h and 48h against the rear wall panel 15 in a close bracing relationship to rigidify the continuous wall structure . referring to fig2 blank 20 is generally similar to blank 10 and has a series of wall panels 62 , 64 , 66 and 68 connected end to end foldably relative to each other about lines 70 , 72 , and 74 that may be perforated , scored , or otherwise weakened so that folding of the panels relative to each other occurs in a predetermined fashion . wall panels 64 and 66 cooperatively provide a single rear wall panel 65 . to provide a continuous wall structure , the free ends 76 and 78 of the blank are joined . the end 76 has an integral flap 80 which is bendable about a fold line 82 relative to panel 62 . the end 78 has an integral flap 84 which is bendable about a fold line 86 relative to panel 68 . a common adhesive 88 is used to secure the facially mating of inwardly folded flap 80 on panel 62 with the inwardly folded flap 84 on panel 68 to form a triangulated interior display or storage space . a pair of similar flaps 92 and 94 are struck from and remain integral with wall panel 62 , and a pair of similar flaps 96 and 98 are struck from a remain integral with wall panel 68 . these flaps 92 , 94 , 96 , 98 are similar respectively to flaps 42 , 44 , 46 , 48 in structure , orientation and function . flap 92 comprises a shelf panel 92a bendable about a fold line 92b . a free edge 92c has an integral panel 92d which is bendable about a fold line 92e and has a notch 92f formed therein to define a tab 92g on the flap 92 . bending of flap 92 about fold line 92b establishes a generally rectangular opening 93 in panel 62 . similarly , flap 94 comprises a shelf panel 94a bendable about a fold line 94b . a free edge 94c has an integral panel 94d which is bendable about a fold line 94e and has a notch 94f formed therein to define a tab 94g on the flap 94 . bending of flap 94 about fold line 94b establishes a generally rectangular opening 95 in panel 62 . flap 96 comprises a shelf panel 96a bendable about a fold line 96b . a free edge 96c has an integral panel 96d which is bendable about a fold line 96e and has a notch 96f formed therein to define a tab 96g on the flap 96 bending of flap 96 about fold line 96b establishes a generally rectangular opening 97 in panel 68 . similarly , flap 98 comprises a shelf panel 98a bendable about a fold line 98b . a free edge 98c has an integral panel 98d which is bendable about a fold line 98e and has a notch 98f formed therein to define a tab 98g on the flap 98 . bending of flap 98 about fold line 98b establishes a generally rectangular opening 99 in panel 68 . each of the flaps 92 , 94 , 96 , 98 have angular cuts at 92h , 94h , 96h and 98h for purposes previously described . formed along fold line 72 between wall panels 64 and 66 are a pair of spaced apart slots or openings 100 and 102 . an upwardly opening slot 104 is formed in alignment with the openings 100 and 102 and communicates with an edge 106 of the blank 20 . a foldable lip 108 is joined to panel 62 about a fold line 110 ; a foldable lip 112 is joined to rear wall panel 65 about a fold line 114 ; and a foldable lip 116 is joined to wall panel 68 about a fold line 118 . as may be appreciated from the foregoing , the steps for converting a display module from the flattened state illustrated in fig2 to a display state illustrated in fig8 are substantially identical to those described above with respect to upper display module 50 . initially the flap 80 on panel 62 is inwardly folded and facially mated with the inwardly folded flap 84 on panel 68 by means of a suitable adhesive 88 to form a lower display module 120 . as will be shown , display module 120 is a lower display module . lip portions 108 , 112 , and 116 are upwardly folded about fold lines 110 , 114 , and 118 , respectively , to define a stable platform upon which the module is supported . integral panels 92d and 96d are then folded substantially 90 degrees about fold lines 92e and 96e , respectively , and the flaps 92 and 96 are inwardly folded substantially 90 degrees about fold lines 92b and 96b , respectively , to facially mate panels 92d and 96d . notches 92f and 96f engage opening 100 such that tabs 92g and 96g project through the rear panel to secure and support flaps 92 and 96 in juxtaposed relationship with one another to define a first shelf 122 within the display module . similarly , integral panels 94d and 98d are folded substantially 90 degrees about fold lines 94e and 98e , respectively , and the flaps 94 and 98 are inwardly folded substantially 90 degrees about fold lines 94b and 98b , respectively , to facially mate panels 94d and 98d . notches 94f and 98f engage opening 102 such that tabs 94g and 98g project through the rear panel to secure and support flaps 94 and 98 in juxtaposed relationship with one another to define a second shelf 124 beneath first shelf 122 . as illustrated in fig8 upper display module 50 and lower display module 120 are arranged in stacked relation to define a four - shelf display tower . tabs 42g and 46g projecting through the rear panel of display module 50 are aligned with slot 104 formed in upper edge 106 of display module 120 , and inwardly folded flaps 30 and 34 ( fig5 ) are aligned with a notch 126 ( fig8 ) formed in a support pillar 128 extending vertically between wall panels 62 and 68 . upper display module is moved downwardly into telescoping engagement with the lower display module , such that tabs 42g and 46g are received in slot 104 in rear wall panel 15 and flaps 30 and 34 are received forwardly in the notch 126 to rigidify the stacked arrangement fore and aft . referring to fig3 a shelf blank is depicted generally at 130 as having a pair of bendable side walls 132 and 134 and a perpendicular rear wall 136 . side wall 132 and 134 are foldable about parallel fold lines 138 and 140 , respectively , and flank a platform 142 . a foldable tab 133 is formed at one end of side wall 132 , and a foldable tab 135 is formed at one end of side wall 134 . rear wall 136 extends between the side wall panels and is bendable about a fold line 144 . a pair of front edge panels 146 and 148 are formed integrally with platform 142 and extend between side wall panels 132 and 134 . front edge panel 146 has a series of spaced apart teeth 150 which are aligned with corresponding openings 152 formed in platform 142 . the steps for converting a removable display tray from the flattened state illustrated in fig3 to a display state illustrated in fig9 can be summarized as follows . side walls 132 and 134 and rear wall 136 are upwardly folded to define a generally upright container 138 . corner portions 154 and 156 intermediate the side walls and the rear wall and tabs 133 and 135 on the side wall panels are inwardly folded such that the outer edges of the container retain a substantially rectangular contour . front edge panels 146 and 148 are then upwardly folded to define a triangular lip 158 along the front edge of the container , with the teeth 150 of panel 146 engaging the openings 152 and the triangular lip securing the tabs 133 and 135 to prohibit unfolding of the tray . fig1 illustrates an assembled display device according to the present invention having a plurality of removable trays 160 positioned therewithin . each tray is supported on a shelf formed within the triangulated storage space by the inwardly folded flaps struck from opposite side wall panels as previously described , and partially extends through the substantially rectangular openings formed in opposite side wall panels by the inwardly folded flaps . in order to enhance the engagement of the trays with the display device , each of the flaps 42 , 44 , 46 , and 48 on upper display module 50 and each of the flaps 92 , 94 , 96 , and 98 on lower display module have an integral triangular portion 162 , such that the openings formed in the wall panels due to the inward folding of the flaps include a congruent triangular notch 164 extending into the support pillar 128 . when each of the trays 160 is inserted in the display device , as illustrated in fig1 and fig1 , the triangular notches 164 receive the triangular lip 158 formed on each tray and securely engage the forward end of the tray . after engaging the lip 158 , each tray is lowered so that its rear wall 136 makes a close , firm frictional fit with the rear wall panel ( such as 15 , 65 ) to provide an interior bracing function fore and aft between the front pillar 128 and the rear wall panel . note also that the bracing function is enhanced because tray side walls 132 , 134 make a close fit rearwardly between opposite side wall panels adjacent the rear wall panel ( fig1 ). thus the trays will not become inadvertently separated from the display , yet the trays may be easily removed to replenish articles to be displayed . in a modification of the exemplary embodiment , fig1 and 12 illustrate a wall blank 166 including a number of interconnected wall panels 167 , 168 and 169 for defining an upper display module 172 with foldable flaps 170 , generally as previously described . wall blank 166 has a plurality of circular apertures 174 formed parallel to a top edge 176 and in vertical alignment with the flaps . the apertures advantageously position articles , such as cylindrical plastic containers or cans 178 , for display adjacent the display trays . in an alternate embodiment , and as shown in fig1 - 15 , a blank 210 comprises a series of wall panels 212 , 214 , 216 , 218 and 220 connected end to end foldably relative to each other about lines 222 , 224 , and 226 and 228 , respectively . to provide a continuous wall structure , the free ends 230 and 232 of the blank are joined . the end 230 has an integral flap 234 which is bendable about a fold line 236 relative to panel 212 . an adhesive 38 of a type known to those skilled in the art is used to facially mate the inwardly folded flap 234 on panel 212 with the free end 232 of panel 220 ( see fig1 ). as in the exemplary embodiment described above , a plurality of flaps 238 are struck from and remain integral with the wall blank and are inwardly folded to define shelves within the display module . a pair of complementary wall blanks are used to form an upper display module 240 and a lower display module 242 , which may be interconnected by means of previously described tabs and notches ( not shown in fig1 ) to form a stacked display device 244 for positioning a number of removable trays 246 . an important feature of the alternate embodiment of fig1 - 15 lies in the front panel 248 formed between the fold lines 222 and 224 . circular apertures 250 are formed in the front panel and allow for the display of generally cylindrical articles 252 in combination with the articles displayed on the trays 246 . they trays 246 are preferably identical to trays formed from previously described tray blank 130 and perform the same functions . it will be understood that the invention may be embodied in other specific forms without departing from the spirit or central characteristics thereof . the present examples and embodiments , therefore , are to be considered in all respects as illustrative and not restrictive , and the invention is not to be limited to the details given herein .	0
with regard to aspects of the invention any ang ii antagonist can be suitable , unless otherwise specified , e . g ., the sartans such as candesartan , eprosartan , irbesartan , losartan , telmisartan , valsartan , olmesartan and tasosartan mentioned hereinbefore , preferably losartan or telmisartan , most preferred telmisartan { 4 ′-[ 2 - n - propyl - 4 - methyl - 6 -( 1 - methyl - benzimidazol - 2 - yl ) benzimidazol - 1 - ylmethyl ] biphenyl - 2 - carboxylic acid } and the pharmaceutically acceptable salts thereof , furthermore , any ace inhibitor can be used with regard to aspects of the invention mentioned hereinbefore , unless otherwise specified , e . g ., benazepril , captopril , ceronapril , enalapril , fosinopril , imidapril , lisinopril , moexipril , quinapril , ramipril , trandolapril , and perindopril , preferably captopril , enalapril , lisinopril and ramipril , most preferred ramipril . in a preferred embodiment of the method - of - treatment aspect ramipril is co - administered with an ang ii antagonist . in a second preferred embodiment of the method - of - treatment aspect an ace inhibitor is co - administered with telmisartan . in a third preferred embodiment of the method - of - treatment aspect ramipril is co - administered with telmisartan . co - administration of an ang ii antagonist and an ace inhibitor is meant to include administration sequential in time or simultaneous administration , the simultaneous administration being preferred . for sequential administration , the ang ii antagonist can be administered before or after administration of the ace inhibitor . the active compounds can be administered orally , bucally , parenterally , by inhalation spray , rectally or topically , the oral administration being preferred . parenteral administration may include subcutaneous , intravenous , intramuscular and intrasternal injections and infusion techniques . the active compounds can be orally administered in a wide variety of different dosage forms , i . e ., they may be formulated with various pharmaceutically acceptable inert carriers in the form of tablets , capsules , lozenges , troches , hard candies , powders , sprays , aqueous suspensions , elixirs , syrups , and the like . such carriers include solid diluents or fillers , sterile aqueous media and various non - toxic organic solvents , etc . moreover , such oral pharmaceutical formulations can be suitably sweetened and / or flavored by means of various agents of the type commonly employed for such purposes . in general , the compounds of this invention are present in such oral dosage forms at concentration levels ranging from about 0 . 5 % to about 90 % by weight of the total composition , in amounts which are sufficient to provide the desired unit dosages . other suitable dosage forms for the compounds of this invention include controlled release formulations and devices well known to those who practice in the art . for purposes of oral administration , tablets containing various excipients such as sodium citrate , calcium carbonate and calcium phosphate may be employed along with various disintegrants such as starch and preferably potato or tapioca starch , alginic acid and certain complex silicate , together with binding agents such as polyvinylpyrrolidone , sucrose , gelatin and acacia . additionally , lubricating agents such as magnesium stearate , sodium lauryl sulfate and talc or compositions of a similar type may also be employed as fillers in soft and hard - filled gelatin capsules ; included lactose or milk sugar as well as high molecular weight polyethylene glycols . when aqueous suspensions and / or elixirs are desired for oral administration , the essential active ingredient therein may be combined with various sweetening or flavoring agents , colouring matter or dyes and , if so desired , emulsifying agents and / or water , ethanol , propylene glycol , glycerin and various like combinations thereof . for purposes of parenteral administration , solutions of the compounds in sesame or peanut oil or in aqueous propylene glycol may be employed , as well as sterile aqueous solutions of the corresponding pharmaceutically - acceptable salts . such aqueous solutions should be suitably buffered if necessary , and the liquid diluent rendered isotonic with sufficient saline or glucose . these particular aqueous solutions are especially suitable for intravenous , intramuscular and sub - cutaneous injection purposes . in this connection , the sterile aqueous media employed are readily obtained by standard techniques well known to those skilled in the art . for instance , distilled water is ordinarily used as the liquid diluent and the final preparation is passed through a suitable bacterial filter such as a sintered glass filter or a diatomaceous - earth or unglazed porcelain filter . preferred filters of this type include the berkefeld , the chamberland and the asbestos disk - metal seitz filter , wherein the fluid is sucked into a sterile container with the aid of a suction pump . the necessary steps should be taken throughout the preparation of these injectable solutions to insure that the final products are obtained in a sterile condition . for purposes of transdermal administration , the dosage form of the particular compound or compounds may include , by way of example , solutions , lotions , ointments , creams , gels , suppositories , rate - limiting sustained release formulations and devices therefor . such dosage forms comprise the particular compound or compounds and may include ethanol , water , penetration enhancer and inert carriers such as gel - producing materials , mineral oil , emulsifying agents , benzyl alcohol and the like . several ang ii inhibitors are already on the market and can be used for administration , e . g ., micardis ®, lorzaar ®, cozaar ®, lortaan ®, losaprex ®, neo - lotan ® or oscaar ®, approvel ®, karvea ®, diovan ®, atacand ®, blopress ® and teveten ®. also several ace - inhibitors are already on the market and can be used for administration , e . g ., briem ®, cibacen ®, cibacne ®, lotensin ®, dynacil ®, elidiur ®, fosinorm ®, fositen ®, fozitec ®, monopril ®, staril ®, tensozide ®, novaloc ®, tanapril ®, fempress ®, perdix ®, univasc ®, accupril ®, accuprin ®, accupro ®, acequin ®, acuitel ®, korec ®, quinazil ®, xanef ®, pres ®, acerbon ®, lopirin ®, tensobon ®, delix ® or vesdil ®. the ace inhibitor may be administered in a daily dosage of 1 . 25 mg ( or 0 . 018 mg / kg , based on a person of 70 kg ) to 450 mg ( 6 . 429 mg / kg ) orally and of about 20 mg ( 0 . 286 mg / kg ) parenterally , preferably of 5 mg ( 0 . 071 mg / kg ) to 100 mg ( 1 . 429 mg / kg ) orally . particularly preferred is an oral daily dosage of 2 . 5 mg ( 0 . 036 mg / kg ) to 10 mg ( 0 . 143 mg / kg ). the ang ii antagonist may be administered in a daily dosage of 10 mg ( or 0 . 143 mg / kg , based on a person of 70 kg ) to 500 mg ( 7 . 143 mg / kg ) orally and of about 20 mg ( 0 . 286 mg / kg ) parenterally , preferably of 20 mg ( 0 . 286 mg / kg ) to 100 mg ( 1 . 429 mg / kg ) orally . particularly preferred is an oral daily dosage of 40 mg ( 0 . 571 mg / kg ) to 80 mg ( 1 . 143 mg / kg ). in all administration modes and dosages mentioned hereinbefore the preferred ace inhibitor is ramipril and the preferred ang ii antagonist is telmisartan . in the most preferred embodiment ramipril is administered simultaneously in a daily dosage of about 10 mg together with telmisartan in a daily dosage of about 80 mg via the oral route . pharmaceutical compositions comprising one ace inhibitor in an amount of 1 . 25 mg to 450 mg and one ang ii antagonist in an amount of 10 mg to 500 mg in single dosage units , optionally together with one or more pharmaceutically acceptable diluents and / or carriers , could be used for the method of treatment aspect of the invention . for instance , pharmaceuticals comprising one ace inhibitor selected from benazepril , captopril , ceronapril , enalapril , fosinopril , imidapril , lisinopril , moexipril , quinapril , ramipril , trandolapril and perindopril in an amount of 1 . 25 mg to 100 mg and one ang ii antagonist selected from candesartan , eprosartan , irbesartan , losartan , telmisartan and valsartan , olmesartan , tasosartan in an amount of 20 to 100 mg in single dosage units , optionally together with one or more pharmaceutically acceptable diluents and / or carriers would be suitable for the method of treatment according to the invention . the most preferred pharmaceutical compositions comprise as ace inhibitor ramipril in an amount of 1 . 25 mg to 100 mg and as ang ii antagonist telmisartan in an amount of 20 mg to 100 mg , in single dosage units , optionally together with one or more pharmaceutically acceptable diluents and / or carriers . especially preferred pharmaceutical compositions comprise as ace inhibitor ramipril in an amount of about 10 mg and as ang ii antagonist telmisartan in an amount of about 80 mg in single dosage units , optionally together with one or more pharmaceutically acceptable diluents and / or carriers . as already mentioned above the present invention also provides the use of an ang ii antagonist for manufacture of a pharmaceutical composition for the treatment of the human or non - human mammalian body for treating the indications mentioned hereinbefore when used in combination with an ace inhibitor . this use aspect is meant to include the manufacture of all pharmaceutical compositions mentioned hereinbefore .	0
as used herein the term &# 34 ; c 1 - c 4 alkyl &# 34 ; refers to a saturated straight or branched chain hydrocarbon radical of one to four carbon atoms . included within the scope of this term are methyl , ethyl , n - propyl , isopropyl , n - butyl , isobutyl and the like . as used herein the terms &# 34 ; halo &# 34 ;, &# 34 ; halogen &# 34 ; or &# 34 ; halide &# 34 ; refer to a chlorine , bromine or iodine atom . as used herein the term &# 34 ; pfaudler reactor &# 34 ; refers to a glass lined steel reactor as appreciated by one of ordinary skill in the art . as used herein the term &# 34 ; baffle &# 34 ; refers to a fixed object placed in the reactor to increase the turbulence and thus improve mixing of the contents within the reactor . the process for preparing the starting material of formula ( ii ) is described generally in scheme i . all the substituents , unless otherwise indicated , are previously defined . the reagents and starting materials are readily available to one of ordinary skill in the art . ## str4 ## in scheme i , a compound of formula ( ii ) is prepared from a dihalo compound of formula ( iii ) under the following conditions . the dihalo compound of formula ( iii ) is combined with magnesium , clsir 1 r 2 r 3 and a suitable aromatic solvent under an inert atmosphere , such as nitrogen . it is preferred that all reagents and starting materials be essentially anhydrous . examples of a dihalo compound of formula ( iii ) are 1 , 3 - dibromobenzene , 1 , 3 - dichlorobenzene , 1 - chloro - 3 - bromobenzene , 1 , 3 - diiodobenzene , 1 - chloro - 3 - iodobenzene and 1 - bromo - 3 - iodobenzene , with the preferred dihalo compound of formula ( iii ) being 1 , 3 - dibromobenzene . the total number of equivalents of magnesium employed in the process of scheme i relative to the dihalo compound of formula ( iii ) is from about 0 . 9 eq to about 1 . 1 eq , with about 1 eq being preferred . in addition , magnesium suitable for grignard reactions is preferred , such as magnesium powder , magnesium granules , magnesium ribbon , magnesium turnings and the like . magnesium turnings are most preferred . the reaction vessel is fitted with an agitator , such as a retreat curve agitator . the agitator is set at a speed sufficient for good mixing . the total number of equivalents of clsir 1 r 2 r 3 employed in the process of scheme i relative to the dihalo compound of formula ( iii ) is from about 0 . 8 eq to about 1 . 2 eq , with about 1 . 1 eq being preferred . examples of clsir 1 r 2 r 3 are chlorotriethylsilane , chloro - tri - n - propylsilane , chloro - tri - n - butylsilane , chlorodimethylethylsilane , chlorodimethylisopropylsilane , chlorotrimethylsilane and the like . chlorotrimethylsilane is the preferred clsir 1 r 2 r 3 . the mass ratio of suitable aromatic solvent to dihalo compound of formula ( iii ) employed in the process of scheme i is from about 3 to about 10 , with about 4 . 6 being preferred . for example , as described in table 1 , batch # 2 , 810 lb of toluene are utilized with 176 lb of 1 , 3 - dibromobenzene resulting in a mass ratio of 4 . 6 ( 810 lb / 176 lb ). examples of a suitable aromatic solvent are benzene , ethylbenzene , xylene , diethylbenzene , toluene and the like . the preferred suitable aromatic solvent is toluene . the above mixture is heated at a temperature of from about 20 ° c . to about 80 ° c . the preferred temperature of the mixture is about 50 ° c . when the temperature of the mixture begins to fall , the addition of a suitable ether is initiated . examples of a suitable ether are diethyl ether , tetrahydropyran , tetrahydrofuran , and the like . the preferred suitable ethers are tetrahydropyran and tetrahydrofuran , with tetrahydrofuran being most preferred . the total number of equivalents of suitable ether employed in the process of scheme i relative to the dihalo compound of formula ( iii ) is from about 1 . 8 eq to about 4 eq , with about 2 . 5 eq of suitable ether being preferred . it is preferred that from about 2 % to about 15 % of the total amount of the suitable ether be added to the mixture in one portion initially , with about 10 % of the total amount of the suitable ether being the preferred initial amount added to the mixture . the remaining portion of the total amount of the suitable ether is then added at a rate of from about 0 . 15 eq / hour to about 2 eq / hour , with about 0 . 7 eq / hour to about 1 . 2 eq / hour being preferred and 1 . 13 eq / hour being the most preferred rate of addition of the suitable ether . the controlled rate of addition of the remaining portion of the total amount of the suitable ether allows the temperature of the reaction to be controlled and essentially maintained at the mixture temperature , such as the preferred temperature of 50 ° c . it is preferred that the temperature of the process of scheme i be maintained at about 50 ° c . during addition of the suitable ether . after addition of the total amount of suitable ether is complete , the reaction is allowed to stir for about 10 hours to about 15 hours at a temperature of from about 20 ° c . to about 70 ° c . with about 50 ° c . being the preferred temperature . the slurry is then cautiously added to water which is at a temperature of from about 5 ° c . to about 50 ° c ., with stirring . the compound of formula ( ii ) is then isolated and purified by techniques well known in the art , such as extractive methods , distillation , chromatography and the like . for example , the mixture is then stirred for about 10 minutes to about 1 hour . the phases are then separated and the organic phase is optionally subjected to a second water wash . the organic phase is then dried with a suitable drying agent , such as anhydrous magnesium sulfate , filtered and concentrated under vacuum to provide the compound of formula ( ii ) which can be further purified by techniques well known in the art such as chromatography and / or vacuum distillation . the process of the present invention is described in scheme ii . all the substituents , unless otherwise indicated , are previously defined . the reagents and starting materials are readily available to one of ordinary skill in the art . ## str5 ## in scheme ii , a suitable reaction vessel , such as a dry 200 gallon pfaudler reactor , fitted with a retreat curve agitator and a baffle , is charged with an excess of magnesium suitable for grignard reactions under an inert atmosphere , such as nitrogen . it is preferred that the suitable reaction vessel be charged with 1 . 0 equivalents of magnesium , with 1 . 05 equivalents of magnesium being most preferred . examples of magnesium suitable for grignard reactions are magnesium powder , magnesium granules , magnesium ribbon , magnesium turnings and the like . magnesium turnings are preferred . then about 10 equivalents of a suitable ether are added to the reactor . examples of a suitable ether are diethyl ether , tetrahydropyran , tetrahydrofuran , and the like . tetrahydrofuran is the preferred suitable ether . the suitable ether must be essentially anhydrous . it is preferred that the water content of the suitable ether not exceed 100 ppm of water . the mixture is heated at a temperature of about 30 ° c . to about 55 ° c ., with a preferred temperature of about 45 ° c . about 0 . 02 eq to about 0 . 10 eq of a suitable initiator , such as 1 , 2 - dibromoethane is then added to the mixture . it is preferred that about 0 . 04 eq of 1 , 2 - dibromoethane be added to the mixture at about 45 ° c . initiation occurs when an exotherm is observed subsequent to addition of the suitable initiator . when the temperature steadies at about 45 ° c ., one equivalent of a suitable 1 - halo - 3 - trialkylsilanyl - benzene of formula ( ii ) is added to the reaction vessel . the suitable 1 - halo - 3 - trialkylsilanyl - benzene is added slowly until an exotherm is indicated . the suitable 1 - halo - 3 - trialkylsilanyl - benzene is then added at a rate that maintains the temperature of the reaction below about 58 ° c ., preferably below 50 ° c . examples of suitable 1 - halo - 3 - trialkylsilanyl - benzenes are 1 - bromo - 3 - trimethylsilanyl - benzene , 1 - chloro - 3 - trimethylsilanyl - benzene , 1 - iodo - 3 - trimethylsilanyl - benzene , 1 - bromo - 3 - triethylsilanyl - benzene , 1 - bromo - 3 - tri - n - propylsilanyl - benzene , 1 - bromo - 3 - dimethylethylsilanyl - benzene , 1 - bromo - 3 - dimethylisopropylsilanyl - benzene , 1 - bromo - 3 - tri - n - butylsilanyl - benzene and the like . the preferred suitable 1 - halo - 3 - trialkylsilanyl - benzene is 1 - bromo - 3 - trimethylsilanyl - benzene . alternatively , one equivalent of a suitable 1 - halo - 3 - trialkylsilanyl - benzene of formula ( ii ) may be slowly added directly to the magnesium / suitable ether mixture in the reaction vessel with caution , without addition of a suitable initiator . however , extreme caution must be exercised when the suitable initiator is eliminated from the process , as addition of a large amount of the 1 - halo - 3 - trialkylsilanyl - benzene of formula ( ii ) prior to initiation of the exotherm can result in an uncontrollable reaction . after addition of the suitable 1 - halo - 3 - trialkylsilanyl - benzene is complete , the reaction mixture is maintained at a temperature of about 45 ° c . for about 2 hours to about 4 hours , with about 3 hours being preferred . the reaction mixture is then cooled to about - 12 ° c . to about 0 ° c ., with about 0 ° c . being preferred . an excess of lithium trifluoroacetate is then added to the reaction mixture at such a rate that the reaction temperature is maintained at less than about 10 ° c . it is preferred that about 1 . 3 eq of lithium trifluoroacetate be added to the reaction mixture , with about 1 . 1 eq being most preferred . in addition , it is preferred that about 1 . 1 eq of lithium trifluoroacetate be combined with about 10 eq of a suitable organic solvent in a suitable addition reactor , such as a dry 50 gallon glass - lined reactor and agitated at about 90 rpm for about 2 - 4 hours . examples of a suitable organic solvent are tetrahydrofuran , diethyl ether , tetrahydropyran , dioxane and the like . the preferred suitable organic solvent is tetrahydrofuran . it is most preferred that about 1 . 1 eq of lithium trifluoroacetate be combined with the suitable organic solvent . it is preferred that the suitable organic solvent / lithium trifluoroacetate solution be essentially anhydrous prior to addition to the reaction mixture . this can be achieved by drying the suitable ether / lithium trifluoroacetate solution over 3a molecular sieves until the water content of the solution is less than about 200 ppm . the solution is then added to the reaction mixture at such a rate that the reaction temperature is maintained at less than about 10 ° c . the reaction mixture is then agitated at about 12 ° c . for about 30 minutes . a suitable quench reactor , such as a 300 gallon pfaudler reactor fitted with a retreat curve agitator and a baffle is then charged with a suitable quench solution . examples of suitable quench solutions are aqueous hydrochloric acid , aqueous sulfuric acid , aqueous hydrochloric acid / heptane , water / 37 % hydrochloric acid / glacial acetic acid / heptane and the like . the preferred suitable quench solution is water / 37 % hydrochloric acid / glacial acetic acid / heptane . in addition , it is particularly preferred that the water / 37 % hydrochloric acid / glacial acetic acid / heptane quench solution have a composition by weight of about 73 % water , 2 % hydrochloric acid ( 37 %), 6 % glacial acetic acid and 19 % heptane . the suitable quench solution is cooled to less than 5 ° c . prior to addition of the reaction mixture . the reaction mixture is then added to the suitable quench solution at a rate that maintains the temperature of the quench reactor mixture at less than about 15 ° c . after the addition is complete , the 200 gallon reactor is rinsed with a suitable organic solvent , such as tetrahydrofuran and the organic rinse is added to the quench reactor . the mixture in the quench reactor is then agitated at about 15 ° c . for about 15 minutes . agitation is then stopped and the mixture is allowed to settle for about 40 minutes . the bottom aqueous layer is decanted out of the quench reactor . the upper organic layer is then transferred to a suitable reactor , such as a 200 gallon glass lined reactor which is used as an in - process holding tank . it is understood by one of ordinary skill in the art that if the starting material of formula ( ii ) used in scheme ii is contaminated with undesired organohalides , such as dihalobenzenes , for example 1 , 3 - dibromobenzene , 1 , 3 - dichlorobenzene , 1 - chloro - 3 - bromobenzene , 1 , 3 - diiodobenzene , 1 - chloro - 3 - iodobenzene and 1 - bromo - 3 - iodobenzene , an additional two equivalents of magnesium in step a and an additional two equivalents of lithium trifluoroactetate in step b must be used in the process of scheme ii for each equivalent of undesired dihalobenzene present in the starting material . for example , if the starting material consists of 1 mole of 1 - bromo - 3 - trimethylsilanyl - benzene contaminated with an additional 0 . 10 moles of 1 , 3 - dibromobenzene , then under the most preferred conditions 1 . 25 moles of magnesium must be used in step a and 1 . 30 moles of lithium trifluoroacetate must be used in step b . the amount of undesired dihalobenzene can be readily determined by techniques and procedures well known in the art , such as gas chromatography . as with any synthetic process , various undesired by - products are produced along with the desired compound . thus , it is preferred that the resulting crude material be purified to remove the undesired by - products . for example , the crude product of formula ( i ) can be purified following the novel extractive procedure set forth in scheme iii . all the substituents , unless otherwise indicated , are previously defined . the materials for extraction are readily available to one of ordinary skill in the art . ## str6 ## in step a , the decanted aqueous layer obtained in scheme ii , is reloaded into the quench reactor and extracted with a suitable organic solvent . examples of a suitable organic solvent are heptane , diethyl ether , hexane , toluene , xylene and the like . the preferred suitable organic solvent is heptane . the lower aqueous layer is decanted out of the quench reactor and the upper organic extract is combined with the first organic layer ( obtained in scheme ii ) in the 200 gallon reactor . the combined organic layers are concentrated under vacuum to a concentration of about 30 - 35 % of formula ( i ) compound by weight in the suitable organic solvent , such as heptane . in step b , the organic solution is washed 2 to 3 times with a methanol / water mixture wherein the methanol water mixture has a composition by volume of about 50 % methanol and 50 % water , with 3 washes being preferred . this washing step removes undesired by - products of formula ( iv ). in step c , the organic solution is extracted 3 to 7 times with a methanol / water mixture wherein the methanol / water mixture has a composition by volume of about 80 % methanol and 20 % water , with 5 extractions being preferred . step c results in extraction of compounds of formula ( i ) away from the undesired by - products of formula ( v ). the methanol / water extracts are then combined and concentrated under vacuum to a concentration of about 13 to 18 % of compound of formula ( i ) in solution ( at this concentration two phases result ). in step d , the concentrated methanol / water layer is then extracted 1 to 2 times with a suitable organic solvent . examples of a suitable organic solvent are heptane , diethyl ether , toluene , hexane and the like . heptane is the preferred suitable organic solvent . a total of 2 extractions are preferred . the organic extracts are then combined and concentrated under vacuum to provide the 1 -( 3 - trialkylsilylphenyl )- 2 , 2 , 2 - trifluoromethyl ethanone derivative of formula ( i ). the compound of formula ( i ) exists in equilibrium with the hydrate of formula ( ia ) and the hemiacetal of formula ( ib ) at various stages of the extraction and purification process described above . the equilibrium can be driven to essentially complete formation of formula ( i ) by techniques well known in the art , such as molecular sieves , distillation , azeotropic distillation and heating at various pressures . the ratio of the desired compound of formula ( i ) to the hydrate of formula ( ia ) and the hemiacetal of formula ( ib ) can be determined by one of ordinary skill in the art , such as by gas chromatography . the compound of formula ( i ) can be further purified , if necessary , by techniques well known to one of ordinary skill in the art , such as chromatography and / or distillation . the following examples present typical syntheses as described in schemes i and ii . these examples are understood to be illustrative only and are not intended to limit the scope of the present invention in any way . as used herein , the following terms have the indicated meanings : &# 34 ; ppm &# 34 ; refers to parts per million ; &# 34 ; g &# 34 ; refers to grams ; &# 34 ; mmol &# 34 ; refers to millimoles ; &# 34 ; l &# 34 ; refers to liters ; &# 34 ; ml &# 34 ; refers to milliliters ; &# 34 ; bp &# 34 ; refers to boiling point ; &# 34 ; mp &# 34 ; refers to melting point ; &# 34 ;° c .&# 34 ; refers to degrees celsius ; &# 34 ; mm hg &# 34 ; refers to millimeters of mercury ; &# 34 ; μl &# 34 ; refers to microliters ; &# 34 ; μg &# 34 ; refers to micrograms ; &# 34 ; μm &# 34 ; refers to micromolar ; &# 34 ; eq &# 34 ; refers to equivalents ; &# 34 ; min &# 34 ; refers to minutes ; &# 34 ; rpm &# 34 ; refers to revolutions per minute ; &# 34 ; thf &# 34 ; refers to tetrahydrofuran ; &# 34 ; litfa &# 34 ; refers to lithium trifluoroacetate ; and &# 34 ; lb &# 34 ; refers to pounds . scheme i ; a 500 ml round - bottomed , 3 necked , fluted flask with a thermowell is fitted with an addition funnel , mechanical stirrer , reflux condenser and thermocouple recorder . the atmosphere is flushed with nitrogen . magnesium ( 4 . 84 g , 0 . 199 mole ), chlorotrimethylsilane ( 45 . 9 g , 0 . 422 mole ), toluene ( 214 g ) and 1 , 3 - dibromobenzene ( 46 . 5 g , 0 . 197 mole ) are then added . the mixture is heated to 50 ° c . with a heat gun and then allowed to slowly cool . when the temperature starts to fall , tetrahydrofuran ( 38 . 1 g ) is added . the temperature continues to fall to 42 ° c . where it stabilizes and then begins to rise . the temperature is controlled at 50 °± 2 ° c . while the remaining tetrahydrofuran ( 342 . 9 g ) is added dropwise ( 1 drop every 5 to 8 seconds ) over a 2 hour period . when about 60 - 70 % of the tetrahydrofuran has been added the exotherm subsides and a fluffy solid forms . the remainder of the tetrahydrofuran is added rapidly without evidence of an exotherm . the mixture is then allowed to cool to room temperature overnight . the slurry is vacuum transferred to a one liter flask containing water heated to 50 ° c . producing a temperature increase . the mixture is stirred for 10 minutes and the phases are separated ( mixture temperature is 45 ° c . when separated ). the organic phase is washed with water ( 50 ml ), dried over anhydrous magnesium sulfate / sodium sulfate , filtered , concentrated under vacuum and distilled through a 40 theoretical plate concentric tube distillation column at 15 mm hg . the title compound is then collected at a temperature of from 94 ° c . to 105 ° c . to provide a colorless oil ( 32 . 7 g , 76 . 8 %). reverse - phase hplc ( high performance liquid chromatography ) analysis of the title compound can be performed utilizing a hitachi model l - 6200 gradient pump , a perkin - elmer diode array 235 detector , a spectra - physics model 4270 integrator , a hitachi model as - 2000 autosampler , and a rheodyne model 7125 injector equipped with a 20 μl sample loop and a 4 . 0 × 80 mm zorbax ods ( 5 μm particles ) column . the detector is set at 255 nm , the mobile phase is 90 : 10 acetonitrile / water and the flow rate is set at 2 ml / min resulting in a retention time ( rt ) for the title compound of about 0 . 92 to 0 . 95 minutes . preparative lc ( liquid chromatography ) of the title compound can be performed utilizing a gilson model 305 pump equipped with a gilson manometric module model 805 , a linear model uv - 106 ( 254 nm ) detector , a sargent - welch model srg - 2 chart recorder , and a rheodyne 7125 injector equipped with a 1 . 0 ml sample loop and an alltech 22 . 5 × 250 mm econosphere c 18 ( 10 μm particles ) column . the crude material is dissolved in acetonitrile prior to injection . the detector is set at 254 nm , the mobile phase can be 90 : 10 or 85 : 15 acetonitrile / water and the flow rate is set at 15 ml / min resulting in an rt range for the title compound of about 8 . 5 to 11 minutes . gas chromatographic analysis of the title compound can be performed utilizing a hewlett packard 5890a gas chromatograph , a hewlett packard 7573a autosampler fitted with a 10 μl syringe , a hewlett packard 7673 autosampler tray , a flame ionization detector , a pe - nelson accesschrom rev . 1 . 9 with model 941 a / d data system , a supelco spb - 1 30 m × 0 . 32 mm id column with 1 μfilm thickness ( cut from a 60 m column ) and helium as the carrier gas . the conditions used are a 10 psi column head pressure , a 105 ml / min split flow , a 1 . 8 ml / min column flow , 20 ml / min detector make up ( nitrogen ), 20 ml / min detector hydrogen flow , 300 ml / min detector air flow , detector range = 2 , injector temperature of 275 ° c . and a detector temperature of 300 ° c . the temperature gradient program used has an initial temperature of 60 ° c . that increases to 130 ° c . at a rate of about 16 ° c ./ min , it is then held at 130 ° c . for 12 min , and finally increased to 320 ° c . at a rate of about 22 ° c ./ min at which time the run is terminated . the retention time is approximately 16 min for 1 - bromo - 3 - trimethylsilanyl - benzene . example 1a provides the general procedure followed for 10 separate batches for the large scale preparation of 1 - bromo - 3 - trimethylsilanyl - benzene . following example 1a , table 1 provides the individual amounts of reagents and starting materials utilized and the results obtained for each of the 10 batches . scheme i , ; magnesium turnings ( 18 . 25 lb ) are loaded into a 200 gallon glass - lined reactor fitted with a retreat curve agitator . the reactor is sealed , pressure tested and purged with nitrogen . 1 , 3 - dibromobenzene ( 176 lb ) is then vacuum loaded into the reactor followed by vacuum loading of toluene ( 806 . 6 lb ). the agitator is set to 130 rpm in order to obtain good mixing . chlorotrimethylsilane ( 180 lb ) is then loaded into the reactor by adding nitrogen pressure to the cylinder of chlorotrimethylsilane and opening the cylinder to the reactor headspace . after loading the chlorotrimethylsilane , the transfer line is blown clear with nitrogen . the temperature control system of the reactor is set to maintain an internal reactor temperature of 50 ° c . when the internal temperature and jacket temperature of the reactor stabilize at 50 ° c ., tetrahydrofuran ( 14 lb ) is pumped into the reactor headspace . the temperature of the reactor is monitored to determine when the reaction ( exothermic ) starts . the reaction is determined to have started when the difference between the internal temperature of the reactor and the jacket temperature is greater than 5 °- 10 ° c . after the reaction starts , tetrahydrofuran ( 130 lb ) is pumped into the reactor at a rate of about 0 . 7 eq / hour to about 1 . 2 eq / hour . after addition of the tetrahydrofuran is complete , the reactor contents are agitated for an additional 10 - 15 hours at 50 ° c . the contents of the reactor are then transferred to a 300 gallon glass - lined reactor fitted with a pitched blade agitator and containing water ( about 100 gallons at 5 °- 10 ° c .). toluene ( about 20 lb ) is vacuum loaded into the original 200 gallon reactor and is used to flush the transfer line between the 200 gallon and 300 gallon reactors . the 300 gallon reactor is agitated for about one hour , agitation is then stopped and the contents are allowed to settle for about 30 - 60 minutes . the aqueous phase is then drained out of the 300 gallon reactor and water ( about 25 gallons ) is again added , followed by agitation for about 30 minutes . the agitation is then stopped , the contents are allowed to settle for about 30 - 90 minutes and the aqueous layer is drained out of the 300 gallon reactor . the organic phase is then drained to 55 gallon drums . the 300 gallon reactor is then pressure tested , purged with nitrogen and about 1600 - 2000 lb of the above organic solution from the 55 gallon drums is vacuum loaded into the reactor . the agitator is set at about 100 rpm and the jacket system set to hold the jacket temperature at 10 °- 20 ° c . above the internal temperature to begin distillation of the volatiles into a distillate receiver . as the level in the reactor decreases , additional organic solution from the 55 gallon drums is loaded until 5 batches have been loaded into the reactor . the distillation is continued until the internal temperature of the reactor reaches 68 °- 72 ° c . the jacket temperature is then set to about 25 ° c . and the vacuum is broken with nitrogen . when the internal temperature of the reactor is less then about 35 ° c ., the manway is opened and diatomaceous earth ( about 20 lb ) and magnesium sulfate ( about 20 lb ) are loaded into the reactor through the manway . the manway is then closed and the reactor is pressure tested and purged with nitrogen . the contents of the reactor are then drained into 55 gallon drums through a nutsche filter ( prepared by placing a new filter cloth in the bottom ) to provide the title compound . table 1__________________________________________________________________________summary of reaction conditions and % yield of 1 - bromo - 3 - trimethylsilanyl - benzene for ten individual batches following the procedure described inexample 1 foreach individual batch in an analogous manner . # 1 # 2 # 3 # 4 # 5 # 6 # 7 # 8 # 9 # 10 total__________________________________________________________________________magnesium ( lb ) 18 . 25 18 . 25 18 . 25 18 . 25 18 . 25 18 . 25 18 . 3 18 . 5 18 . 3 17 . 5 1823 - dibromobenzene ( lb ) 176 176 176 176 176 176 176 176 176 . 3 168 . 9 1753toluene ( lb ) 806 . 6 810 811 812 810 811 810 810 814 780 8075chlorotrimethylsilane ( lb ) 176 180 178 159 176 171 172 215 177 138 1742initial thf ( lb ) 28 14 14 14 14 14 14 14 14 . 1 13 . 3 153final thf ( lb ) 116 130 130 130 130 130 . 1 130 130 120 125 1271total thf ( lb ) 144 144 144 144 144 144 . 1 144 144 144 . 1 138 . 3 1434 . 5time for final thf 140 180 140 145 145 135 160 194 210 215addition ( min ) quench water ( gal ) 100 100 100 100 100 100 100 100 100 100 1000toluene flush ( lb ) 21 . 5 20 20 20 20 20 20 28 20 21 211water wash ( gal ) 25 25 25 25 25 25 25 25 25 25 250agitator speed ( rpm ) 130 . 4 130 . 8 130 110 110 135 133 135 132 . 5 127 % yield of 64 . 58 68 . 78 63 . 93 64 . 90 63 . 53 64 . 39 64 . 35 63 . 40 66 . 20 66 . 04 65 . o1 - bromo - 3 - trimethylsilanyl - benzene__________________________________________________________________________ scheme i ; 1 - chloro - 3 - trimethylsilanyl - benzene is prepared in a manner analogous to the procedure described in examples 1 and 1a utilizing chlorotrimethylsilane and 1 - chloro - 3 - bromobenzene as the dihalo compound of formula ( iii ). scheme i ; 1 - bromo - 3 - trimethylsilanyl - benzene is prepared in a manner analogous to the procedure described in examples 1 and 1a utilizing chlorotrimethylsilane and 1 - bromo - 3 - iodobenzene as the dihalo compound of formula ( iii ). scheme i ; 1 - chloro - 3 - trimethylsilanyl - benzene is prepared in a manner analogous to the procedure described in examples 1 and la utilizing chlorotrimethylsilane and 1 - chloro - 3 - iodobenzene as the dihalo compound of formula ( iii ). scheme i ; 1 - iodo - 3 - trimethylsilanyl - benzene is prepared in a manner analogous to the procedure described in examples 1 and 1a utilizing chlorotrimethylsilane and 1 , 3 - diiodobenzene as the dihalo compound of formula ( iii ). scheme i ; 1 - bromo - 3 - triethylsilanyl - benzene is prepared in a manner analogous to the procedure described in examples 1 and 1a utilizing 1 , 3 - dibromobenzene and chlorotriethylsilane as the clsir 1 r 2 r 3 compound . scheme i ; 1 - bromo - 3 - tri - n - propylsilanyl - benzene is prepared in a manner analogous to the procedure described in examples 1 and 1a utilizing 1 , 3 - dibromobenzene and chloro - tri - n - propylsilane as the clsir 1 r 2 r 3 compound . scheme i ; 1 - bromo - 3 - dimethylethylsilanyl - benzene is prepared in a manner analogous to the procedure described in examples 1 and 1a utilizing 1 , 3 - dibromobenzene and chlorodimethylethylsilane as the clsir 1 r 2 r 3 compound . scheme i ; 1 - bromo - 3 - dimethylisopropylsilanyl - benzene is prepared in a manner analogous to the procedure described in examples 1 and 1a utilizing 1 , 3 - dibromobenzene and chlorodimethylisopropylsilane as the clsir 1 r 2 r 3 compound . scheme i ; 1 - bromo - 3 - tri - n - butylsilanyl - benzene is prepared in a manner analogous to the procedure described in examples 1 and 1a utilizing 1 , 3 - dibromobenzene and chloro - tri - n - butylsilane as the clsir 1 r 2 r 3 compound . scheme ii ; a one liter , three necked round bottom flask fitted with a mechanical stirrer , temperature probe and nitrogen bubbler , is purged with nitrogen . magnesium turnings ( 11 . 9 g , 0 . 49 mol ) and anhydrous tetrahydrofuran ( 250 g ) are added . to this mixture is added 1 , 2 - dibromoethane ( 2 . 4 g , 0 . 0128 mol , dbe ) in one shot . an exotherm is detected almost immediately with the temperature rising to 29 ° c . when the temperature falls to 25 ° c ., 1 - bromo - 3 - trimethylsilanyl - benzene ( 80 . 63 g , 0 . 352 mol , 80 . 63 %) is added over 30 minutes . during the addition , the temperature again rises and is maintained at 50 °± 2 ° c . with an ice bath . after the addition is complete , the exotherm subsides and the mixture is then heated at 45 ° c . with stirring overnight . the temperature of the mixture is then lowered to 0 ° c . and a solution of lithium trifluoroacetate ( 352 g , 0 . 575 mol , 200 ppm water ) in tetrahydrofuran ( 250 g ) is added over 30 minutes . the mixture is then allowed to warm to room temperature . it is then vacuum transferred to a stirred mixture of water ( 583 g ), glacial acetic acid ( 51 g ), aqueous hydrochloric acid ( 27 g , 37 %) and heptane ( 142 g ) while maintaining the temperature at approximately 10 °- 15 ° c . after addition is complete , the mixture is allowed to warm to 20 ° c . the layers are then separated and the aqueous layer is extracted with heptane ( 50 g ). the organic layer and organic extract are combined and concentrated under vacuum ( 45 ° c ., 45 mmhg ) to a concentration of 38 . 5 %. this solution is then washed with methanol / water ( 50 / 50 , v / v , 4 × 185 g ). the solution is then extracted with methanol / water ( 80 / 20 , v / v , 5 × 185 g ). the combined extracts are partially concentrated under vacuum ( 45 ° c ., 45 mmhg ). the two phase mixture is then extracted with heptane ( 150 g ). the organic extract is then dried over anhydrous magnesium sulfate , filtered and concentrated under vacuum ( 45 ° c ., 45 mmhg ) to provide the title compound as a light yellow oil ( 78 . 2 g , 77 . 5 % overall yield ). the title compound can be further purified by distillation through a 40 theoretical plate concentric tube distillation column ( 94 °- 105 ° c ., 15 mmhg ) to provide the title compound as a colorless oil . example 11b provides the general procedure followed for 10 separate batches for the large scale preparation of 1 -( 3 - trimethylsilylphenyl )- 2 , 2 , 2 - trifluoromethyl ethanone . following example 11b , table 2 provides a summary of reaction conditions and % yield of 1 -( 3 - trimethylsilylphenyl )- 2 , 2 , 2 - trifluoromethyl ethanone for 10 individual batches following the procedure described in example 11b for each individual batch in an analogous manner . scheme ii ; a 200 gallon glass - lined pfaudler reactor fitted with a retreat curve agitator and a baffle ( designated reactor a ), and a 50 gallon glass - lined reactor ( designated reactor b ) are dried at 80 ° c . while pulling a vacuum and sweeping the reactors with nitrogen . magnesium turnings ( 15 . 2 lb ) are loaded into reactor a through the manway , followed by addition of tetrahydrofuran ( 390 lb ). the tetrahydrofuran is first sampled and analyzed for water content , with an upper limit of 100 ppm of water in the tetrahydrofuran being permitted . the agitator in reactor a is set to 100 rpm . the reactor a jacket is set for master / slave control with an internal temperature setpoint of 45 ° c . when the reactor a internal temperature steadies at about 45 ° c ., about 2 . 8 to 3 . 6 lb of 1 , 2 - dibromoethane are loaded into reactor a . the load line is flushed with 3 lb of tetrahydrofuran and the jacket temperature is monitored for the exotherm indicating reaction initiation . when the reaction initiates and the internal temperature of reactor a steadies at about 45 ° c ., 1 - bromo - 3 - trimethylsilanyl - benzene ( 6 to 8 lbs ) is loaded into reactor a . a nitrogen operated teflon diaphragm pump is used to control the addition of 1 - bromo - 3 - trimethylsilanyl - benzene to the reaction vessel . the jacket temperature is monitored for the exotherm indicating reaction initiation . when the reaction initiates , the remaining 1 - bromo - 3 - trimethylsilanyl - benzene ( 120 - 122 lb ) are loaded into reactor a maintaining the internal temperature at less than about 50 ° c . after addition is complete , the load line is flushed with tetrahydrofuran ( 5 lb ). the mixture is then maintained at a temperature of about 45 ° c . for approximately 3 hours . the mixture is then cooled to about 0 ° c . lithium trifluoroacetate ( about 88 lbs , litfa ) and tetrahydrofuran ( about 300 lb ) are loaded into reactor b and agitated at 90 rpm for about 2 - 4 hours . the lithium trifluoroacetate / tetrahydrofuran solution is then transferred to reactor a while maintaining the internal temperature in reactor a at less than about 10 ° c . the transfer is stopped as needed to maintain the reactor a internal temperature at less than about 10 ° c . after addition is complete , tetrahydrofuran ( about 64 lb ) is loaded into reactor b . this tetrahydrofuran rinse is then transferred to reactor a and the mixture is agitated at about 12 ° c . for about 30 minutes . a 300 gallon glass - lined pfaudler reactor ( designated reactor c ) fitted with a retreat curve agitator and a baffle is charged with a quench solution consisting of water ( about 751 lb ), 37 % aqueous hydrochloric acid ( about 22 lb ), glacial acetic acid ( 65 lb ) and heptane ( 190 lb ). the quench solution is cooled to less than 5 ° c . and the reaction mixture in reactor a is transferred to reactor c , maintaining the internal temperature of reactor c at less than about 15 ° c . after addition is complete , tetrahydrofuran ( about 60 lb ) is added to reactor a which is then transferred to reactor c . the mixture in reactor c is then agitated at about 15 ° c . for at least 15 minutes . agitation is then stopped and the solution is allowed to settle for at least 40 minutes . the bottom aqueous layer is decanted to drums . the upper organic layer is transferred to a 200 gallon glass lined reactor ( designated reactor d ) which is used as a distillate receiver and an in - process hold tank . the earlier removed aqueous layer is reloaded into reactor c and is extracted with heptane ( 100 lb ). the lower aqueous layer is drained to drums , and the upper organic layer is transferred to reactor d and combined with the first organic layer . the combined organic layers are concentrated at a vacuum at the pump inlet of about 25 mmhg with an internal temperature of 25 °- 30 ° c . and a jacket temperature of about 40 °- 45 ° c . the solution is concentrated to about 40 gallons . this concentrated solution is then transferred to reactor b and concentrated further to about 30 - 35 % title compound by weight in heptane . additional heptane is loaded as needed to achieve the desired weight percent of title compound in heptane . this organic solution is then washed three times with a mixture of methanol / water ( 50 / 50 , v / v , 180 lb ). the organic solution is then extracted five times with a mixture of methanol / water ( 80 / 20 , v / v , 190 lb ). the methanol / water extracts are combined and concentrated under vacuum of about 25 mmhg and an internal temperature of about 20 °- 25 ° c . to about 13 to 18 % of title compound in solution at which point two phases result . the concentrated methanol / water layer is extracted twice with heptane ( 250 lb ). the combined heptane extracts are then concentrated under vacuum to provide the title compound . the title compound can be further purified through distillation . for example , the title compound isolated above ( 436 lb ) is vacuum loaded into a 100 gallon glass - lined reactor which is the distillation vessel and reboiler . a 4 inch distillation column containing 4 feet of structure packing is connected to the head space of the distillation vessel and is equipped with a reflux splitter for either distillate reflux or collection . a 28 ft 2 hastalloy c tube heat exchanger is used as the condenser . a 50 gallon glass lined reactor is used as the distillate receiver . the distillation vessel agitator is set to about 80 rpm . the jacket temperature of the distillation vessel is set to 150 ° c . with a maximum temperature difference of 30 ° c . between the jacket and internal temperatures . the lights fraction is collected at about 150 - 200 mmhg until the internal temperature of the distillation vessel reaches 140 ° c . the contents of the distillate receiver are then drained and the temperature of the distillation vessel is dropped to less than 50 ° c . the pressure is lowered to about 15 mmhg . the jacket temperature of the distillation vessel is set to 150 ° c . with a maximum temperature difference of 30 ° c . between the jacket and internal temperatures . with the reflux splitter set to a reflux ratio of from 3 : 1 to 10 : 1 , the low boiling impurities are distilled off until the overhead temperature levels off at about 100 ° to 105 ° c . the distillate receiver is then drained . the reflux ratio is then set to 1 : 1 or less and the title compound is distilled off until no additional material will distill over . the product fraction in the distillate receiver is then transferred to a shipping drum through a 0 . 1 micron polish filter to provide the further purified title compound . if necessary , this material can be re - distilled under conditions analogous to those described above , by one of ordinary skill in the art . table 2__________________________________________________________________________batch no ./ wgt ( lb ) # 1 # 2 # 3 # 4 # 5 # 6 # 7 # 8 # 9 # 10__________________________________________________________________________magnesium 15 . 3 15 . 2 15 . 2 15 . 2 15 . 2 15 . 2 15 . 2 15 . 2 15 . 2 15 . 2tetrahydrofuran 399 398 398 398 398 398 398 399 398 4001 , 2 - dibromoethane 3 . 1 3 . 5 3 . 2 3 . 4 3 3 . 6 2 . 8 3 . 5 3 . 1 3 . 51 - bromo - 3 - 128 128 . 2 128 . 0 128 . 0 128 . 0 128 . 0 128 . 0 128 . 0 128 . 5 128 . 0trimethylsilanyl - benzenelitfa 88 . 7 88 . 6 87 . 8 88 . 0 88 . 0 88 . 0 88 . 0 88 . 0 88 . 0 87 . 0thf combined 300 301 300 300 300 301 344 300 300 300with litfalitfa / thf addition ( min ) 60 60 59 44 60 60 65 60 55 60thf rinse of reactor b 64 64 64 64 64 64 64 65 65 66quench water 909 751 751 751 751 751 751 751 751 75137 % hcl 22 22 22 22 22 22 22 22 22 22glacial acetic acid 63 65 65 65 65 65 65 65 65 65heptane 191 190 190 190 190 190 190 190 191 196quench addition ( min ) 210 25 25 25 20 20 25 12 10 20thf rinse of reactor a 60 60 60 60 60 60 60 60 60 60title compound ( wgt ) 70 . 9 76 . 9 77 . 7 75 . 1 82 . 7 73 . 3 69 . 7 80 . 8 77 . 4 82 . 1percent yield 66 . 5 72 . 0 72 . 9 70 . 4 77 . 6 68 . 7 65 . 3 75 . 8 72 . 3 77 . 1__________________________________________________________________________ gas chromatographic analysis of the final isolated title compound can be performed utilizing a hewlett packard 5890a gas chromatograph , a hewlett packard 7573a autosampler fitted with a 10 μl syringe , a hewlett packard 7673a autosampler tray , a flame ionization detector , a nelson accesschrom data system , a supelco spb - 1 30 m × 0 . 32 mm id column with 1 μfilm thickness and helium as the carrier gas . the conditions used are a 10 psi column head pressure , a 105 ml / min split flow , a 1 . 8 ml / min column flow , 20 ml / min detector make up ( nitrogen ), 20 ml / min detector hydrogen flow , 300 ml / min detector air flow , injector temperature of 275 ° c . and a detector temperature of 300 ° c . the temperature gradient program used has an initial temperature of 120 ° c . which is held for 22 minutes and then increases to a final temperature of 320 ° c . at a rate of about 30 ° c ./ min at which time the run is terminated . table 3______________________________________approximate retention times using the aboveanalytical method . retentioncompound time ( min ) ______________________________________trifluoroacetophenone 3 . 12 - chloro - p - xylene 6 . 01 -( 3 - trimethylsilylphenyl )- 2 , 2 , 2 - 10 . 0trifluoromethyl ethanone1 -( 3 - trimethylsilylphenyl )- 2 , 2 , 2 - 20 . 5trifluoromethyl ethanone hemiacetal1 -( 3 - trimethylsilylphenyl )- 2 , 2 , 2 - 21 . 7trifluoromethyl ethanone hydrate______________________________________	2
fig1 illustrates a reclosable pouch 50 having a first side - wall 52 and a second sidewall 54 that are connected by , for example , folding , heat sealing , and / or an adhesive , along three peripheral edges 56 , 58 , 60 to define an interior space 62 between the first and second sidewalls 52 , 54 , and a mouth 64 along a top edge 66 where the first and second sidewalls 52 , 54 are not connected , so as to allow access to the interior space 62 . an elongate closure mechanism 68 is disposed along the first and second sidewalls 52 , 54 across the mouth 64 , extending longitudinally between the peripheral edge 56 and the peripheral edge 60 of the pouch 50 , to allow the mouth 64 to be repeatedly occluded and deoccluded , thereby respectively sealing and unsealing the mouth 64 . the closure mechanism 68 , in one aspect , include a first base member 70 and a second base member 72 as illustrated , for example , in fig2 a and 2b . a first pair 74 of opposing interlocking members 74 a and 74 b project from opposing interior surfaces 76 and 78 of the base members 70 and 72 , respectively . similarly , a second pair 80 of opposing interlocking members 80 a and 80 b project from the opposing interior surfaces 76 and 78 of the base members 70 and 72 , respectively . the second pair 80 of opposing interlocking members is parallel to and spaced on an exterior side from the first pair 74 . each pair of the opposing interlocking members 74 a and 74 b , and 80 a and 80 b includes elongate generally constant profiles disposed across the mouth 64 of the pouch 50 . each pair 74 , 80 of opposing interlocking members is illustrated in fig2 a and 2b as having a single male and a female profile . however , each of the pairs 74 , 80 of opposing interlocking members may include one or more sets of elongate profiles , as desired , that form a seal across the mouth 64 of the pouch 50 , for example , as illustrated in pawloski et al . u . s . pat . no . 7 , 437 , 736 , pawloski u . s . pat . no . 7 , 410 , 298 , and dais et al . u . s . pat . no . 5 , 070 , 584 , no . 5 , 478 , 228 , and no . 6 , 021 , 557 . further , the first and second base members 70 , 72 may be integral with or separate and attached to the respective first and second sidewalls 52 , 54 . in a preferred embodiment , the sidewalls 52 , 54 and the closure mechanism 68 are made of thermoplastic , which may be formed by known thermoplastic extrusion and bag forming techniques , such as , disclosed in dais et al . u . s . pat . no . 5 , 070 , 584 , no . 5 , 478 , 228 , and no . 6 , 021 , 557 , geiger et al . u . s . pat . no . 4 , 755 , 248 , zieke et al . u . s . pat . no . 4 , 741 , 789 , and porchia et al . u . s . pat . no , 5 , 012 , 461 . other materials and formation techniques sufficient to form structures as described herein are also within the general purview of the present invention . referring to fig1 - 3 , a first plurality 82 of partial indentations 84 is disposed along an exterior surface 86 of the first base member 70 , wherein the first plurality of partial indentations extends longitudinally along the closure mechanism 68 between the first and second pairs 74 , 80 of opposing interlocking members . a second plurality 88 of partial indentations as may optionally be disposed along an exterior surface 92 of the second base member 72 , wherein the second plurality of partial indentations also extends longitudinally along the closure mechanism between the first and second pairs 74 , 80 of opposing interlocking members . in one aspect , each plurality 82 , 88 of partial indentations is arranged in a generally linear pattern extending completely from the peripheral edge 56 to the peripheral edge 60 , as illustrated for the pluralities 82 and 88 of partial indentations in fig1 . however , each plurality 82 , 88 of partial indentations may extend partially across the sidewalls 52 , 54 or may be broken up into regions including indentations and regions lacking indentations ( not shown ). further , each plurality 82 , 88 of partial indentations may be arranged in a curvilinear pattern between the peripheral edges 56 , 60 , as illustrated for the plurality 88 of partial indentations in fig3 , or may be alternatively arranged as a mix of generally linear and curvilinear patterns . the partial indentations 84 , 90 that make up the first and second pluralities 82 and 88 , respectively , may be generally linear , generally curvilinear , or may have shapes having generally linear and / or curvilinear perimeters . the partial indentations 84 , 90 may be manufactured , in one preferred method , for example , using a double roller mechanism applied to create the partial indentations 84 , 90 , wherein the double roller mechanism includes a first roller wheel with cutting and / or embossing surfaces applied to the exterior surfaces 86 , 92 and a second roller wheel with a smooth surface of a rubber or hard metal such as steel , applied opposite to the first roller wheel . in another method , a double roller having complimentary opposing male and female embossing surfaces may be used to create the partial indentations 84 , 90 . alternatively , the double roller mechanism , may be applied such that the embossing surfaces thereon are applied to interior surfaces of the first and second base members 70 , 72 . the partial indentations 84 , 90 do not extend completely through the respective first and second base members 70 and 72 . rather , each of the partial indentations 84 , 90 extends only part way through the corresponding base member , thereby not allowing any leakage therethrough . the partial indentations 84 , 90 may touch each other , as shown , for example , in fig1 as overlapping offset zigzag or interlocking diamond shapes , which according to one preferred aspect , is used for the indentations 84 . 90 of one or more of the pluralities of indentations 82 , 88 . alternatively , the partial indentations 84 , 90 may be spaced apart from each other longitudinally , as shown , for example , in fig2 and 4 , such that spacing between longitudinally spaced partial indentations 84 , 90 may be constant or variable along the first and / or second pluralities 82 , 88 , respectively . the partial indentations 84 , 90 may include longitudinally spaced apart transverse linear indentations and / or may include indicia , such as words , logos , or other informational patterns , and may be selected for aesthetics of the pattern or to enhance the tactile sensation imparted to a user &# 39 ; s fingers . fig3 illustrates some other exemplary possible patterns that may be utilized for the partial indentations 84 , 90 , such as wavy hues , and longitudinally spaced sets of transversely aligned circles . in one embodiment , illustrated in fig1 and 2a , the exterior surfaces 86 , 92 of the respective first and second base members 70 , 72 do not have indentations and are therefore , smooth in regions that are directly opposite to or coextensive with the pairs of opposing interlocking members 74 , 80 . thus , a transverse space is formed between each of the pluralities 82 , 88 of the longitudinally spaced partial indentations 84 , 90 , respectively , and each adjacent interlocking member . in another embodiment , illustrated in fig2 b , regions that are directly opposite to or coextensive with the pairs of interlocking members 74 , 80 are adjacent to or may slightly overlap with uppermost and lowermost extremes of the pluralities 82 , 88 of the longitudinally spaced partial indentations 84 , 90 , respectively . in another aspect , a closure mechanism 68 a optionally includes a third pair 94 of opposing interlocking members 94 a and 94 b projecting from the opposing interior surfaces 76 and 78 of the base members 70 and 72 , respectively , as shown in fig4 . the third pair 94 of the opposing interlocking members is parallel to and spaced from the second pair 80 on an opposite side thereof from the first pair 74 of opposing interlocking members . in this aspect , the first and second pluralities 82 , 88 of partial indentations 84 , 90 , respectively , are disposed along the respective exterior surfaces 86 , 92 of the respective first and second base members 70 , 72 coincident with the second pair 80 of opposing interlocking members and transversely spaced between the first pair 74 and the third pair 94 of interlocking members . it is contemplated that further aspects may include more than three pairs of opposing interlocking members , as desired . it is contemplated that a third plurality 96 of partial indentations 98 may be disposed along an exterior surface 86 of the first base member 70 , wherein the third plurality 96 of partial indentations 98 extends longitudinally along the closure mechanism 68 below the lowermost pair of opposing interlocking members , for example , the first pair 74 of opposing interlocking members . similarly , a fourth plurality 100 of partial indentations 102 may be disposed along an exterior surface 92 of the second base member 72 , wherein the fourth plurality 100 of partial indentations 102 extends longitudinally along the closure mechanism 68 below the lowermost pair of opposing interlocking members , for example , the first pair 74 of opposing interlocking members . similar to die first and second pluralities 82 , 88 , the third and fourth pluralities 96 , 100 of partial indentations 98 , 102 , respectively , may be longitudinally continuous or longitudinally spaced . in one embodiment , illustrated in fig2 a , the third plurality 96 of partial indentations 98 is transversely spaced from a bottom edge of the first pair 74 of opposing interlocking members . in another embodiment , illustrated in fig2 b , a top edge of the third plurality 96 of partial indentations 98 is adjacent to or may slightly overlap with a bottom edge of the first pair 74 of opposing interlocking members . in use , each of the first and second pluralities 82 , 88 of the partial indentations 84 , 90 , respectively , can provide a tactile guide path tor a user &# 39 ; s finger to facilitate proper occlusion of the closure mechanism 68 . referring to fig2 a , 2 b and 5 , to occlude the closure mechanism 68 that includes the first plurality 82 of the partial indentations 84 , a user grasps the closure mechanism 68 , for example , between a first finger 104 and a second finger 106 , lire user locates the first finger 104 between the first and second spaced apart pairs 74 , 80 of opposing interlocking members by feeling whether the first finger 104 is engaged against the first plurality 82 of the partial indentations 84 . the second finger 106 is located on the exterior surface 92 of the second base 72 opposite to the first finger 104 . thus grasped , the user forces the first and second opposing fingers 104 , 106 , together as indicated by the arrows 108 shown in fig5 , to locally occlude the first and second spaced apart pairs 74 , 80 of opposing interlocking members that are disposed on either side of the user &# 39 ; s fingers . the user slides the first and second opposing fingers 104 , 106 along the closure mechanism 68 , as illustrated by die arrow 110 shown in fig5 , with the first and second fingers 104 , 106 forced together , such that the first finger 104 is guided by the first plurality 82 of the partial indentations 84 . the user maintains the first finger 104 between the first and second spaced apart pairs 74 , 80 of opposing interlocking members , while sliding the first and second fingers 104 , 106 by feeling the first plurality 82 of the partial indentations 84 with the first finger 104 , whereby the first and second spaced apart pairs 74 , 80 of opposing interlocking members are occluded along their entire length , and the mouth 64 is sealed . a closure mechanism has been presented that may be used on reclosable thermoplastic pouches and that includes a tactile guide path . the tactile guide path may facilitate proper occlusion of the closure mechanism by guiding one or more of a user &# 39 ; s lingers along a preferred path along the length of the closure mechanism . it is also contemplated that regions adjacent to and between the pairs of opposing interlocking members 74 , 80 may be thicker than , and , therefore , stiffer than , the pouch sidewalls 52 , 54 or other portions of the closure mechanism 68 . without being bound by theory , it is believed that embossing and / or creation of the partial indentations in the above - noted regions may increase the pliability of the above - noted regions over a base that does not have such partial indentations , which can feel better to a user and can make the opposing interlocking members 74 , 80 easier to occlude . numerous modifications to the present invention will be apparent to those skilled in the art in view of the foregoing description . accordingly , this description is to be construed as being illustrative only and is presented for the purpose of enabling those skilled in the art to make and use the invention , and to teach the best mode of carrying out the same . the exclusive right to all modifications within the scope of the impending claims is expressly reserved . all patents , patent publications and applications , and other references cited herein are incorporated by reference herein in their entirety .	1
the method for producing low - substituted hydroxypropyl cellulose by using a raw material pulp will next be described . the raw material pulp can be immersed in an aqueous alkali solution having a concentration of preferably from 20 to 60 % by weight and then compressed for removal of excess of the aqueous alkali hydroxide solution to obtain alkali cellulose having a desired composition . the alkali cellulose may be reacted with propylene oxide through sufficient mixing . the propylene oxide may be used in an amount of preferably from 0 . 15 to 2 . 0 moles per mole of the cellulose . the blending of propylene oxide may be carried out by using any of a method of adding a required amount of propylene oxide all at once , a method of dividing the required amount into two or more portions which will be added in two or more times , and a method of adding the required amount in a continuous manner . in the low - substituted hydroxypropyl cellulose thus obtained , the alkali used as a catalyst has remained so it may be neutralized with an acid . neutralization may be carried out , for example , by putting the crude reaction product in water ( preferably of from 20 to 60 ° c .) containing an acid in an amount stoichiometric to the amount of the alkali . examples of the acid to be used include a mineral acid such as hydrochloric acid , sulfuric acid and nitric acid , and an organic acid such as formic acid and acetic acid . after neutralization with the acid , an optional washing may be carried out . in the step of washing , byproducts such as sodium chloride may be washed away with water , preferably hot water ( preferably of from 70 to 100 ° c .) by taking advantage of the water - insolubility of the low - substituted hydroxypropyl cellulose . this washing may be carried out successively by using a continuous horizontal vacuum filter , a horizontal table filter , or a horizontal belt filter . the hydrous low - substituted hydroxypropyl cellulose thus obtained may then be dehydrated . the water content of the hydrous low - substituted hydroxypropyl cellulose before dehydration may preferably be from 85 to 95 % by weight in consideration of the burden on a drying step to be conducted subsequently . the term “ water content ” as used herein means a percentage of water weight content in the weight of the hydrous low - substituted hydroxypropyl cellulose . for dehydration , a compression type dehydrator may be used . the compression type dehydrator may be an apparatus equipped with a roller or screen for compacting a material to be dehydrated , and applies a pressure to the material for dehydration . examples of a commercially available dehydrator include a screw press ( produced by tsukishima techno machinery co ., ltd .) and a v - shaped disc press (“ asahi press ” produced by flow dynamics ). a screen type v - shaped disc press may be preferred from the standpoint of the properties of the hydrous low - substituted hydroxypropyl cellulose and the throughput capacity of the apparatus and the fact that the hydrous low - substituted hydroxypropyl cellulose itself may serve as a filtering material . in the v - shaped disc press , dehydration is carried out by the aid of a pair of disc - shaped screens which allows the distance between the screens to decrease with rotation . these screens have pores through which water passes , and water having passed through the pores of these screens is collected . the low - substituted hydroxypropyl cellulose is , on the other hand , discharged from the rotating disc press and is collected . the rotational speed of the v - shaped disc press may preferably be from 1 . 0 to 2 . 5 rpm , more preferably from 1 . 5 to 2 . 0 rpm from the standpoint of the filling ratio in the v - shaped disc press . the filling ratio in the compression type dehydrator can be increased by connecting a screw conveyer , which is a push - fit type apparatus , to an inlet of this compression type dehydrator . the throughput capacity of this screw conveyer may preferably be from 1 . 0 to 2 . 0 times the throughput capacity of the v - shaped disc press . the screw conveyer is not limited as long as it is equipped with a casing for covering a shaft therewith and is capable of transferring the hydrous low - substituted hydroxypropyl cellulose to the inlet of the compression type dehydrator and putting it into the compression type dehydrator without causing a loss at the screw conveyer . more specifically , in practice , prior to the dehydration with the compression type dehydrator , the hydrous low - substituted hydroxypropyl cellulose , which is a material to be dehydrated , may be supplied into the compression type dehydrator via the screw conveyer . after the compression type dehydrator is filled fully therewith , in other words , the pressure at the inlet of the compression type dehydrator reaches preferably from 0 . 10 to 0 . 25 mpa , more preferably from 0 . 15 to 0 . 20 mpa , the compression type dehydrator may be started into operation for dehydration . when the pressure at the inlet of the compression type dehydrator is less than 0 . 10 mpa , the filling ratio of the hydrous low - substituted hydroxypropyl cellulose in the v - shaped disc press may be reduced . when the pressure is more than 0 . 25 mpa , returning of the hydrous low - substituted hydroxypropyl cellulose to the screw conveyer , so - called “ back mixing ,” may take place . the feed rate of the hydrous low - substituted hydroxypropyl cellulose to the inlet of the screw conveyer and the discharge rate may each preferably be from 10 to 30 kg / h , more preferably from 20 to 25 kg / h in terms of net weight of cellulose ether . the dehydrated low - substituted hydroxypropyl cellulose may then be dried . in the step of drying , it may be dried with a drier such as a fluidized - bed drier or a drum drier . the drying temperature may preferably be from 60 to 120 ° c ., more preferably from 80 to 100 ° c . the drying time varies depending on the temperature and the water content of the dehydrated cellulose ether . the drying time may preferably be from 2 to 5 hours . since the water content of the hydrous low - substituted hydroxypropyl cellulose can be reduced in the preceding dehydration step , the amount of steam can be reduced greatly . the dehydration of hydrous low - substituted hydroxypropyl cellulose in the method for producing low - substituted hydroxypropyl cellulose from pulp has been explained . however , according to the invention , the dehydration can be applied not only to low - substituted hydroxypropyl cellulose but also to the whole hydrous low - substituted hydroxypropyl cellulose . the dehydration of hydrous low - substituted hydroxypropyl cellulose according to the present invention will next be described in detail by examples and comparative examples . a pulp sheet was immersed in an aqueous 43 % by weight sodium hydroxide solution at 35 ° c . for 5 seconds and then compressed for removing excess of the aqueous sodium hydroxide solution to obtain alkali cellulose . the weight ratio of sodium hydroxide to the cellulose and the weight ratio of the water content to the cellulose were adjusted to 0 . 55 and 0 . 90 , respectively . the alkali cellulose thus obtained was shredded using a slitter cutter and placed in a pressure - resistant reactor equipped with an internal stirrer . after the reactor was purged sufficiently with nitrogen , propylene oxide was charged ( at a molar ratio of 0 . 67 relative to the cellulose ) and a reaction was carried out at 50 ° c . for 3 hours . the sodium hydroxide remaining in the reaction product was neutralized with an aqueous 33 % by weight acetic acid solution , and then the neutralized product was washed and filtered with hot water at 95 ° c . to obtain hydrous low - substituted hydroxypropyl cellulose having water content of 90 % by weight as a material to be dehydrated . dehydration was carried out as follows . first , operation of a screw conveyor was started and via the screw conveyer , the hydrous low - substituted hydroxypropyl cellulose was supplied into a v - shaped disc press (“ asahi press ” produced by flow dynamics ), a compression type dehydrator , at a rate of 20 kg / h in terms of net weight of cellulose ether . at the time when the filling ratio of the hydrous low - substituted hydroxypropyl cellulose in the v - shaped disc press increased and the pressure at the inlet of the v - shaped disc press reached 0 . 2 mpa ( on the presumption that the filling ratio was 100 % because the pressure did not increase any more ), the operation of the v - shaped disc press was started at a rotational speed of 1 . 5 rpm ( bayer : 0 . 2 ) so that the discharge rate from the v - shaped disc press became 20 kg / h equal to the feed rate in terms of net weight of cellulose ether . dehydration was continued for about 2 hours while keeping the pressure at the inlet of the v - shaped disc press at 0 . 2 mpa . the results are shown in table 1 . the water content in the cake obtained by dehydration of the low - substituted hydroxypropyl cellulose was determined to be 70 . 1 % by weight of the water content of the material to be dehydrated . during operation , no reduction in the dehydration degree was observed . further , the amount of steam used in the step of drying was 0 . 50 when the amount of steam used in comparative example 1 is regarded as 1 . in comparative example 1 , a conventional dehydration method was employed and the water content of the cake obtained by dehydration was 82 . 5 % by weight of the water content of the material to be dehydrated . thus , the amount of steam was reduced greatly . hydrous low - substituted hydroxypropyl cellulose obtained in the same manner as in example 1 was supplied to a v - shaped disc press having no screw conveyer connected thereto , followed by dehydration . the dehydration was carried out as follows . the hydrous low - substituted hydroxypropyl cellulose , a material to be dehydrated , was supplied to the v - shaped disk having no screw conveyer connected thereto at a rate of 20 kg / h in terms of net weight of cellulose ether and an attempt was made to increase the filling ratio of the hydrous low - substituted hydroxypropyl cellulose in the v - shaped disc press by taking advantage of the weight of the hydrous low - substituted hydroxypropyl cellulose . however , the weight of the hydrous low - substituted hydroxypropyl cellulose alone could not increase the pressure at the inlet of the v - shaped disc press , and the pressure at the feed port remained at 0 mpa . the filling ratio became lower than that when the screw conveyer was used . the operation of the v - shaped disc press was then started but the discharge rate was 12 kg / h in terms of net weight of cellulose ether . dehydration was continued for about 2 hours . the results are shown in table 1 . the water content of the cake of the low - substituted hydroxypropyl cellulose obtained by dehydration was determined to be 82 . 5 % by weight of the water content of the material to be dehydrated . the operation of a screw conveyer was started first . hydrous low - substituted hydroxypropyl cellulose obtained in the same manner as in example 1 was supplied to the screw conveyer at a rate of 20 kg / h in terms of net weight of cellulose ether . at the time when the filling ratio of the hydrous low - substituted hydroxypropyl cellulose in the v - shaped disc press increased and the pressure at the inlet of the v - shaped disc press reached 0 . 2 mpa , the operation of the v - shaped disc press was started . it was operated at a discharge rate of 22 . 5 kg / h in terms of net weight of cellulose ether from the v - shaped disc press and a rotational speed of 2 . 3 rpm ( bayer : 0 . 3 ) so that the pressure at the inlet of the v - shaped disc press became 0 . 1 mpa . dehydration was continued for about 2 hours while keeping the pressure at the inlet of the v - shaped disc press at 0 . 1 mpa . the results are shown in table 1 . the water content of the cake of the low - substituted hydroxypropyl cellulose thus obtained by dehydration was determined to be 81 . 2 % by weight of the water content of the material to be dehydrated . the amount of steam used in the step of drying was 0 . 92 when the amount of steam used in comparative example 1 was regarded as 1 . in comparative example 1 , a conventional dehydration method was employed and the water content of the cake obtained by dehydration was 82 . 5 % by weight of the water content of the material to be dehydrated . it was evident that the filling ratio in the v - shaped disc press largely affected the water content . the operation of a screw conveyer was started first . hydrous low - substituted hydroxypropyl cellulose obtained in the same manner as in example 1 was supplied to the screw conveyer at a rate of 20 . 0 kg / h in terms of net weight of cellulose ether . at the time when the pressure at the inlet of a v - shaped disc press reached 0 . 2 mpa , the operation of the v - shaped disc press was started at a discharge rate of 24 . 8 kg / h in terms of net weight of cellulose ether from the v - shaped disc press and a rotational speed of 3 . 0 rpm ( bayer : 0 . 4 ). since the feed rate largely exceeded the discharge rate , the pressure at the inlet of the v - shaped disc press during operation was 0 mpa . dehydration was continued for about 2 hours at a discharge rate of 24 . 8 kg / h in terms of net weight of cellulose ether and a rotational speed of 3 . 0 rpm ( bayer : 0 . 4 ). the results are shown in table 1 . the water content of the cake of the low - substituted hydroxypropyl cellulose obtained by dehydration was determined to be 85 . 6 % by weight of the water content of the material to be dehydrated . the amount of steam used in the step of drying was 1 . 26 when the amount of steam used in comparative example 1 was regarded as 1 . in comparative example 1 , a conventional dehydration method was employed and the water content of the cake obtained by dehydration was 82 . 5 % by weight of the water content of the material to be dehydrated . when the throughput capacity of the v - shaped disc press exceeded that of the screw conveyer , the filling ratio in the compression type dehydrator decreased and the water content of the cake obtained by dehydration increased . a it means the water content of the cake obtained by dehydration when the water content of the material to be dehydrated is regarded as 100 % by weight . b it means the amount of steam when the water content 82 . 5 % of cake obtained by dehydration is regarded as 1 . 00 .	2
fig1 shows a schematic block diagram illustrating a network device 20 and terminal devices 10 , 11 , 12 according to an embodiment of the invention . the network device 20 such as an im ( instant messaging ) server , chat server or the like in a packet switched communication network such as an ip multimedia network ( e . g . an ip multimedia subsystem ( ims )) controls a session among at least two users , e . g . among at least two of terminal devices 10 , 11 , 12 shown in fig1 . the network device 20 comprises a recording block 21 for recording contents associated with the session in accordance with a recording request ( e . g . commands such as record , stop , pause , etc .) for recording the contents , and a notifying block 22 for notifying information on a status of recording by the recording block 21 . the network device 20 may further comprise an instantiating block 23 for instantiating a record event package for each recording session , wherein the notifying block 22 notifies information on the status of recording associated with the recording session . the recording block 21 may receive the recording request from one of users , e . g . from one of the terminal devices 10 - 12 involved in the session , and the notifying block 22 may notify the information on the status of recording upon receiving a subscription request . the recording request may be issued by a user or terminal device participating the session . alternatively , there may be a case where the user or terminal device that controls the recording is not a participant of the session , i . e . the recording request can be received from an authorized third party . in addition , not all participants of the session may be authorized to record . stated differently , there are at least two users in an established session , and there may be a controlling user who sends record commands to the session . moreover , the subscription request may be issued by a user or terminal device participating the session or by an authorized user or terminal device not participating the session . in the configuration shown in fig1 , sip may be used between the terminal devices 10 - 12 and the network device 20 as protocol for the recording request , subscription request and for notifying the information . fig2 shows a schematic block diagram illustrating a network device 50 and terminal devices 40 - 42 according to another embodiment of the invention . this embodiment differs from that shown in fig1 in that an http protocol such as xcap ( extensible markup language ( xml ) configuration access protocol ) is used by e . g . the terminal device 40 to send commands ( recording requests ), such as record , stop , pause , etc ., to the network device 50 . it is to be noted that the network devices and terminal devices shown in fig1 and 2 may have further functionality for working e . g . as application servers and ims terminal devices . here the functions of the network devices and terminal devices relevant for understanding the principles of the invention are described using functional blocks as shown in fig1 and 2 . the arrangement of the functional blocks of the network devices is not to be construed to limit the invention , and the functions of the recording , notifying and generating blocks may be grouped together in one block or further split into sub - blocks . the terminal devices 10 - 12 comprise e . g . ims mobile terminals , typically referred to as user equipments ( ues ). an ims mobile terminal attaches to a packet network , such as the gprs ( general packet radio services ) network , through a radio link . ims supports also other types of devices and accesses . personal digital assistants and computers are examples of terminal devices that can connect to the ims . examples of alternative accesses are wlan ( wireless local area network ) or adsl ( asymmetric digital subscriber line ). in the following an implementation example of the invention will be described with reference to fig3 . fig3 shows a diagram illustrating signaling between a user equipment ( ue ) 100 and an application server ( as ) 200 according to the configuration of fig1 . the terminal devices 10 - 12 comprise the user equipment 100 , and the network device 20 comprises the application server 200 . the idea is to develop a “ record ” event package in sip . for this purpose , the functionality is split as described below . when the ue 100 wants to start or stop recording of a session content , e . g . an im , in a network through which it communicates , the ue sends a publish request with an xml content indicating the “ user willingness ” for the network to record the conversation . as shown in fig3 , in message # 1 first of all the ue 100 establishes a new session or joins an existing multi - party session with a sip invite request which traverses allocated p - cscf ( proxy - cscf , not shown ) and s - cscf ( not shown ) which evaluates initial filter criteria and forwards the request to the application server 200 controlling the session . if the new session is created , the session invitation is then forwarded to at least one more user equipment ( not shown ), so that the session is established between at least two user equipments via the application server 200 . then , in message # 2 the ue 100 sends a sip publish request towards the as 200 with an indication of the user &# 39 ; s willingness to start the recording of the session content in the network in the format of a publication to the record event package . such indication can be contained directly in the sip headers of the publish request or as part of an enclosing body . upon receiving the publish request , the as 200 creates a new instance of the record event package ( procedure # 3 ). such instance contains the state information of the current recording conditions , including but not limited to : current state ( idle , recording , paused ), recorded time , size , pointer for retrieval , and any other relevant information . the as 200 may first check if a user associated with the sip publish request has activated or subscribed to a recording service ( to be described below ), and if so , check if the user has storage space left in the server . also other policy checks may be performed by the as 200 . a sip event package is an additional specification which defines a set of state information to be reported by a notifier ( i . e . the as 200 ) to a subscriber ( i . e . the ue 100 ) and to be published by a publisher ( i . e . the ue 100 ). event packages also define further syntax and semantics based on the framework defined by rfc 3265 required to convey such state information . the key part of this invention is the development of a sip event package ( per rfc 3265 ) that provides the means to publish record requests from the user , such as record , pause , stop , inform , etc ., and means to provide notifications ( recording , paused , idle ), any potential limit such as size , time , or number of messages , pointer for retrieval , etc . when the user wants to be informed of the status of the network recording feature , the ue 100 subscribes to the above - mentioned record event package that provides the ue 100 with information on the status of the recording activity . as shown in fig3 , in message # 4 the ue 100 sends a susbcribe request towards the as 200 in which the ue 100 subscribes to the record event package instantiated in procedure # 3 . the information on the status of the recording activity is sent in notify requests ( message # 7 ) that contain the status ( recording or not ), number of stored messages , storage size , any potential limit ( size , time , or number of messages ), time of start / stop , and any other type of information associated to the instance of the record event package . the application server 200 sends notify requests including the current status of the record event package to subscribed parties periodically , or whenever there has been a change in the state of the instantiated record event package . additionally , the application server 200 may have a policy that limits the number of notifications to avoid a high frequency of them . for example , the application server 200 may limit the number of notifications to one every 10 seconds . as the ue 100 has sent an instant message with the msrp ( message session relay protocol ) send request ( message # 5 ) which the as 200 has recorded according to the publish request ( message # 2 ) in a procedure # 6 , when notifying the number of stored messages in the notify request ( message # 7 ), one stored message is notified to the ue 100 . when the user wants to stop or pause an existing recording , the ue 100 sends a publish request that contains the stop or pause command according to the syntax of the recording event package . the application server 200 receives the publish request , acts accordingly , and sends a notify request to the subscriber ue 100 to inform about the new state , including but not limited to the current status ( idle , paused ), the total length and size of the current recording , a pointer for retrieval , and all the necessary information . fig4 . shows a signalling diagram corresponding to another embodiment describing the mechanism whereby a ue 400 sends commands ( e . g ., record , pause , stop ) to an application server as 500 implemented with xcap . the ue 400 uses an xcap put operation to send the commands ( record , pause , idle ) to the application server 500 . as shown in fig4 , in message # 2 the ue 100 sends an xcap put ( record ) request towards the as 200 indicating the user &# 39 ; s willingness to start the recording of the session content in the network . communications and procedures # 1 and # 3 -# 7 of fig4 correspond to those described in connection with fig3 . it must be noted that the xcap server can be separated to a standalone server outside the application server 500 ( not shown ), in which case an interface between the xcap server and the application server 500 is required . according to the invention , a server controlling user &# 39 ; s participation in a communication session also has a control over recording content of the session based on the instructions received from the user . it is to be understood that the above description is illustrative of the invention and is not to be construed as limiting the invention . various modifications and applications may occur to those skilled in the art without departing from the true spirit and scope of the invention as defined by the appended claims . particularly , the user equipment device in the description need not necessarily be governed by a human user , but rather the user equipment may be governed by an automaton . that is the case when , e . g ., the user equipment is the focus of a centralized conference , or when the user equipment is a service controller .	7
fig2 illustrates a first embodiment of the present invention . this embodiment will be described by using a printer as a peripheral device . since a cpu 102 is identical to that in fig1 its description will be omitted . the microcomputer 201 of the first embodiment comprises the cpu 102 , an sog region 203 to which is input a signal from the cpu 102 only when a mode switching signal input from an external input terminal 204 of the microcomputer 102 indicates a normal operation mode , a selection circuit 202 which selectively outputs to external terminals 2011 , 2012 and 2013 the output from the sog region when the mode switching signal input to the external input terminal 204 is in the normal operation mode , and the output from cpu when it is in the test mode , and a printer 104 supplied with signals to the external terminals 2011 , 2012 and 2013 . here , the mode switching signal from the external input terminal 204 indicates the normal operation mode in which an output from the sog region 203 is output to the external terminals 2011 , 2012 and 2013 . in other words , since the output of the sog region 203 is input to the printer 104 via the external terminals 2011 , 2012 and 2013 , the operation of this system is identical to that of the system in fig1 and the description of its operation will be omitted . note , however , that the signal line 1031 in fig1 is replaced in fig2 by signal lines 2031 , 2032 and 2033 corresponding to the signal lines 1021 , 1022 and 1023 from cpu 102 . fig3 illustrate a system for carrying out system debugging by the use of an externally provided gate array when a signal showing the test mode is input to the external input terminal 204 . a microcomputer 301 is constituted of cpu 102 , an sog region 203 , a selection circuit 202 , a gate array 302 to which are input signals from the external terminals 2011 , 2012 and 2013 via a signal line 3021 , and a printer 104 to which is input the output of the gate array 302 via a signal line 3022 . description about the parts identical to those in fig2 will be omitted . namely , the case in which a mode switching signal showing the test mode is input to the external input terminal 204 , and a signal of cpu 102 is output to the external terminals 2011 , 2012 and 2013 is illustrated in the figure . the signal from cpu 102 output to the external terminals 2011 , 2012 and 2013 is input to the gate array 302 having an interface function designed by the user . based on the signal received , a signal is output from the gate array 302 to the printer 104 . since the printer 104 is connected to confirm the operation of the system , use of any circuit is possible as long as it is a circuit to monitor the output information from the gate array 302 . as in the above , it is possible to input a signal from cpu 102 to the gate array 302 installed outside the microcomputer 301 via the external terminals 2011 , 2012 and 2013 . accordingly , it is possible to carry out debugging of the system by connecting the gate array 302 to the microcomputer 301 . shown in fig4 is a more detailed system configuration , especially the internal configuration of cpu 102 , of the first embodiment of the invention . the central processing unit 102 comprises a data bus 4011 through which data is input and output , an address bus 4012 through which an address is input and output , a control bus 4013 through which a control signal such as a read or write signal is input and output , an execution unit ( exu ) 402 connected to the data bus 4011 , the address bus 4012 and the control bus 4013 for generating an address and a control signals , and carries out data processing , a memory 403 connected to the data bus 4011 , the address bus 4012 and the control bus 4013 for storing or reading a program and data , based on the data , address and control signals , an i / o device 404 connected to the data bus 4011 , the address bus 4012 and the control bus 4013 for controlling the input and output of the data , address and control signals for cpu 102 , an sog control circuit 405 connected to the data bus 401 , the address bus 4012 and the control bus 4013 for outputting a control signal to signal lines 4051 and 4052 in response to an input , a switching circuit 406 connected to the signal lines 4051 , 4052 and 4053 to which is input a mode switching signal from the external input terminal 204 , and a gate array 407 to which is input a signal from the switching circuit 406 via signal lines 4061 , 4062 and 4063 . further , the sog control circuit 405 comprises an address decoder circuit 4054 which outputs an activation signal when an address designating the gate address 407 is input , an and circuit 4055 which outputs a read signal to a signal line 4041 when both the activation signal and the read signal on the control bus 4013 are activated , and an and circuit 4056 which outputs a write signal to a signal line 4052 when both the activation signal and the write signal on the control bus 4013 are activated . to the switching circuit 406 there are input a mode switching signal supplied from the external input terminal 204 , a signal from the data bus 4013 , and control signals from the sog control circuit 405 via the signal lines 4051 and 4052 . when the mode switching signal is in the normal operation mode which selects the sog region 203 , the and circuits 4064 and 4065 to which is input the mode switching signal are activated , the signals input to the signal lines 4051 , 4052 and 4053 are output by activating a tristate buffer 4068 to signal lines 4061 , 4062 and 4063 , respectively , which are in turn output to the gate array 407 . when the mode switching signal is in the test mode , the and circuits 4064 and 4065 are inactivated , and the input signals are not transmitted to the signal lines 4061 , 4062 and 4063 by inactivating the tristate buffers 4068 and 4069 , namely , the signals on respective signal lines are not transmitted to the gate array 407 . at this time , the signal lines 4051 , 4052 and the data bus 4053 are connected to the external terminals via the selection circuit which is not shown . further , the data bus 4067 within the switching circuit 406 is a bi - directional bus which is constituted of the two buffers 4068 and 4069 connected in mutually opposite directions to which are input signals of the and circuits 4064 and 4065 , respectively . at the time of reading , only the buffer 4068 on the read side is activated while at the time of writing , only the buffer 4069 on the write side is activated . in this way , the data bus 4067 transfers the data in both directions . in fig5 is shown the second embodiment of the invention . a microcomputer 501 is constituted of a cpu 102 , a gate array 407 , and a selection circuit 503 . the central processing unit 102 comprises an exu 402 connected to a data bus 4011 , an address bus 4012 and a control bus 4013 , and an output circuit 502 and an sog control circuit 405 . although a memory and an i / o controller are also connected to each bus , they are not shown in the figure . an output circuit 502 is activated only when pieces of information are output to external terminals 5011 , 5012 and 5013 . the selection circuit 503 connected to a write signal line 2031 , a read signal line 2032 and a data bus 2033 , inputs respective signals to the gate array 407 when the mode switching signal input from the external input terminal 204 is in the normal operation mode , and connects a read signal line 2031 and a write signal line 2032 to external terminals 5014 and 5015 , respectively , when the mode switching signal is in the test mode . however , when the number of the external terminals connected to an sog region 203 is small , the data on the data bus 2033 cannot be output to the outside of the microcomputer 501 . accordingly , by noting the fact that when the mode switching signal is in the test mode , the output circuit 502 is inactivated because cpu 102 is transferring signals between the sog region 203 within the microcomputer 501 , the signal of the data bus 4011 is output to the outside by using the external terminals 5011 , 5012 and 5013 that are not in use . in order to do this , it is only needed to connect the data bus 4011 to the external terminal 5012 via the selection circuit 507 . debugging of the system can be done by connecting the external terminals 5014 , 5015 and 5012 to the gate array provided in the outside . as in the above , even when the number of external terminals used by the sog region is smaller than the number of signals from cpu 102 , it is possible to debug the gate array 407 by using a signal of a system data bus 5017 output to another system from cpu 102 . in fig6 is shown the third embodiment of this invention . a microcomputer 601 comprises a cpu 102 having a read only memory ( rom ) 603 , a sog region 203 , and a decoder 602 which is connected to a selection circuit 202 and external input terminals 6011 and 6012 , and its control signal is input to cpu 102 , rom 603 and the selection circuit 202 via signal lines 6021 , 6022 and 6023 , respectively . the decoder circuit 602 receives control signals through the terminals 6011 and 6012 , and switches , based on the control signals , among the test mode of rom 603 , the test mode of cpu 102 , the test mode of the sog region 203 and the normal operation mode . when the external input terminals 6011 and 6012 are both at low levels , the control signal line 6021 alone is activated and the system goes to the test mode of cpu 102 , which is the mode to confirm the operation of cpu 102 by means of information output to external terminals 5011 , 5012 and 5013 . when the external input terminal 6011 is high and 6012 is low , the control signal line 6022 alone is activated and the system goes to the test mode of rom 603 , and carries out the internal test of the rom by isolating rom 603 from the various buses and using an externally provided rom ( not shown ). when the external input terminal 6011 is low and 6012 is high , the control signal line 6023 alone is activated , and the system goes to the above - mentioned test mode . finally , when both the external input terminals 6011 and 6012 are high , none of the signal lines is activated and the system goes to the above - mentioned test mode of the normal operation . although in each embodiment in the above the case has been shown in which the mode switching signals are given through the external input terminals , a configuration may also be chosen where the mode switching signals are given by the cpu . furthermore , the case where there is involved only one line for the data bus , address bus , control bus , and each signal line has been described , but the case when there are plural lines also work just as well .	6
fig1 is a block diagram illustrating a random access memory 10 . in one embodiment , random access memory 10 is a double data rate synchronous dynamic random access memory ( ddr sdram ). the ddr sdram 10 includes a memory controller 20 and at least one memory bank 30 . memory bank 30 includes an array of memory cells 32 , a row decoder 40 , a column decoder 44 , sense amplifiers 42 , and data in / out circuit 46 . in other embodiments , data in / out circuit 46 is separate from memory bank 30 . memory controller 20 is electrically coupled to memory bank 30 , indicated at 22 . conductive word lines 34 , referred to as row select lines , extend in the x - direction across the array of memory cells 32 . conductive bit lines 36 , controlled by the column select lines , extend in the y - direction across the array of memory cells 32 . a memory cell 38 is located at each cross point of a word line 34 and a bit line 36 . each word line 34 is electrically coupled to row decoder 40 and each bit line 36 is electrically coupled to a sense amplifier 42 . the sense amplifiers 42 are electrically coupled to column decoder 44 through conductive column decoder lines 45 and to data in / out circuit 46 through data lines 47 . data in / out circuit 46 includes data input / output ( i / o ) circuitry and pins ( dqs ) to transfer data between memory bank 30 and an external device . data to be written into memory bank 30 is presented as voltages on the dqs from an external device . the voltages are translated into the appropriate signals and stored in selected memory cells 38 . data read from memory bank 30 is presented by memory bank 30 on the dqs for an external device to retrieve . data read from selected memory cells 38 appears at the dqs once access is complete and the output is enabled . at other times , the dqs are in a high impedance state . the array of memory cells 32 includes a first portion of memory cells and a second portion of memory cells . a first portion of data lines 47 are configured to pass first data signals between a first portion of dqs and the first portion of memory cells and a second portion of data lines 47 are configured to pass second data signals between a second portion of dqs and the second portion of memory cells . the first and second portions of memory cells are configured to be made inaccessible to eliminate the first and second data signals respectively and the first and second portions of dqs respectively . memory controller 20 controls reading data from and writing data to memory bank 30 . during a read operation , memory controller 20 passes the row address of a selected memory cell 38 to row decoder 40 . row decoder 40 activates the selected word line 34 . as the selected word line 34 is activated , the value stored in each memory cell 38 coupled to the selected word line 34 is passed to the respective bit line 36 . the value of each memory cell 38 is read by a sense amplifier 42 electrically coupled to the respective bit line 36 . memory controller 20 also passes a column address of the selected memory cell 38 to column decoder 44 . column decoder 44 selects which sense amplifiers 42 pass data to data in / out circuit 46 for retrieval by an external device . during a write operation , the data to be stored in array 32 is placed in data in / out circuit 46 by an external device . memory controller 20 passes the row address for the selected memory cell 38 where the data is to be stored to row decoder 40 . row decoder 40 activates the selected word line 34 . memory controller 20 passes the column address for the selected memory cell 38 where the data is to be stored to column decoder 44 . column decoder 44 selects which sense amplifiers 42 are passed the data from data in / out circuit 46 . sense amplifiers 42 write the data to the selected memory cell 38 through bit lines 36 . fig2 illustrates an exemplary embodiment of one memory cell 38 in the array of memory cells 32 . memory cell 38 includes a transistor 48 and a capacitor 50 . the gate of transistor 48 is electrically coupled to word line 34 . the drain - source path of transistor 48 is electrically coupled to bit line 36 and capacitor 50 . capacitor 50 is charged to represent either a logic 0 or a logic 1 . during a read operation , word line 34 is activated to turn on transistor 48 and the value stored on capacitor 50 is read by a corresponding sense amplifier 42 through bit line 36 and transistor 48 . during a write operation , word line 34 is activated to turn on transistor 48 and the value stored on capacitor 50 is written by a corresponding sense amplifier 42 through bit line 36 and transistor 48 . the read operation on memory cell 38 is a destructive read operation . after each read operation , capacitor 50 is recharged with the value that was just read . in addition , even without read operations , the charge on capacitor 50 discharges over time . to retain a stored value , memory cell 38 is refreshed periodically by reading the value from and then writing the value back to the memory cell 38 . all memory cells 38 within the array of memory cells 32 are periodically refreshed to maintain their values . in ddr sdram , the read and write operations are synchronized to a system clock . the system clock is supplied by a host system including the ddr sdram 10 . operations are performed on both the rising and falling edges of the system clock . ddr sdram uses a double data rate architecture to achieve high speed operation . the double data rate architecture is essentially a 2 n prefetch architecture with an interface designed to transfer two data words per clock cycle at the dqs . a single read or write access for the ddr sdram effectively consists of a single 2 n bit wide , one clock cycle data transfer at the internal memory array and two corresponding n bit wide , one half clock cycle data transfers at the dqs . a bidirectional data strobe ( dqs ) is transmitted externally along with data for use in data capture at data in / out circuit 46 . dqs is a strobe transmitted by the ddr sdram during read operations and by an external memory controller during write operations . dqs is edge aligned with data for read operations and center aligned with data for write operations . input and output data is registered on both edges of dqs . ddr sdram operates from a differential clock , ck and bck . the crossing of ck going high and bck going low is referred to as the positive edge of ck . commands such as read and write operations , including address and control signals , are registered at the positive edge of ck . read and write accesses to the ddr sdram are burst oriented . accesses start at a selected location and continue for a programmed number of locations in a programmed sequence . accesses begin with the registration of an active command , which is followed by a read or write command . the address bits registered coincident with the active command are used to select the bank and row to be accessed . the address bits registered coincident with the read or write command are used to select the bank and the starting column location for the burst access . fig3 is a block diagram illustrating an exemplary embodiment of ddr sdram 10 with an array of memory banks 31 . the array of memory banks 31 includes four memory banks , bank zero through bank three , indicated at 30 a - 30 d . each memory bank 30 a - 30 d includes all of the circuitry of memory bank 30 illustrated in fig1 and previously described . in one embodiment , a single data in / out circuit 46 is shared by memory banks 30 a - 30 d . multiple memory banks 30 a - 30 d increase the storage capacity of ddr sdram 10 and reduce the access time of ddr sdram 10 as one bank can be prepared for access while another bank is being accessed . fig4 illustrates a portion of bank zero 100 a and a portion of bank one 100 b of ddr sdram 10 . in the exemplary embodiment , ddr sdram 10 is in a × 16 dq organization . the portion of bank zero 100 a includes word line 34 a , multiple bit lines , blocks of memory cells 110 a , 112 a , 114 a , and 116 a , even and odd data dividing line 102 a , and data lines 120 a , 122 a , 124 a , and 126 a . the portion of bank one 100 b includes word line 34 b , multiple bit lines , blocks of memory cells 110 b , 112 b , 114 b , and 116 b , even and odd data dividing line 102 b , and data lines 120 b , 122 b , 124 b , and 126 b . the portion of bank zero 100 a and the portion of bank one 100 b use data lines dl 1 & lt ; 0 : 7 & gt ; 130 , dl 2 & lt ; 0 : 7 & gt ; 132 , dl 1 & lt ; 8 : 15 & gt ; 134 , and dl 2 & lt ; 8 : 15 & gt ; 136 . in the portion of bank zero 100 a , each block of memory cells 110 a , 112 a , 114 a , and 116 a , includes at least eight memory cells 38 along word line 34 a the memory cells 38 of block 110 a are electrically coupled to data line 120 a through sense amplifiers 42 of bank zero 30 a . the memory cells 38 of block 112 a are electrically coupled to data line 122 a through sense amplifiers 42 of bank zero 30 a . the memory cells 38 of block 114 a are electrically coupled to data line 124 a through sense amplifiers 42 of bank zero 30 a and the memory cells 38 of 116 a are electrically coupled to data line 126 a through sense amplifiers 42 of bank zero 30 a . data line 120 a is electrically coupled to data line dl 1 & lt ; 0 : 7 & gt ; 130 . data line 122 a is electrically coupled to data line dl 2 & lt ; 0 : 7 & gt ; 132 . data line 124 a is electrically coupled to data line dl 1 & lt ; 8 : 15 & gt ; 134 and data line 126 a is electrically coupled to data line dl 2 & lt ; 8 : 15 & gt ; 136 . for the portion of bank one 100 b , each block of memory cells 110 b , 112 b , 114 b , and 116 b , includes at least eight memory cells 38 along word line 34 b . the memory cells 38 of block 110 b are electrically coupled to data line 120 b through sense amplifiers 42 of bank one 30 b . the memory cells 38 of block 112 b are electrically coupled to data line 122 b through sense amplifiers 42 of bank one 30 b . the memory cells 38 of block 114 b are electrically coupled to data line 124 b through sense amplifiers 42 of bank one 30 b and the memory cells 38 of 116 b are electrically coupled to data line 126 b through sense amplifiers 42 of bank one 30 b . data line 120 b is electrically coupled to data line dl 1 & lt ; 0 : 7 & gt ; 130 . data line 122 b is electrically coupled to data line dl 2 & lt ; 0 : 7 & gt ; 132 . data line 124 b is electrically coupled to data line dl 1 & lt ; 8 : 15 & gt ; 134 and data line 126 b is electrically coupled to data line dl 2 & lt ; 8 : 15 & gt ; 136 . data lines 120 a , 122 a , 124 a , 126 a , 120 b , 122 b , 124 b , 126 b , dl 1 & lt ; 0 : 7 & gt ; 130 , dl 2 & lt ; 0 : 7 & gt ; 132 , dl 1 & lt ; 8 : 15 & gt ; 134 , and dl 2 & lt ; 8 : 15 & gt ; 136 are data busses or other suitable data transmission lines for carrying at least eight data bits at a time to pass data into or out of the portion of bank zero 100 a and the portion of bank one 100 b . in other embodiments , the data lines are configured for carrying any suitable number of data bits . word lines 34 a and 34 b activate the selected memory cells 38 during a read or write operation as previously described . in the exemplary embodiment , ddr sdram 10 is in a × 16 dq organization and 32 data bits are read , two per dq , per memory read access . likewise , 32 data bits are written , two per dq , per memory write access . the first 16 data bits on the dqs are referred to as the even data bits . the second 16 data bits on the dqs are referred to as the odd data bits . the array of memory cells 32 in each bank 30 a - 30 d of ddr sdram 10 is divided into even and odd sections to facilitate the data transfer . even and odd data dividing line 102 a divides the upper and lower half of bank zero portion 100 a . the lower half of bank zero portion 100 a includes block 110 a and block 114 a , which represent the even data . the upper half of bank zero portion 100 a includes block 112 a and block 116 a , which represent the odd data . even and odd data dividing line 102 b divides the upper and lower half of bank one portion 100 b . the lower half of bank one portion 100 b includes block 110 b and block 114 b , which represent the even data . the upper half of bank one portion 100 b includes block 112 b and block 116 b , which represent the odd data . data line 120 a passes data from the memory cells 38 in block 110 a to data line dl 1 & lt ; 0 : 7 & gt ; 130 during a read operation . data line 120 a passes data from data line dl 1 & lt ; 0 : 7 & gt ; 130 to memory cells 38 in block 110 a during a write operation . data line 120 b passes data from the memory cells 38 in block 110 b to data line dl 1 & lt ; 0 : 7 & gt ; 130 during a read operation . data line 120 b passes data from data line dl 1 & lt ; 0 : 7 & gt ; 130 to memory cells 38 in block 110 b during a write operation . data lines 122 a and 122 b with data line dl 2 & lt ; 0 : 7 & gt ; 132 perform the same finction for their respective blocks 112 a and 112 b as data lines 120 a and 120 b . data lines 124 a and 124 b with data line dl 1 & lt ; 8 : 15 & gt ; 134 perform the same finction for their respective blocks 114 a and 114 b as data lines 120 a and 120 b and data lines 126 a and 126 b with data line dl 2 & lt ; 8 : 15 & gt ; 136 perform the same function for their respective blocks 116 a and 116 b as data lines 120 a and 120 b . data line dl 1 & lt ; 0 : 7 & gt ; 130 passes data from data lines 120 a and 120 b to the first eight dqs ( eight least significant dqs ) to output as even data . data line dl 2 & lt ; 0 : 7 & gt ; 132 passes data from data lines 122 a and 122 b to the first eight dqs to output as odd data . data line dl 1 & lt ; 8 : 15 & gt ; 134 passes data from data lines 124 a and 124 b to the second eight dqs ( eight most significant dqs ) to output as even data . data line dl 2 & lt ; 8 : 15 & gt ; 136 passes data from data lines 126 a and 126 b to output as odd data . on the rising edge of a clock pulse , the data on data lines dl 1 & lt ; 0 : 7 & gt ; 130 and dl 1 & lt ; 8 : 15 & gt ; 134 is output to the 16 dqs and on the falling edge of the clock pulse , the data on data lines dl 2 & lt ; 0 : 7 & gt ; 132 and dl 2 & lt ; 8 : 15 & gt ; 136 is output to the 16 dqs . one of the banks 30 a - 30 d is read from or written to during each memory access . further , one portion of one bank 30 a - 30 d , such as the portion of bank zero 100 a or the portion of bank one 100 b , is read from or written to during each memory access . the other portions of bank zero 30 a and bank one 30 b are treated similar to the portion of bank zero 100 a and the portion of bank one 100 b . in addition , bank two 30 c and bank three 30 d of ddr sdram 10 are treated similar to bank zero 30 a and bank one 30 b . to reduce the size of ddr sdram 10 , one of at least two options , cut option one 140 and cut option two 142 , can be selected . fig4 illustrates cut options 140 and 142 for the portion of bank zero 100 a and the portion of bank one 100 b . in the portion of bank zero 100 a , cut option one 140 includes blocks 114 a and 116 a and cut option two 142 includes blocks 110 a and 112 a . likewise , in the portion of bank one 100 b , cut option one 140 includes blocks 114 b and 116 b and cut option two 142 includes blocks 110 b and 112 b . if cut option one 140 is selected , blocks 114 a , 116 a , 114 b , and 116 b are no longer used . selecting cut option one 140 also makes data lines 124 a , 126 a , 124 b , and 126 b no longer needed . with data lines 124 a , 126 a , 124 b , and 126 b no longer needed , data lines dl 1 & lt ; 8 : 15 & gt ; 134 and dl 2 & lt ; 8 : 15 & gt ; 136 also are no longer needed and the second eight dqs are no longer needed . if cut option two 142 is selected , blocks 110 a , 112 a , 110 b , and 112 b are no longer used . selecting cut option two 142 makes data lines 120 a , 122 a , 120 b , and 122 b no longer needed . with data lines 120 a , 122 a , 120 b , and 122 b no longer needed , data lines dl 1 & lt ; 0 : 7 & gt ; 130 and dl 2 & lt ; 0 : 7 & gt ; 132 also are no longer needed and the first eight dqs are no longer needed . selecting cut option one 140 deactivates the portions of the array of memory cells 32 of banks 30 a - 30 d that are electrically coupled to the upper eight dqs . selecting cut option two 142 deactivates the portions of the array of memory cells 32 of banks 30 a - 30 d that are electrically coupled to the lower eight dqs . selecting either cut option one 140 or cut option two 142 reduces the addressable memory size of ddr sdram 10 by one half . therefore , with cut option one 140 or cut option two 142 selected , 16 data bits are accessed per read or write operation instead of the original 32 data bits . the ddr sdram 10 in a × 16 dq organization is reduced to a × 8 organization . fig5 is a diagram illustrating an exemplary embodiment of block 114 a and an associated redundant block 214 a . block 114 a includes word line 34 a , data line 124 a , and part of cluster fail 150 . block 214 a includes word line 34 a , data line 224 a , and part of cluster fail 150 . the data lines 124 a and 224 a are electrically coupled to data line dl 1 & lt ; 8 : 15 & gt ; 134 . block 214 a and data line 224 a include the same features as block 114 a and data line 124 a previously described . block 214 a and data line 224 a , however , are not used unless a defect , such as a cluster fail , in block 114 a or data line 124 a prevents block 114 a from being used . similarly , blocks 110 a , 112 a , 116 a , 110 b , 112 b , 114 b , and 116 b shown in fig4 also have an associated redundant block and data line . in the exemplary embodiment , cluster fail 150 extends into block 114 a and 214 a . therefore , neither block 114 a nor block 214 a can be used . cluster fail 150 renders ddr sdram 10 defective , preventing ddr sdram 10 from being sold in a × 16 dq organization . by selecting cut option one 140 , however , blocks 114 a and 214 a are no longer used and cluster fail 150 is bypassed . the resulting ddr sdram 10 in a × 8 organization is not defective and can be sold . fig6 is a block diagram illustrating an exemplary embodiment of a data line multiplexing circuit 306 for cut option one 140 and cut option two 142 . multiplexing circuit 300 is part of data in / out circuit 46 and is used to route data to the lower eight dqs if either cut option one 140 or cut option two 142 is selected . multiplexing circuit 300 includes multiplexers 302 and 304 . multiplexer 302 receives input data lines dl 1 & lt ; 0 : 7 & gt ; 130 and dl 2 & lt ; 0 : 7 & gt ; 132 and select lines cut option one 140 select line ( sc 1 ) and cut option two 142 select line ( sc 2 ). multiplexer 304 receives input data lines dl 1 & lt ; 8 : 15 & gt ; 134 and dl 2 & lt ; 8 : 15 & gt ; 136 and select lines sc 1 and sc 2 . if sc 1 is true , indicated as a logic high level ( logic 1 ), and sc 2 is false , indicated as a logic low level ( logic 0 ), cut option one 140 is selected . if sc 2 is true , indicated as a logic high level ( logic 1 ), and sc 1 is false , indicated as a logic low level ( logic 0 ), cut option two 142 is selected . sc 1 and sc 2 are not both set true as that would result in none of ddr sdram 10 being addressable . sc 1 and sc 2 are shorted to a logic high level or a logic low level during the manufacturing and testing process of ddr sdram 10 . selecting cut option one 140 results in data on data lines dl 1 & lt ; 8 : 15 & gt ; 134 and dl 2 & lt ; 8 : 15 & gt ; 136 being ignored , indicated at 312 , and data on data lines dl 1 & lt ; 0 : 7 & gt ; 130 and dl 2 & lt ; 0 : 7 & gt ; 132 passing through to data lines dl 1 / 2 & lt ; 0 : 7 & gt ; 306 , indicated at 314 . selecting cut option two 142 results in data on data lines dl 1 & lt ; 8 : 15 & gt ; 134 and dl 2 & lt ; 8 : 15 & gt ; 136 being passed through to data lines dl 1 / 2 & lt ; 0 : 7 & gt ; 306 , indicated at 310 , and data on data lines dl 1 & lt ; 0 : 7 & gt ; 130 and dl 2 & lt ; 0 : 7 & gt ; 132 being ignored , indicated at 316 . selecting neither cut option one 140 nor cut option two 142 results in the data on data lines dl 1 & lt ; 0 : 7 & gt ; 130 and dl 2 & lt ; 0 : 7 & gt ; 132 passing to data lines dl 1 / 2 & lt ; 0 : 7 & gt ; 306 and data on data lines dl 1 & lt ; 8 : 15 & gt ; 134 and dl 2 & lt ; 8 : 15 & gt ; 136 passing to data lines dl 1 / 2 & lt ; 8 : 15 & gt ; 308 . fig7 a and 7 b are block diagrams illustrating an exemplary embodiment of the portion of bank zero looa before and after cut option one 140 is selected . in this embodiment the portion of bank zero 100 a illustrated in fig7 a is a portion of a 512 - mbit × 16 ddr sdram with 32 data bits per memory access . the portion of bank zero 100 a illustrated in fig7 b is a portion of the 512 - mbit × 16 ddr sdram after it is reduced to a 256 - mbit × 8 ddr sdram with 16 data bits per memory access . as illustrated in fig7 a , 32 data bits can be accessed during a read or write operation of the 512 - mbit × 16 ddr sdram . when the 512 - mbit × 16 ddr sdram is cut down to the 256 - mbit × 8 ddr sdram illustrated in fig7 b , 16 of the data bits can no longer be accessed . the memory cells within blocks 114 a and 116 a are no longer addressable . in addition , data lines dl 1 & lt ; 8 : 15 & gt ; 134 and dl 2 & lt ; 8 : 15 & gt ; 136 are no longerused . the portions of memory array 32 of banks 30 a - 30 d that are included in cut option one 140 are deactivated ( made inaccessible ) by blowing fuses for the corresponding bit lines 36 , by blowing fuses for the corresponding data lines , or in any other suitable manner . the 512 - mbit × 16 ddr sdram with 16 dqs and a 16 k page size is cut down to produce a conforming 256 - mbit × 8 ddr sdram with eight dqs and an 8 k page size . this same method can apply to other dq organizations as well . for example , a 512 - mbit × 8 ddr sdram can be cut down to produce a conforming 256 - mbit × 4 ddr sdram .	6
fig1 depicts a plate fin and tube heat exchanger 10 containing plate fins 12 that embody the present invention . each plate fin has a plurality of holes 16 . a common method of manufacturing heat exchanger 10 is to first assemble a plurality of plate fins 12 between two tube sheets 18 , then lace a plurality of hairpin tubes 20 through selected holes 16 in the plate fins 12 and similar holes 16 in each of tube sheets 18 . the heat exchanger assembly is completed by fitting up a plurality of return bends 22 to the ends of hairpin tubes 20 so as to form one or more closed fluid flow paths through the tubes of the heat exchanger . when installed and operating in a device such as an air conditioner , a first fluid , such as a refrigerant , flows through heat exchanger 10 via a fluid flow path or paths defined by interconnected hairpin tubes 20 and return bends 22 . a second fluid , such as air , flows over and around plate fins 12 and tubes 20 . if there is a temperature differential between the two fluids , then heat transfer from the warmer to the cooler of the two takes place through the tube walls and plate fins . turning to fig2 , a single tube 20 is shown disposed through a plurality of plate fins 12 . each plate fin 12 is provided with an upstanding fin collar 30 disposed around the openings 16 . as shown , the collar 30 may be curved so that a convex surface 31 faces the tube 20 . the number of plate fins 12 that can be placed around the tube 20 is determined by the height of the collar 30 . in order to manufacture the heat exchanger of the present invention , the tube 20 to fin 12 joint is brazed in a controlled atmosphere braze furnace . the brazing temperatures will range between 1070 ° f . and 1120 ° f . depending on the clad used . the tube 20 may be constructed of an aluminum alloy that is clad or unclad . the tube 20 may be roll formed with a welded seam or a lock seam . as an alternative , the tube 20 may be extruded . the tube 20 may have a wall thickness of 0 . 016 ″ to 0 . 05 ″ depending on the tube diameter and the working pressure . the tube 20 may have a cross - sectional shape that is round , circular , oval , or the like . the tube material is a long life , high strength , corrosion resistant alloy . for extruded tubes , a 3003 aluminum alloy may be used . for roll formed tube an alcan x - 1000 may be used . the clad alloys may be 4045 or 4343 aluminum alloys . the fins 12 and fin collar 30 may be constructed out of an aluminum alloy 3003 with a 4045 or 4343 alloy clad . if unclad , the fin may be constructed from an 1100 aluminum alloy . the fins may be constructed with a thickness of 0 . 003 ″ to 0 . 016 ″. in addition to the aluminum alloys described above , the present invention may be used for brazing a copper fin to copper tubing or brazing an aluminum fin to copper tubing , as will be evident to those of ordinary skill in the art . in fig3 , a first embodiment of the fin collar 30 of the present invention is shown . a plurality of slits 32 are disposed around the circumference of the fin collar 30 . the slits 32 may be formed by removing material from the collar and may be disposed equidistantly around the perimeter of the collar 30 . the slit may extend from the top 43 of the collar 30 and terminate at a point approximately 0 . 02 ″ from the underside of the fin . the slit 32 is defined by a pair of opposed walls 34 and 36 . the walls 34 and 36 may be angled such that the width 40 across the slit 32 gradually increases from the bottom 42 of the slit 32 to the top 43 of the collar 30 . the slit 32 may range from 0 . 015 ″ to 0 . 15 ″ in width depending on the collar height and the number of slits . the slits 32 improve the tube - to - fin joint both thermally and structurally . with regard to structural properties at the joint , the fin collar 30 of the present invention enhances the flux application and the brazing clad flow because the slits 32 allow the cladding to flow through on both sides of the collar 30 . with regard to heat transfer performance , the split fin collar 30 increases heat transfer between the air and tube surfaces . the slits 32 open access to a portion of the surface of the primary tube 20 for the air flow allowing direct heat transfer from air to the tube 20 without the resistance from secondary sources . ordinarily these portions of the primary tube 20 would be covered by a solid fin collar . turning to fig4 , an alternate embodiment of the fin collar of the present invention is shown . fin collar 40 has a rectangular - shaped slit 42 . the slit 42 is defined by a bottom wall 44 and opposed side walls 46 and 48 . the bottom wall 44 may extend to a point approximately 0 . 02 ″ from the underside of the fin 12 . the collars 40 may have a curvature such that they have a convex shape on the side that faces the tubes 20 . in fig5 , another alternate embodiment of the fin collar of the present invention is shown . fin collar 60 is elongated in the longitudinal ( tube axis ) direction . the collar 60 has a plurality of slits 62 defined therein . the slits 62 also have a rectangular shape and are defined by a bottom wall 64 and a pair of opposed side walls 66 , 68 . the bottom wall 64 may extend to a point approximately 0 . 02 ″ from the underside of the fin 12 . in fig6 and 7 , the fin collar 30 of the present invention is shown with arrows 70 representing air flow around the collar 30 during use . the shape of the fin collar 30 provides interruptions around the circumference of the fin collar 30 perpendicular to air flow . the interruptions will provide turbulence , which is indicated by curved lines 80 , in the boundary layer of air along the fin collar 30 which will increase the rate of heat transfer between the air and the tube 20 . the increased turbulence will also occur around the area near the base of the fin collar 30 in the area of highest fin efficiency , increasing heat transfer rates in that area . while the invention has been described in connection with certain embodiments , it is not intended to limit the scope of the invention to the particular forms set forth , but , on the contrary , it is intended to cover such alternatives , modifications , and equivalents as may be included within the spirit and scope of the invention as defined by the appended claims .	5
referring now to the figures , wherein like reference numbers indicate like elements , fig1 shows a flash - spinning spinneret device 1 connected to a polymer solution supply source . polymer solution 2 under pressure is fed through an orifice 3 into intermediate pressure or letdown pressure zone 4 and then through spinning orifice 5 into web forming chamber 6 . the extrudate from spinning orifice 5 is a plexifilamentary strand 7 . due to the pressure drop at spinning orifice 5 and the high temperature of the spinning solution , vaporization of solvent ( i . e ., fluid medium ) creates a vapor blast which , by passage along the surface of baffle 8 concomitantly with plexifilament 7 , generally follows the path of advance from spinning orifice 5 to collection surface 9 , thereby creating a flow pattern within chamber 6 as indicated by the arrows in fig1 . baffle 8 is mounted on shaft 10 which is mounted in bearing 11 and is rotated by means not shown . the surface of baffle 8 is contoured so that the plexifilamentary strand 7 issuing from orifice 5 is deflected into a generally vertical plane and simultaneously spread laterally to form a plexifilamentary web 21 which oscillates from side - to - side as baffle 8 is rotated . the plexifilamentary web 21 passes from baffle 8 directly into the aerodynamic shield which is comprised of front member 18 and a rear member comprising elements 13 and 17 . multineedle ion gun 14 is mounted on the interior surface of front member 18 , and is connected to constant current power source 35 which supplies a potential that depends upon the fluid medium utilized . in the case of trichlorofluoromethane (&# 34 ; cfc - 11 &# 34 ;), a potential of approximately 50 - 60 kilovolts ( kv ) is necessary . a corona discharge occurs between needles 14 and target plate 13 which is disposed so that the vapor blast originating at 5 and deflected by baffle 8 carries the plexifilamentary web along its charging surface . target plate 13 is connected via commutating ring and brushes to ground by wire 15 and microammeter 16 which indicates target plate current . target plate 13 is an annular metal disc electrode , and is preferably covered with a dielectric insulating surface as disclosed in u . s . pat . no . 3 , 578 , 739 . target plate 13 together with concentric annular segment 17 comprise the rear member of the aerodynamic shield , and are adapted to be rotated concentrically with , but independent of , baffle 8 by means not shown . during rotation of the rear member , its interior surface passes by rotating brush 20 , driven by means not shown , so that the surface of target plate 13 and adjacent parts may be cleared of any debris , thereby furnishing a continuously cleaned surface for optimum operation of the corona discharge . at intervals , in a circular pattern , the rear shield member is pierced by ports 19 through which ambient gas may be aspirated into the step region between concentric disc segments 13 and 17 . after exiting the aerodynamic shield , plexifilamentary web 21 is deposited upon a moving collection surface 9 by impinging on the collection surface at a fiber deposition point . the collection surface is shown moving in direction m . the surface illustrated is a continuous electrically conductive belt forwarded by drive roll 36 . the belt may either be grounded or charged to a positive or negative potential by power source 37 . due to differences in their electrostatic charge , the plexifilamentary web 21 is attracted to collection surface 9 and clings to it in its arranged condition as a swath 38 with sufficient force to overcome the disruptive influences of whatever vapor blast may reach the impingement area . according to the invention , pinning of the plexifilamentary web 21 to collection surface 9 is enhanced by the electrostatic field generated by auxiliary electrostatic field enhancing plate 50 which is charged by power supply 52 . in a preferred embodiment , a curved shield 54 is attached to plate 50 to prevent fibers from depositing on the tip of the plate ( see fig2 and 3 ). wide sheets are produced by blending and overlapping the output ( i . e ., swaths ) from several spinning positions placed in an appropriate manner across the width of a receiving surface such as the collection surface 9 . the sheet is then lightly compacted by roll 41 and is collected on windup roll 42 after passing through port 39 and flexible elements ( or rolls ) 40 which assist in retention of vapor within chamber 6 . a conventional solvent recovery unit 44 may be beneficially employed for environmental considerations and to improve economic operation . the inventive apparatus utilizes an electrostatic field enhancing plate 50 positioned above the collection belt and downstream from the fiber deposition point . it will be understood that another electrostatic field enhancing plate 50 ( not shown ) may be placed slightly upstream of the fiber deposition point to further aid web pinning , however this arrangement is not critical to the invention . this arrangement may be helpful in some operations since the web is directed towards the collection belt on a slight upstream angle to help in web laydown . in this embodiment , the plate 50 is flat although this is not critical to the invention . plate 50 should be made of metal ( e . g ., steel or nickel ) or other highly conductive material . plate 50 is attached to a high electrostatic voltage source 52 , which generates voltages of up to 100 kv . suitable voltage sources include commercial power supplies produced by del electronics , inc . of mt . vernon , ny , glassman high voltage , inc . of white horse station , nj or hipotronics , inc of hipo brew , ny . preferably , the plate is positioned between about 3 and 10 cm above the collection surface and between about 5 and 10 cm downstream from the fiber deposition point ( i . e ., laydown position ). as shown , the plate can be positioned parallel with the collection surface although it will understood that the plate may also be slightly slanted ( e . g ., 10 degrees from horizontal ). in a preferred embodiment as shown in more detail in fig3 shield 54 is attached to the leading edge of plate 50 . the purpose of shield 54 is to direct the plexifilaments underneath plate 50 , and to prevent the plexifilaments from depositing on the tip of the plate . shield 54 may be made of acrylic resin , polycarbonate resin , or other non - conductive material . such a suitable acrylic resin material is commercially available from e . i . du pont de nemours and company , wilimington , delaware under the trademark &# 34 ; lucite ®&# 34 ;. the magnitude of the electrostatic field generated by plate 50 will depend on the fluid medium inside the spinning cell , the charge on the fibers , and the aerodynamic forces acting on the fibers . pinning forces are a product of charge and electrostatic field . thus , fibers with high charge need less electrostatic field to pin as effectively as fibers with lower charge and high electrostatic field . the strength of the electrostatic field must not exceed the electrostatic breakdown potential of the surrounding fluid medium . the following is believed to be the most accurate data available for several fluid mediums useful in the invention . for trichlorofluoromethane , known in the trade as cfc - 11 and identified in the prior art as a commercial flash spinning agent , the breakdown potential is about 80 kv / cm . for hydrocarbons containing 4 to 6 carbon atoms , such as butane , pentane or hexane , the breakdown potential is about 50 kv / cm . for 2 , 2 - dichloro - 1 , 1 , 1 - trifluoroethane (&# 34 ; hcfc - 123 &# 34 ;) the breakdown potential is about 75 kv / cm , for 2 - chloro - 1 , 1 , 1 , 2 - tetrafluoroethane (&# 34 ; hcfc - 124 &# 34 ;), the breakdown potential is about 45 kv / cm and for pentafluoroethane (&# 34 ; hfc - 125 &# 34 ;), the breakdown potential is about 25 kv / cm . preferably , the impressed electrostatic field will be no greater than about 95 % of the breakdown potential of the fluid medium . as noted before , although the previous description has focused on flash - spinning operations , the process and apparatus of the present invention may also be advantageously applied to any of several fiber - forming processes in which fibers are formed and collected on a moving collection surface to make a fibrous web , for example , by melt - blowing or spunbonded processes . moreover , it will be understood that spinning orientation is arbitrary and that , as an example , fibers may be deposited horizontally on a vertical collection surface ( e . g ., some melt - blown processes ). the following example is provided for purposes of illustration only and not to limit the invention in any way . fig4 shows the results of a particular computational experiment conducted using a flash - spinning computer study . the lower curve ( a ) represents the prior art ( i . e ., the process and apparatus of brethauer et al ., u . s . pat . nos . 3 , 851 , 023 and 3 , 860 , 369 ) and shows the electrostatic field as a function of distance from a point directly beneath the spinning jet centerline ( i . e ., below the space defined by the center of elements 17 and 18 of fig1 ). the upper curve ( b ) represents the inventive process and apparatus and demonstrates that higher electrostatic fields are generated when a plate ( a flat plate in this case ) of about 12 inches ( 30 . 5 cm ) in width ( w ) and infinite length ( l ) is positioned about 2 1 / 2 inches ( 6 . 4 cm ) downstream ( d ) from the spinning jet centerline and about 3 inches ( 7 . 6 cm ) above ( h ) the collection surface , and is charged to an electrostatic potential of about 100 kv ( see fig2 and 3 ). in both of these curves , the electrostatic field was measured about 1 / 2 inch ( 1 . 3 cm ) above the collection surface . although particular embodiments of the present invention have been described in the foregoing description , it will be understood by those skilled in the art that the invention is capable of numerous modifications , substitutions and rearrangements without departing from the spirit or essential attributes of the invention . reference should be made to the appended claims , rather than to the foregoing specification , as indicating the scope of the invention .	1
fig1 shows a schematic diagram of an internal combustion engine starting system 10 according to an embodiment of the present invention . starting system 10 of fig1 comprises starter motor 14 , alternator 16 , battery 18 , power module 20 , solenoid 32 , and switch 40 . starter motor 14 is an internal combustion engine starter motor comprising a pinion gear ( not shown ). starter motor 14 is installed in a typical arrangement with an internal combustion engine ( not shown ), where the pinion gear of starter motor 14 drives a flywheel ring gear ( not shown ) on the internal combustion engine in order to crank the internal combustion engine . solenoid 32 is an internal combustion engine starter motor solenoid comprising pull - in coil 31 , hold - in coil 33 , and contacts 34 . alternator 16 is an internal combustion engine alternator . after the internal combustion engine has started , the alternator 16 is mechanically driven by the internal combustion engine and provides electric current to recharge battery 18 , and to fulfill the electrical needs of the vehicle or apparatus in which the internal combustion engine is installed . battery 18 is a battery , such as an automotive battery , comprising negative terminal 17 and positive terminal 19 . battery 18 is connected to alternator 16 such that battery 18 can be charged by the electrical current delivered from alternator 16 . switch 40 is an ignition switch of a type known in the art . power module 20 comprises m (+) terminal 22 , b (+) terminal 24 , neg (−) terminal 26 , c terminal 28 , capacitor 30 , relay 42 , relay 44 , control logic device 46 , and , optionally , diode 52 . relay 42 is an electrical relay comprising terminals 41 , 43 , and 45 . relay 42 is shown in fig1 as an electromechanical relay , however it is within the scope of the present invention to deploy a solid state relay as relay 42 . relay 44 is an electrical relay comprising terminals 47 , 49 , and 51 . relay 44 is shown in fig1 as a solid state relay , however it is within the scope of the present invention to deploy an electromechanical relay as relay 44 . terminal 45 of relay 42 is electrically connected to terminal 49 of relay 44 . in an embodiment , capacitor 30 is an electric double layer capacitor of the type referred to as a “ super capacitor ” or an “ ultra capacitor .” in an alternative embodiment , capacitor 30 may comprise a bank of capacitors . as shown fig1 , the positive lead of capacitor 30 is connected to terminal 43 of relay 42 . the negative lead of capacitor 30 is connected to neg (−) terminal 26 and to terminal 47 of relay 44 . control logic device 46 is electrically connected to c terminal 28 and to terminal 51 of relay 44 . the function of control logic device 46 according to the present invention is discussed hereinafter . the function of control logic device 46 may be deployed in a number of different physical forms as may occur to one of skill in the art . for example , control logic device 46 may be comprised of electronic logic devices or may comprise a microprocessor and associated software . b (+) terminal 24 is electrically connected to the positive terminal 19 of the battery 18 . c terminal 28 is electrically connected to node 50 , which is in the electrical path between the starter switch 40 and the solenoid 32 . the m (+) terminal 22 is electrically connected to b (+) terminal 24 , to terminal 41 of relay 42 , and to contacts 34 . diode 52 may be included between the m (+) terminal 22 and b (+) terminal 24 to prevent discharging of capacitor 30 into battery 18 . when relay 42 is closed , m (+) terminal 22 is electrically connected to capacitor 30 . when contacts 34 are closed , m (+) terminal 22 is electrically connected to starter motor 14 . neg (−) terminal 26 is electrically connected to ground . in an embodiment , power module 20 comprises an insulated casing with capacitor 30 , relay 42 , relay 44 , and control logic 46 contained inside the insulated casing , and m (+) terminal 22 , b (+) terminal 24 , neg (−) terminal 26 , and c terminal 28 protruding through the insulated case to electrically connect capacitor 30 , relay 42 , relay 44 , and control logic 46 to other components of the electrical system . in the embodiment of starting system 10 shown in fig1 , battery 18 and capacitor 30 are available to provide cranking current to starter motor 14 . when switch 40 is closed , current flows from battery 18 to pull - in coil 31 and hold - in coil 33 of solenoid 32 , causing the contacts 34 to close . closing contacts 34 short - circuits pull - in coil 31 , and causes the pinion gear of starter motor 14 to engage the flywheel ring gear of the internal combustion engine . when switch 40 is closed , the current flow / voltage change is detected by control logic device 46 at node 50 . upon sensing of this current / voltage change , control logic device 46 implements a short delay ( e . g ., less than one second ) before providing a control signal to relay 44 . when this control signal is applied to relay 44 , a path is established between the windings of relay 42 and ground . current flows through the windings of relay 42 , closing the relay contacts and establishing an electrical connection between capacitor 30 and m (+) terminal 22 . this allows the current from capacitor 30 to be delivered to starter motor 14 through closed contacts 34 . because of the delay implemented by control logic device 46 , the current from capacitor 30 is not delivered to starter motor 14 until the pinion gear of starter motor 14 has been given the opportunity to fully engage the flywheel ring gear of the internal combustion engine . in an embodiment of the present invention , control logic device 46 is designed to close relay 44 two - tenths ( 0 . 2 ) of a second after switch 40 is closed , and to open relay 44 thirty ( 30 ) seconds later or twenty - five ( 25 ) seconds after sensing a condition of greater than 14 volts at node 50 . other timing parameters may be selected according to the needs of a practitioner of the present invention , with each selected parameter falling within the scope of the present invention . because relay 44 is closed for a period of time after the internal combustion engine is started , capacitor 30 is allowed to be recharged by alternator 16 . once capacitor 30 is recharged , it must be prevented from discharging back into the battery . thus , relay 44 is opened after a pre - determined period of time , or upon the sensing of certain conditions . in an embodiment , control logic device 46 also is designed to open relay 44 if a voltage of less than six volts is sensed at node 50 . fig2 shows a schematic diagram of another embodiment of internal combustion engine starting system 10 according to the present invention . the embodiment of starting system 10 of fig2 comprises many of the same elements shown in fig1 . however , in the embodiment of starting system 10 of fig2 , relay 42 and relay 44 are replaced by a single relay 54 . in the embodiment shown in fig2 , relay 54 is a solid state relay comprising terminals 56 , 58 , and 59 , however it is within the scope of the present invention to use an electromechanical relay as relay 54 . terminal 56 of relay 54 is electrically connected to the positive lead of capacitor 30 . terminal 58 of relay 54 is electrically connected to m (+) terminal 22 . terminal 59 of relay 54 is electrically connected to control logic device 46 . in the embodiment of starting system 10 shown in fig2 , when switch 40 is closed , the current flow / voltage change is detected by control logic device 46 at node 50 . upon sensing of this current / voltage change , control logic device 46 implements a short delay ( e . g ., less than one second ) before providing a control signal to relay 54 . when this control signal is applied to relay 54 , relay 54 establishes an electrical connection between capacitor 30 and m (+) terminal 22 . this allows the current from capacitor 30 to be delivered to starter motor 14 through closed contacts 34 . because of the delay implemented by control logic device 46 , the current from capacitor 30 is not delivered to starter motor 14 until the pinion gear of starter motor 14 has been given the opportunity to fully engage the flywheel ring gear of the internal combustion engine . in an embodiment of the present invention , control logic device 46 is designed to close relay 54 two - tenths ( 0 . 2 ) of a second after switch 40 is closed , and to open relay 54 thirty ( 30 ) seconds later or twenty - five ( 25 ) seconds after sensing a condition of greater than 14 volts at node 50 . other timing parameters may be selected according to the needs of a practitioner of the present invention , with each selected parameter falling within the scope of the present invention . because relay 54 is closed for a period or time after the internal combustion engine is started , capacitor 30 is allowed to be recharged by alternator 16 . once the capacitor is recharged , it must be prevented from discharging back into the battery . thus , relay 54 is opened after a pre - determined period of time , or upon the sensing of certain conditions . in an embodiment , control logic device 46 also is designed to open relay 54 if a voltage of less than six volts is sensed at node 50 . as described above , power module 20 not only provides an additional power source for cranking an internal combustion engine , but also implements a delay between the time the ignition switch is closed and the time when the additional power source is called upon to provide cranking power for the internal combustion engine . in particular , power module 20 allows only one power source ( e . g ., a standard battery ) to be used when the pinion gear is moved into engagement with the flywheel ring gear , thereby limiting the rotational speed and force of the pinion gear as it moves into engagement with the flywheel ring gear . this reduces the chance for less than full engagement between the pinion gear and flywheel ring gear as they are moved together , and reduces the chance for milling between the pinion gear and ring gear once the drive shaft of the starter motor transmits torque to the pinion gear . fig3 shows a schematic diagram of a internal combustion engine starting system 10 according to another embodiment of the present invention . starting system 10 of fig3 comprises starter motor 14 , alternator 16 , battery 18 , capacitor 30 , solenoid 32 , switch 40 , optional diode 52 , and current limiting device 60 . starter motor 14 , alternator 16 , battery 18 , capacitor 30 , solenoid 32 , switch 40 , and optional diode 52 are described above in reference to fig1 and 2 . current limiting device 60 comprises a pulse width modulation circuit designed to interrupt direct current at predetermined intervals , thereby producing pulses of direct current . in an embodiment , current limiting device 60 comprises a dc chopper device . in the embodiment of starting system 10 shown in fig3 , when switch 40 is closed , current flows from battery 18 to pull - in coil 31 and hold - in coil 33 of solenoid 32 , causing contacts 34 to close . closing contacts 34 short - circuits pull - in coil 31 , and causes the pinion gear ( not shown ) of starter motor 14 to engage the flywheel ring gear of the motor vehicle engine . the current flow / voltage change through switch 40 is detected by current limiting device 60 at node 50 . upon sensing of this current / voltage change , current limiting device 60 operates to interrupt direct current from battery 18 and capacitor 30 at predetermined intervals . pulses of direct current are thereby delivered to motor 14 . after a predetermined period of time , current limiting device 60 ceases its direct current pulsing effect , and uninterrupted direct current from battery 18 and capacitor 30 then is delivered to motor 14 . the effect of the temporary direct current pulsing created by current limiting device 60 is to reduce the rotational acceleration of starter motor 14 , thus enhancing the probability of proper engagement between the pinion gear and the flywheel ring gear before the full current from battery 18 and capacitor 30 is delivered to starter motor 14 . in the embodiments shown in fig1 - 3 , an electric double layer capacitor is deployed as an additional voltage source for providing internal combustion engine cranking current . however , any number of voltage sources can be used , such as one or more additional batteries . these additional voltage sources enhance battery 18 during engine cranking , and help maintain battery 18 at a higher state of charge , thereby extending the life of battery 18 . in yet another embodiment , starting system 10 is adapted to include a sensor ( not shown ) that provides positional information about the pinion gear of motor 14 . in the embodiment of starting system 10 shown in fig1 and 2 , such a sensor may be used in lieu of control logic device 46 . in operation , the sensor is operable to detect when the pinion gear of motor 14 has moved to a point where it necessarily must be engaged with the internal combustion engine ring gear . when this degree of movement is detected , the sensor is operable to actuate relay 44 ( in the embodiment of fig1 ) or relay 54 ( in the embodiment of fig2 ), thereby making the electrical connection between capacitor 30 and motor 14 . in the context of the embodiment shown in fig3 , when this degree of movement of the pinion gear is detected , the sensor is operable to cause current limiting device 60 to permit uninterrupted direct current from battery 18 and capacitor 30 to be delivered to motor 14 . fig4 shows a schematic diagram of a internal combustion engine starting system 10 according to another embodiment of the present invention . starting system 10 of fig4 comprises starter motor 14 , alternator 16 , battery 18 , capacitor 30 , solenoid 32 , switch 40 , and current booster 70 . starter motor 14 , alternator 16 , battery 18 , capacitor 30 , solenoid 32 , and switch 40 are described above in reference to fig1 and 2 . current booster 70 is operable to enhance the current delivered from battery 18 to starter motor 14 . in an embodiment , current booster 70 comprises a dc - to - dc converter circuit operable to boost the voltage of battery 18 , thereby delivering additional cranking current to starter motor 14 . in the embodiment of starting system 10 shown in fig4 , when switch 40 is closed , current flows from battery 18 to pull - in coil 31 and hold - in coil 33 of solenoid 32 , causing contacts 34 to close . closing contacts 34 short - circuits pull - in coil 31 , and current flows from battery 18 to starter motor 14 causing the pinion gear ( not shown ) of starter motor 14 to engage the flywheel ring gear of the motor vehicle engine . the current flow / voltage change through switch 40 is detected by current booster 70 at node 50 . current booster 70 then is activated a predetermined period of time after the current flow / voltage change is detected at node 50 . when activated , current booster 70 boosts the voltage of battery 18 , thereby delivering additional cranking current to starter motor 14 . because of the delay implemented by current booster 70 , the stepped up current is not delivered to starter motor 14 until the pinion gear of starter motor 14 has been given the opportunity to fully engage the flywheel ring gear of the internal combustion engine . in an embodiment of the present invention , current booster 70 is activated two - tenths ( 0 . 2 ) of a second after switch 40 is closed , and deactivates thirty ( 30 ) seconds later or twenty - five ( 25 ) seconds after sensing a condition of greater than 14 volts at node 50 . other timing parameters may be selected according to the needs of a practitioner of the present invention , with each selected parameter falling within the scope of the present invention . while this invention has been described as having a preferred design , the present invention can be further modified within the scope and spirit of this disclosure . this application is therefore intended to cover any variations , uses , or adaptations of the invention using its general principles . each such implementation falls within the scope of the present invention as disclosed herein and in the appended claims . furthermore , this application is intended to cover such departures from the present disclosure as come within known or customary practice in the art to which this invention pertains and which fall within the limits of the appended claims .	5
a sample of raw undecomposed ; i . e ., unactivated , sewage sludge was obtained from the sewage treatment plant located at the city of woonsocket , r . i . analysis of the material showed the following : ______________________________________total solids 6 % total nitrogen ( solids ) 2 % bacteriological reportculture report indicates the pressureofstreptococcus ( alpha ) gr . 0escherichia colienterobacter groupb . sablilissmear report : gram neg . - gram pos . rods gram positive diplorocci______________________________________ 1 , 000 grams of this raw sewage sludge was treated with 60 grams of a urea - formaldehyde solution prepared in the following manner : 50 grams of commercially available 37 % formaldehyde was neutralized with triethanolamine to a ph of 8 . 0 . to this was added 50 grams of a commercially available prilled urea containing 46 % nitrogen . the negative heat of solution caused a drop in temperature to 5 ° c . the solution was gently heated to 30 ° c at which point the urea was in solution with the formaldehyde . after 10 minutes the temperature of this solution rose to 60 ° c at which point it was added to the 1 , 000 grams of sewage sludge . the resulting mixture ( a heavy viscous mass ) was kept under constant agitation at a temperature of 20 ° to 25 ° c . the temperature was raised to 60 ° c and maintained at this level for a period of about 30 minutes at which time sufficient dilute hydrochloric acid was added to reduce the ph to 3 . 0 . the resulting slurry began to thicken quite rapidly at this point and was transferred to a mechanical kneader for further handling . after a period of about 5 minutes , the methyleneization was considered complete because of an absence of any formaldehyde odor . the compound was further tested by deniges method and a modified schiff &# 39 ; s reagent and no formaldehyde was found to be present . at this point a sufficient quantity of calcium carbonate was added to neutralize the mixture and to raise the ph to 6 . 5 to 7 . 0 . without further treatment , the product was subjected to the same analysis as the raw sewage sludge with the following results : ______________________________________total solids 10 % total nitrogen ( solids ) 21 % bacteriological reportculture -- no growthsmear -- no bacteria______________________________________ a portion of the above sample was passed through a 10 - mesh sieve . the resulting granular product was then subjected to drying at 100 ° c for a period of 30 minutes . the sample was then analyzed for its agronomic usefullness as a high analysis organic nitrogen fertilizer . the qualities sought for in an organic material as a fertilizer are : most nitrogenous organic fertilizers contain about 6 % nitrogen , while the average mineral or inorganic fertilizer contains between 10 and 20 percent of this essential plant food element . from the economic standpoint of transportation and application of fertilizer this means that the currently available sources of organic fertilizers are between 100 and 300 percent more expensive than their mineral counterparts . therefore , an organic compound with competitive nitrogen contents would be highly desirous . organic forms of nitrogen have always commanded a premium price in the fertilizer market because of the relative insolubility of their plant food nitrogen . this insolubility leads to longer lasting nitrogen and considerably less leaching of the nitrogen . from the standpoint of ecology , insoluble forms of nitrogen prevent leaching or washing into surrounding water stratums , rivers , streams , etc .. insoluble forms of nitrogen usually depend on their release of nitrogen plant food through natural bacterial decomposition in the soil . this results in a more gradual release of the nitrogen plant food , as well as a stimulation of the soil micro flora and fauma . many forms of insoluble nitrogen are so tightly bound in complex molecules that for all practical purposes they are available for bacterial breakdown and therefore cannot enter the food chain cycle . recent work has indicated that the availability of insoluble nitrogen can be obtained by determining the percentage of water insoluble nitrogen which dissolves when a sample of 0 . 25 grams of the product is heated to 100 ° c for 30 minutes in 250 milliliters of neutralized water . the percentage figure thus obtained is called the &# 34 ; activity index &# 34 ;. it is generally accepted that a product with an &# 34 ; activity index &# 34 ; of greater than 40 will yield the bulk of its nitrogen within a six - months incubation period in the soil . the analysis of the product obtained from this example was : 1 , 000 grams of a fish meal intended for use as a poultry feed supplement , and containing about 9 % nitrogen , and found to be contaminated with pathogenic salmonella was treated with 10 , 20 , 30 , 40 , 50 , 60 , 70 , 80 , 90 , and 100 grams respectively of a urea - formaldehyde solution prepared in the same manner as indicated in example 1 . the urea - formaldehyde solution was added to the dry fish meal as a fine spray , while the meal was being rotated in a cylinder similar in appearance to a small sized cement mixer . the temperatures of the resulting mixtures were raised to 30 ° c . the products were held at this temperature for a period of about 2 minutes at which point the methyleneization step was introduced by spraying a dilute solution of hydrochloric acid until a ph of 3 . 0 was recorded . the products were held under this condition until methyleneization was complete as indicated by the tests performed in example 1 . a sufficient amount of calcium carbonate was added to the mixtures to insure a neutral ph . without further treatment , the samples were subjected to bacteriological and chemical analysis with the following results : ______________________________________ salmonella % protein______________________________________check 0 treatment + 56 . 25 10 gr . treatment - 57 . 09 20 gr . treatment - 57 . 93 30 gr . treatment - 58 . 78 40 gr . treatment - 59 . 62 50 gr . treatment - 60 . 46 60 gr . treatment - 61 . 30 70 gr . treatment - 62 . 14 80 gr . treatment - 62 . 98 90 gr . treatment - 63 . 82 100 gr . treatment - 64 . 66______________________________________ a sample of tannery waste sludge containing about 10 % solids and composed of such materials as fleshings , hair , entrails , and general nide scrappings ( in addition to these organic constituents there was a sufficient amount of sulfide contamination to cause considerable odor problems ) was subjected to our treatment by adding 166 grs . of urea - formaldehyde solution , prepared in accordance with example 1 , to 1 , 000 grams of the tannery waste sludge . in the same manner as previously disclosed , the resulting slurry was maintained at a ph of 8 . 0 and a temperature of 30 ° c for a period of 30 minutes . the ph was then reduced to 3 . 0 by the addition of a dilute solution of sulfuric acid and the temperature was raised to 60 ° c . sufficient agitation was supplied to maintain a state of equilibrium between solid and liquid phases . methyleneization was allowed to continue to a point where no free formaldehyde was detected by deniges method described in example 1 . the resulting mixture was then neutralized with a sufficient quantity of a dilute sodium hydroxide solution ( 1 % naoh ) to raise the ph level to 7 . 5 , dried by subjecting the mixture to a continuous stream of hot air ( 110 ° c ) while tumbling in a rotating cylinder for a time sufficient to reduce the moisture content to about 5 % and then ground to a uniform particle size (- 10 - 20 mesh ). this product was then analyzed for its agronomic properties and found to contain the following : the process of my present invention has many advantages in the treatment of pathogenic waste materials in so far as the investment of capital equipment is minimal . for example , a small jacketed reaction vessel may be used to prepare the methylol solution . this solution may be added batch - wise or continuously to the organic waste material . the methyleneization step of our process can be carried out by an in - line injection of the mineral or organic acid . neutralization can also be effected in the same manner . both steps can be greatly accelerated by elevating the temperature of the organic waste material to be treated . in the case of a sludge - like material such as the raw sewage sludge and tannery waste used in our experiments , the material can be passed through a heat exchange . the urea - formaldehyde solution can also be handled in the same manner . in the case of dry materials , such as the fish meal used in our second experiment , they can be passed through a rotating cylinder concurrently or countercurrently to a stream of heated air in order to raise the temperature to around 60 ° c . it has been found that the preparation of a preformed urea - methylol solution and prereaction with an organic waste material provides unexpected and increased efficiency in the dewatering of the waste product from the solution . the addition and prereaction of the methylol solution is superior to the addition separately of urea or formaldehyde and in situ condensation . two buckets of sewage sludge were collected from the merrimack , new hampshire waste treatment plant , in each run , 1 , 000 ml of sludge were used . adjustment of ph in the process was done with 12 % koh for the alkaline step , and 30 % h 3 po 4 for the acid step . both samples of sludge contained 3 . 7 - 4 . 0 % solids as determined by overnight drying at 100 ° c . the samples were treated with urea , formaldehyde and urea - formaldehyde methylol solutions as set forth in table i . table i______________________________________ m1 reactant - grams ureasample sludge reactant to - sludge gramsno . taken added solids ratio formaldehyde______________________________________1 1 , 000 u / f 1 / 1 20 / 202 1 , 000 u / f 1 . 5 / 1 30 / 303 500 blank -- -- 4 1 , 000 u - f 1 / 1 20 / 205 1 , 000 f - u 1 / 1 20 / 206 1 , 000 f - u 1 . 5 / 1 30 / 307 1 , 000 u - f 1 . 5 / 1 30 / 308 1 , 000 u / f 1 . 5 / 1 30 / 30______________________________________ * u / f = normal makeup of urea - formaldehyde solution ( methylol solution ) u - f = urea added for 10 minutes followed by formaldehyde for 10 minutes f - u = formaldehyde added first , followed by urea - same time . all samples were treated at 60 °- 65 ° c at ph 7 . 2 to 7 . 5 alkaline conditions , and then subsequently converted to an acid condition ph of 3 . 0 to 3 . 5 . the samples were placed in one quart plastic containers and filtered . filtrations were carried out , of 200 grams of each sample , through two pieces of 12 . 5 cm whatman # 1 filter paper using a vacuum pump set at 15 inches water vacuum . the amount of filtrate obtained in 10 minutes was determined along with the grams and percent solids of the filter cake . sedimentation tests were attempted in 40 ml centrifuge tubes ; however , because of the heavy amount of flocculation , sedimentation rates had to be carried out on diluted samples ( 35 gram sample -- 15 grams water ) and thoroughly shaken before sedimentation . table ii shows the results of the filtration experiment . the processed sludge samples , regardless of the method , filtered well , while the blank sample filtered only slightly in the 10 - minute period . in comparing the ( f - u ) versus the ( u - f ) method , the ( f - u ) gave better filtrations . the u / f preparation gave the highest solids filter cake at both reactant levels of 1 / 1 and 1 . 5 / 1 . table ii______________________________________ react / sludge gms ** % solidssample reactant ratio ml * filter filterno . added ( gms ) filtrate cake cake______________________________________1 u / f 1 / 1 157 40 . 8 21 . 22 u / f 1 . 5 / 1 -- -- -- 3 blank -- 35 too wet to determine4 u / f 1 / 1 134 58 . 9 14 . 75 f - u 1 / 1 151 45 . 9 18 . 56 f - u 1 . 5 / 1 151 47 . 4 23 . 77 u - f 1 . 5 / 1 145 52 . 0 19 . 48 u / f 1 . 5 / 1 151 47 . 8 25 . 5______________________________________ * after 10 minutes filtration at 15 &# 34 ; vacuum ** grams wet filter cake after 10 minutes the sedimentation tests showed only that all the processed samples , regardless of the method , settled out in a uniform rate ; that is , no differences in sedimentation rate were seen . after one hour in the centrifuge tubes , samples 1 , 6 , 7 and 8 showed 6 ml of clearing . the blank showed only 1 ml , indicating that processing did have an affect on the sedimentation . the use of methylol solution ( sample # 1 ) in comparison to the addition of formaldehyde first ( sample # 5 ) provided for an additional 2 . 7 % solids collection or an increased dewatering efficiency of 14 . 5 %. sample # 8 compared with sample # 7 with urea added first provided for an additional 6 . 1 % solids on increase in efficiency of 31 . 4 %. my process has also the advantage that it can reduce organic waste materials to pathologically pure materials which can be recycled to the ecology in a matter of minutes , where as concurrently available methods require 30 to 60 days to achieve a similar result . this process has further advantages in that its products can be recycled to the ecology at a level substantially higher than similarly biologically treated products . biologically treated products are not pathologically pure and therefore cannot be considered for use as an animal or human feed supplement . the products of my invention are pathologically pure and could be considered for these purposes .	8
as used throughout this application , the term halogen includes all four halogens i . e ., fluorine , chlorine , bromine and iodine with chlorine , bromine and iodine being preferred and chlorine being especially preferred . furthermore , as used throughout the application , the term &# 34 ; lower alkyl &# 34 ; includes both straight and branched chain alkyl groups having from 1 to 7 carbon atoms such as methyl , ethyl , propyl , n - butyl , isopropyl etc . with methyl and ethyl being preferred . also as used herein , the term &# 34 ; lower alkanoic acids &# 34 ; comprehend an alkanoic acid of from 1 to 7 carbon atoms such as acetic acid , formic acid and propionic acid . as also used herein , the term &# 34 ; aryl &# 34 ; signifies mononuclear aromatic hydrocarbon groups such as phenyl , which can be unsubstituted or substituted in one or more position with a lower alkylenedioxy , a halogen , nitro , lower alkyl or lower alkoxy substituent and polynuclear aryl groups such as naphthyl , which can be unsubstituted or substituted with one or more of the aforementioned groups . the preferred aryl group is the substituted or unsubstituted mononuclear aryl group , phenyl . the term &# 34 ; aryl lower alkyl &# 34 ; comprehends aryl lower alkyl groups wherein aryl and lower alkyl are as defined above , preferably those groups where lower alkyl is methyl . the preferred aryl lower alkyl substituent is benzyl . the term &# 34 ; aryl lower alkanoic acid &# 34 ; comprehends aryl lower alkanoic acid groups where &# 34 ; aryl &# 34 ; and &# 34 ; lower alkanoic acid &# 34 ; are as defined above and includes aryl carboxylic acids . the preferred &# 34 ; aryl lower alkanoic acid &# 34 ; being an arylcarboxylic acid such as benzoic acid . as used herein , lower alkoxy comprehends lower alkoxy groups having 1 to 7 carbon atoms such as methoxy and ethoxy . the term &# 34 ; lower alkylenedioxy &# 34 ; designates lower alkylenedioxy group contain from 2 to 7 carbon atoms such as ethylenedioxy . in the compound of formula ii which is used as starting material for vitamin e or intermediates for vitamin e , r 1 can be any protecting group removable by basic hydrolysis or by hydrogenolysis . therefore the conventional protecting groups removable either by basic hydrolysis or hydrogenolysis to yield the hydroxy group can be utilized as the protecting group r 1 in the process of this invention . among these protecting groups are included ester groups derived from a lower alkanoic or aryl lower alkanoic acid . any conventional method of forming these ester protecting groups can be utilized in the process of this invention . any conventional ether protecting groups removable by hydrogenolysis can be utilized in this invention . among the preferred ether protecting groups are the aryl methyl ethers such as benzyl ethers . these protecting groups can be removed by hydrogenolysis to yield the corresponding hydroxy group by conventional means well known in the art . the compound of formula ii is converted to the compound of formula i by treating the compound of formula ii with a hydrohalic acid preferably hydrochloric acid at temperatures of from - 30 ° c . to + 30 ° c . preferably from - 10 ° c . to + 10 ° c . in a inert organic solvent medium . generally , this reaction is carried out under anhydrous conditions . in carrying out this reaction , it is generally preferred to utilize an inert organic solvent . any conventional ether solvent can be utilized to carry out this reaction . among the preferred ether solvents are diethylether , tetrahydrofuran , glyme and diglyme . in the next step of this invention , the compound of formula i is reacted with the compound of formula iii to produce either the compound of formula iv or the compound of formula v or the compound of formula vi . formation of either the compound of formula iv , v or vi will depend upon the precise substituent utilized for r 2 in the compound of formula iii . where y in the compound of formula iii is an alkali metal , y can be any conventional alkali metal , such as lithium , sodium or potassium with sodium and potassium being especially preferred . the reaction of the compound of formula i with the compound of formula iii where y is alkali metal is carried out under anhydrous conditions in an inert organic solvent medium . in carrying out this reaction any conventional inert organic solvent can be utilized as the reaction medium with either solvents such as those mentioned hereinbefore being particularly suitable . the preferred inert organic solvent medium is diethylether . in carrying out this reaction temperature are from - 30 ° c . to + 30 ° c . can be utilized with temperatures of from 0 ° c . to 15 ° c . being especially preferred . when y in the compound of formula iii is mgx , the compound of formula i and the compound of formula iii are reacted to produce either the compound of formula iv , v or vi , depending upon r 2 , in an inert organic solvent at temperatures ranging from - 100 ° c . to 0 ° c . it is preferred to carry out this reaction at temperatures from - 80 ° c . to - 30 ° c . this reaction can be carried out at these temperatures in an inert organic solvent medium with the ethers such as those mentioned hereinbefore being especially suitable for this reaction . in accordance with this invention the compounds of formula iv are converted to the known vitamin e intermediates of the formula : ## str5 ## where r 1 is as above by conventional procedures . any conventional method for converting a malonic acid to an acetic acid can be utilized in this conversion . among the preferred methods is hydrolysis followed by decarboxylation . in accordance with this invention the compounds of formula v are converted to the known vitamin e intermediates of the formula : ## str6 ## wherein r 1 is as above ; by conventional procedures for converting a terminal double bond to an aldehyde among the preferred methods for carrying out this reaction is ozonolysis followed by a reductive workup . in the examples , reactions described below were carried out under an atmosphere of argon . column chromatography was performed using em silica gel 60 ( 0 . 063 - 0 . 2 mm ). anhydrous ether and tetrahydrofuran were distilled from sodium benzophenone ketyl immediately prior to use . the ether used in these examples is diethyl ether . to a solution of 5 g ( 16 mmol ) of rac - 3 , 4 - dihydro - 6 -( phenylmethoxy )- 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran - 2 - ol in 50 ml of anhydrous ether was added 5 g of 4 a molecular sieves . the mixture was stirred mechanically with ice - bath cooling while hcl gas was bubbled in for 30 min . stirring was continued at 0 ° c . for 30 min and then the solvent was removed in vacuo . the residue was treated with 500 ml of hexane and the solution was decanted . the hexane solution was then treated with 10 g of anhydrous cacl 2 and the mixture stirred for 2 hr . the solids were filtered and the filtrate was concentrated in vacuo to a volume of ca . 20 ml . crystallization was induced by cooling to - 10 ° c . and stirring , then the remaining solvent was removed in vacuo giving 4 . 9 g ( 92 . 8 % yield ) of rac - 2 - chloro - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 6 -( phenylmethoxy )- 2h - 1 - benzopyran as a colorless solid . the chlorochroman decomposed upon attempted column or thin layer chromatography . it was stored at 0 ° c . a mixture of 10 g ( 37 . 9 mmol ) of rac - 3 , 4 - dihydro - 6 - acetyloxy - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran - 2 - ol and 10 g of 4 a molecular sieves in 200 ml of anhydrous ether was stirred with ice - bath cooling while hcl gas was bubbled in for 30 min . the mixture was filtered and the filtrate concentrated in vacuo . the residue was taken up in 600 ml of hexane and anhydrous cacl 2 was added . the mixture was stirred for 1 hr then filtered and the filtrate was concentrate in vacuo giving 4 . 3 g ( 40 . 2 % yield ) of rac - 2 - chloro - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran - 6 - ol acetate as a colorless solid , mp 102 °- 106 ° c ., which was unstable to column or thin layer chromatography . a 370 mg ( 9 . 25 mmol ) sample of 60 % by weight sodium hydride 40 % by weight mineral oil dispersion was washed free of oil with hexane and treated with 20 ml of anhydrous tetrahydrofuran . the resulting slurry was stirred with ice - bath cooling while 1 . 056 g ( 8 mmol ) of dimethyl malonate was added dropwise . after stirring for 10 min at 0 ° c ., the sodiomalonate mixture was treated , dropwise , with a solution of rac - 2 - chloro - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 6 -( phenylmethoxy )- 2h - 1 - benzopyran in 4 ml of dry thf . stirring at 0 ° c . was continued for 1 . 5 hr at which point the reaction mixture was poured into water and extracted three times with ether . the ether extracts were dried ( mgso 4 ), filtered , and concentrated in vacuo giving a yellow , oily residue . this material was dissolved in 5 ml of pet . ether ( 30 ° c .- 60 ° c .) and stirred leading to a white precipitate . the solid was isolated by filtration and recrystallized from pet . ether giving 0 . 4 g ( 23 . 4 % yield ) of rac - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 6 -( phenylmethoxy )- 2h - 1 - benzopyran - 2 - ylpropanedioic acid dimethyl ester as a colorless solid , mp 80 °- 81 ° c . to 12 ml ( 24 mmol ) of 2m allylmagnesium chloride in tetrahydrofuran , cooled in an ice bath , was added , with stirring , a solution of 4 . 95 g ( 14 . 98 mmol ) of rac - 2 - chloro - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 6 -( phenylmethoxy )- 2h - 1 - benzopyran in 60 ml of anhydrous ether . the reaction mixture was stirred at 0 ° c . for 6 hr then worked up by being poured into cold , saturated nh 4 cl solution and ether extraction . the product ( 5 . 4 g of a pale - yellow oil ) was dissolved in 40 ml of methanol and 10 ml of ether containing 10 mg of p - toluenesulfonic acid monohydrate . the solution was stirred at room temperature for 21 hr then concentrated in vacuo . the residue was chromatographed on 75 g of silica gel . elution with 40 : 1 parts by volume hexane - ether gave 2 . 88 g ( 57 . 2 % yield ) of rac - 3 , 4 - dihydro - 6 -( phenylmethoxy )- 2 -( 2 - propenyl )- 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran as a colorless oil . a solution of 10 . 44 g ( 45 . 8 mmol ) of ( 3r , 7r )- 3 , 7 , 11 - trimethyldodecan - 1 - ol in 150 ml of anhydrous pyridine was stirred in an acetone - ice bath while 17 . 4 g ( 91 . 3 mmol ) of p - toluenesulfonyl chloride was added in one portion . the mixture was stirred in the acetone - ice bath for 2 hr then kept at 0 ° c . for 40 hr before being quenched by the addition of 300 ml of ice - water . the product was isolated by extraction with 3 × 300 ml of ether . the ether extracts were combined , washed with 400 ml of cold 3n hcl and saturated brine , then dried ( mgso 4 ), filtered and concentrated in vacuo . there was obtained 16 . 6 g ( 94 . 9 %) of ( 3r , 7r )- 3 , 7 , 11 - trimethyldodecyl p - toluenesulfonate . this tosylate ( 43 . 45 mmol ) and 4 . 25 g ( 86 . 7 mmol ) of sodium cyanide , in 80 ml of ethanol and 20 ml of water was stirred and refluxed for 2 . 5 hr . most of the ethanol was removed in vacuo and the residue was treated with 75 ml of water and 75 ml of saturated brine and extracted with 3 × 100 ml of ether . the ether extracts were combined , washed with saturated brine , dried ( mgso 4 ), filtered through a plug of silica gel , and concentrated in vacuo . this afforded 10 . 25 g ( 99 . 5 %) of ( 4r , 8r )- 4 , 8 , 12 - trimethyltridecanenitrile as a yellow oil . gc analysis revealed a purity of 95 . 2 %. a mixture of this nitrile ( 43 . 25 mmol ) and 18 . 4 g ( 0 . 33 mol ) of potassium hydroxide in 162 ml of ethylene glycol and 13 . 5 ml of water was stirred in a 150 ° c . oil bath for 4 hr then cooled to 0 °- 5 ° c . and poured into 300 ml of 6n hcl . the mixture was extracted with 2 × 400 ml of ethyl acetate . the organic extracts were combined , washed with 300 ml of saturated brine , dried ( mgso 4 ), filtered and concentrated in vacuo giving 11 . 1 g ( 100 %) of ( 4r , 8r )- 4 , 8 , 12 - trimethyltridecanoic acid as an oil . a solution of this acid in 50 ml of toluene was stirred at room temperature while 25 ml of sodium bis ( 2 - methoxyethoxy ) aluminum hydride in toluene was added dropwise . after being stirred for 3 hr at room temperature , the reaction mixture was decomposed by the cautious addition of 5 ml of ethanol . the mixture was then treated with 300 ml of 6n hcl and extracted with 3 × 300 ml of ethyl acetate . the organic extracts were combined , washed with 300 ml of saturated brine , dried ( mgso 4 ), filtered , and concentrated in vacuo . kugelrohr distillation ( 160 ° c . bath temperature , 1 mm hg ) of the residue ( 9 . 7 g ) gave 7 . 0 g of ( 4r , 8r )- 4 , 8 , 12 - trimethyltridecanol as a colorless liquid having a gc purity of 94 . 5 %. the distillation residue contained starting acid and was re - reduced with 6 ml of sodium bis ( 2 - methoxyethoxy ) aluminum hydride as described above . this provided an additional 1 . 8 g [ total yield 8 . 8 g ( 84 . 2 %)] of alcohol having a gc purity of 95 . 8 %. to a solution of 9 . 6 g ( 39 . 6 mmol ) of ( 4r , 8r )- 4 , 8 , 12 - trimethyltridecanol in 30 ml of anhydrous n , n - dimethylformamide was added 10 . 7 g ( 40 . 84 mmol ) of triphenylphosphine . the solution was stirred in an acetone - ice bath (- 10 ° c .) while 2 . 1 ml ( 41 mmol ) of bromine was added dropwise . the temperature rose to 5 ° c . the reaction mixture was stirred at room temperature for 1 hr then poured into 100 ml of water and 150 ml of hexane . after filtration , the layers were separated and the aqueous phase was extracted with 2 × 150 ml of hexane . the hexane layers were washed with saturated nahco 3 solution , dried ( mgso 4 ), filtered through a plug of silica gel , and concentrated in vacuo . kugelrohr distillation ( 150 °- 160 ° c . bath temperature , 1 mm hg ) of the residue gave 2 fractions : 5 . 15 g of 95 . 8 % gc purity and 3 . 55 g of 97 . 9 % gc purity ( 72 . 2 % yield ). redistribution of the larger fraction gave ( 4r , 8r )- 1 - bromo - 4 , 8 , 12 - trimethyltridecane as a colorless liquid bp 120 ° c . ( 0 . 15 mm ) having a gc purity of 97 . 9 %; [ a ] 25 d - 3 . 01 ° ( c 2 . 09 , hexane ). a grignard solution was prepared from 0 . 28 g ( 11 . 2 mmol ) of magnesium and 3 . 4 g ( 11 . 2 mmol ) of ( 4r , 8r )- 1 - bromo - 4 , 8 , 12 - trimethyltridecane in 25 ml of anhydrous ether . grignard formation was induced with a few drops of 1 , 2 - dibromoethane and the mixture was stirred and refluxed for 3 . 5 hr . to a stirred solution of 2 . 6 g ( 7 . 87 mmol ) of rac - 2 - chloro - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 6 -( phenylmethoxy )- 2h - 1 - benzopyran in 25 ml of anhydrous ether , cooled to - 10 ° c . ( ice - acetone bath ), was added the c 16 - grignard solution , dropwise . the resulting mixture was stirred at 0 ° c . for 18 hr then treated with 100 ml of saturated nh 4 cl solution . the product was isolated by extraction with 2 × 100 ml of ether . the ether extracts were washed with saturated brine , dried ( mgso 4 ), filtered , and concentrated in vacuo . the residue ( 4 . 95 g ) was dissolved in 50 ml of methanol and 30 ml of ether containing 200 mg of p - toluenesulfonic acid monohydrate . after being stirred at room temperature for 24 hr , the solution was concentrated in vacuo and the residue was chromatographed on 200 g of silica gel . elution with 40 : 1 parts by volume hexane - ether gave 1 . 82 g ( 44 . 5 %) of pure ( 2rs , 4 &# 39 ; r , 8 &# 39 ; r )- alpha - tocopheryl benzyl ether . the identity of this material was proven by spectral and tlc comparison with an authentic sample of ( 2r , 4 &# 39 ; r , 8 &# 39 ; r )- alpha - tocopheryl benzyl ether . a mixture of 10 g of rac - 2 - methoxy - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 6 -( phenylmethoxy )- 2h - 1 - benzopyran , 10 g of calcium chloride , 100 ml of hexane and 50 ml of diethyl ether was stirred at - 5 ° to - 10 ° c . while hcl gas was bubbled in for 1 hr . an additional 10 g of calcium chloride was added and stirring was continued at room temperature for 2 hr . the mixture was filtered and the filtrate was concentrated in vacuo giving 10 . 2 g of title product as a light - brown oil . proton nmr analysis revealed that this product consisted of 66 % of the title compound and 33 % of the starting 2 - methoxy chroman . a mixture of 0 . 43 g ( 1 mmole ) of rac - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 6 -( phenylmethoxy )- 2h - 1 - benzopyran - 2 - ylpropanedioic acid dimethyl ester , 0 . 56 g ( 10 mmoles ) of potassium hydroxide , and 25 ml of 9 : 1 ethylene glycol - water is stirred and refluxed for 8 hr . the mixture is cooled , diluted with water , and extracted with ether ( the ether extract is discarded ). the aqueous , alkaline solution is acidified with 3nhcl and the acid product isolated by ether extraction . the ether extracts are combined , washed with water and brine , dried ( mgso 4 ), filtered and concentrated in vacuo . recrystallization of the residue from aqueous ethanol gives rac - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 6 -( phenylmethoxy )- 2h - 1 - benzopyran - 2 - acetic acid which can be converted to vitamin e by the procedures in helv . chim acta 61 , 837 ( 1978 ); helv . chim . acta 59 , 290 ( 1976 ) and helv . chim . acta 64 , 1158 ( 1981 ). an ozone - oxygen gas mixture is passed into a solution of 0 . 67 g ( 2 mmoles ) of rac - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 2 -( 2 - propenyl )- 6 -( phenylmethoxy )- 2h - 1 - benzopyran in 100 ml of methanol , with stirring , at - 78 ° c . after the starting olefin has been consumed , the ozone flow is stopped and the solution is treated with excess dimethyl sulfide and allowed to warm to room temperature . the solution is concentrated in vacuo . the residue is chromatographed on silica gel giving rac - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 6 -( phenylmethoxy )- 2h - 1 - benzopyran - 2 - acetaldehyde , which can be converted to vitamin e by the procedures in helv . chim . acta set forth in example 8 . a 0 . 6 g ( 2 . 13 mmole ) sample of rac - 2 - chloro - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran - 6 - ol acetate is treated with ( 4r , 8r )- 4 , 8 , 12 - trimethyltridecylmagnesium bromide as described in example 6 except that an excess of the grignard reagent is employed . chromatography of the crude product on silica gel gives ( 2rs , 4 &# 39 ; r , 8 &# 39 ; r )- alpha - tocopherol as an oil . using the procedure of example 6 , rac - 2 - chloro - 6 - methoxy - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran is treated with ( 4r , 8r )- 4 , 8 , 12 - trimethyltridecylmagnesium bromide to give ( 2rs , 4 &# 39 ; r , 8 &# 39 ; r )- alpha - tocopheryl methyl ether as an oil . a solution of 0 . 25 g ( 0 . 56 mmole ) of ( 2rs , 4 &# 39 ; r , 8 &# 39 ; r )- alpha - tocopheryl methyl ether in 10 ml of 1 , 2 - dichloroethane is treated with 0 . 7 g ( 2 . 25 mmoles ) of boron tribromide dimethyl sulfide complex and the reaction mixture is stirred and refluxed for 20 hr . the mixture is cooled and treated with water . the organic layer is separated , washed with water and brine , dried ( mgso 4 ), filtered and concentrated in vacuo . the residue is chromatographed on silica gel giving ( 2rs , 4 &# 39 ; r , 8 &# 39 ; r )- alpha - tocopherol as an oil . a mixture of 84 . 3 g ( 0 . 337 mole ) of rac .- 2 , 6 - dimethoxy - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran , 370 ml of acetone , 300 ml of water , and 2 . 5 ml of conc . hydrochloric acid was distilled until the distillate temperature reached 90 ° c . after being cooled , the mixture was diluted with water and extracted three times with ether . the ether extracts were combined , washed with saturated brine , dried ( mgso 4 ), filtered , and concentrated in vacuo . the residue was recrystallized from aqueous acetone giving rac .- 6 - methoxy - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran - 2 - ol as an off - white solid , in crops of 34 . 6 g ( 43 . 5 %) and 11 . 1 g ( 13 . 9 %). using the procedure of example 1 , rac .- 6 - methoxy - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran - 2 - ol was converted into rac .- 2 - chloro - 6 - methoxy - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran , an off - white solid , in 90 . 2 % yield . using the procedure of example 3 , except that diethyl malonate was employed in place of dimethyl malonate , rac .- 2 - chloro - 6 - methoxy - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran was converted into rac .- 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 6 - methoxy - 2h - 1 - benzopyran - 2 - ylpropanedioic acid diethyl ester , a colorless solid , m . p . 74 °- 76 ° c ., in 54 % yield , purified by a combination of hplc and recrystallization from pet . ether . a mixture of 1 . 29 g ( 3 . 41 mmoles ) of rac .- 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 6 - methoxy - 2h - 1 - benzopyran - 2 - ylpropanedioic acid diethyl ester , 1 . 68 g of potassium hydroxide , and 75 ml of 9 : 1 parts by volume ethylene glycol - water mixture was stirred and refluxed for 6 hours . the resulting mixture was poured on ice and extracted with ether ( the ether extract was discarded ). the aqueous solution was acidified with 3n hcl and the precipitated acid was extracted 3 times with ether . the combined ether extracts were washed with brine , dried ( mgso 4 ), filtered and concentrated in vacuo . purification of the residue by preparative thick layer chromatography gave 0 . 72 g ( 75 . 9 %) of rac .- 3 , 4 - dihydro - 6 - methoxy - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran - 2 - acetic acid , as a colorless solid , mp 96 °- 98 ° c . dimethylation using the procedure of example 14 gives rac .- 3 , 4 - dihydro - 6 - hydroxy - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran - 2 - acetic acid which can be converted to alpha - tocopherol as described in helv . chim . acta . 59 , 290 ( 1976 ). a mixture of 200 g ( 0 . 847 mole ) of rac .- 3 , 4 - dihydro - 2 - methoxy - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran - 6 - ol , 1200 ml of acetone , 200 ml of dimethyl sulfate , and 100 g of sodium hydroxide in 100 ml of water was stirred at room temperature for 4 hours whereupon 500 ml of 10 % aqueous ammonium hydroxide solution was added and stirring continued for 30 minutes . the mixture was extracted 3 times with ether . the ether extracts were combined , washed with water and saturated brine , dried ( mgso 4 ), filtered and concentrated in vacuo giving 238 . 4 g of residue which was recrystallized from ether - hexane at - 20 ° c . there was obtained 145 . 9 g ( 68 . 9 %) of rac .- 2 , 6 - dimethoxy - 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 2h - 1 - benzopyran as a colorless solid . the product upon being recrystallized from hexane at - 60 ° c ., gave a solid , mp 37 °- 38 ° c . anal . calcd . for c 15 h 22 o 3 : c , 71 . 97 ; h , 8 . 86 . found : c , 71 . 84 ; h , 8 . 82 .	2
herein the terms “ nano - powder ,” “ powder ,” nano - particles ,” and “ particles ” refer to the as - synthesized nano - material , the term “ disc ” means nano - powder that that been formed in to selected shaped , such as a disc as illustrated in fig2 a and 2b , and sintered at a sintering temperature for a selected time to form a solid article . the present disclosure is directed to the synthesis of y 2 o 3 nano - powders , and composites of y 2 o 3 / mo x ( both after sintering ), where mo x is at least one other metal oxide in which x is in the range of 1 - 3 , using low - cost precursors in a time - and cost - saving way that is also ease to scale up to produce larger amounts of the material . spinning and ultra - sonication are used to break down the y 2 o 3 soft agglomeration of the nano powders in a fast and efficient way as compared to either traditional ball - milling , which is time - consuming , or freeze - drying which is expensive to use . the y 2 o 3 nano - powder or y 2 o 3 / mo x composites , when consolidated as a composite / solid solution systems , including nanocomposites , are designed to and produced to get multiple functional ceramics or materials with improved thermal - mechanical properties compare to the pure y 2 o 3 . in general , the method involves dissolving yttrium nitrate in water in a vessel and titrating the resulting solution with an ammonium carbonate solution containing ammonium sulfate and a water soluble lubricant , for example , commercially available lutrol e - 400 which a polyethylene glycol ( basf ) or similar material . the vessel is spun during the titration with control of the ph in the range of 8 . 3 - 9 . 5 . in an embodiment the ph is controlled to be in the range of 8 . 7 - 9 . 0 . after the titration is completed the precipitated and sonicated for an additional time to homogenize the precipitants . the precipitants are collected on a filter , an vacuum dried . following the drying the precipitants are calcined . a 0 . 5m solution y ( no 3 ) 3 . 6h 2 o was prepared and place in a vessel . a solution of 2 - 2 . 5m ammonia carbonate solution containing 5 mol % ammonia sulfate and 0 . 3 - 0 . 8 wt . % lutrol e - 400 [ a polyethylene glycol , cas 25322 - 68 - 3 ] as the dispersant . the vessel containing the y ( no 3 ) 3 solution was placed in a 70 ° c . water bath and was titrated with the ammonium carbonate solution at the rate of 2 - ml / min ammonia carbonate while the vessel containing the y ( no 3 ) 3 solution was spun at a speed in the range of 120 - 150 rpm to five a uniform precipitation of the yttrium product . during the titration the ph of the solution was controlled such that the ph of the precipitated material was in the range of 8 . 7 - 9 . 0 ( b ) synthesis of y 2 o 3 - based composites / compounds y 2 o 3 / mo x ( after sintering ) the amount of the non - yttrium metal is determined beforehand and is added to the yttrium - containing solution . depending on the amount of non - yttrium material that is used , the final functional material , after sintering and containing yttrium and at least one additional metal , can be a nano - composite or doped ceramic , a solid solution or a compound . the at least one additional metal m can be added to the yttrium containing solution as a nitrate , chloride or other water soluble salt in a selected percentage or y : m ratio depending on the intended purpose of the final product . the y / m containing solution is then titrated with an ammonium carbonate solution containing ammonium sulfate and a lubricant as described above and spun at a spinning in the range of 120 - 150 rpm while maintaining the ph in the range of 8 . 3 - 9 . 5 , preferably in the range of 8 . 7 - 9 . 0 . the material that can be added into the y 2 o 3 system include mgo , cao , bao , beo 2 , al 2 o3 , tio 2 , zro 2 , sio 2 , hfo 2 , ybo 2 , gdo 2 , lu 2 o 3 and additional rare earth oxides . an exemplary y 2 o 3 — zro 2 — mgo composite y 2 o 3 doped with 6 - 9 mol % zro 2 and 0 . 5 - 2 mol % mgo . describes herein is a general composite system once the titration has been completed , the precipitant in the vessel was further spun while sonicating the solution to homogenize the precipitant . this spinning / sonication treatment was done for a time in the range of 5 - 60 minutes . the fluid in the vessel was decanted and the precipitate was water washed at least once to remove unreacted materials and the lubricant , alcohol washed using a c 1 - c 3 alcohol , and was collected on a 0 . 2 μm - 0 . 4 μm filter paper or equivalent filter , for example a frit filter . 4 . the collected precipitate was then vacuum dried at room temperature , approximately 15 - 30 ° c ., to fully dry and powderize the precipitant . 5 . after the powder had been dried it was calcined in air at a selected temperature in the range of 1050 ° c . to 1150 ° c . for a time of at least 2 hours . in an embodiment the time is at least 4 hours . in a further embodiment the time is at least 6 hours . in an embodiment the calcination temperature 1100 ° c . and the time was 4 hours . once the powder was fully dried and calcined it was used to form an article the dried , calcined nano - powder is illustrated in fig1 a and 1b . fig1 a illustrates of the dried and calcined nano - powder as a soft agglomeration . ( a ) the calcined powder was suspended in an alcohol solution and ultrasonically treated for a time in the range of 5 minutes to 1 hour to breakdown the soft agglomeration of particles that is illustrated in fig1 a . fig1 b is a photograph of particles , ( he bright spots ) from the powder of fig1 a after this ultrasonic treatment . in the fig1 b photograph the size bars indicate nano - particles , the bright “ spots ” in the photograph of size 15 nm and 17 nm . in addition , the photograph shows particles as small as approximately 5 nm ( the small fuzzy circle to the left of the 17 nm particle ). ( b ) the dried , ultra - sonicated nano - powder was then pressed into a die at a pressure 1500 psi , followed by cold isostatic pressing of 25 - 30 kpsi for the final compacting and to form an article that can be further processed . the sintering conditions may change in accordance with the different chemical components present in the nano - particles and the amount of such components . the sintering can be done as a two - stage process or a one stage process . ( 1 ) sintering in air at a temperature in the range of 1400 ° c . to 1500 ° c . for a time in the range of 4 to 10 hours followed by hot isostatic pressing (“ hip ”) at a temperature that is 20 - 50 ° c . lower than above sintering temperature . ( 2 ) oxygen annealing to burn out any residual carbon and / or color centers inside the sintered material that are due to the graphite furnace used during hip treatment . one - stage sintering combines the above traditional 2 - stage treatments into one - step . the sample is placed directly put into the hip furnace and is : ( a ) sintered at a temperature in the range of 1400 ° c .- 1500 ° c . for a time 4 hours to 10 hours using a blended glass consisting of 15 - 20 % o 2 — ar at normal pressure of 1 atmospheric ; and ( b ) increasing the pressure during the hot isostatic pressing to 200 mpa and holding the sample at this pressure for an additional time to achieve the best results , such time being in the range of 1 hour to 5 hours . fig2 a illustrates opaque y 2 o 3 green body pellets that were obtained before sintering and fig2 b illustrate the transparent pellets that were obtained after sintering . the pellets were placed on a sheet of paper with lettering on it to show the transparency of the sintered pellets . some of the major differences between the method describes herein and the art include : ( 1 ) the method disclosed herein does not use any binder or chelating agent s during the synthesis of the pellet . ( 3 ) an ammonium carbonate solution was used as the precipitating agent instead of the ammonium bicarbonate used in the art . the use of ammonium carbonate results in a better product — fewer color centers , better nano - particle size distribution , fine particle size resulting in a clearer product . ( 4 ) the inclusion of ammonium sulfate in the initial titrating solution and sulfate is included in the initial precipitation product . sulfur is burned out as a gaseous oxide during the sintering process . ( 5 ) the use of an alcohol washing agent which aids in dehydrating the product and reduces drying time . ( 6 ) using dispersion in an alcohol solution with sonication to de - agglomerate the soft agglomeration of particles , instead of the traditional ball milling , gives a more uniform nano - particle size distribution . ( 7 ) the use of a 1 - state hip process which results in a time and cost savings over the traditional two - step process . fig3 a is a surface profile graph , generated by a zygo ® interferometer , illustrating that the surface smoothness of sample discs such as those of fig2 a is within the 3 - 5 nm scale . the graph indicates that the peak - to - valley ( pv ) variation is approximately 4 nm and the average pv variation is approximately 0 ± 1 . 5 nm . fig3 b is a surface photograph over a 5 μm portion of as - pressed and unpolished pure y 2 o 3 disc such as shown in fig2 a . the surface indentation are due to the pressing of the material to form the disk and will be substantially removed upon polishing . fig4 is a graph of transmittance versus wavelength illustrating that sample y 2 o 3 discs ( numeral 10 ) made from the y 2 o 3 nano - powder synthesized in accordance with the disclosure of the have a transmittance that is substantially identical to the theoretical transmittance value ( numeral 12 ). fig5 a is an sem image of the of an as - synthesized nano - composite consisting having the composition of y 2 o 3 doped with 2 mol % mgo and 8 mol % zro 2 and showing a 50 nm distance range . fig5 b is the edax analysis ( energy dispersive x - ray analysis ) for the nano - composite of fig5 a confirm that the material comprises y , mg , zr and o , with no other materials . fig6 is flow diagram of the method for preparing the nano - powder according to the disclosure . the numerals 10 to 26 have the meaning shown in table 1 . fig7 is a transmittance vs . wavelength graph over the 200 nm - 8450 nm range ( 0 . 2 μm - 8 . 45 μm ) for discs made from pure y 2 o 3 only ( numeral 30 ) discs and discs made from pure y 2 o 3 doped with 8 mol % zro 2 and 1 mol % mgo ( numeral 32 ). the graph shown that in the 0 . 90 - 7 . 0 μm the transmission of the y — mg — zr oxide composition is greater than 70 % and the transmission is greater than 80 % in the 1 . 6 - 6 . 2 μm range . the pure as - produced y 2 o 3 has greater than 70 % transmission in the range of 0 . 7 - 7 . 5 μm . fig8 a ( 10 μm full width ) and 8 b ( 5 μm full width ) are sem photographs showing the microstructural morphology of composites containing the pure y 2 o 3 disclosed herein doped with 8 mol %- zro 2 - 1 mol % mgo , composite and the figures show that the average grain size is not larger than 2 . 5 μm fig9 is a representative edx ( energy dispersive x - ray ) analysis of the grains shown in fig8 a and 8b which confirmed that there was no compositional difference between grains . fig1 a - 10c are representative nano - indentation and scratch test images of the transparent ceramic composites described herein made from y 2 o 3 - 8 mol %- zro 2 - 1 mol % mgo ( y — zr — mg composite ). fig1 a shows that the vestige image of the y — mg — zr composite material which has a hardness in the range of 17 - 18 gpa . fig1 b is a shows the vestige image of a disk make from pure y 2 o 3 only . a comparison of the vestige images of fig1 a and 10b indicate that the 10 a image is sharper than that 10 b , and that fig1 a does not show the spalling and light scattering ( arrows s ) as is visible in fig1 b , the pure y 2 o 3 material in fig1 b has a hardness in the range of 9 . 5 - 10 gpa . fig1 c is a scratch test of a disc made from the pure y 2 o 3 material of fig1 b which shows that the that there is no spalling or micro - crack propagation in the illustrated vestige image . the use of the pure y 2 o 3 material in composites , for example , the composite of fig1 a , results in composite ceramics that have good scratch resistance and have a uniform compositional structure . without being held to any particular theory , uniform compositional structure is believed to play a role in providing good scratch resistance by preventing the formation of softer areas in the final ceramic material . this disclosure is thus directed to a method of making yttrium oxide nano - particles , yttrium oxide nano - particles containing one or a plurality of selected dopants , and ceramic materials made the nano - particles or doped nano - particles . the method comprises preparing a solution y ( no 3 ) 3 . 6h 2 o placing the solution in a vessel rotatable table ; preparing a solution of ammonia carbonate solution containing ammonia sulfate and 0 . 2 - 1 . 0 wt . % of a water soluble polyethylene glycol as a dispersant ; placing the vessel containing the y ( no 3 ) 3 solution in a 60 - 80 ° c . water bath and titrating the y ( no 3 ) 3 solution with the ammonium carbonate solution at the rate of 1 - 4 ml / min while the vessel containing the y ( no 3 ) 3 solution was rotated at a speed in the range of 100 - 200 rpm to form a uniform precipitation of the yttrium nano - particles ; spinning the precipitated yttrium nano - particles with sonication for a time in the range of 2 - 60 minutes after completion of the titration followed by decantation of the liquid and washing the nano - particles with an alcohol / water solution ; collecting and drying the nano - particles in vacuum at a temperature in the range of 15 - 30 ° c . to provide dried yttrium oxide nano - particles ; and calcining dried yttrium oxide nano - particles at a temperature in the range of 1050 ° c . to 1150 ° c . for a time of at least 2 hours . in one embodiment , during the titration of the y ( no 3 ) 3 solution the ph of the solution was controlled such that the ph of the precipitated material was in the range of 8 . 5 - 9 . 5 . in another embodiment , during the titration of the y ( no 3 ) 3 solution the ph of the solution was controlled such that the ph of the precipitated material was in the range of 8 . 7 - 9 . 0 . making the doped yttrium oxide nanoparticles comprises adding least one water soluble metal salt to the yttrium nitrate solution prior the beginning of the titration for forming a doped yttrium after calcination . the at least one water soluble metal salt is a chloride , nitrate or acetate selected from the group of metal consisting of mgo , cao , beo 2 , al 2 o3 , tio 2 , zro 2 , sio 2 , hfo 2 , ybo 2 , gdo 2 , lu 2 o 3 and the remaining rare earth metals . the disclosure is also directed to a method of making yttrium oxide articles , and articles made from a yttrium oxide doped with a selected dopant , the method comprising preparing a solution y ( no 3 ) 3 . 6h 2 o placing the solution in a vessel rotatable table ; preparing a solution of ammonia carbonate solution containing ammonia sulfate and 0 . 2 - 1 . 0 wt . % of a water soluble polyethylene glycol as a dispersant ; placing the vessel containing the y ( no 3 ) 3 solution in a 60 - 80 ° c . water bath and titrating the y ( no 3 ) 3 solution with the ammonium carbonate solution at the rate of 1 - 4 ml / min while the vessel containing the y ( no 3 ) 3 solution was rotated at a speed in the range of 100 - 200 rpm to form a uniform precipitation of the yttrium nano - particles ; spinning the precipitated yttrium nano - particles with sonication for a time in the range of 2 - 60 minutes after completion of the titration followed by decantation of the liquid and washing the nano - particles with an alcohol / water solution ; collecting and drying the in vacuum at a temperature in the range of 15 - 30 ° c . to provide dried yttrium oxide nano - particles ; calcining dried yttrium oxide nano - particles at a temperature in the range of 1050 ° c . to 1150 ° c . for a time of at least 2 hours ; placing the calcined nano - particles in a hot isostatic pressing apparatus ; sintering the calcined yttrium oxide nano - particle at a temperature in the range of 1200 - 1500 ° c . for a time in the range of 4 - 10 hours in a 15 - 20 % v / v o 2 / ar and a pressure of 1 atmosphere ; and hot isostatic pressing by increasing the pressure to 200 mpa and holding the pressure for an additional time in the range 1 hour to 5 hours ; and cooling to obtain yttrium oxide article . in one embodiment , during the titration of the y ( no 3 ) 3 solution the ph of the solution was controlled such that the ph of the precipitated material was in the range of 8 . 5 - 9 . 5 . in another embodiment , during the titration of the y ( no 3 ) 3 solution the ph of the solution was controlled such that the ph of the precipitated material was in the range of 8 . 7 - 9 . 0 . in addition , doped yttrium oxide articles can be made from a doped yttrium nano - particle by adding at least one water soluble metal salt to the yttrium nitrate solution prior the beginning of the titration for forming a doped yttrium after calcination . the at least one water soluble metal salt is a chloride , nitrate or acetate selected from the group of metal consisting of mgo , cao , beo 2 , al 2 o3 , tio 2 , zro 2 , sio 2 , hfo 2 , ybo 2 , gdo 2 , lu 2 o 3 and the remaining rare earth metals . the resulting yttrium oxide article thus contains the at least one selected metal as a metal oxide . while the invention has been described with respect to a limited number of embodiments , those skilled in the art , having benefit of this disclosure , will appreciate that other embodiments can be devised which do not depart from the scope of the invention as disclosed herein . accordingly , the scope of the invention should be limited only by the attached claims .	2
fig1 is a block diagram of a particular embodiment of a dynamo control circuit according to the present invention . as shown in fig1 the dynamo control circuit comprises a dynamo ( dyn ) 1 serving as a generator ; a rectifier circuit ( rect ) 2 ; an accumulator ( acc ) 3 serving as the power supply for the electrically - powered units ; a lamp ( lmp ) 4 ; and a switch ( sw ) 5 situated between the dynamo 1 and the lamp 4 . dynamo 1 comprises , for example , a hub dynamo housed within the hub of the front wheel of the bicycle . rectifier circuit 2 is a circuit for rectifying the ac voltage output of dynamo 1 , and it includes a diode and the like . accumulator 3 is a device that includes a capacitor , transistor , etc ., and controls on / off operation of switch 5 by means of its charged voltage . fig2 is a detailed schematic diagram of a particular embodiment of the dynamo control circuit shown in fig1 . as shown in fig2 dynamo 1 is coupled with a first capacitor c 1 , a second capacitor c 2 , a first diode d 1 , and a second diode d 2 . in this circuit , the first and second capacitors c 1 , c 2 and the first and second diodes d 1 , d 2 constitute a voltage - doubling rectifier circuit . the first capacitor c 1 is charged during the positive half - cycle of dynamo 1 output , and during the subsequent negative half - cycle the second capacitor c 2 is charged with voltage equal to the voltage generated by dynamo 1 plus the charged voltage of the first capacitor c 1 . thus , the second capacitor c 2 can acquire high charged voltage at low speed . the second capacitor c 2 functions as a power supply for driving first and third field - effect transistors fet 1 and fet 3 , described later . a third diode d 3 serving as a rectifier circuit is coupled with dynamo 1 , and the output of this third diode d 3 is coupled , via the first field - effect transistor ( hereinafter simply “ transistor ”) fet 1 , to a third capacitor c 3 serving as a rechargeable battery . the gate of first transistor fet 1 is coupled , via a first resistor r 1 , to the second capacitor c 2 . in this circuit , the third diode d 3 allows the third capacitor c 3 to be charged , via first transistor fet 1 , with the output of dynamo 1 only during the negative half - cycle thereof . as is well known for such transistors , if the potential at the gate of first transistor fet 1 is higher than that at the source by more than a predetermined level ( 2 v , for example ), first transistor fet 1 switches on . since the voltage of the second capacitor c 2 is applied to the gate of the first transistor fet 1 , the applied voltage is sufficiently high even under the low speed condition described earlier , the first transistor fet 1 is stabilized in the on state , and the third capacitor c 3 charging operation is stabilized . the second transistor fet 2 , third transistor fet 3 ( corresponding to switch 5 in fig1 ) and lamp 4 are connected in series to dynamo 1 . diode d 5 , shown connected in parallel with second transistor fet 2 , and diode d 4 , shown connected in parallel with third transistor fet 3 , are parasitic diodes for the respective transistors fet 2 , fet 3 . the gate of the second transistor fet 2 is coupled via a second resistor r 2 to the second capacitor c 2 , and the gate of the third transistor fet 3 is coupled to a control circuit 10 . a third resistor r 3 is also connected in parallel with the gate of third transistor fet 3 . with this circuit arrangement , the gate potential of the first transistor fet 1 can be controlled by control circuit 10 to control charging of the third capacitor c 3 , and the gate potential of the third transistor fet 3 can be controlled according to the charged voltage of the third capacitor c 3 to control on / off operation of the third transistor fet 3 . by switching off the second transistor fet 2 together with the third transistor fet 3 , the lamp 4 can be extinguished completely . the operation of the circuit will now be described . it is assumed that all capacitors are initially empty . first , during the positive half - cycle of the output of dynamo 1 , current flows over path ( 1 ): this results in charging the first capacitor c 1 . the voltage across the first capacitor c 1 reaches approximately the dynamo output peak voltage of 0 . 6 v . during the subsequent negative half - cycle current flows in reverse over path ( 2 ): this results in charging the second capacitor c 2 . the current supplied to the second capacitor c 2 is equal to the current from dynamo 1 plus current from the charged first capacitor c 1 . thus , the second capacitor c 2 can be charged adequately even at low speed . when the voltage across the second capacitor c 2 reaches {( voltage across c 3 )+( on trigger voltage for gate of fet 1 )}, the first transistor fet 1 turns on . the second transistor fet 2 turns on as well . thus , current now flows also over path ( 3 ): this initiates charging of the third capacitor c 3 . with this arrangement , the third capacitor c 3 can be stably charged to relatively high voltage during the negative half - cycle of dynamo output only . furthermore , as the voltage applied to the gate of the first transistor fet 1 can be stabilized by the second capacitor c 2 , the on state of the first transistor fet 1 can be stabilized . at this time the voltage across the third capacitor c 3 is not adequate for driving other electrically powered units in a stable manner . thus , the voltage applied to the gate of the third transistor fet 3 is controlled by the control circuit 10 so that the third transistor fet 3 remains off . during the positive half - cycle , the first capacitor c 1 is charged by means of current flowing over path ( 1 ): as described above , and the lamp 4 is lit by means of current flowing over path ( 4 ): during the subsequent negative half - cycle , the second capacitor c 2 and third capacitor c 3 are charged by means of current flowing over path ( 2 ): the above operation by means of current flowing over paths ( 1 ) and ( 4 ) during the positive half - cycle of dynamo output and operation by means of current flowing over paths ( 2 ) and ( 3 ) during the negative half - cycle , are performed repeatedly . fig3 ( b ) shows the waveform of dynamo output in this case , and fig3 ( a ) shows the waveform of the voltage applied to the lamp . as will be apparent from the drawings , the lamp 4 is lit during the positive half - cycle of dynamo output , while the rechargeable battery ( capacitor c 3 ) is charged during the negative half - cycle . in fig3 ( b ), the positive peak voltage v 1 is lower than the negative peak voltage v 2 ; this is due to a drop in voltage in the dynamo resulting from the lamp load . the third capacitor c 3 is repeatedly recharged in this manner , and when the voltage across the third capacitor c 3 reaches a level sufficient to drive other devices , the third transistor fet 3 is turned on by the control circuit 10 . this causes current to flow over path ( 5 ); so that the lamp lights . in this state the lamp is lit not intermittently , but continuously during both the positive and negative half - cycles of dynamo output . the lamp 4 can be extinguished completely by switching off the second transistor fet 2 in addition to the third transistor fet 3 . in the embodiment described above , the three transistors fet 1 , 2 , 3 , the second and third capacitors c 2 , c 3 , and the control circuit 10 have uniform gnd level , thus obviating the need to provide a special circuit for providing uniform ground level for the elements and enabling the three transistors to be switched easily . furthermore , since the power for operation of the control circuit 10 is obtained from the third capacitor c 3 , application of high voltage from the dynamo to the control circuit 10 can be prevented , thus obviating the need for circuitry to protect the control circuit 10 . while the above is a description of various embodiments of the present invention , further modifications may be employed without departing from the spirit and scope of the present invention . for example , the size , shape , location or orientation of the various components may be changed as desired . components that are shown directly connected or contacting each other may have intermediate structures disposed between them . the functions of one element may be performed by two , and vice versa . it is not necessary for all advantages to be present in a particular embodiment at the same time . every feature which is unique from the prior art , alone or in combination with other features , also should be considered a separate description of further inventions by the applicant , including the structural and / or functional concepts embodied by such feature ( s ). thus , the scope of the invention should not be limited by the specific structures disclosed or the apparent initial focus on a particular structure or feature .	1
fig1 a and 1b are block diagrams for describing the general features of aspects of the present invention . shown in fig1 a are a clock driver 11 , first and second clock - signal cut - off detectors 12 , 13 for detecting cut - off of an input clock signal cla and output clock signal clb of the clock driver 11 , and an abnormality discriminating unit 14 for outputting an alarm signal , which indicates that the clock driver 11 is abnormal , in a case where the output clock signal clb is cut off but not the input clock signal cla . shown in fig1 b are a clock driver 21 , and a phase - difference monitoring unit 22 for comparing a phase difference between the input clock signal cla and the output clock signal clb of the clock driver 21 , and outputting an alarm signal , which indicates that the clock driver 21 is abnormal , in a case where a phase difference greater than a prescribed value has been detected . according to a first method of the invention , the first and second clock - signal cut - off detectors 12 , 13 , respectively , monitors cut - off of the input clock signal cla and cut - off of the output clock signal clb of the clock driver 11 and an abnormality discriminating unit 14 outputs an alarm upon judging that the clock driver 11 is abnormal in a case where the output clock signal clb has been cut off but the input clock signal cla has not . ( see fig1 a above in regard to the first method .) according to a second method of the invention , the phase - difference monitoring unit 22 monitors the phase of the input clock signal cla and the phase of an output clock signal clb of the clock driver 21 and outputs an alarm upon judging that the clock driver 21 is abnormal in a case where the output clock signal clb has developed a phase shift , in excess of a prescribed value , with respect to the input clock signal cla . ( see fig1 b above in regard to the second method .) a third method of the invention includes monitoring cut - off of the input clock signal and cut - off of the output clock signal of the clock driver , monitoring the phase of the input clock signal and the phase of an output clock signal of the clock driver , judging that the clock driver is abnormal when the output clock signal has been cut off but the input clock signal has not , and judging that the clock driver is abnormal when the output clock signal has developed a phase shift , in excess of a prescribed value , with respect to the input clock signal . fig2 is a circuit diagram illustrating a first embodiment of the present invention for detecting abnormality in a clock driver . numeral 11 denotes the clock driver , 12 the first clock - signal cut - off detector for detecting cut - off of the input clock signal cla of the clock driver 11 , 13 the second clock - signal cut - off detector for detecting cut - off of the output clock signal clb of the clock driver 11 , and 14 the abnormality discriminating unit for outputting an alarm signal , which indicates that the clock driver 11 is abnormal , in a case where the output clock signal clb is cut off but not the input clock signal cla . the clock driver 11 is constituted by a pll circuit , by way of example . as shown in fig3 the clock driver 11 includes a phase comparator 11a for outputting the phase difference between the input clock signal cla and a signal clb &# 39 ; obtained by frequency - dividing the output clock signal clb , a phase - difference voltage generating unit 11b such as a low - pass filter for generating a voltage commensurate with the phase difference , a voltage controlled oscillator ( vco ) 11c , to which the voltage commensurate with the phase difference is applied as an input , for outputting the signal ( the output clock signal ) clb , the frequency of which conforms to the input voltage , and a frequency dividing circuit 11d for frequency - dividing the output clock signal . the first clock - signal cut - off detector 12 comprises a monostable multivibrator ( 74hc123 manufactured by national semiconductor or motorola , by way of example ) 12a , and a resistor r1 and capacitor c1 for setting cut - off detection time . when an input is applied to the monostable multivibrator 12a , the latter outputs a pulse whose duration ( the duration of the low level ) is decided by c1 · r1 (= t1 ). accordingly , as illustrated in fig4 a , by setting c1 · r1 (= t1 ) to be longer than the period ta of the input clock signal cla , the output ( alarm signal ) alm1 of the multivibrator can be made a low - level signal at all times in a case where the input clock signal cla is entering normally . however , when the input clock signal cla is cut off , as shown in fig4 b , the alarm signal alm1 is raised to the high level after a period of time t1 following the leading edge of the last input clock signal cla . the second clock - signal cut - off detector 13 comprises a monostable multivibrator ( 74hc123 manufactured by national semiconductor or motorola , by way of example ) 13a , and a resistor r2 and capacitor c2 for setting cut - off detection time . when an input is applied to the monostable multivibrator 13a , the latter outputs a pulse ( an alarm signal alm2 ) whose duration ( the duration of the low level ) is decided by c2 · r2 (= t2 ). operation is exactly the same as that of the first clock - signal cut - off detector 12 . the abnormality discriminating unit 14 has an inverting gate ( not gate ) 14a for inverting the level of the alarm signal alm1 , and an and gate 14b for taking the logical product between the inverted signal * alm1 and the alarm signal alm2 , which is outputted by the second clock - signal cut - off detector 13 . in a case where the input clock signal cla is entering and the clock driver 11 is delivering the output clock signal clb normally , the alarm signals alm1 , alm2 are both at the low level and , hence , the abnormality discriminating unit 14 does not output an alarm signal indicative of an abnormality . in a case where the input clock signal cla is not entering , the output clock signal clb is not delivered . however , since the alarm signals alm1 , aml2 are both at the high level , the abnormality discriminating unit 14 is not outputted . if an abnormality develops in the clock driver 11 so that the output clock signal clb is not delivered in a case where the input clock signal cla is entering , the alarm signal alm1 assumes the low level and the alarm signal alm2 rises to the high level . as a result , the output of the and gate 14b attains the high level and the abnormality discriminating unit 14 outputs the abnormality alarm signal alm (=&# 34 ; 1 &# 34 ;). fig5 is a circuit diagram illustrating a second embodiment of the present invention . numeral 21 denotes the clock driver . by adopting a pll circuit as the clock driver 21 , the phase difference between the input / output clocks cla , clb is suppressed and made a small value . numeral 22 denotes the phase - difference monitoring unit for comparing the phase difference between the input clock signal cla and the output clock signal clb of the clock driver , and outputting an abnormality alarm signal alm , which indicates that the clock driver is abnormal , in a case where a phase difference greater than a prescribed value has been detected . the phase - difference monitoring unit 22 has a delay circuit ( dly ) 22a for delaying the input clock signal cla by a prescribed period of time , thereby outputting a delayed clock signal cla &# 39 ; and a flip - flop ( 74as74 , etc .) 22b . a power - on reset signal por , which assumes the low level a prescribed period of time after power is introduced , is applied to the set terminal of the flip - flop 22b so that the abnormality alarm signal alm will not be outputted when power is introduced . the delayed clock signal cla &# 39 ; enters the d terminal of the flip - flop 22b , and the output clock signal clb enters the clock terminal of the flip - flop 22b . when the clock driver 21 is operating normally , the flip - flop 22b does not latch the input clock signal cla ( i . e ., does not output the abnormality alarm signal alm ) at the timing of the leading edge of the output clock signal clb . when the clock driver 21 is operating abnormally , the flip - flop 22b latches the input clock signal cla and outputs the abnormality alarm signal alm at the timing of the leading edge of the output clock signal clb . when power is introduced to the electronic apparatus , the low - level power - on reset signal por ( see fig6 ) is generated for a prescribed period of time t , the flip - flop 22b of the phase - difference monitoring unit 22 is reset and the abnormality alarm signal alm is initially set to the low level . when the input clock signal cla subsequently enters , this signal is delayed for a prescribed period of time td by the delay circuit 22a before entering the flip - flop 22b . if the clock driver 21 is operating normally and the output clock signal clb is being generated at a frequency and phase identical with those of the input clock signal cla , then the delayed input clock signal cla &# 39 ; cannot be latched at the timing of the leading edge of the output clock signal clb and the abnormality alarm signal alm will be at the low level . if the clock driver 21 develops an abnormality and the phase of the output clock signal clb shifts at a time tab ( see fig6 ) under these conditions , then the delayed input clock signal cla &# 39 ; will attain the high level at the leading edge of the output clock signal clb , the flip - flop 22b will be set and the high - level abnormality alarm signal alm will be outputted . in the second embodiment shown in fig5 the clock driver 21 outputs the clock signal clb having a frequency and phase identical with those of the input clock signal cla . however , there are cases in which the clock signal clb outputted by the clock driver 21 has a frequency n times that of the input clock signal . in such cases , a frequency dividing circuit 23 for frequency - dividing the output clock signal clb by n is provided , as shown in fig7 and a frequency - divided clock signal clb &# 39 ; outputted by the frequency dividing circuit 23 is applied to the clock terminal of the flip - flop 22b . in the first embodiment , a failure that results in complete cut - off of the output from the clock driver can be detected but a failure that results in a phase shift or loss of synchronization in the pll cannot . in the second and third embodiments , on the other hand , there are cases in which , depending upon the arrangement of the phase - difference monitoring unit , the abnormality alarm signal cannot be outputted owing to an impediment in the alarm - signal output function itself when the output of the clock driver is cut off completely . accordingly , if the first and second embodiments are combined , cut - off of the output clock signal , a phase shift and loss of synchronization can all be detected . fig8 is a block diagram illustrating a fourth embodiment of the invention for achieving this . elements identical with those of the first and second embodiments are designated by like reference numerals . numeral 11 denotes the clock driver ( clk drv ), 12 the first clock - signal cut - off detector ( dwn det ) for detecting cut - off of the input clock signal cla of the clock driver 11 , 13 the second clock - signal cut - off detector ( dwn det ) for detecting cut - off of the output clock signal clb of the clock driver 11 , 14 the abnormality discriminating unit for outputting an alarm signal alm &# 39 ;, which indicates that the clock driver 11 is abnormal , in a case where the output clock signal clb is cut off but not the input clock signal cla , 22 the phase - difference monitoring unit for comparing a phase difference between the input clock signal cla and the output clock signal clb of the clock driver 11 , and outputting an alarm signal alm &# 34 ;, which indicates that the clock driver 11 is abnormal , in a case where a phase difference greater than a prescribed value has been detected , and 31 an or gate for taking the logical sum of the first alarm signal generated by the abnormality discriminating unit 14 and the second alarm signal generated by the phase - difference monitoring unit 22 and outputting the abnormality alarm signal alm . thus , in accordance with the present invention , cut - off of the input clock signal and output clock signal of a clock driver is monitored and an alarm is issued upon discriminating that the clock driver is abnormal in a case where the output clock signal is cut off but not the input clock signal . alternatively , the phases of the input clock signal and output clock signal of a clock driver are monitored and an alarm is issued upon discriminating that the clock driver is abnormal in a case where the output clock signal has developed a phase shift , in excess of a prescribed value , with respect to the input clock signal . as a result , abnormality in a clock driver circuit , which occupies an important position in an electronic apparatus , can be monitored with ease and the reliability of the apparatus can be improved . further , the apparatus for monitoring abnormality in a clock driver according to the present invention is capable of being incorporated in a single - chip ic or the like along with the clock driver circuit . this contributes to an economical and highly reliable clock driver . as many apparently widely different embodiments of the present invention can be made without departing from the spirit and scope thereof , it is to be understood that the invention is not limited to the specific embodiments thereof except as defined in the appended claims .	6
the flow diagram in fig1 shows a preferred embodiment of the invention . the only drawing shows an example of a flow diagram of a cement clinker line . core of the line is a rotary kiln 10 between a clinker cooler 20 and heat exchanger tower 30 . the rotary kiln 10 has a burner protruding into the rotary kiln 10 from the clinker cooler side ( not illustrated ), to produce the heat required for clinker manufacture by combustion in the rotary kiln 10 . the flue gas arising in combustion escapes from the rotary kiln 10 on the heat exchanger tower side . from this side , raw - meal is in return supplied to the rotary kiln 10 . the heat exchanger tower 30 in this example has four cyclones 32 connected in a cascade , i . e . serially connected , for preheating and partial deacidification of raw - meal by heat of the flue gas and for gross dedusting of the flue gas . any other suitable number of cyclones may be used as well . the flue gas escaping from the heat exchanger tower 30 has a typical temperature of 300 - 500 ° c . before the flue gas is supplied to a flue gas filter 50 for further dedusting , it is cooled to a temperature below at least approximately 150 ° c . this leads to condensation of heavy metals in the flue gas , such as mercury and thallium , on the dust contained in the smoke . this dust is separated in the flue gas filter 50 and thus acts as cold trap for heavy metals . additionally , the volume to be dedusted ( per unit of time ) is drastically reduced and more cost - efficient fabric filter techniques can be used . three options are intended to cool the flue gases : ( 1 ) supply of the flue gases to a steam boiler 100 , to produce steam that is expanded in a turbine setup 120 , e . g . to power a generator , ( 2 ) supply of the flue gases to a raw mill 34 , to dry the raw material supplied to the raw mill and preheat the raw - meal , and ( 3 ) supply of the flue gases to an evaporation cooler 36 . the corresponding conduits have flaps 38 to separate the flue gas flow between the three cooling options . in regular operation , as little as possible , that is no or hardly any flue gas should be cooled with the evaporation cooler 36 , since the heat removed from the flue gas in the evaporation cooler 36 is no longer available as process heat . the evaporation cooler thus preferably only has the function of emergency cooling if the steam boiler 100 cannot be used . the cooled flue gas is then dedusted in a flue gas filter 50 and the dedusted flue gas is supplied to an scr - system 60 for catalytic denitrification of the flue gases . for this , it must be heated to at least 230 ° c .- 270 ° c . therefore , it is supplied from the flue gas filter 50 first to a recuperator 62 that is supplied by denitrified flue gas escaping from the scr system in the counterflow , so that heat is transferred from the denitrified ( pure gas ) to the flue gas to be subjected to denitrification ( raw gas ). the flue gas to be denitrified escaping from the recuperator is supplied to a further heat exchanger to heat it further . this further heat exchanger 64 is also referred to as “ second heat exchanger ” in the scope of this patent application . the heat necessary for heating the flue gas is supplied to the second heat exchanger 64 through a thermal oil as heat carrier fluid . the flue gas heated in this manner in two steps ( first step recuperator 62 , second step “ second heat exchanger 64 ”) is supplied to the scr - system 60 and denitrified there . the denitrified flue gas heats the flue gases to be denitrified in the recuperator 62 as already described and is cooled off accordingly . then the flue gas is cooled in another heat exchanger 102 to preferably about 110 ° c . and can be discharged through a stack as indicated . the heat removed from the flue gas in the heat exchanger 102 is used for feed water preheating for the steam boiler 100 and / or a boiler 110 . alternatively , they can also be fed into a district heat network or used for power generation in an orc - procedure . “ orc ” is the common abbreviation for “ organic rankine cycle ”, a procedure in which steam turbines are operated with the steam of low - boiling organic fluids . additionally , the preferably continuous removal of clinker from the rotary kiln 10 removes heat from the rotary kiln 10 . this clinker , which is initially about 1450 ° c . hot , is cooled in the clinker cooler 20 . the cooling agent is preferably air . the clinker cooler 20 therefore is a heat exchanger . part of the cooling agent heated in the clinker cooler 20 is drawn off from the clinker cooler through a middle air outlet 24 . the heat stored in the discharged cooling agent , hereinafter briefly called exhaust , heats thermal oil as heat carrier fluid in a heat exchanger 80 after gross dedusting in a cyclone 77 . the heat transferred to the heat carrier fluid can also be transported across long distances with low heat loss , specifically to heat the flue gas to be denitrified to the temperature required for denitrification in the second heat exchanger 64 . the heat exchanger 80 has an inlet 81 for the exhaust that is routed first through a first conduit 83 in the heat exchanger to heat the heat carrier fluid that flows through the first conduit . subordinately to the first conduit 83 , there is a second conduit 84 through which the exhaust is routed . in the second conduit 84 , another heat carrier fluid flows and is heated by the exhaust . in the example shown , the other heat carrier fluid is water , which is preheated as feed water for the steam boiler 100 and / or a boiler 110 . the exhaust leaves the heat exchanger 80 through an outlet 82 . the exhaust is routed in a flow channel in the heat ex - changer 80 . the flow channel is u - shaped , i . e . it has two free legs 85 , 86 that are connected by a bottom cross leg 87 . each of the two free legs 85 , 86 has one of the two conduits 83 , 84 . deflection of the exhaust in the area of the cross leg 87 leads to clinker dust carried along in the exhaust collecting at the bottom of the cross leg , where it can be separated . the outlet 85 is connected to a cooler 70 to set the temperature for the down - stream filter 75 . the filter 75 is used to dedust the exhaust air , which can then , e . g ., be discharged through an indicated stack . the device for baking of clinker has a chloride bypass in addition to the flue gas treatment described above . part of the flue gas escaping from the rotary kiln 10 is not supplied to the raw - meal preheater but first mixed with fresh air in a mixing chamber 90 . a mixing temperature of about 450 ° c . ( 400 ° c .- 500 ° c .) is set . the temperature achieved in this manner permits hot gas dedusting in a hot gas filter 94 . the hot gas filter is followed by a boiler 110 . in the boiler , steam is gen - erated that is relieved in the turbine setup . the flue gas escaping from the boiler is used as cooling air for the clinker cooler 20 and returned to the rotary kiln 10 through the clinker cooler 20 . because the flue gases escaping from the boiler still have a temperature clearly above the usual ambience temperatures , the return of the flue gases through the clinker cooler enables achievement of a high secondary air temperature and the fuel consumption drops accordingly in return . it will be appreciated to those skilled in the art having the benefit of this disclosure that this invention is believed to provide a method an apparatus for cement clinker manufacture . further modifications and alternative embodiments of various aspects of the invention will be apparent to those skilled in the art in view of this description . accordingly , this description is to be construed as illustrative only and is for the purpose of teaching those skilled in the art the general manner of carrying out the invention . it is to be understood that the forms of the invention shown and described herein are to be taken as the presently preferred embodiments . elements and materials may be substituted for those illustrated and described herein , parts and processes may be reversed , and certain features of the invention may be utilized independently , all as would be apparent to one skilled in the art after having the benefit of this description of the invention . changes may be made in the elements described herein without departing from the spirit and scope of the invention as described in the following claims .	1
the detailed description set forth below in connection with the appended drawings is intended as a description of the presently preferred embodiment of the invention and is not intended to represent the only form in which the present invention may be constructed or utilized . it is to be understood , however , that the same or equivalent functions may be accomplished by different embodiments that are also intended to be encompassed within the spirit and scope of the invention . with reference to fig1 and 2 , the presently disclosed adjustable knee brace 100 with respect to a wearer &# 39 ; s leg 10 is shown . leg 10 is anatomically comprised of femur ( thigh ) section 16 , knee 12 , and tibia ( shin ) section 14 . femur section 16 is braced by femoral frame 200 and is in a pivoting relationship with tibial frame 300 , which braces tibia section 14 . such a pivoting relationship is enabled by hinge components 401 and 402 , which preferably are ratio swing hinges constructed according to the disclosure in u . s . pat . no . 4 , 940 , 044 , owned by the current assignee , the disclosure of which is expressly incorporated herein in its entirety by reference . such hinge components 401 and 402 are designed to closely simulate the rotational movement of the tibia relative the femur , and essentially simulate normal knee movements . all connections herein to hinge components 401 and 402 are as described in the referenced patent . those skilled in the art will recognize that other conventional hinge constructions are clearly contemplated for use herein . referring specifically to fig2 , an exploded view of the knee brace 100 is shown . femoral frame 200 is comprised of medial frame 220 , lateral frame 210 , inner width adjustment plate 260 , and outer width adjustment plate 250 . medial frame 220 has a horizontally elongate section 224 and vertically elongate section 226 . horizontally elongate section 224 includes a width adjustment slot 222 which extends substantially across horizontally elongate section 224 . furthermore , horizontally elongate section 224 is preferably formed in an arcuate configuration to accommodate the shape of leg 10 , specifically the curvature of femur section 16 so as to minimize the profile resulting from and the obstruction caused by the presence of knee brace 100 . vertically extending section 226 is comprised of upper angular adjustment bolt securing hole 228 a , and lower angular adjustment bolt securing hole 228 b . angle adjustment arm 240 has a vertically elongate angle adjustment slot 242 , which slidably engages medial frame 220 at angular adjustment bolt securing holes 228 a and 228 b . angle adjustment retaining bolts ( not shown ) are inserted through angle adjustment holes 228 a and 228 b and angle adjustment slot 240 . in its most extended state , the upper end of angle adjustment slot 242 corresponds in position to that of upper angular adjustment bolt securing hole 228 a . in its most contracted state , the lower end of angle adjustment slot 242 corresponds in position to that of lower angular adjustment bolt securing hole 228 b . thus , the effective height of the medial side of knee brace 100 can be adjusted , and accordingly , adjustable for bow - legged and knock - kneed legs , a condition characterized by the tibia angling towards the medial - side of the leg or the lateral side of the leg . by tightening the angle adjustment retaining bolt , the position of the angle adjustment arm 240 is secured relative to the medial frame 220 . an analogous angular adjustment is disclosed in u . s . pat . no . 6 , 875 , 187 , the disclosure of which is expressly incorporated by reference in its entirety herein . lateral frame 210 , similar to its counterpart medial frame 220 , has a horizontally elongate section 225 and a vertically elongate section 227 . horizontally elongate section 225 includes a width adjustment slot 233 which extends substantially across horizontally elongate section 225 . like the horizontally elongate section 224 of medial frame 220 , the horizontally elongate section 225 of lateral frame 210 is preferably formed having an arcuate configuration to accommodate the shape of leg 10 . unlike medial frame 220 , however , lateral frame 210 has an extended vertically elongate section to compensate in height for the lack of an angle adjustment arm . instead , the lower end of lateral frame 210 has hinge connecting holes 404 to the hinge component 401 shown in fig1 , whereas the medial frame 210 has no hinge connecting holes ; the hinge connecting holes 404 being on the angle adjustment arm 240 . with reference to fig2 , 4 a , and 4 b , the details of the width adjustment mechanism will be explained . specifically referring to fig2 and 3 , width adjustment slot 222 has a distal end 238 and a proximal end 236 . lateral frame 210 also has width adjustment slot 233 configured to mirror width adjustment slot 222 on medial frame 220 . lateral frame adjustment slot 222 has a proximal end 237 and a distal end 239 . outer width adjustment plate 250 has medial extrusion 254 and lateral extrusion 256 , and inner width adjustment plate 260 similarly has medial extrusion 264 and lateral extrusion 266 . medial extrusion 264 and lateral extrusion 266 of inner width adjustment plate 260 is configured to abut slightly into width adjustment slots 222 and 233 so as to facilitate a sliding relationship along semicircular horizontal axis 270 with minimal angular deviation from the same . as illustrated in fig3 , medial frame 220 and lateral frame 210 is sandwiched i . e . disposed between outer width adjustment plate 250 and inner width adjustment plate 260 . outer width adjustment plate 250 and inner width adjustment plate 260 include retaining bolt securing holes 258 . the sandwiched relationship is maintained by retaining bolt 280 , which is passed through retaining bolt securing holes 258 on outer width adjustment plate 250 , then through width adjustment slots 222 and 233 on medial frame 220 and lateral frame 210 , respectively , then through retaining bolt securing holes 258 on inner width adjustment plate 260 , and finally tightened with retaining nut 281 . when the width configuration is determined by the user , retaining bolt 280 and retaining nut 281 is tightened to prevent further movement of medial frame 220 and lateral frame 210 against outer width adjustment plate 250 and inner width adjustment plate 260 . when the width configuration is to be modified , retaining bolt 280 and retaining nut 281 is loosened . now referring to fig4 a and 4 b , the width adjustment functionality of femoral brace 200 is shown . in its most extended position as shown in fig4 a , retaining bolt 280 is positioned in the most inward location , proximal ends 236 and 237 of width adjustment slots 222 and 233 . in its most contracted position as shown in fig4 b , retaining bolt 280 is positioned in the most outward location at distal ends 238 and 239 of width adjustment slots 222 and 233 . as can be seen , the width 232 of femoral brace 200 can be increased or decreased depending on the relative position of the lateral frame 220 and medial frame 210 with respect to the outer and inner width adjustment plates 250 and 260 shown in fig2 . thus , legs of a variety of widths can be rapidly and securely accommodated with the present inventive device . the above description is given by way of example , and not of limitation . given the above disclosure , one skilled in the art could devise variations that are within the scope and spirit of the invention disclosed herein . further , the various features of the embodiments disclosed can be used alone , or in varying combinations with each other and are not intended to be limited to the specific combination described herein . thus , the scope of the claims is not to be limited by the illustrated embodiments .	0
the preferred embodiments will be described with reference to the drawing figures wherein like numerals indicate like elements throughout . with reference to fig1 there is shown plasma treatment chamber 2 which is useful in accordance with the present invention . plasma treatment chamber 2 is divided into a plasma generating side 4 and a plasma focusing side 6 . in use , the plasma generating side 4 and the plasma focusing side 6 are joined together in a sealed relationship except for openings 8 and 10 at the respective upper and lower ends . entry and exit openings are created by the recesses 12 , 14 , 16 and 18 . since the pressure in the plasma treatment chamber 2 is preferably below atmospheric pressure , the recesses 12 , 14 , 16 and 18 will be provided with air locks of foam material or loop pile material , such as is available under the trade name velcro ®. presently , a closed cell polyolefin , such as polyethylene or polypropylene , foam is preferred . when chamber 2 is closed , the walls 20 and 22 will form a channel 24 through the apparatus 2 . a substrate passing between the air locks at openings 8 and 10 will pass into channel 24 and be sufficiently sealed against the atmosphere so as to maintain the desired vacuum level within the plasma treatment chamber 2 . the vacuum in chamber 2 is drawn through the outlet ducts 30 and 32 by a suitable vacuum generating device as will be known to those skilled in the art . currently , the plasma is being generated between 900 milli torr ( 0 . 900 torr ) and 3 torr . in earlier trials , plasma was generated at up to 34 torr . with reference to fig2 taken along line 2 -- 2 of fig1 there is illustrated a substrate 3 as it passes through the plasma treatment chamber 2 and the hollow cathode assemblies 36 . as shown in fig1 and 2 , the hollow cathode assemblies 36 define multiple hollow cathodes 38 . the plasma generated in the hollow cathodes 38 will be initially focused in the vicinity of the substrate 3 . additional focusing of the plasma on the substrate is accomplished by the focusing means included in plasma focusing side 6 . turning now to fig3 there is a view of the plasma focusing side 6 of plasma treatment apparatus 2 that is taken along the line 3 -- 3 of fig1 . the plasma focusing side 6 includes a plurality of focusing arrays 50 which are located in space relative to each other so as to achieve a reinforcement of the magnetic focusing field . surrounding the magnets 50 ( shown in crosshatch for clarity ) are the cooling ducts 52 which serve to control the temperature in the chamber , thereby protecting the magnets from overheating . plasma treatment to remove low molecular weight material or surface impurities will preferably use readily available , inexpensive , environmentally benign gases . in some applications , plasma treatment alone may be sufficient , however , it can be followed by coating with metals , ceramics , or polymerizable compounds . preferred polymerizable compounds are radiation curable organic monomers containing at least one double bond , preferably at least two double bonds , especially alkene bonds . acrylates are particularly well - suited monomers . metals suitable for deposition include , but are not limited to al , cu , mg , and ti . ceramics suitable for deposition include , but are not limited to , silicate - containing compounds , metal oxides particularly aluminum oxide , magnesium oxide , zirconium oxide , beryllium oxide , thorium oxides , graphite , ferrites , titanates , carbides , borides , silicides , nitrides , and materials made therefrom . multiple coatings comprising metal , ceramic or radiation curable compound coatings are possible . plasma treatment leads to one or more of the following benefits : cleaning , roughening , drying , or surface activation . plasma treatment can also lead to chemical alteration of a substrate by adding to a substrate or removing from a substrate , functional groups , ions , electrons , or molecular fragments , possibly accompanied by cross - linking . all materials are of interest for plasma treatment or application of a secondary coating . those of primary interest are polymers , such as aramids , polyesters , polyamides , polyimides , fluorocarbons , polyaryletherketones , polyphenylene sulfides , polyolefins , acrylics , copolymers and physical blends or alloys thereof . preferred secondary layer coating thickness for polymers is in the range of 0 . 1 to 100 microns , more preferably 20 to 100 microns , most preferably 20 to 40 microns . preferred metal or ceramic secondary layer coating thickness is in the range of 50 angstroms to 5 microns , more preferably 100 to 1000 angstroms . a preferred polymer is an acrylate of acrylic acid or its esters . the preferred acrylates have two or more double bonds . monoacrylates have the general formula ## str1 ## wherein r 1 , r 2 , r 3 , and r 4 are h or an organic group . diacrylates are acrylates of formula i wherein either r 1 , r 2 , r 3 , or r 4 is itself an acrylate group . organic groups are usually aliphatic , olefinic , alicyclic , or aryl groups or mixtures thereof ( e . g . aliphatic alicyclic ). preferred monoacrylates are those where r 1 , r 2 and r 3 are h or methyl and r 4 is a substituted alkyl or aryl group . preferred diacrylates have the formula ## str2 ## where r 1 , r 2 , r 3 , r 5 , r 6 , r 7 are preferably h or methyl , most preferably h . r 4 is preferably c 2 - c 20 alkyl , aryl , multialkyl , multiaryl , or multiglycolyl , most preferably triethylene glycolyl or tripropylene glycolyl . the notation , c 2 - c 20 alkyl , indicates an alkyl group with 2 to 20 carbon atoms . r 4 in a mono - or multiacrylate is chosen to yield the desired surface properties after the monomer has been radiation cured to form a surface on a substrate . table 1 contains a list of examples . table 1______________________________________r . sup . 4 surface properties______________________________________ -- ch . sub . 2 ch . sub . 2 ch . sub . 2 och . sub . 2 ch . sub . 2 ch . sub . 2 och . sub . 2ch . sub . 2 ch . sub . 2 -- abrasion resistance -- ch . sub . 2 ch . sub . 2 och . sub . 2 ch . sub . 2 och . sub . 2 ch . sub . 2 -- abrasion resistance -- ch . sub . 2 ch . sub . 2 cooh hydrophilicity -- ch . sub . 2 ch . sub . 2 oh hydrophilicity______________________________________ formula i and ii can also include triacrylate and other polyacrylate molecules . mixtures of diacrylates can be copolymerized , for example a 50 : 50 mix of two structurally different diacrylates . diacrylates can also be copolymerized with other polymerizable components , such as unsaturated alcohols and esters , unsaturated acids , unsaturated lower polyhydric alcohols , esters of unsaturated acids , vinyl cyclic compounds , unsaturated ethers , unsaturated ketones , unsaturated aliphatic hydrocarbons , unsaturated alkyl halides , unsaturated acid halides and unsaturated nitrites . diacrylates of interest also include 1 , 2 - alkanediol diacrylate monomers of formula ## str3 ## where r 1 is in an acrylate radical having about 8 to 28 carbon atoms and r 2 is hydrogen or methyl ( see for example u . s . pat . no . 4 , 537 , 710 ). the agent for promoting polymerization may be radiation , such as uv radiation or electron beam radiation . in some instances , it may be preferred to use a photoinitiator , such as an appropriate ketone . acrylate - based formulations of interest also include heterogeneous mixtures . these formulations contain a very fine dispersion of metal , ceramic , or graphite particles . these coatings are designed to enhance the abrasion resistance and / or the conductivity of the surface . for the photo - curing ( uv / visible ) of these pigmented dark acrylate - based formulations , a long wave length (& gt ; 250 nm ) radiation source in combination with a compatible photoinitiator may be preferred . turning now to fig4 and 5 , there are illustrated apparatuses for sequential plasma treatment , coating , and curing of a continuous substrate which may most easily be thought of as a strand 3 . in fig4 a plasma treatment apparatus 2 , a coating applicator 60 , and a curing unit 70 , provide an integrated system for treatment of the strand 3 . the direction of movement of the strand 3 is indicated by the in and out arrows . the strand 3 moves over a guide roller 88 and enters the plasma treatment apparatus 2 at the opening 8 . to achieve uniform coverage , the strand 3 will not touch either wall 20 or wall 22 . however , the strand 3 will pass closer to wall 22 than to wall 20 . if it is desired to treat only one surface of a strand , the surface to remain untreated may be shielded , such as by contact with wall 22 . after the strand 3 passes through channel 24 , it exits the plasma apparatus 2 through opening 10 . in the preferred embodiment , the coating applicator 60 , is a capillary drip system 400 including a reservoir 402 , a pump 404 , a dispensing manifold 406 , a plurality of capillary tips 408 , and a separating roller 410 having a plurality of grooves 412 dimensioned to receive a substrate as shown in fig5 . the coating solution 61 is pumped from the reservoir 402 into the dispensing manifold 406 and through the plurality of capillary tips 408 . each tip 408 is associated with a groove 412 in the separating roller 410 . in this arrangement , the roller 410 may rotate or be held stationary . the strand 3 is directed to engage the roller 410 horizontally or at an angle up to 45 ° above horizontal . the strand 3 travels around the roller 410 and continues vertically upward into the curing unit 70 . the variation in the initial angle θ determines how the strand 3 is coated . depending on the angle θ , the strand contacts 25 - 50 % of the roller 410 circumference . use of this capillary tip system is accurate and efficient , requires less coating solution 61 , and provides a more uniform coating than other methods . this approach is believed to be beneficial because it allows for remote location of the reservoir 402 away from potential curing radiation which may impact a dip bath . returning to fig4 the strand 3 then enters into the curing apparatus 70 through channel 72 and passes out of the apparatus at channel 74 . the channels 72 and 74 are defined by the extensions 75 and 76 . the central channel 77 is defined by the walls 78 and 79 of the curing apparatus 70 . after passing the last guide roller 88 , the strand 3 is handled in the usual manner associated with normal production of an unmodified product . in one embodiment , curing apparatus 70 has one section 80 with a plurality of uv lamps ( one lamp is noted as 82 ) and an opposed section 84 with a plurality of opposing mirrors ( one mirror is noted as 86 ). in a preferred arrangement for curing certain monomer coatings , there are up to four lamps , in opposed pairs . each lamp is preferably adjustable for controlling their combined output . the sections 80 and 84 are hinged relative to each other to allow access for startup and repair . the uv light used for curing preferably emits radiation between 150 and 400 nanometers . the series of guide rollers 88 change the direction of the strand 3 so it passes continuously through plasma treatment apparatus 2 , coating applicator 60 , and curing apparatus 70 . the system components , plasma treatment apparatus 2 , coating applicator 60 , curing apparatus 70 , and rollers 88 , are secured in a stable manner to preserve the spacial relationship between them . fig7 illustrates the case for multiple strands 3 , such as monofilaments , passing through the plasma treatment apparatus 2 . the strands are spaced across the width , preferably in individual paths , so that the entirety of the strand is exposed to treatment . the individual strands are preferably guided by grooves cut in the rollers 88 . using a series of grooved rollers 88 keeps the strands in the desired relationship as they move through the treatment process . the treated substrate is tested according to test method 118 developed by the american association of textile chemists and colorists ( aatcc ). drops of standard test liquids , consisting of a selected series of hydrocarbons with varying surface tensions , are placed on the surface and observed for wetting , wicking , and contact angle . the oil repellency grade is the highest numbered liquid which does not wet the surface . the method was modified to test for water repellency , using test liquids of isopropanol and water in ratios of 2 : 98 , 5 : 95 , 10 : 90 , 20 : 80 , 30 : 70 , and 40 : 60 ( in percent by volume ) numbered one through six respectively . if surface wetting does not occur within 10 seconds , the next test liquid is applied . lower ratings indicate oleo - or hydrophilicity while higher ratings indicate oleo - or hydrophobicity . using a continuous treatment system shown in fig1 - 5 , a plurality of strands are treated . an extruder is adjusted to produce 10 ends of a polyethylene terephthalate monofilament with a nominal size of 0 . 26 mm × 1 . 06 mm . these sizes have a tolerance of 0 . 22 - 0 . 304 mm and 1 . 01 - 1 . 11 mm respectively , with an expected yield of 2900 denier . additionally the yam would have a relative elongation at 3 grams per denier of 19 %, and a free shrinkage at 200 degrees centigrade of 6 . 5 %. the production speed of the extruder line is set at 216 . 8 fpm , with the godet rolls and oven temperatures appropriately adjusted to give the specified yarn . immediately after exiting the extruder , nine of the ten strands are introduced into the plasma chamber , which is at 1 . 01 torr , with constant induction of 400 ml / min of commercial grade argon . the amplifier and tuner are adjusted to introduce 1326 watts to the hollow cathode , with less than 10 watts of reflected power . an external chiller is used , which maintains the temperature near room temperature , but above the dew point . upon exiting the plasma chamber , the nine ends are then directed to a grooved separator roll where monomer is applied . from a one inch manifold being supplied formulation mm2116 by a diaphragm pump , nine capillaries drop to individual grooves spaced evenly across the roller . the air - operated pump is adjusted with a micro air valve to supply a steady state of monomer to the monofilament . a weighing device is used to continually monitor the amount delivered . coating thickness can be controlled by increasing or decreasing pump pressure , fiber speed or stopping the rotation of the roller . after coating , the yarn proceeds directly upward , and enters the ultra violet cure box , which has three lamps operating . two lamps are set on medium , and one is set on high , providing an immediate and complete cure of the monomer . in the upper section , two of the lamps are opposed to each other rather than having one lamp opposed by a mirror . other applications may demand more or fewer lamps . after the yarn exits the uv chamber , it continues down the line through a nip roll and onto the spools mounted on a conventional spool winder . this particular run experienced an increase in the minor axis of 0 . 0274 mm and in the major axis of 0 . 1486 mm , causing an increase in weight of 178 grams per 9000 meters or approximately a 5 . 8 % add on . the resulting yarn has an oil , water rating of 4 , 6 when tested with aatcc test method # 118 . the yarn was then woven into a filling float fabric using conventional processing methods . the yarn survives the rigors of warping and weaving without abrasion , or flaking indicating the coating is securely affixed . resulting fabrics also have an oil , water rating of 4 , 6 on one surface designated as the face . the untreated pet control has an oil , water rating of 0 , 2 - 3 . in this particular example , a series of acrylate - based fluorinated monomer / oligomer formulations have been tested for this application . these materials cover a broad range of surface energies ( hydrophobic / hydrophilic and oleophobic / oleophilic ), crosslinking densities , abrasion resistance and adhesion to the substrate . the formulation sigma - mm - 2116 is a solvent - free , acrylate based monomer / oligomer mix which contains 50 - 95 % perfluorinated monoacrylate with fluorine content ranging from 30 - 64 %. the formulation also contains 3 - 50 % multi - functional , compatible crosslinking agents , e . g . di - and tri - acrylate monomers . also 1 - 20 % of an adhesion promoter was added to enhance diacrylate monomers functionalized with hydroxyl , carboxyl , carbonyl , sulfonic , thiol , or amino groups . the high fluorine content lowers the surface energy of the cured coating and turns the coated yarn into hydrophobic and oleophobic material . combining the plasma treatment of the surface of the substrate with the functionalization of the coating with a specialty adhesion promoter formulation helps to achieve an excellent adhesion between the coating and the substrate while keeping the energy low , making the surface of the substrate both hydrophobic and oleophobic . in addition to the formulation for hydrophobicity / oleophobicity , formulations are also contemplated in applications for electrostatic dissipation and abrasion resistence . although the presently preferred embodiment uses the capillary drip applicator , initial efforts called for a monomer bath . as shown in the sectional view of fig6 the bath 418 is essentially a tub 420 for holding the monomer solution 61 and a submersible frame 422 for controlling passage through the monomer solution 61 . the frame 422 moves horizontally on shaft 424 and vertically on shaft 425 . the depth of roller 426 in the monomer solution 61 may be controlled by fixing the position of shaft 425 . when the roller 426 is submerged in the monomer solution 61 , each strand 3 is passed around the roller 426 so that it will exit vertically from the bath as indicated by the broken line . using a continuous treatment system as shown in fig1 to 5 , a polyethylene terephthalate ( pet ) monofilament of 0 . 5 mm diameter is treated . in this example , a sample monofilament is fed from the final extrusion process directly to the plasma treatment apparatus . the control sample is fed from the final extrusion process directly to a wind up roll . as used herein , directly means the absence of intermediate processing steps or storage between processing steps for an extrudate . the line speed in the test system is 200 ft / min but speeds up to 700 feet / min are employed during production . the gas in the plasma treatment apparatus may be 10 % argon and 90 % nitrogen but is more preferably 20 % oxygen and 80 % argon . the gas is introduced into the treatment chamber at a rate sufficient to achieve a stable plasma . the vacuum pressure is 10 - 1 - 10 - 4 torr . power supplied to the plasma chamber is about 2 kw ( kilowatts ). the power is created with direct current or alternating current but is preferably created with an alternating current in the range of 10 to 100 khz , with 40 khz being preferred . the monomer bath contains a solution of triethyleneglycol diacrylate . the lamps in the uv treatment apparatus are 15 inch hanovia high pressure hg lamps that generate 300 w / inch . the treated monofilament is compared to the control monofilament by surface tension measurements using the oil and water tests described above . it is preferred to use continuous or in - line processing where the substrate moves through the base processing step , such as extrusion , and plasma / coating treatment at the same speed . other alternative coating means may be used such as u shaped applicators , a kiss roll , eyelet applicators , and clamshell eyelet applicators . in a more traditional finishing device , the strand passes through a liquid - filled u - shaped device , and emerges with a coating around its entire perimeter . where capillary action can be used to carry a coating around the strand , a kiss roll applicator may be used . in this technique , the strand is coated when it &# 34 ; kisses &# 34 ; a liquid covered roller which is rotating with or against the strand &# 39 ; s direction of travel . in yet another embodiment , the strand passes through an eyelet through which the coating is pumped . the eyelet may have a clam - shell design to avoid the need for threading the strand through the eyelet . fig8 a through 8g illustrate exemplary cross - sections of coated strands which are producible in accordance with the above example . all cross - sections are greatly exaggerated to permit demonstration of the point . in fig8 a , the substrate 302 has a plasma - treated outer surface 303 surrounded by a coating layer 304 . more than one type of coating may be applied through repeated coating techniques . in fig8 b , the usually preferred embodiment , the first coating layer 304 and a secondary coating 306 surround the core 302 . in fig8 c , the outer layer 306 is disposed only partly around the first coating layer 304 . in fig8 d , the first coating 304 and the secondary coating 306 are disposed only partly around core 302 . in fig8 e , the coating layer 304 is only partly around the core 302 but the coating 306 is completely around the core 302 . fig8 f illustrates exemplary cross - sections of rectangular strands . in fig8 f , the plasma - treated substrate 302 , like in 7b , is coated with a first layer 304 , such as a metal or polyacrylate , and a second layer , 306 , such as a metal or polyacrylate . in fig8 g , like 7d , the substrate 302 is covered for a portion thereof by a first layer 304 and a second layer 306 . depending on the substrates dimensions , the cross - section in fig8 g can resemble that of a thin film . in general , the coating is nonconformational . that is , it will tend to be self - leveling and will not conform to the geometry of the substrate . fig9 - 12 show alternative plasma treatment chambers and coating and curing units . fig9 shows a representative upper chamber , 126 and a representative lower chamber , 127 , to illustrate one treatment arrangement . in fig9 upper chamber 126 has the hollow cathodes arrays 36 and 36 , and lower chamber 127 has focusing magnets 50 . the arrangement of fig9 will plasma treat only the upper surface 98 of a substrate 97 when it is relatively dense . for an open , less dense substrate , like a web or open fabric , it may be possible to treat surfaces 98 and 99 at one time . if desired , additional hollow cathodes arrays 36 may be located in the adjacent lower chamber and additional focusing magnets 50 may be located in the adjacent upper chamber 126 , to simultaneously treat upper surface 98 and lower surface 99 . fig9 does not show a gas feed connection for introducing gas to be ionized or electrical connections linked to the cathodes as these connections will be known to those skilled in the art as a matter of design choice . fig1 shows a representative upper chamber 128 and a representative lower chamber 129 in an arrangement for metal deposition . lower chamber 129 has resistively heated boats 171 and a supply of aluminum wire 173 on spool 175 . as the wire 173 contacts the resistively heated boats 171 , the wire is vaporized . it then condenses on the lower surface 99 . alternatively , one can create a ceramic coating by introducing oxygen in to chamber 129 to oxidize the aluminum and create aluminum oxide ( al 2 o 3 ). fig1 shows a representative upper chamber 124 and a representative lower chamber 125 for creating a monomer layer on surface 98 . a monomer vaporizer 180 creates a cloud of monomer vapor which will be deposited through condensation on the upper surface 98 . if desired , avaporizer 180 , shown in phantom could be located as a mirror image in lower chamber 125 . fig1 shows a representative upper chamber 130 that has a bank 190 of uv emitting lights 82 that irradiate and cure the monomers on surface 98 . alternatively , the radiation device can be one that emits an electron beam . if the substrate is treated on both surfaces a second bank 190 , as shown in phantom will be located in chamber 131 .	7
it is believed that one skilled in the art can , based on the description herein , utilize the present invention to its fullest extent . the following specific embodiments are , therefore , to be construed as merely illustrative , and not limitative of the remainder of the disclosure in any way whatsoever . unless defined otherwise , all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . also , all publications , patent applications , patents , and other references mentioned herein are incorporated by reference . somatostatin ( somatotropin release inhibiting factor or srif ) has both a 14 amino acid isoform ( somatostatin - 14 ) and a 28 amino acid isoform ( somatostatin - 28 ). see wilson , j . & amp ; foster , d ., williams textbook of endocrinology , p . 510 ( 7th ed ., 1985 ). the compound is an inhibitor of secretion of the growth hormone and was originally isolated from the hypothalamus . brazeau , et al ., science 179 : 77 ( 1973 ). native somatostatin has a very short duration of effect in vivo since it is rapidly inactivated by endo - and exopeptidase . many novel analogs have been prepared in order to enhance the duration of effect , biological activity , and selectivity ( e . g ., for the particular somatostatin receptor ) of this hormone . such analogs will be called “ somatostatin agonists ” herein . various somatostatin receptors ( sstrs ) have been isolated , e . g ., sstr - 1 , sstr - 2 , sstr - 3 , sstr - 4 , and sstr - 5 . thus , the somatostatin agonist may be a sstr - 1 agonist , sstr - 2 agonist , sstr - 3 agonist , sstr - 4 agonist or an sstr - 5 agonist . in one embodiment , the somatostatin agonist of the present invention is an sstr - 5 agonist or an sstr - 2 agonist . what is meant by an “ sstr - 5 agonist ” or an “ sstr - 2 agonist ” is a compound which ( 1 ) has a high affinity ( e . g ., ki of less than 1 μm or , preferably , of less than 10 nm , or less than 2 nm , or of less than 1 nm ) for the sstr - 5 or sstr - 2 , respectively ( e . g ., as defined by the receptor binding assay described below ), and ( 2 ) decreases body weight of a patient ( e . g ., as defined by the biological assay described below ). the somatostatin agonist may also be selective for a particular somatostatin receptor , e . g ., have a higher binding affinity for a particular somatostatin receptor subtype as compared to the other receptor subtypes . in one embodiment , the somatostatin receptor is an sstr - 5 selective agonist or sstr - 2 selective agonist . what is meant by an sstr - 5 selective agonist is a somatostatin agonist which ( 1 ) has a higher binding affinity ( i . e ., ki ) for sstr - 5 than for either sstr - 1 , sstr - 2 , sstr - 3 , or sstr - 4 and ( 2 ) decreases body weight of a patient ( e . g ., as defined by the biological assay described below ). in one embodiment , the sstr - 5 selective agonist has a ki for sstr - 5 that is at least 2 times ( e . g ., at least 5 times or at least 10 times ) less than its ki for the sstr - 2 receptor ( e . g ., as defined by the receptor binding assay described below ). somatostatin agonists which can be used to practice the therapeutic method of the present invention include , but are not limited to , those covered by formulae or those specifically recited in the publications set forth below , all of which are hereby incorporated by reference . horvath , a . et al . abstract , “ conformations of somatostatin analogs having antitumor activity ”, 22nd european peptide symposium , sep . 13 - 19 , 1992 , interlaken , switzerland ; examples of somatostatin agonists include , but are not limited to , the following somatostatin analogs which are disclosed in the above - cited references : ac - d - phe - lys - tyr - d - trp - lys - val - asp - thr - nh 2 ( an amide bridge formed between lys and asp ); note that for all somatostatin agonists described herein , each amino acid residue represents the structure of — nh — c ( r ) h — co —, in which r is the side chain ( e . g ., ch 3 for ala ) except for thr - ol which means — nh — ch ( ch ( ch 3 ) oh )— ch 2 — oh and pro which means prolinyl . lines between amino acid residues represent peptide bonds which join the amino acids . also , where the amino acid residue is optically active , it is the l - form configuration that is intended unless d - form is expressly designated . a disulfide bridge is formed between the two free thiols ( e . g ., cys , pen , or bmp residues ); however , it is not shown . use of linear somatostatin agonists of the following formula is also within the invention : a 1 is a d - or l - isomer of ala , leu , ile , val , nle , thr , ser , β - nal , β - pal , trp , phe , 2 , 4 - dichloro - phe , pentafluoro - phe , p - x - phe , or o - x - phe , wherein x is ch 3 , cl , br , f , oh , och 3 or no 2 ; a 2 is ala , leu , ile , val , nle , phe , β - nal , pyridyl - ala , trp , 2 , 4 - dichloro - phe , pentafluoro - phe , o - x - phe , or p - x - phe , wherein x is ch 3 , cl , br , f , oh , och 3 or no 2 ; a 3 is pyridyl - ala , trp , phe , β - nal , 2 , 4 - dichloro - phe , pentafluoro - phe , o - x - phe , or p - x - phe , wherein x is ch 3 , cl , br , f , oh , och 3 or no 2 ; a 6 is val , ala , leu , ile , nle , thr , abu , or ser ; a 7 is ala , leu , ile , val , nle , phe , β - nal , pyridyl - ala , trp , 2 , 4 - dichloro - phe , pentafluoro - phe , o - x - phe , or p - x - phe , wherein x is ch 3 , cl , br , f , oh , och 3 or no 2 ; a 8 is a d - or l - isomer of ala , leu , ile , val , nle , thr , ser , phe , β - nal , pyridyl - ala , trp , 2 , 4 - dichloro - phe , pentafluoro - phe , p - x - phe , or o - x - phe , wherein x is ch 3 , cl , br , f , oh , och 3 or no 2 ; each r 1 and r 2 , independently , is h , lower acyl or lower alkyl ; and r 3 is oh or nh 2 ; provided that at least one of a 1 and a 8 and one of a 2 and a 7 must be an aromatic amino acid ; and further provided that a 1 , a 2 , a 7 and a 8 cannot all be aromatic amino acids . examples of linear agonists to be used in the method of this invention include : if desired , one or more chemical moieties , e . g ., a sugar derivative , mono or poly - hydroxy c 2 - 21 alkyl , mono or poly - hydroxy c 2 - 21 acyl groups , or a piperazine derivative , can be attached to the somatostatin agonist , e . g ., to the n - terminus amino acid . see pct application wo 88 / 02756 , european application 0 329 295 , and pct application no . wo 94 / 04752 . an example of a somatostatin agonists which contain n - terminal chemical substitutions are : the methods for synthesizing somatostatin agonists is well documented and are within the ability of a person of ordinary skill in the art . synthesis of short amino acid sequences is well established in the peptide art . for example , synthesis of h - d - phe - phe - phe - d - trp - lys - thr - phe - thr - nh 2 , described above , can be achieved by following the protocol set forth in example i of european patent application 0 395 417 a1 . the synthesis of somatostatin agonists with a substituted n - terminus can be achieved , for example , by following the protocol set forth in wo 88 / 02756 , european patent application no . 0 329 295 , and pct publication no . wo 94 / 04752 . the human sstr - 1 , sstr - 2 , sstr - 3 , sstr - 4 , and sstr - 5 cdna clones have been described ( sstr - 1 and sstr - 2 in yamada , y ., et al ., proc . natl . acad . sci . usa , 89 : 251 - 255 ( 1992 ); sstr - 3 in yamada , et al ., mol . endocrinol . 6 : 2136 - 2142 ( 1993 ); and sstr - 4 and sstr - 5 in yamada , et al ., biochem . biophys . res . commun . 195 : 844 - 852 ( 1993 )) and are also available from american type culture collection ( atcc , rockville , md .) ( atcc nos . 79044 ( sstr - 1 ), 79046 ( sstr - 2 ), and 79048 ( sstr - 3 )). based on the restriction endonuclease maps , the entire coding region of each sstr cdna may be excised by suitable restriction endonuclease digestion ( maniatis , t ., et al ., molecular cloning — a laboratory manual , cshl , 1982 ). restriction endonucleases are available from new england biolabs ( beverly , mass .). this cdna fragment was inserted into the mammalian expression vector , pcmv ( russell , d ., et al ., j . biol . chem ., 264 : 8222 - 8229 ( 1989 )), using standard molecular biology techniques ( see e . g ., maniatis , t ., et al ., molecular cloning ,— a laboratory manual , cold spring harbor laboratory , 1982 ) to produce the expression plasmid , pcmv - human sstr - 1 through pcmv - human sstr - 5 . other mammalian expression vectors include pcdna1 / amp ( invitrogen , sandlesy , calif .). the expression plasmids were introduced into the suitable bacterial host , e . coli hb101 ( stratagene , la jolla , calif .) and plasmid dnas , for transfection , were prepared on cesium chloride gradients . cho - k1 ( ovary , chinese hamster ) cells were obtained from atcc ( atcc no . ccl 61 ). the cells were grown and maintained in ham &# 39 ; s f12 media ( gibco brl , grand island , n . y .) supplemented with 10 % fetal bovine serum under standard tissue culture conditions . for transfection , the cells were seeded at a density 1 × 10 6 / 60 ˜ cm plate ( baxter scientific products , mcgaw park , ill .). dna mediated transfection was carried out using the calcium phosphate co - precipitation method ( ausubel , f . m ., et al ., current protocols in molecular biology , john wiley & amp ; sons , 1987 ). the plasmid prsv - neo ( atcc ; atcc no . 37198 ) was included as a selectable marker at { fraction ( 1 / 10 )} the concentration of the expression plasmid . cho - k1 clonal cell lines that have stably inherited the transfected dna were selected for growth in ham &# 39 ; s f12 media containing 10 % fetal bovine serum and 0 . 5 mg / ml of g418 ( sigma ). the cells were ring - cloned and expanded in the same media for analysis . expression of the human sstr - 1 through sstr - 5 receptors in the cho - k1 cells were detected by northern blot analysis of total rna prepared from the cells ( sambrook , j . e ., et al ., molecular cloning — a laboratory manual , ed . 2 ., cold spring harbor laboratory , cold spring harbor , n . y ., 1989 ) and by receptor binding using [ 125 i - tyr 11 ] somatostatin - 14 as a ligand . transfected cell lines expressing the human sstr receptors were clonally expanded in culture and used in the following sstr binding protocol . crude membranes were prepared by homogenization of the transfected cells in 20 ml of ice - cold 50 mm tris - hcl with a polytron homogenizer ( setting 6 , 15 sec ). buffer was added to obtain a final volume of 40 ml , and the homogenate was centrifuged in a sorval ss - 34 rotor at 39 , 000 g for 10 min at 0 - 4 ° c . the resulting supernatant was decanted and discarded . the pellet was rehomogenized in ice - cold buffer , diluted , and centrifuged as before . the final pellet was resuspended in the 10 mm tris hcl and held on ice for the receptor binding assay . aliquots of the membrane preparation were incubated for 30 min at 30 ° c . with 0 . 05 nm [ 125 i - tyr 11 ] somatostatin - 14 ( 2000 ci / mmol ; amersham corp ., arlington heights , ill .) in 50 mm hepes ( ph 7 . 4 ) containing a test somatostatin agonist of various concentrations ( e . g ., 10 − 11 to 10 − 6 ), 10 mg / ml bovine serum albumin ( fraction v ) ( sigma chemical co ., st . louis , mo . ), mgcl 2 ( 5 mm ), trasylol ( 200 kiu ml ), bacitracin ( 0 . 02 mg / ml ), and phenylmethylsulphonyl fluoride ( 0 . 02 mg / ml ). the final assay volume was 0 . 3 ml . the incubations were terminated by rapid filtration through gf / c filters ( pre - soaked in 0 . 3 % polyethylenimine for 30 min ) using a brandel filtration manifold . each tube and filter were then washed three times with 5 ml aliquots of ice - cold buffer . specific binding was defined as the total [ 125 i - tyr 11 ] srif - 14 bound minus that bound in the presence of 1000 rim . the ki values for the tested somatostatin agonists were calculated by using the following formula : ki = ic 50 /[ 1 +( lc / lec )] where ic 50 is the concentration of test somatostatin agonist required to inhibit 50 percent of the specific binding of the radioligand [ 125 i - tyr 11 ] somatostatin - 14 , lc is the concentration of the radioligand ( 0 . 05 nm ), and lec is the equilibrium dissociation constant of the radioligand ( 0 . 16 nm ). the ki values ( nm ) for the tested somatostatin agonists are shown in table i . table i hsstr - 1 hsstr - 2 hsstr - 3 hsstr - 4 hsstr - 5 somato - 2 . 26 0 . 23 1 . 2 1 . 8 1 . 41 statin - 14 somato - 2 . 38 0 . 30 1 . 3 7 . 93 0 . 4 statin - 28 octreotide 875 0 . 57 26 . 8 5029 6 . 78 bim - 23014 2414 0 . 75 97 . 9 1826 5 . 21 bim - 23052 97 . 6 11 . 96 5 . 6 127 1 . 22 bim - 23190 9120 0 . 35 215 7537 11 . 1 bim - 23197 6016 0 . 19 26 . 8 3897 9 . 81 bim - 23272 47 . 7 3 . 23 10 . 9 753 1 . 01 bim - 23284 27 . 9 19 . 3 35 . 6 58 . 6 0 . 85 bim - 23295 86 . 9 6 . 19 9 . 7 3 . 4 0 . 34 bim - 23313 15 . 1 4 . 78 25 . 5 55 . 3 0 . 30 bim - 26268 1227 15 . 06 545 3551 0 . 42 the effect of chronic ( one week ) treatment with bim - 23268 on insulin sensitivity was examined in an obese hyperinsulinemic , insulin resistant animal model , the fatty ( fa / fa ) zucker rats ( bray , g ., federation proceedings 36 : 148 - 153 ( 1977 ); shafris , e ., diabetes / metab . rev . 8 : 179 - 208 ( 1992 )). male fatty zucker rats ( harlan - olac , bicester , oxon , u . k . ), which were 15 - 17 weeks old , were randomly divided into two groups . the animals were house in pairs in a normal 12 hour light : 12 hour darkness cycle at 20 ± 2 ° c . and fed a standard laboratory rat diet ( beekay rat and mouse diet , bantin & amp ; kingman , hull , humberside , u . k .) ad libitum . for the group assigned to receive drug treatment , the rats received bim - 23268c at 3 mg / kg , by subcutaneous injection , twice a day at 10 : 00 am and 5 : 00 pm . the other group , the control group , was treated with a subcutaneous injection of 0 . lml / 100 g of saline twice a day at 10 : 00 am and 5 : 00 pm . the animals were subjected to the bim - 23268 or saline treatment for a total of 7 days . on the last day of treatment , at 5 : 00 pm food was removed , and the rats were fasted overnight . a method for assessing insulin sensitivity is to administer an oral glucose challenge and monitoring the secretion of insulin and disposal of glucose from the blood stream over a 240 min period ( bergman , r . n ., et al ., endocrine review 6 : 45 - 86 ( 1985 )). at 9 : 00 am the next day , both control and bim - 23268 treated animals were administered a 0 . 8 grams / kg body weight glucose challenge at 0 minutes . 20 μl blood samples were taken from tail vein ( abdel - halim , s . m ., et al ., diabetes 43 : 281 - 288 ( 1994 )) at − 60 min , − 30 min , 0 min , 30 min , 60 min , 90 min , 120 min , and 240 min . the 20 μl samples were taken into 380 μl of hemolysis reagents ( sigma , poole , dorset , uk ) containing 50 mg / liter of digitonin ( cat # d - 1407 ) and 100 mg / liter of maleimide ( m - 3766 ). from this , 100 μl of the hemolysed blood sample was added to 0 . 9 ml of tinder reagent ( sigma enzymatic calorimetric assay for blood glucose , cat # 315 - 100 , sigma chemical co . ltd , poole , dorset , uk ). blood glucose was determined according to vendor &# 39 ; s recommendation at 505 nm . insulin was measured by the conventional radioimmunoassay method as described ( dunmore , s ., & amp ; beloff - chain , a ., j endocrinol . 92 : 15 - 21 ( 1982 )). samples were assayed in triplicates with a 1 : 30000 dilution of an insulin antiserum ( from guinea pig ) raised in the laboratory ( dunmore , s . j ., et al ., j . endocrinol . 137 : 375 - 381 ( 1993 ), and using 125 i - labelled bovine insulin , iodinated by the chloramine t method ( sambrook , et al ., molecular cloning - a laboratory manual , ed . 2 ., cold spring harbor laboratory press , 1989 ). rat insulin ( 2000u / 0 . 1 ml , novo nordisk laboratories , basingstoke , hants , u . k .) was used as a standard in the assay . the standards and samples were diluted in assay buffer containing nah2po4 5 . 7 g / l , bovine serum albumin ( sigma a4378 , sigma chemical co . ltd ., poole , dorset , uk ) 5 . 0 g / l , nan3 1 . 0 g / l buffered to ph 7 . 4 ). antibody - bound insulin was separated on from free insulin by the addition of a second antibody ( donkey anti - guinea pig ig ) coated on cellulose , sac - cel ( ids , boldon , tyne & amp ; wear , uk ). the antibody - bound insulin precipitate was separated by centrifugation . counts bound were measured on an lkb rackgamma solid scintillation counter . although the fatty zucker rats in the control ( saline treated ) group were insulin resistant , they were not hyperglycemic ( ˜ 5 mm ambient plasma glucose concentration at time − 60 min , − 30 min and 0 min , after an overnight fast ) because the prevailing hyperinsulinemic state ( 2 - 3 nmol / l after an overnight fast ) of these animals compensated for the reduction in glucose disposal rate in peripheral tissues . this is evident in the plasma glucose curve and the insulin response during a glucose challenge . thus , any normal suppression of plasma insulin in these animals should result in an impairment of glucose tolerance after a glucose challenge . the bim - 23268 treated group , examined after 7 days of treatment with agent by subcutaneous injection at 3 mg / kg , twice daily , showed a significant suppression of glucose stimulated insulin secretion to the glucose challenge . despite an inhibition of pancreatic insulin response to the glucose challenge , the bim - 23268 - treated animals did not show an impairment in glucose tolerance . the plasma glucose profile of the treatment group was not significantly different from that in the untreated group . taken together , the results demonstrate that bim - 23268 treatment , while suppressing hyperinsulinemia , produced an improvement in insulin - sensitivity . the effect of chronic ( 6 day ) treatment with bim - 23268 on body weight gain / loss was examined in an obese animal model , the fatty ( fa / fa ) zucker rats ( purchased from harlan - olac , bicester , oxon , u . k . see bray , g ., federation proceedings 36 : 148 - 153 ( 1977 ). eleven male fatty zucker rats weighing about 450 grams were randomly divided into two groups , and their initial body weights recorded . the animals were housed in pairs in a normal 12 hour light : 12 hour darkness cycle at 20 ± 2 ° c . and fed overnight ad libitum . for the group assigned to receive drug treatment , the rats received the type - 5 somatostatin receptor selective agonist bim - 23268c at 3 mg / kg , by subcutaneous injection twice a day at 10 : 00 a . m . and 5 : 00 p . m . the other group was treated with a subcutaneous injection of 0 . 1 ml / 100 g of saline twice a day at 10 : 00 a . m . and 5 : 00 p . m . the animals were subjected to the bim - 23268 or saline treatment for a total of six days . at 10 : 00 a . m . each day , food was removed and replaced with accurately weight 100 gram food pellet ( a standard laboratory rat diet , beekay rat and mouse diet , bantin & amp ; kingman , hull , humberside , u . k .). the amount of food remaining a 10 : 00 a . m . the next day was accurately weighed , recorded and replaced with 100 grams of fresh food pellets . the animals were weighed each day during the 6 - day treatment period at 5 : 00 p . m . the untreated control group mean weight was 414 . 09 at the start of the trial and was 418 . 89 after six days . the bim - 23268 treated group &# 39 ; s mean weight was 413 . 6 at the start of the trial and remained at 413 . 6 after six days . the average food consumption for the control group was 26 . 0 g / rat / day and for the bim - 26268 group was 25 . 9 g / rat / day . these results showed that body weight gain was lower in animals treated with bim - 23268 . the effect on body weight change was not due to a toxic effect of the agent , as the treated group appeared healthy , and there was no difference in the amount of food consumed over the entire treatment period . obese ( fa / fa ) zucker rats were treated as in example 1 above . on the last day of treatment ( day 6 ), food was removed at 5 : 00 p . m ., and the rats were fasted overnight . at 9 : 00 a . m . the next day , the animals were subjected to a glucose challenge , given as 0 . 8 gram / kg of glucose orally . periodic 400 μl of blood samples were taken from the tail vein ( peterson , r . g ., ilar news , 32 : 16 - 19 ( 1990 )) 60 min . and 30 min . before and at 30 , 60 , 90 , and 120 min . after the administration of the glucose challenge ( 0 . 8 gram / kg orally ). aprotinin ( traysylol , bayer uk , hayward &# 39 ; s health , w . sussex , u . k .) and heparin ( sigma chemical co ., poole , dorset , u . k .) were added to the blood samples to a final concentration of 400 kiu / ml and 100 units / ml , respectively . plasma fractions were prepared from these samples by centrifugation at 4000 × g in a microfuge , for the estimation of triglycerides and glycerol . samples were then stored at − 80 ° c . until assayed . plasma glycerol and triglycerides were determined using the sigma enzymatic ( tinder ) calorimetric assay kit ( cat # 337 - b , sigma chemical co ., poole , dorset , u . k .) and measuring absorbance at 540 nm in a spectrophotometer . after six days of treatment with bim - 23268c at 3 mg / kg twice a day by subcutaneous injection , both plasma glycerol and triglycerides were significantly lowered , as exemplified by the samples taken at tim 30 and 60 minutes before the oral glucose challenge . see fig1 and fig2 + l . the administration of an oral glucose challenge have no significant effect on plasma lipids . the bim - 23628c treated group showed a significantly lower plasma glycerol and triglycerides throughout the 2 - hour test period . the results suggested that bim - 23268c , following a 6 - day treatment period at the prescribed dose was effective in reducing hypertriglyceridemia . the foregoing description has been limited to specific embodiments of this invention . it will be apparent , however , that variations and modifications may be made to the invention , with the attainment of some or all of the advantages of the invention . such embodiments are also within the scope of the following claims .	2
[ 0103 ] fig1 shows a system 10 for producing an early warning advance alert , or notice , to a prospective bus passenger , or an actual bus passenger , that a bus is about to arrive at a selected bus stop : i . e . that the bus they are waiting for is about to arrive , or that the bus they are actually on is about to arrive , at a selected bus stop . the system comprises a bus station 12 , a number of buses 14 a , 14 b , 14 c . . . 14 m ( only two of which are shown ), a number of bus stops 16 a , 16 b , 16 c . . . 16 n ( only some of which are shown ), and a number of passengers 18 a , 18 b , 18 c . . . 18 x ( only three of which are shown ), each with a mobile wireless telecommunications device , in this example a mobile phone , referenced 20 a to 20 x ( only three of which are shown ). the bus station 12 has a control processor assembly 22 , and a transmitter and receiver assembly 24 . the buses 14 have a transmitter 26 and a location finder 28 . the mobile telephones have antennae 30 and position sensors 31 . as seen in fig3 the mobile phones 20 have a display screen 30 , input keys 32 , and navigator buttons 34 . a user 18 who wishes to be informed in advance when a particular bus is expected to arrive at a particular bus stop enters his request for an early warning alert alarm into the processor 22 using their mobile phone 20 . they activate advance notice software on their mobile phone ( e . g . by entering a code , or by moving an active cursor or screen region to an appropriate icon on a menu screen of their mobile phone ) and the telephone displays a request form , referenced 36 in fig3 on the screen 30 . the user completes the request form and sends the data to the processor 22 via the telecommunication antenna 30 of the phone . for example , as shown in fig3 the user may be asked for the route number of the bus they wish to be notified of ( in this example the user has keyed in , using keys 32 , route “ 9 ” into a first data input field 33 a ). the user then presses “ enter ”, or “ ok ”, or shifts down to the next box or field 33 b displayed , using the navigator keys 34 . another item of information is required to be entered : the destination . in this example the user enters “ university ” using the keys 37 . in an alternative embodiment a menu may appear allowing the user to select a chosen destination / disembarkation stop from a menu of possible locations at which the selected bus stops . in another embodiment the user may not be asked for a destination , or may choose not to complete that field . the user navigates to the next field , field 33 c , which is for the answer to the next prompt or question , which relates to the identity of the bus stop which the user wishes to know when the bus will be arriving ( i . e . usually the stop at which the user wishes to catch the bus ). in this example the user has entered “ queens hospital ”. again , this may be done via keys 32 , or via keys 34 , possibly in response to selecting from a possible menu of options ( e . g . a drop down or expand up box ). the user enters the selected bus stop to which they want the early warning to relate and progresses to field 33 d which relates to how much time they want as an early warning that the bus will be at their selected bus stop . they then enter the notice period required , in this example 10 minutes . this is typically entered using keys 32 , but it could be from up or down keys ( indeed any entry may be made by stepping through possible options until the desired option is displayed ). the user then sends their request off to the control processor 22 via the telephone &# 39 ; s cellular , or other wireless , link . the processor 22 has a data base 23 of entries , schematically represented in fig4 linking telecommunications address 40 of user telecoms devices , the bus numbers that the user wishes to be alerted to ( referenced 42 ), optionally the desired destination 44 , the embarkation bus stop 46 , and the desired warning period 48 . in the example shown in fig4 the user wishes to board a bus at either the queens hospital stop or alternatively the green man pub stop ( both bus stops are a convenient walk from their house , for example ), and travel to either the university stop , or the cross street train station stop ( typically either destination , referred 46 in fig4 is close enough to the user &# 39 ; s office which is the user &# 39 ; s eventual destination ). for example bus routes 9 , 16 , and 28 may all go from the queens hospital stop to the university stop , and bus routes 105 and 110 may go from the green man pub bus stop to the cross street train station . the database shows two alternative notice periods have been entered into the database at 48 ; 5 minutes ( a first period ) for one travel option , and a second period ( 10 minutes ) for the second travel option . this is to reflect the fact that the user is closer to the queens hospital bus stop than they are to the green man pub bus stop . the processor 22 also receives present position signals , referenced as 50 in fig2 from each bus . each bus has its location finder 28 which sends a telecommunications signal indicative of the geolocation position of the bus to the control processor 22 . the present position signals may be sent substantially continuously from the buses , or periodically ( for example every 10 or 20 seconds or so ). the location finder 28 could be any suitable menu such as a gps transponder , or possibly an inertial navigation system which monitors the direction of travel , speed , and time of travel of the bus and determines its position from dead reckoning . this latter option is preferred over gps in some environments where the gps signals may be blocked . it is possible for the bus inertial dead reckoning position finder to be recalibrated periodically upon receipt of a location identifying signal from a fixed beacon . for example some , or all , bus stops may have transponders which tell a bus that it is near them when it is near them . this could be used instead of dead reckoning or gps : i . e . noting when a bus is near an earlier bus stop . with a knowledge of the current position of the bus of interest , say bus number 9 , and the position of the embarkation bus stop , the processor can evaluate a predicted time for the bus to reach the selected bus stop , with a knowledge of the expected speed of the bus . the processor can compare the expected time to arrival at the selected bus stop for the selected bus with the early warning notice period required by a user . when the two are equal , or nearly so within a predetermined margin , the control processor instigates the generation of a telecommunication advance warning signal 49 , transmitted via the antenna 24 , to the user &# 39 ; s mobile phone 20 . this signal could result in an sms early warning message being displayed , or an audio tone , or a voice message , or a vibration of the telephone , or any other way of sending an alert alarm to the user . the user may be able to select what type of alert message they want . the antenna 24 may communicate directly with the buses , but more likely the communication will be via a telecomm network , such as via a cellular link , on a metropolitan area wireless network ( possibly bluetooth or 802 . 11 ). [ 0115 ] fig5 shows a modification of the system . a bus 52 has a receiver 54 which receives vehicle position signals 56 from roadside transponders 68 ( e . g . mounted on bus stop poles or street lights / lamp posts 70 ). lamp posts and street lights ( and other electrical street furniture ) already have a power supply 72 for the transponder 68 . the bus has a position output transponder 74 which communicates its position to the control processor 22 . alternatively the roadside transporters could note the proximity of the bus and they could communicate its position to the control processor . [ 0116 ] fig6 shows another modification in which a bus 75 which has an onboard control processor 76 and a position sensor 78 . instead of communicating its position to a central control processor the bus 75 has the database 23 on - board in its on - board processor 76 and emits advance warning signals , via an emitter 24 , 49 to the user &# 39 ; s mobile devices 20 . the mobile telephones 20 are monitored by a device position monitoring system , in this example a gps system , but it could be an inertial system , a proximity to monitor beacon signal system , or a triangulation system , or indeed any suitable system . if a user 18 moves further away from a bus stop for which they have already entered a request for an early warning notification to the server 22 , then whatever warning period they originally requested may or may not be enough time for them to reach the selected bus stop in time to reach the bus ( e . g . a person could enter a 10 minute early warning period when they were 5 minutes walk away from the bus stop , and then walk a further x minute walk from the selected bus stop . since the server 22 knows the position of the bus stop and the position of the user when they entered their “ y ” minutes warning , the server can estimate how much longer it would take a user to walk to the selected bus stop and automatically add that on to the notice period — giving an x + y minutes early warning notice to the user . the server may be able to establish that the user is now , after moving ( or indeed before moving ), closer to another pick - up point for the bus and may inform the user of this , with the identity of the alternative pick up point . the mobile device may be capable of displaying a map , or travel directions , to the user telling than how to get to the selected bus stop , and / or an alternative , possibly computer - selected , bus stop . this may be generated within - the mobile device , or at the base station control processor and transmitted to the mobile device . other information may be displayed / displayable , such as the bus fare for the entered journey or the return timetable ( and / or outward timetable ). in the case of large bus stations ( or train stations ), for example , being the embarkation point , the platform number or bus stop number may be displayed ( or other such identifier — a display of number is not necessarily essential , perhaps “ green line ”, or a representative of a green line ( i . e . a colour ) could be enough to identify a specific bus or train route ). in another embodiment the user can input the desired destination and the control processor , or mobile device , can inform them of the available transport routes and expected times of departure from appropriately local pick up points . this may not be restricted to the buses of one company , or even to one mode of transport . for example bus , train ( overground and / or underground ) and tram timetables may be available for analysis by the user or computer . thus the system may not only provide an early warning , but also route planning / timetable information , and even computer - selected travel plans . in another modification the user does not have to input a desired notice period to the system , and may not be asked to do so . since the control processor knows the position of the selected bus stop and the position of the user ( for example either from user - device position detecting , or because the user has elected to send the advance warning signal to a fixed , stationary , telecoms device ) the control processor can estimate how long it will take the user to walk to the bus stop / location of the event being considered . the computer system can then automatically set the time of the advance notice alert signal . it may evaluate how long it predicts it will take a user to get to the desired location and add on a further short period for the comfort of the user . it will be appreciate that although walking to the site of the event for which an advance notification has been discussed , it may be that the computer knows that the user will use some other mode of transport ( e . g . bicycle , or car ) and the journey - to - site time can be estimated accordingly . for example a user could input the event as being the landing of a particular airliner at a specific airport , ( e . g . to meet someone off the plane ) and the system could give an early warning by using advance knowledge of the progress of the aircraft , or even just from a knowledge of when it really took off , and could give the user advance notice a suitable time before predicted landing , perhaps allowing for driving to the airport and parking . when a user is at a particular location the system could be informed , or learn , that extra time is needed to be added to its normal notice period . for example , in a large skyscraper it could take 5 minutes to leave the building , before the user even begins to walk to a bus stop or train station . the control processor may know that certain geographical locations are associated with extra delays and so could , using the position of the user information , build in extra time in the warning notice period that is generated . [ 0125 ] fig8 shows a schematic representation of a control processor arrangement for use in a system similar to that of fig1 and 2 . the control processor , or control server , referenced 80 in fig8 comprises two servers : a telecommunication access server 82 which uses a session initiation protocol ( sip ) to access an external telecommunication network , ( e . g . wap ), and a data processing control server 84 which receives inputs from the user ( referenced 86 ) and inputs from automatically monitored things 88 ( such as the position of a bus , weather and traffic conditions etc .) and produces early warning notification signals using inputs 86 and 88 and using system known / derived things 89 . the signals sent out from the system 80 to user &# 39 ; s mobile devices ( e . g . phones ) are sent continuously using the telecasting technique . instead of sending a separate message to each user , a single message ( for a particular event , e . g . bus no . 9 arriving at university stop in 5 minutes ) is sent and the message carries a header or flag identifying it as being of interest to a subclass of all possible users ( i . e . the ones looking out for the event that is the no . 9 bus arriving at the university stop ), and those devices which have a filter set appropriately will react to receipt of the telecast broadcast , and those that do not will not . the system 80 sends out the signals continuously indicating for each bus route and each stop when a bus is within any of a number of time periods of the stop . for example signals will be sent out each time that a bus on route a is 5 minutes , 10 minutes , or 15 minutes from a particular stop , and corresponding signals will be sent out for other routes and other stops . each signal gives a header or flag which indicates the bus route and the stop and the time to arrival . each mobile phone or other suitable device which is set up to receive the signals indicates a filter which can be set by a user using the device &# 39 ; s normal user input to filter out all signals except those carrying the flag for the route ( s ) and stop ( s ) of interest to and selected by the user . the device then produces an alarm when a signal relating to a selected stop and bus route is received but does not respond to the other signals . the alarm may be a single audible alarm and / or may indicate to the user , for example on a display of the device , the estimated time to arrival . this arrangement has the advantage that the phone does not need to communicate anything to the session initiation protocol server , and is particularly useful in urban areas , especially in a city centre where the number of users could be very high and the processing request from users could be difficult . [ 0129 ] fig9 schematically shows one embodiment of the inputs a user makes in order to set up an event notification request , and simultaneously set up a filter on their mobile device ( a flag for which bus stop and which bus ). the user may be able to set up a threshold time or window before which or after which , he does not want to be notified . for example he may wish not to know about the event of the correct bus arriving at the correct bus stop all of the time — he may wish to spend a certain period free of alerts . for example , the user may set their request for an alert profile to be such that no alerts are requested before 5 . 00 p . m . this could be useful , for example , if the user wanted to spend a few hours at a meeting , or doing something , and did want to leave at the latest by a certain time to catch the bus but did not want to be interrupted too early before their deadline for leaving . [ 0131 ] fig1 shows schematically steps that a control processor similar to that of processor 22 in fig1 may go through . [ 0132 ] fig1 shows a flow chart for a software routine 110 running in a control processor such as that of processor 22 of fig1 . for each bus the routine determines at 112 , or updates , the expected times of arrival of the selected bus ( e . g . bus id abfgh 14 operating on route number 9 ) at its next scheduled bus stop and indeed all of its scheduled stops . at 114 the routine checks to see if there are any requests awaiting fulfilment for advance notice of that bus arriving at the next bus stop ( the system knows where the bus is and so knows what is its next stop ). if there is an unfulfilled request the system creates a warning message at 116 and transmits it at 118 . the system then increases the bus stop number being considered 120 i . e . it moves on to consider the next bus stop and returning to routine 114 after checking at stop 122 that it has not returned to the start bus stop i . d . it will be appreciated that instead of cycling through each bus stop on the selected route starting with the next stop that the bus will reach , the system could start at the same stop each time ( e . g . stop number one ), and not care , for this purpose , where the bus is located . it will cycle through the available bus stop for the selected bus very fast in any case . once all of the available bus stops have been evaluated the system increments the bus being considered to the next bus , shown as 122 in fig1 . there may be another bus operating the same route , or it may be a bus on a different route . the system checks at routine 126 that the bus identification number has not returned to the start bus i . d . number , and if not proceeds to routine 114 again , but for a different bus than previously . if the route 110 has cycled through all available bus identifications ( and hence all buses for all allowable stops have been considered ) the routine waits a while ( step 128 ), for example 10 seconds or 20 seconds , and then starts again at routine 114 with an initial bus i . d . and an initial bus stop id . it will be appreciated that the system could cycle through the available buses first and then the bus stops ( the opposite way around to that described above ), or , indeed may not cycle in any logical sequence , but could simply check all buses and stops in any order . it will be appreciated that instead of creating warnings as they are needed the system could create them in advance and release them when the expected time of arrival of a selected bus at a selected stop matches the advance notice period . [ 0141 ] fig1 illustrates one particular request for advance notice alert set up routine for a user . a user selects at 130 a bus route , or a destination ( or both ), selects at 132 an embarkation bus stop , selects at 134 a notice period required as advance notice of the bus arriving , selects at 136 a threshold time before which an alert is not desired , selects at 138 the device to which they wait the alert to be sent ( e . g . the mobile phone , or other device making the request , another mobile phone or mobile device , a selected land - line telephone , a selected pc ), and at 140 they select the manner in which they wish to be alerted ( e . g . sms message , audio — e . g . beep or buzzer , voice message , visually — e . g . flashing light or a display message / indication on a screen , by vibration , by e - mail etc ). the control processor may be able to check that the transmitted early warning notification message , e . g . signal 49 in fig2 was received by the user &# 39 ; s device ( e . g . by the device acknowledging receipt / acknowledging a telecoms link ). if the control processor does not receive this confirmation of receipt it may re - send the message , possibly periodically up to a set limit ( e . g . limit in time , or limit in number of attempts ). a user may be able to elect to have an alert sent to more than one telecom address . it will be appreciated that by monitoring a parameter that is associated with the arrival of a specified event ( e . g . a specific type of bus arriving at a specific stop ) advance notifications that are more meaningful than simply pre - planned scheduled event warnings can be achieved . the monitored parameter is preferably representative of a real physical thing ( e . g . the position of a vehicle ). of course , instead of pressing keys on a device to input data a user could talk into the device if it is configured for speech recognition . in one example , the invention may comprise a vehicle arrival ( or event notification ) system which does not monitor the position of the vehicle , but instead varies the timing of the sending out of alert signals dependent upon how far away a user is from the vehicle meeting / pick up point . however , in the vast majority of applications it will be appropriate to monitor the progress of the vehicle in some way . in one specific example the application will use the session initiation protocol to send and receive the alert signals . a device installed in a bus will compute the exact position of the bus using gps or by using the speed of the vehicle , a compass and a map . when the bus reaches any preprogrammed position , the device will send the signal using a multicast mode . the multicast address is function of the distance or the time between the user ( s ) and the bus stop . all these signals can also be sent from the bus station , which tracks all the buses . the user can choose any bus depending on the destination and ask the session initiation protocol server to filter all the other signals except the one concerning the bus he intend to take . it will be possible to send the signal on the phone . as suggested above , in some embodiments a vehicle may communicate its presence / position to a base station when it reaches predetermined physical locations , instead of a set point in time . for example , each time a bus or train reaches a bus stop or station it may communicate its position to the base station . session initiation protocol is important to some aspects of the invention . it is application layer software ( in the osi model ). it is easy to install on processors . some existing processors , for example of cellular telephones or pda &# 39 ; s , are configured to allow retrofitting of session initiation protocol telecommunications software , possibly remotely . more typically we envisage mobile general purpose telecommunications devices , such as telephones , pda &# 39 ; s laptops etc ., being factory configured to enable session initiation protocol telecommunications . it is then a matter of loading the specific application software to those mobile devices to enable them to receive / recognise alert signals as being for them . it may also be usual for us to load software onto the devices to enable them to input information to a base station / alert generator server and / or to enable them to have user - set filters . in one embodiment a central session initiation protocol enabled server emits signals detailing the expected arrival times of all vehicles known to it at their next stop ( or stops ) and users set the filter on their portable devices to alert them only to the events of interest . the event detection / recognition software and / or the filter - setting software may be downloaded at the point / time of use ( wirelessly ) by a user , and may have a limited duration when it is operable or limited usage conditions . for example , the downloaded software may only be good for a single day , or week , or period , or it may be good for a set number of alerts to the user . in this way the transport company and / or the telecommunications company and / or the device - controlling company may be able to access an on - going income if they make users pay for access to the enabling software . one session initiation protocol is chosen as the telecommunications platform it is not too difficult to convey software solutions to the mobile telecoms devices , and not difficult to change things . for example , the session initiation protocol - enabled multicast signals may be code - protected , and the code may change from time to time , and the user may have to pay for access to new codes to access the signals / decode them . session initiation protocol is a light protocol that is easily downloaded . it operates in real time . it has applications typically in voice - over - ip , but we have realised that it is suitable for our purposes . it is suitable for copying short messages similar to sms messages , but via an ip network . session initiation protocol allows the establishment of a real time application software running to monitor broadcast messages and / or vehicle positions . session initiation protocol has multi - user facilities — so more than one user can input and receive data . this is , of course , useful with many vehicles inputting their position and many passengers wanting to know when they will arrive . we envisage not only one kind of transport vehicle having their arrival times alertable to a user : different kinds of vehicle may have their schedules altertable . for example trains and buses ( and indeed aircraft , ships etc .) may be covered . a user may be able to select between the type of vehicle whose movements are required . in one embodiment a user may not specify which route or which stop they want , just their destination , and the system may report possible options to them . the user may select one preferred event ( vehicle - at - stop ) or more than one , about which they want to be alerted in the future . the software loadable onto the portable device may also enable the device to display the location of a stop ( e . g . a map ), or a plurality of stops , and may also enable the device to display the position of the user ( e . g . on the map ). as discussed , the impromptu downloading of appropriate event - notification software is used when a user decides they would like to be notified of an event is envisaged . a user does not therefore have to choose to buy a device with the specific application software loaded on it , or to subscribe in advance ( days or weeks in advance ) to a service : they just dial up and download there and then ( possibly incurring a cost / fee ). other options can be added : extra / different functionality can readily be loaded in the future , for example using session initiation protocol telecoms . this somewhat “ future proofs ” the portable device — but it does require the device to have appropriate processing capability and hardware / firmware . it is also possible for a user to uninstall the event - notification software from their device ( or for it to cause itself to be uninstalled ( or blocked ) at a future time / event . the portable user device may be battery powered , with replaceable batteries , and may be “ pocketable ” ( small enough to be put into a normal trouser or jacket pocket . the device may telecommunicate at a frequency of the order of about 1 ghz it will be appreciated that many embodiments of the invention use a general purpose mobile telecommunication device to input and / or receive signals relating to the selection of the location ( e . g . bus stop ) and / or advance notice time , and / or bus route / number , and / or the advance notice warning signal itself . for example , there are already millions and millions of mobile telephones ( satellite and even more common cellular phones ). they are well suited to inputting / receiving signals , especially using session initiation protocol techniques . indeed , it may not be necessary to implement hardware changes in existing mobile telephones to implement the invention : software changes may be all that is required , especially with those mobile phones that have a display . such software changes may be achieved wirelessly : i . e . software could be telecommunicated to the mobile telephones ( depending upon the capabilities of the cpu chip in the mobile phone ). thus retro - fitting the functionality discussed to existing mobile phones is conceivable , especially using session initiation protocol . other general purpose wireless telecommunications devices can be configured as receivers / input devices , such as pda &# 39 ; s or palm computers . many portable internet - accessing devices now exist which could be suitable . even if the cpu chip of an existing device is not configured to allow wireless software changes , it is straightforward to manufacture new devices with the requisite software to perform as discussed . by “ general purpose ” wireless telecommunications device is meant a device that has functionality beyond simply the impending event notification and / or input of registration / notice period information functionality discussed . for example a “ general purpose ” device may allow voice communication ( e . g . mobile telephone ) or text communication ( e . g . pda with internet access / e - mail capability ), or both voice and text , or multimedia : more than a dedicated single - use device .	6
fig1 shows a schematic illustration of a cable drum 1 with a drum axis 22 , a drum body 21 , an upper drum wall 12 and a lower drum wall 13 . a cable can be wound onto the drum body 21 of the cable drum 1 . in fig2 a developed view of the drum body 21 of the cable drum 1 is illustrated wherein the cable body 21 is provided with a groove arrangement . the surface of the drum body 21 in the circumferential direction is divided parallel to the drum axis 22 into four areas : two parallel areas 2 , 3 in which grooves 4 and 5 extend parallel to the drum walls 12 and 13 and two incline areas 6 and 7 . the incline areas 6 and 7 have grooves 8 and 10 which are slanted at a positive angle to the horizontal and grooves 9 and 11 which are slanted at a negative angle to the horizontal . the parallel areas 2 and 3 cover approximately 35 % to 40 %, respectively , of the surface area of the drum body 21 and the incline areas 6 and 7 cover approximately 10 % to 15 %, respectively . the grooves 4 and 5 in the parallel areas 2 and 3 have a width a . the pitch c by which the neighboring grooves 4 , 5 , 8 , 9 , 10 , and 11 are displaced relative to one another in the longitudinal direction of the cable drum 1 matches approximately 1 to 1 . 1 times the diameter of the cable to be wound . since the neighboring grooves 4 , 5 contact or touch one another in the longitudinal direction of the cable drum 1 within the parallel areas 2 , 3 , the groove width a corresponds to the pitch c . the parallel areas 2 , 3 are displaced in the axial direction by an axial displacement b which matches half the pitch c . the grooves 8 , 9 , 10 , and 11 are slanted such that they adjoin with one end the grooves 4 of the parallel area 2 and with the other end adjoin the grooves 5 of the parallel area 3 . the grooves 8 and 9 cross one another in the incline area 6 and the grooves 10 and 11 cross one another in the incline area 7 , respectively . as a result of the axial displacement b of the parallel areas 2 and 3 relative to one another , the grooves 4 adjoin directly the upper drum wall 12 and the lower drum wall 13 while a spacing of the size of the displacement b is provided between the grooves 5 and the upper drum wall 12 and the lower drum wall 13 . at the location of this spacing , a filler wedge 14 is arranged in the parallel area 2 and a filler wedge 15 is arranged in the parallel area 3 at the upper drum wall 12 . the filler wedge 14 has a width which matches the pitch c and the filler wedge 15 has a width which matches the axial displacement b . a ramp wedge 16 is arranged on the lower drum wall 13 and extends from the incline area 7 via the parallel area 3 to the incline area 6 . the function of the filler wedges 14 and 15 and of the ramp wedge 16 will be explained infra . when winding the cable in a direction from the left to the right of fig3 the cable extends along the cable path 18 from the cable inlet opening 17 , where the end of the cable secured on the cable drum 1 exits from the interior of the drum body 21 , via an upper groove 4 to the incline area 7 , from there in a groove 11 to a groove 5 , which is displaced downwardly by the displacement b , and via a groove 9 to the parallel area 2 where , after having been wound once about the drum body 21 , it extends in a second groove 4 displaced downwardly by the pitch c relative to the upper groove 4 . all further windings of the cable extend along a corresponding downwardly displaced cable path and thus form the first cable layer . when the cable has reached the lowermost groove 4 , it is lifted in the incline area 7 by the ramp wedge 16 onto a diameter which is larger by approximately twice the diameter of the cable so that a second cable layer can be wound onto the first cable layer . the second cable layer is wound in a direction counter to that of the first cable layer from the lower drum wall 13 toward the upper drum wall 12 . as soon as the cable has reached the upper drum wall 12 , the filler wedges 14 and 15 prevent that the cable can be wound into the spacing between the drum wall 12 and the upper cable winding of the first layer . in fig4 a cable path 20 is illustrated which results when winding the cable in the opposite rotational direction , i . e ., when winding the cable in fig4 from the right to the left . the cable extends from the cable inlet opening 19 via a groove 4 to groove 8 in the incline area 6 , from there in a groove 5 in the parallel area 3 via a groove 10 in the incline area 7 to the parallel area 2 where , after having being wound once about the drum body 21 , it extends in a groove 4 below the first groove 4 . as a result of the mirror - symmetrical configuration of the filler wedges 14 and 15 and of the ramp wedge 16 relative to the center of the parallel area 2 in which the inlet openings 17 and 19 are located , the function of the wedges is ensured for both rotational directions . in another embodiment , the inlet openings 17 and 19 can be arranged in the upper drum wall 12 in the parallel area 2 wherein the inlet opening 17 adjoins the incline area 6 and the inlet opening 19 adjoins the incline area 7 . with this embodiment , the filler wedge 14 is no longer needed because the cable rests against the upper drum wall 12 over the entire width of the parallel area 2 . while specific embodiments of the invention have been shown and described in detail to illustrate the inventive principles , it will be understood that the invention may be embodied otherwise without departing from such principles .	1
reference will now be made to the accompanying drawings , which form a part hereof , and which show , by way of illustration , specific exemplary embodiments . the principles described herein may , however , be embodied in many different forms . the components in the figures are not necessarily to scale , emphasis instead being placed upon illustrating the principles of the invention . in some instances , example measurements are mentioned merely as illustrations of one or more embodiments and not to restrict the invention . moreover , in the figures , like referenced numerals may be placed to designate corresponding parts throughout the different views . an interchangeable rotating free - motion fitness handle system may provide more accurate and consistent results because the tube / cord is always stretching linearly and thus , it &# 39 ; s not manipulated by a fixed point . additional muscles can be targeted by using the rotational features . in one example of an interchangeable rotating free - motion fitness handle system , a fitness handle that features an opening “ oculus ” that permits a resistance tube anchoring mechanism to enter into a sliding channel such that when combined with a rotational - hand - grip , allows a fitness resistance tube equipped with a resistance tube anchoring mechanism to both pan left and right , as well as hinge up and down as users move through exercise motions is disclosed . a “ barb ” that may be located next to the oculus prevents the resistance tube anchoring mechanism from exiting the sliding channel when under any tension . a resistance tube anchoring mechanism can be a mechanism that is applied to the tail end ( s ) of plugged resistance tubes which allows for said tubes to be connected to tube accessories including interchangeable handle ( s ) and any appropriate accessories . such accessories may be equipped with , for example , a button - style fabric tube anchor point ( see fig1 for example ). of course , the length and resistance characteristics of the cables / stretch tubes the resistance tube anchoring mechanism is applied to can vary depending on the needs of the user . a hinge - locking tube anchor and pulley system may be a mechanism that allows users to create an anchor point from which they are able to generate resistance using resistance tubes . key features can include , but are not limited to , the outer ends of a component which allow sewn webbing loop , or suitable design , to be applied and removed from the component when said webbing is not under tension . the component may be made of , but of course , is not limited to plastic . other suitable materials may be also be used . when under tension , the webbing loops may secure the component as an anchor point , while allowing it to rotate , creating a pulley which responds to torsion friction applied by the fitness tube , thereby reducing wear / damage to the tube . this removable webbing loop design allows the hinge - locking tube anchor and pulley system to be secured to door hinges to create a superiorly secure anchor point , regardless of user orientation to the door . this allows the system to work on both open and closed doors , and offers the convenience of remaining in place when not in use , if the user so chooses . one additional feature is the larger pulley guide fins that define the outer limits of the pulley space . these large fins respond to pressure coming from the resistance tube , when in use , and adjust the orientation of the pulley to minimize wear on the tubes as different exercise movements are performed . a button - lock ankle / wrist attachment allows a sewn or otherwise connected cuff to be attached to body regions of the user without requiring hand - grip . the key feature is the sewn button lock ( slit ) which receives the resistance tube anchoring mechanism and holds it securely when under tension , similar to the manner a shirt button behaves . the length of fabric between the sewn button lock and the sewn attachment point to the cuff creates a flexible ‘ hinge ’ which allows the system to remain secure as orientation to the tube forces change . referring to fig1 , an exemplary embodiment of an interchangeable rotating free - motion fitness handle system is illustrated . interchangeable rotating free - motion fitness handle system includes cable / stretch tube / resistance band (“ fitness tube ”) 110 and interchangeable and rotational fitness handle system 120 . fig2 illustrates the components of an interchangeable rotating free - motion fitness handle system . fig2 includes an exemplary stretch tube / resistance band 110 , anchoring mechanism 210 and fitness handle 220 . flat slide surface 211 of anchoring mechanism 210 is also illustrated . fig3 - 5 illustrate various views of fitness handle system 120 . referring briefly to fig4 a and 5 , opening 410 allows the anchoring mechanism 210 to enter into a sliding channel 420 such that when combined with a rotational - hand grip 430 allows a fitness tube to both pan left and right , as well as hinge up and down as users move through exercise motions . barb 440 can prevent the anchoring mechanism 210 from exiting sliding channel 420 when under any tension . fig6 illustrates several embodiments of anchoring mechanism 210 including pill 610 , barrel 620 , and cone 630 . as can be seen , fitness tube 110 can be inserted into the anchoring mechanisms 610 , 620 , and 630 . fig7 a - 7c illustrate various embodiments of a fitness handle 220 . fig7 a - 7c also illustrate more detailed views of some embodiments of sliding channel 710 and rotational - hand grip 720 . fig8 illustrates various views of components of an embodiment of an interchangeable rotating free - motion fitness handle system . fig9 illustrates a more detailed view of the components of an embodiment of an interchangeable rotating free - motion fitness handle system . this embodiment of an interchangeable rotating free - motion fitness handle system includes clip lock 910 , plastic grip with tpr overmold 920 , frame / main body 930 , connection bar 940 and anchoring mechanism 210 . plastic grip with tpr overmold 920 may provide a comfortable grip to a user and may not be required . while this embodiment uses a plastic grip with tpr overmold , numerous alternative grips are also possible within the scope of the invention . the anchoring mechanism 210 includes resistance band insert 950 for inserting a resistance band . clip lock 910 may be made from a variety of different materials . in one embodiment clip lock 910 is made of plastic . other materials may be used within the scope of the invention . additionally , any specific measurements in this figure and others are illustrated to assist in the understanding of the invention and not to restrict or in any way limit the invention . fig1 illustrates detailed views of the components of one embodiment of a fitness handle . clip lock 910 , main body 930 , and connection bar 940 are further broken down to illustrate the components in detail . once again , measurements in fig1 are illustrated to assist in the understanding of the invention and not to restrict or limit the invention . fig1 illustrates detailed views of the components of grip 920 and resistance band insert 950 . fig1 illustrates one embodiment of a fitness cable anchor and pulley system . multi cable pulley 1210 may be designed such that it is wear reducing , thus increasing the life of the system . a rib 1220 may be added for strength purposes . loop 1230 may “ lock ” onto the pulley 1210 contour when under tension , and may completely encompass the hinge for added safety . loop 1230 may be sewn . the material of loop 1230 may be made of nylon but any other suitable material can also be used . the system may be used on both sides of the door 1240 . for example , an open door install may be configured to stay up when the door is opened or not in use . fig1 illustrates one embodiment of a button lock ankle / wrist attachment . in this embodiment , a velcro strap with a soft - inner - backer is used . fig1 illustrates one embodiment of a multi - attachment point fitness harness . fig1 illustrates one embodiment of a 360 degree rotating fitness harness . while various embodiments of the invention have been described , it will be apparent to those of ordinary skill in the art that many more embodiments and implementations are possible within the scope of the invention . accordingly , the invention is not to be restricted , except as set forth in the following claims .	0
referring to the drawings in detail wherein like numerals designate like parts , the numeral 10 designates a main rectangular cabinet body of a modified existing vending machine , such as a well - known semi - honor machine which has had its front and rear access doors and its top wall removed in order to receive the kit in accordance with the present invention . in some cases , the invention may be embodied in a wholly new machine , as previously noted , in which case the cabinet 10 or other support structure may be new . the removed top wall of the converted semi - honor vending machine is replaced by a new top wall 11 having a marginal down - turned flange secured to the cabinet body 10 as by pop rivets 11 &# 39 ;. the top wall 11 serves as a mounting surface for a relocated standard type coin mechanism 12 having a horizontally movable control arm 13 which is released to move forwardly from the position of fig2 to the position of fig3 following the placement of proper coins in the mechanism 12 by a customer . the vending machine comprises a rectangular storage compartment 14 for newspapers 15 to be vended which includes a fixed interior forwardly open box - like housing section 16 , somewhat below the top wall 11 , and suitably secured to the cabinet body 10 . the compartment 14 further comprises a horizontally shiftable box - like housing section 17 telescopically engaged within the fixed housing section 16 and having its rear end open . the movable housing section 17 is biased inwardly to a fully retracted or closed position against the back wall of the fixed housing section 16 by retractile spring means 18 . the bottom wall of the movable housing section 17 has an opening 19 formed therethrough rearwardly of an upturned newspaper retainer flange 20 whose function will be described . the bottom wall of the fixed housing section 16 has a cooperative opening 21 formed therethrough adapted for registration with the opening 19 when a newspaper 15 is being dispensed , fig3 . below the opening 21 , the fixed housing section 16 has a curved deflector plate 22 preferably having a hand recess 23 , fig1 to guide the dispensed newspaper to the hand of the customer in a downward and forward direction , fig3 . preferably , a stiffening member 24 is provided on the bottom wall of the fixed housing section 16 at its forward end . a pair of spaced parallel horizontal channel tracks 25 are fixed to the rear vertical wall 26 of housing section 16 and extend forwardly to points adjacent the top of the deflector plate 22 . the bottom wall 27 of the movable housing section 17 is able to telescope between the bottoms of channel tracks 25 and the bottom wall 28 of the fixed housing section 16 . the forward ends of channel tracks 25 are rigidly interconnected by a steeply inclined abutment plate 29 beneath which the bottom wall 27 may slide freely during the movement of the housing section 17 . a carriage 30 for the stack of newspapers 15 has base wheels 31 guidingly engaged with the channel tracks 25 for horizontal movement . the carriage 30 includes an inclined rest plate 32 for the newspapers parallel to the abutment plate 29 and extending near the top unfolded edges of the inclined stacked newspapers . the abutment plate 29 is vertically shallow and merely laps the lower end portion of the frontmost newspaper in the stack . the folded edges 33 of the newspapers 15 are lowermost and rest on the upper horizontal edges of the tracks 25 . mounted on the wheeled carriage 30 is a spring motor unit 34 of a conventional type connected by a cable 35 to the back of the abutment plate 29 . as newspapers are dispensed one at a time from the front of the stack , the carriage including the back - up plate 32 will creep forwardly under influence of the spring motor 34 so that one newspaper at the front of the diminishing stack will always be held in firm engagement with the inclined abutment plate 29 . the bottom edge of the plate 32 is slotted at 36 , fig4 to clear the channel tracks 25 . a pair of arms 37 are pivoted at 38 to the forward corners of movable housing section 17 . stop pins 39 on the side walls of the movable housing section limit downward movement of the arms 37 to inclined positions substantially normal to the stacked newspapers 15 , fig2 and 3 . at their free ends , the arms 37 have opposing inwardly projecting lateral leaf spring extensions 40 thereon which are tensioned to exert a yielding pressure on the forwardmost newspaper 15 of the stack to stabilize the stack , and to assure the proper dispensing of the newspapers one - by - one in the manner to be further described . the forward creeping action of the carriage 30 will assure that the newspaper stack , regardless of how many papers are in it , will always be held firmly between the back - up plate 32 and leaf spring elements 40 and between the plate 32 and the short abutment plate 39 . also bodily mounted on the front of movable housing section 17 is a customer - operated vertically swingable lever 41 or frame pivoted as at 42 to the housing section 17 and projecting forwardly thereof through slots 43 . within the housing section 17 , the lever 41 carries a cross axis newspaper lift roller 44 preferably having a sand covered periphery , or other friction face , and extending fully across the front of the newspaper stack . the sand roller 44 has a one - way clutch mechanism therein which locks the roller 44 against rotation when the handle bar of lever 41 is depressed by a customer to turn the lever 41 clockwise , fig2 . the locked roller 44 will frictionally engage the forwardmost newspaper 15 in the stack as the lever is swung toward the phantom line position in fig2 and the friction between the roller and newspaper is sufficient to lift the forwardmost newspaper above the abutment plate 29 . on the return stroke of the lever 41 , the roller may rotate in the direction of the arrow , fig2 and on the return stroke , the forwardmost newspaper shown in phantom lines in fig2 will be nudged downwardly so that its folded edge 33 will enter between the front of the abutment plate 29 and the vertical retainer flange 20 while the movable housing section 17 remains in the innermost locked position under control of the arm 13 of the coin mechanism 12 which is not yet released . the manual lever 41 is free to be operated at any time to raise the forwardmost newspaper and place it in the position shown in phantom lines in fig2 but the paper cannot be delivered to the customer until proper coins have been placed in the coin slots of the standard mechanism 12 . when such coins are placed , the mechanism control arm 13 is released and the customer uses a handle 45 on the front of housing section 17 to pull the housing section forwardly to the position of fig3 where the leading newspaper 15 drops by gravity through the openings 19 and 21 of the two housing sections which are now in registration , fig3 . forward movement of the housing section 17 causes the retainer flange 20 to separate from the fixed abutment plate 29 to thus release the forwardmost paper for dropping onto the deflector plate 22 and passing into the hand of the customer with the assistance of gravity . the top wall of housing section 17 is connected to the coin mechanism control arm 13 by a connecting member 46 and both elements 13 and 46 are inside of a protective cover 47 hinged at 48 to the main body portion of the coin mechanism 12 . the cover 47 is locked down by a spring - urged locking bolt 49 beneath the top wall 11 of the cabinet . in some cases , the protective cover 47 can also be externally padlocked for extra security . it may also be mentioned here , in terms of security , that the bottom compartment of the cabinet 10 below the newspaper storage compartment 14 can be weighted down with sand bags up to 300 pounds or more . the movable housing section 17 , fig5 also has a hinged top wall panel 50 carrying the member 46 upon it and normally resting horizontally on a stop bar 51 beneath the top wall of the movable housing section . a further hinged access panel 52 is provided in the rear wall of cabinet 10 to cover access openings 53 and 54 in the cabinet and in the rear wall 26 of the fixed housing section 16 . the hinged panel 50 , fig2 is normally padlocked as at 55 . referring to fig5 when it is necessary to reload the machine with newspapers , authorized personnel may open the lock 55 and the hinged panel 52 , may reach in to the back of the machine and release the bolt 49 which , in turn , allows raising of the protective cover 47 as well as raising of the closure panel 50 after the movable housing section 17 is pulled to the extreme forward position of fig5 where the panel 50 is out from under the top wall of the fixed housing section 16 . the arms 37 may also be raised out of the way at this point and a fresh stack of papers may be loaded through the top of housing section 17 so as to rest on the top edges of tracks 25 . after loading , the various closure parts are returned to their normally locked positions depicted in fig1 through 4 . the entire device is characterized by simplicity and durability , ease and convenience of operation , and comparative economy of manufacture . many existing semi - honor vending machines in the field can be readily converted by the kit to the machine embodied in the invention , and newly manufactured machines can also be provided . in lieu of the cabinet 10 , the two part box - within - a - box horizontally telescoping compartment 14 may be supported on a suitable open framework instead of an enclosed cabinet . it should be mentioned finally in connection with fig5 that the top wall of housing section 16 contains a hand clearance opening 56 through which access to the handle of bolt 49 may be had . it is to be understood that the form of the invention herewith shown and described is to be taken as a preferred example of the same , and that various changes in the shape , size and arrangement of parts may be resorted to , without departing from the spirit of the invention or scope of the subjoined claims .	6
for the purposes of promoting an understanding of the principles of the invention , reference will now be made to the embodiment illustrated in the drawings and specific language will be used to describe the same . it will nevertheless be understood that no limitation of the scope of the invention is thereby intended , such alterations and further modifications in the illustrated device , and such further applications of the principles of the invention as illustrated therein being contemplated as would normally occur to one skilled in the art to which the invention relates . referring to fig1 there is illustrated a cone - stack centrifuge 20 according to a preferred embodiment of the present invention . centrifuge 20 includes as some of its primary components base 21 , bell housing 22 , shaft 23 , rotor hub 24 , rotor 25 , cone stack 26 , jet nozzles 27 and 28 , and modified pelton turbine 29 . as described and used herein , the rotor 25 includes a cone - stack assembly . fig2 provides a diagrammatic top plan view of jet nozzles 27 and 28 as well as impulse turbine 29 showing the direction of the flow jets 27a and 28a exiting from jet nozzles 27 and 28 , respectively . turbine 29 includes a circumferential series of eighteen buckets 32 attached to a rotatable wheel 33 . the flow jets 27a and 28a are directed tangentially to the wheel on opposite sides of the wheel , and are aimed at the center of the buckets which rotate into the tangency zone on the corresponding side of wheel 33 . rotatable wheel 33 is securely and rigidly attached to rotor hub 24 which is concentrically positioned around shaft 23 . the rotor hub is bearingly mounted to and supported by shaft 23 by means of upper roller bearing 34 and lower roller bearing 35 . sealed bearings are used as opposed to shielded bearings in order to reduce bearing leakage flow . while turbine 29 can be configured in a variety of styles , the preferred configuration for the present invention is a modified half - bucket style of pelton turbine . the modified half - bucket turbine 29 is illustrated in fig1 while a conventional pelton turbine 29a ( split - bucket ) is illustrated in fig1 a . the differences between these two turbine options are effectively limited to the geometry of the buckets , 32 and 32a , respectively . with the exception of replacing the modified half - bucket style of turbine 29 in fig1 with the split - bucket style of turbine 29a in fig1 a , the construction of the fig1 and fig1 a centrifuges are identical . while the construction of a split - bucket 32a is believed to be well known , the modified half - bucket 32 configuration is unique to this application . reference to fig2 a and 2b will provide additional details regarding the geometry and construction of each half - bucket 32 . the cone - stack assembly or rotor 25 is defined herein as including as its primary components base plate 38 , vessel shell 39 , and cone stack 26 . the assembly of these primary components is attached to rotor hub 24 such that as rotor hub 24 rotates around shaft 23 by means of roller bearings 34 and 35 , the rotor 25 rotates . the rotary motion imparted to rotor hub 24 comes from the action of turbine 29 which is driven by the high pressure flow out of jet nozzles 27 and 28 . as the flow jets 27a and 28a impinge on the buckets 32 , each corresponding bucket is pushed , rotating the wheel 33 so as to bring the next sequential bucket into position for the point of tangency striking by the flow jets . this procedure occurs on each side of the wheel in a cooperating manner as the points of tangency for flow jets 27a and 28a are 180 degrees apart . the wheel rotates faster and faster until a steady state speed of rotation is achieved based on the characteristics of the flow jets 27a and 28a and the characteristics and dynamics of the turbine . since the turbine is attached to the rotor hub 24 which is bearingly mounted on the shaft 23 , the rotor 25 rotates at a rpm speed which corresponds to the speed of the wheel 33 of the turbine 29 . in the preferred embodiment of turbine 29 , each bucket 32 ( the modified half - bucket style ) has an ellipsoidal profile and a 10 to 15 degree exit angle on the edge of the ellipsoid . a front elevational view of one bucket 32 is illustrated in fig2 a . a perspective view of one bucket 32 is illustrated in fig2 b . the flow exiting from the bucket is directed downward and away from the spinning rotor , thus reducing droplet impingement drag . except for those portions within base 21 and below base plate 38 , the structure of centrifuge 20 is similar in certain respects to the structure disclosed in u . s . pat . nos . 5 , 575 , 912 and 5 , 637 , 217 , which patents have been expressly incorporated by reference herein . more specifically , the outer radial lip 40 of the bell housing 22 is positioned on the upper surface of flange 41 . the interface between radial lip 40 and flange 41 is sealed in part by the addition of an intermediate annular , rubber o - ring 42 . a band clamp 45 is used to complete and complement the sealed interface . clamp 45 is positioned around the lip 40 and flange 41 and includes an inner annular clamp 46 and an outer annular band 47 . as the band 47 is drawn tight , the clamp inside diameter is reduced and the tapered sides of annular channel 48 pull the lip 40 and flange 41 together axially into a tightly sealed interface . the drawing together of the lip 40 and flange 41 compresses the o - ring 42 . at the top of bell housing 22 , a cap assembly 51 is provided for receipt and support of the externally - threaded end 52 of shaft 23 . the details of shaft 23 are illustrated in fig3 . adapter 53 is internally threaded and includes a flange 54 that fits through and up against the edge of opening 55 . sleeve 56 , o - ring 57 , and cap 58 complete the assembly . with the end 52 first threaded into adapter 53 , and with the o - ring assembled , the housing and sleeve are then lowered into position . the cap is attached to secure the cap assembly 51 to the shaft 23 and housing 22 and the band clamp assembled and tightened into position . cap assembly 51 provides axial centering for the upper end 52 of shaft 23 and for the support and stabilizing of shaft 23 in order to enable smooth and high speed rotation of rotor 25 . disposed at the upper end of the rotor 25 , between the bell housing 22 and the externally - threaded end 52 , is an attachment nut 61 and support washer 62 . the annular support washer has a contoured shaped which corresponds to the shape of the upper portion of rotor shell 39 . an alternative envisioned for the present invention in lieu of a separate component for washer 62 is to integrate the support washer function into the rotor shell by fabricating an impact extruded shell with a thick section at the washer location . upper end 63 of rotor hub 24 is bearingly supported by shaft 23 and upper bearing 34 and is externally threaded . attachment nut 61 is threadedly tightened onto upper end 63 and this draws the support washer 62 and rotor shell 39 together . the opposite ( lower ) end 64 of rotor hub 24 is configured with a series of axial notches 64a and an alternating series of outwardly extending splines 64b ( see fig4 and 5 ). this splined end fits tightly within the cylindrical aperture 65 which is centered in base plate 38 . aperture 65 is concentric with hub 24 and with shaft 23 and the anchoring of the hub to the housing and to the base plate ensures a concentric rotation of the cone - stack assembly around the shaft 23 . the fit between the splined end 64 and aperture 65 also creates a series of spaced - apart , exiting flow channels 66 by way of the notches 64a and splines 64b . a radial seal is established between the inner surface 67 of lower edge 68 of rotor shell 39 and the outer annular surface 69 of base plate 38 . this sealed interface is determined in part by the closeness of the fit and in part by the use of annular , rubber o - ring 70 . o - ring 70 is compressed between the inner surface 67 and the outer annular surface 69 . the assembly between the rotor shell 39 and base plate 38 in combination with o - ring 70 creates a sealed enclosure defining an interior volume 73 which contains cone stack 26 . each cone 74 of the cone stack 26 has a center opening 75 and a plurality of inlet holes disposed around the circumference of the cone adjacent the outer annular edge 77 . typical cones for this application are illustrated and disclosed in u . s . pat . nos . 5 , 575 , 912 and 5 , 637 , 217 . the typical flow path for the rotor 25 begins with the flow of liquid upwardly through the hollow center 78 of rotor hub 24 . the flow through the interior of the rotor hub exits out through apertures 79 . a total of eight equally - spaced apertures 79 are provided , see fig4 . a flow distribution plate 80 is configured with vanes and used to distribute the exiting flow out of hub 24 across the surface of the top cone 74a . the manner in which the liquid ( lubricating oil ) flows across and through the individual cones 74 of the cone stack 26 is a flow path and flow phenomenon which is well known in the art . this flow path and the high rpm spinning rate of the cone - stack assembly enables the small particles of soot which are carried by the oil to be centrifugally separated out of the oil and held in the centrifuge . the focus of the present invention is on the design of base 21 , the use of a turbine 29 , the manner of routing a fluid to the flow jet nozzles 27 and 28 , and the configuration of shaft 23 which provides the desired design compatibility with the base 21 , turbine 29 , and nozzles 27 and 28 . the base 21 is configured with and defines an inlet aperture 82 and main passageway 83 . intersecting main passageway 83 at right angles are jet nozzle passageways 84 and 85 . passageway 84 is defined by mounting post 86 and provides a fluid communication path to jet nozzle 27 . on the opposite side of wheel 33 and on the opposite side of base hub 87 for mounting post 86 is a second mounting post 88 which defines passageway 85 . passageway 85 provides a fluid communication path to jet nozzle 28 . the hub 87 of base 21 includes a cylindrical aperture 89 which is internally threaded and which intersects main passageway 83 at a right angle . the base 90 of shaft 23 is externally threaded and threadedly secured and assembled into aperture 89 . base 90 is hollow and defines passageway 91 , which has a blind distal end 92 and throttle passageway 93 . the distal end of passageway 83 is closed ( i . e ., blind ) as is the distal end of passageway 84 and the distal end of passageway 85 . the fit of splined end 64 of rotor hub 24 into cylindrical aperture 65 supports the rotor hub 24 within base plate 38 and maintains the securely assembled status between base plate 38 , rotor shell 39 , and rotor hub 24 . a press fit or even a tight fit between end 64 and aperture 65 is sufficient for the desired support . the splined fit between end 64 and aperture 65 is also designed to prevent relative rotational movement between the rotor hub 24 and base plate 38 . the fit of end 64 within aperture 65 creates exiting flow channels 66 which open into the interior space 95 of base 21 defined by the side wall 96 of base 21 . side wall 96 further defines outlet drain opening 97 which permits the oil exiting from the rotor 25 by way of flow channel 66 to drain out from base 21 and continue on its circulatory path to and through the corresponding engine , or other item of equipment . the lubricating oil which is used through the jet nozzles 27 and 28 to drive the turbine 29 also accumulates in interior space 95 and combines with the oil exiting through flow channel 66 and it is this blended oil which exits through the outlet drain opening 97 . splash plate 98 is attached to the upper end surface 99 and 100 of posts 86 and 88 , respectively . for the operation of the centrifuge 20 as illustrated in fig1 pressurized ( 20 - 90 psi ) fluid flow ( oil ) enters the centrifuge base 21 via inlet aperture 82 and main passageway 83 . pressurized oil is supplied to passageways 84 and 85 as well as to passageway 91 by way of cylindrical aperture 89 . post 86 defines an exit orifice 103 which flow connects with jet nozzle 27 . a similar exit orifice 104 is defined by post 88 and flow connects with jet nozzle 28 . the blind nature of passageways 84 and 85 forces the entering flow out through orifices 103 and 104 in order to create flow jets 27a and 28a which drive the turbine 29 which in turn rotatably drives rotor hub 24 and the remainder of rotor 25 . the high velocity streams of fluid exiting from the two flow jet nozzles create the necessary high rpm speed for the rotor 25 in order to achieve the desired soot removal rate from the oil being routed through the rotor 25 . the requisite speed is a function of the outside diameter size of the cone stack as previously discussed . in the preferred embodiment , jet nozzles 27 and 28 each have an exit orifice sized at a diameter of approximately 2 . 46 mm ( 0 . 09 inches ). each nozzle has a tapered design on the interior so as to create a smooth transition leading to the exit orifice diameter in order to develop a coherent stable jet with minimal turbulent energy and maximum possible velocity . the turbine 29 converts the kinetic energy of the jets to torque which is imparted to the rotor hub 24 . as has been described , various styles or designs for turbine 29 are contemplated within the scope and teachings of the present invention , including a classic pelton turbine , though miniaturized in size , a modified half - bucket style , and a vane - ring or &# 34 ; turgo &# 34 ; style . of these options , the modified half - bucket style is the preferred choice . the turbine is optimized in performance efficiency when the bucket velocity is slightly less than one - half that of the impinging flow jet velocity . in an ideal design , the driving fluid &# 34 ; drops off &# 34 ; the bucket with nearly zero residual velocity and falls down into the interior space 95 of the base and exits by way of drain opening 97 . a target speed of 10 , 000 rpms with a 70 psi jet , a design for turbine 29 with a bucket pitch diameter of 28 . 96 mm ( 1 . 14 inches ), and a delivery torque of approximately 1 inch / pound are characteristics of the design of the preferred embodiment . under these specifications , the pumping horsepower ( parasitic ) loss to the engine is only 0 . 2 hp ( less than 0 . 03 percent of engine output for the size of engine under study for these conditions ). the entering oil by way of passageway 83 also flows up through cylindrical aperture 89 into passageway 91 of shaft 23 . the upward flow exits the interior of shaft 23 by way of throttle passageway 93 . in the preferred embodiment , the exit orifice diameter for passageway 93 is 1 . 85 mm ( 0 . 073 inches ) which limits the flow rate through the rotor 25 to approximately 0 . 6 gallons per minute . under test it has been learned that there is a high - torque drag spike when flow is between 0 . 2 and 0 . 4 gallons per minute through the rotor . a flow of 0 . 6 gallons per minute avoids this problem . a critical aspect of the present invention is the throttling of the incoming flow by the use of passageway 93 which is located adjacent to the inlet end 107 of the rotor hub 24 . in the illustration of fig1 the rotor hub 24 extends in an upward direction from base 21 and base plate 38 to the area of the attachment nut 61 at the upper end or top of the vessel shell 39 . since the incoming oil enters at aperture 82 and from there flows in and up , the lower end 107 of the rotor hub is the inlet end for the purpose of defining the flow path . locating the throttle passageway 93 at the inlet end 107 of the rotor hub in effect depressurizes the interior 78 of the rotor hub 24 and this permits the use of standard deep - groove sealed roller bearings at the locations of upper roller bearing 34 and at lower roller bearing 35 . the use of these styles of roller bearings dramatically reduces the rotational drag compared to the prior art ( old style ) journal bearings . at higher internal pressures within the interior 78 of rotor hub 24 than what is present with the present invention due to the throttling effect , journal bearings are needed since they can withstand the higher pressure . the problem is that journal bearings have substantial levels of rotational drag which limit the rpm speed which can be achieved for the rotor 25 . the resulting soot removal efficiency drops off substantially , resulting in a noticeably less efficient design and arguably an unacceptable design , if control of soot is the objective . there is a domino effect by throttling the flow and reducing the interior pressure in interior 78 . the ability to use roller bearings in the centrifuge design according to the present invention permits higher rotational speeds due to the lower drag and thus speeds in the range of 10 , 000 rpms ( and higher ) can be achieved with the present invention . it has been determined that speeds in this range are required for efficient soot removal . after exiting the shaft throttle passageway 93 , the process fluid ( oil ) travels upwardly in the hollow center or interior 78 of rotor hub 24 between the shaft 23 and hub 24 . near the upper portion of hub 24 , there are a plurality of outlet holes , eight total in the preferred embodiment . the flowing oil passes through each of these outlet holes 79 and the flow is directed up and around the cone stack by a flow distribution plate which is equipped with radial vanes that accelerate the fluid in the tangential direction . the flow is distributed throughout the cone stack through the vertically - aligned cone inlet holes and flows through the gaps in the cone stack radially inwards toward the hub . the stack of cones is rigidly supported by the rotor hub base plate . upon reaching the hub outside diameter , the flow passes down through aligned cut outs on the inside diameter of the cones and exits the interior volume 73 through the flow channels 66 . as an alternative to this configuration , the base plate 38 can be a one - piece design with holes drilled through the plate for fluid exit paths . it is important that the flow exits from the flow channels 66 as near the rotational axis as possible to avoid drag / speed reduction due to centrifugal &# 34 ; pumping &# 34 ; energy loss by dumping flow out at a high tangential velocity , which increases proportionately with radius . also , the exiting flow must leave the cone - stack assembly in a manner such that it does not contact the outside surface of the base plate and , as a result , rob energy by being re - accelerated and &# 34 ; slung &# 34 ; from the outside diameter of the rotor base at a high speed . this result is achieved by routing the exiting oil flow through flow channel 66 to a point beneath splash plate 98 and this diverts the spray of oil down and away from the spinning rotor hub 24 towards the drain opening 97 . if , in an alternative design , the splash plate is not used , then the exiting oil needs to exit from a point lower than the lowest point of the base plate so that oil is not re - entrained on the surface of the spinning rotor as it flies radially outward from the exit point . as has been described , the &# 34 ; clean &# 34 ; process fluid then mixes with the driving fluid and drains out of the housing base 21 by way of drain opening 97 through the force of gravity . with reference to fig6 an alternative cone stack centrifuge 120 is disclosed . it should be noted that centrifuge 120 has a structure which in many respects is quite similar to the cone - stack centrifuge 20 of fig1 . the principal differences between cone stack centrifuge 120 and cone - stack centrifuge 20 involve the designs and the relationships for the base 21 , shaft 23 , cylindrical aperture 89 , and main passageway 83 . comparing these portions of centrifuge 20 with the corresponding portions of centrifuge 120 reveals the following differences . in the fig1 design for centrifuge 20 , the main passageway 83 is in direct flow communication with aperture 89 of base hub 87 . as illustrated , the aperture 89 does not axially extend through the main passageway 83 , but effectively is a t - intersection at that point . in the fig6 design , there is no flow communication between cylindrical aperture 121 in the base and main passageway 122 . instead , the lower end or base 123 of the shaft 124 of centrifuge 120 is axially extended over that of base 90 such that shaft 124 extends through main passageway 122 and exits out through the lower aperture extension 125 of cylindrical aperture 121 . shaft 124 is illustrated in fig7 as a separate component part . this lower aperture extension 125 intersects the main passageway 122 as is illustrated , and is axially aligned with the upper portion of cylindrical aperture 121 which is above the main passageway 122 . the design of base 126 of centrifuge 120 is illustrated in fig8 . the base 123 of shaft 124 still includes a passageway 127 which provides a flow path from inlet aperture 128 to throttle passageways 129 and 130 . turbine 29 is now numbered as 134 , but the designs are basically the same . in fig6 a , the alternative style of turbine with the split - bucket configuration is identified as turbine 134a . it will be noted that shaft 23 includes a single throttle passageway 93 while shaft 124 ( fig6 ) includes two throttle passageways , 129 and 130 . the reason for this is due to the fact that in the fig6 embodiment , it is possible to throttle the incoming flow of oil at almost any point upstream from passageways 129 and 130 , preferably outside of the centrifuge . as a result , passageways 129 and 130 do not have to serve as the sole throttling means . in fig1 the incoming oil is also used to drive the turbine 29 and throttling the flow outside of the centrifuge would adversely affect the turbine speed . for this reason , throttling of the flow to the rotor 25 is accomplished by passageway 93 . it is easier to accomplish the throttling function with one passageway as compared to two . for this reason , only a single passageway 93 is provided in the fig1 embodiment . since the interior passageway 127 through the shaft is not in flow communication with main passageway 122 , the incoming flow ( oil ) at inlet aperture 128 is not used to drive turbine 134 . turbine 134 is virtually identical to turbine 29 and the balance of centrifuge 120 is virtually identical to centrifuge 20 , except as being described herein . in order to drive the turbine 134 by way of flow jet nozzles 135 and 136 , a pressurized fluid is introduced into main passageway 122 by way of inlet aperture 137 . in the preferred embodiment , this pressurized fluid ( i . e ., driving fluid ) is a gas . the pressurized gas follows the same path as the oil in the fig1 configuration except that the pressurized gas does not flow into passageway 127 and , as such , is not introduced into the cone - stack assembly 138 . in order for the pressurized gas to flow to passageway 139 in post 140 and ultimately to jet nozzle 136 , the base 123 of shaft 124 is notched or indented at location 141 in order to permit the pressurized gas a free flow path around the base 123 of shaft 124 . passageway 142 in post 143 is in communication with passageway 122 for the delivery of the pressurized gas to jet nozzle 135 . an o - ring 144 is positioned between base 123 and the lower aperture extension 125 . inlet aperture 128 is internally threaded for coupling the input conduit which delivers the fluid to be introduced into the cone - stack assembly . the gas ( typically air ) which is used to drive the turbine 134 in fig6 must be vented from the centrifuge 120 to the atmosphere . while a variety of vent designs and locations are suitable for this function , it is important to first separate any oil mist which may have co - mingled with the air . for this purpose , a coalescer 150 is attached to bell housing 151 and sealed around outlet 152 . as the spray mist or aerosol of air and oil exits through outlet 152 , the interior of the coalescer 150 pulls the oil out of the air . the air then passes to the atmosphere and the oil gradually drips back into the centrifuge . the interior of coalescer 150 includes a metal mesh or alternatively a woven or non - woven synthetic mesh , all of which are well known in the art . various styles or designs for turbine 29 and the corresponding buckets have been mentioned herein , including a classic pelton turbine 29a with its split - bucket configuration for the individual buckets 32a ( fig1 a ) and a modified half - bucket style of turbine 29 with its buckets 32 ( fig1 ). either style of impulse turbine is suitable for the fig1 and fig6 embodiments as well as for the alternative embodiments of fig1 a and 6a . the diagrammatic illustration of fig2 is intended to be a suitable generic representation of turbines 29 and 29a , even though numbered as turbine 29 . in the discussion of other options or variations for turbine 29 , mention was made of a vane - ring or turgo style of turbine . while the individual vanes of such a turbine style can be placed at virtually any diameter , the efficiency with the gas - driven mode of operation is improved if the vane circle diameter is increased over the illustrated bucket circle diameter for turbine 29 . the vane - ring style of turbine is preferred for gas - driven centrifuges . it is known that the optimal vane velocity is equal to one - half of the jet velocity and , based on choked flow ( sonic velocity jet ), it is preferable to locate the gas - driven vanes around a larger diameter . accordingly , fig9 - 11 illustrate a vane - ring turbine 160 which is created by the attachment of individual vanes 161 to the outer surface of the generally cylindrical portion 162a of the rotor shell 162 which is adjacent the lower edge 163 . each vane 161 has a curved form with a concave impingement surface 164 . with this type of vane , the jet nozzle 165 is directed at an angle of between 5 and 20 degrees relative to the vane centerline , an angle which generally coincides with the leading edge angle of the vane 61 . the jet nozzle 165 delivers a jet of air from passageway 166 which strikes the vanes in rotary sequence and thus drives ( rotates ) the rotor which is bearingly mounted onto the shaft . for gas - driven operation of the centrifuge of fig6 a , and 9 , the gas jet is at sonic velocity ( for pressures above approximately 13 psig ). the optimal vane velocity ( fig9 ) for maximum kinetic energy extraction is about 0 . 4 times the jet velocity , which would be about 440 feet per second ( for a sonic velocity of 1100 feet per second ). at 10 , 000 rmp with a 7 . 3 inch diameter rotor , the vane velocity ( with the vanes 161 located at the perimeter illustrated in fig9 ) is approximately 320 feet per second which is still &# 34 ; slow &# 34 ; relative to optimal . the vane ( vane - ring ) style of turbine used for the fig9 centrifuge can be used with the centrifuge embodiments of fig1 a , 6 , and 6a as a replacement for the modified half - bucket and split - bucket turbine styles . there are though efficiency differences based on the turbine style which is used , the location of the turbine , the rotor diameter , the driving medium , and the jet velocity . while the invention has been illustrated and described in detail in the drawings and foregoing description , the same is to be considered as illustrative and not restrictive in character , it being understood that only the preferred embodiment has been shown and described and that all changes and modifications that come within the spirit of the invention are desired to be protected .	1
in the following description frameworks and methods of cooperatively processing a task by multiple threads in a multi - threaded computer system are described . in general , upon receipt of a packet associated with the task , a first thread partially processes the task . the packet is then passed from the first thread to a second thread that , upon receipt of the packet , further processes the task . since only the thread currently possessing the packet can process the task , no synchronization primitives , such as mutexes , are required for the threads to cooperate with each other . the invention will initially be described in terms of an interrupt handler for a device driver . the interrupt handler itself is conceptually divided into a plurality of different order handlers . the tasks that are to be handled by the interrupt handler are also divided into various segments with each order interrupt handler being designed to handle an associated segment of the overall task . the tasks can conceptually be organized in any appropriate manner , however , in the context of an interrupt handler it is typically most logical to divide the activities by their relative priority . more specifically , it should be appreciated that some of the activities performed by an interrupt handler may be very time critical and must be handled as quickly as possible , while other tasks are not particularly time critical and may effectively be handled on a less time critical basis . the various order handlers are arranged to partition the work performed by the interrupt handler such that the most time critical activities are handled by the order - 1 interrupt handler . less time critical , but still high priority tasks are handled by the order - 2 interrupt handler . the least time critical tasks are handled by the order - 3 handler . of course , a task could readily be broken into more or less segments based on the nature of the task being handled . in the described embodiment , the order - 1 interrupt handler is designed to perform tasks that are deemed to require the use of a micro - kernal thread . these are generally the tasks that are considered to be the most time critical . the order - 2 interrupt handler is designed to perform tasks that are deemed to require the use of a high priority system thread ( higher than a non - native thread and any other system thread ). thus , tasks that are considered to be very important , but not as time critical as the order - 1 tasks are handled by the order - 2 interrupt handler . the order - 3 interrupt handler is arranged to run non - native threads and to perform the tasks that are not particularly time critical . fig1 illustrates a device driver 100 that may benefit from cooperative task processing performed in accordance with an embodiment of the invention . as will be appreciated by those skilled in the art , a device driver is a program written to support an associated device . in computer systems , devices supported by a device driver may include , but are not limited to input and output devices such as printers , monitors , modems and / or network / telephone connections . the device driver 100 illustrated in fig1 includes an interrupt handler 102 arranged to process hardware interrupts generated by the device that the device driver 100 is managing . the interrupt handler is partitioned into a plurality of sub - parts , including an order - 1 interrupt handler 106 , an order - 2 interrupt handler 108 , and an order - 3 interrupt handler 110 . in alternative embodiments , any combination of these and other orders may be defined for a particular interrupt handler . in the illustrated embodiment , a device interrupt source 104 is provided which defines the particular interrupt handlers used by and associated with the device driver 100 , such as , for example , the interrupt handler 102 . fig2 illustrates a particular relationship 200 between the various interrupt handlers defined by the device interrupt source 104 in accordance with an embodiment of the invention . in the described embodiment , the order - 1 interrupt handler 106 is invoked at 206 in the context of a microkernal interrupt handler 202 included in a microkernal 201 well known by those skilled in the art . the microkernal interrupt handler 202 is software that immediately begins running whenever hardware coupled to the microkernal 201 asserts an interrupt . it is important to note , however , that once the microkernal interrupt handler 202 begins to run , any thread that is currently running in the multi - threaded computer system is immediately suspended . it should also be noted , that once the microkernal interrupt handler 202 returns , a microkernal scheduler 204 ( i . e ., software used to schedule prioritized threads ) un - suspends the highest priority thread even though that thread may or may not be the thread that was interrupted . in one embodiment , the order - 1 handler 206 runs native code ( i . e ., platform dependent code ) and subsequently fulfills the most immediate needs of the interrupting device such as , for example , when the interrupting device is a serial device whose buffer may overrun if not handled fast enough . it should be noted that while the order - 1 handler 106 is running , all further interrupts from the interrupting device are masked . after the microkernal interrupt handler 202 calls the order - 1 interrupt handler 106 and the order - 1 interrupt handler 106 returns ( if it is the lowest order handler ), or after the microkernal interrupt handler 202 signals the order - 2 interrupt handler 108 or order - 3 interrupt handler 110 ( whichever is lowest ), the microkernal interrupt handler 202 transfers control to the microkernal scheduler 204 . all hardware interrupts are for a particular level , and a higher hardware level will pre - empt an interrupt currently being processed at a lower level . for example , if an order - 1 interrupt handler is currently running for a level - 3 hardware interrupt , and an interrupt for a level 4 occurs , that level 4 interrupt will pre - empt the order - 1 handler running for the level - 3 interrupt . in addition , the running order - 1 interrupt handler 106 also preempts other order - 1 interrupt handlers coupled to the microkernal 201 that were invoked by the lower - level microkernal interrupt handler 202 as well as any non - native threads ( i . e ., platform independent threads such as java threads ). it is for at least this reason that the order - 1 interrupt handler 106 should do the absolute minimum that is necessary to satisfy the most immediate needs of the interrupting device and leave the remainder of interrupt handling for higher - order interrupt handlers ( such as the order - 2 and order - 3 interrupt handlers ). it is important to note that in those situations where non - native threads , such as java , are suspended during , for example , garbage collection , the order - 1 interrupt handler 106 is still capable of running . in this way , time critical processes are still capable of being run . in the described embodiment , the order - 2 interrupt handler 108 is , in some cases , signaled from the order - 1 interrupt handler at 208 . in those cases where no order - 1 interrupt handler exists , the order - 2 interrupt handler 108 is signaled from the microkernal interrupt handler 202 at 210 . in a preferred embodiment , the order - 2 interrupt 108 handler runs native code in a high priority system thread ( higher than a non - native thread and any other system thread ) and performs additional interrupt handling . since the order - 2 interrupt handler 108 runs native code ( platform dependent ), and since it has higher priority than any other non - native thread , the order - 2 interrupt handler 108 can handle real time needs of the interrupting device . at the same time , unlike the order - 1 interrupt handler 106 , the order - 2 interrupt handler 108 can continue interrupt processing without masking additional interrupts from the interrupting device . an interrupt can still occur , and the order - 1 interrupt handler 106 can run while the order - 2 interrupt handler 108 is in the middle of interrupt handling . once the order - 2 interrupt handler 108 finishes its interrupt handling , it signals the order - 3 interrupt handler 110 at 212 . it is important to note that the order - 2 interrupt handler 108 should be able to run while the non - native threads are suspended during , for example , garbage collection . in addition to the order - 1 interrupt handler 106 and the order - 2 interrupt handler 108 , the device interrupt source 104 is arranged to define the order - 3 interrupt handler 110 . the order - 3 interrupt handler 110 is signaled to run from either the order - 2 interrupt handler 108 or the order - 1 interrupt handler 106 at 214 in the case where there is no order - 2 interrupt handler . however , if there is neither an order - 1 interrupt handler nor an order - 2 handler present , the signaling can come from the microkernal interrupt handler 202 directly at 216 . it is important to note that in the described embodiment , the order - 3 interrupt handler 110 runs non - native code , such as java , exclusively and for this reason can be especially slow when it is pre - empted for long periods such as when the non - native threads are suspended . for this reason , the order - 3 interrupt handler 110 should not be used for time critical interrupt processing . in addition , since the order - 3 interrupt handler 110 is the only interrupt handler capable of running non - native code , such as java , the device interrupt source 104 must define the interrupt handler 104 , as a minimum , to include the order - 3 interrupt handler 110 in those situations where non - native threads are contemplated . typically , the number and type of interrupt handlers defined by the device interrupt source 104 is determined by the particular application as well as the number and type of hardware devices . in those situations where the delay experienced by native threads when non - native threads are suspended is not significant or doesn &# 39 ; t cause significant system performance problems , the device interrupt source 104 may find it necessary to only allocate the order - 3 interrupt handler 110 . on the other hand , in those situations where it is imperative that native threads be left to run substantially unhindered ( even though non - native threads are suspended for reasons such as garbage collection ) it is important to allocate more of the lower order interrupt handlers . by way of example , the device interrupt source 104 can allocate relatively more of the order - 1 interrupt handlers 106 and / or the order - 2 interrupt handlers 108 in than of the order - 3 handlers 110 when running time critical processes without substantial hindrance is important . referring again to fig1 in one embodiment of the invention , when the device interrupt source 104 is instantiated , an interrupt packet 112 is allocated . in the described embodiment , the actual number of interrupt packets 112 is determined by the device driver 100 based upon particular requirements of the device being managed . it should be noted that based upon these requirements , the device interrupt source 104 can allocate a pool of interrupt packets 114 represented by interrupt packets 112 a - 112 d . fig3 a and 3b illustrates different aspects of an interrupt packet 300 in accordance with an embodiment of the invention . it should be noted that the interrupt packet 300 is one particular implementation of the interrupt packet 112 . in a preferred embodiment , the interrupt packet 300 contains a protected owner field 302 that takes on a value indicative of current ownership of the interrupt packet 300 . the interrupt packet 300 also includes a processing data field 303 used to store relevant task processing information . table 1 lists representative owner field values and associated ownership status according to one embodiment of the invention . by way of example , if the owner field 302 has a value of “ 0 ”, as indicated by table 1 , the interrupt packet 300 is un - owned ( i . e ., no interrupt handler currently owns the interrupt packet 302 ). alternatively , if the owner field 302 has a value of “ 1 ”, as indicated by table 1 , the interrupt packet 300 is owned by the order - 1 handler 106 . it should be noted that , in a preferred embodiment , when the device interrupt source object 102 is instantiated , all corresponding interrupt packets 112 a - 112 d are allocated with their respective owner fields set to 0 indicating that no interrupt handler currently owns the particular interrupt packet . in the described embodiment , the interrupt packet 300 can be extended to include information in addition to the current owner . by extended , it is meant that additional data fields containing information specific to the particular device the associated device driver manages for example , are added . by way of example , the interrupt packet 300 can be extended to include additional data fields associated with , for example , financial data particularly useful for specific financial applications and associated devices . such an interrupt packet 304 is shown in fig3 b . the interrupt packet 304 includes an owner field 306 and a processing data field 307 . for this example , the interrupt packet 304 has been extended to include additional data fields 308 used , for example , in defining particular application specific data depending upon the particular native application for which the additional data fields 308 are associated . it is important to note that since the native operating system only interacts with the owner field , the presence of additional data fields in the extended interrupt packet 304 is irrelevant to the execution of the native operating system . it is for at least this reason , that any extension of an interrupt packet by a particular application leaves the interrupt packet platform independent . since the order - 1 , order - 2 , and order - 3 interrupt handlers for a particular device driver can handle interrupts concurrently it is necessary to avoid any synchronization problems . such problems caused by , for example , garbage collection result in native threads being suspended . in one embodiment of the invention , such synchronization problems are avoided by using an efficient message passing approach . in a preferred embodiment , the efficient message passing utilizes the interrupt packets 112 provided by the device interrupt source 104 . during operation , when an interrupt handler ( of any order ) exclusively processes an interrupt , it stores processing information relevant to the interrupt processing in the interrupt packet 112 . when a particular interrupt handler has completed its processing of the interrupt and is ready to hand the processing off to a higher order interrupt handler ( i . e ., from the order - 1 interrupt handler 106 to the order - 2 interrupt handler 108 , for example ), the lower order interrupt handler passes the interrupt packet to the higher order interrupt handler . the higher order handler then appropriately updates the interrupt packet and continues to process the interrupt . since no two interrupt handlers possess the same interrupt packet at the same time , synchronization is unnecessary . by way of example , fig4 a illustrates a scheme 400 for cooperatively processing an interrupt in accordance with an embodiment of the invention . for this example , the device driver 100 includes an order - 1 interrupt handler 406 as well as an order - 3 interrupt handler 408 ( required to run non - native code ) instantiated by the device interrupt source 104 . when the interrupt int 1 is asserted , the microkernal handler 202 suspends all native threads until such time as it sends an interrupt packet 410 to the order - 1 interrupt handler 406 . it should be noted that while in possession of the microkernal handler 202 , the owner field 412 of the interrupt packet 410 has a value of “ 0 ” indicating that it is un - owned . once the microkernal handler 202 has sent the interrupt packet 410 to the order - 1 interrupt handler 406 , the owner field 412 of the interrupt packet 410 is updated to a value of “ 1 ” indicating that it is now owned by the order - 1 handler 406 . since the order - 1 interrupt handler 406 currently owns the interrupt packet 410 , it is now the only interrupt handler included in the device driver 100 enabled to process the interrupt int 1 . it should be noted as well , that any additional interrupts asserted while the order - 1 interrupt handler 406 is processing the interrupt int 1 are masked until such time as the interrupt packet 410 is passed along to a higher order interrupt handler . in this case , even if the non - native code is suspended , the order - 1 interrupt handler 406 is still able to process time critical native threads since it alone owns the interrupt packet 410 . assuming at a time δt 0 subsequent to the completion of either order - 1 interrupt handling ( if there is one ) or signaling of what is otherwise the lowest order interrupt handler of the interrupt int 1 another interrupt int 2 is asserted . as described above , the interrupt int 2 is masked until the order - 1 interrupt handler 406 sends the interrupt packet 410 to a higher order interrupt handler , such as the order - 3 interrupt handler 408 . therefor , in order for the order - 1 interrupt handler 406 to process the interrupt int 2 , it must send the interrupt packet 410 to the order - 3 interrupt handler 408 . once the order - 1 interrupt handler 406 sends the interrupt packet 410 to the order - 3 interrupt handler 408 , it gets a new interrupt packet 414 from the microkernal interrupt handler 202 in order to process the newly asserted ( and heretofore masked ) interrupt int 2 . it should be noted that the owner field 412 of the interrupt packet 410 has been updated to a value of “ 3 ” indicating that it is now owned by the order - 3 interrupt handler and that the owner field 416 of the interrupt packet 414 is updated to a value of “ 1 ”. in this configuration , the remainder of the interrupt int 1 can be processed by the order - 3 interrupt handler 408 concurrently with the interrupt int 2 being processed by the order - 1 interrupt handler 406 . if an occasion arises where the order - 3 interrupt handler is suspended for any reason unrelated to the native operating system , time critical native threads can still be processed by the order - 1 interrupt handler 406 after it has completed its processing of the interrupt int 2 . fig4 b illustrates processing of the interrupt int 1 shown in fig4 a . for this example , the interrupt int 1 includes a series of tasks identified as 1 , 13 , 18 , d 3 , e 3 , which must be completed in order for the interrupt int 1 to be considered fully processed . it should be noted that “ a1 ” refers to the process “ a ” being performed by the order - 1 handler 406 whereas “ c3 ” refers to the process “ c ” being performed by the order - 3 handler 408 , and so on . therefor , the order - 1 interrupt handler 406 will process tasks “ a ” and “ b ” quickly , since , at least for this example , they represent time critical processes . whereas , when the interrupt packet 410 is passed to the order - 3 interrupt handler 508 , the tasks “ c ”, “ d ”, and “ e ”, are processed by the order - 3 interrupt handler 408 . in this way , the interrupt int 1 is fully processed by the cooperative effort of the order - 1 interrupt handler 406 and the order - 3 interrupt handler 408 as mediated by the interrupt packet 410 that is associated with the interrupt int 1 only . it should be noted that the same procedure is followed for the cooperative processing of the interrupt int 2 . a particular implementation of the invention will now be described with reference to fig5 - 8 . fig5 is a flowchart detailing a possible process 500 for handling device interrupts by a lowest order interrupt handler in accordance with an embodiment of the invention . the process 500 begins at 502 when a device driver receives an interrupt from the device it is managing . once the interrupt is received , the device driver calls a get_next_packet function at 504 . once the get_next packet function has been completed the get_next_packet is passed the order of the interrupt handler that wants the next packet and the fetched interrupt packet is passed to the lowest order handler at 506 . by way of example , if the device driver includes an order - 1 interrupt handler and an order - 3 interrupt handler , then the interrupt packet is passed to the order - 1 interrupt handler . alternatively , if the device driver has only an order - 3 interrupt handler , then the interrupt packet is passed from the microkernal directly to the order - 3 handler . once the interrupt packet has been passed to the lowest order interrupt handler , the interrupt handler processes the interrupt packet by , in one embodiment , storing appropriate lowest order state information in the interrupt packet at 508 . such state information includes information related to processing the interrupt associated with the interrupt packet . a particular example relates to a serial device driver having an array of characters that are read out of some hardware register by an order - 1 interrupt handler . the order - 1 interrupt handler in this case processes only these characters while the order - 2 and order - 3 interrupt handlers do further processing of the state information . a determination at 510 is then made regarding whether or not the interrupt packet is ready to be passed on . by passed on , it is meant that the interrupt packet is ready to be sent to the next interrupt handler . if the determination at 510 is that the interrupt packet is ready to be passed on , then the device driver calls a send_packet function at 512 . after the send_packet function has been completed , the process 500 waits at 514 for a next interrupt from the device being managed by the device driver . alternatively , if it was determined at 510 that the interrupt packet was not ready to be passed on , then control is passed to 514 without calling the send_packet function until such time as a next interrupt is received from the device being managed by the device driver . fig6 is a flowchart detailing a possible process 600 for handling device interrupts by a higher order interrupt handler in accordance with an embodiment of the invention . it should be noted that the process 600 is used in conjunction with the process 500 in those situations where interrupt handlers of more than one order have been instantiated . the process 600 begins at 602 by calling the get_next_packet function . once the next packet has been obtained , the packet is passed to an associated higher order interrupt handler which further processes the packet , by for example , storing appropriate state data in appropriate data fields at 604 . at 606 , it is then determined whether or not the packet is ready to be passed on . if it is determined that the packet is not ready to be passed on , control is returned to 602 where the next packet function is called . on the other hand , if the packet is ready to be passed on , then the packet is passed on to a next appropriate interrupt handler by calling the send_packet function at 608 . fig7 is a flowchart detailing a possible process 700 for getting a next interrupt packet in accordance with an embodiment of the invention . it should be noted that the process 700 is one particular implementation of the get_next_packet function at 504 of the process 500 . the process 700 begins at 702 by a determination of whether or not an unsent interrupt packet exists for the current interrupt handler . if it is determined that there is an unsent interrupt packet , then the unsent interrupt packet is returned to the calling interrupt handler at 704 . if , however , it is determined that there is no unsent interrupt packet , then the next interrupt packet for the calling interrupt handler is identified at 706 . once the next interrupt packet is identified , a determination at 708 is made whether or not the identified interrupt packet is owned by the calling interrupt handler . if it is determined that the identified next interrupt packet does not belong to the calling interrupt handler , then the process waits at 710 for the identified next interrupt packet to be assigned to the calling interrupt handler . if , however , it was determined at 708 that the identified next interrupt packet is owned by the calling handler , then the identified next interrupt packet is returned at 712 . it should be noted , that in one implementation of the invention , an array of state variables is used . fig8 is a flowchart detailing a process 800 for sending a next interrupt packet in accordance with an embodiment of the invention . it should be noted that the process 800 is a particular implementation of the send_next_packet function at 508 of the process 500 . the process 800 begins at 802 by setting an unsent packet flag in the interrupt packet to null indicating that there are no unsent packets . at 804 , the current owner of the packet is set to a value corresponding to the next highest order handler available ( which now becomes the current handler ). at 806 , a determination is made whether or not the current handler is now the highest order handler . if the current handler is now the highest order handler , then the process 800 stops . otherwise , the next highest order handler available is notified at 808 after which the process 800 stops . in one embodiment of the invention , the get_next_packet function and the send_next_packet function taken together manage the array of interrupt packets . in one particular implementation , the interrupt packets are managed as a ring buffer . one such ring buffer is configured in such a way that after a particular order interrupt handler has processed , for example , an interrupt packet p , the next interrupt packet that the particular interrupt handler will process is always the interrupt packet identified by the relation : such a ring buffer arrangement is shown in fig9 . a ring buffer 902 contains 4 interrupt packets arranged between an order - 1 handler , an order - 2 handler , and order - 3 handler , and as unowned . although only a few embodiments of the present invention have been described , it should be understood that the present invention may be embodied in many other specific forms without departing from the spirit or the scope of the present invention . steps may also be removed or added without departing from the spirit or the scope of the present invention . fig1 illustrates a computer system 1000 in accordance with an embodiment of the invention . the computer system 1000 includes a central processing unit (“ cpu ”) 1002 , such as , for example , a sun microsystems sparc , motorola powerpc , or intel pentium processor . cpu 1002 is coupled with a memory 1004 that includes any type of memory device used in a computer system , such as for example , random access memory (“ ram ”) and read - only memory (“ rom ”). cpu 1002 is also coupled with a bus 1006 , such as a pci bus , or an s bus . a variety of input devices 1008 and 1010 , and output devices 1012 are also coupled with bus 1006 . examples of such input and output devices include , but are not limited to , printers , monitors , modems , and / or network / telephone connections . typically each of these devices has an associated with it a device driver . a device driver is an object - oriented program written to support an associated device coupled with computer system 1000 . by way of example , the device driver 114 manages the input device 1008 . likewise , other device drivers can be utilized to support and manage any device , such as devices 1010 and 1012 , coupled to the computer system 1000 . although the methods of cooperative execution of native and non - native threads in a multi - threaded system in accordance with the present invention are particularly suitable for implementation with respect to a java based environment , the methods may generally be applied in any suitable object - based environment . in particular , the methods are suitable for use in platform - independent object - based environments . it should be appreciated that the methods may also be implemented in some distributed object - oriented systems . while the present invention has been described as being used with a computer system that has an associated virtual machine , it should be appreciated that the present invention may generally be implemented on any suitable object - oriented computer system . specifically , the methods of passing interrupt packets with the present invention may generally be implemented in any multi - threaded , object - oriented system without departing from the spirit or the scope of the present invention . therefore , the present examples are to be considered as illustrative and not restrictive , and the invention is not to be limited to the details given herein , but may be modified within the scope of the appended claims along with their full scope of equivalents .	6
the process of manufacturing of medium density fibreboards ( mdf ) or the like is shown in fig1 a and the potential application of high - intensity ultrasound to support or replace part processes are marked in the fig . ( 201 ). in traditional mdf manufacturing biomass chips , preferably on the basis of debarked solid wood , are used as raw material ( 1 a - 1 ); bark residuals and dirt are removed from the chips in a chip washer ( 1 a - 2 ). using this technique requires large amounts of clean water and produces large amounts of contaminated water , handling of which is a very costly process ; the wet chips are milled into fibres in a disc refiner ( 1 a - 3 ). milling the biomass chips into fibres in a disk refiner requires large amounts of electric energy and mechanical wear of machinery ; usually , a aqueous solution of binder is added to the wet fibre furnish in the so - called blow - line at the outlet of the refiner ( 1 a - 4 ). in the blowline , the fibre furnish tend to agglomerate to large lumps and the binder added at this stage of the process has very limited access to the single fibres ; the fibre - binder mixture is dried in an airborne drying process using hot air as a heating and transportation medium ( 1 a - 5 ). also during drying in an air - borne process the fibres tend to agglomerate and thus make drying inefficient . additionally , the transfer of heat energy into the fibres and of water vapour out of the fibres is limited by the laminar boundary layer on the surface of the fibres . alternatively , other techniques to add the binder to the fibre after drying ( see e . g . danish patent application pa 200401297 and patents quoted herein ) are used in mdf manufacturing . application of binder to the fibre furnish after drying is a more modern approach , the efficiency of which , however , in terms of binder distribution on the single fibres is limited by the tendency of the fibres to once again agglomerate into large lumps ; after drying of fibre and application of binder , the fibre furnish is screened , usually in an air - borne system , in order to remove larger fibre agglomerations , which may cause damage in the hot press ( 1 a - 6 ). screening of the fibre furnish to remove fibre lumps is a costly process in terms of equipment , energy and loss of material ; subsequently the fibre furnish is formed into a homogeneous mat ( 1 a - 7 ), either by an airborne or by a mechanical device . forming of the fibre mat in conventional formers establishes a 2 dimensional orientation of the fibres in the plane of the mat ; the fibre mat may be preheated by introducing steam or hot air or a mixture of steam and hot air into the surfaces of the mat ( 1 a - 8 ) may be made ( optimally ); finally , the mat is pressed and cured in a hot press ( 1 a - 9 ). the majority of the part processes of mdf manufacturing is strained by problems in relation to separating particles : to separate contamination from the biomass chips , to disintegrate the chips into fibres , and to keep the fibres separated throughout the process steps of drying of fibre , application of binder and forming of the fibre mat . further , the efficiency of the process of drying fibres in an air - borne process using hot air or superheated steam as a transportation and heating medium is limited by the presence of a laminar boundary layer of air at the surface of the fibres . the part processes in which the application of high - intensity ultrasound has the potential of improvement are marked in fig1 a ( 201 ). the process of manufacturing particleboards ( pb ) is schematically shown in fig1 b and the potential applications of high - intensity ultrasound to support or replace part processes are marked in the figure ( 201 ). in particleboard manufacturing , a wider variety of low quality raw material is used ( wood residuals , recycling wood , agricultural biomass etc . ( 1 b - 1 ); screening into coarse and fine particles ( 1 b - 2 ). the efficiency of screening biomass particles by means mechanical sifters or air - borne equipment is limited by the tendency of fine particles and dirt to stick to larger particles ; large particles are flaked into proper size ( 1 b - 3 ); the particle furnish is dried , usually in drum dryers using hot gas as a heating medium and mechanical devices as a transportation medium ( 1 b - 4 ). the efficiency of the process is limited by the laminar boundary layer at the surface of the particles ; the dry particle furnish is usually separated ( 1 b - 5 ) into a fine fraction to be used for the panel surface and a coarse fraction to be used for the panel core . the separation of coarse and fine particles by traditional mechanical or air - borne techniques is limited by the tendency of coarse and fine particles to stick together ; a binder is added to these fractions separately in mechanical blenders ( 1 b - 6 ); the fractions of particle furnish are formed into a 3 - layer mat ( 1 b - 7 ). the particle mat may be preheated by introducing steam or hot air or a mixture of steam and hot air into the surfaces of the mat ( 1 b - 8 ); the mat is pressed and cured in a hot press ( 1 b - 9 ). the process of manufacturing oriented strand boards ( osb ) is schematically shown in fig1 c and the potential application of high - intensity ultrasound to support or replace part processes are marked in the figure ( 201 ). oriented strand boards ( osb ) are made from regular , debarked round wood from the forest ( 1 c - 1 ); the logs are cut into thin ( 0 . 5 - 0 . 7 mm ), wide ( 20 - 25 mm ) and long ( 100 - 150 mm ) strands ( 1 c - 2 ); cleaning of the strands from dirt and bark contamination is made in a dry process in mechanical sifters ( 1 c - 3 ). the efficiency of traditional cleaning of strands from dirt and bark contaminations in mechanical sifters is limited by the adhesion of fine particles and dirt to the rough surface of the strands ; drying of strands is made in drum dryers using hot gas as a drying medium and mechanical devices for transportation of the strands ( 1 c - 4 ). the process is limited by the laminar boundary layer at the surface of the strands ; application of binder in the form of a powder or an aqueous solution of resin is made in rotating drums ( 1 c - 5 ); forming of strands into a mat is made in mechanical devices , orientating the strands into 3 layers parallel and perpendicular to the process direction , respectively ( 1c - 6 ); the strand mat may be preheated by introducing steam or hot air or a mixture of steam and hot air into the surfaces of the mat ( 1 c - 7 ); the mat is pressed and cured in a hot press ( 1 c - 8 ). common to all 3 manufacturing processes of biomass - based panel board products as illustrated in fig1 a - 1 c is a number of problems with relation to the boundary layer of air between the particles and the surrounding process atmosphere of air , steam or another gas , e . g . : biomass particles tend to stick together , biomass particles and contaminating particles tend to stick together , the exchange of heat energy and moisture at the surface of the particles is inefficient . traditionally , these problems are dealt with by applying shear forces to the flow of particles using a turbulent gas flow . alternatively , especially in cleaning and screening techniques , shear forces are applied to the particle flow by mechanical vibrations or washing water . it is the object of the present invention to provide a system and corresponding method to apply shear forces to the particle flow and the process atmosphere to overcome the above problems in a more efficient way than traditional techniques , using a novel kinetic technique . unlike the above mentioned traditional techniques , the invention is based on high - intensity sound or ultrasound waves created by means of a special device driven by pressurized gas such as atmospheric air , steam or other gases . high - intensity sound or ultrasound in gases leads to very high velocities and displacements of the gas molecules . i . e . a sound level of 160 db corresponds to a velocity of 4 . 5 m / sec and a displacement of 33 μm at a frequency of 22 . 000 hz . in other words , the kinetic energy of the gas molecules increases significantly . the distance between gas - molecules moving in one direction and having the maximal velocity and gas - molecules moving the opposite direction is given by half the wavelength of the ultrasound . the resulting effect is a very efficient separation of the fibre lumps into single fibres . applied to biomass particles , e . g . an air - borne flow of fibre lumps , the kinetic energy and the displacements create a field of shear forces in the fibres and thus tears the fibre lumps apart into single fibres . the same effect is obtained i . e . by applying high - intensity sound or ultrasound to biomass particles contaminated with adhering particles of bark and dirt or large particles with adhering smaller particles which are difficult to unstick by traditional means like mechanical vibration or washing water . in the following firstly , the application of the technique according to the present invention in a number of process steps within the manufacturing processes as illustrated in fig1 a - c is described . other applications within the area of manufacturing of biomass - based panel board products or within other product manufacturing processes characterized by the same problems and features as described above are included in the invention ; secondly , the effect of applying high - intensity sound or ultrasound to a flow of biomass - based particles will be described , using as an example the application of an aqueous solution of binder to an air - borne flow of dry fibres — or fibre lumps — in an mdf manufacturing process ; thirdly , a preferred embodiment of a device designed to create high - intensity ultrasound , driven by a pressurized gas , will be described . cleaning / screening from sand , dirt and other contaminants is usually made by means of water ( chip washing in the mdf process , 1 a - 2 ) or mechanical sifters / screeners ( chips , particles for particleboards or strands for osb , fig1 b - 2 , 1 c - 3 ). using the ultrasound device to replace or support the traditional cleaning techniques will improve the cleaning effect as the ultrasound efficiently unsticks / removes dirt particles from the biomass particle surface as described below . high intensive sound or ultrasound in gases leads to very high velocities and displacements of the gas molecules . for example , 160 db corresponds to a particle velocity of 4 . 5 m / s and a displacement of 33 μm at 22 . 000 hz . in other words , the kinetic energy of the molecules has been increased significantly . the distance between gas - molecules moving in one direction and having the maximal velocity and gas - molecules moving the opposite direction is given by half the wavelength of the ultrasound . the resulting effect is a very efficient separation of the fibre lumps into single fibres . also , for separation of particles of various size and shape as used in multilayer particleboards or oriented strand boards , the separating effect of the high intensity ultrasound can be utilised to support the effect of the mechanical sifters / screeners ( fig1 b - 2 , 1 b - 5 , 1 c - 3 ). in the process of refining biomass chips in a pressurised refiner , ( fig1 a - 3 ), saturated steam at high pressure is fed into the cavity between the refiner discs . feeding the steam into the refiner through one or more of the above mentioned ultrasound generators directed into the refiner cavity , a high - intensive ultrasound level is established which assists a fully or partly disintegration of the biomass chips . as a result , the mechanical energy used in the refiner can be reduced significantly . besides , the high - intensity ultrasound helps keep the refiner discs clean from resin and other contaminations and to prevent clogging up the grooves of the refiner disc . in the traditional mdf manufacturing process the wet fibre furnish from the refiner is fed into the so - called blowline and an aqueous solution of binder is added ( fig1 a - 4 ). as well known , the fibre furnish in this stage forms large lumps , and consequently the application of binder is very inhomogeneous . using one or more ultrasound devices at various positions along the blowline , preferably both before and after the application of binder , will produce a very homogeneous distribution of the binder onto the single fibres . traditional drying of biomass particles such as fibres ( fig1 a - 5 ), particles ( fig1 b - 4 ), strands ( fig1 c - 4 ) or the like by means of hot air or steam is hindered by the so - called laminar sub - layer at the surface of the drying particles . independently of the type of dryer and thermal conditions in relation hereto , a basic condition will always command and limit the efficiency of the drying process : namely the energy and mass ( moisture ) exchange at the surface of the biomass particles ( i . e . heat in , moisture out ). the energy and mass exchange at the surface of the biomass particles is largely determined by the character of the gas flow and more specifically by the character or presence of the so - called laminar sub - layer . heat transport across the laminar sub layer will be by conduction or radiation , due to the nature of laminar flow while mass transport across the laminar sub layer will be solely by diffusion . this will be explained in greater detail in a later part of this chapter . it is an object of the present invention to provide a system and a corresponding method for drying a flow of biomass particles that solves ( among other things ) the above - mentioned shortcomings of prior art . the ultrasound technique removes this sub layer very efficiently and thus facilitates the exchange of heat and water vapour ( heat in , water vapour out ) significantly . the technique can be applied in all kinds of dryers ( drum dryers for larger particles , tube dryers for fibres ) and drying medium ( hot air or steam ). it is a further object of the present invention to provide an efficient drying of biomass particles using less energy than required by traditional processes . yet another object is to provide methods and equipment for drying of biomass particles enabling acceleration of the drying process compared to traditional processes . these objects ( among others ) are solved by a system for drying a flow of biomass particles , the system comprising : a dryer adapted to receive a flow of wet biomass particles and to dry the flow of wet biomass particles using a gaseous drying medium , wherein the dryer comprises at least one ultrasound device ( 301 ) or is in connection with at least one ultrasound device ( 301 ), where said at least one ultrasound device is adapted , during use , to supply at least a part of said gaseous drying medium to said flow of biomass particles . high intensive sound or ultrasound in gases leads to very high velocities and displacements of the gas molecules . for example , 160 db corresponds to a particle velocity of 4 . 5 m / s and a displacement of 33 μm at 22 . 000 hz . in other words , the kinetic energy of the molecules has been increased significantly . the distance between gas - molecules moving in one direction and having the maximal velocity and gas - molecules moving the opposite direction is given by half the wavelength of the ultrasound . the resulting effect is a very efficient separation of the fibre lumps into single fibres . in this way , a more efficient drying of the biomass particles is obtained , which results in a significant reduction in drying time and power consumption of the dryer . the reason is that the ultrasound minimizes or eliminates the laminar sub - layer , as described elsewhere , where the absence of the sub - layer enables a much enhanced heat and moisture exchange . the application of ultrasound ( 201 ) intensifies very efficiently the energy and mass exchange at the surface of the biomass particles and thus helps to reduce the drying time of the biomass particles , to reduce the volume of the dryer vessel , to reduce the surplus volume of drying medium needed to establish heat and mass transfer at the surface of the biomass particles under non - optimal conditions , and to improve the thermal efficiency of the process significantly . in a preferred embodiment , at least one ultrasound device is activated by at least a part of the gaseous drying medium . in this way , the large amount of energy typically present in such systems is utilized in generating ultrasound with a high effect and efficiency . further , since the gaseous drying medium is present in traditional systems already less modifications are needed for modifying traditional system into applying the present invention . in one embodiment , the gaseous drying medium is hot air or superheated steam . the present invention also relates to a method of drying a flow of biomass particles , the method comprising the step of : drying a received flow of wet biomass particles using a gaseous drying medium , wherein the step of drying comprises supplying at least a part of said gaseous drying medium to said flow of biomass particles using at least one ultrasound device ( fig4 , 301 ). in one embodiment , the flow of biomass particles is an airborne flow of fibres ( fig1 a - 4 , fig4 ). in one embodiment , the system further comprises binder application means for applying a binder solution to said flow of biomass particles before they are received in said dryer ( fig1 a - 4 ). in one embodiment , the flow of biomass particles is a mechanically activated flow of larger biomass particles such as particles for traditional particleboards ( fig1 b - 6 ) or strands for oriented strand boards , ( fig1 c - 5 ) or similar biomass - based products . in one embodiment , the dryer comprises a plurality of ultrasonic devices for supplying at least a part of said gaseous medium ( fig4 , 301 ). in one embodiment , the gaseous drying medium is hot air or superheated steam . in one embodiment , the system further comprises binder application means for applying a binder solution comprising binder droplets to the flow of biomass particles wherein the binder application means comprises at least one ultrasound device adapted , during use , to apply ultrasound to the flow of biomass particles before the binder solution is applied , whereby particle lumps , if any , in the flow of biomass particles are separated , or substantially at the same time that the binder solution is applied whereby particle lumps , if any , in the flow of biomass particles are separated and binder droplets are reduced to a smaller size . application of binder to the biomass particles after drying is limited by the access of the binder droplets from the spraying device to the single particles . also in this stage of the process mdf fibres tend to agglomerate into large lumps and thus prevent contact with the binder droplets . to achieve a homogeneous distribution of the binder droplets in a device used in the process after the dryer , these fibre lumps are to be separated into single fibres . at the same time , the binder preferably has to be atomised into droplets of a proper size in relation to the size of the fibres and they have to be brought into contact with the fibres to ensure a homogeneous distribution on the fibre surfaces . besides , the binder droplets preferably have to have a specific viscosity to adhere sufficiently to the fibre surfaces without becoming fully absorbed , and they must be prevented from sticking to the walls of the device . unlike the blow - line application of binder ( fig1 a - 4 ), the dry application of binder after the dryer does not offer the opportunity of homogenizing the mixture during the long travel through the tube dryer . therefore all the above mentioned conditions in relation to traditional application of binder to dry fibres are to be satisfied within little time and space . in the following , a novel method based on a different kinetic technique and an equipment to handle the fibres and binder droplets will be disclosed . it is an object of the present invention to provide a system ( and corresponding method ) for applying a binder to an airborne flow of fibres , that solves ( among other things ) the above - mentioned shortcomings of prior art . it is a further object to provide a method and system enabling efficient separation of fibres in an airflow while applying binder to the fibres . another object is to enable a more uniform and effective distribution of binder to fibres in an airflow . an additional object of the present invention is to improve the probability of collision between fibres and binder droplets in an air stream in order to further homogenize the binder distribution . these objects ( among others ) are solved by a system ( fig4 ) for applying a binder to an airborne flow of fibres ( 105 ), the system comprising : means for applying a binder solution comprising binder droplets to an airborne flow of fibres , wherein said system further comprises at least one ultrasound device adapted ( 301 ), during use , to apply ultrasound to the airborne flow of fibres ( 105 ) before the binder solution is applied ( 401 ) whereby fibre lumps ( fig2 a - d , 201 , 202 , 204 ), if any , in the airborne flow of fibres are separated , or substantially at the same time that the binder solution is applied whereby fibre lumps , if any , in the airborne flow of fibres are separated and binder droplets are reduced to a smaller size ( fig2 b - d , 201 , 203 ). like the known methods , the invention is based on the application of shear forces to split the fibre lumps and binder droplets . however , according to the present invention , the shear forces are not produced by means of turbulent air flow , but by means of ultrasonic waves created by means of a special device driven by a pressurized gas such as atmospheric air , steam or other gases . high intensive sound or ultrasound in gases leads to very high velocities and displacements of the gas molecules . for example , 160 db corresponds to a particle velocity of 4 . 5 m / s and a displacement of 33 μm at 22 . 000 hz . in other words , the kinetic energy of the molecules has been increased significantly . the distance between gas - molecules moving in one direction and having the maximal velocity and gas - molecules moving the opposite direction is given by half the wavelength of the ultrasound . the resulting effect is a very efficient separation of the fibre lumps into single fibres . in fig2 b ultrasound ( 201 ) is applied to the large / normal sized binder droplets ( 203 ) e . g . from a spraying nozzle ( not shown ; see e . g . fig4 ) where the movement of the gas - molecules tears the droplets into smaller and finely distributed droplets ( 203 ). at 22 khz , 160 db the maximum displacement of the gas - molecules will be 33 μm , see 204 in fig2 d . in fig2 c and 2 d the single fibres ( 202 ), typically having a diameter in the range of 20 - 50 μm , and the finely distributed binder droplets ( 203 ), both oscillating with a frequency of 22 khz due to the application of ultrasound , are brought into close contact at high velocity to facilitate the contact . establishing the contact between fibres ( 202 ) and binder droplets ( 203 ) as well as the exchange of energy and moisture between the particles and the atmosphere is governed by the conditions as summarized below . in one embodiment , the pressurized gas is in a first step cooled to a low temperature , preferably below 3 ° c ., and dried , and in a second step heated up to a temperature below 100 ° c ., preferably 50 - 70 ° c . thereby drying the surface of the fibres and the binder droplets on the fibre surface . in one embodiment , steam is used as a part of the pressurized gas to drive the ultrasonic device and to add moisture and heat to the fibres as further a means to control the total moisture content and temperature of the fibre furnish . in one embodiment , an equal electrostatic potential (++ or ÷÷) is applied to both the means for applying a binder solution and to walls of said system , in which the binder is applied to the fibres . in one embodiment , a plurality of ultrasonic devices ( 301 ) are installed as one or several rings along walls of a duct , where the binder solution is applied to the airborne flow of fibres . in one embodiment , the ultrasonic device ( s ) ( 301 ) and the means for applying a binder solution ( 401 ) are used in combination with a section of a duct shaped as a venturi nozzle , where the duct is positioned where the binder solution is applied to the airborne flow of fibres . in one embodiment , the means for applying a binder solution comprises at least one spray nozzle ( 401 ) and in that the at least one ultrasonic device ( 301 ) are integrated with the at least one spray nozzle ( 401 ). in one embodiment , the at least one ultrasound device ( 301 ) and the means for applying a binder ( 401 ) solution are directed in the same direction as the transport air flow . in one embodiment , the binder is applied in a place in a vertically or approximately vertically oriented body of angular or tubular or conical shape , where the transport of the fibres take place mainly by gravity , and where the at least one ultrasound device ( 301 ) or at least a part of the at least one ultrasound device are oriented in an upward angle to meet the fibres falling from a top inlet of fibres to a fibre outlet at the bottom of the device . in one embodiment , a number of the ultrasound devices ( 301 ) are oriented in an angle to the length axis of the system ( i . e . the ultrasound devices are ‘ tilted ’) and the main transport direction as to create a spiral - shaped flow of the fibres . according to another aspect , the dryer comprises one or more ultrasound generators ( 301 ). in this way , a more efficient drying of the fibres is obtained , which result in a significant reduction in power consumption of the dryer . the reason is that the ultrasound minimizes or eliminates the laminar sub - layer , as described elsewhere , where the absence of the sub - layer enables a much enhanced heat and moisture exchange . this aspect may be utilized in connection with the use of ultrasound to separate fibres and / or reduce the size of the binder droplets or alone . the method and embodiments thereof correspond to the device and embodiments thereof and have the same advantages for the same reasons . sorting out of large and heavy lumps of fibres fig1 a - 6 , which frequently cause damage of the steel belts in the continuous hot press is usually made in an airborne sifter , the so - called z - sifter , a vertical , zig - zag - shaped duct with an upstream flow of air . experiments have demonstrated the ability of the ultrasound technique to more efficiently separate these fibre lumps into single fibres . thus , the technique is considered a powerful tool to improve or to replace the z - sifter . the use of the ultrasound technique in the process of mat or sheet forming ( fig1 a - 7 ) profits from the ability to establish a homogeneous airborne suspension of single fibres and , as the fibres are statically loaded by oscillation , a three - dimensional orientation of the single fibres and as a result a mat or a felt with improved properties is achieved . for nearly all practically occurring gas flows , the flow regime will be turbulent in the entirety of the flow volume , except for a layer covering all surfaces wherein the flow regime is laminar ( see e . g . 313 in fig3 a ). this layer is often called the laminar sub layer . the thickness of this layer is a decreasing function of the reynolds number of the flow , i . e . at high flow velocities , the thickness of the laminar sub layer will decrease . fig3 a schematically illustrates a ( turbulent ) flow over a surface of an object according to prior art , i . e . when no ultrasound is applied . shown is a surface ( 314 ) of an object with a gas ( 500 ) surrounding or contacting the surface ( 314 ). as mentioned , thermal energy can be transported through gas by conduction and also by the movement of the gas from one region to another . this process of heat transfer associated with gas movement is called convection . when the gas motion is caused only by buoyancy forces set up by temperature differences , the process is normally referred to as natural or free convection ; but if the gas motion is caused by some other mechanism , such as a fan or the like , it is called forced convection . with a condition of forced convection there will be a laminar boundary layer ( 311 ) near to the surface ( 314 ). the thickness of this layer is a decreasing function of the reynolds number of the flow , so that at high flow velocities , the thickness of the laminar boundary layer ( 311 ) will decrease . when the flow becomes turbulent the layer are divided into a turbulent boundary layer ( 312 ) and a laminar sublayer ( 313 ). for nearly all practically occurring gas flows , the flow regime will be turbulent in the entirety of the streaming volume , except for the laminar sub - layer ( 313 ) covering the surface ( 314 ) wherein the flow regime is laminar . considering a gas molecule or a particle ( 315 ) in the laminar sub - layer ( 313 ), the velocity ( 316 ) will be substantially parallel to the surface ( 314 ) and equal to the velocity of the laminar sub - layer ( 313 ). heat transport across the laminar sub - layer will be by conduction or radiation , due to the nature of laminar flow . mass transport across the laminar sub - layer will be solely by diffusion . the presence of the laminar sub - layer ( 313 ) does not provide optimal or efficient heat transfer or increased mass transport . any mass transport across the sub - layer has to be by diffusion , and therefore often be the final limiting factor in an overall mass transport . this limits the interaction between binder droplets and fibres when binder droplets are dispersed in the gas and the object is a fibre . further , the droplets are generally of a greater size and not as finely distributed . fig3 b schematically shows a flow over a surface of an object according to the present invention , where the effect of applying high intensity sound or ultrasound to / in air / gas ( 500 ) surrounding or contacting a surface of an object is illustrated . more specifically , fig3 b illustrates the conditions when a surface ( 314 ) of a fibre is applied with high intensity sound or ultrasound . again consider a gas molecule / particle ( 315 ) in the same spatial position in the laminar layer as shown in fig2 a ; the velocity ( 316 ) will be substantially parallel to the surface ( 314 ) and equal to the velocity of the laminar layer prior applying ultrasound . in the direction of the emitted sound field to the surface ( 314 ) in fig3 b , the oscillating velocity of the molecule ( 315 ) has been increased significantly as indicated by arrows ( 317 ). as an example , a maximum velocity of v = 4 . 5 m / sec and a displacement of +/− 32 μm will be achieved where the ultrasound frequency f = 22 khz and the sound intensity = 160 db . the corresponding ( vertical ) displacement in fig3 b is substantially since the molecule follows the horizontal air stream along the surface . in result , the ultrasound will establish a forced heat flow from the surface to surrounding gas / air ( 500 ) by increasing the conduction by minimizing the laminar sub - layer . the sound intensity is in one embodiment 100 db or larger . in another embodiment , the sound intensity is 140 db or larger . preferably , the sound intensity is selected from the range of approximately 140 - 160 db . the sound intensity may be above 160 db . the minimization of the sub - laminar layer has the effect that the mass trans - port between the surface of the fibre and the gas containing binder droplets is enhanced whereby a greater interaction between binder droplets and fibres is obtained . the key method and device to be used in the invention shall be briefly described below . according to the present invention , ultrasound is applied to the fibres by a suitable ultrasound generator ( 301 ) at various stages of the process of manufacturing biomass - based panel board products . in this way , the agglomerated particle lumps are transformed into a homogeneous flow of single particles using ultrasound from one or more ultrasound devices driven by pressurized air , steam or another pressurized gas . many types of ultrasound generators ( 301 ) are suitable for this and one preferred well known ultrasound generator is explained in connection with fig5 a - 5 f . fig5 a schematically illustrates a preferred embodiment of a device ( 301 ) for generating high intensity sound or ultrasound . pressurized gas is passed from a tube or chamber ( 309 ) through a passage ( 303 ) defined by the outer part ( 305 ) and the inner part ( 306 ) to an opening ( 302 ), from which the gas is discharged in a jet towards a cavity ( 304 ) provided in the inner part ( 306 ). if the gas pressure is sufficiently high then oscillations are generated in the gas fed to the cavity ( 304 ) at a frequency defined by the dimensions of the cavity ( 304 ) and the opening ( 302 ). an ultrasound device of the type shown in fig5 a is able to generate ultrasonic acoustic pressure of up to 160 db spl at a gas pressure of about 4 atmospheres . the ultrasound device may e . g . be made from brass , aluminium or stainless steel or in any other sufficiently hard material to withstand the acoustic pressure and temperature to which the device is subjected during use . the method of operation is also shown in fig3 a , in which the generated ultrasound 307 is directed towards the surface 308 of the fibres and binder droplets . please note , that the pressurized gas can be different than the gas that contacts or surrounds the object . fig5 b shows an embodiment of an ultrasound device in form of a disc - shaped jet . shown is a preferred embodiment of an ultrasound device ( 301 ), i . e . a so - called disc jet . the device ( 301 ) comprises an annular outer part ( 305 ) and a cylindrical inner part ( 306 ), in which an annular cavity ( 304 ) is recessed . through an annular gas passage ( 303 ) gases may be diffused to the annular opening ( 302 ) from which it may be conveyed to the cavity ( 304 ). the outer part ( 305 ) may be adjustable in relation to the inner part ( 306 ), e . g . by providing a thread or another adjusting device ( not shown ) in the bottom of the outer part ( 305 ), which further may comprise fastening means ( not shown ) for locking the outer part ( 305 ) in relation to the inner part ( 306 ), when the desired interval there between has been obtained . such an ultrasound device may generate a frequency of about 22 khz at a gas pressure of 4 atmospheres . the molecules of the gas are thus able to migrate up to 36 μm about 22 , 000 times per second at a maximum velocity of 4 . 5 m / s . these values are merely included to give an idea of the size and proportions of the ultrasound device and by no means limit of the shown embodiment . fig5 c is a sectional view along the diameter of the ultrasound device ( 301 ) in fig5 b illustrating the shape of the opening ( 302 ), the gas passage ( 303 ) and the cavity ( 304 ) more clearly . it is further apparent that the opening ( 302 ) is annular . the gas passage ( 303 ) and the opening ( 302 ) are defined by the substantially annular outer part ( 305 ) and the cylindrical inner part ( 306 ) arranged therein . the gas jet discharged from the opening ( 302 ) hits the substantially circumferential cavity ( 304 ) formed in the inner part ( 306 ), and then exits the ultrasound device ( 301 ). as previously mentioned the outer part ( 305 ) defines the exterior of the gas passage ( 303 ) and is further bevelled at an angle of about 30 ° along the outer surface of its inner circumference forming the opening of the ultrasound device , wherefrom the gas jet may expand when diffused . jointly with a corresponding bevelling of about 60 ° on the inner surface of the inner circumference , the above bevelling forms an acute - angled circumferential edge defining the opening ( 302 ) externally . the inner part ( 306 ) has a bevelling of about 45 ° in its outer circumference facing the opening and internally defining the opening ( 302 ). the outer part ( 305 ) may be adjusted in relation to the inner part ( 306 ), whereby the pressure of the gas jet hitting the cavity ( 304 ) may be adjusted . the top of the inner part ( 306 ), in which the cavity ( 304 ) is recessed , is also bevelled at an angle of about 45 ° to allow the oscillating gas jet to expand at the opening of the ultrasound device . fig5 d illustrates an alternative embodiment of a ultrasound device , which is shaped as an elongated body . shown is an ultrasound device comprising an elongated substantially rail - shaped body ( 301 ), where the body is functionally equivalent with the embodiments shown in fig5 a and 5 b , respectively . in this embodiment the outer part comprises two separate rail - shaped portions ( 305 a ) and ( 305 b ), which jointly with the rail - shaped inner part ( 306 ) form a ultrasound device ( 301 ). two gas passages ( 303 a ) and ( 303 b ) are provided between the two portions ( 305 a ) and ( 305 b ) of the outer part ( 305 ) and the inner part ( 306 ). each of said gas passages has an opening ( 302 a ), ( 302 b ), respectively , conveying emitted gas from the gas passages ( 303 a ) and ( 303 b ) to two cavities ( 304 a ), ( 304 b ) provided in the inner part ( 306 ). one advantage of this embodiment is that a rail - shaped body is able to coat a far larger surface area than a circular body . another advantage of this embodiment is that the ultrasound device may be made in an extruding process , whereby the cost of materials is reduced . fig5 e shows an ultrasound device of the same type as in fig5 d but shaped as a closed curve . the embodiment of the gas device shown in fig5 d does not have to be rectilinear . fig5 e shows a rail - shaped body ( 301 ) shaped as three circular , separate rings . the outer ring defines an outermost part ( 305 a ), the middle ring defines the inner part ( 306 ) and the inner ring defines an innermost outer part ( 305 b ). the three parts of the ultrasound device jointly form a cross section as shown in the embodiment in fig5 d , wherein two cavities ( 304 a ) and ( 304 b ) are provided in the inner part , an wherein the space between the outermost outer part ( 305 a ) and the inner part ( 306 ) defines an outer gas passage ( 303 a ) and an outer opening ( 302 a ), respectively , and the space between the inner part ( 306 ) and the innermost outer part ( 305 b ) defines an inner gas passage ( 304 b ) and an inner opening ( 302 b ), respectively . this embodiment of an ultrasound device is able to coat a very large area at a time and thus treat the surface of large objects . fig5 f shows an ultrasound device of the same type as in fig5 d but shaped as an open curve . as shown it is also possible to form an ultrasound device of this type as an open curve . in this embodiment the functional parts correspond to those shown in fig5 d and other details appear from this portion of the description for which reason reference is made thereto . likewise it is also possible to form an ultrasound device with only one opening as described in fig5 b . an ultrasound device shaped as an open curve is applicable where the surfaces of the treated object have unusually shapes . a system is envisaged in which a plurality of ultrasound devices shaped as different open curves are arranged in an apparatus according to the invention . although the invention has been described in the above mainly in relation to processes of manufacturing various kinds of board products from biomass raw material such as solid wood , chips from solid wood , wood residuals , recycling wood or agricultural crop residuals , it shall be noted that the invention can also be applied to other biomass product manufacturing processes or manufacturing processes on the basis of other raw materials , as far as these processes are characterized by the same problems and features as described in the summary and scope of the invention . more specifically , the following examples can be mentioned : drying of bulk material , as e . g . grain , feedstock , cereal products etc ; sifting , cleaning and grading of granular material , as e . g . inorganic materials like stone , gravel , sand , cement or organic material like chips , particles , fibres or dust to be utilized for other processes than panel board and related products ; forming of mats , sheets or other shapes of products which require a specific structure and orientation of particles , like dry forming of paper , cardboard or non - woven organic sheets as e . g . tissues , napkins , nappies etc , or inorganic mats or sheets , e . g . insulating products like glass wool and similar products . thus the invention is not restricted to the described and shown embodiment , but may also be embodied in other ways within the scope of the subject - matter defined in the following claims . in the claims , any reference signs placed between parentheses shall not be constructed as limiting the claim . the word “ comprising ” does not exclude the presence of elements or steps other than those listed in a claim . the word “ a ” or “ an ” preceding an element does not exclude the presence of a plurality of such elements .	1
fig1 shows the physical training device 200 in use . attachment hooks 202 and 203 are attached to attachment rings 304 and 305 of ankle fasteners 300 . the attachment hooks 204 and 205 are attached to the curved attachment loops 404 and 405 of the toe fasteners 400 . a shoulder harness 234 is properly positioned to protect the user &# 39 ; s shoulders from being impacted by the elastic , such as rubber cords 206 and 207 . the user athlete is shown properly grasping the handles 250 , 251 in an exercise position . all forward thrusts by the arms will keep the shoulder harness in place . the training device 200 is designed for an athlete , such as a boxer . as shown in fig2 , a series of elastic cords , such as surgical rubber tubes form the main structure of training device 200 . as shown in fig2 , attachment hook 202 attaches to one end of a rubber cord 206 . attachment hook 204 attaches to one end of a rubber cord 208 . attachment hook 203 attaches to one end of a rubber cord 207 . attachment hook 205 attaches to one end of a rubber cord 209 . a rectangular web piece 210 has sleeves 212 and 214 at both ends . rubber cords 206 and 208 are contained by sleeves 212 and 214 , respectively . a rectangular web piece 211 has sleeves 213 and 215 at both ends . rubber cords 207 and 209 are contained by sleeves 213 and 215 , respectively . a web piece 216 , with sleeves 218 and 220 , contains rubber cords 206 and 207 . web piece 222 , with sleeves 224 and 226 , contains rubber cords 206 and 208 . web piece 223 , with sleeves 225 and 227 , contains rubber cords 207 and 209 . web piece 228 , with sleeves 230 and 232 , contains rubber cords 206 and 207 . a shoulder harness 234 made of a soft material to protect the shoulders from being impacted by the rubber cords , has sleeves 236 and 238 . rubber cords 206 and 207 are fed through and contained by sleeves 236 and 238 , respectively . a web piece 240 , with sleeves 242 and 244 , contains rubber cords 206 and 208 . a web piece 241 , with sleeves 243 and 245 , contains rubber cords 207 and 209 . attachment hook 246 attaches to the other end of rubber cord 206 . attachment hook 248 attaches to the other end of rubber cord 208 . attachment hook 247 attaches to the other end of rubber cord 207 . attachment hook 249 attaches to the other end of rubber cord 209 . a pair of plastic handles 250 , 251 have u - shaped portions 252 and 253 and straight portions 254 and 255 . attachment hooks 246 and 248 attach rubber cords 206 and 208 to u - shaped portion 252 of handle 251 . attachment hooks 247 and 249 attach rubber cords 207 and 209 to u - shaped portion 253 of handle 250 . the straight portions 254 and 255 may be fitted with a soft grip . foot attachments and fasteners are shown in fig3 - 5 . the foot attachments are left and right ankle fastener 300 and 301 and toe fasteners 400 , 401 , interlaced with the user &# 39 ; s shoelaces . as shown in fig3 , the ankle fastener 300 has an upper section 302 , which is a mock up of a ring of expandable material or a velcro ™ fastening strip or equivalent structure , that slips over a user &# 39 ; s ankle . the interior surface 308 of the ring is thickly padded . attached to the exterior surface 310 of the ring is an attachment loop 304 . attachment hook 202 of rubber cord 206 attaches to attachment loop 304 . a heel strap 306 is an integral part of the upper section 302 by being attached to the interior surface 308 of the upper section 302 . as can be seen in fig4 , a toe fastener 400 is preferably made of a single piece of plastic , which has of a flat portion 402 and a curved attachment loop 404 . the flat portion 402 contains shoelace holes 406 , 408 , and 410 , which allow the toe fastener 400 to be interlaced with the user &# 39 ; s shoelaces at the toe 401 of the shoe 403 . attachment hook 204 of end 208 attaches to curved attachment loop 404 , for example . fig5 shows the toe fastener 400 attached to the toe section 401 of a shoe 403 by the shoelaces 405 . this invention provides a physical training device 200 that facilitates a workout where the aerobic efforts of the user &# 39 ; s legs and feet simultaneously impacts the effort required by the arms . fig1 shows the physical training device 200 in operation . the physical training device 200 is particularly applicable to , but not limited to , training for boxing , tennis , baseball , basketball , football , and aerobic conditioning . cords 206 , 207 , 208 , and 209 which may be surgical rubber tubing may be made in small , medium , and large lengths . the thickness of the rubber for rubber cords 206 , 207 , 208 , and 209 can also be made in light , medium , and heavy thicknesses for different workout levels . the thickness of the rubber for rubber cords 206 , 207 , 208 , and 209 does not need to be the same for each . for example , a right handed person may want rubber cords 206 and 208 to be thicker than rubber cords 207 and 209 . a person may also want different thicknesses for rubber cords 206 and 208 . for example , a person may want 206 to be of medium thickness and 208 to be of heavy thickness for a workout level between medium and heavy . webbing pieces 210 , 211 , 216 , 222 , 223 , 228 , 240 , and 241 can either be fixed in place or adjustable . to use the physical training device , a user will first put on ankle fasteners 300 and 301 by placing the feet through the upper sections 302 and 303 and resting the heels against heel straps such as 306 . the user will then put on his shoes and interlace the toe fasteners 400 and 401 into the shoelaces of their shoes 403 at the toe 401 . the user then connects attachment hooks 202 and 203 to attachment rings 304 and 305 , and attachment hooks 204 and 205 to curved attachment loops 404 and 405 . the user will then grasp plastic handles 250 and 251 and manipulate the arms to position shoulder harness 234 in a comfortable location . this physical training device 200 exercises several muscle groups at the same time . when the user makes a forward or lateral step with the right foot , web pieces 216 and 218 hold rubber cords 206 and 207 together , forcing them to expand , increasing the amount of resistance , and thus increasing the force required to make a step . this step will also force rubber cord 208 to expand and additionally increase the amount of resistance . in turn , the expansion of rubber cords 206 and 208 will increase the resistance to the user &# 39 ; s attempts to fully extend the arm in a punching motion . when a user extends the right arm forward in a punching motion , for example , rubber cords 206 and 208 will expand and increase the amount of resistance felt . this increased resistance will require the user to apply additional downward force in order to keep their foot planted . when the user throws a punch , they will likely be simultaneously extending their arm and leg , which will simultaneously increase the amount of force required to fully extend the arm and leg , due to the increased resistance provided by the expansion of rubber cords 206 and 208 . there are a great number of exercises that can be done with physical training device 200 , beyond the motions described above . a user can perform any numbers of combination of arm and leg motions in conjunction with one another . the training device 200 is uniquely adaptable to the great variety of arm and leg movements possible in a number of sports . various modifications of the invention are contemplated by the inventor , and they obviously will be resorted to by those skilled in the art without departing from the spirit and scope of the invention as hereinafter defined by the appended claims .	0
it is customary in the fertilizer industry to refer to nitrogen , phosphorus and potassium by their chemical symbols n , p and k , and to collectively refer to combinations containing them as npk fertilizers . the percentage of each are reported in terms of percent n , percent p 2 o 5 ( phosphorus pentoxide ) and percent k 2 o ( potassium oxide ) even though these elements are not present specifically in that form . polyphosphoric acid may be commercially obtained as may polyphosphate salts . potassium polyphoshpates may be prepared by reacting superphosphoric acid with a basic potassium compound such as potassium hydroxide , carbonate or bicarbonate . the distinction between meta -, pyro - and other polyphosphates from orthophosphates is well known and documented such as by u . s . pat . no . 3 , 856 , 500 and standard chemical texts . therefore , it would serve no useful purpose to attempt to discuss the chemical and physical properties of polyphosphoric acid , potassium or ammonium polyphosphates . however , because polyphosphates are relatively unstable and tend to convert back to orthophosphates in the presence of water , they should be used as soon as possible after being diluted for use as a foliar spray . the use of activated carbon as a promoter for increasing polyphosphate uptake is believed to be unique . activated carbon , because of its inertness and extremely high surface area , has been primarily utilized to absorb gases or to filter out impurities from solutions . activated carbon is inert and insoluble in aqueous solutions . it is therefore highly unexpected that this ingredient would , in some way , enable foliar plant tissues to absorb increased amounts of phosphorus from polyphosphates . also , there is evidence to show increased amounts of carbon in these plant tissues . whether it is the activated carbon that is absorbed is not known . it may be that the activated carbon combined with the polyphosphates serves in some way to enable a plant to absorb greater quantities of carbon dioxide from the atmosphere or , in the alternative , to better and more efficiently utilize the carbon dioxide when it is absorbed . the use of activated carbon alone does not show the same results regarding carbon uptake as does carbon combined with polyphosphates . the formulations are preferably prepared as a field solution concentrate which may subsequently be diluted with water just prior to using to provide the proper dosage . polyphosphoric acids may contain about 80 to 85 % by weight p 2 o 5 . on the other hand fertilizer grade potassium and ammonium polyphosphate blends may be prepared containing about 2 to 5 % nitrogen , 15 to 19 % phosphorus ( as p 2 o 5 ) and 15 to 19 % potassium ( as k 2 o ). depending upon the form of polyphosphate used , field solution concentrates may be prepared containing about 0 . 2 to 20 % by weight polyphosphate and a similar range , i . e . 0 . 2 to 20 % by weight , of activated carbon . however , the ratio of polyphosphate to carbon may vary anywhere from about 0 . 1 : 1 to 1 : 0 . 1 . preferably the polyphosphate will be either polyphosphoric acid or a blend of potassium and ammonium polyphosphates . the field solution concentrate is prepared by admixing the various components with sufficient water to form the desired concentration of ingredients . surfactants , wetting agents or other additives conventionally used in foliar sprays may also be added to the concentrate if desired . the field solution concentrate is adapted for use as a foliar spray by being diluted with the desired amount of water in a mixing tank or sprayer and thoroughly mixed just prior to application . dilution ratios may vary from as low as 5 volumes of water per volume of concentrate to as high as 200 volumes of water per volume of concentrate , i . e ., ratios of from 5 : 1 to 200 : 1 . generally speaking , dilution ratios from about 10 : 1 to 150 : 1 are preferable . since activated carbon is insoluble in aqueous solutions the spray solution should be agitated to keep the carbon particles in suspension . the spray equipment should be clean and appropriately sized to prevent plugging of the nozzles by carbon particles . since the npk dosage requirements may vary according to plant species , geographical location , climate , season of year , etc ., it is not possible to specify exact dosages . however , the amount to be applied to any given crop will be referred to herein as an &# 34 ; effective amount &# 34 ;. effective amounts may be determined by calculation or empirically by those having ordinary skill in the art . for this reason , the invention does not lie as much in specific concentrations as in the discovery that a combination of polyphosphates and activated carbon serves to increase phosphorus contents in plant tissues when the combination is applied to plants as a foliar spray . preferably , the composition of the invention is applied to immature crops as a foliar spray one or more times at intervals between germination of the plant and maturity of the fruit or crop to be obtained from the plant . the invention can best be illustrated by the following example which shows the unexpected increase in phosphorus into plant tissues . the example is for purposes of illustration and is not to be interpreted as defining the scope of the invention . sweet corn ( hybrid golden beauty ) was used to illustrate the invention due to the fact that corn plants grow rapidly in green house experiments and corn is not a nitrogen fixing plant and is therefore completely dependent on fertilizers and water applications . all plantings were treated in the same manner with the only variants being in the ingredients contained in the foliar sprays . the corn was planted , fed and watered as according to the following procedure . planting pots ( gallon plastic buckets ) were filled with 10 lbs . of silica sand . each bucket was wetted with 750 mls . of distilled water . the wetted sand in each pot was then planted with eight corn seeds at a depth of between about 3 / 4 &# 34 ; and 1 &# 34 ; with the sand covering the seeds being compressed slightly . the pots were watered weekly with hoagland &# 39 ; s # 2 nutrient solution and with distilled water as needed . hoagland &# 39 ; s # 2 nutrient solution is a combination of calcium nitrate tetrahydrate , potassium nitrate , magnesium sulfate heptahydrate , ammonium dihydrogen phosphate , boric acid , manganese sulfate monohydrate , zinc sulfate , cupric sulfate pentahydrate , sodium molybdate dihydrate and ferrous tartrate containing 196 ppm nitrogen as nitrate , 14 ppm nitrogen as ammonia , 160 ppm calcium , 234 ppm potassium , 48 ppm magnesium , 31 ppm phosphorus , 0 . 1 ppm manganese , 0 . 02 ppm zinc , 0 . 01 ppm copper , 0 . 01 ppm molybdenum , 1 . 0 ppm ironand 62 ppm sulfur . three weeks after germination replicates of four containers each were separated and the plants in each replicate were sprayed with a foliar spray until runoff . a different solution was used for each replicate as follows : replicate a was sprayed with a solution consisting of distilled water ( control ), replicate b was sprayed with a solution containing only activated carbon ( 0 . 2 gms carbon per 100 mls solution ), replicate c was sprayed with a solution containing only polyphosphates ( 0 . 06 ml polyphosphoric acid per 100 mls solution ) and replicate d was sprayed with a solution containing both polyphosphates and activated carbon ( 0 . 2 gms carbon and 0 . 06 ml polyphosphoric acid per 100 mls solution ). eight weeks after germination the plants were harvested and the roots were cut from the foliage . the harvested foliage and roots were washed in distilled water to remove all foreign matter and were then dried in an oven maintained at 75 degrees c . until completely dry . the foliage was weighed and then analyzed for phosphorus and carbon content . the roots were also analyzed for phosphorus content . although four containers were used for each replicate , the results listed in the following table are an average of the four containers which are not reported individually . table i______________________________________ % change in plant phosphorusreplicate foliage roots______________________________________a ( control ) 0 0b ( carbon ) + 0 . 009 - 0 . 13c ( polyphosphate ) + 0 . 009 + 0 . 12d ( carbon + polyphosphate ) + 0 . 026 + 0 . 22______________________________________ the increase in phosphorus content in both foliage and roots is clearly evident from replicate d results . the above description sets forth the invention in the best mode presently available .	2
fig1 is a block diagram of the invention system 100 for improving media data transmission from a mobile device 101 to a recipient device 107 . it is intended that two or more communications networks in wireless communications interface 102 will establish communications sessions with mobile device 101 for the purpose of forming , at least initially , parallel , continuous and simultaneous data packet streams that are transmitted to recipient device 107 . mobile device 101 is a wireless communication device capable of establishing and maintaining the parallel transmission paths just described and is also capable of establishing wireless telephone communications with recipient device 107 . communication network 103 comprises a cellular communication system including its antenna communications devices and its extensive system of communication connection assurance . communication network 105 comprises a wi - fi network comprising a base station and wireless access points establishing a local broadcasting range . communication network 104 comprises a dect radio system equipped with means for establishing data communications with recipient device 107 . peer to peer network 106 ( shown in broken lines ) comprises a direct wireless data packet communication session between mobile device 101 and recipient device 107 . networks 103 , 104 and 105 are adapted to connect to a packet computer network 109 ( such as an internet protocol network ) whereby the packetized media data stream formed at mobile device 101 is transmitted to a recipient interface 108 , which may or may not include intervening communications networks such as those found in interface 102 . wi - fi network 105 may bypass network 109 by using a local protocol for transmitting packetized data between local users of a wi - fi network similar to such transmissions in peer to peer network 106 . fig2 is a high level flow diagram of the invention system . step 120 causes a mobile device as described above to establish parallel and simultaneous communications sessions with one or more of the wireless communications networks described above and to transmit a packetized media data stream to a recipient device , duplicating the transmitted packets along parallel communication paths . step 122 causes a recipient device , comprising a microprocessor and control program , to execute a coordination function to evaluate arrived packets . the coordination function in one form compares timestamps of duplicate packets to assure that such packets are in fact duplicates . the coordination function further compares transmission times from sampled sets of duplicate arrived packets and determines by averaging which of the communications networks has transmitted the media data stream at the fastest overall rate and which of the communications networks has transmitted data at the slowest overall rate . the recipient device in step 124 transmits to the mobile device either or both of said transmission times and the determination of the fastest and / or slowest communications network . in step 126 , the mobile device acts to terminate communication sessions with a slowest rate communication network and determines if sessions with all but one of the communications networks have been terminated . if all but one have not been terminated , step 126 returns the system to step 122 . if all but one communications sessions have been terminated , the mobile device completes transmission of the media data stream to the recipient device in step 128 . in a preferred embodiment of the invention , a determination is made by the invention system that transmission of data packets in a first communications network are more reliable than transmission of data packets by way of other communications networks , all of which a plurality of communications networks current maintain communications sessions with the mobile device described above . in making that determination , the mobile device stores reliability information received from the recipient device concerning previously transmitted data packets . in a first specific example , the recipient device determines packet loss for a predetermined number of packets as indicated by expected packet sequence numbers for each data packet stream received from each communications networks from and with which the mobile device has established communications and which communication networks the recipient device has also established communications . the recipient device operates to determine which communications network &# 39 ; s transmission of data packets has resulted in the lowest number of lost data packets and this result is transmitted to the mobile device , whereupon the mobile device identifies said lowest loss communication network as the most reliable media data stream and acts to terminate communications with other communications networks . in a second specific example , the recipient device determines the strongest signal strength of wireless communications links between the recipient device and each of said communications networks for a predetermined time or over the course of receiving a predetermined number of data packets from the mobile device in parallel over multiple communications networks . said determination of a strongest signal for a communication network is transmitted to the mobile device , whereupon the mobile device identifies said strongest signal strength for a communication network connected with the recipient device as the most reliable media data stream and acts to terminate communications with other communications networks . in a third specific example , the mobile device determines the strongest signal strength of wireless communications links between the mobile device and each of said communications networks for a predetermined time or over the course of transmitting a predetermined number of data packets to the recipient device in parallel over multiple communications networks . said determination of a strongest signal for a communication network is acted upon by the mobile device , whereby the mobile device identifies said strongest signal strength for a communication network connected with the mobile device as the most reliable media data stream and acts to terminate communications with other communications networks . in a fourth specific example , the mobile device obtains the recipient device determination of strongest signal communication network as in the second specific example and also determines the strongest signal strength of wireless communications links between the mobile device as in the third specific example . if the recipient device has determined that a first communications network is the strongest signal network and the mobile device has determined that a second communications network is the strongest signal network for the mobile device , the mobile device identifies said strongest signal strength for a communication network connected with the mobile device as the most reliable media data stream and acts to terminate communications with other communications networks . alternately , the mobile device identifies said strongest signal strength for a communication network connected with the reliable device as the most reliable media data stream and acts to terminate communications with other communications networks . the above design options will sometimes present the skilled designer with considerable and wide ranges from which to choose appropriate apparatus and method modifications for the above examples . however , the objects of the present invention will still be obtained by that skilled designer applying such design options in an appropriate manner .	7
the term “ organic acid ” refers to any organic compound with acidic properties . representative examples include but are not limited to acetic acid , citric acid and propionic acid . the term “ alcohol ” refers to any organic compound in which a hydroxyl group (— oh ) is bound to a carbon atom of an alkyl or substituted alkyl group . representative examples include but are not limited to ethanol , methanol and propanol . in the present invention curcumin nanoparticles were prepared . in one embodiment , nanoparticles were also made out of the mucoadhesive biopolymer chitosan to deliver curcumin orally into mice . curcumin was loaded on the surface of the chitosan nanoparticles . this more efficient delivery vehicle ensured enhanced bioavailability and sustained circulation of curcumin in the blood compared to oral delivery of curcumin alone dissolved in olive oil . importantly , this procedure does not involve any chemical modification of curcumin and binding occurs due to the availability of hydrophobic pockets on the surface of the chitosan nanoparticles . chitosan nanoparticles not only improved the bioavailability of curcumin but also increased its stability . the process involved dissolving a clear solution of chitosan in an organic acid by heating the mixture at 50 ° c .- 80 ° c . the mixture was rapidly cooled to 4 ° c .- 10 ° c . and this process was repeated till a clear solution was obtained . the solution was then heated at 50 ° c .- 80 ° c . and sprayed under pressure into water kept stirring at 2 ° c .- 10 ° c . this solution containing the chitosan nanoparticles was stored for further use . the chitosan nanoparticles can be concentrated by centrifugation at slow speed . a clear solution of curcumin was prepared in alcohol . this curcumin solution was added under pressure to vigorously stirred aqueous suspension of chitosan nanoparticles in an organic acid and the resulting suspension was stirred overnight at room temperature to load curcumin on the chitosan nanoparticle . for the release study , curcumin - chitosan nanoparticles suspension was centrifuged and the pellet was resuspended with equal volume of water and was centrifuged two more times with purified water to remove unbound curcumin from the nano particles . accordingly in one embodiment the process involved dissolving a clear solution of 0 . 025 %- 1 % ( w / v ) chitosan in 0 . 1 % - 10 % or more , preferably 0 . 5 %- 1 % aqueous acetic acid by heating the mixture at 50 ° c .- 80 ° c . the mixture was rapidly cooled to 4 ° c .- 10 ° c . and this process was repeated till a clear solution was obtained . the solution was then heated at 50 ° c .- 80 ° c . and sprayed under pressure into water kept stirring at 200 - 1400 rpm at 4 ° c .- 10 ° c . this solution containing the chitosan nanoparticles was stored for further use . the chitosan nanoparticles can be concentrated by centrifugation at slow speed . a clear solution of 0 . 1 - 1 . 0 g of curcumin was prepared in 100 - 1000 ml of ethanol . this curcumin solution was added under pressure to vigorously stirred aqueous suspension of chitosan nanoparticles in 0 . 1 %- 10 % or more , preferably 0 . 25 % - 1 % acetic acid and the resulting suspension was stirred overnight at room temperature to load curcumin on the chitosan nanoparticle . for the release study , curcumin - chitosan nanoparticles suspension was centrifuged and the pellet was resuspended with equal volume of water and was centrifuged two more times with purified water to remove unbound curcumin from the nano particles . in the case of curcumin bound to chitosan nanoparticles , the concentrations of both chitosan and curcumin affect the size of the nanoparticle . in another embodiment of the invention , curcumin nanoparticles were prepared by dissolving curcumin in alcohol and then spraying the solution kept at 25 ° c .- 40 ° c . under nitrogen atmosphere and high pressure into an organic acid solution kept stirring at room temperature . stabilizers or surfactants were not used and the finished product entirely consisted of curcumin in the form of nanoparticles . accordingly , curcumin nanoparticles were prepared by dissolving 0 . 1 - 1 g curcumin in 100 - 1000 ml 5 %- 100 % of ethanol , preferably absolute ethanol and then spraying the solution kept at 25 ° c .- 40 ° c . under nitrogen atmosphere and high pressure into 0 . 1 %- 10 % or more , preferably 0 . 25 %- 0 . 1 % aqueous acetic acid solution kept stirring at room temperature . stabilizers or surfactants were not used and the finished product entirely consisted of curcumin in the form of nanoparticles . dynamic light scattering ( dls ) ( malvern , autosizer 4700 ) was used to measure the hydrodynamic diameter and size distribution ( polydispersity index , pdi = — μ2 — / γ2 ). chitosan loaded curcumin nanoparticles of size 43 nm to 325 nm , preferably 43 nm to 83nm , and curcumin nanoparticles of size 50 nm to 250 nm , preferably 50 nm to 135 nm were obtained as indicated in fig1 . 1 & amp ; 1 . 2 . the zeta potential and viscosity of nanoparticles was measured on a zeta potential analyzer ( brookhaven , usa ) and a viscometer fig1 . 3 & amp ; 1 . 4 . particle morphology was examined by transmission electron microscopy ( tem ) ( hitachi , h - 600 ). fig2 . 1 - 2 . 3 nanoparticles were dried in a vacuum dessicator and their ftir were taken with kbr pellets using the nicolet magna 550 ir spectrometer fur spectra of chitosan nano particle has similar absorbance pattern as that of chitosan . ( fig9 . 1 - 9 . 2 ). similarly the ftir spectra of curcumin and curcumin nano particles were similar indicating that curcumin was not chemically modified when it is converted into nanoparticles ( fig9 . 3 - 9 . 4 ). the ftir spectra of curcumin bound to chitosan nano particles as expected had all the features of chitosan and curcumin indicating the curcumin is not altered in the process of binding to chitosan nano particles ( fig9 . 5 ). both the curcumin nanoparticle and the curcumin bound to chitosan nanoparticle cured 100 % of the mice infected with a lethal strain of plasmodium yoelii parasite compared to infected untreated control where all animals died fig4 . 1 - 4 . 6 . the cured mice populations survived for at least 100 days and were resistant to subsequent reinfection in 100 % cases . it was found that curcumin preferentially accumulated inside the infected erythrocytes , the quantity increasing with increase of parasite load in the erythrocyte fig5 . 5 . confocal microscopy revealed that curcumin was bound to the parasite fig5 . 7 . just like chloroquine , curcumin inhibited hemozoin formation in vivo which the parasite makes to avoid the toxicity of heme ( fig6 .) curcumin nanoparticles and curcumin bound to chitosan nanoparticles demonstrated a 10 fold increase in bioavailability of curcumin ( fig3 .) and they were efficient in killing malaria parasite in vivo in mice . fig4 . 5 - 4 . 6 . the scope of the invention extends to all possible pharmacological uses of curcumin such as use of curcumin in the treatment of cancers , diseases involving an inflammatory reaction , alzheimer &# 39 ; s disease , cholesterol gall stones , diabetes , alcohol and drug induced liver diseases , parasitic infestation , malaria and other parasitic diseases , neurological disorders and all other diseases that can be treated or managed using curcumin . a clear solution of 0 . 2 % chitosan ( w / v ) in 1 % acetic acid was prepared by heating the mixture to 75 ° c . the mixture was rapidly cooled to 4 ° c . and this process was repeated several times till a solution of chitosan was obtained . this solution was then heated to 75 ° c . again and sprayed under pressure into water kept stirring very rapidly at 4 ° c . this ensured production of uniformly dispersed chitosan nanoparticles which can be concentrated by centrifugation a clear solution of 1 gm of curcumin in 1000 ml of absolute ethanol was added under pressure to vigorously stirred aqueous suspension of chitosan nanoparticles in 1 % acetic acid and the resulting suspension was stirred overnight at 200 - 1400 rpm at room temperature to load curcumin on the chitosan nanoparticle . 1 gm of curcumin was dissolved in 1000 ml of absolute ethanol . the solution was kept at 40 ° c . and then sprayed under nitrogen atmosphere and high pressure into 0 . 1 % aqueous acetic acid solution which was kept stirring at 200 - 1400 rpm at room temperature . this lead to the production of uniformly dispersed curcumin nanoparticles . the particle size can be controlled by varying the pressure at which curcumin solution is sprayed into 0 . 1 % aqueous acetic acid kept at different temperatures ( 25 ° c . - 40 ° c .). dynamic light scattering ( dls ) was used to measure the hydrodynamic diameter and size distribution ( fig1 . 1 - 1 . 2 ). dynamic light scattering ( dls ) experiments were performed ( scattering angle = 90 °, laser wavelength = 632 . 8 nm ) on a 256 channel photocor - fc ( photocor inc ., usa ) that was operated in the multi - tau mode ( logarithmically spaced channels ). during the titration process , a few milliliters of the sample was drawn from the reaction beaker and loaded into borosilicate cylindrical cell ( volume = 5 ml ) and dls experiment performed . the data was analyzed both in the contin regularization and discrete distribution modes ( multi - exponential ). the contin software generates the average relaxation time of the intensity correlation function , which is solely related to brownian dynamics of the diffusing particles for dilute solutions . the intensity correlation data was force fitted to a double - exponential function without success . thus , we have relied on a single exponential fitting ( with polydispersity ) and the chi - squared values were & gt ; 90 % consistently for all the correlation data . this yielded the apparent translational diffusion coefficient values . correspondingly , the apparent hydrodynamic radii , r h of the particles , at room temperature (° c .) were determined from the knowledge of translational diffusion coefficient d γ . these values were used in stoke - einstein equation , d = k b γ / f with the translational friction coefficient , f = 6πη 0 r h , where k b is boltzmann constant , and n 0 is solvent viscosity . electrophoretic mobility measurements were performed on the prepared nanoparticles ( fig1 . 3 ). the instrument used was zeecom - 2000 ( microtec corporation , japan ) zeta - sizer that permitted direct measurement of electrophoretic mobility and its distribution . in all our measurements the migration voltage was fixed at 25 v . the instrument was calibrated against 10 − 4 m agi colloidal dispersions . all measurements were performed in triplicate . particle morphology was examined by transmission electron microscopy ( tem ) ( hitachi , h - 600 ). samples were immobilized on copper grids . they were dried at room temperature , and subsequently examined using transmission electron microscope after staining with uranyl acetate ( fig2 . 1 - 2 . 3 ). chitosan nanoparticles and chitosan nanoparticles loaded with curcumin were separated from suspension and were dried ., and their ftir was recorded with kbr pellets on nicolet , magna - 550 spectrum . hplc was performed after extracting curcumin from the nanosuspension . the particles were collected after high centrifugation and washed several times till the presence of curcumin was not detected in the supernatant by spectroscopic measurnent ( absorbance recorded at 429 nm against ethanol ). curcumin was extracted from the pellet by the extraction solvent consisting of ethyl acetate and isopropanol ( 9 : 1 ). the upper organic layer was dried under nitrogen atmosphere . it was then reconstituted in ethanol and absorbance was recorded at 429 nm against ethanol as blank . hplc was performed using c18 column and isocratic solvent system consisting of acetonitrile : methanol : water : acetic acid :: 41 : 23 : 36 : 1 , at a flow rate of 1 ml / min . mass was determined by using maldi - tof mass spectrophotometer from bruker daltonik gmbh , ( germany ). curcumin was dissolved in ethanol while curcumin nanoparticles were resuspended in 20 % ethanol and the mass spectra was recorded . both curcumin and curcumin nanoparticles showed the presence of curcumin ( mass 369 ), demothoxy curcumin ( 339 ) and bisdemethoxy curcumin ( 309 ) indicating that the original molecules present in the curcumin sample are not modified by conversion to curcumin nanoparticles ( fig1 . 1 and 10 . 2 ). viscosity of nanoparticles : the viscosity of individual nanoparticle suspension was measured at room temperature and normal atmospheric pressure . the result indicates a change in viscosity of chitosan nanoparticles bound to curcumin from that of chitosan nanoparticles and curcumin nanoparticles ( fig1 . 4 ). this indicates binding of curcumin to chitosan which also correlates with changes in zetapotential of chitosan nanoparticles bound to curcumin from that of individual nanoparticles , indicating the binding of curcumin to chitosan . blood samples were obtained at different time intervals , that is , 30 min , 2 h , 4 h and 6 h after oral administration of curcumin ( 100 mg / kg through olive oil , 160 micrograms per mice through curcumin bound to chitosan nanoparticles and 160 micrograms per mice through curcumin nanoparticles ). plasma was collected ( after heparinization ) by centrifugation at 4300 g for 10 min . plasma ( 0 . 5 ml ) was acidified to ph 3 using 6 n hcl and extracted twice ( 1 ml each ) using a mixture of ethyl acetate and isopropanol ( 9 : 1 ; v / v ,) by shaking for 6 min . the samples were centrifuged at 5000 g for 20 min . the organic layer was dried under inert conditions and the residue was dissolved in an eluent containing ethanol and filtered to remove insoluble material . the amount was quantitated from standard plot of curcumin in ethanol , by measuring the absorbance at 429 nm . the identity of curcumin was established by hplc ( c18 column , isocratic solvent system acetonitrile : methanol : water : acetic acid :: 41 : 23 : 36 : 1 , at a flow rate of 1 ml / min ) and by mald1 - tof mass spectrophotometer . ( fig1 . 1 - 10 . 4 ) the increase in bioavailability of curcumin in terms of folds when compared to curcumin delivered through olive oil is depicted in fig3 . the results show enhanced bioavailability of curcumin when fed through chitosan nanoparticles and as curcumin nanoparticles along with sustained release in the plasma till 6 hours . male swiss mice weighing 25 - 30 g were maintained on a commercial pellet diet and housed under conditions approved by the institutional animal ethics commitee of the university . p . yeolli n - 67 rodent malarial parasite , was used for infection . mice were infected by intra peritoneal passage of 10 6 infected erythrocytes diluted in phosphate buffered saline solution ( pbs 10 mm , ph 7 . 4 , 0 . 1 ml ). parasitemia was monitored by microscopic examination of giemsa stained smears . in vivo antimalarial activity was examined in groups of 6 male swiss mice ( 25 - 30 g ) intraperitoneally infected on day 0 with p . yeolli such that all the control mice died between day 8 and day 10 post - infection . the mice were divided in to 4 groups of six mice each . untreated control group which was further subdivided into infected control group , olive oil control group and chitosan control group 1 . group treated with curcumin in olive oil control group 2 . group treated with curcumin on chitosan nanoparticles 3 . group treated with curcumin nanoparticles for the group treated with curcumin in olive oil , curcumin was suspended in olive oil ( 100 mg / kg body weight ). they were given curcumin at a dose of 3 mg / mice once , suspended in olive oil through the oral route . for the group treated with curcumin bound to chitosan nanoparticles and curcumin nanoparticles , 160 micrograms of curcumin ( through chitosan or curcumin nanoparticles ) was made available per mouse and was introduced by means of feeding gauge into the oral cavity of non - anesthetized mice as daily doses . each of the groups was infected with 1 × 10 6 red blood cells taken from an animal having approximately 30 % parasitemia . treatment , in each case , was started only when individual mouse showed parasitemia of 1 - 3 %, that is , by the 4 th day of infection . survival of mice was monitored for a period of 120 days . all the mice in the infected control group and olive oil control group died between 7 th to 11 th day post - infection ( fig4 . 1 - 4 . 2 ). all the mice in the chitosan control group died between 7 th to 12 th day post infection ( a delay of two days in comparison to the infected control and olive oil control groups ) ( fig4 . 3 ). in the group treated with curcumin in olive oil control , 2 out of the 6 mice survived for more than 100 days after cure while 4 died between 10 th to 12 th day post infection ( fig4 . 4 ). all the mice survived in the groups treated with curcumin bound to chitosan nanoparticles and curcumin nanoparticles . all of the mice survived for more than 100 days after cure and were resistant to reinfection by the same parasite ( fig4 . 5 - 4 . 6 ). infected mice with different parasitemia ( 0 % to 17 . 8 %) were given curcumin bound to chitosan nano particles orally . red blood cells were purified from each mice by density gradient centrifugation and curcumin fluorescence was detected by using facs . facs data showing curcumin fluorescence intensity of uninfected and infected rbcs is depicted in fig5 . 2 - 5 . 3 . red blood cells from both control and infected mice were purified by density gradient centrifugation , and curcumin was extracted out from 1 × 10 8 red blood cells using the procedure as described in example 5 and the result shows more accumulation of curcumin in rbc having higher level of parasitemia as indicate in the fig5 . 5 . 7 . 3 accumulation of curcumin in infected red blood cells by confocal microscopy slides for confocal microscopy were prepared by fixing erythrocytes or lymphocytes separated by density gradient centrifugation using ficoll from non infected plasmodium yoelli infected mice fed with curcumin nanoparticles . the isolated cells ( erythrocytes ) were then sealed with cover slip using mounting medium . fluorescence imaging of cells was performed with an olympus fluoview 500 confocal laser - scanning microscope ( olympus , tokyo , japan ) equipped with a multi - argon laser for excitation at 458 , 488 and 515 nm . the images were acquired either with 20 × objective or a 60 × water immersion objective using the fluoview software ( olympus , tokyo , japan ). the curcumin emission was collected using the barrier filter ba505 . the excitation wave length was 458 nm for curcumin . fig5 . 6 - 5 . 7 . in vivo inhibition of hemozoin synthesis by chloroquinine as well as curcumin infected mice were divided into 4 groups ( each having 4 mice ), namely : 1 . control group which was further sub - divided into the infected control group , olive oil control group and chitosan control group 2 . infected and fed with chloroquinine ( 1 . 7 mg in 100 μl of normal saline / mouse / day orally ) 3 . infected and fed with curcumin bound to chitosan nanoparticles ( 160 μg of curcumin bound to 200 μg of chitosan nanoparticles / per mouse / twice a day ) through oral route 4 . infected and fed with chitosan nanoparticles ( 200 micrograms of chitosan / day ) orally treatment in each group except the control was started when parasitemia had reached ˜ 10 % in each mouse and was carried out for 3 days . red blood cells were purified on the third day of treatment . approximately 4 × 10 7 cells were suspended in 25 mm tris hcl ph 7 . 8 containing 2 . 5 % sds . the cells were centrifuged at 10 , 000 g for 10 min , supernatant was discarded and the pellet washed in 1 ml of 0 . 1 m alkaline bicarbonate buffer ( ph 9 . 2 ). the washed pellet was dissolved in 0 . 05 ml of 2 n sodium hydroxide and absorbance was read at 400 nm after dilution to 1 ml using 2 . 5 % sds solution in water . the concentration of heme was calculated by using 90 . 8 as the milli molar extinction coefficient of heme . the results of in vivo inhibition of hemozoin synthesis in p . yoelii infected mice by feeding chloroquinine in normal saline or curcumin bound to chitosan nanoparticles ( hemozoin concentration is measured in terms of dissociated heme ) is depicted in fig6 . terminaldeoxynucleotidyl transferase - mediated deoxyuridine triphosphate biotin nick - end labelling ( tunel ) was performed using the apoalert ™ dna fragmentation assay kit ( r & amp ; d systems ). parasitic cells were isolated from infected rbcs from different groups by density gradient centrifugation . the parasitic cells were washed twice with 1 ml pbs and fixed with 4 % formaldehyde / pbs for 25 min at 4 ° c . after two washes with pbs , the pellet was resuspended in 5 ml permeabilization solution ( 0 . 2 % triton x - 100 in pbs ) and incubated on ice for 5 minutes . eighty microlitres of equilibration buffer was added and was incubated at room temperature for 5 minutes . the cells were labeled by adding 50 ml tunel mix followed by incubation for 60 minutes at 37 ° c . in a dark , humidified incubator . one millilitre of 20 mm edta was then added to terminate the tailing reaction . the samples were washed with pbs and the pellet was resuspended in 250 ml pbs for flow cytometry analysis . the results of this experiment are depicted in fig7 and 8 . toxicological studies were carried out on five groups of swiss albino mice and five groups of male wister rats as per the details in table 3 . histopathological examination of organs was completed in six animals from each group . the organ taken for histological study from each animal included brain , liver , kidney and heart . eosin and hematoxylin stained section were available for study from all these organs . no histological evidence of damage to the liver , heart , brain or kidney was seen in any animal in any group . the histological features clearly indicate that the preparations administered by the oral route , that is , curcumin in olive oil , curcumin bound to chitosan nanoparticles , chitosan nanoparticles and curcumin nanoparticles are non - toxic in wister rats and swiss albino mice . blood samples from members of the five groups of swiss albino mice and wister rats after oral feeding to pbs , curcumin in olive oil , curcumin bound to chitosan nanoparticles , chitosan nanoparticles and curcumin nanoparticles as directed in table 3 , were subjected to determination of serum glutamic oxaloacetic transaminase ( scot ) level , serum glutamic pyruvic transaminase ( sgpt ) level , serum urea level , serum creatinine level , serum cholesterol level , serum albumin level and serum hemoglobin level . no rise was seen in the serum sgot , sgpt , urea and creatinine levels after oral feeding of pbs , curcumin in olive oil , curcumin bound to chitosan nanoparticles , chitosan nanoparticles and curcumin nanoparticles . the serum levels of cholesterol , albumin and hemoglobin were also not significantly altered . this indicates that the curcumin nanoparticles of the present invention are non - toxic and safe . curcumin nanoparticles at a dose of 500 mg / day / person were given orally to nine human volunteers ( 1 , 3 , 4 , 6 , 8 , 9 , 10 , 11 & amp ; 12 ) who gave their informed consent to participate in the study . their blood glucose level was measured under fasting conditions before the start of the experiment ( dark spots ) and after 15 day of continuous oral consumption of same quantity of curcumin nanoparticles ( white spots ) normal curcumin was given orally to another group of seven human volunteers ( 2 , 5 , 7 , 13 , 14 , 15 & amp ; 16 ) at a dose of 500 mg / day / person . the results of the analysis are depicted in fig1 . while fasting glucose level was not altered in the curcumin control group there was a significant decrease in the nanocurcumin group indicating its ability to lower blood glucose level . curcumin nanoparticles at a dose of 500 mg / day / person were given orally to nine human volunteers ( 1 , 3 , 4 , 6 , 8 , 9 , 10 , 11 & amp ; 12 ) who gave their informed consent to participate in the study . normal curcumin was given orally to another group of seven human volunteers ( 2 , 5 , 7 , 13 , 14 , 15 & amp ; 16 ) at a dose of 500 mg / day / person . the level of serum urea , creatinine and potassium ( in case of potassium human volunteers ( 1 , 3 , 4 , 6 were given curcumin nanoparticles where as 2 , 5 , 7 were given normal curcumin ) were measured before the start of the experiment ( dark spots ) and after 15 day of continous oral comsumption of same quantity of curcumin nanoparticles ( white spots ). results of said tests are depicted in fig1 . 1 - 12 . 3 . the serum creatinine , urea and potassium levels ( 7 volunteers ) of all the volunteer under the study were within the normal range both before and after 15 days of continous oral consumption . there is slight decrease in serum creatinine and urea levels and increase in potassium level indicating tubular reabsorption of potassium by kidney , thereby showing an overall beneficial effect of curcumin on kidney . curcumin nanoparticles at a dose of 500 mg / day / person were given orally to nine human volunteers ( 1 , 3 , 4 , 6 , 8 , 9 , 10 , 11 & amp ; 12 ) who gave their informed consent to participate in the study . normal curcumin was given orally to another group of seven human volunteers ( 2 , 5 , 7 , 13 , 14 , 15 & amp ; 16 ) at a dose of 500 mg / day / person . the level were measured before the start of the experiment ( dark spots ) and after 15 day of continous oral comsumption of same quantity of curcumin nanoparticles ( white spots ). the effect of curcumin and nanocurcumin was studied on the levels of serum total cholesterol , hdl cholesterol , ldl cholesterol , triglycerides and sodium ( in case of sodium only seven human volunteers 1 , 3 , 4 , 6 were given curcumin nanoparticles where as 2 , 5 , 7 were given normal curcumin ). results of said tests are depicted in fig1 . 1 - 13 . 5 . a decline in total cholesterol level was seen in the nanocurcumin group consistently as compared to normal curcumin group . furthermore there is a marked increase in hdl cholesterol ( good cholesterol ) in case of curcumin nanoparticle group . level of ldl cholesterol ( bad cholesterol ) and triglycerides were lowered consistently in curcumin nanoparticle group as compared to normal curcumin group . decrease in serum sodium level was also observed indicating the promising anti - cholesterolic , anti - stroke , and other beneficial effects on cardiovascular diseases . effect of oral intake of curcumin and nanocurcumin on hemoglobin and rbc level of human volunteers curcumin nanoparticles at a dose of 500 mg / day / person were given orally to nine human volunteers ( 1 , 3 , 4 , 6 , 8 , 9 , 10 , 11 & amp ; 12 ) who gave their informed consent to participate in the study . normal curcumin was given orally to another group of seven human volunteers ( 2 , 5 , 7 , 13 , 14 , 15 & amp ; 16 ) at a dose of 500 mg / day / person . the levels were measured before the start of the experiment ( dark spots ) and after 15 day of continuous oral consumption of same quantity of curcumin nanoparticles ( white spots ) the effect of curcumin and nanocurcumin was studied on the levels of blood hemoglobin and rbcs . results of said tests are depicted in fig1 . 1 - 14 . 2 , which indicates that there is no adverse effect in terms of induction on anemic condition or lowering of rbc counts following the treatment regime . ( ). curcumin nanoparticles at a dose of 500 mg / day / person were given orally to nine human volunteers ( 1 , 3 , 4 , 6 , 8 , 9 , 10 , 11 & amp ; 12 ) who gave their informed consent to participate in the study . normal curcumin was given orally to another group of seven human volunteers ( 2 , 5 , 7 , 13 , 14 , 15 & amp ; 16 ) at a dose of 500 mg / day / person . the level were measured before the start of the experiment ( dark spots ) and after 15 day of continuous oral consumption of same quantity of curcumin nanoparticles ( white spots ). the effect of curcumin and nanocurcumin was studied on the levels of serum sgpt , sgot , alp , albumin and bilirubin . results of said tests are depicted in fig1 . 1 - 15 . 5 . it is apparent that sgot and sgpt levels are not significantly altered and albumin levels are increased in naocurcumin treated group indicating that nanocurcumin is good for the liver . the alp and bilirubin levels were also in the normal range except in one or two cases showing that curcumin and nanocurcumin do not have any adverse effect on liver function . effect of oral intake of curcumin and nanocurcumin on globulin level , eosinophils and neutrophils count and platelet count of human volunteers curcumin nanoparticles at a dose of 500 mg / day / person were given orally to nine human volunteers ( 1 , 3 , 4 , 6 , 8 , 9 , 10 , 11 & amp ; 12 ) who gave their informed consent to participate in the study . normal curcumin was given orally to another group of seven human volunteers ( 2 , 5 , 7 , 13 , 14 , 15 & amp ; 16 ) at a dose of 500 mg / day / person . the level were measured before the start of the experiment ( dark spots ) and after 15 day of continuous oral consumption of same quantity of curcumin nanoparticles ( white spots ). results of said tests are depicted in fig1 . 1 - 16 . 4 . the result indicates that there is no significant effect of curcumin on the levels of eosinophiles , neutrophils and platles . patients suffering from malaria were administered nanocurcumin capsules after having their informed consent under the supervision of a traditional medicine practitioner at a dose of 200 mg twice daily for 5 to 7 days for plasmodium vivax cases and 200 mg four times per day for 5 to 7 days for plasmodium falciparum cases . all nine patients were cured ( table 4 ). another group of five patients were studied for relapse . the patients who were cured did not show any relapse for at least 9 months . ( table 5 ).	8
an immunotoxin is defined as any immunological molecule such as an antibody which has been conjugated with a toxin , preferably a cytotoxin . the present invention is directed to a method of treating an individual having a pathophysiological state , comprising the step of administering to said individual an a pharmacologically effective dose of an agent which upregulates the expression of a cellular target . this administration is followed by the administration of a pharmacologically effective dose of an immunotoxin directed against the cellular target . preferably , the administered agent is selected from the group consisting of differentiating agents , cytokines , interleukin - 2 , tumor necrosis factor , interferon - α , interferon - γ and peptide hormones . in one embodiment , the invention comprises the administration of a pharmacologically effective dose of a retinoid . preferably , the retinoid induces expression of cd38 antigen in cells . if this is the case , a pharmacologically effective dose of a anti - cd38 immunotoxin is administered . representative pathophysiological states which may be treated using the methods of this embodiment of the invention include rarα selective acute myeloid leukemia , acute promyelocytic leukemia , lymphomas , and myelomas . representative retinoic acid metabolites which may be used in the methods of the present invention include all - trans - retinoic acid ( ra ); 9 - cis retinoic acid ( 9 - cis ra ); ( e )- 4 -[ 2 -( 5 , 6 , 7 , 8 - tetrahydro - 5 , 5 , 8 , 8 - tetramethyl - 2 - naphthalenyl )- 1 - propenyl ] benzoic acid ( ttnpb ); ( e )- 4 -[ 2 -( 5 , 6 , 7 , 8 - tetrahydro - 3 , 5 , 5 , 8 , 8 - pentamethyl - 2 - naphthalenyl )- 1 - propenyl ] benzoic acid ( 3 - met ttnpb ); and other retinoids that can bind and activate the rarα receptor . preferably , the retinoid is administered in a dose of from about 0 . 1 mg / kg to about 2 mg / kg . the immunotoxin used in the methods of the present invention specifically target cells expressing the cd38 antigen . preferably , the immunotoxin comprises a monoclonal antibody directed against the cd38 antigen conjugated to a toxin molecule . although a person having ordinary skill in this art could substitute any toxin , a preferred toxin useful in these methods is gelonin . although a person having ordinary skill in this art could substitute any monoclonal antibody specific for the cd38 antigen , ib4 or ib6 antibodies were used herein to demonstrate the present methods . preferably , the immunotoxin is administered in a dose of from about 0 . 05 mg / kg to about 2 mg / kg . the following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion . cd38 expression in normal tissues is limited mainly to the thymus . the tissue specificity of cd38 was examined by the hybridization of a radiolabeled cd38 nucleic acid probe against a commercial ( clontech ) tissue specific mrna dot blot . the results of the hybridization are shown in fig1 . it was observed that cd38 is mainly expressed in the thymus with significantly lower levels of expression in the prostate . retinoic acid ( ra ) augments the cytotoxic effect of immunotoxin through enhanced expression of cd38 . hl - 60 cells were incubated with either immunotoxin alone or in the presence of 5 nm retinoic acid ( ra ). increasing concentrations of unconjugated ib4 monoclonal antibody were added to the cells incubated with immunotoxin and retinoic acid . after three days , the cells were assayed for viability with the mts assay . briefly , 6 . 5 mg / ml mts solution [( 3 -( 4 , 5 - dimethylthiazol - 2 - yl )- 5 -( 3 - carboxymethoxyphenyl )- 2 -( 4 - sulfophenyl )- 2h - tetrazolium ] and 0 . 5 mm pms ( phenazine methosulfate ) solution were mixed at a ratio of 20 : 1 . 20 μl of the combined mts / pms solution was placed in each well of a 96 well plate containing samples of the cells to be tested . the plate was incubated for 1 – 4 hours at 37 ° c . in a 5 % co 2 atmosphere , after which time , the amount of formazan produced by live cells from cellular reduction of mts was measured by reading the absorbance at 490 nm . the results are shown in fig2 . immunotoxin alone had little effect on the viability of the cells ( c ). however , when the cells were incubated with immunotoxin in the presence of 5 nm retinoic acid , a significant reduction in cell viability was observed . increasing concentrations of unconjugated ib4 monoclonal antibody blocked the cytotoxic effect of immunotoxin and retinoic acid . the fact that unconjugated ib4 blocked the ability of the immunotoxin to kill the cells demonstrates that the immunotoxin is specifically interacting with the cd38 surface marker and that the effect of the retinoic acid is to increase the expression of the cd38 antigen . all - trans - retinoic acid ( ra ) pretreatment enhances the induced killing of hl - 60 cells . hl - 60 cells were preincubated overnight in either the presence or absence of 5 nm all - trans - retinoic acid . the cells were washed twice and incubated in increasing concentrations of immunotoxin in either the presence or absence of ib4 unconjugated anti - cd38 moab . after three days , the cell were assayed for viability . the results are shown in fig3 . preincubation with all - trans - retinoic acid followed by immunotoxin treatment resulted in more cell death than treatment with immunotoxin alone . the presence of 100 fold excess of the unconjugated anti - cd38 monoclonal antibody ib4 blocked the toxicity of the immunotoxin in both cases by competing with the immunotoxin for access to the cd38 markers on the cells . these results demonstrate that the all - trans - retinoic acid ( ra ) was causing some change in the cells which render them more susceptible to the immunotoxin rather than playing a direct role in the death of the target cells . gelonin must be conjugated to the anti - cd38 antibody to have a toxic effect on the target cells . hl - 60 cells were incubated for three days with increasing concentrations of either immunotoxin or gelonin in either the presence or absence of 5 nm retinoic acid . afterwards , the cells were assayed for viability using the mts assay . as seen in fig4 , gelonin alone had no toxic effect in either the presence of absence of 5 nm . thus , the toxic effect of gelonin depends on it being conjugated to the anti - cd38 monoclonal antibody in order to deliver the toxin to the cell . even nominal levels of all - trans - retinoic acid ( ra ) lead to increased toxicity of the immunotoxin . hl - 60 were incubated with either immunotoxin or unconjugated ib4 monoclonal antibody in increasing concentrations of monoclonal antibody . fig5 shows that even the lowest level of all - trans - retinoic acid ( ra ) ( 1 nm ) lead to almost complete killing of the target cells by the immunotoxin . this effect was not observed with the unconjugated monoclonal antibody . this result indicates that it is the gelonin conjugated to the monoclonal antibody in the immunotoxin that leads to the increased cell death rather than some effect of the antibody itself . retinoic acid can induce expression of the cd38 marker in a variety of cell lines . the daudi , thp - 1 , k562 , and hl60 - rarα cell lines were treated with increasing concentrations of immunotoxin in either the presence or absence of 5 nm all - trans - retinoic acid ( ra ). after three days , the viability of the cells was examined using the mts assay , which is shown in fig6 . in the thp - 1 and hl60 - rarα cell lines , all - trans - retinoic acid induced cell death while the cell which were cultured in the absence of all - trans - retinoic acid were mostly unaffected by the immunotoxin . in the daudi cells , which have a high basal expression of cd38 , the immunotoxin resulted in almost complete cell death regardless of whether retinoic acid was present . on the other hand , k562 , which are resistant to ra - induced cd38 expression , were unaffected by the immunotoxin regardless of the presence of retinoic acid . hl - 60 subcloned cells , resistant to adriamycin - induced killing were cultured with immunotoxin either alone or in the presence of 5 nm all - trans - retinoic acid . after three days , the mts assay was used to test cell viability . fig7 shows the results obtained . some cell death was observed in the presence of immunotoxin alone which was greatly augmented by the addition of 5 nm all - trans - retinoic acid . cells which have high basal expression of cd38 are killed by immunotoxin regardless of the presence or absence of all - trans - retinoic acid ( ra ). mz , a non - hodgkin lymphoma cell line which has a high basal expression of cd38 , was treated with increasing amounts of immunotoxin in either the presence or absence of 5 nm all - trans - retinoic acid . the addition of immunotoxin resulted in a high level of cell death regardless of the presence or absence of retinoic acid ( fig8 ). this is strong evidence that retinoic acid is increasing the toxicity of immunotoxin by enhancing the level of cd38 on other cell lines which do not have a high basal level of cd38 . retinoic increases cd38 expression in a number of lymphoid tumor cells . table i lists the potential targets for anti - cd38 bound toxin treatment a number of different lymphoid tumor cell lines were treated with 5 nm all - trans - retinoic acid ( ra ). afterwards , the expression of cd38 in untreated versus treated cell was measured by flow cytometry . a significant rise in cd38 expression was observed in acute myeloid leukemia ( aml ), acute promyelocytic leukemia ( apl ), lymphoma , and myeloma tumor cells . the increase in cd38 expression ranges from 2 . 5 to 20 fold . thus , retinoic acid can be used in all of these tumor types to increase the vulnerability of the tumor cells to immunotoxin treatment . hl - 60 cells with a mutated rarα gene that renders the cells resistant to the effects of retinoic acid were treated with immunotoxin in either the presence or absence of 5 nm retinoic acid . in these cells , the addition of retinoic acid had no effect on the toxicity of the immunotoxin . as shown in fig9 , no appreciable cell death was observed in the cells treated with all - trans - retinoic acid ( ra ), with unconjugated ib4 and gelonin , or with gelonin alone . this is further proof that the immunotoxin kills cells which are affected by retinoic acid because of a retinoid induced increased in expression of cd38 target of the immunotoxin . any patents or publications mentioned in this specification are indicative of the levels of those skilled in the art to which the invention pertains . these patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference . one skilled in the art will readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned , as well as those inherent therein . the present examples along with the methods , procedures , treatments , molecules , and specific compounds described herein are presently representative of preferred embodiments , are exemplary , and are not intended as limitations on the scope of the invention . changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention as defined by the scope of the claims .	0
the present invention is further described below with reference to the accompanying drawings . as shown in fig1 , the bottom portion of the wind power generator of the present invention is a support , and at a middle height position of the support 1 , a platform with a generator and a speeder installed thereon is configured . a central shaft 2 is arranged in the center of the support . a wind wheel is sleeved on the central shaft , in which a radial thrust bearing is installed on the lower end thereof and a journal bearing is installed on the top end thereof to ensure that the wind wheel can flexibly rotate while being sleeved on the central shaft 2 . a generator 9 , a speeder 8 , and a controller can also be implemented through landing installation . when rotating , the wind wheel drives the speeder 8 at the lower end to rotate and then drives the generator 9 to generate power . the positions of vanes 7 where the vanes change their locations among different quadrants under the effect of the wind power are restrained by a stop mechanism . a baffle or anemometer of a strong wind cutout protection device 6 is disposed at the top portion . when the wind power exceeds a predetermined value , the baffle falls down , the stop mechanism is withdrawn , and the vanes 7 automatically orientate windward in the strong wind , and the force impinged on the vanes 7 are turned to a minimum state , so as to protect the vanes 7 from being damaged . as shown in fig2 , the number of the vanes 7 in the wind power generator of the present invention is selected to be 6 , that is , a first vane 7 - 1 , a second vane 7 - 2 , a third vane 7 - 3 , a fourth vane 7 - 4 , a fifth vane 7 - 5 , and a sixth vane 7 - 6 respectively . an upper wind disc 5 and a lower wind disc 3 are both of a regular polygon structure and the upper and lower wind discs and supporting rods 11 constitute a truss - type wind wheel . each of the vanes 7 is perpendicularly arranged at a corresponding vertex angle position of the upper and lower wind discs . pivots 10 of the vanes are all installed with bearings . as shown in fig3 , an overall shape of the vanes 7 of the present invention is an air - foil shape and of a hollow structure with a framework braced therein . the vanes 7 are designed with equal cross sections and the height of the vanes is equivalent to that of the wind wheel . the shape of the cross section is specifically that , a circular - arc radius of a head portion r 1 is 1 / 18 - 1 / 22 of a vane chord length l , an arc radius of an outer surface r 3 is ⅜ of the chord length l , an arc radius of an inner surface r 2 is 3 / 16 of the chord length ; a central angle γ of an overall circular - arc portion is 40 - 50 degrees , an arch height of a circular arc of the outer surface ( i . e ., an outer arch height h 1 ) is ⅕ - 1 / 7 of the chord length , an arch height of a circle chord of the inner surface ( i . e ., an inner arch height h 2 ) is 1 / 10 - 1 / 14 of the chord length , a back portion of each of the vanes is linear intersection between the outer surface and the inner surface , and the pivots 10 of the vanes are located at positions 1 / 7 - ⅙ of the chord length from the head . the vanes 7 are made of light , weather - resistant , and corrosion - resistant materials , so that the requirement for the mechanical intensity of the materials of the vanes 7 is rather low . the present invention may further add an arc - shaped wind collecting baffle in an upwind direction of the wind wheel , so as to collect the incoming winds , increase the force impinged on the vanes , and increase the output power . as shown in fig4 , a stop mechanism is disposed at a bottom portion of the pivots 10 of the vanes , and the bottom portion of the pivots 10 is correspondingly sleeved with a disc 16 having a fan - shaped notch β fitting with the pivots . a central angle of the notch is 65 - 75 degrees , and the stop mechanism is axially or radially arranged to fit with the fan - shaped notch β , so as to control a maximum angle of attack to be 25 - 30 degrees when the vanes 7 are in an upwind direction and a maximum angle of attack to be 40 - 45 degrees when the vanes 7 are in a downwind direction . as shown in fig4 , a mechanical - type stop mechanism includes a stop assembly 12 and a sliding rod 14 . a guiding wheel 13 is disposed at a top end of two sides of the sliding rod 14 , a front end is connected with a sliding wheel 15 , and a back end is connected with a windward baffle at the upper portion of the wind wheel through steel wires . in a normal situation , the sliding rod 14 is inserted into the notch of the disc 16 and performs a stopping operation on a rotating angle of the vanes . when encountering a strong wind , the windward baffle drives the sliding rod 14 to be withdrawn out of the notch , and the vanes 7 automatically rotate downwind to reach a position where the wind force is at the minimum level , so as to avoid being damaged , and then the vanes 7 are restored automatically after the strong wind . the vanes 7 of the present invention are changed at the illustrated positions . under the effect of the wind power , four quadrants are all corresponding to the lift force due to the aerodynamic principle . the stop mechanism may be disposed at a top portion of the pivots 10 of the vanes , and may also be disposed at the top or bottom portion of the pivots at the same time . in additional to the above mechanical - type structure , the stop mechanism may further adopt an electrical - type structure . the electrical - type stop mechanism automatically detects and controls the sliding rod to be withdrawn out of and inserted into the fan - shaped notch of the pivots of the vanes through an anemometer and a motor mechanism , so as to control the angle of attack of the vanes . when encountering a strong wind , the anemometer enables the sliding rod 14 to be withdrawn out of the notch under an electrical driving motion , and the vanes 7 automatically rotate downwind to reach a position where the wind force is at the minimum level , so as to avoid being damaged , and then the vanes 7 are automatically restored after the strong wind . in order to increase the power generation capability , the wind wheel can be stacked and expanded in a building block mode . in order to enhance the wind - resistant capability of the entire generator , medium and large - scaled units are fixed by adding inclined steel wire cables at a top end thereof . the number of the vanes in the wind power generator of the present invention may be selected as three or an integral multiple of three , the upper and lower wind discs of the wind wheel can adopt a corresponding regular polygon structure , and each of the vanes is perpendicularly arranged at a corresponding vertex angle position of the wind wheel . as shown in fig5 , zxvwg - 300 denotes an output characteristic curve of a 300 w generator designed according to the present invention , zxvwg - 200 denotes an output characteristic curve of a 200 w generator designed according to the present invention , and fd - 400 denotes an output characteristic curve of a 400 w traditional horizontal shaft wind power generator . upon the comparison test with the traditional wind power generator , the swept area of the generator according to the present invention is 26 % less than that of the horizontal - shaft generator . in a situation that the capacity of the generator is 25 % less than that of the traditional generator , at a wind speed of 12 m / s , the generation power of the wind power generator designed according to the present invention is about 26 % higher than that of the traditional wind power generator , and has a rising tendency along the curve of the cube of the wind speed .	5
reference now should be made to the drawings , in which the same or similar components have the same reference numbers throughout the different figures . fig1 is a side view of a short length of elongated flexible tube or conduit , which is intended to be formed into a coiled spring conduit member designed to interconnect two different parts of a powdered medicine delivery inhaler mechanism . an inhaler device , in which the tube shown in fig1 and 3 , is used , is subjected to air pressure of approximately 80 psi when air is released through the dispenser device and the tube 10 . the tube 10 of fig1 is formed from thermoplastic material , which may be extruded and then subsequently heat formed . initially , extruded tubular material , having the desired internal and external diameters , is cut into the desired length ; and segments 14 and 16 , at both ends , are flared by means of heat forming insert mandrels . the manner in which this is accomplished is not important to an understanding of the present invention . it is to be noted , however , that the starting material for use with the machine described subsequently is the tube 10 , shown in fig1 with the enlarged or flared segments 14 and 16 on the ends . the flared segments are selected to have an internal diameter which is greater than the uniform internal diameter of the main body 10 of the tube , for purposes of interconnecting the finished product in an inhaler with a uniform internal diameter airflow passage throughout the length of the entire mechanism , including the portions to which the flared end segments 14 and 16 are attached . in order to form a substantially single - turn helical coil 12 , thermoset into the shape shown in fig2 from the straight length of tube 10 of fig1 the machine shown in fig4 through 9 is employed . this machine is designed to simultaneously produce six thermoset coiled spring tube members of the type shown in fig2 and 3 with each cycle of operation . the finished product , as shown in fig2 and 3 , is a thermoplastic tube 10 with a uniform cross - sectional thickness throughout its length . the tube is thermoset formed as a helical spring which may be extended and released repeatedly to its thermoset - biased coiled condition , for use in manually - charged , powdered medication delivery systems . fig4 is a top perspective view of the primary operating components of the machine of the preferred embodiment used to form the product shown in fig2 . some conventional mechanisms , which may be associated with the machine of fig4 and 5 , have not been shown in order to more clearly present the features which are unique to the operation of the preferred embodiment of the invention . basically , the machine includes two spaced - apart parallel mounting blocks 20 and 22 , which are secured to a machine base ( not shown ) in any suitable manner . the blocks are spaced a uniform distance apart ; and each of them includes six aligned , equally spaced support bearings for rotating mandrels . the mandrels , in turn , are supported in a pair of movable , bearing support members 24 and 26 for the blocks 20 and 22 , respectively . six mandrels 28 extend through bearings 32 in the member 24 ; and a corresponding six mandrels 30 extend through bearings 34 in the mandrel support member 26 . as shown in both fig4 and 5 , the mandrels 30 also slidably extend through the bearings 36 in the main support block 22 , as well . similar bearings ( not shown ) in the support block 20 are used for allowing pivotal rotation of the mandrels 28 in that support block for either or both sets of mandrels 28 and 30 . the mandrel support members 24 and 26 for either or both sets of mandrels 28 and 30 are arranged to be moved toward and away from the blocks 20 and 22 , respectively , through means of a suitable electromechanical system 94 . this is diagrammatically illustrated in fig4 by means of the dotted lines 100 and 102 interconnecting the mandrel support members 24 and 26 with a control and drive motor unit 94 . in the operation of the machine , at the beginning of each cycle , six pre - formed plastic tube sections of the type shown in fig1 are dropped into aligned slots 62 and 83 , formed on the upper surfaces of opposite sleeves 60 and 82 , respectively , which surround the mandrels 30 and 28 , as shown most clearly in fig6 . one of the pre - formed lengths of tube 10 , with the flared end segments 14 and 16 , is placed in each of these opposing sleeves in the slots on the top of the mandrels 30 and 28 , in each of the six different positions of the six - unit machine shown in fig4 . each of the different positions are identical ; and one of them is diagrammatically illustrated in fig6 . fig5 illustrates , in an exploded view , the portions of the sleeves and operating parts which are associated with one of the mandrels 30 . it should be noted that each of the mandrels 30 are identical , and that the corresponding parts which are associated with those mandrels are identical . for that reason , only one has been shown in exploded detail . similarly , the mandrels 28 are surrounded with sleeves and operating collars which are identical to one another , and are identical to the one shown in exploded view in fig5 . in order to avoid cluttering the drawing with unnecessary details , only one of the mandrel and sleeve sets is shown in exploded detail ; and only a partial cross section of some of the operating features is shown in fig6 . when a part 10 is dropped into the slots 62 and 83 , as shown in fig5 and 6 , the flared end rests on a wider flat portion 61 on the sleeve 60 ( and a corresponding flat portion on the sleeve 82 ) with the main body of the tube 10 which is located between the end segments 14 and 16 extending through the narrower slot 62 , for example , in the sleeve 60 . an identical construction on all of the other sleeves on both sides of the machine is employed ; so that the tube 10 extends through the narrow slots 60 on the machine portion carried by the block 22 , and a similar set of slots 83 carried by the sleeves 82 on the block 20 . fig7 is a cross - sectional view of this portion of the machine , which illustrates the orientation of the sleeve 82 and its slot 83 , with respect to the mandrels 28 . again , a similar cross section taken on any of the other sleeves and mandrels , on both sides of the machine , is identical to the one shown in fig7 . in order to lock the thermoplastic tube section 10 / 14 / 16 into place for effecting a subsequent rotating operation , a second sleeve is provided at each of the mandrel positions . this is a larger sleeve , 90 for the mandrels associated with the block 20 , and 54 for the mandrels 30 associated with the block 22 . the cross - sectional views of fig6 and 7 illustrate the general orientation of the locking sleeves 90 and 54 with respect to the other parts . after the tube section 10 of fig1 is placed in the slots on the smaller sleeves 82 and 60 , as described above , the locking sleeves 90 and 54 are rotated to cause the open gap , such as the gap 84 shown in fig6 and 7 , to rotate over and close the opening over the top of the flanges 14 and 16 . the flanges 14 and 16 stick up just slightly above the upper diameter projection of the sleeves 60 and 82 ; so that when this rotation of the sleeves 90 and 54 is effected , a vice - like clamping action is provided to tightly grip the end segments 14 and 16 in place , and hold them against any rotation of the tube 10 during the next cycle of operation of the machine . to effect the clamping of the end segments 14 and 16 , a rectangular sliding bar assembly , including a pair of spaced - apart horizontal end members 76 and 88 , which are interconnected by elongated side members ( not shown ) is provided . this rack slides in facing slots 70 and 72 in the support blocks 22 and 20 , respectively , and . is operated by the control and drive motor mechanism 94 at the beginning and end of each cycle to reciprocate back and forth , as indicated by the double - ended arrow at the left - hand end of fig4 . once all of the tubes 10 are in place as described above , the rack 76 / 88 is moved toward the right , as viewed in fig4 to cause six spaced engaging pins 78 , on the right - hand end side of the rack 76 , and a corresponding set of six engaging pins 80 on the left - hand side of the rack , to engage corresponding slots 52 and 42 located , as is most readily apparent in fig4 and 5 , on the lower sides of circular operators 48 and 38 which are fixedly attached for rotation with the sleeves 54 and 90 , respectively . when the rack 76 / 88 moves toward the right , as seen in fig4 the operators 48 associated with the sleeves 54 are rotated clockwise ( as viewed in fig5 ); and the operators 38 , associated with the sleeves 90 in the support block 20 , are operated counterclockwise ( as viewed in fig4 ) to rotate over the openings in the ends of the slots 62 and 83 and effect the clamping of the flanges 14 and 16 , as described above . the rack 78 / 88 remains in its rightmost position for the duration of the next portion of the cycle of operation . it should be noted , however , that for the operation just described , the pins 78 and 80 engage the slots 52 and 42 , respectively , to effect the rotation . this causes a second set of slots ( located 180 ° from the slots 42 and 52 engaged by the pins 78 and 72 ) to be rotated into position for subsequent engagement for rotating the assembly back to the starting position , once a complete cycle of operation has taken place . for the purposes of the next portion of the ensuing discussion , however , it should be noted that the rack 78 / 88 moves from the position shown in fig4 toward the right ( as shown in fig4 ), as described above , and remains there until it is time to commence a new cycle of operation . after the flanges 14 and 16 are locked into place , the control and drive motor mechanism 94 commences rotation of the mandrels 30 , through a set of drive shafts , while the mandrels 28 remain in a fixed or non - rotating condition . at the same time , the control and drive motor 94 moves the mandrel support members 24 and 26 toward the blocks 20 and 22 , respectively , in synchronism with the rotational force applied through the drive shafts 96 to the mandrels 30 to cause a coil 12 to be formed in the center of the pre - formed cut length of thermoplastic tubing 10 of fig1 . in fig2 the coil 12 is shown offset from the center , but in reality , the coil 12 will form at the center of the tube 10 because of the uniform wall thickness and strength of the material . the movement of the mandrel support blocks 24 and 26 , toward one another , is at a rate to accommodate for the reduction in length between the ends of the tube 10 as the coil 12 is formed in it . the coil 12 forms around the path of the mandrels 28 and 30 ; and in fact , as they approach one another , the coil 12 is wound around the mandrels 28 and 30 . at the end of the rotation to form the coil 12 ( chosen to be slightly more than 360 ° of relative rotation between the mandrels 30 and 28 ), the mandrel ends 29 and 31 engage one another . fig6 and 9 show details of this portion of the mechanism . the mandrels 28 have a slot 29 formed in their end ; and the mandrels 30 have a flat projection 31 formed in the end , which mates with the slot 29 . as a consequence , when the mandrel 30 is moved into engagement with the end of the mandrel 28 , the flat projection 31 extends into the slot 29 . continued rotation of the mandrel 30 under control of the drive motor 94 , through the shaft 96 , now causes the entire assembly of joined mandrels 30 and 28 to rotate together at the same rate . this occurs immediately after the coil is formed in the tube 10 . during the time mandrels 28 and 30 are engaged ( as indicated in dotted lines in fig6 ) for rotation together , hot air at a sufficiently high temperature to exceed the thermosetting temperature characteristics of the plastic used in the tube 10 , is applied to the coils 12 through a heater 110 . the coils 12 rotate in the region of the hot air applied from the heater 110 ; and this rotation in thermosetting heat is effected for a length of time sufficient to cause the thermosetting formation of the coil 12 . once thermosetting of the coil 12 in the tube 10 has been completed , heat application from the heater 110 is discontinued . continuous rotation of the mandrels 30 and 28 together is effected ; and if desired , cooling air may be blown across each of the coils 12 in a conventional manner ( not shown ) to effect a more rapid cooling down of the parts . once the parts are sufficiently cooled , the rack 78 / 88 is operated by the control and drive motor mechanism 94 , through the control link indicated in dotted lines 98 , to move back toward the left and to rotate the sleeves 54 and 90 back to the relative positions shown in fig4 and 7 . the slots 62 and 84 once again are opened . continued rotation of the mandrels 30 and 28 then causes the assembly , including the sleeves 54 , 90 , 60 and 82 , to rotate where the openings 62 , 83 , 56 and 84 are pointed downwardly ; so that gravity allows the finished parts of the type shown in fig2 to drop out of the open slots . rotation another 180 ° back to the position shown in fig4 and 7 is effected . rotation of the mandrels 30 / 28 ceases ; and the mandrel support members 24 and 26 are moved back to the positions shown in fig4 by the control and drive motor mechanism 94 . the finished parts drop free . the system now is ready for a new cycle of operation , repeating all of the steps which have been described above . the foregoing description of a preferred embodiment of the invention is to be considered as illustrative and not as limiting . various changes and modifications will occur to those skilled in the art for performing substantially the same function , in substantially the same way , to achieve substantially the same result without departing from the true scope of the invention as defined in the appended claims .	0
fig2 a - 2 c illustrate a method of forming a conductive polymer bump on a substrate , such as a silicon wafer , a printed circuit board , or the like , of the present invention . fig2 a illustrates an exposed electrode substrate assembly 200 comprising a substrate 202 which has at least one conductive electrode 204 , usually aluminum electrodes , disposed thereon . a passivation film 208 may be formed over a face surface 206 of the substrate 202 . the passivation film 208 is selectively etched to expose the conductive electrode 204 . the exposed electrode substrate assembly 200 is immersed in an electroless plating bath plating bath containing palladium in solution , whereby through an exchange reaction the exposed conductive electrodes 204 are selectively plated with a palladium layer 210 atop an upper surface 212 of the conductive electrode 204 , as shown in fig2 b . as shown in fig2 c , a conductive polymer is applied to an upper surface 214 of the palladium layer 210 to form a conductive polymer bump 216 . the conductive polymer bump 216 preferably comprises a two - stage epoxy which does not completely set . the conductive polymer used to form the conductive polymer bump 216 preferably has a high electrical conductivity metal , such as palladium , gold , silver , or the like , dispersed therein . the conductive polymer bump 216 is preferably formed by stencil printing or stenciling the conductive polymer onto the conductive electrode 204 . it is , of course , understood that the passivation film 208 may be stripped from the substrate 202 . fig3 a - 3 c illustrate a method of forming a conductive polymer bump on a printed circuit board of the present invention . fig3 a illustrates an exposed bond pad chip assembly 300 comprising a printed circuit board 302 which has at least one bond pad 304 , usually copper pads , disposed thereon . the bond pad 304 has a lead 306 ( shown in shadow ) within the printed circuit board 302 attached to a lower surface 308 of the bond pad 304 . optionally , a passivation film 310 such as at least one layer of resist polyimide film , or the like , is formed over a face surface 312 of the printed circuit board 302 . the passivation film 310 is selectively etched to expose the bond pad 304 . the exposed bond pad chip assembly 300 is immersed in an electroless plating bath containing palladium in solution , whereby through an exchange reaction the exposed bond pads 304 are selectively plated with a palladium layer 314 atop an upper surface 316 of the bond pad 304 , as shown in fig3 b . as shown in fig3 c , a conductive polymer is applied to an upper surface 318 of the palladium layer 314 to form a conductive polymer bump 320 . the conductive polymer bump 320 preferably comprises a two - stage epoxy which does not completely set . the conductive polymer used to form the conductive polymer bump 320 preferably has a metal , such as palladium , gold , silver , or the like , dispersed therein . the conductive polymer bump 320 can be formed in a manner discussed for the conductive polymer bump 216 of fig2 . it is of course , understood that the passivation film 310 may be stripped from the printed circuit board 302 . fig4 illustrates a substrate assembly 400 of the present invention . the substrate assembly 400 comprises a first substrate 402 with a plurality of conductive electrodes 404 disposed on a facing surface 406 of the first substrate 402 . a palladium metal layer 408 is disposed on each conductive electrode 404 by electroless plating . the substrate assembly 400 further comprises a second substrate 410 with a plurality of bond pads 412 disposed on a facing surface 414 of the second substrate 410 . a palladium metal layer 416 is also disposed on each bond pad 412 . the first substrate 402 and the second substrate 410 are mechanically attached to and in electrical communication with one another via a plurality of conductive polymer bumps 418 extending between the first substrate 402 palladium metal layers 408 and the second substrate 410 palladium metal layers 416 . an under - fill encapsulant 420 may be disposed between the first substrate 402 and the second substrate 410 for environmental protection and to enhance the attachment of the first substrate 402 and the second substrate 410 . fig5 illustrates a first embodiment of a substrate / chip assembly 500 of the present invention . the substrate / chip assembly 500 comprises a substrate 502 with a plurality of conductive electrodes 504 disposed on a facing surface 506 of the substrate 502 . a palladium metal layer 508 is disposed on each conductive electrode 504 by electroless plating . the substrate / chip assembly 500 further comprises a semiconductor chip 510 with a plurality of bond pads 512 disposed on a facing surface 514 of the semiconductor chip 510 . a palladium metal layer 516 is also disposed on each bond pad 512 . the substrate 502 and the semiconductor chip 510 are mechanically attached to and in electrical communication with one another via a plurality of conductive polymer bumps 518 extending between the substrate 502 palladium metal layers 508 and the semiconductor chip 510 palladium metal layers 516 . an under - fill encapsulant 520 may be disposed between the substrate 502 and the semiconductor chip 510 for environmental protection and to enhance the attachment of the substrate 502 and the semiconductor chip 510 . fig6 illustrates a second embodiment of a substrate / chip assembly 600 of the present invention . the substrate / chip assembly 600 comprises a substrate 602 with a plurality of conductive electrodes 604 disposed on a facing surface 606 of the substrate 602 . the conductive electrodes 604 may comprise any suitable type metal electrode , such as aluminum . the substrate / chip assembly 600 further comprises a semiconductor chip 610 with a plurality of bond pads 612 disposed on a facing surface 614 of the semiconductor chip 610 . a palladium metal layer 616 is also disposed on each bond pad 612 . the substrate 602 and the semiconductor chip 610 are mechanically attached to and in electrical communication with one another via a plurality of conductive polymer bumps 618 extending between the substrate 602 conductive electrodes 604 and the semiconductor chip 610 palladium metal layers 616 . the conductive material in the conductive polymer bumps 618 is capable of making electrical contact with the conductive electrodes 604 and penetrating any coating thereon whether an oxide coating or a passivation layer coating . an under - fill encapsulant 620 may be disposed between the substrate 602 and the semiconductor chip 610 for environmental protection and to enhance the attachment of the substrate 602 and the semiconductor chip 610 . it is , of course , understood that , although the assemblies shown in fig4 and 6 show substrates and / or semiconductor chips which use the palladium layered structures of the present invention , one of the substrates and / or semiconductor chips could be one of industry standard manufacture . having thus described in detail preferred embodiments of the present invention , it is to be understood that the invention defined by the appended claims is not to be limited by particular details set forth in the above description as many apparent variations thereof are possible without departing from the spirit or scope thereof .	7
in the description of the invention above and in the detailed description of the invention , and the claims below , and in the accompanying drawings , reference is made to particular features of the invention . it is to be understood that the disclosure of the invention in this specification includes all possible combinations of such particular features . for example , where a particular feature is disclosed in the context of a particular aspect or embodiment of the invention , or a particular claim , that feature can also be used , to the extent possible , in combination with and / or in the context of other particular aspects and embodiments of the invention , and in the invention generally . referring now in detail to the fig1 though 11 a , wherein the same numbers are used where applicable , a fuel control apparatus , namely a servo , constructed in accordance with an embodiment of the invention is identified generally as the reference number 100 . although the description below anticipates the servo ( 100 ) will be used on homebuilt aircraft , it will be obvious to those skilled in the art that the servo ( 100 ) can be used on any type of aircraft and generally , on any combustion engine of appropriate size . referring to fig4 and 5 , the servo ( 100 ) comprises an air passage mechanism (“ throttle body ”) ( 200 ), a fuel pressure modifying mechanism ( 300 ), and a fuel metering mechanism ( 400 ). the throttle body ( 200 ) comprises a central section ( 210 ) that defines a plenum ( 205 ). the throttle body ( 200 ) further comprises a first end ( 201 ) and a second end ( 202 ). a venturi ( 500 ) is mounted within the plenum ( 205 ) at a location between the first end ( 201 ) and the second end ( 202 ). also mounted within the plenum ( 205 ) is a throttle valve ( 204 ). the fuel pressure modifying mechanism ( 300 ) comprises a mixture control valve and an idle valve ( 305 ), as shown in fig7 . the underlying principles of the servo ( 100 ) are well known in the art . generally , air flows through the throttle body ( 200 ) and works in combination with the venturi ( 500 ), fuel metering system ( 400 ), and other components to provide the proper amount of fuel to the combustion chambers of the engine . the amount of fuel received in the combustion chamber is directly proportional to air flow . this is accomplished by channeling ambient air impact pressure and venturi suction pressure to opposite sides of an air diaphragm into the fuel metering system ( 400 ). more specifically , referring to fig8 , fuel is supplied to the engine from the aircraft fuel system . this system usually comprises an engine driven pump (“ fuel pump ”) ( 600 ) and a boost pump ( 605 ) that supplies fuel , at a relatively constant pressure , to the pressure modifying mechanism ( 300 ). engine manufacturers specify the required fuel pump ( 600 ) pressure for a specific type of fuel injection servo . the fuel injection servo is calibrated at the servo inlet pressure . the fuel injection servo is tuned to assure that metered fuel flow will not be affected by changes in inlet fuel pressure caused by boost pump on or off operations . air flow through the throttle body ( 200 ) generates an air pressure differential which is the difference between the impact pressure and the venturi suction pressure . this pressure differential applied across the air diaphragm exerts force f 1 . fuel flow to the engine , passes through a main metering jet ( 305 ), generating a fuel pressure differential which is the difference between un - metered fuel and metered fuel pressure . this pressure deferential , applied across the fuel diaphragm exerts force f 2 . when f 1 is equal to f 2 , the servo valve ( 310 ) is held in a fixed position allowing discharge of enough metered fuel to maintain a pressure balance . if the throttle valve ( 204 ) is opened to increase power , air flow increases resulting in a increase pressure differential across the air diaphragm asserting a force of f 1 ′. f 1 ′ causes the servo valve ( 310 ) to move to the right causing a decrease in differential pressure across the fuel diaphragm which asserts a force f 2 ′. when f 2 ′ equals f 1 ′, the system reaches a steady state condition described above . this sequence of operations is true over all power changes . in this system , it is essential to have the largest differential pressure over the air diaphragm . one way to adjust the differential pressure is by adjusting the venturi ( 500 ). fig1 and 1a shows a fuel injection servo that is well known in the art . as described above , a fuel injection servo can be tuned by changing the size of the venturi ( 500 ). this is difficult and time consuming . referring to fig9 and 9a , the servo ( 100 ) allows the manufacturer to easily adjust the differential air pressure over the air diaphragm . the servo ( 100 ) has a single venturi suction tube ( 505 ) and a shim ( 506 ). the venturi suction tube ( 505 ) senses the venturi pressure . the shim ( 506 ) allows the manufacturer to make minor changes in the location of the venturi suction tube ( 505 ). consequently , it is easier for the manufacturer to adjust the venturi pressure prior to leaving the factory . the amount of fuel received by the engine at lower speeds can be optimized by modifying the idle valve ( 305 ). fig6 shows an exploded view of a idle valve ( 305 ) known in the art . the idle valve ( 305 ) comprises a metering jet ( 310 ) and a rotating plate ( 315 ). the metering jet ( 310 ) defines a metering jet hole ( 311 ) that allows fuel to flow into the servo ( 100 ). the rotating plate ( 315 ) defines a notch ( 316 ). as the rotating plate ( 315 ) turns the size of the metering jet hole ( 311 ) changes depending on up the location of the notch ( 316 ). fig7 shows an exploded view of the idle valve ( 305 ) on the servo ( 100 ). the idle valve ( 305 ) comprises a metering jet ( 320 ) and a means to modify the metering jet ( 328 ). the metering jet ( 320 ) screws into a barrel valve ( 321 ). the barrel valve ( 321 ) is comprised of a sleeve piece ( 322 ) and a barrel ( 324 ). the barrel ( 324 ) fits into the sleeve ( 322 ). the sleeve defines an outlet hole ( 325 ). the barrel defines a notched hole ( 326 ). the effective size of the outlet hole ( 325 ) is reduced depending on the location of the notched hole ( 326 ). that is when the notched holed ( 326 ) is lined up with the outlet hole ( 325 ), fuel flow through the metered jet ( 320 ) is at a maximum . the means to modify the metering jet ( 328 ) comprises a needle valve ( 329 ). the needle valve ( 329 ) sits inside the barrel valve ( 321 ). depending on the position of the needle valve ( 329 ) the effective size of the metering jet ( 320 ) can decrease thereby , decreasing the amount of fuel the engine receives . the position of the needle valve ( 329 ) is controlled by screw ( 327 ). the screw ( 327 ) is accessible to the homebuilder , allowing the homebuilder to fine tune the amount of metered fuel entering the engine . also , because of the smooth travel and minimal loading of the barrel valve ( 321 ), wear and tear is minimal . additionally , if a component of the idle valve ( 305 ) wears , only that component would need to be replaced . in a second embodiment , the servo ( 100 ) is spis which replaces the carburetor of smaller aircraft . carburetor flaws are discussed above . homebuilders who prefer a fuel injection system can adapt a mpis for their smaller aircraft . however , adaptation of a mpis is not an ideal solution for the homebuilder . carburetors , known in the art , receive fuel at a point above the throttle valve leaving fuel to vaporize causing icing on the carburetor and , in some cases , icing on the throttle valve . referring to fig1 and 10a , fuel enters the servo ( 100 ) at a position downstream the throttle valve ( 205 ). as discussed above , smaller aircraft have a delayed response at lift off ( or acceleration ). this is a natural occurrence in smaller aircraft because the fuel discharge is further away from the cylinders . consequently , in the second embodiment , the fuel pressure modifying mechanism ( 300 ) further comprises an accelerator pump with a fuel reservoir ( 350 ) to compensate for the distance between the fuel discharge and the cylinder , as shown in fig1 and 11a . accelerator pumps are well known in the art . the greater inertia of liquid gasoline , compared to air means that if the throttle is suddenly opened , the airflow will increase more rapidly than the fuel flow , which can cause a temporary lean condition which causes the engine to stumble under acceleration . this is remedied by the use of an accelerator pump . the fuel reservoir ( 350 ) holds a reserved amount of fuel to compensate for the distance between the fuel outlet and the cylinder . when the throttle valve ( 205 ) opens there exists an increase in the pressure differential across the air diaphragm which causes the servo valve ( 310 ) to open creating a sudden drop in metered fuel pressure and causing the reservoir ( 350 ) to empty . when the throttle valve ( 205 ) is still or is closing and the metered fuel stabilizes , the fuel reservoir ( 350 ) fills .	5
reference to the drawings illustrating various views of exemplary embodiments of the present invention is now made . in the drawings and the description of the drawings herein , certain terminology is used for convenience only and is not to be taken as limiting the embodiments of the present invention . furthermore , in the drawings and the description below , like numerals indicate like elements throughout . illustrated in fig1 is a top view of an exemplary embodiment of a magnetoelastic sensor , generally designated as 100 , in accordance with an exemplary embodiment of the present invention . fig2 a illustrates a right - side view along a cross - section of the magnetoelastic sensor 100 at a section line 180 , and fig2 b illustrates a left - side view along a cross - section of the magnetoelastic sensor 100 taken at a section line 170 . referring to fig1 , 2 a , and 2 b , the magnetoelastic sensor 100 comprises a plate 110 , a first distribution bar 120 connected to the plate 110 at a first end 111 of the plate 110 , and a second distribution bar 130 connected to the plate 110 at a second end 112 of the plate 110 . disposed in the plate 110 is a magnetic band 140 . in the exemplary embodiment of the magnetic band 140 illustrated in fig1 , the magnetic band 140 is an annulus . in other exemplary embodiments of the magnetic band 140 , different shapes of the magnetic band 140 are contemplated . for example , the magnetic band 140 may be diamond shaped . it is to be understood that the plate 110 may have various dimensions , may not be perfectly planar on either surface , and may not have a perfectly uniform thickness across its entire length . disposed above the magnetic band 140 are a plurality of sensor assemblies 150 a , 150 b , 150 c , and 150 d . each of the sensor assemblies 150 a , 150 b , 150 c , and 150 d comprises , respectively , a sensor platform 152 a , 152 b , 152 c , and 152 d on which a respective sensor 154 a , 154 b , 154 c , and 154 d is disposed . the sensors 154 a and 154 c are disposed along the section line 170 ( also referred to herein as “ centerline 170 ”). the sensors 154 b and 154 d are disposed along the section line 180 ( also referred to herein as “ centerline 180 ”). the centerline 170 longitudinally bisects the sensor assemblies 150 a and 150 c and their respective sensors 154 a and 154 c . the center line 170 longitudinally bisects the sensor assemblies 150 b and 150 d and their respective sensors 154 b and 154 d . the sensors 154 a , 154 b , 154 c , and 154 d are disposed symmetrically about a center point 165 of the plate 110 , which center point 165 is also the center point of the magnetic band 140 . the sensors 154 a , 154 b , 154 c , and 154 d are disposed over the magnetic band 140 such that a centerline 145 of the magnetic band 140 laterally bisects the sensors 154 a , 154 b , 154 c , and 154 d . the sensor assemblies 150 a , 150 b , 150 c , and 150 d are disposed on the magnetic band 140 each at a respective angle , − α , α , − α , and α , relative to a longitudinal axis 160 of the plate 110 . the angles , α and − α , are chosen so that the centerlines 170 and 180 are neither parallel to the longitudinal axis 160 nor perpendicular thereto . in an exemplary embodiment , the angles , α and − α , are chosen so that the centerlines 170 and 180 intersect the magnetized band 140 perpendicularly to a tangent of the centerline 145 of the magnetic band 140 , and where the magnetic field produced by the magnetic band 140 at the points of intersection is neither parallel nor perpendicular to the centerline 160 of the plate 110 . in another exemplary embodiment , the magnitude of angle , α , − α , is chosen to be greater than or equal to 30 ° and less than or equal to 60 °. in yet another exemplary embodiment , the magnitude of angle , α , − α , is chosen to be greater than or equal to 40 ° and less than or equal to 50 °. in still another exemplary embodiment , the magnitude of angle , α , − α , is 45 °. the magnetic field sensors 154 a , 154 b , 154 c , and 154 d each produce an output signal that changes when a magnetic field produced by the magnetized band 140 in a direction parallel to the centerlines 170 and 180 changes . the magnetic field sensors 154 a and 154 c have high sensitivity to magnetic fields parallel to the centerline 170 , and the magnetic field sensors 154 b and 154 d have high sensitivity to magnetic fields parallel to the centerline 180 . the first and second distribution bars 120 , 130 at the top 111 and the bottom 112 of the plate 110 are thicker than the plate 110 . thus , as forces , f 1 and f 2 , are applied to the distribution bars 120 , 130 , respectively , an even amount of strain or compression is produced in the plate 110 , rather than a large amount of strain or compression along the center line 160 of the plate 110 and less elsewhere . in an alternative exemplary embodiment of the magnetoelastic sensor 100 , the first and second distribution bars 120 , 130 are formed integrally with the plate 110 and are areas of the plate that are thicker than the portion of the plate 110 in which the magnetized band 140 is disposed . in such embodiment , as forces , f 1 and f 2 , are applied to the distribution bars 120 , 130 , respectively , an even amount of strain or compression is produced in the plate 110 , rather than a large amount of strain along the center line 160 of the plate 110 and less elsewhere . in the exemplary embodiment of the magnetoelastic sensor 100 described above , the magnetic band 140 is formed within the plate 110 . in such embodiment , the magnetic band 140 may be formed from a magnetized band that is molded within a nonmagnetized or nonmagnetizable , e . g ., non - ferromagnetic , plate 110 . in another exemplary embodiment of the magnetoelastic sensor 100 , the magnetic band 140 may be a magnetized region of the plate 110 , in which case the plate 110 is formed entirely from a ferromagnetic material . it is to be understood that other exemplary embodiments of the magnetoelastic sensor 100 in which the magnetic band 140 is disposed above or on a top surface 113 of the plate 110 are contemplated . in such other embodiments , the plate 110 is not magnetized and may be formed from a material that is not capable of being magnetized . in yet another exemplary embodiment of the magnetoelastic sensor 100 , the plate 110 is made from a non - magnetic material where the region 140 can be subjected to a process to change its metallurgical phase . a type of austenitic non - magnetic stainless steel alloy is selected to form the plate 110 . the area corresponding to the region 140 is cold - worked to convert it to martensite , which is ferromagnetic . the plate 110 is rotated around an axis perpendicular to the center point 165 of the plate 110 , and then while it is rotating , a permanent magnet is brought close to the surface 113 of the plate 110 near the area of the plate 110 corresponding to the region 140 for a large number of revolutions . the permanent magnet is removed after a magnetization direction has been imparted in the region 140 . this approach is beneficial because forming the plate 110 from a homogeneously ferromagnetic material could lead to problems , and molding or attaching the region 140 could be problematic because of the extremely high interface shear stresses in the plate 110 in certain applications . sensor assemblies in accordance with the exemplary embodiments described herein are then mounted above the surface 113 of the plate 110 . in an exemplary embodiment in which the plate 110 is formed from a ferromagnetic material , the magnetized band 140 having a circumferential magnetization direction indicated by the arrowed centerline 145 in fig1 is produced by rotating the plate 110 around an axis perpendicular to the center point 165 of the plate 110 , and then while it is rotating , bringing a permanent magnet close to the surface 113 of the plate 110 for a large number of revolutions . the permanent magnet is removed after a magnetization direction has been imparted in the magnetic band 140 , which is a magnetized region of the plate 110 . in this exemplary embodiment , the plate 110 is formed from a ferromagnetic material . it is to be understood that reference number 145 also refers to the magnetic field produced by the magnetic band 140 . sensor assemblies in accordance with the exemplary embodiments described herein are then mounted above the surface 113 of the plate 110 . although fig1 illustrates a single magnetic band 140 , it is to be understood that other exemplary embodiments in which a plurality of permanent magnets placed at various azimuthal locations in the plate 110 can also be used . in other exemplary embodiments , more than one magnetic band may be formed in or on the plate 110 , in which case the magnetoelastic sensor comprises four sensor assemblies for each ring . in still other exemplary embodiments , instead of a permanent magnet forming the magnetic band 140 , an electromagnet is used to produce the magnetized band 140 . fig2 a illustrates the relative positions of the sensor assemblies 150 b and 150 d and the plate 110 . fig2 b illustrates the relative positions of the sensor assemblies 150 a and 150 c and the plate 110 . as illustrated in fig2 a and 2b , the sensor platforms 152 a , 152 b , 152 c , and 152 d comprise , respectively , inside surfaces 151 a , 151 b , 151 c , and 151 d on which the sensors 154 a , 154 b , 154 c , and 154 d are respectively disposed . the sensor platforms 152 a , 152 b , 152 c , and 152 d further comprise , respectively , outside surfaces 153 a , 153 b , 153 c , and 153 d . the inside surfaces 151 a , 151 b , 151 c , and 151 d face the magnetic band 140 such that the sensors 154 a , 154 b , 154 c , and 154 d , as disposed on the respective inside surfaces 151 a , 151 b , 151 c , and 151 d , are between the magnetic band 140 and the respective sensor platforms 152 a , 152 b , 152 c , and 152 d . fig3 illustrates a detailed view of a region 300 of the plate 110 under the sensor assembly 150 c and specifically a region 300 of the magnetic band 140 under the sensor assembly 150 c , in accordance with an exemplary embodiment of the present invention . inside this region 300 , there are illustrated a tension axis ( also referred to as a “ magnetoelastic anisotropy axis ”) 310 , a first effective anisotropy axis 320 , and a second effective anisotropy axis 330 . the first effective anisotropy axis 320 is the direction of the magnetic field 145 produced by the magnetic band 140 when the forces , f 1 and f 2 , are not present . the second effective anisotropy axis 330 is the direction of the magnetic field 145 produced by the magnetic band 140 when the forces , f 1 and f 2 , are present . the second effective anisotropy axis 330 is a result of the combination of the tension axis 310 and the first effective anisotropy axis 320 and is proportional to the strength of the forces , f 1 and f 2 . the first effective anisotropy axis 320 is offset from the second effective anisotropy axis 330 by an angle β , which changes as the magnitude of the forces , f 1 and f 2 , change . the angle , β , increases as the magnitude of the forces , f 1 and f 2 , increase and decreases at the magnitude of the forces , f 1 and f 2 , decrease . fig4 illustrates another detailed view of the region 300 of the plate 110 , in accordance with an exemplary embodiment of the present invention . the view of the region 300 in fig4 illustrates an effect of the tension caused by the forces , f 1 and f 2 . the magnetic field 145 in the magnetic band 140 is represented in fig4 by a vector 410 . as the direction of the effective first anisotropy axis 320 changes to the direction of the second anisotropy axis 330 , the magnetic field 410 inside the magnetic band 145 changes direction to a direction represented by a vector 420 . the change in magnetic field is represented by a vector 430 , which is perpendicular to the vector 410 , the sum of the vectors 410 and 430 being the vector 420 . the change of the magnetic field , i . e ., the magnetic field component 430 , produces a change in the magnetic field outside the plate 110 in the region 300 . the sensor 154 c is positioned to detect the change in the magnetic field 430 outside the plate 140 . the sensor 154 c is positioned to be especially sensitive to magnetic fields in an outwardly radial direction , i . e ., in a direction parallel to the centerline 170 . thus , the sensor 154 c is positioned to sense the component of the magnetic field outside the plate 140 caused by the magnetic field component 430 . the sensor 154 c is configured to output a signal indicative of the magnetic field 430 when the tension caused by the forces , f 1 and f 2 , is present . the sensors 154 a , 154 b , and 154 d are positioned similarly to the sensor 154 c . thus , the sensor 154 a is positioned to be especially sensitive to magnetic fields in an outwardly radial direction , i . e ., in a direction parallel to the centerline 170 . the sensors 154 b and 154 d are positioned to be especially sensitive to magnetic fields in a direction parallel to the centerline 180 . the sensors 154 a , 154 b , and 154 d are positioned to sense a component of the magnetic field outside the plate 140 caused by a change of the magnetic field outside of the plate 110 because of tension in the plate 110 . although fig3 and 4 are described with reference to a tension in the plate 110 , it is to be understood that such description is applicable to an instance in which the forces , f 1 and f 2 , cause compression in the plate 110 . under compression , however , the changes in the anisotropy axis and the magnetic fields are opposite to the changes described with reference to fig3 and 4 when tension is present . referring now to fig5 , there is illustrated the magnetoelastic tension sensor 100 of fig1 annotated to show strain axes 510 and 520 , in accordance with an exemplary embodiment of the present invention . the strain axis 510 passes through a center point of the sensor 154 c and the center point of the sensor 154 b . the strain axis 520 passes through a center point of the sensor 154 d , and the center point of the sensor 154 a . the sensor assembly 150 a is positioned to sense a portion 145 a of the magnetic field 145 ; sensor assembly 150 b is positioned to sense a portion 145 b of the magnetic field 145 ; sensor assembly 150 c is positioned to sense a portion 145 c of the magnetic field 145 ; and sensor assembly 150 d is positioned to sense a portion 145 d of the magnetic field 145 . the sensors 154 a through 154 d produce respective signals indicative of the magnetic fields that they sense . each sensor signal produced by the sensors 154 a through 154 d comprises a first component resulting from the tension or compression in the plate 110 caused by the forces , f 1 and f 2 , and a second component resulting from environmental magnetic field ( s ). when connected correctly to electronic circuitry ( described below with reference to fig1 ), the first components of the sensor signals provided by the magnetic field sensors 154 a , 154 b , 154 c , and 154 d in response to the tension or compression created by the forces , f 1 and f 2 , add constructively . the second component of the sensor signals provided by the magnetic field sensors 154 a , 154 b , 154 c , and 154 d in response to environmental magnetic fields largely add destructively . thus , the final sensor output ( described below with reference to fig1 ) is mostly insensitive to environmental magnetic fields . referring now to fig6 , there are illustrated various directions of the changes in the magnetic fields produced at the locations of the sensor assemblies 150 a , 150 b , 150 c , and 150 d as a result of tension in the plate 110 , in accordance with an exemplary embodiment of the present invention . when the plate 110 is placed under tension , the magnetic field 145 a under the sensor assembly 150 a changes , as represented by a vector 650 a ; the magnetic field 145 b under the sensor assembly 150 b changes , as represented by a vector 650 b ; the magnetic field 145 c under the sensor assembly 150 c changes , as represented by a vector 650 c ; and the magnetic field 145 d under the sensor assembly 150 d changes , as represented by a vector 650 d . the angles of the vectors 650 a , 650 b , 650 c , and 650 d are − α , α , α , and − α relative to the centerline 160 of the plate 110 ( illustrated in fig1 ). providing for the magnetic field sensors 154 a , 154 b , 154 c , and 154 d to have identical polarity of sensitivity to the changes 650 a , 650 b , 650 c , and 650 d in the magnetic field 145 produced by the magnetized band 140 causes the sensitivity of the final sensor output to the tension to be high . note that the direction of the vector 650 c is the same as the vector 430 . in one exemplary embodiment , the magnetic field sensors 154 a , 154 b , 154 c are fluxgate magnetometers . in another exemplary embodiment , the magnetic field sensors 154 a , 154 b , 154 c are hall sensors . the various embodiments of the magnetoelastic sensor 100 described herein are advantageous in that the magnetic field sensors 154 a , 154 b , 154 c , and 154 d sense very little magnetic field when the tension or compression is not present . this is the result of the magnetic band 140 being ring shaped or generally symmetrical about the center point 165 . thus , the magnetoelastic sensor 100 ideally has no unpaired magnetic poles where the sensor assemblies 150 a , 150 b , 150 c , and 150 d are disposed . illustrated in fig7 is an exemplary alternative embodiment of the magnetoelastic sensor 100 , generally designated in fig7 as 700 , in accordance with an exemplary embodiment of the present invention . in the magnetoelastic sensor 700 , the sensor assemblies 150 a through 150 d are replaced with sensor assemblies 750 a through 750 d . the magnetoelastic sensor 700 is otherwise similar to the magnetoelastic sensor 100 . illustrated in fig8 a and 8b are cross - sectional views of the magnetoelastic sensor 700 , in accordance with an exemplary embodiment of the present invention . fig8 a illustrates a right - side view along a cross - section of the magnetoelastic sensor 700 at the centerline 180 , and fig8 b illustrates a left - side view along a cross - section of the magnetoelastic sensor 700 taken at the centerline 170 . the sensor assemblies 750 a through 750 d comprise respective sensor platforms 752 a , 752 b , 752 c , and 752 d , respectively , having inside surfaces 751 a , 751 b , 751 c , and 751 d and outside surfaces 753 a , 753 b , 753 c , and 753 d . the sensor assemblies 750 a through 750 d further comprise , respectively , first sensors 754 a , 754 b , 754 c , and 754 d disposed , respectively , on the inside surfaces 751 a , 751 b , 751 c , and 751 d and second sensors 755 a , 755 b , 755 c , and 755 d disposed , respectively , on the outside surfaces 753 a , 753 b , 753 c , and 753 d . the first sensors 754 a , 754 b , 754 c , and 754 d and the second sensors 756 a , 756 b , 756 c , and 756 d are symmetrically disposed about the center point 165 of the plate 110 . the second sensors 756 a , 756 b , 756 c , and 756 d are disposed near the first sensors 754 a , 754 b , 754 c , and 754 d but at a distance greater from the magnetic band 140 than the first sensors 754 a , 754 b , 754 c , and 754 d . the first sensors 754 a , 754 b , 754 c , and 754 d are chosen to have a direction of sensitivity opposite ( 180 °) from their respective paired second sensors 756 a , 756 b , 756 c , and 756 d . the pairing reduces the sensitivity of the magnetoelastic sensor 700 to ambient magnetic fields compared to the magnetoelastic sensor 100 . the first sensors 754 a and 754 c are disposed above the magnetic band 140 along the centerline 170 , and the first sensors 754 b and 754 d are disposed above the magnetic band 140 along the centerline 180 . the centerline 170 longitudinally bisects the first sensors 754 a and 754 c , and the centerline 180 longitudinally bisects the first sensors 754 b and 754 d . the sensors 754 a , 754 b , 754 c , and 754 d are disposed over the magnetic band 140 such that a centerline 145 of the magnetic band 140 laterally bisects the sensors 754 a , 754 b , 754 c , and 754 d . the second sensors 756 a and 755 c are respectively disposed above the first sensors 754 a and 754 c along the centerline 170 , and the second sensors 756 b and 756 d are respectively disposed above the first sensors 754 b and 754 d along the centerline 180 . the centerline 170 longitudinally bisects the second sensors 756 a and 756 c , and the centerline 180 longitudinally bisects the second sensors 756 b and 756 d . the sensors 755 a , 755 b , 755 c , and 755 d are disposed over the magnetic band 140 such that a centerline 145 of the magnetic band 140 laterally bisects the sensors 755 a , 755 b , 755 c , and 755 d . fig9 , 10 a , and 10 b illustrate an exemplary alternative embodiment of the magnetoelastic sensor 700 , generally designated in fig9 , 10 a , and 10 b as 900 , in accordance with an exemplary embodiment of the present invention . fig1 a and 10b illustrate cross - sections of the magnetoelastic sensor 900 taken along the centerlines 180 and 170 , respectively . the magnetoelastic sensor 900 comprises the elements of the magnetoelastic sensor 700 . in the magnetoelastic sensor 900 , the sensor assemblies 750 a through 750 d are replaced with sensor assemblies 950 a through 950 d . the sensor assemblies 950 a through 950 d comprise respective sensor platforms 952 a , 952 b , 952 c , and 952 d respectively having inside surfaces 951 a , 951 b , 951 c , and 951 d and outside surfaces 953 a , 953 b , 953 c , and 953 d . the sensor assemblies 950 a through 950 d further comprise , respectively , first sensors 954 a , 954 b , 954 c , and 954 d disposed , respectively , on the inside surfaces 951 a , 951 b , 951 c , and 951 d and second sensors 956 a , 956 b , 956 c , and 956 d disposed , respectively , on the outside surfaces 953 a , 953 b , 953 c , and 953 d . the sensor assemblies 950 a through 950 d are similar to the sensor assemblies 750 a through 750 d , but they differ in that the second sensors 956 a , 956 b , 956 c , and 956 d are inset radially relative to the center point 165 of the magnetic band 140 compared to the second sensors 755 a , 755 b , 755 c , and 755 d . this inset is best seen in fig9 . the magnetoelastic sensor 700 includes no such inset . referring now to fig1 , there is illustrated a schematic drawing of an exemplary embodiment of a sensor assembly , generally designated as 1100 , in accordance with an exemplary embodiment of the present invention . the sensor assembly 1100 comprises a magnetoelastic sensor 100 , 700 , or 900 connected to circuitry 1110 via a communications link 1115 . the magnetoelastic sensor 100 , 700 , or 900 outputs the signals from its sensor assemblies via the communications link 1115 to the circuitry 1110 . the circuitry 1110 combines the signals provided by the sensor assemblies and outputs the combined signal via an output 1120 . the output 1120 indicates the amount of tension or compression sensed by the magnetoelastic sensor 100 , 700 , or 900 . referring now to fig1 , there is illustrated a graph of data from a test of an exemplary implementation of the magnetoelastic sensor 100 . weights were hung from the exemplary implementation of the magnetoelastic sensor 100 , and the output voltage was recorded . the slope in the graph shows a sensitivity of 0 . 56 mv / pound . these and other advantages of the present invention will be apparent to those skilled in the art from the foregoing specification . accordingly , it is to be recognized by those skilled in the art that changes or modifications may be made to the above - described embodiments without departing from the broad inventive concepts of the invention . it is to be understood that this invention is not limited to the particular embodiments described herein , but is intended to include all changes and modifications that are within the scope and spirit of the invention .	6
in one embodiment , the invention provides a salt of l - carnitine or an alkanoyl - l - carnitine with benzoic acid . examples of alkanoyl - l - carnitines benzoic acid salts include acetyl - l - carnitine benzoic acid salt , propionyl - l - carnitine benzoic acid salt , butyryl - l - carnitine benzoic acid salt , valeryl - l - carnitine benzoic acid salt , and isovaleryl - l - carnitine benzoic acid salt . in one embodiment , the invention provides a composition suitable for human consumption containing a benzoic acid salt of l - carnitine or an alkanoyl l - carnitine selected from the group consisting of acetyl , propionyl , butyryl , valeryl and isovaleryl , in an amount sufficient to stabilize at least one property of the composition selected from the group consisting of flavor , color , smell and a combination of these ; and sufficient to at least partially compensate for a carnitine insufficiency in an individual ; and at least one additional edible ingredient . in certain embodiments , the composition can be in liquid form such as a functional beverage , flavored water , dietary supplement , energy food or a combination of these ; or a solid food product . furthermore , in other embodiments , separately or in combination with the above , the composition can also contain at least one additional source of l - carnitine or a salt thereof such as an alkanoyl derivative of l - carnitine or a salt thereof . in certain embodiments , separately or in combination with the above , the composition can also contain other edible ingredients such as an electrolyte , a mineral , a vitamin , a coenzyme , an antioxidant , a sweetener , a flavorant , and mixtures thereof . in one embodiment , the invention provides a packaged material such as a bottle , can or box , containing the composition described herein , which are preferably suitably structured to store and / or deliver the product to the consumer . in certain embodiments , the composition can be used to treat carnitine deficiency in an individual in need thereof , by providing the composition described herein to the individual whereby the individual consumes at least a part of the composition . in one embodiment , the invention provides food and / or beverage compositions containing l - carnitine benzoate , and / or any benzoic acid salt of l - carnitine . in such compositions , the treatment or supplementation of carnitine deficiency while simultaneously extending the shelf life of the product into which it is contained can be achieved . the stable , non - hygroscopic benzoic acid salts of l - carnitine have enhanced nutritional and / or therapeutic efficacy with respect to their inner salts congeners and to the compositions containing the benzoic acid salts of l - carnitine , particularly suited to ingestion in humans . carnitine and derivatives of carnitine can be used in various therapeutic uses such as e . g . in the cardiovascular field for the treatment of acute and chronic myocardial ischemia , angina pectoris , heart failure and cardiac arrhythmias . acetyl l - carnitine is used in the neurological field for the treatment of both central nervous system disturbances and peripheral neuropathies , particularly diabetic peripheral neuropathy . propionyl l - carnitine is used for the treatment of chronic arteriosclerosis obliterans , particularly in patients showing the symptom of severely disabling intermittent claudication . in professional athletes and other individuals engaging in physical activity , l - carnitine supplies energy to the skeletal musculature and increases the resistance to prolonged , intense stress , enhancing the performance capability of such individuals . in addition , the beverages and food compositions described herein can be used as nutritional supplements for both vegetarians , whose diets have a low carnitine content as well as a low content of the two amino acids , lysine and methionine ( the precursors of the biosynthesis of l (−)- carnitine in the kidneys and liver ) and those subjects who have to live on a diet poor in protein for prolonged periods of time . consequently , the beverage and food compositions described herein containing benzoic acid salts of carnitine or derivatives thereof , either as single components or in combinations with further active ingredients , can be in the form of functional beverages , flavored waters , dietary supplements , health foods , energy foods and similar products , such as oleomargarine , butter , cheese , sport supplements , meat replacement products , vegetarian products , baked goods , confectionaries , etc . other salts that may be used in place of or in addition to the benzoic acid salts include l - carnitine sorbate ( sorbic acid ), l - carnitine adipate ( adipic acid ) and l - carnitine lactate ( lactic acid ). each of these salts can perform anti - microbial action within the specific ph range characteristic for meat replacement , vegetarian , bakery and confectionary functional food platforms while providing a source of l - carnitine supplementation . in addition , other carnitine derivatives , such as salt forms and alkanoyl derivatives may be included in the compositions described herein . many fruit flavors , herbs , sweeteners , level of sweetness , vitamins , and nutritional supplements can be chosen , and therefore may combinations and products are possible . packaging design sometimes can serve as a good product differentiator . therefore , in one embodiment , an article such as a bottle , can or box containing the compositions of the invention is provided . the article can be composed of food - grade materials such as plastics , paper , aluminum and others . in a preferred embodiment , the article is configured in such a way to permit storage and / or delivery of the composition to the consumer . the compositions can be provided as dry powders by freeze drying , spray drying , etc , and as liquids , each of which may be premixed to deliver ready - to - use composition or as a concentrate which can be incorporated into liquid and / or solid edible mediums . if liquid , the composition can be carbonated or still . the compositions of the present invention can be provided as a variety of forms of . foods and beverages , for example , beverages such as sport drinks , fruit beverages , tea beverages , vegetable juices , dairy beverages , milk beverages , alcoholic drinks , jelly drinks , carbonated drinks , and the like ; confectionaries such as jelly , chewing gum , chocolate , ice cream , candy , biscuit , or the like ; starch - based processed foods such as snacks , breads , cakes , or the like ; protein - based processed foods such as . meat or meat substitute products , cheese , etc ; and supplements . additional additives to the compositions described herein include carbohydrates , electrolytes , carotenoids , vitamins , minerals , antioxidants , proteins , amino acids such as taurine , glutamine , and arginine , sugar or other natural or artificial sweeteners such as sucralose , aspartame , acesulfame - k , saccharin , cyclamate , neohesperidin dihydrochalcone , thaumatin , altame , stevioside , and glycyrrhzin , caffeine , ginseng , natural lipids and oils , plant extracts , fiber , fruits , jerry , or the like , milk components , flavors , flavor enhancers , food - approved colors , glucides such as flour , starches , hormones , nourishing components , and the like . the flavors useful in the compositions described herein are sometimes available as dry ingredients , liquids or emulsions . they can be mixed into the concentrate or final product form . in addition to the active flavor itself , industrially available flavors can contain , weighting agents , emulsifiers , emulsion stabilizers , antioxidants , liquid vehicles , and other common beverage and food manufacturing ingredients . the particular amount of the flavor component effective for imparting flavor characteristics depend upon the flavor , the flavor impression and formula flavor component . for example , using beverages as an example , the flavor can be included in at least 0 . 05 % by weight of the beverage composition and , for example , in a range of from 0 . 1 % to about 2 % by weight of the beverage in its final ready - to - use stage . in addition to fruity flavors , such as lemon , orange , lime , cherry , strawberry , raspberry , grape , grapefruit , and others , other flavors , e . g . cola , root beer , coffee , tea , botanical flavors can also be included in the compositions as well as those derived from nuts , bark , roots and leaves . combinations are may also be used . the ideal combination of color , taste , consistency ( mouth feel ) and appearance can pose shelf stability problems . a citrus green or carrot orange beverage will look best on the shelf if packaged in a clear container . clear , light admitting containers , along with the aqueous environment and contained sweeteners may significantly contribute to fermentative and oxidative reactions that at least tend to rapidly destroy the delicate flavor attributes of these products . flavor systems , critical to both brand development and repeat sales ; tend to be the most expensive part of any beverage formulation . the addition of benzoic acid salts of l - carnitine can improve shelf life for these types of products relative to a similar product not containing the benzoic acid salt of l - carnitine . food grade benzoic acid , itself difficult to handle for reasons of dissolution , performs relatively well in a reduced sodium or potassium salt . such preservatives have wide acceptance in the beverage industry , since they maintain a consistently acidic ph that naturally inhibits mold and other microbial growth of the type that disturbs beverage gas content and destroys flavor attributes . this is typically accomplished at concentrations of 0 . 1 % on a w / v basis . this can permit the preparation of ready to mix flavor bases that may be economically shipped to distant markets , an additional benefit . l - carnitine inner salt can be made in an acid base reaction with molten benzoic acid in such a way as to produce the a salt solution that may be dried to a fine white powder within a gas fired , rotary drum or similar dryer to a water content of lt 2 %. it may then be further processed , e . g ., drummed , or entered in various forms of roller compaction ( chilsonation ) then milled and screened to obtain preferred particle sizes . in one embodiment , particle size would be 100 % to pass a number 100 usbs mesh screen . particles may then be blended with a food grade , hydrophobic fumed or precipitated silica ( s ) that possesses an overall surface area of 190 - 475 square meters per gram and a tapped density of 80 - 275 grams per liter . obviously , numerous modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that within the scope of the appended claims , the invention may be practiced otherwise than as specifically described herein .	2
the problems associated with the use of sodium silicate cure accelerators that contain ec stemming from the relatively high freezing point of ec are alleviated by the instant discovery that mixtures of pc and another alkylene carbonate known as glycerine carbonate ( hereafter “ gc ”) accelerate the cure of sodium silicates to about the same extent as does pure ethylene carbonate . however , unlike ec , gc does not disadvantageously freeze at temperatures above − 40 ° c . thus , the invention provides blends of gc and pc that offer a wide range of curing times to the industry , while retaining liquid - state status over a broader temperature range than the cure accelerators of the prior art . it is known that the reactivity of alkylene carbonates with amines follows the order : ec & gt ; pc & gt ; bc . thus , the prior art teaches that the reactivity of the carbonates with amines decreases with the size of the substituent attached to the carbonate ring , and one of ordinary skill would naturally expect that gc should possess a relative reactivity somewhere between pc and bc , based on substituent size , given its molecular structure . however , as the data herein show , the reactivity of gc actually lies very close to that of ec in the case of catalyzing the cure of sodium silicate . cure accelerator blends according to the invention containing gc were found to cure sodium silicate as fast as ec as the data set forth herein shows . this result is unexpected in view of the reaction rate of gc in reactions with other chemical species , such as amines . the rate of sodium silicate cure in the presence of alkylene carbonates was determined by measuring the time required for the mixture to first show visible signs of gellation following the addition of the sodium silicate . in all cases , aqueous sodium silicate solution was added to a glass vial containing the desired alkylene carbonate or alkylene carbonate mixture . the resulting mixture was then stirred vigorously with a metal spatula and the time required for the mixture to change from a translucent liquid to an opaque gel was recorded . for each of the examples herein , the weight ratio of sodium silicate solution to carbonate ( s ) was maintained at 9 : 1 ( 10 wt . % carbonate ). sodium silicate mixtures possessing different ratios of silica ( sio 2 ) to sodium oxide ( na 2 o ) were tested . relevant properties of the different sodium silicate solution tested are given in the table i below : table i sio 2 / nao 2 water density viscosity brand * ratio ( wt . %) ( g / ml ) ( centipoise ) 1 3 . 22 62 . 4 1 . 38 180 2 3 . 21 61 . 7 1 . 40 237 3 2 . 40 52 . 9 1 . 56 600 4 1 . 80 62 . 5 1 . 44 * brand 1 - pq corporation , n ® clear * brand 2 - fisher scientific products , technical grade * brand 3 - pq corporation , ru ™, 10 % dilution with water * brand 4 - pq corporation , starso ® table ii below displays gel times ( in seconds ) for each of the aforementioned sodium silicate solutions in the presence of ec , pc , bc , gc , and mixtures thereof data is given in the format x - y , wherein x and y represent the time required to reach the onset of gel and a fully gelled state , respectively . note that the onset of gel is usually accompanied by an abrupt increase in the viscosity and cloudiness of the mixture , whereas a mixure that ceases to flow under the stirring action of the spatula is considered a gelled mixture . the time required for mixtures to fully harden was not measured . all values are an average of two trials . table ii carbonate component ( wt . %) sodium silicate brand ec pc bc gc 1 2 3 4 *** 100 — — — 10 - 13 13 - 16 39 - 61 104 - 108 100 — — 23 - 29 61 - 70 & gt ; 240 & gt ; 240 — — 100 — 215 - 234 * & gt ; 240 & gt ; 240 & gt ; 240 — — — 100 10 - 24 12 - 30 14 - 36 ** & gt ; 240 25 75 — — 14 - 18 26 - 32 240 - 260 & gt ; 240 50 50 — — 13 - 16 12 - 16 150 - 164 & gt ; 240 75 25 — — 10 - 12 12 - 16 103 - 114 195 - 199 — 90 10 — 27 - 33 81 - 87 & gt ; 240 & gt ; 240 — 70 30 — 46 - 60 * 122 - 130 * & gt ; 240 & gt ; 240 — 50 50 — 68 - 82 * 182 - 197 * & gt ; 240 & gt ; 240 — 95 — 5 18 - 22 48 - 54 & gt ; 240 & gt ; 240 — 90 — 10 16 - 20 31 - 39 & gt ; 240 & gt ; 240 — 80 — 20 10 - 12 13 - 22 235 - 252 & gt ; 240 — 70 — 30 10 - 12 11 - 16 151 - 168 & gt ; 240 — 50 — 50 & lt ; 10 10 - 15 58 - 76 & gt ; 240 — 25 — 75 & lt ; 10 & lt ; 10 33 - 43 & gt ; 240 90 — — 10 & lt ; 10 10 - 14 52 - 59 102 - 109 75 — — 25 & lt ; 10 10 - 14 34 - 46 107 - 114 40 — — 60 & lt ; 10 & lt ; 10 25 - 35 & gt ; 240 20 — — 80 & lt ; 10 12 - 20 ** 19 - 31 & gt ; 240 * unlike most mixtures , gellation of formulations containing bc is not accompanied by an abrupt viscosity increase . rather , gellation occurs over a broader time range . formulations containing significant amounts of gc are not initially compatible , which results in longer than expected mixing times to reach a gelled state . * unlike most mixtures , a slight to moderate exotherm accompanies gellation of all formulations containing sodium silicate brand 4 . it can be concluded from the data in table ii that the general order of cure enhancement due to the presence of added alkylene carbonate is as follows : ec ≅ gc & gt ; pc & gt ; bc . it can also be concluded that the rate of cure is strongly dependent on the sio 2 / na 2 o ratio and increases with this ratio . a ratio of sio 2 / na 2 o greater than 2 . 4 is required if fast curing is desired . in general mixtures of gc / pc blends outperformed the analogous ec / pc blends for all but brand 4 , which possesses an sio 2 / na 2 o ratio much too low to promote fast curing . in addition , ec / gc blends outperformed the analogous ec / pc blends as well . these results are set forth graphically in fig1 .	2
referring now to the figures of the drawings in detail and first , particularly to fig3 and 4 thereof , there is shown a measuring device with a cartridge according to the invention that is now explained in more detail . a frequency oscillator with mass balance 30 of the measuring device according to the invention has already been explained with reference to fig1 and 2 . such a frequency oscillator with mass balance 30 is inserted in the measuring device according to the invention or a part thereof . the frequency oscillator with mass balance 30 is inserted into a housing 21 , wherein the housing 21 is in the form of a cartridge 20 ; the cartridge 20 receives the frequency oscillator with mass balance 30 . furthermore , measuring and sensor electronics 23 are arranged in the cartridge 20 , and receive oscillation parameters of the frequency oscillator with mass balance 30 and / or forwards them and / or evaluates them . further , there is a memory unit 22 in the cartridge 20 , in which data are stored prior to the start of the measuring , wherein the data were obtained using density measurement standards for the frequency oscillator with mass balance 30 . alternatively , another frequency oscillator with mass balance could be used here . the inventive measuring device is shown in more detail in fig3 in its entirety . the measuring device 28 has an end part , in which may be arranged the displays , settings and / or the measuring and evaluation unit 50 , with which the data obtained from the measurement and sensor electronics 23 are evaluated . in principle , it would also be possible to arrange the measurement and evaluation unit 50 in the cartridge 20 . the measurement and evaluation unit 50 can also control the oscillation movement of the frequency oscillator with mass balance 30 . it can also do this , however , with its own control unit 51 . the cartridge 20 has connecting elements or a connection 25 via which the cartridge 20 can be connected with a base body 29 of the measuring device 28 , and which is connected with the end part . connecting parts , correspondingly adapted to one another , may be formed on the base body 29 and / or on the cartridge 20 as shown in fig3 by the number 31 . the measured fluid is supplied through the oscillator tube 10 , 11 , 12 , 13 via a connection 26 and an outlet 26 ′, which preferably link the inlet and outlet directly to the oscillator tube 10 , 11 , 12 , 13 . a corresponding contact 27 to which the evaluation unit 50 is connected , is provided for the transmission of the electrical signal . the control unit 51 is provided in the measuring device 28 and / or in the base body 29 to adjust the oscillation parameters of the frequency oscillator with mass balance 30 . a tube 35 may also be connected to the base body 29 , via which the medium to be examined can be supplied to the cartridge 20 via the inlet 26 . with appropriate suction or pump devices ( not shown ) medium can be sucked through the tube 35 and passed through the frequency oscillator with mass balance 30 for measurement . all relevant parts of the measurement and evaluation electronics together with the oscillator tube for the behavior characteristics may be housed together in an easily exchangeable , mechanically - resistant , partially - transparent , thermally - insulating , liquid - tight , sample - resistant enclosure or a cartridge , and electrically , mechanically and fluidly coupled to the measuring device or its housing via a detachable connection . the components housed in the cartridge include the relevant electronics containing exciter amplifier , exciter and sensor for the oscillation , for example , magnets , piezo elements , temperature sensors and / or as well as actuators , for example , for switching the excitation angle as well as backlighting for optical inspection of the cell filling . these components are preferably installed on at least a printed circuit board and fitted together with the frequency oscillator in the housing or in the cartridge . the cartridge can be factory - set for the respective measuring device through measurements of measurement standards , while the calibration data are made available to be electronically readable with the cartridge . the cartridge can thus be made available as a standalone part or kept in stock . the measuring device , optionally featuring a handle , contains in its housing , the control and evaluation electronics , including a microcontroller or computer , and the keyboard , monitor , voltage / power supply including power supply unit , battery , accumulator , and filling aids , e . g . syringe , pump or sampler , and , where appropriate , storage media for recording data and interfaces for the output of measured data . the measuring device may be equipped with different cartridges . the measuring device displays the calibration constants stored in the respective cartridge from the cartridge for each of the cartridges used , in order to calculate the measured value , e . g . density , by using the calibration constants that are stored in the cartridge . the liquid - tight and / or shock - absorbing and / or thermally - insulating cartridge can be connected with the measuring device via a plug for electrical or electronic coupling and grommets or cables and connection openings or openings for fluid coupling as well as mechanical fixings e . g . screws and / or clamps . at least the following electrical connections are made between the cartridge and the measuring device : electrical connections for the exciter mechanism and pick - up coil or excitation and pick - up piezo elements between the measuring device and the cartridge . in addition , a control signal for the phase angle of the excitation of the oscillator is sent to the cartridge . a control signal is sent to the cartridge to switch the backlighting of the oscillator on and off . an electrical periodic signal that is generated from the pick - up signal of the oscillator is sent as a characteristic signal for the density analysis from the cartridge to the measuring device . at least one , but preferably two , temperature measurement signal ( s ), for example concerning the environment and / or oscillator temperature , that are required for temperature compensation of the density measurement or pre - calculate equilibrium temperature , is / are sent from the cartridge to the measuring device . the voltage and / or current supply of the cartridge is supplied from the measuring device . a 1 - wire bus signal transmits the calibration constants from the cartridge to the measuring device . in addition , it is possible to store values from the measuring device in the data storage of the cartridge , such as oscillator - relevant data or the maximum acceleration during operation as well as quality checks ; for example , a water check is possible . thus , particularly in handheld devices , simple field replacement of defective frequency oscillators can be ensured without the need to re - set them . after aging , existing cartridges may be used again through factory re - setting . the contamination of the measuring device with the sample fluid can be prevented . after a breakage , defective measuring devices can be easily repaired by exchanging cartridges . servicing the device is simplified and is possible in the field . a set can be easily exchanged for suitable cartridges for different samples with frequency oscillators with mass balance . the frequency oscillator with mass balance can be protected against environmental influences . the entire cartridge can be immersed in the medium to be examined in order to generate optimized temperature control . in a particular embodiment , in addition to the excitation amplifier , an evaluation unit , for example a micro - controller , together with wired or wireless interfaces , such as rs232 , usb , bluetooth and / or wlan , is integrated into the cartridge . it is thus possible , to create a simple density measurement device with the cartridge in the form of a module or smart sensor without local operation or keyboard or visualization or display . the visualization and operation is effected by a pc , tablet pc or mobile phone medium by means of a pc program or application . the power for such a module can be supplied either directly from the communication interface , e . g . usb , can , or through a battery supply . in addition , the combination of a supply from the wired interface , e . g . usb , and wireless communication , e . g . bluetooth is also conceivable . for a preferred embodiment , the cartridge or its housing can be connected or screwed onto the housing of the measuring device or an additional housing or compartment of the measuring device via a connecting part , in particular a screw cap . an additional housing can be used as a battery compartment or as a support for communication ports , e . g . usb , can plugs / sockets , or , in the case of a wireless interface , as a carrier for the antennas . alternatively , it would also be possible to integrate the evaluation unit , not in the housing but in an additional housing in order to protect the evaluation unit in the event of an oscillator tube breakage . the tubing or the fluid path can be provided through this additional housing via connection nozzles or a tube adapter to the frequency oscillator with mass balance . ideally , this additional housing also serves as a base on which the housing is mounted . the coupling between the cartridge and the measuring device can be effected via a fluid distributor , which serves as a point of suspension and support and may optionally also be replaced . the two legs of the oscillator which are used for the supply and discharge of the sample are coupled or tightly connected to the fluid distributor . the fastening of the sensor of the frequency oscillator with mass balance in the housing is so configured that it is only fixed at the supports , and does not make mechanical contact with the housing wall . in this way , one can achieve an influence on the oscillation mechanical decoupling from environmental influences , for example , caused by impact or stress on the cartridge . the mounting of the cartridge on the measuring device is configured advantageously so that the fluid connections of the frequency oscillator in the measuring position of the measuring device are inclined upwards at an angle , for example , of 10 °, in the standing position of the measuring device , in particular they may be oriented directly upwards thus allowing gas bubbles , which are troublesome for density measurement , to escape . the connection is sealed by seals on the frequency oscillator with mass balance or the fluid distributor . the inlet and outlet of the fluid may be performed in principle by any filling mechanism . i . e . the sample may be supplied either manually by a manual pump , but also electrically supplied by a pump motor or a linear drive for the supply of the hand pump . the hand pump can be in the form , for example , of a spring - loaded syringe that is tensioned against the spring force by the user and then the sample is automatically sucked out under the action of the spring force . in a simple form that is preferred for high - viscosity liquids , the sample can be passed from a syringe into the frequency oscillator with mass balance . sampling by pumping from a reservoir is also possible , such as an arrangement in the handheld device for controlled withdrawal from a sample container by a syringe . the connections from the respective filling system can be made to the fluid distributor of the measuring device . the cartridge is secured to the measuring device by dowel pins , quick release fasteners , screw caps with a union nut or similar devices . the electrical connections are made separately via a plug contact , or the plug contacts are already on the measuring device and the cartridge is so fixed that the contact is made by a precisely fitting insertion . an electrically contactless coupling is also possible between the cartridge and the measuring device . by known procedures , e . g . transformers , optocouplers , rfid , etc ., both the power supply and the data communication can take place wirelessly . this can thus prevent the problem of fluid sealing or the disadvantages of mechanical plugs due to corrosion , contact problems , and so on . the encapsulation of the frequency oscillator with mass balance and the electronic components is carried out in a preferred manner with unbreakable material . this can be done simply , for example , by a metallic enclosure in the case of metallic oscillators . a visual check of the filled fluid for bubbles is possible in the case of glass oscillators . these glass oscillators are , therefore , preferably encased with transparent materials . this may be glass but also , for example , shatterproof plastic material , e . g . polycarbonate . in addition , at least a part of the cartridge is transparent and the cartridge can have a viewing window . the cartridge can be fitted with lighting of the frequency oscillator with mass balance to facilitate the optical control of the filled fluid . backlighting may be attached to the back of the oscillator tube against the viewing window . optionally , a reflective film for observing the filling level may be mounted behind the oscillator . a partial section of the cartridge may be in the form of a magnifying glass in order to facilitate and improve the visual inspection . in one embodiment , the housing of the cartridge may also be thermally insulated . thus the influence of changing environmental conditions can be minimized especially in handheld instruments . the insulation can provide a more rapid achievement of stable measurement conditions which means shorter measuring times in combination with the measurement of two temperature values for the housing and the oscillator by pre - calculated temperature equilibrium . the housing contains at least one , preferably two , temperature sensor ( s ), e . g . ntcs , ptc &# 39 ; s , thermocouples etc . in order to detect the attainment of stable temperature conditions in the housing . thus , both the temperature of the oscillator tube on filling the oscillator with the fluid as well as the temperature in the interior of the cartridge , can be measured . this allows a stable measurement point to be reached in the measurement by a hand - held measuring device without temperature control and this allows to measure the temperature of the sample at the time of measurement . by using calibration tables , optionally calibration polynomials , for the temperature dependence of the density of different samples , the density at any temperature can be determined . in the case of laboratory equipment with temperature control of the sample , the sample temperature can be checked as necessary . the calibration data of the temperature measurement used and the calibration constants for the evaluation of the density from the measurement signals of the frequency oscillator are determined for each factory - set frequency oscillator with mass balance and made available in the cartridge for incorporation into , or transfer to , the measuring device . in the simplest case , the cartridges are provided with a unique identifier , such as a number or an electronically - readable code such as a barcode . the calibration data can be entered from a datasheet with this number to ensure compatibility with the measuring device and can be accessed with the number in the storage media for evaluation of the measured data . the calibration data can thereby also be transmitted on a data carrier / storage media and copied or interpreted from the measuring device with a reader . the calibration data can be read out electronically , for example , via an interface and read by the measuring device . in one embodiment , the cartridge can be automatically recognized by the measuring device and the factory calibration data can be stored directly on the non - volatile memory on the cartridge . on aging of the oscillator , it can possibly be factory reset through additional calibration measurements . in one embodiment , the calibration data are made directly available to the cartridge from a non - volatile memory , where they can be read out directly from the measuring device for example an i - button from dallas using a known one - wire bus system via a single contact and be stored in the memory on calibration . in another embodiment , the data can be written at the factory to a rfid - tag and be read from the measuring device by an optional non - contact reader , for example , incorporated in the measuring device . the installation of the cartridge can be performed with an additional degree of freedom for shock absorption in order to reduce the likelihood of breakage of the oscillator and to increase the robustness of the entire measuring device . for this purpose , the connection between the instrument and the cartridge may be cushioned by the use of resilient elements , for example , rubber seals . the cartridge advantageously completely or fully encloses the components arranged inside .	6
fig1 shows a foldable box 1 in the folded state , comprising i ) panels 2 which are linked by folds 4 , together with ii ) flaps 6 . each panel 2 has a width w 2 , measured perpendicularly to the folds 4 , corresponding to the height of the foldable box 1 in the unfolded state . each flap 6 is linked to a respective panel 2 by a fold 8 formed by a corrugating machine . two neighboring flaps 6 are separated by a respective slot 10 . each slot 10 extends between a central region 11 and a peripheral face 12 of the foldable box 1 . the slot 10 has a peripheral end 14 opening on the peripheral face 12 and delimiting a lateral interval 16 between the two neighboring flaps 6 . the slot 10 has a central end located in the central region 11 , and therefore opposite to the peripheral end 14 . as shown in fig1 , the foldable box 1 has a fault , because the slots 10 have oblique edges , instead of edges parallel to one another . one of the slots 10 has an excessively wide peripheral end 14 , and therefore an excessively large lateral interval 16 , while the other slot 10 has an excessively narrow peripheral end 14 , and therefore an excessively small lateral interval 16 . this fault may be due to incorrect cutting , incorrect gluing and / or incorrect folding . sometimes , a width w 10 of a slot 10 is determined near the folds 8 , by measurement in a prior art device , or by extrapolation in the case of the present invention . fig2 shows a manufacturing installation 50 intended to manufacture foldable boxes 1 and comprising at least : a gluing device 52 configured to apply glue to a gluing area of each foldable box 1 , a folding device 54 configured to fold panels 4 so as to glue an area to be glued onto the gluing area , a stacking device 56 configured for stacking the foldable boxes 1 in the folded state , a squaring device 60 configured for squaring the foldable boxes 1 so as to form packs 201 , a conveying device 58 , configured to place the foldable boxes 1 in the gluing device 52 , then in the folding device 54 , then in the stacking device 56 ; in this case , the conveying device 58 is a belt conveyor providing an output rate of the installation equal to about 1800 foldable boxes 1 per hour , and in the example of fig2 and 3 , the checking devices 200 are placed downstream of the stacking device 56 and of the squaring device 60 . the gluing device 52 , the folding device 54 , the stacking device 56 and the squaring device 60 follow one another from the upstream to the downstream end , in the direction of circulation determined by the conveying device 58 . each checking device 200 therefore checks the foldable boxes 1 in packs 201 . additionally , the two checking devices 200 are arranged so as to form respective images of two peripheral pack faces 212 , particularly the two opposite faces of each pack onto which the respective slots open and where the interval of the flaps at each face are seen and measured . this arrangement can be used to check all the slots of each foldable box 1 contained in a pack 201 . fig3 , 5 and 6 show one of the checking devices 200 . the checking device 200 comprises an illumination system 202 with two illumination sources 202 . 1 and 202 . 2 , two cameras 204 forming an imaging device , and an image processing system 206 . the illumination system 202 and the cameras 204 are mounted on a framework 203 . in this case , the checking device 200 is positioned in line ; that is to say , the checks are made when the conveying device 58 brings the packs 201 to a position in front of the checking device 200 . the conveying device 58 is arranged to convey the packs 201 in a horizontal direction . the illumination system 202 is configured to illuminate a pack 201 formed from superimposed foldable boxes , wherein the illumination system 202 is configured to illuminate the foldable boxes 1 one by one . the pack 201 has two peripheral pack faces 212 on which the slots 210 open , which are defined by peripheral faces of all the foldable boxes composing the pack 201 . the solid angle illuminated by one illumination system 202 . 1 is therefore larger than the solid angle illuminated by the other illumination system 202 . 2 . as shown in fig6 , the checking device 200 comprises two cameras 204 . the cameras 204 are placed at two different heights , so as to form plural images 205 of a lower part and an upper part , respectively , of the peripheral pack face 212 . thus the two cameras 204 can be used to form high - resolution plural images 205 , even if the packs 201 contain large numbers of foldable boxes 1 . in this case , the cameras 204 are configured for producing an overlap area between a plural image of the lower part of the pack 201 and a plural image of the upper part of the pack 201 . the checking device 200 is arranged so that the optical axis of each camera 204 forms an angle ( not shown ) of about 60 degrees to the horizontal direction . each camera 204 is a matrix camera , while the camera 204 may be a line scan camera . each camera 204 is configured to form at least one plural image 205 ( fig8 and 10 ) of the peripheral pack face 212 when the illumination system 202 illuminates the peripheral pack face 212 . each plural image 205 represents at least a part of the peripheral pack face 212 when the illumination system 202 illuminates the peripheral pack face 212 . fig8 , 13 , 14 and 16 show equivalent plural images 205 . the field of view of one camera 204 is therefore greater than the field of view of the other camera 204 . i ) detecting each peripheral end 214 ( fig4 and 8 ) in the plural image , that is to say all the peripheral ends 214 of the slots 210 defined by the foldable boxes composing the pack 201 , ii ) generating a set of data representing the geometry of each peripheral end 214 , iii ) analyzing the set of data so as to determine the width of each lateral interval 216 ( fig4 and 8 ). in the example of fig2 to 6 , the image processing system 206 is also configured for : a ) detecting the boundaries of the peripheral face 212 perpendicularly to the largest dimension of the peripheral pack face 212 , b ) measuring a reference level of brightness between one of these boundaries of the peripheral pack face 212 and an edge 205 of the plural image , and c ) generating a binary plural image 207 ( fig1 to 19 ) by using this reference brightness level to perform a thresholding operation on the plural image 205 . on the basis of a binary plural image 207 , the image processing system 206 can then : vii ) compare the height h 220 of each dark object 220 with the nominal thickness of a foldable box 1 in the folded state , viii ) select each dark object 220 having a height h 220 equivalent to the nominal thickness of a foldable box in the folded state subject to a predetermined tolerance , so that each dark object of the height is one folded box , and its folded condition can be singled out for consideration by the image processing system , xii ) extract dark objects 220 from each binary plural image 207 , xiii ) detect , in each binary plural image 207 , the boundaries of the foldable boxes forming the ends of the pack 201 perpendicularly to the largest dimension of a foldable box 1 in the folded state , and xiv ) discriminate each foldable box in the pack 201 ; the image processing system 206 carries out the discrimination of each foldable box by processing a binary plural image 207 ( fig1 to 19 ). the image processing system 206 then generates a set of data representing the geometry of the peripheral ends 214 of the slots 210 , so as to determine the width of each lateral interval 216 , for all the foldable boxes appearing in the binary plural image 207 , and therefore in the plural image 205 . by processing a single plural image 205 , the image processing system 206 can thus determine the lateral intervals 216 of the slots 210 of all the foldable boxes composing a pack 201 . in practice , the image obtained from one camera 204 is larger than the plural image 205 . the plural image 205 is the useful portion of the image obtained from a camera 204 , that is the portion where the lateral ends can be detected . in other words , the other portions of the image obtained from a camera 204 show no lateral ends . the useful portion can be selected automatically on the basis of the dimensions of each foldable box 1 , with a margin intended to compensate for imperfect alignment of the foldable boxes in the pack 201 . by reducing the image obtained from a camera 204 to the useful portion forming a plural image 205 , the duration of the image processing can be minimized . fig7 and 9 show schematically , in cross section , the geometry of two types of slots . fig7 shows a first type of slot called “ straight ”, because the edges of the slot are parallel to one another . fig9 shows a second type of slot called “ v - shaped ”, because the edges diverge obliquely toward the peripheral end . fig8 and 10 show the plural images 205 obtained for the first type of slot ( fig7 ) and for the second type of slot ( fig9 ), respectively , when the illumination sources 202 . 1 and 202 . 2 simultaneously illuminate the peripheral pack face 212 . the plural image 205 of fig8 has peripheral ends whose edges have a high level of contrast . that is because the edges defining the slot do not project into the slot . the image processing system 206 can therefore easily process the plural image 205 of fig8 , in order to detect the peripheral ends of the slots and determine the width of each lateral interval . conversely , the plural image 205 of fig1 has peripheral ends whose edges have a low level of contrast , because the slot is of the “ v - shaped ” type and the end edges of the flaps extend into the slot . the image processing system 206 therefore finds it more difficult to process the plural image 205 of fig1 than the plural image of fig8 . the two illumination sources 202 . 1 and 202 . 2 are arranged on either side of the cameras 204 . as shown in fig1 and 13 , the illumination sources 202 . 1 and 202 . 2 are configured to illuminate the same peripheral pack face 212 successively . thus each camera 204 successively forms two different plural images 205 . 1 and 205 . 2 , visible in fig1 and 14 , for the same peripheral pack face 212 . the plural image 205 . 1 is formed during the illumination by the illumination source 202 . 1 , and the plural image 205 . 2 is formed during the illumination by the illumination source 202 . 2 . in the plural image 205 . 1 , the left - hand boundary of each peripheral end 214 has a high contrast level , and in the plural image 205 . 2 the right - hand boundary of each peripheral end 214 has a very high contrast level . the illumination system 202 is configured to illuminate the peripheral pack face 212 in a pulsed manner . the duration of an illumination pulse is about 20 ms in this case . between the two pulses , the pack 201 remains immobile , to ensure that the two successively formed images coincide . the image processing system 206 then processes the plural images 205 . 1 and 205 . 2 for the purpose of : i ) detecting the left and right boundaries of each peripheral end 214 , ii ) generating a set of data representing the geometry of each peripheral end 214 , iii ) analyzing said set of data so as to determine the width of each lateral interval 216 . this configuration of the illumination sources 202 . 1 and 202 . 2 enables the illumination system 202 to produce alternating illumination , which improves the detection of all the peripheral ends 214 of the v - shaped slots . in use , the checking device 200 is operated according to a checking method 2000 according to the invention , illustrated in fig1 . the checking method 2000 comprises the steps of : 2002 . illuminating , by means of the illumination system 202 , a peripheral pack face 212 , 2004 . forming , by means of each camera 204 , plural images 205 of the peripheral pack face 212 when the illumination system 202 illuminates the peripheral pack face 212 , 2006 . actuating the image processing system 206 for the purpose of : 2008 . i ) detecting each peripheral end 214 in each plural image 205 of the peripheral pack face 212 , 2010 . ii ) generating a set of data representing the geometry of each peripheral end 214 , and 2012 . iii ) analyzing the set of data so as to determine the width of each lateral interval 216 . fig2 and 21 show part of a checking device 300 according to a second embodiment of the invention . to the extent that the checking device 300 is similar to the checking device 200 , the description of the checking device 200 given above in relation to fig1 to 19 can be transposed to the checking device 300 , with the exception of the notable differences stated below . any element of the checking device 300 which is identical or similar , in its structure and / or function , to an element of the checking device 200 carries the same reference , increased by 100 . thus an illumination system 302 with two light sources 302 . 1 and 302 . 2 , a framework 303 , a camera 304 and an image processing system 306 are defined . the checking device 300 differs from the checking device 200 , notably , in that the camera 304 is a line scan camera , whereas the checking device 200 comprises two matrix cameras 204 . a line scan camera is a camera in which the photosensitive part is composed of a line of sensors ( with a dimension of 1 × n ). the sensors may be ccd (“ charge - coupled device ”) sensors , or cmos (“ complementary metal - oxide - semiconductor ”) sensors . the camera 304 is configured to receive an optical beam 304 . 4 . the checking device 300 also differs from the checking device 200 , notably , in that its imaging device is formed by a single camera 304 , whereas the imaging device of the checking device 200 comprises two cameras 204 . the camera 304 has an optical correction device 304 . 5 and a heat sink 304 . 6 configured to cool the camera 304 in use . furthermore , the checking device 300 differs from the checking device 200 , notably , in that each illumination source 302 . 1 and 302 . 2 is composed of light - emitting diodes ( led ) 302 . 5 arranged in a rectangular matrix , whereas the illumination system 202 is formed by two linear illumination sources . each illumination source 302 . 1 and 302 . 2 comprises a respective heat sink 302 . 6 and 302 . 7 . additionally , the checking device 300 differs from the checking device 200 , notably , in that the checking device 300 further comprises a reflecting mirror 308 arranged so as to reflect the light received from each pack of foldable boxes toward the camera 304 . this reflecting mirror 308 makes it possible to form a compact checking device 300 . each illumination source 302 . 1 and 302 . 2 directly illuminates each pack of foldable boxes through an aperture 309 formed in the framework 303 . in use , the checking device 300 can be operated according to the checking method 2000 illustrated in fig1 . clearly , the present invention is not limited to the specific embodiments described in the present patent application , nor to embodiments within the compass of a person skilled in the art . other embodiments may be envisaged without departing from the scope of the invention , using any element equivalent to an element indicated in the present patent application .	1
by way of disclosure , and not by way of limitation , a tubular doorbeam constructed in accordance with a preferred embodiment of this invention is illustrated in fig1 - 3 and generally designated 10 . the doorbeam 10 is formed from a web stock 40 and generally includes a center section 20 and end portions 30 . the center section 20 interconnects the end portions 30 , which secure the doorbeam 10 in a door 100 , as shown in fig1 . the web stock 40 includes opposing lateral edges 50 , as illustrated in fig2 and 4 . in the preferred embodiment , the web stock 40 is formed from a martinsitic steel ( i . e . martinsite ) such as inland m220 ultra high strength low alloy steel . of course , other materials that have the suitable properties for the performance requirements of a doorbeam may be used . the edges 50 are generally linear and uniformly spaced from one another , allowing the web stock 40 to have a uniform width . the web stock 40 may include a varying thickness profile , but will be described in relation to the preferred embodiment with the web stock 40 having a first and second thicknesses 42 and 44 , although in some embodiments , more than two thicknesses may be used ( not illustrated ). the location of the first and second thicknesses 42 and 44 may vary , but in the preferred embodiment , the second thickness 44 is approximately centered between the edges 50 as illustrated in fig2 . the thickness profile between the first and second thickness 42 and 44 may change abruptly or gradually . the type of change may depend on the location of the first and second thickness 42 and 44 . the type of change also may be chosen to ensure that the beam is no thicker at any given point than required , thereby allowing for the optimal balance of weight and impact strength . the web stock 40 is rolled into a tubular shape , and formed into a doorbeam 10 . a cross section of the tubular shape generally includes a varying thickness circumferential profile , relatively proportional to the varying thickness profile of the web stock 40 , rolled into the tubular shape . the web stock 40 is generally rolled into a continuous tubular shape that is then formed into the doorbeam 10 . the beam 10 generally includes a center section 20 and end portions 30 . in some embodiments , the beam 10 may be formed without the end portions . the formed center section 20 includes a first thickness 22 , the second thickness 24 , and a seam 26 . the first thickness 22 and second thickness 24 are the first thickness 42 and second thickness 44 of the web stock 40 rolled into the tubular shape . the first thickness 22 and second thickness 24 are illustrated in fig3 and 5 as being located approximately opposite on the doorbeam 10 , but may be located almost anywhere on the beam , with varying thickness . the location of the thicknesses depends on the location of the thicknesses on the web stock 40 . of course any third thickness and / or an additional second thickness on the web stock will show up proportionately on the beam 10 . the seam 26 may be located anywhere on the beam 10 but for ease of manufacture is preferably located as shown in fig3 and 5 , approximately in the middle of the first or second thickness 22 and 24 . in the preferred embodiment , the seam 26 is a weld sean . the end portions 30 are usually brackets formed from the ends of the center section 20 . the end portions 30 are generally well known in the art and may be formed to any shape or size to attach to a variety of doors 100 . the beam 100 may also be formed without end brackets ( not illustrated ), for example , as an elongate center section 20 that is attached to a door 100 by clamp , fastener , weld , or other means . for ease of manufacture , the end portions 30 may also include the varying thickness . the thickness variations may also increase the strength of the end brackets 30 while saving weight . the doorbeam 10 starts out as a web stock 40 that includes a first and second thickness 42 and 44 as may be seen in fig2 and 4 . in the preferred embodiment , the first and second thicknesses 42 and 44 are formed while the web stock 40 is formed . of course , the first and second thickness 42 and 44 may be formed at any other time before the web stock 40 is enclosed upon itself into the tubular shape . the first and second thickness 42 and 44 may be formed by rolling , stamping , or any other process . in the preferred embodiment , the web stock 40 is formed from continuous web stock 40 into a continuous beam , cut to length , and formed into individual doorbeams 10 . a continuous web stock 40 may also be formed into individual metal blanks ( not shown ) and then formed into the doorbeam 10 or the web stock may be made as individual metal blanks that are formed into the doorbeam 10 . the beam 10 is then welded along the seam 26 . the preferred welder is a laser welder to obtain high weld quality , but any other suitable welding technique may be used . either before or after the beam is welded , the end brackets 30 are formed . the method of forming end brackets is well known in the art . the end brackets 30 may also be attached by welding , fasteners , or any other means . [ 0036 ] fig4 and 5 show a first alternative embodiment of the web stock 40 , and a sectional view of the doorbeam 10 . in this alternative embodiment , the web stock 40 is formed having a greater thickness near the lateral edges 50 , than the center . therefore , the seam 26 is along the area of greater thickness . [ 0037 ] fig6 and 7 show a second alternative embodiment of the doorbeam 10 . in this alternative embodiment , the web stock 40 includes a base stock 48 with at least one metal strip 46 attached approximately in the center of the base stock 48 . the base stock 48 forms the first thickness 42 . the combination of the metal strip 46 and the base stock 48 form the second thickness 44 . in the preferred embodiment , the metal strip 46 is attached to the base stock 48 by welding . the methods of welding may include , laser , resistance , electron beam , or any other suitable welding means to attach the metal strip or strips 46 to the base stock 48 . additional spot welds 54 may be added to further secure the metal strips 46 , as may be seen in fig6 and 8 . [ 0038 ] fig8 and 9 show a third alternative embodiment of the doorbeam 10 . the third alternative embodiment is similar to the second alternative embodiment , except that the metal strips 46 are located near each of the lateral edges 50 . of course , it should be apparent that the metal strips 46 may be located anywhere on the base stock 48 . the actual placement of the metal strips 46 is not critical , so long as when the beam 10 is added to the door 100 , the areas needing extra thickness are somewhat positioned to provide maximum strength against impacts . this positioning may also be set when the end brackets 30 are formed , or when the beam is installed into the door 100 . [ 0039 ] fig1 and 11 show a fourth alternative embodiment of the doorbeam 10 . in the fourth alternative embodiment a doorbeam 10 is formed with a high strength center portion 20 and lightweight end portions 30 , as seen in fig1 . the web stock 40 is formed as discussed above with the preferred embodiment . one difference is that the web stock 40 in the fourth alternative embodiment has a much greater distance between the opposing lateral edges than in the preferred embodiment . the web stock 40 is cut into metal blanks 52 , approximately perpendicular to the opposing lateral edges 50 . the width of a metal blank 52 is approximately the circumference of the center section 20 of the doorbeam 10 . the length of the doorbeam 10 is approximately the width between the lateral edges 50 of the web stock 40 . the web stock 40 is rolled into a doorbeam as shown in fig1 . variations of the fourth alternative embodiment should be readily apparent . for example , varying the proportions of the first and second thicknesses 42 and 44 on the web stock 40 may easily change the proportions of the center section 20 and end brackets 30 . also , if the web stock 40 is formed as in the second alternative embodiment , with the second thickness 44 located near the edges 50 and the first thickness 42 located near the center , the beam 10 may be formed with a lightweight center portion 30 and high strength end portions 30 . the present invention can be used to create a wide and indeed limitless variety of light - weight , yet high - strength tubular doorbeams 10 , reinforced only as needed for a balance of strength and weight . the present invention results in an improved doorbeam 10 that is manufactured at a lower cost with increased impact strength and decreased weight . the above descriptions are those of preferred embodiments of the invention . various alterations and changes can be made without departing from the spirit and broader aspects of the invention as defined in the appended claims , which are to be interpreted in accordance with the principles of patent law , including the doctrine of equivalents .	8
fig1 has been described with respect to the related art . referring next to fig2 , is the block diagram of a jtag unit and target device test configuration 20 according to the present invention . the jtag unit 211 exchanges signals with and is controlled by a host processing unit ( not shown ). the jtag unit 211 exchanges the tms signals , the tdo signals and the tdi signals with the jtag interface unit 212 . the jtag interface unit 212 exchanges sck signals with the i . c . interface unit 220 , the t . d . interface unit 220 being a part of the target device 22 . the sck signals are exchanged over a single conducting path and are coupled to the target device 22 by a single pin . the t . d . interface unit exchanges tck signals , tms signals , tdi signals and the tdo signals with the jtag tap controller 221 . the jtag tap controller 221 exchanges signals with the emulation unit 222 . the emulation unit 223 exchanges signals with the core logic 223 . referring to fig3 , the basic timing for the serial interface according to the present invention is shown . the serial communication uses time division multiplexing . three time slots are allocated tms_slot , tdi_slot , and tdo_slot . these slots are indicated under the clock cycle diagram in fig3 . data from jtag unit is written between two logic high states during the high time of the sck clock cycle . these two levels are referred to as v ih and v ihh . the v ih level never exceeds the logic high level for normal device operation . in the case of cmos operation , this voltage is typically the provided by the upper supply rail . the v ihh level can exceed the upper supply rail voltage . these voltages are modulated by the incoming data stream . to write a logic “ 1 ”, the jtag unit drives the sck line to the v ihh voltage level during the high cycle . to write a logic “ 0 ”, the jtag unit drives the sck line to the logic high ( v ih ) level . circuitry in the t . d . interface unit determines when the v ihh signal is present and will store the associated data on the falling edge of the sck signal . because the sck is clocked by the jtag unit , a good time - base is formed with each falling edge , thereby allowing for relatively high speed data transfer . the sck signal is set to input both on the tms slot and the tdi slot . internally to the target device , the serial sdata signal stream is shifted into a two bit register at each falling edge of the sck clock . during the tdo_slot , the shift register is disabled . at the end of three cycles , the serial shift register is transferred into a two bit register . the contents of this register are then entered in the jtag tap controller . fig3 also includes some of the internal signals in the target device . the shift_count signal keeps track of the current clock cycle . the jtag_reg signal is the two bit register that stores the parallel jtag commands . this register is updated each time shift_count reaches zero . note that the tck signal for the jtag tap controller is delayed one cycle from the jtag_reg update as required . therefore , the jtag tap controller state changes at each rising edge of the tck signal . the tclk signal represents the test clock signal . the value of the tclk signal value is determined by writing a “ 1 ” or a “ 0 ” during the tdi_slot during the run - test - idle of the jtag algorithm . referring once again to fig3 , the tdo signal stream is allocated one time slot . the jtag interface unit releases sck signal at the end of the tdi slot , the release being triggered by the falling edge of the sck signal . once the sck signal is released , tdo data can be placed on the sck conductor from the t . d . interface device . two possibilities can be considered . the first case occurs when tdo data is a high logic level , referred to in fig3 as “ slave read 1 . in this case , the t . d . interface unit will drive the sck conductor to a logic signal high . the sck conducting path is driven actively for a predetermined period of time , the period of time determined by the parameters of one - shot multi - vibrator . the use of a one shot component allows for a fast transition of the sck signal under heavy loads . the one shot component is required because no sck signal is available during the tdo_slot to indicate when the t . d . interface unit is to be disabled . the one shot component automatically disables the t . d . interface unit after a set period of time . the jtag interface unit has a weak signal holder to prevent the sck line form floating . therefore , once the signal on the sck conductor is released , the last previously driven value will be maintained . as shown in fig3 , the jtag interface unit is enabled at the end of the tdo_slot . for the case when tdo data is a logic high signal , this signal causes the sck conductor to transition from high to a logic low signal . for the case when the tdo signal is a logic low signal , (“ slave read ”), the t . d . interface unit does not actually drive the sck conducting path . the bus holder simply maintains the logic low signal imposed by the jtag interface unit . in this case , no high to low transition is imposed on the sck conducting path during the tdo_slot . apparatus inside the t . d . interface unit handles both cases to ensure proper shifting of the data into the internal two bit register . referring to fig4 , detection apparatus 40 for the sck signals by the t . d . interface unit is shown . as discussed before , the lower voltage is the supply ( rail ) voltage v dd . the sck conductor is coupled through a strong p - channel fet 42 and a weak n - channel fet 43 to ground potential . an amplifier 44 is coupled between the p - channel fet 42 and the n - channel fet 43 . the v dd voltage is coupled to the control terminal of both fet devices . at normal input voltages the p - channel fet 42 is not turned on . once the signal on the sck conductor exceeds the threshold voltage above v dd , the p - channel begins to conduct . the process for fabricating the components must be selected to provide for the higher voltages . for mixed mode components , e . g ., 3 . 3v / 1 . 8v systems , this interface circuit is easily implemented . the sck conductor can be switched between 1 . 8v and 3 . 3v . the i / o components are implemented with 3 . 3v tolerant transistors . while the invention has been described with respect to the embodiments set forth above , the invention is not necessarily limited to these embodiments . accordingly , other embodiments , variations , and improvements not described herein are not necessarily excluded from the scope of the invention , the scope of the invention being defined by the following claims .	6
referring now to the drawings , fig1 depicts a bat 40 which has a core component 42 , a handle 44 , a knob 46 , and a cap 48 at the end of core component 42 . the core component 42 has a hollow barrel 50 and an integral , hollow stem 52 extending from , and axially aligned with , barrel 50 . handle 44 surrounds the stem 52 of core component 42 . annular , elastomeric decouplers are installed between core component 42 and handle 44 , preferably near or at opposite ends of the handle . the decouplers isolate handle 44 from core component 42 , keeping shock ( and to a significant extent other vibrations ) from being transmitted to the batter &# 39 ; s hands when a ball is struck . consequently , the batter is not stung or otherwise subjected to pain or discomfort . this is per se advantageous and also improves performance by keeping the batter from flinching when swinging at a ball . one of the just - discussed decouplers is shown in fig1 and identified by reference character 54 . further , significant , isolation of a batter &# 39 ; s hands from shock and other vibrations may be obtained by installing a grip 56 as shown in fig2 on the handle 44 of bat 40 . this grip isolates the user &# 39 ; s hands from the bat by tuned , progressive resistance , which keeps pain - and discomfort - attributable energy from reaching the user &# 39 ; s hands . grip 56 is fashioned by training an elastomeric wrap 58 as shown in fig4 - 7 around handle 44 in the helical manner shown in fig2 . elastomeric wrap 58 is constructed in accord with , and embodies , the principles of the present invention . isolation from shock and vibration and the adverse effects those phenomena can cause is achieved by the use of the above - discussed tuned progressive resistance technology in wrap 58 . to this end , integral pillars 60 are formed on an exposed side 62 of wrap substrate 64 . continuing deformation of pillars 60 results in progressively increasing resistance of the elastomeric material and highly efficient prevention of shock and vibration energy transfer . the pillars may have the illustrated frustoconical shape or an elliptical , square , rectangular , triangular , or other configuration . a recess 66 may be formed in each integral pillar . at one end , the recess opens onto that exposed end 68 of the pillar opposite the substrate 64 ( see fig7 ). the recess may extend through the substrate and open onto its opposite face , or it may have a blind inner end . each pillar may have multiple open - ended recesses , and they may be of the through - bore or blind - end type or a mixture of those types . the recesses 66 of elastomeric wrap 58 have a conical configuration and a blind inner end 70 . the pillars 62 in which recesses 66 are formed have the above - mentioned frustoconical configuration ; and there is one , centrally located aperture in each pillar . the pillars are closely packed with adjacent pillars touching . as discussed above , the use of recesses is one factor that may be employed in tuning the progressive resistance of the pillars . grasping grip 56 produces suction akin to that of an octopus tentacle , improving the grasp of the bat afforded by the grip . the grasp is further enhanced by virtue of grip 56 conforming to the contour of the batter &# 39 ; s hand due to ability of the pillars 60 to deform and deflect . referring now most particularly to fig2 , 6 , and 8 , it was pointed out above that wrap 58 is trained around handle 44 in a helical manner in fashioning grip 56 . wrap 58 has a central section 72 , relatively narrow , elongated , integral end segments 74 and 76 , and transition sections 78 and 80 with edges 82 and 84 which angle from end segments 74 and 76 to the central section 72 of wrap 58 . the edges 86 and 88 of wrap central section 72 , the edges 90 and 92 of end segment 74 , the edges 94 and 96 of end segment 76 , and transition segment edges 82 and 84 are all chamfered as shown in fig6 . when wrap 58 is trained around handle 44 as shown in fig2 , a chamfered , central segment edge 86 ( or 88 ) in one turn 98 , and the adjacent segment of the same edge in the next turn 99 overlap in the manner shown in fig8 . thus , grip 56 lies flat on handle 44 instead of bulging or bunching up as successive turns are laid down which might otherwise be the case . similarly , the tampered edges 82 and 84 of transition segments 78 and 80 and the chamfered edges 90 . . . 96 of elastomeric wrap end segments 74 and 76 cooperate in like manner to form a smooth , advantageously bulge - free grip . it is also to be noted ( see fig4 and 5 ) that the end segments 74 and 76 of elastomeric wrap 58 are free of the pillars 60 found in the central and transition segments 72 , 78 and 80 of the wrap . among other things , this allows segment 74 ( and / or segment 76 ) to be tucked under the end 96 or 98 of the wrap to secure the wrap in place without forming a bulge in grip 56 . also , the winding of the wrap around a handle can be started without bunching or bulging of the wrap . it is apparent from the foregoing that a wide variety of alternate embodiments are subsumed by the compass of the present invention . fig9 and 10 depict a wrap 100 embodying the principles of the present invention which has a substrate 102 , pillars 104 , and centrally located apertures 106 in the pillars . these pillars in this wrap do not have blind ends , but are the through - type in that they extend between and open onto the tops 108 of pillars 104 and the opposite ( or reverse ) side 110 of wrap 100 ; i . e ., the back or bottom side of substrate 102 . fig1 - 13 depict a wrap 120 with a substrate 122 and other , exemplary forms of pillars ; viz . : also , and as is shown in fig1 , a single wrap embodying the principles of the present invention may have pillars with both blind and through apertures , as well as pillars with apertures of different configurations , pillars with multiple apertures , and pillars with no apertures at all . above , wrap 58 was disclosed by relating it to an exemplary application in which the wrap is employed to form a grip on a bat handle . this is not intended to limit the scope of the invention in that wrap 58 wrap 120 , and other wraps embodying the principles of the present invention may be employed equally well , and in the same manner , to form wraps on other handles . as examples only , those of : golf clubs ; bicycle and motorcycle handlebars ; hammers , lawn mowers , weed - eaters ; and a host of other products . the principles of the present invention may be embodied in a wide variety of artifacts other than the elongated wraps discussed above and illustrated in fig1 - 13 . fig1 and 15 , for example , depict an elastomeric pad 180 with a substrate 182 and closely - packed pillars 60 on one side of the substrate . fig1 - 18 similarly depict a pad 190 which differs from pad 180 in that there are closely - packed sets or arrays of pillars 60 on both sides 192 and 194 of substrate 196 . pads embodying the principles of the present invention need not have the rectangular shape of pads 180 and 190 , but may be of generally any desired , geometric configuration . pads such as those identified by reference characters 188 and 190 may be used for many different purposes : as examples only , to isolate human anatomy from shock and vibration and to similarly protect a host of artifacts and devices from the adverse effects of shock and vibration . it was pointed out above that v / si &# 39 ; s employing the principles of the present invention may have pillars with any of a wide variety of configurations and that combinations of different pillars may be used in a single device . a v / si with both of these features is illustrated in fig1 and 20 and identified by reference character 200 . v / si has a substrate 202 and pillars 204 . . . 212 of circular , square , triangular , hexagonal , and pentagonal configurations . while apertured pillars are shown in fig1 , it is to be understood that apertures need not be provided , irrespective of the pillar configuration . also , fig1 and 20 make it clear that pillars need not touch , or even be in close proximity , for a v / si embodying the principles of the present invention to be effective . the invention may be embodied in many forms without departing from the spirit or essential characteristics of the invention . the present embodiments are therefore to be considered in all respects as illustrative and not restrictive , the scope of the invention being indicated by the appended claims rather than by the foregoing description ; and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein .	0
referring to fig1 a , the underlayment of the system 10 incorporates a three dimensional confinement structure 1 for filler material 2 comprising sub - assemblies ; each made up of a plurality of interconnected open cells of fabric material ( see fig1 b ) that have openings in the vertical dimension relative to a horizontal surface , such as the earth . an exemplary embodiment of the confinement structure 1 is sold under the tradename groundgrid ® ground stabilization system , manufactured by dupont . the three dimensional confinement structure 1 as illustrated in fig1 b and 2a is usually constructed from a nonwoven fabric . it is laid over a prepared base 3 and anchored on one end . the base 3 may comprise : about a ¼ ″ ( 0 . 25 inch ) crushed fine gravel or decomposed granite added to a stabilized about 1 . 0 to about 4 . 0 inches sub - base . crushed gravel may be spread and compacted to create an about 3 . 0 inch height base 3 . in other exemplary embodiments , the base may have a thickness that ranges from about 1 . 0 inches to about 6 . 0 inches , and preferably about 2 . 0 inches in height . in some instances , base 3 may be omitted from the system 10 . for example , base 3 may be omitted if the system 10 is to be provided on a surface comprising concrete . meanwhile , the confinement structure 1 may have thickness that ranges between about 0 . 5 of an inch to about 5 . 0 inches . more preferably , the confinement structure may have thickness that lies between about 2 . 0 inches to about 4 . 0 inches . particulate filler 2 , as illustrated in fig1 a - 1b and 2 a , is placed into the three dimensional confinement structure 1 at a depth that is equivalent to the top of the structure 1 in the vertical dimension , usually which is about two inches ( but the range of the vertical dimension for the structure may comprise between about ¼ ( 0 . 25 ) of an inch to about 5 . 0 inches ). the turf 4 may have a thickness that ranges between about 1 . 0 to about 3 . 0 inches , and preferably , from about 1 . 75 inches to about 2 . 25 inches as illustrated in fig1 . particulate filler 2 may comprise any type of elastomeric material such as styrene - butadiene rubber , butyl rubber , cis - polyisoprene rubber , neoprene rubber , nitrile rubber , ethylene propylene diene monomer , polyurethane , elastomeric polyester and other similar materials . the diameter of such particulate fillers is usually about ⅜ ″ inch , however , diameters larger or smaller are within the scope of this disclosure . particulate filler 2 of other synthetic polymers not normally considered to be elastomers may also be used as the particulate filler 2 . these include the vinyls , e . g ., vinyl chloride , vinyl ethers , vinyl acetate etc ., the acrylates and methacrylates , polyvinylidene chloride , urethanes , polyethylene , polypropylene , polystyrene , polyamides and polyesters . inorganic aggregate such as sand and gravel that has been coated with an elastomeric coating such as polyurethane , acrylic , vinyl and polyester may also be used . the size of the particulate filler 2 may vary between about 4 . 0 to about 70 . 0 u . s . screen mesh size . preferably , the particulate filler 2 will lie between about 6 . 0 to about 60 . 0 u . s . screen mesh size . it is also possible to use a mixture of particulate fillers 2 of two or more different materials . for example , a mixture of rubber and sand particulate may be used to adjust drainage and resiliency characteristics for the system . when sand is utilized as the particulate filler 2 , then generally sand smaller in size than 30 . 0 u . s . screen mesh size is used . preferably , sand between about 40 . 0 to about 200 . 0 u . s . screen mesh size is used for the particulate filler 2 . the figures of this disclosure illustrate a mixture of particulate fillers having different diameters and screen mesh size . one of ordinary skill in the art recognizes that the cross - sectional view of each granule for a particular filler 2 would be uniform if only one type of material and size were used in an exemplary embodiment . other three dimensional confinement structures 1 than those illustrated in fig1 b - 2a 1 may be used . other three dimensional confinement structures 1 may have the same or similar dimensions but with alternative cellular geometries than those illustrated in fig1 b - 2a . alternative cellular geometries include , but are not limited to , circles , triangles , quadrilateral shapes such as squares , rectangles and diamonds , pentagons and octagons . three dimensional geotextiles that have a waffle shaped thick three - dimensional cusp shaped profile such as is disclosed in u . s . pat . no . 5 , 616 , 399 ( which is hereby incorporated by reference ) may also be used for the three dimensional confinement structure 1 . geocells , three dimensional , expandable panels made from high density polyethylene , polyester , or other polymer material may be used for the confinement structure 1 . examples of such structures 1 include matrix and erocells produced by fiber web , ega produced by geo products llc , huitex produced by huikwang corp , geoweb produced by presto products co ., scc produced by strata systems inc . and tenax tenweb produced by syntec . other similar structures may also be used without departing from this disclosure . for example , other structures for the confinement structure 1 besides those listed above , may include an elastomeric or foam panel with open cells . these cells can be filled with elastomeric particulate 2 and such a structure 1 could be used instead of the geotextile fabric for the confinement structure 1 . the synthetic turf 4 that may be used may comprise any of the following artificial turfs sold by foreverlawn , inc . located in ohio as listed in table 1 provided below . the several figures also illustrate the synthetic turf 4 , the three dimensional confinement structure 1 , and prepare base 3 having very similar or close thickness dimensions . the dimensions provided in the figures have been exaggerated for clarity and for teaching purposes . fig2 b illustrates water drainage through the system 10 . specifically , the arrows penetrating the turf 4 , confinement structure 1 , and base 3 illustrate the direction that water from rainfall or other sources may take through the system 10 . water from rain may enter the top turf 4 and then flow through that layer to the particulate filler 2 contained by the confinement structure 1 . the water flows through the particulate filler 2 and then into the base 3 in which the water spreads out and disperses within the base layer 3 . fig2 c is a cross - sectional view of the system 10 and it illustrates how both the synthetic turf 4 and the confinement structure 1 may be secured . according to this exemplary embodiment , the system 10 comprises one or more staples 6 that penetrate through the turf 4 to couple to a nailer board 5 . the staples 6 may be made from stainless steel and may be galvanized . the staples 6 may comprise about ¼ ″ inch to about ½ ″ inch in length , and in some instances , about 1 ″ inch in length . the nailer board 5 may comprise a standard wood 2 ″× 4 ″ as understood by one of ordinary skill in the art . the nailer board 5 may also comprise a composite material . the nailer board 5 may be oriented so that its longer side is in the vertical position relative to the earth . generally , the nailer boards 5 are provided on the periphery or outline of a two - dimensional space . for example , for a square - shaped or rectangular area , the nailer boards 5 would be provided on the edges or border of the square - shaped area such that the boards 5 would define the perimeter of the area . see fig2 d which illustrates the nailer boards 5 provided on the periphery of a two dimensional space occupied by the synthetic turf 4 . the boards 5 in this figure have been illustrated with dashed lines to convey that they are hidden from view under the turf 4 . the dashed arrows adjacent to the boards 5 and staples 6 convey that the staples 6 are continuously positioned within the boards 5 along their length . however , as appropriate , intermediate boards 5 may be provided within an area as understood by one of ordinary skill in the art . other fasteners , besides staples 6 and boards 5 , like screws , nails , tacks , adhesives like glue , spikes , hook and loop fasteners , may be used without departing from the scope of this disclosure . typically , the boards 5 may be attached to a sidewalk , building , curb , or if in an open area , will be anchored to some type of rebar or metal stake . once the perimeter of the area to be covered is defined , the confinement structure 1 is spread out or expanded . usually , the confinement structure 1 does not need to be attached to the boards 5 , but sometimes the confinement structure may open / expand easier and holds in place better if it is stapled it to the boards 5 . once it is opened up , the confinement structure 1 is then filled with the particulate filler 2 . finally , the turf 4 may be laid over the area and attached to the boards 5 with the fasteners 6 noted above . in many exemplary embodiments , the turf 4 is usually not attached to the confinement structure 1 : the turf 4 usually just lays over the confinement structure 1 . fig3 a - 3c illustrate some exemplary steps of a method 300 ( see fig3 g for complete method ) for installing the system 10 . step 305 of fig3 a generally refers to preparing an appropriate base 3 using one or more different materials . this step 305 may include spreading the 0 . 25 crushed fine gravel or decomposed granite which may be added to a stabilized about 3 . 0 inches to about 4 . 0 inches sub - base . step 305 in fig3 a corresponds with a worker taking an appropriate tool , such as a shovel rake , and spreading the material forming the base 3 . step 305 may also include spreading crushed gravel and compacting it to create a base 3 having a height of approximately 3 . 0 inches . steps 310 , 320 in fig3 b generally correspond to laying down the confinement structure 1 across an area of interest . according to one exemplary embodiment , the confinement structure 1 is manufactured in strips that may be expanded or opened up in an accordion - like are fan - like manner . one strip when it is opened up were spread out may cover an area of approximately 107 . 0 square feet . however , one of ordinary skill the art recognizes that other areas greater or less than 107 . 0 square feet can be made and used without departing from the scope of this disclosure . how the confinement structure 1 is secured to the prepared base 3 is described in detail below in connection with fig3 d - 3f . step 330 in fig3 c generally corresponds with spreading the particulate filler 2 into the confinement structure 1 . how the particulate filler 2 is spread into the confinement structure 1 depends on the size of the area of interest . for smaller areas of interest , a 50 pound bag of rubber may be poured into each cell of the confinement structure 1 and may be spread across the cells with the back edge of a landscape rake as understood by one of ordinary skill the art . for larger areas of interest , the particulate filler 2 may be transported and applied with a wheelbarrow . in other instances , a “ cannon ” that disperses rubber into the confinement structure 1 may be used as understood by one of ordinary skill the art . fig3 d - 3f also illustrate some exemplary steps of a method 300 for installing the system 10 . fig3 e - 3f illustrate steps 315 through step 325 . in step 315 of fig3 e ( see fig3 d which illustrates locations for the first two anchors 7 ), the ends of the confinement structure 1 — before it is expanded — may be anchored with anchors 7 . each anchor 7 may comprise a long nail or a short pole . in step 325 of fig3 f , the remaining one or more ends of the confinement structure 1 may be anchored with the anchors 7 . as illustrated in fig3 f , the confinement structure 1 may secured every several feet . however , in many exemplary embodiments , this securing of the confinement structure 1 with this frequency of anchors 7 is only temporary as the anchors 7 should not be present in a “ fall safe ” areas , such as in children playgrounds . in some exemplary embodiments , the confinement structure 1 may be anchored close to the base 3 , such as with landscape staples 6 where they are positioned low enough that they could remain in the base 3 after the turf 4 is secured to the nailer boards 5 . in other embodiments , most of the anchors 7 for the confinement structure 1 may be removed after the turf 4 is secured . fig3 g is a flow chart illustrating an exemplary method 300 for installing the system 10 . step 305 may comprise the first step of the method 300 . in step 305 , the base 3 as illustrated in fig1 and fig3 a may be prepared . as described previously , this step may include spreading the 0 . 25 crushed fine gravel or decomposed granite which may be added to a stabilized about 3 . 0 inches to about 4 . 0 inches sub - base . step 305 in fig3 a corresponds with a worker taking an appropriate tool , such as a shovel rake , and spreading the material forming the base 3 . step 305 may also include spreading crushed gravel and compacting it to create a base 3 having a height of approximately 3 . 0 inches . subsequently , in step 310 , the three - dimensional confinement structure 1 may be laid down across the area of interest defined by the base 3 . next , in step 315 , one end of the confinement structure 1 may be anchored with nails or poles as illustrated in fig3 e . in step 320 , the confinement structure 1 may be spread out to cover the area of interest defined by the base 3 as illustrated in fig3 f . in step 325 , one or more additional ends of the confinement structure 1 are anchored with nails or poles to remain in place over the area of interest . next , in step 330 , the particulate filler 2 is spread across the area of interest and evenly into the confinement structure 1 . a rake or a broom may be pulled across the confinement structure 1 in order to spread the particulate filler 2 . the particulate filler 2 to be dropped into cells of the confinement structure that are below capacity and slide across cells that may be full . if needed , more particulate filler 2 may be added , and then raked or pulled across the confinement structure 1 in order to fill the cells of the confinement structure 1 that may have been low as illustrated in fig3 c . in step 335 , the contents of each cell of the confinement structure is checked for an adequate height for the particulate filler 2 . step 335 may be completed with foot traffic from workers as the confinement structure 1 is filled . such foot traffic may compact and settle in the particulate filler 2 into each of the cells of the confinement structure 1 . as appropriate , a power tamper may be used to further compact and settle the particulate filler 2 into the confinement structure 1 . in block 340 , the anchors 7 of fig3 f may be removed from the confinement structure 1 . next , in step 345 , a synthetic turf 4 for may be installed on top of the filled confinement structure 1 . the turf 4 may be unrolled from storage rolls or unfolded . in step 350 , the synthetic turf 4 may be secured to the confinement structure 1 using one or more various techniques . according to one exemplary embodiment , nailer boards 5 may be used to secure the synthetic turf 4 on top of the confinement structure 1 as illustrated in fig2 c - 2d . alternatively , instead of using nailer boards 5 or perimeter anchor boards , the synthetic turf 4 may be filled with a ballast in order to weigh - down the synthetic turf for so that it remains on top of the confinement structure 1 . the ballast may comprise at least one of sand , chunk rubber , or other particular matter as appropriate for synthetic turfs 4 . the method 300 then ends . a three dimensional cellular confinement structure 1 , groundgrid ® ground stabilization system from dupont , was laid down on a prepared base 4 and restrained on one end with vertically placed rods that extended above the top of the structure . the confinement structure 1 was stretched out to open the cells of the structure 1 and to cover the installation area that had an approximate size of about 4 . 0 feet by about 25 . 0 feet . chunk rubber particulate 2 , having a diameter of about ⅜ ″ ( inch ), was added to the open cells of the confinement structure 1 starting at the constrained end and working out to completely fill the three dimensional confinement structure 1 . after the three dimensional confinement structure 1 was completely filled , the surface was tamped to consolidate particulate 2 . additional particulate 2 was added and smoothed to fill in to the top of the three dimensional confinement structure 1 . the vertically placed rods were removed . synthetic turf 4 , playground grass having product name of forever lawn playground grass ultra and a thickness of approximately 1 . 875 inches ( including backing ), sold by forever lawn , inc . located in ohio , was installed on top of the particulate filled three dimensional confinement structure 1 and secured in place nailer boards . referring now to fig4 , this figure illustrates a graph 400 listing the head injury criteria ( hic ) corresponding to the astm standard specification for impact attenuation of surface systems under and around playground equipment , astm f1292 . if a person experiences a head impact equivalent to a hic score of 500 , then there is about a 79 . 0 % chance ( corresponding to point a which point also defines curve a on graph 400 ) that the person will likely suffer a minor injury . in other words , after an hic score is calculated from the standard , one reads the hic score along the x - axis of graph 400 to see where the hic score corresponding to the y - axis intersects one of the five curved lines a - e . at about 38 . 0 % ( corresponding to point b which point also defines curve b on graph 400 ), then there is the risk of a moderate injury ( curve b ) at this hic level . the risk of this impact having an hic score of 500 producing a severe or fatal head injury is very low ( corresponding to points d , e on graph 400 ). curve d defines critical head injuries while curve e defines fatal head injuries . however , it is also noted that the chance of experiencing a 500 hic score without suffering an injury of any kind is only about 21 . 0 % ( corresponding to point c which point also defines curve c on graph 400 ). for the two inch and four inch sample in table 2 above ( which corresponds to the height of the confinement structure 1 ), the synthetic turf 4 had a height of approximately 1 and ⅞ths of an inch . however , the synthetic turf 4 may comprise a height dimension anywhere from about 1 . 0 inch up into an excess of about 2 . 0 inches as understood by one of ordinary skill in the art . also , for these two samples , no ballast ( no particulate or granules were spread within the synthetic turf 4 ) was utilized . additionally , no base 3 was used for these two samples as required by astm 1292 - 04 . astm 1292 - 04 requires testing over a concrete surface so there was no base material 3 or one could state that the base was concrete for these two examples . the type of synthetic turf 4 which was utilized was the type sold under the name playground grass ultra , by foreverlawn , inc . located in ohio . the technical specifications for playground grass ultra are listed in the last column of table 1 provided above . what is unexpected and surprising about the system 10 is that such a relatively simple system 10 , as illustrated in fig1 a , may provide such adequate shock attenuation , stabilization and drainage for playgrounds , as evidenced by the astm f1292 data in table 2 listed above . specifically , a person of ordinary skill in the art would not have reasonably predicted the inventive system 10 yielding hic scores between 510 . 0 and about 755 . 0 for simulated fall heights between about 8 . 0 and 11 . 0 feet , wherein the inventive system 10 comprises a confinement structure 1 having a vertical dimension of about ¼ ( 0 . 25 ) of an inch to about 5 . 0 inches ), more preferably between about 2 . 0 and about 4 . 0 inches ; synthetic turf 4 having a thickness that ranges between about 1 . 0 to about 3 . 0 inches , and more preferably about 1 and ⅞ths of an inch ; a particulate filling material 2 comprising any type of elastomeric material such as styrene - butadiene rubber , butyl rubber , cis - polyisoprene rubber , neoprene rubber , nitrile rubber , ethylene propylene diene monomer , polyurethane , elastomeric polyester and other similar materials , and wherein the particulate filling material 2 may vary between about 4 . 0 to about 70 . 0 u . s . screen mesh size , and the filling material 2 preferably comprising chunk rubber with a diameter of about ⅜ ″ ( inch ). it is noted that in some conventional turf systems which have deflection layers , such layers may be a nonwoven or woven , however , they are generally laid flat . meanwhile , the system 100 is dependent on the resilience of the nonwoven or woven material of the structure 1 to absorb shock . conventional turf systems do not provide any teachings of resilient materials used for the particulate filler 2 . the particulate filler 2 usually should have some resilient / elastomeric properties . the system 10 combines the function of a deflection layer and a flexible grid system . the word “ exemplary ” is used herein to mean “ serving as an example , instance , or illustration .” any aspect described herein as “ exemplary ” is not necessarily to be construed as preferred or advantageous over other aspects . certain steps in the processes or process flows described in this specification naturally precede others for the invention to function as described . however , the invention is not limited to the order of the steps described if such order or sequence does not alter the functionality of the invention . that is , it is recognized that some steps may performed before , after , or parallel ( substantially simultaneously with ) other steps without departing from the scope and spirit of the invention . in some instances , certain steps may be omitted or not performed without departing from the invention . further , words such as “ thereafter ”, “ then ”, “ next ”, etc . are not intended to limit the order of the steps . these words are simply used to guide the reader through the description of the exemplary method . although selected aspects have been illustrated and described in detail , it will be understood that various substitutions and alterations may be made therein without departing from the scope of the disclosure , as defined by the following claims .	4
the present invention relates to break - open firearms of the type in which the barrel or barrels of the firearm are mounted on a barrel housing that is pivotally secured to the frame of the firearm , the barrel and barrel housing being rotatable from their closed ready - to - fire position to their open loading - and - unloading position . the improved monolithic ejector system of the invention will be described in conjunction with the over - and - under shotgun shown in the drawings but is not limited to this particular firearm . as shown best in fig1 - 3 , the over - and - under shotgun 10 embodying the invention has a stock 12 , a frame 14 mounted on the stock 12 , an upper barrel 16 , a lower barrel 18 , a monoblock or barrel housing 20 and a forearm stock 22 . the barrel housing 20 is formed with an upper barrel receiving bore 24 and with a lower barrel receiving bore 26 ( shown best in fig3 ) in which the chamber portion of the upper and lower barrels 16 , 18 are received and to which they are secured . the forearm stock 22 is releasably secured to the underside of the lower barrel 18 by a forearm latch ( not shown ), the barrel housing 20 and forearm stock 22 being pivotally mounted on the frame 14 so that the barrels can be rotated from their closed positions as shown in fig1 to their open position as shown in fig2 . in a prior art dovetailed ejector system 30 illustrated in fig4 and 5 , an ejector 32 is mounted in a pair of slots 34 , ( 36 not shown ) milled in a chamber portion 28 of a barrel . an annular shoulder 38 includes sections 38 a and 38 b , in which the section 38 b travels with the ejector 32 and section 38 a is a rigid portion integrally formed with the chamber portion 28 . this ejector system 30 requires precision milling on both the ejector 32 and the chamber portion 28 , and the rim recess geometry is dependent on the chamber geometry . further , in the prior art ejector system 30 , the spent cartridge is pulled from only one small section ( typically 120 °) of the circular ejector 32 . the inventive ejection system 40 comprises a chamber portion 42 of barrels 16 , 18 and a separate extractor 44 as illustrated in fig6 - 12 . when the barrels and barrel housing in a break - open firearm are rotated from their closed position to their open loading - and - unloading position , the longitudinally movable ejector ejects a spent cartridge from one of the barrels 16 , 18 . the maximum length of travel of the extractor is called its full throw . this travel is restricted by the chamber &# 39 ; s outer surface geometry interfering the extractor &# 39 ; s inner surface geometry . the interior surface of chamber 42 is uninterrupted , whereas the outer surface 46 of chamber 42 has sections of reduced diameter ( fig6 , 12 ). the outer surface 46 of chamber 42 has a first section 48 having a first diameter a that is generally the outer diameter of the barrels 16 , 18 . a second section 50 is adjacent first section 48 and has a second diameter b that is smaller than the diameter a of section 48 . a third section 52 is adjacent second section 50 and has a diameter c that is slightly larger than the diameter b of second section 50 but smaller than the diameter a of section 48 . the intersection of section 48 and section 50 form a first ledge 54 and the intersection of section 50 and section 52 form a second ledge 56 ( fig6 , 12 ). the extractor 44 is a hollow cylindrical tube having first and second ends 58 , 60 respectively . the first end 58 includes a rim 62 positioned around the circumference of the first end 58 . rim 62 also includes a generally u - shaped cutout 64 ( fig6 , 10 , 11 ). the u - shaped cutout 64 is provided for shooters who desire to reload spent shells and for the extraction of an unfired shell . the second end 60 includes a plurality of slots 66 placed equal - distant around the circumference of the second end 60 ( fig6 , 10 ). the number of slots 66 is generally at least four , preferably between four to eight , but can be even more depending upon the diameter of the chamber 42 . the slots 66 extend at least one half to one third of the distance of the extractor 44 . the slots 66 are for the purpose of assembling the extractor 44 and chamber 42 to form the ejection system 40 . slots 66 allow expansion of the second end 60 of extractor 44 so that is can be slid over chamber section 52 until it matches up with chamber section 50 . the lower interior portion 68 of each slot 66 includes an expanded portion 70 that is configured to engage the second ledge 56 of the chamber 42 when the extractor 44 is in the full throw position ( fig1 ). in the closed position , the second end 60 of the extractor 44 is adjacent to and buts up against the first ledge 54 of chamber 42 ( fig9 ). the length of the extractor 44 can be generally from 2 inches to 0 . 8 inches and the diameter will depend upon the diameter of the chamber 42 . the length of the slots 66 can range from about 1 . 5 inches to 0 . 375 inches . the extractor 44 can be sized to accommodate any gauge shell and can be configured for a variety of rifles . the inventive ejection system 40 provides a number of advantages . first , the two piece ejection system separates the chamber geometry from the rim recess geometry wherein the rim recess geometry now becomes the extractor for the spent cartridges . this allows for more flexibility in manufacturing the ejection system . second , the inventive ejection system 40 requires little milling on the extractor 44 and no milling on the chamber 42 . third , with the extractor 44 of the present invention , the spent cartridge is pulled from almost all of the circumference of the rim 62 of the cylindrical ejector 44 . the ejection system can be constructed from material well know to one skilled in the art of rifle manufacturing . although the present invention and its advantages have been described in detail , it should be understood that various changes , substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims . moreover , the scope of the present application is not intended to be limited to the particular embodiments of the process , machine , manufacture , composition of matter , means , methods and steps described in the specification . as one of ordinary skill in the art will readily appreciate from the disclosure of the present invention , processes , machines , manufacture , compositions of matter , means , methods , or steps , presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present invention . accordingly , the appended claims are intended to include within their scope such processes , machines , manufacture , compositions of matter , means , methods , or steps .	5
fig1 and 2 show the right - hand part , tubular in the usual fashion , of a steering device 1 for a motor - driven double - wheeled vehicle . the steering device 1 consists of an ordinary , surface - cleaned steel tube , nickel - plated , for example . a rotatable tubular handle 2 , made of plastic , is set on the steering device 1 ( compare also fig3 and 4 ). the tubular handle 2 is held by the grip 3 , made of a rubber - like material , which is grasped by the right hand of the vehicle driver . the tubular handle 2 turns with rotation of the grip 3 . the end of the tube handle 2 projecting from the grip 3 ( to the left of fig1 and 2 ) is covered and surrounded by a two - sectioned housing 4 , for example , fixed to the steering device . both parts 5 and 6 of the housing 4 are secured to the steering device 1 by screws in a conventional and therefore not separately described fashion . the upper part 5 of the housing is closed by a cover 7 , held to part 5 by the screw 8 . a rotatable cable drum 11 , on which a bowden control cable 12 can be wound in the usual manner , is set on a circular axle journal 9 above the upper housing part 5 . the underside of cable drum 11 is formed with a unitary bevel gear 13 . the bevel gear 13 meshes with bevel gear 14 formed as a unitary part at the free end of the tubular handle 2 . when the tubular handle 2 is correspondingly rotated by means of the grip 3 , the cable drum 11 is forced to turn and the bowden control cable is wound up to a greater or lesser extent such that , in this fashion , the fuel feed to the motor can be controlled in the usual way . to keep the bevel gear 14 continually meshed with the bevel gear 13 and thus secure the tubular handle against axial shifting on the steering device 1 , the housing 4 fixed to the steering device 1 -- compare fig3 and 4 in particular -- has an annular flange 15 which meshes with the circular groove 16 at the free end of the tubular handle 2 . the side walls of the circular groove 16 are formed by the back wall of the bevel gear 14 on one side , and on the other by a unitary collar 17 on the tubular handle 2 . to prevent friction wear between the arm 15 and the side walls of the groove 16 in the invention embodiment described , a clip or clamp type sheath 18 ( fig5 ) is fixed on the section of the annular flange 15 on the upper part 5 of the housing 4 , against which the inner walls of the groove 16 rub when the tubular handle 2 is turned . the sheath 18 is made of a material that is more resistant to wear than the material -- e . g ., magnesium alloy -- from which the flange 15 is made . the sheath 18 may , for example , consist of tempered or hardened steel . special types of synthetic material may also be suitable in certain cases . in any event , depending on the materials of which the arm 15 and the inner walls of the groove 16 are made , one can select a material for the sheath 18 that is wear - resistant and has practically no erosive effect on the inner walls of the groove 16 . in this way , the life of the system described is considerably extended . as shown in fig5 sheath 18 is in the form of a clamp that can be placed loosely over the upper part of the annular flange 15 . thus , sheath 18 covers only part of the flange 15 . if desired , a corresponding sheath may also be placed -- compare with fig2 -- on the part of flange 15 in the lower part 6 of housing 4 . this , however , is not required as a rule . in the design above , cable drum 11 is mounted on the upper part 5 of the housing ( fig3 ) so that it can rotate around the axle journal 9 . here also , to prevent wear on the axle journal 9 made of magnesium alloy , for example , by the constant rotation of a cable drum 11 made of a plastic , an improved version of the invention has a shell 19 on the axle journal 9 formed of a suitable material such as steel . this too almost completely precludes wear and extends the life of the system .	1
network devices perform a variety of operations to process packets . these operations can include packet classification , determining how to forward a packet , and so forth . to perform these operations on the large volume of rapidly arriving packets , some devices feature multi - core processors where the different cores simultaneously operate on packets in parallel . in some processors , the cores can execute multiple threads . the threads can further mask the latency of certain operations such as memory accesses . for example , after one thread issues a memory read , a different thread can execute while the first thread awaits the data being retrieved . a wide variety of software architectures can be used to process packets . for example , fig1 a depicts a sample packet processing architecture where a packet 104 is processed by a thread 102 . the thread 102 can feature a series of packet processing stages such as a de - encapsulation stage , packet classification stage , metering stage , queueing stage , and so forth . by performing operations on a packet using the same thread , data associated with the packet can remain in quickly accessible local memory . though different threads may operate on different packets , the threads may nevertheless need to share access to the same data . for example , the different packets may belong to the same packet flow ( e . g ., an asynchronous transfer mode ( atm ) circuit or transmission control protocol / internet protocol ( tcp / ip ) connection ). thus , the different threads may vie for access to update the flow - related data ( e . g ., the number of flow packets received ). to coordinate access to this shared data , the threads may feature one or more critical sections of instructions ( shaded ) executed by each thread . a critical section protects shared data by preventing more than one thread from executing the shared data access operations of the critical section at a time . for example , the critical section may use a lock ( e . g ., a mutual exclusion ( mutex )) that a thread acquires before it can continue critical section execution . after acquiring the lock , the thread can read , modify , and write the shared data back to memory . the thread can then release the lock to permit access by other threads . while ensuring coherency in the shared data , threads implementing a critical section , as described above , may experience a delay awaiting completion of the initial memory read of the shared data performed by the thread 102 upon entering the critical section . for example , as shown in fig1 a , after entering a critical section , the thread 102 issues a read to access the data shared by the different threads . due to the latency associated with memory operations , the thread 102 may wait a considerable period of time for the access to complete . in a “ lock - step ” implementation where each thread must complete each critical section within a fixed period of time , the memory access may leave the thread 102 with little time to perform operations on the shared data after the read completes . as shown in fig1 b , to avoid the latency associated with the initial critical section read of the shared data , thread 102 can issue a memory read operation to initiate a memory read ( labeled mr ) of the shared data from memory before thread 102 execution reaches the critical section . in the example shown , the retrieved value of the shared data has an arbitrarily labeled value of “ a ”. as shown , by using the retrieved copy , the thread 102 can avoid the initial memory access latency after entering the critical section , essentially moving the latency to a more convenient time . use of the copy of shared data in fig1 b , however , assumes that the shared data was not changed in the period of time between the read of thread 102 and the entry of thread 102 into the critical section . as shown in fig1 c , to preserve coherence in the shared data in this scenario , a core executing thread 102 may receive one or messages from another core indicating that one or more threads on the other core made changes to the shared data . the updated values ( arbitrarily labeled “ δ ”) may completely replace the “ early ” copy made by the thread 102 or only update a few data elements . as shown , by using the updated values instead of the copy (“ a ”), thread 102 can preserve data coherence while still avoiding a costly read operation inside the critical section . that is , the thread 102 either uses data obtained by the pre - critical section read and / or data included in the update messages . in either case , a memory read to retrieve the shared data is not needed upon entering the critical section to recap , in the absence of update message ( s ) ( fig1 b ), the thread 102 can safely assume that the value (“ a ”) copied from memory before reaching the critical section can be used . however , when update messages indicate changes to the shared data ( fig1 c ), the thread 102 uses the updated data (“ δ ”) instead of the data copied from memory earlier . fig2 a - 2b illustrate the use of this technique in a software architecture designed for a multi - threaded multi - core environment . as shown in fig2 a , in this architecture , each packet 104 a - 104 i is processed by a respective thread 102 a - 102 i . in the example shown , each thread 102 a - 102 i features multiple critical stages ( arbitrarily labeled x , y , and z ). entry into each critical stage by different threads 102 a - 102 is controlled by a signaling scheme . that is , each thread awaits a signal from a previous thread completing a given critical section before entering that critical section . for example , thread 102 d awaits a signal from thread 102 c before executing critical section y . thread 102 c provides this signal ( the solid arrow between threads 102 c and 102 d in fig2 a ) to thread 102 d when thread 102 c completes critical section y . likewise , thread 102 e awaits a signal from thread 102 d before entering a given critical section , thread 102 f awaits a signal from thread 102 e , etc . this chain of signals sent by each thread permitting entry into a given critical section creates a sequence of threads 102 a - 102 i entering the critical section . as shown , the sequence of threads spans multiple cores with each core providing some set of the threads . the sequence may “ wrap - around ” ( not shown ). that is , thread 102 i may signal thread 102 a to enter a given critical section for a next packet . as shown in fig2 a , in addition to signaling the next thread in the sequence to enter a completed critical section , a thread can issue a signal that permits a pre - critical section read . for example , as shown , thread 102 c not only issues a signal to thread 102 d permitting entry of thread 102 d into critical section y , the thread 102 c also issues a signal ( shown as a dotted line between threads 102 c and 102 g ) to core 100 c that permits threads 102 d - 102 f on core 100 c to initiate a pre - critical section read ( labeled mr ( y )) of shared data protected by critical section y . as shown , the signal triggering the pre - critical section read skipped the set of threads 102 d - 102 f provided by an intermediate core 100 b in the thread sequence . as shown , the pre - critical section read may be provided by one or more instructions executed at the end of a previous critical section ( e . g ., mr ( y ) occurs at the end of critical section x ). thus , as thread 102 d enters critical section y , thread 102 g can initiate a pre - critical section read ( mr ( y )) that will complete before thread 102 g enters critical section y . as shown in fig2 b , eventually , after sequential execution of critical section y by threads 102 d , 102 e , and 102 f , thread 102 g on core 100 c receives a signal from thread 102 f permitting entry into critical section y . again , due to the signal earlier received from thread 102 c , thread 102 g has already copied shared data for critical section y into local core 100 c memory before thread 102 g enters critical section y . potentially , however , any of the intervening threads 102 d - 102 f that executed critical section y after / during the pre - critical section read of thread 102 g may have altered the shared data . thus , as shown , the thread ( s ) 102 d - 102 f can write messages indicating changes ( labeled “ δ ”) to the shared data to the core 100 c executing the thread 102 g that performed the pre - critical section read . the messages indicating an update of data can include a flow identifier and a sequence of variable values and , potentially , field identifiers indicating which data values have been changed . the flow identifier may be formed from a tuple of header data ( e . g ., the ip source and destination addresses and transport layer source and destination ports ). if such messages were sent , the thread 102 g can use the updated data instead of data obtained in the pre - critical section read . in either case , the latency associated with a memory operation to read the shared data within the critical section can be avoided . fig2 a - 2b simplified some aspects of the implementation for ease of illustration . for example , fig2 a illustrated a single signal permitting entry into a critical section and a single signal permitting the pre - critical section read . in operation , thread 102 c may issue both types of signal at the completion of each critical section ( e . g ., x , y , z ) so configured . additionally , threads 102 f and 102 i ( and other lcore threads ) may similarly provide such signals to threads / cores downstream in the thread sequence . further , these signals may also “ wrap around ”. for example , thread 102 f may signal thread 102 a to perform a pre - critical section read for critical section “ x ” for a next packet after thread 102 f completes critical section x . while fig2 a - 2b illustrated a core that provided three threads , a core may provide many more threads ( e . g ., 8 or 16 ) or less . similarly , a processor will typically include more than three cores ( e . g ., 8 or 16 ). additionally , while fig2 a - 2b illustrated a given packet being processed by a single thread , a packet may be processed by more than one thread . for example , a first core may perform a first set of operations for a packet and pass the packet off to a second core for the next set of operations . the techniques can be implemented in a wide variety of hardware environments . for instance , fig3 depicts an example of network processor 200 . the network processor 200 shown is an intel ® internet exchange network processor ( ixp ). other network processors feature different designs . the network processor 200 shown features a collection of processing cores 202 on a single integrated semiconductor die . each core 202 may be a reduced instruction set computing ( risc ) processor tailored for packet processing . for example , the cores 202 may not provide floating point or integer division instructions commonly provided by the instruction sets of general purpose processors . individual cores 202 may provide multiple threads of execution . for example , a core 202 may store multiple program counters and other context data for different threads . as shown , the network processor 200 also features at least one interface 202 that can carry packets between the processor 200 and other network components . for example , the processor 200 can feature a switch fabric interface 202 ( e . g ., a common switch interface ( csix )) that enables the processor 200 to transmit a packet to other processor ( s ) or circuitry connected to the fabric . the processor 200 can also feature an interface 202 ( e . g ., a system packet interface ( spi ) interface ) that enables the processor 200 to communicate with physical layer ( phy ) and / or link layer devices ( e . g ., mac or framer devices ). the processor 200 also includes an interface 208 ( e . g ., a peripheral component interconnect ( pci ) bus interface ) for communicating , for example , with a host or other network processors . as shown , the processor 200 also includes other components shared by the cores 202 such as a hash core , internal scratchpad memory shared by the cores , and memory controllers 206 , 212 that provide access to external memory shared by the cores . the network processor 200 also includes an additional processor 210 ( e . g ., a strongarm ® xscale ®) that is often programmed to perform “ control plane ” tasks involved in network operations . the core processor 210 , however , may also handle “ data plane ” tasks . the cores 202 may communicate with other cores 202 via core 210 or other shared resources . the cores 202 may also intercommunicate via neighbor registers featuring a direct wired connection to adjacent core ( s ) 202 . the next neighbor registers can be used as a first - in - first - out ( fifo ) queue between adjacent cores . alternately , cores 202 may communicate with non - adjacent cores , e . g ., via a control and status register proxy reflect operation that moves data between transfer registers of the cores . individual cores 202 may feature a variety of local memory elements in additional to a given amount of local core 202 ram . for example , each core 202 may include transfer registers that buffer data being read from / written to targets external to the cores 202 ( e . g ., memory or another core ). additionally , each core may feature a command fifo queue that queues commands being sent to other elements . in addition to the transfer registers , the individual cores 202 may also feature other local core memory such as a content addressable memory ( cam ). the features of the network processor may be used to implement the techniques described above . for example , the cam of a core may be used to determine whether shared data has been updated . for example , the cam may store an id of shared data ( e . g ., a packet flow and , potentially , field identifier ) and a pointer to the location where shared data is currently stored ( e . g ., in one or more transfer registers or local core ram ). when a core receives a shared data update message , a thread executing on the core can compare the flow id of the messages against the flow ids currently stored in the cam . a match indicates that the update messages correspond to a shared data obtained by a pre - critical section read and the thread can correspondingly write the updated values into local ram and set a corresponding “ dirty ” bit in a predefined memory location indicating that the value to be used is in local core memory instead of the transfer registers . upon entering a critical section , a thread can check the associated “ dirty ” bit to determine which data to use . in the event of a cam “ miss ”, the core can disregard the update message as the updated data is not needed . potentially , the cam may be logically divided into segments to identify shared data of different critical sections . for example , a first set of cam entries may be used to store shared data ids for the critical section being executed while the next set of cam entries is used to store shared data ids for the following critical section . for example , a critical section identifier may be prepended to the flow id key stored in the cam or a fixed number of entries ( e . g ., entries 1 - 8 ) may be assigned to the section . in such an implementation , before a first thread of a core starts a critical section ( e . g ., critical section x ), the thread also clears the cam segment related to the next critical section ( e . g ., y ) so that pre - critical section reads launched for y can be stored in the cam segment . to illustrate application of the techniques described above , fig2 a - 2b will be renarrated using the features of the network processor architecture shown in fig3 . in this sample implementation , when the last thread 102 c of core 100 a exits critical section y , the thread 102 c , if necessary , sends the shared data ids and updates to shared data affected by core 100 a execution of critical section y through the next neighbor registers to core 100 b along with a next neighbor signal that enables core 100 b threads to enter critical section y . the core 100 a also sends a signal towards thread 102 g in core 100 c by placing a command in the core 100 a command fifo after a command writing the shared data to external memory . due to the sequential handing of commands in the command fifo , when the signal reaches core 100 c , it is guaranteed that the write back of data modified by core 100 a execution of critical section y has moved towards its destination . on receiving this signal , threads in core 100 c are permitted to initiate memory reads ( e . g ., to sram or dram ) for the critical section y and store the shared data in the core &# 39 ; s 100 c transfer registers . the results of a pre - critical section read can be tracked by a cam entry storing the corresponding shared data id and location of the copy of the shared data in the transfer registers . the core 100 c threads continue execution until reaching critical section y when a core 100 c thread reaches critical section y , the thread checks for a signal coming from core 100 b signaling that updated data messages have been queued in the core &# 39 ; s 100 c next neighbor registers . if the signal is available , the thread uses the shared data id from the next neighbor registers to do a cam search . if the id matches a cam entry , the pre - critical section data read into the core transfer registers from memory is obsolete and needs to be updated with the data included in the update messages currently in the core &# 39 ; s 100 c next neighbor registers . at this point , a dirty bit for the cam entry may be set and the update data stored in local core memory . after all the update messages ( e . g ., ( shared data id , var ) pairs ) enqueued to the core 100 c in the next neighbor registers have been processed , threads on core 100 c can enter critical section y in turn . the threads can access the dirty bit to determine whether to access the shared data from the transfer registers or the local core memory . as described above , the sequence of critical sections may “ wrap around ”. e . g ., execution of critical section x by thread 102 a follows execution of critical section x by thread 102 i . to provide such wrap - around signaling , the cap may be used to write signals and update messages to a core that is not directly connected by next neighbor circuitry . fig4 depicts a network device that can process packets using techniques described above . as shown , the device features a collection of line cards 300 (“ blades ”) interconnected by a switch fabric 310 ( e . g ., a crossbar or shared memory switch fabric ). the switch fabric , for example , may conform to csix or other fabric technologies such as hypertransport , infiniband , pci , packet - over - sonet , rapidio , and / or utopia ( universal test and operations phy interface for atm ). individual line cards ( e . g ., 300 a ) may include one or more physical layer ( phy ) devices 302 ( e . g ., optic , wire , and wireless phys ) that handle communication over network connections . the phys translate between the physical signals carried by different network mediums and the bits ( e . g ., “ 0 ”- s and “ 1 ”- s ) used by digital systems . the line cards 300 may also include framer devices ( e . g ., ethernet , synchronous optic network ( sonet ), high - level data link ( hdlc ) framers or other “ layer 2 ” devices ) 304 that can perform operations on frames such as error detection and / or correction . the line cards 300 shown may also include one or more network processors 306 that perform packet processing operations for packets received via the phy ( s ) 302 and direct the packets , via the switch fabric 310 , to a line card providing an egress interface to forward the packet . potentially , the network processor ( s ) 306 may perform “ layer 2 ” duties instead of the framer devices 304 . while fig3 and 4 described specific examples of a network processor and a device incorporating network processors , the techniques may be implemented in a variety of architectures including network processors , general purpose processors ( e . g ., a central processing unit ( cpu )), and network devices having designs other than those shown . additionally , the techniques may be used in a wide variety of network devices ( e . g ., a router , switch , bridge , hub , traffic generator , and so forth ). the term packet can apply to ip ( internet protocol ) datagrams , tcp ( transmission control protocol ) segments , atm ( asynchronous transfer mode ) cells , ethernet frames , among other protocol data units . the term circuitry as used herein includes hardwired circuitry , digital circuitry , analog circuitry , programmable circuitry , and so forth . the programmable circuitry may operate on computer programs such as instructions included on an article of manufacture such as a read only memory or other storage medium .	6
the invention is described in detail below with reference to the drawings for purposes of illustration only . modifications within the spirit and scope of the invention , set forth in the appended claims will be readily apparent to one of skill in the art . referring to fig1 through 10 , there is shown a high capacity napkin dispenser 10 including a housing 12 , a faceplate 14 and a movable support plate 16 provided with a biasing spring 18 . faceplate 14 is hinged to a mounting bracket 20 which , in turn , is secured to housing 12 . a hinge suitably includes a pin ( not shown ) as well as a hinge plate 22 to secure faceplate 14 to bracket 20 such that it pivots between a closed position ( fig1 ) and an open position for reloading . hinge plate 22 includes ribs 23 . housing 12 and faceplate 14 thus define a storage chamber generally indicated at 13 for receiving a stack of napkins . housing 12 suitably includes two multi - faceted panels 24 , 26 as well as an end plate 28 . panels 24 , 26 define opposed sidewalls 30 , 32 , 34 and 36 when secured together by way of tabs 38 which fits in slots 40 . preferably , plates 16 , 28 are injection - molded and of identical construction . this reduces fabrication costs as well as provides an opportunity to include molded - in features in the plate such as the quick lock mounting for spring 18 described herein . so also , panels 24 , 26 are of identical construction which saves considerable capital costs when producing the molds . injection - molding allows for providing multiple molded - in features which reduces the number of parts as well as the labor required to fabricate the inventive dispensers . an optional tether 42 secures plate 28 to movable support plate 16 so that when the empty dispenser is opened support plate 16 is not pushed out of the interior of the housing by spring 18 . preferably , the ends of the spring are bent inwardly at ends 18 a , 18 b and secured to support plates 16 , 28 provided by way of quick locking hooks 17 , 19 with fingers 17 a and 19 a over apertures 17 b and 19 b respectively configured so that a tether is not necessary . details are best seen in fig8 . in particular , retention finger 17 a projects radially outward while retention finger 19 a projects tangentially with respect to the coils of helical spring 18 . retention protuberance 19 c formed on the lower surface of retention finger 19 a serves to retain the inwardly projecting free end 18 a of helical spring 18 . guide posts 21 and 23 together with rack 17 and 19 as well as stop pin 25 define an imaginary mounting circle 29 . during assembly , inwardly projecting end 18 a of helical spring 18 may be placed between stop pin 25 and retention hook 19 while diametrically opposed portion 31 of helical spring 18 is slipped under retention finger 17 b with guide posts 21 and 23 restraining lowermost coil 33 of helical spring 18 . helical spring 18 is then locked into position by urging inwardly projecting end 18 a of helical spring 18 under retention finger 19 a and past a retention protuberance protuberance 19 c thereby locking helical spring 18 in place . this arrangement ( repeated with plate 28 on the other end of spring 18 ) greatly expedites assembly of the dispenser . further , plates 16 and 28 may be substantially identical eliminating extra cost for an additional mold . after assembly and loading with napkins , the weight of a napkin stack compresses spring 18 which , in turn , forces the stack to the faceplate as the stack is depleted . faceplate 14 is provided with an elongate aperture 44 which extends between sidewalls 30 and 36 and provides access to the napkin stack . at the outer surface 46 of the faceplate there is optionally provided a molded - in label film layer 48 , which extends substantially over the entire outer surface of faceplate 14 . at the inner surface 50 of faceplate 14 there is provided a plurality of triangular guide ridges 52 , 54 and so forth inclined towards aperture 44 as is seen in fig3 . aperture 44 is suitably configured to restrict access to the napkins and encourage withdrawal of 1 napkin at a time . in this regard , the length of the aperture at 55 is typically about 5½ inches and the opening has a maximum width of about 1⅜ inches when single fold napkins having a tail of about 6½ are aligned with axis 55 of the aperture . the faceplate , with its relatively restrictive aperture , is also effective to hinder or prevent contaminants and debris such as drinking straws , used packaging material and so forth from finding their way into the interior of the dispenser . it is appreciated from fig3 in particular that the guide ridges extend progressively further from the inner surface of faceplate 14 with increasing distance from the dispensing aperture , thereby flaring away therefrom . the guide ridges are further characterized in that they are generally orthogonal to an elongate axis 55 of the dispensing aperture . it is also appreciated from the various diagrams , that the guide ridges are generally parallel to an axis 57 of the storage chamber when the faceplate is in the closed position . faceplate 14 is preferably injection - molded and of unitary structure . a preferred class of materials are acrylonitrile - butadiene - styrene ( abs ) molding compositions due to their unique combination of impact resistance and warp resistance . faceplate 14 is also provided with a unitary injection - molded locking latch 56 which is provided with a molded - in spring in the form of a pair of arms 58 , 60 which bear upon the guide ridges to bias latching member 62 of the latch to a locking position where it is maintained when mounted in the faceplate . when faceplate 14 is closed ( fig1 ) lock member 62 is thus maintained in locking engagement with portion 64 of bracket 20 when the faceplate is closed so that the faceplate cannot be opened . moreover , the locking latch 56 is mounted at inner surface 50 of faceplate 14 adjacent an end 66 of aperture 44 . latch 56 is thus concealed from view when the dispenser is closed , but readily accessible through aperture 44 to a technician aware of its placement at the end of the dispensing aperture . in order to release the latch , a technician simply pulls the latch away from the locking position by pulling on a lip 68 of the latch to displace it inwardly toward the center of the aperture . preferably , the latch has a beveled edge 72 to facilitate closing and is made of relatively durable polymer such as nylon or polyacetal . celcon acetal copolymer is available from celanese limited , dallas , tex . optionally , faceplate 14 and bracket 20 are provided as part of a kit with an additional collar 80 as shown in fig5 . collar 80 is sized to fit around an existing dispenser and to be secured to bracket 20 through an existing flange , for example . holes 82 , 88 , 94 and 96 are provided to secure the collar to bracket 20 , while holes 84 , 86 , 90 and . 92 can be used to secure the collar to a counter in which the dispenser is mounted . a cutaway 98 in the collar can be used to accommodate features of an existing dispenser , such as a latch which is no longer used . thus , the inventive arrangement is used to retrofit existing dispensers so that they are easier to operate . in a preferred construction of the inventive dispenser , bracket 20 defines an opening 100 ( fig3 ) suitable for retaining a stack of napkins 102 so that the dispenser may be more easily loaded . to this end , opening 100 is adjacent a pair of lateral retention ledges 102 , 104 which progressively project inwardly so that the napkins will be restrained within the dispenser when the cover ( faceplate 14 ) is open . preferably retention ledges 102 , 104 have a profile configured to grip the napkins lightly but allow them to slip out without imposing such a force on them that they will not be torn or otherwise damaged as they are dispensed . in this regard , it is noted that a geometry with simply a rectangular cantilever projecting over the opening of the storage chamber was less desirable than the bowed geometry seen in fig6 . the relative dimensions of opening 100 and a napkin stack 106 are better understood with reference to fig6 and 7 . fig6 is a view in section along line 6 - 6 of fig3 showing the profile of bracket 20 . bracket 20 has two laterally inwardly projecting retention ledges 102 , 104 as shown in the figures . each of these retention ledges 102 and 104 has an arcuate profile which flares upwardly and inwardly from its lower portions to its upper portions located adjacent dispensing opening 100 . at the lower portion , the bracket defines a lateral span 108 which is generally larger than the lateral span or width 110 of napkins to be dispensed through opening 100 . at the upper part of opening 100 the span between edges 102 , and 104 as shown at 112 is generally less than the span 110 of a napkin stack 106 to be dispensed there through . thus , if it is desired to dispense a stack of interfolded , single folded napkins 106 as shown in fig7 through opening 120 , the progressively inwardly projecting retention ledges 102 , 104 will restrain the stack as well as guide it through opening 102 . as will be appreciated from the diagram , portions 102 , 104 most preferably have an inwardly bowed , convex profile which projects progressively toward the center of the dispenser with height ( toward the aperture ) to facilitate dispensing through the opening without tearing or otherwise damaging the napkins . this geometry is also effective for hindering upward motion of the stack which is biased by spring 18 . it will be further appreciated from fig6 and 7 that the tails ( such as tail 105 ) of the napkins have their edges parallel to the contour lines of convex profiles 102 , 104 in a preferred embodiment . that is to say , the edges of the tails of the napkins are generally parallel to axis 55 of aperture 44 as may be seen in fig1 . in a preferred embodiment , span 110 of the napkins may be about 5 inches or so and the span at 112 may be about 4 . 5 inches , about 10 % less than the width of the napkin stack . fig8 is a detail showing spring 18 attached to end plate 16 , there is shown in fig9 an enlarged view of hook 19 and stop pin 25 for purposes of illustration . it will be appreciated from the discussion above that plate 28 is most preferably identical to plate 16 and secured to spring 18 in an identical manner . to this end , posts such as 21 , 23 and hooks such as 17 , 19 position and secure the plates to the spring . the radial hooks 17 have a finger 17 a extending generally in a radial direction with respect to axis 57 of spring 18 to secure the spring axially , while the tangential hooks 19 have a finger 19 a extending generally in a tangential direction with respect to the coils of spring 18 to hinder rotation of the spring and secure it to the plates . plates 16 , 28 are suitably injection - molded from an abs resin composition which is used for the other components of the dispenser such as the u - shaped panels defining the storage chamber for the napkins . a napkin dispenser faceplate of the invention is likewise made by injection - molding such that it has molded - in guide ridges inclined to the aperture in a unitary structure as illustrated . a preferred faceplate has a molded - in label film at its outer surface which gives the faceplate a brushed stainless steel appearance , for example , when a polymer layer printed with an appropriately pigmented ink is used . the inventive dispenser is most preferably provided with a decorative cover film 48 of the type illustrated schematically in fig1 . in fig1 there is shown a film such as film 150 which is provided with an ink layer 152 as shown in the diagram . film 150 may be a relatively thin , polycarbonate film if so desired , while ink layer 152 may be any suitable ink , preferably an ink which provides a metallic appearance to film 150 . a preferred method of fabrication is to print ink 152 onto film 150 and then thermoform the film into the desired shape . the thermoformed film is then positioned in a mold . thereafter a structural resin , such as resin 154 , is injection - molded onto the ink layer of the film while it is disposed in the mold . thus , the surface appearance is provided by way of a thermoformed film which has been positioned in the mold and provided with a structural backing to form the faceplate . the bilayer film preferably extends substantially over the entire outer surface of the faceplate . alternatively , metallic foil containing label film is used . a label film is shown schematically in fig1 . film 200 includes an optional adhesive layer 202 for securing it to the mold , optionally a protective outer layer 204 of transparent polymer , a facestock layer 206 and another optional melt - activated adhesive layer 208 . other suitable films are disclosed in u . s . pat . no . 6 , 773 , 653 to miller et al . the films are pre - cut and adhered to the mold by way of layer 202 , then the part is injection - molded from a molten injection - molding composition applied over the film . the heat - activated adhesive layer 208 of the film melt - bonds with the part to produce a durable structure which provides a very large number of decorative options by way of choosing a suitable facestock layer . moreover , other layers may be added as desired . the faceplate of the invention can thus be made with a metallic appearance on one side and integral plastic guide ridges on the other side without the need for making multiple parts to achieve the desired effect . the optional heat activated or heat - activatable layer of the label film is a layer of material which is activated by heat during the molding process to improve bonding of the label to a plastic article in the molding process . materials for the heat - activatable adhesive layer may comprise any heat - activatable adhesive or thermoplastic film material . such materials include but are not limited to the following film - forming materials used alone or in combination such as polyolefins , ( linear or branched ), metallocene catalyzed polyolefins , syndiotactic polystyrenes , syndiotactic polypropylenes , cyclic polyolefins , polyacrylates , polyethylene ethyl acrylate , polyethylene methyl acrylate , acrylonitrile butadiene styrene polymer , ethylene - vinyl alcohol copolymer , ethylene - vinyl acetate copolymers , polyamides such as nylon , polystyrenes , polyurethanes , polysulfones , polyvinylidene chlorides , polycarbonates , styrene maleic anhydride polymers , styrene acrylonitrile polymers , ionomers based on sodium or zinc salts of ethylene / methacrylic acid , cellulosics , fluoroplastics , polyacrylonitriles , and thermoplastic polyesters . more specific examples are the acrylates such as ethylene methacrylic acid , ethylene methyl acrylate , ethylene acrylic acid and ethylene ethyl acrylate . also , included are polymers and copolymers of olefin monomers having , for example , 2 to about 12 carbon atoms , and in one embodiment 2 to about 8 carbon atoms . these include the polymers of alpha - olefins having from 2 to about 4 carbon atoms per molecule . these include polyethylene , polypropylene , poly - 1 - butene , etc . an example of a copolymer within the above definition is a copolymer of ethylene with 1 - butene having from about 1 to about 10 weight percent of the 1 - butene comonomer incorporated into the copolymer molecule . the polyolefins include amorphous polyolefins . the polyethylenes that are useful in the heat seal layer include those with various densities including low , medium and high density ranges . the ethylene / methyl acrylate copolymers available from chevron under the tradename emac can be used . these include emac 2260 , which has a methyl acrylate content of 24 % by weight and a melt index of 2 . 0 grams / 10 minutes at 190 ° c ., 2 . 16 kg ; and emac sp 2268t , which also has a methyl acrylate content of 24 % by weight and a melt index of 10 grams / 10 minutes at 190 ° c ., 2 . 16 kg . polymer film materials prepared from blends of copolymers or blends of copolymers with homopolymers are also useful . also , the heat activatable first adhesive layer may contain antiblock additives ( such as silica , diatomaceous earth , synthetic silica , glass spheres , ceramic partides , etc .) this layer also may contain an antistatic additive ( such as an amine or an amide or a derivative of a fatty acid ). the heat activatable adhesive layer is designed for and activated at temperatures known to those skilled in the art . generally the heat - activatable first adhesive layer has a lower melting point than any of the other layers of the in - mold label . while the heat activatable layer may activate at temperatures below those specified for activation , the layer is designed to activate at certain temperatures based on the substrate material under normal in - mold labeling conditions . in one embodiment , the heat activatable adhesive layer activates at temperatures between about 80 ° c . to about 300 ° c ., more often the heat seal layer activates at temperatures between about 87 ° c . to about 250 ° c . the facestock layer may include or consist of paper , foils , pigmented polymer layers and so forth as enumerated in u . s . pat . no . 6 , 773 , 653 noted above . the polymer facestock and the heat activatable first adhesive layer may be formed by simultaneous extrusion from two or more extruders with a suitable coextrusion die whereby the facestock and first adhesive layer are adhered to each other in a permanently combined state to provide a unitary coextrudate . a tie layer ( adhesion promoting layer ) may also be coextruded with the facestock and the heat - activatable first adhesive layer to improve the adhesion of the heat - activatable layer to the facestock . alternatively , a coating process may be used to lay down a layer of the heat - activatable material on the facestock , or the two layers can be formed separately and thereafter laminated together with or without the acid of an adhesive layer . while the invention has been illustrated in connection with several examples , modifications to these examples within the spirit and scope of the invention will be readily apparent to those of skill in the art . in view of the foregoing discussion , relevant knowledge in the art and references discussed above in connection with the background and detailed description , the disclosures of which are all incorporated herein by reference , further description is deemed unnecessary .	0
reference will now be made to the drawings , wherein to the extent possible , like elements are designated by like reference numerals in the various views . in fig1 , an exemplary prior art quick connector assembly 10 is illustrated . such quick connector assemblies typically include a male adaptor 12 which is received and sealingly retained in a plastic or metal female connector housing 14 defining a through bore . within the connector housing 14 , an o - ring sealing element 16 is typically seated within an o - ring groove 18 defined on one side by a sealing ring 20 . in the prior art construction , the sealing ring 20 is fixed in place by welding or the like so as to contain the o - ring sealing element 16 within the o - ring groove 18 . in this configuration , the o - ring sealing element 16 is substantially blocked against axial movement . as illustrated , in the exemplary prior art construction , a spring clamp 30 of metal or the like is positioned rearward of the sealing ring 20 . as shown , the spring clamp 30 may be of a generally ring - shaped configuration with a substantially elliptical or other non - circular geometry . the male adaptor 12 may include a proximal end 32 which matedly engages a hose or other structure ( not shown ). the male adaptor 12 also includes a distal end 34 which is adapted for insertion into the connector housing 14 in substantially coaxial relation to the housing through bore . an enhanced diameter intermediate collar 36 is disposed between the proximal end 32 and the distal end 34 . a radial groove 40 is disposed within the intermediate collar 36 . as the male adaptor 12 is inserted into the connector housing 14 , the spring clamp 30 is first engaged and caused to deform radially outwardly by outward force from the distal end 34 . as the male adaptor 12 is advanced further into the connector housing 14 , the distal end 34 is forced through the o - ring sealing element 16 , thereby causing the o - ring sealing element 16 to expand radially outwardly to fill the o - ring groove 18 . upon full insertion of the male adaptor 12 into the connector housing , the spring clamp 30 falls into the radial groove 40 at the intermediate collar 36 . with the spring clamp 30 captured in the radial groove 40 , the male adaptor 12 is blocked against axial displacement . the radial expansion of the o - ring sealing element 16 provides a fluid tight seal between the male adaptor 12 and the surrounding connector housing 14 . in this configuration a sealed fluid passageway is established across the connector housing 14 . referring now to fig2 and 3 , an improved quick connector assembly 110 consistent with the present disclosure will now be described wherein elements corresponding to those previously described will be designated by like reference numerals within a 100 series . as illustrated , the quick connector assembly 110 includes a male adaptor 112 and a connector housing 114 defining an axial through bore . the male adaptor 112 and the connector housing 114 are adapted for mated engagement as illustrated by the force arrows in the various views . as shown , the male adaptor 112 may have a configuration generally as described in reference to the prior art . in this regard , the male adaptor 112 may include a proximal end 132 which matedly engages a hose or other structure ( not shown ). the male adaptor 112 may also include a flared distal end 134 having a rounded nose 135 as best seen in fig3 which is adapted for insertion into the connector housing 114 . in the illustrated exemplary construction , an enhanced diameter intermediate collar 136 is disposed between the proximal end 132 and the distal end 134 . a radial groove 140 may be disposed within the intermediate collar 136 . referring jointly to fig2 and 3 , it may be seen that the illustrated , exemplary quick connector assembly 110 includes a compressible sealing element 150 in combination with a floating retainer ring 160 . this combination facilitates the insertion of the male adaptor 112 by reducing the force required during the initial stage of insertion . in particular , the use of the floating retainer ring 160 which may slide axially relative to the adjacent surface of the connector housing 114 permits early stage insertion forces to be minimized , while nonetheless permitting compression and reshaping of the compressible sealing element 150 to establish a fluid tight seal . as best illustrated in fig3 , the floating retainer ring 160 may have a generally wedge - shaped cross - section construction incorporating a rear forward sloped face 162 projecting in a direction generally opposing the direction of male adaptor insertion . the floating retainer ring 160 may also include a forward face 164 which is adapted to engage and compress the compressible sealing element 150 as will be described further hereinafter . prior to insertion of the male adaptor 112 into the connector housing 114 , the compressible sealing element 150 may be disposed in resting relation within the interior of the connector housing 114 adjacent to a supporting radial shoulder surface 168 . in this regard , it will be understood that the compressible sealing element 150 may be a generally ring - shaped structure with a cross - section adapted for folding deformation upon the application of compression in the axial direction . in this regard , the cross - section of the compressible sealing element 150 may define one or more leg segments intersecting to form living hinges to facilitate such folding deformation . the compressible sealing element 150 may be formed from an elastomer with sufficient dimensional stability such that the sealing element 150 maintains a general ring structure within the connector housing 114 prior to use and does not fall out . prior to insertion of the male adaptor 112 into the connector housing 114 , the floating retainer ring 160 may be disposed in floating relation between the compressible sealing element 150 and a sealing ring ( not shown ) as previously described in relation to fig1 . thus , the floating retainer ring 160 is initially permitted to slide axially relative to the opposing surface of the connector housing 114 within a zone bordered by the compressible sealing element 150 and the sealing ring . of course , other arrangements may likewise be used if desired . as best seen in fig3 , in the exemplary construction , the male adaptor 112 may include a forward projecting sloped shoulder surface 170 defining a portion of flared distal end 134 in spaced apart relation to the rounded nose 135 . the sloped shoulder surface 170 of the male adaptor 112 is adapted to contact and bear against the rear sloped face 162 of the floating retainer ring in the final assemble condition . in this final condition , the compressible sealing element 150 may be deformably compressed between the forward face 164 of the floating retainer ring 160 and the opposing radial shoulder surface 168 . the compressible sealing element 150 is also compressed between flared distal end 134 and the opposing surface of the connector housing 114 thereby providing a fluid - tight seal . at the same time , axial withdrawal of the male adaptor 112 may be blocked by engagement between in the same manner as described in relation to fig1 . as noted previously , a significant benefit of the quick connector assembly 110 is the reduction in the force required to achieve full insertion of the male adaptor 112 . in this regard , upon initial insertion of the male adaptor 112 , the male adaptor 112 will first contact the floating retainer ring 160 and will cause the floating retainer ring 160 to move axially forward generally into the position illustrated in fig3 as the male adaptor 112 itself moves inwardly . as will be appreciated , during this initial stage of insertion , the male adaptor 112 encounters minimal resistance as the surface of the male adaptor moves over the compressible sealing element 150 . at the final stage of insertion , as axial force is applied to the male adaptor 112 , the sloped shoulder surface 170 urges the floating retainer ring 160 progressively forward against the compressible sealing element 150 until the final locked relation is achieved . however , this final distance of movement by the floating retainer ring 160 may be quite short such that the overall insertion effort is still relatively minimal . in the final assembled condition , the compressible sealing element is compressed to a deformed shape thereby forming the desired sealed relationship . as indicated previously , the compressible sealing element 150 may be a generally ring - shaped structure with a substantially non - circular cross - section adapted for folding deformation or reorientation upon the application of compression in the axial direction . in this regard , the compressible sealing element may have one or more leg segments with a length to thickness ratio greater than about 1 . 2 and more preferably a length to thickness ratio greater than about 2 . 0 and more preferably a length to thickness ratio greater than about 3 . 0 . as illustrated in fig2 and 3 , one possible configuration for the compressible sealing element 150 is an elastomer ring structure with a generally “ v ” shaped cross - section . as will be readily understood , as axial forces are applied , such a “ v ” configuration may undergo folding deformation at the living hinge formed at the intersection of the leg segments forming the “ v ”. thus , the structure may fold in a hinging manner as the compressible sealing element 150 is pressed between the floating retainer ring 160 and the radial shoulder surface 168 . as this folding takes place , the compressible sealing element 150 will be urged to adopt an increased height within its zone of confinement thereby pressing against the opposing surfaces of the male adaptor 112 and the connector housing 114 and establishing the desired sealed condition . it is also contemplated that any number of other cross - sectional configurations may be used for a compressible sealing element within a quick connector assembly consistent with the present disclosure . by way of example only , and not limitation , fig4 illustrates one exemplary configuration for a compressible sealing element 250 for use in a quick connection assembly 210 consistent with the present disclosure . in the embodiment illustrated in fig4 , a compressible sealing element 250 may be an elastomeric ring having a generally “ m ” shape or “ w ” shape cross section . such a sealing element may be disposed in a compression zone bordered by the male adaptor 212 , the connector housing 214 and the floating retainer ring 260 as previously described . such a configuration may undergo folding deformation as axial forces are applied . more particularly , the structure may fold in a hinging manner as the compressible sealing element 250 is pressed between the floating retainer ring 260 and the radial shoulder surface 268 . as this folding takes place , the compressible sealing element 250 will also be urged to adopt an increased height within its zone of confinement thereby pressing against the opposing surfaces of the male adaptor 212 and the connector housing 214 and establishing the desired sealed condition . fig5 illustrates yet another exemplary configuration for a compressible sealing element 350 for use in a quick connection assembly 310 consistent with the present disclosure . in the embodiment illustrated in fig5 , a compressible sealing element 350 may be an elastomeric ring having a generally tilted , elliptical cross section for disposition in a compression zone bordered by the male adaptor 312 , the connector housing 314 and the floating retainer ring 360 as previously described . such a configuration may undergo folding deformation and / or reorientation to a more vertical orientation as axial forces are applied and the compressible sealing element 350 is pressed between the floating retainer ring 360 and the radial shoulder surface 368 . as this folding and / or reorientation takes place , the compressible sealing element 350 will also be urged to press against the opposing surfaces of the male adaptor 312 and the connector housing 314 and establish the desired sealed condition . it is also contemplated that the use of a floating retainer ring may be eliminated if desired . by way of example only , and not limitation , fig6 - 8 illustrate one exemplary construction for a quick connector assembly 410 consistent with the present disclosure and wherein no floating retainer ring is used . in fig6 - 8 , elements corresponding to those previously described will be designated by like reference numerals within a 400 series . as illustrated , the quick connector assembly 410 includes a male adaptor 412 and a connector housing 414 defining an axial through bore . the male adaptor 412 and the connector housing 414 are adapted for mated engagement as best illustrated in fig7 and 8 . as shown , the male adaptor 412 may include a proximal end 432 which matedly engages a hose or other structure ( not shown ). the male adaptor 412 may also include a flared distal end 434 having a rounded nose 435 which is adapted for insertion into the connector housing 414 . in the illustrated exemplary construction , an enhanced diameter intermediate collar 436 is disposed between the proximal end 432 and the distal end 434 . a radial groove 440 may be disposed within the intermediate collar 436 for engagement with the spring clamp 430 . referring jointly to fig6 - 8 , it may be seen that the illustrated , exemplary quick connector assembly 410 includes a compressible sealing element 450 adapted for disposition in sealing relation between the distal end 434 of the male adaptor and an interir surface of the connector housing 414 . as can be best seen through joint reference to fig6 and 7 , the compressible sealing element 450 may be a generally ring - shaped structure with a cross - section adapted for folding deformation upon the application of compression in the axial direction . in this regard , the cross - section of the compressible sealing element 450 may define one or more leg segments intersecting to form living hinges to facilitate such folding deformation . such leg segments may be characterized by a length to thickness ratio greater than about 1 . 2 and more preferably a length to thickness ratio greater than about 2 . 0 and more preferably a length to thickness ratio greater than about 3 . 0 . prior to insertion of the male adaptor 412 into the connector housing 414 , the compressible sealing element 450 may be disposed in resting relation within the interior of the connector housing 414 adjacent to a supporting radial shoulder surface . the compressible sealing element 450 may be formed from an elastomer with sufficient dimensional stability such that the sealing element 450 maintains a general ring structure within the connector housing 414 prior to use and does not fall out . as illustrated , in the exemplary construction , the male adaptor 412 may include a forward projecting sloped shoulder surface 470 defining a portion of the flared distal end 434 in spaced apart relation to the rounded nose 435 . the sloped shoulder surface 470 of the male adaptor 412 is adapted to contact and bear against the rear face 452 of the compressible sealing element 450 in the final assembled condition . as shown , the sloped shoulder surface 470 and the rear face 452 of the compressible sealing element 450 may have generally complementary angles such that they may slide over one another as the male adaptor is being inserted into the final sealed condition illustrated in fig8 . in this final condition , the compressible sealing element 450 may be deformably compressed between the sloped shoulder surface 470 of the male adaptor and and an opposing radial shoulder surface 468 in the connector housing , thereby providing a fluid - tight seal . at the same time , axial withdrawal of the adaptor 412 may be blocked by engagement between the spring clamp 430 and the radial groove 440 in the same manner as described in relation to fig1 . of course , variations and modifications of the foregoing are within the scope of the present disclosure . the use of the terms “ a ” and “ an ” and “ the ” and similar referents in the context of describing the invention ( especially in the context of the following claims ) are to be construed to cover both the singular and the plural , unless otherwise indicated herein or clearly contradicted by context . the terms “ comprising ,” “ having ,” “ including ,” and “ containing ” are to be construed as open - ended terms ( i . e ., meaning “ including , but not limited to ,”) unless otherwise noted . recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range , unless otherwise indicated herein , and each separate value is incorporated into the specification as if it were individually recited herein . all methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context . the use of any and all examples , or exemplary language ( e . g ., “ such as ”) provided herein , is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed . no language in the specification should be construed as indicating any non - claimed element as essential to the practice of the invention . preferred embodiments of this invention are described herein , including the best mode known to the inventors for carrying out the invention . variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description . the inventors expect skilled artisans to employ such variations as appropriate , and the inventors intend for the invention to be practiced otherwise than as specifically described herein . accordingly , this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law . moreover , any combination of the above - described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context .	5
embodiments of the fuel cell discharge - gas processing device of the present invention shall be explained hereinbelow referring to the drawings of fig1 to fig4 . fig1 is a schematic lineblock diagram of a fuel cell system equipped with the discharge - gas processing device according to this invention , which in this embodiment is mounted in a fuel cell vehicle . a fuel cell 1 is of the type that obtains electrical power through chemical reactions of reactant gases . it is constituted by , for example , laminating a plurality of cells formed by sandwiching a solid polymer electrolyte membrane 2 including a solid polymer ion exchange membrane etc . between an anode 3 and a cathode 4 ( shown by the single cell in fig1 ). when hydrogen gas ( reactant gas ) is supplied to the anode 3 as a fuel gas , and air containing oxygen ( reactant gas ) is supplied to the cathode 4 as an oxidizing agent gas , hydrogen ions generated by a catalytic reaction in the anode 3 pass the solid polymer electrolyte membrane 2 and travel to the cathode 4 , where electricity is generated by the electrochemical reaction with the oxygen and water is produced . since a portion of the produced water generated at the cathode side penetrates the solid polymer electrolyte membrane 2 and back diffuses to the anode side , produced water also exists at the anode side . air is pressurized to a prescribed pressure by a compressor 7 , such as a supercharger ( s / c ), and is supplied to the cathode 4 of the fuel cell 1 through an air supply path 8 . after the air supplied to the fuel cell 1 is used for electricity generation , it is discharged , along with the produced water of the cathode side , from the fuel cell 1 to an air exhaust path 9 , and introduced into the discharge - gas processing device 50 through a pressure control valve 10 . hereinafter , the air supplied to the fuel cell 1 is referred to as supply air , and the air discharged from the fuel cell 1 is referred to as discharged air to distinguish between them . either supply air or discharged air may be used as diluent gas . the hydrogen gas supplied from a hydrogen tank 15 flows through a hydrogen gas supply path 17 , is decompressed to a prescribed pressure along the way by a regulator 16 , controlled to a prescribed flow rate by a flow control valve 23 , and supplied to the anode 3 of the fuel cell 1 through an ejector 19 . the unreacted hydrogen gas which was not consumed is discharged as anode off - gas from the fuel cell 1 , sucked by the ejector 19 through an anode off - gas path 18 , merged with the fresh hydrogen gas supplied from the hydrogen tank 15 and supplied again to the anode 3 of the fuel cell 1 . to wit , the anode off - gas discharged from the fuel cell 1 circulates through the fuel cell 1 , passing the anode off - gas path 18 and the hydrogen gas supply path 17 downstream of the ejector 19 . in this embodiment , the hydrogen gas supply path 17 downstream of the ejector 19 and the anode off - gas path 18 constitute a fuel gas circulation path 20 . an anode off - gas exhaust path 22 equipped with an exhaust valve 21 branches off from the anode off - gas path 18 , and the anode off - gas exhaust path 22 is connected to the discharge - gas processing device 50 . in this discharge - gas processing device 50 , the anode off - gas discharged from the anode off - gas exhaust path 22 is diluted by the discharged air discharged from the air exhaust path 9 , and then discharged to a discharge section through a mixed gas exhaust path 30 . moreover , the discharge - gas processing device 50 is constituted to be able as required to discharge gas therein from the upper portion thereof through a gas venting path 32 by opening a gas venting valve 31 . the gas venting path 32 is connected to an air exhaust path 33 to which air is supplied from a fan 34 , with an ejector 35 provided at the connection with the gas venting path 32 . electric power obtained by power generation of the fuel cell 1 is supplied to a load , such as a motor for driving a vehicle ( not illustrated ). moreover , the rotation frequency of the compressor 7 , opening of the pressure control valve 10 and the flow control valve 23 , the exhaust valve 21 , the gas venting valve 31 , and the fan 34 are controlled by an electronic control unit ( hereafter , ecu ) 40 . in the fuel cell system constituted thus , as mentioned above power generation of the fuel cell 1 may become unstable during continuous operation due to an increased concentration of impurities ( such as water and nitrogen ) in the hydrogen gas flowing though the fuel gas circuit 20 . therefore , when it is judged by the ecu 40 in this fuel cell system that the fuel cell system has been in continuous operation for a definite period of time , or when it is judged that the stability of power generation of the fuel cell 1 has dropped , determining there is a demand to discharge impurities , it opens the exhaust valve 21 , intermittently discharges anode off - gas containing the impurities from the anode off - gas path 18 to the discharge - gas processing device 50 through the anode off - gas exhaust path 22 , and controls the impurity concentration in the hydrogen gas which flows through the anode 3 of the fuel cell 1 to not exceed a predetermined value , and so maintains power generation of the fuel cell 1 in a stabilized state . next , the structure of the discharge - gas processing device 50 shall be explained in detail referring to the drawings of fig2 to fig4 . the discharge - gas processing device 50 is equipped with an airtight cylindrical dilution container 51 . the dilution container 51 is provided in a vehicle with its axial center oriented in a substantially horizontal direction , with its cross - sectional shape perpendicular to the axial center direction forming an identical elliptical shape along the full length in the axial direction , and the long axis of this ellipse arranged in the vertical direction . in other words , the axial center of the dilution container 51 is set in a substantially horizontal orientation , and its cross - sectional shape perpendicular to the axial center is composed of a curve forming a convex curve shape on the outside along the perimeter of the closed cross section . an anode off - gas introduction pipe ( anode gas introduction path ) 52 arranged horizontally with its axial center slightly lower than the axial center of the dilution container 51 is passed through and fixed to an end plate 51 a of one end side of the dilution container 51 in the axial direction . the distal end of the anode off - gas introduction pipe 52 inserted into the dilution container 51 is cut obliquely to be made into an anode off - gas emission hole 52 a . the opening of the anode off - gas emission hole 52 a is oriented obliquely upward . the anode off - gas exhaust path 22 is connected to the base end of the anode off - gas introduction pipe 52 , so that when the exhaust valve 21 opens , anode off - gas is introduced into the dilution container 51 from the anode off - gas emission hole 52 a . moreover , in the inside of the dilution container 51 , a partition panel 53 is fixed forward of the distal end of the anode off - gas introduction pipe 52 , in substantially the middle of the dilution container 51 in the axial direction , with a substantially vertical orientation . the partition panel 53 forms the shape of an ellipse with its upper portion cut away , and is closely fixed to the inner surface of the dilution container 51 except for a notch portion 53 a . the inside of the dilution container 51 is divided by the partition panel 53 into an upstream chamber 54 communicating with the anode off - gas introduction pipe 52 and a diluent gas emission hole 58 to be described hereinbelow , and a downstream chamber 55 communicating with a mixed gas discharge hole 61 described hereinbelow , with the side above the notch portion 53 a forming a communication gas path 56 that communicates with the upstream chamber 54 and the downstream chamber 55 . the notch portion 53 a of the partition panel 53 is positioned sufficiently above the axial center of the dilution container 51 , with the partition panel 53 existing on the axial extension of the anode off - gas introduction pipe 52 . accordingly , as shown in fig3 , most of the anode off - gas emitted from the anode off - gas emission hole 52 a is emitted toward the partition panel 53 , with a portion being emitted obliquely upward from the anode off - gas emission hole 52 a . moreover , a top gas discharge hole ( gas discharge hole ) 62 is formed above the partition panel 53 in the dilution container 51 , and the gas venting path 32 is connected to this top gas discharge hole 62 . furthermore , a diluent gas pipe ( diluent gas path ) 57 that passes from the end plate 51 a on one side of the dilution container 51 to an end plate 51 b on the other side in the axial direction is fixed along the lowest portion ( inner bottom ) of the inner surface of the dilution container 51 . this diluent gas pipe 57 also penetrates the partition panel 53 . the air exhaust path 9 is connected to an upstream end portion 57 a of the diluent gas pipe 57 , and the mixed gas exhaust path 30 is connected to the downstream end portion 57 b . the discharged air discharged from the cathode of the fuel cell 1 to the air exhaust path 9 passes through the diluent gas pipe 57 and is discharged to the discharge section through the mixed gas exhaust path 30 . the diluent gas emission hole 58 is provided in the portion of the diluent gas pipe 57 accommodated in the upstream chamber 54 , in the vicinity of the end plate 51 a . the diluent gas emission hole 58 opens at the top portion of the diluent gas pipe 57 , and is provided at a position that is closer than the anode off - gas emission hole 52 a of the anode off - gas introduction pipe 52 to the end plate 51 a . this diluent gas emission hole 58 emits a portion of the discharged air flowing through the diluent gas pipe 57 to the upstream chamber 54 . in addition , in this embodiment , since the diluent gas emission hole 58 is directly provided in the diluent gas pipe 57 , the diluent gas emission hole 58 itself doubles as a communicating portion with the diluent gas emission hole 58 and the diluent gas pipe 57 . here , since the anode off - gas emission hole 52 a is oriented facing obliquely upward as described above , and the diluent gas emission hole 58 faces straight up , it can be the that the anode off - gas emission hole 52 a and the diluent gas emission hole 58 are in a mutually non - opposing spatial relationship . since this can prevent the anode off - gas emitted from the anode off - gas emission hole 52 a from flowing backward in the diluent gas pipe 57 through the diluent gas emission hole 58 , it can prevent discharge of insufficiently diluted anode off - gas . moreover , a constriction portion 59 that depresses the top portion of the diluent gas pipe 57 to reduce the opening area is provided in the portion of the diluent gas pipe 57 accommodated in the upstream chamber 54 , downstream of the diluent gas emission hole 58 . the constriction state ( opening area ) of the constriction portion 59 can adjust the flow rate of the discharged air introduced into the upstream chamber 54 from the diluent gas emission hole 58 . in addition , in this embodiment , the diluent gas pipe 57 is formed with a uniform pipe diameter except for the constriction portion 59 . furthermore , drain holes 60 are provided in the diluent gas pipe 57 , downstream of the constriction portion 59 , at portions accommodated in each of the upstream chamber 54 and the downstream chamber 55 . as shown in fig4 , paired left and right drain holes 60 are provided at the lower half portion of the diluent gas pipe 57 , near the point of contact with the lowest part ( inner bottom ) of the inner surface of the dilution container 51 . liquid that accumulates at the inner bottom of the upstream chamber 54 or the downstream chamber 55 is drawn into the diluent gas pipe 57 through these drain holes 60 . in addition , in this embodiment , since the drain holes 60 are directly established in the diluent gas pipe 57 , the drain holes 60 themselves become communicating portions of the drain holes 60 and the diluent gas pipe 57 . moreover , a mixed gas discharge hole 61 is provided in the portion of the diluent gas pipe 57 accommodated in the downstream chamber 55 , downstream of the drain holes 60 and near the end plate 51 b . the mixed gas discharge hole 61 opens at the top portion of the diluent gas pipe 57 , with gas in the downstream chamber 55 being discharged into the diluent gas pipe 57 through this mixed gas discharge hole 61 . in this embodiment , since the mixed gas discharge hole 61 is directly formed in the diluent gas pipe 57 , the mixed gas discharge hole 61 itself doubles as a communicating portion with the mixed gas discharge hole 61 and the diluent gas pipe 57 . next , the operation of the discharge - gas processing device 50 shall be explained . in this discharge - gas processing device , always while supplying air from the compressor 7 to the cathode 4 of the fuel cell 1 , the discharged air discharged from the cathode 4 of the fuel cell 1 is introduced into the diluent gas pipe 57 of the discharge - gas processing device 50 through the air exhaust path 9 and the pressure control valve 10 , flows through the diluent gas pipe 57 toward the mixed gas exhaust path 30 , with a portion of the discharged air flowing through the diluent gas pipe 57 being emitted from the diluent gas emission hole 58 into the upstream chamber 54 . on the other hand , as mentioned above , when the ecu 40 judges there to be a demand to discharge impurities , the exhaust valve 21 opens , anode off - gas is discharged from the anode off - gas path 18 , introduced into the anode off - gas introduction pipe 52 of the discharge - gas processing device 50 through the anode off - gas exhaust path 22 , and emitted from the anode off - gas emission hole 52 a into the upstream chamber 54 . accordingly , when anode off - gas is not emitted from the anode off - gas emission hole 52 a to the upstream chamber 54 , ( to wit , when the exhaust valve 21 is closed ), the pressure in the dilution container 51 hardly rises . however , when the exhaust valve 21 is open and anode off - gas is intermittently emitted from the anode off - gas emission hole 52 a to the upstream chamber 54 , the internal pressure of the dilution container 51 suddenly rises . that is , a pressure change occurs in the dilution container 51 according to the discharge cycle of the anode off - gas . the dilution container 51 in this embodiment has a cross - sectional shape perpendicular to the axial center direction that consists of a curve ( ellipse ) forming a convex curve shape on the outside along the perimeter of the closed cross section . therefore , the dilution container 51 has extremely high mechanical strength ( pressure capacity ) against internal pressure and deformation ( repetitive stress ) due to breathing of the dilution container , which can be sufficiently withstood without a special reinforcing structure . a special reinforcing structure is unnecessary , the discharge - gas processing device 50 can be easily manufactured . as shown in fig3 , anode off - gas emitted from the anode off - gas emission hole 52 a collides with the partition panel 53 , altering its flow direction , and the collision with the partition panel 53 reduces its flow speed so that it spreads mostly throughout the inside of the upstream chamber 54 at a moderate flow speed . thereby , while being partially mixed with the discharged air in the upstream chamber 54 , the anode off - gas flows into the downstream chamber 55 through the communication gas path 56 and flows toward the mixed gas discharge hole 61 . in the meantime , blending is further performed between the mixed gas flowing in from the upstream chamber 54 and the gas in the downstream chamber 55 . the gas of the downstream chamber 55 is discharged from the mixed gas discharge hole 61 to the diluent gas pipe 57 to be further diluted by being mixed with discharged air flowing through the diluent gas pipe 57 before being discharged . in this embodiment , the travel distance of the gas within the dilution container 51 can be lengthened by providing the partition panel 53 . furthermore , the travel distance of the gas in the dilution container 51 can also be lengthened even by disposing the diluent gas emission hole 58 in the vicinity of one end portion in the axial direction of the dilution container 51 and disposing the mixed gas discharge hole 61 in the vicinity of the other end portion in the axial direction of the dilution container 51 . as a result , since the stagnation time of the gas in the dilution container 51 can be prolonged to be able to ensure sufficient time necessary for dilution , the anode off - gas can be reliably diluted . in addition , as stated above , since the flow rate of the discharged air introduced into the upstream chamber 54 from the diluent gas emission hole 58 can be adjusted by the constriction state ( opening area ) of the constriction portion 59 provided downstream of the diluent gas emission hole 58 in the diluent gas pipe 57 , by setting the constriction state ( opening area ) of the constriction portion 59 to a predetermined value , the flow rate of diluent gas emitted from the diluent gas emission hole 58 to inside the upstream chamber 54 can be set to the optimal flow rate for dilution of the anode off - gas , so that the anode off - gas can be discharged sufficiently diluted . moreover , water is contained in a liquid or gas ( steam ) state in the anode off - gas introduced into the dilution container 51 as mentioned above . in this embodiment , the axial center of the anode off - gas introduction pipe 52 is disposed horizontally , and the distal end of the anode off - gas introduction pipe 52 is obliquely cut to form the anode off - gas emission hole 52 a . this can prevent accumulation of liquid at the distal end of the anode off - gas introduction pipe 52 , and can prevent blocking of the anode off - gas introduction pipe 52 by liquid accumulation . furthermore , in this embodiment , since the anode off - gas is emitted toward the partition panel 53 from the anode off - gas emission hole 52 a , liquid contained in the anode off - gas collides with and adheres to the partition panel 53 , and then falls along the vertically oriented partition panel 53 . moreover , condensation is promoted because the steam in the anode off - gas also collides with the partition panel 53 , and this condensate also falls along the vertically oriented partition panel 53 . that is , the partition panel 53 catches the moisture in the anode off - gas , aiding collection at the bottom of the dilution container 51 . moreover , the water in the anode off - gas ( liquid and steam ) is caught also on the inner surface of the dilution container 51 . liquid adhering to the inner surface of the dilution container 51 and the condensate condensed on the inner surface of the dilution container 51 fall along the inner surface of the dilution container 51 , as shown in fig4 . in this embodiment , since the axial center of the dilution container 51 is provided in a horizontal orientation , and the cross - sectional shape perpendicular to the axial center direction forms a convex curve on the outside along the perimeter of the closed cross section , liquid can be reliably collected at the lowest portion of the dilution container 51 in the vertical direction ( that is , the inner bottom portion of the dilution container 51 ), with no stagnation occurring at the other areas . in particular , in this embodiment , since the cross sectional shape of the dilution container 51 is elliptical , and the long axis of this ellipse is disposed in the vertical direction , the flow speed of liquid that falls along the inner surface of the dilution container 51 can be quickened , and as a result , the liquid can be swiftly collected at the lowest portion ( that is , the inner bottom portion ) of the dilution container 51 . liquid collected at the inner bottom portion of the dilution container 51 is thus drawn from the drain holes 60 into the diluent gas pipe 57 , to be discharged to the mixed gas exhaust path 30 together with the mixed gas . in this embodiment , since the drain holes 60 are provided in the lower half of the diluent gas pipe 57 , at a position near the inner bottom portion of the dilution container , liquid that stagnates at the bottom of the dilution container 51 can be easily discharged , and the un - discharged liquid that remains in the dilution container 51 can be reduced , thereby enhancing drainage performance . in addition , in this embodiment , since the constriction portion 59 is formed immediately upstream of the drain holes 60 , stagnate liquid inside the dilution container 51 can be effectively sucked up . for this reason , liquid can be discharged promptly . the suction force can be increased because the pressure on the downstream side of the constriction portion 59 is less than the upstream side . moreover , while the fuel cell 1 is stopped , the slight amount of anode off - gas ( hydrogen gas ) which remains in the dilution container 51 may stagnate at the top portion . when this happens , opening the gas venting valve 31 can discharge the anode off - gas to the air exhaust path 33 via the gas venting path 32 . in this case , activating the fan 34 forces air into the air exhaust path 33 through the ejector 35 . thereby , anode off - gas stagnated at the top portion of the dilution container 51 during stoppage of the fuel cell 1 can be diluted and discharged while being drawn by negative pressure of the discharged air . as a result , the anode off - gas in the dilution container 51 can be prevented from flowing backward upstream while the fuel cell 1 is stopped . moreover , in this embodiment , since the diluent gas emission hole 58 , the mixed gas discharge hole 61 , and the drain holes 60 are all directly provided in the diluent gas pipe 57 , the structure of the discharge - gas processing device is simple . for example , in the aforementioned embodiment , the cross section of the dilution container was made elliptical , but it is also possible to be circular . also , in the aforementioned embodiment , discharged air ( cathode off - gas ) discharged from the cathode of the fuel cell was used as the diluent gas , but the diluent gas is not limited thereto . moreover , it is also possible not to provide the diluent gas emission hole , the mixed gas discharge hole , and the drain holes in the diluent gas path directly , but to provide these holes in branch pipes that branch from the diluent gas path . moreover , in this embodiment , although there was only one partition panel , there may be a plurality , for example , alternately arranged . in this case , among the plurality of partition panels , some of the partition panels form an upstream chamber and a downstream chamber , with places that communicate with the upstream chamber and the downstream chamber forming communication gas paths . in addition , in the present embodiment , the partition panel is closely fixed to the inner surface of the dilution container except for the notch portion , but slits may be provided in the lowest portion of the partition panel . this is preferable since liquid inside the dilution container can move through the partition panel , and drainage can be performed at places where drain holes are not provided , such as when drain holes are only set in one of the upstream chamber and downstream chamber . moreover , although the communication path in the aforementioned embodiment is a cutaway portion , it may also be formed by piping . while preferred embodiments of the invention have been described and illustrated above , it should be understood that these are exemplary of the invention and are not to be considered as limiting . additions , omissions , substitutions , and other modifications can be made without departing from the spirit or scope of the present invention . accordingly , the invention is not to be considered as being limited by the foregoing description , and is only limited by the scope of the appended claims .	8
before the subject invention is described further , it is to be understood that the invention is not limited to the particular embodiments of the invention described below , as variations of the particular embodiments may be made and still fall within the scope of the appended claims . it is also to be understood that the terminology employed is for the purpose of describing particular embodiments , and is not intended to be limiting . instead , the scope of the present invention will be established by the appended claims . where a range of values is provided , it is understood that each intervening value , to the tenth of the unit of the lower limit unless the context clearly dictates otherwise , between the upper and lower limit of that range , and any other stated or intervening value in that stated range , is encompassed within the invention . the upper and lower limits of these smaller ranges may independently be included in the smaller ranges , and are also encompassed within the invention , subject to any specifically excluded limit in the stated range . where the stated range includes one or both of the limits , ranges excluding either or both of those included limits are also included in the invention . in this specification and the appended claims , the singular forms “ a ,” “ an ” and “ the ” include plural reference unless the context clearly dictates otherwise . fig2 a - 2f show a method of forming a vacuum insulated cabinet 10 according to the present invention . fig2 a shows a first forming tool 24 having a generally quadrilateral perimeter formed from a base wall 29 and a plurality of sidewalls 31 with two extending flanges 28 configured to extend from a bottom portion 25 of the quadrilateral perimeter . the first forming tool 24 may further include at least one vacuum channel 26 . fig2 a also shows a first material sheet 20 . the first material sheet 20 is typically comprised of a first layer of thermoplastic material that is partially permeable to oxygen , nitrogen and water vapor and a second layer of material that is substantially impermeable to oxygen , nitrogen and water vapor . a typical plastic composite used in this process is a first layer of high impact polystyrene ( hips ) food grade , specially tailored for refrigeration products and a second impermeable layer of evoh . one exemplary embodiment uses polystyrol 2710 by basf and edistr rr740e by polimeri europa as the first layer . the first material sheet 20 is first softened typically using heat until the first material sheet 20 reaches a temperature at which the first material sheet 20 can be plastically deformed . typically , the first material sheet 20 is deformed into a semi - circle like shape typically formed by blowing air centrally on the first material sheet 20 while the first material sheet 20 has its edges clamped down to hold the edges in place , as shown in the dashed lines in fig2 a . the first material sheet 20 is then lowered onto a top perimeter 27 of the first forming tool 24 . the edges of the first material sheet 20 are configured to be clamped onto the flanges 28 of the first forming tool 24 . the flanges 28 are typically comprised of the sidewalls 31 of the first forming tool 24 . a vacuum is then used to thermoform the first material sheet 20 over the first forming tool 24 to form the first intermediate structure 30 ( shown in fig2 b ). next , as shown in fig2 b , the first intermediate structure 30 is aligned over a second forming mold 50 . as also shown in fig2 b , the first intermediate structure 30 has a base sidewall 32 defining a generally quadrilateral perimeter 34 and a plurality of first sidewalls 36 , typically four sidewalls , extending transversely from the quadrilateral perimeter 34 in order to define a cavity 38 which has an opening 40 that opens in a first direction and defines a peripheral edge 42 extending around the opening 40 . the opening 40 of the cavity 38 of the first intermediate structure 30 is aligned with a second forming tool 50 . the second forming tool 50 is typically comprised of sidewall portions 52 which define a plurality of generally rectangular outwardly facing surfaces 54 and a plurality of generally rectangular inwardly facing surfaces 56 , and at least one end surface 58 extending transversely between the inwardly 56 and outwardly 54 facing surfaces . again , the second forming tool 50 includes vacuum holes 53 , to help form the first intermediate structure 30 onto the second forming tool 50 in order to produce the second intermediate structure 60 . as shown in fig2 b , the first intermediate structure 30 is heated to a temperature at which it can plastically deform . the first intermediate structure 30 is then formed over the second forming mold 50 using vacuum holes 53 to help form the second intermediate structure 60 . optionally , a third forming tool 80 may be utilized . the third forming tool 80 is configured to engage the second forming tool 50 in order to help form the second intermediate structure 60 . the third forming tool 80 is typically an opposite version of the second forming tool 50 . for example , if the second forming tool 50 is a female mold , the third forming tool 80 is a corresponding male mold , and vice versa . fig2 c shows the second intermediate structure 60 . the second intermediate structure 60 typically includes a base sidewall 62 and a plurality of inner sidewalls 64 extending transversely from the base sidewall 62 and defining a second cavity 66 that opens in a second direction that is substantially opposite the first direction . the inner sidewalls 64 are spaced apart inwardly from the first sidewalls 62 to define an annular space 70 that opens in the first direction . next , a second material sheet 22 is sealingly connected to the second intermediate structure 60 . the second material sheet 22 is extended across the peripheral edge of the second intermediate structure 60 in order to substantially close off the opening 68 of the second intermediate structure 60 and form an annular space 70 . as shown in fig2 e , the porous insulation material 90 is typically inserted and compacted to a density to withstand atmospheric pressure into the annular space 70 through at least one opening hole 92 typically located on the second material sheet 22 . additionally , the second material sheet 22 may have additional holes 94 in order to let air exit out of the annular space 70 . alternatively , the pre - formed and compacted insulation material 90 may be inserted into the annular space 70 of the second intermediate structure 60 prior to the sealing of the second material sheet 22 . once the insulation material 90 is inserted and the second material sheet 22 is sealingly connected to the second intermediate structure 60 , a vacuum is used , typically in holes 92 and 94 , in order to form a vacuum within the annular space 70 and sealed to produce a vacuum insulated cabinet 10 . moreover , as shown in fig2 f , a sheet wrapper 100 may optionally be disposed over the vacuum insulated structure 10 in order to provide additional structural support . the sheet wrapper 100 is typically comprised of steel and is generally quadrilateral in shape having an opening 102 on one side configured to receive the vacuum insulated cabinet 10 . fig3 a - 3d show an alternate embodiment of the present invention . fig3 a shows a first forming tool 24 having a base sidewall 29 defining a generally quadrilateral perimeter and a plurality of sidewalls 31 extending transversely from the quadrilateral perimeter in order to define a cavity 33 having an opening 35 that opens in a second direction . as shown in fig2 a and 3a , the first forming tool 24 may be a male or a female type mold structure . the first material sheet 20 is plastically deformed through heating the first material sheet 20 which allows the first material sheet 20 to form a first intermediate structure 30 utilizing the first forming tool 24 . edges of the first material sheet 20 are clamped to the flanges 28 or transversely extending sidewalls 31 in order to form the first intermediate structure 30 . once the first intermediate structure 30 is formed , it typically comprises a base sidewall 32 defining a generally quadrilateral perimeter 34 and a plurality of sidewalls 36 extending transversely from the quadrilateral perimeter 34 in order to define a cavity 38 having an opening 40 that opens in the second direction . next , a second forming tool 50 is disposed inside of the cavity 38 of the first intermediate structure 30 . the second forming tool 50 typically has sidewall portions 52 defining a plurality of generally rectangular outwardly facing surfaces 54 and inwardly facing surfaces 56 and at least one end surface 58 extending transversely between the inwardly 56 and outwardly 54 facing surfaces . moreover , the second forming tool 50 includes a cavity 57 defined by the at least one base sidewall 55 and plurality of inner sidewalls 64 extending transversely from the base wall 55 defining a second cavity 59 that opens in the first direction . once the second forming tool 50 is engaged with the first intermediate structure 30 , the first intermediate structure 30 is plastically deformed using a vacuum system to produce a second intermediate structure 60 . the second intermediate structure 60 typically has a base wall 62 and inner sidewalls 64 extending transversely from the base wall 62 defining a second cavity 68 that opens in the first direction and the inner sidewalls 64 are spaced apart inwardly from the first sidewall 62 in order to define an annular space 70 . in the embodiment shown in fig3 a - 3d , the second forming tool 50 is comprised of pre - formed and compacted highly porous insulation material 90 . the insulation material 90 is configured to be solid enough to withstand atmospheric pressure when evacuated and to allow the first intermediate structure 30 to be formed over the insulation material 90 to produce the second intermediate structure 60 . in the embodiment shown in fig3 c , the second forming tool 50 remains within the annular space 70 , and is sealed inside by the second material sheet 22 . the second material sheet 22 is sealingly connected to the second intermediate structure 60 around an edge of the base sidewall 62 of the second intermediate structure 60 . as shown in fig3 d , air can then be evacuated from the structures shown in fig3 c in order to produce a vacuum insulated cabinet 10 . as shown in fig4 , the insulation material 90 may be inserted into the second intermediate structure prior to the covering of the structure 60 with the second material sheet 22 . the insulation material 90 may be inserted in such a way that forms a semi - circle shape rising above the cavity 66 in the second intermediate structure . the second material sheet 22 is configured to compact the insulation material 90 to a desired compaction level during the sealing process . the addition and compaction steps can be repeated as desired to reach the desired compaction level of the insulation material 90 to withstand atmospheric pressure when the annular cavity is which contains material 90 is evacuated . the insulation material 90 is typically a highly porous granular insulation such as fumed silica or an open cell polyurethane foam or may be any other insulation material 90 known to one of ordinary skill in the art . any ambient air is then evacuated from the annular space 70 forming a vacuum insulated cabinet 10 . the processes described above result in less thinning of the first 20 and second 22 material sheet in order to ensure that the first material sheet 20 and the second material sheet 22 remain intact in order to provide a vacuum insulated structure .	5
the present invention relates to utilization of virtual rename buffers in a superscalar processor to reduce dispatch stalls . the following description is presented to enable one of ordinary skill in the art to make and use the invention and is provided in the context of a patent application and its requirements . various modifications to the preferred embodiment and the generic principles and features described herein will be readily apparent to those skilled in the art . fig1 is a block diagram of a processor system 10 for processing information in accordance with the present invention . in the preferred embodiment , processor 10 is a single integrated circuit superscalar microprocessor , such as the powerpc ™ processor from ibm corporation , austin , tex . accordingly , as discussed further hereinbelow , processor 10 includes various units , registers , buffers , memories , and other sections , all of which are formed by integrated circuitry . also , in the preferred embodiment , processor 10 operates according to reduced instruction set computing (&# 34 ; risc &# 34 ;) techniques . as shown in fig1 a system bus 11 is connected to a bus interface unit (&# 34 ; biu &# 34 ;) 12 of processor 10 . biu 12 controls the transfer of information between processor 10 and system bus 11 . biu 12 is connected to an instruction cache 14 and to a data cache 16 of processor 10 . instruction cache 14 outputs instructions to a sequencer unit 18 . in response to such instructions from instruction cache 14 , sequencer unit 18 selectively outputs instructions to other execution circuitry of processor 10 . in addition to sequencer unit 18 which includes execution units of a dispatch unit 46 and a completion unit 48 , in the preferred embodiment the execution circuitry of processor 10 includes multiple execution units , namely a branch unit 20 , a fixed point unit a (&# 34 ; fxua &# 34 ;) 22 , a fixed point unit b (&# 34 ; fxub &# 34 ;) 24 , a complex fixed point unit (&# 34 ; cfxu &# 34 ;) 26 , a load / store unit (&# 34 ; lsu &# 34 ;) 28 and a floating point unit (&# 34 ; fpu &# 34 ;) 30 . fxua 22 , fxub 24 , cfxu 26 and lsu 28 input their source operand information from general purpose architectural registers (&# 34 ; gprs &# 34 ;) 32 and fixed point rename buffers 34 . moreover , fxxua 22 and fxub 24 input a &# 34 ; carry bit &# 34 ; from a carry bit (&# 34 ; ca &# 34 ;) register 42 . fxua 22 , fxub 24 , cfxu 26 and lsu 28 output results ( destination operand information ) of their operations for storage at selected entries in fixed point rename buffers 34 . also , cfxu 26 inputs and outputs source operand information and destination operand information to and from special purpose registers (&# 34 ; sprs &# 34 ;) 40 . fpu 30 inputs its source operand information from floating point architectural registers (&# 34 ; fprs &# 34 ;) 36 and floating point rename buffers 38 . fpu 30 outputs results ( destination operand information ) of its operation for storage at selected entries in floating point rename buffers 38 . sequencer unit 18 inputs and outputs information to and from gprs 32 and fprs 36 . from sequencer unit 18 , branch unit 20 inputs instructions and signals indicating a present state of processor 10 . in response to such instructions and signals , branch unit 20 outputs ( to sequencer unit 18 ) signals indicating suitable memory addresses storing a sequence of instructions for execution by processor 10 . in response to such signals from branch unit 20 , sequencer unit 18 inputs the indicated sequence of instructions from instruction cache 14 . if one or more of the sequence of instructions is not stored in instruction cache 14 , then instruction cache 14 inputs ( through biu 12 and system bus 11 ) such instructions from system memory 39 connected to system bus 11 . in response to the instructions input from instruction cache 14 , sequencer unit 18 selectively dispatches through a dispatch unit 46 the instructions to selected ones of execution units 20 , 22 , 24 , 26 , 28 and 30 . each execution unit executes one or more instructions of a particular class of instructions . for example , fxua 22 and fxub 24 execute a first class of fixed point mathematical operations on source operands , such as addition , subtraction , anding , oring and xoring . cfxu 26 executes a second class of fixed point operations on source operands , such as fixed point multiplication and division . fpu 30 executes floating point operations on source operands , such as floating point multiplication and division . processor 10 achieves high performance by processing multiple instructions simultaneously at various ones of execution units 20 , 22 , 24 , 26 , 28 and 30 . accordingly , each instruction is processed as a sequence of stages , each being executable in parallel with stages of other instructions . such a technique is called &# 34 ; pipelining &# 34 ;. in a significant aspect of the preferred embodiment , an instruction is normally processed as six stages , namely fetch , decode , dispatch , execute , completion , and writeback . in the preferred embodiment , each instruction requires one machine cycle to complete each of the stages of instruction processing . nevertheless , some instructions ( e . g ., complex fixed point instructions executed by cfxu 26 ) may require more than one cycle . accordingly , a variable delay may occur between a particular instruction &# 39 ; s execution and completion stages in response to the variation in time required for completion of preceding instructions . in response to a load instruction , lsu 28 inputs information from data cache 16 and copies such information to selected ones of rename buffers 34 and 38 . if such information is not stored in data cache 16 , then data cache 16 inputs ( through biu 12 and system bus 11 ) such information from a system memory 39 connected to system bus 11 . moreover , data cache 16 is able to output ( through biu 12 and system bus 11 ) information from data cache 16 to system memory 39 connected to system bus 11 . in response to a store instruction , lsu 28 inputs information from a selected one of gprs 32 and fprs 36 and copies such information to data cache 16 or memory . as an example of the interaction among the execution units , e . g ., fxua 22 , fxub 24 , rename buffers 34 , and the dispatch unit 46 , an instruction &# 34 ; add c , a , b &# 34 ; is dispatched from the dispatch unit 46 to the fxua 22 . the dispatch unit 46 provides the fxua 22 with tags for the operands &# 34 ; a &# 34 ; and &# 34 ; b &# 34 ; to tell the fxua 22 where to retrieve the data for the operands , as is well understood by those skilled in the art . for example , in a system with six rename buffers , the dispatch unit 46 might suitably tag the operand for &# 34 ; a &# 34 ; as being located in a rename buffer 1 with a six bit tag 100000 . a tag of 010000 might then suitably be used to indicate that the operand &# 34 ; b &# 34 ; is in the rename buffer 2 . since the fxua 22 does not write into gprs 32 , the dispatch unit 46 must use a rename buffer tag for the target of the operation , such as 001000 , for the result of the ` add ` instruction to be placed in rename buffer 3 . since the dispatch unit 46 suitably employs rename buffers 34 and 38 to identify the location of the operands and results of operations , an allocation / deallocation table is preferably employed to track which buffers have been renamed . for example , fig2 illustrates a suitable allocation / deallocation table 70 , stored in the processor , for a superscalar processor system having , as a representation , six rename buffers . by way of example , the table 70 includes six slots , one for each rename buffer , with each slot including fields for the instruction identifier ( idn ), gpr identifier ( gprs ), rename register identifier ( rename ) and a valid field ( valid ). with the use of the rename buffer table 70 , the dispatch unit 46 can accurately keep track of which rename buffers have been used and which are available . also , the relationship between the gprs with the rename buffers is maintained in order to identify which register or rename buffer has the appropriate data for subsequent instructions . typically , the dispatch unit 46 stops allocating rename buffers 34 once all of the rename buffers 34 have been allocated . unfortunately , execution units may be idle while all of the rename buffers 34 are full thus , potential instructions for execution by idle execution units are delayed due to the lack of dispatching by the dispatch unit 46 . accordingly the present invention provides a method and system for allowing dispatch of instructions to execution units when all of the rename buffers of a system are in use . as shown in fig3 extra slots for virtual rename buffers are added to form an allocation / deallocation table 70 &# 39 ;. with the addition of the data for these slots in the allocation / deallocation table 70 &# 39 ;, stalls in the dispatch unit due to a lack of an available rename buffer are significantly reduced . by way of example , fig4 and 5 illustrate how the table 70 &# 39 ; is utilized in accordance with the present invention . as shown in fig4 each dispatched instruction is loaded into a real rename buffer if there is an empty slot available in the real rename buffer portion of the table . suppose , for example , that an instruction with identifier 0 ( idn 0 ) comprises a 1 wzx g18 , op1 , op2 ( load word and zero indexed , which adds the operands , op1 and op2 , to produce the effective address for loading a word from memory into the location of a target register , gpr 18 ). since the table in initially empty and no other real rename buffers have been assigned , g18 is renamed as rename buffer 0 , r0 . thus , the target tag for the instruction suitably is represented by a 100000 bit sequence . however , in accordance with the present invention , an additional bit , a rename busy bit , would also be included in the target tag . using the data shown in fig4 once the real rename buffers were all allocated , a next instruction , i . e ., instruction 6 ( idn 6 ), would be assigned to a virtual rename buffer slot , e . g ., virtual rename buffer 6 , r6 . in a preferred embodiment , the virtual rename buffers do not physically exist but are assigned to the instructions so that the instructions can be dispatched to the appropriate execution units if there are no operand conflicts . since the instruction has been allocated a virtual rename buffer , the rename busy bit for the instruction is set . thus , a suitable representation of the bit tag sequence for idn 6 comprises 1100000 , with the most significant bit representing the set rename busy bit . the execution units thus recognize the set value for the rename busy bit and determine that the instruction can be operated upon but not finished until the rename busy bit is reset fig5 illustrates how the rename busy bit for an instruction becomes reset as shown , once an instruction , i . e ., instruction 0 , is completed , it is deallocated from the table 70 &# 39 ;. at this point , a real rename buffer , r0 , is available for use by the first instruction entry in the virtual rename buffer portion of the table , i . e ., idn 6 . the instruction idn 6 is then placed into the real rename buffer portion of the table . in conjunction , a rename available signal is asserted to inform the appropriate execution unit that the rename buffer for the instruction is now a real rename buffer . a search for the appropriate idn , e . g ., idn 6 , among the execution units suitably provides the rename available signal to the proper execution unit fig6 presents a flow diagram illustrating the allocation / deallocation of rename buffers including virtual rename buffers in accordance with the present invention . when an instruction is received , via step 100 , a determination is made as to whether any real rename buffers are available for allocation of the instruction , via step 102 . if there is a real rename buffer available , the instruction gets allocated to the real rename buffer via step 104 . if there is no real rename buffer available , i . e ., the real rename buffer portion of table 70 &# 39 ; is full a determination is made via step 106 as to whether a virtual rename buffer is available . if no virtual rename buffer is available , the dispatch unit stalls via step 108 until a virtual rename buffer is available . when a virtual rename buffer is available , the virtual rename buffer is allocated to the instruction , and the rename busy signal for the instruction is set via step 110 . a determination is then made via step 112 as to whether a current instruction in the real rename buffer portion of the allocation / deallocation 70 &# 39 ; has completed . when completed , the current instruction is deallocated from the real rename buffer portion of table 70 &# 39 ;, via step 114 . a determination is then made , via step 116 , as to whether there is a next instruction allocated in the real rename buffer portion . if so , the next instruction becomes the current instruction , via step 118 . the process continues with a determination of whether there is an instruction in a virtual rename buffer via step 120 . when there is an instruction allocated to a virtual rename buffer , i . e ., step 120 is positive , the instruction is deallocated from the virtual rename portion and allocated via step 122 , to the real rename buffer , which had been deallocated from the completed current instruction in step 114 . the rename available signal is also transmitted to the appropriate execution unit via step 122 when the instruction is allocated the real rename buffer portion , and the process continues , via step 112 . if step 120 is negative , and no instructions are in the virtual rename buffer portion , the process returns to step 112 . when there are no next instructions , as determined via step 116 , the process is completed . thus , overall operation of the use of the table 70 &# 39 ; proceeds as summarized below . instructions are loaded into the real rename buffer portion of the table 70 &# 39 ; if there in an empty slot available . each instruction is completed out of the real rename buffer . an instruction is loaded into the virtual rename buffer portion when all of the real rename buffer slots are filled . when the virtual rename buffer portion is also full , the problem of dispatch stalling occurs , but , the number of slots in the virtual rename buffer portion of the table can be increased rather inexpensively to combat such problems . the rename busy bit is set for each valid instruction in the virtual rename buffer portion . each instruction in the virtual rename buffer portion is loaded into the real rename buffer portion upon completion of an instruction in the real rename buffer portion . once loaded into the real rename buffer portion , a rename available signal is asserted to notify the particular execution unit that the real rename buffer is now valid for the instruction , and the instruction can be finished , since it has been allocated a real rename buffer for its target operand . although the present invention has been described in accordance with the embodiments shown , one of ordinary skill in the art will recognize that there could be variations to the embodiment and those variations would be within the spirit and scope of the present invention . for example , although the rename busy bit has been identified as one bit , a plurality of bits may be used as desired without departing from the present invention . further , although the examples have used a particular number of rename buffers and virtual rename buffers , the numbers chosen have been used for illustrative purposes and are not meant as restrictive of the present invention . accordingly , many modifications may be made by one of ordinary skill without departing from the spirit and scope of the present invention , the scope of which is defined by the following claims .	6
the hydroxamic acid derivatives of the present invention may form salts with alkali metals , such as lithium , sodium or potassium . in addition , the compounds of formula i will form salts with dicyclohexylamine or other amines as well as with tris ( hydroxymethyl ) aminomethane , glucamine a amines as set out in u . s . pat . no . 4 , 294 , 759 . the term &# 34 ; lower alkyl &# 34 ; or &# 34 ; alkyl &# 34 ; as employed herein by itself or as part of another group includes both straight and branched chain radicals of up to 12 carbons , preferably 1 to 8 carbons , such as methyl , ethyl , propyl , isopropyl , butyl , t - butyl , isobutyl , pentyl , hexyl , isohexyl , heptyl , 4 , 4 - dimethylpentyl , octyl , 2 , 2 , 4 - trimethylpentyl , nonyl , decyl , undecyl , dodecyl , the various branched chain isomers thereof , and the like as well as such groups including a halo - substituent , such as f , br , cl or i or cf 3 , an alkoxy substituent , an aryl substituent , an aralkyl substituent , a haloaryl substituent , a cycloalkyl substituent , an alkylcycloalkyl substituent , hydroxy , an alkylamino or dialkylamino substituent , an alkanoylamino substituent , an arylcarbonylamino substituent , a nitro substituent , a cyano substituent , a thiol substituent or an alkylthio substituent . the term &# 34 ; cycloalkyl &# 34 ; employed herein by itself or as part of another group includes saturated cyclic hydrocarbon groups containing 3 to 12 carbons , preferably 3 to 8 carbons , which include cyclopropyl , cyclobutyl , cyclopentyl , cyclohexyl , cycloheptyl , cyclooctyl , cyclodecyl and cyclododecyl , which groups are substituted with the same , or a different cycloalkyl . the term &# 34 ; aryl &# 34 ; or &# 34 ; ar &# 34 ; as employed herein by itself or as part of another group refers to monocyclic or bicyclic aromatic groups containing from 6 to 10 carbons in the ring portion , such as phenyl , naphthyl , substituted phenyl or substituted naphthyl wherein the substitutent on either the phenyl or naphthyl may be 1 or 2 lower alkyl groups , 1 or 2 halogens ( cl , br or f ), 1 or 2 lower alkoxy groups , 1 or 2 hydroxyl groups , 1 or 2 alkylamino or dialkylamino groups , 1 or 2 alkanoylamino groups , 1 or 2 arylcarbonylamino groups , 1 or 2 amino groups , 1 or 2 nitro groups , 1 or 2 cyano groups , 1 or 2 thiol groups and / or 1 or 2 alkylthio groups . the term &# 34 ; aralkyl &# 34 ;, &# 34 ; aryl - alkyl &# 34 ; or &# 34 ; aryl - lower alkyl &# 34 ; as used herein refers to lower alkyl groups as discussed above having an aryl substituent , such as benzyl . the term &# 34 ; lower alkenyl &# 34 ; or &# 34 ; alkenyl &# 34 ; as employed herein by itself or as part of another group includes an unsaturated hydrocarbon group having from 2 to 8 carbons and a single carbon - carbon double bond , such as ethenyl , 1 - propenyl , 2 - propenyl , 1 - butenyl , 2 - butenyl , 3 - butenyl and the like . the term &# 34 ; lower alkynyl &# 34 ; or &# 34 ; alkynyl &# 34 ; as employed herein by itself or as part of another group includes an unsaturated hydrocarbon group having from 3 to 8 carbons and a single carbon - carbon triple bond , such as 1 - propynyl , 2 - propynyl , 1 - butynyl , 2 - butenyl , 3 - butenyl and the like . the term &# 34 ; alkanoyl &# 34 ; as used herein by itself or as part of another group refers to an alkyl carbonyl or alkenyl carbonyl group . the term &# 34 ; aroyl &# 34 ; as used herein by itself or as part of another group refers to an aryl carbonyl group . the term &# 34 ; halogen &# 34 ; or &# 34 ; halo &# 34 ; as used herein refers to chlorine , bromine , fluorine or iodine with chlorine being preferred . preferred are those compounds of the invention wherein r 1 is methyl , r 2 is hydrogen , r 3 is n - hexyl , a is ch 2 -- ch ═ ch and n = 3 or 4 . the various compounds of the invention may be prepared as described below . to make the compounds of formula i , a carboxylic acid of the formula ## str4 ## the preparation of which has been described in u . s . pat . no . 4 , 582 , 854 , is reduced with lithium aluminum hydride in the presence of a dry organic solvent , e . g . tetrahydrofuran or ether , to the alcohol ## str5 ## the reaction of the alcohol iii with a complex prepared from n - bromosuccinimide and triphenylphosphine at a temperature within the range of from about 0 ° c . to about 25 ° c . affords a bromide of the formula ## str6 ## the bromide iv can be reacted with a hydroxylamine in which the oxygen is protected , e . g . o - tetrahydropyranyloxy hydroxyl amine in the presence of a solvent , e . g . dimethylformamide , and a base , e . g . sodium bicarbonate , at a temperature within the range of from about 25 ° c . to about 70 ° c . to produce ## str7 ## in which the tetrahydropyranyl ( thp ) &# 34 ; o &# 34 ;- protecting group &# 34 ; appears as shown . amine v can thereafter be reacted with a carboxylic acid chloride of the formula ( wherein r 1 is the desired alkyl or aryl group ) in the presence of a base , e . g . aqueous sodium hydroxide and a solvent such as tetrahydrofuran to afford the &# 34 ; o - protected &# 34 ; hydroxamic acid ## str8 ## compound vii , where r 1 = h , can be prepared by the reaction of v with acetic formic anhydride preferably in the presence of a base such as triethylamine . compound vii is thereafter &# 34 ; de - protected &# 34 ;, such as by treatment with pyridinium - paratoluene sulfonate in methanol or dilute hydrochloric acid in methanol , to remove the thp group and provide the compounds of the present invention . alternatively , the alcohols of formula iii can be prepared by the wittig reaction of an aldehyde of the formula ## str9 ## with the phosphonium salts of the formula in the presence of bases to afford ## str10 ## wherein the protecting group can be thp , t - butyl dimethyl silyl , or the like . compound x can thereafter be &# 34 ; deprotected &# 34 ;, e . g . by treatment with tetrabutylammonium fluoride or dilute acetic acid ( in the case of t - butyl dimethyl silyl ) or pyridinium paratoluene sulfonate or dilute hydrochloric acid in methanol ( in the case of thp ) to produce the alcohols iii . the aldehyde viii may be substituted by the hemiacetal xi ## str11 ## for reaction with the phosphonium salt ix and afford alcohols of the formula xii ## str12 ## alcohols of formula xii can be reacted with mesylates or tosylates of formula where x = mesyloxy or p - toluene sulfonyloxy in the presence of an inorganic base like potassium hydroxide in an organic solvent like xylene at temperatures within the range of 100 ° c . to 150 ° c . to afford ethers of the formula x which can thereafter be &# 34 ; deprotected &# 34 ; as described before to produce alcohols iii . another alternative includes converting the alcohols iii into tosylates or mesylates , instead of the bromides iv , for reaction with the o - tetrahydropyranyloxy hydroxylamine . the compounds of this invention have four centers of asymmetry as indicated by the asterisks in formula i . however , it will be apparent that each of the formulae set out above which do not include asterisks still represent all the possible stereoisomers thereof . all of the various stereoisomeric forms are within the scope of the present invention . the various stereoisomeric forms of the compounds of the invention , namely , cis - endo , cis - exo and all trans forms and stereoisomeric pairs may be prepared as shown in the working examples which follow and by employing starting materials and following the procedures as outlined in u . s . pat . no . 4 , 582 , 854 . examples of such stereoisomers are set out below . ## str13 ## the nucleus in each of the compounds of the invention is depicted as ## str14 ## for matter of convenience ; it will also be appreciated that the nucleus in the compounds of the invention may be depicted as ## str15 ## the compounds of the invention are inhibitors of the arachidonic acid enzymes 5 - lipoxygenase and cyclooxygenase and prevent formation of certain leukotriene and prostaglandins . the administration of compounds of this invention to humans or animals provides a method for treating allergy of a reagin or non - reagin nature . asthma and psoriasis are preferably treated but any allergy or inflammation wherein leukotrienes or prostaglandins are thought to be involved as pharmacological mediators can be treated . for example , the compounds of this invention can be used for treatment of such conditions as allergic rhinitis , food allergy and urticaria , as well as asthma and psoriasis . an effective but essentially non - toxic quantity of the compound is employed in treatment . the compounds of the invention can be administered parenterally , orally or topically to various mammalian species known to be subject to such maladies , e . g ., humans , cattle , horses , cats , dogs , and the like in an effective amount within the dosage range of about 1 to 100 mg / kg , preferably about 1 to 50 mg / kg and especially about 2 to 25 mg / kg on a regimen in single or 2 to 4 divided daily doses . the active substance can be utilized in a composition such as tablet , capsule , solution or suspension , lotion , cream or ointment containing about 5 to about 5000 mg per unit of dosage of a compound or mixture of compounds of formula i . they may be compounded in conventional matter with a physiologically acceptable vehicle or carrier , excipient , binder , preservative , stabilizer , flavor , etc . as called for by accepted pharmaceutical practice . also as indicated in the discussion above , certain members additionally serve as intermediates for other members of the group . a solution of 3 - iodopropanol ( 15 g , 80 . 65 mole ), dihydropyran ( 14 . 7 ml , 161 . 29 mole ) and pyridium p - toluenesulfonate ( 500 g , 2 . 0 mole ) in 100 ml of dry dichloromethane was stirred at room temperature under an atmosphere of nitrogen for 2 . 5 hours . the resulting mixture was diluted with dichloromethane ( 150 ml ), washed with water and a saturated sodium bicarbonate solution , dried over anhydrous magnesium sulfate and evaporated in vacuo . the residue was flash chromatographed on a silica gel to give 20 . 43 g of the title a compound as an oil . a solution of 3 - iodo - 1 - tetrahydro - 2 - pyranyloxy propane ( 20 . 43 g , 75 . 63 mmole ), and triphenylphosphine ( 19 . 84 g , 75 . 63 mmole ) in 150 ml of dry benzene was refluxed under an atmosphere of nitrogen for 24 hours . the solvent was evaporated in vacuo to give a sticky gum . this was rinsed with acetonitrile ( 80 ml ) when a white solid precipitated out . the solid was filtered and dried over phosphorous pentoxide at 60 ° c . in vacuo for 20 hours to give 32 . 8 g of the title b compound . to a chilled and stirred slurry of 3 - tetrahydro - 2 - pyranyloxy triphenyl phosphonium iodide ( 4 . 224 g , 9 mmole ) in 40 ml of dry tetrahydrofuran was added dropwise potassium - t - amylate ( 4 . 03 ml , 1 . 7m in toluene ) over five minutes under nitrogen . the orange solution was stirred at - 20 ° for 2 hours and then a solution of 1r -[ 4ar -( 4aα , 5α , 8α , 8aα )] octahydro - 5 , 8 - epoxy -( 1h )- benzopyrane - 3 - ol ( 510 mg , 3 mmole ) in 10 ml of dry tetrahydrofuran was added dropwise . the solution was gradually warmed up to room temperature , stirred for 18 hours and quenched with acetaldehyde ( 1 . 5 ml ). after stirring at room temperature for another 30 minutes , the mixture was diluted with 30 ml of a saturated sodium bicarbonate solution and extracted three times with ethyl ether . the combined ether extracts were washed with brine , dried over anhydrous magnesium sulfate and evaporated in vacuo . the residue was flash - chromatographed on a silica gel to give 810 g of the title c compound as an oil . powdered potassium hydroxide ( 900 mg , 16 mmole ) in 80 ml of dry xylene was refluxed under stirring in an atmosphere of nitrogen and 35 - 40 ml of xylene was removed by distillation . to this was added dropwise a solution of the alcohol of step c ( 400 mg , 1 . 35 mmole ) and n - hexylmesylate ( 1 . 216 g , 6 . 75 mmole ) in 25 ml of dry xylene . the mixture was refluxed for one hour and was then cooled . water ( 25 ml ) was added and the solution was extracted three times with ethyl ether . the combined ether extracts were washed with brine , dried over anhydrous magnesium sulfate and evaporated in vacuo . the residue was flash chromatographed on a silica gel column to give 455 mg of title d compound as an oil . a solution of the ether of step d ( 125 mg , 0 . 328 mmole ) and pyridium p - toluenesulfonate ( 91 mg , 0 . 361 mmole ) in 5 ml of methanol was stirred at 70 ° ( oil bath temperature ) under an atmosphere of nitrogen for 1 . 5 hours . the methanol was mostly removed in vacuo , the residue diluted with 15 ml of water and extracted three times with ethyl ether . the combined ether extracts were washed with brine , dried over anhydrous magnesium sulfate and evaporated in vacuo . the residue was flash chromatographed on a silica gel column to give 85 mg of the title e compound . n - bromosuccinimide ( 356 mg , 2 mmole ), triphenylphosphine ( 524 . 6 mg , 2 mmole ) and dry celite ( dried at 100 ° in vacuo overnight ) were mixed in benzene ( 15 ml ) at 0 ° under an atmosphere of nitrogen and then stirred at room temperature for 1 . 5 hours . a solution of the alcohol of step e ( 296 . 5 mg , 1 mmole ) in dichloromethane ( 5 . 0 ml ) was added . after stirring for 18 hours , the mixture was filtered through a bed of celite and washed with a small amount of dichloromethane . the filtrate and washings were dried over anhydrous magnesium sulfate and evaporated in vacuo . the residue was chromatographed on a silica gel column to give 340 mg of the title f compound as an oil . a mixture of the bromide of step f ( 450 mg , 1 . 25 mmole ), o - tetrahydropyranyloxy hydroxylamine ( 293 mg , 2 . 5 mmole ) and anhydrous sodium bicarbonate ( 1 . 05 g , 12 . 5 mmole ) in 7 ml of dry hmpa was stirred at 70 ° c . ( oil bath temperature ) under an atmosphere of nitrogen for 18 hours . the mixture was then cooled to room temperature , diluted with water ( 20 ml ) and extracted three times with ethyl ether . the ether extracts were combined and washed several times with water , dried over anhydrous magnesium sulfate and evaporated in vacuo . the residue was chromatographed on a silica gel column to give 400 mg of the title g compound as an oil . a mixture of the compound of step g ( 395 . 6 mg , 1 mmole ) and 1 . 0n sodium hydroxide ( 20 ml , 20 mmole ) in 10 ml of tetrahydrofuran was stirred vigorously at ˜ 0 ° c . under an atmosphere of nitrogen . a solution of acetyl chloride ( 0 . 285 ml , 4 mmole ) in 3 ml of tetrahydrofuran was then added dropwise . the mixture was stirred at ˜ 0 ° for five hours and extracted three times with ethyl ether . the combined ether extracts were washed with brine , dried over anhydrous magnesium sulfate , filtered and evaporated in vacuo to give 415 mg of slightly impure the title h compound , as an oil . a solution of the compound of step h ( 415 mg , 0 . 948 mmole ) and pyridium p - toluenesulfonate ( 400 mg , 1 . 59 mmole ) in 20 ml of dry methanol was stirred at 75 ° c . ( oil bath temperature ) under an atmosphere of nitrogen for five hours . the solvent was then evaporated in vacuo . the residue was diluted with water ( 20 ml ) and extracted three times with ethyl ether . the combined ether extracts were washed with brine , dried over anhydrous magnesium sulfate and evaporated in vacuo . the residue was chromatographed on a silica gel to give 245 mg of the title compound as an oil . a slurry of 3 - carboxypropyltriphenylphosphonium iodide ( 41 . 13 g , 0 . 086 mole ) and [ 4ar ( 4aα , 5α , 8α , 8aα )]- octahydro - 5 , 8 - epoxy -( 1h )- benzypyrano - 3 - ol ( 10 g , 0 . 059 mole ) in dry toluene ( 236 ml ) was chilled to ˜ 0 ° c . under nitrogen and treated dropwise with a solution of 1 . 74m potassium t - amylate in toluene ( 97 . 1 ml , 0 . 169 mole ) over a period of ninety minutes . the mixture was then stirred at room temperature for twenty hours , chilled to ˜ 0 ° c . and treated slowly with glacial acetic acid ( 9 . 5 ml ) in toluene ( 11 . 8 ml ) in the course of thirty minutes . the thick suspension was treated with water ( 177 ml ) and brought to a ph of about 1 . 5 with concentrated hydrochloric acid ( 12 ml ). the mixture was diluted with ethyl acetate ( 177 ml ), treated with sodium chloride ( 41 . 3 g ) and stirred vigorously for fifteen minutes . the resultant precipitates were removed by filtration , washing the solids twice with ethyl acetate . the toluene - ethyl acetate layer was separated and the aqueous layer extracted twice with ethyl acetate . the combined organic extracts were dried over anhydrous magnesium sulfate and concentrated in vacuo to a thick oil . this oil was stirred vigorously with 5 % potassium carbonate ( 177 ml ) for 30 minutes , filtered and the resultant solid washed thoroughly with water ( 100 ml ). the aqueous filtrate was extracted with ethyl ether : toluene ( 1 : 1 ; 5 times ), chilled in an ice bath and treated slowly with concentrated hydrochloric acid to ph 2 . 5 . the aqueous layer was extracted three times with ethyl acetate and the combined extracts were dried over anhydrous magnesium sulfate , filtered and concentrated in vacuo to give 15 . 2 g of the title a compound as a thick oil . a solution of the title a compound ( 15 . 2 g , 0 . 059 mole ) in dry methanol ( 78 ml ) was stirred vigorously with crushed amberlyst - 15 resin ( 7 . 70 g ) at room temperature for two days . the mixture was diluted with ether ( 80 ml ) and filtered through a celite pad , washing the pad thoroughly with ether . the combined filtrate and washings were concentrated in vacuo , the resultant oil was dissolved in ether ( 150 ml ) and washed with a 5 % sodium bicarbonate solution ( 25 ml ), water ( 20 ml ) and brine ( 20 ml ). the organic phase was dried over anhydrous magnesium sulfate , filtered and concentrated in vacuo to a thick oil which contained the title compound as the major component and small amounts of three less polar components . this product mixture was chromatographed on a silica gel column to give 8 . 88 g of the title b compound as an oil . a stirred suspension of crushed potassium hydroxide ( 18 . 4 g ) in dry xylene ( 700 ml ) was brought to reflux under nitrogen and 180 ml of xylene was removed by distillation . the mixture was cooled and a solution of the title b compound ( 9 . 2 g , 0 . 036 mole ) and n - hexylmesylate ( 33 g , 0 . 18 mole ) in dry xylene ( 60 ml ) was added . the mixture was gently refluxed , azeotroping off xylene (˜ 180 ml ) over a period of one hour , cooled and treated with a solution of potassium hydroxide ( 18 . 5 g , 0 . 33 mole ) in water ( 220 ml ). the solution was refluxed under vigorous stirring for 1 . 5 hours , cooled , diluted with water ( 450 ml ) and extracted with ether ( 2 . 0 liters ). the aqueous layer was acidified with concentrated hydrochloric acid ( 50 ml ), extracted three times with ether , and the combined organic extracts washed with brine ( 450 ml ), dried over anhydrous magnesium sulfate , filtered and evaporated in vacuo to give the acid corresponding to the title compound as a thick oil ( 10 . 4 g ). the crude acid was dissolved in ether ( 150 ml ), cooled down to 0 ° c . and treated with excess diazomethane in ether . the yellow solution was allowed to stand at 0 ° c . for thirty minutes , at room temperature for one hour and the excess diazomethane blown off with a stream of nitrogen . the resulting solution was evaporated in vacuo and the residual oil chromatographed on a silica gel column to give 10 . 05 g of the title c compound as a homogeneous oil . a solution of the title c compound ( 5 g , 0 . 015 mole ) in dry tetrahydrofuran ( 25 ml ) was added under nitrogen to a cooled (˜ 0 ° c .) suspension of lithium aluminum hydride ( 936 . 2 mg , 0 . 025 mole ) in dry tetrahydrofuran ( 115 ml ). the mixture was stirred at ˜ 0 ° c . for thirty minutes , at room temperature for 2 . 5 hours and quenched by the subsequent addition of water ( 1 . 0 ml ), 10 % sodium hydroxide ( 1 . 5 ml ) and water ( 3 . 0 ml ). the slurry was stirred for thirty minutes , diluted with ether ( 100 ml ) and the supernatant solution was decanted , washing the precipitates thrice with ether ( 225 ml ). the combined organic extracts were dried over anhydrous magnesium sulfate , filtered and evaporated to dryness to give an oil ( 5 . 04 g ) which contained the title compound as the major component and traces of three more polar components . the crude product was chromatographed on a silica gel to give 353 g of the title d compound as a homogeneous oil . a mixture of 99 % triphenylphosphine ( 5 . 44 g , 20 . 5 mmole ), n - bromosuccinimide ( 3 . 67 g , 20 . 6 mmole ) and celite ( 11 . 6 g ) was stirred at ˜ 0 ° c . in a mixture of dry benzene ( 116 ml ) and dry dichloromethane ( 29 ml ) under nitrogen for ten minutes and at room temperature for one hour . a solution of the alcohol of step d ( 2 . 89 g , 9 . 3 mmole ) in dry dichloromethane ( 50 ml ) was added to the resulting complex and the stirring continued at room temperature for 24 hours . the mixture was diluted with dichloromethane ( 50 ml ), stirred and filtered , washing the solids with more dichloromethane ( 300 ml ). the filtrate and washings were combined and evaporated to dryness and the residual oil partitioned twice between water ( 150 ml ) and dichloromethane ( 300 ml ). the organic phase was dried over anhydrous magnesium sulfate , filtered and evaporated to dryness to give an oil containing traces of triphenylphosphine and a slightly more polar component . the crude product was chromatographed on a silica gel column to give 3 . 10 g of the title e compound as a homogeneous oil . a mixture of the title e compound ( 800 mg , 2 . 14 mmole ), 0 - tetrahydropyranyloxy hydroxylamine ( 501 . 6 mg , 4 . 28 mmole , 2 eq .) and sodium bicarbonate ( 1 . 8 g , 21 . 4 mmole ) in dry hmpa ( 10 . 4 ml ) was heated at 70 ° ( oil - bath ) under nitrogen for 6 . 5 hours . the mixture was then cooled , diluted with water ( 50 ml ) and extracted three times with ether . the combined organic extracts were washed with brine ( 40 ml ), dried over anhydrous magnesium sulfate , filtered and evaporated to dryness . the residual oil was chromatographed on a silica gel column to give 838 . 9 mg of the title f compound as a homogeneous oil . a solution of the title f compound ( 833 . 6 mg , 2 . 04 mmole ) in 1n sodium hydroxide ( 40 . 7 ml , 20 eq .) and tetrahydrofuran ( 20 . 4 ml ) was stirred vigorously at ˜ 0 ° c . and treated dropwise with a solution of acetyl chloride ( 1 . 45 ml , 20 , 3 mmole , 10 eq .) in dry tetrahydrofuran ( 20 ml ). the mixture was stirred at ˜ 0 ° c . for six hours and extracted three times with ether . the combined organic extracts were washed with brine ( 30 ml ), dried over anhydrous magnesium sulfate , filtered and evaporated to dryness to give 925 . 9 mg of the title g compound as an oil . a solution of the title g compound ( 500 mg , 1 . 11 mmole ), in dry methanol ( 25 ml ) was mixed with 98 % pyridinium p - toluenesulfonate ( 467 . 1 mg , 1 . 29 mmole ) and heated at 75 ° ( oil bath ) under nitrogen for 5 hours . the solvent was then evaporated in vacuo and the resdiual oil partitioned between water ( 25 ml ) and ether ( 3 × 50 ml ). the combined organic extracts were washed with brine ( 25 ml ), dried over anhydrous magnesium sulfate , filtered and evaporated to dryness . the residual oil was chromatographed on a silica gel column to give 305 . 2 mg of the title compound as an oil . a solution of [ 1r -[ 1α , 2β ( z ), 3β , 4α ]- 7 -[ 3 -[( hexyloxy ) methyl ]- 7 - oxabicyclo ( 2 . 2 . 1 ) hept - 2 - yl ]- 5 - heptenoic acid ( 900 mg , 2 . 66 mmole ) in dry ether ( 50 ml ) was treated with an excess of diazomethane in ether and stirred at room temperature for one hour . the excess diazomethane was blown off with a stream of nitrogen and the colorless solution evaporated to dryness . the residual oil was chromatographed to give 1 . 1 g of the title a compound as an oil . a solution of the title a compound ( 2 . 1 g , 6 . 55 mmole ) in dry tetrahydrofuran ( 10 ml ) was added dropwise to a suspension of lithium aluminum hydride ( 410 mg , 10 . 8 mmole ) in dry tetrahydrofuran ( 50 ml ) under nitrogen at ˜ 0 ° c . the mixture was stirred at 0 ° c . for 30 minutes and at room temperature for 2 . 5 hours , then quenched by the sequential addition of water ( 0 . 41 ml ), 10 % sodium hydroxide for 30 minutes , diluted with ether ( 200 ml ) and filtered , washing the precipitates well with ether ( 50 ml ). the filtrate was dried over anhydrous magnesium sulfate , filtered and evaporated to dryness to give 1 . 93 g of the title b compound as a homogeneous oil . a mixture of 99 % triphenylphosphine ( 901 mg , 3 . 4 mmole ), n - bromosuccinimide ( 611 . 7 g ) and dry celite ( 2 . 0 g ) in a mixture of benzene ( 20 ml ) and dry dichloromethane ( 5 ml ) was stirred at 0 ° c . ( ice bath ) under nitrogen for 10 minutes and at room temperature for one hour . a solution of the title b compound ( 500 mg , 1 . 71 mmole ) in dry dichloromethane ( 5 ml ) was added to the complex and stirring continued at room temperature for 20 hours . the mixture was diluted with dichloromethane , stirred and filtered , washing the solids with more dichloromethane ( 50 ml ). the organic extracts were evaporated to dryness and the residual oil partitioned twice between water ( 25 ml ) and dichloromethane ( 25 ml ). the organic phase was dried over anhydrous magnesium sulfate , filtered and evaporated to dryness to give an oil containing traces of starting material and triphenylphosphine . the crude product was chromatographed on a silica gel column to give the title c compound as a homogeneous oil ( 519 mg ). a mixture of the title c compound ( 434 . 5 mg , 1 . 12 mmole ), o - tetrahydropyranyloxy hydroxylamine ( 262 . 4 mg , 2 . 24 mmole ) and sodium bicarbonate ( 940 . 8 mg , 11 . 2 mmole ) in hmpa ( 5 . 4 ml ) was heated at 60 ° under nitrogen for 12 hours . the reaction mixture was cooled , diluted with water ( 25 ml ) and extracted twice with ether . the organic extracts were washed with water , dried over anhydrous magnesium sulfate , filtered and evaporated to dryness to give an oil which contained the desired compound as the major component and traces of the starting material and another product . this mixture was chromatographed on a silica gel column to give 432 . 5 mg of the title d compound as a homogeneous oil . an emulsion of the title d compound ( 541 mg , 1 . 28 mmole ) in 1n sodium hydroxide ( 28 ml ) was stirred in an ice bath and was treated with acetyl chloride ( 0 . 91 ml , 12 . 8 mmole ). the mixture was stirred at ˜ 0 ° c . under nitrogen for another 2 hours , at room temperature overnight , and was extracted thrice with ether . the organic extracts were washed with brine ( 50 ml ), dried over anhydrous magnesium sulfate , filtered and evaporated to dryness to give 510 . 5 mg of the title e compound as a homogeneous oil . a solution of the title e compound ( 510 . 5 mg , 1 . 1 mmole ) in dry methanol ( 20 ml ) was treated with 98 % pyridinium p - toluenesulfonate ( 500 mg , 1 . 94 mmole ) and heated under nitrogen at 55 ° for 35 hours . the solvent was evaporated in vacuo and the residual oil partitioned twice between methylene chloride ( 100 ml ) and water ( 25 ml ). the organic phase was washed with brine ( 25 ml ) dried over anhydrous magnesium sulfate , filtered and evaporated to dryness to give a product mixture of the desired compound and starting material . this mixture was chromatographed on a silica gel column to give 217 mg of the title compound as an oil . the following additional compounds within the scope of the present invention may be prepared by employing the teachings as outlined above and in the working examples . __________________________________________________________________________ ## str16 ## ex . no . r . sub . 1 r . sub . 2 r . sub . 3 a n__________________________________________________________________________4 h h ch . sub . 3 ch . sub . 2chch 25 h ch . sub . 3 c . sub . 2 h . sub . 5 ch . sub . 2chch 16 c . sub . 2 h . sub . 5 ch . sub . 3 c . sub . 5 h . sub . 11 ch . sub . 2chch 3 ## str17 ## h ## str18 ## ch . sub . 2chch 38 ## str19 ## h c . sub . 2 h . sub . 5 -- 59 ch . sub . 2ch . sub . 2chch ch . sub . 3 c . sub . 6 h . sub . 13 ch . sub . 2chch 310 ch . sub . 3 ## str20 ## ch . sub . 2ccch . sub . 2 ch . sub . 2chch 411 c . sub . 3 h . sub . 7 ## str21 ## c . sub . 3 h . sub . 7 -- 612 ## str22 ## ## str23 ## ch . sub . 3 ch . sub . 2chch 213 c . sub . 4 h . sub . 9 h ch . sub . 2chch -- 714 ## str24 ## ## str25 ## ch . sub . 2chchc . sub . 2 h . sub . 5 ch . sub . 2chch 315 ch . sub . 2chchch . sub . 3 h c . sub . 7 h . sub . 15 ch . sub . 2chch 816 ch . sub . 2chchch . sub . 3 c . sub . 3 h . sub . 7 ch . sub . 2ccch . sub . 3 -- 917 ## str26 ## c . sub . 4 h . sub . 9 ch . sub . 3 ch . sub . 2chch 418 ## str27 ## c . sub . 5 h . sub . 11 ## str28 ## ch . sub . 2chch 319 ## str29 ## c . sub . 6 h . sub . 13 ## str30 ## ch . sub . 2chch 220 ch . sub . 2chchc . sub . 3 h . sub . 7 c . sub . 7 h . sub . 15 c . sub . 3 h . sub . 7 ch . sub . 2chch 2__________________________________________________________________________	2
a connector 1 according to a first embodiment of he invention is disclosed with reference to fig1 to 3 . connector 1 is shown in a perspective view and in a not tight condition in fig1 , in a longitudinal section in fig2 and in a partly assembled perspective view and in a partly tight condition view in fig3 . connector 1 comprises a mid section 2 , two outer bodies 3 and a number of shims 4 . each outer body 3 is coupled to one respective side of the mid section 2 . a threaded coupling is shown in fig1 - 3 by way of an example . a number of shims 4 is housed between each outer body 3 and the mid section 2 . more specifically , the mid section 2 comprises a central disc wall 5 , which may be solid as shown or bored ( compare fig5 ), and two collars 6 each having an outer threading 7 . the inner wall of each collar 6 is conical as shown at 8 , specifically flared , for reasons that will be clear hereinafter . each outer body 3 is an essentially cylindrical hollow body . each outer body 3 has an inner threading 9 at a first longitudinal end 10 , matching and coupled with the outer threading 7 of the mid section . each outer body 3 has an inner conical surface 11 at a second longitudinal end 12 opposed the first longitudinal end 10 . each shim 4 is an elongate rigid member shaped as a section of a cylindrical wall , having a first and a second , conical , specifically tapered longitudinal end 13 and 14 . each longitudinal end 13 and 14 matches the conical surface 8 of flared collar 6 of mid section 2 and the conical surface 11 at the second longitudinal end 12 of outer body 3 , respectively . in use of the connector 1 , a conductor c is axially inserted in one of the outer bodies 3 and its associated shim assembly 4 . the end portion or free end of the conductor c is preferably brought to abutment with the flared surface 8 or the disc wall 5 of mid section 2 . the mid section 2 partially surrounds the exposed section of the conductor c . the outer body 3 is then axially moved towards the mid section 2 and coupled therewith , screwed thereto in the example shown . both the outer body 3 and the mid - section 2 have hexagonal profiles 15 , 14 cut into the outer surface as shown , allowing the use of a wrench , preferably of a torque wrench to tighten the connector 1 to a specific torque . the outer bodies 3 may be further locked to the mid - section 2 using a safety means to stop the connector 1 from loosening off , e . g . a pin and groove locking mechanism as disclosed below in connection with fig5 . the provision of the disclosed matching conical or slanted surfaces 8 , 13 , and 11 , 14 allows the shims 4 to be forced radially inwards , towards axis x of connector 1 , when they are forced axially while the outer body 3 is coupled with the mid section 2 during tightening of the connector 1 . namely , as the length of the assembly of mid section 2 and outer body 3 decreases because of threading them together , the axial compression onto the shims 4 causes a radial compression or force of the shims 4 around and towards the conductor c . the shims 4 thus close down onto the conductor c , also becoming closer to each other . the tightening of the outer bodies 3 to the mid section 2 can be completed using a torque wrench up to a specified torque as said . the slant of the conical surfaces 8 , 13 , and 11 , 14 and the length and circumferential extent of the shims 4 are properly selected so that the shims 4 may get closer to each other to clamp onto a connector c essentially all around , irrespectively of the outer diameter of the connector c within a range of outer diameters . thus , connector 1 has range taking capability as far as the outer diameter of the conductor c is concerned . three shims 4 each extending slightly less than 120 ° are shown in the exemplary embodiment but they can be less or more than three , of a proper angular extent . each shim 4 preferably has a scored inner surface to promote gripping on the conductor c and also to break oxidisation of an aluminium conductor c . when aluminium reacts with oxygen in the air it develops a thin oxide film on the outer surface of the conductor c and / or on the inner surface of the shims 4 . this film can affect the conductivity and therefore it is necessary to remove it just before connection , e . g . using a wire brush . advantageously , a scored inner surface of the connector 1 will penetrate the thin oxides and will make a clean connection without the necessity to remove it manually . preferably , the scores on the inner surface of shims 4 comprise grooves circumferentially arranged . in one version , the grooves are helically arranged . in order to keep together the shims 4 that are associated with a same outer body 3 or shim assembly , in the embodiment shown a collapsible spacing ring 17 extends in a groove 18 of the shims 4 . this aids assembly of the connector 1 as well as mounting thereof to conductor c . in order to preserve an equal circumferential spacing or gap between the shims 4 , collapsible spacing ring 17 advantageously has a round pin or bulge 19 between adjacent shims 4 . bulges 19 maintain the orientation of the shims 4 and their spacing so as to aid fitting by allowing easy insertion of conductor c inside the shim assembly . upon tightening the connector 1 , all the bulges 19 collapse together so that the gaps between shims 4 reduce together and the circumferential distribution of contact surfaces with conductor c is kept . the size and resistance of the bulges 19 of collapsible spacing ring 17 is so selected that the shims 4 may clamp the conductor c but are prevented to slip around the conductor and group together at the bottom of the connector 1 , what would leave too great of a gap at the top of the connector 1 . apart from the collapsible spacing ring 17 , the connector 1 is made of metal , preferably of aluminium , brass or copper to ensure electrical conductivity between the two conductors c . collapsible spacing ring 17 is made for example of a soft rubber . it is emphasised that the connector 1 of the invention provides for several advantages : the shims 4 ensure each conductor c is kept concentric to the outer surface of the connector 1 , and therefore also with each other in the case of a straight joint as shown ; thanks to bulged ring 17 , the shims 4 are evenly spaced around the conductor c ensuring good surface contact and , from an electrical point of view , low electrical resistance and absence of voltage differences between the layers of strands of the conductor c ; as seen above , the radial movement of the shims 4 allows for some range taking capability what allows less components to be manufactured , stored and carried at junction sites ; moreover there is no need of providing a stepped connector in case two different diameter conductors c are to be jointed ; range taking capability also easily allows jointing connectors c of different diameters ; no special tool is required for installation , rather a wrench suffices ; the connector 1 is highly resistant to axial forces , in that any attempt to withdraw the conductor c from the connector 1 will only result in tightening of the shims 4 . in an alternative embodiment , two or more collapsible spacing rings may be used for each shim assembly . in an alternative embodiment , the shims may have bevelled end ( s ) and the outer body and / or the mid section may have flared surface ( s ). in an alternative embodiment , only one or two of the ends of the outer body and the mid section may be bevelled or conical . in other embodiments , interchangeable shims and / or either interchangeable outer bodies or mid sections may be provided to further extend the range take with respect to the diameter of conductor c . fig4 shows a termination lug 1 a wherein instead of one symmetrical mid section 2 and two outer bodies 3 as disclosed thus far , only one outer body 3 and one lug 2 a that plays the role of one half mid section and that is shaped to allow e . g . ground or mass connection are used . shims ( not visible in fig4 ) as discussed above are provided within the single outer body . although the threaded engagement of mid section 2 and outer bodies 3 or lug 2 a is particularly advantageous because it allows tightening by a usual wrench , different tightening mechanisms and use of specialized tooling may be provided . a torque limiting device that indicates the connector is tight may also be provided for . by way of an example , fig5 shows a connector 21 differing from connector 1 in that instead of a screw thread coupling , a pin and groove locking mechanism is used , resembling a bayonet coupling . as the connector outer body 23 is turned to lock the conductor c , a pin 26 of the mid section 22 clicks into one of a plurality of grooves 25 in the side of the outer body 23 , that are arranged at different longitudinal positions along a diagonal groove wherein the pin 26 can slide . there may be provided one groove 25 for each of a plurality of specific size conductors c . an increasing depth of engagement of the outer body 23 with the mid section 22 will again cause an increasing clamping of the shims around the conductor c . two diametrically opposed pins 26 and corresponding grooves 25 , or a larger number thereof , may also be provided to increase the axial force onto the shims . as mentioned , the screw thread coupling of fig1 and the pin and groove locking mechanism of fig5 may be both provided for in a single connector , to enhance the coupling . fig6 shows a connector 31 that differs from that of fig1 - 3 in that the mid section 32 is made longer , and comprises an internal cylindrical wall 35 adjacent a conical surface 38 at an intermediate position thereof . the outer bodies 33 having a hexagonal profile 16 are matingly threaded with the mid section 32 , internally thereto , and exert an axial force onto the shims 34 through a clamping ring 36 having a conical inner surface 37 ( not visible ). in use , an outer layer of conductor strands s is splayed and spread outside the shims 34 , and held by clamping ring 36 , as the connector 31 is tightened the shims 34 clamp onto the inner layers of strands whilst the outer layer of strands s is held by the clamping ring 36 . this advantageously produces a great surface contact between connector 31 and conductor c for an improved electrical connection . the differences highlighted above may be individually provided as a modification of the connector 1 of fig1 - 3 . fig7 shows a connector 41 wherein again the mid section 42 is made longer , and comprises an internal cylindrical wall 45 and no conical surface . the outer bodies 43 are e . g . matingly threaded with the mid section 42 and exert an axial force onto a collapsible inner member 44 . collapsible inner member 44 is a tube shaped body comprising two end collars 46 and an intervening portion that comprises apertures 47 . more specifically , apertures 47 are rhomboidal and each wall 48 between two such apertures is hourglass - shaped . moreover each wall 48 is so slanted with respect to the collars 46 that the neck of the hourglass - shaped wall 47 lies on a smaller circumference than the collars 46 . when the connector 41 is tightened , inner member 44 collapses and the hourglass - shaped walls 48 indent onto the conductor c . in order to increase the grip and electrical contact , more than one series of apertures 47 and hourglass - shaped walls 48 might be provided along the length of the inner member 44 . fig8 shows a connector 51 wherein the two outer bodies 53 are one piece , mid section missing . each outer body has , at its cable - side end , two or more fingers 55 having a radially inward protruding collar 56 . conical shaped shims 54 having at least one groove 57 are forced inside the fingers 55 against the action of a spring 58 that surrounds the fingers 55 . as the shims 54 are pushed further in , they clamp the conductor c and are locked in by the radially inward protruding collars 56 of the fingers 55 . collars 56 exert an axial force onto the shims 54 against axial displacement thereof . fig9 shows a connector 61 wherein again the mid section 62 is made longer , and in this case is preferably comprised of three parts 62 a , 62 b , 62 c threaded together . lateral parts 62 a , 62 c preferably have female threading and intermediate part 62 b preferably has two male threading matching therewith . mid section 62 comprises a first internal cylindrical wall 65 having a first diameter at the cable side , and a second internal cylindrical wall 66 having a second diameter smaller than the first diameter and adjacent the first cylindrical wall 65 . each outer body 63 is matingly threaded with the mid section 62 , internally thereto , and exerts an axial force onto a collapsible inner member 64 axially forcing it towards the step formed by the second internal cylindrical wall 66 . collapsible inner member 64 is in the form of an o ring having an olive - shaped cross section . in the various embodiments , the outer body ( ies ) or outer member ( s ) exert a force in an axial direction onto the shims or inner member ( s ), which in turn exert ( s ) a force in a radial direction onto the conductor ( s ) c . as said terms outer and inner are used relative to each other , not with an absolute meaning . indeed , in the embodiments of fig6 , 7 , 9 the mid section 32 , 42 , 62 is outer with respect to the outer bodies 33 , 43 , 63 . in the various embodiments , the mid section , where provided for , acts as a counter member configured to engage with the outer member ( s ) to exert the force in axial direction . in the various embodiments , the mid section where provided for may be split into two or three portions connectible with each other as shown in fig9 or with flanges connected through bolts , so that each of two conductors c may first be independently coupled to a respective connector half . this may simplify the assembly operation . the connectors of the invention are suitable for connecting the inner conductor of a coaxial power cable , or each conductor of a non coaxial power cable . in other embodiments , the inner face of shims 4 may depart from a portion of a cylindrical wall to better adapt to shaped conductors such as lobe shaped conductors or to cables having conductors lying in a plane . the collapsible spacing ring 17 of the embodiment of fig1 - 3 can be provided for in the other embodiments also . as said in connection with fig8 , the mid section may be missing , the two outer bodies being one piece . in other embodiments , the mid section may be missing , the two outer bodies being coupled to each other , such as by providing an outer threading of one outer body and a matching inner threading of the other outer body , or through bolted flanges . it is highlighted that in the above embodiments the conductor c is held almost about its entire circumference , instead of using screws that screw inside the conductor , that might damage the strands or create voltage differences among them . experimental testing showed that the connectors of the invention perform well both in terms of resistance to traction and in electrical terms .	7
referring first to fig3 it will be seen that the punch of the present invention generally designated at p is formed to present eight symmetrically disposed corners or edges 1 each defined by right angularly disposed adjoining wall portions 2 and 2 which define a corner angle &# 34 ; x &# 34 ; of 90 ° at each of the corners . with reference to fig7 and 8 the edges or corners 1 starting from the top and moving clockwise are designated 1a , 1b , 1c , 1d , 1e , 1f , 1g , and 1h and the defining wall portions are designated 2a 3a , 2b 3b , 2c 3c , 2d 3d , 2f 3f , 2g 3g , 2h 3h . it will be seen that the corners 1a , 1c , 1e , and 1g in conjunction with the wall portions 2a 3a , 2c 3c , 2e 3e , and 2g 3g define one square outline 4 shown in solid line and cross hatched . the alterntative sequence of corners and wall portions 1b , 1d , 1f , and 1h and 2b 3b , 2d 3d , 2f 3f , and 2h 3h also define a square outline 4 &# 39 ; shown in dotted line in fig7 in a 45 ° angular relation to the square outline 4 . adjoining wall portions such as 2a and 3h meet to define an included angle &# 34 ; y &# 34 ; of 135 ° and an internal angle of 225 °. as seen in fig9 the wall portions 2 and 3 , all of which are identical in shape and area preferable deviate slightly from the vertical and incline inwardly at an angle of from 3 to 31 / 2 ° towards the bottom wall 5 of the punch which preferably is of conical form having an angle from 50 ° to 56 ° to the horizontal . at the top the punch is also preferably bevelled as at 6 at an angle of 45 ° to provide a chamfered recess entrance . the juncture of the conical bottom wall 5 and the side walls 2 and 3 are defined by arcutate juncture lines 7 and 8 . as will be seen from fig8 the eight cornered punch of the present invention will provide a recess having an increased area of entrance as compared to the recess produced by prior art square recess producing punches . in this connection the inner circle 9 represents the area which would be cleared by a square cross section punch and hence the area available for entrance of a square driver bit into such a square recess . the second inner circle 10 represents the area which in fact is cleared by the present punch and hence the area available for entrance of a square cross section bit into a recess produced by a punch of the present invention . the area between the two circles 9 and 10 represents increased area for entrance , i . e . the increased ease of driver bit entrance produced by the punch of the present invention over a square recess producing punch . in forming a recess in a screw head the distortion to which the head is subjected has been found to vary almost directly to the degree that the recess deviates from a circle . thus , as seen with reference to fig8 a square punch involves the displacement out of circular form of four times the mass of metal lying between the inner circle 9 and the outer circle 11 between say corner 1a and corner 1c and represented by the shaded areas , 12 , 13 , 14 . in the case of the punch of the present invention the amount of metal displaced out of circular form is represented only by four times the shaded areas 12 and 14 and all of this mass lies between the second inner circle 10 and the outer circle 11 . as a result , it has been found that the eight cornered punch can form a recess in a screw head without distorting the round configuration of the head . this ability to maintain a precisely circular head configuration has not heretofore been possible with square punches . the precisely circular form is achieved by the ability of the punch to uniformly stress the metal of the head so that essentially no crystallized or highly stressed metal areas which are subject to fracture occur in the head . further this ability to maintain perfectly round screw heads while forming the recess coupled with the esthetic appearance of the eight point recess enables the punch to produce a screw of highly desirable appearance for use on exposed surfaces . the punches p of the present invention while having recess forming shank portions s of corresponding cross sections may be adapted for use with different types of screws . for example , the punch p of fig1 has the shank portion s projecting from the end of the punch body 15 and is used to produce a flat head screw 16 shown in fig2 . one of the critical points of wear in a punch occurs at a corner such as the corners 1 which form the points of corners 17 of the screw socket . this wear is particularly concentrated at the juncture points 18 of the edges 1 with the bottom wall formation 5 . in the case of the square cross section punch for producing a square recess , the impact blow of the punch is absorbed at only four corners and when these corners wear , the recess will not be sufficiently accurate to allow the driving bit to seat firmly and properly in the recess . this problem is compounded when the side walls of the punch and hence recess are tapered because of the mismatch of the driver bit taper with the recess taper if the bit cannot seat fully home . in the case of the punch of the present invention , eight corner juncture impact absorbing points 18 are provided with the result that the wear per corner is substantially reduced . this fact coupled with the ease of forming the metal of the screw head around the more clearly circular shape of the punch in comparison with the flat sided prior art square punch provides a substantially increased punch life so that each punch can produce a substantially greater number of recessed screws before replacement . moreover the more nearly circular shape of the punch greatly facilitates the ease and cost of making the punch itself so that the initial punch cost is less than the present square punches . desite the provision of the eight corners 1 and the eight junctures 19 intermediate of the corners 1 on the punch , there are not corners or junctures less than 90 ° and therefore no thin punch sections which would tend to fracture , and there are correspondingly no thin recess sections which would tend to ream out under high torque . furthermore , this punch is not easily broken by the side deflection forces from off center punching blows because the wall portions , in effect , reinforce each other . this advantage can be better understood by referring to fig7 where the cross hatched square 4 can be regarded as a cross section of conventional prior art square punch ; note that the sides of square 4 are relatively wide and flat . however , the corners 1b , 1d , 1f , and 1h of the dotted square 4 &# 39 ; are at the center of the sides of square 4 . thus , the corners of square 4 &# 39 ; act as reinforcing ribs for square 4 , and vice versa , thereby preventing fracture of the punch by side deflection forces . fig4 illustrates a punch having a modified form of body 20 used to produce the screw 21 . in this case the shank s is set in a recess 22 formed in the end of the body 20 and this recess 22 is adapted to shape the rounded head 23 of the screw 21 at the same time that the recess forming shank s forms the screw recess . while the preferred punch has been illustrated , variations may for example be made in the punch taper . for instance because the displacement of metal out of circular form in producing screws with punches of the present invention is less than in the case of simple square cross section punches , the fall away of metal from this punch during forming is less and therefore more nearly vertical recess side walls forming an accurate reproduction of the punch can be obtained with the present punch than with simple square punches . also , square punches produce a larger number of fasteners with defective recesses because they require that the metal being deformed flow across the entire relatively broad surface of each of their four sides . in the present eight sided punch , the corners 1 of each square 4 and 4 &# 39 ; function as tapered wedges which uniformly spread the flow of metal and ease the entry of the punch into the blank being deformed . fig7 reveals that corners 1b , 1d , 1f , and 1h of dotted square 4 &# 39 ; are centered on the sides of cross hatched square 4 . as seen in fig3 such corners define inwardly tapered wedges , the projections of which would terminate on the center axis of the punch . such wedges spread the flowing metal laterally and therefore cause it to flow more evenly over the entire surface of any side of either square 4 or 4 &# 39 ;. the present punch also provides a larger number of driver bit engaging wall surfaces in the resulting recess than is available from a simple square punch , thereby enabling the taper of the recess wall to be increased without loss of driver bit cling . an eight cornered driver bit having a cross section corresponding to this punch is disclosed in co - pending application ser . no . 835 , 533 , filed june 23 , 1969 . although the forms of the invention shown and described herein constitute preferred embodiments , it is not intended to illustrate herein all equivalent forms and ramifications thereof . also , the words used are words of description rather than of limitation , and various changes may be made without departing from the spirit or scope of the invention .	1

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.